Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1
Life Sciences International Journal Issue 7 Volume 1
...s were collected from suspected outbreaks in Southern Punjab. The virus was primarily detected with RT-PCR with P1/P2 and 1F/1R universal primer pairs directly from field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype<...
Gregg D. Caruso
Science, Religion and Culture
...f life and of the human species), ethics, and the human mind (minds, brains, souls, and free will)? Do science and religion occupy non-overlapping magisteria? How do science and religion support, oppose, and/or inform each other? What is the relationship between religion and modern culture? What is the relationship between science and modern culture? How do the various faith traditions view the relationship between science and religion? What, if any, are the l...
Victor J. Stenger
Science, Religion and Culture
...ash;a set of unfounded superstitions that have been the greatest hindrance to human progress that ever existed on this planet....
Massimo Pigliucci
Science, Religion and Culture
...n points of my earlier paper....
Sehrish Kanwal, Ali Saeed, Muhammad Munir, Memoona Arshad
British Journal of Virology
...s were collected from suspected outbreaks in Southern Punjab. The virus was primarily detected with RT-PCR with P1/P2 and 1F/1R universal primer pairs directly from field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype<...
Robert E. Pollack
Science, Religion and Culture
...ous tradition, but for a person like me — a scientist for fifty years and at seventy three already in Biblical terms 13 years an elder — it is easier instead to let the Sages come to me; that is, to turn to the Siddur, the Jewish book of daily prayers, codified in Hebrew for the most part a few hundred years ago but including some passages from the Hebrew bible’s Torah, Prophets and Writings that are millennia old.
...
Francisco J. Ayala and John C. Avise (eds.)
Johns Hopkins University Press, 2014, 547 pp., $47.64 (hbk),
ISBN 1421413051.
Reviewed by David Pindel
Science, Religion and Culture
...ollection of classical papers, encompassing virtually all aspects of evolutionary biology and including all of key figures in the development of this field.
...
John Shook
Science, Religion and Culture
...s. Scientific atheology specifically appeals to current sciences and scientific methodologies to help explain why no gods are real. Folk religions and anthropomorphic gods can’t survive, but science vs. religion is hardly the whole story. Only science joined by philosophical reflection suffices to skeptically analyze the natural theology arguments for supernatural gods, too aloof and...
Ruse, Michael, The Gaia Hypothesis: Science on a Pagan Planet, The University of Chicago Press, 2013, 251 pp, $26.00, ISBN 978-0-226-73170-4
Science, Religion and Culture
...9) and Walden (1854). Respectively, Thoreau’s well-reasoned politics and his keen observations of the natural world appealed to my hormone-driven defiance and pacified my unruliness. I thought I knew my Thoreau.
...
Tom Gilson & Carson Weitnauer (eds), True Reason: Confronting the Irrationality of the New Atheism (Grand Rapids, MI: Kregel Publications, 2013), 315pp, US$17.99 (paperback), ISBN 978-0-8254-4338-1
Reviewed by Gregory W. Dawes, Associate Professor of Philosophy
Science, Religion and Culture
...e present work is quite openly a work of Christian apologetics. Its aim, as the title suggests, is both to counter the work of the so-called “new atheists” and to offer a defence of the reasonableness of Christianity. Its essays cover an extraordinarily wide range of topics. These include the theological problems posed by religious diversity, the so-called “naturalism” of the modern sciences, the relations between faith and reason and r...
Timothy Helton
In a Mirror Dimly: Anthropology and Restoring a Sense of Presence to an Empty World
...f religion, everything depends on the lens through which the ethnographers gaze at the objects of their study. Scholars that approach religion as an object fit only for analysis discover in it a model of an objectified universe; and those that assume a universe subject only to natural law find in the religions that they study worlds devoid of others–sterile worlds populated only by selves incapable of meaningful relationships. The essay urges that those ...
Johanna Lindahl 1, 2
British Journal of Virology
...ing urbanization, with especial focus on vector-borne diseases, particularly Japanese encephalitis. It is concluded, that although the mechanisms required for an extensive human to human transmission is not present for Japanese encephalitis virus, there is evidence of urban virus transmission. Thus, considering increasing urbanization rates and intense contact between humans and pigs within the growing urban agriculture, there remains a risk for future emergen...
Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1
British Journal of Virology
...s were collected from suspected outbreaks in Southern Punjab. The virus was primarily detected with RT-PCR with P1/P2 and 1F/1R universal primer pairs directly from field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype<...
Joseph Andrew Bracken
Metaphysics for a World in Evolution
...n the basis of momentary personal preference. In this article, I first review the classical philosophical understanding of the relation between the One and Many in which the One is conceived as ontologically prior to the Many as their necessary principle of unity and intelligibility. I then propose a new paradigm for the relation between the One and the Many in which the Many by their dynamic interrelation from moment to moment initially co-create and then sus...
David N. Livingstone, Dealing with Darwin. Place, Politics, and Rhetoric in Religious Engagements with Evolution, Johns Hopkins University Press, 2014, 265 pp., ISBN 13: 978-1-4214-1326-6
Reviewed by Francisco J. Ayala, University Professor & Donald Bren Professor of Biological Sciences, University of California, Irvine, email: fjayala@uci.edu
Science, Religion and Culture
...squo;s On the Origin of Species received by his contemporary scholars, particularly by theologians and religious authors? That is the subject of the thoroughly researched and elegantly written book by David N. Livingstone, Dealing with Darwin. Place, Politics, and Rhetoric in Religious Engagements with Evolution....
Reviewed by David Svolba, Fitchburg State University, USA email: dsvolba@fitchburgstate.edu
Science, Religion and Culture
...tizens from laws that compel them to act in ways their religions forbid, or that forbid them from acting in ways their religions require. According to Brian Leiter, religious tolerance, in this sense, is prima facie morally justified.1 It is prima facie morally justified because religion is a source of claims of conscience, and liberty of conscience is supported on both broadly Kantian and utilitarian grounds. People will likely be happier in a society that al...
Reviewed by John Shook, University at Buffalo, USA; Email: jshook@pragmatism.org
Science, Religion and Culture
...estions” series is permitting readers to examine direct answers on all sorts of topics from today’s premier public intellectu- als. Reading the answers about science and religion in this volume is consistently informative and inspi- rational, and frequently revealing in stunning ways. Comparing the answers from the impressive figures in the book takes readers on a journey through truly deep and important issues with honesty and clarity....
Reviewed by Rick Repetti, Kingsborough Community College, CUNY; Email: Rick.Repetti@kbcc.cuny.edu
Science, Religion and Culture
Stephen Kershnar
...es in a way that will shape future discussions of the field. It is also well-written, including interesting-and-enjoyable references to historical figures (for example, Mother Theresa, Adolf Hitler, and Paul Gauguin), artists (for example, Aldous Huxley and Woody Allen), and works of art (for example, Groundhog Day and Guernica). In this critical study, I summarize the book and then put forth objections to its central ideas. In particular, I argue that Metz fa...
Thaddeus Metz
...ield, also advances some penetrating criticisms of it that merit engagement. Specifically, Kershnar maintains, first, that I did not provide enough evidence that meaning in life is a genuine value-theoretic category as something distinct from and competing with, say, objective well-being, and, second, that, even if there were a value of meaning in life, my fundamentality theory of it would...
Stephen Kershnar
...aning in life is not a type of value distinct from the standard types of value, specifically, what is good in itself (intrinsic good), good for someone (prudential good), or good for someone independent of pleasure and desire-fulfillment (objective-list good). Second, if there is meaning in life, then Metz’s theory does not capture it because it is...
Reviewed by Elly Vintiadis (www.ellyvintiadis.com)
...ion’ stories of 16 people of different gender, race, age, and religion. If, like me, you have never heard of the term “deconversion” before, it is the atheist equivalent to the religious finding of faith – it is a conversion from belief to agnosticism or atheism....
H. Bruce Rinker
...that later accelerated especially with the emergence of ecology and evolutionary thinking. However, the strict determinism and mechanistic assumptions inherent in the physical sciences delayed unification and, thereby, contributed inadvertently to the present-day scourges of fragmentation such as human-accelerated climate change and biodepletion. A philosophia prima is now required to repair and reunite human thought to achieve a consilient valuing as a platfo...
Mark Zelcer
...h (the language of Eu- ropean Jewry) and also to science. But what does it mean for an ethnicity to have strong cultural ties to science and how did it get that way in this case? Put another way, why put all this effort into producing Yiddish texts for an audience, part of which could get by in English and part of which was not particu- larly well educated enough to appreciate them? Why would Jews put such a Jewish spin on science?...
Muhangi Denis
...pread within Eastern Europe. Involvement of all stakeholders in the pig value chain in designing and implementing of prevention and control strategies could be explored in future control programs. This may call for investing resources in changing disease management behaviour in managing this disease....
Sandeep Satapathy and Rupam Ghosh
...ons have been seen to be persistent throughout the year seasonally claiming several lives. IL-6/IL-2 receptors have been identified as crucial mediators for clearance of influenza by up regulating several intracellular defense mechanisms. Associated with IL-6 signalling is the expression acceleration of sequestrome 1(SQSTM1) / aggrosome and colocalization of HDAC6 to the cytoplasm. The key player HDAC6 is investigated for modelling several intracellular proces...
Yanina Panzera1*, Nicolas Sarute1, Lucia Carrau1, Jaime Aldaz2, Ruben Perez1
...ains....
Hanqin Shen1,3, Boliang Wu1,2, Guangwei Li1, Feng Chen1, Qingbin Luo1,3, Yimin Chen1, Qingmei Xie1,2,3*
...ina....
Ye Liu2, Yulong Cong2, Yiming Shao1*
...is review exhibits the superior potential of Tat as immunoregulator on optimizing immune responses mediated by vaccines. These examples of selected studies will provide researchers some implications and inspirations for using HIV Tat to optimize immune responses of vaccines....
Aradhana Chopra1, Ravi Shukla2 and Tarun Kumar Sharma2,3*
... with high affinity and specificity. The ease in synthesis and modification makes them an attractive candidate for a variety of applications. Since the last decade, aptamers have been regarded as an emerging player in biology. They have found applications not only in biosensors, but also in other areas such as diagnostics, biomarker discovery, drug delivery, bio-imaging and molecular therapy. In this review we have summarized recent advancements and applicatio...
Maureen McKeague1, Maria C. DeRosa2*
...f aptamers with optimal specificity and high affinity remains a challenge, leading to the recent emergence of elegant new approaches and tools for SELEX. In this commentary, we discuss recent advancements in the selection of aptamers....
Nicola J. Stonehouse
...s, selected in vitro to specifically bind target molecules. They can therefore be useful as molecular tools and also as novel therapeutic agents. This commentary describes RNA aptamers selected to bind to the RNA-dependent-RNA polymerase of foot-and-mouth disease virus. The aptamers are able to inhibit the function of the enzyme both in vitro and in the context of a sub-genomic replicon an...
Justin P. McBrayer
...rtain thing advances our personal goals. When it comes to belief in God, the most famous formulation of a prudential reason for belief is Pascal’s Wager. And although Pascal’s Wager fails, its failure is instructive. Pascal’s Wager fails because it relies on unjustified assumptions about what happens in the afterlife to those who believe in God verses those who do not. A renewed wager can avoid this difficu...
Mark Zelcer
... not recommend this to experts in those fields, but rather to non-professionals....
Justin P. McBrayer
...rtain thing advances our personal goals. When it comes to belief in God, the most famous formulation of a prudential reason for belief is Pascal’s Wager. And although Pascal’s Wager fails, its failure is instructive. Pascal’s Wager fails because it relies on unjustified assumptions about what happens in the afterlife to those who believe in God verses those who do not. A renewed wager can avoid this difficu...
Bruce L. Gordon
...(YEC) is one of the more peculiar manifestations of broader evangelical culture. It continues to be the most common view of the relationship between science and Scripture held in the evangelical community and, unfortunately but understandably, the view of science most non-Christians associate with evangelicalism. For scientifically literate non-Christians, it presents an obstacle to Christian faith, and for young Christians who have been raised to equate YEC w...
Michael R. Molnar
...es about what may have appeared in the skies, marking the birth of Jesus as Christians believe. Details of the ce- lestial event given in the New Testament Bible are vague leaving much room for widely varying ideas. As the Star involves Christian faith, there are valid suspicions that some explanations may have taken liberties to support religious beliefs. That idea is central to one of the more recent publications on this subject. Aaron Adair promotes his boo...
Kathryne E. Taylor1 and Karen L. Mossman1,2*
...the ICP0 protein from herpes simplex virus is complex and frequently contradictory, meaning that although this protein has been implicated in a wide variety of diverse functions, the mechanisms through which it produces these effects continue to be elusive. Recent investigations into the ability of ICP0 to block the activation of antiviral signaling have revealed a potential explanation for some of this confusion – namely, that ICP0 has important functio...
Xingdong Yang and Lijuan Yuan
...rus strain or bacterial species and being maintained free of unwanted microbiota in sterile isolators. The sterile surgical derivation and gnotobiotic status of the pigs allow studies of the infection, disease and immune responses caused by a specific pathogen in the absence of interfering maternal antibodies, other maternal immune regulators, and intestinal and environmental microbes. Due to the similarities between pigs an...
Matheus Nunes Weber1, Simone Silveira1, André Felipe Streck1, Luís Gustavo Corbellini2, Cláudio Wageck Canal1*
Simon Mwangi Kihu1*, George Chege Gitao1, Lily Caroline Bebora1, Njenga Munene John1, Gidraph Gachunga Wairire2, Ndichu Maingi1, Raphael Githaiga Wahome1, Davis Njuguna Karanja1, Julius Otieno Oyugi3, Ernest Lutomia3
...n Kenya....
Qin Zhao1,2, Yani Sun1,2, Gaiping Zhang1,3, Frederik Widen4, En-Min Zhou1,2,*
zhouem@nwsuaf.edu.cn
...ains immunodominant epitopes and is responsible for the induction of the protective humoral immune response. Six antigenic domains in the capsid protein have been identified. The fragmented proteins in these domains are analyzed for their application in serological diagnosis of HEV....
James Ayukepi Ayukekbong1,2
E-mail | james.ayukekbong@microbio.gu.se
...no licensed vaccines or specific therapeutics. The virus and its vector are widely distributed throughout the tropics and subtropics regions of the world. Dengue and malaria are endemic in Nigeria. Two independent studies among febrile patients revealed dengue IgG seroprevalence of 73% and malaria prevalence of 80% in some areas of the country. The diagnosis of the disease is further compl...
Gregg D. Caruso
... the view he first developed in Living without Free Will (2001). Important objections to the early book are answered, some slight modifications are introduced, and the overall account is significantly embellished—for example, Pereboom proposes a new account of rational deliberation consistent with the belief that one’s actions are causally determined (ch.5) and develops a forward-looking theory of moral responsibility consistent with free will skep...
John Martin Fischer
...ew) the most fully developed and most appealing. Although I am not myself a moral responsibility skeptic, and, in particular, I do not believe that causal determinism is incompatible with the kind of freedom that grounds robust, desert-based moral responsibility, I find that (surprisingly) our views don’t really differ that much from each other. It might seem that our views are miles apart; but upon reflection, it tu...
Dana Kay Nelkin
...ll can be meaningful and perhaps even better in certain important respects than life on the assumption that we have it. At the same time, there are some subtle shifts in particular commitments, new ways of framing certain issues, and detailed responses to a good number of the very many challenges to the view as originally set out in Living Without Free Will and related articles. The responses to challenges serve to elabora...
Derk Pereboom
...and Ravizza (1998) developed, which, he correctly points out, I neglect in favor of the reasons-responsiveness component....
Weili Kong1, Guangpeng Ma2 and Jinhua Liu1*
...e are length variation types of NS1 in different subtype influenza viruses. CTT functions in several ways to defeat the cellular innate immune responses. Here, we discuss those different effects of CTT truncation or elongation of NS1 protein in different genetic backgrounds of influenza experimentations. Conclusively, it can be stated that CTT confers a positive role during the infection o...
Khalid Usman, Aziz-Ur-Rehman
...cation as well as soil type and cropping system. The objective of this study was to evaluate the response of spring wheat seeded in three tillage systems viz., zero (ZT), reduced tillage (RT), and conventional tillage (CT) to split application of N fertilizer [50 kg N at sowing + 100 kg N ha-1 at first irrigation (T1); 50 kg N at first irrigation + 100 kg N ha-1 at second irrigation (T2); 50 kg N at sowing + 50 kg N at first irrigation + 50 kg N ha-1 at second...
Muhammad Arif1, Fazal Jalal1, Mohammad Tariq Jan1, Dost Muhammad2
...stems. Two years field experiments were conducted on corn crop at the research farm of the University of Agriculture Peshawar, during 2011-2013. Wheat-maize-wheat cropping pattern was followed with the adjustment of legumes in summer gap (land available after wheat harvest till maize sowing). Legumes i.e. mungbean, cowpea and sesbania with a fallow were adjusted in the summer gap with and without biochar application. Biochar...
Zaheer Ahmed Deho1, Shamsuddin Tunio2, Qammaruddin Chachar2, Fateh Chand Oad2
...ign: justify;">A field experiment was conducted to evaluate the impact of sowing dates and pick- ing stages on yield and seed maturity of cotton varieties at Nuclear Institute of Agriculture (NIA) Tandojam, Sindh Pakistan. Three cotton varieties (Sadori, Chandi-95 and Malmal) were evaluated under four sowing dates (15th April, 1st May, 15th May and 1st June). Four pickings at various boll openingstage viz. 30%, 50%, 70% and ...
Salma Shaheen, Muhammad Jamil Khan, Saleem Jilani
...tify;">A two years pot experiment was conducted using loamy textured soil to study the effect of organic manure and complex chemical fertilizer (NPK) with or without effective microorganism (EM) on the agronomic performance of spinach crop, at Gomal University D.I. Khan during 2009- 11. A commercial product called Bio-Aab was used as a source of EM. Organic manure was first mixed with Bio-Aab, left for 7 to 15 days at room t...
Muhammad Irshad1, Abdur Rab1, Javed Rahman2, Muhammad Sajid1, Ilyas Khan2, Sajad Ali1, Muhammad Razaq1, Sallahuddin1
...Swat, during 2011. The experiment was laid out in Randomized Complete Block Design (RCBD) with split plot arrangement in three replications. Planting Dates (20th Jan, 30th Jan, 10th Feb, 20th Feb and 2nd March) were allocated to main plots, whereas soil media (Silt+ Garden soil+ FYM) at the rate of 1:1:1, 2:1:1, 1:2:1 and 1:1:2 were assigned to sub plots. Days to 50% sprouting, survival percentage, number of roots plant-1 an...
Muhammad Ashraf Khan1, Hizbullah Khan1, Abid Farid2
...- treated host eggs. The percent emergence (mean) of tiny parasitoid from host eggs treated during egg, larval and pupal stages with the virus at field dose (x), 2x dose, and 0.5x dose ranged from 83.2- 87.3%, 87.1- 91.6%, and 83.7- 89.7%, respectively, relative to control eggs treated with water. The parasitism rates by female parasitic wasps emerged from host eggs treated at x dose when parasitoid was during egg, larval, a...
Shahid Ali, Munir Khan
...ncy ranges from 34 to 88 per cent for the farms in the sample, with an average of 62 per cent. This means that if the average farmer in the sample was to achieve the technical efficiency level of its most efficient counterpart, then the average farmer could increase wheat yield by 30 per cent. Similarly the most technically inefficient farmer could enhance wheat yield by 61
Arshad Ali Khan1, Muhammad Sajid1, Abdur Rab1, Sahib Alam2, Abdul Bari3
... and 75-25 treatment, respec- tively. Whereas, the less number of leaves plant-1 (15), plant height (28.25 cm), fruit size (92.3 cm3) and tomato yield (7.5 t ha-1) were recorded for Rio Grande in control during, 2009. The fruit weight (69.25 g) and TSS (4.55 oBrix) were higher in Rio Grande cultivar in treatment 75-25 and 50-50, re- spectively. It is concluded that a combination of PM and SOP at 50-50 and 75-25 ratio may be ...
Mohammad Fayaz, Abbas Ullah Jan, Dawood Jan
...dy estimated quantity, expenditure and quality elasticities for five vegetables namely potato, onion, tomato, cabbage & cauliflower and peas, mostly consumed in Pakistan. A comparison of quality elasticity between urban and rural households is provided using Household Integrated Economic Survey (HIES) data from Pakistan Social and Standards Living Measurement (PSLM) 2010-11. The elasticities of interest were obtained via...
Farhad Zulfiqar, Muhammad Ashfaq
... mean maximum average temperature at the time of maturity, ceteris paribus with one oC increase in temperature the average wheat yield increased by 56.64 kg per hectare in the study area. It was deduced from the economic variable that the level of input used was less than optimum. The negative coefficient of the location variables revealed that increasing the area virtually decr...
Raja Waqar Ahmed Azad, Tahir Sarwar
...00, 2006-07 and 2011, respectively. Conveyance losses in the selected watercourses were determined by inflow-outflow method, wherein the flow velocity was measured using current meter. The conveyance losses were found 13.2%, 11.8% and 7.8% in watercourses Sarai, Derkot and Mera Dadu, respectively, which resulted in conveyance efficiency of 86.8%, 88.1% and 92.4%, respectively. Results show...
Mohammed Ali Hussain, Zakiya Ahmed Hassan
...pring season 2012. The experimental materials comprise seven F1 hybrids (sangaria, IK8 x zp-707, DK x Hs, zp-707 x un 44052, IK 8 x un44052, un 44052 x DK and polina). The experiment was laid out in randomized complete block design with three replications. The analysis of variance showed highly significant differences among maize hybrids for all the traits. The hybrid un44052 x DK took minimum days to tasseling (65.83 days) ...
Sajid Ali1, Nouman Badar1, Hina Fatima2
E-mail | sajid_economist@yahoo.com
...and cotton production respectively, whereas ARIMA (2, 1, 1) was the suitable model for forecasting cotton yield. Some diagnostic tests were also performed on fitted models and were found well fitted....
Stephen Suleyman Schwartz
...ism and terror are not aspects of Islamic history. To declare, as even French president Francois Hollande did, “these terrorists and fanatics... have nothing to do with the Muslim religion” is inaccurate....
Hussein Rashid
...-Postens, a Danish newspaper, in 2005. In addition, the release of a You- Tube film in 2011 called Innocence of Muslims is often cited as a proximate cause of an attack on a US consulate in Benghazi, Libya. This narrative sets up an easily understood conflict between Islam and free speech....
Massimo Pigliucci, K.D.
...ttack on the satirical paper Charlie Hebdo, which took place on 7 January 2015. Some of the commentary has been insightful, some full of pious platitudes about defense of free speech by sources with not exactly a stellar record in that department, and some of it has ranged from the woefully uninformed to the downright awful. It is, therefore, with some recalcitrance that I write these lines, particularly because I’m co...
Michael Shermer
...out after murder- ing 17 people in Paris in January, 2015, including edi- tors and cartoonists of the satirical publication Charlie Hebdo?
A. “Moses rocks!”
B. “Jesus saves!”
C. “Vishnu lives!”
D. “Buddha avenged!” E. “Atheists rule!”
F. “Allahu Akbar!”
Varadaraja V. Raman
...ighten and possibly kill people. Invading soldiers over the ages have terrorized innocent civilians in many regions of the world. Governments have terrorized their own people, the most glaring instance was in post-Revolutionary France during the Reign of Terror. On the other hand disgruntled, oppressed, and frustrated citizens (Irish Catholics, Algerian Muslims, Sri Lankan Tamils, etc.) have terrorized ...
Frank Griffel
...age taking at a Jewish supermarket two days later, yet another Western country asked itself why do they attack us? Why do they hate us? France experiences a moment of bewilderment and soul-searching similar to the one the US went through after the attacks of September 2001 and to what took place in Britain after July 5, 2005. The gut-reaction of nations struck by such horrific acts of terrorism is to say: We have done nothin...
Ali Sina
...d the Jews in a kosher supermarket have made more people concerned about the rise of terrorism.Tens of thousands have come out to demonstrate....
Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4
...vements....
Muhammad Mushtaq
E-mail | mushtaq@uaar.edu.pk
... forest and agricultural pest throughout southern Asia and the Middle East, including Pakistan. The results suggested that in case of pre-baiting trial, a 25% reduction in burrow activity was achieved in case of groundnut – maize (1:1) grain bait loaded with 2% strychnine alkaloid and supplemented with 5% saccharin and a 10% reduction could be achieved without saccharin supplementation. In case of without pre-baiting trial, a 10% reduction in burrow acti...
Ghazalah Yasmin1*, Mir Ajab Khan2, Nighat Shaheen3, Umbreen Javed Khan4
E-mail | ghazalahrizwan@yahoo.com
Sarhad Journal of Agriculture, Vol. 31, Iss. 1
...d A. tortuosum) of five species distributed in Pakistan using light microscopy and scanning electron microscopy. Results showed that Aconogonon is characterized by tricolpate pollen with microspinulose type of exine ornamentation. One distinctive pollen type was recognized on the basis of aperture number and sculpturing of exine under SEM. Based on analy...
Yashab Tur
Science, Religion and Culture, Vol. 2, Iss. 2
...n transforming, and the opening view panoramic: Imagine a world still living with centuries-old routines and patterns of individual and communal life, submerged in the slow rhythm of a pre-modern era, about to encounter modernity! This is the world that Elshakry describes in her groundbreaking work, a world which encounters cylinder-powered platen printing machines, the telegraph, the steam ships and railways—all coming from countries dimly
Thomas J. Coleman III
Science, Religion and Culture, Vol. 2, Iss. 2, Pages 39-41
...">Who owns Darwin? More specifically, who gets to claim both the man and his theory in support of their ideological worldview? If you were like me, at first glance this would be an obvious answer: godless naturalism intertwined with the “New Atheism” of the Richard Dawkins’s and Sam Harris’s of the world gets to lay claim to the man and his ideas, or at least they have often appropriated him in this fashion. However, J. David Pleins&rsq...
Masood ur Rahman1*, Zahid Mahmood2, Taj Ali2, Muhammad Aziz Irfan Mufti3, Jehangir Khan Seyal4, Munir Ahmad5
E-mail | masoodra@hotmail.com
Sarhad Journal of Agriculture, Vol. 31, Iss. 1
...s conducted on a self-propelled locally made rotary hoe to overcome a problem of frequent transmission failure. The machine is used for mechanical weed control and hoeing. It was observed that the worm gear used in its transmission often failed due to surface wear of gear teeth. Worm gears made from three different copper alloys were tested against soil resistance in sandy loam soil bin. The gears were formed of commercial g...
Nayle Maria Oliveira da Silva1*, Ricardo do Carmo Zanella2
...ch is characterized by a persistent hepatic parenchyma inflammatory process that may progress to cirrhosis and hepatocarcinoma. Viral clearance occurs in a minority of patients with viral hepatitis C, whereas chronic infection is established in 60 to 80% of all cases, 20 to 40% of which may evolve to cirrhosis and hepatocarcinoma. Genetic differences among infected hosts can determine the progression and outcome of the virus infection, causing different indivi...
Muhammad Zahid1*, Muhammad Salman2, Shah Alam Khan2, Alamzeb1, Inamullah Khan1
...en.) is the major insect-pest of stone fruit orchards. Survey of three districts of Khyber Pakhtunkhwa revealed the highest mean infestation in plum orchards of district Peshawar (89.60%), followed by Nowshera (75.79%) and Swat (45.42%). In peach orchards, highest mean infestation was recorded in Peshawar (88.33%), followed by Nowshera (72.77%) and Swat (53.72%). The mean infestation of 70.86% was recorded in apricot orchard...
Chun-Yi Lin1, Meng-Ling Wu2, Tang-Long Shen1, Hsin-Hung Yeh3, Ting-Hsuan Hung1*
...tionships and develop proper prevention strategies in the near future.
...
Rashid Saleem1*, Zammurad Iqbal Ahmad2, Muhammad Abbas Anees2, Abdul Razzaq3 and Ashiq Saleem1
...le mungbean and intercropped mungbean with maize were treated with five fertility treatments (T1, control; Phosphorus and Potash (PK) (80-60 kg ha-1) + inoculation, T3, (120-80-60 NPK kg ha-1); T4, poultry manure (PM) @ 15 t ha-1 and half PM+ half PK+ inoculation, half poultry manure (7.5 t ha-1) + half PK (40-30 kg ha-1) + inoculation. According to statistical analysis, data revealed that plots treated with PK + inoculation with Rhizobium gave 33% higher mung...
Galina N. Leonova1*, Ilya G. Kondratov2, Sergei I. Belikov2
...ast isolated from Ixodes persulcatus ticks and one strain was isolated from the blood of a person after a tick bite. Phylogenetic analysis showed that these strains are related to LI/A and LI/K strains isolated in England and Scotland.
...
Hu Zenglei1 and Xiufan Liu1, 2*
...rains of different genotypes induce distinct pathological manifestations in chicken organs, especially in lymphoid tissues. Genotype VIId of NDV, which is currently endemic in many countries of Asian and Middle East, replicates at a significantly higher level, induces more potent innate antiviral and inflammatory response, and causes more severe damages in lymphoid tissues when compared wi...
Malik Ikram Ullah1, Abdul Aziz Khakwani1*, Muhammad Sadiq1, Inayatullah Awan1, Muhammad Munir2, Ghazanfarullah1
...e cultivar Kissan. The experiment was conducted on silt loam soil at Faculty of Agriculture, Gomal University, Dera Ismail Khan, Pakistan during 2011. Six nitrogen treatments (80, 120, 160, 200, 240 and 280 kg ha-1) and a control one were studied in this trial. Growth and yield traits and quality such as plant height, stem diameter, leaf area plant-1, leaf area index, chlorophyll content, green fodder yield, dry matter yield, crude protein, crude fiber and ash...
Muhammad Mudassar Maqbool1, Anser Ali1, 2 *, Tanveer ul Haq1, Muhammad Nasir Majeed1, Dong Jin Lee2
...ion with water deficit depends not only on the magnitude of water deficit but also on the stage of plant growth at which it develops. A pot study was conducted during 2011-12 at College of Agriculture, Dera Ghazi Khan, to assess the effect of induced water stress on performance of different wheat varieties at critical growth stages. Three wheat varieties viz. Faisalabad-2008, Lasani-2008 and Kohistan-97 were manually sown in...
Ahmed Sultan Jatoi1*, Shahid Mehmood2, Jibran Hussain2, Hafiz Muhammad Ishaq2, Yassar Abbas3, Muhammad Akram2
...gate the six-week growth performance in four different strains of Japanese quails maintained at Avian Research and Training Centre, University of Veterinary and Animal Sciences, Lahore. For this purpose, 2160 newly hatched quail chicks were randomly picked up from available stock and then placed into 108 experimental units (replicates comprising 20 chicks each). Growth parameters i.e. weekly body weight (g), weight gain (g),...
Nisar Ahmad1*, Inayatullah Jan2, Saif Ullah1 and Sidra Pervez1
...actor etc. Similarly, 80 percent of credit users are borrowing from Zarai Tarqiati Bank Limited (ZTBL). It is suggested that financial institution should expand the credit facilities to the farmers which shall be utilized exclusively for agricultural purposes. It is also suggested that credit constraint should be plausibly minimized so that small farmers could also get loans easily....
Dallin D. Oaks
...by some as problematic aspects of the account may actually relate to claims that have been incorrectly attributed to the account. In fact, the account may not be reporting a sudden and immediate confusion of languages, or even a sequence in which a confusion of languages led to a scattering of the people. Indeed, a close examination of the account seems to allow an interpretation of events that is compatible with what lingui...
Muhammad Rizwan Tariq1*, Muhammad Issa Khan1, Aysha Sameen1, Mahr un Nisa2
...bits were reared for the period of eight weeks. Enrichment of 7% flaxseed in the diet of rabbits significantly enhanced growth performance of rabbits and improved poly unsaturated fatty acids in the meat of rabbits as compared to other groups.
...
Huaichang Sun
...ariation or mutation escape. This review is intended to present the current situation of antiviral roles of amiRNAs, against variable RNA viruses in particular....
Hayat Badshah1*, Farman Ullah1, Abid Farid2, Ahmad-U-Rahman Saljoqi1, Sajjad Ahmad3
...is Linn) and tomato (Lycopersicon esculentum Mill.). The experiment was conducted under Laboratory conditions (25-32°C, 55-65% R.H. and 12:12 light: dark, photoperiod) during 2012. Results revealed that P. solenopsis successfully and significantly (P<0.05) completed its life cycle along with highest body weight gain on China rose followed by potato. Moreover, P. solenopsis had the b...
Khalid Usman1*, Niamatullah Khan2, Fazal Yazdan3
...>Yield and fibre quality performance of DNH-105 strain in comparison with standard cotton varieties (CIM-573, CRIS-342, Gomal-93, NIAB-112 and CIM-612) was assessed at Cotton Research Station, D.I. Khan, Pakistan, during growth season 2011‑2013 in a randomized complete block design replicated thrice. The strain DNH-105 gave optimum yield owing to more bolls per plant (37.2), boll weight (3.4 g) plus higher ginning out ...
Kemi Funmilayo Omotesho1*, Isreal Ogunlade1, Opeyemi Eyitayo Ayinde2
... analysed farmers’ perception of the accountability of agricultural extension services rendered in Oyo State, Nigeria. Structured interview schedule was used in eliciting information from 195 farmers in rural communities across the four agro-ecological zones in the study area using a two-stage random sampling technique. Data used for the study were analysed using descriptive statistics, Likert scale and the regression analysis. The study revealed that fa...
Asma Noshad1, Mudassar Iqbal1*, Zafar Iqbal1, Hamida Bibi2, Saifullah3, Salma Bibi4, Hamid Ullah Shah1
...the oyster mushroom. The percent mortality of Macrosiphum rosae (rose aphids) and the LC50 values were calculated and used as an indicative of insecticidal potential. The maximum mortality of aphids was achieved at 80 µg mL-1 and the LC50 for the fruit body extract after 24 HRS was calculated as 12.83μg mL-1, followed by the extract from the fermentation filtrate with LC50 value 25.03 μg mL
Faheem Khan*, Muhammad Zafarullah Khan
...stan, however, its yield per hectare remains low. The present research aims at evaluating the role of education in enhancing sugarcane yield. Two districts namely Mardan and Charsadda of Khyber Pakhtunkhwa Province were selected for this purpose. A multi-stage sampling method was used to draw sample of 336 sugarcane growers for the present study and an interview schedule was used to solicit responses that addressed the research objectives. The findings from t...
Imdad Sohu1, Allah Wadhayo Gandahi2*, Ghulam Raza Bhutto2, Muhammad Salim Sarki2, Rabail Gandahi3
...lign: justify;">The chickpea is a major legume crop of Pakistan cultivated under rice-chickpea cropping system. Integrated nutrient management is important for higher crop yields and sustainable agriculture. A field experiment was conducted to study the residual effect of integrated nutrient management on growth and yield of chickpea crop. The treatments...
Shahid Iqbal Awan1*, Syed Dilnawaz Ahmad2, Muhammad Amjad Ali3, Muhammad Shahzad Ahmed1, Aurangzeb Rao1
...rsity in 176 wheat genotypes for morpho-physiological traits. Simple correlation coefficients indicated that grain weight had a significant positive relationship with residual transpiration, osmotic adjustment, cell membrane stability, flag leaf weight, specific flag leaf weight, while negatively correlated with specific flag leaf area. These results indicated the importance of physiologic...
Thomas J. Coleman III1*, Ralph W. Hood Jr.1 and John R. Shook2
...lic in general. In this special issue of Science, Religion & Culture, Guest Edited by John R. Shook, Ralph W. Hood Jr., and Thomas J. Coleman III, we present 8 articles, 2 research notes, and 3 book reviews on the topics of atheism, secularity, and science. Each article is introduced with brief commentary drawing attention to some of the key theoretical and methodological issues surrounding them as well as their implications for the study of atheism and se...
Jonathan Jong
...osed definitions. This paper argues that scholars of religion and nonreligion should accept the fact that “religion” and “nonreligion” are, like all social scientific concepts (and some biological ones), fuzzy categories. There is no such thing as religion, such that the term “religion” picks out all and only all examples of religion, or specifies the necessary and sufficient conditions fo...
Ethan G. Quillen
...cal discourse, garnering perspectives from a number of different methodological and theoretical approaches so as to develop a truly inter- and multi-disciplinary understanding about what we mean when we discuss Atheism. On the other, this myriad of voices has equally led to an ever-broadening discordancy, an equivocal discourse that makes it all the more difficult to identify any sort of common or universal definition. This...
Ryan T. Cragun1*, Joseph H. Hammer2, Michael Nielsen3
... hundreds of measures of personal religiousness and spirituality exist, none are capable of reliably and validly assessing individuals who identify as nonreligious and nonspiritual. There is a need to develop a valid and reliable measure of (non)religiousness and (non)spirituality. This article discusses these problems, and presents the development and initial validation of a 17-item Nonreligious-Nonspiritual Scale (NRNSS) across three studies. The NRNSS exh...
Luke Galen
...on putative beneficial aspects, implying that the absence of religious belief is accompanied by liabilities. However, a closer examination of the literature reveals that the mechanisms of most beneficial associations with religiosity are attributable to factors other than beliefs, chiefly, social engagement and embeddeness in supportive groups. Often, those with the lowest levels of well-being and prosociality are uncommitted or indifferent religious believers...
Joseph Langston1*, Joseph Hammer2, Ryan T. Cragun3
...and assessing attitudes, perceptions, and preferences in three areas. First, we examined the preferences of nonbelieving group members (“secular affiliates”), former members, and nonbelieving non-members (“secular nonaffiliates”) on nonbeliever group goals, functions, and activities. Second, we examined the perceptions of secular affiliates regarding why secular nonaffiliates do not join nonbeliever...
John Stinespring, Ryan T. Cragun*
...us nonaffiliation. A two-period, two-variable Markov switching model is used which yields a tractable steady state solution and growth path for the share of the population that is nonreligious. The model setup and solution are shown to be both intuitive and determined by three parameter values. The authors illustrate its use by estimating these parameter values using biannual data from the 1973 to 2012 General Social Surveys (GSS). The parameter estimates from...
Benjamin Beit-Hallahmi
...n striking. Academics, especially eminent ones, turn out to be quite irreligious. This is especially striking for academics in the United States, where a culture which is manifestly the most devout among First World nations has produced a sub-culture, which is a mirror image of itself. How can we explain the secularity of academics? Research indicates that it has to do with a process of selection and self-selection, which st...
David F. Bradley*, Julie J. Exline, Alex Uzdavines
...egression, we found that personality factors (Big Five personality traits, adult attachment style, and socially desirable responding) were not strong predictors of the characteristics nonbelievers assign to hypothetical gods. Seeing a hypothetical god as more loving, less cruel, and less distant was associated with more past positive emotional experiences with gods, less past anger at gods...
Rabbi Paul Shrell-Fox
...egree that belief in a supernatural God is a derivative of religious intuition, it is safe to assume that over one’s lifetime, intuition and attitudes towards a belief in God is subject to fluctuation. Dennett and LaScola found this to be true with priests and ministers. That study was the catalyst for the current study of rabbis’ shift in religious beliefs in general, and belief in God in particular. Approximately 25 rabbis voluntarily submitted v...
Liz Goodnick
... is the problem of evil (perhaps better understood as the problem of pain and/or suffering): it is difficult to understand why an all-knowing, all-powerful, and perfectly good being2 would allow his creatures to suffer: “Epicurus’s old questions are yet unanswered. Is he willing to prevent evil, but not able? then is he impotent. Is he able, but not willing? then is he malevolent. Is he both able and willing? whe...
Marcus Mann
...in his opinion, was an impetus just as effective and real as the jet engines that propelled the terrorists’ weapons of choice to their targets. The End of Faith was the first of four polemics that have come to symbolize what is now known as “The New Atheism,” a term meant to encapsulate a 21st century religious skepticism characterized by its vitriolic and unapologetic stance toward religion and the moral r...
Amanda Schutz
... navigate tragedy, or cooperate effectively with others in society. Phil Zuckerman spends the remainder of the book refuting this claim. His goal is to explore “how secular people navigate their lives,” which is no small task. Throughout the book he discusses how secularists do in fact have morals, successfully raise children, deal with death and heartache, and build communitie...
Rick Repetti
...al readership, but is of perhaps equal value to Buddhist philosophers insofar as it articulates many of Buddhism’s core philosophical values, to and for Western philosophy, and in a distinctly recognizable Western philosophical voice, but one that does no damage to the often radically different frameworks, methods, and modes of discourse that are distinctively Buddhist, much of which it presents in its own modality...
Ghulam Ali Bajwa and Muhammad Arshad Khan
...ion. Contrarily, high copper and potassium contents were found. After three weeks of fertilizer application, concentration of N, P, K and Fe in the soil almost doubled. Zinc and Cu contents decreased significantly (p<0.01). The highest N, P and K were found in mulberry variety PFI-1, M. latifolia and Karyansuban, respectively. The highest Cu and Mn were found in Kanmasi. The highest Zn and Fe were found in Husang and Kary...
Rabnawaz1*, Muhammad Jamal Khan2, Tahir Sarwar2, Mohammad Jamal Khan3
...p;under civil system, respectively. In public canal system, the average CWP of the selected crops was 7, 40, 44 and 21% higher than civil canal system, respectively. Low CWP in civil canal system was mainly attributed to over irrigation (because of high water allowance). Quantitative analysis of the yield per unit volume of water applied was carried out using dummy-regressio...
Ali Muhammad*, Muhammad Ayub
...glucoside such as oleourepean. Aim of this research work was to reduce the bitterness level of olive fruit by different treatment such as water, salt and lye solution which were coded as RW1, RW2 and RW3 respectively. During treatment process the bitter glucoside level such as oleourepean leached out from the fruits to the solvents by osmosis process which alters the composition of ol...
Muhammad Nawaz Kandhro*, Habib-Ur-Rehman Memon, Muhammad Ali Ansari, Ahmed Naqi Shah
...g summer 2010 and repeated during summer 2011 for validating the previous results. The experiments were laid out in three replicated randomized complete block design. The seed of cotton variety “Sindh-1” was sown through drilling in the 1st week of May each year. The treatments consisted of: weedy check (no weeding), interculturing twice (30+60 DAS), Dual Gold 960-EC (S-metolachlor) @ 2.50 L h...
Gultaj Hussain1, Abdur Rahman1*, Tariq Hussain2, Siraj Uddin1, Tariq Ali3
E-mail | abdur_rahman@aup.edu.pk
Guoyi Li1, Haiyan Tong1, Jiansheng Chen2, Jinliang Wei2, Xiaoming Zhao2, Guoping Zhang2, Zixue Shi2*
E-mail | shizixue@gmail.com
...sia and Australia, where periodic outbreaks take thousands of lives. With rapid globalisation and climatic shift, JEV has started to emerge in previously unaffected areas. Scientific evidences show that JEV would remain a global pathogen and might cause worldwide pandemics. Currently, more research is required to be applied to JEV pathogenesis and antivirus therapy. This review aims to reveal the exigency of developing a worldwide effort to acknowledge the imp...
Brittany D. Rife 1,2, Marco Salemi 1,2*
E-mail | salemi@pathology.ufl.edu
...ected tissues and cell types, provides valuable insight into immunopathological processes, and ultimately paves the way for a better understanding of the interplay between viral evolution and pathogenesis....
Rick Repetti
... as an ultimately impersonal, agentless process, Buddhism is nonetheless capable of formulating the diametrical opposite of Strawson’s impossibilism and Pereboom’s hard incompatibilism, what I call possibilism or soft compatibilism, the view that free choices and actions can emerge from conditioned or unconditioned mental states, independently of whether the world is deterministic. This is not...
Opeyemi Eyitayo Ayinde1*, Kayode Ayinde2, Tofunmi Emmanuel Ilori1, Raphael Olanrewaju Babatunde1
E-mail | opeyemi@unilorin.edu.ng
...ng structural adjustment period (SAP) and post-structural adjustment period (PSAP) were statistically significant while the agricultural input subsidy scheme was statistically insignificant in their impact on the prices of major staple crops. The study recommended painstaking formulation and implementation of agricultural policies and re-structuring of agricultural of input scheme....
Reviewed by Dr William Patterson
...audience and deservedly spent time on the bestsellers list. In his second book, Faith vs. Fact: Why Science and Religion are Incompatible, Coyne does less well. His aim is to demonstrate that the contrasting mindsets underlying science (with its emphasis on rationality, evidence, experimentation, and observation) and religion (with its emphasis on faith) are intrinsically opposed and that all attempts to reconcile them must ...
Oladipo Elijah Kolawole*, Oloke Julius Kola, Awoyelu Elukunbi Hilda, Olasunmibo Oluwatobi Gabriel, Ogunyale Tolulope Temitope
E-mail | koladipo2k3@ yahoo.co.uk
...nce of Hepatitis E among people living with Human Immunodeficiency Virus in Ogbomoso. The blood sample of consented two hundred and seventy five (275) subjects were obtained and their sera were screened for antibodies to HEV using Enzyme Linked Immunosorbent Assay. Samples were collected over a period of 4 months (September – December, 2014). The mean age and mean CD4+ count of the subjects were 40.14±0.47 years...
Luca Vitale
...le, to some extent, to cope with limiting environmental conditions by means of different mechanisms that contribute to their adaptive success in different habitats....
Stephen Kershnar
Email: stephen.kershnar@fredonia.edu
...ld standards in their respective fields. His most recent book, The Non-Identity Problem & the Ethics of Future People (New York: Oxford University Press, 2014), is again the best work on the topic and required reading for anyone who wants to think seriously about the topic....
Temitope Oluwasegun Cephas Faleye1, Johnson Adekunle Adeniji1, 2 *
Rodolfo Villagra-Blanco1*, Gaby Dolz1, Danilo Montero-Caballero2, Juan Jose Romero-Zuniga2
...hin flock seropositivity percentages ranged between 0% and 100.0%. Flocks with the highest seropositivity were found in low altitude regions close to the coast. Risk and protective factors determined in the present study were not in accordance with this insect borne disease. The results of this study indicate that BTV is endemic in sheep herds from Costa Rica, and animals seem not show clinical signs. We recommend carrying out further studies, to determine the...
Elly Vintiadis
...is ill-posed because, properly understood, theism incorporates science since it too, just like science, requires people to seek the truth and to think critically. In order to go about showing why this
is so, Steane embarks on showing what theism is and how it offers an explanation of the world and life of which science is a part....
is so, Steane embarks on showing what theism is and how it offers an explanation of the world and life of which science is a part....
Mohammed A. Rohaim1*, Rania F. El-Naggar2, Abdulrahman M. Gamal3, Elshaimaa Ismael3, Mohamed M. Hamoud4, Sherif T. Moubarak3, Ashraf M. Metwally1, Manal M. Zaki3, Shimaa A.E. Nasr3, Samah Elsaid3, Mohamed M. Ali3, Hussein A. Hussein1 and Osama K. Zahran3
Email: mohammedvet1986@gmail.com; mohammed_abdelmohsen@cu.edu.eg
...s because they are enveloped viruses. Disinfection against avian influenza viruses at the poultry farms would significantly reduce and/or limit the chance for its transmission and outbreaks. Many disinfectants have been evaluated for their inactivation ability, but there is still a need for their evaluation under different conditions and in different ways. In the present study, representative disinfectants from chlorine and non-chlorine oxi...
Shumaila Manzoor1, Afshan Ahmed1 and Muhammad Abubakar2*
...;">The present study was performed to compare the efficacy of two techniques i.e. serum neutralization test (SNT) and solid-phase competitive ELISA (SPCE) for foot and mouth disease virus (FMDV) structural antibodies detection in terms of their sensitivity and specificity. These methods were performed by using set of sera collected from ca...
Muhammad Arif Zafar1, Murtaz-ul-Hasan1*, Aayesha Riaz1, Asim Shamim2, Muhammad Farooq Iqbal1 and Arfan Yousaf
E-mail | murtazhassan@yahoo.com
...nducted to evaluate therapeutic value of autogenous vaccine along with immune-modulators and to compare its efficacy with autogenous vaccine alone and partial excision of the lesions. To this end, nine animals were selected clinical and sporadic papillomas different body parts. These animals were divided into three groups; Group A animals were operated for partial excision of the lesions, Group B were inoculated with au...
Youssef Lhor1*, Mounir Khayli1, Mohamed Bouslikhane2, Mehdi El Harrak3, Ouafaa Fassi Fihri2
Email: y.lhor@yahoo.fr
...a collected from a retrospective surveillance of Culicoides (Diptera: Ceratopogonidae) biting midge vectors from April 2009 to March 2010 in Morocco. In order to assess the implementation of integrated control measures and disease risk analysis, this entomological survey was performed on the risk of transmission of bluetongue virus (BTV) and identification of the main breeding sites of Culicoides. From April 2...
Tomas Jinnerot1*, Karin Malm1, Erik Eriksson1 and Jonas Johansson Wensman2
E-mail | Tomas.Jinnerot@sva.se
...sp;can spread rapidly, especially among dogs in close quarters. Fast and accurate diagnostics enables the selection of proper management. Our objective was to develop a sensitive and specific real-time PCR for detection of B. bronchiseptica in samples from dogs with respiratory signs. A genome comparison program was used to select a suitable target DNA sequence. A P...
Claudia Kohl*, Andreas Nitsche, Andreas Kurth
Email: kohlc@rki.de
...ration sequencing (NGS) opened up a plethora of new research possibilities in biology and medicine. Metagenomics is one of these emerging NGS applications and offers the opportunity to study i.e. whole ecosystems. Basically, the metagenomics approach is similar to well-known shotgun-sequencing, though on a much bigger scale. For instance, the metagenome of a lake would include all the fish, ducks, plants, fungi, bacteria and everything else that belongs to the...
Mudasir Irfan Dar*, Fareed Ahmad Khan and Farha Rehman
E-mail | irfanmudasir@gmail.com
... grams active ingredient per hectare (g.a.i ha-1) through foliar spray. Analyses were done at days 3, 7, and 15 after treatment. Lipid peroxidation rates and contents of proline, ascorbate (ASC), glutathione (GLU), antioxidative enzymes; superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) were assessed. I...
Ummara Waheed Khan, Raza Ahmed, Irum Shahzadi and Mohmmad Maroof Shah
Email | mmshah@ciit.net.pk
...chniques have been developed and tested to improve important cereal crop species since quite long time. Among the prominent techniques, traditional plant breeding has been on leading edge. The discovery of molecular genetics and biotechnological techniques, such as genome mapping, tissue culture, genetic transformation and in vitro regeneration offered new dimensions of research to improve important crop ...
Shubhada K Chothe, Bhushan M Jayarao and Suresh V Kuchipudi
...ry factors which can escape the anti-protein environment in the virus infected cells and are likely to be conserved across the species. Here, we summarize our current knowledge about the role of lncRNAs in influenza virus infection and the exciting prospect of exploiting lncRNAs as targets to develop novel anti-viral therapies....
Nagina Zeb, Muhammad Sajid, Abdul Mateen Khattak and Imtiaz Hussain
...xt-align: justify;">An experiment on the effect of potassium and maleic hydrazide on growth and flower quality of chrysanthemum (Dendranthema grandiflorum) was carried out at Ornamental Nursery, Department of Horticulture, Khyber Pakhtunkhwa Agricultural University, Peshawar during 2011. Suckers of chrysanthemums were planted during the first week of January and transplanted in 20 cm clay pots in July. The experiment was lai...
Muhammad Imran1*, Muhammad Mobashar2, Muhammad Irfan3, Shazia Hanif4, Sumaira Hanif5 and Muhammad Abubakar6
...-align: justify;">This experiment was conducted to evaluate the potential of Moringa Oleifera leaf meal (MOLM) as partially replacement of the cotton-seed cake (CSC) in lactating Nili-Ravi buffaloes. On the basis of nearly similar lactation stage and body weight, sixteen individually confined buffaloes were randomly blocked and allotted to four different dietary treatments. MOLM in proportion to CSC was supplemented along with maize silage as basal diet. Four ...
Muhammad Arif Zafar1*, Arfan Yousaf1, Murtaz-ul-Hasan1, Faisal Ayub Kiayani1, Matee ul Islam2 and Muhammad Farooq Iqbal1
...ic umbilical hernia with peritonitis. A cross-bred calf was presented with peritonitis due to traumatic umbilical hernia. The decision to operate the calf was made after confirmation of umbilical hernia resulted in septic shock. Animal was first stabilized with supportive treatment prior to surgical decompression. A modified two-layer hand-sewn anastomosis technique was used. Herniorrhaphy...
Tauseef Taj Kiani1*, Mozammil Hussain1 and Hidayat ur Rahman2
...f this phenom- enon of superior performance of F1 progeny over their parents not only trans gured maize breeding schemes but also constituted the foundation of maize seed industry. Evaluation of per se performance of parental lines and estimation of heterosis and inbreeding depression are prerequisites to start hybrid development program. In this context...
Mushtaq Ahmad1*, Habib Akbar1, Mohammad Tariq Jan1, Muhammad Jamal Khan Khattak2 and Abdul Bari3
...11-12 and 2012-13. The experiment was laid out in a randomized complete block design with split plot arrangement in four replications. Sugar beet was sown at the rate of 6 kg ha-1 at four seeding depths from 1 to 4 cm. Nitrogen was applied at band and broadcast methods at the rate of 140 kg ha-1 mixed with biochar at the rate of 25 and 50 t ha-1. The data collected on various parameters were statistically analyzed and planned mean comparisons were carried out ...
Corey McCal
...seeks to account for European secularization during the modern period. Unlike Hans Blumenberg, and, more recently, Charles Taylor, who tell the story of secularization as a process distinct from religious belief and religious institutions, Erdozain argues that the basis for secularization can be found in the religious ferment of modernity itself, beginning with the Protestant Reformation and extending through the first half ...
Rick Repetti
...rgued that in creating imperfect beings God was graceful in giving the undeserved gift of life. There have been many objections to Adams’s argument; e.g., Jerome A. Weinstock (1975) objected that God still would have been graceful in granting undeserved life to superior beings, and, among others, E. Wielenberg (2004) objected that grace doesn’t erase the imperfection of creatin...
Shahid Ali1, Habib Akbar2, Mohammad Tariq Jan2, Mohammad Jamal Khan3 and Abdul Bari4
..., Mardan-Pakistan. The experiment was conducted in RCB Design with split plot arrangement, over years (2012-13 and 2013-14). Planting sources i.e. standing (fresh canes frost exposed) trenched (stored canes frost protected) and canes portions top, middle, bottom and mixed 33 % each were assigned to main plots, while setts placement methods i.e. single, one and a half, double and triple setts 40 cm in length were allotted to sub-plots. Recommended dose of ferti...
Ghulam Ali Bajwa1, Faizah Abood2, Yusof Bin Ibrahim3
... 75% RH and 12:12 h photoperiod. Instar 3rd responded with 100% mortality at 5x107 conidia ml-1, while same level of mortality was recorded in 5th instar at 1x108 conidia ml-1. Instar 5 also showed the lowest mortality (33.3%) at 1x106 conidia ml-1. Median effective concentration (EC50) ranged between 9.87x105 and 21.30x105 conidia ml-1 for 3rd to 5th instars. Median effective time (ET50) ranged between 3.3 days and 8.2 days for different tested concentration...
Kang-Seuk Choi
...any applications. This paper reviews the potential of VLPs as an alternative to IBD vaccines, along with their specific applications in the field....
Mohammad Taghi Karimi
...deformities. Different types of orthoses have been used to treat the kyphosis. The aim of this review is to determine the effciency of various orthoses to reduce kyphotic curve based on the available literature. A search was performed in some databases including PubMed, Google Scholar, Scopus, Embasco and ISI Web of Knowledge between 1960 and 2015 years. Keywords such as kyphosis, spinal deformities were used in combination ...
Monireh Ahmadi Bani1*, Mostafa Kamali2, Iman Borji3, Soheyla Aslani3, Francis Fatoye4
... that any stability test performed for less than five minutes is not clinically valuable. This study has evaluated stability with open and close eyes in normal subjects during five minutes standing in twenty healthy subjects. The subjects were asked to stand on a force plate for one and then five minutes, respectively. Their stability parameters were evaluated based on the old and new meth...
Ali Mohammadi, Mohammad Hossein Ebrahimi
...ethod is suitable especially for elderly subjects with limited degree of physical activity. However, most of young subjects are not recommended to be treated with this method owing to high level of physical activities. KineSpring knee implant system was designed for young subjects with knee OA to reduce knee pain, improve stability and knee function. The aim of this review article is to screen for the available information on knee impl...
Fatemeh Kheiri
...as aimed to evaluate the per- formance of amputees walking with this knee joint. Two above-knee amputees using Nabtesco knee joint were recruited. eir kinematic and kinetics parameters were evaluated by use of the motion analysis system and a Kistler force plate. The stability of subjects during standing and their energy consumption while walking were analyzed by the use of a Kistler force plate and a polar heart rate monitoring. The difference between the ki...
Seyed Mohsen Mirbod
...ase which influences the performance of the joint during walking. Various types of knee orthosis have been designed to improve the performance of the subjects, however, such cases are often associate with post-operational complications. The aim of this study is to design an orthosis which is easy to use, economical and effective. A new knee orthosis was ...
Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6
...;">Borna disease virus type 1 (BDV) comprises highly conserved neurotropic non-segmented negative strand RNA-virus variants causing neurological and behavioral disorders in a wide range of mammalian animals, possibly including humans. Viral persistence in the brain has been frequently observed, however, the exact mechanisms behind BDV’s ability to establish persistence despite a prom...
Maurice A. Finocchiaro
... Galileo for defending Copernicus’s hypothesis of the earth’s motion and denying the scientific authority of Scripture. This ended the original controversy, but generated a new one that continues today, for example, about whether the condemnation proves the incompatibility between science and religion. Recently the Galileo affair has been studied by several scholars whom I label “Berkeley para-clericals,” chiefly philosopher Paul Feyera...
Muhammad Amjad Nadim1*, Mohammad Safdar Baloch1, Ejaz Ahmad Khan1, Abdul Aziz Khakwani1, Kashif Waseem2
...xt-align: justify;">An experiment to investigate the effect of organic, synthetic fertilizers and micronutrients on growth and yield of wheat was conducted at the Agricultural Research Institute, Dera Ismail Khan, Pakistan. The trial was laid out in a randomized complete block design (RCBD) using split-plot arrangements with four replications. Main plot consisted of NPK and organic fertilizers while micronutrients viz. Zn, Cu and B (alone and in combinations) ...
Khalid Ali1*, Amanullah Jan2
...soil physico-chemical properties and fertility. Two years field experiments were conducted at the Agriculture Research Institute Tarnab, Peshawar- Pakistan (semiarid conditions) to investigate the effect of two green manuring crop species (guar and millet), their incorporation age (40, 70 and 100 days after sowing, DAS) and parts (whole plants incorporation and stubbles incorporation) unde...
Rehmat Ullah1*, Muhammad Zafarullah Khan1 and Kalim Ullah2
...atistics i.e. frequency, percentages and rank order was calculated. Chi-square test was performed to find out association among demographic characteristics and MFSC registration duration and Rank Based Quotient was calculated for problem identification. It was found that machinery was provided to almost half of the respondents. Similarly seed was the most provided input followed by fertilizers. Top most source of agriculture...
Abiodun D. Olabode
...ple food in Nigeria is experiencing decrease in yield over the years. This study evaluates the productive capacity of some selected rice farms in Kwara State, Nigeria, with a view to identify farm management practices that enhance sustainable production of rice in the study area. Primary data were obtained through the use interview schedule. Eighty copies of structured interview were purposively employed to obtain individual response of the farmers whose plots...
John G. Bruno1*, Chien-Chung Chao2,3, Zhiwen Zhang3, Wei-Mei Ching2,3, Taylor Phillips1, Allison Edge1, Jeffery C. Sivils1
... DNA aptamers were developed against Rickettsia typhi (R. typhi) whole cells and individual candidate aptamer sequences were ranked according to affinity by an ELISA-like microplate-screening assay (ELASA). Top three candidate aptamers were then paired in a matrix of all possible capture and reporter aptamer combinations and tested in a fluorescent peroxidase-linked Amplex® UltraRed (AUR; a resazurin-like s...
John G. Bruno
...commentary addresses the perceived need for automated robotic development of aptamers or aptamer conjugates with associated mass production to provide rapid passive immunity for large human populations in the event of a major pandemic or infectious disease doomsday scenario. ...
Behzad Hussain1, 2, Abdullah Iqbal2, Muhammad Abubakar2*
...act with blood of the suspected animal. ...
Mohammed A. Rohaim1*, Rania F. El Naggar2, Ahmed M. Helal3, Hussein Ahmed Hussein1 and Neil LeBlanc4
...e pigeon paramyxovirus type I (PPMV-1) from pigeon in Egypt during 2014. Pathotyping, based on the mean death time (86 hours) in eggs and the intracerebral pathogenicity index (1.2), and the amino acid motif, (112KRQKR116), at the cleavage site of the fusion (F) protein indicated the emergence of PPMV-1 in Egypt. Phylogenetic analysis of the F and haemagglutinin-neuraminidase (HN) genes indicated that the isolate clustered with the PPMV-1 strains recently repo...
Anna-Maria Andersson*, Ann-Kristin Nyman, Per Wallgren
...n mink typically cause hypergammaglobulinemia, plasmacytosis and immune complex disease. Due to lack of success in eradicating Aleutian disease (AD) by stamping out, a new strategy for disease control with focus on evaluation of disease progression has been proposed. For estimation of antibodies in serum and dried blood samples collected from mink, a VP2 ELISA (enzyme-linked immunosorbent assay) system was recently evaluated. However, s...
Ilham Ulla, G. Arjumand, Nawab Ali and Mohammad Akmal*
...), the net returns per unit area, is of interest of the crop cultivation and observed the maximum at 120 kg N ha-1. The study suggests that delay sowing of summer sunflower crop in the region either by monsoon rains or any other circumstances decreased production drastically. Moreover, an increase of N from 120 kg ha-1 is not of much value under these circumstances but have the potential to investigate for increasing production of t...
Haq Aman Ullah1*, Aneela Zameer Durrani2, Muhammad Ijaz2 and Aqeel Javeed3
...lds particularly by Aspergillus flavus and Aspergillus parasiticus. Aflatoxin B1 is the most common metabolite highly toxic for humans and animals. In the present study contamination status of aflatoxin B1 in cotton seed cake, wanda, wheat bran and homemade concentrate mixture of dairy goats was investigated in district Lahore of Pakistan. A total of Twenty 20 goat farms were randomly selected and out of t...
Moustafa Kardjadj
...ease. Currently, 3 serotypes of FMD virus (O, A and SAT-2) and 06 lineage are circulating in the North Africa, of which serotype O is responsible for most of the outbreaks. However, the rapid spread of SAT2 and other exotic FMDV lineages in Libya and Egypt demonstrated the need for a robust surveillance system to detect and respond effectively to exotic infections. Emergence an...
Shahida Bibi* and Ijaz Ahmad Khan
Nazish Huma Khan*, Mohammad Nafees and Adila Bashir
...cted in orchard field of peach and comparative non-orchard field with an attempt to know about the soil and wheat crop contamination caused by heavy metals (Cd, Cr and Ni). Soil samples were collected from both orchard and non-orchard fields and were extracted with Aqua-regia and Mehlich-3 extracting solutions for total and available metals respectively. Wheat crops from both fields (orchard and non-orchard) were collected a...
Murtaza Ali*, Yasser Durrani and Muhammad Ayub
...r activity, ash content, percent acidity, pH, moisture content, reducing and non-reducing sugars, taste, texture, color and overall acceptability). Statistically minimum decrease was observed in water activity, pH, moisture content and organoleptic characters. While, stable increase was noted in percent acidity and ash content during storage. It was concluded and recommended on the basis of mentioned facts that mulberry frui...
Mukhtarullah1, Jawad Ali2 and Mohammad Akmal1*
...ted on a significant cropped area (Ca. 38%) every year. In Khyber Pakhtunkhwa (KP), wheat is also a popular crop in the cropping system, however, average yield differs by 100% from the national average yield due to rainfed planting (67%). Sowing of wheat in the area starts in October subject to onset of winter rains which delays its planting in the season. This study aims to compare yield performance of newly released variet...
Tahir Khan, Raziuddin, Fakharuddin* and Muazam Jamal Razi
...xt-align: justify;">An experiment was conducted to estimate genetic variability, heritability and genetic advance for important attributes in Brassica napus using 10 parental lines and their 21 F4 populations. Significant differences were observed among genotypes, parents, F4 populations and parents versus F4 populations for days to 50% flowering, days to maturity, plant height, primar...
Imtiaz Hussain, M. Sajid, Noor ul Amin, Abdul Mateen Khattak, Abrar Hussain Shah, S. Mussarat Hussain, Sayed Hussain and Nagina Zeb
...ement was used for the experiment. The experiment was replicated four times. The Silvery softwood cuttings were planted in two different growing conditions i.e. under plastic tunnels and open field growing conditions, on five different planting dates with the regular interval of 15 days such as January 15th, January 31st, February 15th, March 2nd...
Qaizar Ahmed1, Fida Mohammad2, Hidayat-ur-Rahman2, Sheraz Ahmed2* and Fakharuddin2
...hybrids was environment-specific. However, heterobeltiosis estimates ranged between -7.9 and 25.90 for leaf area, -6.76 and 130.8 for number of cured leaves kg-1, -10.8 and 17.1 for yield, -16.0 and 9.94 for grade index, -10.4 and 68.66 for nicotine and -26.89 and 31.25 for reducing sugar, respectively. The current study identified KHG24/Spt G 28; KHG21/NC606 and Spt G 126/KHG24 as best crosses for yield while KHG...
Nadeem Khan1*, Arshad Ali Khan1, Mukhtar Ahmad2, Muhammad Nouman2 and Badshah Islam1
... Islamabad. The experiment was performed on randomized complete block design (RCBD) consisting of eleven treatments (cultivars) replicated three times during 2015. The results showed that Tarocco attained maximum height (156.13 cm), followed by Mexican Lemon (146.80 cm). Similarly, maximum plant spread and leaf area were recorded in Mexican Lemon 124.07 cm and 11.35 cm2, respe
Ashley C. Banyard1* and Satya Parida2
...tract | Peste des petits ruminants virus causes an economically important disease of small ruminants that causes extensive livestock losses across areas where it is endemic. Further the recent description of the disease in naïve populations of animals have demonstrated an expansion of the distribution of the disease. Having been in the shadow of rinderpest virus for decades little is understood regarding fact...
Vinayagamurthy Balamurugan*, Gurrappa Naidu Govindaraj and Habibur Rahman
...tract | Peste des petits ruminants (PPR) is an acute, highly contagious, notifiable and economically important transboundary viral disease of sheep and goats. PPR is enzootic in India as more number of outbreaks have occurred in the past and now occurring regularly, round the year and most frequently during the lean period throughout the country. In some Indian states viz. Andhra Pradesh, Karnataka, and Chhattisga...
Moustafa Kardjadj1, Pam Dachung Luka2
...tract | Peste des petits ruminants virus (PPRV) causes an economically important plague of sheep and goats that serves as a major constraint in the development of the small ruminant’s production within an infected area. The virus is endemic across much of the developing world and has spread into the developed European borders. The small ruminants industry within an infecte...
Gurrappa Naidu Govindaraj, Vinayagamurthy Balamurugan*, Habibur Rahman
...tract | Peste des petits ruminants (PPR) is a highly contagious viral disease in small ruminants causing huge loss to farmers. In this study, an attempt has been made to estimate the economic losses based on the annual incidence, morbidity, mortality levels etc. derived from literature, discussion with experts, and based upon scientific facts. Different mathematical models were used to assess the losses due to mor...
Ahmed Zein Mahmoud1, Muaz Abdellatif 2, 3*, Luai Shazali1
...cribes the prevalence of peste des petits ruminants (PPR) virus antibodies in sheep, goats and camels at Hail, Bagaa, Shenan and Ghazalah, Saudi Arabia. Serum samples (n=400), collected during 2012–2013 from sick and clinically healthy herds, were subjected to antibodies detection using c-ELISA. Out of examined animals, 83 (62.9%) goats and 70 (33.2%) sheep were detected positive against PPRV antibodies, whereas camels...
Amitha Reena Gomes1, Belamaranahally Muniveerappa Veeregowda2, Sonnahallipura Munivenkatappa Byregowda1, Vinayagamurthy Balamurugan3*
...tract | Peste des petits ruminants (PPR), a viral disease of goats and sheep caused by a morbillivirus of the family paramyxoviridae is a major threat to small ruminant farming. Global announcement of PPR eradication by 2030 has opened lot of research gaps for the development of vaccines and diagnostics for differentiating infected and vaccinated animals. With the advent of recombinant DNA technology...
Neil Levy
...ence, resulting in the appearance of AIs that are vastly superior to us cognitively – will or might occur in the relatively near future. Understandably, many are worried by this prospect. In this paper, I argue that we have less to fear from the singularity than many people think. Depe
Neil Levy
...ence, resulting in the appearance of AIs that are vastly superior to us cognitively – will or might occur in the relatively near future. Understandably, many are worried by this prospect. In this paper, I argue that we have less to fear from the singularity than many people think. Depe
Klara Fischer1*, Erika Chenais1,2, Emeli Torsson1, Jonas Johansson Wensman1
...and goats are important species for the livelihoods of poor people in many developing countries. Within societies where PPR is now spreading, poverty is widespread and the disease is expected to have significant negative impacts on livelihoods. In resource-constrained marginalised societies, it is often difficult to collect disease data in conventional ways. Participatory epidemiology (
Keyvan Sharifmoradi1*, Nader Farahpour2
...were evaluated using independent t-test with significant point set at p< 0.05. There was no difference in cadence between left and right of normal subjects and those with PD. However, there was a significant decrease in walking speed and stride length in both sides of PD patients compared to normal subjects. Patients with PD showed a significant decrease in progression force and the second ...
Ali Tahmasebi1, Parvin Raji1*, Mostafa Kamali2
...0 ± 1.73 kg/m2 respectively and 15 normal children with mean age and body mass index of 7.2 ± 1 years and 14.83 ± 1.57 kg/m2. Children were instructed to stand with bare feet for 60 seconds on a 5-cm-thick piece of foam which was placed on a Kistler force plate with their Eyes Open (EO), Eyes Close (EC) and Mirror Visual Feedback (MVF). Results demonstrate that there were no significant differences in me...
Mohammad Mushfiqur Rahman1, Rokshana Parvin1, Ataur Rahman Bhuiyan1, Mohammad Giasuddin2, Shah Md. Ziqrul Haq Chowdhury3, Mohammad Rafiqul Islam1, Emdadul Haque Chowdhury1*
...tract | Peste des petits ruminants (PPR) is an acute and highly contagious viral disease of small ruminants. The disease is endemic in Bangladesh and causes considerable economic losses due to its high morbidity and mortality. The study was undertaken to detect and characterize the PPR virus (PPRV) circulating in Bangladesh. Twelve local isolates of Bangladeshi PPRV were successfully detected from post mortem samples (lymph node, spleen and trachea)...
Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4
...ular discharges, high temperature, diarrhea and ulcerative lesions in the oral cavity. A total of eighteen goats from a herd of sixty, were affected and two goats succumbed within two weeks. Interestingly, the disease was exclusively observed in goats and all sheep kept in the same herd were serologically positive but did not show any clinical signs of PPR. The active PPR virus (PPRV) infection was confirmed by antigen capture ELISA and RT-PCR in both swab and...
Muhammad Jurial Baloch1*, Ghulam Murtaza Channa2, Wajid Ali Jatoi2, Abdul Wahid Baloch1, Imdad Hussain Rind1, Muhammad Ahmed Arain1 and Ayaz Ali Keerio1
...to 75% maturity, tillers per plant. Parental cultivar TD-1 expressed maximum GCA effects for tillers plant-1, spike length, grain yield plant-1, seed index and harvest index; while negative and desirable GCA for days to 75% maturity. The SCA estimates revealed that F1 hybrid TD-1 × TJ-83 manifested maximum SCA effects for tillers plant-1, spike length, grains spike-1 and negative yet desirable...
Muhammad Siddiq1* and Hamid Ullah Shah2
...ending of oil has been expected as one of the most important solution in producing vegetable oil with good storage stabilities. The current study was conducted to identify the best oil blend in terms of physicochemical properties between olive and palm oils. Laboratory experiment on “Effect of stress conditions on the quality and stability of olive and palm oil blends” was cond...
Ishfaq Ahmed, Ihsan Mabood Qazi and Suraiya Jamal
...itions and functional properties. It was found that percent protein (8.93–12.25%), ash (0.52–1.01%) and moisture contents (4.47–7.09%) showed significant (P < 0.05) increase, while fat content (1.41-1.17%) showed significant (P < 0.05) decrease by blending WF with BRF. Similarly, water solubility index (WSI), water absorption index (WAI) and swelling power (SP) showed significant (P < 0.05) decreas...
Murad Ali Khan and Mohammad Akmal
...during spring 2011 and repeated in spring 2012. The planting geometries were (a) 70 x 20 cm with rows spaced at 70 cm and plants spaced within the rows at 20 cm and (b) 90 x 15.5 cm with rows spaced at 90 cm and plants spaced within rows at 15.5 cm. It is important to mention here that 70 cm is the recommended row spacing used for sunflower crop in the region. Experiments were conducted in randomized complete block design, r...
Zar Muhammad and Mohammad Tariq Jan
...ear over 1st year. Maize performance linearly increased with increase in FYM (25 to 75%). Compost application with or without fert-N, enhanced maize productivity, in a more productive and sustainable way. FYM as composting material is superior over legume and cereal residue....
Muhammad Ishaq and Raziuddin
...× 8 diallel intra specific F1 crosses in rapeseed (Brassica napus L.) during 2011-2013 to scrutinized potential lines, hybrids, and nature of gene action involved in the inheritance of maturity and plant architecture traits. Analyzed data revealed highly significant differences among the genotypes for days to flowering, maturity, plant height, primary branches plant-1 and main raceme...
Mohammad Fayaz, Abbas-ullah Jan, Dawood Jan, Ghaffar Ali and Yousaf Hayat
...dy used log-log-inverse specification of Engel curve for cereals’ quantity and quality response to households’ income in Pakistan. The elasticities of interest (quantity, expenditure and quality) were inelastic with reasonable difference in magnitude across urban and rural households. Overall, the quality elasticity turned out to be positive with an estimated value of 0.0061 and 0.2375 for wheat & wheat flour...
Shahab e Saqib, Mokbul Morshed Ahmad, Sanaullah Panezai, Hidayatullah, Khalid Khan Khattak
...el results showed that experience, education, landholding size and total income had positive relationship with access to credit whereas, age and farmers’ group had negative association with access to credit. Our findings suggest that there is a need to revamp the policy to address the interests of small landholders, particularly those who possess land less than 5 acres because they had limited access to formal sources of credit....
Aqila Shaheen
...omplex and detrimental types of land degradation that deteriorates both soil quality and land productivity. Determination of soil characteristics and nutrient status of eroded lands is pre-requisite for restoring their productivity. The objective of present study was to quantify the selected soil properties and nutrient status of eroded soils. The study was undertaken on eight soil series (Missa, Pirsabak, Guliana, Raj...
Farmanullah Khan, Samad Khan, Wiqar Ahmad and Imran Khan
...ield. As regards soil properties, NPK20FYM20 reduced bulk density, increased WHC, saturation percentage, organic matter content, plant available N, P and K significantly (p<0.05) both at 0-15 and 15-30 cm depths. Effect of fertilizer sources either alone or in integrated form was non-significant on Cu, Zn, Fe and Mn concentration. Economic analysis showed that NPK75FYM20 rewarded the maximum net income of Rs. 43108 ha-1, ...
Zahir Shah, Shakoor Ahamd, Mian Saeed Sarwar, Murad Ali Khan and Javid Ali
...an or tissue through an opening. The present study describes a typical case of hernia in four weeks old cross Holstein Friesian dairy breed calf with hanging mass in the umbilical region. Tentative diagnosis was made through clinical sign and physical examination; the area was incised under local anesthesia. After surgical procedure site was closed by applying mattress sutures. Adjunct therapy of broad-spectrum antibiotic wa...
Zafar Khan, Asad Sultan, Rajwali Khan, Sarzamin Khan, Imranullah and Kamran Farid
...using atomic absorption spectrophotometer. In all the three districts the egg albumen was found to contain significantly higher levels of Pb, Cd and Cr as compared to egg yolk which contains significantly higher levels of essential elements (Fe, Mn and Zn). The mean concentrations of toxic heavy metals; Pb, Cd and Cr in albumen samples collected from Peshawar were 0.13, 0.06 and 0.09 (ppm) respectively. Concentrations of Pb,...
Inamullah Khan, Muhammad Subhan Qureshi, Rajwali Khan, Syed Muhammad Sohail, Ijaz Ahmad, Muhammad Shoaib and Asim Ijaz
...framework and One Health perspective. A total of 410 and 202 blood samples were collected from cattle and humans respectively. Total 40 samples of subsistence farms and 30 nomadic herds were analysed. Forty eight farm workers, 40 farm owner 36 abattoirs workers, 15 veterinary assistants, 15 veterinarian and 40 butchers were also screen out. Overall sero-prevalence in cattle was 15.36% on S...
Gul Naz and Mohammad Akmal
...grown on the maximum cropped area every year. The suitable variety identification for agro-climate and its optimum N-fertilizer demand with application are need of the day to overcome on N-leaching from the soil and to ensure future food security. Present study was, therefore, conducted in two seasons (2011-12 and 2012-13) at the Agronomy Research Farm, the University of Agriculture Peshawar, Pakistan. Treatments were laid-out in a randomized complete block de...
Umed Ali Laghari, Ahmed Naqi Shah, Muhammad Nawaz Kandhro, Zia-ul-Hassan, Ghulam Murtaza Jamro and Khalid Hussain Talpur
... of crops in Pakistan, especially grass pea (Lathyrus sativus L.). We evaluated K requirements of five elite grass pea genotypes in a field experiment. The experiment was organized in factorial block design with three replications. The study involved five commonly grown grass
Arif Khan, Abdur Rahman, Shoail Akhtar, Siraj Uddin, Zahid Ullah and Nazir Ahmad
Christopher U Orji1*, Ignatius O Onyeocha2, Steven S Shaida3, Peter M Dede4, Bitrus Yakubu5, Elijah E Ella6 and Pam D Luka5
...netic diversity between species’ population. Two species were studied: Glossina palpalis palpalis and Glossina morsitans submorsitans using two mitochondrial DNA fragment primers- Cytochrome oxidase subunit II (COII) and Cytochrome b (CytB). Twelve samples of laboratory-reared population of each species were used for the study. Sequencing data were used to calculate hap...
Abdul Qahar and Bashir Ahmad
...;Balanced nutrition is imperative for efficient nutrient management and has considerable role in enhancing crop yield. To study the effect of nitrogen (N) and sulfur (S) on maize hybrids, field experiments were laid out at the Agronomy Research Farm, the University of Agriculture Peshawar, Pakistan during 2013 and 2014, respectively. Nitrogen (0, 250, 300, 350 kg ha-1) and Sulfur (0, 20, 4...
Neha Singh and Anjana Pandey
...ir high selectivity and specificity and their ability to form 3D conformations. CELL SELEX is a modification of SELEX where instead of using purified ligand molecules, whole live cells are used as targets, so the aptamers being generated could bind target molecules on live cells in their native conformation and it is possible to know the molecular profile of the cellular surface. Whole CELL SELEX is very useful in the field of diagnostics and targeted therapy ...
Jannatul Noor, Md. Ahaduzzaman, Mir Md. Afzal Hossain, Mohammad Alamgir Hossain, Sardar Abdur Rahim and Md. Samun Sarker
John G. Bruno and Jeffery C. Sivils
..., thus attesting to the specificity of these aptamers. In general, the use of aptamers in Western blot formats is advantageous for validation of aptamer binding and specificity based on molecular weight matching of detected electrophoretic bands across a spectrum of related and unrelated bacteria....
Koksal Karadas1, Muhammad Tariq2, Mohammad Masood Tariq3* and Ecevit Eyduran4
...stive CHAID, and a ANN type MLP (Multilayer Perceptron) in the prediction of lactation milk yield in sheep was measured comparatively by model assessment criteria, such as R2, R2ADJUSTED, SDRATIO, CV(%), RMSE, RAE, MAPE, MAD and Pearson correlation coefficient (r) between actual and predicted milk yield values, respe
Muhammad Nawaz Kandhro, Qamaruddin Jogi, Mahmooda Buriro, Aijaz Ahmed Soomro, Ghulam Mustafa Laghari and Ali Nawaz Khaskheli
...ation of allelopathic properties of plants is thought to be an effective and environment-friendly approach for weed management. A pot experiment to evaluate the allelopathic potential of leaves of Eucalyptus camaldulensis (L.) against Convolvulus arvensis (L.) and Cyperus rotundus (L.) was undertaken during summer 2011. The study was conducted at Department of Agronomy, Sindh Agriculture U...
Ian von Hegner
...p, and is defined as a type of government in which power flows from the citizens to the leaders of government, who are selected through free elections. This article argues, that if the concept of democracy is generalized to be universally applicable, then the concept of hypothetical gods’ right to rule results in dictatorship. Whereas the concepts of dictator and tyrant originally had a more positive meaning, those meanings have changed. However, the con...
Rashid Mahmood1*, Saima Asad2, Waqar Ahmad1, Ghulam Sarwar1, Muhamamd Khalid Rafique1, Noor Islam1, Ziyad Abdul Qadir1 and Zain Ul Abiden2
...plusmn;SE) in summer, respectively. The average efficacy (%) of the four groups were 86±.58, 66.5±3.93, 75±7.04, 18.25± 10.25 in winter, 77±3.52, 76.75±30, 79±2, 18.25±0.75 in spring and 74.75±1.44, 65.75±1.11, 63±2.04, 18.25±1.11 in summer season, respectively. No queens were lost, and there was no adult honeybee mortality in any of the colo...
Muhammad Ibrahim, Jawaria Ali Khan, Muhammad Sarwar Khan, Wasim Shehzad, Muhammad Avais, Ali Husnain, Naimatullah Khan, Muhammad Kamran Ameen and Abdullah Iqbal
... were treated with Black pepper for five days and group four cows were treated with Lemon for five days. Group five having 6 healthy cows were used as negative control so they can be used for comparing blood values and milk composition of healthy cows with animals under trial. Our study concluded that Vitamin E+ Se and Garlic were the most efficient drugs as 66% cows suffering from subclinical mastitis were recovered by trea...
Yingbin Wang*, Ting Ye, Xiaogang Wang and Congyu Zhou
...ELE), and sea surface temperature (SST). The results showed that the interpretation ratio (IR) of the 6 factors reached 83.76%, within which the IR of the RELE is the largest (26.02%). The IRs of NMV and PTV also exceed 20% (20.21% and 20.10%, respectively). The IRs of SST, PMV and NTV are similar, and all are between 5.6% and 6%. The catch of P. trituberculatus positively correlated with the fishing efforts of main catch ve...
Amtul Jamil Sami1*, Madeeha Khalid1, Sara Iqbal1, Maira Afzal1 and A.R. Shakoori2
...bital shaking at room temperature. The same procedure was performed for commercial dyes. The dye was removed due to the interaction with the polysaccharide starch and flocculation phenomenon. Chitosan starch based polymer composites can be used as an efficient and cost effective method to treat waste water polluted with carcinogenic dyes by coagulation-flocculation. Moreover this method is beneficial over other methods that ...
Mian Shamas Murtaza1, Aysha Sameen1, Nuzhat Huma1 and Fatma Hussain2
...he cheese samples were ripened at 6-8oC for 30 days and analyzed for physico-chemical composition, functional, textural and sensory quality. The results showed that reduction in fat significantly (p < 0.05) increased the moisture and protein content. The addition of gums further augmented the moisture level owing to owing to their water retention properties. The melt-ability, flow-ability and yield of cheese decreased sig...
Sayeda Sarah and Muhammad Ibrar
... justify;">The present experiment was carried out in a net house at the University of Peshawar, Pakistan. The main purpose of this research was to find out the effects of arbuscular mycorrhizal fungal (AMF) inoculation (with and without Mycorrhiza) along with application of various levels (0%, 25%, 50% and 100%) of rock phosphate (RP) fertilizer on spores density and percent root colonization of selected sunflower (Helianthu...
Hina Fatima, Muhammad Azeem Khan, Mahreen Zaid-Ullah, Abdul-Jabbar, Khurram Nawaz Saddozai
...e increased by 30 and 10 percent, respectively by adopting the technology with an appropriate approach. The results of the inefficiency model reveal that the factors like education, experience and distance from the main market, are the most influential determinants of the technical efficiency in both NonBT and BT- cotton farms. Extension of cotton production required the development of cot...
Allah Wadhayo Gandahi, Khalilluah Panhwar, Rabail Gandahi, Muhammad Saleem Sarki and Mahmooda Buriro
...ustify;"> A field experiment was conducted to study the effect of nutrient management on growth, yield characters and leaf reddening in cotton (Gossypium hirsutum L.). Cotton variety Haridost was studied under 4 NPK treatments (000 NPK kg ha-1, 120-0-0 kg N ha-1, 120-70-0 kg N ha-1, 120-70-40 kg NPK ha-1 and 5 secondary and micronutrient (Control, 50, 3, 4 and 1.5 kg ha-1 Mg, Fe, Zn and B, respectively) treatments. NPK ...
Muhammad Khurshid, Muhammad Nafees, Inam-ur-Rahim and Wajid Rashid
... rotational grazing and open mobility within the pastures. This led to decrease herding venues 43.7% mobility routs 37.5% and herd size by 60.4% for both groups respectively. Analysis of gender-based family labor distribution during past 30 years shows that herding labor (male and female) of age 14 to 60 significantly (P<0.01) reduced during past 30 years and partly shifted to cropping. The male herding labour reduced 40....
Hassan Tarik Atmaca
... the livelihoods of poor people in many developing countries. Efforts are being made to advance our understandings on different aspects of molecular biology of the virus and to consolidate national and international strengths to eradicate the disease from the planet. This Editorial highlights recent research articles and reviews that have provided up-to-date and current research trends in the field to further facilitate dise...
Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek
...: justify;">Five fungal apecies Arthrobotrys oligospora, Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata and Lecanicillium muscarium isolated from root and soil samples collected in Prague, Czech Republic, were cultured on agar media and tested against Meloidogyne hapla both in-vitro and in-vivo. All fungi proved to be efficient in reducing final population of northern root knot ne...
Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek
...n final numbers of cysts per 250 g of soil, eggs and juveniles per cyst. Nematicides effects were not quite significant among each other but had tremendous effects in reducing nematode population compared to that of untreated control. A significant (P=0.05) reduction in numbers of eggs per cyst warrants that nematicides were able to penetrate into cysts....
Felwa A. Thagfan1, Mohamed A. Dkhil1,2* and Saleh Al-Quraishy1
...: justify;">Salvadora persica is one of the commonly used plants in Islamic countries.The root extracts of S. persica has been tested for its anticoccidial activity against Eimeria paillata induced infection in mice jejunum. Three different doses, 300, 600 and 900 mg/kg were used after infection of mice with sporulated oocysts. A dose of 300 mg/kg reduced the number of oocyst output in mice faeces by abo...
Wan-Long Zhu* and Gao Wenrong
...als. Ambient cues, as temperature and photoperiod, play important roles in animals’ physiological adjustments. In order to determine the contributions of temperature and photoperiod to seasonal changes in body mass and thermogenesis in Apodemus chevrieri, we examined seasonal-acclimatized and lab-acclimated animals on several physiologi...
Usman Ijaz1, Muhammad Sajid Tahir2, Khalid Abdul Majeed3*, Shahid Iqbal4, Iffat Huma5, S. Firyal6, Ijaz Ahmed7, Shahid Chohan8 and Aamir Riaz Khan9
...>Panthera pardus subspecies found in Pakistan by exploring the partial DNA sequences of mitochondrial Cytochrome c Oxidase subunit I (COI) gene. Scat samples of 15 different known leopards were collected from Nathiagali, Khyber Pakhtunkhwa, Pakistan and Azad Jammu and Kashmir, Pakistan. After amplification with specific oligos, the amplicons of partial region of COI were subjected to sequencing, and then observed for sin...
Sungil Kim1, Muhammad Riaz2, Amjad Farooq3 and Sungkwon Park4*
...olubles (DDGS) on growth performance, meat quality and fatty acid composition of pork belly. A total of 50 gilts and 50 barrows (initial BW 26±6.3 kg) were randomly allotted to 2 diets including a corn-based control diet and control plus 9% DDGS. After 105 d administration of experimental diets, growth performance, pork quality traits, and fatty acid composition in loin were analyze...
Paul I. Ankeli, Mashood A. Raji, Haruna M. Kazeem, Moses O. Odugbo, Nendir J. Umaru, Idowu O. Fagbamila, Livinus T. Ikpa, Obinna O. Nwankiti, Issa A. Muraina, Pam D. Luka and Nicholas D. Nwankpa
... Mycoplasma mycoides subspecies mycoides (Mmm) from the ear canal of apparently healthy cattle in Plateau State, Nigeria. One hundred and sixty six ear swab samples (n=166) were cultured from which eight (8) Mycoplasma species were isolated and characterized using conventional biochemical tests and polymerase chain reaction (PCR), respectively. Six (6) were observed to ferment glucose, red...
Muhammad Aslam
... justify;">This review paper intends to portray current scenario of agricultural productivity through yields and gaps of five major crops; wheat, cotton, rice, maize and sugarcane. The review discusses major constraints, identifies future prospects and makes policy recommendations for enhanced agricultural productivity in Pakistan. The review revealed that in Pakistan, on average current yield of wheat, cotton, rice, maize a...
Mazhir Nadeem Ishaq, Li Cui Xia, Rukhsana Rasheed, Zeeshan Ahmad, Muhammad Abdullah
...its of milk marketing cooperatives working in two districts (Vehari and Muzzafargrah), geographically located in the southern region of Punjab province of Pakistan. The study analyzed the significance of milk marketing cooperatives by revealing and evaluating possible returns to smallholders in dairy sector. The hypothesis that milk marketing cooperatives are beneficial for milk producers ...
Muhammad Mushtaq, Umer Sadique, Naila Chand, Iftikhar Ahmed, Said Sajjad Ali Shah, Ijaz Ahmad, Imran Ullah and Muqadar Shah
..."text-align: justify;">Hyperlipedemia is the term refers to high lipids contents in the blood. These lipids content can cause the atherosclerosis by blocking the arteries canal which increase the risk factors associated with heart attack. Atherosclerosis is also associated with development of diabetes, high blood pressure and kidney failure. Hypercholesterolemia is mainly caused by high fa...
Safdar A. Wahocho, Tanveer F. Miano, Noor U.N. Memon and Niaz A. Wahocho
...lign: justify;">The photoperiodic effects on vegetative growth and flower quality of Zinnia (Zinnia elegans Jacq.) were examined during 2015 at the Horticulture orchard, Sindh Agriculture University Tandojam in a three replicated RCBD design. The zinnia plants were grown under four photoperiodic treatments which included T1=Natural photoperiod (Control), T2=4 hours daylight (8 am -12 noon)...
Gerald E. Marsh
...ligence in particular, appears to have no meaning. This essay explores the epistemological basis of this lament....
Tarun Kumar Sharma, John G. Bruno and William C. Cho
...o the high affinity and specificity in recent years aptamers, have emerged as competitive tools with the potential to replace antibodies in many diagnostic formats. The aptamer industry is continuously growing to create space in research and diagnostics markets. However, translation of aptamer in several applied disciplines is still lagging behind as compared to antibodies. In this article, we discuss the translational as
Ghani Akbar, Muhammad Munir Ahmad, Muhammad Asif, Iqbal Hassan, Qurban Hussain3 and Greg Hamilton
...se issues, a long term experiment (2000 to 2009) under wheat-maize (9 seasons each) cropping pattern was conducted on raised beds (with furrow spacing of 65 cm (Narrow Bed-NB), 130 cm (Medium Bed- MB) and 180 cm (Wide Bed-WB)), with controlled traffic regime emplaced, in comparison with traditional intensive cultivated flat basin (FB) for evaluating impacts on soil, crop and water productivity. The results showed reduced bulk density by 7%, 6% and 5% and incre...
Zuhao Huang1, Feiyun Tu2 and Dianhua Ke1*
...s: Meropidae) is a bird species of family Meropidae with a very large distribution. The complete mitochondrial genome of Blue-throated Bee-eater M. viridis was determined. The mitogenome is a circular DNA molecule of 18,295 bp and comprises of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and two control regions CR and CCR, which was first reported in the order Coraciiformes. The overall A+T content for the mitogenome is 52%, and the GC and AT ...
Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1
...H), nitric oxide (NO), superoxide dismutase (SOD) and lipid peroxides (LP) levels were estimated. Moreover these biochemical parameters were confirmed by histopathological examination using hemotoxylin and eosin (H&E) and Mason trichrome stains (MTC). Immunohistochemical investigations for the expression of the proapoptotic protein (Bax) and the expression of macrosialin cluster of differentiation (CD68). APAP elevated o...
Haidar Ali, Malik Muhammad Shafi and Himayatullah Khan
...howed that owners (59.31 percent off-farm employment) were performing more off-farm jobs than the tenants (50.74 percent off-farm employment) and owner-cum-tenants (41.77 percent off-farm employment). The dominancy of owners in the off-farm employment was associated to the farm holding size (up to 1 acre), they operate...
Mehreen Zaidullah and Hina Fatima
...nsumption pattern of the people, and hence result in the food demand shifts. The current study estimates for the presence of structural shifts in the demand for food in Pakistan for the selected food groups from the Household Integrated Economic Survey for the years1985-86, 1993-94, 2001-02 and 2007-08. Quadratic Almost Ideal Demand System (QUAIDS) is employed to estimate the budget shares and test for these shifts. The results confirm for the significance of ...
Shagufta Jabeen1, Muhammad Saqlain Raja1, Sadia Saeed1, Muhammad Mobeen Zafar1, Rizwana Abdul Ghani1, Abid Mahmood1, Muhammad Fiaz2, Pakeeza Arzoo Shiaq1, Shahid Mahmood Baig3, S.M. Saqlan Naqvi1 and Ghazala Kaukab Raja1*
...tionnaire consisting of open and closed-ended questions. Data regarding key factors such as age and ethnicity, communal domain, education level, employment status and demographic factors (drug route, drug dose) have bearing upon heroin addiction was collected. Descriptive and inferential statistics were used for data analysis. Early age of addiction onset, low literacy rate, peer pressure, occupation ty...
Abida Saleem, Sajida Parveen and Muhammad Jamal Khan
...ate of 10 g kg-1. The suspension was shaken on horizontal shaker for 20 h continuously to assess the equilibrium Zn concentration (EZnC). The difference between the IZnA and EZnC was assumed to be adsorbed. Results showed that FYM, PM or BC yielded lower EZnC and higher Zn adsorption (x/m) at higher IZnA but at lower IZnA< 20 mg Zn L-1 the reverse was observed. The data in non-treated soils were fit to both Langmuir and Freundlich but in treated soils they ...
Iqra Mahmood1, Asif Nadeem1*, Masroor Ellahi Babar2, Muhammad Muddassir Ali1, Maryam Javed1, Aisha Siddiqa1, Tanveer Hussain2 and Muhammad Tariq Pervez2
...mammary gland genes were performed to find mastitis resistant genes, which helped us to identify prime genes of mammary gland that are more resistant to mastitis, and analysis of those resistant genes helped to find the solution of mastitis and immunity related diseases.
...te mitogenomes of three species (O. lacepedii, O. rebecca and <...
Determination of Early Colonizer Urban Blowfly Species Using Small Bait Traps on a University Campus
Halide Nihal Açikgöz1*, Serdal Kenan Köse2 and Ali Açikgöz3
...ntify the urban blowfly species having forensic importance on Ankara University Medical Faculty Cebeci Campus in Ankara. Eight small liver bait traps were used for catching flies. Chicken liver was used in the study to attract blowflies. Eggs and larvae of the flies that oviposited on the liver were raised and identified. Six different indices were used to determine diversity (Shannon-Wiener [H’], Simpson Dominance [Sd], Simpson Diversity [S], Margalef S...
Metin Duru1*, Asuman Arslan Duru1, Köksal Karadaş2, Ecevit Eyduran3, Harun Cinli4 and Mohammad Masood Tariq5
...g hens as a commercial type through two-way ANOVA, to estimate the Pearson correlation between pairs of egg external and internal characteristics and to predict each of egg internal characteristics from egg external characteristics, treatment and week through CHAID analysis. A total number of eighty, 56 weeks old Hy-Line White laying hens (commercial type) of nearly similar initial body weight (1360.6±14.25 g) were as...
Ai Ming Zhou1,2, Guang Wen Liang2, Ling Zeng2, Yong Yue Lu2 and Yi Juan Xu2*
...ny studies. Laboratory experiments showed that invasive ant Solenopsis invicta (Hymenoptera: Formicidae) suppress ghost ants Tapinoma melanocephalum (Hymenoptera: Formicidae) through interference competition. However, relatively less testing have been done to evaluate the competition for mutual exploitation between the two ant species in the field. Here,...
Muhammad Khalid Mukhtar*
...align: justify;">The Oxyopes Latreille, 1804 is a large genus of spider with cosmopolitan distribution but has not been much studied in Pakistan. Two new species, Oxyopes chenabensis new species, and Oxyopes bidentata new species are being reported from Punjab.
...tern. A total 2249 fish specimen were collected using a variety of fish nets and identifications of these fishes were made by using standard taxanomic keys on the basis of morphometric characters. Seventy species belonging to 43 genera and 17 families were recorded from the study area of Indus River. Thirty two species were commercially important. Alpha Diversity Indices study showed that ...
Sadiq Hussain, Muhammad Sharif, Sarmad Khan, Fazli Wahid, Hina Nihar, Wiqar Ahmad, Imran Khan, Nadeem Haider and Tabassum Yaseen
...xt-align: left;">A pot experiment was conducted to assess the effect of mycorrhiza inoculation with vermicompost on yield and P uptake of wheat. The experiment was carried out in Completely Randomized Design replicated four times during season 2014-15. Phosphorus (P) was applied at recommended level of 90 kg ha-1. Vermicompost was used as a source of P on the basis of its P concentration. The recommended dose of N @ 120 kg h...
Irfan Ullah and Abbas Ullah Jan
...ext-align: left;">This paper aims to examine the food consumption decisions of the urban and rural household in order to understand the demand for different food commodities and to determine the effects of important economic factors such as prices and income. Flexible Linear Approximate Almost Ideal Demand System model is used to estimate food demand patterns using the Household Integrated Economic Survey of Pakistan for the year 2011-12. Food products are cat...
Zaheer Ahmad Qureshi and Khuram Nawaz Sadozai
...: left;">This research paper is designed to estimate the income inequality of rural region of Khyber Pakhtunkhwa (KP) Province, Pakistan. This study utilized cross sectional data of House Hold Integrated Economic Survey (HIES) collected by Pakistan Bureau of Statistics to obtain the income and expenditure level of sampled House Hold. The HIES data set of year 2011-12 for KP Province was comprised of the total of 1352 sampled...
Robina Karim and Dawood Jan
...quo;s foreign trade is expected to be largely better off once WTO’s regime is fully implemented in Pakistan and rest of the world”. The statistical results show that, the coefficient of variation of Pakistan exports trade estimates at 0.1657 during 1985-90 and 0.0936 during 1990-95 pre-WTO periods, which with the exception of sub-period 2000-05 decreased throughout post-WTO
Muhammad Zahid1, Muhammad Hamid Bashir1*, Bilal Saeed Khan1 and Muhammad Shahid2
...-align: justify;">Insect pests are the major yield decreasing factors in our agro-ecosystem. Among many pest management approaches, biological control is considered as the main strategy to address these issues including sucking pests. Different biocontrol agents are being used for the management of these sucking insect pests. Neoseiulus barkeri (Acari: P...
Atul Sharma, Aruna Chandra Singh, Gautam Bacher, Sunil Bhand
...crobial contamination, especially in food, dairy products, agriculture and environment, their regular monitoring is on prime interest. Aptamers are synthetic short sequences of single stranded (ss) oligonucleotides (ss-RNA or DNA), which are developed by an in-vitro selection process known as “Systematic Evolution of Ligands by Exponential Enrichment (SELEX)” technique. Among the receptors available for biosensin...
Asma-ul-Husna1, Muhammad Sajjad Ansari2, Bushra Allah Rakha3, Rabea Ejaz1, Nemat Ullah1 and Shamim Akhter1*
...y;">Oxidative damage to sperm during cryopreservation is one of the main causes of decline in fertilizing potential. Present study aimed at evaluating the role of melatonin in extender for its cryoprotective effect on post-thaw quality of buffalo bull semen. For this purpose, two consecutive ejaculates were collected from three Nili-Ravi buffalo bulls using artificial vagina at weekly intervals for a period of three weeks (t...
Muhammad Imran*, Munir Ahmad, Muhammad Naeem, Muhammad Farooq Nasir, Imran Bodlah, Muhammad Nasir and Umer Ayyaz Aslam Sheikh
...aying (first oviposition period) and earlier emergence of first worker were found in polycarbonate box as compared to others. Similarly, colony foundation stage in polycarbonate box took 58.3 days which was about 7-10 days shorter than others box types. Early emergence of sexual were observed in polycarbonate box with maximum numbers of daughter queens and males emerged 1.7-4.0 fold higher than from cardboard and wooden mate...
Ayanda Opeyemi Isaac,1,* Oniye Sonnie Joshua2 and Auta Jehu2
...ral abnormalities like hyperactivity, abnormal swimming, restlessness, loss of equilibrum and haemorrhage. Observation of opercular ventilation count (OVC), tail fin movemant rate (TMR) and air gulping index (AGI) showed a marked difference between control and exposed fishes, indicating that the herbicides negatively impact on these parameters. These behavioural and morphological anomalies became more pronounced with increas...
Ambreena Hafiz1, Tanzeela Riaz2 and Farah Rauf Shakoori1*
...D.G Khan populations, respectively compared to susceptible population. Free amino acids content of Gujranwala (22, 42, 75%), Okara (18, 30 and 17%) and D.G Khan (4, 15 and 25%) also showed the same trend of elevation in the 4th and 6th instar larvae and adult beetles, respectively compared to susceptible population. Glucose contents were significantly enhanced in Gujranwala (25, 336 and 356%), Okara (36, 163 and 74%) and D.G...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
...t and often marginalized pest of sugar beet, cabbage, broccoli and radish, among other crops. It is a cyst-forming nematode that affects plant growth and yield. We report on studies aimed to evaluate the effects of five nematophagous fungi on the population dynamics of this pest in sugar beets in laboratory and greenhouse trials. The fungi chosen were Arthrobotrys oligospora, Dactylella oviparasitica, Clonostachys rosea, Str...
Syeda Farzana Bibi*, Lal Badshah and Siraj-ud-Din
...A total of 30 different species ,which belong to 29 genera and 16 families, were recorded from the area.Poaceae was the most dominating family including 7 genera. Ecological characteristics like life form spectra indicated that Therophytes (53.33%) were the most dominating life form. Leaf size spectra showed that the most abundant leaf size was Microphyll (50%). This study not only gives i...
Muhammad Basit1, Shafqat Saeed2, Mushtaq Ahmad Saleem3, Rana Zulfiqar4
...on fluctuation of insect pests and their predators in sunflower ecosystem. The data revealed that B. tabaci and Empoasca spp were present throughout the cropping season. Their average maximum populations (5.65 and 3.20 individuals / leaf) were recorded during 3-week of May 2009. Aphis gossypii was recorded during the month of March and its maximum population (28.3 individuals / leaf) was observed during 2-week of March 2009. Likewise, Nysius inconspicuous was ...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
... justify;">A series of experiments were conducted in a greenhouse to determine the population dynamics of the root knot nematode, Meloidogyne incognita, and the nematophagous fungus, Lecanicillium muscarium, on tomato. The nematode population densities were measured by determining the number of galls and egg masses, juveniles and eggs per root system, and reproduction factor. Four initial populations (Pi) (500, 1000, 1500, a...
Misbah Riaz1, Qaiser Mansoor2, Maleeha Akram1, Muhammad Ismail2, Parveen Akhtar3, Shakeel Mirza4, Mazhar Qayyum1, Afzaal Ahmed Naseem1, Faheem Tahir5 and Syed Shakeel Raza Rizvi1*
... amplified by PCR using specific primers for GPR54 and GNRHR splice site exons. Mutations were analyzed by single-stranded conformation polymorphism (SSCP) and/or sequencing. No mutation was identified in GPR54 gene, while two mutations in GNRHR gene were observed in one sporadic case of isolated HH. The first was a synonymous substitution mutation of T to G at nucleotide position 123, which did not replace valine with any other amino acid. The other mutation ...
Afzaal Ahmad Naseem1*, Maleeha Akram1, Sarwat Jahan2, Kiran Afshan2, Zubaria Iqbal1, Faheem Tahir3, Mazhar Qayyum1 and Syed Shakeel Raza Rizvi1
...nd developmental stage dependent changes in GH and T and LGV and their associations require further investigation. This study examined relationships between GH and LGV, T and LGV and GH and T in 540 normal healthy boys of 1 to 20 years (n=27 boys/age group). The concentrations of GH and T were measured using specific ELISA systems and LGV was calculated for each age/stage group. Pearson correlation r and ANOVA were employed....
Ali Murad Rahoo1,2, Tariq Mukhtar3,*, Simon R. Gowen1, Rehana Kanwal Rahoo4 and Shaukat Ibrahim Abro5
...ogenic nematodes (EPN) depend on the use of host insects for in vivo production. As there is little information regarding relationship between nematode dosage and production of infective juveniles (IJ) of Steinernema feltiae and ability to locate hosts, therefore, in the present studies investigations were done on these aspects. A significantly greater emergence of IJ of S. feltiae from Galleria mellonella was observed with ...
John Gachohi, Simon Karanja, Salome Wanyoike, Nduhiu Gitahi, Salome Bukachi, Kenneth Ngure
...ign whose findings are expected to inform public health decision-making. Going forward, it will be possible to parameterize complex realistic Leptospira transmission models for understanding urban Leptospirosis dynamics....
Pan-pan Guo1, Wei Liu2, Yan Li2, Rui-yu Ma2, Wang Zaigui1*, Kai Zhan2*, Jun-ying Li2 and Sheng-nan Liu2
...ociation with production performances in two Anhui local chicken breeds. A total of 800 chickens (400 Huangshan black chickens and 400 Huainan partridge chickens) of similar age and weight were evaluated in the present study. We extracted DNA from blood samples and analyzed polymorphisms of HTT gene as wells as possible association with egg production performances including age at first egg (AFE), laying rate (LR), egg produ...
Characterization, Tissue-Specific and Developmental Stage Expression of Somatostatin in Coilia nasus
Siyu Yang1, Fukuan Du2 and Pao Xu1,2*
...n: justify;">Estuarine tapertail anchovy (Coilia nasus) is a rare and endangered species and also an important resource with high economic value. Somatostatin (SS) is a neuropeptide family which effects growth, development and metabolism. In this study, full-length of one type of SS cDNA from C. nasus was synthesized, cloned and sequenced. This SS cDNA e...
Taghreed A. Hafiz1, Murad A. Mubaraki1*, Mohamed A. Dkhil2,3 and Saleh Al-Quraishy2
...were determined using a spectrophotometric method. The antiradical scavenging property and the maximum nontoxic concentration of the extract was determined using DPPH assay and MTT method, respectively. Serial concentrations of the extract not exceed the maximum nontoxic concentration were used against Vero cells for anti-HSV-1 and ant-HSV-2 effects by plaque assay. The results of the...
Ecevit Eyduran1, Daniel Zaborski2*, Abdul Waheed3, Senol Celik4, Koksal Karadas5 and Wilhelm Grzesiak2
... networks and multilayer perceptrons with one (MLP1) and two (MLP2) hidden layers in body weight (BW) prediction from selected body measurements in the indigenous Beetal goat of Pakistan. Moreover, the results obtained with the data mining algorithms were compared with multiple linear regression (MR). A total of 205 BW records including one categorical (sex) and six continuous (head girth above eyes, neck length, diagonal body length, belly sprung, shank circu...
Ali Raza Awan*, Sehrish Firyal, Muhammad Tayyab, Lala Rukh, M. Zia ul Haq, Shagufta Saeed and Muhammad Wasim
...is sub-divided in 4 sub-species (P. krameri krameri, P. krameri parvirostris, P. krameri manillensis and P. krameri borealis). Identification of the sub-species is an intricate chore. This study aimed to genetically identify and classify the indigenous wild Rose-ringed Parakeet of Pakistan using Cytochrome b (Cytb) gene polymorphism. Mitochondrial DNA of 24 unrelated Pakistani wild Ring-rose Parakeets was isolated and utiliz...
Shakeel Ahmed* and Sarwat Jahan
...investigated the role of peripheral administration of neuromedin S (NMS) on adipokines (adiponectin, leptin and resistin) secretion in 48-h fasting and normal fed adult male Rhesus monkeys. After NMS administration plasma adipokines levels were determined in fed and fasting monkeys. Four intact adult male monkeys were used in this study. 50 nmol of NMS was injected intravenously. Blood samples were collected individually 60 min before and 120 min after NMS adm...
Süleyman Kök1*, Sertaç Atalay1, Hasan Semih Eken2 and Mustafa Savaşçi3
...The application of gene specific molecular markers in genotyping and genetic identification is of essential significance for preserving genetic diversity. The aim of this study was to reveal the genotype profile of indigenous types for TGC breed. In order to characterize TGC population, two polymorphic loci in cattle Calpain gene (CAPN1) and one polymorphic locus in Calpastatin gene CAST w...
Tayiba Latif Gulraiz1, Arshad Javid1*, Syed Makhdoom Hussain2, Muhammad Shahbaz3, Irfan3 and Sharoon Daud4
...ve fungal (Alternaria, Aspergillus, Chrysosporium, Exophilaand Scopulariopsis) and four bacterial (Bacillus, Corynebacterium, Listeria and Streptomycete) genera were common in bolus and guano samples. Seasonal variations were recorded in occurrence of various fungal and bacterial genera. From bolus samples, two fungal Aspergillus and Fusarium and one bacterial Bacillus genera were recorded throughout the year while from guan...
Sania Subhan Qureshi, Mian Saeed Sarwar and Zahir Shah
...Physical examination was performed and it was diagnosed a case of muscle tumor (myoma). A skin incision was given to expose and to remove tumor mass from the surrounding tissues. Peritoneum, muscle and subcutaneous tissues were sutured with absorbable suture (vicryl; polyglactin 910) and skin with a non-absorbable suture (silk). Owner was advised for daily check-up for any damage to the stitches and for regular dressing of the wound with antiseptic. Antibiotic...
Muhammad Sohail1,*, Muhammad Naeem Khan1, Naureen Aziz Qureshi2 and Abdul Shakoor Chaudhry3
...ta anatina), a sentinel species in aquatic environment. Freshwater mussels were exposed to none (0µg L-1), low (120 µg L-1), medium (240 µg L-1) and high (360 µg L-1) levels of lead (Pb), chromium (Cr) and copper (Cu) alone and in combinations (Pb + Cr + Cu) for 15 days under laboratory conditions. Gill cells of mussels were used to determine the DNA damage by comet assay. The tail DNA (%), comet tail...
Abdullah Mart1* and Orhan Erman2
...: justify;">Twenty nine species and 2 subspecies belonging to 10 genera of water scavenger beetles (Coleoptera: Hydrophilidae) collected from Bingöl province between May 2003-October 2004 have been described....
Jose M. Rojas, Noemi Sevilla and Veronica Martin
...-align: left;">Peste des petits ruminants virus (PPRV) is the causal agent of a highly contagious disease that affects domestic and wild small ruminants, Peste des petits ruminants (PPR). Due to the important economical losses caused by this virus in Africa and Asia, the development of more effective, targeted and successful treatments for the disease are necessary. Like other Morbilliviruses, PPRV induces a suppression of t...
Giselle R.R. Ayres* and Brandão P.E
...s, made possible by the special characteristics of AvCoV genome. This manuscript aims to present an overview of the main aspects of the current knowledge on the main AvCoV replicase genes....
Abdur Rahim1, Ghulam Abbas1, Muhammad Naeem2, Sara Ferrando3, Lorenzo Gallus3, Noor Khan4, Muhammad Hafeez-ur-Rehman4, Abdul Ghaffar5 and Abdul Mateen6
...l composition, and fish species being used for producing fish meal. The overall production of single processing unit ranged from 40 to 500 metric tonns per month. Kampa Industry (Unit 1) was found to be the first largest contributor producing 100 metric tons in 24 h. The second largest producers of fish meal in this region were Abdul Baqi, Ghulam Hussain and Kampa Industry (Unit 2) which produced 300 to 500 metric tons
Sabri Unal1, ASır Er2, Erol Akkuzu1* and Lubomir Salek3
..., and 232.7 M. rosea, respectively. The predation efficacy of the C. septempunctata was increased with the progress of the larval instars up to the fourth which was the most voracious....
Mostafa A. Abdel-Maksoud1,2, Fathy A. Abdel-Ghaffar2, Azza El-Amir2, Gamal Badr3 and Saleh Al-Quraishy1*
...ical investigations were performed.Live P. chabaudi infection was accompanied with an increase in spleen weight in comparison to either the control or the gamma irradiated P. chabaudi infected group. Differential count of WBCs has revealed an increase in lymphocytes, monocytes and granulocytes count in plasma samples of the live P. chabaudi infected group in comparison to either the control or the gamma irradiated P. chabaudi infected group. Additionally, live...
Muhammad Hafeez-ur-Rehman1, Farzana Abbas1, Muhammad Ashraf1, Naeem Tariq Narejo2, Khalid Javed Iqbal3, Ghulam Abbas4* and Syedah Andleeb5
...e fecundity with latency period of 47.70±0.54 h was observed in treatment 3 (40% CP) while treatment 2 (35% CP), in combination of ovaprim + fresh PG showed very short latency period when compared to the ovaprim+HCG injected fish. Treatment 1 and control failed to spawn. Fish fed on 30% protein diet (treatment 1) and the control had the lowest fecundity showing insufficiency of protein required for pro
Tasnim Farasat*, Saima Sharif, Farkhanda Manzoor, Muneeza Zafar and Shagufta Naz
Dallin D. Oaks and Cynthia L. Hallen
...gnificant attention. The pervasiveness of certain metaphors in the lives of members of a religious community is especially significant when they are incorporated into sacred texts. This would seem to be the case not only for Judaism, Islam, and mainline Christianity, but also for Mormonism, a distinctive branch of Christianity. Officially known as The Church of Jesus Christ of Latter-day Saints (LDS), Mormonism shares some r...
Imed Ben Salem*, Aymen Ben Ibrahim, M’barek Chetoui and Said Nouira
...netic analysis of eight species viz. Lemniscomys barbarus, L. bellieri, L. griselda, L. limulus, L. macculus, L. rosalia, L. striatus and L. zebra; which have practically similar external morphologies although they spread in completely different geographical areas. The approach adopted was to identify landmarks on the skulls of all specimens using the tpsDig software, and then analyzing them through the program MorphoJ. Our ...
Faiqah Ramzan*1 and Muhammad Haris Ramzan2
...ign: justify;"> Kisspeptin, a product of the KISS1 gene, plays an essential role in the regulation of spermatogenesis acting primarily at the hypothalamic level of the gonadotropic axis. Citric acid is synthesized and secreted by the prostate gland. Its synthesis is regulated by androgens. As, dose dependent degeneration of prostate gland has been described following intra
Marryam Bakhtawar1, Qamar Saeed1* and Naeem Iqbal2
...ally control a number of pests for an eco-friendly pest control system....
Abdul Sattar Baloch1*, Abdul Rasheed1,2, Rahmatullah Rind1, Jam Kashif Sahito1, Rehana Buriro1, Muhammad Faisal Ayoob1 and Parkash Dewani1
... a wide range of animal species including human beings and is more severe in human than in animals. It imposes a huge burden on human health due to its zoonotic nature. Our study involves the testing of 100 sera samples and 50 milk samples from camels of three districts of Sindh province of Pakistan. Rose Bengal Plate Test (RBPT), serum agglutination test (SAT) and competitive-ELISA (c-ELISA) were used as screening tests, an...
Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2
... of H9 gene of H9N2 subtypes using one step Reverse Transcriptase Polymerase Chain Reaction (RT-PCR). Out of 24 samples taken from each organ, 22, 21, and 18 samples from trachea, lungs, and intestine showed viral RNA, respectively. Taken together, results showed that the H9N2 is endemic and widely distributed in asymptotic layers. Furthermore results indicated that H9N2 subtype may surviv...
Rashid Ahmed Khan* and Muhammed Naveed
... Tephritidae) is a major pest of fruits causing severe losses to the fruit production and quality in Pakistan. Its management has largely relied upon the indiscriminate and injudicious use of conventional insecticides resulting in problem of insecticide resistance, environmental pollution, fruit contamination and health hazards. The major goal of the present study was to evaluate the effectiveness of a bio-insecticide, emamectin benzoate with other conventiona...
Abdul Mannan Babar1* and Abdul Hannan Nagi2
... justify;">Keloids and hypertrophic scars are an exaggeration of fibroplasia in dermal repair. Keloids are found solely in humankind, and not in animals. Thus far no practicable animal model of Keloid has been made. Recently a prototype rabbit ear keloid model has been produced by the authors by giving Transforming Growth Factor Beta 1 injection, and then skin punch excision on rabbit ear. In the present follow-up study cons...
Rongrong Li1, Kun Li2, Xiaoqiang Wang2, Houqiang Luo2, Gang Qiu2, Hui zhang2, Yanfang Lan2 and Jiakui Li2,3*
...in males and females, respectively. The results indicates that the Tibetan gigs were exposed to T. gondii in Tibet area, which should arise a public concern of the threat to human and other animals in this unique region of the world....
Atta ur Rehman1, Sher Ali2 and Sajid Malik2*
...-West Pakistan deserves special attention due to the demographic transitions caused by recurrent displacements, fragmentation and migrations. In order to observe the genetic differentiation in lower Khyber Pakhtunkhwa (KPK) region, ABO and Rh blood groups record of nine Pashtun populations, i.e., Bannu, Dera Ismail Khan, Hangu, Karak, Kohat, Kurram Agency, Lakki Marwat, South Waziristan Agency, and Tank, was collected. Absolute gene diversity, gene differentia...
Hussain Ahmad1, Inamullah1, Ijaz Ali2, Tauseef Ahmad3, Muhammad Tufail4, Kabir Ahmad5 and Bibi Nazia Murtaza3,6*
...ffecting several animal species and human beings. It is caused by Brucella abortus in animals and Brucella melitensis in human. The current study aimed to find out the prevalence of Brucella and active brucellosis in the human population of district Swat. Total 300 individuals (both female and male of all ages, meeting our inclusion/exclusion criteria) with informed consent were included in the study. Blood samples were collected and brucellosis was detected b...
Muhammad Raheel1,*, Nazir Javed2, Sajid Aleem Khan2, Hafiz Muhammad Aatif3 and Sohail Ahmed4
...nfluence of different temperature ranges on the reproductive potential of native and exotic species of entomopathogenic nematodes (EPNs) was checked on Galleria mellonella larvae. The native species included Steinernema asiaticum and Heterorhabditis indica whereas exotic species were S. feltiae and H. bacteriophora. G. mellonella larvae were exposed to 3...
John G. Bruno
... DNA aptamers were developed against extracted lipopolysaccharides (LPS) of E. coli O157 and the so called “Big six” non-O157 Shiga-toxin producing E. coli (STEC) serovars (O26, O45, O103, O111, O121 and O145). These aptamers were assessed by enzyme-linked aptamer sorbent assay (ELASA) to rank their relative affinities and discriminatory ability for distinguishing between each of the STEC serovars. The most speci...
Dein Simon
...he two groups. In this paper I analyse new atheism in terms of fundamentalist characteristics discussed by the Fundamentalism Project: Reactivity, dualism, absolutism and inerrancy, apocalypticism. Additionally both underscore the role of evidentialism. From my analysis of these characteristics I conclude that the movement is fundamentalist...
Zafar Waheed, Khalid Usman, Iftikhar Ali
...ed to investigate the competitive effects of Rumex dentatus sown at varying densities in association with wheat (Triticum aestivum L.) under field conditions. The experiment was conducted at Agronomic Research Farm, Faculty of Agriculture, Gomal University, Dera Ismail Khan in randomized complete block design having three replications during 2013-2014. The treatments comprised of wheat + Rumex dentatus 0 plants m-2 (T1), whe...
Ahmed Samy, Wesam Mady, Naglaa M. Haggag, Samah H. Mohamed, Ebtissam N. AlShamy, M.K. Hassan
...zation of H9N2 in avian species. However little is known about the impact of different strains on the innate immune response. In the present study, using quantitative real-time PCR, cytokines gene expression were examined in response to infection with two strains of Egyptian H9N2 (namely V3 and RSF/1) in chicken peripheral blood mononuclear cells (PBMC). Hemagglutinin gene sequence analysis of the two strains reveal high sim...
Muhammad Shafiq and Tahir Maqsood
...rm of the soil was developed at the Institute of Soil and Environmental Sciences, University of Agriculture, Faisalabad, during 2013-14. Adsorption procedure was done by harmonizing 2.5g soil in 0.01M CaCl2 solution having diverse B doses (0, 0.01, 0.03 , 0.05 , 0.07, 0.09, 0.11, 0.13,0.15 and 0.17 mg B L-1). Freundlich and Langmuir adsorption models were applied to the data to check the sorption of B on sandy clay loam soil. Freundlich model depicted su
Oladipo Elijah Kolawole, Oloke Julius Kola and Awoyelu Hilda Elukunbi
..., also known as human herpes virus-4 (HHV-4), is a virus of the Herpesviridae family, and is one of the most common viruses in humans. It is the best known cause of infectious mononucleosis. In acquired immuno-deficient Syndrome patients, several distinct and additional EBV-associated diseases may occur and some forms of malignancies. This study was designed to determine the incidence of EBV in Human immune-deficient virus (...
Dilawar Hussain* and Abdul Mateen
...its effect on the growth performance of Nile tilapia over a period of 10 weeks. Inclusion of AFB1 at both 2 and 4 ppm levels significantly (p<0.05) decreased specific growth rate (SGR), net weight gain (NWG), average daily gain (ADG), survival, feed intake, feed efficiency ratio (FER) and protein efficiency ratio (PRE), irrespective the addition of th...
G.E. Odo1*, E.J. Agwu1, N.I. Ossai2, C.O. Ezea3, J. Madu1 and V. Eneje2
...ective and commonly used pesticide in agriculture for pest control in Nigeria. This study investigated the effects of aluminium phosphide on the behaviour, haematology, oxidative stress biomarkers and biochemistry of African catfish (C. gariepinus) juvenile on days 7, 14, 21 and 28. Fish were exposed to 0.175, 0.0875 and 0.035 mg/L corresponding to 1/10, 1/20 and 1/50 of the 96 h LC50 value (1.75) of the
KM Fakhrul-Islam, Mohammad Shah Jalal, Sonnet Poddr, Md Nurul Quader, Md Sahidur-Rahman, Avijit Dutta and Shuvo Mazumder
...as evaluated. Both retrospective and prospective FMD clinical cases were included considering clinical signs and drugs used for treatment during 13 January to 15 March 2015. A total of 131 cattle was investigated and 16.8% cattle cattle were recorded as FMD. The proportionate prevalence of FMD in different study areas were 4.5-18.2%. The occurrence of FMD was higher in February (23.3%) than in January (13.5%) and March (18.5...
Sezgi Arman* and Sema Isisag Ucuncu
..., aldehyde fuchsin (AF), periodic acid-Schiff (PAS), KOH/PAS and PAS/AB (pH 2.5) and investigated. Goblet cells of anterior intestine were colored strongly by AB (pH 2.5), AF and PAS; and moderately by PAS/AB (pH 2.5) (AB dominant). In the mid part of the gastrointestinal tract, goblet cells were also stained strongly with AB, PAS and PAS/AB (pH 2.5) (AB dominant), however, their reactions to KOH/PAS treatment were recorded as negative. Because of numerous sup...
Sezgi Arman* and Sema Isisag Ucuncu
..., aldehyde fuchsin (AF), periodic acid-Schiff (PAS), KOH/PAS and PAS/AB (pH 2.5) and investigated. Goblet cells of anterior intestine were colored strongly by AB (pH 2.5), AF and PAS; and moderately by PAS/AB (pH 2.5) (AB dominant). In the mid part of the gastrointestinal tract, goblet cells were also stained strongly with AB, PAS and PAS/AB (pH 2.5) (AB dominant), however, their reactions to KOH/PAS treatment were recorded as negative. Because of numerous sup...
Noor Us Saher1, Zunaira Amanat2, M. Asif Gondal3 and Naureen Aziz Qureshi4,*
...n: justify;">Matuta planipes and Ashtoret lunaris were collected as a part of by catch of gillnet deployed for shrimps from April 2005 to March 2007 in Sonmiani Bay waters (Miani Hor lagoon). M. planipes was found abundantly in Sep. 2005, Nov. - Dec. 2005 and Dec. 2006 (93.3%, 94.7%, 92.3% and 87 % respectively). A. lunaris was found in abundance during May 2005 (85.7%) and Aug. 2005 (81.8...
Ibrar Khan1,2,3,*, Sadia Qayyum2, Shehzad Ahmed2, Kashif Syed Haleem2, Mujaddad-ur-Rehman1, Guang-Lei Liu3 and Zhen-Ming Chi3
... fauna. The Penicillium species belongs to one of the most common and economically significant group of marine micro-fungi family. The study comprised isolation, microscopic observations and ribotyping, allowed discrimination of the marine fungal isolates as Penicillium viticola F1, Penicillium restrictum F2, Penicillium rubens F8, Penicillium implicatum F10, Penicillium piceum F11, Penicillium oxalicum F12, Penicillium sumatrense F15, and Penicillium vinaceum...
Nighat Sultana1,2,*, Shazia Iftikhar1, Nafeesa Qudsia Hanif2 and Iffat Tahira2
...resent study evaluated Aspergillus (A) spp. and mycotoxins in fresh and ensiled maize fodder using a model fermentation system and raw materials from different areas of Punjab, Pakistan. A. niger, A. flavus and A. fumigatus were the most dominant followed by A. terrus and A. ochraceous in fresh and ensiled maize fodder. Total fungal counts ranged from 1×103 to 4×103cfu/ml for all species in both fresh and ensiled...
Abdul Aziz Khan1,*, Waseem Ahmad Khan2, Waseem Ahmad Khan3 and Najam-ul-Huda Khan4
...of 141 small mammals trapped. Majority of the Mus booduga specimens were adults (56.06%) while the juvenile/sub-adults were 43.94% of the total specimens trapped. The highest trap success of Mus booduga of 74% was achieved at Namal Lake, followed by Khabeki (38.67%), Uchali (30.67%), Kallar Kahar (16%) and the lowest at Jahlar Lake (12%). The results of ...
Asmaa Hamid1,* and Samia Kalsoom2
...et AIN-76-A, Kabuli chickpea HFD and Bengal gram HFD and were monitored for random blood glucose and weight for a period of six weeks. Another three groups of rats with induced hypercholesterolemia were fed the same diet as the diabetic rats and were monitored for total serum cholesterol. It was found that both Bengal gram and chickpea had a significant ...
Wang Tian1, Huayong Zhang1,*, Jian Zhang2, Lei Zhao1, Mingsheng Miao3 and Hai Huang1
...total of 76 zooplankton species were identified in the lake, including 17 protozoa, 36 rotifera, 12 cladocera and 11 copepods species, respectively. Zooplankton species richness changed slightly in the four seasons but varied a lot in different positions. Protozoa was absolutely dominated in zooplankton abundance and i...
Jixue Hou1,2, Xueling Chen3, Jing Wang4, Hongwei Zhang2, Yu Xi2, Jie Xia2, Xinyu Peng2,* and Xiangwei Wu2,5*
...isms to restenosis after percutaneous transluminal coronary angioplasty (PTCA) as well as translational approaches. In this Experiment, we established a unique murine model of femoral artery injury through a home-made wire. The mouse model of vascular injury may be used to explore the molecular mechanism of post-angioplasty restenosis with lowest costing....
Xiangxing Zhu1, Junyu Nie1, Shouneng Quan1,2, Huiyan Xu1, Xiaogan Yang1, Yangqing Lu1, Kehuan Lu1 and Shengsheng Lu1*
...the most abundant cell type in the mammalian central nervous system (CNS), perform many important neurobiological functions. Although a large number of transgenic mouse models carrying astrocyte-specific transgene expression of transgene have made significant contributions to understanding astrocytic structure and function in vitro and in vivo, evidence suggests that mouse models are limit...
Abdul Baset1, Qun Liu1,*, Muhammad Tariq Hanif1, 2, Baochao Liao1, Aamir Mahmood Memon1,3 and Muhammad Mohsin1
...iennes, 1847, Family: Clupeidae), fishery resources from Pakistani waters. The catch and effort data (1994 – 2009) were analyzed by CEDA (catch and effort data analysis) consists of Fox, Schaefer and Pella Tomlinson models and ASPIC (a surplus production model incorporating covariates) contain Fox and Logistic models. The average annual landings of S. longiceps stocks were 38 353 t while the highest and lowest 65 050 t in 1994 and 26 937 t in 2009 was re...
Aiza Tahir, Muhammad Asif, Zaigham Abbas and Shafiq ur Rehman*
Fukuan Du1,2, Yan Li2, Zhixin Wen1, Ruguo Chen1 and Pao Xu2*
...aused extinction of the species in the the Yangtze River. Therefore, it is very urgent to carry out genetic breeding to improve yield. In this study, we developed SSR markers by transcriptome, which could be used to genetic research. In this study, we performed transcriptome sequencing of six libraries from hepatopancreas samples in E. sinensis. After removing low-quality reads, short read...
Oluwasogo David Olorunfemi, Oluwasegun Adetokunbo Adekunle, Felix Olayinka Oladipo, Temitope Oluwaseun Oladele and Oladimeji Idowu Oladele
...tional level, years of experience and fish farm income. The value addition initiatives use profile of the fish farmers was still very low among the respondents and training was highly needed on value addition initiatives in seven major areas. It was recommended that robust training programmes and advisory services should be packaged by extension organizations and other stakeholders for fish farmers in the major areas of capacity deficiencies indicated so as to...
Bahattin Cak1, Orhan Yilmaz1, Siddik Keskin2, Tahir Bayril3 and Mohammad Masood Tariq4*
...redict body weight at a specific age. We investigated the growth characteristics of Colored Mohair goat using four nonlinear growth models. Thirty (n=22 males and n=8 females) Colored Mohair kids were used. The kids were weighed at 2-week intervals from birth to 150 days. The Monomolecular, Gompertz, Richards and Three Parameter Logistic models were used. The best model was determined by considering the root mean square erro...
Shazia Irfan1*, Asima Rani1, Muhammad Arshad2 and Razia Bashir1
...nvestigate the role of Superoxide dismutase 1 (SOD1) gene polymorphism [rs2070424 (–251A/G)] in RA and to compare the levels of metals and minerals among its various genotypes in RA patients. A total of 400 individuals including age and gender matched healthy individuals (control group) and RA patients were genotyped. Detection of rs2070424 polymorphism was carried out using allele s...
Abdur Rahim1, Ghulam Abbas1*, Lorenzo Gallus2, Sara Ferrando2, Muhammad Hafeez-ur-Rehman3, Abdul Ghaffar4 and Abdul Mateen5
... and frequency on growth performance, nutrient utilization and body composition of juvenile black fin sea bream, Acanthopagrus berda (weight 23.5g−125.8 g) were investigated. Fish were randomly distributed in rectangular glass tanks (150 liter) and were fed at six ration levels of 2.0, 2.5, 3.0,3.5, 4.0 and 4.5% body weight per day (BW d−1) and four feeding frequency i.e., once, twice, thrice and four times
Iram Liaqat1*, Najma Arshad2, Muhammad Arshad3, Safdar Ali Mirza4, Nazish Mazhar Ali1 and Ammara Shoukat1
.... 16SrRNA sequencing was performed to identify three highly resistant strains at species level. Antimicrobial activity of aqueous and methanolic plant extracts of Camellia sinensis (Green tea), Syzygium aromaticum (Clove) and Mentha piperita (Peppermint) was evaluated against identified isolates. Agar well diffusion assay was used to monitor the antimicr...
Bin Wang, Bo Zhang, Nan Yang, Liang Dou and Jianghong Ran*
...China and is known to cooperatively breed in a population habituated to supplemental feeding by humans. The social structure and demography of this species, however, have not been examined in natural populations. To determine if cooperative breeding occurs in populations unassociated with humans, we surveyed two natural populations in the Ganzi Tibetan Autonomous Prefecture in western Chin...
Sidra-Tul-Muntaha1, Muhammad Sagheer1*, Mansoor-ul-Hasan1 and Shahbaz Talib Sahi2
...ducted to evaluate the repellent and growth inhibitory efficiency of five plant extracts (Azadirachta indica, Melia azadirach, Pegnum hermala, baryosma and Zingiber officinale) and three synthetic pyrethroids (bifenthrin, cypermethrin and deltamethrin) on three geographical populations of Callosobruchus chinensis collected during 2013 from Faisalabad, Multan and Nankana districts of Punjab, Pakistan. Three concentrations of...
Muhammad Saeed* and Iftikhar Hussain Khalil
...ombining ability (GCA), specific combining ability (SCA) and narrow sense heritability for maturity and yield components traits were determined. The main objective of the research was identification and proper selection of best performing wheat parental genotypes and best F1 crosses, based on GCA and SCA estimates. Significant differences were observed a...
Aziz-ul-Rahman, Farooq Yousaf, Naveed Anwar and Muhammad Abubakar
...-align: left;">Peste des petits ruminants virus (PPRV) causes an economically important disease of small ruminants that causes extensive livestock losses across areas where it is endemic. A serological survey on the prevalence of antibodies to PPRV was carried out in sheep and goats of Jatoi and surrounding areas in Muzaffargarh districts South Punjab of Pakistan. A total of 965 serum samples were collected from sheep and goat’s farms from January to Dec...
Ahmed Zein Mahmoud, Muaz Abdellatif and Ahmed Abdalla
...-align: left;">Peste des petits ruminant’s virus (PPRV) causes a highly contagious disease in both domestic, wild ruminants and camels. Sera from non-vaccinated sheep (n=683), goats (n=624) and camels (n=155) of all ages and sexes were collected in a cross-sectional study in Hail, Bagaa, Shenan and Ghazalah. Saudi Arabia. The seroprevalece was determined by NP-epitopes based competit...
Salma Shaheen, Mumtaz Khan, Muhammad Jamil Khan, Saleem Jilani, Zarina Bibi, Muhammad Munir and Mehwish Kiran
...yield is scarce. A pot experiment was conducted at Gomal University D.I. Khan, Pakistan, during 2009-10 to study the changes in soil fertility and spinach growth after the application of EM with organic wastes and chemical fertilizers. The six treatments were; control (T0), 10 tons (t) ha-1 farm yard manure (FYM) (T1), 20 t ha-1 pressmud (T2), 0.7 t ha-1 compost (T3), 5 t ha-1 poultry manure (T4) and mixed chemical fertilizer in the ratio of 100 : 40 : 56 kg h...
Neelum Andaleeb and Munir Khan
...w was 180 and 135 liters per month, respectively. Average total costs of milk production of buffalo and cow were Rs.12835 and Rs.10070 per month respectively whereas the average net income per liter from the buffalo and cow milk was Rs. 29 and Rs. 5 thus benefit-cost ratios for buffalo and cow is1:1.43 and 1:1.07, res<...
Fida Mohammad, O.S. Abdalla, Sheraz Ahmed, Fakharuddin and S. Rajaram
...s (ICARDA), Syria. The experimental material comprised of forty synthetic derived wheat lines along with eight check cultivars was planted in alpha lattice design with three replications. Genotypes exhibited significant (p≤0.01) variations for all the studied traits excluding biomass. Genotype by environment interactions (GEI) were significant for all the characters except for thousand ...
Nusrat Habib, Safeena Inam and Abdul Hayee Qureshi
...flower were respondent experience, access to credit, total cost of sunflower, access to price information of market, distance from input shop and more profit from competing crops indicating that the 1 percent increase in these parameters will decrease the probability to adopt sunflower. Whereas supporting parameters were highest educations level in the family, total o...
Amjad Ali and Abbas Ullah Jan
...f sugarcane crop for the period under study in Khyber Pakhtunkhwa ranges from minimum 0.47 to maximum 0.98 with mean value of 0.84 percent. This mean that with same resource base average sugarcane growers can increase his yield up to 14% and most technical inefficient grower can increase his per acre yield up to 52% in order to achieve technical efficiency level (98%) of efficient fellow g...
Mariano Gastón Asla
...cond, from a theoretical perspective, I will present some examples that show the philosophical value of the extraterrestrial intelligence fiction as a mental experiment of remarkable heuristic fertility....
Muhammad Jamal Nasir, Anwar Saeed Khan, Said Alam and Saeed Akhtar
...ata about crop yield and per acre production, new seed and crop varieties etc. was collected with the help of a questionnaire survey. A total of 50 household were surveyed which make 45 percent of the total (114 households). The analysis of acquired data reveals that in 2008-09 tube well irrigated land account for 81.67 acre which decreased to 37.46 acre in 2013-14, after the dam construction. The number of parcels irrigated...
Muhammad Shahzad Ahmed and Dilnawaz Ahmed Gardezi
... explored using 20 genotypes for initiation of breeding program in the country. A site near Bagh district (Arja) Azad Kashmir was found suitable and used for morphological evaluation, phenotypic diversity analysis and their flowering behavior sugarcane under local conditions. Two year data revealed that genotype HSF-242 showed maximum mean values for, internodes length, brix percentage and...
Sheraz Ahmad Khan and Ghulam Hassan
...tify;">A set of 27 genotypes were tested for estimation of heritability, genetic advance and association of yield and yield related traits in wheat. For all the studied traits, mean squares showed the presence of significant variation (p≤0.01) among the genotypes. Heritability estimates were observed high (h2˃0.60) for all the traits. The highest heritability (0.93) was noticed in plant height followed by flag leaf a...
Muhammad Aslam Shahid, Muhammad Iqbal and Muhammad Niamatullah
...et and yield. In this respect, an experiment was conducted during 2012 and 2013 to evaluate the male spath characteristics and to observe the effect of pollen sources on fruit set, yield and physico-chemical characteristics of Dhakki date palm. Data were recorded for spath length, width, number of strands/spath, number of flower per strands, number of spath pe
Hina Fatima, Lal Almas and Bushra Yasmin
...nd 75%. Approximately 36 percent of farms allocative efficiency varies from 0.20 to 0.60. Around 60% of farms allocative efficiency ranges from 0.61 to above 0.90. The under and over-utilization of inputs such as land, seeds, fertilizers and pesticides reflect the general performance of the inputs in terms of their degree of changes in cotton-melon output to change inputs reflected by the ...
Aqila Shaheen and Nadia Sabir
...bsp;STR and DTR, respectively. F2 and F3 increased grain and straw yield compare to F1. In the case of maize, DT increased grain yield by 53%, 20% and 15%, over ST, STR and DTR, respectively. Deep tillage showed statistically higher water use efficiency (WUE) of 4.56 kg ha-1 mm-1 and 4.02 kg ha-1 mm-1 for both wheat and maize, respectively. Howe...
Naushad Khan1*, Shahnaz Akhtar1, Munir Khan1, Shaista Naz2, Javeria Tanveer1 and Muhammad Kaleem3
...d by short term credit type. Thus, higher amount of credit was disbursed under the category of medium term followed by short term. The average yield, cost and return for the maize crop showed significant results due to the proper utilization of the credit by the farmers. The major constraints to farmers while obtaining credit were complicated procedure of pass book preparation, amount less than requirement, unavailability of...
Sana Irshad Khan1*, Zafar Iqbal2, Hamid Ullah Shah2 and Shaukat Hussain3
...ening of various fungal species for antimicrobial natural products. During this study five different fungi, including Alternaria alternata, Acremonium sp., Alternaria brassicicola, Pythium sp. and Aspergillus flavus were screened against Wilt causing pathogens using the dual culture assay. Among them, Aspergillus flavus was found active fungus against the selected vascular Wilt causing fun...
Zaffar Malik, Moazzam Jamil, Ghulam Hassan Abassi, Muhammmad Nafees, Muhammad Rafey and Muhammad Kamran
...he physico-mechanical properties of vertic soils were studied. The potential soil amendments were fly ash (FA) and three types of biochar (straw biochar (SB), woodchips biochar (WCB), waste water sludge biochar (WSB). The physical and mechanical parameters of vertic soil like soil consistency limits like plastic limit (PL), liquid limit (LL) and plasticity index (PI), tensile strength (TS), shear strength (cohesion (C) and a...
Zamarud Shah, Safdar Hussain Shah, Asad Jan and Gul Shad Ali
...deg;C compared to wild type plants (WT). No significant decrease was recorded in the chlorophyll content of overexpression lines whereas significant decrease was recorded in the chlorophyll content of WT plants following heat stress. Similarly, no significant reduction in the water content of the leaves of overexpression lines was recorded compared to 33.87% reduction in leaf water content of WT plants as a result of heat stress. Furthermore, overexpression li...
Zeeshan Haider, Inayatullah Jan and Waqar Akram
...0.91 with (p<0.01) respectively. It was mainly due to restrained mobility during the conflict, farmers had limited or no access to cultivable land, irrigation facilities, and input and output markets which resulted in increased cost of production and decreased farm productivity of tomato. This further resulted in decreased net income of farmers from tomato crop. The study concludes that poverty in these areas can be alleviated if the government and non-gove...
Ibni Amin Khalil* and Raziuddin
...n fifteen parental genotypes following 11× 4: line × tester fashion. The resultant 44 F1 hybrids along with parental genotypes were evaluated under field condition in a replicated trial for seed yield plant-1 performance. Differences among the parental lines, testers, F1 hybrids and line × tester interaction for found significant (P<0.01) for the studied parameter. Pro...
Muhammad Afzal1 and Murad Khan2*
...ry farm was Rs. 3,10,067 per flock while that of medium and large farms were Rs. 4,99,002 and Rs.7,34,290 respectively. The highest cost was estimated for feed followed by chicks cost. The average gross margin of small farms was Rs. 38,556 while that of medium and large farm were Rs. 62,844 and Rs. 89,261 respectively. The highest net benefits were reported from the large scale poultry far...
Yusuf Koc1, Ecevit Eyduran1* and Omer Akbulut2
...s to evaluate predictive performances of CHAID, Exhaustive CHAID, and CART regression tree methods for different combinations of parent node: child node in the data set regarding animal science. To achieve the aim, 1884 Mengali lambs were provided for predicting weaning weight from sex (male and female), birth type (single and twin), birth year (2005, 2006, 2007, 2008 and 2009), farm (Research station, Mastung, Quetta, and N...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahim2 and Ghada Kamal El Khalafawy2,*
... yeast to the genus and species level is necessary for effective antifungal therapy, and can also facilitate control of infections. A total of 50 isolates were isolated from 60 swab samples collected from two poultry processing plants represented broiler carcasses swabs and worker (hand swabs and nail scrapings). Phenotype-based methods for identifying yeast especially Candida s
S. Bushra1,*, M. Tariq1, M. Naeem1, M. Ashfaq1, I. Bodlah1 and M. Ali2
...y;">Aphids are the major pests of plant crops in temperate areas of the world. They are monophagous as well as polyphagous and damage wheat, oilseeds, vegetables and fruit crops. This study was carried out to observe the effect of plant extracts and semiochemicals on physiology and performance of endoparasitoid of aphids, Diaeretiella rapae. Seven different treatments of semiochemic...
Muhammad Arshad1*, Hafiz Azhar Ali Khan2*, Faisal Hafeez3, Ravaid Sherazi1 and Naeem Iqbal4
...nd four different aphid species (spinach aphid, Aphis fabae Scopoli; coriander aphid, Hyadaphis coriandri (Das); cabbage aphid, Brevicoryne brassicae L.;pea aphid, Acyrthosiphon pisum Harris) was evaluated in the laboratory in no choice and free choice feeding assays. In the no choice feeding assay, the stages of beetle (adults, 3rd and 4th instar) consumed more aphids than e...
Önder Duysak*andKübra Azdural
...ulea changes with respect to season and the type of heavy metal.
...
Waheed Anwar*, Muhammad S. Haider, Ahmad A. Shahid, Hamid Mushtaq, Usman Hameed, Muhammad Zia Ur Rehman and Muhammad Javed Iqbal
...y among Fusarium species based on ITS showed that it is not enough to score diversity within species and isolates. Additionally pathogenicity of isolated Fusarium species was evaluated against nymph and adult of Bemisia tabaci. Under controlled conditions different species of Fusarium restrained the growth of B. taba...
Wan-Long Zhu1 and Guang Yang2,*
...ole of hypothalamic neuropeptides genes expressions on body mass regulation under different photoperiods in Eothenomys miletus, body mass, food intake, serum leptin levels and hypothalamic neuropeptide neuropeptide Y (NPY), Agouti related peptide (AgRP), pro-opiomelanocortin (POMC), cocaine and amphetamine regul...
Abdur Rahim1, Ghulam Abbas1,*, Muhammad Naeem2, Sara Ferrando3, Lorenzo Gallus3, Muhammad Hafeez-ur-Rehman4, Abdul Ghaffar5 and Abdul Mateen6
...niles for 60 days. Best specific growth rate (SGR) and feed conversion ratio (FCR) were noted in the fish fed diet containing FO. Fish fed diet comprising OO and PO showed poor SGR and FCR values than those fed with FO and SO diets. Body composition was not significantly influenced by different lipid sources although low crude lipid was found in fish fed diet containing FO. The hepatosomatic index (HSI) and visrosomatic index (VSI) were greater in the fish fed...
Effect of Supplemented Algal Carotenoid Diets on Skin Color of Tomato Clownfish, Amphiprion frenatus
Muge Aliye Hekimoglu*, Kgrşat Fırat, Şahin Saka, Cüney Suzer, Aysun Kop and Yaşar Durmaz
...als. At the end of the experiment the highest weight gain was found to be 1.73±0.37g in Group B, whereas the lowest performance (1.29±0.38 g) was received in Group C. The best feed conversion ratio was found in at Group B. The total carotenoid content of skin of fish were found to be 0.77±0.61 µg.g-1 on the initial day in the experimental group. As a r...
Naime Zülâl Elekcioğlu*
...he effect of constant temperatures on developmental time and parasitization rate of Citrostichus phyllocnistoides was evaluated on Phyllocnistis citrella at nine constant temperatures ranging from 15ºC±1 to 35ºC±1 in 2.5ºC increments in the laboratory. Developmental periods of immature stages ranged from 34.98 days at 15ºC to 9.15 days at 35&...
Irshad Ahmad
...ed by a number of insect pests including walnut borer (Zeuzera coffeae Nietner) that adversely affects the yield and quality of the fruit and wood. This study describes the life cycle of the pest, the nature and extent of damage done to walnut, and the preventive measures applied under integrated pest management program (IPM) and includes the cautious use of chemical insecticides, m...
Lingtong Ye1, Chao Cao1,2, Bin Tang1,2, Tuo Yao1, Ruixuan Wang1 and Jiangyong Wang1*
...entation pattern, the shape of the anterior edge of the prostomium, the shape of the major spines on chaetiger 5, and the shape of the pygidium. The COI gene sequence demonstrated that the intraspecific distance of P. websteri was 0.33%, whereas the interspecific distance of P. websteri ranged from 18.88%...
Muhammad Mohsin Javed*, Muhammad Azhar Nisar, Bushra Muneer and Muhammad Usman Ahmad
...ropylene random (PP-R) pipes jointed in U-shaped manner with a cation exchange membrane. The MFC constructed was subjected for the bioelectricity production by using vegetable waste extract as substrate. The power production was analyzed for three days. Maximum power density of 88990mW/m2 with a current density of 314.4mA/m2 was observed on the second day of process with minimum internal resistance comp...
Hafiz Aftab Ahmed1, Asif Ali2, Akbar Ali2, Salman Ahmed Abid3 and Sajid Umar4*
...sented with complaint of persistent unilateral hind limb extension. The animals were unable to flex the limb during walk. Diagnosis was based on case history, clinical sign and clinical examination. Upward fixation of patella was diagnosed in all three animals. After careful palpation of the ligament, medial patellar desmotomy was performed in lateral recumbence, under local anesthesia achieved by 2% lignocaine hydrochloride...
Mahanama De Zoysa1, Si-yun Ryu1, Hyeon-cheol Kim2 and Bae Keun Park1*
...with all Argulus species, isolated fish lice was identified as Argulus japonicus Thiele, 1899. A. japonicus is native to Asia, which also is a habitat for its typical hosts, such as goldfish and common koi carp (Cyprinus carpio). A. japonicus has not previously been described from goldfish from the ornamental facilities in Korean. This is the first report of A. japonicus morphology with light and scanning electron micr...
Rashid Mahmood1*, Saima Asad2, Ghulam Sarwar1, Waqar Ahmad1, Ziyad Abdul Qadir1, Ammara Balouch1 and Muhammad Khalid Rafique1
...ica) from Brassica campestris was examined during February - March 2015 at National Agricultural Research Centre, Islamabad. Twenty five honeybee colonies were used which had similar number of worker bees, brood and stored food. In order to study the foraging activity of honeybees in the field condition, the number of pollen foragers returning to the hive entrance was recorded for 10 min duration on hourly basis between 0800 h to 1600 h for 3 days
Kiran Afshan1*, Sarwat Jahan1 and Mazhar Qayyum2
..., while sensitivity and specificity of this assay for small ruminants was 97.83% (95% CI: 92.35% to 99.67%) and 93.75% (95% CI: 87.54% to 97.44%) respectively. In field this test indicated significant (p<0.05) values for sheep as compared to goat indicating high risk of infection in sheep. The current study showed that commercial bovine F. hepatica ELISA test is effective in Pakistan for small ruminants.
...
Farkhanda Manzoor1, Iram Amin2,*, Muhammad Shahid2,Samia Afzal2,Hania Ramzan1, Tahir Rehman Samiullah2 and Muhammad Idrees3
...the most prevalent serotype. DENV-1 was not found in any pool. While all pools of Aedes albopictus were negative for dengue virus. Our study showed that the main cause of spreading of dengue virus was Aedes aegypti. Serotype DENV-2 was dominant in the field collected larvae of Aedes aegypti in Lahore and Sheikhupura, Pakistan.
...
Syed Fazal Baqi Kakakhel*, Asad Ullah and Abdur Rashid
...ened’ Markhor sub species Flare-horned Markhor (Capra falconeri falconeri Wagner 1839) in District Swat covering an area of 5337 km² in 2013. The population survey was conducted in two phases i.e. December 21-24 in Kalam and December 26-29 in Mankial valleys. Vintage point count surveys revealed that the Markhor preferred habitats in Kalam and Mankial valleys in District Swat. Among the six sub valleys of Kalam, only Shahoo and Mahodan...
Sameera Akhtar1*, Muhammad Akram Muneer1, Khushi Muhammad1, Muhammad Yasin Tipu1, Muhammad Anees2, Imran Rashid1, Raza-ur-Rehman3 and Irshad Hussain1
...ains. The NDVs, a prototype of Avian Paramyxoviruses (APMV-1), have been reported previously both in chicken and feral birds (natural reservoirs) in Pakistan; however, their molecular characterization is largely inadequate and requires continuous evaluation. In this study, sequencing and molecular analysis of fusion (F) and hemagglutinin (HN) genes of NDV strain isolated from an outbreak in a peacock flock was undertaken. Pr...
Gabriela Mansano do Nascimento, Helena Lage Ferreira and Clarice Weis Arns
... whose activation is independent of the antigen and depends on the ability of the host to recognize pathogens by means of specific pattern recognition receptors. This interaction induces the production of cytokines, chemokines and interferons. Through Janus kinase/signal transducers and transcription activators pathway, interferon induces the transcription of interferon-stimulated genes (I...
Pam D Luka, Frank N Mwiine, Bitrus Yakubu, Joseph Erume, Ricardo Pérez-Sánchez, Hermann Unger and David Shamaki
...has been reported in Europe, East and Southern Africa to be part of ASFV transmission cycles. Ticks in an ASFV infected area have been reported to influence the emergence of genetic variation and long-term persistence of the virus in an area. Since the first report of ASF in Nigeria, periodic outbreaks have continued to occur among domestic pigs with a few incidences in wild pigs. However,...
Sumra Ashraf1, Zain ul Abdin1,*, Saqi Kosar Abbas2,Rao Sohail Ahmad Khan3, Muhammad Tahir1, Sehrish Rasool1, Maryam Anwar1 and Fiaz Hussain1
...;">To enhance their life period and reproductive potential, the adults of parasitoids mostly depend on supplemental food sources, such as sugars and other carbohydrates. These food resources are commonly obtained from animal secretions or plant exudates which include honeydew, fruit juices and both floral and extra-floral nectar. A direct behavioral assay was conducted to investigate the dietary preference and effects of dif...
Jehangir Khan1,2*, Inamullah Khan3, Ijaz Ali2, Aqib Iqbal2 and Muhammad Salman4
...nd Hayat Abad) dengue suspected locations of district Peshawar, Khyber Pakhtunkhwa (KPK), Pakistan. A semi-nested multiplex PCR was used to amplify the cDNA of the four dengue serotypes. Six out of 35 (17.14%) adult mosquito pools were found positive for dengue virus with type-2 (77.77 %) and type-3 (11.11 %) while a single (11.11%) pool of concurrent in...
Muhammad Afzal1,Naveeda Akhtar Qureshi1,*, Khalid Zamir Rasib2 and Irfan Hussain1
...ng the most devastating species causing significant loss annually in South Asia. Feeding deterrence of H. indicola among 10 different woods species were evaluated in choice and no-choice assays conducted under laboratory and field conditions. Visual rating according to (AWPA, 1997) scale, mass loss, wood consumption per termite and mortality rate were determined to evaluate resistan...
Zafrullah Khan1, Shah Alam Khan1*, Hamayoon Khan2, Naeem Khan3, Khwaja Junaid1 and Inamullah Khan1
...>L.) is a serious pest of wheat (Triticum aestivum L.) crop and causes significant production losses to the wheat crop in Pakistan. So far eight genes from the conventional wheat cultivars that are resistant to the attack of R. padi have been incorporated in the commercial wheat cultivars to help manage R. padi. During this study seven wheat genotypes were evaluated as antixenosis, antibiosis and ...
Md. Yeamin Hossain1,*, Md. Alomgir Hossen1, Md. Nasir Uddin Pramanik1, Fairuz Nawer1, Md. Mosaddequr Rahman2, Suraiya Sharmin1, Dalia Khatun1, A. H. Bahkali3, Abdallah M. Elgorban3 and Khairun Yahya4
...significantly from the expected 1:1 ratio (χ2 = 4.06, p > 0.05). Total length was varied from 5.59 to 12.87 cm and body weight ranged from 3.40 to 27.87 g. All LWRs were highly significant (p < 0.001), with all r2values exceeding 0.97. The calculated allometric coefficient (b) indicated negative allometric growth in male, female, and combined sexes (b < 3.00, p < 0.001). All LLR...
Pinar Oztopcu-Vatan1, Gokhan Kus2, Emine Inan3, Melek Gunindi Korkut3, Selda Kabadere4,* and Ruhi Uyar4
...with an inverted microscope, apoptosis using flow cytometry and statistical significance with one way analysis of variance followed by Tukey’s multiple comparison test. IC50 values of licofelone were determined as 171 µM for 24 h and 140 µM for 48 h applications. Used as a positive control, 250 µM 5-Fluorouracil decreased the cell survival by only 40 % after 48 h, but licofelone treatment with the same dose and time duration ...
Tanzeela Riaz1, Farah Rauf Shakoori2* and Syed Shahid Ali3
...15 years) of wheat grain pest, Trogoderma granarium collected from various storage facilities of Punjab, Pakistan viz., Mandi Bahauddin-I, Mandi Bahauddin-II, Gujrat, Gujranwala and Sargodha. The activities of all esterases tested were significantly increased in all field collected phosphine-tolerant populations when compared with phosphine-susceptible population. Among developmental stages, the 4th instar larvae possessed higher ester...
Mehmet Cilbiz1* and F. Banu Yalim2
... cm and -0.476 years, respectively. Total mortality (Z) by length-converted catch curve was estimated at 0.83 year-1, fishing mortality (F) 0.14 year-1, natural mortality (M) 0.69 year-1 and exploitation rate (E) 0.17. According to the result of Relative Yield/Recruit analysis estimated Emax>E, so in this context stock of O. mykiss was not overexploited in Karaca&ou...
Yaoguo Li1,2 and Maoxian He1*
...evel and growth traits inpearl oyster, Pinctada fucata (P. fucata). The incidence of type II locus (hemi-methylation locus) was significantly correlated with the shell height and the shell length, with Pearson correlation coefficients of 0.204 and 0.233, separately. The incidence of type IV locus (super methylated locus) on the other hand w...
Glomus mosseae (Gerd and Trappe) and Neemex Reduce Invasion and Development of Meloidogyne incognita
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
Muhammad Luqman Sohail1,*, Muhammad Sarwar Khan1, Muhammad Ijaz1, Muhammad Avais1, Muhammad Yasir Zahoor2, Omer Naseer1 and Muhammad Usman Saleem3
... a wide range of animal species and humans. 18 Leptospira positive horses based on ELISA and 9 healthy horses were included in the study. Blood profile, serum biochemistry and mineral profile were analyzed at day 0, 7 and 21 of infection. Results showed significant decrease (P<0.05) in red blood cells (RBC), packed cell volume (PCV), hemoglobin (Hb), mean corpuscular hemoglobin concentration (MCHC) and platelets while total leucocytes count (TLC), ne...
Abida Butt,* Imtiaz Alam and Rabia Naz
...s of the spider, Argiope trifasciata, with its body measurements was investigated. Also, role of stablimenta in efficiency of capturing prey was discussed by comparing web parameters and number of intercepted insects in decorated and non-decorated webs. For the study, 236 randomly selected webs of A. trifasciata were observed in the rice fields around the cities of Sheikhupura and Lahore, Punjab, Pakistan. In the adult spiders, mesh height, captu...
Amjad Islam Aqib1, Muhammad Ijaz1,*, Aneela Zameer Durrani1, Aftab Ahmad Anjum2, Riaz Hussain3, Saba Sana2, Shahid Hussain Farooqi1, Kashif Hussain1 and Syed Saleem Ahmad1
...uare test at nighty five percent confidence interval was used to analyze the collected data. Antibiotic sensitivity was checked with twenty four antibiotics by disc diffusion method. Over all mastitis was found 52.5% (63/120) with leading subclinical (41.67%, 50/120) form of mastitis on overall milk collected data. Pathogen type was crowned by Staph. aureus with 74.5% (47/63) prevalence, following which were Strept...
Abdur Rahim1, Ghulam Abbas1,*, Sara Ferrando2, Lorenzo Gallus2 and Abdul Ghaffar3
...ocked @ 1500 individuals per pond (2 treated and 2 control) of approximate dimensions, 13.72 m × 10.97 m × 1.52 m (229 m3). In treated ponds, fish were fed with artificial diet (protein 42%, lipid 20% and energy 25.2 kJ g-1) for 120 days in three equal meals. On the other hand, control ponds remained without additives. During the whole study period, water quality parameters of the ex
Ali Zurwan1,*, Muhammad Moaeen-ud-Din2, Ghulam Bilal2, Zia-ur-Rehman1,2 and Muhammad Sajjad Khan1
...tudy was to estimate the persistency of lactation in Sahiwal cows using different persistency indices and to estimate heritability of persistency. Data on 808 Sahiwal cows maintained at the Livestock Experiment Station (LES), Jahangirabad, District Khanewal were used for the present study. Persistency of lactation was determined using five indices viz...
Muhammad Akbar Khan1,*, Sayyed Ghyour Abbas1, Muhammad Adeeb Babar1, Sabah Kiran1, Ayesha Riaz2 and Muhammad Akhtar1
... Pakistan. The referred specimens comprise isolated dental elements and mandible fragments. The presence of tragulids in Dhok Bun Amir Khatoon during Middle Miocene Chinji Formation of Pakistan suggests a humid habitat with abundant cover.
...
Jiancheng Zhai, Li Gao, Yanling Xia and Heping Li*
...;">Reindeer is the only species in which the females carry antlers in Cervidae, and the differences between the antler tips of the two sexes are one of the most interesting scientific mysteries. The objective of this study was to isolate preliminarily differentially expressed genes in antler mesenchyme of both sexes. The genes were detected with three anchored primers and ten random primers using differential display reverse transcription PCR (DDRT-PCR). Five ...
Rashid Mahmood1,*, Waqar Ahmad1, Muhamamd Khalid Rafique1, Ghulam Sarwar1 and Anjum Shahzad2
...h crop yield. Apple is dependent on insect pollinators to set fruit. Farmers in Pakistan are generally not aware of pollination needs of apple. Results depicted a high population decline of Syrphids and Non-Apis bees. Syrphids were recorded as 12.65 to 13.85 per 250 flowers in 2013 but decreased in year 2014 by 7.82 to 7.88 per 250 flowers and Non-Apis bees was recorded as 6.15 to 7.59
Yang Wang1, Zhide Cheng2, Mengjie Tang3, Haixia Zhou1, Xiaolu Yuan4,Muhammad Aqeel Ashraf5, Shuting Mao1 and Jing Wang1,*
...ment. We found that the sperm-specific lactate dehydrogenase (LDH-C4) gene Ldh-c is expressed in plateau pika skeletal muscles. In order to shed light on the effect of LDH-C4 on the anaerobic glycolysis in plateau pika skeletal muscle, 20 pikas were randomly divided into two groups the inhibitor group (experimental) and the control group, reach of 10 pikas. The...
Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*
...">The Wap65 is a warm temperature acclimation-related protein, and it plays an important role in adapting temperature shock. But the research about Wap65 in crucian carp is very limited. In this study, the CDS of Wap65 was firstly cloned and characterized from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids. The calcul...
Mousa Keshavarz1*, Ehsan Kamrani1, Narges Amrollahi Biuki1 and Hossein Zamani2
...d for 71, 126 and 20, respectively. Females were totally 1.77 times heavier than males. Wet weights of gonads were nearly 8.25% of the mean total wet body weights. Only females were observed by gonad wet weights more than 12 g. The gonad wet weights of females (3.74±3.26) was heavier than males (3.46±2.63). March to August was the spawning months, as a U-shaped trend by August (mid-summer) as its concave curve ...
Faiz Muhammad,1, 2,*, Zhang Zhi-Feng,1, Shao Ming-Yu1 and Muhammad Shafi3
...white leg shrimp (Litopenaeus vannamei) has been cloned by rapid amplification of cDNA (RACE) and anchored PCR method. The full length of the (LvCypA) had 855 bp, containing 495 bp of open reading frame (ORF), encoding 164 amino acids with an estimated molecular mass of 17.6 kDa. The LvCypA has four β- strands. Tissue distribution of the LvCypA after real time analysis revealed that expression is in...
Fazal Said1,Mian Inayatullah2 and Hussain Ali3*
...A. florea showed two peaks of visitation between 1400 to 1600 h. First peak (15 honeybee/3 m2) was recorded at 1600 h, whereas second peak (12 bees) was recorded at 1400 h. Lowest visitation rate of both species was noticed during evening after 1800 h. High frequency of both speciesfound engaged in forag...
Nagwan F. Zahran, Ali F. Hamza and Rehab M. Sayed*
... grown male pupae of the peach or guava fruit fly, Bactrocera zonata were irradiated with sterilizing and substerilizing doses of gamma radiation. The effect of gamma rays on the DNA patterns of adult males showed alterations from the control. Exposure to radiation caused very frequently the appearance of some extra bands and the deficiency of others in the RAPD-PCR amplification patterns of the irradiated insects.&nb...
Shazia Ali, Hizb Ullah and Sarwat Jahan*
...TSH (μIU/mL), and kisspeptin (ng/ml) was done. BMI and hemoglobin were significantly reduced (P<0.001), while serum ferritin were significantly increased (P<0.001) in all four thalassemic groups on comparison with control. Kisspeptin levels were significantly reduced in ≤13 years female (P<0.001). While significantly high levels were observed in >13 years of male (P<0.01). T3 levels were signi...
Mürşide Dartay*, Tuncay Atessahin and Erdal Duman
...multifilament), water temperature, and water depth. CPUE values were found to be higher at 24.5 °C water temperature and 13.7 m water depth with multi-monofilament gillnets with a result of 15.23 g/m, and the lowest was with multifilament gillnets with a result of 3.95 g/m (0.5); however, multi‑monofilament gillnets had a result of 23.28 g/m and multifilament gillnets 14.58 g/m (0.67) in July, res
Fermín Lopez-Uriostegui1, Jesús T. Ponce-Palafox2,*, Fabiola Lango-Reynoso1, María del Refugio Castañeda-Chavez1, Virgilio Eugenio Arenas-Fuentes3 and Fernando Vega-Villasante4
...etion index showed both species feed 24 h, but forage activity differs in intensity in the two species. In M. tenellum repletion index was greatest during the day and M. americanum in the night.
...
Sadaf Ijaz Malik1, Kiran Afshan2* and Mazhar Qayyum1
...the basis of size and shape of worm. The hematological and bile biochemical changes were found in two groups. Pathologically significant changes were observed in the infected tissue. The parasites had formed pocked in the bile duct mucosa, glandular hyperplasia, thickened blood vessels. The results demonstrate that morphological markers, pathological, hematological and bile biochemical studies are effective tools that could ...
Andrea Rezic1, Ivica Boskovic2, Piera Lubinu3, Marina Piria1, Tihomir Florijancic2, Massimo Scandura3 and Nikica Sprem1*
...n golden jackal skull shape and size due to sexual dimorphism were examined using two dimensional geometric morphometrics approach. A total of 21 landmarks described the dorsal side of the skull and lateral side of the mandible. Individual variation in skull and mandible morphology was statistically significant for the shape (p<0.01). Sexual dimorphism as main effect was highly significant for the dorsal skull sha
Rashid Ahmed Khan* and Muhammed Naveed
... are among the major pests of fruits worldwide. Among the many species of fruit flies, Bacterocera zonata is a serious pest of fruits causing severe losses to the fruit production and quality, in Pakistan. In the present experiment the population of B. zonata was monitored using methyl eugenol traps during the year, 2015. Occurrence and...
Waqar Islam*1, 2, Madiha Zaynab3, Muhammad Qasim2 and Zujian Wu1,2
... evolution and have equipped themselves with counter defense and tolerant strategies against viral infections. In the 21st century, considerable progress has been made in understanding the available natural resistance in plants against viral threats. The review aims to explain the molecular mechanisms involved in triggering the antiviral resistance in plants. Antiviral RNA silencing, R-gene mediated resistance and host factor related recessive resis...
... in 2014 with six issues per year.
Hosts and Viruses is an initiative of virologists around the globe who gathered after publishing a series of books on the mononegaviruses of veterinary importance. The rebranding of the journal is a part of the journal’s re-structuring process to expand the avenue from regional to global audiences. With heavy contributions from auth...
Mingqin Shao1*, Bin Chen1, Peng Cui2, Binbin Zeng1 and Jianhong Jiang1
...up> during the wintering period. No significant difference was detected in the daily travel distance between different months (F = 0.658, P > 0.05). Significant differences were detected in the daily home rang between January and February, and between February and March. No significant correlation was observed between daily travel distance and home range (R = 0.256, n = 12, P > 0.05). The significant correlation between daily home range and...
K.N. ArulJothi1, M. Abinaya1, B. Suruthi Abirami1, Melvin George2, S. Elangovan3 and A. Devi1*
...enger receptor class B type I protein (SCARB1) plays an essential role in cholesterol homeostasis. The effect of the polymorphisms in the gene have varying influences on lipid levels and development of cardiovascular disease (CVD) in different populations. In this study, we investigated the association of rs5888 polymorphism with serum lipid levels and CVD risk in an Indian population. A total of 412 samples which included 148 myocardial infarction surv...
Zafar Iqbal1* and Muhammad Khurshid2
...t has the potential to expedite the detection of plant viruses from plant species containing various forms of PCR amplification inhibitors. In current study, IC-PCR was used for the detection of Tomato leaf curl New Delhi virus (ToLCNDV) from plant extracts of Nicotiana benthamiana plants inoculated with ToLCNDV. To immunocapture the ToLCNDV, two antisera raised against Tomato yellow leaf curl virus-coat protei...
Nosheen Noor Elahi* and Misbah Mughal
...f stomata, number and shape of cork, silica, long, and pointed elongated cork cells. It is therefore contended that the structure of the epidermis in sugar cane can be used as a characteristic of variety differentiation....
Hui Zhang2, Yajing Wang2, Kun Li2, Mujeeb Ur Rehman2, Fazul Nabi2, Rui Gui2, Yanfang Lan2 and Houqiang Luo1,2*
...u, Bengbu and Fuyang, respectively. The present survey showed that free-ranging chickens of Anhui province have been exposed to lymphoid leukosis virus subgroup A, indicating a high risk factor for poultry industry.
...
Akbar Ali1,*, Khalil Mohamed2 and Fawzia Toulah3
...phic data was recorded. Specific Toxoplasma gondii IgG and IgM were detected in serum by ELISA method. Toxoplasma gondii DNA was detected using PCR. Most women were in the 20-29 years age group (48%), followed by 30-39 years (33%) and >40 years (14%). Overall prevalence of Toxoplasma gondii IgG was seen in 12%, with significantly more in women with age more than 30 years as compared to those with age less than 30 years (19% vs 8%; p=...
Tuli Dey, Sonnet Poddar and Mukti Barua
...nce of the condition. Proper postoperative treatment with antibiotic, antihistaminic and hormonal drugs were given. This case as well as the condition of the animal were followed up and gave the result of successful recovery without any complication....
Eman M. Farghaly1, Ahmed Samy1,2*, Heba Roshdy
...d freshly dead quails respectively. Bacterial isolation and characterization were performed in accordance with the clinical laboratory standards and confirmed by PCR. In life birds, only E.coli and Salmonella could be recovered from Cloacal swabs, while in freshly dead birds all four pathogens disseminated in various organs with higher incidence of mixed compared to single infection. Different seroty...
Zahir Shah, Ahmed Nawaz Tunio, Shakoor Ahmad, Ijaz Ahmad, Javid Ali, Sher Bhader Khan
...akistan. The surgery was performed under paravertebral anesthesia at T13, L1-3 using xylocaine 2% in standing position after proper sedation. The operated site was prepared for aseptic surgical procedure. A vertical incision was given in middle of the left flank region. Twin fetuses (one male and female) were surgically removed with care to avoid proliferation of uterine contents into the ...
Iftikhar Ahmad, Abdul M. Saleem, Ghulam Mustafa, Khurram Ziaf, Irfan Afzal and Muhammad Qasim
...er for 24 h and 12 h, respectively, and germinated at 25 ± 1 °C with 40-60% R.H. in 16/8 hours day/night conditions. Results revealed that pre-sowing seed treatment particularly halopriming with CaCl2 was the most effective for invigoration of gerbera and zinnia seeds. For Gerbera jamesonii, 25 mM CaCl2 and for Zinnia elegans, 50 mM CaCl2 proved best priming treatments followed by 100 mM KCl and 50 to 100 mM KNO3 for both tested s
Abdul Wajid Khalil and Zafar Iqbal
... while lead was found in permissible limits in both the aerial parts and roots of B. procumbens. The aspartic acid (31.25±0.08g/100g), Glutamic acid (25.27±0.06 g/100g), Alanine (12.74±0.12g/100g) was found in higher concentration in aerial parts than roots while some essential amino acid, Tryptophan (6.23±0.06g/100g), Arginine (3.49±0.08 g/100g), Phenylalanine (1.77±0.08 g/100g) were recorded higher in roots as compar...
Sheraz Ahmed and Fida Mohammad
...ive selection indices. Experimental material was planted at two locations i.e. Mardan (E-1, E-3 and E-5) and Mansehra (E-2, E-4 and E-6) using alpha lattice design with three replicates during 2012/13, 2013/14 and 2014/15. Heritability in broad sense was generally low for all traits except nicotine and reducing sugar. Days to flowering was the most environment responsive trait and its heritability fluctuated between 0.22 and 0.91. Plant height was significantl...
Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1
...polis at intervals for a period of 6 months to check for presence of Salmonella during various stages of processing. Salmonella was isolated from at least one of the four matrices in the three LBM with an overall prevalence of 20.2%. Of the 84 samples collected, 17 contained Salmonella. With regard to the matrices, there was no difference in Salmonella prevalence among the four matrices considered. Four different serotypes w...
Abdul Malik1,4, Ghulam Abbas1*, Hameeda Kalhoro2, Illahi Bux Kalhoro3, Syed Sajjad A. Shah4 and Halima Kalhoro3
...rying salinity levels (0‰-30‰ with 5% increment) on breeding of red tilapia. Brood fish were stocked in hapa nets suspended in cemented rectangular tanks (11×7×4 feet) . Three females (mean weight 145 g) and one male (140 g) were kept per tank with 2 replications. They were fed with commercial floating p...
Mirza Imran Shahzad1,*, Anna Iqbal2, Farrah Ali1, Nuzhat Sial3, Muhammad Ashfaq4, Abul Hasanat5 and Azra Khanum6
...ed in order to collect supernatant. While the second and third parts were also centrifuged but however supernatants were discarded to get their pellets, which were dissolved in normal saline. Of this one part was taken for thaw and freeze treatment, while the second for ultrasonication treatment, before conducting antimicrobial activities. Zones of inhibition were measured by using disc di...
Majed Rafeeq1,*, Nadeem Rashid1, Muhammad Masood Tariq1, Rassol Bakhsh Tareen2, AsadUllah1 and Zahid Mustafa1
...erbs as feed additive on performance of broiler alternative to antibiotics. One-day-old (N=320) broiler chicks were divided into eight treatment groups with four replicates of ten chicks. Six treatments were three herbs i.e. Allium sativum, Cassia angustifolia and Artemisia scoparia @ 0.5 and 1.0% respectively, control (basal diet), and a positive control (Oxyfeed® @ 2g/kg). In the ...
Nadeem Rashid1,*, Masroor Ahmad Bajwa1, Mohammad Masood Tariq1, Tanvir Ahmad2, Majed Rafeeq1, Zafar Ahmad1, Mohammad Arif Awan1, Mohammad Ali1, Muhammad Zahid Mustafa1, Muhammad Shafee1, Asad Ulah1 and Amanullah Khan3
...ify;">Occurrence of Aspergillus flavus (A. flavus) in finished commercial broiler feed and among the isolated strains of A. flavus having capacity to produce aflatoxin was investigated in this study. Finished commercial broiler feed samples (n=96) were collected from broiler chicken farms in and around Quetta district. Physical properties i.e. moisture and pH were determined by oven drying and pH ...
Mohammad Raoofi and Mohammad Taghi Alebrahim
...fy;">In this study, an experiment was conducted to evaluate the effect of weed interference and non-interference in different densities of alfalfa on yield, nutritional value and some morphological traits of alfalfa, forage crop, as factorial and based on a randomized complete block design with three replications in two cuttings during 2013-14 crop years. The experimental treatments were weed interference and non-interferenc...
Cansu Akbulut1,*, Tuğba Kotil2, Burcu Öztürk1 and Nazan Deniz Yön1
...rial vesiculation and dispersion at ooplasm were observed. In mitochondria, mitotic catastrophe , vesiculation, swelling and loss of organization of cristae were detected.Here we showed that TiO2 exposure trigger paraptotic type cell death in zebrafish ovary.
...
Sehrish Rasool1, Zain ul Abdin1,*, Saqi Kosar Abbas2, Sumra Ashraf1, Maryam Anwer1, Atif Manzoor1, Muhammad Tahir1 and Hoor Shaina1
...ect of size of two host species Galleria mellonella (Pyralidae: Lepidoptera) and Spodotera litura (Noctuidae: Lepidoptera) was studied on larval competition, survival and development of a gregarious ectoparasitoid Bracon hebetor (Say.) (Hymenoptera: Braconidae). The number of adults, sex ratio and size of emerging adults were recorded. Smaller and larger host spe
Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*
...B), Anoplophora glabripennis. It further provides a brief impression of ALB’s biological characteristics, ecology, chemical ecosystem, economic significance, and management. Beetles in the Cerambycidae family have implicit increasing importance as pests of green forest in addition to shade trees, shrubs, and pink wood products as well as vectors of tree ailments. The alien spe...
Sung Kwon Park1a, Jin Young Jeong2a, Eun Seok Cho3, Yong Dae Jeong3 and Chang Seok Park4*
... sequencing (RNA-seq) in peripheral blood mononucleated cell (PBMC) of piglets, Large White x Landrace crossbreds, infected with live strain PED virus (PEDV). Several gene ontology (GO) and differentially expressed gene (DEG) are also identified by RNA-seq. The analyzed transcriptome provides the 1805 DEGs and gene net...
Wali Khan*, Ghazal Mumtaz, Saima Bibi and Salma Afzal
...e markets in Lower and Upper Dir districts. A total of 520 vegetable samples were collected during April to October 2016. These vegetable samples were screened for parasitic contamination. The results showed that 10.7% of the vegetables were found to be contaminated with one or more than one species of parasites. Intestinal parasites Ascaris lumbricoides 26.7%, Trichuris trichura 19.6%, Taenia saginata 25 % and Entamoeba his...
Muhammad Shahid1, Iram Amin1,*, Samia Afzal1, Zareen Fatima1, Sadia Zahid1, Usman Ashraf1 and Muhammad Idrees2
...us having five serotypes 1-5 and infecting about 100 million people each year. To address dengue outbreak 2013 in Pakistan we aimed to conduct a comprehensive study at molecular level to determine the main causative serotype of 2013 DENV outbreak in Pakistan. Overall 703 serologically positive suspected patients from different major health centers of...
Tausif Ahmad1, Iahtasham Khan2, Saddaf Razzaq1, Saeed-ul-Hassan Khan1,* and Raheela Akhtar3
...buffaloes and cattle (60 per species) at Civil Veterinary Hospitals, animal markets and peri-urban livestock holdings in Rawalpindi and Islamabad. Serum samples were initially screened by the Rose Bengal Plate Test (RBPT). RBPT positive samples were subjected to a B. abortus specific indirect enzyme-linked immunosorbent assay (i-ELISA). Serum samp...
Memoona Akber1, Muhammad Mushtaq1,*, Muhammad Sajid Nadeem1, Amjad Rashid Kayani1 and Noor-un-Nisa2
...attus = 35) were trapped during 720 trap nights @ 0.13 captures per night and the trap success was 13.88%. Maximum captures of the Norway rats were recorded during summer (n = 33), followed by winter (n = 13), autumn (n = 12) and the least number was recorded during spring (n = 7). A non-significant difference between numbers of captured individuals of both the sexes was recorded. Adult population of the Norway rat domin...
Erum Bughio1, Ahmed Sultan Jatoi*1, Muzamil Memon2, Reema Bughio3, Pervez Ahmed Khoso4, Zafar Ali Khoso1 and Ali Asghar Baloch5
...ines in the presence of specific maternally antibodies of IBD could no induce antibodies titer 1500 with live vaccines were protective against the IBDV. Based on the findings of present study, it can be concluded that all vaccinated group displayed similar antibody response irrespective of the types of vaccines administration to the chicks....
Irum, Akram Shah*, Sobia Wahid, Nazma Habib Khan and Qaisar Jamal
...nces and Cyclops species in drinking water sources. A cross-sectional household survey was carried out using in-person questionnaire evaluation along with microscopic assessment of water samples for Cyclops species. Based on previous clinical records of dracunculiasis, five villages of Dera Ismail Khan including Kath Garh, Wanda Dost Ali, Chah Mundar Wala, Ketch and Gara Balo...
Salman Khalid1,*, Abdul Rehman2, Mohammad Yasin Amir1, Abdul Rehman1, Imran Sarfaraz1 and Muhammad Asif1
... was conducted. For therapeutic trials, the 80 birds (n= 60 infested with ticks, n= 20 healthy birds) were selected and divided into four groups (A, B, C and D), each comprising of 20 birds. Group A and B were treated with Ivermectin @ 0.2mg/Kg orally for two days and Fipronil (Spray at once), respectively. Group C was kept as positive control whereas the ticks free birds were kept in group D. The results showed the signific...
Abdul Aziz Khan1,*, Shahid Munir2 and Irfan Ahmed2
...mptotically and attained peak on the 7th night. The bait in-take, external and internal pathological symptoms were similar as has been described for warfarin and brodifacoum. The bleeding period ranged from 8.06 to 12.94 nights with 13% variation in time. Based upon the total consumption of coumatetralyl bait, 400-450 wild boars were estimated as killed during the operation. The...
Uzma Farid Durrani1,*,Sagar Mal Goyal2, Asim Khalid Mahmood1,Cathleen Hanlon3, Susan Moore3, Muhammad Waqas1 and Raheela Akhtar4
...A). All puppies were whelped by dams regularly vaccinated with high quality inactivated rabies vaccines. Rapid Fluorescence Focus Inhibition Technique (RFFIT) revealed mRVNA titer (>0.5 IU/mL) in 29 puppies while 48 puppies showed mRVNA titer less than minimum protective level (0.2-0.4 IU/mL). RFFIT did not reveal mRVNA in 23 puppies that were declared lacking maternal rabies immunity. One basis of findings of this study it was concluded that puppies popula...
Habib Ullah Khan1*, Saleem Ullah1, Hamid Ullah Shah1, Muhammad Arif2
...45 to 28.4µs/dl respectively. Soil EC was lower 96.60 µS/dl in untreated soil while highest 190.10 µS/dl in NSP treated soil. Acidity of the treated soil ranged from 0.97g/L in S to 1.41 g/L in FN treated soils. The highest value (6.58x10-3%) of total nitrogen was in CFNSP treated soil. An increase in soil pH was noted where treatments variation ranged from 8.10 to 8.32 in CFP and CNS respectively. The effe...
Muhammad Waqas1*, Anwar Ali Shad1, Omaira Bashir2 and Mohsin Iqbal3
... carotenoids from tomato peel was elucidated by HPLC to utilize it as natural colorants in sunflower oil and spaghetti. Tomato peel contained 720 mg/100g of carotenoids consisting phytoene (3.15%) followed by phytofluene (2.31%), β-carotene (2.11%), cis-lycopene (1.71%), lutein (1.51%), cis-ζ-carotene (0.61%), ζ-carotene (0.56%), and γ-carotene (0.52%). Lyco
M. Abdus Salam1, M. Moynul Haque2, Md. Obaidul Islam3, M. Nasir Uddin4 and Md. Nazmul Haque3*
...tify;">Five cotton genotypes viz., CB-08, SR-08, BC-0125, BC-0236 and BC-0252 were used to determine the effects of seeds of different storage containers on growth, yield and quality of cotton genotypes. The experiment was conducted between July, 2010 to February, 2011 at Cotton Research, Training and Seed Multiplication Farm, Sreepur, Gazipur, Bangladesh. Significant variations related to...
John G. Bruno
... DNA aptamers were developed against the Fab fragments of murine antibodies developed to bind Rickettsia rickettsii and Rickettsia typhi. A feasibility study was conducted to generate anti-idiotypic aptamers against Fab fragments of these antibodies and to determine if the aptamers were capable of emulating rickettsial antigens to enable sensitive detection of rickettsia exposure in humans who have seroconverted. Such anti-i...
Muhammad Zafarullah Khan
...ultural mechanization competencies of AEOs. Sum total of 111 AEOs were contacted for data collection. Primary data were collected from the selected sample of AEOs by mailing the questionnaires. The results showed that overwhelming majority of the respondents i.e., 88% were M.Sc degree holders. They have had an average work experience of 16 years. Significant differences were observed among the compe<...
Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2
...nza viruses (LPAIV) subtype H9N2 are highly prevalent in the Middle East and are causing economic losses in the commercial poultry production sectors. Due to potential of H9N2 infections in human, LPAI H9N2 poses serious public health risk. Therefore, development of new potent and cost-effective influenza vaccines is urgently needed to safeguard poultry and to contain zoonosis. The primary goal of this study was to develop H9 plasmid-based DNA vaccine against ...
Waqar Islam
...t viruses, what is their perception about yield losses by virus diseases and what management strategies they choose to apply against viruses. We further added our suggestions that how plant viruses can be managed effectively through simple and credible efforts....
Mohammad Salim1, Arshad Javid2,*, Faiz-ur-Rahman3, Khalid Javed Iqbal4 and FarmanUllah5
...="text-align: justify;">Specimens of Rhinilophus ferrumequinum (n = 2) and R. lepidus (n =3) were captured from Malakand district, Khyber Pakhtunkhwa during a three years survey extending from June 2010 through May 2013. Mean body mass of the captured R. ferrumequinum specimens was 18.45 ± 0.35 g, head and body length was 60.11 ± 1.42 mm and forearm length was 60.01 ± 1.41 mm. Simila...
Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*
...ples, either one of the species or simultaneous infection. M. gallisepticum was found in 39/96 samples (40.62%) and M. synoviae in 32/96 samples (33.34%), whereas 25/96 samples (26.04%) were detected with simultaneous infection with both species. Altogether, it has been observed that multiplex-PCR is a sensitive tool for early and accurate diagnosis of Mycoplasma infections from samples collected from clinically sick and app...
Sadiq Ali* and Ijaz Ahmad Khan
... invasive weed but it is perennial in Pakistan. Parthenium weed is a weed of a national significance in Pakistan. Although, parthenium weed is infesting many parts of Khyber Pakhtunkhwa province, but more affected regions are Peshawar valley and Hazara division where it has enormously invaded most of the open spaces like roadsides, wasteland and water ways resulting in loss of local biodiversity. Field survey of district Swa...
Syed Ishfaq Ali Shah1,*, Tassawar Hussain Malik2, Imran Rafi Khan1 and Zahid Hussain3
.... Maximum and minimum temperatures, rainfall and wind velocity were negative and non-significantly correlated while, % relative humidity (%R.H) was found non-significantly and positively correlated both with USDA accessions and local varieties. On overall basis, during the course of the season, lowest number of jassid/leaf was recorded on USG-12-8 (1.7) followed by USG-12-44 (3.2) and USG-12-24 (3.3) while, number of whiteflies/leaf on USG-14-2460 (11.6) follo...
Tianzhu Chao, Huiqiang Cai, Yuxun Zhou, Kai Li* and Junhua Xiao
...fy;">The patterns of subspecies distribution, diversity and differentiation of the house mouse Mus musculus provide insights into past dispersal events in natural populations of this species. We investigated the molecular phylogenetics of Chinese house mice based on 466 DNA sequences from mitochondrial D-loop fragments. Our analyses revealed that Mus musculus musculus and ...
Jun Gao1,2, Liang-Liang Yue3, Xianhuan Jiang1, Liju Ni4, Muhammad Aqeel Ashraf5, Yuxun Zhou,1 Kai Li1,* and Junhua Xiao1,*
... sequenced and 49 haplotypes were observed. No shared haplotype was found among different geographic populations. High Fst values among the populations suggested that fragmentation of habitat has resulted in genetically distinct populations. The trees, inferred from maximum likelihood and Bayesian phylogenetic analysis, highly supported all the M. fortis individuals clustering into one monophyletic l...
Xiang Nong1,2,3,*, Yao-jun Yang1,2, Guang-you Yang3, Feng-zheng Chen2, Mei Tang1,2 and Gang Wang2
...order to develop a new type of insecticide, this study lays foundation for the development of stigmasterol from the Eupatorium adenophorum Sprengas nontoxic and pollution-free pesticides that can be released to the environment. The toxicity test of stigmasterol against Psoroptes cuniculi in vitro showed that stigmasterol was toxic under 0.5% concentration. Treatment under this condition also showe...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
... the root knot nematode species was identified based on observations on morphology of different life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of M. incognita infecting passion fruit. Pathogenic relationship with the passion fruit was proved through inoculation studies and inoculated plants also produced almos...
Adel Eid Mohamed Mahmoud*
...minal parameters, growth performance, meat analysis and feed intake of growing lambs. Fifty one Barki lambs with body weight of 30±0.57 kg; in three groups (17 animals, each). Experimental rations were composed of concentrate and clover hay in a 60:40 concentrate: roughage ratio.There was no effect of bakery by-products inclusion on nutrients digestibility and nutritive values except digestion coefficients of crude pr...
YaQiu Liu and ZhiJian Wang*
...re present. Highly developed junction complex were seen in anterior intestine. Cytoplasm contained abundant mitochondria and pinocytotic vesicles. Epithelium of posterior intestine was thin, translucent and squamous with dense blood capillary network underground, while there were no folds on mucous membrane surface. Distance between blood capillary network and intestinal cavity was 1.95±0.34 μm. Respiration epithelial cells of posterior intest...
Yi-qiang Ouyang1, Zhen-xin Liang1, Shi-wen Huang2, Ying Zhang3, Shao-shi Luo1, Jin-ning Liang1, Jia-fu Li1, Yu He4 and Song-chao Guo1,*
...ngeri) is in many respects more similar to primates than rodents are. To demonstrate the feasibility and usefulness of using the tree shrew as an AD model, we examined how well the model recapitulates features of the disease. Injecting animals intraperitoneally with d-galactose to induce acute senility, and then injecting them with β amyloid fragment 1-42 and ibotenic acid into the bilateral hippocampus led to signi...
Hamayun Khan1,*, Momen Khan2, Muhammad Subhan Qureshi3, Shakoor Ahmad1, Ali Gohar4, Hameed Ullah5, FarmanUllah6, Arab Hussain7, Pershotam Khatri8, Said Sajjad Ali Shah1, Hamid Rehman1 and Azmatullah Khan1
...opreserved bull semen. Experiments were carried out on Achai breeding bulls of similar age at the Semen Production Unit, Harichand, District Charsadda, Khyber Pakhtunkhwa. Collection of semen was done using artificial vagina (42°C) for three weeks. Semen was extended in egg yolk extender at various inclusion levels (0.0%, 0.25%, 0.5%, 0.75 and 1.0%) of green tea extract. Testing was consummated for quality characteristics of post-thawed s
Muhammad Noor, Hidayat ur Rahman and Muhammad Iqbal
...oss-II and cross-III, respectively. Similarly minimum heritability estimate of 0.60 was observed in cross cross-III. The mean of F1 generations was low in almost all crosses from their parents for flowering and plant characters. It is concluded that in all crosses broad and narrow sense heritability estimates were of moderate to high range, indicating that the total variability was mostly of genetic nature and hence, could be effectively utilized in maize bree...
Urooj Fatima1, Arslan Mehboob2, Muhammad Abid3, Muti-ur-rehman Khan4 and Tahir Yaqub4*
...amples from sick dogs suspected for parvovirus infection were collected from different geographic areas of the country. Samples were screened for positivity and verified for CPV using PCR. From a 30% positive samples for hemagglutination, nineteen (38.4%) samples were positive in PCR. Sequence analysis of the selected positive samples revealed that both CPV-2 and new CPV-2a strains are circulating in the domestic dog poputlation in Pakistan. This pioneer resea...
Sanaullah Jalil*, Asim Hayat, Abid Majeed, Syed Haider Abbas, Muhammad Noman, Muhammad Imran Kasana and Muhammad Mazhar Hussain
...k phosphate @150 kg P2O5 per hectare, T2 = FYM @5 tons per hectare, T3 = RP @100 kg P2O5 per hectare+ FYM @5 tons per hectare, E0 = without effective microbes and E1= EM-Biozote @ 50 l ha-1) on yield parametrs of wheat crop planted after the harvest of rice. All yield parameters significantly increased by the treatments consisting of RP (100 kg) with FYM...
Neelum Andaleeb, Munir Khan and Syed Attaullah Shah
... involved for 4.81 hours per day in livestock farming activities. Regression results show that respondent’s age, experience in livestock farming and education, education of the household head, access to credit, livestock income, tenural status and distance to city significantly affect women’s involvement in livestock farming. Based on these findings the study recommends that significance of women participation to...
Response of Spring and Autumn Sunflower to Chemical and Bio-Fertilizers for Yield and Quality Traits
Muhammad Tahirand Memoona Shehzadi*
...re Faisalabad. In this experiment Randomize Complete Block Design (RCBD) with factorial arrangements having three replications was used. Significantly maximum 1000 achene weight, achene yield, biological yield, harvest index and protein content were recorded where seed inoculation with PGPR-1 + PGPR-2 and full dose of recommended chemical was applied during both the growing seasons. Overall the performance of sunflower was b...
Zia Ur Rahman1*, Syed Mehar Ali Shah1, Hidayat Ur Rahman1, Fida Mohammad1, Mian Ahmad Raza1 and Ijaz Ahmad Khan2
...justify;">This study was performed to assess resistance potential of 142 indigenous accessions along with two check cultivars against bacterial leaf blight disease at the University of Agriculture, Peshawar-Pakistan during 2011 rice crop growing season. On artificial inoculation with Xanthomonas oryzae pv. Oryzae, the fundamental agent of bacterial leaf blight, most of the studied rice accessions and the two commercial rice cultivars displayed susceptible reac...
Muhammad Qadir Ahmad¹*, Farheen Ashraf Raza¹, Abdul Qayyum¹, Waqas Malik¹, Rao Wali Muhammad2, Muhammad Asif Saleem1, Amir Hamza2, Ahmad Baksh Mahar3
...ncial assistance to many people across the world. Leaf morphology and physiology provides a balance between leaf temperature, leaf energy exchange and photosynthesis. The experiment was undertaken to study the association of leaf related traits i.e. leaf area (LA), leaf angle position (LP), number of lobes per leaf (NL), leaf chlorophyll contents (SV), r...
Abdus-Subhan1, Qudratullah Khan1, Muhammad Mansoor2, Muhammad Jamil Khan1, Ammanullah2, Matiullah Khan3
...and economics, a field experiment was carried out at Arid Zone Research Center, Dera Ismail Khan, Khyber Pakhtunkhwah Province, Pakistan, during rabi season of 2014-15 and 2015-16. The experiment was laid in randomized complete block (RCB) design with split plot arrangement keeping pulverization viz. single tiller P1, double tiller P2, triple tiller P3 and mould board plow P4 follo...
Muhammad Khurshid1,2*, Muhammad Nafees1, Mehmet Somuncu2
...ricultural system and shaped an uncertain environment that is not suitable for both landless nomadic pastoralism and ecological sustainability. This study reflects that how this agriculture encroachment may have contributed to the pastoral resources degradation and subsequent landless pastoralist’s marginalization in uplands of Naran. Extensive field surveys carried out during last three years (2013-2016) to understand crops encroachment process and its ...
Wazha Mugabe1,2, Lawrence Akanyang1, Mackenzie Nsinamwa1, Batanani Moatswi1, Naledi Matthews1, Kealeboga Dipheko1, Imtiaz Ahmed Ujjan3 and Assar Ali Shah2*
... changes in fodder tree species composition caused by grazing pressure is critical since fodder trees form the base diet for browser such as goat as well as maintenance purposes for cattle in the dry season. Thus understanding the dynamics on rangeland response to grazing could prove worthy in finding an equilibrium point for optimizing animal productivity, with limited range degradation. Therefore, the current study was aimed at determining and comparing fodd...
Waqas Ahmed Dogar2, Arshad Ali Khan3*, Saeed Ahmed2, Sudheer Tariq2, Mukhtar Ahmad2, Muhammad Imran2, Muhammad Noman2 and Nadeem Khan1
...eld. Maximum fruit yield per plant (3.6373 kg) was observed from the same plants. T2 (11 x 11ft) was close plantation and had more total number of flowers per plant (441.58) and fruit length (58.243 mm), but yield was less due to more fruit drop % (74.165). While, T3 (22 x 22ft) exhibited the poorest results. V2 (Musambi) showed best results for most parameters. Overall situation indicated that plants planted at 11 x 22ft (T...
Antibacterial Activity by Chlorogenic Acid Isolated through Resin from Apricot (Prunus Armeniaca L.)
Ahmed Mujtaba1, Tariq Masud1, Asif Ahmad1, Waqar Ahmed3, Saqib Jabbar3* and Robert E. Levin2
Ahmad Khan1, Raza Ullah Khan1*, Muhammad Zameer Khan1, Fayyaz Hussain1,Muhammad Ehsan Akhtar2, Jalal-Ud-Din3
...ign: justify;">A field experiment was conducted at NARC, Islamabad to evaluate the effect of humic substances (HSs) derived from coal, sunflower, and maize waste materials on onion yield. Four HSs rates; 0, 20, 30 and 40 kg/ha were applied to onion (variety Red Swat) transplanted earlier to field (plot size=1.2×0.8 m2). Results showed that maximum bulb yield of 25.1 and 24.5 t/ha were obtained with application of plant derived HSs; SFDH...
Said Rawan1, Farzana bibi1, Nadeem Khan1*, Abdul Mateen Khattak1, Zahir shah3, Asif Iqbal2, Madeeha Alamzeb2, Saeed Ul Haq1, Abid Kamal3, Fawad Ali Shah2, Ahmad Naeem1 and Wajid Ali3
...age intervals at room temperature” was conducted at post harvest laboratory, Department of Horticulture, The University of Agriculture Peshawar, during the year 2015. The research work was conducted in Complete Randomized Design (CRD) with three replications and two factors i.e. guava varieties (Safeda and Karela) and storage intervals (0, 3, 6, and 9 days). The data was recorded onfirmness (kg/cm2), weight loss (%), moisture contents (%), tas...
Usman Shakoor1*, Mudassar Rashid1, Abdul Saboor2, Nabila Khurshid1, Zuhair Husnain2 and Abdul Rehman2
...ic CO2, variations in temperature and precipitation are helping tools to forecast scenarios for the climate in an area. Changes in these tools from the past due to any unavoidable circumstances for today and in the future is refers to climate change (CC). Besides other living being, crops are either benefited or adversely affected by these changes in the climate of an area. Maize is one of the widely grown crops in the world and even in Pakistan has also influ...
Zain-ul-Aabdin Abro1*, Naheed Baloch1, Niaz Hussain Khuhro2, Waseem Akbar Qazi2, Noor Abid Saeed3
...n fortnightly basis in experimentation sites. Results revealed that significantly highest (124.86) population was recorded on L. acutangula and lowest (104.725) on L. siceraria at both experimental sites throughout the course of experiment. Moreover, significantly higher population densities of B. cucurbitae were observed during the 4th week of May on L. acutangula (339.4±22.59) and...
Mustafa Cengiz1*, Jama Hussein Ali2, H. Mehtap Kutlu2, Djanan Vejselova2 and Adnan Ayhanci3
... to investigate the therapeutic and protective effects of ellagic acid (EA) on the toxicity of the liver induced by D-Galactosamine (D-GaIN) in rats. With this in mind, the rats were categorized into five groups. The study groups were given saline, 0.2 % dimethyl sulfoxide, D-GaIN, EA plus D-GaIN and D-GaIN plus EA, respectively. In the group given D-GaIN, the following transmission electron microscopic and light microscopic...
Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty
Recent advances in geminivirus detection and future perspectives
... methods have been developed that permit differentiation of viral pathogens.These methods, initially based solely on identifying the distinct biological characteristics of different viruses, were soon supplemented with methods based on light or electron microscopy and serology and subsequently by Enzyme Linked Immunosorbant Assay (ELISA) and finally the use of molecular (nucleic acid-based) techniques have revolutionized the...
M. B. Meah
Biopesticides for crop growth and crop protection
...on of stem borer,leaf hoppers of rice; shoot & fruit borer of brinjal and fruit flies of vegetables.Biopesticides (formulated trichoderma) and bio-agents (bracon,trichogramma, ladybird beetle) and sex pheromone are in the pipeline for commercial use....
Sitansu Pan and Amrita Das
Evaluation of shelf life of some value added organic formulations of Trichoderma harzianum
....f.u. /g of substrate respectively at 120 days of incubation. When oilcake was amended with organic material, vermicompost + mustard cake produced high population of the antagonist upto 60 days....
Honnur Basha, Vinaya Hemannavar, B.Ramanujam, R. Rangeshwaran and S.Sriram
Screening of chilli microflora and other biocontrol agents for their antagonistic effects on Colletotrichum spp. infecting chillies
...af and fruit tissues, respectively. Among them, 70 fungal isolates belonged to plant pathogenic genera like,Alternaria, Cercospora, Colletotrichum, Curvularia, Glomerella, Mycosphaerella, Phoma and Stemphylium and the other 24 isolates of fungi belonged to Aspergillus, Acremonium, Chaetomella,Cunninghamella, Geotrichum, Gliocladium, Monodictys, Mucor, Myrothecium, Penicillium, Periconia and Pithomyces. One-hundred and thirte...
Neerja Agrawal, Mukesh Srivastava, Akhilesh Tripathi and Amrendra Singh
Survey and monitoring of pests, parasites and predators of pulse crops in central and eastern Uttar Pradesh
...ey was conducted in chickpea, pigeonpea and lentil crops in different districts of Uttar Pradesh.Atotal of 22 districts were surveyed to record gram pod borer Helicoverpa armigera, Bihar hairy caterpillar, Spilarctia obliqua, plant hopper of Pentatomorpha group, termite Odontotermes spp, and cut worm Agrotis ipsilon in chickpea whereas Campoletis chlorli...
K.N. Ahmed, S.H.A. Pramanik, M. Khatun A. Nargis M. R. Hasan
Efficacy of plant extracts in the suppression of insect pests and their effect on the yield of sunflower crop under different climatic conditions
...m (inflorescence). Other pests encountered were Spilosoma obliqua (Walker) (Lepidoptera: Arctiidae),Homoeosoma sp. (Lepidoptera: Phyticidae),Heliothis armigera (Hb.) (Lepidoptera: Noctuidae), Monolepta signata(Oliv.) (Coleoptera: Chrysomelidae) and Epilachna septima Dieke. (Coleoptera: Coccinellidae) . The efficacy of five kinds of plant extracts or botanicals viz., Neem (Azadirachta indica) seed oil, castor ( Ricinus communis) oil, a mixture of Neem seed oil ...
Sitansu Pan, Surojit Khalko and Amrita Das
Effect of some fungicides on seed mycoflora, germination, viability and their persistence in treated seeds
...seed viability and their persistence in treated seeds of mungbean, mustard and rice was studied in vitro. The highest appearance of pathogens viz.,Alternaria alternata was recorded in seeds of mungbean (Phaseolus aureus Roxb.), A. brassicae in mustard (Brassica campestris L.) and Drechslera oryzae in rice (Oryza sativa L.). Propineb 70WP and prochloraz 45EC considerably reduced the ap
A. K.Bhattacherjee and B. K. Pandey
Dissipation of carbendazim in mango after pre- and post-harvest treatments
...carbendazim@0.05 and 0.1 per cent were given to mango fruit (cv. Chausa) at 10 days interval in such a way that last spray fell 12 days prior to harvest to control post harvest diseases viz., anthracnose (Colletotrichum gloeosporioides) and stem end rot (Lasiodiplodia theobromae). Carbendazim dissipated to 1.01 and 2.14 mg kg in mature whole fruit after harvest (12 days after second spray) at 0.05 and 0.1 per cent concentrat...
Wajid Hasan1 and C. P. Singh2
Relationship between the population of mustard aphid,Lipaphis erysimi (Kaltenbach) and weather parameters on different cultivars of Indian mustard ( Brassica juncea L.)
...t-align: justify;">The experiments were conducted during rabi season (2007-08 & 2008-09) at Crop Research Centre of G.B. Pant University of Agriculture & Technology,Pantnagar, U.S. Nagar, Uttarakhand to investigate the population dynamics of the mustard aphid,Lipaphis erysimi Kalt. on different 42 cultivars of Indian mustard (B. juncea). The results revealed that the population of L. erysimi exhibited negative correlation with maximum and minimum tem
Palash Mondal1 , Amitava Konar2 and N. Johnson Singh3
Evaluation of insecticidal schedules for the management of insect pests of potato
...reatments against insect pests of potato. The minimum population of aphids, whitefly and epilachna beetle was observed in the treatment T which received soil application of phorate followed by spraying of chlorpyriphos,imadicloprid and cartap hydrochloride, respectively at 40, 55 and 70 DAP than other treatments. Maximum yield of healty potato tuber was recorded in the plot treated with chlorpyriphos before planting and foli...
M.K. Pandit,P. K. Pal and B. K. Das
Effect of date of sowing on flowering and incidence and damage of melon fruit fly in snap melon Cucumis melo var.momordica genotypes
...="justify">The present experiment on snap melon [Cucumis melo (L.)var. momordica Duth.&Full.], was carried out during 2004-2005 to determine the best sowing date for higher female flower production and more number of fruits as well as lower fruit fly incidence. Three sowing dates viz. S =25 November, 2004, S =25 January 2005 and S =25 March, 2005 were selected to evaluate performance of eight genoty...
M. D. Maji, N.K.Das, S. Chatterjee, A. Ghosh and A.K. Bajpai
Forecasting models of bacterial leaf spot disease of mulberry for Birbhum district of West Bengal
...caused by Xanthomonas campestris pv.mor was found to be one of the major foliar diseases in mulberry at farmers field in Birbhum district.BLS incidence appeared in May and continued up to November. The correlation coefficient between disease severity and meteorological parameters revealed that BLS disease severity showed significant positive correlation with max & min temperatures, min...
1N. Johnson Singh, 2Amitava Konar and 3Palash Mondal
Incidence of aphids in different traps on potato in Gangetic plains of West Bengal
...ign: justify;">A field experiment was conducted during rabi season of 2006-07 and 2007-08 at Adisaptagram Block Seed Farm, Hooghly,West Bengal to evaluate the population dynamics of aphids with the help of yellow pan trap and yellow sticky trap. The population of aphid catches was quite lower in yellow pan trap than yellow sticky trap. Aphids were first observed in traps during third week of December and the population of pe...
B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran
Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
...choderma is grown in inexpensive media like molasses and yeast medium in deep tanks on a commercial scale. Biomass from the liquid fermentation can be made into different formulations like, dusts, granules, pellets, wettable powders. Trichoderma formulations can be applied to the seed either by dry seed treatment or by seed biopriming for control of several soil-borne diseases of some field crops. Similarly, seedlings of hor...
1S. A. Khan and 2S. Jha
Effect of dates of sowing, moisture regimes, varieties and weather factors on incidences of aphid, Lipaphis erysimi (Kalt.) in rape and mustard
... the most noxious insect pest limiting production of rape and mustard. Field experiment was carried out with 3 varieties of rape and mustard, 6 dates of sowing and 2 moisture regimes to understand aphid population dynamics during different phases of growth of rainfed vis-à-vis irrigated rape and mustard crops, a...
1Parvin Noor and 2Md. Nashir Uddin
Morphological changes of different castes of the subterranean termites (Odontotermes proformosanus) in fungus combs of termitophiles
... development. During the period of study, eggs and nymphs were collected in different seasons from the fungus combs of termite mounds. Eggs of O. proformosanus were found profusely in fungus comb in the months of March, May, September and October of 2006 to 2008 Average lengths and standard deviation (mean±SD) of the eggs were (0.66 ± 0.09), width (0.04 ± 0.07) mm and egg shape ratio is 0.53. Eggs were m...
1Bikash Ranjan Ray and 2Mrinal Kanti Dasgupta
Management of root holoparasite Aeginetia pedunculata of (Orobanchaceae), causing wilt of sugarcane by trap and catch crops
...wilt caused by Aeginetia pedunculata (Roxb.) Wall. (Orobanchaceae) is endemic in the command area of Plassey Sugar Mill in the districts of Nadia and Murshidabad in West Bengal. It spreads through water-and soil-borne seeds. With the objective of developing location-specific integrated management schedule of the parasite, crops, other than sugarcane, grown in the target area were evaluated for their potential as trap and cat...
A. K. Chaubey and Satyandra Kumar
Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...ium oxysporum f. sp. lycopersici on tomato in laboratory and pot culture experiment. All the isolates were isolated by serial dilution and cultured in liquid protein supplemented broth medium and culture filtrates (CF) were prepared. In in-vitro test single eggmasses of uniform size were kept in 5ml CF in 5cm diameter Petri plates. Antifungal activity was tested by dual culture of wilt fungus with antagonist fungus and bacte...
K.N. Ahmed and M.R. Hasan
Sudden outbreak of mealy bug and armoured scale causing severe damage to economic crops in Bangladesh
...ngladesh. It is mainly a pest of citrus and coffee crops but now it has become polyphagous in nature. Based on laboratory studies on immature and mature fruits of lady's finger; the total period of all four nymphal stages lasted for 32.6 ± 4.17 days at an average room temperature of 28 ± 2ºC and 70-75% RH during September, 2009. Male mealybug has a short life span of 3.0...
Sitansu Pan and N. K. Mishra
Epidemiological studies on some diseases of guava (Psidium guajava L.)
...ther factors, such as temperature, total rainfall, number of rainy days and relative humidity on the development of diseases like canker (Pestalotia psidii), anthracnose and die back (Colletotrichum gloeosporioides), stem canker and dry fruit rot (Botryodiplodia theobromae) and Phytophtora fruit rot (Phytophthora nicotianae var parasitica) of guava were analysed for predictive purpose from regression equations. The simple correlation coefficient matrix showed ...
Bijan Kumar Das
Incidence of Aleurocanthus spp. (Aleyrodidae: Hemiptera) on betelvine (Piper betle L.) and their interaction with host plants
...: justify;">Betelvine (Piper betle L.) is a perennial evergreen shade loving creeper belonging to the family Piperaceae. In India, it is commercially cultivated over an area of 50,000 ha as an important and potential cash crop. In spite of the tremendous potentially of the crop, cultivation of betelvine is highly risky and returns are uncertain because o...
Bushra Afreen, Geetesh Baghel, Akil A. Khan and Q.A. Naqvi
Virus- vector relationship of yellow vein disease of calendula and the whitefly
...es were required for 100 percent transmission. The minimum acquisition access feeding period and minimum inoculation access feeding period for the present virus were 10min and 30min, respectively. Acquisition access feeding period and inoculation access feeding period was 100
S. Subharani, S. S. Thorat, N. Abem, L. Amit Kumar and T. K. Singh
A database on parasitoid of insect pests of crops in Manipur, India
...sting of 62 (sixty two) species records gathered by conducting a systematic survey of parasitoids on insect pests of crops in different localities of Manipur was developed by using MS-Access. The database is for academic purpose and it includes the taxonomic details of the parasitoid, host insect, host plant, morphological characters, geographical distribution, pe<...
S. K. Dutta, S. Roy Chowdhuri, D. Pandit and A. K. Bajpai
Rot diseases of muga host, Som (Persea bombycina) in Assam, India
...hat stems of som plant (specifically the pollarded plants) were generally infected with rot disease when it grows older. Phellinus contigus (under Polyporaceae), a white rot fungus, causes heart rot disease and Biscogniauxia mediterranea (= Hypoxylon mediterranea) (under Xylariaceae) causes canker rot disease of Som plant. A survey was conducted to study the infection of rotting pathogens on Som plants at Regional Muga Research Station (RMRS), Boko, Assam, Ind...
Sitansu Pan and Someshwar Bhagat
Biological control of plant diseases
...ocladium, Trichoderma, Ampelomyces, Candida and Coniothyrium. Trichoderma and Pseudomonas fluorescens are the most important and widely used bioconrol agents being used across the world for the management of several plant diseases. Some bacterial biocontrol agents can inhibit both bacterial and fungal pathogens. Smilarly, fungal-fungal, fungal-bacteria and actinomycete-fungal/actinomycete interactions exist in nature and ope...
Basudeb Dasgupta, Partha Dutta and Srikanta Das
Biological control of foot rot of betelvine (Piper betle L.) caused by Phytophthora parasitica Dastur
...justify;">Abstract The experiment was carried out over two consecutive years to study the impact of incidence of foot rot of betelvine caused by Phytophthora parasitica and growth, yield, and keeping quality by applying two bioagents, viz., P. fluorescens and Trichoderma harzianum. P. fluorescens inoculated in 500 kg oil cake ha-1 was applied once at pre-monsoon, twice during pre- and post- monsoon and four times at quarterly intervals. T. harzianum inoculated...
Debjani Chowdhury, P. C. Paul and B. Dasgupta
Management of leaf spot of Centella asiatica (Thankuni) caused by Alternaria sp. and target leaf spot of Rauvolfia serpentina (Sarpagandha) caused by Corynespora cassicola
...eaf spot of Rauvolfia serpentina (Sarpagandha) caused by Corynespora cassicola by spraying three fungicides (carbendazim at 0.1%, mancozeb at 0.025% and blitox at 0.25%) and four biocontrol agents (Trichoderma viride at 107 cfu / ml, T. harzianum at 107 cfu / ml, Pseudomonas fluorescens at 108 cell / ml and Biomonas-a formulated product of P. fluorescens preparation at 0.15% for three times at an interval of 15 days. The results revealed that the lowest
Amitava Konar, Palash Mondal and N. Johnson Singh
Occurrence of potato pests in different dates of planting in Gangetic plains of West Bengal, India
...xt-align: justify;">An experiment on the incidence pattern of various insect pests of potato under five different planting dates (P1 to P5) was carried out for two consecutive years, 2006-07 and 2007-08 at Adisaptagram Block Seed Farm, Hooghly, West Bengal, India. Kufri Chandramukhi was planted in five dates of planting starting from 3rd week of November with one week interval upto 3rd week of December with a spacing of 60&t...
D. Sharmah, K.C. Deka and A.K. Phukan
Field evaluation of efficacy of some botanical dust against rice bug (Leptocorisa oratorius Fabr.)
...000-2001 on the basis of per cent reduction under field condition. The per cent reduction in number of rice bug adults due to neem seed kernel powder, neem seed kernel powder + multani powder, multani powder, neem leaf powder, neem leaf powder + multani powder, neem leaf powder + ash, soap nut kernel powder, soap nut kernel powder + multani powder tested as dust were found to be 24.44, 14.78, 5.65, 17.06, 11.88, 6.54, 18.18 ...
Sitansu Pan and Amrita Das
Population proliferation and spread of Trichoderma spp. in soil under two different delivery systems
...ide in three different types (sterilized, solarised and natural) clay loam soil at 50% water holding capacity (pH 6.5) was studied both under laboratory and field conditions following two types of delivery systems, through organic based (vermicompost + neem cake (90% + 10% w/w)) and seed based (sterilized wheat seed) inocula. The population proliferation and spread of the antagonists were faster when they were applied throug...
K.N. Ahmed , M.A. Al-Helal, N-E-P. Khanom, S. Bulbul
Control strategies of papaya mealybug, Paracoccus marginatus Williams & Willink infesting vegetable crops in Bangladesh
...g the veins and later disperse to the unripe fruits rendering them unmarketable and inedible. The damage appeared to be in the range between 70 and 95 per cent. Generally young plants die due to heavy infestation and colony formation of the mealybug. P. marginatus is a polyphagous pest attacking several agricultural, h...
P. Barma and S. Jha
Biology, seasonal activity of fruit fly (Bactrocera cucurbitae Coq.) on pointed gourd (Trichosanthes dioica Roxb.) and weather relations
... considered as a serious pest of pointed gourd. Peak incidence of it was obtained in third week of May to first week of June during all the three years of study (i.e. 2007-08, 2008-09, 2009-10). Studies on biology showed that the incubation, larval, pupal and adult longevity periods were 2 to 5 days, 5 to 7 days, 6 to 9 days, 37 to 41 days in June-July and 4 to 6 days, 16 to 19 days, 17 to 21 days, 23 to 32 days in August-Oc...
M. S. A. Mamun and M. Ahmed
Integrated pest management in tea: prospects and future strategies in Bangladesh
...sis (L.) O. Kuntze, is a perennial crop and grown as a monoculture on large contiguous areas. Tea plant is subjected to the attack of several notorious pests such as insects, mites, nematodes, diseases and weeds. Globally 1034 species of arthropods and 82 species of nematodes are associated with tea plants. Among them 25 spe
Nilesh Suresh Gole and Bijan Kumar Das
Biology of Dichromia sagitta (Fabricius) (Noctuidae: Lepidoptera), a serious pest of Indian ipecac, Tylophora indica
...align: justify;">Indian ipecac, Tylophora indica (Burm. f.) Merr. commonly known as dumvel or antomul, is an important medicinal plant in the family Asclepiadaceae, indigenous to India. In West Bengal, we observed the herb to be heavily infested by a defoliator pest, Dichromia sagitta (Fabricius) (Noctuidae: Lepidoptera). A study was conducted in the field and laboratory of All India Coordinated Research Project on Medicinal...
Sitansu Pan and Amrita Das
Control of cowpea (Vigna sinensis) root and collar rot (Rhizoctonia solani) with some organic formulations of Trichoderma harzianum under field condition
...text-align: justify;">Cowpea (Vigna sinensis) has been considered as an important legume fodder and green manure crop during pre-kharif and kharif season. It has been considered even better in performance than maize. In some parts of India it is also used as green vegetable and pulse. The crop is known to suffer from a variety of diseases. Among those root rot and collar rot are important and R. solani has been an important ...
Sunita J. Magar and D.D. Nirmal
Effect of plant spacings and cultivars on spread of Yellow Vein Mosaic Virus (YVMV) disease
...dicated that the first appearance of symptom was earlier in cv. Local and late in cv. Parbhani Kranti. The rate of infection was higher at 45 to 60 days after sowing in both kharif and summer while in cv. Local it was higher at 30 to 45 days after sowing. Less infection rate was observed at 30 to 45 days after sowing in closer plant spacing 30 x 30 cm in both kharif and summer seasons also the minimum infection rate throughout its growth ...
SK Fashi Alam, Atanu Seni and Ajoy K Sahoo
Biology of the mealybug, Phenacoccus solenopsis Tinsley (Pseudococcidae: Hemiptera) on sprouted potato and brinjal plant
... 19.53±1 days, respectively on brinjal plant at 20-36.2° C temperature and 15.1±1 days and 18±0.82 days respectively on sprouted potato. The ratio of the male: female were 1:1.75 and 1:1.87. The duration from nymphs to adult female was 28 days on brinjal plant and 25 days on sprouted potato tubers. The pre-¬oviposition period...
Amitava Konar, Kiran A. More and Pradip Mondal
Efficacy of some insecticides against cutworm and molecricket of potato in West Bengal
...nsecticides against soil pests i.e. cutworm (Agrotis ipsilon Hufner; Noctuidae: Lepidoptera) and molecricket (Gryllotalpa africana P. de Beau; Gryllotalpidae: Orthoptera) infesting potato at Adisaptagram Block Seed Farm, Mogra, Hooghly, West Bengal (India) during 2007-08 and 2008-09. The field trial was conducted in Randomized Block Design with six treatments and five replications. Among the various treatments for managing soil pe
Amitava Konar, S. Paul and Kiran A. More
Efficacy of different insecticidal treatment schedules against aphid and whitefly on brinjal
...y conducting two field experiments at 'Adisaptagram Block Seed Farm, Hooghly, West Bengal, India in two consecutive kharif seasons i.e., 2010 and 2011. The experiment was laid in RBD with seven treatment schedules and three replications. Among all the treatments soil application of phorate at transplanting, followed by foliar spray with acephate, thiodicarb and Bacillus thuringiensis var. kurstaki at 50, 70 and 90 days after...
A. Regupathy and R. Ayyasamy
Initiatives of papain industry by private-public-farmer link-ages in classical biocontrol program for papaya mealybug in Tamil Nadu
...oduction. The need for repeated application of insecticides and dearth of labour for application of insecticides made it difficult for the farmers to maintain the crop and forced many farmers to even abandon papaya crop cultivation altogether. Considering the drastic reduction in the wet latex supply, SPFP has taken up series of initiatives which are summarized in this paper. Initially, a survey made in more than 80 farmers ...
P.S. Ajith, K.K. Lakshmesha, S. Mahadev Murthy and N. Lakshmidevi
Botanicals for control of anthracnose of bell peppers
... and under green house experiments for control of Colletotrichum capsici, fungal pathogen responsible for anthracnose disease in bell peppers (Capsicum frutescence L.). The results showed that all the selected plants have potential to inhibit the radial mycelial growth of C. capsici in-vitro. The plant extract from C. aromaticus at 50% concentration showed 42% radial mycelial growth inhibi...
S.K. Sahoo
Incidence and management of mustard aphid (Lipaphis ery-simi Kaltenbach) in West Bengal
... the most serious insect-pest of rapeseed- mustard and responsible for causing the yield losses ranging from 35.4 to 96 per cent depending upon weather condition. The experiment was carried out to assess it’s incidence and their management during the winter seasons of 2009-10, 2010-11 and 2011-12 at the Pulses an...
Goutam Samui and Shantanu Jha
Branch gall of mango (Oligotrophus mangiferae Keiffer) its bioecology and management
...e Keiffer has recently appeared in serious proportion in the major mango growing districts of West Bengal, India. The present study had been taken up regarding the biology, population dynamics and management of this pest. Branch gall is a univoltine species. Emergence of adults from gall could be found from 2nd week of February, which continued up to 2nd week of March. Incubation, larval a...
Md Riton Choudhury, Koushik Brahmachari, Sudeshna Kar and Rupayan Deb
Integration of weed management practices in rice-potato-groundnut cropping sequence
...ign: justify;">A field experiment was carried out at ‘C’ Block Farm, Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia West Bengal in two consecutive years (2009-10 and 2010-11) to study the effect of different weed management measures (e.g. hand weeding, herbicides, mulching etc.) on the yield of crops in sequence and cost effectiveness of different weed control measures. Rice exhibited the maximum yield when treated with two hand weedings, but...
Madhuban Gopal, Rajesh Kumar and Arunava Goswami
Nano-pesticides - A recent approach for pest control
...se of synthetic chemical pesticides has led to several environmental problems such as resistance and environment pollution. Nanotechnology visualized as a rapidly evolving field has potential to revolutionize agriculture and food systems. We utilized nano-technological interventions for developing nanopesticides with potent fungicidal and miticidal properties. Nanosulphur and nanohexaconaz...
M. A. Al-Helal, K. N. Ahmed, N-E-P. Khanom, and S. Bulbul
Observations on papaya mealybug, Paracoccus marginatus Williams & Willink (Hemiptera : Pseudococcidae) damag-ing some crops in Bangladesh
...small polyphagous insect pest sucking saps from the attacking fruits and leaves. P. marginatus passes through egg and three nymphal stages to become adult. Generally, three and four nymphal instars occur in case of female and male mealybug, respectively. The adults are most active in warm, dry and humid weather. The male adult mealybugs possess two pairs of wings. Female have no wings and move by crawling short distances or ...
Goutam Mondal
Plant growth promoting activity of some indigenous Tricho-derma isolates and their field performance against sheath blight of rice in old alluvial zone of North Bengal
...cens L.) and tomato (Lycopersicon esculentum Mill.) with culture filtrate of biocontrol agents and found both positive and negative effect on seed germination, plant growth and vigour. Maximum increase in germination by 13.64% (chilli), shoot length by 59.69% (tomato), root length by 84.51% (cauliflower) and biomass by 46.55% (cauliflower) were obtained by the isolate B16 followed by B14 and B13. However, the isolate, B18 showed negative result with maximum re...
M.S. Islam, M.Ali, and I. Ahmad
Efficacy of sedomil 72WP and recozeb 80WP to control die-back (Colletotrichum gloeosporioides) of tea in Bangladesh
...ny growth inhibition, respectively by 75.00-90.77% and 75.88-91.33% in 2008 and 74.66-90.55% and 75.66-91.11% in 2009. In a field experiment at the main farm of Bangladesh Tea Research Institute (BTRI), both fungicides were applied as foliar spray for three times at 1.0, 1.5, 2.0 and 2.5 kg ha-1. In 2008, sedomil 72WP gave 45.52-92.78% and recozeb 80WP gave 46.47- 90.39% reduction in PDI. In 2009, the reduction in PDI was 45...
Biswajit Pramanick, Sruti Karmakar, Koushik Brahmachari, Rupayan Deb
An integration of weed management practices in potato un-der New Alluvial soil
...eld of potato, a field experiment was carried out with this crop (var. Kufri-Jyoti) for two consecutive years (2009-10; 2010-11) at ‘C’ Block farm of Bidhan Chandra Krishi Viswavidyalaya, Kalyani, Nadia, West Bengal. The experiment was laid out in RBD with nine treatments replicated thrice. The predominant weed flora in the experimental field of potato was Cy
Dipak Mandal, Paramita Bhowmik and M.L. Chatterjee
Evaluation of new and conventional insecticides for the management of mustard aphid, Lipaphis erysimi Kalt. (Homoptera: Aphididae) on rapeseed (Brassica juncea L.)
... align="justify">Field experiment was conducted during rabi season at Raipur, Bankura, West Bengal to study the effect of few insecticides against mustard aphid, Lipaphis erysimi K. on rapeseed (Brassica juncea L.). Experiment was laid out in Randomized Block Design with eight treatments. Insecticides used in the experiments were imidacloprid 17.8% SL at...
M.A. Pendse, P.P. Karwande and M.N. Limaye
Past, present and future of nematophagous fungi as bio-agent to control plant parasitic nematodes
...er, is enigmatic. This paper takes a review of the researches done by various workers on the diversity, morphology ecology, physiology of nutrition, trap formation and mechanism of nematode capture as well as probable causes of death. The review traces the shift in the areas of research as well as ups and downs in the interest shown by the researchers. Guide lines for organized, coordinated research to i) screen different strains of NF that are tolerant to ant...
A.A. Oyerinde, P.Z. Chuwang, P.Z. and G.T. Oyerinde
Evaluation of the effects of climate change on increased in-cidence of cowpea pests in Nigeria
...o rise in atmospheric temperature and carbon dioxide differ from one region to the other. The latest assessment report from the Intergovernmental Panel on Climate Change (IPCC) predicts an increment in mean atmospheric temperature from 1.1 to 6.4°C toward the year 2100 with equally increasing atmospheric carbon dioxide (CO2). Such climatic changes could profoundly affect insect’s population on essential crops. This...
A. Sajeena and T. Marimuthu
Efficacy, stability and persistence of Ganosol, a Ganoderma based fungicide against plant pathogens
...thogen of rice was developed as an emulsifiable concentrate. The formulation of 10EC at 0.25% was standardized as the best emulsifiable concentration for use against the pathogen. The pre inoculation spray of the formulation was observed to produce 63.62% reduction in lesion height caused by the sheath blight pathogen. Two isoforms of poly phenol oxidase, PPO 1 and PPO 3 were observed to be induced only in Ganosol 10EC sprayed plants and were absent in control...
Dipak Mandal, Paramita Bhowmik, Pronobesh Halder and M. L. Chatterjee
Determination of relative toxicity and base line data of dif-ferent insecticides against cotton mealybug (Phenacoccus solenopsis Tinsley)
...e relatively toxic in respective method after 24 hours when compared to the standard check flonicamid 50 WG. Based on the LC50 values (ppm) and relative toxicity, the descending order of toxicity was chlorpyriphos 20 EC (226) > dichlorvos 75 EC (282) > triazophos 40 EC (369) > spinosad 45 SC (630) > endosulfan 75 EC (950) through treated food untreated insect method and chlorpyriphos 20 EC (113) > triazophos 40 EC (217) > dichlorvos 75 EC (23...
D. C. Khatua, B. Mondal and G. Saha
Bioassay of some agricultural chemicals, human drugs and disinfectants on Phytophthora melonis Katsura causing fruit and vine rot of pointed gourd
...ntly its germination. Copper sulphate (CuSO4, 5H2O) had adverse effect on mycelial growth and sporangia formation. Potassium permanganate (KMnO4), Savlon, Dettol and tinidazole were not good inhibitor for P. melonis. Sporangia did not form in water containing 0.0125g/L chloroquin phosphate - an antiprotozoal drug. ...
S. Patra, V.W. Dhote, SK F. Alam, B.C. Das, M.L. Chatterjee and A. Samanta
Population dynamics of major insect pests and their natural enemies on cabbage under new alluvial zone of West Bengal
...dynamics of major insect pests and their natural enemies on cabbage were studied at Bidhan Chandra Krishi Viswavidyalaya (BCKV), Kalyani, West Bengal(India) during rabi season of 2011-12 and 2012-13. Experiment was laid out in Randomized Block Design with three replications. Cabbage (cv Rareball) seedlings were transplanted in the plot of 9 m2 area with 45cm x 45cm spacing. Observation was recorded at weekly interval from ra...
Abhijit Ghosal and M. L. Chatterjee
Bioefficacy of imidacloprid 17.8 SL against whitefly, Bemisia tabaci (Gennadius) in brinjal
...align: justify;">Field experiments were conducted in two crop seasons during 2010 and 2011 with brinjal (var Muktakeshi) to evaluate the efficacy of chloro-neonicotinoid as foliar application against whitefly, Bemisia tabaci (Gennadius). Imidacloprid 17.8 SL @ 50 g a.i./ha, was found superior against whiteflies among other treatments, received lowest number of whitefly population (1.55/plant) and offered maximum reduction of...
D.K. Hazra, Megha Pant, S.K. Raza and P. K. Patanjali
Formulation technology: key parameters for food safety with respect to agrochemicals use in crop protection
... fraction of all applied pesticides is directly involved in the pesticidal mechanism. This implies that most of the applied pesticides find their way as 'residue' in food chains where they undergo concentration and pro-duce potential, long term, adverse health effects. Pesticides in developing countries in Asia and Pacific region are mainly available as dust, wettable powder, emulsifiable ...
Lakshman Chandra Patel and Chandan Kumar Mondal
Management of causal agents of chilli leaf curl complex through bio-friendly approaches
...ne predator insect Chrysoperla carnea and untreated control. The lowest population of thrips, mites and white fly was recorded with application of diafenthiuron at 15 days interval from seedling to early fruiting stage. Among the ecofriendly options, alternate use of garlic with spirit performed better than their single repeated use starting from seedling to early fruiting stage at every 1...
Dharmishthabahen R. Shah and Abhishek Shukla
Reaction of gerbera cultivars to spider mite, Tetranychus urti-cae Koch (Tetranychidae: Acari) under polyhouse conditions
...with 7.72 and 9.67 mites per plant, respectively. The gerbera cultivar C. F. Gold (13.31 mites/plant) and Stanza (15.56 mites/plant) were medium tol-erant under polyhouse conditions. On the basis of biomorphological characters cultivar stanza has maximum mite population having green coloured leaves and red coloured flowers, while the highly tolerant cultivar Cherany with dark green leaves and pink coloured flower....
Dinesh Kachhawa and Sahidur Rahman
Factors influencing incidence of red spider mite of tea, Oligonychus coffeae (Nietner) in Assam
...: justify;">During the experimental period all data on meteorological factors viz., temperature (maximum and minimum), relative humidity, total rainfall and bright sunshine hours were collected for the entire period of study from the Department of Agrometeorology, AAU, Jorhat.The incidence of red spider mite, Oligonychus coffeae on tea leaves was maximum...
Shams Ur Rehman, Muhammad Arif and Abdul Mateen
Soil-borne viruses in major potato growing areas of Pakistan
...was 17.34% and 11.99% respectively. The average DAS-ELISA based incidence in Malakand division for PMTV was 21.36% and TRV was 13.71%. The highest symptom based incidence of PMTV in the Hazara was in Baffa 10.75% and in Kalam 10.34% was in Malakand division whereas the highest incidence of TRV in Hazara was in Gojri 8.08% and in Malakand was in Shangla-top 11.62 %. The highest incidence of PMTV based on ELISA was recorded in samples collected from the farmers ...
Rashid Pervez, Santhosh J. Eapen, S. Devasahayam and M. Dinsha
Characterization of entomopathogenic nematode, Stein-ernema carpocapsae from ginger (Zingiber officinale Rosc.) rhizosphere in India
...rulence on above insect species. This study reported occurrence of a isolate of S. carpocapsae from ginger rhizosphere from India. This indigenous isolate could be investigated further for managing insect pests of ginger....
M. S. Joshi , D.M. Sawant and A.P. Gaikwad
Isolate variations in Colletotrichum gloeosporioides infecting pomegranate
...moderately virulent irrespective of varieties. Fruit varieties Aarakta and Bhagwa were found to be highly susceptible as both displayed maximum mean DRI 10.38 and 8.56, respectively irrespec-tive of isolates. Resistant varieties Yarcud local and Bedana thin skin showed uniform resistant reaction against six isolates of the pathogen. The interaction between isolates x varieties was also sta...
A. K. Ganguly and Uma Rao
Decades of researches in biochemical and molecular nematology at IARI
...nt parasitic nematodes. Specific isozymes have been identified for differentiating the important root knot nematodes species of India belonging to the genus Meloiodogyne. Further, molecular markers like RAPDs, AFLP, SSRs and PCR–RFLP of rDNA have been employed to study the molecular genetic diversity in major root knot and cyst nematode species of India to assist the breeding program...
Anjan Bhattacharyya, Suhrid Ranjan Barik & Pritam Ganguly
New pesticide molecules, formulation technology and uses: Present status and future challenges
...ing compounds to highly specific synthetic and biological materials for assured food production and protection of environment since long time. There is a sequential rise in the production and consumption of pesticides in India during the last three decades. Researches are going on to develop safer molecules which could undergo photo-degradation, microbial degradation as well as chemical degradation leaving very less amount o...
Goutam Samui and S. Jha
Biology, seasonal incidence and management of Apsylla cistellata Bucton. on mango in West Bengal
...tacked by various insect pests among which mango shoot gall psylla Apsylla cistellata Bucton.(Psyllidae: Hemiptera) is the most important one in the district of Malda and Murshidabad, West Bengal. Adult females of the pest had been found to lay eggs at the sides of midribs during first week to end of March. Incubation period lasted from first week of March to middle of August. Eggs hatched...
Amitava Konar and N. Johnson Singh
Occurrence of aphids on various potato germplasms in eastern gangetic plains of West Bengal
... application. The aphid species viz. Myzus persicae (Sulzur) and Aphis gossypi Glover were recorded first during third week of December and crossed the threshold limit (20 aphids/100 compound leaves) during first to second week of January in Kufri Chandramukhi whereas in Kufri Jyoti and Kufri Joawhar, the pest was observed first by fourth week of December and attained the critical level du...
Anil Sehajpal, Saroj Arora and Parminder Kaur
Evaluation of plant extracts against Rhizoctonia solani causing sheath blight of rice
...is, Morus alba, Thevatia peruviana, and Withania somnifera did not exert any effect. Among all the plant extracts, A. sativum exhibited strong fungitoxicity even at the lowest concentration, i.e. 100 ppm, with relative magnitude of inhibition 2.0 mm against the pathogen R. Solani. With regard to the effect of 8 plant oil samples tested, it was noticed that the oil of Syzygium aromaticum showed strong inhibition i.e. 7.5 mm at 1000ppm whereas Helianthus annus a...
S. Pal, H. Banerjee and N. N. Mandal
Efficacy of low dose of herbicides against weeds in transplanted kharif rice (Oryza sativa L.)
...>Comparative efficacy of penoxsulum 24 SC against weeds in transplanted kharif rice was studied at Regional Research Sub-Station (New Alluvial Zone), Bidhan Chandra Krishi Viswavidyalaya, Chakdaha, Nadia, West Bengal. The experiment was laid out in a randomized block design with 7 treatments and 3 replications. The results revealed that the major weed flora associated with the transplanted rice during kharif season was mainl...
Someshwar Bhagat and Sitansu Pan
Comparative ecological behaviour of some pre- and post-tsunami isolates of Trichoderma harzianum and T. viride from Andaman & Nicobar Islands
...colonization when the competition of other organisms withdrawn compared to natural and sun dried soil. Both competitive parasitic behaviour and rhizosphere colonization was low in post-Tsunami isolates of Trichoderma. The chlamydospore inoculum was found best in percentage colonization of sclerotia of boh R. solani and S. rolfsii, followed by mycelial and conidial inoculum. The isolate Thr...
Dhananjoy Mandal
Eco-friendly management of mealybug and wilt in pineapple
...Bengal, for eco-friendly pest management of mealy bug, Dysmicoccus brevipes Cockerell in pineapple, the treatments were: T1 [Farmers’ practice: phorate 10 G @ 20 kgha-1 during planting + monocrotophos 36% EC @ 0.03% at 100 DAP + endosulfan 35% EC @ 0.02% during 150-180 DAP]; T2 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G @ 15 kg ha-1at 100 DAP + Neem oil 1500 ppm spray ...
Dhananjoy Mandal 2K. Baral 3M. K. Dasgupta
Developing site-specific appropriate precision agriculture
...r soil borne pathogen or pest across vast cultivated area but not for the peasant farming or the pest complex ridden unaided agriculture as in India. PA is not about an abstract of characterization. The specific values indicating variations in population at exact grids and helping the individual farmer in decision-making in pe
Partha Pratim Ghosh and 2N. C. Mandal
Some disease management practices for bacterial wilt of potato
...uber planting) and T4 (supervised management - cowdung @ 40 ha-1 at land preparation + seed piece tuber treatment with carbendazim 2.5 gL-1 and Streptocycline @ 1 gL-1 + stable bleaching powder drenching with out removal of affected plant at 40 Days After Planting (DAP) @ 10 gL-1, along with protective banding with well decomposed cowdung + oilcake + Single Super Phosphate + Muriate of Potash mixture at 20:5:3:1 in each bact...
T. P. Ghosh, D. Mandal, S. Laha and M. K. Dasgupta
Dynamics and severity model in managing fungal diseases
... in different commercial perennial ornamentals in gardens and nurseries at Bolpur, Santiniketan and Sriniketan of Birbhum District, West Bengal, India, to study the fungal diseases of some commercial ornamentals. The leaf spot of Ficus religiosa (c.o. Alternaria sp.) is the first record. Fifteen fungal diseases have been formally described from West Bengal for the first time on these twelve ornamentals. Monthly dynamics was determined for occurrence, intensity...
K. K. Hegde and B. S. Nandihalli
Bioefficacy of some indigenous products in the management of okra fruit borers
...lign="justify">A field experiment was conducted in kharif, 2003 at Main Agricultural Research Station, University of Agricultural Sciences, Dharwad to evaluate the bioefficacy of some indigenous products against okra fruit borers, Earias vittella Fabricius and Helicoverpa armigera Hubner. Different indigenous products like NSKE (5%), GCKE, sweet flag extract (5%), garlic extract (5%), cow dung (10%) and cow urine (10%) were tried individually and in combinatio...
B. S. Nandihalli
Utilization of botanicals in the management of the coconut perianth mite, Aceria guerreronis Keifer
...t-align: justify;">The experiment on utilization of botanicals in the management of the coconut perianth mite, Aceria guerreronis Keifer was conducted at Main Agricultural Research Station, Dharwad, Karnataka during 2003-04 with nine treatments. The results of the present study indicated that among different botanicals, NSKE 5 percent was found significantly supe
Shrinivas Mudigoudra and Shekharappa
Evaluation of plant products aganist sorghum shoot fly, Atherigona soccata Rondani
...ign: justify;">A field experiment was conducted to evalute the efficacy of different plant products against sorghum shoot fly during Kharif 2005 at University of Agricultural Sciences, Dharwad. The different plant products used in the study were, Vitex negundo, NSKE, Adathoda vesica, Pongamia glabra, Vinca rosea, Butea monosperma, Aloevera @ 5% concentration and were compared with carbofuran 3 G @ 30 kg. ha-1 to know its eff...
Shekharappa
Biological control of earhead caterpillar, Helicoverpea armigera Hubner in sorghum
...lign="justify">A field experiment was conducted with biopesticides viz., Nomurae rileyi (Farlow) Samson and NPV of Helicoverpa armigera (HNPV) and compared with chemical control with Melathian 5% @ 30 kg.ha-1 for the management of ear head caterpillar (H. armigera) in sorghum ecosystem of University of Agricultural Sciences, Dharwad. The mycoinsecticide N. rileyi was highly infective at both the dosages 1x108 conidia
Sujoy Mondal and S. S. Ghatak
Bioefficacy of some indigenous plant extracts against epilachna beetle (Henosepilachna vigintioctopunctata Fabr.) infesting cucumber
... impact of plant derived pesticides viz; Neem Azal, Rhizome extracts of Acorus calamus with petroleum ether as solvent and seed extracts of Annona squamosa with methanol as solvent in controlling epilachna beetle, Henosepilachna vigintioctopunctata, Fabr; Both Neem Azal and seed extracts of Annona squamosa were used at 4ml, 5ml and 6ml (per Lt. of water) while this was 1ml, 2ml and 3ml (
V. S. Desai, S. D. Desai, A. J. Mayekar and V.G. More
Infestation of coconut eriophyid mite, Aceria guerreronis Keifer in Konkan region of Maharashtra
...nfestation level of this pest in April and October of 2004 and March 2005. The survey indicated that the infestation was higher in Thane district followed by Sindhudurg district.
...
Manidipa Chowdhury
Incidence of saw fly, Athalia lugens proxima Klug. as influenced by level of irrigation and fertilizers on mustard
...iv align="justify">The experiments were conducted in the Instructional farm of Uttar Banga Krishi Viswavidyalaya, Pundibari, Cooch Behar, West Bengal in two successive Rabi seasons of 2005-06 and 2006-07with an objective to study the incidence of saw fly (Athalia lugens proxima Klug.) as influenced by level of irrigation and fertilizers on mustard c.v. NC-1 (Jhumka) of Brassica campestris var. yellow sarson. Highest saw fly ...
S. Choudhury and S. Pal
Population dynamics of mustard aphid on different Brassica cultivars under terai agro-ecological conditions of West Bengal
...
Experiments were conducted at the Instructional Farm of Uttar Banga Krishi Viswavidyalaya, Pundibari, Cooch Behar during rabi season of 2002-03 and 2003-04 to study the population dynamics of mustard aphid on seven popular rapeseed-mustard cultivars. The incidence of aphid commenced from 52nd to 2nd standard week with a very low population levels on all the cultivars. The aphid (Lipaphis erysimi) popul...
Shyam Singh and L.P. Awasthi
Plant products for the management of yellow mosaic disease of mungbean and urdbean
...div align="justify">An experiment was designed to test the efficacy of a few botanical extracts on the yellow mosaic of mug bean. Maximum reduction in disease incidence recorded were 66.70 and 63.65 percent in mungbean and Urdbean, respectively by eight sprays of Clerodendrum aculeatum. Whereas, eight sprays of Boerhaavia diffusa root extract could reduce the disease incidence by 60.27 and...
N. Mandi and A. K. Senapati
Integration of chemical botanical and microbial insecticides for control of thrips, Scirtothrips dorsalis Hood infesting chilli
...lign="justify">A field experiment was conducted during winter season of 2004-05 and 2005-06 to evaluate the effectiveness of different conventional & eco-friendly insecticide (synthetic and biological origin) against thrips (Scirtothrips dorsalis Hood) infesting chilli (Capsicum frutescens). The effectiveness of four insecticides acetamiprid 0.004% (Dhanpreet – 20% SP), thiamethoxam 0.005% (Avant-25% WG), neem pest...
V. N. Jalgaonkar, M. S. Gawankar, V. W. Bendale and P. D. Patil
Efficacy of some insecticides against cashew tea mosquito bug Helopeltis antonii Sign
...ate. Nearly 60 different pests have been reported on cashew. Among them the Tea Mosquito Bug, Helopeltis antonii Sign. is the most serious one, which is responsible for considerable yield losses in cashew. A field trial was conducted during 2005 at Cashew Research Farm, Regional Fruit Research station, Vengurle, Dist. Sindhudurg, (M.S.) with an objective to identify an alternative insecticide for management of Tea Mosquito B...
S. Pal and I. Sarkar
Pests infesting ornamental plants in hilly region of West Bengal
...ower. A number of aphid species were found infesting different ornamental plants viz. Myzus persicae on Carnation, gerbera and Anthurium; Macrosiphoniella sanborni on Chrysanthemum; Aphis gossypii on China rose. Other sucking pests infesting ornamentals included Bemisia tabaci on Gerbera, leafhopper on Gladiolus and scale insect (uns
Zhensheng Liu1,2, Hui Gao1,2, Jiapeng Dong1, Mingming Zhang3 and Liwei Teng1,2,*
...h predicts that females spend more time on feeding and that the activity synchronization of same-sex groups is higher than for mixed-sex groups. Our results support the hypothesis. Both males and females spent most of their time on feeding and moving. Feeding behavior differed significantly by sex but moving behavior did not. Activity synchronization indices of same-sex groups were higher than for mixed-groups and were highe...
Bao-Ming Ge* Dai-Zhen Zhang, Qiu-Ning Liu, Sen-Hao Jiang, Jun Cui, Chun-Lin Zhou and Bo-Ping Tang
...ly affected by habitat type (F5,120 = 49.409, P < 0.001) and season (F3,120 = 13.577, P < 0.001), however, there was no significant interaction of habitat type and season (F15,120 = 0.529, P = 0.919). The abundances distribution was significantly different among habitats in each season as shown by one-way ANOVA, the higher abundance can be found in the warmer seasons. The highest abunda...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...ough eye drops. Group B specific antibody negative (SAN) chicks were challenged with same dose at 2nd week of age. While the group C and D was unchallenged control containing commercial and SAN chicks. The Blood samples were collected from group A, B, C and D on 3rd, 5th and 7th day of post infection for biochemical analysis. The Albumin and total protein values were significantly low (P<0.05) in infected groups A...
Jakub Jan Skorupski
...rowth hormone gene genotypes has tri-allelic polymorphism g.1219C>G (PIC = 0.3039), and three di-allelic polymorphisms - g.616G>C, g.846A>G and g.931C>T (PIC>0.2400). The recognized SNPs enrich the database of single nucleotide polymorphisms for American mink.
...
Nasreen Memon1,*, Rukhsana Parveen2 and Imtiaz Ahmad2, Nadir Ali Shah3
...ify;">Till to date nine species of the genus Halys are described from Asia. Of the nine species, five are described from Pakistan, including present two new species from Sindh province. These two new species are described, illustrated and compared with the allied species. Illustrations include dorsal view, scent...
Sadia Munir1a, Asif Nadeem1a*, Maryam Javed1, Masroor Ellahi Babar2, Tanveer Hussain2, Wasim Shehzad1, Rajput Zahid Iqbal3 and Sidra Manzoor1
... a member of the tissue-specific POU homeobox transcription factor family that is found in all mammals. Pit1 encodes a pituitary-specific transcription factor, which is involved in pituitary development and regulating the hormone expression in animals. In current study, Pit1 gene was screened for polymorphic sites in Sahiwal cattle. Samples from Sahiwal cattle breeds were sequenced using six set of primers. A to...
Song Li1,* and Zuojian Feng2
...ely little work has been performed on mapping its geographic variations in China. In this study, we used 45 P. albiventer specimens from Xizang and Yunnan in China to conduct multivariate analyses and calculate coefficients of differences on cranial measurements, together with a comparison of pelage characteristics. Results indicated that the allopatric samples from Xizang were obvi...
Physiological Responses to Fasting and Refeeding in Apodemus chevrieri from Hengduan Mountain Region
Hai-Ji Zhang1, Di Zhang2, Dong-Min Hou1 and Wan-Long Zhu1,*
... were no post-fasting compensatory increases in food intake. All of the results indicated that A. chevrieri can adjust their physiological functions to cope with food shortage, mainly by decreasing body mass, thermogenesis and serum leptin levels.
...
Sohail Ahmed, Muhammad Arshad and Babar Hassan*
... on woods of three tree species to ward off subterranean termites. Three resins types in three concentrations were applied by brushing and dipping on wooden stakes which were exposed to termites’ for a period of 4 weeks in the field. Weight loss before and after resin treatment was indicative of effectiveness. Highest concentration of all resins significantly reduced the chances of t...
Freeha John, Noor Abid Saeed*, Sajid Nadeem and Muhammad Hamed
...d in wheat crop. Field experiment was conducted at NIAB, Faisalabad to evaluate the use of the planting time and the insecticide sprays for managing aphids to avoid losses to grain yield. During the crop season in year 2015-16, wheat variety (Millat 2011) was sown on three planting dates: mid Nov (crop 1), end Nov (crop 2), and mid Dec (crop 3). Trial was laid out in split plot design having three replications. Planting dates were kept in main plots while, ins...
Yasemin Bircan Yildirim* and Hediye Tugce Vurmay
...ially important finfish species: saddled seabream (Oblada melanura), gilthead sea bream (Sparus aurata), Bogue (Boops boops), horse mackerel (Trachurus mediterraneus), red mullet (Mullus barbatus), brushtooth lizardfish (Saurida undosquamis), grey mullet (Mugil cephalus), threadfin bream, (Nemipterus randalli), which were caught from the Iskenderun Bay at 6 different locations (local fishermen’s fis...
Burhan Azam1, Muhammad Naeem Tahir2,*, Faisal Shahzad2, Abdul Ghaffar3, Ghulam Abbas4, Madiha Gohar5 and Saima1
...-over design with four experimental periods. Each period consisted of a 14-days enzyme supplementation period following a 3-day transition period without enzyme supplementation between consecutive experimental periods. The results showed a signific...
Ayesha Zahid,Ammara Muazzam, Sidra Mustafa, Saba Irshad*,Malik Siddique Mahmood and Rehman Shahzad
...visual impairments among people, although ocular surgery can reestablish vision in such patients but genetic researches have validated that, mutations in GJA8 are coherent source of lens opaqueness and inappropriate growth of fiber cells. In the present study, a novel G to C substitution (1104G>C) (pE368Q) was screened by PCR-SSCP in exon 2 of GJA8 and this tansversion altered exceedingly conserved glutamic acid to glutamine at site which was involve...
Rauf Ahmad1, Karam Ahad2 and Aziz Ullah Shah3
...y, were tested for their performance against the respective standards. In hybrid category, 58% candidates milling quality found excellent or good (head rice yield– HRY 51-70%), 23% marginal (HRY 40 – 50%) and 18% below limit (< 40%). Physically, 60% samples were extra-long size, slender shape and coarse type. Nineteen
Mousa Keshavarz1*, Maryam Soyuf Jahromi2
... see if they effect the operational sex ratio (OSR). The number of males and females were 71 and 126, respectively. Twenty samples by the total wet weights less than 12 g were non-sexual. The wet weight of the gonads was ~8.25% of the mean total wet body weights. The most distribution of gonad wet weights and total wet weights were generally less than 10 g and 80 g, respectively. The femal...
Madeeha Arshad1, Naveed Ahmad2,*, Muhammad Khalid3, Asmatullah1, Mohammad Tahir2, Khadija Naveed1 and Asia Iqbal4
...ub>50 of Cr VI, respectively, with one control and one vehicle control group. Fetuses were recovered on 18th day of gestation and fixed for morphometric and morphological studies. Experimental groups showed variable degree of fetal abnormalities, along with reduction in body weights parallel to increase in dose concentration, as compared to control and vehicle control. Morphometric studies showed significant...
Jia-xiang Wang1,2,* and Peng Li1,2
...e portionis comprised of peripheral gland cells and centroacinar cells; the endocrineportion consists of islet cells. Ghrelin-immunopositive (ghrelin-ip) cells were found in both the pancreatic exocrine portion and islets. The greatest number of ghrelin-ip cells was found in the islets, and the cell density decreased gradually from the pancreatic islets to the extrainsular regions. The distribution of ghrelin-ip cells was observed mostly atthe
P.P. Ghosh*, C. Ghosh, B. Mahato, A. Chakraborty, S.K. Bhattacharya and M.K. Bhattacharjya
...acterial wilt being an impediment of brinjal (Solanum melongena L.) production under the acidic soil condition of Purulia district of West Bengal resulted in 20-30% yield loss every year. The present participatory action research was aimed to study the (i) adeptness of integrated module of prophylactic soil disinfection and bio-control, (ii) only prophylactic soil disinfection, and (iii) only curative soil disinfection over uprooting and destruction of ...
1Sitesh Chatterjee, 1Chirasree Gangopadhyay and 2Santosh Kumar Roy
...t-align: justify;">The experiment was conducted during kharif seasons of 2014 and 2015 to evaluate field bio-efficacy of new generation molecules against rice insect-pests. Control of pests in seedbed is relatively less expensive than transplanted main-field because of smaller area of nursery that can be managed better way as compared to transplan...
P.P. Ghosh*, A. Chakraborty, S.K. Bhattacharya, C. Ghosh, B. Mahato and M.K. Bhattacharjya
...s the major stored grain pest of blackgram under homestead condition resulting 15 – 30% grain damage during storage. An attempt was made to identify a practical and low cost solution of such damage with the active participation of village women responsible for the storage. Proven biological, chemical and botanical (vegetable oil) approaches of management were tested against traditional practice and replicated among 10 different household at 10 villages. ...
Obaidullah1, Zafar Ali Shah1* and Sami Ullah2
...and to synthesize its copper and silver nanoparticles followed by their antibacterial assessment. Lapachol was isolated from stem heartwood of heterophragma adenophyllum seem through column chromatographic technique. Characterization of Lapachol was carried through melting point assessment and running its comparative TLC against standard, added with structure elucidation by FT-IR spectrum. Silver nanoparticles of Lapachol we...
Elvera Monin, B. Dasgupta, Palash Chandra Paul, Jayanta Saha and Srikanta Das
...t associated with this type of article....
Gadeeyya G and Ratna Kumar P.K.
...ommelina benghalensis, Cyperus rotundus, Crotalaria verrucosa, Digera muricata, Sida cordifolia, Ipomoea pestigridis and Trianthema portulacastrum were selected for in vitro studies. Fungal isolates namely Ascochyta cypericola, Bipolaris sp., Chaetomium globosum, Colletotrichum capsici, Colletotrichum sp., Curvularia lunata, Curvularia tuberculata, Fusari...
Fariha Imtiaz1, Muhammad Islam1, Hamid Saeed2,*, Bushra Saleem1, Maryam Asghar1 and Zikria Saleem2
...ned in various solvents (petroleum ether, chloroform, methanol, ethanol and distilled water) using hot and cold extraction methods. Phytochemical analysis of leaves was performed on powder and extracts of leaves using already reported methods. Mineral analysis was done using atomic absorption spectrophotometer. Hair growth promoting effects were examined using alop...
Mahmoud Said1*, Abd El Satar Arafa1, Mohammed A. Rohaim2* and Hussein A. Hussein2
... Newcastle disease genotype VII. Comparative blood profiling in vaccinated and challenged, non-vaccinated and non-challenged and non-vaccinated and challenged indicated that MDA for H5N1 gradually decreased from 5.1 to 0.4 log2 and disappeared with in a month. While MDA for NDV remained 2.1 log2 until 28th day of age, the Geometric mean titers (GMT) for H5 were increased from the 7th day of age using both antigens (RE-5 anti...
Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1
...ically identical, their specific identification relies exclusively on the use of molecular tools. In this study, we analysed the G-protein-coupled chemokine receptor (GPCR) genes of two LSDV isolates from Ixodid (hard) ticks (Amblyomma hebraeum) in Egypt. Multiple alignments of the nucleotide sequences revealed that both isolates had nine nucleotide mutations in comparison with the local reference strain, LSDV-Egypt/89 Ismalia. Compared with the GPCR sequences...
Amir Ismail1, Muhammad Riaz1,2*, Saeed Akhtar1, Amjad Farooq3, Muhammad Arif Shahzad1 and Ahmad Mujtaba4
...nd to exceed the maximum permissible limit (0.02 µg/g) set by Codex Alimentarius Commission in 53% milk samples. In 44% milk samples the level of Cd was found to exceed the permissible limit (0.0026 µg/g) set by International Dairy Federation (1979). The mean levels of Ni, Cu and Co were found in the normal ranges. The data for estimated daily intake of heavy metals through milk showed that infants are most prone...
Süleyman Kök*
...1922, while the expected heterozygosity (He) value was found 0.3909±0.1663. The research findings show that the difference between the two TGC groups in terms of Calpastatin gene (CAST) loci (P<0.01) and Calpain gene (CAPN1) loci (P<0.05), gene assortment was found to be meaningful and these are incompatible along with Hardy-Weinberg theory. In addition, significance check was done for the expe...
Mehmet Avci1, Recep Aydin1,* and Jale Metin Kiyici2
...with mixed ration of chopped roughage (5-7 cm) and concentrate calf starter feed and the calves in control group were supplied with natural roughage and concentrate feed separately. The calves were supplied with milk at about 8% of their birth weights and weaned at 49th day. Mixed chopped and separate natural supply of roughage and concentrate feed did not created any significant differences in live weights, daily...
Baohua Chen1,2, Wenzhu Peng3, Jian Xu2, Jingyan Feng1,2, Chuanju Dong1,2 and Peng Xu2,3,*
...ST class from different species share more similarity than genes of different classes in the same species. Copy number of GSTs examining showed that five classes of GST genes in common carp have undergone the gene duplications, including MGST1, GSTK, GSTM, GSTA and GSTT. Comparative genomics and syntenic analysis provided new evidences for better understanding on gene fates post whole genome duplication (WGD) of common carp....
Erol Akkuzu1,*, Hidayet Güzel2 and Özkan Evcin1
...) the body length of the pest did not differ significantly between two site productivity classes and between two stand compositions.
...
Naimat Ullah Khan1,2, Muhammad Hassan Saleem1, Aneela Zameer Durrani1, Nisar Ahmad3, Ayesha Hassan1, Sultan Ayaz2, Sajid Umar4, Muhammad Luqman Sohail5,*, Muhammad Shafee6, Ikramullah Khan7, Mumtaz Ali Khan1, Azmat Ullah Khan8, Naimat Ullah Malik1 and Abdul Razzaq9
...oth developing and developed countries, causing millions of deaths each year. This study was designed to estimate the zoonotic potential of Cryptosporidium in three districts of Khyber Pakhtunkhwa (KPK), i.e. Bannu, Lakki Marwat and Kohat. For this purpose 360 stool samples were collected from the District Headquarter Hospitals of all the three districts and were screened through microscopy. Results yielded an overall prevalence of 11.11%, with s...
Rafi Ullah1, Sarzamin Khan1,*, Abdul Hafeez1, Asad Sultan1, Nazir Ahmad Khan2, Naila Chand1 and Naseer Ahmad1
...kworm meal on production performance, hematology and carcass traits in broilers at finisher phase. Five isonitrogenous and isocaloric diets were uttered with the step-wise i.e. 0% (D1), 25% (D2), 50% (D3), 75% (D4) and 100% (D5) replacement of soybean meal with silkworm meal in commercial broiler rations. A total of 150 day-old broiler chicks (Ross 308) were randomly distributed into fifteen replicate groups (n=10), and consequently reared on five ex
Mutassim M. Abdelrahman1,*, Riyadh S. Aljumaah1, Moez Ayadi1 and Shabana Naz2
...e elements containing copper (Cu) cobalt (Co); selenium (Se), manganese (Mn); zinc (Zn) and iodine (I). Blood samples were collected from ewes and their newborns at parturition. Colostrum yield and biochemical analysis at parturition was also determined. A significant (P<0.05) increase of calcium (Ca), Zn, Co and Se levels in blood of ewes treated with bolus with a significant increase in phosphorous (P), Co and Se in the blood of their newborn lambs. Furth...
Viram Kumar1,*, Moolchand Malhi1, Saeed Ahmed Soomro1, Toufique Ahmed Qureshi2, Muhammad Nawaz Sanjrani3 and Khushal Das Malhi1
... in the wild Indian blue peafowl (Pavo cristatus) of Thar (desert) region in the Sindh province of Pakistan. A total of 60 blood samples were collected from peafowl (30 males and 30 female) in months of March and April, 2015. The gender difference showed that RBC, MCV and MCH concentrations were significantly higher (P < 0.05) and the serum total protein and Mg concentrations were significantly lower (P < 0.05) ...
Muzammil Sattar
...e diet of adult Chrysoperla carnea (Stephens). Results show that proteins play a vital role in the fecundity, fertility and all the biological parameters of F1 for mass rearing. The tested proteins were: Casein, Protein hydrolysate, Torula yeast and Nu lure. Al these proteins were tested in laboratory at four concentrations, i.e., 1, 3, 5 and 7 mg/ml in diet. Significantly higher fecundity 785.12±25.7, fertility 89.23±0.3...
Ahmad Ali1,*, Sheikh Muhammad Azam2, Khalid Javed Iqbal1, Ghulam Mustafa1 and Mujahid Kaleem3
... There are five big cat species in the genus Panthera and tiger is the biggest one. Data were collected by recording observations on breeding of Royal Bengal Tiger in captivity at Bahawalpur Zoo from June 2012 to July 2014 (two years) on prescribe sheets. Data from June, 2003 to December, 2011 (nine years) were collected from zoo management. In two years study Tiger breed once and produce four cubs (female) while in nine years it breed three times;...
Muhammad Ayaz1,*, Muhammad Athar Abbas2, Pervez3, Noorulain3, Yasir Amin1, Zubair Ali3, Naila Siddique2 and Khalid Naeem2
...N2 subtypes isolates were recorded. The total prevalence recorded was 3.66%and out of 498 broiler operations yielded 17 (3.4%) positive isolates and 44 golden type native chicken farms yielded 05 (11.36%) isolates of AIV H9N2 and 58 captive pheasant’s samples were negative. It was observed that frequency of H9N2 prevalence ...
Yun Wang1,*, Lei Guan1, Jiding Chen1, Yaping Kong1, Lang Si2 and Asif Shah3
...er of ungulates, and the perpendicular distance between QTH and QTR. To improve the protection mechanism for the four large ungulates viz., Tibetan antelope Pantholops hodgsonii, Tibetan gazelle Procapra picticaudata, Kiang Equus kiang) and Wild Yak Bos grunniens; we suggest that the distance between the proposed route for the expressway and the present h...
Muhammad Ashfaq,1 Shamim Akhtar,2 Saleem Akhtar2,* and Mariyam Masood2
...">PCR protocol was developed to detect hyperparasitism in cotton mealybug. Cotton mealybug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae) is an invasive and major pest on cotton. Aenasius bambawalei (Hymenoptera: Encyrtidae) is an effective parasitoid of mealybug and has been the backbone of the biological control program of cotton mealybug in Pakistan, but its multiplic...
Mutassim M. Abdelrahman1*,Ibrahim Alhidary1, Abdullah H. Alyemni2, Rifat U. Khan3, Abdel Raouf S. Bello4, Mohamed Y. Al-Saiady2 and Ramzi A. Amran1
...inal characteristics and performance of growing Naemi lambs fed TMR. Four groups, each of 3 months old growing Naemi male lambs (28.85±1.09 kg), were fed on TMR (NDF=41. 95%) (T1). TMR plus 100 g alfalfa hay (NDF= 43.3%) daily (T2), TMR plus 200 g alfalfa hay (NDF= 43.3%) every two days (T3) and TMR plus 300 g alfalfa hay (NDF= 43.3%) every three days (T4). Rumen fluid samples were analyzed for volatile fatty acids and ammonia nitrogen levels. Acetic ac...
Javeria1, Masroor Ellahi Babar2,*, Tanveer Hussain2, Rashid Saif2, Sadaf Rashid3, Hanan Sarfraz4, Abbas Ali Shah3, Muhammad Wasim1 and Muhammad Abdullah1
.... In-silico analysis was performed to detect the possible disease causing effect of genetic variants with OCD. Sequencing of BDNF gene showed one change G>A at position c.196 (rs6265) resulting in a nonsynonymous change from valine to methionine. We found only one homozygous and heterozygous carrier for this polymorphism. Healthy siblings of the carrier individuals and control group were screened and found as negative for this polymorphism. In-silico...
Sidra Manzoor1,Asif Nadeem1,*, Masroor Ellahi Babar2, Wasim Shehzad1, Abu Saeed Hashmi1, Muhammad Imran1, Tanveer Hussain2, Abdul Wajid1 and Maryam Javed1
...ne. Association test was performed to analyze its relation with milk composition but it was found non-significant in all analyzed traits. So, it was inferred that it might be due to environmental or epigenetic effect, sampling number or a breed difference. To know the functional consequences of the identified polymorphism, RNA secondary structure analysis was performed and SNP was found changing the termination loop sha
Muzafar Shah1,*, Mian Sayed Khan1, Muhammad Ather Rafi2, Habib Ahmed3 and James M. Carpenter4
...an during 2011 to 2013. Species was confirmed by taxonomic key, which are belonging to subfamily of Polistinae. Phylogenetic tree were reconstructed using 12 SrRNA (12S) gene showing homology of 73% compared with gene bank data while on the basis of cytochrome oxidase 1 (Co1) gene 93% homology were recorded. It was concluded that Co1 gene is more reliable than 12S rRNA gene for confirmation of R. brevita position in the Vespidae family.
Azhar Abbas Khan1,*, Arif Muhammad Khan2 and Muhammad Afzal3
...2.1444±0.2027, respectively) attracted significantly more numbers of C. septempunctata as compared to control and aphids alone (0.7667±0.1204 and 0.8333±0.1153). With every next hour (3, 6 and 12 h) of observation the movement of C. septempunctata toward target localities was elevated. Finding of the current investigation revealed that wheat, brassica, citrus and rose infested with aphids can be used as host plants for mass r...
Shahid Iqbal Khattak1*, Mohammad Safdar Baloch1, Khalid Naveed2 and Ejaz Ahmad Khan1
...variety Hashim-08. The experimental trial was conducted following RCB design with three replications. Fertilizer applications (foliar and soil) were assigned to main plots, while nitrogen levels 0, 24, 36, 48, 60 and 120 kg ha-1 were kept in sub plots. Results revealed that foliar application of N significantly (P≤0.05) affected plant height (89 cm), tillers m-2 (313), grains spike-1 (48), 1000-grain weight (43.0 g) and economic yield (3760 kg ha-1). Foliar...
Khurram Shahzad and Mohammad Akmal*
...es and timings for wheat performance in recent weather condiction. Experiment was conducted at Agronomy Research Farm, The University of Agriculture Peshawar in 2015-16 in a randomized complete block (RCBD) design with four replications. Seedbed was prepared as recommended for wheat, planting was made with basic seeds (cv. Pakhtunkhwa) using seed drill in rows spaced 0.25 m equal distances. Recommended rates of phosphorus an...
Umer Wahid1, Shahid Ali2* and Nihal Ahmad Hadi3
...-align: justify;">This paper estimated and examined technical efficiency of tomato growers in Malakand district of Khyber Pakhtunkhwa, Pakistan. A sample of 120 tomato growers was selected employing multistage sampling technique. An interview schedule was used for data collection during November-January, 2016. Maximum likelihood technique was used for the estimation of the Cobb-Douglas stochastic frontier production model. After running various econometrics so...
Naveed Muhammad, Syed Attaullah Shah*, Abbas Ullah Jan, Irfan Ullah, Muhammad Ibrahim and Salman Khan
...rowers. A Cobb-Douglas type production model is used to estimate tomato yield and identify important factors affecting yield. Ordinary Least Square estimates for the model indicate that machinery, seed quantity, labor, number of irrigation, chemicals spray and fertilizers have positive significant effects on tomato yield. Allocative efficiency analysis reveals that machinery, seed quantity, number of irrigation, fertilizers and chemicals are underutilized, whi...
Muhammad Mansoor1, Amanullah1, Zafar Islam2*,Sher Muhammad3, Muhammad Umair4, Mehmood Ayaz5, Asghar Ali Khan6, Muhammad Asif2 and Ya Sakina3
...ab Mung (DM-3) was developed through cross between VC1482 C (AVRDC line Vigna cross, bold seeded, small stature and susceptible to Mungbean Yellow Mosac Virus (MYMV) and NM-92 (a promising variety of Pakistan, bold seeded, high yielding and MYMV resistant) at Agricultural Research Institute, Dera Ismail Khan. Inqalab Mung was tested in various experiments for production technology and yield trials for its
Furukh Faiz1,2, Muhammad Issa Khan2, Masood Sadiq2 and Haq Nawaz3
...water, vaccination and experimental feed for 42 days. The body weight gain, feed intake and the feed conversion ratio was observed weekly. After 42 day of the growth, the birds were slaughter with the Islamic Halal Method and the blood samples of the birds were preserved for antioxidant enzymes assay analysis. The data showed that as the citrus waste percentage in the feed of the broiler was increased, its feed intake and th...
Oaj Khurshid1*, Naureen Aurangzeb1, Ayaz Khan1, Alia Naz1, Abdullah khan1, Sobia Nisa2 and Sehrish Sajawal3
...xt-align: justify;">An experimental study was piloted to evaluate the possibility of composting of source separated organic substance of municipal solid waste (MSW) produced in low, middle and high income areas of Peshawar having the a population more than 2 million. Outcomes of MSW investigation showed the occurrence of great proportion of Decomposable organic matter, adequate moisture content and C/N ratio. On windrow composting, not only the bulk of the was...
Shah Saud Ahmad and Muhammad Zafarullah Khan*
...luded that FSC had developed the linkages of the respondents with agriculture research and water management department in the study area. Top learned skills from this approach were fertilizer application, improved agricultural technology and sowing methods. It is suggested that there is a need that FSC has to establish the linkages of the farmers with the entire line department associated with the farming. FSC should take steps to build the capacity of the far...
Ayesha Ilyas1, Hafiz Azhar Ali Khan2,* and Abdul Qadir1,*
...t-align: justify;">The experiments were set up to investigate the settling and ovipositional deterrent effects of crude leaf extracts of six indigenous plants viz., amaltas (Cassia fistula), datura (Datura alba), neem (Azadirachta indica), niazboo (Ocimum basilicum), yellow kaner (Thevetia peruviana) and safeda (Eucalyptus camaldulensis) against the pe...
Hazrat Ali1,*, Wajid Ali1, Karim Ullah1, Fazle Akbar1, Sher Ahrar1, Irfan Ullah1, Irum Ahmad1, Ashfaq Ahmad1, Ikram Ilahi2 and Muhammad Anwar Sajad3
...omically important fish species, an herbivorous fish Schizothorax plagiostomus and a predatory fish Mastacembelus armatus, from three rivers of Malakand Division, Pakistan. Concentrations of Cu and Zn were determined in fish samples by atomic absorption spectrophotometer. Highest Cu concentration of 4.52 ± 0.24 mg kg−1 wet weight was observed in muscles of M. armatus at Chakdara o...
Madiha Hashmi1, Abid Hussain1, Shafiq ur Rehman1, Farida Ahmed2, Shahbaz Aslam3,Nadeem Afzal4 and Zaigham Abbas1,*
...year, almost 2.4 million people get vaccine for allergy from Allergy Centre, National Institute of Health (NIH), Islamabad. Human Leukocyte Antigens (HLA) genes are located on the short arm of the chromosome number 6 and position 21 and the allele frequency is associated with allergy. The study was conducted to investigate the relationship between the aero-allergens and the frequency of HLA-DRB1*11 and HLA-DRB1*12 allele in aeroallergen se...
Aneela Qureshi1, Ammara Ainee1*, Muhammad Nadeem1, Masooma Munir1,2*, Tahir Mahmood Qureshi1, Saqib Jabbar2
...erent proportion with grape fruit albedo powder. The effect of fiber source on physicochemical, sensory attributes and microbiological properties of fruit cakes were examined during 30 days of storage. Results showed that with varying fiber content water activity, texture, color, moisture, fat, protein, ash, NFE and fiber content changed significantly (p<0.05). Gross energy level in cake which is desirable by consumers wa...
Huseyin Sasi1* and Gulcin G. Ozay2
...me, we investigate the aspect of bio-ecological of chub(Squalius cephalus L., 1758) in upper Akcay River (Buyuk Menderes Basin) including the age, growth, length-weight relationship and reproduction. The study was conducted in upper Akcay River between June 2012 and May 2013. Monthly data showed that native fish chub were aboundantly with other native fish (Acanthobrama mirabilis...
Wu Yi-qun* and Xu Xiu
...gn: justify;">During the period from January 26th to February 3rd, 2013, the time budget and rhythm of wintering behaviors of Great Bustard (Otis tarda) was studied with instantaneous-scanning method in the intersection area of the Yellow River, the Wei River and the Luo River located at the middle reaches of Yellow River basin of China. The results showed that standing accounts for 32.75 % of wintering behaviors for Great Bustard, followed by the feedi...
Farah Ashfaq* and Tasnim Farasat
... = 0.329, p<0.01), respectively. To conclude this study suggests a positive association between serum resistin and metabolic markers of obesity in young Pakistani subjects.
...
Sogolo L. Lebelo1,* and Gerhard van der Horst2
...tations of nuclear envelope. The nuclei are characterized by patches of euchromatin and heterochromatin regions with the latter usually occupying the periphery of the organelle. The cytoplasm contains numerous mitochondria containing distinct lamellar cristae, small patches of rough endoplasmic reticulum as short cisternae, a large dense network of interconnecting tubular smooth endoplasmic reticulum, and round or oval lysos...
Muhammad Imran Shabbir
...red varieties as well as performing genetic analysis including prediction of patterns of inheritance in family lines and to calculate the recurrence risk for relatives etc. Punnett square is used to describe the possible combinations of paternal and maternal alleles for a particular cross. Described here is a line-dot method using ternary genotype codes to determine genotype probabilities ...
Noor Islam1, Muhammad Amjad2, Ehsan ul Haq3, Elizabeth Stephen1 and Falak Naz4
...Islamabad, Pakistan. The percentage of infestation by T. clareae on worker brood, number of dead/fallen mites per hive/weekon white formica sheet, percent mite mortality and honey yield per colony was determined before and after the treatments in the experimental colonies. The results revealed that formic acid a...
Mazher Abbas1, Irfan Mahmood1*, Arshed Bashir1, Tahir Mehmood2, Khalid Mahmood1 and Zubair Ikram1
...age age, education and experience of the citrus growers were estimated 43.92 years, 9.74 schooling years and 17.72 years respectively. The awareness and adoption of recommended citrus practices was generally good. The results of the logit model for adoption of recommended irrigation practices however postulate positive and significant impact of citrus producing experience and family income...
Dilshad Ahmad*, Muhammad Irfan Chani and Asad Afzal Humayon
.... Forecasting plays an imperative role in adjusting the vision and applicability regarding aspirations. The study attempted to forecast major crops area, production, yield and per capita food availability using Autoregressive Integrated Moving Average (ARIMA) model. Sixty-seven years annual time series data from 1947-48 to 2013-14 was obtained to forecast major crops and per capita food av...
Predicting Honey Production using Data Mining and Artificial Neural Network Algorithms in Apiculture
Koksal Karadas1* and Ibrahim Hakki Kadırhanogullari2
...verage honey yield (AHY) per beehive in the year 2014. For this purpose, predictive performances of several data mining algorithms (CART, CHAID, Exhaustive CHAID and MARS) and artificial neural network algorithm (Multilayer Perceptron, MLP) were evaluated comparatively. Several factors thought as independent variables in the survey were age of beekeeper ...
Hassen Allaya1,2,*, Abderraouf Ben Faleh1, Manel Rebaya1, Sonia Zrelli3, Abdallah Hattour2, Jean-Pierre Quignard4 and Monia Trabelsi1
...e differences among the specimens of the little tunny Euthynnus alletteratus (Rafinesque, 1810) inhabiting Tunisian waters. Our investigation based on the analysis of morphological characteristics of Euthynnus alletteratus from two distant sampling sites (Mahdia and Zarzis) along the Tunisian coast using 11 morphometric and 3 meristic characters in order to investigate the morpholgical variation among them. Uni and Multivariate analysis of varian...
Aftab Wajid1, Ashfaq Ahmad1, Muhammad Awais2, Muhammad Habib-ur-Rahman3*, M. Aown Sammar Raza2, Usman Bashir2, Muhammad Naveed Arshad1, Sana Ullah4, Muhammad Irfan5 and Umair Gull1
...ved more number of bolls per plant (31.00), average weight per boll (3.48 g) and ultimately lead to higher seed cotton yield (2.42 t ha-1) as compared to other N rates (50, 100, 150 kg ha-1). Significant differences were also observed in cultivars, CIM-496 produced higher seed cotton yield than other under arid climate of Multan in Cotton-Wheat Cropping system. Empirical model was develope...
A. Hamid1,*, M. Ilyas2 and S. Kalsoom3
..."text-align: justify;">Hypercholestrolemia leading to cardiovascular diseases are very common problem in Pakistan and in most cases it is caused due to insufficient intake of dietary fiber.A study was conducted to evaluate the role of dietary fiber and ß-glucan from major food grains used locally on plasma cholesterol level of dietary-induced hypercholesterolemic rats. Insoluble dietary fiber (lignin and cellulose) was...
Vladimir Avdalovic1, Marijana Vucinic2, Radmila Resanovic3, Jelena Avdalovic4, Danka Maslic-Strizak5 and Milos Vucicevic3*
...xt-align: justify;">An experiment was conducted to determine whether it is possible to replace the chopped wheat straw with newly formulated pelleted straw taking into account the prevalence and severity of footpad dermatitis (FPD) in broiler chickens. The study included 300 one-day-old Ross 308 broilers. One group of broilers was reared on chopped wheat...
Niamatullah Khan1*, Najeeb Ullah2, Inam Ullah2 and Asif Imran Shah1
...ing 2015 and 2016. The experiment was laid out in split plot design having three repeats. Sowing dates; March 15, April 01, April 15, May 01, May 15 and June 01 were kept in main plots while sub plot contained seven cotton varieties (CIM-600, CIM-616, CIM-622, CRIS-641, DNH-105, DNH-40 and DNH-57). Results indicated that earlier sowing produced extra vegetative growth rather than seed cotton yield while late planting induced...
Muhammad Zafarullah Khan
...nt of Pakistan through supervision and administration of agricultural activities. The current study was carried out to measure the level of competency of AEOs in skills regarding management of supervision and administration that is considered necessary in order to deal with farmers where a wide range of variations exists in their personalities and habits...
Shuangye Wang1, Yunlin Zhao1, Zhenggang Xu1,2,*, Li Li3, Liang Wu1, Choucang Duan1 and Jiao Peng1
...observations. Nineteen types of behaviour were observed which were classified into nine categories: resting, feeding, moving, excreting, parental behaviour, embellishing, rutting, vigilance and social behaviour. This study analyzed the time-allotment and behavioural rhythms for resting, feeding, moving, and excreting categories. The result showed that before 9:00 and after 18:00 hours, the Miluwere almost always resting. Resting behaviour was exhibited and mai...
Saba Irshad1,*, Ayesha Ashfaq1, Ammara Muazzam1 and Abida Yasmeen2
... longa L.) and black pepper (Piper nigrum L.), used in Pakistani cuisine to enrich flavour and to treat infectious wounds. Their crude ethanol and methanol extracts were tested against five important bacterial and fungal strains. Both extracts showed maximum antibacterial activity against B. subtilis, E. coli and S. aureus. All alcoholic extracts were com
Adnan Yousaf1,Jia Wu1, Qaiser Shakeel2, Yasir Iftikhar3, Muhammad Irfan Ullah4, Uzma Tahira5,Mustansar Mubeen1 and Wubei Dong1,*
..."text-align: justify;">Experiments were carried out to screen resistance of chili cultivars against Meloidogyne incognita and Sclerotium rolfsii and their integrated management by using derosol, cadusafos and Trichoderma harzianum in the green house at 25 ± 4ºC. Primarily, 15 chilies cultivars viz., 28-2010, C-72, Sanam, C-73, Gola Peshawari, 27-2010, Tata Puri, C-302, C-33, C-19, 5-2010, C-68, 11-2010, 18-2010 an...
Wesam Hasan Mohamed Mady1*, Bing Liu2, Dong Huang2, Abdel Satar Arafa1, Mohamed Khalifa Hassan1, Mona Mehrez Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2
...ontrol of the virus in imperative. DNA vaccination is a promising new approach for the prevention and treatment of many viral diseases because of its ability to induce both humoral and cellular immune responses against antigens encoded by recombinant DNA. The goal of this study was to construct Egy-H5 plasmid DNA-based vaccine against a currently circulating avian influenza virus H5N1 strain in Egypt targeting the HA gene. The HA gene of AIV Egyptian strain H5...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and Kui Chen2,*
...sciatus is a unique species of China which is distributed in the estuary of the Yangtze River, and belongs to the same genus with Red fin puffer T. rubripes which has been used as one of human genome model animal since mid-1990s. In this experiment, we cloned a pair of DNA fragment sequence including complete ORF (921bp) of taste receptor candidate gene T2R1 of T. fasc...
Murad Ali1, Farmanullah Khan1, Wiqar Ahmad2* and Imran Khan1
...proved yield and soil properties. However, determination of a suitable dose from either source that could beneficially and easily combine to give maximum output still needs lots of research. The experiment was conducted during wheat season 2014-15 on a selected water eroded site in District Swabi. Fourteen treatments viz the control (T1), recommended dose (RD) (120:90:60 kg ha-1 N: P2O5: K2O. T2), four combinations of farmya...
Muhammad Hanif1,*, Naureen Rana1, Muhammad Akbar Khan2, Muhammad Javed1 and Muhammad Sajjad Khan1
... molars. The identified species of hipparionines include Hipparion sp. small, Cormohipparion sp., Sivalhippus cf. nagriensis, and Sivalhippus cf. theobaldi. These specimens provide additional information about the recorded species and contribute to recent work of Perissodactyla from the Middle Siwalik Hills of Pakistan.
...
Ghulam Abbas1,Asif Nadeem1,*, Masroor Ellahi Babar2, Tanveer Hussain2, Muhammad Sajid Tahir3, Wasim Shehzad1, Rajput Zahid Iqbal3, Muhammad Tayyab1 and Maryam Javed1
...t-align: justify;">Many species of mammals have declined within the past two centuries due to human caused disturbances and the unsustainable use of natural resources. Molecular methods have an important role in phylogeny and diversity analysis. In Pakistan hog deer (Axis porcinus) is an important wild species belongs to the family Cervidae. The hog deer is one of the least studied spe<...
Muhammad Ibrahim and Ahmad Khan*
Syed Makhdoom Hussain1,*, Tasneem Hameed1, Muhammad Afzal2, Arshad Javid3, Nosheen Aslam4, Syed Zakir Hussain Shah6, Majid Hussain5, Muhammad Zubair ul Hassan Arsalan1 and Muhammad Mudassar Shahzad1
...robial phytase on growth performance and nutrient digestibilityof Cirrhinus mrigala fingerlings fed sunflower meal based diet. The chromic oxide was added as inert marker in the diets. Three replicate groups of 15 fish (Average weight 5.05±0.013 g fish-1) were fed at the rate of 5% of live wet weigh and feces were collected twice daily. The results of present study showed improved growth performance ...
Rahat Naseer1*, Abu Saeed Hashmi1, Zulfiqar-ul-Hassan2, H. Rehman1, Saima Naveed1, F. Masood1 and M. Tayyab1
...rials were included in experimental ration at a fixed level (20 %). All iso-caloric and iso-nitrogenous rations were offered to experimental animals (n=36, 22 male 14 female Lohi sheep almost evenly distributed in experimental groups) having almost uniform body weight (BW). During 60 days of the trial, no significant difference (p =0.067) in the daily feed intake among the different ex
Ali Karabacak1, Senol Celik2, Adile Tatliyer3, Ismail Keskin1, Yakup Erdal Erturk4, Ecevit Eyduran5, Yasir Javed6 and Mohammad Masood Tariq7,*
...o compare the predictive performance of three data mining algorithms viz., CHAID, Exhaustive CHAID, and CART implemented in the estimation of cold carcass weight (CCW) and body weight (BW) from several body measurements (withers height (WH), chest depth (CD), body length (BL), hearth girth (HG) and leg circumference (LC)) measured from five sheep breeds (Akkaraman (9), Dağlıç (10), Kivircik (10), Merinos (10) and Karacabey Merino (8)) r...
Muhammad Abid1*, Tahir Yaqub2, Arslan Mehboob3 and Muhammad Zubair Shabbir4
...ere isolated from 400 suspected samples and were confirmed through serological and molecular assays. The sequence analysis of NA genes shown 99% homology with the H9N2 AIV recently isolated from Pakistan and their phylogenetic analysis revealed that all the isolates belonged to the G- lineage. Amino acid analysis of NA stalk regions of these isolates illustrated no insertion, deletion and substitutions compared to A/DK/HK/Y280/97 lineage and human isolates (A/...
Attaullah Khan1, Muhammad Shafi1*, Jehan Bakht2 and Shazma Anwar1
... winter 2013-2014. The experiment was conducted in completely randomized design (CRD) with three replications. The response of fourteen wheat varieties at two seed treatments (primed with 50 mM CaCl2 and un-primed) with four salinity levels (0, 45, 90, 135 mM) was studied in sand as growth media. The results revealed that incremental increase of salinity stresses had decreasing effect on growth parameters compared with control. Highest germination (85.42% and ...
Sania Shaheen1*, Hina Fatima2 and Muhammad Azeem Khan3
...icides, insecticides and pesticide variable would significantly contributes to improve the rice production. On average technical efficiency of sample rice farmers is 86 percent, which indicates that rice farmers in selected areas can increase the production of rice 14 percent only by managing efficiency level, without increasing input quantities. Hence, it is possible for rice farmers to i...
Rais Ahmed1,*, Khushi Muhammad1, Masood Rabbani1 and Muhammad Sarwar Khan2
...stify;">Brucella species are cause of abortions and other reproductive disorders in animals and human beings. In this project, prevalence and distribution of soil borne Brucella species in nine districts of Punjab including Lahore, Faisalabad, Sheikhupura, Sargodha, D.G. Khan, Chakwal, Sahiwal, Gujranwala and Attock were determined. By using grid based sampling strategy, soil samples (n= 1280) were collected fr...
Kanwer Shahzad Ahmed1, Muhammad Zeeshan Majeed1,*, Muhammad Ather Rafi2, Fatima Sellami3 and Muhammad Afzal1
...predators of many insect pests of economic importance. Among 6,000 species of coccinellids described worldwide, only 75 species have been reported from Pakistan so far. Keeping in view the limited work on these important beetles, an extensive faunal survey was conducted in the district Sargodha (32°05’02’’ N and 72°40’18’’ E), Pakistan to assess ...
Muhammad Aslam Farooqi1,*, Mansoor-ul-Hasan2, Sohail Akhtar1, Muhammad Arshad2, Muhammad Naveed Aslam3 and Muhammad Rafay4
Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla3
...
...
Wali Khan1, Naushad Khan2 and Shaista Naz2*
...ns of beekeeping with respect to challenges and opportunities in Bajaur Agency of Federally Administered Tribal Areas of Pakistan. For this, through purposive sampling technique a sample size of 80 bee keepers was selected from the three tehsils of the agency (i.e; Khar, Salarzai, and Nawagai). The data were collected from the sampled bee keepers using a pretested questionnaire by face to ...
Fareeda Tasneem1, Farah Rauf Shakoori1 and Abdul Rauf Shakoori2,*
...ns found in the ciliate species. Thus a fragment of histone H4 gene (160bp) was sequenced in ten locally isolated strains of Paramecium species including a standing-alone on the basis of 18SrDNA gene sequence strain FT8. In order to readdress the relationships of FT8 strain with other strains of Paramecium species, a molecular phylogenetic analysis was <...
Netti Aryani1, Azrita2, Ainul Mardiah3 and Hafrijal Syandri2*
...h, and 12% moisture as a percentage of fish body weight, with three replicates per treatment. Fish were fed three times per day at 09:00, 14:00, and 18:00. The experiment was carried out for 120 days. Each month, 30 fish were removed from each of the floating net cages to be measured and weighed. The biomass of fish was calculated, and the amount of feed...
Sumaira Maqsood1,*, Muhammad Afzal1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1,Waqas Wakil2 andMuhammad Hussnain Babar3
...was the key factor for type of interaction, its combination with NPV at lower dose showed synergistic interaction (CTF≥20). While rest of the combination showed additive effect (CTF≤20). Integration of NPV and flubendiamide proved more fatal at higher concentrations than the individual application at lower concentration for pupation and adult emergence of S. litura. Apart from untreated larvae (control) maximum pupation (66.01±1.32 and 73.9...
Talha Nazir1,2,*, Muhammad Dildar Gogi2, Muhammad Zeeshan Majeed1, Waheed ul Hassan2, Abdul Hanan2 and Muhammad Jalal Arif2
...justify;">Sucking insect pest complex, comprising of aphids Aphis gossypii Glover, jassids Amrasca devastans Distant, whiteflies Bemisia tabaci Gennadius, thrips Thrips tabaci Lindeman, red cotton bugs Dysdercus koenigii Walk and dusky cotton bugs Oxycarenus hyalinipennis Costa, has been a challenge on transgenic (Bt) cotton crop all over the world. This study assessed the field effi...
Mehran Kausar1,2, Naveed Ashraf3, Farzana Hayat4, Asraf Hussain Hashmi1, Saima Siddiqi1,* and Mariam Anees2
...ity and stubby hands. We performed direct sequencing of CTSK for five members of the family to find out the causative mutation. All coding exons of CTSK gene were amplified and sequenced in the affected and unaffected individuals of a consanguineous Pakistani family consisting of five members, three affected brothers, one unaffected sister and the unaffected mother. We identified a known missense mutation c.136 C>T in the third exon of CTSK...
Ayşe Gül Harlıoğlu*
... give rise to (AA)/eicosapentaenoic acid (EPA) and DHA/EPA ratios in absorbed yolk-sac larvae.
...
Muhammad Ibrahim1,2*, Syed Jawad Ahmad Shah1, Shaukat Hussain2, Musharaf Ahmad2 and Farhatullah3
...d impact on wheat landscape was carried out along with recent deployment status of cultivars during 2012 in northwest Pakistan located close to the center of diversity of P. striiformis f.sp. tritici. Around 1600 wheat fields were sampled covering a geographical area of little less than 5000 acres in the southern, central and northern zones located in the Khyber Pakhtunkhwa (KPK) Province. Yellow rust occurrence was distributed over an area of 463 acres in all...
Muhammad Arslan Khan1,*, Sajid Aleem Khan1, Imran-ul-haq1 and Rashad Waseem Khan2
...huge losses to cotton. Experiments were conducted to assess the role of fungi and root knot nematodes in root rot disease complex of cotton and to optimize their control. For this purpose fifteen cotton growing areas in Southern Punjab were surveyed in year 2013-14. Data were recorded on disease prevalence, incidence, frequency percent of root rot fungi and nematodes population. Maximum disease prevalence was recorded in Tib...
Raza Ullah1*, Qaisar Shah Safi2, Ghaffar Ali3 and Irfan Ullah3
...tify;">Citrus is a group perishable fruit and require good marketing practices, proper time and methods of harvesting, packaging, storage and processing. There are various middlemen (market intermediaries) involved at different stages in the marketing of citrus. This study is an attempt to examine the marketing margins of the intermediaries involve in the value chain of sweet oranges of citrus group. Three villages in Bunir ...
Usman Waheed1,*, Humayoon Shafique Satti2, Muhammad Arshad3, Ahmed Farooq3, Abdul Rauf4 and Hasan Abbas Zaheer1,5
... selected HRGs. During a period from September 2015 to February 2016, community-based sampling was done from 134 Hijra sex workers (HSW), 101 female sex workers (FSW), 104 jail prisoners and 48 intravenous drug users (IDUs) through community outreach, peer referring and field sampling. Blood samples were tested for syphilis and HIV infections after pre-test counseling and receiving informed written consent. Initial testing w...
Kadir Karakuş1, Bahat Comba2, Abuzer Taş3, Tunahan Sancak3, Arzu Comba2, Devrim Saripinar Aksu4, Hasan Koyun5 and Mohammad Masood Tariq6,*
...al castration group), respectively. Blood sample was taken from vena jugularis of the animals before the application and every two months for a total of 4 times for 6 months and hormone analyses were performed. The order of statistical significance for TSH (thyroid stimulating hormone) were found as Surgical > Control > Formol (P <0.05). The order of statistical significance for growth hormone was Formol = Surgery &...
Ibrahim A. Alhidary1,*, Mutassim M. Abdelrahman1, Riyadh S. Aljumaah1, Abdullah H. Alyemni2, Moez A. Ayadi1,3 and Mohamed Y. Al-Saiady2
... levels of NDF on growth performance, metabolic profile and rumen characteristics in Naemi lambs. Fifty growing Naemi lambs at age of three months with an average bodyweight of 27.77 ±1.09 kg were randomly distributed to five different treatments, ten lambs each, as follow: 1. Alfalfa hay and barley grain (ABG); 2. Pelleted alfalfa hay and barley (PAB); 3. TMR1 (25.67% NDF); 4. TMR2 (30.88% NDF); and 5. TMR3 (55.93% NDF). Lambs were housed in an individ...
Kamran A. Awan1, Jawad Ali2 and Mohammad Akmal3
...n: justify;">Rains are expected to decrease and temperature has to rise for wheat growth in Pakistan. Wheat crop is planted on more than 52% area as rainfed crop in the providence Khyber Pakhtunkhuwa (KP). The study, therefore, aims to plant wheat in season from early to late i.e. November 15 to December 25 with about 10 days intervals. Field experiment was conducted at Agronomy Research F...
Fawad Ali1*, Hidayat Ullah2, Ikhtiar Khan1
...een found well above the permissible limits of World Health Organization (WHO) which may lead to a detrimental effect on soil quality, leading to food contamination. The extractable concentration of metals viz Pb, Cr, Cd and Zn through ammonium bicarbonate diethylenetriaminpenta acetic acid (AB-DTPA) showed significant differences between the two studied localities. Linear regression analysis indicates that concentration of ...
Naila Chand1,*, Shabana Naz2, Hamza Maris1, Rifat Ullhah Khan1, Sarzamin Khan1 and Muhammad Subhan Qureshi1
...upplementation on growth performance and immunity in broilers under natural summer stress. A total of one hundred and twenty day-old broiler chicks were divided into four different treatment groups such as Bet-0, Bet-1.0, Bet-1.5, Bet-2.0 having betaine supplementation at the rate of 0, 1, 1.5 and 2 g/kg feed, respectively. Significantly (P<0.05) higher weekly and total feed intake and weight gain were recorded in group B...
Muhammad Abdullah1,*, Rashid A. khan2, Muhammad Rafay3, Tanveer Hussain3, Tahira Ruby4,Fariha Rehman5, Sangam Khalil3 and Sohail Akhtar6
...red as biological insect pest control agent in our agricultural ecosystem. To analyze this activity present work was planned to collect the preliminary information about habitat requirements and different breeding aspects of Cattle egret (Bubulcus ibis). The fieldwork was performed for two years (2012, 2013) at three different stations in the surrounding area of Faisalabad. Based on...
Hameeda Kalhoro1, Abdul Malik2,Ghulam Abbas2,*, Illahi Bux Kalhoro3, Sajjad Ali Shah4and Haleema Kalhoro3
...reatment (T3, pellet feed). Juveniles were fed with 5% of total biomass twice in a day. At the end, higher growth increments were found such as length and weight in average, T1=15.01±0.33cm and 15.80±0.01g, T3=14.13±0.76cm and 13.35±0.67g whereas in T2=11.80 ± 0.96cm and 10.47±1.19g lower growth were found. Specific growth rate (SGR) were o...
Tanveer Ahmad1, Hafiz Sultan Mahmood1*, Zulfiqar Ali1, Muhammad Azeem Khan2 and Shahid Zia3
...in Pakistan for making ropes, twines, paper, carpets, cloth and handicrafts, which has not been exploited so far. The aim of this study was to design and develop a small-scale portable sisal decorticator for extracting fibre from sisal leaves. A prototype of sisal decorticator was designed and fabricated at Agricultural and Biological Engineering Institu...
Muhammad Tariq Saeed1*, Muhammad Ashfaq Wahid1, Muhammad Farrukh Saleem1, Mumtaz Akhtar Cheema2, Muhammad Shahid1, Abdul-Shakoor1, Abdul-Sattar3
...uring spring 2011. The experiment was composed of two soybean varieties (Faisal Soybean and 95-1) and five priming techniques (control, on-farm priming, hydro priming, hydration inoculation and osmo priming with 0.5% urea solution. Results revealed that hydro priming, on-farm priming and hydration inoculation significantly reduced the time to 50% emergence (E50), mean emergence time (MET) and emergence index (EI) of both soybean varieties. Moreover,...
Shazia Rasheed1,* and Javed Mustaquim2
...us crabs, Potunus pelagicus and p. sanguinolentus, they belong to five species; namely Octolasmis angulata (Aurivillius, 1894), O. cor (Aurivillius, 1894), O. lowei (Darwin, 1851), O. tridens (Aurivillius, 1894) and O. warwickii Gray, 1825. The rate of infestation was found markedly low in P. pelagicus (2.9 %) and P. san...
Omar S.O. Amer1,3,*, Mohamed I. Waly2,4 andSaeed A. Al-Zahrani1
...ustify;">This is a retrospective analysis of reported intestinal parasitic infections for patients visiting Prince Sultan Military Medical City, Riyadh, KSA from 2010 to 2014. Our retrospective study estimated a total 775 case out of 11110 case were infected with one or more intestinal parasites, with prevalence rate 6.98 %. The prevalence of intestinal parasitic infection during the perio...
Lu Liu1, Sher Khan Panhwar2, Tianxiang Gao3, Zhiqiang Han3, Chunhou Li4, Dianrong Sun4 and Na Song1,*
...ify;">Three Liza species exhibiting a dorsal keel have been identified based on morphology: Liza affinis, Liza carinata, and Liza klunzingeri. To confirm the validity of the species by molecular methods, we sequenced a fragment of the cytochrome oxidase subunit I (COI) gene of mitochondrial DNA of Liza affinis and Liza klunzingeri from coastal waters of China and Pakistan, res
Jawad Anwar* and Zafar Iqbal
...bacteria (Xanthomonas campestris and Clavibacter michiganensis). Extracts that resulted in strong activity were fractionated into acetonitrile and ethyl acetate followed by testing against human pathogenic bacterial strains (Eschericia coli, Pseudomonas aeruginosa and Staphylococcus aureus) using 96 well microtitre plate method. The Ethyl acetate fraction showed maximum zone of inhibition (24.25±1.06 mm) against X. campe<...
Muhammad Amin1*, Khalid Mahmood2, Imran Bodlah3, Muhammad Rahim Khan2
... justify;">Twelve aphid species, inclusive of 6 new records to Pakistan’s aphidofauna, were found infesting Rosa species in study conducted during 2015-2016 in Poonch division of Azad Jammu and Kashmir-Pakistan. Chaetosiphon (Pentarichopus) fragaefolii (Cockerell), Chaetosiphon (Pentarichopus) thomasi Hille Ris Lambers, Chaetosiphon (Pentarichopus) tetrarhodum (Walker), Metopolophium montanum Hille Ris Lambers, Myzaphi...
Muhammad Zafarullah Khan*, Shah Saud Ahmad and Asif Nawaz
...like seeds, fertilizers, pesticides, machinery along with advisory services in order to increase per acre yield. This study was conducted in Khyber Pakhtunkhwa province in the year 2016. The study was conducted to assess the effectiveness of Farm Services Centers (FSCs) in district Charsadda regarding provision of agricultural services to its member farmers. About 57% respondents were registered with FSC since last 4-6 years...
Sadia*, Abdur Rab, Sayyed Hamad Ahmad Shah, Irfan Ullah, Farida Bibi and Islam Zeb
...sign was used for this experiment with three replications i.e. factor A was Deblossoming Time (Control, May, June, July, August and September) and factor B was GA3 application (0, 10, 20, 30, 40 and 50 ppm). Results demonstrated that minimum fruit drop (5.95%), fruit density (0.80gcm-3) with maximum number of new shoots (55.7), number of new flowers (225.3), fruit weight (197.5g), and fruit volume (245.5cm3) were recorded in plants deblossomed in September tre...
Mohammad Umar Farooq1*, Sarfaraz Ahmad2, Ghulam Nabi1, Ijaz Ali1 and Imtiaz Ahmad1
...s sites for conducting experiment were selected for grazed and un- grazed range land at Pabbi hills Kharian, District Gujarat, Pakistan. Carbon is played a vital role in the green house gases. Carbon sequestration during the photosynthesis process via plant biomass is the extent of this atmospheric gas. An experiment the data for above and below phytomass for grazed and un- grazed range land was collected and carbon pool was...
Saleem Khan1, Amir Hamza2, Farhadullah Khan3, M. Subhan4, Aziz Khan1, Irfan Ali Shah1, Shakirullah Khan Shakir3*
...eds of four cotton genotypes (Gomal-93, Bt-131, Bt-121 and Bt-CIM-602) were exposed to gamma rays with 10, 15, 20 and 25 Kilo Radium (KR) doses sourced from 60Co. The irradiated seed samples were assumed treated seeds while non-irradiated seeds of each genotype were used as control. Field experiment was conducted in randomized complete block design (RCBD) in three replicates in ...
Sumit K. Satpathi1, Suprakash Pal2*, Rupsanatan Mandal2, Nonigopal Shit2 and Ashutosh Sarkar3
...ign: justify;">A field experiment was conducted at Regional Research Station (Terai Zone), Uttar Banga Krishi Viswavidyalaya, Pundibari, Cooch Behar (India) during the summer season of 2016 to determine the utility and economics of biointensive pest management modules against major insect-pests of cowpea in comparison to conventional
Shantanu Jha1, A. Rama Devi1, Ngalaton Kasar1 and Abhishek Mukherjee2
... interact, share their experience and finally to prioritize areas for future Research. The meeting started at 12:00 noon on 7th of August and continued till 5:00 pm and was attended by 31 participants. The programme was inaugurated by Prof. D. D. Patra, Hon’ble Vice-Chancellor, Bidhan Chandra Krishi Viswavidyalaya (BCKV) and was chaired by Professor C. Sen, President of Association for Advancement in Plant Protection (AAPP). Oher dignitaries a...
Wanchao Zhu1, Qinguo Wei1, Shuyu Xue1, Huanxin Zhang2, Tianshu Lv1 and Honghai Zhang1,*
...zibellina), we developed six microsatellite markers using a method of fast isolation by AFLP of sequences containing repeats (FIASCO) from them in this study. The primers designed by Primer Premier 5.0 based on conservative regions were tested on 22 individuals. Our results demonstrated that the number of alleles per locus ranged from two to five and the mean number of alleles was 3.67...
Gülnur Metin* and İlker Aydin
...the jinga shrimp, Metapenaeus affinis (H. Milne Edwards, 1837), in Izmir Bay (Aegean Sea, Turkey) were investigated. A total of 2894 M. affinis were obtained from commercial fishermen between November 2008 and January 2011. The total length and weight of the females or males were measured as 7.3–17.5 cm and 2.6-38.9 g or 7.8–15.4 cm and 2.6-41.6 g, respectively. The samples were composed of 56.6% fe...
Zuhao Huang*, Meifang Li, Rujue Ruan and Jiawei Qin
...trol region genes of 20 species were analyzed. All the Ardeidae species had duplicate control regions, except four species having only single region. The control region spans the region between the genes for tRNAGlu - tRNAPhe in the most Ardeidae species. The length of the control region sequences ranged from 1427 bp (Ixobrychus ...
Javeria1, Masroor Ellahi Babar1,2,*, Akhtar Ali2, Asif Nadeem1, Abdul Wajid1, Sajjad Ali Shah3, Sadaf Rashid4, Muhammad Wasim1 and Muhammad Abdullah1
...ion the factors like age/period, employment status and marital status were considered after informed consent. We found one single base change G>C at c.745 resulting in a nonsynonymous change p.E249Q in theCOMT gene. In-silico analysis predicted it to be damaging and disease causing. Screening of case and control group data showed no deviation from Hardy-Weinberg equilibrium with p-value 0.879 and 0.32, respectively...
Muhammad Fiaz1, Khadija Munawar2, Muhammad Mushtaq2,*, Mukhtar Ahmad3, Mushtaq Ahmad Chaudhry3, Muhammad Aslam3, Tanveer Ahmad1 and Nasrullah4
...lambs for optimum growth performance and survivability. For this purpose, Salt Range neonatal lambs (n = 24, age = 01 week) were selected and divided equally into three groups having 08 lambs each. The experimental lambs were fed ewe milk, calf milk replacer-1 (Telilac) and calf milk replacer-2 (Creamo) through nipple feeding for optimum performance in lambs after mandatory colostrum feedi...
Mushtaq Ahmad1,*, Mehboob Ahmed1,2 and Nasim Ahmad1
...>The integral genome of sperm is crucial for successful fertilization and embryonic development. Different techniques have been used to determine the integrity of DNA in which acridine orange (AO) assay is easy and less costly. Though used in many species but the variability exists in technique. Therefore, the present study was aimed to optimize the steps of AO staining protocol for buffalo spe
Shabana1,*, Farah Ehsan1 and Shahida Hasnain1,2
...controls=449) were genotyped by PCR-RFLP. A significant difference in genotype distribution was observed between cases (Gly/Gly, 66.9%; Gly/Ser, 20.17%; Ser/Ser, 12.8%) and controls (Gly/Gly, 67.4%; Gly/Ser, 28.5%; Ser/Ser, 4.00%) (p = 0.013). The cases showed significantly higher frequency of the Ser allele compared to the controls (22.9% vs. 18.3%; OR: 1.32, CI: 0.95–1.83, p=0.013). The minor allele (Se...
Syed Tanveer Shah* and Muhammad Sajid
...the post harvest life of peach. The research was laid out in Randomized Complete Block (RCB) Design with three factors replicated three times. Peach fruit trees at berry stage were sprayed with three sources of calcium (calcium chloride, calcium nitrate and calcium sulphate) at three calcium concentrations (0.5, 0.75 and 1.0%) stored for 30 days at 10 days interval. The experimental results showed that calcium sources, conce...
Umair Talib1*, Ijaz Ashraf1, Khalid Mahmood Chaudhary1, Riaz Ahmad2
...lic extension through competition. This study conducted in 2016, sought to analyze whether smallholder rice growers are more satisfied with public or private extension organizations and development of a strategy to enhance the effectiveness of extension work. The specific objectives were to ascertain the satisfaction smallholder rice growers regarding the extension work conducted by public and private extension organiza...
Mian Ahmad Raza*, Ghulam Hassan and Naqib Ullah Khan
...justify;">This study was performed to investigate combining ability effects and gene actions for some important traits using diallel mating design in wheat at Peshawar Pakistan. Eight wheat genotypes viz. Janbaz (JNB), Fakhr-i-Sarhad (FS), Pirsabak 2005 (PS), AUP-5008 (AUP), Saleem 2000 (S2K), Tatara (TTR), Barsat (BST) and Siren (SRN) were crossed in all possible combinations during 2011-12 cropping season. The resultant F1...
Muhammad Hannan Ahmed1, Muhammad Irfan Ullah1,*, Abu Bakar M. Raza1, M. Afzal1, A. Khaliq1, Yasir Iftikhar2 and Hafiz Muhammad Aatif3
...ewing and sucking insect pests attack on different Bt and non-Bt cotton genotypes. Furthermore, metrological factors (especially temperature, relative humidity and rainfall) also play vital role in the population dynamics of sucking insect pest complex like jassid, aphid, thrips and mites. The present study was ...
Furqan Sabir1, Muhammad Tayyab1,*, Bushra Muneer2, Abu Saeed Hashmi1, Ali Raza Awan1, Naeem Rashid3, Muhammad Wasim1 and Sehrish Firyal1
... 2500 µmole/min respectively when sodium phytate was used as substrate. The stability of enzyme at a wide range of temperature and pH makes it a potential candidate to be used in the poultry feed industry.
...
Ambreen Butt1, Uzma Malik2, Khadija Waheed3, Amna Khanum3, Samar Firdous4, Sara Ejaz5 and Fawad Randhawa2, Tania Shakoori6*
...t which sensitivity and specificity were was 56.9% (95%CI 44.1-68.8%) and 80.5 % (95%CI 65.6-89.9%) at P<0.0001. It was concluded that low serum cobalamin levels may be a risk factor and may predict the development of GDM.
...
Fang Wang, Yong-Fang Jia, Po Wang, Qi-Yan Du and Zhong-Jie Chang*
...uous exposure to LET may perturb sex differentiation in carp, the molecular mechanism not only involve inhibition of cytochrome P450 aromatase activity, but also the changes of upstream genes in sex differentiation. So, LET can be used as a reagent to control the sex differentiation of carp, but also can be used to disturb gonad differentiation, and then to reveal the molecular mechanism....
Asad Abdullah1, Muhammad Irfan Ullah1,*, Muhammad Waqar Hassan2, Samina Khalid3, Yasir Iftikhar4, Muhammad Arshad1 and Jaime Molina-Ochoa5,6
...iguttula. The insect pest population was recorded 24 hours before and 24h, 72h and 168h after spray. Maximum reduction of 60.20% of B. tabaci on Bt cotton was recorded at 6% NSE while at 2% concentration of NSE after 148 hrs, 39. 16% reduction was observed. While maximum reduction on non-Bt cotton at 6% recorded as 66.60% and minimum at 2% concentration recorded as 48.72% of neem seed extract against B. tabaci. In case of A. ...
Alaeldein M. Abudabos1,*, Abdullah H. Alyemni2, Elsayeid O. Swilam1 and Mu’ath Q. Al-Ghadi3
.../div>...
Muhammad Usman Qamar1, 2, Sidrah Saleem1, Usman Arshad1, Muhammad Farhan Rasheed3, Hasan Ejaz4, Naveed Shahzad5 and Shah Jahan6,*
... to wide range of broad spectrum antibiotics leaving the treatment options limited. Manuka honey is traditionally used for medical purposes including remedy of bacterial infection. However, scientific evidences for its antimicrobial effects particularly against NDM-1 producing bacteria are lacking. In addition to antibiotic profiling, the present study aimed at determining the in vitro anti- bacterial activity of Manuka honey against NDM-1 producing cli...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Irfan Ullah1,*, Muhammad Arshad1, Mubasshir Sohail1,2 and Jaime Molina-Ochoa3,4
... rigorous and economical pest of Apis mellifera L. worldwide. Many control measures including application of chemicals are adapted to resistor the influx of mites in hives of honey bee. The indiscriminate use of pesticides involve many problems; cause resistance in mites, residual in honey, wax and potentially hazardous to man and environment. Plant-derived mixtures are normally more easily degradable and could show a...
Carolina Torres Alejo1,2, Laila Andreia Rodrigues Beserra1,2, Paulo Eduardo Brandão1,2, Luis Ramiro Luna Espinoza1,2 and Fabio Gregori1,2*
...teric diseases in avian species, causing decreased growth performance and mortality. In this study, 59 pools of intestinal content of layers, broilers, and breeders were investigated from different Brazilian regions for the presence of rotavirus (RVA, RVD, and RVF), avian coronavirus (ACoV), and avian astrovirus (AAstV), using PCR reactions followed by nucleotide sequencing and analysis. Twenty-nine pools (29/59; 49%) ap
Mohsan Ullah Goraya1,2, Liaqat Ali1,2 and Iqra Younis3
...us, coronaviruses and herpes viruses are important pathogens that cause significant losses in the poultry industry. However, successful establishment of infection in the respiratory tract switch on the pathogen recognition by innate immune receptors and establish first line of defense against viral infections. When specific cellular receptors recognize a virus they trigger the translation of inflammatory cytokine and chemoki...
Muhammad Sohail1, Muhammad Nauman-ul-Islam1, Hayazuddin2*, Imtiaz Ali Shah1, Abdur Raziq1, Subhan Ullah3 and Arsalan Ali Shah1
...uctive status (n= 08). Experimental animals were allocated to diet containing zero (control), 12 and 18 percent MSC. All the three rations were iso-caloric and iso-nitrogeniuos. Each cow was given a daily feed ration according to NARC standards. Milk yield of each experimental animals were recorded twice daily while its composition were checked through milk analyzer twice a week. Mean dail...
Shahid Hussain Farooqi1,*, Muhammad Ijaz1, Muhammad Hassan Saleem1, Muhammad Imran Rashid2, Muhammad Oneeb2, Amjad Khan3, Amjad Islam Aqib1 and Shakeel Mahmood4
...ious Ixodid tick species and risk factors associated with tick infestation and burden levels were studied in bovine from three distinct temporal zones of Khyber Pakhtunkhwa province of Pakistan. Twelve hundreds ticks were collected from four hundreds animals comprising of two hundred and fifty cattle and one hundred and fifty buffaloes. Descriptive statistics with Pearson’s Chi-square test and regression model were applied to analyze the data. The...
Rana Muhammad Aadil1,2*, Xin-An Zeng1, Saqib Jabbar3, Akmal Nazir2, Abid Aslam Mann2, Muhammad Kashif Iqbal Khan2, Abdullah2, Amna Ramzan2
...quality parameters of grapefruit juice were investigated based on pH, acidity, ºBrix, viscosity, cloud value, hunter color values, bioactive compounds, microorganisms and enzyme analysis. The grapefruit juice was treated with processing variables of HPP treatment (0, 150, 200 and 250 MPa), temperature (40, 50 and 60 oC), for processing time of 3 minutes and thermal treatmen...
Aqsa Qayyum1*, Masooma Munir1, Saeeda Raza1, Mussarat Gillani1, Saima Kanwal1, Nouman Rashid1, Amer Mumtaz1, Naeem Safdar1, Zarmina Gillani2
...ituting wheat flour with pea flour at different levels and to check its suitability in biscuits through its rheological and qualitative study. Results indicated rheological parameters including water absorption, dough development time, dough stability, gluten content and falling no. values differed significantly (p < 0.01) among all the treatments of composite flour. Wet and dry gluten content decreased from 22.16 ± 1.58 % (T0) to 16.43 &p...
Asim Gulzar1,*, Ather Maqsood1, Munir Ahmed1, Muhammad Tariq1, Muhammad Ali2 and Rahmatullah Qureshi3
...rtant polyphagous insect pest with wide host range known for its economic losses worldwide. Its ability to develop resistance to insecticides faster to identify alternates like biocontrol agents, plant extracts etc. In the present study the extract of Citrullus colocynthis in different solvents were evaluated on second instar larvae of H. armigera under laboratory studies for toxicity, sublethal and antifeedant effect. The result showed th...
Jie Wu1, Jiagui Zhu2, Ke Wang2, Dejing Cai2, Yingying Liu1, Yanzhen Bu1,* and Hongxing Niu1,*
... reintroduction of this species, the process of pairing, nest site selection, egg laying, incubation and brooding of the crested ibis in the wild was studied in Dongzhai National Nature Reserve, Luoshan County, Henan Province, China. From October 2013 to May 2015, a total of 78 captive-bred individuals have been released into the reserve and monitored through radio transmitters or satellite transmitters. Twelve nests of 10 pairs were recorded over three breedi...
Nargis Bano and Khalid Mahmood Qureshi*
...ound to protect several species of plants against environmental stresses by initiating different processes that are involved in the mechanism of stress tolerance. SA is part of an extremely complex signal transduction network’s part and it works differently in different systems. Drought stress is a major restraint for crop production in arid and semi arid states such as Pakistan. In this study experiments were conducte...
Rabia Tahir1*, Khushi Muhammad1, Masood Rabbani1, Muti-u-Rehman Khan2, Farah Khan1, Hassan Bin Aslam1 and Arslan Mehboob3
...f avian adenovirus serotype 4 (AAV-4) causing hydropericardium syndrome (HPS) by transovarian route. For this purpose, liver and spleen samples (n=90) were collected from day-old-chicks derived from breeders at 14, 21 and 30 days of post-infection with AAV-4. The presence of AAV-4 DNA was detected through PCR. Chicks from virus-challenged breeders failed to show a clear and expected PCR po...
Lucas Pedroso Colvero1, Paulo Eduardo Brandão2*, Cesar Alejandro Rodriguez Rosales2, Hanny Swam3 and Laura Yaneth Buitrago Villarreal1
...e of physico-chemical properties of the emulsions are overlooked when compared to antigenic properties. This study was designed to assess the effect of two different commercial inactivated water-in-oil multivalent vaccines; vaccine A contains IBV (Massachusetts M41 and D274 strains), NDV (Clone 30), aMPV (BUT 8544) and IBDV (classic strain) whereas vaccine B contains IBV (Massachusetts M41 and a Brazil ty
Aqsa Mehboob1, Noor Khan1,*, Usman Atiq1, Khalid Javed Iqbal2, Rafia Tayyab1, Syeda Suhaira Batool1, Hafiza Saleha Batool1, Sana Amjad1 and Mehwish Tanveer1
... body composition of striped catfish Pangasius hypophthalmus. The experiment was conducted in fiberglass tank having capacity of 18 L water with a stocking density of 25 fish fry per aquaria. There were two treatment groups; T1, T2 and a control (T0) each was replicated twice. Fenugreek as an additive was added in expe...
Nasira Kazi1, Muhammad Israr2 and Shahina Fayyaz1,*
...trated.
...
Zakirullah Jan1, Shamsher Ali1*, Tariq Sultan2, Wasiullah1 and Wiqar Ahmad1
...align: justify;">A pot experiment in pots was conducted with the aim to assess the role of different strains of cyanobacteria in improvement of some major plant nutrients and soil organic matter content (SOM) under saline soil and yield of rice crop at National Agricultural Research Center (NARC) Islamabad during summer 2016. Pots were induced with salinity of 7.0 dS m-1 and arranged in Completely Randomized Design (CRD) with three replications. Six treatments...
Zahid Mehmood*, Alam Zeb and Muhammad Ayub
...and stored at ambient temperature (22-320C). The jam was studied for physicochemical attributes (TSS, pH, titratable acidity, total phenolic compounds, antioxidant activity, ascorbic acid) and organoleptic characteristics (flavor, color, texture and overall acceptability). The results revealed decrease (P<0.05) in pH, ascorbic acid, total phenolic content, antioxidant activity while increase in acidity, total soluble solids during six months storage. Decrea...
Abdus Subhan1, Qudrat Ullah Khan1, Muhammad Mansoor2 and M. Jamil Khan1
...ve crop yield. A field experiment was conducted at Arid Zone Research Centre (AZRC), D. I. Khan during year 2014 –15 and 2015–16 to investigate the water use efficiency and response of winter wheat (Triticum aestivum L.) crop to organic and inorganic fertilizers on a heavy textured soil. The treatments used in the experiment include compost @5 t ha-1, cattle manure @ 5 t ha-1, compost + cattle manure each @ 2.5 t...
Hassan Hashim Ghalib, Syed Attaullah Shah*, Abbas Ullan Jan and Ghaffar Ali
...investigate impact of temperature and rainfall on wheat growers’ net-return in Khyber Pakhtunkhwa (KP) province of Pakistan. Data for this purpose are collected from 255 wheat growers, selected from Southern, Central and Northern climatic zones of KP. Results from descriptive statistical analysis demonstrate that net-return per acre from wheat crop is highest in the Central zone because of conducive agro-climatic condi...
Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali*
...ical age, co-cultivation period, addition of L-cysteine in co-cultivation medium, heat shock to immature embryos prior to infection, resting stage and Agrobacterium strains that deliver T-DNA into plant cell from which whole plant can be regenerated. The results indicated that optimal embryo physiological age is 15 and 18 days after pollination and transient transformation efficiency decreased at 22 days after pollination. Enhanced transient beta glucuronidase...
Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali*
...ze inbred line was developed. Regeneration from coleoptilar node circumvented tedious procedures of raising the immature embryos as a starting material for genetic transformation. Unlike immature embryos, the development of coleoptilar node is seasonal free and green house independent which would accelerate the work relevant to genetic transformation of maize. MS medium fortified with 3 mgL-1 BAP and 5 mgL-1 picloram produce...
Ghani Akbar1, Steven Raine2, Allen David McHugh3, Greg Hamilton4 and Qurban Hussain5
..., 90% for NB and WB, respectively. Majority (67%) of WB irrigations monitored were under irrigated while large number (50%) of NB irrigation were over irrigated. Simulation modelling showed that achievement of above 90% Potential Application Efficiency (PAE) is possible by improving operation (inflow rate and time to irrigation cut-off) and field design (field length and width/number of furrows pe
Asmatullah Kaka2, Wahid Haron1,*, Rosnina Yusoff 1, Nurhusien Yimer1, A.M Khumran1, Akeel Ahmed Memon2, Kazhal Sarsaifi1 andMahdi Ebrahimi3
...awing and evaluation was performed for sperm motility, viability, membrane integrity, morphology, malondialdehyde (MDA), fatty acid composition and super oxide dismutase (SOD). Sperm characteristics such as sperm motility, viability, morphology, membrane integrity, and acrosome integrity were decreased in treated group...
Kashif Prince1,*, Muhammad Sarwar Khan1, Muhammad Ijaz1, Aftab Ahmad Anjum2, Atif Prince3, Naimat Ullah Khan1 and Mumtaz Ali Khan1
...with and without VES: respectively. At day 0 of experimental trial VES was given to animals in group C, E and G. All groups were given oil based HS vaccine at day 15 and alum based FMD trivalent vaccine at day 30 of experimental trial except Group A. Blood samples from adult cattle were collected at day 0, 15 and 30 after parturition and in cattle calves at age of 0, 14, 28 and 42. Colostr...
Habibun Nabi1, Saher Islam2, Amna Arshad Bajwa2, Imran Rashid1,*, Haroon Akbar1, Wasim Shehzad2, Kamran Ashraf1, Nisar Ahmad1 and Aneela Durrani3
...T. gondii PCR was performed. Five sets of primers were designed using PrimerSelect tool for PCR to amplify SAG2 gene 5’ and 3’ regions. Sequences of 5 fragments of SAG2 were annotated and analyzed using DNASTAR Lasergene. After phylogenetic analysis with 3 clonal types and atypical strains, and on the basis of restriction map of HhaI and Sau3AI, our 3 isolates of T. gondii were found more closely li...
Rabia Arif*, Shahar Bano, Muhammad Ishfaq and Muhammad Saleem
...div>...
Zia-ur-Rehaman1, Naila Chand1, Sarzamin Khan1 and Rifat Ullah Khan2,*
...(TN) and high ambient temperature (HAT) on immune response and oxidative status of four broiler strains. Day old broiler chicks (n=242) of four different commercial strains (Ross, Hubbard, Cobb and Arber Acer) were placed in brooding room in first two weeks and then chicks were divided into two groups: TN and HAT zones. Chicks in TN group were housed at constant room temperature, while chicks in HAT zone were kept at hi...
Zabih Ullah*, H. Rahman and Niaz Muhammad
... it allows plants to escape various biotic and abiotic stresses. It also makes multiple cropping possible as the land becomes available for next crop. Keeping the importance of early maturity of maize crop in view, the present study was conducted to evaluate different maize hybrids for maturity and related traits in the geographical location of Khyber Pakhtunkhwa. The experiment was conducted at The University of Agriculture...
Rehmat Ullah1*, Kalim Ullah2, Inam Ullah3, Muhammad Zafarullah Khan1 and Asif Nawaz1
...investigate the role and performance of field assistants in Agricultural Extension, the present study was commenced in district Dera Ismail Khan, Khyber Pakhtunkhwa during year 2014. Eight villages were selected randomly. Among all the farmers, 120 farmers were evaluated through valid, reliable and pre-tested interview schedule. Data collected was analyzed through Statistical Package for Social Sciences ver. 20. Descriptive and inferential statistics were used...
Shakeel Ahmad Anjum, Muhammad Farrukh Saleem, Muhammad Shahid, Abdul Shakoor*, Muhammad Safeer, Imran Khan, Ayesha Farooq, Iftkhar Ali and Usman Nazir
...and Boron dearth is an imperative soil constraint in Pakistan. Zinc (Zn) and boron (B) deficiency in soil is primary hindrance to achieve yield potential of maize. An experiment was conducted with the objectives to optimize methods of B and Zn application in maize and ultimately enhance profitability. The experiment was laid out in randomized complete block design with factorial arrangemen...
Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3*
...GF drugs have been developed over the last two decades and some are still at different development stages of pre-clinical and clinical trials. In this study, we explored the anti-angiogenic properties of three anti-VEGF molecules such as two fusion proteins, VEGF TrapR1R2 and VEGFR1(D1-D3)-Fc, and one DNA aptamer, RNV66, in an in vivo model of human A549 lung cancer. VEGF TrapR1R2 is a commercial anti-angiogenic fusion prote...
Mahmood-Ul-Hassan*, Naeem Fiaz, Muhammad Akhlaq Mudassir and Muhammad Yasin
...s essential since low temperature severely effects the sprouting of subsequent ratoon in cane growing areas. A field study was conducted on loamy soil during 2011-2013 at Sugarcane Research Institute (SRI), Faisalabad to explore the ratooning ability of five sugarcane varieties/clones under varying harvesting dates of plant crop using randomized complete block design (RCBD) with split plot arrangements. The cane genotypes
Naheed Bano* and Muhammad Afzal
...tion is less than other species due to its slow growth and high mortality due to unavailability of suitable diet especially at juveniles stage. This study focus on the healthy production with low cost by using sunflower meal to some extent replace fish meal. In this 3× 3 factorial and completely randomized design study 324 fish were used. The acidification levels were (0, 1.5 and 3%) whereas the phytase levels were (0,...
Akerele Dare*, Ashaolu Olumuyiwa Fowowe, Sanusi Rahman Akintayo and Egbetade Adedolapo
... output growth in the respective subsectors. Likewise, the amount of the fund allocated to fishery subsector on fish output has positive influence on fish output but significant only at 10% level. While increases in the amount of the fund in a given year may substantially raise crop and fish production in that same year, it may take up to 2 years to experience a significant output expansion in livestock. Although results sug...
Trinh Thi Viet Ha1, Pham Duy Liem2 and Li Shuang1*
...e the rice export interdependency between these two countries using empirical approaches. The findings of the study show that the pattern of rice trade between China and Vietnam is fluctuated. The trade volume between China and Vietnam is smaller, and the fluctuation of trade is larger, and there is a large space for the development of rice trade between the two countries. Through further comparison of the comparative advantages of Chinese and Vietnamese rice ...
Abbas Ullah Jan1, Muhammad Fayaz1*, Yousaf Hayat2, Dawood Jan3 and Ghaffar Ali3
...g household income and expenditure data of Pakistan Social and Living Standard Measurement (PSLM) survey 2005. The log-log-inverse econometric model, representing nonlinear Engel curve relationship proved to be a valid estimation technique for fruit consumption in Pakistan. The results show that quantity elasticity with respect to income is constant for dates, grapes, guava and mango and t...
Mehmet Guvenc1,*, Ayşe Nilay Guvenc3, Ökkeş Yılmaz2 and Mehmet Tuzcu2
...ministered 30 mg/kg intraperitoneally. Fructose (10% w/v) was administered with drinking water for 56 days every alternate day. Fructose administration increased the hepatic omega-6/omega-3 and 16:1 n7 / 16:0 ratios (p<0.001, p<0.001), but decreased the retinol and alfa tocoferol levels (p<0.01) compared with control group. Resveratrol administration to fructose treated rats decreased the retinol and cholesterol levels (p<0.01, p<0.05), and incr...
Nosheen Rafiq1, Asmatullah Kakar2,*, Arshad Ghani3, Asim Iqbal2, Wali Mohammad Achakzai2, Shagufta Sadozai2, Mohammad Shafiq4 and Mohammad Alam Mengal5
...termining the hard tick species and their abundance with respect to host-related risk factors in Bos permiginu s cattlewas conducted in farm houses at three main regions (Western by-pass, Spiny village, and Sariab region) of District Quetta from March, 2013 to March, 2014. Around 1649 ticks were captured from six main body parts of 404 cattle. Of these 346 (65.96%) wer...
Attaullah Ansari* and Nasreen Memon
...to December 2015. Adult specimens were captured/trapped through Malaise trap, Yellow pan water trap and insect hand net. As a result, a total of 783 specimens belonging to 8 species, 6 genera of two subfamilies were collected, among which Episurphusbaltatus, De Geer, Eritalinus aeneus, Scopoli, and Ischiodon scutellaris, Fabricius were found to be m...
Shengyan Su, Zaijie Dong*, Wenbin Zhu, Lanmei Wang and Jianjun Fu
...larity with high growth speed in the later period for common carp Cyprinus carpio L cross-breeding. A compensatory index matrix for 3×3 full diallel cross combinations used for selection was built to investigate compensatory like growth of each combination. Yes/No(Y/N) effect was determined for specific co...
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
...tect Mycoplasma gallispeticum, Mycoplasma synoviae and nonpathogenic mycoplasmas at the same in a single PCR reaction collected from diseased chicken. Direct PCR from the clinical samples produced false negative results. Both culture and PCR were combined as culture-enhanced PCR approach. Three different DNA crude preparation methods were used and broth dilution method found simpler and most efficient for positive PCR. Primers were selected for 1...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...bach) is a cosmopolitan species who can cause direct damage to the plants by extracting the sap, and indirectly it is a vector to 16 plant viruses. The study presents data referring to the external morphological characteristics, to the biometrical measurements and to the life cycle of Aphis nasturtii. The researches have been carried out for a period of four years on the potato and for a pe
Saba Manzoor1,*, Ali Raza Awan1, Abdul Wajid1, Sehrish Firyal1, Muhammad Tayyab1, Muhammad Mansha2, Asim Khalid Mahmood3, Abu Saeed Hashmi1 and Muhammad Wasim1,*
...dy in different cancer types of animal origin has its pivotal role in diagnosis, prognosis and comparative studies. c-Myc gene was selected to study the mutation and expression profiling of different canine and feline tumors due to its predetermined role in tumor pathogenesis. A total of 52 tumor and normal samples were examined, among these, 40 canine and 12 feline samples were analyzed using Sanger sequencing method and RT-qPCR for the mutation and ex...
Rehana Shahida1, Tasnim Farasat1, Shagufta Naz1,* and Shahjahan2
...of atherosclerosis and hyperglycemia within the context of chosen pro atherogenic parameters including plasma glucose level, serum levels of insulin, IL-6, and TNF-α. Serum level of thrombomodulin was assessed as a measure of vascular damage. Different demographic parameters as age, BMI, waist /hip ratio, B.P., personal history and socioeconomic status were recorded. Fasting glucose and HbA1c was done by chemistry anal...
Talat Bilal Yasoob and Nasir Ali Tauqir*
...aHCO3) on the performance of broilers. Experiment was conducted in two phases. In first phase (0-4 weeks), six broiler starter rations were formulated; a ration without NaHCO3 was served as control whereas other five rations had 0.15-0.73% NaHCO3 in the rations. In this way six dietary treatments resulted in dietary electrolyte balance (DEB) and sodium levels of 245, 262, 279, 297, 314, 331 m...
Amjad Ali1*, Sher Aslam Khan2, Abid Farid2, Ayub khan2, Shah Masaud Khan2 and Naushad Ali2
...Fourteen sugarcane genotypes and two check cultivars were evaluated in randomizedcomplete block design with three replications at Sugar Crops Research Institute Mardan during 2012-13 and 2013-14. The studies were conducted in two plant crops to calculate broad sense heritability (repeatability), genetic gain and correlations among the parameters, and establish selection criteria.Highly significant (p ≤ 0.01) differences w...
Estimation of Heritability, Genetic Advance and Correlation for Marphological Traits in Spring Wheat
Arshad Iqbal1*, Iftikhar Hussain Khalil1, Syed Mehar Ali Shah1 and Muhammad Sharif Kakar2
...eeders could predict the performance of crop plants by knowing the magnitude of heritability. An experiment was conducted using a set of spring wheat genotypes to estimate heritability for various plant traits during crop season 2014-15 at the University of Agriculture, Peshawar. The randomized complete block design with three replications was used in the expe
Sikandar Hayat, Khalid Usman* and Muhammad Tahir Amin
...at growing season. The experimental design was randomized complete block with split plot arrangement replicated thrice. Four row-spacing i.e., 10, 20, 30, and 40cm were assigned to main-plots while N fertilizer application methods (broadcast and placement) were kept in subplots. Results revealed that row spacing of 30 cm had higher yield and yield components besides higher benefit cost ratio (3.50). Nitrogen placement method proved to be su
Jiandong Wu, Miao Ye and Zaigui Wang*
...orn silk, and the anti-hyperlipidemic activities was analyzed in rabbits by feeding experiment. Firstly, the high extraction yield (5.32 mg·g-1) of total flavonoids were obtained under the optimal extraction conditions, which are 80°C for 3 h with corn silk over 60% ethanol ratio of 1:30. Then, the AB-8 resin was selected for the purification of flavonoids due to the higher static adsorption and adsorpt...
Xue-yang Wang1, Shang-zhi Zhang1, Ming-hui Liu2, Dong Yu1, Yan Ma1, Dong-qiong Fei1, Hai-zhong Yu1 and Jia-ping Xu1,*
...v>...
Ayesha Aihetasham1,*, Muhammad Saeed Akhtar1, Maryam Umer1, Khalid Zamir Rasib2 and Muhammad Imran Din3
... by chromatography-mass spectrometry (GC-MS) revealed five different compounds in F. vulgare: Piperidine, 3-isopropyl, Bicyclo[2.2.1]heptan-2-one, 1,3,3-trimethyl, Benzaldehyde, 4-methoxy, Estragole, 11-Octadecenoic acid, methyl ester and 9-Octadecenoic acid ethyl ester. Whereas nine different compounds were identified in extracts of O. basilicum. These were: 1-Isopropyl-2, 2-dimethylpropylideneamine, Camphor, ...
Nehafta Bibi1, Muhammad Shafiq2, Munawar Saleem Ahmad3 and Haitao Wang1,4,*
...xt on foraging. In our experiments, a subject (observer) was presented with three novel and familiar food in each of three contexts: asocial, first social context (conspecifics without food) and second social context (conspecifics with food). The results showed that individuals preferred to consume novel food only in social context comparing to asocial. Furthermore, individuals consumed si...
Müge Aliye Hekimoğlu*, Cüneyt Süzer,Şahin Saka andKürşat Firat
...n of some aquarium fish species. The induction and recovery times were determined at five stages of melanistic and not melanistic clownfish (Amphiprion ocellaris) and different sexes of Swordfish (Xiphophorus helleri). Clownfish were tested with 0.4, 0.6 and 0.8 ml/l phenoxyethanol and 0.5, 1 and 1.5 ml/l clove oil. Swordfish were tested with 1, 3 and 5 ml/l phenoxyethanol and 2, 4, 6 ml/l clove oil. For short-term application the safe dose for c...
Mahreen Yahya, Noor Abid Saeed*, Sajid Nadeem, Muhammad Hamed and Sajid Shokat
...lerant varieties against pests is the main way to overcome these field losses. Present study is an effort to screen different wheat varieties/lines against aphids under field conditions. Wheat varieties, Galaxy-13, Millat-11, Lasani-08, Faisalabad-08, and two wheat lines NW-1-8183-8 and NW-3-3341-7 were sown at Nuclear Institute for Agriculture and Biology (NIAB), Faisalabad during the crop season 2015-2016. The aphid infestation started in mid-January on all ...
Mubashir Hussain1,Safdar Ali1, Muhammad Naveed Tahir1, Ghulam Abbas Shah1, Ijaz Ahmad2*, Muhammad Aqeel Sarwar3 and Sohail Latif4
...n the soil profile. An experiment was conducted at University Research Farm, Chakwal Road, Rawalpindi to compare the techniques for determination of soil weed seed bank during winter 2012-2013 under rainfed conditions of Pothowar. Soil samples for the weed seed bank analysis were taken from the experimental field before wheat sowing from 0-10 cm, 11-20 cm and 21-30 cm soil depth. Two soil weed seed bank determination techniq...
Inayatullah Jan*, Sajid Khan, Noor Paio Khan and Muhammad Ashfaq
.... After procuring and properly utilizing credit, the yield of the major crops such as wheat, maize, and sugarcane and the resultant income of the respondents exhibited significant increase, as confirmed by higher t-values. The study concludes that the socio-economic conditions of the farmers can be improved if credit programme is extended which could benefit all farmers in the area. ...
Tahira*, Muhammad Arshad, Muhammad Ayub Khan and Mubashar Ahmad Khan
...ree of variation among rapeseed hybrids and the best selection criteria for yield enhancement in rapeseed (Brassica napus).For this thirty-six rapeseed hybrids were sown in a RCBD with four repeats at NARC, Islamabad during the cropping season 2014 and 2015. Cluster analysis based on WARD’s method showed considerable genetic variation among ...
Muhammad Qaisar Nawaz
...tor in Pakistan. In this perspective a field study was conducted for three consecutive years (2013 to 2015) at Soil Salinity Research Institute, PindiBhattian, Hafizabad, Pakistan to evaluate different nitrogen levels and the cost-effective sowing technique for oat forage production under salt affected conditions. Two sowing methods i.e. broad cast and drill sowing with 30 cm apart rows and four nitrogen levels (75,100,125 a...
Muhammad Imran Mahmood* and Muhammad Zubair
...ronment.
...
Zeenat Bano1,*, Sajid Abdullah1, Waqas Ahmad2, Muhammad Anjum Zia3 and Wardah Hassan1
...nt enzymes i.e. superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in vital organs (gills, liver and kidney) of fish, Cirrhina mrigala. The 3 different representative water samples and 60 fish samples (20 fish from each site) were collected from three sites i.e. fish-farm, hatchery and Indus River of Punjab, Pakistan. The results showed differences in physico-chemical parameters of water sam...
Carolina A. Bonin1,2, Eric A. Lewallen2,3, Andre J. van Wijnen3, Marta Jussara Cremer4 and Paulo C. Simões-Lopes5*
...ions of coastal dolphin species indicate that marine mammal populations are susceptible to rapid decline. Yet, effective conservation efforts depend on population-level ecological data. To obtain principal baseline data that will inform management efforts, we characterized the habitat and recorded the behaviour of a Guiana dolphin (Sotalia guianensis) population within one of the most well-preserved estuaries off sout...
Liushuai Hua1,3, Shiping Gong1,*, Xiangjing Zhong2, Jun Tao2, Yu Chen2 and Jieming Deng2
....01) when the ambient temperature is not cold enough for normal hibernation. These findings can provide technical guidance for safe overwintering of big-headed turtles in captivity, and will help facilitate conservation of this endangered freshwater turtle species.
...
Zhenyu Chang1, Hui Zhang1, Khalid Mehmood1,2, Mujeeb Ur Rehman1, Xiaodan Yuan1, Zhaoyang Li1, Fazul Nabi1, Xiaoxing Wu1, Xinxin Tian1, Xueting Liu1, Jingen Xu3 and Donghai Zhou1,*
...lture and subculture was performed from the intestinal epithelial cells of piglets. Then the effects of intestinal trefoil factor (TFF3) in intestinal disease was explored. Porcine intestinal epithelial cells were treated with lipopolysaccharide (LPS) and recombinant human (rh) TFF3. Cell proliferation and TFF3 mRNA expression were examined by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assays and real-time quantitative PCR, res
Boran Karataş, Muhammed Arabaci and Şükrü Önalan*
...is to analyze the growth performance of rainbow trout (Oncorhynchus mykiss) (G) and brown trout (Salmo trutta ssp) (K) monoculture and polyculture in 75-25%, 66-34% and 50-50% stocking rates and its effects on food utilization and to determine the results with respect to aquaculture. Stocking was conducted in 5 different ratios in the study and each different stocking ratio was considered as a group and 24 fish...
Minmin Chen1, Xiaoke Zhang1, Kexiong Wang2, Zhigang Liu1, An Wan3, Daoping Yu1,*, Hong Ji3 and Fangzhen Peng1
...a critically endangered species, as the whole population in the wild suffered sharp decline and fragmentation. Observations of the local spatial and temporal distribution dynamics can help establish better conservation strategies. In order to understand the characteristics of habitat chosen, a continuous 15 months observation on the distribution patterns of the Yangtze finless porpoise at the confluence of Yangtze and Wanhe rivers was conducted. The results sh...
Ehab Bo Trabi1,2, Xianjun Yuan1, Junfeng Li1, Zhihao Dong1, Assar Ali Shah2 and Tao Shao1,2,*
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
... CdGSTP1-1 is grouped with the enzyme from S. scrofa. The 3D homology model of CdGSTP1-1 showed similar fold and topology with the porcine GSTpi enzyme. Gene expression analysis in five camel tissues was examined employing real-time PCR. The highest level of transcripts was found in the camel testis, followed by liver, spleen, kidney and lung. CdGSTP1-1 was heterologously expressed in Eschericia coli BL21(DE3) as a ~24 kDa so...
Tahira Perveen1,*, Shaista Emad1, Saara Ahmad2, Zehra Batool1, Sarwat Yousuf1, Sheeza Sheikh1, Sara Qadeer1 and Saida Haider1
...ses and also it has therapeutic purposes. In the present study antidepressant effects of fennel oil was monitored by comparing it with a synthetic antidepressant drug, fluoxetine. The rats were divided into three groups as control, drug and oil which were respectively treated with water, fluoxetine (0.3 mg/kg) and fennel oil (0.5 ml/day). The treatment was continued for three weeks. Struggling time in forced swim test (FST),...
Jianping Li1, Qian Jiang2, Wei Chen2, Yumei Li3, Huaizhi Jiang4, Jinlong Huo5 and Qiaoling Zhang2*
..., comparison with other species revealed three dramatic amino acid mutation areas. Our results also indicated that c-kit expression was higher in the white cashmere goat than in the black goat, and this significant difference was detected by q-PCR and western blotting. All cashmere goats of different colors examined by immunohistochemical analysis showed either weak (the black cashmere goat) or strong (the white cashmere goat) expression of the KIT prot...
Zahid Latif1,*, Kathrin Blasius2-4, Tufail Hussain Tahir7, Muhammad Nasim Khan1, Ghazanfar Ali5, Ansar Ahmed Abbasi6, Abdul Rauf1, Hao Hu8 and Angela M. Kaindl2,3,4
...uffering with RP first experience nyctalopia which gradually progress to tunnel vision and ultimately masks with complete blindness. Autosomal recessive mode of inheritance which contributes 20-25% of total known cases of RP, is almost the result of inbreed union or cousin marriages. In this study, a large consanguineous family with 11 affected individuals was recruited from Azad Jammu and Kashmir which was analyzed through linkage mapping and confirmed by San...
Mumtaz Akhtar1, Shabana Naz2,*, Muhamamad Iqbal3, Waqar Azeem4 and Mirza Azhar Beg5
...v>Two hundred and eight specimens of Indian gerbille were captured from the fields and farmhouses of the croplands of the Central Punjab. The collected animals were segregated into five age classes, i.e. I (immature), II (sub-adults), III (adults), IV (middle aged), V (old), on the basis of tooth wear, mandibular length, and condition of reproductive organs. In the winter samples, most of the animals belonged to the middle body weight classes, while in ...
Karim El-Sabrout* and Mohamed H. Khalil
...mi eggs on hatchability (period length, dead embryos and percentage) and hatch chick performance (weight, vitality). The experiment was carried out in two groups with total number of 1800 eggs (900 eggs for each group). Eggs were incubated 12 h of light (natural) then 12 h of complete darkness (G1); and 12 h of light (natural) then 12 h of LED lighting (...
Muhammad Khaled Siddiq1, Ayesha Riaz2, Muhammad Akbar Khan1, Muhammad Adeeb Babar1, Khalid Mahmood1,* and Muhammad Akhtar1
... Group. The Pleistocene species, Boselaphus cf. namadicus, was adapted to open and dry habitats of the Siwaliks.
...
Saba Khalid*, Muhammad Saddique Awan, Riaz Aziz Minhas, Nasra Ashraf, Khawaja Basharat Ahmed, Nuzhat Shafi and Sajid Abassi
...tes. Seventy eight bird species were recorded that belonged to 34 families and 11 orders. Passeriformes was the dominant specie. The habitat destruction due to deforestation, agricultural activities, infrastructure and land sliding and disturbances by the increasing human population were major threats to the avian fauna of Rawalakot.
...
Toshina Mushtaq, Muhammad Javed and Sidra Abbas*
...2 for 30 days. The peroxidase activity was found to be significantly increased both in liver and kidney after ZnCl2 treatments. Statistically significant increase in the liver and kidney peroxidase activity of 96-h LC50 exposed fish were found as 0.621±0.004UmL-1 and 0.219±0.002UmL-1, respectively as compared to the control fi...
Teresa Napiórkowska* and Julita Templin
..., which had a well-developed prosoma and an additional, partly developed head with two segmented pedipalps and one chelicera with two fangs. The larva was obtained as a result of a teratological experiment based on the application of temperatures of 14 and 32°C changed every 12 h for the first ten days of spider em...
Muhammad Anas1, Abdul Jabbar1, Muhammad Aqeel Sarwar2*, Raza Ullah1, Muhammad Khubaib Abuzar3, Ijaz Ahmad4 and Sohail Latif5
...sole and in the intercropped plots. The results indicated that sole sunflower grown in the pattern of 6 sunflower plants m-2 produced significantly higher achene yield than rest of the planting patterns under study. As regard sunflower-mungbean intercropping system all intercrops gave more economic returns than sole cropping of sunflower and mungbean and planting 6 sunflower plants + 30 mungbean plants m-2 proved to be super...
Sher Khan Panhwar1,2,3, Zhou Yong Dong1,4,*, Gao Tianxiang1,3, Wang Ping5, Han Zhiqiang1, Wang Zhongming1,4 and Wang Yang1,4
...up> in 2013 and 2001, respectively. The exploitation rate was estimated to range from 0.660−0.797 year-1. Catch per unit effort estimates showed a consistent decline in catches. This study is a start to bridge the gap between data and information, allowing resource managers to determine management priorities for this economically and ecologically important species in the E...
Jing Xin Mao1,2, Guo Wei Wang2, Yuan She Huang3, Rui Wang2, Guo Ze Wang4, Bing Zeng1 and Fu Yuan Zuo1,*
...e animal body. In this paper, by comparative study on BPI gene expression in various tissues between Rongchang pig and Landrace, we confirmed the expression of pig BPI gene in various tissues to determine the difference expression of antibacterial related gene among indigenous breed (Rongchang pig) and artificially cultivated breed (Landrace), The Rongchang pig (0 day old, 28 day old, 120 day old) and Landrace BPI (0 day old, 28 day old, 120 day old) gene were...
Pei-feng Yin1,2,Xiu-xiu Li1,Qi-wei Zeng3, Cheng-chen Shen1, Le Gao1 andJian-zhang Ton2,*
...ected leaves on silkworm performance. One group of silkworms was fed infected mulberry leaves and the second silkworms group was given control mulberry leaves that were infection free. Results showed that infected leaves exhibited limited toxicity to the silkworm; however, the cocoons yield found in infected group was deeply affected. Compared with control group, the biggest body weight, cocoon weigh, cocoon shell weight, pupal weight in infected group was 9.3...
LX Ye1,2, JX Wang1,2,*, P Li1,2 and XT Zhang1,2
...ompartments were mainly spermatogenic cells and some Sertoli’s cells. In the insterstitial tissue, the ghrelin-ip cells were identified as Leydig cells. The ghrelin-ip cells showed cytoplasmic staining, and were irregularly shaped. These findings indicate that ghrelin may participate in the spermatogenesis in the African ostrich. Further studies into this regulation will help clarify...
Shaista Naz* and Noor Paio Khan
... descriptive statistics, percentages and rank orders. The results revealed that livestock was the second major source of household income with 19 percent share. Among the livestock types, cattle were the major one followed by goats and sheep. Livestock was found significant at household level in two aspects of income provision and of lowering household a...
Muhammad Asad1, Safdar Ali1, Muhammad Ramzan Ansar2, Ijaz Ahmad3*, Muhammad Suhaib4 and Muhammad Khubaib Abuzar5
...control weeds. A field experiment was conducted to investigate the Chemical control of broad-leaved weeds in wheat at the Koont Research Farm, PMAS-Arid Agricultural University, Rawalpindi, during rabbi season, 2014. The experiment was laid out in a randomized complete block design (RCBD) with four replications, with a plot size of 06 x 04 m2. Four different herbicides were applied as post emergence with three different dose...
Muhammad Aqeel Sarwar1,2*, Muhammad Tahir2, Abid Ali3, Manzoor Hussain3, Muhammad Waheed Anwar4, Muhammad Khubaib Abuzar5 and Ijaz Ahmad6
... as a green manure. An experiment was conducted for evaluating green maunuring of moringa and jantar along with inorganic fertilizers to enhance the yield and quality attributes of autumn maize at Agronomic Research Farm, University of Agriculture, Faisalabad. There were two factors, green manuring (No green manuring, moringa green manuring and Jantar green manuring) and different levels of NPK fertilizers (no fertilizers, 50% of RDF, 100% of RDF). The ex
Ehtisham Shakeel Khokhar1*, Amir Shakeel1, Muhammad Amir Maqbool1, Muhammad Waheed Anwar1, Zoraiz Tanveer1 and Muhammad Fahad Irfan2
...sses and 29 cotton genotypes were field planted in randomized complete block design (RCBD) in three replications to assess the genotypes for plant height (cm), number of sympodial branches, number of monopodial branches, seed cotton yield (g), number of bolls, boll weight (g), lint percentage (%), fiber strength (g/tex), fiber length (mm) and fiber fineness (µg/inch). Analysis of var...
Semra Benzer1,* and Recep Benzer2
...ror (SSE), mean absolute percentage error performance criteria (MAPE) were used for comparison of artificial neural network and linear regression models goodness of fit. The results of the current study show that ANNs can be a superior estimation tool compared to LWR equation. Thus, as an outcome of the present study, ...
Haidar Ali* and Malik Muhammad Shafi
...oyment. While farm area operated was negatively but significantly related to off-farm employment. Similarly the small farm households of developed villages perform more off-farm employment than the small farm households of underdeveloped villages. This could be associated to the developed means of transport and communi...
Guang-Xin E1, Yong-Ju Zhao1, Yue-Hui Ma2, Ming-Xing Chu2, Jia-Hua Zhang1, Zhong-Quan Zhao1, Hui-Jiang Gao2, Huai-Zhi Jiang3, Di Liu4, Li Liu5, Yan-Bin Zhu6, Wang-Dui Basang6, Luo-Bu Danjiu7, Tian-Wu An8, Xiao-Lin Luo8, Shi-Cheng He7 and Yong-Fu Huang1,*
...as 84.99% and 84.47%, respectively. A total of 12577 differentially expressed genes (DEGs) were identified, including 6009 upregulated and 6568 downregulated genes in dominant follicles compared with nondominant follicles of goat. Of the 1026 significantly differentially expressed, long noncoding RNAs (lncRNAs) found, 419 were upregulated and 607 were downregulated. The DEGs related to 56 GO categories, and pathway analysis revealed that these DEGs were signif...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*
...Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isolates through subcutaneous-infection. Out of 81 E.coli isolates, the most prevalent gene detected was ompA (90.12%), followed by ETT2 (69.14%), irp2 (54.32%), EAST1 (46.91%), CS31A (41.98%), estB (19.75%), eaeA (14.81%), estA (12.35%) and K88 (1.23%),...
Imran Ali Rajput1*, Tajwer Sultana Syed1, Ghulam Hussain Abro1, Imran Khatri1 and Abdul Mubeen Lodhi2
...fy;">The frequent use of pesticides at repetitive application have increased the input cost of local farmer and similarly aroused the serious problem of pest resistance. The introduction of transgenic cotton since last decades has played a significant role in suppressing the pest population of Pectinophora gossypiella (Saund) which is the main ...
Imtiaz Ahmed, Muhammad Abbas Khan, Noorullah Khan, Naveed Ahmed, Abdul Waheed, Fazal Yazdan Saleem, Sajjad Khan and Sohail Aslam
...y of Alliaceae family. Experiment was conducted to determine the optimum plant spacing in order to abate garlic rust and maximize garlic crop yield. The experiment was carried out in RCB design with three replications; garlic cultivar (china) and three levels of intra-row spacing (10, 15 and 20 cm) were included in the study. Data regarding disease occurrence, disease severity, plant height (cm), bulb weight (g), bulb diamet...
Jie Wu1, Jiagui Zhu2, Ke Wang2, Dejing Cai2, Yingying Liu1, Yanzhen Bu1,* and Hongxing Niu1,*
... reintroduction of this species, the process of pairing, nest site selection, egg laying, incubation and brooding of the crested ibis in the wild was studied in Dongzhai National Nature Reserve, Luoshan County, Henan Province, China. From October 2013 to May 2015, a total of 78 captive-bred individuals have been released into the reserve and monitored through radio transmitters or satellite transmitters. Twelve nests of 10 pairs were recorded over three breedi...
Fahad Tanveer1, Adnan Afzal2, Muhammad Adeel3*, Sana Shahid4 and Maham Masood5
...herapy in improving non-specific neck pain. It was a quasi-experimental study design. The study was conducted in Chaudhary Muhammad Akram, Teaching & Research Hospital, Lahore and Suriya Azeem Teaching Hospital, Lahore within six months from June 2015 to December 2015. A total of 75 subjects with non-specific neck pain using non-probability convenience sampling technique who fulfilled ...
Sana Imran1*, Sarwat Jahan2 and Mohammad Sair3
...y of mild and moderate types of psoriasis.This comparative study was conducted in Jinnah Postgraduate Medical Centre, Karachi in the Pharmacology and Therapeutics department of Basic Medical Science Institute (BMSI). In 90 days study, 80 patients of mild and moderate psoriasis vulgaris were placed into A and B groups. The Betamethasone valerate treated patients were placed in group A while Calcipotriol treated patients were ...
Bibi Haleema1*, Abdur Rab1 and Syed Asghar Hussain2
...ributes of tomato. The experiment was conducted using Randomized Complete Block (RCB) Design with 3 factors, replicated 3 times. Calcium (0, 0.3, 0.6 and 0.9%), Boron (0, 0.25, 0.5%) and Zinc (0, 0.25, 0.5%) were applied as foliar spray three times. Calcium application at 0.6% increased plant height (88.04 cm), number of primary (2.63) and secondary (7.15) branches, leaves plant-1 (182), leaf area (65.52 cm2), and fruit per ...
Riaz Alam* and Muhammad Sajid
...the rooting response and performance of olive cultivars through Air-Layerage was determined at Olive Model Farm, Sangbhatti Mardan-Pakistan during the year 2014. The experiment was laid out according to Randomized Complete Block Design with two factors factorial arrangement. Air layerings were practiced on July 1, 16, 31; August 15, 30 and September 14 in plants of olive cultivars Frontoio, Manzanilla, Ottobratica, Pendolino...
Medeni Aykut
...total of 3,990 dysticid specimens were collected from 118 different localities and identified. In total, 40 species in 17 genera of family Dytiscidae were recorded, of which 37 were new to the study area. Eretes sticticus (Linnaeus, 1767) is the second record for Turkish fauna. Furthermore, Hydroporus inscitus Sharp, 1882 is new record for the Turkish fauna.
...
Temel Gokturk1, Elif Tozlu2,* and Recep Kotan2
...als used to control this pest are prohibited in this region due to tea cultivation. For this reason, new strategies are needed to control this pest. With the awareness on the negative effects of the chemicals used in the control against pests and with the increasing awareness on environmental issues, alternative methods were sought in the past; and in this context, studies were conducted t...
Falah Baiee1,3, Wahid Haron1,*, Rosnina Yusoff1, Ariff Omar,2 Nurhusien Yimer1, Salman Hammadi1, Tarig Ahmedeltayeb1, Asmatullah Kaka4
...e acute discomfortness experienced in bulls during semen collection by electro ejaculation method. The normal electro ejaculation method of semen collection (Method I) was compared to a modified method involving three stages of graduated electrical stimulation (Method II) in four crossbred bulls. The results showed that intensive muscle spasm, bull struggling and arc back were reduced (p ˂ 0.05), as well as the time of pe
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...important and widespread pests of okra and causes worldwide yield losses. The pest is mainly controlled by chemicals which cause deleterious effects to human, livestock and environment. To dispense with the detrimental consequences of chemicals, use of resistant cultivars can prove one of the effective and reliable alternative approaches for the management of this ...
Ibrar Muhammad Khan1, Rifat Ullah Khan1,*, Muhammad Subhan Qureshi2, Tahir Usman2, Adnan Khan1, Zakir Ullah1 and Hamid Rehman1
...ty, seminal pH and dead sperm percentage in fresh and thawed semen. Data were subjected to one way analysis of variance. High sperm individual motility (85.12 ± 0.51%), progressive motility (20.25 ± 0.47%), plasma membrane integrity (82.25 ± 0.43%), acrosomal integrity (79.91 ± 0.51%), and DNA integrity (98.54 ± 0.14%) were observed in fresh semen in Sahi...
Quang Minh Dinh
...sub>) and the growth performance (Φ’) were 5.56 yrs and 2.50, respectively. The fishing, natural and total mortalities of this fish were 1.29 yr-1, 1.44 yr-1, and 2.73 yr-1, respectively, and its exploitation rate was 0.53. There were two recruitment peaks in May and October, and relative yield-
Shumaila Ashfaq1, Liaqat Ali2*, Muhammad Ashraf Zia2, Rizwan Ahmad Khan2 and Mehtash Butt3
...erable morbidity. PDPH depends on several factor and various methods have been used to reduce and treat the pain of PDPH. We evaluated effects of hydrocortisone on the treatment of PDPH in obstetrical patient.To compare mean decrease in Visual Analogue Scalepain score in patients who developed PDPH after elective caesarean section under spinal anaesthesia who were given conventional treatment versus conventional treatment pl...
H.I. Hosein1, Sherin Reda Rouby1*, Ahmed Menshawy1 and Ahmed E. AbdAl-Ghany2
... of the sensitivity and specificity of some diagnostic procedures used for diagnosis of bovine brucellosis on serological, bacteriological and molecular basis. A total of 141 cows from brucella infected farms under quarantine of the veterinary authorities were employed. Serological examination using BPAT, RBT and CFT in 141 cows revealed 109 (77. 3), 105 (74.47) and 104 (73.76) seropositive respectively. Relative sensitivity...
Qunhua Han1,2, Meiwen Zhang1,*, Cong Guo2, Xunjun Zhou1, Bo Li1 and Yong Wang1
...BL, and TL.
...
Anan Kenthaoand Pornpimol Jearranaiprepame*
...ained using digital calliper from 291 fish individuals, and raw measured data were then subjected to allometric equation to remove size-dependent variation prior further statistical analyses. Multivariate analysis of variance (MANOVA) indicated highly significant differences in morphometric characters between populations (p <0.01). The first three principal axes of principal component analysis (PCA) explained 49.29...
Muhammad Iqbal1, Khalid Usman2*, Muhammad Munir3 and Muhammad Sohail Khan1
...timings i.e., at spathe opening day, 3, 6, 9, and 12 days after spathe opening. Fresh male strand placement technique was used in this study. Strands were cut from a freshly opened male spathe and 2 – 3 strands were placed between the strands of the female inflorescence. Data were collected for fruit set (%), fruit drop (%), fruit yield (kg palm-1) and wide range of physico-chemical ...
Ümit Kumbıçak, Zübeyde Kumbıçak* and Gülnare Huseynli
... first time. Results of spermatogonial metaphases showed that the chromosome number and the karyotype formula of the species was 2n♂=35 (X1X2X30) which is the first record for the family Hersiliidae. Both autosomes and sex chromosomes were acrocentric. The lengths of the chromosomes indicated no significant difference between autosomal pairs, however,...
Muhsan Ali Kalhoro1,2, Danling Tang1,*, Ye Hai Jun1, Morozov Evgeny1, Sufen Wang1 and Muhammad Aslam Buzdar2
...2 =0.586), respectively, whereas the obtained values from Schaefer and Pella-Tomlinson with three error assumptions were 2878 (R2=0.587), 3035 (R2=0.578) and gamma were minimization failure (MF) in both models. The MSY estimated value from ASPIC from Fox and logistic model were 3652 (R2=0.8) and from logistic model were 2962 (R2=0.799), respectively. The present estimate...
Bacillus subtilis BML5 Isolated from Soil Contaminated with Poultry Waste has Keratinolytic Activity
Aqsa Imtiaz and Abdul Rehman*
...as inhibited by added copper ions. A 130-kDa protein was detected from feather-treated bacterial cells, suggesting its role in degrading feather. B. subtilis BML5 can be used to overcome the poultry wastes based environmental pollution and keratinase could be used to improve feather meal digestibility in animal feed as an additive.
...
Rana Manzoor Ahmad1,2, Abdul Majid Khan1,*, Ghazala Roohi3 and Muhammad Akhtar1
... seven extinct giraffid species to determine and compare stress periods during the early Miocene to Pleistocene ages of the Siwaliks of Pakistan. Enamel hypoplasia is a tooth malady which is caused by the deficiency of food/nutrients. The feeding deficiency is directly linked to the physiological or environmental stress. In this study occurrence of enamel hypoplasia in giraffids has been observed in s
Saswati Roy1, Rakesh Pashi2, S. Dey3 and Shantanu Jha2
...15 to April 2016. Landscapes of the area can be classified into two major categories: agricultural fields and non-agricultural areas. Observations on birds were taken twice a week, at early morning, starting from just after the sunrise around 7a.m and till before sunset up to 5.30 pm. Data were collected by using the line transect method. Total 74 number of bird species were recorded which belonged to 18 orders. Out of 74 bi...
Pan Hong, Ruonan Li, Yumeng Li, Hainan Lan* and Xin Zheng*
... hepatocytes in a time-dependent manner. The results also showed that pGH could be translocated into cell nuclei in a time-dependent manner. In addition, the subcellular localization, according to immunoelectron microscopy, showed that pGH was localized in cytoplasmic organelles, e.g., the mitochondria and Golgi apparatus. The present study shows the first exploration of the behaviour of pGH in a somatic cell model of...
Gut Microbe Analysis between Asthma Patients and Healthy Volunteers in Shaanxi Province, Xian, China
Hafiz Muhammad Ishaq1, Muhammad Shahzad2, Xiaokang Wu3, Chaofeng Ma4 and Jiru Xu1,*
...on of 16S rRNA gene, was performed for characterization of gut microbial composition. Sequencing of most dominant excised gel bands was done. Real-time PCR was performed to evaluate the copy numbers of dominant bacteria of gut microbiota. The results indicated that a significant diversity difference between asthma and healthy groups (*P< 0.05), was shown in DGGE profile. Similarity index was found to be lower in in...
Muhammad Saqlain1, Humaira Kalsoom1, Muhammad Fiaz1,2, Abid Mahmood1, Rizwan Aziz Qazi4 ,Waseem Safdar5, Pakeeza Arzoo Shaiq1,Bernard M.Y. Cheung3 and Ghazala Kaukab Raja1,*
...200 healthy controls was performed using a PCR-RFLP. Genotype and allele frequencies were calculated and computed for genetic associations presented as odds ratios (ORs) with a threshold of p≤0.05 to determine statistical significance. The frequency of 54Thr allele of FABP2 significantly associated with MetS risk in Pakistani population. Our results showed that frequency of the FABP2 54Thr allele was ...
Relationship of PIT-1 Gene Polymorphism with Breeding Parameters and Body Weights of Cows and Calves
Jarosław Pytlewski1, Ireneusz Antkowiak1 and Ewa Czerniawska-Piątkowska2,*
...k was to determine the dependency between polymorphism in the PIT-1and fertility rates, body weight of cows and calves, the course of parturition and viability of calves in Polish Black-and-White Holstein-Friesian cattle. The analysis included 1024 cows and 3663 calves of the Polish Black-and-White Holstein-Friesian breed (phf). The study included an analysis of one polymorphic place PIT-1 (c.1178G>A). The source data used to calculate the indicators of rep...
İbrahim Aytekin1,*, Ecevit Eyduran2, Koksal Karadas3, Rifat Akşahan4 and İsmail Keskin1
...asurements and fattening period of native, crossbred and exotic breeds. For this aim, a total of 103 young bulls were used. In the prediction of fattening final live weight as an output variable, several continuous predictors evaluated in the current study were: withers height (WH), back height (BH), front rump height (FRH), back rump height (BRH), body length (BL), back rump width (BRW), chest depth (CD) and chest circumference (CC). Also, the breed factor wa...
Rafiullah*, Muhammad Jamal Khan and Dost Muhammad
...ed by 55, 40 and 35%, respectively, at 144 mM KH2PO4 solution over control. The shoot and root [P] as well as its total uptake by wheat seedlings also showed several times increase over control. Further increase beyond 144 mM KH2PO4 though did not show any adverse effect and was no better than lower P levels. It is concluded from the present study that [P] applied as foliar spray up to 144 mM KH2PO4 could be an effective way to enhance the plant growth in P de...
Muhammad Siraj-ud-Din1,2, Riaz Aziz Minhas1, Usman Ali3,*, Mayoor Khan2, Muhammad Siddique Awan1, Nuzhat Shafi1 and Basharat Ahmad1
...ation management of the species in the area. The habitat use of urial was determined on the basis of direct or indirect evidence (e.g. animal sightings, fecal pallets and hairs) in different habitats. Information on food consumption was collected by using scan sampling technique and also collected from local people, hunters and shepherds (n=78). During scan sampling, focused feeding animals were observed with the help of a t...
Hayat Badshah1, Farman Ullah1, Paul-André Calatayud2, Hidayat Ullah3 and Bashir Ahmad1
... is a highly polyphagous pest of fruits, vegetables, crops and ornamentals in Pakistan. Biological control approach by using Aenasius bambawalei Hayat(Hymenoptera: Encyrtidae) has been developed recently to control this pest. However, the efficiency of this parasitoid is variable according to the locality and the plants on which P. solenopsis is feeding. In this contex...
Sayyed Ghyour Abbas1, Muhammad Adeeb Babar1,*, Muhammad Akbar Khan1, Kiran Aftab2, Ayesha Riaz3, Abdul Ghaffar4 and Muhammad Akhtar1
...vered from Dhok Pathan type locality of Northern Pakistan. The assemblage presents seven bovid species Pachyportax latidens, P. cf. nagrii, Selenoportax cf. vexillarius, Tragoportax punjabicus, T. cf. salmontanus, Elachistoceras khauristanensis and Gazella lydekkeri. The boselaphines are predominant at the type locality. The taxa are consistent wit...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
...ccharide (MOS) on growth performance, body physiology and tissue morphology of gilthead seabream (Sparus aurata). Treatment of fish with MOS-feed shown a significant increase in live weight and protein efficiency rates when were directly compared with mock-treated fish control. However, there was no statistically supported level of significance was observed for growth rates and feed conversion rates among groups. Improved live weight and protein efficie...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...aboratory conditions, respectively. The side effects of Huwa-San TR50 on predatory mite, Neosiulus cucumeris, were also tested to gain successful implementation of new integrated pest management. After the direct application of Huwa-San TR50, N. cucumeris could also sustain its population on treated and/or dead T. urticae, under laboratory and greenhouse conditions. Statistically, the difference between ...
Saleh S. Alhewairini
...after 1, 24 and 48 h, respectively. Alive adult and larvae were completely paralyzed after 24 hours. There was significant difference between 2 treatments, 1 and 24 h, in both adult and larvae. The mortality of both adult and larvae was 100% after 48 hours of exposure to oxamyl. In the field, however, Oxamyl was applied in two different applications. A foliar application by spraying and watering application by adding the to the irrigation water. After 2 days o...
Rana Hanan1*, Muhammad Waqar Shafi1, Sumair Anwar2 and Numrah Nawaz1
.../b>rtension.
...
Xiaoting Zhang1,2, Jiaxiang Wang1,2,*, Peng Li1,2,* and Lixun Ye1,2
...e tertiary bronchus had openings for the atria and respiratory capillaries. The respiratory capillaries were surrounded by a rich blood capillary bed. Ghrelin-ip cells were located among the tertiary bronchus mucosal epithelial cells, respiratory capillary epithelial cells and macrophages. The ghrelin-ip cells showed cytoplasmic staining, they were cone, oval, spindle, round or irregular in shape and tended to be restricted ...
Wen-Feng Li, Xiao-Yan Wang, Ying-Kun Huang*, Rong-Yue Zhang, Jiong Yin, Zhi-Ming Luoand Hong-Li Shan
...(Bojer) were measured in pesticide–treated and untreated areas during 2014-2016. The results indicated that the in untreated areas, percent dead-heart was 8.30% - 58.83%, the percent stalk injured was 26.73% - 96.67%, the percent internodes bored was 4.40% - 25.87%, and the effective stem number was reduced by 4440-21900 stalk/ha. Measured y...
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
...e in the development of sperm. Meanwhile, DUSP4, PDK4 and FKBP1B were also found to participate in testis development and spermatogenesis. In this study, online software and luciferase reporter gene system were used to predict and verify the target relationship between miR-122 and DUSP4/PDK4, miR-449a and FKBP1B. Thereafter, comparison analysis was done on miR-122, miR-449a, DUSP4...
Bian Xunguang1,2, Li Jiancheng1, Xu Chu1 and Yang Li2,3,4,*
...R) to achieve. In this paper, the expression of AR mRNA in various parts of the oviduct was analyzed by qPCR. Oviductal structure was observed by H&E staining. The distribution of AR in the cells was detected by immunohistochemistry. The results showed that the expression of AR mRNA was found in the infundibulum, magnum, isthmus, uterus and vagina of the oviduct. The expression of the AR mRNA in infundibulum was the strongest, and the vaginal expression wa...
Tanzeela Riaz1, Farah Rauf Shakoori2,* and Syed Shahid Ali3
...ontents of a wheat grain pest, Trogoderma granarium collected from godowns of Punjab, Pakistan. Six populations of khpara beetle with different levels of susceptibility to phosphine were used in this study. Based on LC50, five populations (previously exposed to phosphine for 15 years)viz., Mandi Bahauddin-I (MBDIN-I), Mandi Bahauddin-II (MBDIN-II), Gujrat, Gujranwala and Sargodha were labeled as phosphine-tolerant populations and one p...
Rana Fartab Shoukat1, Shoaib Freed1,*, Kanwar Waqas Ahmad1 and Ateeq-ur-Rehman2
...iens. Highest larval percent mortality (73.3 ± 4.7) was observed after application of Ma-11.1(LC40) + nitenpyram (LC40) mixtures under laboratory and field conditions (71.5 ± 7.4). The results showed a significant effect of binary treatments of fungi and chemical insecticides on biological parameters of C. pipiens and its progeny (P<0.05). The insect pathogenic fungi showed compatibility with insecticides and t...
Wanrong Wei and Weiguo Zhang*
...e). Pikas have two types of burrow systems, namely temporary and permanent burrows. The number of surface holes and length of tunnels were significantly different between the temporary and permanent burrows. Tunnel width and tunnel height were not significantly different between the temporary and permanent burrows. The pe
Muhammad Nabeel,1,* Humayun Javed1 and Tariq Mukhtar2
... affected by many insect pests and maize borer (Chilo partellus Swinhoe) has been identified as one of the major limiting factors to maize production throughout the world. As the information regarding its distribution is lacking therefore, its incidence and prevalence was determined in seven major maize growing districts of Punjab during 2016. The maximum overall incidence of maize borer (12%) was recorded in Khanewal district followed by Multan (6%) wh...
Salma Javed, Saima Majeed, Nasira Kazi and Shahina Fayyaz*
...us mubarakvilli new species is described and illustrated from specimens collected from sediments of Mubarak Village in Karachi, Pakistan. The new species is characterized by a cuticle bearing 20-22 longitudinal ridges, tail conical, tapering evenly to narrow terminus 116-128 µm long. Cellular body content extending 2/3 of the tail length. He...
SHARIF UDDIN, MD. HASIBUL HASAN, MOHAMMED MAHBUB IQBAL, MOHAMMAD AMZAD HOSSAIN
...llen abdomen and reddish pelvic fin while the male fish also possess a reddish pelvis fins but generally smaller, narrower. The surfaces of male’s pectoral were little rough during the breeding season. The Gonado-somatic index (GSI) value of female Anabus testudineus was ranged from 12.71±0.73 (July) to 1.13±0.10 (October) while hepato-somatic index (HSI) value of femal...
Safdar Ali1*, Ghulam Abbas Shah1, Muhammad Naveed Tahir1, Shahid Mehmood2, Asim Gulzar3 , Ijaz Ahmad4 and Bashir Ahmad Khan5
...re applied in the fallow periods (summer seasons) of both years before sowing of wheat crop. These tillage treatments were (i) Once Mould board plowing followed by 8 cultivations with planker (1 MBP + 8 CS) as a check, (ii) No-till followed by twice application of glyphosate herbicide (NT + GH), (iii) Once Mould board plowing followed by twice application of glyphosate herbicide (1 MBP + GH), (iv) Once Mould board plowing followed by 4 cultivations with planke...
Tariq Mahmood*1, Syed Wasif Ahmed Shah1, Muhammad Rais1, Hira Fatima1, Faraz Akrim1 and Muhammad Sajid Nadeem2
...ted nesting use of tree species by avifauna at Pabbi Range Forest Kharian (32.811°N and 73.865°E), District Gujrat, from September 2013 to June 2015. Data were collected from five selected sampling sites by searching and identifying nests of different bird species in various vegetation types and observing birds on the nest. The nests were monitored for breeding activity of the part...
Faiza Ambreen*1 and Muhammad Javed2
...he DNA damage induced by pesticide mixture (endosulfan+chlorpyrifos) in peripheral blood erythrocytes of freshwater fish, Oreochromis niloticus by using Comet assay. The 96-h LC50 value of pesticide mixture was estimated for 180-old fingerlings of O. niloticusin a static system and then four sub-lethal concentrations viz. 1/3rd of LC50,...
Naila Riaz1 , Hafiz Muhammad Tahir2* , Khizar Samiullah3
... topical application, respectively. It is concluded that oral treatment of venom was more efficient compared to its topical treatment with same doses of treatment.
...
Irfan1* , Arshad Javid2 , Muhammad Altaf3 , Muhammad Shahbaz3 , and Khalid Javed Iqbal4
.... Total sixty (n = 60) experimental birds were divided in to three groups i.e., poults having age 4-8 weeks (10 ♂ and 10 ♀
Warda Fatima1 , Shahida Hasnain1 , Saqib Mahmood2
...nces of disorder so that people take it cautiously and it may treated early and its bad consequences be reduced.
...
Sidra Iqbal1, Muhammad Irfan2*, Hafiz Abdullah Shakir1, Fouzia Tabbsum1, Javed Iqbal Qazi1
...dm;C, pH 5 with shaking speed of 120 rpm using 2% pretreated eucalyptus leaves as carbon source and 2% v/v inoculum size in submerged fermentation for 24h. Results showed that among these two treatments, only chemical treated substrates gave better enzyme yield as compared to chemical followed by steam. The highest FPase (2.526 IU/ml/min) activity was found at pretreatment conditions of 0.6% NaOH conc., 10% biomass loading and 4h reaction time while CMCase (2....
Haji Muhammad1, 2, Zafar Iqbal1, Qamar Bashir2, Muhammad Amir Hanif3
...n factor of 18 cat fish species belonging to five families of Indus River in Taunsa barrage from Punjab, Pakistan. The value of length weight relationship (LWR) equation and condition factor (K) ranged W= -0.249 TL0.79 – W= -2.803 TL3.55 and 0.07 – 1.69 respectively. The objective of this study was to determine LWR and condition factor of cat fish species of Indus River that co...
Ayesha Aihetasham1*, Khalid Zamir Rasib2, Syeda Rida Hasan1, Imran Bodlah3
... Bougainvillea glabra (Paper flower) against Heterotermes indicola. The leaf extract of C. papaya caused highest mortality i.e. 100% of 10%, 5% and 3% concentration. Bougainvillea glabra and H. annus caused 100% mortality at 10% and 5% concentration while 96.4% mortality on 3% concentration after exposure period of 10 hours. B. glabra extracts also caused 100% mortality on 10% and 5% concentration while 96.4% mortality on 3%...
Muhammad Iqbal Anjum*, Shahbaz Javaid and Mukhtar Ahmad Nadeem
...t group having 13 chicks per replicate per pen. Three iso-nitrogenous and iso-caloric rations were prepared as: R-I served as control with 0.83% di-calcium phosphate (DCP); R-II contained 50% less DCP (0.41%) than R-I and R-III contained R-II plus phytase Quantum® Blue @ 100 g/ton feed. Daily feed intake and weekly body weight gain per replicate were...
Muhammad Khalid, Muhammad Naeem*
...Dorsal fin length (DFL), pectoral fin length (PtFL), pelvic fin length (PvFL), anal fin length (AFL), eye diameter (ED), caudal fin length (CFL), caudal fin width (CFW) of farmed collected Ctenopharyngodonidella were studied to know their correlation with reference to size (TL and W), and types of growth pattern. Correlation coefficient (r) value (0.984) shows high significant relationship...
Muhammad Mudassar Shahzad1*, Syed Makhdoom Hussain1, Farhat Jabeen1, Abdullah Ijaz Hussain 2,Sajjad Ahmad3, Abida Ashraf4,Muhammad Zubair-ul-Hassan Arsalan1
... (MOLM) to prepare six experimental diets that were supplemented with graded levels of phytase (0, 300, 600, 900, 1200 and 1500 FTU kg-1). The fingerlings were fed at the rate of 4% of live wet weight twice a day and feces were collected from each tank. On the basis of results it was noted that addition of phytase showed clearly significant (p<0.05) enhancement in bioavailability of minerals. Maximum ADC% of minerals was noted at 900 FTU kg-1 level of phyta...
Effect of Post-coital intervals on DNA STR profiling of semen donor in the post-coital vaginal swabs
Manzoor Hussaina,b
...t the DNA profile of the perpetrator. With the increase in post-coital interval, the possibility to get the autosomal DNA STR profile of the perpetrator diminishes rapidly from an alive victim. This becomes more serious problem especially when victims of rape cases provide vaginal sw...
Fatima Arshad1, Muhammad Irfan2*, Hafiz Abdullah Shakir3, Fouzia Tabbsum3, Javed Iqbal Qazi3
...ric acid pretreatment of peanut shells as substrate for the production of cellulose enzyme using Box-Bhenken design of Response Surface Methodology. The pretreatment of substrate was conducted through Box- Bhenken design of Response Surface Methodology. Three factors with three levels such as H2SO4 conc. (0.6, 0.8, 1%), substrate conc. (5, 10, 15%) and residence time (4, 6, 8h) were employed for pretreatment with and without autoclaving at 121oC for 15 min. Th...
Naeem Iftikhar1, Qamar Zaman Qamar2, Usman Ali3, Muhammad Siddique Awan4, Syeda Shaista Bibi4, Riaz Aziz Minhas4*
...to the survival of this species in AJK. This study recommended the immediate formulation and implementation of Cheer pheasant conservation action plan along with declaration of its potential habitats as protected area to ensure the further survival of this important species....
Maleeha Manzoor1*, Madiha Manzoor2, Qurat-ul-ain Ahmed3, Sobia Ahmed4, Shazia Manzoor5
...illing a questionnaire especially designed to record various socio-demographic characters of patients and their dietary history. Prevalence rate of anemia in the present study was found to be 78% (9.57±1.07), between age 19-40 years and it’s higher in 3rd trimester of their pregnancies. Additionally low educational status and poor dietary habits showed high risks of anemia among the pregnant women....
Maryum Fakhar, Iqra Jabbar, Anjum Nasim Sabri*
...cterial survival. This paper provides the basis for use of bacteria isolated from saline environment and to check their biofilm forming ability under nickel stress. Our previous results showed that these bacteria are capable of producing proline, glycine betaine, choline and other osmolytes under NaCl stress. On the basis of those results it is hypothesized that this osmolyte production ability may help them in nickel resistance under Ni salt stress. This stud...
Asma Akhtar, Abdul Rehman
...) when ompared to the respective control indicating the ability to tolerate tellurite tress. Differential pattern of bacterial proteins in tellurite stress was obtained by SDS-PAGE. Both bacterial strains can be utilized to convert toxic tellurite into its elemental form from the contaminated sites....
Bushra Mazhar1, Nusrat Jahan1, Nazish Mazhar Ali1, Saiqa andleeb2, Shaukat Ali2*
...maechei was 7 and the temperature was 30°C. Using optimum growth conditions and suitable fermentation medium, E. hormaechei can be used at an industrial level as producer of vanillin. Bioconversion of waste residues of rice bran oil to vanillin by bacterial strains is of greater interest nowadays. Bioproduction of vanillin is not only considered natural but also safe for human health....
Hafiz Muhammad Tahir1, Khanum Zahra2, Arooj Zaheer2, Khizar Samiullah3
...piders produce several types of silk. Spider silk is important because of its maximum mechanical strength, biocompatibility and biodegradability, pore filling ability and very low immunogenicity. In this review structure and types of silk producing gland, spinning process, chemistry of spider silk fiber, mechanical properties and applications of silk in health, military industry and many o...
Telat Yanik1,* and Irfan Aslan2
...on biodiversity, it is imperative to investigate the global warming on aquaculture welfare and productivity. Our current understandings on impacts of altered climate dictate a weak relationship between global warming and naturally occurring migrations. However, several models have been presented that elucidate the negative impact of global warming on the aquatic biodiversity. While impact of global warming on habitat is impe...
Rabia Qurashi, Qurat ul Ane Gillani* and Furhan Iqbal*
...l-phosphinic acid), intraperitoneally injected for 12 days, on hematological and serum biochemical profile of 6 week old male albino mice. Blood samples from male albino mice (CGP55845 treated N = 14 and saline treated N = 16) were collected directly by cardiac puncture and used for estimation of hematological and some serum biochemical parameters. The hematological parameters did not show any significant variation between the two groups. From amongst serum bi...
Malak Atiq Ullah Khan* and Fida Mohammad
...ify;">Knowledge of genotype by environment interaction (GEI) is essential for identifying environment-specific and widely adapted genotypes. Multi-environment trials were conducted to evaluate the magnitude of genotype (G), environment (E) and GEI effects on yield and yield components of wheat. Eighty-one wheat genotype
Qingying Jia1, Hui Wang1, Tianhong Wang1, Na Dong1, Shuguang Ren1,2, Xiaolong Yang1, Jingze Liu1,* and Zhijun Yu1,3,*
...igated the effects of temperature on reproductive fitness of the engorged H. longicornis, results indicated that the engorged H. longicornis could survive all treatments at 0°C and 4°C, and pre-ovipositon periods were prolonged after 0°C, 4°C and 40°C treatment, whereas it was shortened after 37°C stress (P<0.05). The oviposition periods were varied...
Sajid Muhammad* and Fida Mohammad
...gh yielding stable genotypes is always on the agenda of cultivar development programs. Testing of genotypes across environments is required to determine yield stability of genotypes. The specific objective of the current study was to analyze genotype by environment interaction (GEI) of grain yield for 50 genoty
Ayesha Aihetasham1,*, Humaira Aziz1 and Khalid Zamir Rasib2
...1 ppm and 177.32 ppm, respectively. Pronil was found more toxic than Mirage with low LC50 value however both insecticides revealed to be non-repellent against H. indicola.
...
Rimsha Nawaz1, Muhammad Javed1, Sidra Abbas1* and Safina Kousar2
...ects of iron chloride on peroxidase enzyme activity in the fish, Labeo rohita. For this purpose, four groups of Labeo rohita (one-year old) were exposed to different treatments as 96-h LC50, 2/3rd, 1/4th and 1/5th of LC50 concentrations of iron chloride for 30 days in the glass aquaria with three replications for each treatment. After 30-day exposure of iron chloride, the fish organs viz
Ikramul Haq1, Aneela Zameer Durrani*1, Muhammad Sarwar Khan1, Muhammad Hassan Mushtaq2, Imtiaz Ahmad3, Amjad Khan2 and Mehboob Ali1
... of different bacterial species shows that E. coli was the most prevalent bacteria with 48.77% as compared to Clostridium perfringens (18.56%) and Salmonella (17.9%). It was concluded that bacteria were the major cause of foal diarrhea in Punjab, Pakistan.
...
Tariq Mahmood1,*, Fakhra Fazal1, Faraz Akrim1, Hira Fatima1 and Muhammad Sajid Nadeem2
...t; 0.05).
...
Faiza Hassan1, Mubshara Saadia1,*, Muhammad Sher1, Mian Anjum Murtaza2, Muhammad Arshad3,Asam Riaz4 and Mahmood Ahmad Khan5
... against hypoglycemia, hyperlipidemia, and hypercholesterolemia. Present study was designed to evaluate the relative antidiabetic potential of garlic aqueous (AGE) and petroleum ether (EGE) extracts compared to black cumin (Nigella sativa oil; NSO) and insulin. Alloxan induced diabetic rats were post treated with plant extracts (150 mg/kg) and serum samples were collected from overn...
Abu ul Hassan Faiz1,*, Fakhar-i-Abbas2 and Lariab Zahra Faiz2
...o study impact of soil types on rodent distribution and abundance in North Punjab. The survey was conducted from February to December, 2015 using snap traps by applying line transect technique in wild area by using over 3840 trap nights in eight type of soil (sand, loamy sand, sandy loam, sandy clay loam, loam, clay loam, silt loam, silty clay loam). A total of 1571 animals were captured belonging to s<...
Zahid Farooq1, Sufi Muhammad Akram2, Muhammad Saleem Khan3,* and Muhammad Wajid4
...cal features. Total 521 specimens collected/captured belonged to 5 families, 16 genera and 25 species. Indian cobra (Naja naja)(8.83%; N = 46), Glossy-bellied racer(Coluber ventromaculatus)(7.87%; N = 41) and Common krait (Bungarus caeruleus)(7.49%; N = 39) were higher in prevalence. Northern wolf snake (Lycodon striatus striatus), Sind long-nose sand snake (Lytorhynchus paradoxus)an...
Niamat Ullah Khan1*, Abdul Aziz Khakwani2, Sami Ullah2, Najeeb Ullah2, Abdur Rauf3 and Inam Ullah2
...quality and earliness. Experiment was laid out in a RCB design with split plot arrangements replicated thrice. Tillage methods were allotted to main plots while nitrogen levels were kept in sub plots. Results showed that RT produced higher bolls per plant, weight per bolls, lint yields, earliness % and benefit cost ratio (BCR) than FT. Ridge tillage gave lower pe
Soraya Khosravian Dehordi*, Abdolnaser Mohebbi and Kahin Shahanipour
...ive substances (TBARS),superoxide dismutase (SOD) glutathione peroxidase (GPx) and catalase (CAT) values in spleen were measured. An increase in TBARS and PC levels was obtained in rats' spleen of the Cd-group than controls and nano-Se decreased this effect close to the control. The CAT values of all groups did not differ significantly. The values of SOD and GPx were reduced in splenic tissue of Cd-intoxicated rats, but the ...
Ayesha Aihetasham*, Faiza Qayyum and Muhammad Xaaceph
...n. Fungal conidia were repellent to C. heimi. The workers of C. heimi were exposed to fungus for 60, 45, 30, 20, 15, 10 minutes and percentage mortality and consumptions were noted during eight days period. Results showed that workers of C. heimi responded effectively to different exposure time. Percentage mortality in 10, 15, 20, 30, 45, 60 minutes exposure was 46.7%, 55.6%, 67.5%, 76%, 8...
Addishiwot Fekdu, Afework Bekele and Demeke Datiko*
...ne recorded as observed species during both dry and wet season. They were identified into six species. Among these, 458 (99.1%) were rodents and 4 (0.9%) were insectivores. The trapped species were: Lophuromys melanonyx (242), Stenocephalemys albocaudata (126), Arvicanthis blicki (86), Mus Mahomet (3), Dendromus lovati (1), and Crocidura fumosa (4). Tach...
Farah Rauf Shakoori, Momina Shokat, Faiza Saleem and Tanzeela Riaz
...stability at elevated temperatures and in alkaline conditions. The present study was aimed to isolate and screen xylanase producing bacteria and to optimize cultural conditions for maximum production of enzyme from locally isolated bacteria and to optimize the assay conditions under which enzyme possessed maximum activity. Two bacterial isolates XPB-GS02 and XPB-CW01 with maximum activity ratio showed 18.3 and 12.2 U/ml xylanase activity, res
Mohammed Mahbub Iqbal*, Mehedi Hasan Kanon, Mohammad Amzad Hossain, Abul Hossain, Shamima Nasren, Md. Jahidul Islam, Md. Arifur Rahman
...ter. A total of 37 fish species belong to 7 orders including prawns were found. Among the 37 species 5 were vulnerable, 7 endangered, 1 critically endangered, 3 exotic, 20 not threatened and 1 not evaluated according to IUCN, Bangladesh, 2000. The Shannon-Weaver diversity index was found highest (3.12) in June and lowest (2.9) in January. Margalef richness index was found highest (3.02) in July and lowest (2.70) in December....
Hafiz Muhammad Tahir*, Arooj Zaheer and Rabia Yaqoob
...si possess antifungal property....
Phong Huy Pham*
...rm, one of mainly insect pests on sesban, is one of the preferred prey of D. esuriens. ...
Syed Kashif Nawaz*, Faiza Zubair and Sidra Kanwal
...vestigated the various types of overlapping genes in human genome. Study was completed using genome assembly GRCh 38/ hg38 data was accessed using NCBI map viewer for the identification of exact loci of overlapping genes. It was noticed that maximum number (635) of overlapping genes were present on chromosome 1. Chromosome 21 carried the minimum number (85) of overlapping genes. Overlapping genes were further categorized on the basis of their orientation. It w...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4 and Lorenzo Gallus4
...ying salinity levels (15‰ to 40‰ with 5‰ increment) on growth, feed efficiency and meat quality of red tilapia, Oreochromis sp. (mean body weight 5±0.07g) were investigated. Juveniles of red tilapia were randomly distributed into seawater tanks (60 cm × 30 cm × 45 cm each). Ten fish were stocked in each tank with 2 replications. Fish were fed ...
RuiHua Zhang, YongFang Jia, TingTing Liang, QianWen Yang, QiYan Du and ZhongJie Chang*
...2 amino acid protein, respectively. Chromosome synteny analyses revealed that CcSox5 and CcSox13 weretightly linked with the etnk gene, which was conserved in all species; however, there were no conserved regions flanking CcSox6. Numerous essential transcription factor binding sites (TFs) were predicted within the 2000 bp upstream of the 5’ end of these genes. These TFs include BSX, BRN4 and NGN&nd...
Zia ur Rehman1, Naila Chand1, Rifat Ullah Khan2,*, Sarzamin Khan1 and Muhammad Subhan Qureshi3
...was planned to study the performance and potential profitability of four commercial broiler strains in two different temperature zones i.e., thermoneutral zone (TN) and high ambient temperature zone (HAT) group. Day-old broiler chicks (n=242) of four different commercial strains (Ross, Hubbard, Cobb and Arber Acer) were placed in brooding room for the first two weeks and then chicks...
Yakut Gevrekçi* and Çiğdem Takma
...atched at four different periods were collected from a commercial flock in west of Turkey. The analysis performed with cathegorical (cage and line) and continuous (hatch, age at sexual maturity and body weight of sexual maturity) predictors and a continuous response variable (EP). The Spearman’s rho correlation coefficients among all predictor variables were significantly changed fro...
Ozgur Altan*
...arus aurata) and European sea bass (Dicentrarchus labrax) produced by aquaculture into a raw material that can be used in fish feed ingredient by means of a system called flash dryer has been researched. Before being subjected to drying and grinding in the flash dryer system, the FBP have been passed through the press and decanter, and it has been endeavored to separate the liquid part to the extent possible and to store them separately. At the end ...
Amjad Khan1,*, Muhammad Hassan Mushtaq1, Mansur ud Din Ahmad1, Jawad Nazir1, Zahida Fatima2, Asghar Khan3 and Shahid Hussain Farooqi3
...) province of Pakistan experienced an extensive epidemic of equine influenza (EI) in October 2015 in equine population. EI is among the OIE or WHO notifiable, contagious equine respiratory diseases. Due to lack of awareness and interest of all the equine industry stakeholders no vaccination against EI is performed, also the information regarding the epidemiology and occurrence of EI is lacking in Pakistan. We hereby attempte...
Yunjun Yan, Zhenming Lü, Tianming Wang, Yongjiu Chen, Jingwen Yang, Baoying Guo, Lihua Jiang, Changwen Wu and Liqin Liu*
...p with other cephalopod species. The results show that the mitochondrial genome of O. dollfusi composed of 15843 nucleotide pairs and encodes 13 proteins, 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a major long noncoding region (LNCR) of the mitochondrion’s own protein synthesizing system. Seven of thirteen proteins, eight tRNAs are encoded by the plus strand, while the other proteins and tRNAs, as well as two rRNAs are encoded by the ...
Muhammad Usman Saleem1, Saima Masood1,*, Hafsa Zaneb1, Aneela Zameer Durrani2, Asim Aslam3, Kamran Ashraf4, Habib-ur-Rehman5, Muti-ur-Rehman3 and Muhammad Shabir Shaheen6
...tes. The number of birds per group were 32 whereas the number of birds per replicate were 8.The first group was kept as control (CONT) whereas, the second (MOSG) and third (OABG) groups were given MOS (2g / kg of feed) and OAB (3g / kg of feed), respectively. The fourth group (MOS+OAB) was given combination of MOS (2g / kg of feed) and OAB (3g / kg of feed). Birds were given ad-libitum fee...
Abd El-Nasser Ahmed Mohammed*
...iazepam and xylazine, respectively. The female of control group was subjected to sham operation whereas the other two groups were subjected to ovarian transplantation from adult to adult and (adult-adult) and from young to adult (young-adult). After 8 weeks of ovarian transplantation, the females were mated with vasectomized males and were checked daily for vaginal plug. Females were killed for morphological and histological...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool3, Fatima Ahmed4, Saiqa Tabassum3,6, Syeda Madiha3, Tahira Perveen3 and Saad Bilal Ahmed5
...ken meat consumption has peaked current days due to its incredible taste and low cost. However, to meet the increasing demand the chickens are reared commercially through feeds and battery cages allowing maximum weight gain and growth in considerably less time. The constituents that are fed to chickens concentrate in the flesh and bring deleterious health outcomes on the consumers. The ill effects account for hyper-lipidemia...
Qamar-un-Nisa1, Muhammad Younus2,*, Muti-ur-Rehman1, Azhar Maqbool3 and Sajid Umar4
...osses at poultry farms especially during during co-infections of respiratory pathogens. However, impact of co-infections is not well known, especially in broilers. The current study was aimed to assess the probable synergism of E. coli (O78) and velogenic Newcastle disease virus in the broiler model. Three-week-old commercial broilers were inoculated with either vNDV, E. coli serotype
Tania Ahmed Shakoori1,*, Muhammad Saqib Saeed2, Asif Hanif2, Saima Mukhtar3 and Ayesha Ghauri4
...xacerbator’ phenotype and determine the risk factors for increased frequency of acute exacerbations in local chronic obstructive pulmonary disease (COPD) patients in a cross sectional analytical study design. For this purpose 137 patients were included in the study after obtaining necessary permissions from the ethical board of the hospital. COPD was diagnosed on the basis of clinical symptoms and a post bronchodilator...
Muhammad Zahid1*, Muhammad Ather Javed Khan2, Muhammad Idrees3 and Ahmad Kamran Khan4
...fy;">Rural communities depend upon cotton as cash crop for their livelihood. Agro-based industries are depending upon its yield. Our per acre cotton yield is still far behind than the developed countries. Integrated pest management project was launched in Punjab and run by agriculture extension department. Farmer Field...
Tania A. Shakoori1,*, Soumble Zulfiqar2, Khadija Irfan Khawaja3 and Faisal Masud4
...inistered oral NaB, intraperitoneal (i.p) NaB, oral placebo or i.p placebo for 16 days. RNA was isolated from the epididymal fat pads and relative genetic expression of AMPK, Sirt1, mTOR and Akt was measured using real time PCR. Oral NaB group showed decreased genetic expression of AMPK (0.04 fold, p<0.001), mTOR (0.30 fold, p=0.04), Akt (0.29 fold, p=0.67) and Sirt1 (0.83 fold, p=0.18). In the I/P group AMPK (2.26 fold, p=0.33), Akt (1.3 fold, p=0.59) and ...
Muhammad Jamal Nasir*, Anwar Saeed Khan and Said Alam
...rs are adapting to new type of weather. The study was carried out in Balambat Tehsil District Dir Lower. They study is primarily based on questionnaire survey and focus group discussion. A total of fifteen villages out of total 173 were selected for study, 75 farmers were interviewed, 05 from each of the 15 selected villages. A total of 15 focus group discussions were organised, one is each selected village. The key parameters addressed during survey were crop...
Muhammad Tariq1*, Muhammad Khawar Hussain1, Zilakat Khan Malik2 and Noor Jehan1
...duction of 2898 kilogram per acre. The per acre average values of land preparation, NPK fertilizer, labor, seedling, farm yard manure and pesticides were recorded 6.00 hrs, 248 kgs, 143 man days, 24413 seedling, 1.48 trollies and 1.21 litres respectively. The results also showed that strawberry producers were having 81% of mean technical efficiency with ...
Tahira Kamal1*, Saeed-Ul-Hassan Khan2, Amir Bin Zahoor3, Khalid Naeem3, Muhammad Naeem Riaz1, Siddra Tayyab Akhtar4, Ghulam Muhammad Ali1*
...idae. It has seven serotypes with no cross protection among these. FMD is responsible for heavy economic losses in cattle and buffalo. So rapid and accurate diagnosis of FMD is uttermost need of this time. Several lab.techniques are developed for rapid detection of FMD but these are expensive and time consuming. Elisa, cell culture, Reverse Transcriptase (RT-PCR) and real time PCR need s
Lowell Gustafson
...se they want to know why people believe what they do; and (3) it is a mark of hubris or pride that a religious person (or even a scientist) would claim total knowledge about ultimate reality. Ted Peters adds to a discussion that is taking place along our current pilgrimage, but he would be the first to say that is not the final word about ultimate reality.
...
Waqas Liaqat1, Mohammad Akmal1* and Jawad Ali
... is grown on largest cropped area every year for food and fodder in Pakistan. Nonetheless, its yield is low with almost half of the national average in the Khyber-Pakhtunkhwa province. The study aims to find outoptimum sowing time for a suitable variety (OPV or hybrid) in Peshawar. Field experiment was conducted at Agronomy Research Farm, the University of Agriculture Peshawar during summer 2016. Exp...
Ann Milliken Pederson
...ny, it is no wonder that people long for wholeness, healing, transformation, and an encounter with the ultimate. Ted Peters’ new book locates the vocation of humankind within their cosmic home, brings together the disciplines (humanities, social sciences, natural sciences) into a holistic integration of knowledge, places the quest and the question of God within the historical narrative of the natural and cultural history of the entire cosmos, and offers ...
Nancy R. Howell
...oes Peters lead us to deeper thinking about the nature of God? Surely, reflection on these two questions will show that Peters has generated a fruitful method for and approach to Cosmic History.
...
George L. Murphy
...ropic principle, I appeal to a theanthropic one. It is God who created the cosmos so that flesh would evolve for the Word to become flesh, and to unite all things in that incarnate Word.
...
Muhammad Zamin* and Abdul Mateen Khattak
...is purpose, various ecotypes of Sporobolus spicatus were investigated by conducting mowing tests in the year 2013 under UAE climatic conditions. Fifty ecotypes of Sporobolus spicatus were cut at various heights, i.e. 1, 2, 3, 4 and 5 cm. Significant differences were found among various ecotypes and mowing heights for different growth and quality parameters including green cover, canopy sti...
Francisco J. Ayala
...cussion. Scientifically speaking, we can perceive design in nature without a designer. On the one hand, there is purpose in nature. Human eyes have a purpose, namely, to see. Teleological explanations are required in biology for (1) goal oriented behavior; (2) self-regulating systems; and (3) the function of organs and limbs. On the other hand, the natural history of evolution does not require a Creator or a planning agent e...
Ted Peters
...ng within an otherwise impersonal universe. In this article, I entertain criticisms of my book, God in Cosmic History, raised by Lowell Gustafson, President of the International Big History Association; Ann Milliken Pederson, Professor of Theology at Augustana College in Sioux Falls SD; Nancy Howell, Professor of Theology at St. Paul Seminary in Kansas City; George Murphy, physicist and pastor in Akron OH; and distinguished evolutionary biologist and wi...
Ayesha Bibi*, Musharaf Ahmad and Shaukat Hussain
...oming one of the serious pests in vegetables in Northwest Pakistan. We investigated primary sources of inoculum for bacterial canker of tomato (BCT) caused by Clavibacter michiganensis subsp. michiganensis (Cmm), in a set of 20 weeds commonly found in tomato fields of major tomato growing areas of Khyber Pakhtunkhwa (KP) province, Northwest Pakistan. Based on agroclimate, KP was divided into five zones as Northern KP, Southern KP, Eastern KP, Western KP and Ce...
...g, head tossing was more periodic in lions housed at Lahore Zoo (site 1) in contrast to lions at display at Safari zoo Lahore (site 2). The frequency of natural behavior was periodic in African lions housed at Safari zoo Lahore. In the present study stereotypic behavior in lions represented here as a tool to measure the level of comfort at housing sites. This behavioral display also defines the safety of these groups of lion...
Shahid Mehmood1,*, Bushra Nisar Khan1, Hassan Raza1, Rida Ahmad1, Azhar Muhammad3, Zulfiqar Ali2, Farhan Abid1, Fehmeeda Bibi4 and Syed Maviz Ahmed5
...rve the year round bird species diversity from October 2014 to September 2015 at Safari Zoo Lahore (31°22’57 N, 74° 12’ 47 E and elevation 208m) located in district Lahore, Punjab, Pakistan. In total, 5456 birds belonging to 71 species, 40 families and 12 orders were recorded. Bird species distribution was: year round residents 50 (70.4%), winter m...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4, Lorenzo Gallus4 and Syed Sajjad A. Shah2,3
...l salinity level among 0‰, 5‰, 10‰, 15‰, 20‰ and 25‰ for successful breeding of Nile tilapia, Oreochromis niloticus. The duration of study was 56 days. Brooders (48) having mean weight (male 162±0.2 g and female 160±2.5 g...
Jo Ik-Hwan1, Choi Kwang-Won1 and Muhammad Fiaz2,*
...om 2012-13 to 2014-15. Experiment was conducted under split plot arrangement having 3 main plots (Sole Rye, Rye with hairy vetch and rye with pea) and 4 sub-plots (0, 50, 100 and 150 kg N/ha). Findings showed if rye was mixed cropped with hairy vetch, dry matter (DM) and total digestible nutrient (TDN) yield was not different (P>0.05) from control, whereas rye-vetch mixture had increase...
Syed Asif Imran Shah1*, Shah Jehan Khan2, Kalim Ullah1 and Obaid Ullah Sayal2
...four upland cotton genotypes were investigated for genetic divergence regarding yield related attributes, seed cotton yield and fibre quality traits using principle component analysis. The experiment was carried out at Cotton Research Station, Deara Ismail Khan, Pakistan during 2014-15. The triplicated randomized complete block design was followed and attributes of interest were plant height, monopodia plant-1, sympodia plan...
Muhammad Abubakar,1,2,* Aamer Bin Zahur,1,3 Khalid Naeem1,3, Muhammad Azeem Khan1,3 and Subhan Qureshi4
... and 46.82% in goats, respectively. Overall, disease affected all three age groups of sheep and goats but the younger animals were more severely affected with a morbidity rate of 37.19%. The mortality and case fatality rates were also higher in young which were 46.86% and 17.39%, respectively. Yearly data of outbreaks was suggestive that a cyclic as well as seasonal pattern of disease occurred. The results of the phylogeneti...
Tasleem Akhtar*, Muhammad Asif Aziz, Muhammad Naeem, Muhammad Sheraz Ahmedand Imran Bodlah
...rvival of several plant species. Agricultural productivity depends on population interactions of these pollinators. A field experiment was conducted at PMAS-Arid Agriculture University Research Farm, Koont, Gujar Khan during 2015 to compare the diversity and abundance of different insect pollinators on canola (Brassica napus L. Var. Chakwal Sarsoon) crops along with managed Apis ...
Muhammad Luqman1,3, Raheel Saqib2*, Xu Shiwei3 and Yu Wen3
... women) in agricultural operations and also towards gender disparity in agricultural extension. Agriculture comprises of a number of farming activities, where both men and women are involved in multiple diverse nature of field operations. Inspite of their high contribution in farm and non-farm activities, there exist gender disparity with reference to agricultural extension, education and other farm advisory services. The st...
Imran Khan*, Zahir Shah, Wiqar Ahmad, Farmanullah Khan and Muhammad Sharif
...t status and physical properties of soil at the NDF Farm, the University of Agriculture, Peshawar during 2015-16. The study was planned in RCB split plot design with fertilizers; control (Farmer’s practices, FP, 60-45 N-P2O5 kg ha-1), NPK recommended dose (RD, 120:90:60 N:P2O5:K2O kg ha-1), 5, 10, 15 and 20 t FYM alone (FYM5,10,15,20) and 5, 10 and 15 t ha-1 FYM in combination with 75, 50 and 25% of the recommended NPK (INM5:75, 10:50, 15:25) in sub plot...
Ronaq Zaman*, Shahid Ali and Inam Ullah
...-align: justify;">This paper estimates the technical efficiency of broiler farms in district Mansehra, Khyber Pakhtunkhwa, Pakistan. Primary data were collected from 134 respondents using multi-stage sampling technique through well-structure interview schedule. For the estimation of Stochastic frontier tans-log production function, maximum likelihood estimation technique was used. To ensure the abnormality of data set Chow test and Dummy variable test was empl...
Senol Celik1,* and Orhan Yilmaz2
...f WH > 51 cm can be expected to have the highest body weights. The calculated model evaluation criteria of CART algorithm was R2=0.6889, Adj. R2=0.6810, r=0.830, SD ratio=0.5549, RMSE=1.1802, RRMSE=6.3838 and ρ=3.4884, respectively, whereas the calculated model evaluation criteria of MARS method were R2=0.9193, Adj. R2=0.8983, r=0.9588, SD ratio=0.2840, RMSE=0.6041, RRMSE=3.2635 and ρ=1.6661. Taken together, the M...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Ghulam Dastagir4, Sara Ferrando5, Lorenzo Gallus5, Asad Ali Muhammad1,6, Abdul Jabbar2 and Khalil-ur-Rehman2
...timum salinity level (10‰, 15‰, 20‰, 25‰ and 30‰) for growth performance, food conversion, body composition and survival rate of Nile tilapia, Oreochromis niloticus (mean body weight 4.5±0.5 g) were investigated. Fingerlings were rando...
Meghan Griffith
...wledge and determinism appear throughout the book, typically when Fischer is defending incompatibilist arguments regarding foreknowledge and freedom to do otherwise (i.e., alternatives). But in an intriguing discussion in the introductory chapter, Fischer draws a comparison between determinism and foreknowledge with respect to moral responsibility, arguing that, like determinism, foreknowledge is compatible with our h...
David P. Hunt
...lem—five earlier papers, and six that appeared just within the last eight years. It also opens with a substantial overview, itself worth the price of admission, written specially for the book.
...
Saima Akhtar Qureshi1 and Asim Anwar2*, Ather Maqsood Ahmed3
...n: justify;">Doubt about pesticides based agriculture productivity motivated agriculture departments to collaborate with international agencies to introduce sound agriculture practices like Integrated Pest Management (IPM) in Pakistan. In IPM technique natural parasites and predators are used to check pest growth instead of pesticides which reduces ecological and health damage. Pesticides ...
Muhammad Ijaz Khan* and Amanullah Jan
...rrigation regimes on the performance of maize crop during 2011 and 2012. Four irrigation regimes ranging from 3-6 irrigation in relation to the critical stages of maize crop were applied. Irrigation consisted of 93 mm water. Three organic soil conditioners viz., farmyard manure (10000 kg ha-1), wheat straw as crop residue (10000 kg ha-1) and two levels of humic acid (2 and 4 kg ha-1), alone and in combinations with gypsum (1000 kg ha-1) as inorganic soil condi...
Aqsa Waqar1, Sahir Hameed Khattak2, Sania Begum2*, Tayyaba Rehman1, Rabia1, Armghan Shehzad2, Wajya Ajmal2, Syeda Shahdana Zia2, Iqra Siddiqi2 and Ghulam Muhammad Ali2*
...he world. Yellow or stripe rust (produced by Puccinia striiformis), is a globally significant disease of wheat. Stripe rust was primarily considered a disease of cooler climate (2°C - 15°C), upper altitudes and northern latitudes, but current epidemics of the disease have confronted this supposition because fresh strains have greater adaptation to higher tem<...
Wang Jian1, Abdur Rehman2*, Noor Khan3, Wang Zhengjia4, Ji Peng-fei5, Xie Cong6, Muhammad Niamatullah Khan Babar7 and Raheel Saqib8
...conducted to examine the per capita consumption and per capita net income of the rural households using statistical data of Hebei province China for the period 2000-2014.The descriptive statistical analysis, correlation test, Extend Linear Expenditure System (ELES) model, Gray relational analysis and the residual test have been used in this study.The res...
Afsheen Masood1*, Rubab Musarrat2, Shama Mazahir3 and Adeela Ashraf4
...rted quality of life and perceived marital satisfaction in parents of children with leukemia with that of normal cohort. Case control study design was used. The sample consisted of N=120 parents out of which n=60 were the parents of children with leukemia and n=60 were the parents of normal children, , taken as normal cohort and drawn through non-probability purposive sampling procedure. Both cohorts were matched on the basis of the age and income level of the...
Aneeza Jamshed1* and Syed Amir Gillani2
...ement of quacks and less penetration of mass media. To develop the awareness of hepatitis C among primary grade students. A total of 150 students of primary grade among 300, of Government sector Middle School Lahore were selected through multistage cluster sampling. A quasi-experimental study was conducted in the time period of 6 months from April 2014 to Sep 2014. Data analysis was done w...
Arooj Fatima1* and Ashfaq Ahmed2
... and DASH (0.000) when repeated measure analysis of variance (ANOVA) was applied comparing four sub groups. Eccentric exercises give better results in reducing pain intensity and gaining functional outcome with routine physiotherapy maneuvers in subjects having rotator cuff tendinopathy. Eccentric loading training for the cure of shoulder pain due to rotator cuff tendinopathy has confirmed to be more helpful in aiding pain, and fixing functional impairment in ...
Zehra Mohsin1*, Sarah Shahed2 and Talat Sohail2
...n demographic variables, perceived social support and professional quality of lifeof nurses in public hospitals. A sample of 160 nurses of age (M=33.48, SD=9.18) was selected from public hospitals of Lahore. The nurses completed a demographic information form, Multidimensional Scale of Perceived Social Supportand Professional Quality of Life Scale. The data were analyzed using SPSS version 20. Two demographic variables, age and expe
Muhammad Yahya Noori1*, Saharish Rizwan2, Zaheer Ali3 and Shaheen Sharafat4
...ations and analysis were performed in Microsoft Excel® and online calculators. Analysis of contact data showed that only 36% of the patients had a close contact with a known Tuberculosis patient. Chi-square test did not show any association between history of presence of a contact and the patients’ gender (p>0.5). Among the cases with established exposure with a TB patient among close contacts, 17.5% females and 12.5% males reported exposure with ...
Uzma Zahid
...evement and leadership aspects of medical students, which can ultimately enhance their career aspirations. ...
Attia Anwar1, Sajida Malik2*, Zobia Usman1 and Sadia Chiragh3
... acid and WBC count in experimental group as compared to control group. There were no significant untoward effects of berberine on platelet count, LFTs and RFTs of Spargue-Dawley rats except neutropenia. ...
Michael Almeida
...ith offering the most compelling formulation of an ancient argument against human freedom.1 According to Pike, God’s foreknowledge that we will perform some action is inconsistent with our freedom to do otherwise. If freedom requires the freedom to do otherwise, then God’s foreknowledge undermines our freedom. Divine foreknowledge that we will perform some action mak...
Alan R. Rhoda
... have a great deal of respect for his work in this area and have learned much from him, so it’s an honor to have been invited to comment on his recently published collection of essays on this topic (Fischer 2016). Given my space limitations and time constraints, I have decided to focus my comments on what he dubs the “Bootstrapping View” in section V of the volume’s introductory essay. The view is a novel proposal for how God might be a...
Bashir Ahmad1*, Ahmad-Ur-Rahman Saljoqi1, Hayad Zada2, Shahid Sattar1, Toheed Iqbal3, Saddam Hussain1 and Muhammad Saeed4
...observe the impact of temperature, relative humidity and rainfall on population of Plutella xylostella (L.) in Cauliflower, Brassica oleracea crop at District Haripur of Khyber Pakhtunkhwa. Field studies results showed that the population of P. xylostella gradually increased from mid of July where the population was 2.1 and 2.0 larvae and pupae per plant in the year 2012 and 2013 respectiv...
Shahid Iqbal1*, Amir Nawaz Khan2, Mushtaq Ahmad Jadoon3 and Intikhab Alam3
...nt, was reported with respect to use of agricultural chemicals. The floods-2010 has also had adverse effects on crops production where significant decrease has occurred in wheat, sugarcane and maize production. The most important effect was that vegetables growing were stopped after the floods-2010. The study recommends to address the issues through the involvement of both the agricultural extension and research with major e...
Fazal Ullah1*, Muhammad Sajid1, Syeda Leeda Gul2, Bibi Zainub1 and Maaz Khan1
...t-align: justify;">The experiment “Influence of hot water treatments on the storage life of sweet orange (Citrus sinensis) cv. Sherkhana-I” was carried out at Post harvest Laboratory, Department of Horticulture, The University of Agriculture, Peshawar, Pakistan. The research was conducted in completely randomized design (CRD) with two factors i.e. hot water dipping times (0, 5, 10, and 15 Minutes) and storage durations (0, 15, 30, 45 and 60 Days). ...
Muhammad Hafeez-ur-Rehman1,Farzana Abbas2,Ghulam Abbas3,*, Arshad Javid4, Ali Hussain4, Syedah Andleeb5,Khalid Javed Iqbal6 and Muhammad Akmal1
...v>...
Mahboob Ali1, Muhammad Avais1, Riaz Hussain2, Kashif Prince1,*, Muhammad Ijaz1, Mamoona Chaudhry 3, Sehrish Firyal4, Amjad Islam Aqib1, Naimat Ullah Khan5 , Mian Saeed Sarwar5, Hazrat Ali5, Shahid Hussain Farooqi1, Ikramul Haq1 and Muhammad Sajid Hasni3
...and in-vitro therapeutic response to drugs. Two different ecological zones, Cholistan (n=185) and Suleiman Range (n=177) of Pakistan having major population of camel were screened for subclinical mastitis using California mastitis test using convenient sampling technique. Biochemical examination was performed to isolate S. aureus that further were tested Penicillin, Glycopept...
Kashif Prince1,*, M. Sarwar Khan1, Muhammad Ijaz1, Aftab Ahmad Anjum2, Muhammad Asad Ali2, Jawaria Ali Khan1, Nisar Ahmad3,Rais Ahmed2, Aamerzish Mushtaq4, Sajid Umar4 and Yung-Fu Chang5
...d by Atomic Absorptions Spectrophotometery (AAS) with respect to sex of animals, geographical area, age of animals, herd size, stage of animals, production level and concentrate feeding. Selenium deficiency was also evaluated as a risk factor of mastitis and repeat breeding. About 48.43% cattle and 72.39% buffaloes were found positive in selenium deficiency. Spe
Alptug Sari*, Ahmet Arpacik and Sagdan Baskaya
...bserved.
...
Wali Khan1,*, Noor-Un-Nisa2 and Muhammad Asif Nawaz3
...div>Diseases caused by tapeworms remain a public health problem in low and middle-income countries including Pakistan. The current study was aimed to assess the prevalence of Taenia saginata and Hymenolepis nana (tapeworms) infections among farmers, education concerned and shepherds of Swat, Pakistan. A total of 1041 stool samples were examined from January 2006 to December 2008 using direct smear and concentra...
Justyna Batkowska1,*, Lukasz Wlazlo2, Kamil Drabik1, Bozena Nowakowicz-Debek2, Karrar I.A. Al-Shammari3 and Magdalena Gryzinska1
...>) after applying red grapefruit juice (Citrus paradisi) for hatching eggs disinfection. 420 eggs were randomly divided into 3 groups (150 pcs each). 1st group was not disinfected (NC – negative control), the 2nd one was disinfected with formaldehyde and KMnO4 fumigation (PC - positive control). In 3rd group fresh juice of red grapefruit was used as disinfectant (GT). ...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5
...hoot proliferation (4.48 per explant) was observed in MS medium containing 0.2/0.4 mg/L BAP/IAA combination. For rooting of the micro shoots, MS medium was supplemented with 1.0 mg/l IBA exhibited best results with 4.69 mean value of roots per shoot at an average root length of 3.86 cm. After acclimatization and transplantation, 90% of the In- vitro derived plants were found healthy in ex vivo conditions.
...
Muhammad Aqeel Sarwar1*, Abid Ali2, Manzoor Hussain2, Saadia3, Muhammad Khubaib Abuzar4, Ijaz Ahmad5 and Sohail Latif6
... quality of wheat. The experiment was laid out in randomized complete block design (RCBD) with factorial arrangement by using three replications. Treatments included different fertilizers combinations i.e (F1) control, (F2)100% recommended dose of NPK, (F3) 75% recommended dose of NPK + 1.5 t ha-1 poultry manure(PM), (F4) 75% of recommended dose of NPK +3 t ha-1 farmyard manure (FYM) and(F5...
Alim-un-Nisa1*, Sajila Hina1, Sania Mazhar1, Imran Kalim1, Ijaz Ahmad1, Naseem Zahra1, Shahid Masood1, Muhammad Khalid Saeed1, Qurat-ul-Ain Syed1 and Maida Asif2
...aking it stable for long period of time in food products as well as in extracted form by using preservatives and antioxidants like citric acid and determining its usefulness by applying on food products. Natural edible color was extracted from T. erecta gave lemon yellow color shade which when applied on candies increased the attractiveness. The spectrophotometric analysis at 474nm of extracted color both in crude for...
Noreen Rasul1*, Madeeha Rashid2, Aqeela Abbas1 and Rubina Sohail3
...iated after birth, after performing early essential newborn care practices. Weight gain of 20-30 gram for three consecutive days, establishment of breast-feeding for 20-30 minutes every two hourly and maintenance of body temperature at 37 degree centigrade is the discharge criteria. During the period of six months, total number of deliveries was 6459, out of them spontaneous vaginal delive...
Muhammad Naeem1, Bushra Sadia1,2,*, Faisal Saeed Awan1and Muhammad Anjum Zia3
...rtant approach for its hyper production. In this connection, wild bacterial strain Streptococcus equisimilis was mutagenized using ethidium bromide and UV radiation. The colonies (15 each) showing > 1% survival rate at 150 min of UV exposure and 12 % survival at 0.5 mg/ml of ethidium bromide for 120 min were selected. Casein hydrolytic assay identified EB3, EB4, EB6, EB7, EB9, EB11, EB13, UV2, UV4, UV6, UV7, UV9, UV11, UV12 and UV 15 mutants producin...
Bashir Ahmad1, Muhammad Idrees1,*, Kafeel Ahmad1, Dawood Ahmad2, Sajid Ali3 and Shumaila Bashir4
...ients were tested for suspected tuberculosis by fluorescence microscopy and GeneXpert system during the study period (2015-2016) at the Provincial TB Reference Laboratory, Khyber Pakhtunkhwa, Pakistan. Among the 794 patients studied, 170 samples gave positive results. Fifty-two Mycobacterium tuberculosis complex (MTBC) isolates were randomly selected for RAPD-PCR and PCR-restriction...
Ali Murad Rahoo,1,2,* Tariq Mukhtar,1,3 Shoukat Ibrahim Abro,4 Barkat Ali Bughio5 and Rehana Kanwal Rahoo6
...gical control agents of specific target insects is affected by their level of infectivity and reproductive capacity. Therefore, in the present study the productivity of five entomopathogenic nematodes (Steinernema feltiae, S. kraussei, S. carpocapsae, Heterorhabditis bacteriophora and H. indica) were compared in Galleria mellonella larvae. The production of infective juveniles (IJ) in G. mellonella was significantly affected by nema...
Rahila Nizami1, Muhammad Zahid Latif2*, Intzar Hussain3 and Khalid Rashid4
...p is an obligatory inter-personal skill for executive positions and medical professionals are no exception. They play crucial roles in variety of scenarios including leading wards, camps, campaigns, open houses, seminars and symposiums as well as day-to-day bases dealing with clinical directors and managers. This research was conducted to study the leadership styles among the medical professionals. For this purpose, a cross ...
Sadaf Ghulam Rasul1*, Uzma Yaqub2, Maida Manzoor1 and Hafsa Mubasshar1
...ity, mostly from serious pelvic pain(1). Endometriotic tissue has the potential for aromatase gene expression that leads to aromatase and estrogen production. Danazol is a synthetic androgen whereas Letrozole is aromatase inhibitor. This study was conducted to compare the mean decrease in visual analogue scale (VAS) pain score with Danazol versus Letrozole for the pain management of endometriosis in females. A total of 140 females fulfilling inclusion criteria...
Nukhbat-Ullah Awan1*, Muhammad Sohail2, Zeeshan Sarwar3, Muhammad Mustahsen Bashir4, Muhammad Abbas Khokhar5 and Asad Aizaz Chatha6
...de of trauma, incubation period, vaccination status and investigations were recorded. All patients were managed in ICU and early tracheostomy was performed in addition to standardized medical treatment. A total of 86% males with age 32±8.3 years presented the study participants. Results demonstrated thatmost common mode of trauma was road traffic accident, and majority (54%) of patients were never vaccinated. Incubati...
Ayesha Saeed*, Mobina Naqvi and Ahsan Javed
...Lahore, Pakistan.Ina prospective cohort conducted at Shalamar Hospital Lahore; from April to August 2016, written informed consents were obtained from 103 eligible pregnant women. Data on demography was collected through a structured questionnaire and exposure was assessed through 6-items Version of U.S. Household Food Security Survey and cohort was followed until delivery, and birth weight was recorded. Follow up could be completed for 50 women only and respo...
Abida Sajid* and Aqsam Sajid
...erse pregnancy outcome especially in young girls. Anemia is a major public health problem. Around 58.27 million women worldwide are anemic during pregnancy 95% of whom live in countries that are developing. To know the frequency of anemia, and obstetric outcome in terms of preterm delivery, low birth weight and rate of caesarean section in young Primigravida. It was a cross sectional study, conducted in the department of Gynae & Obstetric unit 5 King Edwar...
Zahid Akram, Saif Ullah Ajmal, Ghulam Shabbir, Muhammad Munir and Nasir Mahmood Cheema
INHERITANCE MECHANISM OF SOME YIELD COMPONENTS IN BREAD WHEAT
...mprising promising genotypes was studied to analyze the inheritance pattern of yield components in bread wheat. The different yield related traits estimated were spike length, number of spikelets spike-1, number of grains spike-1, 1000 grain weight and grain yield plant-1. The analysis of variance depicted that 56 F1 and their parents were significantly different for all the parameters. Uniformity of Wr-Vr over arrays as well as significant deviation of regres...
Parvez Khaliq*, Muhammad Azim Malik** and M. Aslam Gill***
EFFECT OF CROPPING SYSTEMS, TILLAGE PRACTICES AND FERTILIZER TREATMENTS ON WHEAT STAND ESTABLISHMENT UNDER RAINFED CONDITIONS
..., mungbean-wheat, and cowpea-wheat system. Tillage practices (shallow and deep) and fertilizer treatments {recommended dose of fertilizer (F); fertilizer + manure (F+FYM); manure only (FYM) and control (C)} did not show significant effect on both emergence and emergence rate index. Overall, significantly (P<0.05) higher residual soil moisture content was available in fallow-wheat system which resulted in better wheat emergence. This ultimately resulted in v...
Muhammad Naeem Safdar, Khalid Naseem, Muhammad Amjad, Amer Mumtaz and Saeeda Raza*
...number, and minerals (copper, manganese, iron, zinc). It was observed that wheat samples varied considerably within each region and also between regions. Attock region samples had highest test weight (80.50 kg hl -1), protein (11.80 %) and lowest nonedible foreign matter (0.45%) and broken/shrunken grains (0.88 %). Highest wet and dry gluten (27.44 % and 9.29 %) while other damaged grains were observed lowest (0.47 %) in Lahore region samples. Test weight was ...
Golam Moula*
EFFECT OF SHADE ON YIELD OF RICE CROPS
...0.76 and 2.21 t ha-1, respectively. The yields of paddy of BRRI-32 in the shaded and un-shaded area were 1.83 and 3.63 t ha-1, respectively. The yields of green straw of Kazol Shail in the shaded and un-shaded area were 4.89 and 10.11 t ha-1, respectively. The yields of green straw of BRRI-32 in the shaded and un-shaded area were 7.61 and 14.17 t ha-1, respe...
S. M. I. Hossain*, S. U. K. Eusufzai and M. A. Rahman**
...xt-align: justify;">An experiment was conducted in Bangladesh Sugarcane Research Institute (BSRI) farm at Ishurdi during 2003-04 and 2004-05 cropping seasons to find out the effect of different irrigation levels on growth and yield parameters of six sugarcane varieties (Isd 16, Isd 30, Isd 31, Isd 32, Isd 33 and Isd 34). The experiment was laid up in two factors split-plot design with five irrigation levels in main plots and...
Muhammad Iqbal, Jalal-ud-Din*, Muhammad Munir** and Mohibullah Khan***
...antly in days to spathe opening. The M6 took significantly maximum time for spathe opening while the least time was noticed in M13. The significantly longest spathes were found in M10 whereas the M12 possessed spathes of maximum width. The greatest flower spike length was observed in M8. Male palms did not differ significantly in number of strands as well as number of flowers per spathe. T...
A. R. Rattu, M. Fayyaz, I. Ahmad, M. A. Akhtar* A. A. Hakro and K. A. Khanzada**
...re evaluated against stripe and leaf rust at multilocations in different agro-ecological zones of the country presenting hot spots for leaf and yellow rust along with artificial inoculation with prevalent pathotypes. These candidate lines were undergoing mandatory testing to develop varieties for irrigated and rainfed areas of Pakistan. Out of these 29 candidate lines, 9 were common to NUWYT 2003-04 and 2004-05. Three candid...
Saeeda Raza, Muhammad Naeem Safdar, Amer Mumtaz, Nouman Siddiqui, Khalid Nasim and Muhammad Amjad*
...ions. Four different recipes of baby foods were developed containing 50% cereals, 30% legumes, 10% vegetables and 10% nuts and seeds. Different processing methods cleaning, washing, germination of pulses, peeling, cutting and blanching of vegetables, drying, roasting, grinding and mixing of ingredients were used. Recipe “A” containing rice, m...
Naheed Akhtar, Azra Nasim*, Ata ul Mohsin**, Muhammad Ashfaque, Shaheena Yasmin, Ghulam Jilani, Afzala Tashfeen, Waseem Ahmed Gilani, Irshad Begum* and Muhammad Munir***
...lasm under study was grouped into three categories i.e., resistant, moderately resistant and susceptible. Data from seedling bulk tests showed that five wheat lines namely V- 01078, V-00055, KT-7, V-01180 and DN-47 were resistant with damage rating of 2- 3. Twelve wheat lines/varieties, 99B4012, 99B2278, V-9021, V-002493, Wafaq 2001, PR-84, TW0135, CT-00062, 7-03, PR-86, V-02192 and Chakwal 97 were found moderately resistant. Three wheat lines/varieties namely...
Raania Ahsan* and Zafar Altaf**
...evelopment, adoption and performance of Bt cotton against the background of monopoly pricing of its seed in Pakistan. The area under illegal Bt cotton is 80 % with nearly 36 unapproved varieties. Most of these varieties are Cotton leaf curl virus susceptible, poor in fiber quality and high input demanding unapproved varieties. Almost all these varieties employed Monsanto Cry1Acgene (MON 531) as it was not patented in Pakistan. A positive development was approv...
Mohammad Aslam*
...l for Pakistan since independence. The shortage in domestic production is met through imports for which valuable foreign exchange has to be earmarked. On the other hand, Pakistan has been a sizeable net exporter of rice. An effort has been made in the present paper to probe the possibility of attaining food autarky through a partial substitution of wheat with rice in the consumption plan of consumers. The study reveals that ...
Golam Moula* and Sayedur Rahman**
... Nash) over a five-month period (from mid July to mid November 2003) along with other phenological features. The total length (mean ± SD) of vetiver culms was 206.32 ± 42.43 cm. The root and shoot lengths (mean ± SD) of 8 weeks old seedlings were 3.93 ± 0.25 cm and 4.79 ± 1.29 cm, respectively. The fitted regression line equation for the root and shoot length was found as Y = 0.074 + 1.20 X...
Zaheer Ahmad, M. Yaqub Mujahid, M. Anwar Khan, Shaheena Yasmin, M. Asif and Maqsood Qamar*
...cutive years. The NR-268 performed better than all other lines including local check and gave 21.5% higher grain yield than check in Punjab and 8.3% higher yield on overall country basis during 2005-06; whereas, during 2006-07 it gave 26% higher grain yield than check in Punjab and 10.18% higher yield on overall country basis under rainfed conditions. On station agronomic trials of the line were also carried out. The variety possesses desirable characteristics...
Sidra Majeed, Shahid Ahmad*, Asif Ali Bhatti** and Ghazanfar Abbas***
...fertilizers for the same period were obtained for wheat productivity from the Farm Operations and Services (FOS) crop registers. Water productivity of barani organic desi wheat (C591) grown at NARC was computed using the data of last 10 years (1998-08), which revealed variation from 1.98 to 0.29 kgm-3 of seasonal rainfall. The correlation between seasonal rainfall and water productivity is very high (0.93). There is a strong...
Khalid Mahmood Aujla, Sajida Taj*, Khalid Mahmood** and Nadeem Akmal*
... main staple diet of the people of Pakistan. There were different views for wheat yield decline and crisis in the country during 2007- 08. To assess the wheat situation and compare wheat production practices to identify the major factors of yield decline, a national level field survey was conducted during June 2008 by Social Sciences Division, Pakistan Agricultural Research Council through its satellite institutes in the provinces. Total 238 wheat growers were...
Z. A. Soomro, M.B. Kumbhar, A.S. Larik*, M. Imran** and S.A. Brohi***
...iability among the genotypes for all the traits except sympodia/plant. Genetic parameters computed through variance components method show that all the traits were highly heritable in F2 and F3 generations except sympodia/plant, indicating quantitative pattern of inheritance, offering better chances of selection for these traits in F2 and F3 generations. The traits namely plant height, bolls/plant and seed cotton yield/plant displayed high heritability (72.97 ...
Muhammad Asim, Muhammad Asif, Muhammad Munir* and Muhammad Aslam**
...v. Williams-82 and its hypernodulating mutant, NODI-3. There was a significant difference in the percent uptake of 3H-ABA between the two varieties both in inoculated and uninoculated plants. A marked difference in the percent distribution of 3H-ABA between different parts of the plants was observed at different developmental phases of root nodules. Leaves of NODI-3 retained more radioacti...
Haq Nawaz Malik*, Iffat Ara**, Muhammad Naeem, Mozammil Hussain, M. Hanif Munawwar and M. Yousaf
...Eighteen hybrids and 13 open pollinated varieties of maize were evaluated at the National Agricultural Research Centre, Islamabad during kharif 2007. Significant differences were observed for days to 50% tasseling and silking, plant height, ear height, number of kernel rows per ear, number of grain per row, 100 grain weight, grain moisture and grain yield. The hybrids NT-6622 and NT- 6651 ...
S.A. Khan*, M.M. Rahman Jamro** and M.Y Arain***
...Potato Seed (TPS). The experiments were conducted to determine the suitable planting geometry for better yield from TPS mini tubers during autumn 2006-2007 and 2007-2008. It was revealed that even small size (5- 20g, 20-30g) tubers planted at closer row and plant spacing (60cm x 15cm,70cm x 15 cm) produced 31.00%, 31.33% and 28.33%, 32.33% medium size tubers (35-55 mm size). Whereas wider spacing (70cm x 20cm, 50cm x 20cm) produced relatively higher number of ...
Mohammad Siddique Munawar, Shazia Raja, Elizabeth Stephen Waghchoure* and Muhammad Barkat**
...economic losses to beekeepers. All work was undertaken in a commercial apiary that showed visual signs of AFB infection. Twenty four hives positive for AFB were identified from the apiary (4 colonies in each replicate). Half of the colonies were treated with shook swarm method while other half were left without any treatment. The treated colonies showed significant difference from untreated colonies (t test, P< 0.005) and moribund colonies got recovered wit...
Aneela Afzal, Tanvir Ali, Munir Ahmad, Humera Amin and Samina Saki*
...gricultural activities especially crop related involvement in the district Okara, Punjab, Pakistan. A multistage random sampling technique was used to collect the data from 480 respondents from three tehsils of the district. The results show that a vast majority of women were illiterate, having annual family income less than one lac, living in joint family system and having small land farms. A large proportion of the respondents reported that they remained eng...
Hassnain Shah, Hina Riaz, Nadeem Akmal , Muhammad Sharif* and Abdul Majid**
...to be 11.3% and 51.8% respectively. Pakistan accounts for 143 million animal heads in 2006. However, livestock population and fodder production are inversely related. The fodder area per adult animal unit has significantly declined from 0.067 ha to 0.035 ha and production declined from 1.31t to 0.80t from 1986 to 2006. Inadequate nutrition is one of the major constraints limiting livestock production in the country. Feed acc...
Babar Hussain*, Muhammad Ashfaq**, Mazher Abbas***, Khalid Mahmood**** and M. Ather Mahmood***
...her there exist market imperfection, which may justify government intervention. This study used the monthly wholesale price (Rs. / 40 kg) data from January 1991 to December 2006 of gram, in logarithmic form and empirically estimated the degree of integration in gram markets of Pakistan using co-integration analysis. Co-integration results show that all gram markets are highly co-integrated in the long run. The high degree of market integration observed in this...
Liaqat Ali Shahid, M. Azhar Saeed and Nadeem Amjad*
... on which government is spending billions of rupees in foreign exchange. It is imperative to mention that the efforts made so far at federal and provincial levels to increase the production of oilseed crops are not fruitful. This crop sector remained neglected for the last two decades due to mainly unfavourable edible oil import policies. Three main institutions/organizations namely Oilsee...
R. Hussain* and A. N. Naqvi**
...e belly and most of the specimen have brown strip from temple to nostrils on both sides. It is a pashmina bearing breed. The breed was studied for morphological characteristics, somatometric measurements, growth, productive and reproductive traits. Somatometric measurements indicated the average height 70.41±0.837 cm vs. 57.91±0.342 cm, heart girth 83.58±0.628 cm vs. 70.42±0.702 cm and body length 78.18±0.355 cm vs. 70.10&plu...
Zafar Khokhar*, Imtiaz Hussain**, Badruddin Khokhar* and Muhammad Sohail**
...o reduction in tillering period and increased risk of hot weather during grain filling, late planting results in linear reduction in wheat grain yield. A study was undertaken to determine the effects of planting dates on growth and yield of different wheat genotypes in Sindh. The trial was laid out in RCBD with split plot arrangement having four replications during 2000-01 and 2001-02 at Sakrand, Sindh. Four sowing dates i.e...
Badaruddin Khokhar*, Imtiaz Hussain** and Zafar Khokhar*
...of different wheat genotypes in the province of Sindh. The trial was laid out in split block design at Wheat Research Institute, Sindh, Sakrand, in which four irrigation treatments I3 (irrigation at crown root, booting and soft dough stage), I4 (irrigation at crown root, tillering, booting and soft dough stage), I5 (irrigation at crown root, tillering, booting, anthesis and soft dough stage) and I6 (irrigation at crown root, tillering, booting, anthesis, soft ...
Rahmat Ullah Khan, Abdur Rashid*, Mohammad Sohail Khan** and Erdogan Ozturk***
...nable basis has become imperative. Two field experiments were conducted to study the potential of humic acid (HA) as a low-cost natural fertilizer and to determine its effect on the yield of rainfed wheat crop (Triticum aestivum L. cv. Naseer) at the research farm of Arid Zone Research Institute, Dera Ismail Khan during two successive winter seasons, 2007-08 and 2008-09. The treatments consisted of HA alone (3 kg ha-1 or 1.5...
Aslam Memon, A. M. Khushk* and Umer Farooq**
...ills for assessing the types of varieties performing better, relative to others. The study document the extent of adoption of recommended sugarcane varieties in Pakistan. The study was based on the primary data collected through a formal survey of sugarcane growers in the different agro-ecological conditions in three provinces of Pakistan during 2007-08. The major study findings showed that nearly one-fifth of total farm are...
Mazher Abbas*, Muhammad Waqas Akram**, Ikram Saeed*** and Arshed Bashir*
...d Rs. 39868.80 acre-1 respectively. Average of net income by small, medium and large farmers was Rs. 21194.59, Rs. 20608.26 and Rs. 19956.50 respectively. Benefit cost ratio for small, medium and large farmers was 2.44:1.00, 2.08:1.00 and 2.00:1.00 respectively. The study revealed that canola production in Central Punjab is profitable enterprise. However, the profitability of canola at sma...
Abdullah Adil Ansari* and Kumar Sukhraj**
...s monitored during the experiment along with plant growth parameters of Okra. The study revealed that combination organic fertilizers vermicompost and vermiwash combination [VW+VC] compared with control [CON] and chemical fertilizers [CHM], had great influence on plant growth parameters. The average yield of Okra during trial showed a significantly greater response in VW+VC compared with the control by 64.27 %. The fruits have a greater <...
S. Shahid Shaukat*, Mian Sayed**, Aly Khan, M. Azhar Khan* and Babar Qazi***
...ation of three nematode species associated with guar (Cyamopsis tetragonoloba) and the yield of guar were investigated. The chemical nematicides and plant extracts significantly reduced the population densities of all three nematodes. Carbofuran was most effective against all the nematodes. Apart from other three treatments, Tridax procumbens emerged as an effective phytonematicide. Helicotylenchus indicus, Rotylenchulus reniformis and Meloidogyne incognita ha...
Aly Khan* and S. Shahid Shaukat**
...nate. The most dominant species was Meloidogyne incognita. Species diversity (H’) was highest in Wadh while lowest in Ali Dasht. Equitability (J’) component of diversity was highest in Kork and lowest in Ali Dasht, while species richness (d’) component was highest in Alat. The soils associated with Pomegranate orchards were coarse-structured, alkaline with low maximum wat...
Abid Hussain*, Imdad Hussain Mirza and Muhammad Azeem Khan**
...fy;"> Goats have helped people to survive and thrive for countless generations. Proper feeding and management is of fundamental importance to the success of any goats’ enterprise. In Pothowar region of Punjab, household and sedentary system of goat production is practiced. The availability of feed varies according to the season. Goats in the region are under nourished and produc...
Nadeem Akmal, Hassnain Shah*, Muhammad Azam Niazi** and Waqar Akhtar*
...fy;"> The present paper is based on the assessment of goat breed improvement intervention through supply of 65 Beetal bucks in rainfed Pothwar. To judge short term impact and assessment, a survey was carried out of both buck holder and non-holder beneficiaries in six project tehsils, after one year of buck distribution. Data were collected from a sample of 38 buck holders and 31 beneficiary farmers using a structured pretested questionnaire. The main infl...
Muhammad Azam Niazi*, Hassnain Shah, Waqar Akhtar and Nadeem Akmal**
...for the overall economic performance of a country. In this paper the terms of trade (1991-2003) for Pakistan’s crop sector have been worked out to reveal how the sector has performed over time in terms of profitability. Various indices were worked out to view the profitability from different angles using weights, giving due importance to all the contributing factors. The results reve...
Sumia Bint Zaman, Sidra Majeed and Shahid Ahmad*
...sp;Globally resources of petro-fuels are diminishing at a rapid rate. Efforts are underway to develop sources of bio-fuels. Out of the known sources of bio-fuels, Jatropha is one of the most promising option. The purpose of this study was to evaluate primarily the regional and global experiences to assess the potential of Jatropha farming in Pakistan and to conduct a comparative economic analysis of alternate feasible option...
Ahmed Aziz Kurd, Amanullah, Saifullah Khan, Basharat Hussain Shah and Munir Ahmed Khetran*
...tings of olive (Olea europea) variety Coratina with 2–4 leaves and 15–18 cm in length were obtained from existing progeny in an orchard of Arid Zone Research Centre (AZRC), Quetta, Pakistan. The basal portion of these cuttings were treated with 3000, 4000 and 5000 ppm IBA solution for 3- 4 seconds. The treated cuttings were immediately planted in polyethylene tubes (10 cm x 20 cm) filled with a sandy loam soil. In the control, the cuttings were pla...
Tariq Mahmood, M. Sudheer Tariq, Khalid Mahmood Khokar, Hidayatullah and Syed Ijaz Hussain*
... leaves) and insecticide permethrin dust alone or mixed with dung, were conducted against red pumpkin beetle in the field at National Agricultural Research Centre, Islamabad during kharif 2008. Permethrin (0.5%) alone or mixed (0.05%) with dung ash as dust controlled the attack of red pumpkin beetle on the crop with no mortality of plants. Highest mortality of plants due to foliage eating by red pumpkin beetle was observed in control where no
Oguz Bilgin, Kayihan Z. Korkut, Alpay Balkan, and Ismet Baser*
..., and to investigate the performance and relationship of F1 hybrids and parents for the spike characters and to select suitable parents and population for designing an effective wheat breeding programme. Highly significant genetic variability was present in parents and their genetic combinations for the characters. The degree and direction of heterosis varied for different characters and for different hybrids. The highest heterosis over mid and better parents ...
Barkat Ali*, Muhammad Shahid Iqbal, Muhammad Kausar Nawaz Shah, Ghulam Shabbir** and Nasir Mahmood Cheema***
... hirsutum L.). Six genotypes viz., BJA-592, ACALA-SJ-4, 4-F, CP-15/2, CIM-497 and PB-899 were included in diallel crosses. Results revealed that over-dominance type of gene action was controlling the inheritance of monopodial and sympodial branches plant height number of bolls and boll weight. The line CP-15/2 possessed maximum dominant genes for monopodial branches, plant height and boll weight, BJA-592 for sympodial branch...
Ghulam Shabbir*, Muhammad Aftab, Abid Mahmood** Muhammad Kausar Nawaz Shah* and Nasir Mahmood Cheema***
...g was carried out by the pedigree method and the elite line was evaluated for its yield potential in various yield trials conducted at BARI, Chakwal from 1994 to 1998. Based on the desirable phenotypic traits and superior seed yield, SPS-5 was approved as a rapeseed variety “Chakwal Sarson” by the Punjab Seed Council in 2002 for general cultivation in the Punjab barani tract.
M. Yasin Mirza, Mubashir A. Khan, M. Akmal, Akbar S. Mohmand, Malik S. Nawaz, Nazakat Nawaz and Najeeb Ullah*
...ferences among the genotypes in three seasons were statistically significant for plant height, number bolls plant-1, 1000-seed weight and seed yield hectare-1. These studies were conducted at National Agricultural Research Centre, Islamabad, Pakistan during rabi 2002-03, 2003-04 and 2004-05. Pooled genotypic and phenotypic variances were maximum for seed yield and minimum for 1000-seed weight. Genotypic coefficient of variation and phenotypic coefficient of va...
Shazia Erum, Rashid Anwar and Shahid Masood*
...h other Trigonella genotypes by SDS-PAGE. Results showed that at protein level Kasuri methi acquired a unique status as a G.I of Kasur. Cluster analysis (UPGMA) of 28 genotypes including both methi and methray from various agro ecological zones of Pakistan were interlinked to some extent however Kasuri methi make their identity by standing alone among tested genotypes on the dendrogram, du...
Ashiq Saleem, Habib Iqbal Javed, Rashid Saleem,* Muhammad Ansar** and M. Amir Zia*
...row was 75 cm. A field experiment was conducted to investigate the effect of split doses of potash fertilizer on maize and sorghum. Potash fertilizer was applied @ 0, 60 and 120 kgha-1 K2O as single, two split and three split doses at planting, after one month and after two months of planting. The experiment consisted of seven levels (0, 60, 30 + 30, 20 + 20 +20, 120, 60 +60 and 40 + 40 + 40 kgha-1). Grain yield in maize and...
Sarfraz Ahmad, Shaista Koukab, Nayyar Razzaq, Muhammad Islam, Aneel Rose*, and Muhammad Aslam**
...ng. Traditionally these species are used for the treatment of fever and pain. Annual or German chamomile (Matricaria recutita L.), and perennial chamomile (Chamaemelum nobile) are the most important species all over the world due to multipurpose uses. Field experiments were conducted at Arid Zone Research Centre, Quetta to evaluate the growth and product...
Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*
...present study different species of Ocimum (Ocimum basilicum and O. sanctum) were collected from different agro-ecological zones of the world and compared for their phenotypic (qualitative and quantitative) and biochemical trait. Comparatively high variation was seen for seed germination, canopy and spikes/plant, florets/spike and leaf area. A UPGMA cluster, grouped the 9 Ocimum genotypes i...
Rahila Nazli, Tehmina Sohail, Bushra Nawab and Zahra Yaqeen*
...s also extended to some species of fungi. Results showed that the activity was more pronounced against gram +ve organisms and fungi. Maximum inhibition activity was calculated against all the groups of organisms, which was between 0.5 and 1mg ml-1 against bacteria and 2.5 mg ml-1 against fungi. It is therefore concluded that G. sepium provide a lead towards the exploration of new antimicrobial agent....
Zaheeruddin Mirani*and Aslam Memon**
...s designed to assess the performance of farm advisory services of agricultural extension and pesticide/fertilizer companies. The most important finding of the study was the fact that farmers were not receiving new agricultural information from agricultural extension as most of the farmers were not visited. This entails the fact that farmers are not alone responsible for non-adoption of improved practices. Pesticide/fertilize...
Muhammad Azeem Khan*, Abid Hussain, Irfan Mehmood and Sonila Hassan **
...crease in mean annual temperatures and irregular rain patterns, area under major crops at Kohat and productivity of major crop at Attock decreased. Bivariate correlations between mean seasonal rainfall, area and production of major crops were moderately positive and statistically significant (except for wheat crop at Attock). This means that an increase in rainfall contribute positively towards area under major crops and their production and vice-versa. Farmer...
Rubina Bano, Hassnain Shah, Muhammad Sharif and Waqar Akhtar*
... profitability index of open house broiler farms and is based on the survey of 40 broiler farms in district Rawalpindi. The analysis covers the descriptive analysis of socioeconomic characteristics of the sample poultry farmers along with cost and profitability analysis. Broiler farming was done by adult males on full time basis. It was the main source of income of a family. The average flock size in the study area was 4033 birds. The study also bifurcates the...
Farhan Ahmed, Hassnain Shah, Irum Raza* and Abdul Saboor**
...: justify;"> This paper forecasts milk production in Pakistan using time series data from 1990 to 2010. ARIMA (p, d, q) model is considered for estimation where ‘p’ is the order of the autoregressive process; ‘d’ is the order of the homegeneity and ‘q’ the order of the moving average process. Presence of trend in data was checked through time series plots and stationarity through auto correlation and partial auto correl...
Muhammad Afzal, Sarfraz Ahmad , Abdul Salam Baloch* and Qazi Bashir Ahmad**
...and severe feed shortage period. The prices were the highest at Eid-ul - zha followed by Ramadan and feed shortage (winter) season. The explanatory power of the model was considered adequate as the factors included in the model accounted for 76% of the price variation at Quetta market. Producers should consider major marketing demand events like Eid-ul-Azha, Ramadan, etc. as the exceptional occasion to put up their animals for sale. The price
Muhammad Athar Khan1, Muhammad Zahid Latif2*, Syed Amir Gilani3 and Ifrah Bukhari4
... slaughtering, owners of pet shops, farm workers, handlers of meat, sewerage and agriculture workers. Leptospirosis affect multiple organs in human body and may lead to myocarditis, renal failure, respiratory distress and hypotension. This disease is an emerging infectious problem in many developing countries like Pakistan. A total of 250 subjects were selected from five different rice growing districts of Punjab, Pakistan after the approval of institutional e...
Mian Sajjad Ahmad1, Somia Iqtadar1, Sami Ullah Mumtaz1*, Zafar Niaz1, Iqra Waheed2 and Sajid Abaidullah1
...mp; is associated with hyperglycemia and insulin resistance. To determine the frequency of impaired glucose tolerance in obese patients. This Cross Sectional study was carried out in North Medical Ward, King Edward Medical University/ Mayo Hospital Lahore for 6 months i.e. January to June 2014. Total 160 obese patients visiting outpatient department of North Medical Ward, Mayo Hospital Lahore for 6 months were included by non-probability purposive sampling. Pa...
Sana Qanber Abbasi1*, Ejaz Ahmed2 and Rabia Sattar1
...iovascular pathologies especially those involving left ventricular dysfunction which may depict a probable association between migraine and CVD. To compare the levels of serum pro Brain natriuretic peptide (pro BNP) between migraineurs and hypertensive migraineurs. It was a cross sectional comparative study in which serumpro BNP levels were measured in migraine patients and hy
Halima Shoukat1*, Hafiz Sheraz Arshad2, Faiza Sharif1, Arooj Fatima1 and Filza Shoukat1
...nee, hip and spine. Long persistent tightness results in pain, decreased range of motion and others pathologies in knee joint. Stretching techniques are used to treat muscle tightness. In clinical settings, different stretch holding times are used to treat hamstring tightness. The purpose of the study was to determine effects of different static stretch holding-times on hamstring muscles flexibility and their impacts on improving range of motion (ROM) of knee ...
Maryyum Khalil1, Hamda Azmat1,*, Noor Khan1, Arshad Javid2, Ali Hussain1, Syed Makhdoom Hussain3, Asim Ullah1 and Sumaira Abbas1
...se) added feed on growth performance, health and hematological analysis of Pangasianodon hypophthalmus (initialaverage weight 32.46±0.36 g). The 40% crude protein diet was prepared by adding feed ingredients along with 0.75, 0.50, 0.25, 0.00 g kg-1 of α-amylase as T1, T2, T3 and T4 (control). At the end of feeding trial, 100% survival rate was recorded. Growth rate was significantly increased in fish fed with enzyme supplemented ...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...IBV) recovered from a suspected case of avian infectious bronchitis from commercial poultry. Initially the isolated IB-virus was characterized by RFLP using enzymes Alu I, Hae III, BstYI and XcmI. On the basis of its distinct RFLP pattern from other known IBV vaccine strains, the isolate was named as KU145467_NARC/786_Pakistan_2013 (also named as Pak-786) was subjected to Spike gene sequencing covering the amino-terminus region of 01 to 974 base pairs. The S p...
Promy Virk
... rats was assessed for a period of 7 weeks. Metformin was used as a standard drug. The results of Zetasizer and Transmission and Scanning Electron Microscopy images showed the presence of spherical to irregularly shaped green gold and silver (Au/Ag) nanopcomposite with an average size of 73.18 nm with polydispersity. A typical optical absorption peak at ...
Abul Hassan Faiz*, Fakhar-i-Abbas and Lariab Zahra Faiz
...ect technique in eight types of soil (sand, loamy sand, sandy loam, sandy clay loam, loam, clay loam, silt loam, silty clay loam) to determine six soil properties (plant biomass, saturation, electrical conductivity, pH, organic matter, phosphorus and potassium) in Pothwar Plateau (250 km long and 100 km wide). We compared 216 soil samples (mound soil and undisturbed soil), to collect data on pe
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2
...nzymes of a stored grain pest, Tribolium castaneum and a socioeconomic insect, Apis mellifera. A comparative study was designed to identify the role of saponins on insect acetylcholinesterase (AChEs). The enzyme activities were tested for the effect of saponins. The AChE activity of T. castaneum was inhibited by the saponins and follows competitive inhibition kinetics. In case of A. mellifera enzy...
Nazish Shaukat1, Muhammad Javed1,Faiza Ambreen2* and Fariha Latif1
...tion of reactive oxygen species (ROS) which ultimately leads to tissue damage and oxidation of biomolecules. Aquatic organisms possess antioxidant system to cope with the oxidative stress. This research was conducted to see the effect of lead on peroxidase activity (antioxidant enzyme) in the gills and liver of Labeo rohita. Experiment was conduct...
Haixia Liu, Yuwei Ye, Yang Li, Xiaolin Liu, Dongmei Xiong* and Lixin Wang
...phic loci. The average expected heterozygosity (He) and observed (Ho) heterozygosity in four populations ranged from 0.6421-0.6980 and from 0.4841-0.6999. Significant deviations from Hardy–Weinberg were found in the four populations at some loci. Analysis of molecular variance (AMOVA) revealed that relatively little (11.02%) genetic diversity came from individual among population. In contrast, the majority of diversity (88.98%) occurred amo...
Muhammad Zafarullah Khan1*, Rehmat Ullah1, Asif Nawaz1 and Ejaz Ashraf2
...to investigate about the performance of Farm Services Centers in the empowerment of farmers towards the sustainable development. Five districts of Khyber Pakhtunkhwa such as Mansehra, Dir Lower, Swat, Dera Ismail Khan and Swabi were the sampled districts and 80 farmers registered with Farm Services were randomly selected from each district. Thus, sample size was making a total of 400 respondents. Primary data were collected with the help of pre-tested intervie...
Anish Shrestha
...st, migration cost and expenditure on sugar drug and comb foundation seems to have positive and significant relation with gross return. All of them appeared to be underutilized and needed to be increased by 39%, 74% and 34% respectively for the profit maximization. Main production problem found to be high cost and inadequate availability of modern equipment with the index score of 0.81. An...
Asad Sultan1, Sahal Ahmad1, Sarzamin Khan1, Rifat Ullah Khan2,*, Naila Chand1, Muhammad Tahir3 and Shakoor Ahmad2
...oups in thermoneutral temperature (TN) and three dietary groups under high temperature. One group of birds received a basal diet only (control group), second group of birds received a diet supplemented with silymarin at the level of 10g/kg and third group of birds received a diet supplemented with ZnO at the level of 60 mg/kg in both TN and HS birds. It was found that supplementation of ZnO significantly (P<0.05) improved...
Mustafa Sahin1,*, Esra Yavuz1 and Fatih Uckardes2
... (X3), and shape index (X4). The impact of these variables on albumen index was analyzed. Due to the multicollinearity between independent variables, the standard errors and VIF values of the partial regression coefficients in the LS method were found to be quite high. Therefore, the RR and PCR methods were used as an alternative to LS. Compared with LS, PCR and RR led to small standard deviations and m...
Irfan1,*, Arshad Javid7, Muhammad Ashraf2, Athar Mahmud3, Muhammad Altaf4, Syed Makhdoom Hussain5, Muhammad Shahbaz4 and Khalid Javed Iqbal6
...ecorded and hatchability percentages of the artificially inseminated hens were assessed. To study the effect of natural mating on hatchability 15 (3♂, 12♀) M. gallopavo were randomly selected, were kept separately and were allowed to mate through stud mating. For artificial insemination, male (n = 3) and female (n = 12) birds were kept separately. Semen of the male birds was collected on weekly basis to record morphological characteristics a...
Jaime Molina-Ochoa1, 2, 6,*, Edelmira Galindo-Velasco2, Ana María Rosales-Gutiérrez2, Martín González-Ramírez3, Roberto Lezama-Gutiérrez3, Wilberth Chan-Cupul3, Steven R. Skoda4, Muhammad Irfan Ullah5, Luis Jorge García-Márquez2 and John E. Foster6
...erile distilled water dispensed on the surface of a couple of moistened filter papers. For each treatment concentration, 10 adult engorged ticks were placed in the Petri dishes, and each treatment was replicated four times; the experiment was replicated two times. Tick mortality was recorded daily for 9 days. Our EPNs were able to parasitize engorged ticks, and tick mortality ranged betwee...
Hina Safdar1,*, Nazir Javed1, Sajid Aleem Khan1 and Muhammad Arshad2
...ed upto four days. Both species of entomopathogenic nematodes proved effective against all larval instars. Maximum mortality was observed in 2nd and 5th larval instar. After the fourth day 100% mortality was observed in all larval instar. Mortality was increased with an increase in exposure time. Nematodes were harvested using White Traps. Multiplication of entomopathogenic nematodes was also recorded in all larval instar. The maximum num...
Saleem Abid1*, Nasir Jamal2, Muhammad Zubair Anwar3 and Saleem Zahid4
...ors namely mean absolute percentage error (MAPE), mean absolute deviation (MAD) and mean squared deviation (MSD) were used as model selection criteria. Lowest values of these errors indicated a best fitting model. The study showed that exponential growth model was appropriate for forecasting potato area and production in Pakistan due to lowest values of the forecasting errors. The forecast...
Umair Riaz*1, Zafar Abbas1, Qamar uz Zaman2, Muhammad Mubashir1, Mahwish Jabeen2, Syed Ali Zulqadar1, Zeenat Javeed1, Saeed-ur-Rehman1, Muhammad Ashraf1 and Muhammad Javid Qamar1
...rious physic-chemical properties like pH, electrical conductivity (EC), sodium adsorption ratio (SAR), residual sodium carbonate (RSC), calcium (Ca++), magnesium (Mg++), sulfates (SO4-), carbonates (CO3-), bicarbonates (HCO3-), sodium (Na+), and chloride(Cl-). Results showed that 52.78% samples were unfit and 34.37% samples were considered as fit for i...
Naveed Akhtar,1,* Riaz Muhammad2, Kausar Saeed2, Muhammad Fiaz Khan1, Muzaffar Shah3, Jehan Zeb2, Shahid Ahmad2, Azam Jan Afridi4 and Aftab Hussain5
...this study 10 different species belonging to 9 families, 5 orders and 10 genera of mammalswere identified. The reported species are Naemorhedus goral, Panthera pardus, Sus scrofa, Lepus nigricollis, Macaca mulatta, Canis aureus, Vulpes vulpes, Myotis myotis, Herpestes edwardsii and Hystrix indica. ...
Xia-Lin Zheng1, Pan Wang2, Jun-Yan Liu1, Yu-Jing Zhang1, Jun Li1 and Wen Lu1,*
...an City.
...
Muhammad Rasool1,*, Muhammad Zahid1, Muhammad Ismail Khan1, Qadeem Khan2 and Khalid Khan1
...of already reported subtype “adr4”. This sample showed 1.2 to 20% variation with the other reported sequences. Nucleotide sequence of the Pre-S2 region of the second sample MR03 does not show 100% homology with any of the reported sequences. It differs 2.4 to `18.8 % from the other reported sequences. Further it was established that MR02 and MR03 nucleotide sequences differ from one another at four positions, all substitutions. The first difference...
Lin Wang1,2, Ye Gong3, Kelin Chen1, Haitao Wang3 and Xianguo Lyu1,*
...is listed as vulnerable species by IUCN. For improving the research on conservation of this species, we tested the cross-species amplification of 90 microsatellite loci developed for eight other species. Eleven out of them were successfully amplified and polymorphic with 2-10 alleles. The observed heterozygosities rang...
Qin Liu1,2, Feiwei Liu1, Xiuyue Zhang1, Nan Yang1 and Jianghong Ran1,*
...nyii) is an endemic species which is protected in first-grade state in China. Here, 22 polymorphic tetranucleotide microsatellite markers were isolated from T. szechenyii using a next-generation sequencing technology. The allele number of these loci ranged from two to six in genotyped 35 individuals. Polymorphism information content ranged from 0.2735 to 0.7717 with an average of 0.5149. Observed and ex
Akhlaq Ahmad, M. Anwar Arain*, Rahila Nazli**, Syed Anser Rizvi***,
Mubarik Ahmed* and Farzana Ibrahim****
Corresponding author: dr.akhlaqahmad@yahoo.com
COST EFFECTIVENESS OF UNDER-SHEET AND WHOLE GODOWN FUMIGATION OF BAGGED WHEAT
...e in stored grain insect pests in Pakistan is the result of whole godown improper fumigation of bagged wheat over the past several years. Trials were conducted in 338 godowns in 8 districts of upper Sindh. Out of these, 169 godowns were selected for fumigation with phosphine inside and under polyethylene sheets, while the others for indoor space fumigation in godowns without covering wheat...
Arshed Bashir *, Shamsheer-Ul-Haq**, Mazher Abbas*, M. Aamir Munir** and Aneela Afzal***
Corresponding author:ssrifaisalabad@gmail.com
IMPACT OF SUGARCANE MILLS DEVELOPMENT ACTIVITIES ON CANE PRODUCTION IN PUNJAB
...eneficiary farmers were operating significantly larger land holdings. Area under new high yielding, with more sugar recovery varieties was relatively higher at beneficiary farms as compared to non-beneficiary farms. The beneficiary farmers were getting higher returns from sugarcane production (fresh and ratoon crops) as compared to non-beneficiary farms. Inclusion of small and medium farmers in the sugar mills development activities is recommended to meet the ...
Nazakat Nawaz, Malik Shah Nawaz*, Nasir M. Cheema** and Mubashir A. Khan*
Corresponding author:nazakat_nawaz@yahoo.com
ZINC AND IRON APPLICATION TO OPTIMIZE SEED YIELD OF MUSTARD
...and -1 -1 5-3 kgha ), respectively. A basal dose of 90N and 60P kg ha was applied, in the form of Urea and triple super phosphate (TSP) with Zn and Fe. The increase in -1 Zn and Fe fertility from 0-1.5 to 5-1.5 kg ha increased yield of BARD-1. The maximum yield response was recorded when 5 kg ha-1 -1 Zn and 1.5 kg ha Fe were applied. Beyond this level, no further increase in yield was recorded in any mustard traits. A positi...
Parvez Khaliq*, Muhammad Azim Malik**, M. Aslam Gill*** and
Nasir M. Cheema*
Corresponding author: parvezkhaliq786@yahoo.com
EFFECT OF TILLAGE AND FERTILIZER TREATMENTS ON MAIZE FODDER YIELD UNDER RAINFED CONDITIONS OF PAKISTAN
...height, number of leaves per plant and maize fodder yield enhanced, with the application of RF+FYM. However, the effect of FYM+RF and recommended dose of fertilizer was statistically non-significant and on average basis RF+FYM treatment -1 produced higher green fodder (19971.5 kg ha ) than fodder yield of 18349.1 kg -1 ha produced by applying recommended dose of fertilizer. However, green fodder yield produced with these two fertilizer treatments were signific...
Shazia Erum*, Muhammad Naeemullah and Shahid Masood**
Corresponding author: shazia_rm@yahoo.com
PHENOTYPIC VARIATION AMONG MENTHA SPP.
...tionship within 17 genotypes of mentha species. Different species of Mentha were collected from different ecological zones of the world. Great variation was observed in stem length with the coefficient of variation of 198.7% and standard deviation of 14.1. Among the 17 mint collection, nine special aromas was smelled including mint gum, strong camphorace...
Farhat Ullah Khan, Nowshad Khan and Zaibunnisa Abdullah*
Corresponding author: farhatkhan7@gmail.com (This is part of Ph.D. work of senior author)
IMPACT OFKINNOW (MANDARIN) YIELD LOSSES ON SOCIOECONOMIC CONDITIONS OF THE FARMING COMMUNITY IN PUNJAB, PAKISTAN
...terview schedule. Simple percentage and chi-square techniques were used for analysis. According to analysis 91.5% respondents reported that yield losses of kinnow fruits have negative impact on socio-economic conditions of the majority respondents of the project area. Chi-square test also shows negative link of the kinnow fruits and socio-economic uplift of the farming community in the project area. Serious attention on scientific basis to yield losses through...
Javid Iqbal, Asghar Ali Mian, Tanveer Ahmad*, Shamsul Hassan** and Sohail Hassan Khan*
COMPARATIVE PERFORMANCE OF DIFFERENT ECONOMIC TRAITS OF FOUR IMPORTED BROILER STRAINS UNDER LOCAL CONDITIONS OF PAKISTAN
...initiated to compare the performance of economic traits of four internationally reputed broiler strains, imported in Pakistan, under the local environmental and management conditions. A total of 360 day old chicks of four broiler strains (90 from each strain) were procured from the local hatcheries and designated as four treatments i.e., A (Hubbard), B (Arbor Acres), C (Ross 308) and D (Hybro PN). The chicks were raised under recommended rearing requirements f...
Shahida N.Khokhar*
CROP INOCULANTS- AN UNDEREXPLORED POTENTIAL IN AGRICULTURE
...fe. Bioinoculants are in perfect harmony with the concept of Evergreen Revolution. They have the potential to improve value cost ratio (VCR) of agricultural production. Pakistan faces increase in degraded lands, water shortage, energy crisis, all contributing to poverty. During last two decades, many efforts were made to address the issue through developing and applying the inoculants. Several research institutions including National Agricultural Research Cent...
Hassnain Shah, Muhammad Azeem Khan, Umar Farooq, Nadeem Akmal*, Shahid Munir and Bashir Hussain**
POTENTIAL FOR INVESTMENT IN INDIGENOUS TECHNOLOGIES: A CASE OF LOW COST SOIL AND WATER CONSERVATION STRUCTURES IN RAINFED POTHWAR, PAKISTAN
... the livelihood of rural people even hard. Soil and water conservation under such an environment could provide the foundation for agricultural and natural resource development. To develop appropriate technologies for increasing land productivity through soil and water conservation, applied research has been carried out during 2001-07 in the rainfed Pothwar area. Low cost soil and water conservation structures were developed ...
Muhammad Arifullah, Muhammad Munir*, Abid Mahmood**, Saifullah Khan Ajmal and Ghulam Shabbir*
COMBINING ABILITY ANALYSIS OF SOME YIELD ATTRIBUTES IN INDIAN MUSTARD (BRASSICA JUNCEA L.)
...sp;Eight promising genotypes were crossed in all possible combinations using 8×8 diallel system for combining ability analysis. Data was recorded for seed yield and some important yield attributes. The results for combining ability analysis indicated significant general combining ability for most of the traits except plant height and siliqua length. UCD-8/4, KJ-119 and BRS-2 were good general combiners for yield related traits. A cross BRS-2 × UCD-...
Mazher Abbas*, Tahir Mehmood**, Arshed Bashir*, Muneeb Zafar*** and Aneela Afzal****
ECONOMICS OF LALLEMANTIA ROYLEANA (TUKHAM-EBALANGOO) PRODUCTION IN THE LOW INTENSITY CROPPING ZONE OF THE PUNJAB, PAKISTAN
...and Rs. 55247.73 acre respectively. Average net income by small, medium and large farmers was Rs. 25281.02, Rs. 28734.98 and Rs. 28763.83, respectively. Benefit cost ratio for small, medium and large farmers was 2.34:1.00, 2.21:1.00 and 2.09:1.00 respectively. Cultivation of L. royleana in Punjab is profitable enterprise. Because of low cost of production the profitability of L. royleana a...
Faisal Khalil, Khalid Mahmood Qureshi, Ammaz Khan, Fakhar-ul-Hassan and Nabila Bibi*
EFFECT OF GIRDLING AND PLANT GROWTH REGULATORS ON PRODUCTIVITY IN OLIVE (OLEA EUROPAEA)
...r coupled with girdling operations may improve cropping potential of existing olive varieties in Pakistan. Therefore, this study was envisaged on olive trees to explore possibilities of inducing fruitfulness through the use of hormones and girdling operations under Islamabad conditions. Treatments consisted of control, girdling and spray of gibberellic acid, salicylic acid and naphthalene acetic acid @ 30 ppm, 250 ppm and 60...
Khalid Mahmood Qureshi, Fakhar ul Hassan, Qamar ul Hassan, Usman Shaukat Qureshi, Saman Chughtai and Adnan Saleem*
IMPACT OF CULTIVATION SYSTEMS ON GROWTH AND YIELD OF STRAWBERRY (FRAGARIA ANANASSA) CV. CHANDLER
...(T ), 1 2 3 4 including open field condition on ridges (T ) by keeping plant to plant 5 distance of 30 cm and row to row distance of 60 cm. The study was conducted to evaluate the effects and suitability of different cultivation systems for better vegetative growth, production and fruit quality of strawberry. The results of cultivation systems on different vegetative traits i.e., plant height, number of leaves, leaf area, fresh and dry weights of leaves, crown...
Waseem Ahmad Gillani* and Mike Copland**
INFLUENCE OF THREE CONSTANT AND TWO RHYTHMICALLY FLUCTUATING TEMPERATURE REGIMES ON THE LIFE-TABLE PARAMETERS OF BROWN LACEWING SYMPHEROBIUS FALLAX
...thmically fluctuating temperature regimes from 16°C to 24°C and 24°C to 32°C. Studies were carried out describing survival, reproduction and development of S fallax. Survival was positively temperature dependent. Sex ratio was not affected by constant temperatures from 20 to 28°C; however this ratio was affected by rhythmically fluctu...
Habib Iqbal Javed, Ashiq Saleem, Javed Fateh, Mozammil Hussain, Naheed Akhtar and Shamim-ul-Sibtain Shah*
DEVELOPMENT OF RESISTANT MAIZE GERMPLASM
...festation, 100 progenies performed little better. The best plants among these progenies were advanced by self pollination. A total of 400 self pollinated cobs (as progenies) were screened during spring 2000 under natural infestation. The borer attack started at a very initial stage of the crop and swept down many of the progenies. Only 88 exotic and 7 indigenous progenies showed some resistance. The survived plants, among these progenies, were advanced by self...
Zammurad Iqbal Ahmed, Muhammad Ansar*, Ashiq Saleem**, Zafar ullah Arif*, H.I. Javed and Rashid Saleem**
IMPROVEMENT OF MASH BEAN PRODUCTION UNDER RAINFED CONDITIONS BY RHIZOBIUM INOCULATION AND LOW RATES OF STARTER NITROGEN
...m + 50 kg N ha 1 . The experiment was laid out in a split plot design keeping varieties in main plots and fertilizer/inoculum combinations in sub-plots. The results showed significant differences for all the plant characters under the study. -1 The crop maturity was earlier in control and inoculation + 20 kg N ha as compared to all other treatments. Inoculation in combination with 50 kg N -1 ha significantly delayed crop maturity. The maximum mean average grai...
Muhammad Tariq*, Raja Muhammad Omer**, Muhammad Ashraf Mian*, Obaid Ur Rehman***, Amjad Tahir Virk and Kazim Abbass**
PROMOTING CERTIFIED SEED AVAILABILITY OF WHEAT (TRITICUM AESTIVUM L) THROUGH PUBLIC-PRIVATE PARTNERSHIP AND ITS IMPACT ON YIELD IN RAINFED AREAS
...uding number of spikelet per spike, numbers of grains per spike and 1000 grain weight were at par in both seed sources. It was concluded that healthy and pure seed source gave high seed germination and good crop stand which enabled the plants to withstand abiotic stress especially drought during the crop season. The seed multiplication of crop varieties of rainfed areas can be done in irri...
Ashiq Saleem, Muhammad Ashraf Zahid, Habib Iqbal Javed*, M Ansar**, Asghar Ali, Rashid Saleem* and Noor Saleem***
EFFECT OF SEEDING RATE ON LENTIL (LENS CULINARIS MEDIK) SEED YIELD UNDER RAINFED CONDITIONS
...yield of lentil. Field experiments were conducted for three consecutive years (2001-02 to 2003-04) at the National Agricultural Research Centre (NARC), Islamabad, Pakistan during the lentil growing season. An improved medium-grain size (1000-grain weight. around 25 g) variety Masoor 93 (18-12 x ILLP 4400) was used in these experiments. Eleven seeding rates i.e., 14.0, 21.25, 28.50, 35.75, 43.0, -1 50.25, 57.50, 64.75, 72.0, ...
Gulzar S. Sanghera and Wassem Hussain*
HETEROSIS IN RELATION TO COMBINING ABILITY PER SE PERFORMANCE IN TEMPERATE RICE (ORYZA SATIVA L.)
...cross combinations developed by crossing 2 Cytoplamic male sterility (CMS) lines with 18 testers in line x tester mating design were evaluated to find out best heterotic combinations in terms of yield and yield components of rice (Oryza sativa L.). Analysis of variance revealed significant differences among genotypes, crosses, lines, testers and line x tester interactions for all the traits studied. The s
Safdar Ali, Sahiba, M. Azim Malik, Fayyaz-ul-Hassan and M. Ansar*
GROWTH OF RAINFED FODDER MAIZE UNDER DIFFERENT LEVELS OF NITROGEN AND PHOSPHORUS
...annual rainfall at the experimental site during 2009 was 685.9 mm. The -1 experimental soil was of loamy texture having E.C. of 0.48 dscm , pH 7.7, -1 organic matter 0.65%, saturation 30%, available phosphorus 5.7 mg kg -1 and available potassium 78 mg kg . Maize cv. Sargodha-2002 was sown in randomized complete block design (factorial) and was fertilized with four -1 each nitrogen @ 0, 60, 120 and 180 kg ha and phosphorus 0...
Sonila Hassan, Abid Hussain*, Muhammad Azeem Khan** and Irfan Mahmood*
RURAL-URBAN RETAIL PRICES AND MARKETING MARGINS OF FRESH FRUITS AND VEGETABLES IN PAKISTAN
...les. A checklist and an open-ended questionnaire were developed and used to interview a total of 200 retailers (rural and urban), 100 producers, 30 commission agents and 10 transporters in July 2010. Price data were collected from rural and urban retailers in Hyderabad, Faisalabad, Peshawar, Muzaffarabad and Quetta. It was observed that the retail prices of fresh fruits and vegetables were higher in rural markets as compared...
Ambreen Akhtar Saddozai, Saeeda Raza* and Shahzad Arshad Saleem**
MICROBIAL COUNT AND SHELF LIFE OF STRAWBERRY JUICE
...for two weeks at room temperature to check its shelf life. Total plate count (TPC), pH, flavor, color, yeast and moulds were checked weekly. Quality changes of strawberry juice during storage can be caused both by microbiological and physiological processes. At day 0; pH 3.2, color bright 2 -1 red, excellent flavor, TPC 2.7 x 10 cfu g were recorded, while no yeast or mould were found. After one week, the pH 3.6, dull red color, TPC 2 -1 3 -1 5 -1 2.25x10 cfug ...
Javed Khan, Ehsan-ul-Haq, Naheed Akhtar, Waseem Ahmad Gillani*, Naila Assad**, M.Asif Masood and Irum Raza*
EFFECT OF TEMPERATURE ON BIOLOGICAL PARAMETERS OF IMMATURE STAGES OF CHRYSOPERLA CARNEA (NEUROPTERA: CHRYSOPIDAE) FEEDING ON RICE MEAL MOTH, CORCYRA CEPHALONICA EGGS
...immature stages of Chrysoperla carnea, feeding on Corcyra cephalonica eggs at three constant temperatures 24 ±1 ºC, 28 ±1 ºC and 32 ±1 °C were studied. The results indicated that incubation period was 4.9±0.08, 3.8±0.08 and 3.0±0.06 days at three temperatures, respe
Naheed Akhtar, Yasmin Ahmad, Muhammad Shakeel, Waseem Ahmad Gillani, Javed Khan, Tahira Yasmin and Irshad Begum*
RESISTANCE IN PEARL MILLET GERMPLASM TO GREENBUG, SCHIZAPHIS GRAMINUM (RONDANI)
...istance was evaluated in pearl millet (Pennisetum glaucum L.) against aphid species greenbug, Schizaphis graminum (Rondani). It was determined by the ability of seedlings to resist for plant stunting caused by aphid's feeding at seedling stage. The results indicated that out of 135 pearl millet entries tested, 21 were resistant, 69 were moderately resistant and 45 were susceptible to green...
Saima Rani and Irum Raza*
COMPARISON OF TREND ANALYSIS AND DOUBLE EXPONENTIAL SMOOTHING METHODS FOR PRICE ESTIMATION OF MAJOR PULSES IN PAKISTAN
...g method was found to be pertinent for price estimation of major pulses in Pakistan because of smaller values of accuracy measures. Six-year's forecasts of prices of gram, mash, masoor and mung in Pakistan in 2010-11 were Rs.31.80, Rs.84.09, Rs.72.06, and Rs.47.69 per kg respectively along with 95% prediction intervals. The results showed that if the present growth rates remain the same th...
Akhtar A. Siddiqui and Allah W. Rind*
EXTENSION FIELD WORKERS PERCEPTION OF COTTON INTEGRATED PEST MANAGEMENT PROGRAMME IN SINDH PROVINCE
...f Pakistan to assess the performance of Extension Field Worker (EFWs) performed during FAO-EU-ADB funded National Integrated Pest Management Programme (Nat-IPM) for cotton. The basic principle of Nat-IPM programme was to enable farmers to be self sufficient, using practices that are agro-ecological friendly. This study was carried out in four districts of Sindh province (Hyderabad, Tando Allahyar, Matiari, and Mirpurkhas). T...
Muhammad Yaqoob*, Rukhsana Anjum, Mumtaz Hussain and Muhammad Jahangir Shah**
GENETIC DIVERSITY ANALYSIS AND CHARACTER ASSOCIATION IN SOME CHINESE HYBRID RICE UNDER DRY CONDITIONS
...onducted to evaluate the performance of 10 hybrid rice along with two high yielding varieties under drought conditions at Arid Zone Research Institute (AZRI), Bahawalpur. The experiment was designed in RCBD with three replications. The crop was maintained under moisture stress conditions. The data on various plant traits including, days to panicle initiation, panicle length, spikelet fertility, days to maturity, plant height...
Arshad Ali, Muhammad Arshadullah, Syed Ishtiaq Hyder, Imdad Ali Mahmood and Badar-uz-Zaman*
RICE PRODUCTIVITY AND SOIL HEALTH AS AFFECTED BY WHEAT RESIDUE INCORPORATION ALONG WITH NITROGEN STARTER DOSE UNDER SALT-AFFECTED SOIL
...ustify;"> A field experiment was conducted to determine the effect -1 of wheat straw incorporation @ 5 t ha along with different N starter doses -1 (0, 30, 60 and 90 kg N ha ) on rice (Supper basmati) production and soil health at MK Farm, Farooqabad, district Sheikhupura under saline sodic -1 soil (ECe=5.65 dS m , pH=8.57and SAR=19.38) during 2010. Treatments were arranged in RCBD with three replications. The crop was ...
Syed Ishtiaq Hyder, Muhammad Arshadullah, Arshad Ali and Imdad Ali Mahmood*
EFFECT OF BORON NUTRITION ON PADDY YIELD UNDER SALINESODIC SOILS
...ustify;"> A field experiment was carried out to investigate the -1 effect of different levels of boron (0.5, 1.0, 1.5 and 2.0 kg ha ) on growth, yield and ionic concentration of rice directly sown on raised beds under -1 saline sodic soils (ECe=5.32 dS m , pH=8.52 and SAR=18.87) at Soil Salinity Research Institute, Pindi Bhattian, district Hafizabad, Punjab Pakistan during 2009 and 2010. Treatments were arranged in RCBD with three replications. The crop w...
Munir Ahmad* and Asif Ali Mirani**
HEATED AIR DRYING OF GROUNDNUT
...dryer designed and developed at Agricultural and Biological Engineering Institute (ABEI), National Agricultural Research Centre, Islamabad was evaluated for drying groundnut. The dryer had been found capable to dry about 1818 kg groundnut from 23.3% moisture content to 14% within 2.4h. On average the groundnut drying rate was 3.9% per hour, and the average efficiency of the dryer was 69%. However, typical tests indicated tha...
M. Asif Masood, Irum Raza* and Muhammad Yaseen**
ESTIMATION OF OPTIMUM FIELD PLOT SIZE AND SHAPE IN PADDY YIELD TRIAL
...um plot size with the shape for field research experiments on paddy yield trial considering the effect of plot size on variability in yield of crop as well as studying the coefficients of variation of different plot sizes and shapes of plots. The Smith's index of soil heterogeneity was computed to estimate optimum plot size and shape using yield data of ...
Ayesha Tahir, Hassnain Shah, Muhammad Sharif, Waqar Akhtar and Nadeem Akmal*
AN OVERVIEW OF TOMATO ECONOMY OF PAKISTAN: COMPARATIVE ANALYSIS
...ify;"> This paper reflects the overtime changes in global tomato production and export trends, market destinations for Pakistani tomato, regional acreage comparison, country's share in tomato export and revealed comparative advantage (RCA) of tomato. Pakistan's share in world tomato exports was negligible in 2000.The results of global and domestic tomato production and export trends depict that the export share in production for the world and Pakist...
Muhammad Zubair Anwar, M. Azeem Khan, Ikram Saeed, Akhtar Ali*, Shafique Zahid and Abdul Majid**
SMALL FARMERS PERCEPTIONS REGARDING IMPROVED FODDER AND FORAGE VARIETIES: RESULTS OF PARTICIPATORY ON FARM RESEARCH
...binding constraints are: persistent nutritional stress, lack of improved fodder varieties and lack of fodder preservation techniques for lean period. To resolve this issue improved fodder varieties and forage species were introduced. About 52 % women were of the view that in rabi season 50% grain yield was increased and 44% said that the increase in dry stalk was about 50%. While in kharif...
A.A. Mengal* , M. U. Mallah, Z. A. Mirani* and B. N. Siddiqui**
AN ANALYSIS OF PUBLIC AND PRIVATE AGRICULTURAL EXTENSION SERVICES IN BALOCHISTAN, PAKISTAN
... of extension activities performed by public and private sector extension field staff. The results revealed that a number of farmers received visits from private extension field staff on a fortnightly, monthly and quarterly basis, but not from public extension staff during these periods. When public field staff did visit, the favored method of extension was by exhibition and seminar, which ranked 1st and nd 2 , res
Asrar Ali*, Ehsan-ul-Haq**, Abdul Rehman***, Javed Khan, Waseem Ahmad Gillani** and Maria Rauf*
BIOLOGICAL PARAMETERS AND PREDATORY POTENTIAL OF MENOCHILUS SEXMACULATUS FAB. (COLEOPTERA:COCCINELLIDAE) AT VARYING TEMPERATURE ON RHOPALOSIPHUM PADI L.
...fluenced by different temperature regimes and host were studied at Insectary-Biological Control Laboratories, National Agricultural Research Centre (NARC), Islamabad. The results revealed that there was a significant effect of different temperature regimes on the development and predatory potential of M. sexmaculatus reared on Rhopalosiphum padi. The egg incubation period of predator beetl...
EVALUATION OF LEGUME HERBS NUTRITIVE VALUE AS A RUMINANT FEED AND NITROGEN SUPPLY ON SOIL IN WEST TIMOR, INDONESIA
...ustify;"> The four species of legumes used as ruminant feed were Clitoria ternatea (CT), Centrosema pascuorum (CP), Dolichos lablab (DL), and Macroptilium bracteatum (MB). The study was conducted in Randomized Complete Block Design. The research showed that the highest -l NO concentration after planting was in CP (5.72 mg ), followed by CT 3 -l -l -l (4.21mg ), MB (3.44 mg ), and DL (2.83 mg ). The species of legume was...
Wabekwa, J.W., I.A. Sodagni and F.K. Mohammad*
PHYSIOLOGICAL GROWTH AND YIELD EVALUATION IN PMINERALIZED SUNFLOWER (HELIANTHUS ANNUS L.) UNDER SUDANOSAHELIAN AGRO-ECOLOGY, NIGERIA
... 60 and 80 kg ha . The experi- 2 5 mental design was randomized complete block and replicated thrice. It was observed that leaf area per plant and plant dry weight increased with -1 increasing P O rates (40-60 kg ha ) at 6, 8 and 10 weeks after sowing (WAS) 2 5 . Crop growth rates similarly increased with increasing P O rates (40-80 kg 2 5 -1 ha ) at 6 WAS in both years and the combined means for the two years, and at 8 WAS ...
Arshad Ali, Imdad Ali Mahmood, Muhammad Salim, Muhammad Arshadullah* and Abdul Rasool Naseem**
GROWTH AND YIELD OF DIFFERENT BRASSICA GENOTYPES UNDER SALINE SODIC CONDITIONS
... (average of five plants per replication) at the time of crop maturity. Ionic concentration in plant tissues and oil content in seeds were also determined. Comparatively more number of branches and pods per plant were produced by cultivar Dunkled closely followed by BARD-I while maximum seed yield (241.7 and -1 235.1 kg ha ) was obtained from Dunkled and Sultan Raya, respectively which was...
Sajida Taj*, Muhammad Tariq Iqbal Khan**, Mazher Abbas and Arshed Bashir***
PRICE SPREAD AND MARKETING MARGINS OF CUT ROSE IN PUNJAB, PAKISTAN
...n: justify;"> The paper analyzes the structure and operation of the flower marketing system in Punjab, Pakistan. Based on cross sectional data collected from 34 farmers, 13 wholesalers-cum-commission agents and 20 retailers from main flower producing areas of Kasur and Faisalabad districts from Punjab province, the structure and marketing margins of producers and other marketing intermediaries are quantified along the e...
Ayesha Tahir* and Zafar Altaf**
DETERMINANTS OF INCOME FROM VEGETABLES PRODUCTION: A COMPARATIVE STUDY OF NORMAL AND OFF-SEASON VEGETABLES IN ABBOTTABAD
...etable consumption. The spectrum of year round availability of vegetables could be further extended. The off-season vegetable production offers a promising opportunity in this direction. The study is based on comparison of income obtained from production both in normal and off–season vegetables. Total sample of study was 150 vegetable producers of Abbottabad district. Majority of the sampled farmers were growing tomato and cucumber. There was not much fl...
Shafique Qadir Memon*, Muhamamd Safar Mirjat, Abdul Quadir Mughal** Nadeem Amjad***, Muhammad Azhar Saeed, Shabbir Kalwar, Asif Ali Mirani and Habib Iqbal Javed****
TILLAGE AND NPK EFFECT ON GROWTH AND YIELD OF SPRING MAIZE IN ISLAMABAD, PAKISTAN
...actice which affect crop performance. An experiment was conducted during the spring crop season 2009 to compare the effect of three different tillage regimes i.e. deep, conventional and zero and four fertilizer levels viz., -1 control 100-50-50, 150-75-75 and 200-100-100 NPK kg ha . The randomized complete block design was used with three replications. There was significant differences in maize emergence
Amir Khatam*, Sher Muhammad, and Ijaz Ashraf**
ROLE OF INDIVIDUAL CONTACT METHODS IN DISSEMINATION OF AGRICULTURAL TECHNOLOGIES
...e collected on various aspects of individual contact methods in diffusion of agricultural technologies from 280 randomly selected farmer respondents. Researchers collected the data with the help of a pretested and validated interview schedule using survey technique. The results show that majority of the farmer respondents is aware of the farm visits (66.43%), demonstrations being conducted (62.50%) and home visits made by the extension staff (60.71%) as extens...
Muhammad Arshadullah, Syed Ishtiaq Hyder, Arshad Ali and Imdad Ali Mahmood*
CUMULATIVE EFFECT OF SULFUR AND CALCIUM ON WHEAT GROWTH AND YIELD UNDER SALINE-SODIC SOILS
...ustify;"> A field experiment was carried out to investigate the effect of three rates of gypsum on growth and ionic concentration of -1 wheat variety (Saher) sown in saline-sodic soil (ECe=5.32 dS m , pH=8.52 and SAR=18.87) at Soil Salinity Research Institute (SSRI) Farm, Pindi Bhattian during rabi 2009-10. Treatments were arranged using randomized complete block design (RCBD) with three replications. The crop was harvested at maturity, data on tillering,...
Amir Khatam*, Sher Muhammad and Ijaz Ashraf**
ROLE OF FARMER FIELD SCHOOLS IN ENHANCING SKILLS OF FARMING COMMUNITY IN KHYBER PAKHTUNKHWA, PAKISTAN
...rvey method on various aspects from 280 randomly selected farmer respondents. The data collected were analyzed by applying simple descriptive statistics showing means, scores, ranking order and standard deviations. The results show that skills were highly enhanced in st the aspect of nursery raising techniques which was ranked 1 with mean value 3.40 closely followed by timely and balanced use of fertilizers and nd rd using r...
Rizwana Sultan*, Javed Khan, Ehsan ul Haq, Tariq Mehmood**, Roshan Zada Khattak***, and Naheed Akhtar**
BIOLOGICAL PARAMETERS OF TRICHOGRAMMA CHILONIS ISHII (TRICHOGRAMMATIDAE: HYMENOPTERA) FEEDING ON SITOTROGA CEREALELLA EGGS AT THREE CONSTANT TEMPERATURES
...ggs at three constant temperatures and five different ages of host eggs at Insect Pest Management Programme, National Agricultural Research Centre, (NARC) Islamabad. The results revealed that maximum rate of parasitism was 95.70 ± 1.94 at 28 ± 1 °C while minimum was 61.30 ± 1.70 at 32 ± 1 °C. Maximum adult emergence and female ratio from parasitized eggs were 96.30% with 59.2± 5.83 female ratio at 28 ±1 °C ...
Muhammad Sohail*, Imtiaz Hussain*, Riaz-ud-din*, Syed Haider Abbas*, Maqsood Qamar* and Muhammad Noman*
EFFECT OF SPLIT N FERTILIZER APPLICATION ON PHYSIOAGRONOMIC TRAITS OF WHEAT (TRITICUM AESTIVUM L.) UNDER RAINFED CONDITIONS
...during vegetative growth period provide an opportunity to apply N in split doses. Study was conducted to find out appropriate N rate and application method to enhance wheat productivity. -1 Three N rates i.e., 60, 90, and 120 kg ha and three application methods i.e. full basal N dose at planting and N application in two and three equal split doses at tiller formation and stem elongation stages. Maximum grain yield -1 -1 (5.20 t ha ) was achieved when N was app...
Sajida Taj*, Akhter Ali*, Nadeem Akmal*, Shujaat Yaqoob** and Mubarik Ali***
RAISED BED TECHNOLOGY FOR WHEAT CROP IN IRRIGATED AREAS OF PUNJAB, PAKISTAN
...fy;"> The present paper analyzes the determinants of adoption of raised bed planting of wheat in irrigated areas of Punjab, Pakistan. Wheat is an important staple food of Pakistan. It contributes 13 % to the value added in agriculture and 2.6 % to the GDP. The agrarian economy of Pakistan is continuously under stress due to the low yield of almost all the crops and constrained with many problem. One of the most important issues of agriculture is water sho...
Waqar Akhtar*, Nadeem Akmal*, Hassnain Shah*, Muhammad Azam Niazi** and Ayesha Tahir*
EXPORT COMPETITIVENESS OF PAKISTANI HORTICULTURAL PRODUCTS
...: justify;"> This paper examines Pakistan's competitiveness in export of selected horticulture commodities by employing set of revealed comparative advantage (RCA) and revealed competitive advantage indices with respect to global trade. Results demonstrate that Pakistan has comparative and competitive advantage ov...
Muhammad Farooq*, Hidayat Ullah*, Nausherwan Nobel Nawab* and Khalid Mahmood Qureshi**
EVALUATION OF INDIGENOUS TOMATO HYBRIDS UNDER PLASTIC TUNNEL
...;Seventeen locally developed indeterminate tomato hybrids were evaluated along with 'Sahel' as check under plastic tunnel for yield and yield components at National Agricultural Research Centre, -1 Islamabad. Maximum yield of 71.58 tha was recorded in NTT-12-08 while minimum -1 yield (34.75 tha ) was observed in NTT-16-08. Sahel used as -1 check bore maximum number of fruits plant (30.26) and followed by NTT- -1 04-08 and NTT-03-08 bearing 28.68 and 24.16 frui...
Sara Khalid*, Khalid Mahmood Qureshi*, Ishfaq Ahmad Hafiz*, Khalid Saifullah Khan* and Usman Shaukat Qureshi*
EFFECT OF ORGANIC AMENDMENTS ON VEGETATIVE GROWTH, FRUIT AND YIELD QUALITY OF STRAWBERRY
...th issues resulting from pesticides and hazardous chemicals. In this regard, studies were conducted using six different organic amendments on strawberry (Fragaria ananassa Duch.) cv. Chandler which included T = planting 1 media -1 (soil + silt + farm yard manure); T = planting media + 400 mgl humic 2 -1 acid; T = planting media + 200 g kg leaf manure; T = planting media + 200 3 4 -1 -1 g kg vermicompost; T = planting media + 200 g kg plant fertilizer and T = 5...
Rabeea Tariq*, Khalid Mahmood Qureshi*, Imran Hassan*, Muhammad Rasheed* and Usman Shaukat Qureshi*
EFFECT OF PLANTING DENSITY AND GROWING MEDIA ON GROWTH AND YIELD OF STRAWBERRY
... delicate flavors. It is perishable crop which is exceedingly in demand for its taste, profitability, high yield and good quality. To make the plant growth successful in the container, the requirement of special media is very important step because plant growth is largely depended on the physiochemical properties of the growing media used. Winter strawbe...
Maria Rauf*, Ehsan-ul-Haq**, Javed Khan**, Abdul Rehman***, Waseem Ahmad Gillani* and Asrar Ali**
BIOLOGY AND PREDATORY POTENTIAL OF COCCINELLA SEPTEMPUNCTATA LINN. ON SCHIZAPHIS GRAMINUM APHID UNDER CONTROLLED CONDITIONS
...ni) at three constant temperatures 20±1 °C, 25±1 °C and 30±1 °C in Insectary-Bio Control Laboratories, National Agricultural Research Centre (NARC), Islamabad. The results revealed that incubation period of C. septempunctata was 5.12, 3.62 and 3.20 days with 75.6%, 82.0% and 71.2% hatchability, respectively. The larval durations were 29.5, 15.9 and 8.1 days...
Abid Hussain*, Khalid Mahmood Aujla* and Sonila Hassan**
PRODUCTION AND MARKETING OF CAMEL PRODUCTS IN SEMIDESERT AND DESERT AREAS OF PAKISTAN
... Mean production of milk per farm household was 5.4 and 6.5 liters per day in summer and winter seasons, respectively; however, none of the surveyed farmers reported milk sale. During last one year, sales of camel hides and hair were reported by few farmers (6% each). Mean purchase price of camel hides reported by shopkeepers in nearby town markets were ...
Naheed Zahra*, Muhammad Zubair Anwar*, Sonila Hassan** and Irfan Mehmood**
INSTITUTIONAL CREDIT ARRANGEMENT AND THEIR IMPLICATION ON AGRICULTURAL INCOME IN THE SELECTED VILLAGES OF RAWALPINDI DISTRICT
... relationship with the dependent variable except the age of the farmer. Therefore it is recommended that there is a strong need to enhance easy and timely accessibility of institutional credit for all growers so that they could increase their agricultural productivity that will further lead to increase their agricultural income. It is neccessary that government should practice the credit policy to protect the interest of small and medium farmers by providing t...
Hafiz Sultan Mahmood*, Munir Ahmad**, Tanveer Ahmad*, Muhammad Azhar Saeed* and Muhammad Iqbal***
POTENTIALS AND PROSPECTS OF PRECISION AGRICULTURE IN PAKISTAN - A REVIEW
...al stresses in the developed world. Present paper provides an overview of precision agriculture and examines the potentials, prospects, implications, issues and relevance of precision agricultural applications in Pakistani agricultural system. There is a scope of many precision technologies to be implemented in the country. In this ...
Muhammad Yasin Mirza*, Mubashir Ahmad Khan*, Muhammad Amjad* and Malik Shah Nawaz*
STABILITY ANALYSIS FOR ECONOMIC TRAITS IN SESAME ( L.)
... examined 10 elite genotypes of sesame across three locations for the estimation of genotypes environment(GE) interaction and to identify stable genotype(s) using stability parameters, and to determine inter-parameters correlation. Two locations (NARC and D.I. Khan) were suitable for high productivity. PR-19-9-S produced maximum (341 kgha ) at NARC and V-90005 produced 344 kgha and PARS-I ...
Mubashir Ahmad Khan*, Muhammad Yasin Mirza*, Muhammad Amjad*, Nazakat Nawaz*, Malik Shah Nawaz* and Doulat Baig*
ASSESSMENT OF GENETIC DIVERSITY IN GERMPLASM OF LINSEED ( L.)
..., maturity, reproductive period, plant height, branches per plant, bolls per plant, plot biomass, harvest index and seed yield. Wide ranges between the mean values with high CV values were exhibited by plant height, bolls per plant, biomass and seed yield accompanied with maximum values of variances and standard deviation, revealed the existence of great...
Muhammad Shahzad*, Akhter Ali**, Abdul Hayee Qureshi**, Naveed Jehan*, Imran Ullah* and Majid Khan*
ASSESSMENT OF POST-HARVEST LOSSES OF PLUM IN SWAT, PAKISTAN
... fruit of Pakistan after peach. It is prone to post harvest losses at different levels during its production and consumption. Evaluating post harvest losses in the marketing channel of the plum was necessary for the stake holders to make informed decision about harvest and post harvest practices. This study was conducted in Swat district in 2012 to quantify these losses at different levels using four different questionnaires. Proportionate stratified random sa...
Elizabeth Stephen Waghchoure-Camphor* and Mohammad Irshad**
SURVEY OF MANAGED F. (APIDAE: HYMENOPTERA) POPULATION IN GALIAT, MURREE AND ISLAMABAD
...ough a dialogue with the people of Abbottabad, Murree and Islamabad to estimate the population of honey bee Fabricius. Subsequent field visits were made to locate these bees. This study is first of its type in Pakistan to document the population density of this bee. It reveals the distribution and strength of population of in mainly hilly areas of Pakistan. The objective of this study is not only useful to upscale honey prod...
Abdul Rehman Roonjho*, Waseem A. Gillani**, Awais Rasool**, Naheed Akhtar**, Tariq Mahmood**, Arsalan A.***, M. Afzal*, Iqbal Khan* , M. Asghar Ranjha**** , M. Irfan**** and Javed Khan**
REPELLENCY EFFECTS OF DIFFERENT PLANT EXTRACTS TO COTTON MEALY BUG, TINSLEY (HEMIPTERA: PSEUDOCOCCIDAE)
...align: justify;"> Repelling effects of peach plant L. (Rosales: Rosaceae), Eucalyptus, L. (Myrtales: Myrtaceae), Ashok, (Magnoliids: Annonaceae), Milk thistle, (Asterales: Asteraceae), and Sow thistle, (Asterales: Asteraceae) extracts each in petroleum ether, acetone and ethanol were evaluated at the concentration of 1000, 500 and 250 ppm against cotton mealy bug ( ) in a free choice ...
Shahid Ali*, Anjum Shehzad*, Muhammad Ather Rafi* and Ahmed Zia*
INSECT POLLINATORS OF LITCHI ( ) FROM DISTRICT HARIPUR, PAKISTAN
...lected which yielded 20 species under 16 genera of eight families belonging to orders Diptera and Hymenoptera. Family Calliphoridae, Muscidae, Sarcophagidae and Syrphidae, represented the order Diptera, while families, Andrenidae, Apidae, Halictidae and Vespidae belonged to order Hymenoptera....
Khalid Naseem*, Naseem Bibi**, Saeeda Raza*, Amer Mumtaz*, Nouman Rashid Siddiqui*, Amina Bibi*** and Muhammad Ahsan Khan****
DEVELOPMENT, CHARACTERIZATION AND EVALUATION OF HIGH ENERGY BISCUITS FOR COMBATING MALNOURISHMENT AMONG CHILDREN IN PAKISTAN
...ed by supplementing chickpea and oat in patent flour (fine flour) with different ratio (5%, 10%, 15% and 20 %). Biscuits with no supplementation were kept as control treatment. Chemical and sensory evaluation of supplemented biscuits was carried out. An increase in nutritive values have been observed with an increase in supplementation level. Proximate analysis shows that T and T get the highest values for protein, zinc and iron. Results of all treatments were...
Ayesha Tahir* and Sonila Hassan**
ECONOMIC FEASIBILITY OF SMALL SCALE BUTTON MUSHROOM PRODUCTION IN PAKISTAN
...ha and Rs.77,800 ha , respectively. The results indicated the fact that mushroom production is very much remunerative to its producers as it can give maximum net return by reducing their cost of production as its cultivation is dependent on the agricultural raw material which is cheaply available....
Amir Khatam*, Sher Muhammad**, Badar Naseem Siddiqui***, Muhammad Zakaria Yousuf Hassan****, Ijaz Ashraf**, Muhammad Zafarullah Khan***** and Aijaz Kuharoo******
COMMUNICATION OF AGRICULTURAL INFORMATION THROUGH GROUP CONTACT METHODS IN PAKISTAN
...gularly participated, respectively in the panel discussion for obtaining latest agricultural information. About 80.71%, 11.43%, 6.07% and 1.79% of the respondents never rarely, occasionally and regularly, respectively portrayed role playing for obtaining information regarding latest agricultural technology. as much as 62.14% of the respondents never took part in brainstorming, while 17.50%, 17.07% and 4.29% res
Md. Nazirul Islam*, A. K. Azad**, Leon O. Namuco***, Teresita H. Borromeo***, Maria Lourdes O. Cedo*** and Edna A. Aguilar***
MORPHOMETRIC CHARACTERIZATION AND DIVERSITY ANALYSIS OF A MAKAPUNO COCONUT POPULATION IN U.P. LOS BANOS
...apuno coconut whose endosperm is thicker and softer instead of hard crispy, growing at the University of the Philippines, Los Baños, was assessed using morphometric characters from March 2004 to October 2005. Shannon 2 Weaver Diversity Index and Chi-square (÷ ) tests were used to analyze variation in both the qualitative and quantitative characters. Substantial variation in crown shape, bole category, color of ...
Adnan Umair*, Safdar Ali**, Muhammad Sarwar***, Kashif Bashir**, Muhammad Javed Tareen**** and Muhammad Asghar Malik*****
ASSESSMENT OF SOME PRIMING TECHNIQUES IN MUNGBEAN (VIGNA RADIATA) : A GREEN HOUSE STUDY
... does not occur. A pot experiment was conducted in a green house. The seeds were invigorated by traditional soaking (hydropriming), osmo-conditioning using phosphorous (KH PO ; 2 4 -1 200 mM and 400 mM), mannitol (20 and 40 gl ), polyethylene glycol (50 and -1 -1 100 gl ), sodium molybdate dihydrate (0.2 and 0.4 gl ) and hormonal priming by salicylic acid (10 and 20 ppm). Untreated dry seeds were used as control. All the invigoration treatments significantly i...
Sadia Tehrim*, M. Yasin Mirza** and G. Mustafa Sajid*
COMPARATIVE STUDY OF DIFFERENT GROWTH REGULATORS FOR EFFICIENT PLANT REGENERATION IN GRAPES
...: justify;"> The grape (Vitis vinifera L.) is the most valuable and widely cultivated horticultural crop worldwide. In the present study, different hormonal combinations in regeneration media were studied to determine the best combination for in vitro morphogenesis of grapevine accessions viz., 4494(1) Kowar Sufaid, 4472(12) Harker Agoon and 4492(1) Kowar Naray. When levels of benzylaminopurine (BAP) were increased in t...
Rashid Mahmood*, Elizabeth Stephen Wagchoure* and Ghulam Sarwar*
INFLUENCE OF SUPPLEMENTAL DIETS ON APIS MELLIFERA L. COLONIES FOR HONEY PRODUCTION
...ts were tested for their performance in supporting the bee colonies of Apis mellifera during August, 2011 and January, 2012 in the premises of Honey bee Research Institute, National Agricultural Research Centre, Islamabad, Pakistan, to investigate alternative nutrients to pollen grain. Sixteen A. mellifera bee hives were selected alike with respect to number of frames and bees present in them. Honey bee colonies were divided...
Tabinda Qaiser*, Ayesha Tahir*, Sajida Taj* and Murad Ali*
BENEFIT-COST ANALYSIS OF APICULTURE ENTERPRISE: A CASE STUDY IN DISTRICT CHAKWAL, PAKISTAN
... collected from 25 beekeepers of Chakwal district because this enterprise is working more in areas like Chakwal, Sargodha, FatehJang and Mardan. Beekeepers were selected randomly for case study and they were interviewed for getting the necessary data to determine the costs and return of beekeeping and assess the scope of beekeeping. The benefit cost ratio of beekeeping was 1.4709 which sho...
Shahida Khalid*and Shahida Nasreen Khokhar*
INTERACTION OF HERBICIDES AND BIO-INOCULANTS WITH AGRICULTURAL CROPS AND WEEDS
...he test weed. In first experiment, Brassica and maize, grown in soils having residues of either Triasulfuron+Terbutryn (Logran) or Sulfosulfuron (Leader), were found to significantly mitigate (% increase in root length, shoot length, fresh weight and dry weight) the inhibitory effect of residues , when inoculated with Azospirillum A4. In second experiment two Azospirillum (B2 and B3) and two Azorhizobium (3.6ksk and srsn2k4)...
Muhammad Tayyab Mudassar*, Ehsan-ul-Haq*, Muhammad Naeemullah**, Muhammad Shakeel*, Muhammad Ashfaque*, Asmat un Nisa* and Javed Khan*
ECONOMIC REARING OF CHRYSOPERLA CARNEA (STEPHENS) (NEUROPTERA: CHRYSOPIDAE) IN INSECTARY
...enance cost of 100 Chrysoperla carnea adults was Rs. 192.38 per month, which included the labour cost of Rs. 152.38 and diet cost of Rs. 40. Approximately 4000 eggs per month were obtained from the C. carnea adult culture and the cost per egg was Rs. 0.04. This study also revealed that the diet consumption of 100 C. carnea larvae was 3.617g of Sitotroga ...
Naheed Akhtar*, Awais Iqbal**, Habib Iqbal Javed*, Javed Khan*, Muhammad Riaz*, Waseem Ahmad Gillani*, Tariq Mahmood*, Awais Rasool* and Tahira Yasmin*
EVALUATION OF RECOMMENDED WHEAT VARIETIES FOR RESISTANCE AGAINST SCHIZAPHIS GRAMINUM (RONDANI) (APHIDIDAE: HOMOPTERA) UNDER LABORATORY CONDITIONS
...r higher yield and least pest pressure....
Javed Khan*, Ehsan-ul-Haq*, Habib Iqbal Javed*, Tariq Mahmood*,
Awais Rasool*, Naheed Akhtar and Saleem Abid**
BIOLOGICAL PARAMETERS AND PREDATORY POTENTIAL OF CHRYSOPERLA CARNEA (NEUROPTERA: CHRYSOPIDAE) FEEDING ON WHEAT APHID SCHIZAPHIS GRAMINUM (HEMIPTERA: APHIDIDAE) UNDER LABORATORY CONDITIONS
...ical parameters of Chrysoperla carnea (Stephens) on Schizaphis graminum (Rondani) aphid were carried out in Insecatry- Bio control Laboratories, Insect Pest Management Programme, Department of Plant and Environmental Protection, National Agricultural Research Centre, Islamabad, Pakistan. The results indicate that incubation period was 3.8±0.08 days with 87.0% hatchability. The developmental duration of first, second a...
Said Salman*, Shah Jehan Khan*, Javed Khan**, Rehmat Ullah Khan*** and Imran Khan****
GENETIC VARIABILITY STUDIES IN BREAD WHEAT (TRITICUM AESTIVUM L.) ACCESSIONS
...tudied indicating the scope of improvement through simple selection for high mean values of these traits. Maximum genotypic differences were observed for all the studied parameters except chlorophyll concentration index and number of spikelet per spike indicating considerable amount of variation among the accessions for each trait. The genotypic and phenotypic coefficient of variation estimates were higher for all the traits...
Nusrat Habib*, Muhammad Zubair Anwar* and Ikram Saeed*
COMPARATIVE PROFITABILITY ANALYSIS OF RECOMMENDED MUNGBEAN VARIETIES AT NARC EXPERIMENTAL STATION, ISLAMABAD, PAKISTAN
...arieties cultivated at experimental station National Agricultural Research Centre (NARC), Islamabad and thus recommend a higher profit earning variety towards pulses growing areas of the country. Primary data of crop management practices was collected by Pulses Programme, NARC, Islamabad. Pulses Programme, NARC, cultivated different mungbean varieties for experimental purpose to find out the comparatively best variety in ter...
Imtiaz Ahmad Qamar*, Maqsood Ahmad*, Gulshan Riaz* and Sartaj Khan*
PERFORMANCE OF SUMMER FORAGE LEGUMES AND THEIR RESIDUAL EFFECT ON SUBSEQUENT OAT CROP IN SUBTROPICAL SUBHUMID POTHWAR, PAKISTAN
... conducted to assess the performance of five tropical forage legumes namely sesbania (Sesbania aculeata), cowpeas (Vigna unguiculata), rice beans (Vigna umbellata), lablab bean (Lablab purpureus) and cluster bean (Cymopsis tetragonoloba) with reference to a cereal fodder reference crop of millet (Pennisetum typhoides) and their residual effects on the succeeding oat crop at the National Agricultural Research Centre, Islamaba...
Abid Hussain*, Khalid Mahmood Aujla* and Sonila Hassan**
ECONOMICS OF COW MILK PRODUCTION IN SINDH AND AZAD JAMMU & KASHMIR
...es in total feeding cost per annum, milk productivity and profitability of main cow breeds across selected areas have been observed. Concentrate feeding is the main cost item for cow milk production in irrigated areas of Sindh and constitutes more than half (54 %) of the total feeding cost per annum. While, in coastal and desert areas of Sindh, and mountainous - AJK wheat straw is the major cost item and shares more than hal...
Abdul Hassan*, Muhammad Ishaq*, Nisar Ali Shah* and Arshad Farooq*
MILK PRODUCTION POTENTIAL IN KHYBER PAKHTUNKHWA
...mt with 1579 lit of milk per buffalo per year, 663 lit of milk per cow per year, 95 lit milk per goat per year and 64 lit of milk per sheep per year. The data in comparison to the National and World average, is f...
Shafique Qadir Memon*, Nadeem Amjad**, Muhammad Safar Mirjat***, Abdul Quadir Mughal***, Khalil Ahmad Ibupoto***, Shabbir Ahmad Kalwar****, Asif Ali Mirani**** and Muhammad Azhar Saeed****
EFFECT OF TILLAGE AND USE OF ORGANIC AND INORGANIC FERTILIZERS ON GROWTH AND YIELD COMPONENTS OF MAIZE
...ctice which affects crop performance. It was laid out in randomized complete block design (RCBD) with three replications. An experiment was conducted during the spring and autumn crop seasons 2009-2010.The objective of the trial was to compare the effect of three different tillage regimes namely, deep tillage, conventional tillage and zero tillage, and four fertilizer levels. Results showed that plant height, 1000-grain weig...
Naveed Jehan*, Khalid Mahmood Aujla**, Muhammad Shahzad*, Abid Hussain**, Muhammad Zahoor*, Majid Khan* and Ahmed Bilal*
USE OF MOBILE PHONES BY FARMING COMMUNITY AND ITS IMPACT ON VEGETABLE PRODUCTIVITY
...h and farmers’ prosperity. Mobile phone helps farmers in getting information about commodity prices in different markets. The farmers can get up-to-date information about various markets in different regions and can accordingly arrange transportation and labor services in time. The study was conducted to see the effect of timely information availability with mobile on productivity. The data was collected through well structured questionnaire by interview...
Ali Ahsan Bajwa*, Ehsanullah*, Shakeel Ahmad Anjum*, Wahaj Nafees*, Mohsin Tanveer* and Hafiz Salman Saeed*
IMPACT OF FERTILIZER USE ON WEED MANAGEMENT IN CONSERVATION AGRICULTURE - A REVIEW
...ased use of fertilizers, pesticides, chemical growth regulators, machinery and poor management practices are accelerating environmental pollution, soil degradation, global warming, climatic change and food deterioration. Conservation agriculture offers a sustainable solution for all these problems most often. This review focuses the use of fertilizers in conservation agriculture and their impact on weed management. Weeds are major constraint in the productivit...
Muhammad Sohail*, Imtiaz Hussain*, Riaz-ud-Din*, Sikandar Khan Tanveer*, Maqsood Qamar* and Syed Haider Abbas*
EVALUATION OF ADVANCE WHEAT LINES FOR AGRONOMIC TRAITS IN RAINFED ENVIRONMENT
...ture during early growth period and high temperature stress during reproductive growth stage. Better yield under stressful environment is the main objective while evaluating genotypes for rainfed ecologies. A field study was conducted at National Agricultural Research Centre (NARC), Islamabad, Pakistan to evaluate the agronomic traits of three advance lines (NR-397, NR-379 and NR-400) in c...
Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
... Two simultaneous experiments were done to compare the growth, yield and nutritive value of grasses namely Brachiaria brizantha, B. mulato, and B. mutica and five legume herbs such as Clitoria ternatea, Dolichos lablab, Macroptilium bracteatum, Centrosema pascuorum and Centrosema pascuorum in Central Sulawesi, Indonesia using completely randomised block design. Each species was planted on 2.5m x 3m plot, and re
Md. Nazirul Islam*, M. Z. Rahman**, R. Ali***, A. K. Azad**** and M. K. Sultan**
DIVERSITY ANALYSIS AND ESTABLISHMENT OF CORE SUBSETS OF HYACINTH BEAN COLLECTION OF BANGLADESH
...nd purple. Maximum genotypes of the collection were of green vine. Each of two subgroups were divided into three groups according to colors of pod i.e., green, white and red. Each group again divided itself into two according to beak position as central and marginal of pod. High diversity was also found regarding pod curvature and beak position on it. Strategically, a core subset consisting of 36 accessions out of 484 accessions was determined. Diversity Indic...
Nazakat Nawaz*, Malik Shah Nawaz*, Mubashir Ahmad Khan*, Mirza M. Yasin*, Doulat Baig*, Nasir Mehmood Cheema**, Muhammad Amjad** and M. Altaf Sher**
EFFECT OF BORON ON PEANUT GENOTYPES UNDER RAINFED CONDITIONS
...iagnostic parts of three peanut genotypes, BARD-479, ICG-7326 and ICGV-92023. These genotypes were grown in boron deficient soil at National Agricultural Research -1 Centre, Islamabad, Pakistan. Five rates 0.0, 0.5, 1.0, 2.0 and 4.0 kg B ha as boric acid (H BO ) were applied. Boron fertilizer applications significantly 3 3 increased dry pod yield of all the tested genoty
Farman Ullah Shah*, G. Mustafa Sajid** and Sadar Uddin Siddiqui**
EVALUATION OF MULCHING MATERIALS AS INTEGRATED WEED MANAGEMENT COMPONENT IN MAIZE CROP
...tumn) season 2011. The experiment was laid in Randomized Complete Block Design, (RBCD) having eight treatments and four replications. The treatments were black plastic, white plastic, sugarcane straw, wheat straw, live mulch, weeds as mulch, hand weeding and weedy check. Weed data -2 -2 included weed density m , fresh and dry weight g m , while crop data -2 -2 -1 included crop density m , fresh and dry weight g m , number of plant plot , -1 stover yield (g), p...
Asghar Ali*, Muhammad Tahir**, Shahid Riaz Malik* and Muhammad Hanif Munawwar*
EVALUATION OF PRE AND POST-EMERGENCE HERBICIDES FOR WEED MANAGEMENT IN LENTIL (LENS CULINARIS MEDIK.)
...control in lentil. The experiment comprised eight treatments including three herbicides, manual weeding and check (no weeding). The yield was higher in manual weeding but in herbicide treatments Isoproturon as pre-emergence @ 2 kg -1 ha produced statistically at par grain yield to that of manual weeding -1 followed by Isoproturon after one month of planting @ 2 kg ha . Both the treatments showed 193.9% and 109.2% yield increase, respe<...
Nazir Ahmad*, Sultan Ayaz*, Sumaira Shams**, Karimullah*** and Riaz Ahmad****
PREVALENCE AND MORPHOLOGY OF HELMINTH PARASITES OF FISH FROM RIVER SWAT, KHYBER PAKHTUNKHWA
... to five genera and six species were examined. The parasites collected were Diplozoon khyberensis, Bathybothrium rectangulum, Bothriocephalus, Nippotaenia, Cucullanidae, Proteocephalus, Rhabdochona charsaddiensis, Rhabdochona schizothoracis and Neoechynorhynchus devdevi. They were identified by morphological characteristics through microscopic techniques. Overall prevalence of the fish parasites was 58% (145/250). Among these Schizothorax plageostomus fish 93....
Saima Rani*, Hassnain Shah*, Umar Farooq** and Bushra Rehman**
SUPPLY, DEMAND, AND POLICY ENVIRONMENT FOR PULSES IN PAKISTAN
...lations. Therefore the paper fills an information gap regarding factors affecting the supply and demand of pulses in Pakistan. The present study focuses on two important pulses grown in the country namely gram (chickpea) and mung (mungbean). Using Nerlove's adjustment lag model as the basic framework supply and demand aspect has been studied at the national level, based on the time series ...
Rehmat Ullah*, Kalim Ullah** and Mohammad Zafarullah Khan*
EXTENSION SERVICES AND TECHNOLOGY ADOPTION OF DATE PALM (PHOENIX DACTYLIFERA L.) IN DISTRICT DERA ISMAIL KHAN
...rict Dera Ismail Khan by personal interview method from a sample of 51 respondents selected from these villages. Agriculture was the major profession of the farmers (80.3%). It was found that 62.7% of the respondents were never visited by the extension workers while 60.7% of the respondents never attended any meeting with field staff or Agriculture Officers. A single field day was organized by extension workers almost two years ago in the studied area attended...
Muhammad Sharif*, Muhammad Azam Niazi*, Abdul Jabbar** and Sajida Taj***
FINANCIAL PROFITABILITY OF WHITE SUGAR PRODUCTION IN PAKISTAN
...e country. The present paper aimed at up-dating the financial profitability of white sugar on the basis of recent data in the country. The total cost of white sugar production was Rs. -1 50.11kg in Pakistan. The estimated financial profit of white sugar production -1 was Rs. 2.47 kg in the country in 2012-13. The estimated supply and demand of white sugar was worked out as 6.62 and 5.01 m t, respectively during the same -1 -...
Syeda Nasreen*, Mehwish Ishaque**, Muhammad Ayub Khan*, Saleem-ud-din* and Syeda Musarrat Gilani*
COMBINING ABILITY ANALYSIS FOR SEED PROTEINS, OIL CONTENT AND FATTY ACIDS COMPOSITION IN SUNFLOWER (HELIANTHUS ANNUUS L.)
...ic and linoleic acid, respectively. Among males, C-206-R, SF-187R, RHA-295 and RHA-854 were the potential parents exhibiting desirable GCA for seed total proteins, oil content, oleic and linoleic acids, respectively. Among the F hybrids, 1 highest specific combining ability (SCA) estimates were exhibited by CMSNDMTC x RHA-295 (3.837) for seed total proteins whereas for oil content, the hyb...
Abid Hussain*, Khalid Mahmood Aujla* and Nouman Badar*
YIELD GAP DETERMINANTS FOR WHEAT PRODUCTION IN MAJOR IRRIGATED CROPPING ZONES OF PUNJAB, PAKISTAN
...ones of the province, respectively. Ordinary least square regression analysis of wheat production by assuming Cobb-Douglas specification reveals that the number of irrigations, usage of farm yard manure and fertilizers contribute positively and significantly to wheat crop production. Coefficients of dummy variables for cropping zones indicate that farmers in the mixed cropping zone are obtaining better yield of the wheat cro...
Maqsood Qamar*, S. Dilanawaz Ahmad Gardazi**, Riaz-ud-Din*, Muhammad Sohail* and Syed Haider Abbas*
PARTIAL RESISTANCE TO STRIPE RUST AND ITS EFFECT ON SUSTAINABILITY OF WHEAT YIELD
...ign: justify;"> Stripe rust (Puccinia striiformis Westend. f. sp. tritici) poses a serious threat to wheat production in cooler areas of Pakistan. The 70% area of wheat in Pakistan is prone to stripe rust disease. It can cause 10-17% yield losses if susceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at ...
Sajid Ali*, Quratulain Altaf** and Umar Farooq*
ACREAGE RESPONSE OF FLUE CURED VIRGINIA TOBACCO IN KHYBER PAKHTUNKHWA
...71-2011. The newly developed Auto Regressive Distributed Lag (ARDL) model for cointegration was used to estimate the short-run and long-run elasticities. The study found a long-run price elasticity of 0.33, thereby revealing that FCV acreage response to its own price is relatively inelastic. The short-run acreage response was also low (0.13) and therefore relatively inelastic. This implies that price policy could not be used as the sole instrument to affect ar...
Frasat Saeed*, Jehanzeb Farooq*, Abid Mahmood**, Tassawar Hussain***, Muhammad Riaz* and Saghir Ahmad****
GENETIC DIVERSITY IN UPLAND COTTON FOR COTTON LEAF CURL VIRUS DISEASE, EARLINESS AND FIBER QUALITY
...traits, 101 cotton genotypes imported from USA were evaluated. Different statistical procedures like cluster, principle components (PC) and correlation analysis were employed to identify the suitable genotypes that can be further exploited in breeding programme. Significant associations were found between yield contributing trait, boll weight and fiber related trait, staple length. Earliness related traits, like st st days t...
Muhammad Ali*, Ghulam Mustafa Sajid**, M. Faisal Anwar Malik*** and Kalimullah****
ESTABLISHMENT OF IN VITRO CULTURE OF GRAPES
...ristemetic tissue) of grapes was investigated through tissue culture technique. These explants were collected from gene bank of Institute of Agricultural Biotechnology and Genetic Resources (IABGR), National Agricultural Research Centre (NARC), Islamabad, Pakistan. Fifteen accessions of grapes were surface sterilized and tested on 75% MS media for germination and initial growth parameters. Accession No. 020017 (Dakh-1) exhib...
Samiullah*, Mehmood Shah*, Kalim Ullah**, Rehmat Ullah*** and Ibrarullah****
PROFITABILITY OF WHEAT PRODUCTION IN DERA ISMAIL KHAN
...spondents were probed by personal interview method from the sampled villages. Cost and return (gross return) data from the respondents were analyzed. Farm budgeting technique for estimating cost, gross return and profitability was applied. The analysis of data revealed that the average cost per acre was Rs. 24716.32. Similarly average production of wheat (output) was estimated to -1 -1 be 1618.40 kg acre . Thus the gross ret...
Aniqa Iram*, Javed Khan**, Nadeem Aslam**, Ehsan-ul-Haq**, Habib Iqbal Javed**, Muhammad Irfan*, Awais Rasool*, Muhammad Ishaque Mastoi** and Sumera Aslam*
EFFICACY OF PLANT DERIVED OILS AND EXTRACTS AGAINST WHITEFLY, BEMISIA TABACI (GENNADIUS) ON SESAME CROP
...(Genn.) is a polyphagous pest and is reported on more than 600 host plants worldwide. Different methods are being used for its control. The present experiment was conducted to determine the effect of some plant extracts of mint (Mentha spp.) and geranium (Pelargonium graveolens) and soybean oil (Glycine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data...
Naheed Zahra*, Hassnain Shah*, M. Azeem Khan* and M. Zubair Anwar*
LIVELIHOOD ASSETS AND POVERTY NEXUS: A CASE STUDY FROM RAINFED POTHWAR AREA OF PAKISTAN
...fy;"> The present paper is based on primary data collected from a sample of 40 households arround watershed project site at Fateh Jang in Pothwar region. The inter-linkage of livelihood assets and poverty is determined by employing poverty score card technique. The poverty status of household was highly correlated with the livelihood sources (P<0.01), water availability for irrigation(P<0.10) and tenancy status (P<0.05). The results regarding pov...
Rashid Minhas*, Iftikhar Ahmad Khan**, Faisal Saeed Awan**, Lal Hussain Akhtar*, Syed Awais Sajid Shah* and M. Shahjhan Bukhari*
ESTIMATION OF GENETIC DIVERSITY AND HYBRID IDENTIFICATION IN AMERICAN COTTON (GOSSYPIUM HIRSUTUM L.) BY PCR BASED RAPD ANALYSIS
...p;DNA of 15 cotton genotypes comprising five parents and their ten F hybrids was extracted successfully from their immature leaves to estimate 1 genetic diversity and hybrid identification. Out of the 26 RAPD primers used for DNA amplification, 14 primers produced polymorphic bands, while 12 produced monomorphic bands. These 14 primers yielded total 96 RAPD markers, out of which only 40 were found polymorphic which resulted in 41.66% polymorphism among the gen...
Munir Ahmad*, Asif Ali Mirani**, Hafiz Sultan Mahmood**, Tanveer Ahmad** and Muhammad Azhar Saeed**
PERFORMANCE EVALUATION OF CROSS-FLOW RICE DRYERS
...very during the milling operation. Recently, cross-flow rice dryers have been adopted in the rice milling industry of the country. The heat source of these cross-flow dryers can be a gas or rice husk. This study focussed on the performance evaluation of cross-flow rice dryers with both gas and rice husk heat sources. The experimental results indicated that drying air tem
Muhammad Tahir*, Muhammad Irfan* and Aziz-Ur-Rehman*
EFFECT OF FOLIAR APPLICATION OF ZINC ON YIELD AND OIL CONTENTS OF FLAX
... contents of flax. The experiment was laid out in randomized complete block design with three replications. The 12 different zinc levels viz., control, 0.25%, 0.50%, 0.75%, 1.00%, 1.25%, 1.50%, 1.75%, 2.00%, 2.25%, 2.50%, 2.75% and 3.00% were applied by foliar spray at bud initiation and after capsule filling stage of flax. Zinc was used as a source of ZnSO . All the zinc treatments significantly improved plant height, stem 4 -1 length, fruiting zone length, f...
Mian Sabahatullah*, Manzoor Ahmad Mashwani**, Qurratul Ain Tahira* and Mian Inayatullah*
NEW RECORD OF SUBFAMILY CHARMONTINAE (BRACONIDAE: HYMENOPTERA) IN PAKISTAN WITH THE DESCRIPTION OF A NEW SPECIES
...A cosmopolitan braconid species, Charmon extensor (Linnaeus), is first time recorded from Chitral area of Pakistan. A new species, Charmon ovchinnikovi, is described, illustrated and compared with its closely related species Charmon extensor. The new species is different from C. extensor because of different sculpture of metasomal tergum 1 and sha
Gul Zamin Khan*, Imtiaz Ali Khan**, Inamullah Khan* and Mian Inayatullah**
OUTDOOR BREEDING OF MOSQUITO SPECIES AND ITS POTENTIAL EPIDEMIOLOGICAL IMPLICATIONS IN KHYBER PAKHTUNKHWA
...tive abundance of Culex species in different districts were: Peshawar (32.3), Nowshera (18.8), Mardan (20.3) and Charsadda (21.0). Higher numbers of Aedes mosquitoes were observed in Nowshera (19.3), Peshawar (16.4), Charsadda (13.1), and Mardan (9.8), respectively. Mean monthly positive ovitraps of species was high in May and October collected from Peshawar (32.5, 31.5), Nowshera (25.3, 2...
Hassnain Shah*, Nadeem Akmal*, Waqas Farooq*, Muhammad Azeem Khan* and Shahid Munir**
SHIFT FROM SITE DEVELOPMENT TO SKILL DEVELOPMENT: A CASE STUDY OF WATER HARVESTING THROUGH MICRO CATCHMENTS
...vention through farmers' perceptions, feed-back, practices and intentions regarding up-scaling the technology would develop the up-scaling and sustainability options for wider area. Under Watershed Rehabilitation and Irrigation Improvement Project besides other technologies, rainwater harvesting through micro catch-ments were demonstrated by Soil and Water Conservation Research Institute (SWCRI) in Pothwar area, Pakistan. The results highlight that the technol...
Ambreen Akhtar Saddozai*, Amer Mumtaz*, Nouman Rashid*, Shahzada Arshad Saleem**, Saeeda Raza* and Muhammad Naeem Safdar*
COMPARISON OF INDIGENOUSLY DEVELOPED TANGERINE-ORANGE MARMALADE WITH BRANDED MARMALADES AVAILABLE AT LOCAL MARKETS
...tangerine marmalades, respectively. Sugar contents, pH and Brix ranged from 14.97% to 59.70%, 3.00 to 3.46, 15.0 B to 60.2 B in branded and non-branded marmalades, respectively. Organoleptically marmalade developed at FSPDI was non-significantly different from all the branded marmalades except Salman’s....
Nusrat Habib*, Saima Rani*, Sabeen Siddiqui*, Shah Zaman** and Muhammad Zubair Anwar*
IMPACT OF MAJOR FARM INPUTS ON PRODUCTIVITY OF SUGARCANE: A CASE STUDY IN TEHSIL KOT ADDU, PUNJAB, PAKISTAN
... 0.94, 0.23 and 0.76, respectively. The cost of FYM was significant at 1% level with negative impact on sugarcane productivity (-0.07). The coefficient 2 of multiple determinations R was 0.72, which designated that 72% deviation in the productivity of sugarcane was elucidated by all instructive variables and the 2 adjusted R was 0.71. To increase the output of sugarcane in the country, government may resolve the identified hurdles by providing subsidy on major...
Muhammad Sharif*, Muhammad Azam Niazi* and Abdul Jabbar**
SEAFOOD EXPORTS: CHALLENGES AND WAY FORWARD
... and Balochistan. This paper assesses current stock of seafood production, seafood exports, direction and future prospects of seafood exports from Pakistan. The production of inland and marine fish was 729,000 t in 2012-13. Not only seafood output in the country is low but dwindling to the disastrous level. Export of seafood has increased from 131,620 t (a value of US$ 315.5 million) in 2011-12 to 136,360 t (a value of US$ 3...
Farrukh Saleem*, Babar Hilal Ahmad*, Saleem Zahid* and Bilal Kabeer*
COMPARATIVE PRODUCTIVE PERFORMANCE OF INDIGENOUS NAKED NECK AND NAKED NECK CROSSBRED LAYER CHICKENS
...n comparative productive performance of indigenous Naked Neck (NN) and Naked Neck Crossbred (NNC) i.e., Naked Neck x White Leg Horn at Poultry and Wildlife Programme, National Agricultural Research Centre (NARC), Islamabad, Pakistan. A total of 72 birds (16 weeks of age) comprising 30 females and 6 males of each breed were divided into six experimental units / replicates (10 females and 2 male / replicate). Separate breeding...
ZafarUllah*, Muhammad Azim Malik*, Muhammad Ansar*, Shahzada Sohail Ijaz* and Muhammad Rasheed*
WINTER FORAGE QUALITY OF OATS (AVENA SATIVA), BARLEY (HORDEUM VULGARE) AND VETCH (VICIA SATIVA) IN PURE STAND AND CEREAL LEGUME MIXTURE
...h mixtures than their respective pure stands. The higher values of crude protein (CP) and lower values of neutral detergent fiber (NDF) and acid detergent fiber (ADF) reflected quality forage. CP for oats in oats-vetch -1 -1 mixture and barley in barley-vetch mixture was 175 g kg and 170 g kg , -1 respectively. NDF and ADF for oats in oats-vetch mixture were 494 g kg -1 and 341 g kg , respe
Nosheen Zahra*, Ghulam Sarwar* and Sher Muhammad**
COMPARISON OF GYPSUM AND POTASSIUM SILICATE FOR RECLAMATION OF SALINE SODIC SOIL
... the pots i.e., 3 plants per pot. Necessary N, P and K fertilizers were applied at the recommended rate. After crop harvest, soil samples were taken for analysis of pH, electrical conductivity (EC), sodium adsorption ratio (SAR) and exchangeable sodium percentage (ESP) of soil. All the amendments when used alone or in combination with each other improved the chemical parameters of soil. All levels of gypsum (100%, 75% and 50...
Usman Shakoor*, Abdul Saboor*, Irfan Baig*, Anila Afzal** and Abdul Rahman***
CLIMATE VARIABILITY IMPACTS ON RICE CROP PRODUCTION IN PAKISTAN
...t rising mean maximum temperature would lead to reduction in rice production while increase in mean minimum temperature would be advantageous towards rice production. Variation in mean minimum temperature brought about seven percent increase in rice productivity as shown by Variance Decomposition. Mean precipitation and mean temp...
Muhammad Aamir Khan*, Abdul Saboor*, Rauf-i-Azam**, Abdul Qayyum Mohsin* and Fayyaz-ul-Hassan***
IMPACT OF AGRICULTURAL TRADE LIBERALIZATION ON INCOME INEQUALITY IN PAKISTAN
...amework. The newly developed MyGTAP program was used to modify the Pakistan’s data in the Global GTAP Database and Standard GTAP model to include multiple households and labor types. This disaggregation allows to analyze distributional impacts and to implement policy scenarios that target particular households. The economy wise results showed that agricultural trade liberalization increases income inequality and somewh...
Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Abdul Razzaq*
EFFECT OF MIXING LOW PALATABLE GRASSES AND IPIL IPIL LEAVES ON FORAGE QUALITY
...a bipinnata, Sorghum halepense and Chrysopogon aucheri with tree leaves of Leucaena leucocephala (Ipil ipil) in the ratio of 75:25, 50:50, 25:75, along with sole species on their chemical composition. Samples were analyzed for proximate parameters (crude protein (CP), crude fiber (CF), total ash and ether extract (EE)). The results revealed that there were significant differences in dry matter (DM) among different grasses. D...
Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*
EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
... 25:75, along with sole species on their digestibility in small ruminants. Goats fed II , HC II , HC II , HC II and HC had similar 100% 25% 75% 50% 50% 75% 25% 100% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in...
Muhammad Shahzad*, Ayesha Tahir**, Naveed Jehan*** and Muhammad Luqman*
IMPACT OF DIFFERENT PACKAGING TECHNOLOGIES ON POSTHARVEST LOSSES OF STONE FRUITS IN SWAT PAKISTAN
...s were estimated through percentage method while partial losses were estimated at the wholesale and retail level by price differential method. Multiple regression analysis was employed to find relation between post-harvest losses and different factors at three different stages. Findings of the study revealed the channel of cardboard box technology accounted for post-harvest losses of 10.49% while at farm level, losses were 2.90%, at wholesale level 1.45% and r...
Sajid Ali* and Abdul Jabbar**
GROWTH AND VARIABILITY IN AREA PRODUCTION AND YIELD OF SELECTED FRUIT CROPS IN KHYBER PAKHTUNKHWA
...t crops including apple, peach, pear, and plum in Khyber Pakhtunkhwa province. The study is based on secondary data from 1975-76 to 2011-12 which is further bifurcated into three periods; period-I (from 1975-76 to 1990-91), period-II (from 1991-92 to 2011-12), and period-III (from 19...
Muhammad Ayub*, Rizwan Maqbool*, Muhammad Tahir*, Zoaib Aslam*, Muhammad Ather Nadeem* and Muhammad Ibrahim**
IMPROVED GROWTH, SEED YIELD AND QUALITY OF FENNEL (FOENICULUM VULGARE MILL.) THROUGH SOIL APPLIED NITROGEN AND PHOSPHORUS
...ut fertilizer. A field experiment, was conducted to study the effects of nitrogen and phosphorus fertilizer treatments (NP in ratio of 0:0, 30:0, -1 0:30, 30:15, 30:30, 60:30, 60:60, 90:45 and 90:90 kg ha ) on growth, seed yield and quality of fennel during 2011-2012. Fertilizer NP dose (90:45 kg -1 ha ) increased plant height by 44%, number of leaves per plant by 76%, 1000 seed weight by 44%, biological yield by 50%, seed y...
Mazher Abbas*, Irfan Mehmood*, Arshed Bashir*, Muhammad Ather Mehmood* and Sonila Hassan*
WOMEN COTTON PICKERS PERCEPTIONS ABOUT HEALTH HAZARDS DUE TO PESTICIDE USE IN IRRIGATED PUNJAB
...kistan, cotton crop has special importance from the perspective of largest employment generation both for males and females in the production and value chains. Cotton picking is primarily a female specific activity in all cropping zones of Pakistan. Women cotton pickers mostly belong to poor rural society involved in this labour force to feed their famil...
Arshed Bashir*, Fatima Ahmad**, Irfan Mehmood*, Muhammad Qasim*, Mazher Abbas* and Sonila Hassan*
ECONOMICS OF RED MEAT PRODUCTION IN PUNJAB
...: justify;"> This paper analyzes the cost and return estimates of red meat among different meat production systems namely subsistence rural farms, small sized specialized farm and commercial farms. Four districts of Punjab (Gujranwala and Sialkot from rice-wheat zone and Chiniot and Faisalabad from mixed cropping zone) were selected for data collection and 76 red meat producers were interviewed. The results showed that ...
Syeda Aimen Hadi*, Abid Ghafoor Chaudhry*, Aftab Ahmed** and Shaheer Ellahi Khan***
PERCEPTION, APPROACHES AND PRACTICES OF LOCAL FARMING AND DEVELOPMENT: AN ANTHROPOLOGICAL APPROACH
...and political system, shaped by the constraints and opportunities associated to the area. Effective and successful development projects must include the local perceptions, their approaches and practices, as the locals are the ones most representative of their issues and have the most workable solution to them. The traditional agriculture has completely been clutched into the nexus of modern farming methods, due to which they...
Muhammad Akhter*, Muhammad Azhar Ali**, Zulqarnain Haider* and Shahzad Muzammil***
PHYSICO-CHEMICAL CHANGES IN GRAINS OF SOME ADVANCE LINES/ VARIETIES OF RICE (ORYZA SATIVA L.) AFTER PARBOILING
...ce lines/varieties developed at Rice Research Institute, Kala Shah Kaku, including approved fragrant (Basmati) rice variety i.e., Basmati-2000, were used to assess interactive efficacy of parboiling on these varieties/lines and practical expediency of using standardized parboiling technique for improving nutritional, milling and cooking qualities of these lines/varieties. For this purpose, white milled and parboiled rice sam...
Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed****
INOCULATION AND INTER-CROPPING OF LEGUMES IN ESTABLISHED GRASS FOR INCREASING BIOMASS OF FODDER
... under fodders due to competition for food crops. Intercropping (33%, 50% and 67%) of Panicum maximum grass and legumes (Vicia sativa and cowpeas) coupled with inoculation was studied under rainfed conditions at National Agricultural Research Centre (NARC) Islamabad, Pakistan. Intercropping significantly increased tillering of grass. Seed inoculation of legumes also gave maximum tillers. The grass and legumes biomass without...
Tosif Tabassam*, Tariq Sultan**, M.Ehsan Akhtar**, M.Mahmood-ulHassan** and Arshad Ali**
SUITABILITY OF DIFFERENT FORMULATED CARRIERS FOR SUSTAINING MICROBIAL SHELF LIFE
...ormation an important property of a good carrier, mixing 40% of soil with other material was found suitable. Using 40% of soil, six different treatments were formulated and physico-chemical characteristics were determined. Four combinations in the range of 40% clay, 30-40% fly-ash, 10-15% press mud and 10-15% lignitic coal were selected which had good adhesion capacity, moisture holding capacity, nutrient contents and investigated for microbial shelf life. Sig...
Anum Fatima*, Saleem Abid* and Sobia Naheed*
TRENDS IN WHOLESALE PRICES OF ONION AND POTATO IN MAJOR MARKETS OF PAKISTAN: A TIME SERIES ANALYSIS
..., 8.82%, 8.53% and 8.88% per annum, respectively. Similarly, those of potato were increased @ 8.42%, in Lahore; 7.73%, Hyderabad; 8.21%, Peshawar and 7.58%, Quetta market. The increasing prices of these two essential household items will be difficult to manage by the consumers. Hence, the government has to make some measures, rules and regulations regarding control of prices. ...
Rashed Saeed*, Shoaib-ur-Rehman**, Muhammad Qasim*, Hafiz Zahid Mahmood*** and Irfan Mehmood*
ECONOMICS OF PERI-URBAN RADISH PRODUCTION AND MARKETING IN FAISALABAD
...s selected randomly from peri-urban area of district Faisalabad, Pakistan. It was found that majority of farmers were not following recommendations of the agriculture department regarding seed rate, fertilizers, and irrigations. Majority of respondents (94.2%) reported the local Meno as the best yielding variety. Imported and 40 day varieties were not popular as only 5.8% farmers were cultivating these varieties in the study area. On the basis of survey data, ...
Riaz Hussain*, Muhammad Riaz**, Mushtaq A. Saleem*** and Muhammad Ishaque Mastoi**
BIOCHEMICAL ABNORMALITIES INDUCED BY ABAMECTIN IN SIXTH INSTAR LARVAE OF THE RED FLOUR BEETLE, TRIBOLIUM CASTANEUM (HERBST)
... abamectin treated glass petri dishes. The surviving ones were then homogenized in saline and centrifuged prior to biochemical analyses. Results showed differences in the activities of enzymes and quantities of total protein, soluble protein and FAA between strains and among concentrations. Abamectin, at LC and LC , changed the activities 10 20 /levels of TE, CE, AcP, total protein and FAA in the larvae of both the strains. The activities of alpha-amylase, glu...
Khalid Mahmood Aujla* and Abid Hussain*
ECONOMICS OF MILK PRODUCTION OF MAJOR DAIRY BUFFALO BREEDS BY AGRO-ECOLOGICAL ZONES IN PAKISTAN
...uffalo breed farmers, respectively. The study revealed that among the structure of cost components, feed cost occupied the major share in total cost of milk production. Milk production of buffaloes of Nili-Ravi and Kundhi breeds were 2889 and 2375 liter per annum, respectively. Total costs of milk production of Nili-Ravi and Kundhi buffalo breeds were Rs.96155 and Rs.90604
Riaz Hussain*, Muhammad Riaz** and Mushtaq A. Saleem***
TOXICITIES OF AZADIRACHTIN AND POLYCHLORINATED PETROLEUM HYDROCARBON AGAINST RESISTANT AND SUSCEPTIBLE STRAINS OF TRIBOLIUM CASTANEUM (COLEOPTERA: TENEBRIONIDAE) ADULTS
...ermined through filter paper impregnated method against azadirachtin (Nimbokil 60 EC) and polychlorinated petroleum hydrocarbon (Tenekil 100 EC). The LC values of these insecticides were worked out as 12830 and 50 9331 ppm for azadirachtin and 5148 and 4047 ppm for Tenekil 100 EC against PAK and FSS-II strains, respectively. The results revealed that polychlorinated <...
Muhammad Hidayat Rasool*, Abuzar Muhammad Afzal*, Abu Baker Siddique*, Waseem Akram**, Muhammad Saqalein*, Madiha Basit* and Muhammad Farooq Tahir***
ANTIVIRAL ACTIVITY OF VIRO CARE GZ-08 AGAINST NEWCASTLE DISEASE VIRUS IN POULTRY AND ITS IN-VITRO CYTOTOXICITY ASSAY
...assay of the product was performed using Vero cell line. All the trials revealed that the stock solution and 1:2 dilution of GZ-08™ had some antiviral activity as well as were cytotoxic. As the concentration decreased, cytotoxicity as well as antiviral activities were lost. Based on these findings, it was concluded that GZ-08™ sanitizer or spray can be used as antiviral agent to clean or disinfect some non-living surfaces against different viruses ...
Muhammad Asif Jamil*, Nowshad Khan*, FarhatUllah Khan* and Muhammad Zakria*
EFFECTIVENESS OF AGRICULTURAL EXTENSION SERVICES IN DISSEMINATION OF INFORMATION TO THE FARMING COMMUNITY OF DISTRICT BHIMBER, AZAD JAMMU AND KASHMIR
...% of the respondents had personal acquaintance with the extension staff and 12.67% of them knew extension staff through their neighbour, while 38% of respondents from their friends. The farmers who knew extension staff through relatives were only 16%. It was also found that demonstration, personal contact, group meetings and training were effective methods of communication. The study concluded that other sources of informati...
Israr Ali*, Naushad Ali*, Riffat Tahira**, Sardar Ali*, Izhar Hussain* and Sher Aslam Khan*
GENETIC DIVERSITY ASSESSMENT IN BRASSICA GERMPLASM BASED ON MORPHOLOGICAL ATTRIBUTES
...ity of 28 Brassica genotypes was studied using different morphological attributes. Data were recorded on days to maturity (DM), -1 -1 plant height (PH), primary branches plant (PBPP), pod length (PL), seed pod (SP), -1 1000-seed weight (1000-SW), yield plant (YPP) and oil (%). Three checks (Pakola, CM and TA), were used to check the performance of collected materials with already available brassica varieties. Significant sta...
Said Salman*, Shah Jehan Khan* and Javed Khan**
HETEROSIS AND HETROBELTIOSIS PERFORMANCE OF MORPHOLOGICAL TRAITS IN BREAD WHEAT CROSSES UNDER DROUGHT STRESS CONDITIONS
... lines as parents. The experiment was conducted at the Faculty of Agriculture, Gomal University, Dera Ismail Khan, Pakistan during 2012-13. The performance of crosses and their parents were evaluated with three replications. These crosses were -1 evaluated for plant height, number of tillers plant , days to 50% heading, -1 -1 spike length, number of spikelets spike , number of grains spike and 1000-grain weight. Maximum hete...
Muhammad Qasim*, Sonila Hassan*, Arshed Bashir*, Hafiz Zahid Mahmood** and Irfan Mehmood*
ANALYZING PRODUCTION POTENTIAL OF SELECTED FOOD AND LEGUME CROPS FOR FOOD SECURITY IN PUNJAB, PAKISTAN
... 0.9%, 2.1% and 0.8%, respectively with the production growth of 3.0%, 3.8% and 2.2%, respectively and yield growth of 2.1%, 1.6% and 1.5%, respectively. The results highlighted that the major contribution for expansion in production for rice and sugarcane was area while it was yield for wheat. In this scenario the wheat production can be enhanced by increasing its area than that of rice a...
Sameera Arshad*, Iftikhar Hussain*, Maqsood Anwar* and Sarwat Naz Mirza*
HABITAT SURVEY FOR RECOGNIZING BIRD ATTRACTANTS AROUND BENAZIR BHUTTO INTERNATIONAL AIRPORT, ISLAMABAD, PAKISTAN
...ields that attract bird species, pose serious threat to aviation industry. Habitat survey for recognizing bird attractants and hazardous bird species was carried out at 8 selected study sites within 8 km radius of Benazir Bhutto International Airport (BBIA), Islamabad. Each site represented a different habitat and was ranked for the presence of bird attracting sites using Habitat Composite Index (HCI). Habitat representing n...
Amjad Pervez*, Syed Muzaffar Ahmed*, Akhlaq Ahmad** and Qazi Mehmood Ali**
EVALUATION OF DIFFERENT FOOD GRAINS AS BAITS FOR MANAGEMENT OF HYSTRIX INDICA
...buted and serious rodent pest of orchards, field crops and vegetables in Pakistan. Laboratory studies were conducted to determine highly effective cereal used as bait base for its management. Six locally available food grains viz., wheat, rice, maize, black gram, sorghum and millet were offered in whole/crack form. Under no choice and choice tests, rice was the most preferred food, followed by wheat, maize and others. The present study suggested that rice in w...
Quratulain*, Muhammad Aslam**, Muhammad Khalid Rafique*, Mian Atiq Ahmad* and Rashid Mahmood***
POPULATION DYNAMICS OF ROSE APHID MACROSIPHUM ROSAE L. ON DIFFERENT CULTIVARS OF ROSA INDICA L. IN PAKISTAN
...e counted from leaves (upper, middle and lower leaves), buds and flowers by visual observation from tagged plants. Aphid populations start to develop in November and its population decline with decline in temperature in December. While its population started rising again at the end of February. Significantly more aphid populations were observed on Perfecta than other varieties; however, significantly few aphids were observed...
Junaid Alvi*, Ijaz Ashraf*, Khalid Mehmood Ch*, Muhammad Iftikhar* and Saleem Ashraf**
IMPACT OF LIVESTOCK IN UPLIFTING RURAL LIVELIHOOD
...lfillment. Farmers were spending income on family chores, education, health and other aspects of life. Informal discussions and observation dictated the lower productivity than the potential and inadequate awareness and adoption of precise dairy farming practices. Livestock keepers demanded provision of location specific best management practices, traini...
Nouman Badar*, Hina Fatima**, Abdul Jabbar*** and Muhammad Asif*
MAJOR FOOD CROPS PRODUCTION AND YIELD FORECAST IN PAKISTAN
...tons and 3454 kg ha , respectively. The rice (production -1 and yield) forecast for 2029-30 will be about 7176 thousand tons and 2630 kg ha , respectively. The maize (production and yield) forecast for 2029-30 will be about -1 5784 thousand tons and 6088 kg ha , respectively. In short, the production growth rate of wheat, rice and maize was higher in 2012....
Sobia Naheed*, Irum Raza*, M. Zubair Anwar*, Nusrat Habib*, Naheed Zahra* and Sabeen Siddiqui*
FORECASTING AREA AND PRODUCTION OF BARLEY IN PUNJAB, PAKISTAN
...ion (MAD), mean absolute percentage error (MAPE), and mean squared deviation (MSD). The values of these
measures were lowest for the double exponential smoothing method, therefore, this method was selected for predicting barley production and area in Punjab from 2012 to 2016. Five years forecast for barley area in Punjab was 26.140,
25.360, 24.580, 23.800, 23.0...
Saqib Shakeel Abbasi*, Ayesha Tahir**, Irum Raza* Saleem Abid* and Muhammad Nisar Khan*
TREND ANALYSIS AND FORECASTING OF WHEAT AND RICE IN PAKISTAN
... every household. This paper analyses the price trends for these crops over the last 30 years and based on statistical models, forecast their prices from 2013 to 2017. Different models have been applied to get the best fit model. These were linear trend model, quadratic trend model, exponential growth model and S-curve model. The minimum values of Mean Absolute Percentage Error (MAPE), Mea...
Muhammad Mohsin Raza*, Muhammad Aslam Khan*, Irfan Ahmad**, Ali Ahsan Bajwa***, Hafiz Muhammad Usman Aslam*, Badar Ahsan Ullah****, and Kashif Riaz*
FOREST PATHOGENS AND DISEASES UNDER CHANGING CLIMATE -A REVIEW
...equency of occurrence, types and severity of forest diseases caused by diverse pests, resultantly altering the forest ecosystems. The present review covers the relationship between climate and diverse cases of forest diseases and potential shocks of climate change on pathogens and diseases. Biotic diseases, cankers, decays, declines, foliar diseases, root diseases and stem rust of pine have been reviewed with some illustrati...
Khurram Nawaz Saddozai*, Umme Rubab* and Abass Ullah Jan*
STOCHASTIC FRONTIER ANALYSIS OF MAIZE FARMERS IN AZAD JAMMU AND KASHMIR, PAKISTAN
...s through Cobb-Douglas type Stochastic Frontier Analysis in four villages of Muzaffarabad district, Azad Jammu and Kashmir (AJK), Pakistan. The proportional sampling allocation sampling technique was adopted to collect primary data from 80 sampled respondents in 2013-14. The maximum likelihood estimates of major inputs showed that seed, tractor hours, FYM and labor days have contributed significantly to increase the maize yield. However, the DAP and urea have ...
Khurram Nawaz Saddozai*, Muhammad Nasrullah* and Noor P. Khan**
STOCHASTIC FRONTIER PRODUCTION ANALYSIS OF TOBACCO GROWERS IN DISTRICT MARDAN, PAKISTAN
... demonstrate that only experience of tobacco growers in study area was significantly decreasing the inefficiency of the growers. The study has concluded that tobacco growers are operating in the second stage of production; therefore, tobacco production can still be enhanced. It is recommended that season long trainings for tobacco growers may be undertaken by the concerned authorities to enhance the crop management skills fo...
Umar Ijaz Ahmed*, Liu Ying**, Muhammad Khalid Bashir***,
Muhammad Amjed Iqbal*, Muhammad Rizwan*, Muhammad Mazhar
Iqbal****, Muhammad Rafi Qamar***** and Aftab Nazeer******
SPATIAL PRICE TRANSMISSION IN PAKISTAN: THE CASE OF WHEAT AND RICE MARKETS
...rastructure is a major impediment to price transmission among the markets. These market imperfections lead to food insecurity in the country. Government should formulate better policies and develop infrastructure towards better and efficient market function. The results of this study will help the policy makers to formulate a better policy to enhance marketing function to overcome food insecurity situation....
Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**
EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...d phenolic compounds, respectively. Proteins were greatly affected by fertilizer treatment and water stress, but phenolic compounds remained unchanged upon fertilizer treatment. However, they were greatly affected by irrigation and water -1 stress. Crop treated with 100 kg ha P O under water stress maintained high 2 5 protein content as compared to unfertilized and no water stress treatments. However, phenolic compounds were found higher in fully irrigated pla...
Ali Raza Shah**, Muhammad Saffar Mirjat**, Abdul Quadir Mughal***, Inayatullah Rajper** and Asif Ali Mirani****
PERFORMANCE EVALUATION OF DIFFERENT TILLAGE SYSTEMS IN A CLAY LOAM SOIL*
...align: justify;">Field experiments were conducted to assess the performance of different tillage systems in a clay loam soil. A completely randomized block design with four treatments i.e., conventional tillage (CT), minimum tillage (MT), zero tillage (ZT) and controlled traffic farming (CTF) was carried out to evaluate the performance of tillage systems. Results indicated that the soil pu...
Raja Zoq-ul-Arfeen*, Aamir Saleem*, Sarwat Naz Mirza*, Muhammad Akmal**, Hafiz Muhammad Tayyab* and Obaid Afzal***
BIODIVERSITY AND PHYTOSOCIOLOGICAL STUDIES OF UPSTREAM AND DOWNSTREAM RIPARIAN AREAS OF PAKISTAN: SPECIAL REFERENCE TO TAUNSA WILDLIFE SANCTUARY AND KETI SHAH FORESTS
...hich belong to 54 plant species with 18 different families. In Taunsa pre-monsoon survey, total 30 plant species were found with 4476 plants from 16 different families. In Taunsa post-monsoon survey total 3348 individuals were recorded from 20 plant species and 9 families. Similarly, in Keti Shah forest, total 3975 individual were recorded from 22 specie...
Ambreen Akhtar Saddozai*, Amer Mumtaz*, Saeeda Raza* and Shahzada Arshad Saleem**
MICROBIAL COUNT AND SHELF LIFE OF PHALSA (GREWIA ASIATICA) JUICE
...life of laboratory developed phalsa juice at room temperature. Phalsa was purchased from local market, juice was prepared and kept in sterilized bottles at room temperature. Physicochemical and microbial and oragnoleptic quality of the juice was examined till two weeks. Microbial activity in phalsa juice increased while organoleptic attributes such as texture (mouth feel), flavour, taste, ...
Imran*, Shaheeda Naveed**, Asad Ali Khan* and Inayat Khattak*
IMPACT OF PHOSPHORUS LEVELS AND SEED RATES ON GROWTH AND YIELD OF LATE SOWN MAIZE ON HIGH ELEVATION IN SWAT, PAKISTAN
...aize (Zea mays L.). An experiment on effect of different P O levels and seed rates on growth and yield of late sown maize cv. 2 5 Baber on high elevation during kharif season, was conducted at Farmer Field School, Swat, Pakistan during summer 2012. The experiment was laid out in randomized complete block design having three replications. Sowing was done one month late (July 15) than the optimum time of sowing. Optimum time o...
Anwar Hussain* and Muhammad Rahman**
ROLE OF TRAININGS ON FARMERS' PROFITABILITY OF MEDICINAL AND AROMATIC PLANTS IN MOUNTAINOUS AREAS OF DISTRICT SWAT, KHYBER PUKHTUNKHWA
...der Swiss Development Cooperation Project at the time of collection, harvesting, cleaning, drying, packing and marketing of MAPs. The overall findings revealed that the training had positive impact on farmers' revenue. If standardized, the MAPs collected, they can get fair prices for their products. The study recommends that the government and non-governmental organization should arrange such type of trainings in other regio...
Muhammad Nisar Khan*, Tariq Hassan*, Hassnain Shah*, Saleem Abid*, Irum Raza* and Saqib Shakeel Abbasi*
ASSESSMENT OF THE PROFESSIONAL TRAINING COURSE UNDER WATERSHED PROJECT AT FATEHJANG FIELD STATION, PUNJAB, PAKISTAN
...presentations about the specific technologies discussed during the training....
Naheed Zahra*, Nadeem Akmal*, Sobia Naheed*, Nusrat Habib*, Sabeen Siddiqui* and Irum Raza*
TREND ANALYSIS OF RICE AREA AND YIELD IN PUNJAB
...nbsp; The present paper to estimated the situation of rice regarding its area and yield in Punjab, the estimation is based on time series data from 1980 to 2011. On the basis of minimum errors of accuracy measure quadratic model was selected. The estimated results revealed that there is an increasing trend in the area and yield of rice in Punjab. The area of rice was 276800 ha in 2012 and would be 2934280 ha in 2016. Likewise results about yield indicated...
Syeda Nasreen*, Muhammad Ayub Khan*, Muhammad Arshad*, Maryam Kamal**, Doulat Baig *, M. Tariq*, Talat Gilani* and Musarrat Gilani*
COMBINING ABILITY STUDIES FOR SEED YIELD TRAITS IN SUNFLOWER
...1 expressed the highest specific combining ability (SCA) value for yield while CMS 303 x RHA-854 hybrid exhibited the highest SCA estimates for harvest index. CMS-53 x RHA-854 and CMS-64 x SF-187 crosses exhibited the highest SCA estimates for head diameter and 1000-seed weight, respectively. The SCA variances were higher than GCA for seed yield and related traits revealing the involvement of non-additive ty
Doulat Baig*, Fida Mohammad Abbasi*, Habib Ahmed*, Maqsood Qamar** and Muhammad Ayub Khan**
RESPONSE OF SUNFLOWER HYBRIDS TO DIFFERENT NITROGEN LEVELS FOR PHYSIOLOGICAL AND AGRONOMICAL TRAITS UNDER FIELD CONDITIONS
... The protein is wholly dependent upon the amount of nitrogen fertilization available in soil for the plant use. A two year study was conducted in 2012 and 2013 at National Agricultural Research Centre (NARC), Islamabad, Pakistan. The experiment was aimed to –1 –1 evaluate the effect of different nitrogen (N) levels (N = 0 kgha , N = 60 kgha , N = 0 1 2 –1 –1 –1 –1 80 kgha , N3 = 120 kgha ,...
Imdad Ali Mahmood*, Arshad Ali**, Armghan Shahzad**, Muhammad Asif Masud Ghumman***, Muhammad Arshad Ullah**, Tariq Sultan** and Badar-u-Zaman**
CROP RESIDUES AND PHOSPHORUS EFFECT ON YIELD AND ECONOMICS OF DIRECT SEEDED RICE AND WHEAT GROWN UNDER SALINE-SODIC SOIL
...f paddy and -1 wheat, respectively were obtained with P O @ 80 kg ha under crop residue 2 5 -1 incorporation. Although, the yields produced with the treatment, 80 kg P O ha + 2 5 -1 crop residue, performed similar to P O @ 120 kg ha without crop residues 2 5 incorporation during both the years. However, on average, grain yield of direct seeded rice and subsequent wheat was significantly supe
Azhar Usman Ali*, Ghulam Sarwar*, Muhammad Aftab* and Sher Muhammad**
EFFECT OF SOIL AND FOLIAR APPLIED COPPER ON GROWTH AND YIELD OF WHEAT (TRITICUM AESTIVUM L.)
...n: justify;"> The experiment was conducted to evaluate the effect of copper on wheat growth and soil composition through its soil and foliar application. For -1 this purpose, non-saline non-sodic soil (pH = 8.10, EC = 0.85 dS m , SAR = 4.60, saturation percentage = 29 % and sandy clay loam) was collected, brought to -1 green house and filled in the pots @ 6.5 kg pot . All these pots w...
Muhammad Mudasar Aslam ⃰, Muhammad Jamil**, Ijaz Malook**, Amana Khatoon*, Ali Rehman*, Abdur Rahim***, Pirzada Khan*, Shakir Ullah Khan Shakir*, Shahid Irfan*, Faizan Ullah****, Khair Ul Bashar**, Mahideen Afridi** and Shafiq Ur Rehman*
PHYTOTOXIC EFFECTS OF CALOTROPIS PROCERA, TAMARIX APHYLLA AND PEGANUM HARMALA ON PLANT GROWTH OF WHEAT AND MUSTARD
Sohaib Arshad*, Sarwat Naz Mirza*, Imtiaz Ahmad Qamar** and Maqbool Shahbaz**
DETERMINATION OF FORAGE QUALITY OF INDIGENOUS AND EXOTIC RHODES GRASS ACCESSIONS UNDER RAINFED CONDITIONS
...om > 12% to < 5% depending upon the different growth stages of the grasses. Sabre showed highest CP content than other two at flowering stage. The results also showed that protein contents were lowest at the maturity stage of all the experimented grasses. This study has shown that Katambora is the variety which can be adapted to Pakistani climate and can give better forage yield in rainfed conditions, and this variety ...
Hafiz Saqib Habib*, Arshad Mahmood Malik*, Abid Ali** and Muhammad Aamir Khan***
SOCIOECONOMIC DETERMINANTS OF RURAL HOUSEHOLD FOOD EXPENDITURES IN RAWALPINDI
...fy;"> Higher food expenditures disturb the delicate balance of allocated decisions of household monthly expenditures. Several past studies in Pakistan have been committed on determining household consumer's characteristics on requirement for specific kinds of food; however less consideration has been devoted to the parameters of household food expen...
Khalid Mahmood Aujla* and Abid Hussain*
MARKETING SYSTEM OF LIVE CAMELS IN THE DESERT ECOLOGIES OF PAKISTAN
...On an average two camels per farm mainly to meet urgent family cash needs. Mean ages of adult males, milking and non-milking females, male and female young stocks at the time of sale were 8.3, 10.8, 12.3, 1.8 and 2.3 years, respectively, with average sale prices of Rs.102523, Rs.84643, Rs.57800, Rs.43215 and Rs.45833, respectively. The camel markets are generally located far away from the ...
S. Talat Gilani*, Shahid Hameed* and Hussain Shah*
OCCURANCE AND DISTRIBUTION OF POTY VIRUSES INFECTING GARLIC IN PAKISTAN
...Pakistan. The yellow stripes, mosaic and chlorotic spot symptoms of the disease resemble the viral infection in garlic reported to occur worldwide. Altogether 690 samples were collected from 29 locations of Punjab and 40 locations of Khyber Pukhtunkhwa to determine the prevalence of Onion Yellow Dwarf Virus (OYDV) and Leek Yellow Stripe Virus (LYSV). Serological testing DAS-ELISA technique was used to test the samples collec...
Sumia Bint Zaman*, Waqas Farooq*, Sidra Majeed*, Hasnain Shah*, and Abdul Majid**
ASSESSMENT OF AGRICULTURE SERVICE PROVIDERS' TRAINING ON WATER CONSERVATION TECHNOLOGIES IN POTHWAR REGION
...servation technologies especially, High Efficiency Irrigation Systems (HEIS) remained unpopular due to absence of service sector for these technologies despite of the efforts being carried out since long. Therefore, a training component to prepare a cadre was included in the USDA funded 'Watershed Rehabilitation' project being implemented in collaboration with ICARDA and other NARS partners. The prime objective of these training programmes was to impart traini...
Muhammad Farrukh Saleem*, Munir Ahmad*, Shakeel Ahmad Anjum*, Muhammad Aown Sammar Raza** and Abdul Shakoor*
EFFECT OF TOPPING UNDER DIFFERENT NITROGEN LEVELS ON EARLINESS AND YIELD OF COTTON
...ustify;"> Cotton is perennial plant with indeterminate growth habit. However it has been adopted as annual, so efforts like topping and optimum nitrogen levels to modify its architecture can play a role in improving its success as annual. A field experiment to study the effect of topping under different nitrogen levels on earliness and yield of cotton (Gossypium hirsutum L.) was conducted at Agronomic Research Area, Uni...
Muhammad Tahir* and Nawal Zafar*
FORAGE YIELD AND QUALITY PERFORMANCE OF RABI CEREALS SOWN ALONE AND IN BLENDED POPULATION AT VARIABLE SEED RATIOS
...stan. However, the yield per acre is still far below than optimum production level of the livestock. From this perspective, a field trial was conducted using seeds of three cereal crops wheat, oat and barley sown alone and blended together at different seed proportions (100%: 0%, 75% + 25%, 50% + 50% and 25% + 75%) at the Agronomic Research Area, Department of Agronomy, University of Agric...
Muhammad Mansoor*, Noman Latif*, Zafar Islam**, Sher Muhammad**, Amanullah* and Muhammad Umair***
IMPACT ASSESSMENT OF SOIL AMENDMENTS ON SOIL CAPPING IN MUNGBEAN PRODUCTION USING CENTRAL PIVOT IRRIGATION SYSTEM IN CLAYEY SOILS
...ustify;"> A field experiment was conducted to evaluate the soil capping problem under central pivot irrigation system using different soil amendments. The experiment was laid out in randomized complete block design, replicated thrice. Mungbean (Vigna radiata L ) variety “Dera Mung” was used as test crop. Soil amendments were carried out through pure sand and farm yard manure (FYM) in equal proportions and in...
Muhammad Zahid Kiani*, Tariq Sultan**, Arshad Ali**, Ghulam Qadir*** Imdad Ali Mahmood**, Tauseef Tabassam**, Muhammad Arshad Ullah** and Nasir Abbas*
EFFECT OF PGPR STRAINS ON SUNFLOWER GROWTH AND NUTRIENT CONTENTS UNDER SALINITY STRESS
...conducted to examine the performance of four isolated strains in five treatments viz., KS 44, KS 7, KS 41, KS 42 and KS mix under four different artificially developed -1 salinity levels (5, 8, 10 and 12 dS m ) at National Agricultural Research Centre, Islamabad. Hybrid seeds (SMH 0917) of sunflower (Helianthus annuus L.) were used. After six weeks of sowing, plants were harvested and data regarding root length, plant height...
Muneeb Zafar*, Tahir Mehmood**, Irfan Ahmad Baig**, Abdul Saboor** Mazher Abbas***, Shumaila Sadiq** and Khalid Mahmood****
ANALYTICAL DIAGNOSTICS OF NON-OPTIMAL USE OF PESTICIDES AND HEALTH HAZARDS FOR VEGETABLE PICKERS
...: justify;">Economically pesticides are meant to control pests in the fields. Up to certain optimal use of a typical pesticide, it enhances the yield of crops and vegetables. But, eventually amplified use of pesticides results in contamination of environment (water, soil, and air) and increase the health cost of vegetable pickers. The purpose of this stu...
Abdul Hameed Solangi*, Fateh Khan Nizamani*, Aqeel Ahmed Siddiqui*, Muzaffar Ali Khan**, Parwaiz Ahmed Baloch*, Riazuddin* and Khalil Ahmed Solangi***
FIELD COMPARISON AND MORPHOLOGICAL CHARACTERS OF GUAR (CYAMOPSIS TETRAGONOLOBA L. TAUB.) GENOTYPES UNDER AGROCLIMATIC CONDITIONS OF KARACHI, PAKISTAN
...ent study, 12 guar genotypes were evaluated at Institute of Plant Introduction, Pakistan Agricultural Research Council, Karachi, Pakistan. Results revealed that the plant length was high in Acc. No.3 as compared to the other genotypes. Branches per plant were high in Acc. No. 8 as compared to Acc. Nos. 1-7 while, non-significant differences among Acc. Nos. 1, 3, 6 and 9. Moreover, results ...
Samina Qamer*, Iram Nasir**, Um-Habiba Zafar**, Salma Sultana** and Tayyaba Sultana**
BIO-CHEMICAL EVALUATION OF HONEY PRODUCED BY APIS MELLIFERA HONEYBEE COLLECTED FROM JHANG, BAHAWALPUR, MULTAN, JHELUM AND KALAR KAHAR AREAS
...ys were found within the permissible limits. The average moisture contents were 18.30%, 18.35%, 17.66%,16.27% and 18.7% from Jhang, Bahawalpur, KalarKahar, Multanand, and Jhelum, respectively. Similarly, the pH 4.26, 4.50, 3.91, 3.72 and 3.33; electrical conductivity, 204.67mScm-1 ,137.8 mScm-1 , 202.62mScm-1 ,277.33mScm-1 and 196.96mScm -1;free acidity 25.80 meqkg -1, 26.16 meqkg-1 , 24.97 meqkg -1, 30.25 meqkg , 25.4 meqkg...
Farid Asif Shaheen*, Sadia Parveen*, Ahmed Zia**, Ghulam Qadir*,
Mureed Husain*** and Rifat Ullah Khan****
PREDATORY APTNESS OF ANTS AGAINST RED FLOUR BEETLE, TRIBOLIUM CASTANEUM HERBST (TENEBRIONIDAE: COLEOPTERA) IN WHEAT FLOUR
... of the most destructive pests of stored grains and other food products including wheat flour. Due to its severe infestation, the flour gets mouldy, turns yellowish, gets pungent odour and becomes unhealthy for human consumption. The infested samples of wheat flour by T. castaneum were collected from different localities and its culture was maintained in laboratory. Three ant species namely, Dorylus labiatus, Camponotus rufi...
Waqar Akhtar*, Muhammad Sharif**, Abdul Hayee Qureshi*, Khalid Mahmood Aujla*** and Muhammad Azeem Khan*
COMPETITIVENESS OF TOMATO PRODUCTION IN PUNJAB, PAKISTAN
...sp;The study measures competitiveness at farm level and economic efficiency at country level of tomato production in relation to tomato trade by using Policy Analysis Matrix (PAM) framework in Punjab, Pakistan. The province was divided into two tomato production regions i.e., Central and Southern Punjab for analysis purpose under importable scenario by using import parity price. Results of PAM model revealed that tomato production in both regions of Punjab has...
Ghulam Sadiq Afridi*, Abdul Saboor**, Zahoor-ul-Haq***, Sultan Ali
Tariq**** and Muhammad Ishaq*****
EXPLORING POTENTIAL AND OPPORTUNITIES FOR PAKISTAN'S COTTON EXPORT
...ools enabled the trade experts and policy makers to explore the answer of lackness for diversification in export, HS-2- digits aggregated data for cotton sub-sectors have been used with latest data from 2004 to 2013 for the panel of 39 countries. Revealed Comparative Advantage (RCA) index and gravity model approach was employed considering country and time specific fixed effect. The RCA index revealed that cotton sub-sectors...
Sidra Majeed*, Mubbashira Nazir*, Sumia Bint Zaman * and Waqas Farooq*
POTENTIAL OF SUGAR BEET PRODUCTION IN PAKISTAN: A REVIEW
...and of sugar i.e., 25 kg per capita per annum. Cane and beet are two major sources of sugar production in Pakistan. Sugarcane production in the country could meet only 75% demand of existing sugar mills. Present study looks into the prospects of sugar beet production especially in water scarce areas to bridge the demand gap and scrutinize the issues and ...
Nisar Ahmed Soomro*, Abdul Fatah Soomro**, Hamz Ali Samo* and
Muhammad Siddique Depar***
GROWTH AND YIELD COMPARISONS OF FOUR COMMERCIAL WHEAT VARIETIES TO IRRIGATION FREQUENCIES
...Imdad-2005 maximizes its performance with 90.81% germination, 88.33 cm plant height, 10.29 tillers plant , 273.10 tillers m , 54.99 grains spike , 58.40 g 1000-seed weight and 5804.66 kg grain yield ha . However, varieties TJ-83, Kiran and T.D-1 ranked 2 , 3 and 4 in all the growth traits examined in this study. It was concluded that the differences in grain yield between the crop receiving five and four irrigations were statistically nonsignificant; which sug...
Abdul Razaq*, Muhammad Jamal Khan*, Tahir Sarwar* and Mohammad Jamal Khan**
EFFECT OF DEFICIT IRRIGATION, SOWING METHODS AND MULCHING ON WHEAT YIELD AND NITROGEN UPTAKE
...arm lands, increasing temperature with high evaporation rate and poor sowing, an experiment was conducted at the research farm of the University of Agriculture, Peshawar during 2011-12. In the study three factors were studied i.e., sowing methods, mulching and deficit irrigation with four levels viz: full irrigation (DI ), 20% deficit irrigation (DI ), 40% deficit irrigation (DI ) and 60% deficit irrigation (DI ). Soil moist...
Muhammad Nisar Khan*, Hassnain Shah*, Saqib Shakeel Abbasi and Abid Hussain*
FARMERS PERCEPTION TOWARDS THE APPLICATION OF BIOZOTE IN SELECTED DEMONSTRATED RICE FIELDS AT HAFIZABAD AND SHEIKHUPURA DISTRICTS
...an”. The present paper aimed to assess the performance of biozote on rice and is based on perceptions of farmers involved in on-farm demonstration trials. Four different treatments on each selected plot were carried out for demonstration purpose by a team of technical partners from NARC during 2014. The results are based on farmers’ perceptio...
Shahid Iqbal Khattak*, Muhammad Amjad Nadim**, Mohammad Safdar Baloch**, Kashif Waseem** and Muhammad Sohail***
IMPACT OF VARIABLE SEEDING DATES ON CEREALS' PERFORMANCE UNDER AGRO-ECOLOGICAL CONDITIONS OF DERA ISMAIL KHAN
...gh a two factors field experiment under split-plot arrangements at Agricultural Research Institute, D.I.Khan during 2012-13. Four cereals (wheat, triticale, barley, oat) were assigned to main plots while six different sowing dates (October 15, November 1 & 15, December 1 & 15 and January 1) were kept in subplot. The experiment was replicated four times with a sub-plot size of 5 m × 1.8 m (9 m ). Sowing of barle...
Abdul Haq*, Anjum Shehzad**, Muhammad Ilyas**, Muhammad Ishaque Mastoi**, Abdul Rauf Bhatti** and Mian Inayatullah*
DIVERSITY AND RELATIVE ABUNDANCE OF CITRUS POLLINATORS IN DISTRICT HARIPUR, PAKISTAN
...p> As many as 3094 specimens of adult citrus pollinators collected from district Haripur represented four orders of insects i.e., Diptera with 16 species, Hymenoptera with 14 species, Lepidoptera with 3 species and Coleoptera with 2 species. The calculated values of relative abundance showed that is most abundant ...
Inayat-Ur-Rahman*, Shamsher Ali**, Mukhtar Alam*, Mohammad Adnan*, Hidayat ullah*, Muhammad Faisal Anwar Malik*, Abdul Sattar Shah* Mohammad Ibrahim*
EFFECT OF SEED PRIMING ON GERMINATION PERFORMANCE AND YIELD OF OKRA ( L.)
...emergence in okra, two experiments, i.e., laboratory and field were carried out during 2013. In the laboratory experiment, okra seeds were primed in PEG-8000 (polyethylene glycol) and Mannitol solutions (0, -0.4, -0.8, -1.2, -1.6, -2 and -2.4 Mpa osmotic potential) for 6, 12, 18 and 24 hours while dry seeds were used as control. Same primed seeds were us...
Dilawar Khan*, Abid Saeed*, Junaid Ahmad*, Imtiaz Qamar**, Fazal Yazdan**, Saleem ud Din** and Muhammad Tariq**
ASSESSMENT OF RIPARIAN VEGETATION IN DHRABI WATERSHED AND CHAKWAL REGION IN PAKISTAN
... Chakwal. There were 88 species reported in the study area. The five plant communities recognized in the Dhrabi watershed on the basis of importance value (IV) by using line transect sampling method. On the basis of top three highest IV plant community were identified at western side of the Kallar Kahar Lake while plant community was observed in eastern side by using 1x1 m quadrat method....
Ishaq Ahmad*, Abdul Rehman**, Ehsan –Ul- Haq*** and Arif Mahmood****
RESISTANCE RESPONSE OF RICE ( L.) GERMPLASM AGAINST RICE LEAF FOLDER ( G.) UNDER GREENHOUSE CONDITION IN PAKISTAN
...er ( G.) is a key insect pest of rice crop and distributed all over the rice growing areas of the world including Pakistan. The infestation of rice leaf folder often appears very suddenly resulting in huge yield losses. Host plant resistance is an important component of IPM. It is easy to use, viable, durable, effective and long term method as compared to any other control measure. It was impe...
Syed Waqar Shah* and Muhammad Ather Rafi*
PIERID (LEPIDOPTERA: PIERIDAE) PESTS AND THEIR NEW CRUCIFERS HOSTS IN POTHWAR REGION OF PAKISTAN
... to find out the pierids pests on cultivated and non-cultivated cruciferous plants, the known cultivated hosts such as , , ,, var. and were attacked by , and . Among above reported Pieridae species is reported for the first time however, is also a new record from districts Rawalpindi and Chakwal and from Jhelum, Rawalpindi and Chakwal. However, the non-cultivated host plants in the region were , , and . Among noncultivated h...
Mubbashira Nazir*, Saira Batool*, Sultan Ali Tariq**, Abid Hussain** and Ya Sakina**
INTERDECADAL GROWTH VARIABILITY AND DECOMPOSITION ANALYSIS OF FRUIT CROPS IN PUNJAB, PAKISTAN
...utrients in the diets of people in Pakistan. The study examines the trends and variation of area, production and yield of fruit crops in Punjab province from 1971 to 2014. The growth trend of fruits' production in the province showed positive behavior for major fruits (citrus, mango and guava) in almost all the decades, except for mango in 1970s and guava in 2000s. The decline in production of mango in 1970s was due to negative growth in both area and yield. W...
Saleem Abid*, Anum Fatima*, Sobia Naheed*, Asrar Sarwar** and Muhammad Nisar Khan*
DOUBLE EXPONENTIAL FORECASTING MODEL FOR DATES PRODUCTION IN PAKISTAN
...rried out to examine prospect trends of dates area and production in Pakistan by using time series data from 1980- 81 to 2012-13 (32 years).Three accuracy measures were used for the selection of best fitted model. These accuracy measures are mean absolute percentage error (MAPE), mean absolute deviation (MAD) and mean squared deviation (MSD). Double expo...
Hafiz Sultan Mahmood*, Tanveer Ahmad*, Zulfiqar Ali*, Munir Ahmad** and Nadeem Amjad***
FIELD EVALUATION OF A WHEAT STRAW CHOPPER
...;"> Wheat straw chopper is a resource conservation technology that makes chaff from combine-harvested wheat straw and saves the environment from smoke pollution, if straw is burnt in the field. Field performance of this technology has not been evaluated yet, although this technology has been adopted in Pakistan for many years. The objective of this study was to evaluate the performanc...
Hina Fatima** and Bushra Yasmin**
EFFICIENCY AND PRODUCTIVITY ANALYSIS OF PAKISTAN'S FARM SECTOR: A META-ANALYSIS*
...ical, regional and crop specific influences on farm sector of Pakistan. The data rely on the published research papers on efficiency analysis of Pakistan's farm sector from 1971 to 2014. Three models separately estimated included methodological model, crop specific model and provincial model. These models incorporated the impact of methodological variables, crop sp...
Basharat Hussain Shah*, F. S. Hamid*, Shams ul Islam*, Fayaz Ahmad*, Sohail Aslam*, and Noorullah Khan*
EVALUATION OF DIFFERENT PEA (PISUM SATIVUM L.) GENOTYPES FOR YIELD AND OTHER ATTRIBUTES AT SHINKIARI, MANSEHRA
...t may exist in different pea cultivars. For this purpose six advance lines/commercial pea varieties were collected from Ayub Agricultural Research Institute (AARI) Faisalabad and one local variety was included in the experiment as a control. The experiment was conducted during 2014-15 at National Tea & High Value Crops Research Institute (NTHRI) Shin...
Ummad-ud-Din Umar*, Muhammad Aslam Khan**, *Ateeq-urRehman*, Abdul Hannan***, Syed Atif Hasan Naqvi*, Azhar Ali Khan****, Muhammad Asif Zulfiqar****
DEVELOPMENT AND VALIDATION OF POTATO LEAF ROLL VIRUS DISEASE PREDICTION MODEL BASED ON ENVIRONMENTAL FACTORS FOR FAISALABAD, PAKISTAN
...l virus (PLRV) was developed based on a ten year dataset of disease incidence and environmental variables and validated by two years data collected in Faisalabad, Pakistan. Maximum and minimum air temperatures, relative humidity and rainfall were employed as independent variables while PLRV disease incidence served as the response variable. Stepwise regression analysis was
Mohammad Umar Farooq* , Sarfraz Ahmad ** , Mohammad Islam and Imtiaz Ahmad Qamar ***
ASSESSING THE STATUS OF CARBON POOL IN TWO RANGELAND GRASSES ( ) IN POTHWAR, REGION, PAKISTAN
...nes were drawn in each experimental plot. Twenty four samples of each experimental plot were collected with the help of ADC one m quadrat method, weighed and then oven dried at 60 C to find out the dry weight for above phytomass carbon Mg C ha . Similarly, the one m quadrats were dig out up to the root level for each grass and separated the root portion and weighed, oven dried at 60 C for below ground phytomass carbon Mg C h...
Muhammad Bilal*, Zafar Abbas*, Ijaz Ahmad**, Muhammad Aslam*, Muhammad Ijaz****, Adnan Shakeel***, Mushtaq Ahmad*** and Kashif Bashir*****
RESPONSE OF DIFFERENT COTTON ( L.) GENOTYPES AT VARIOUS SALINITY LEVELS
..., a hypothesis was developed that up to what level of salt, the cotton genotypes can survive so that it may provide the shelter for income from textile industry, as mainly the textile industry depends upon cotton production. High salinity levels hamper the boll formation in cotton genotypes as it reduces the yield. To ...
Muhammad Tahir* and Neelam Yasin*
EFFECT OF MICRONUTRIENTS FOLIAR APPLICATION ON YIELD AND QUALITY OF MAIZE
...f micronutrients is an expected trend among cereal crops which confines yield and nutritional value of grains. A field trial was laid out to evaluate the effect of micronutrients on yield and quality of maize in randomized complete block design (RCBD) at Agronomic Research Area, University of Agriculture, Faisalabad . The treatments comprised of no micronutrient application (control), water spray and foliar application of micronutrients mixture @ 250, 500, 750...
Mehwish Kiran*, Muhammad Saleem Jilani*, Kashif Waseem*
and Muhammad Sohail**
EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON GROWTH AND YIELD OF RADISH ( L)
... justify;"> A pot experiment was carried out to check the response of different organic manures and inorganic fertilizers on the growth and yield of radish, at Horticulture Departmental experimental area, Faculty of Agriculture, Gomal University, D.I. Khan. The experiment was laid out in RCD with seven treatments replicated thrice. The treatments included control, farm yard manure (FY...
Arshia Naeem*, Maria Anjum*, Mariam Rehman*, Zahid Mahmood** and Muhammad Asif Kamran**
AN INTEGRATED INFORMATION SYSTEM TO FACILITATE FARMERS IN WHEAT, SUGARCANE AND OTHER CROP DISEASES IDENTIFICATION
...istan, economy largely depends on agriculture. Therefore, the need to move from conventional ways of farming to easy, effective and efficient smart solutions are required to minimize yield losses in crop plants. An integrated application to facilitate farmers to communicate their crop related issues directly to agriculture scientists is proposed. This 'AXPERT Platform' consists of web appl...
Raza Ullah*, Mariam Rehman*, Maria Anjum*, Muhammad Asif
Kamran**, Khuda Bakhsh***, Abdul Saboor****
NAVIGATING FARMING RISKS BY SIMULTANEOUS DIVERSIFICATION AND CREDIT THROUGH FORMAL AND INFORMAL COMMUNICATION CHANNEL
...or diversification to compensate production risks. The existing extension network can be strengthened through its institutional linkage with metrology department and information communication technologies to further inform and train the farmers about disasters and disaster associated risks....
Ghazala Nawaz*, Muhammad Nawaz Malik**, Muhammad Hassan
Mushtaq***, Fraz Munir Ahmad****, Ali Abdullah Shah*****, Farooq
Iqbal******, Shinawar Waseem Ali*******, Zahida Fatima******** and
Amjad Khan*********
SURVEILLANCE OF BRUCELLOSIS IN LIVESTOCK IN RURAL COMMUNITIES OF PUNJAB, PAKISTAN
... in different livestock species and requires to develop prevention and control strategy, that hasn't been done in Pakistan. Active disease surveillance at door steps was conducted to collect blood samples from small and large ruminants of subtropical rural communities in the province of Punjab during January-March, 2015. Total 59665 sera samples from apparently healthy animals were collected and screened by Rose Bengal Plate test and confirmed by Complement fi...
Sadaf Javaria*, Muhammad Qasim Khan*, Kashif Waseem*, Muhammad Saleem Jilani*, Habib ur Rahman*, Muhammad Sohail Khan* and Muhammad Sohail**
EXPERIMENTAL INVESTIGATION ON IMPACT OF BIO AND ORGANOMINERAL FERTILIZES ON COMPOSITION AND SHELF LIFE OF TOMATO ( ) FRUIT.
...ics of tomato. The pot experiment was conducted by combining 7 treatments in completely randomized design with 3 replications. The results revealed that nutrient sources significantly affected different quality parameters including; physicochemical (vitamin C, lycopene, total soluble solids and pericarp thickness); sensory (fruit color, fruit flavor and fruit firmness) and shelf life. It w...
Shafique Qadir Memon* , Nadeem Amjad** and Riaz Ahmed Dayo***
INVESTIGATION ENERGY AND ECONOMICS ANALYSIS OF MAIZE PRODUCATION
...y was conducted at the experimental site in Islamabad, Pakistan, in spring season 2013 (March – July). A randomized complete block design with three treatments and replicated thrice were used in this study, fertilizers were evaluated on the basis of yield, input/output energy of maize crop. NPK had the maximum output energy gain as compared to cow manure and control treatment gave the lowest output energy. Cow manure used high energy as compared to NPK a...
Nusrat Habib*
RELATIVE PROFITABILITY ANALYSIS OF SUNFLOWER IN DISTRICT SWABI AND MARDAN
...ess of sunflower with competing crops like sugarcane and tobacco to find out the major factors which caused the decreasing trend of sunflower in the area. Primary data of 100 respondents was collected and analyzed in SPSS (Special Package for Social Scientists) software. Estimated results revealed that there was a key difference among target three crops profitability such as revenue per cr...
Shakir Ullah*, Aish Muhammad*, Iqbal Hussian*, Hafeez-Ur-Rahman**, Muhammad Zeeshan Hyder***, Muhammad Din**** and Nizamud Din
MORPHOLOGICAL VARIATIONS IN APRICOT CULTIVARS GROWN IN GILGIT BALTISTAN PAKISTAN
...
have firm type of fruit. A statistical tool Principal Component Analysis was
used. The eigenvalue was able to represent 84.8% of total variance. Leaf
size and leaf blade shape were highly correlated (r = 0.383). Positive
correlation found in shape of fruit, weight and percentage of moisture (r =
Abdul Rehman Khan*, Muhammad Mahmood–Ul-Hassan**, Rizwan Ahmad** and Anjum Munir ***
ARSENIC III TOLERANCE POTENTIAL OF FUNGI ISOLATED FROM POLLUTED AND NON-POLLUTED SOILS OF PAKISTAN
...rains were isolated from peri-urban soils of Multan and Gujranwala irrigated with untreated industrial or municipal effluent. Some fungal strains were also isolated from non-polluted soils of Islamabad area. Arsenic (III) tolerance potential of 18 fungal isolates was tested by growing them on Potato Dextrose Agar (PDA) medium amended with different concentrations of As (50 to 5600 mg/L). The fungal tolerance was evaluated by comparing tolerance index (TI), min...
ROLE OF HONEY BEES FORAGING ACTIVITIES IN INCREASED FRUIT SETTING AND PRODUCTION OF APPLES APIS MELLIFERA MALUS DOMESTICA
...n number of apple fruits per panicle and enhancement of apple weight. Apple Ameri trees were applied with natural pollination (T ) , pollination by honey bees only (T ), natural pollination augmented with honey bees (T ) and no pollination (T ,control). There was a significant increase in the apple fruit setting and weight gain in pollinated plants compared to non-pollinated plants. Maximum number of fruits per panicle were ...
Zafar Islam*, Abdul Ghafoor Mangrio*, Muhammad Munir Ahmad*, Ghani Akber*, Sher Muhammad**, Muhammad Umair*** and Yaskina****
APPLICATION AND DISTRIBUTION OF IRRIGATION WATER UNDER VARIOUS SIZES OF CENTER PIVOT SPRINKLER SYSTEMS
...WP and TBK locations, respectively. According to review the DU and CU for all center pivot sprinkler systems should be in the range of 85% or greater and 90-95%, respectively, for excellent ratings. Scheduling coefficient of NARC, BWP and TBK locations were obtained 1.09, 1.07 and 1.12, respectively. Also the calculated linear relationship between values of CU and DU in the all sprinkler s...
Asif ullah Khan*, Faizan Ullah*, Sultan Mehmood*, Muhammad Irshad* and Farhat Ullah Khan**
ALLELOPATHIC EFFECTS OF JATROPHA CURCAS L. LEAF AQUEOUS EXTRACT ON EARLY SEEDLING GROWTH OF L. PARTHENIUM HYSTEROPHORUS
...ants but also with weed species before its introduction into agroforestry systems. During present investigation, allelopathic potential of leaf aqueous extract was investigated on seed germination and seedling development of L. Extracts were applied at 25%, 20%, 15%, 10% and 5% as seed soaking for 8 hours prior to sowing. Phenolics compounds were found in aqueous extracts and were higher in 25% extract (52.72 mg gallic acid eq. / gm of extract). Higher concent...
Ehsanullah*, Muhammad Amjad Shahzad*, Shakeel Ahmad Anjum*, Ali Zohaib*, Muhammad Ishfaq* and Ejaz Ahmad Warraich*
EFFECT OF DIFFERENT SOWING METHODS AND PLANTING DENSITIES ON GROWTH, YIELD, FIBER QUALITY AND ECONOMIC EFFICACY OF COTTON
...ing densities. A field experiment was conducted to evaluate the influence of different sowing methods and planting densities on growth, yield, quality and economic returns of cotton. Sowing methods included pit planting (1 m × 1 m pits), bed planting (75 cm apart beds), ridge planting (75 cm apart ridges) and line sowing with varied inter row spacing (25, 50 and 75 cm). Sowing methods significantly affected growth and yield of cotton. Pit planting impose...
Tassadduq Rasool*, Ali Zohaib*, Ehsanullah*, Riaz Ahmad*, Tasawer Abbas*, Tahira Tabassum*, Muhammad Ather Nadeem*, Mahmood-ul-Hassan*
FORAGE YIELD AND QUALITY IN PEARL MILLET-SESBANIA INTERCROPPING SYSTEM UNDER VARIOUS GEOMETRICAL PATTERNS
...ume forages following proper planting geometry is an important strategy to achieve higher yield of quality forage. A field experiment was performed to evaluate agroqualitative response of forage pearl millet sown as a base crop and sesbania as intercrop under different geometrical patterns (line sowing of sole pearl mi...
Muhammad Nawaz*, Anwar Javaid Wahla*, Muhammad Saleem Kashif*, Masood Qadir Waqar**, Muhammad Anjum Ali*** and Asim Raza Chadhar****
EFFECTS OF EXOGENOUS NITROGEN LEVELS ON THE YIELD OF RICE GRAIN IN SHEIKHUPURA, PAKISTAN
...bsp;A three-year field experiment was conducted at Adaptive Research Farm, Sheikhupura to optimize the nitrogen levels for two coarse cultivars. The coarse rice cultivars are the non-basmati rice cultivars having no fragrance. The experiment was laid out in randomized complete block design in factorial arrangement. The experiment consisted of three nitrogen rates viz. 85, 170 and 255 kg ha...
Syed Haider Abbas*, Ayesha Tahir**, Muhammad Asim***, Muhammad Sohail* and Riaz-ud-Din*
PRODUCTIVITY AND PROFITABILITY OF WHEAT PAK-13 AT DIFFERENT SEEDING DENSITIES UNDER RAINFED CONDITIONS
...of Pakistan. Newly developed wheat cultivar Pak-13 was evaluated by an assortment of seeding densities planted at NARC, Islamabad during the rabi season of 2014-15. The experiment was done under Randomized Complete Block Design and was replicated four times having six different seeding densities (SD1: 50, SD2: 75, SD3: 100, SD4: 125, SD5: 150 and SD6: 175 kg/ha) The analysis revealed that the highest chlorophyll contents (49...
Sher Muhammad , Ijaz Ashraf*, Amir Khatam**, and Naima
Nawaz***
SOCIO-ECONOMIC CHARACTERISTICS OF FARMERS AND THEIR PARTICIPATION IN ACTIVITIES OF MODEL FARM SERVICES CENTERS IN KHYBER PAKHTUNKHWA, PAKISTAN
...ctivities. The present paper focuses on farmers' participation in various activities of MFSCs as influenced by their socio-economic characteristics. The target population of current study consisted of the member farmers of the MFSCs in four districts of KPK having different ecological mix cropping zones. Data were collected with the help of a validated and reliable interview schedule through a research team comprising of four members who were pro
Nasarullah*, Raiz uddin*, Fakhar Uddin* and Muhammad Jamal*
INTERPRETING WHEAT GENOTYPES FOR GRAIN YIELD UNDER DIFFERENT REGIMES OF KHYBER PAKHTUNKHWA
...ed more than 200 million people. To get maximum yield, high yielding genotypes suitable to diverse agro-climatic conditions are needed. However, so for few varieties have been developed that can efficiently grow in different environments. This is one of the reasons for lower wheat production in the country. Current experiment was conducted to monitor sta...
Muhammad Sharif1*, Shahzada Sohail Ijaz2, Muhammad Ansar3, Ijaz Ahmad4 and Syed Abdul Sadiq5
...2 Mg ha-1, respectively), MT (83 plants m-2, 5.90Mg ha-1, 3.26 Mg ha-1, respectively) and RT(72 plants m-2, 5.92 Mg ha-1,3.20Mg ha-1, respectively)tillage systemswith retention of crop residues,whilesignificantly lower values were recorded under ZT without residue return (54 plants m-2, 4.33Mg ha-1...
Waqar Islam*
...towards the famine. To cope with this situation, understanding plant disease triangle and disease epidemic forecasting is very important. So here we have briefly introduced plant disease epidemiology through highlighting its various types by giving important examples. We further have explained the plant disease triangle and disease forecasting systems via inclusion of various models being utilized worldwide.
Dachuan Cheng1,2, Md Mahbubul Hassan3, Zhenhua Ma1, 2, 3,*, Qibin Yang1 and Jian G. Qin3
...eny and anomalies among species of the family Lutjanidae. This study describes the skeletal ontogeny and anomalies of crimson snapper Lutjanus erythropterus larvae and juveniles from hatching to 36 day-post hatching (DPH). Mandible, ceratobranchial, cleithrum and gill arches were the initial skeletal structures appeared at 3 DPH that supported the vital life functions such as feedin...
Wazha Mugabe1,3,Gaolebale Segolame Mpapho1, John Kamau1, Wameotsile Mahabile2, Shalaulani James Nsoso1, Kealeboga Dipheko1 and Assar Ali Shah3,*
...l production of 4 tonnes per year. The objectives of the study were to evaluate goat milk production practices and attributes of goat farmers in the Oodi agricultural region, Botswana. Ninety-one farmers were purposively selected based on milk production potential from a list of 170 farmers officially registered with the Oodi agriculture station. Farmers were visited to conduct face to face interviews and administer a questionnaire. The results showed tha...
Yanling Xia1,2, Heping Li2, Yuntao Liang2, Jichen Zhao2, Binshan Lu2 and Di Liu1,*
...Vps26A cDNA contains an open reading frame of 984bp encoding a polypeptide with 327 amino acids. The deduced molecular mass and isoelectric point of Vps26A protein were 38.2 kDa and 6.13, respectively. Glutamic acid had the largest proportion (10.4%) in the primary structure. Homologous sequence alignment and phylogenetic tree analysis indicated that theVps26A protein of sika deer was high...
Niamat Ullah Khan1*, Farkhanda Khan2, Muhammad Kashan3, Qadir Ullah4 and Abdur Rauf5
...em. Therefore, a field experiment was conducted during 2014, 2015 and 2016 at Cotton Research Station, Dera Ismail Khan, Pakistan to explore N management practices for ZT cotton grown into standing wheat straw. The trial was conducted in a randomized complete block (RCB) design with three replications. Results showed that cotton lint yield and fiber quality was good during 2016 than that in 2014 and 2015. Ammonia volatilization loss from urea broadcast over th...
Anum Rafique, Sajid Abdullah, Khalid Abbas, Huma Naz* and Wardah Hassan
...>In this research work Superoxide dismutase (SOD) enzyme from the kidneyof silver carp(Hypophthalmichthys molitrix) was studied. Fish was divided into two groups. One group kept under chronic exposure of metals mixture (Pb+Cr) for 15 days and other group of fish was kept under controlled conditions. Partial purification of SOD was done by Ammonium sulphate precipitation. Ion-exchange column chromatography was used to purify enzyme for further partial ch...
Youbao Zhong1, Xianlai Zhang1, Xiaofen Hu1 and Yong Li1, 2,*
...uidine blue staining, respectively. Despite its similarity to the general mammal small intestine microstructure, the present results indicated that the hedgehog duodenum contained fewer Brunner’s glands, and that the Paneth cells were lacking in the crypt. The connective tissue was denser in the jejunal submucosa, but the muscularis was thicker. The intestinal glands were greatly developed in the ileum, lymphoid nodule...
Rabia Faiz and Dilara A. Bukhari*
... in decreasing order, respectively. These bacterial isolates have a great potential to grow into a bioinsecticidal formulation for the control of mosquitoes.
...
Hina Zubair1, Saima Perveen2, Saeed Alam3, Akkad Rafiq4* and Sara Ejaz
... in a year time. A retrospective study was performed by analyzing one year records from family planning clinic at divisional headquarter hospital. At family planning centers, a total of 920 individuals attended the Reproductive Health Services from April 2015 to March 2016. Among them, 92% individual utilized temporary methods and only 8% utilized permanent methods. Regarding temporary sol...
Anza Zahid*, Muhammad Ali Ayub, Mujtaba Saeed, Nasir Pasha, Abdul Jabbar Dar, Huzaifa Javed, Aimen Shakeel, Amna Nasir, Ana Akbar, Zainab Tarrar and Ayesha Humayun
...med good practice and competency. Conversely, 94.4% blamed bad attitude as a trait of bad doctor whereas 4.6% reported that the bad practice and incompetency is responsible for the negative trait. Taken together, compliance to physician’s advice is better among diabetics attending tertiary care hospitals in current study. The study encourages our health care system to provide more awareness and obtain a dee
Samina Ashraf1*, Ghulam Haider2 and Maimoona Ashraf3
... have shown that usually people with disabilities and specifically women with disabilities are at increased risk of physical, sexual, and emotional abuse as well as to other practices of violence, such as institutional violence, drug use, undesirable sterilisation, medical abuse, mortification, and nuisance. This study is intended to explore the lived experiences of women with disabilities...
Selçuk Kaplan1,* and Sertaç Atalay2
...the 294 bp region using specific primers and cleavage with the BfoI enzyme. Allele frequencies of A and B were found with 0.915 and 0.085 respectively. The genotype frequencies of IGF1 gene were 0.85 (AA), 0.13 (AB) and 0.02 (BB). The SNP in the exon 3 of the LEP gene was detected by amplification of the 494 bp region using specific ...
Khalid Khan*1, Muhammad Abdul Kamal2, Saubia Ramazan3, Gulawar Khan4, Gulzar Ali5 and Sheharyar Ahmed6
...11%, 0.09 % and 0.05% respectively. Thus, this paper argue that if the policy makers give priority to livestock in agricultural credit and devise easy credit procedures for the small farmers, will ultimately result in alleviating the problem of poverty and unemployment in the region. ...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2 and Zafarullah Baloch3
... than 57 date palm trees per acre on average. It is also observed that respondents generally get 76 kg of dates on average per tree. Many of the farmers use Radio and contact farmers as sources of knowledge for agricultural practices and date palm cultivation. However, more than 68% of the respondents do not get advisory services from government extension service institutions at all. Age and expe
Mohammad Nazeer* and Safdar Hussain Shah
... of the major livestock specie of Pakistan. This study was conducted to analyze morphological traits of four indigenous goat breeds of Khyber Pakhtunkhwa (KP) province of Pakistan. The breeds selected for this study were namely Damani, Surguli, Kaghani and Gaddi. Data was collected from two districts to the south (Dera Ismail Khan and Kohat) and two districts to the north (Kaghan and Naran) of KP province. Total number of 120 goat spe<...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Arshad1, Rashid Mahmood2,* and Ziyad Abdul Qadir2
...t.
...
Naimat Ullah Khan1,2, Muhammad Hassan Saleem1, Aneela Zameer Durrani1, Nisar Ahmad3, Ayesha Hassan1, Muhammad Kashif Prince1, Muhammad Luqman Sohail4,*, Mian Saeed Sarwar2, Hazrat Ali2, Tahir Usman2, Asadullah Khan2, Siffat Ullah Khan3 and Shahid Zaman5
... (25%), while the lowest percent prevalence was recorded in Bannu (23.33%). Highest month-wise prevalence was recorded in the month of August (46.6%), followed by July (40%), and the lowest during February and December (16.66%). Results showed highest prevalence in summer season (36.66%), while the lowest in the winter season (18.33%). The highest prevalence (P < 0.05) was recorded at the age of ≤1-15 days (38.09%) followed by 16-30 days (29.41%) while t...
Martín Grassi
...fe be defined? In this paper, I will stress the importance of self-sufficiency (or, more rigorously, “autarchy”) in defining what life is in Western thought. I will address philosophy, biology, and theology, by studying Aristotle’s natural philosophy, Thomas Aquinas’ theology, and Maturana and Varela’s biological theory of autopoiesis. Although self-sufficiency is quite revealing of what life is, I will argue that it does n...
David Beckwith Greene
...ity between subjective experience and materially conceived reality. He calls for a new understanding of preconscious matter such that genuine continuity between it and subjectivity may become intelligible. According to Monroe Beardsley, music presents modes of continuation. An analysis of modes of continuation in Haydn’s “The Creation” shows that the continuity within the humankind aria and between it and the preceding arias models wha...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
...tan.
...
Mahmoud M. Al-Azzazy1,2 and Saleh S. Alhewairini1,*
...stages of Aculops lycopersici. This includes its side effects on the associated predatory mite, Neosiulus cucumeris. Huwa-San TR50 is a formulation of hydrogen peroxide, stabilized by the addition of a small quantity of silver and is extensively used as a disinfectant. It was found to be very effective in killing A. lycopersici with no significant effect on N. cucum...
Zheng Quan Jiang1,2, Feng Shan Li3, Jiang Hong Ran1,*, Chen Hao Zhao1, Man Zhang1 and Hua Li4
...s the only alpine crane species, whose distribution is restricted to the Tibetan-Qinghai Plateau and the adjacent high altitude areas of China, Bhutan, Pakistan, and India. Study on nest type and size is useful for understanding the life history, evolution and adaptation of birds. A survey was conducted on nest size and the underlying regulatory factors of Black-necked Cranes from 25 March to 31 July in 2013 and 2014 at Ruoe...
Yanxiao Meng1, Guihua Wang1, Dongmei Xiong1,*, Haixia Liu1, Xiaolin Liu1, Lixin Wang1 and Jianlu Zhang2
...on the validation of subspecies B. lenok tsinlingensis Li for a long time. Some ichthyologists thought that there should be two species (B. lenok and B. tumensis) in Amur River and a subspecies (B. lenok tsinlingensis) in the Qinling Mountains, while others believed no division of the subspecies. Thus, 169 s
Muhammad Zameer Kayani1,*, Tariq Mukhtar2 and Muhammad Arshad Hussain3
...n inoculum density and appeared to be negatively correlated with inoculum densities and, on the contrary, was found to be positively correlated with plant ages. The results demonstrated that M. incognita has the potential to severely impair the growth of cucumber and by delaying early exposure of the latter to nematodes can significantly abate yield losses.
...
Filiz Kutluyer*
...ryptophan on quality of sperm and its fertilizing capacity in endangered trout Salmo coruhensis, Anatolian trout Salmo rizeensis and rainbow trout Oncorhynchus mykiss. Different activation media (NaCl, 0.3%; NaHCO3, 1%) were supplemented with L-tryptophan [Control (0), 0.5, 1, 2, 3, 4 and 5 mM] for assessing sperm motility and its duration, fertility and hatching rate of eggs. The results from...
Irfan Ullah, Shahid Ali*, Muhammad Fayaz and Abbas Ullah Jan
...ction of Cobb- Douglas type was used for the estimation of allocative efficiency. The function was estimated using Maximum Likelihood estimation technique. Results revealed that the mean allocative efficiency of broiler farms was 0.84; implies that an average farm could have used 16% less inputs for given level of output if inputs were allocated efficiently. The estimated coefficient of output in the stochastic cost frontier was -0.159 and statistically signif...
Muhammad Zeeshan Majeed1,2,*, Abu Bakar Muhammad Raza2, Muhammad Afzal2,Hafiz Salah-ud-Din2, Imtiaz Sarwar2, Muhammad Yahya2 and Khurram Shehzad3
...nd to biotic and abiotic perturbations in soil profiles, different land-use systems have different community assemblages of macroinvertebrates. This study was conducted to determine the impact of different land-use types viz. natural (grassland, forest/silviculture, barren) and agricultural (lemon, guava, lychee orchards, rice-wheat crop) lands on soil macroinvertebrate fauna. Random sampling was done in winter 2015 a...
Fatmagün Aydin1,* and Fatma Burcu Harmantepe2
...loticus). For this experiment, 360 fish (11.81± 0.02 g) were used. Fish were divided into four equal groups in three replicates and were fed with diets containing 0, 0.25, 0.5 and 1 % of sage oil for 30 days. The results showed that the haematological parameters (total red blood cell count, hemoglobin concentration, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration, total white blood cell cou...
Asmatullah1, Chaman Ara1,*, Shagufta Andleeb2, Maha Tahir1, Beenish Zahid1 and Madeeha Arshad1
... displacement of limbs, open eyelids and distorted axis. Histological defects included dilation and absence of ventricles, underdeveloped cerebellum, microcardia, necrosis in atrium, underdeveloped ventricles, hydropericardium and necrosis of the liver. Skeleton analysis of cadmium treated groups showed mostly un-ossified skeletons. The control mice show...
Nazia Qamar1, Sher Khan Panhwar1,* and Ralf Riedel2,*
...mposition was done using permutational analysis of variance (permanova), with species, life stage (juvenile and adults), gender, and weather (rainy and dry season) as factors. Patterns of empty stomachs were investigated to estimate feeding intensity. Feeding intensity was estimated with logistic regression, using the same independent variables as above....
Alaeldein M. Abudabos*, Abdullah N. Al-Owaimer, Elsayed O.S. Hussein and Mutahar H. Ali
...r animals. The current experiment was conducted to examine the effect of commercial vitamin C supplement (VC100, 200 mg/kg), on performance of broilers. Two levels of environmental temperatures: normal (22°C) and high (32°C) and two levels of vitamin C in drinking water (with and without) were arranged in a factorial arrangement resulted in four dietary treatments for the
Xiaopeng Tang1,3, Rong Xiang1, Sijia Chen1,3, Shufen Yang1,3, Hu Liu1,3, Rejun Fang1,3,* and Aike Li2,*
...SP), amino acid (AA) and peptide fractions, and the AA digestibility and metabolic energy of fermented cottonseed meal (FCSM) and enzymatic hydrolyzed cotton seed meal (EHCSM) in white leghorn roosters. Firstly, CSM were fermented with Aspergillus niger, or hydrolyzed with alcalase and flavourzyme. Secondly, a total of 32 white leghorn roosters with similar body weight (1.95± 0.14 kg) were randomly assigned int...
Burcu Onuk1,*, Murat Kabak1, Bünyamin Sahin2 and Nazan Gezer İnce3
...n stork and seagulls, respectively. The volume fractions of structures did not show statistical difference between two species. Our findings suggest that the nasal structures of the two-different species have similar architecture, which may be linked to the same function in flying birds.
...
Zhiping Hu, Hussain Ahmad, Jingfei Zhang, Lili Zhang and Tian Wang*
...or T2 group) for 42d, respectively. The results showed that alkaline phosphatase in T2 group was significantly decreased at 21d, blood urea nitrogen and alanine aminotransferase were significantly increased compared to CON group at 42d in broilers. Serum globulin content (21d) and total protein content (42d) were lower in T2 group than that of CON group. Serum total antioxidant capacity was higher and malondialdehyde content was lower in T1 group than that of ...
Abdul Nabi Jatt1,*, Sarfraz Ali Tunio1, Shaista Bano Memon1, Abdul Sattar Qureshi2 and Muhammad Aqeel Bhutto2
... potential of bacterial species is an essential feature to carry out a wide range of biological and physiological processes, particularly involved in the hydrolysis of complex organic materials. Several pathogenic microbial species utilize enzymes as virulence factors to cause diseases. The aim of the present study was to evaluate enzymatic activities of the bacterial strain Shigella dysenteriae IM using API-ZYM test ...
Ali Murad Rahoo1,*, Tariq Mukhtar2, Ali Murad Jakhar3, Rehana Kanwal Rahoo3
... and use of EPN mainly depends on the use of host insects such as greater wax moth (Galleria mellonella) for in vivo production. Since G. mellonella may not always be available, therefore, yellow mealworm (Tenebrio molitor) could be an alternative host. Therefore, in the present studies recovery of two EPN (Steinernema feltiae and Heterorhabditis bacteriophora) from T. molitor cadavers was compared in relation t...
Basit Zeshan1,2,*, Mushtaq A. Saleem2,Javed Iqbal Wattoo2, Mohd Mokhtar Arshad1 and Maizan Mohamed1
...s studied in an animal experiment on mice, in which mice were injected subcutaneously. These findings suggest that the truncated Sf200 expressed in the pET-32a (+) prokaryotic vector can be used as antigen to detect antibodies against IBV.
...
Saba Parveen Samo1, Moolchand Malhi1,*, Javed Gadahi2, Yan Lei3, Allah Bux Kaciwal1 and Saeed Ahmed Soomro1
... The physico-chemical properties of meat were not significantly different between the groups except fat content (2.75 ± 0.25 vs 2.00 ± 0.05%, P < 0.096) which tended to increase in B compared to A. These data demonstrated that dietary SY supplementation increased gastrointestinal tract weight and nutrient digestibilities, and improved some carcass characteristics in goats.
...
Aqsa Gulzar1, Tariq Mahmud1,*, Rubina Munir2 and Asma Anjum3
...miluminescence assay, respectively. The novel Schiff bases 4a and 4b have been synthesized by the reaction of 2-[(1,3-benzothiazol-2-yl)sulfanyl]-N-[4-(hydrazinecarbonyl)phenyl]acetamide with 3-nitro and 4-nitrobenzaldehyde. Characterization of the synthesized compounds was done by using various spectroscopic techniques namely FTIR, proton and carbon-13 NMR, Mass spectrometry and el...
Ewa Czerniawska-Piątkowska1,*, Magdalena Skibicka1, Barbara Cioch-Szklarz1, Jolanta Karakulska2, Karol Fijałkowski2 and Sonia Hiller3
...f animals. The study was performed on 28 calves of Polish Holstein-Friesian Black-and-White variety (PHF HO). The average weight of calves at the age of three months differed depending on the housing system. Individuals in igloo type booths were heavier as compared to the traditionally reared calves. The differences regarding the final weight of heifer calves were statistically significant...
Hao Zhang,1,2,3,* Hai Tao Nie,3 Tie Wei Ma,3 Zi Yu Wang3 and Feng Wang3
...rowth of F1Dorper × Hu ewe lambs. Thirty-five ewe lambs averaging 33.52±0.56 kg body weight (BW) were used. Seven ewe lambs were randomly chosen and slaughtered at 34.93 ± 0.37 kg BW as the baseline group for measuring initial body composition. Another seven lambs were also randomly chosen and offered a pelleted mixed diet (approximately concentrate : roughage = 60 : 40, DM basis) for ad libitu...
Ali Haider Saleem1,*, Khalid Javed2, Masroor Ellahi Babar3, Tanveer Hussain3, Asad Ali2, Afzal Ali2, Nisar Ahmad2, Muhammad Zahid Farooq1 and Muhammad Dawood2
...e. “W” type heterozygous condition showed a higher average daily weight gain. Sequence analysis of LEP gene confirmed the presence of genetic variability among Lohi animals; this variation might be associated with other economic traits for future breeding programs and marker assisted selection.
...
Grace C. Onyishi, Ifeanyi Oscar N. Aguzie, Christopher D. Nwani*, R.N.N. Obiezue and I.C. Okoye
...relative humidity and temperature in Nsukka, Nigeria. Hospital records from three hospitals in Nsukka town: Bishop Shanahan Hospital, University of Nigeria Medical Centre and Sadiq Hospital were examined for malaria prevalence and intensity from January to July 2015. Indoor biting Anopheles mosquitoes were collected by standard procedures within the study duration. Meteorological data on relative humidity and temperat...
Wei Dang1, Ning Xu1, Wen Zhang1, Jing Gao2, Handong Fan1 and Hongliang Lu 1,*
...es.
...
Muhammad Umair Sattar1, Aysha Sameen1,*, Nuzhat Huma1 and Muhammad Shahid2
...s, texture (hardness), appearance (L* value) and proteolysis by RP-HPLC. Use of guar gum as fat mimetic and cheese milk homogenization significantly (p<0.01) affected the composition, functionality, texture and appearance of LFMCs. LFMCs functionality and texture also improved during ripening but appearance was negatively affected. Reverse phas...
Hongwei Liang1,2,*, Miaomiao Tong1, Lihuan Cao1,2, Xiang Li3, Zhong Li1 and Guiwei Zou1,*
... Concentrations of eicosapentaenoic acid and docosahexaenoic were higher in male muscle than in female muscle. Opposite results were obtained with calipash. The n-3-to-n-6 polyunsaturated fatty acid ratios were within the recommended range in all three strains. Chinese soft-shelled turtle is a healthy food source to humans.
...
Nasir Abbas1, Muhammad Suleman1, Nazir Ahmad Khan2,*, Ijaz Ali3, Mubashir Rauf1,5 and Sadeeq ur Rahman4,*
...nd pheasantry- birds, respectively. Broiler breeder and broiler showed 58.93% (264/448) and 37.23% (542/1456) seropositivity, respectively. A total of 17.1% (402/2341) samples collected from all these CRD-suspected birds were found positive on modified fray’s media indicating typical mycoplasma like colonies with appearance of fried egg or nipple l...
Grace Chinenye Onyishi, Ifeanyi Oscar Aguzie, Joseph O. Okoro, Christopher Didigwu Nwani*, Ngozi Ezenwaji, Ndubisi Stanley Oluah and Fabian C. Okafor
...e the terrestrial snail species and associated helminth parasites in Ugwueme agricultural zone of Enugu State, Nigeria. The snails were collected from two communities. Light and teasing methods were used for recovery of parasites from the snails. A total of 618 snails belonging to 7 species (Achatina achatina, A. belteata, A. degneri, Limicolaria aurora, L. flammea, Lamellaxis gracilis and Orthalicus sp.) were ...
Shireen Ihsan Izzaddeen1 and Ali Kaygısız2,*
...tial oil (600 mg/day) on performance and blood parameters of Holstein calves. The study was started with total of 24 calves, randomly categorized into two groups of 12 (6 males and 6 females) however, it was completed with 23 calves because of dying a female at the 8th week of the trial. Addition of Laurel essential oil into whole milk did not cause any significant change in weekly live weight gain (kg), total weaning live weight gain (kg), weekly c...
Nilgün Paksoy1, Hikmet Dinç2 and Serap Kılıç Altun3,*
...y coupled plasma - mass spectrometry (ICP-MS). Minimum and maximum levels of Na, Mg, P, K, Ca, Fe, Cu, Zn in donkey milk samples were 108.6-202.7, 48.6-76, 355-670, 565-1053, 279-637, 1.86-5.8, 0.052-0.277, 1.78-10.97 mg L-1; in goat milk samples were 201.7-1087, 81.7-138.8, 818-1132, 972-1802, 678-1323, 1.91-4.48, 0.052-0.576, 1.72-4.68 mg L-1; in sheep milk samples were 219-640.5, 119.7-238.9, 946-1895, 881-1474, 1103-1962, 2.83-4.72, 0...
Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1
..., while a Cobb-Douglas type production function (double log form) was employed to estimate sugarcane yield and its determinants in study area. The results revealed that per acre net return after subtracting total cost from gross revenue was Rs. 33,173.65/-. Results illustrate that labor days, seed quantity, tractor hours, urea and pesticides have positive significant effect on sugarcane y...
Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1
..., while a Cobb-Douglas type production function (double log form) was employed to estimate sugarcane yield and its determinants in study area. The results revealed that per acre net return after subtracting total cost from gross revenue was Rs. 33,173.65/-. Results illustrate that labor days, seed quantity, tractor hours, urea and pesticides have positive significant effect on sugarcane y...
Muhammad Jamal Khan1, Abdul Malik2*, Muhammad Shahzad Khattak2, Naveedullah1, Naeem Ijaz3 and Ishaq Ahmad4
...er of hours the farmers operates their well ranged from 2 to 10 hours per day. The water quality reveals that pH of the water varies from 8.2-8.9 while ECw ranges from 0.4-4.7 dS/m. Out of 36, only inseven villages groundwater has ECw higher than the useable limit recommended by WAPDA (1974) and Sodium Adsorption Ratio was within safe range, following various classification schemes. In Richard’s salinity diagram, it i...
Ejaz Ashraf1*, Hafiz Khuram Sharjeel1, Raheel Babar2, Muhammad Junaid1, Qamar Iqbal3, Rabia Rasheed1 and Nosheen Fatima1
... record and evaluate the performance of extension approaches and Extension Field Staff (EFS) in order to identify the weaknesses or failures behind extension system and to suggest recommendations for improvement in extension approaches and performance of EFS through census study. The total EFS population consists of 155 people and 121 respondents appeare...
Abid Hussain1,*, Mansur-ud-Din Ahmad2, Muhammad Hussan Mushtaq2, Mamoona Chaudhry2, Muhammad Sarwar Khan2, Michael Reichel3, Tanveer Hussain4, Amjad Khan2, MuhammadNisar2 and Imtiaz Ahmad Khan5
... lactating buffaloes was performed with the California Mastitis Test. The overall prevalence of mastitis was recorded at 49%. Among mastitis cases the prevalence of clinical mastitis was 10.2% (106/1036 animals) as a whole. However, the prevalence of clinical mastitis in district Lahore was 11.8% (71/598 animals) whereas it was 8% (35/438 animals) in district Bhimber. The overall prevalence of subclinical mastitis was 38.8% (402/1036). The district wise preval...
Sana Zahra
...iversity and mutational specificity of a population. This study reports p.Y556C mutation as a recurring mutation in Punjabi population of Pakistan. A detailed genetic evaluation of four unrelated but ethnically similar families from Punjab province was performed.Linkage to SLC26A4 locus was confirmed through linkage analysis using Short Tandem Repeat Markers (D7S2420, D7S2459 and D7...
Chuanpeng Zhou1, Heizhao Lin2,*, Zhong Huang2, Jun Wang1, Yun Wang1 and Wei Yu2
...5 and 1670 mg of glucose per kg body weight) were orally administered to golden pompano (Trachinotus ovatus). Plasma glucose and cholesterol level reached its peak 3h after oral administration with high dose of glucose, respectively (P<0.05). Plasma insulin content was significantly lower at 1, 3, 6 and 12 h after oral administration of both doses of glucose (P<0.05). C...
Yan Li1, Kai Zhan1,*, Junying Li1, Wei Liu1, Ruiyu Ma1, Shengnan Liu1, Tao Han2, Shaoquan Li2, Shaolin Wang2 and Yang Hu2
...ters in 20 cages. Laying performances, mortality, egg quality characteristics and welfare level of birds were measured during the study period.Compared with AI birds, NM birds laid the first egg significantly earlier age, and had significantly lower laying rate, mortality and body weight of hens. NM birds however had significantly higher albumen height, Haugh units and yolk colour. No significant differences were found in ot...
Sabah Mansoor1, Muhammad Tayyab1,*, Amna Jawad1, Bushra Munir2, Sehrish Firyal1, Ali Raza Awan1, Naeem Rashid3 and Muhammad Wasim1
...sup> mg-1, respectively when starch was utilized as substrate. To best of our knowledge this is the highest activity among the reported recombinant amylases from genus Geobacillus. Laboratory scale production of reducing sugars from cloth-starch makes AMYSBS a suitable candidate to be used in Textile industry.
...
Kaori Sasaoka1, Takahiro Kataoka1, Norie Kanzaki1, Yusuke Kobashi1, Akihiro Sakoda2, Yuu Ishimori2 and Kiyonori Yamaoka1,*
...in C57BL/6J mice with respect to improved hair condition, whereas radon inhalation exacerbated CDDP-induced toxicity in BALB/c mice, such as a decrease in hair condition, higher creatinine levels, and decreased antioxidant contents (catalase and glutathione). When BALB/c mice were treated with a lower dose of CDDP (15 mg/kg) after 1000 Bq/m3 radon inhalation, the creatinine level was reduced and the superoxide dis...
Mubashar Hussain, Muhammad Faheem Malik, Sehreen Siddique, Muhammad Umar, Tamkeen Zainab, Fatima Zafar
...during 2015-2016. Adult specimens were collected fortnightly from crops, weeds and shrubs from randomly selected locations i.e. Dolat Nagar, Lala Musa, Jalalpur Jatan, Guliyana, Fateh Pur and Kunjah. Analysis of specimens indicated a representation of 14 species, 6 genera and 3 sub families across all sites. Maximum abundance was noticed for Coccinella septempunctata (19.63 %) follo...
Humaira Jabeen and Nazia Jamil*
...d with coconut oil. This percentage is even higher than the glucose, which was 16.6 % after 24 h of incubation. The other competent strains i.e. Exiguobacterium indicum, Bacillus acidiceler were not able to utilize the coconut oil but produced 5 and 22% bio-plastic when supplemented with 2% glucose after 24 h of incubation, respectively. The pe...
Fouzia Tabssum1* and Syed Shahid Ali2
...m;C.
...
Fouzia Tabssum1* and Syed Shahid Ali2
...m;C.
...
Ikramullah Khan1,2*, Muhammad Subhan Qureshi2, Sohail Akhtar2, Ijaz Ali3 and Ghufran Ullah4
...pled at environmental temperature 18, 32 and 42 °C in February, April and June, respectively. The physiological parameters recorded were rectal temperature (RT), respiration rate (RR) and pulse rate (PR) whereas biochemical parameters determined from blood serum were glucose, cortisol and Heat shock protein-70 (HSP-70). Thermal stress increased all physiological parameterssignificantly...
Muhammad Tariq Zahid1, Farah Rauf Shakoori2, Soumble Zulfiqar3, Khalid A. Al-Ghanim4 and Abdul Rauf Shakoori3,4*
...el metallothionein in copper homeostasis in a newly discovered ciliate Tetrahymena farahensis. The ciliate showed optimum growth at 27±1°C and pH 7.0 to 7.5. The maximum resistance dose of copper for T. farahensis was found to be 8, 9 and 80 µg/ml in wheat grain medium, Bold-basal salt medium and modified Neff’s medium, respectively. T. farahensis
María Magdalena Crosby-Galván1, Bernardino Espinoza-Velasco1 and Mónica Ramirez-Mella2,*
...kin (Cucurbita argyrosperma) residue in ruminal digestibility and gas production in an in vitro assay. Four treatments were evaluated: a control using a standard diet for ruminants elaborated with corn stover, corn grain and soybean meal, and three experimental diets with 10, 20 and 30% dry residue of chihua pumpkin instead of corn stover. Dry matter digestibility and gas production was determined at 24 h of in...
Senol Celik1,*, Ecevit Eyduran2, Adile Tatliyer3, Koksal Karadas4, Mehmet Kazim Kara2 and Abdul Waheed5
...905, 0.124 and 0.950, respectively. To conclude, it could be suggested that the Janoscheck non-linear model might help breeders who aim to make precise decisions on optimum slaughtering time and to ensure suitable managerial conditions in DDP goat.
...
Ahmad Farooq1, Usman Waheed2,3, Hasan Abbas Zaheer2,3, Abdul Rauf4, Abida Arshad5, and Muhammad Arshad1,*
...beta;-thalassaemia are dependent upon lifelong blood transfusion. Multiple transfusions expose them to many blood borne diseases, most commonly hepatitis B and C. The aim of current study was to determine the prevalence of HBV and HCV infections among thalassaemia major patients. The study was conducted from June – December 2016, at the Thalassaemia Centre, Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad and the Pakistan Thalassaemia Centre, Pa...
Tariq Mukhtar,1,* Abdul Jabbar1, Muhammad Usman Raja1 and Humayun Javed2
...ence, therefore, it is imperative to keep the nematode under constant surveillance and stringent control strategies should be adopted to prevent the nematode from becoming a threat to wheat. Similarly, no incidence of the nematode was recorded on Shafaq-2006 and Aas-2011 cultivars, therefore, cultivation of these cultivars should be encouraged.
...
Ehtisham Shakeel Khokhar*1, Amir Shakeel1, Muhammad Amir Maqbool1, Muhammad Khubaib Abuzar2, Sumaira Zareen2, Syeda Sana Aamir4 and Muhammad Asadullah4
...tential parents and best performing hybrids for seed cotton yield, yield contributing traits and fiber quality parameters. Six lines, viz., VH-259, IUB-222, CRS-456, AA-703, KZ-191, PB-39 and four testers PB-39, CIM-608, BH-163 and PB-900 were crossed in line × tester crossing fashion to develop 20 F1 hybrids. Analysis of variance displayed significant differences among parents and hybrids indicating the presence of genetic variability except ...
Zahida Parveen1, Safdar Sidra1*, Bushra Nisar Khan2
...ibility of the animal keepers to provide enrichment including adequate space and food to animals for highest possible standards of welfare. At Unversity of Veterinary and Animal Sciences (UVAS), Ravi Campus, Pakistan, a total of eighteen peafowls are housed in different enclosures including Indian, Java green and white peafowls. Additionally, there are different cross breeds of Java and In...
Partial Characterization of α-amylase Produced from Aspergillus niger using Potato Peel as Substrate
Shahzad Mahmood1, Memuna Ghafoor Shahid1, Muhammad Irfan2, Muhammad Nadeem3*, Quratulain Syed3
...e fermentation of potato peels were done by Aspergillus niger for the production of α–amylase. The crude enzyme produced was further characterized. The results showed that enzyme had an optimum pH of 6.0 and stable in range of 4.0-6.0. Optimum temperature of enzyme was 40oC and attained 96% activity at 40oC for 70min. Metal profile showed that ...
Muhammad Zahid Latif1*, Rahila Nizami2, Intzar Hussain3
...choice or free will of a person, organization or group of individuals with no financial gain in full awareness and appreciation (1). It is an international phenomenon in which the individuals provide their time and services free of cost to an organization for the benefit of others (2). It is vital for the sustainability and smooth functioning of the nonprofit and community organizations that the...
Nazish Imran
... delinquency, social and peer problems, substance misuse alongside adverse outcomes in adulthood.
...
Ambreen Asghar, Tasleem Akhtar, Nadeem Sheikh*
...s carrying difference in percentage of fats. Protein profiling of treated groups indicated a marked increase in serum protein (related to iron metabolism and immune response) level compared to low fat-fed rats. Additionally, a decreased level of serum proteins was observed in the serum compared to control rats. Taken together, our findings conclude that diets rich in fats result in dysfunction of immune system and iron metabolism.
...
Shagufta Andleeb*1, Shabana Shaukat1, Chaman Ara2
... and anitodote groups respectively with delayed hatching in some cases in dose and dose+antidote groups. Chicks and dead embryos were studied for morphological and morphometric analysis. Liver tissues were dissected out from each group for histological analysis. Cadmium chloride induced significant developmental abnormalities such as reduced body weight and crown rump length, exencephaly, ablepharia, crossed beak, gastroschisis, crooked toes, non-alcoholic fat...
Olaniyi Alaba Olopade1,*, Henry Eyina Dienye1, Bosede Jimba1, Nathanael Akinsafe Bamidele2, Iyabo Olusola Taiwo2
...t the well-being of the species was slightly better in Buguma Creek than New Calabar River. Collectively these findings confirmed the ability of the species to thrive in brackish water and freshwater, and that these parameters support the assessment of the well-being of different fish in different locations.
...
Muhammad Suleman Bacha1*, Mohammad Nafees1 and Syed Adnan2
...ocused on farmer’s perception about climate change vulnerabilities, their adaptation measures and relationship with the changing climatic records in the district Swat (Pakistan). The data collected through household interviews and focus group discussions. Total 177 questionnaires administered to sample households and 9 FGDs (Focus Group Discussions) in selected villages with the aim to understand local perceptions abou...
Riyadh S. Aljumaah*, Mohammed A. Alshaikh, Abdulrahman Jarelnabi, Mutassim M. Abdelrahman and Mansour F. Hussein
...rologically positive to specific anti-N.caninum antibodies. Logistic regression analysis and estimation of odds ratio revealed significant association of the sex and location of the camels with N. caninum seropositivity. On the other hand, neither the breed nor age of the camels was significantly associated with seropositivity.Studies are needed to evaluate other potential risk factors and to assess the pathogenic effects and economic consequence...
Mei Li1, Di Zhang2 and Wan-Long Zhu1,*
...and 6.6% tannic acid, respectively. The results showed that E. miletus fed the diets with 6.6% tannic acid increased RMR compared with control on day 14, and reduced the gross energy intake (GEI) and digestible energy intake (DEI). On day 28, E. miletus fed diets containing tannic acid showed no significant changes in RMR, GEI and DEI. The apparent digestibility and NST were kept stabled during the experiment. ...
Nadia Mubarik1, Aqib Iqbal1*, Iqbal Munir1 and Muhammad Arif2
...xt-align: justify;">An experiment was conducted to study the effect of foliar application of CaCl2 on alleviation of the adverse effects of water stress on maize (CV. Azam). The experiment was conducted in completely randomized design (CRD) using pots in a glass house and comprised of 2 irrigations (irrigated and water stress) and three concentrations of CaCl2 (5, 10 and 15 mM CaCl2.2H2O) as foliar spray on maize seedlings 2...
Naimat Ullah1,3,*, Aneela Zameer Durrani1, Muhammad Avais1, Nisar Ahmad2, Sana Ullah3, Muhammad Shuaib Khan3, Khalid Mehmood5, Mumtaz Ali Khan1 and Ikramul Haq1
...study was designed to inspect the prevalence and its correlation with various risk factors and host biomarkers concerned with the occurrence of theileriosis in sheep. Total 600 blood samples were taken each 200 from districts Bannu, Tank and Dera Ismail Khan of southern Khyber Pakhtunkhwa Pakistan and screened through blood microscopy. The current study revealed an overall prevalence of ovine theileriosis as 27.5%, 13% and 19.5% in districts of Dera Ismail Kha...
Song Jiang1,2, Fa-lin Zhou3, Jian-hua Huang1, Qi-bin Yang1, Li-shi Yang1 and Shi-gui Jiang1,*
...don broodstock. An experiment of 30 days was carried out on broodstock (average body length 28.4 ± 0.95 cm, average body weight 96.7±6.48 g) with (treatment) or without eyestalk ablation (control), cultivated under a water temperature of 27.0±1.5 °C, salinity of 30–32, pH of 8.0–8.3, and light intensity of 1000 lx. Results showed that food consumption and feeding intensity of the eyes...
Muhammad Arshad,1* Sajjad Ahmad1, Muhammad Sufyan1, Zain-ul Abdin1 and Sumaira Maqsood2
...s are considered serious pests of many agricultural crops worldwide. The present study was conducted to assess the wheat aphids’ diversity and their predators association with strip intercropping (brassica, alfalfa, berseem and garlic) and wheat monoculture. Results showed that the first aphid was seen in the last week of January while the predator population was first recorded during the first week of March. Aphid population was maximum on wheat monocul...
Farhan Ahmad1,*, Muhammad Waris Sanjrani1, Shah Nawaz Khuhro1, Asif Sajjad2, Abid Ali3, Rashad Rasool Khan3, Farooq Ahmed3 and Junhe Liu4,*
...mong abiotic factors, temperature and relative humidity are important factors for higher cotton yields in all cotton growing regions. Cotton whitefly (Bemisia tabaci G.) being vector of CLCuV in Pakistani cotton crop is responsible to cause an economic damage. A survey of whitefly populations and its parasitism with connection to temperature and relative humidity was conducted in fourteen cotton growing districts of S...
Jun-Ying Liu, He-He Liu*, Jie Kou, Yang-Mei Zhao, Ji-Wen Wang, Liang Li and Xiao-Hui Du
Syeda Madiha, Zehra Batool, Saiqa Tabassum, Laraib Liaquat, Sadia Sadir, Tahira Perveen and Saida Haider*
...ses.
...
Abdul Majid Ujjal2, Sharmin Akter1* and Suman Paul1
...ease round the year with peaks during winter season. Similar analysis was also done for HS and like FMD, highest prevalence (16.14%) found in Jaintapur upazila. HS prevalence also found significantly higher in young buffalos (18.56%). HS prevalence was significantly higher in male (12.73%) than female. Epidemic curves of HS showed a clear year round occurrence with peaks in summer season. Though, estimates could not expresse...
Hamza Khan1, Safdar Ali1, Ijaz Ahmad*2, Ihsanullah Khan3, Shujaat Hussain1, Bashir Ahmad Khan4 and Muhammad Suhaib5
...lamabad, to evaluate the performance of 12 locally developed sunflower Hybrids. Twelve sunflower hybrids including two checks viz., SMH 1006, SMH 0907, SMH 0932, SMH 1208, NKS-278, SMH 1001, SMH 0917, SMH 1401, Hysun-33, SMH 0927, SMH 0909 and SMH 1215 were studied in the experiment. The experiment was laid out in Randomized Complete Block Design (RCBD) ...
Ligia Neves Scuarcialupi, Laila Andreia Rodrigues Beserra, Julia Rosas Hochheim, Rodrigo Martins Soares, Fabio Gregori*
...s and diarrhea in avian species, resulting in negative impact on egg and poultry production. The objective of this work was to detect and characterize Rotavirus F (RVF) and G (RVG) found in Brazilian commercial avian farms. A total of 97 intestinal contents was collected between 2008 and 2015 from 10 Brazilian states, and submitted to two different RT-PCR, targeting a fragment of viral VP6-coding nucleotide sequence of each viral group. Amplicons were further ...
Evolutionary Analysis and Phylodynamics of Avian Influenza Virus H5N1 between 2015 and 2016 in Egypt
Osama Elshazly1, AbdelSatar Arafa1, Mohammed A. Rohaim2, Ismaeil M. Reda2 and Hussein A. Hussein2*
...revalence, transmission, persistence and evolution of the virus, and to monitor the circulating AIV strains and emergence of new AIV subtypes in Egypt. The wide circulation of the 2.2.1.2 subclade, carrying triple mutations (120, 129∆, I151T) associated with increased binding affinity to human receptors, is an alarming finding with public health importance.
...
Lotta Wahldén1, 3, Ulf Emanuelson1, Torsten Møller2 and Jonas Johansson Wensman1*
...s) is an endangered species and captive populations are important for conservation. Canine distemper virus (CDV) and canine parvovirus (CPV) are two infections threatening the survival of this species. Based on a limited number of animals, live attenuated vaccines have been suggested to provide protective immunity in the African wild dog; however, their use has been ham
Muhammad Suhaib1, Ijaz Ahmad2*, Masooma Munir3, Muhammad Bilal Iqbal4 , Muhammad Khubaib Abuzar5 and Safdar Ali6
...e factors a hydroponic experiment was conducted on wheat with two levels of salicylic acid (0.25 mM and 0.50 mM) under two salt levels (75 mM and 150 mM) to assess that whether the salicylic acid is helpful in coping the harmful effects of salinity on crop growth or not and if it has certain positive response then which level is more suitable for wheat crop growth along with the genotypic assessment of salt tolerance in wheat cultivars (Faisalabad-2008 and Pun...
Shagufta Andleeb*1, Fariha Zahid1, Noor-ul-Ain1, Yousra Nisar1, Chaman Ara2
...ural and domestic use of permethrin, a pyrethroid insecticide, has led to intoxication of varying intensities in non target organisms including human. In present study, teratogenicity and embryotoxicity of permethrin was tested in developing chick(Gallus domesticus). Different concentrations of permethrin (0, 5, 10 and 20ppm) were prepared in sterilized distilled water. These doses ...
Waqas Ali1,*, Arshad Javid1, Syed Mohsin Bhukhari1, Ali Hussain1, Syed Makhdoom Hussain2, Hira Rafique1
...t>cies.
...
Muhammad Umar1, Mubashar Hussain1,*, Ghulam Murtaza1, Farid Asif Shaheen2 , Fatima Zafar1
...nes in order to shun the perils of extreme cold annually in the winter season. Indus Fly Zone in Pakistan serves as a middle Asian flying route for the migratory birds that is connected to West Asian and East African flying routes. The ecological concerns faced by the migratory birds in Pakistan have been reviewed extensively. The disappearing trends of migratory birds are recorded from fresh water reservoirs of Pakistan and...
Azhar Mehmood1,2,*, Muhammad Farrukh Saleem2, Muhammad Tahir2, Muhammad Aqeel Sarwar3, Tasawer Abbas4, Ali Zohaib2, Hafiz Tassawar Abbas5
...on. Therefore, a field experiment was conducted to examine the combined effect of nitrogen and boron on growth, yield and oil quality of sunflower hybrids during 2009. Two nitrogen levels (0 and 150 kg ha-1) and three boron levels (0, 2 and 3 kg ha-1) were tested against two sunflower hybrids (Hysun-33 and DK-4040). All the growth and yield components like plant height, stem diameter, head diameter, achene and biological yield were significantly affected by va...
Noor Fatima1, Muhammad Irfan2,*, Hafiz Abdullah Shakir1, Javed Iqbal Qazi1
...for 24 h of fermentation period at temperature of 50oC. Results showed that cellulase production was greatly affected by the thermochemical pretreatment as compared to the chemical pretreatment. At the pretreatment condition of 1% H2SO4 conc, 6h residence time, 15% substrate concentration maximum CMCase production (0.858 IU/ml/min) was obtained while at pretreatment conditions of 1% H2
Muhammad Iftikharul Husnain1, Aneel Salman1, Inayatullah Jan2*, Tahir Mahmood3
... Asian countries for the period 1999 to 2014 to investigate the impact of temperature on agriculture controlling for potential endogeneity by using locality as an instrument. Unsurprisingly, the magnitude of temperature coefficient increases substantially when endogeneity is controlled and becomes significantly higher (6 percent to 13
Archana Naithani, Pongthep Suwanwaree* and Bartosz Nadolski
...entification of 94 bird species belonging to 12 orders and 35 families. Altogether 3,328 individuals were observed. Out of 35 Families, Sturnidae and Sylviidae hadthe highest number of species (5 species each).Six simple dietary guilds were observed during the present study; the maximum number of species belonged to insectivore group and minimum to necta...
Mousa O. Germoush1,*, Mohsen G. Al-Mutary2, Ahmad R. Al-himaidi3, Muath G. Al-Ghadi3, Daisaku Iwamoto3,4, Yousef Al-anazi3, Aiman Ammari3, Javed Ahmad3,5, Abdulaziz Al-Khedhairy3,5
... maturation and cleavage percentage whereas 40% SFF supplementation significantly decreased maturation and cleavage. SFF supplemented at 10% concentration showed a significant increase in blastocyst development when compared with other groups. Gene expression analysis revealed a significant increase in BAX expression in groups supplemented with SFF 20% and 40%, whereas the expression of BCL-2 was significantly increased only in the 40% SFF supplemented group. ...
Pei-Ying Peng1,2, Xian-Guo Guo1,2,* and Dao-Chao Jin2
...ont-size: small;">A new species of gamasid mite, Laelaps jinghaensis sp. nov., was described. The new species was collected from the body surface of red spiny rat, Maxomys surifer Miller, 1900 in Jingha, Yunnan province of southwest China. The sternal shield of L. jinghaensissp. nov. is deeply concave anteriorly with serrate internal sides. There are many distinct transverse lines in the presternal area ...
Nanjing Zeng1, Guanhua Liu1, Sibiao Wen1 and Feiyun Tu2,*
...mited checklist of bird species has been available. In order to investigate the bird diversity and avifauna of PLNNR, complete species checklist was strictly checked according to systematic analyses of species records from multisource. Fifty-seven species were newly recorded based on the previous study of 330 bird spec...
Huma Ayub1,Iftikhar Ahmad2, Syed Lal Shah3,*, Muhammad Zafarullah Bhatti4, Nuzhat Shafi5 and Mazhar Qayyum1
...ribution of zooplankton species at Chashma Lake during June 2014 to May 2015. The samples were collected from three partially separated stations of the Chashma Lake on a monthly basis. A total 42 species of zooplankton were identified from the Chashma Lake belonging to three taxa viz.; copepoda, rotifera and cladocera. The diversity of the zooplankton spe
Jehangir Khan1,*, Rasheedullah1, Bakht Tarin Khan2, Ayaz Ahmad3, Muhammad Salman4 and Khalid Khan5
... in males and females respectively. The RT-PCR based result observed maximum infection (14%) in individuals of 41-50 years and minimum (2.7%) in individuals of 10-20 years. The ICT resulted in poor screening for HCV infections. The main route of HCV transmission in males is the sharing razors (33.33%), while in females, is the reuse of contaminated syringes (42%) at maternity homes respectively. These alarming results call f...
Hamayun Khan1,*, Abdul Wahab1, Navaid Kazi2, Younas Muhammad1,Summaya Kazi3, Salman Kazi4, Azmatullah Khan1, Ikramullah Khan5 and Shakoor Ahmad1
... successful pregnancy. Experiments were executed on 15 pregnant rabbits at three different time point of successful pregnancy i.e. day 18, day 25 and day 28 with commercially accessible kits for biochemical markers that includes glucose, total protein, albumin, creatinine, triglycerides, blood urea nitrogen (BUN), alanine transaminase (ALT) and aspartate transaminase (AST). The current study demonstrated the ascertained value in amniotic fluid for gluco...
Najeeb Ullah1, Abdul Aziz Khakwani1, Niamat Ullah Khan2*, Muhammad Safdar Baloch1 and Ejaz Ahmad Khan1
...d and quality. A field experiment was conducted in 2016 at Cotton Research Station, Dera Ismail Khan, Pakistan to evaluate the effects of four moisture regimes on yield and fiber characteristics of two cotton genotypes. The experiment was laid out in split-plot within a randomized complete block design with three replications. Four irrigation intervals namely I1 (10 days interval), I2 (15 ...
Nihal Ahmad Hadi, Shahid Ali* and Umer Wahid
...sed with both close and open-ended questions. Data from broiler farmers were collected during April and May 2016. Maximum Likelihood Estimation (MLE) technique was used for estimation of stochastic frontier Cobb-Douglas type production function. Results indicated the mean technical efficiency of 0.89 with the range of 0.63 to 0.97. This implies that farmers having average technical efficiency level can increase broiler outpu...
Shahid Ali1* and Salamat Ali2
...d costs and revenues of open shed and environmentally controlled (EC) shed broiler farms in Punjab, Pakistan. Multistage sampling technique was applied for selection of sampled respondents. 120 farmers, 60 farmers of open shed and 60 farmers of EC shed were interviewed during 2014. Dummy variable regression was applied for estimation and comparison of costs and revenues of open shed and EC...
Habibullah* and Sahib Alam
... soil physicochemical properties at various growth stages of maize and subsequent wheat crop. Biochar was applied before sowing, while N application was carried out in splits to the crops. The study was conducted in district Buner, Pakistan using randomized complete block design with split-plot arrangement. Biochar was applied at the rates of 0, 5, 10, 15 and 20 ton/ha as the main plot factor. The immediate effect of biochar was assessed on maize crop integrat...
Felicia NkechiEkeh*, Ifeanyi Oscar Ndimkaoha Aguzie, Joy Ihuoma Nzei, Chinenye Maria-Goretti Ohanu, Godwin Ikechukwu Ngwu and ChukwudiebubeUgolo
...he effectiveness of Piper guineense and Capsicum annum in prevention of Dermestes maculatus infestation on sundried catfish, Clarias gariepinus was studied. Ethanolic extracts of P. guineense and C. annum fruits were prepared using Soxhlet extractor. In a split-plot design comprising the two extracts in different concentrations, a total of 63 sundried adult C. gariepinus of mean weight 111.47 ± 2.34g were...
Liumeng Zheng1, Yanmei Wang1, Jiagui Zhu2, Ke Wang2, Dejing Cai2, Yuanzhao Qin3, Yuming Guo3, Hongxing Niu1,* and Yanzhen Bu1,*
...that more ibises will disperse outside the reserve as the population expands. The distribution of crested ibises in the Dongzhai Reserve area was mainly affected by altitude, followed by distance to forest, and distance to roads. Notably, our study confirmed that the crested ibis has adapted and regained the habit of living at low elevations in the Dongzhai Reserve. Although most suitable habitat was found inside the nature reserve, a large proportion of suita...
Kashifa Naghma Waheed1,2,*, Zaid Mehmood2 and Sikender Hayat1
... of sugar industry in respect of its multi-elemental availability was taken into consideration to check its feasibility as an aqua-fertilizer. Eighteen elements including essential macro-elements, essential trace elements and non-essential toxic elements were quantitatively analyzed in sugar press mud by ICP-OES following protocols of AOAC from five randomly selected sugar mills situated in South Punjab, Pakistan. It was observed that the samples contained pot...
Nadia Faqir1, Aish Muhammad2*, Ghulam Muhammad Ali2, Armghan Shehzad2, Hafeez Ur Rahman3, Farhatullah4 and Muhammad Zeeshan Hyder5
...tudied date palm samples pertaining to the studied physical traits and chemical composition of fruit. Sequences of the maturase k gene has complete identity to the reference genome of ‘Khalas’ cultivar. While geranyl geranyl biphosphate reductase has one synonymous single nucleotide polymorphism in Qantar, Hamin wali, Kupra and Shakri, suggesting a lack of divergence in these genes in the studied cultivars. Tree plots generated showed inconsistenci...
Murad Khan1* and Muhammad Afzal2
...variance (ANOVA) and independent t test were used. The average profit of large size farm was Rs. 85228 followed by medium and small farm that were Rs. 58049 and Rs. 36090 respectively. The results of independent sample t-test indicated that there is no significant difference between the profit of the sole proprietors and partnerships. Further results of analysis of variance (ANOVA) reveale...
Leila A. Kaimbayeva1,*, Elena S. Malysheva2, Rashit Kazikhanov3 and Saule R. Kazikhanova4
...structural-mechanical properties of red deer meat that occurred during the course of autolysis were further confirmed by the histological changes in the meat. Specifically, it was observed that post-mortem changes were characterized by multiple destruction and disintegration of fibers in the muscular tissue, and lysing of cores and their structures. Collectively, these results clearly articulate the irreversible destructive ...
Amna Kausar1,2, Sana Anwar1, Naila Siddique2, Safia Ahmed1 and Javid Iqbal Dasti1,*
...fluenza virus (AIV) subtypes (AIV H9, AIV H7 and AIV H5) in non-vaccinated wild and domesticated bird species across Pakistan. During January-December 2013, in total 700 samples were collected from different species of non-vaccinated birds inhabiting diverse ecological zones of Pakistan. Altogether, 507 tissue and swab samples were screened for the presence of viral RNA by reverse transcri...
Hafiz Azhar Ali Khan1,*, Waseem Akram2, Sumi Lee3, Shakir Manzoor1, Syed Rajab Ayub1, Khalil Ur Rehman1, Shinawar Waseem Ali1, Muhammad Bilal Chattha1 and Sumaira Maqsood1
...d in stored grain insect pests has been reported worldwide; however, there is a lack of information in Pakistan. In the present study, one laboratory reference strain and five field strains each of, Rhyzopertha dominica, Sitophilus oryzae and Tribolium castaneum, were collected from Punjab, and assessed for their susceptibility to spinosad via diet incorporation bioassays. Based on median lethal concentr...
Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi3
...important part of the proper management of weeds in the paddy fields is rice postharvest weed management until land preparation for re-cultivation. In order to determine the frequency and relative cover (RC), the samples were collected from 481 fields during the growing season and 255 fields after harvesting rice in Guilan province (Iran) from 2014 to 2016 (from April to March of each year) based on the method of Thomas by throwing 0.5m × 0.5m quadrat to...
Muhammad Waqar Yasin*, Mobushir Riaz Khan and Muhammad Amin
...anges in rainfall and temperature of Punjab, Pakistan on the production of five major crops viz. wheat (triticum), maize (zea mayes), cotton (gossypium), sugarcane (Saccharum officinarum) and gram (Cicer arietinum). Firstly, changes in mean temperature and rainfall from 1951 to 2015 were assessed at district level. Secondly, the changes in crop performance were computed through remote sens...
Mahwish Rehman1*, Sajjad Ahmad1, Maqsood Shah1 and Inamullah Khan2
... the year 2014-15. Mite specimens were collected from the honeybee colonies from different regions of Khyber Pakhtunkhwa i.e. Peshawar, Mardan, Kohat and Chitral to discovered Varroa mite species. Identification was done by using key developed byDe-Guzman and Fernandez and Coineau, (2007), i.e. body size (length and width), location of seta, shape, size ...
Feroza Haider1,2, Shamim Gul2,3*, Javaid Hussain4, Sadaf Asalam Ghori5, Muhammad Naeem Shahwani6, Muhammad Murad6 and Abdul Manan Kakar7
...chars on the crop growth performance and accumulation of chromium, iron, manganese and zinc in the edible parts (roots) of Brassica rapa (turnip) under groundwater and wastewater irrigation. Biochars were applied at 0.25, 0.5 and 1 kg m-2 to soil. Amendment of biochar increased significantly the aboveground plant biomass by 28% - 34.3% under groundwater and 18.3% - 30.4% under wastewater irrigation. Dry weight of root biomass increased by 16.1% - 20.2% under g...
Urooba Pervaiz1, Abdus Salam1, Dawood Jan2, Ayesha Khan1 and Mahmood Iqbal1
...st of seed, weeding, and pesticides were increased, while seed rate gm per acre was decreased. It is concluded that all the respondents adopted HYVs. Major constrains in the adoption of extension recommendations were high price of agricultural inputs, non-availability of; cold storage, agricultural credit and certified vegetable seeds, lack of fertilizers and technical knowledge, pest and ...
Shuai Shang1,2, Honghai Zhang2,*, Xiaoyang Wu2, Qinguo Wei2, Jun Chen1, Huanxin Zhang1, Huaming Zhong2 and Xuexi Tang1,*
...been identified in many species, but the evolution and repertoire of Tas2r genes in raccoon dog (Nyctereutes procyonoides) was still unknown. As a true omnivorous mammal, the Tas2r genes may play a critical role in food selection of raccoon dogs. Thus, we explored the evolution of Tas2r genes in raccoon dogs. In this study, Tas2r genes including eleven intact genes and four pseudogenes from...
Hexaprotodon (Mammalia: Hippopotamidae) from the Pinjor Formation of Bhimber, Azad Kashmir, Pakistan
Muhammad Akbar Khan
...exaprotodon and the species Hex. sivalensis. Due to rarity of this taxon, its morphological characters are incompletely known. Hippopotamid material recently excavated in the middle Pleistocene locality of Bhimber (Azad Kashmir, Pakistan) includes an almost complete mandible that provides a better knowledge of the taxon morphology. Hexaprotodon sivalensis is reported for the first time from the Bhimber Pleistocene locality of Azad Kashmir, Pa...
Jiji Li*, Tianyang Zu, Xiangli Dong, Xiao Yang, Wei Liu and Changwen Wu
...mmune responses in fish species. The current study reports on the gene expression and molecular characteristics of three members of the CC family of chemokines: 1) dual chemokine ligand CCL17; 2) homeostatic chemokines ligand CCL21; and 3) CCL24 in response to bacterial challenge in large yellow croaker (Larimichthys crocea). The results revealed that the immunological effect of CCLs in the croaker is weaker than that of other fish, and revealed the inf...
Abdur Rehman1*, Wang Jian2, Noor Khan3 and Raheel Saqib3
...cts. This ensures the competency, accuracy and decreases significantly the cost of market risk management. ...
Sher Nawab Khan* and Ghulam Hassan
... common wheat and barley pest in many parts of the world including Pakistan. This experiment was conducted at the experimental field of the department of Plant Breeding and Genetics, The University of Agriculture Peshawar, Khyber Pakhtunkhwa, Pakistan during 2014-15 and 2015-16. Eight bread wheat (Triticum aestivum L.) varieties i.e., Atta-Habib (AH), Lalma-13 (Lal-13), Tatara-96 (Tat-96),...
Zakirullah Jan1, Shamsher Ali1*, Tariq Sultan2, Muhammad Jamal Khan1, Zahir Shah1 and Farmanullah Khan1
... In this regard, a pot experiment was carried out with the aim to assess the impact of different strains of cyanobacteria on rice crop growth and nutrients uptake under saline soil condition at National Agricultural Research Center (NARC), Islamabad Pakistan during summer 2016. A total of 18 experimental pots were induced with salinity of 7.0 dS m-1 and arranged in Completely Randomized Design (CRD) with three replications. ...
Imran Khan1, Zahir Shah2, Wiqar Ahmad3*, Farmanullah Khan2 and Muhammad Sharif2
...50 and 25% of the RD, respectively. Tillage practice included shallow tillage (ST; 0-20 cm) and deep tillage (DT; 0-40 cm). The FYM alone resulted in increased soil NPK, organic matter (OM) and the electrical conductivity (EC) but failed to improve the yield significantly. However, the RD, along with improving these parameters, also increased the yield significantly over the FP. Amongst all treatments, the 5 t ha-1 FYM and 75% NPK of the RD (INM5:75) stood su<...
Gulsanga1, Zahin Anjum1, Sahib Alam2* and Farhat Shehzad1
...d 0.38 to 1.93 mg/kg, respectively. The average Na, K, Ca, Mg and P contents in cow’s and buffalo’s meat were found to be 54.75 and 67.45, 351.67 and 333.75, 4.61 and 6.31, 21.50 and 26.76, and 212.75 and 181.32 mg/kg, respectively. The average contents of Cu, Zn, Ni, K and P were higher in cow’s meat whereas the concentrations of Pb, Na, Ca and Mg were higher in buffalo’s meat. The toxic heavy metal ...
Habib-ur-Rehman1, Masood Ahmed Siddiqui1,*, Abdul Qayyum1, Arifa Bano1 and Naeem Rashid2
...ng industry.
...
Muhammad Khalid Mukhtar1,*, Hummaira Iqbal1, Hafiz Muhammad Tahir2, Haseena Ghulam Muhammad1 and Muhammad Irfan1
...tricola showed the type I functional response. It is concluded that both studied insecticides are not suitable for IPM program in the study area.
...
Ghulam Muhae-ud-Din1,4, Anam Moosa1, Umer Farooq Ghummen1, Muhammad Jabran1, Amjad Abbas1, Muhammad Naveed2, Abdul Jabbar1 and Muhammad Amjad Ali1,3,*
...lant parasitic nematode species that infects a huge number of crop plants. It also infects the ornamental plants resulting in a serious growth-limiting factor in ornamentals. In this study, the response of ten ornamental plants to M. incognita was assessed in pot experiments. All the ornamental plant species showed varying degree of infection of M. incognita. Rhapis excels...
Muhammad Suhaib1*, Ijaz Ahmad2, Masooma Munir3, Badar-Uz-Zaman1, Bushra Atta4 and Muhammad Khubaib Abuzar5
...wo different wheat genotypes supplemented with salicylic acid (0.25 and 0.5 mM) under salt stress (75 and 150 mM). It’s an obvious factor that under salt stress certain reactive oxygen species are produced that damage the vital plant organelles causing disturbances in the normal functioning of the plant and even may lead to death in severe cases. The results of this study conferred that there were genotypic variation f...
Mehran Ali, Inamullah*, Sajjad Ahmad and Arsalan Khan
... sheep manure, mushroom spent, mungbean residue and urea) in subplots. The results exhibited that, higher plant height (200.4 cm), grains ear-1(351), seed index (228.8 g), grain yield (3522 kg ha-1), and biological yield (10799 kg ha-1) were observed with nitrogen sources incorporated with mould board plough. In case of nitrogen sources; poultry manure (3507 kg ha-1), sheep manure (3468 kg ha-1) and mushroom spent (3450 kg h...
Madeeha Alamzeb1, Shazma Anwar1, Asif Iqbal1,2*, Song Meizhen2, Mazhar Iqbal3, Sara4, Muhammad Ramzan2 and Afza Tabassum1
...op productivity. Field experiment was conducted at The Agronomy Research Farm of The University of Agriculture Peshawar, during winter 2015 to investigate the effect of organic sources (cattle, sheep and poultry manure each at 5 t ha-1) and nitrogen levels (0, 75, 100, 125 and 150 kg ha-1) on dry matter partitioning of wheat under tillage systems (conventional and deep tillage). The experiment was laid out in randomized comp...
Safdar Ali1*, Obaidullah Shafique1, Tariq Mahmood2, Muhammad Amir Hanif1, Ijaz Ahmed3 and Bashir Ahmad Khan4
...oduction and decrease in pesticide use. Nanotechnology also contributes in increasing the crop yield in agriculture. One of the major contribution of nanotechnology in the field of agriculture is the formulation of nano based pesticides and fertilizers for increased crop production. Precise farming techniques can promote crop production without damaging soil and water, reducing losses due to leaching of nitrogen and enhancin...
Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4
...il in the country. The experiment was conducted at National Agriculture Research Center (NARC) Islamabad, Pakistan, during August to December, 2016, to evaluate different exotic sunflower hybrids for their performance and adaptability in the field area of NARC. Twelve sunflower hybrids including one check i.e. SF-16013, SF-16007, SF-16010, SF-16005, SF-16006, SF-16002, SF-16008, SF-16004, SF-16011, SF16003, SF-160011, Hysun-...
Arshad Mahmood Malik1, Khalid Mahmood Mughal2, Sarfraz Ahmed Mian2 and Atta Ullah Khan2
...le time productivity in specially developed glasshouses under controlled weather conditions during summer and winter. Rising population and stagnancy both in yield of vegetables and cultivated area of the country, are negatively affecting food supply in Pakistan. Supply of hydroponics products provides solution to the problem of decade old stagnancy in yield of the vegetables especially to...
Saleem Ashraf1*, Ashiq Hussain Sangi1Zakaria Yousaf Hassan3 and Muhammad Luqman2
...vernment reports for the period of 1990-2017 was criticaly examined. Empirical results indicated that area under cultivation showed negative compound growth rate while production and average yield showed positive compound growth in Pakistan. While, in Punjab, compound growth rate of area under cotton cultivation and production showed negative while average yield showed positive growth. Forecasting of cotton showed that in Pakistan, area, production and average...
Yakup Erdal Erturk1, Adem Aksoy2 and Mohammad Masood Tariq3,*
...inal live weight (AFFLW) per enterprise for crossbred cattle reared in beef cattle enterprises in North East Anatolia region (comprising Erzurum, Igdir, Kars and Agri provinces) of Turkey. For this goal, Multivariate Adaptive Regression Splines (MARS), a-non parametric regression technique, was used to develop a respectable prediction equation that can denote interaction effects of influential predictors in the definition of...
Muhammad Shahbaz Aslam1, Iram Gull1, Zaigham Abbas2,* and Muhammad Amin Athar1
... 2 (IFNα-2) is a type of cytokine with both antiviral and anticancer activities. Binding of IFNα-2 to its receptor on cell surface leads to activation of interferon stimulated genes which mediate its anti-proliferative and anti-angiogenic properties. Similarly, Thymosin alpha 1 (Tα-1) helps to fight against different infections such as cancer and hepatitis with its immune modulating pro
Pasqua Rotondi1, Maria Antonietta Colonna1, Giuseppe Marsico1, Francesco Giannico1, Marco Ragni1 and Anna Maria Facciolongo2,*
... physical and sensory properties, chemical and fatty acid composition of intramuscular lipids. Twenty-one three-week-old kids were divided into three homogeneous groups (n = 7), according to age and body weight, and assigned to one of the following feeding treatments: C) control: commercial pelleted feed; L) pelleted feed containing 3% extruded linseed; LO) pe
Aqeela Ashraf1,2,*, Muhammad Imran1 and Yung-Fu Chang2
...sceptibility testing was performed by disk diffusion method. Resistance and virulence genes were detected by PCR. The results showed that 100% of isolates were resistant to penicillin, 54% to ampicillin, 44% to tetracycline and 30% to streptomycin, while none of them was resistant to chloramphenicol. These E. coli isolates carried one or more antimicrobial resistance genes. Genes present with highest frequency were
Ayesha Munir, Hafiz Muhammad Umer, Anjum Nasim Sabri and Imran Sajid*
...an being caused by multispecies of bacteria. Among the causative agents of dental caries, notable one is Streptococcus mutans, which is an obligate parasite. In this study eleven S. mutans strains were isolated from carious lesions on Mitis Salivarius Bacitracin agar along with twenty potentially active Streptomyces strains were isolated from the soil of agriculture farmlands. The biochemical and physiological characterization along with t...
Hongqun Li1, Xiaoli Liu2,*, Zhenmin Lian3,RenheWang4, Yongbin Wang4, Yongyao Fu1 andDingyi Wang5
...order interaction as independent variables. Finally, regression equation with the lower Akaike’s Information Criterion for small sample sizes (AICc) value was regarded as the optimal model. The model indicated that nest-site success of brown-eared pheasants was negatively related to cover of shrubs, and first-order interaction between cover of trees and cover of shrub at a height of 1.0 m, suggesting bigger cover of shrubs, cover of trees and cover of sh...
Niamatullah Kakar, Farhat Abbas, Muhammad Shafee and Tauseef Asmat*
...i>. Moreover, the suspected samples were further investigated by polymerase chain reaction (PCR). Three samples were found positive by PCR test while other detection methods were not that sensitive to detect the tuberculosis at that stage. Two patients were reported with history of tuberculosis but were effectively treated before imprisonment. On age basis, 128/186 (68.88%) patients were of younger age (18-30 years) and 10 (5.37 %) were above 50 year. Illi...
Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2,*, Khizar Samiullah3
...lable on these animals especially in Punjab province of Pakistan. Furthermore, distributional pattern and habitat structure of known species is also ambiguous. In this study, we report the scorpion Androctonus finitimus (Pocock, 1897) from several areas of Punjab, Pakistan. This scorpion species has not been previously documented from this part of the country, highlighting the wide ...
Huma Naz1,*, Sajid Abdullah2, Sidra Naz3, Sidra Abbas2, Wardah Hassan2, Shakeela Perveen2, Moazama Batool1, Laiba Shafique2
....07 mgL-1, respectively. The selected concentration of Fe+Ni+Pb+Zn concentrations showed strong and direct relationship with, fin movement followed by mucous secretion, hyperactivity and swimming rate for C. mrigala with R2 value of 0.858, 0.853, 0.216 and 0.005, respectively. The Fe+Ni+Pb+Zn mixture exposure at 96 h LC50 concentration caused signifi...
Farah Rauf Shakoori1,*, Anum Feroz1, Ayesha Gondal1,Sahar Akram2 and Tanzeela Riaz3
...rvae of a stored product pest, Trogoderma granarium. The LC50 values of λ-cyhalothrin for 4th and 6th instar larvae of Lahore population was 15.93 and 13.76ppm respectively, while 19.07 and 16.21ppm were for the 4th and 6th instar larvae of Gujranwala population, respectively. The resistance ratio RR (0.67 and 1.17) for 4...
Ambrina Hafiz1, Tanzeela Riaz2 and Farah Rauf Shakoori1,*
...wards resistance against pesticide in stored grain pests.
...
Asad Sultan1,*, Shahroom Khan1, Sarzamin Khan1, Naila Chand1, Muhammad Shuaib Khan2 and Hamza Maris3
...water during the starter period for 21 days. Feed intake was significantly (P<0.05) lower and weight gain and dressing percentage were significantly (P<0.05) higher in the OA-2 group, resultantly, the best feed conversion ratio (FCR) was recorded in the same group. Tibia dry matter, ash, calcium (Ca) and phosphorous (P) were significantly (P<0.05) higher in OA-2. On the other hand, fecal Ca and P decreased significa...
Muhammad Adeeb Babar1,*, Sayyad Ghyour Abbas1, Muhammad Akbar Khan1, Kiran Aftab2, Muhammad Hanif1, Muhammad Asim1 and Muhammad Akhtar1
.... The identified cervid species include Rucervus cf. simplicidens, Cervus cf. triplidens and Cervus cf. sivalensis. These specimens provide additional information about the recorded cervid species and contribute to recent work from the Middle Siwalik Hills of Pakistan.
...
Baoying Guo*1, Yu Chen1, Chuan Zhang2, Zhenming Lv1, Kaida Xu3, Hongling Ping4 and Huilai Shi4
... genes of 37 cuttlefish species. S. lycidas have a close relationship with S. pharaonis, S. aculeata, and S. esculenta. This result confirmed the relationships of S. lycidas as being similar to the traditional taxonomy. This study plays an important role in the investigation of phylogenetic relationships, taxonomic resolution, and phylogeography for Sepiidae species.
...
Ashraf Sayed Awaad1 and Mohamed Zaki Fathy2*
...anatomy of the lumbosacropelvic region and confirmed by computed tomography (CT) as well as successful application of the needle within the epidural space guided by ultrasonography (US). This study was conducted on seven lumbosacropelvic regions of goat cadavers and five live goats of both sexes ranged between 25-30 kg body weight. Longitudinal and cross anatomical sections were done on these samples; the sections were photo...
Saima Rani*, Hassnian Shah, Nusrat Habib and Muhammad Azeem Khan
...t-align: justify;">The paper analyses the factor that Influence the willingness to pay a high price for organic vegetables by using consumer preferences data by primary sources from Islamabad in Pakistan. The determinants of willingness to pay of consumers estimated by using the probit model. The model contains the information of socioeconomic characteristics, awareness and preferences of organic vegetables and product attributes. The empirical findings in...
Ghufran ul Haq1*, Muhammad Arif2, Asad Ali2 and Mian Inayatullah3
...mine the transmission properties of the prevalent isolate of the virus in the major tomato growing areas of Khyber Pakhtunkhwa (KP). For this purpose, surveys were conducted in the hilly areas of Mohmand Agency and Malakand Agency and plains of Shabqadar, Charsadda and Peshawar during 2011, 2012 and 2013, to determine the incidence of TYLCV and the population of its vector. Triple antibody sandwich-enzyme linked immunosorbent assay (TAS-ELISA) was successful i...
Muhammad Adnan Khan1*, Majid Suhail Hashmi1, Ali Muhammad1, Muhammad Muneeb1, Haris Bilal1 and Gul Wali2
...r, with 3: 4: 1 ratio respectively. All samples were tested for total soluble solids (TSS), pH, titratable acidity, reducing sugar, non-reducing sugar, ascorbic acid and sensory properties as flavor, color and overall acceptability. Samples were stored for three months and readings were recorded at every 15 days interval. During storage intervals, TSS increased from 48.0 to 51.31°Brix, pH increased 3.82 to 4.25, titratab...
Nashwa Mohamed Eid1, Al-Hussien Mohamed Dahshan1, El-Shayma El-Nahass2, Basma Shalaby3 and Ahmed Ali1*
...r control of Clostridium perfringens (CP) type A induced necrotic enteritis (NE) in broiler chickens. The influence of varying concentrations of both EOs was determined in vitro using the agar dilution test. Concentration as low as 0.25% and 0.125% of thyme and clove oils, respectively, were able to completely inhibit the growth of CP. An in vivo study was conducted in commercial broiler c...
Mohammed Al Bratty1, Hassan A. Alhazmi1, Somaya Jadoh Ogdi1, Jana Ahmad Otaif1, Abdul Jabbar Al-Rajab2, Mohammad Firoz Alam3 andSadique Akhtar Javed1,*
...Plasma Optical Emission Spectrometry (ICP-OES). The concentrations of heavy metals in various chicken parts were recorded to be in the range of nd-0.01, 0.07-0.18, 1.08-3.95, 9.61-119.0, nd-0.16, 0.13-1.10, and 8.63-67.58 mg/kg for Cd, Cr, Cu, Fe, Ni, Pb and Zn respectively. Relatively higher metal concentrations were observed in bone, lungs and brain, which are generally not consumed by the local population. Meat, the most ...
Mehmet Aydın*
...the fiveDecapoda species (Pachygrapsus marmoratus, Carcinus aestuarii, Liocarcinus depurator, Liocarcinus navigator, and Eriphia verrucosa) living in the Black Sea. The crab samples were obtained between 2010 and 2016 by SCUBA, trawl, trammel net, and dredges at six locations (Kastamonu, Sinop, Samsun, Ordu, Giresun, and Trabzon). Total carapace length (CL) and weight (W) of each individual were recorded with an accuracy of 0.01 cm an...
Muhammad Shahbaz1,*, Muhammad Anwar Iqbal1, Arshad Javid2, Abu ul Hassan Faiz1, Irfan3 and Muhammad Irshad Arshad4
...er 2016. A total of 172 specimens of genus Pipistrellus belonging to six species i.e. P. pipistrellus (n = 43), P. paterculus (n = 12), P. javanicus (n = 39), P. tenuis (n = 18), P. cylonicus (n = 40) and P. dormeri (n = 20) were captured. Out of these six species, four are reported for the first time from the study area, whereas, P. pipi...
Rehman-Ud-din* and Naeem-Ur-Rehman Khattak
...a large number of both types of farmers are neither completely mechanised nor completely non-mechanised. Majority of the farmers in each type of farmers do not have their own farming machines/animals. Per acre productivity of mechanised farmers is a little bit greater than the non-mechanised farmers. The outstanding feature of farm mechanisation is the time-saving factor that enables mechanised farmers to s
Usman Shakoor1, Ali Nasir2, Mudassar Rashid1, Muhammad Iftikhar-ul-Husnain1, Nabila Khurshid1 and Zuhair Husnain2
...istrict level should be spent on provision of local services which, in return, would help farmers increase income leading to higher income tax revenue. ...
Muhammad Waheed Mushtaq1,*, Jamil Anwar2, Omara Naeem3,Farah Kanwal1 and Waheed-uz-Zaman1
...es were counted after proper Gram staining. It was found that more than 90% bacteria were separated along with freezing front and were concentrated in the centre in the case of radial freezing and at the bottom in case of vertical freezing.
...
Ye Gong, Nehafta Bibi and Haitao Wang*
...Mandarin duck and other species over 11 breeding seasons (2004 - 2014). We monitored the frequency of occurrence and the fate of eggs in those nests and recorded fourteen cases of mixed clutches that contained Mandarin duck eggs. Nine cases were classified as successful nest usurpation: in six cases nests of other birds were usurped by Mandarin duck and in three cases nests of Mandarin duck were usur...
Zeqin Fu, Yunfang Tian, Yingying Ye*, Pengzhi Qi and Changwen Wu
... one of the main mussel species in China, with a widely range of aquaculture markets and importantly economic value. In this study, we used one hundred and twenty primers pairs to screen all microsatellite loci and twenty-three polymorphic loci were identified. The number of alleles per loci ranged from six to twenty-one with an average of 12.913 and the allele size varied between 161 and 470 bp. The observed and ex
Thomas W. Clark
...stitutes each of us as a person. The feeling of being a singular self that owns these characteristics is real enough, but there’s no indivisible thing to which that feeling refers. Rather, it’s the result of a subset of neural goings-on tasked with reliably distinguishing the physical person from the rest of the world, all in service to effective action. For reasons under investigation by neuroscientists and phil...
Yijiang Liu1, Kun Li2, Hui Zhang2, Khalid Mehmood2,3, Muhammad Shahzad3, Houqiang Luo1,*, Muhammad Asif Yaseen4 and Xiong Jiang2,5,*
...drial (mt) genome of the pet bamboo rat Rhizomys pruinosus, which had a problem in standing and walking in a Bamboo farm in Wenzhou, China was carried out, using its tibia. The mt genome (16,579 bp) is composed of 13 protein coding genes, 22 tRNA genes and 2 rRNA genes. The ratio of the bases of the mt genome of R. pruinosus from Wenzhou are A (32.31%), T (31.04%), C (24.77%), G (11.88%), A+T (63.35%), respe...
Muhammad Nazar Aftab1, Ahmed Ali1, Muhammad Asad1, Sadia Fatima2 and Furhan Iqbal2,*
...bino mice were used as experimental animals and were divided into two groups. First group was treated with 80mg/Kg body weight of AlCl3 for 16 days while control group was treated with saline solution for the same period of time. Complete blood count were determined in both experimental treatments at the end of dose supplementation. Our results revealed that oral supplementation...
Fazul Nabi1,2, Hui Zhang1, Muhammad Kashif Iqbal1 , Mujeeb ur Rehman1, Muhammad Shahzad3, Khalid Mehmood1,3 and Jiakui Li1,*
... was aimed to determine specificity of salvia miltiorrhiza (SM) on growth plate width, liver oxidative stress and toxicity in avian TD. One hundred and fifty broiler chicks were equally distributed into three groups: Control, Thiram (50 mg/kg/d) and SM (10 mg/kg/d) treated. Results showed that thiram caused lameness, decrease in alkaline phosphatase (ALP) activity and increase in alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in...
Fayaz Ahmad1*, Noorullah Khan1, Farrukh Siyar Hamid1, Qamar uz Zaman1, Shamsul Islam1, Muhammad Abbas Khan1 and Sair Sarwar2
...t-align: justify;">The experiment was conducted at National Tea and High Value Crops Research Institute, Shinkiari Mansehra during the years 2012-13 with the objectives to find out the most suitable time of pruning and doses of potash fertilizer for deep pruning of tea bushes and their subsequent efficient recovery and proper growth. The experiment was laid out in Randomized Complete Block...
Wiqar Ahmad1* and Farmanullah Khan2
...-align: justify;">This paper describes soil fertility and crop productivity restoration measures for an eroded soil. The study was conducted in RCB split plot (4*5 m2) design with; a) cropping patterns (CP); i. cereal-cereal rotation ii. cereal-legume rotation and iii. cereal-cereal+legume intercrop rotation in main plots and b) soil amendments (SA); i. The control (C), ii. Farmers practice (FP; 60:45:0 N: P2O5: K2O), iii. Recommended NPK dose (RD; 120:90:60 N...
Muhammad Ismaeel1,2*, Syed Mehar Ali Shah1, Aziz Ur Rahman1 and Mian Ahmad Raza1
...osis among 30 rice genotypes for yield and related parameters at The University of Agriculture Peshawar-Pakistan, during 2011. Thirty rice genotypes including 14 parents and 16 F1 hybrids were replicated twice in a randomized complete block design (RCBD). Rice genotypes reflected significant differences (P≤0.01) for all the traits. Among the rice parents, Bas-6129 and Bas-370 showed the...
Samiullah*, Mohammad Aslam Khan and Atta-ur-Rahman
...-align: justify;">This paper spatio-temporally analyses the nexus of landholdings and farm fragmentation (FF) in Peshawar City District, Pakistan. In order to achieve objectives of the study, data were collected from revenue department and field survey. For micro level analysis, five villages were randomly selected for detailed and intensive study. In addition to questionnaire survey, detailed focused group discussion was also arranged with the key stakeholder...
Jia-kui Li1,2,*, Kun Li2, Zhao-qing Han2, Hui Zhang2, Xiao-qiang Wang2, Hou-qiang Luo2, Yan-fang Lan2 and Gang Qiu1,2
...; 95% CI: 43.4-76.0), respectively. The prevalence of BVDV infection in 2012 to 2014 was 45.3% (95% CI: 38.6%-52.1%); 56.0% (95% CI: 49.7-62.2) and 60.5% (95% CI: 43.4-76.0), respectively with a significant difference in the three years (P<0.05). The current result reveal a growing prevalence of BVDV infection in yaks in this area.
...
Nadia Saeed1,Mian Sayed Khan2, Habib Ahmad3, Muhammad Abdullah4 and Muzafar Shah5,*
...he rate of 10kg/tree, respectively. Untreated trees were kept for the comparison. Soil samples and sub samples of both treated and untreated trees after 3, 6 and 12 month from Abbottabad and Mansehra by using Bearmann funnel technique. After Quantitative analysis of both treated and untreated trees, it was observed that treated trees samples showed decline in nematode number as compared to untreated trees. Organic amendments effectively controlled the nematode...
Farrukh Jamil*, Samra Raheel and Haroon Rasheed
...all these residues. It appears that HGbIV is not designed for transport of smaller gaseous molecule like the other heme containing proteins and it may be a phosphate sensor.
...
Gulnaz Malik1, Abdul Qadir1 and Hafiz Azhar Ali Khan2,*
...onidae), is an important pest of stored grains including wheat, maize and rice. Although insecticides are used for the management of this pest, successful management could be compromised by prevailing environmental temperature since it has a significant effect on the toxicities of insecticides. The focus of the present study was to evaluate the effect of post-treatment tem
Xiangbin Meng1,Tianxiang Gao2, Chunhou Li3, Na Song1, Lu Liu1, Liqin Liu2 and Xiumei Zhang1,*
...he conservation of this species. We performed next-generation sequencing and de novo assembly to obtain potential useful microsatellite markers for S. esculenta. Among 80 tested microsatellite markers, 19 showed polymorphism among S. esculenta individuals. The allele number of all polymorphic microsatellite markers ranged from 6 to 10. Expected and observed heterozygos...
Abdur Rahman1,*, Ibrahim Sadi Cetingul2, Ismail Bayram2, Cangir Uyarlar2, Abdil Burhaneddin Akkaya2, Eyup Eren Gultepe2, Hikmet Keles3, Aykut Ulucan4 and Zafar Hayat1
...iet on the intestinal properties and gut morphology. Quails fed diets containing 0% (A), 1% (B), 2% (C), 3% (D), 4% (E) and 5% (F) dried ground Oregano leaves. Results revealed that villus height was significantly higher in group D compared to control group, whereas crypt depth was significantly higher in all supplemented groups specifically remarkable in group D. Thickness of the tunica muscularis was higher in group C whil...
Nausheen Irshad1,*, Imran Yousaf1, Tariq Mahmood2 and Muhammad Saeed Awan1
...f formal studies on the species. A survey was conducted from June to December 2014 to document existence of the leopard in Abbaspur area, Azad Jammu and Kashmir. Direct field observations (opportunistic survey) and indirect observations based on signs of the species were recorded. This was supplemented with information collected through questionnaire survey. Results confirmed the occurrence of leopard at six out of twelve sa...
Muhammad Asim Khan1,*, Shahid Niaz Khan1, Sanaullah Khan2, Abdul Jabbar Khan3, Muhammad Adnan4, Nawab Ali5 and Ijaz Ali6
Tariq Mukhtar
...ht of tomato in a dose dependent manner. Doses of 8×103 and 1×104 cfu/g of soil showed maximum increase in shoot weight and decrease in root weight. On the other hand, both the antagonistic fungi caused significant reductions in number of galls, egg masses, eggs per egg mass and reproductive factors of M. incognita in a dose dependent manner. Both t...
Tariq Mahmood1,*, Shafqat Rasool1, Faraz Akrim1, Shaista Andleeb1, Muhammad Sajid Nadeem2 and Fiaz Nadeem3
...ording diversity of owl species inhabiting Margalla Hills National Park, Islamabad (MHNP). Three owl species viz., Spotted Owlet (Athene brama), Little owlet (Athene noctua) and the Tawny Owl (Strix aluco) were recorded from the park at five different sampling sites, at elevations ranging from 615 m to 655 m above sea level. Only one of the three species Tawny o...
Abdul Samad1, Ferhat Abbas1, Zafar Ahmad1, Olena Pokryrshko2 and Tauseef M Asmat1,*
...> (O157:H7) in various types of food items consumed locally. Total of 800 most common food samples such as chicken, beef meat, raw milk, vegetables and salad samples were collected from retail market, the overall contamination of food samples with infectious agents was 48.37%. Campylobacter jejuni was recorded much higher (28.99%) compared to other foodborne pathogens. Food samples were also found positive for Salmonella spp. (19%), E. ...
Jun Chen1, Shuai Shang2, Xiaoyang Wu1, Jiakuo Yan1, Huaming Zhong1, Huanxin Zhang2, Weilai Sha1, Wanchao Zhu1 and Honghai Zhang1,*
...uminant herbivore, the cape oryx from southern Africa has a digestive system that allows it to absorb and digest large amounts of plant material through microbial fermentation in the hindgut. So far, there has been no study of the gut microbiota of the cape oryx. Here, we provided the first description of the fecal bacterial populations of the cape oryx by using high-throughput Illumina se...
Hazrat Nabi1, Irshad Hussain2, Muhammad Adil3, Amar Nasir3,*, Arbab Sikandar3, Saeed Khan1 and Nasrullah Khan3
...mphoid organs and growth performance of broilers. In this study, a total of 118 day-old broiler chicks were used, of which 108 were randomly divided into 6 groups (A to F) on day 14th. Aflatoxins derived from Aspergillus parasiticus were mixed in the feed measuring 150 ppb and fed to various broiler groups. Mycotoxin binders were also added into the feed and offered to group E and F from 14th-42<...
Tengfei Lu1, Wenhua Pei1, Shuang Zhang2, Yangnan Wu1, Fenghao Chen2, Xiao Han2 and Weijun Guan1,*
...ells, stem cell is a prospective source for tissue engineering. Amniotic mesenchymal stem cells (AMSCs) obtained from amnion do not evoke ethical issues, as they do with the embryonic stem cells. However, a good many experimental tissues and organs were obtained from model animals but rarely from livestock. In this study, AMSCs were obtained from aborted sheep fetuses (1-3 month) under sterile conditions. Primary AMSCs were ...
Shamsher Ali1*, Sarmad Khan1, Muhammad Jamal Khan2, Naveed ullah4, Muhammad Rashid3 and Wiqar Ahmad1
...xt-align: justify;">An experiment in pots was carried out at Amir Muhammad Khan Campus Mardan, The University of Agriculture to screen out bread wheat varieties in different soils at early growth stage. Five bread wheat varieties i.e Atta Habib, Barsat, Siren, Pirsabak-2004 and Pirsabak-2005 were cultivated under three soils having different salinity levels; i- Normal-non saline soil (EC=0.9 dS m-1), ii- moderately saline soil (EC=7.2 dS m-1) and iii- highly s...
Muhammad Zulfiqar1*, Muhammad Jamal Khan1, Irshad Khan Abbasi2, Muhammad Tariq2, Jawad Ali3, Melad Karim4 and Rizwan Ahmad1
...hat increasing global temperature will result in waning glacier based freshwater availability in future. River Indus fed by glaciers is critical for Pakistan as it is irrigating its 80% of agricultural land. Shigari Kalan watershed is one of the water sheds located in Skardu, Northern Pakistan, which also contributes to River Indus flowing to Pakistan. The aim of instant research is to evaluate the correlation amid temperatu...
Chicken Embryo Fibroblasts are Effective Cells to Study the Function of Chicken Neurexophilin 1 Gene
Dongmei Sun, Meiling Chen, Hafiz Ishfaq Ahmad, Yun Liu, Xunping Jiang and Guiqiong Liu*
...pressed gene in chicken sperm storage tubules. In this work, Immunocytochemistry, immunofluorescence and Western-blot were performed to detect the expression of neurexophilin 1 in epithelial cells of chicken utero-vaginal junction, chicken embryo fibroblasts (DF-1 cells) and Hela cells. The immunocytochemistry results showed that neurexophilin 1 was expressed in both the epithelial cells of chicken genital tract and DF-1 cel...
Sumaira Maqsood1,*, Muhammad Afzal2, Muhammad Anjum Aqueel2, Waqas Wakil3 and Hafiz Azhar Ali Khan1,*
...itura is an economic pest of different field crops including cauliflower. In the present study three commercial formulations of biorational insecticides viz., Bacillus thuringiensis (DiPel®), NPV (SpltNPV) and Flubendiamide (Belt®) evaluated (alone and in combination) against S. litura under field condition. Minimum plant infestation (7.60±0.40%) was observed three days after application when...
Fatma Abdallah1*, Ola Hassnain2, Elsayed Attar3, Haytham Ali3,5, Mohamed Megahed1 and Venugopal Nair4
...tortion in the Proline repeats (Proline-to-Alanine) at position 176 in the Egyptian MDV strains. The Phylogenetic analysis grouped the eight analysed sequences with the previously investigated Meq from Egypt (2011-2013) together with the very virulent European and Chinese MDV isolates. The latter confirmed the geographical structuring of the Egyptian MDV strains together with the Eurasian ...
Mingming Ning1,2, Yanjie Zheng1, Yuanyuan Dun1, Weijun Guan2 and Xiuxia Li1,*
... RT-PCR. We carry karyotype analysis out and find that chromosome is 2n=78 and shows normal. CAFSCs in mid period of subculture propagate fastest from cell cycle examination on Flow Cytometer and growth curve using CCK-8 kit on ELIASA. CAFSCs are induced to neuron and epithelium (epiblast), adipocyte (mesoblast), hepatocyte (entoblast).
...
Nadeem Munawar, Iftikhar Hussain and Tariq Mahmood*
...as destructive mammalian pests of agricultural crops at global level. They cause severe damage to various crops, directly and indirectly, by gnawing, spoilage, contamination and hoarding activities. The current study investigated the occurrence of different rodent species inside the crop fields and at field edges, associated with four major crops (wheat, groundnut, millet and maize) in the Pothwar Plateau. In all four crops,...
Adel A. Basyouny Shahin,1,* Amira M. Metwally Mohamed2 and Abd El-Reheem A. El Shatter2
...n between the two karyotype forms I (2n = 60) and II (2n = 62), which have been recently recognized in the Egyptian N. ehrenbergi, was examined at 17 structural genetic loci and interrelationship was discussed. Of these 17 genetic loci, 10 (58.8%) loci were monomorphic with the same allele fixed in all individuals from both karyotype forms and only 7 (41.2%) loci were polymorphic with two different alleles. Lev...
Danyu Zhang1, Ying Liu1, Qinxin Shi1, Zhiwei Peng1, Yan Hua1 and Zhijun Hou1,2,*
...>...
Ali Zaman1,*, Abdul Haleem1, Sajjad Ur Rahman2, Adnan Amin3 Asma Saeed1, Sana Ullah4 and Naimat Ullah4
...the infection with the type of season, health status, vaccination, housing system, biosecurity and housing zones and non- significant (P>0.05) association with rearing system. To the best of our knowledge, this is the first sero-prevalence report of avian influenza (H5) in broilers in these districts of the province. Necessary measures are required to overcome the situation and improve vaccination and hygiene.
...
Souheila Slimani1,*, Sonia Hamouda1, Chahrazed Souadi1, Sara Silini2, Cherif Abdennour2 and Leila Delimi3
...re associated with the appearance of certain metabolic, carcinogenic, neurotoxic and fertility disorders. The objective of this work is to study the toxic effect of the dithiocarbamate “thiram 80% purity” on seasonal reproduction of male domestic pigeons Columba livia domestica, subjected to a long photoperiod (19L: 05D). The fungicide was orally administered at 5 and 10 mg/Kg body weight/day for 10 consec...
Muhammad Anwar-ul-Haq1, Amer Jamal Hashmat1, Ejazul Islam1, Muhammad Afzal1, Abid Mahmood2, Muhammad Ibrahim2,*, Muhammad Nawaz3,*, Shahid Nadeem4 and Qaiser Mahmood Khan1
...lored wastewater. The scope of this new electrochemical treatment is a significant advance to the existing technologies. There were four different treatments employed as; T1: wastewater, T2: wastewater with 0.1% electrolyte, T3: diluted wastewater (50% tap water), and T4: diluted wastewater (50% tap water) with 0.1% electrolyte. The color and COD in the effluent were reduced to 47% and 46% in T1, 70% and 52% in T2, 75% and 57% in T3, 80% and 59% in T4, res
Musrrat Fatima, Muhammad Saad Khan, Hamid Rashid, Asim Mehmood, Sumaira Kanwal, Muhammad Asif Rasheed and Farrukh Jamil*
... it affected millions of people. Studies have shown its role in developing microcephaly and GBS Syndrome. There is a need to develop drugs against ZIKV. Here we uses pharmacoinformatics techniques to identify potential inhibitors against ZIKV protease NS2B-NS3, which has a well-known role in the viral replication. By using three dimensional structure of the NS2B-NS3, an allosteric site has been identified in the protein. Moreover, the identified site is used f...
Muhammad Zameer Kayani1,*and Tariq Mukhtar2
...e deleterious effects of pesticides can be averted by using non-chemical approaches, and resistant cultivars can prove a promising substitute. For their fitness as nematode-suppressive crops, the reproductive and developmental rates of the nematode must be assessed on these cultivars. As there is meager information on the reproductive potential of Meloidogyne incognita on different cucumber cultivars commonly cultivated in Pakistan, therefore, the objec...
Tayfun Karataş
...(p<0.05). The fasting period had no significant effect on the hepatic thiobarbituric acid reactive substances (TBARS), but, it caused a significant decrease in the hepatic catalase and glutathione peroxidase (p<0.05). In muscle tissue, the TBARS levels were significantly decreased (p<0.05). Whereas, antioxidant enzyme activities remained unchanged (p>0.05). The results obtained from this study showed that the sho...
Yakup Erdal Ertürk
...tudies.
...
Zihong Chen1, Ling Xu2, Xiaona Yang2, Yaguan Zhang3* and Yuming Yang4
...gical protection. A new species of the genus, collected from Taibao mountain, Baoshan City, Yunnan Province, southwestern China, was described here as Metarhizium baoshanense. It was proposed and determined based on morphological characters combined with a multigene phylogenetics analysis involving 5.8S–ITS, nrSSU, nrLSU, EF–1α, RPB1 and RPB2. In multilocus phylogeny, M. baoshanense was groupe...
Nina Bao1,*, Yongguang Yin2 and Panpan Wang3
...ude one.
...
Changqing Zhao*, Zhuochi Chen and Yubin Li
... and fermented jerky, respectively. The important compounds affecting the flavor of fermented jerky included DL-Glutamic Acid, Phenylethyl Alcohol, 1-Octen-3-ol, Nonanal, Pentanal, 3-Methyl-Butanal, and 2-Pentyl-Furan. The study results demonstrated that the strains combined with Lactobacillus bulgaricus and Angel Yeast reduced the meat pH, degraded the protein in the meat by the proteases (including acid and neutral proteases) produced during fermentat...
Jia Chen*, Yuanxi Deng and Hui Xu
...
...
Bin Wang1, 2, Qianji Ning1,*, Qian Wang2, Wei Peng2, Tong Hao2,*and Jinsheng Sun2,*
...ainly focused on the independent analysis of single protein, rather than a protein-protein interaction. In this work, with the systematic point of view, the subcellular location of 830 unidentified proteins were annotated based on the previously reconstructed protein-protein interaction network (PIN) of E. sinensis using the bioinformatics analysis method, which accounts for 91.9% of all un-localized proteins in the network. Subsequently, the molting in...
Environmental Determinants of Zooplankton Community in the Damietta Estuary of the Nile River, Egypt
Wael S. El-Tohamy1,*, Russell R. Hopcroft2 and Nagwa E.M. Abdel Aziz3
...zooplankton abundance. Copepods and their larval stages contributed 36.2%. Rotifers ranked the third important group (12.6%). Protozoa contributed 10.6% of the total community. According to the Canonical Correspondence Analysis (CCA), the variations in the species data were significantly (P< 0.05) related to salinity, temperature, phosphate concentration and phytoplankton biomass. The m...
Xi-wen Chen1,2, Qian Wang1,3, Miao Yin1, Zhong-hui Pu1,2, Ai-wei Guo3, Lian Li 1,3, Wen-tao Luo1,3 and Xiong-qing Wang1,*
...optimal at a constant temperature of 65 °C. The output of the RT-LAMP assay was visualized using 1% agarose gel electrophoresis or color change after the addition of the SYBR Green I dye. The RT-LAMP method was approximately 100-fold more sensitive than RT-PCR for PRRSV detection. The assay was also specific for PRRSV and did not cross react with CSFV, PCV-2, PPV or PRV. In clinical samples (n=5) RT-PCR and RT-LAMP both ...
Syed Makhdoom Hussain1,*, Muhammad Zubair ul Hassan Arsalan1, Arshad Javid2, Abdullah Ijaz Hussain3, Nosheen Aslam4, Qasim Ali5, Majid Hussain6, Muhammad Masoom ul Hassan Rehan7, Muhammad Mudassar Shahzad1,8, Anam Khalid1 and Danish Riaz1
...ffects of MOLM on growth performance and nutrient digestibility in L. rohita fingerlings. MOLM was added in the diet by replacing fish meal at the levels of 0%, 10%, 20%, 30% and 40%. Triplicate tanks were used for each treatment having 15 fingerlings. These fingerlings fed at the rate of 5% of live wet weight. Chromic oxide as an inert marker was also added in the diets. Feces from each tank were collected twice a day to estimate the nutrient digestibi...
Syed Makhdoom Hussain1,*, Nosheen Aslam2, Arshad Javid3, Shehzadi Liaquat1,Muhammad Mudassar Shahzad1, 4, Muhammad Zubair-ul-Hassan Arsalan1 and Muhammad Adnan Khalid1
...ve effect on fish growth performance. Chromic oxide (1%) was added in the diets as inert marker. It was noted that probiotics supplementation played a significant role in improving absorption of minerals, carcass composition and haematology of fish. Higher mineral digestibility (Ca 76%, Fe 62%, Zn 57%, P 76%) and carcass composition (crude protein 17% and crude fat 10%) was found in fish fed on 3 gKg-1 level of probiotics supplemented canola meal ba...
Qaisar Jamal1, Muhammad Idrees1, Saif Ullah2, Muhammad Adnan1, Farrah Zaidi1, Qaiser Zaman1,3 and Syed Basit Rasheed1,*
...>r Dir.
...
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Shehla Gul Bokhari1, Ikramul Haq1,*, Imdad Ullah Khan3, Naimat Ullah4, Naimat Ullah Khan4, Kashif Hussain1 and Azmat Ullah Khan2
...thogenic strains of Type D Clostridiumperfringens strains and evaluate its immune responses in rabbits, goats and sheep. C. perfringens were isolated from enterotoxaemia suspected sheep and goats from the endemic areas of Khyber Pakhtunkhwa Province, Pakistan during 2016. The isolates were initially identified through colony characte...
Muhammad Shahid Saeed1, Adeela Shahid2, Samia Jawed3, Muhammad Akram4, Irshad Hussain Qureshi5
...emergency department was performed by Spirolab III. Detailed history, general physical and systemic examination was conducted and all parameters were recorded. Modified Borg scale was used to determine the grade of dyspnea from 0-10. A total of 2ml of venous blood was taken to determine the serum magnesium levels. All patients were given Salbutamol inhalation and intravenous (I/V) Hydrocortisone. The study group was given 2gm of MgS04 intraveno...
Sadaf Noveen1*, Shaista Habib Ullah2, Babar Alam3
...al cavity is to produce speech sounds for verbal communication along with performance of its primary functions. Its defects can decrease intelligibility of speech while affecting production of phonemes. Description of this relationship is important for etiologic diagnosis and treatment planning among children without any disability or ignored craniofacial deformities. Studies highlighting ...
Kaleem Ullah1, Zafar Niaz2, Sami Ullah Mumtaz3, Sajid Abaidullah4*
...0.6±4.6. The mean peak mitral filling velocity of the patients was 69.8±15.9 cm/s. The mean peak mitral filling rate of the patients was 57.2±30.9 cm/s and mean E/A ratio was 1.3±0.3. The mean iso-volumetric relaxation time of the patients was 84.2±14.7 msec. The mean mitral E deceleration time of the patients was 187.4±25.1 msec. The mean atrial flow reversal was 0.28±0.04. T...
Riffat Mehboob1*, Shahida Perveen2, Naseer Ahmed3
...tudy was to analyze the spectrum of BBD in a tertiary care hospital of Lahore to understand the prevalence of inflammatory lesions, benign neoplasms and their age-wise comparison.
Methodology: The study was carried out at Pathology Department, King Edward Medical University, Lahore. Data of 368 cases of BBD during a time span of 3 years (2011-2014) was obtained retrospectively.
Results...
Nasreen Ishaq1, Arif Rasheed Malik2, Zameer Ahmad1, Saad Ehsan Ullah3
...manity, which formulates personal identity. Forensic medicine is basically the science of identification and during last few decades multiple research work has been conducted for detection of different methods of identification to establish a baseline of identity e.g. dental data, fingerprinting, DNA analysis, anthropometry, identification of sex, assessment of age, determination of height and blood groups identification. Among these, DNA analysis and dental d...
Ghulam Abbas1, Muhammad Jawad Asghar1, Muhammad Rizwan2*, Muhammad Akram1, Jaffar Hussain1 and Fiaz Ahmad1
...s diverse mungbean genotypes were evaluated for seed yield and other related traits. The genetic analysis of mungbean germplasm revealed high genotypic (GCV) and phenotypic (PCV) coefficients of variability for biological yield (GCV% = 31.70, PCV% = 33.58), harvest index (GCV% = 27.80, PCV% = 30.16) and seed yield (GCV% = 25.28, PCV% = 27.54). While heritability estimates were high for all the traits except days to maturity and clusters <...
Abdul Basit1, Muhammad Zeeshan Majeed1,4*, Sohail Ahmed2, Gohar Ali2 and Muhammad Javaid3
... (Coquillett) is the key pest of M. charantia and other cucurbitaceous vegetables incurring 30 to 100% crop loss. This study evaluated the use of refractive color sheets on fruit fly incidence and infestation on bitter gourd plants and compared it with reduced-risk insecticide formulations of spinosad. Refractive sheets of red, orange, yellow, green, blue, black and white were installed in M. charantia beds at three different angles (30º, 60º and 90&...
Abdul Wajid1,*, Asma Basharat2, Muhammad Akbar Shahid3, Sidra Tul Muntaha1, Abdul Basit4, Tanveer Hussain5, Muhammad Farooq Tahir6, Muhammad Azhar7, Masroor Ellahi Babar1 and Shafqat Fatima Rehmani2
...hepatitis (IBH) and hydropericardium syndrome (HPS) in chickens worldwide. Identification of fowl adenovirus (FAdV) serotype is of most importance in epidemiological studies of disease outbreak and the adaptation of vaccine strategies. In spite of appropriate administration of vaccination, FAdV outbreaks have been reported and caused significant losses in poultry flocks throughout Pakistan in recent years. To identify the se...
Fangxiao Dong1,2, Xuan Luo1,2, Delu Yuan1,2, Aixin Liang1,2* and Liguo Yang1,2*
... still unsatisfactory, especially in large animals. The present study aimed to investigate whether tissue plasminogen activator (tPA) could be applied as signal peptide for enhancing the effect of somatostatin DNA vaccine. A novel recombinant plasmid pEGS/2SS-tPA encoding two copies of somatostatin genes fused to tPA signal sequence was succesfully constructed and identified in MCF-7 cells. Subsequently, thirty...
Muhammad Rehan Aslam1, Muhammad Maqsood1, Zahoor Ahmad2*, Sajjad Akhtar3, Muhammad Rizwan4 and Muhammad Usama Hameed5
....38 g), number of grains per cob (472.49), 1000-grains weight (265.99 g), biological yield (13.08 t ha-1), grain yield (5.05 t ha-1), harvest index (38.43%), grain protein contents (8.09%) and grain oil contents (4.76%) were obtained when two foliar sprays of 0.5% MgSO4 (T2) were applied. Similarly, highest cob weight without sheath (258 g), number of grains per cob (475.1), 1000-grains weight (272.5 g), biological yield (13...
Malik Muhammad Yousaf1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahmed1, Muhammad Zeshan1,2, Muhammad Mohsin Raza1 and Kazim Ali2
...n clay loam soil. This experiment was laid out in randomized complete block design. Data on plant height, branches per plant, capsules per plant, number of seeds per capsule and yield was taken into account at maturity and statistically analyzed. All yield contributing traits showed positive response with increase in fertilizer rate. Maximum yield was fo...
Rizwana Qamar1, Maria Ghias1, Fida Hussain1, Sajida Habib1, Muhammad Khuram Razzaq2*, Muhammad Aslam1 and Imran Habib3
...re the effective and inexpensive approach by plant breeders to manage with drought. A wire house experiment was conducted in Oilseeds Research Institute, Ayub Agricultural Research Faisalabad for the screening of genotypes against drought. Ten hybrids along with their 13 parental inbred lines were grown in polythene bags following factorial structured completely randomized design by three ...
Ayesha Iftikhar1,*, Muhammad Asif Aziz1, Muhammad Naeem1, Munir Ahmad1 and Tariq Mukhtar2
...tanding the effect of temperature variations on its demography and predation rate is necessary to predict the population dynamics of this beetle against cotton mealy bug. Age-stage, two sex life tables of zigzag beetle were constructed at three different temperature regimes: 24 ± 0.5 °C and 27 ± 0.5 °C with 60-70% R.H. and ambient condition (32 ± 4 °C; 16-50% R.H.) with 14:10 h (L:D) photo
Muhammad Fiaz1*, Muhammad Afzal1 and Muhammad Zeeshan Majeed1,2
...align: justify;">Combing pesticides with different modes of action is a crucial component of pest management strategies. In this study, field efficacy of spirotetramat and Isaria fumosorosea formulations was assessed in spring 2016 and 2017 against Asian citrus psyllid Diaphorina citri, one of the economic insect pests of citrus plants and a putative vector of Huanglongbing worldwide. Trea...
Komal Mushtaq1, Shoaib Waqas2*, Hafiz Muhammad Asim3
...iplinary team approach especially physiotherapy and rehabilitation. In this study, effectiveness of spinal manual therapy (maitland grade I and II mobilization) for CLBP management was assessed.
Methods: All subjects in the study were provided maitland grade I and II spinal mobilization for 20 minutes each. A similar treatment frequency was applied and consisted on three sessions per week for 2 continuous ...
Masood Nizam Tabassum1*, Muhammad Ather Khan2, Saira Afzal3, Amir Gilani4, Abdul Wahab Gureja5, ShafaqTabassum6
... was 27 and 15 years, respectively. The most common age group was 15-24 years that comprised of 473(42.23%) of the cases. A total of 529(47.23%) patients were male and 591(52.77%) were female in this study. In male and female cases, frequency of cases was decreased as age increased. Both male and female cases had almost similar distribution of age. There were 830(74.11%) cases those belonged to Lahore while 25.895% were from other cities. Approximately 48...
Sukirno Sukirno1,2, Muhammad Tufail1,3,*, Khawaja Ghulam Rasool1, Said El Salamouny1, 4, Koko Dwi Sutanto1 and Abdulrahman Saad Aldawood1
...l agents of several crop pests, however, their activity is deteriorated rapidly when exposed to the sunlight. Many UV protectants were used to improve the efficacy of these viruses under field conditions. The objective of the current study was to evaluate the effectiveness of plant extracts to improve the persistence of Spodoptera littoralis multiple nucleopolyhedrovirus (SpliMNPV) against beet army worm, Sp...
Yan Li1, Kai Zhan1,*, Junying Li1, Wei Liu1, Ruiyu Ma1, Shengnan Liu1, Haijun Cui1 and Xin Zhang2
...declawed males on laying performances, egg quality characteristics and feather cover of layer breeders in the mating cage. Ninety-six 230-day-old Hy-line Brown roosters were randomly split into four groups. Group 1 chicks served as intact control. Trimming of claw of group 2 chicks was performed by the method of partial amputation of the third toe (along the distal phalanx) at day of hatch; the first and third toes were decl...
Saeed Ullah1, Amanullah Jan1, Murad Ali2*, Wiqar Ahmad3, Hafeez Ur Rehman2, Muhammad Ishaq2 and Bilal Ahmad2
...cast and banding on chickpea growth and yield during winter 2013-14 at the New Developmental Farm, The University of Agriculture, Peshawar. The experiment was carried out by following randomized complete block design procedure replicated four times. Pods number plant-1 (PN), grain yield (GY) biological yield (BY), and harvest index (HI) were significantly increased by 9, 4, 23 and 8%, respe
Doğan Türkyılmaz1,*, Selçuk Özyürek2,Nurinisa Esenbuğa1 and Mustafa Yaprak1
...ents of milk and udder type and to correlations between udder measurements and milk components in Morkaraman, Tuj and Awassi sheep. Milk components are investigated in order to determination of milk quality. The main components of milk are fat, solid non-fat, density, protein, lactose and ash. Density of the milk is expressed in kg/m3 and the other components are in percent. Fat, solid non-fat, density, protein, l...
Amna Waseem, Sikander Ali* and Syeda Wajiha Khalid
... mutant strain developed by chemical mutagenesis. The wild-type was simultaneously treated with different concentration of EMS and MMS. Among 13 mutant variants, EM-7 showing maximum lipase activity of 71±3.55 U/g, was selected. Resistance in the hyper producing strain was developed by exposing it with low levels of L-cysteine HCl to protect i...
Wasim Javaid1, Farid Asif Shaheen1*, Farah Naz2 and Muhammad Usman Raja2
...spores/ml in stored chickpea grains. Highest mortality (90%) of PB was observed in 72 hours through application of 1×108spores/ml of M. anisopliae compared to B. bassiana with 60% mortality. On 24 hours of exposure, minimum mortality (4%) in PB was recorded in grains treated with 1×106 spores/ml of B. bassiana. In M. anisopliae, the concentrations of 1×108 after 24 hours, 1×107 after 48 hours and 1×107 after 72 hours showed signif...
Tanzim Ullah Khan1*, Mohammad Tariq Jan1, Ahmad Khan1, Gulzar Ahmad2, Muhammad Ishaq2, Khilwat Afridi2, Murad Ali2, Muhammad Adeel Qureshi2, Imtiaz Ahmad3 and Muhammad Saeed2
...), more number of grains per spike (43), thousand grains weight (48.85 g), biological yield (7147 kg ha-1), grain yield (2701 kg ha-1) and harvest index (37.82%) resulted from split application of inorganic N in comparison to both early and late full applications. Thus, the use of 100 kg N ha-1 as half at sowing and half at boot stage with poultry manure incorporation is recommended for improving growth, yield and yield components of wheat. ...
Imadud Din1*, Fazal Munsif1, Irfan Ahmad Shah3, Hamayoon Khan1, Fahad Ullah Khan1, Ibrarullah2, Shahab Uddin4 and Tauqir Islam1
...ur different wheat genotypes for morphological traits and yield components. The experiment was laid out in randomized complete block (RCB) design having three replications. Components of variation, broad sense heritability, genotypic coefficient of variation (GCV), phenotypic coefficient of variation (PCV), range and genetic advance were estimated for yield and yield associated traits. Results revealed significant variation ...
Muhammad Shoaib Saleem*, Muhammad Faheem Akbar, Amjad Sultan and Saqib Ali
...was carried out in the experimental field of Department of Agriculture and Agribusiness Management, University of Karachi to evaluate the efficacy of Neonicotinoids and Insect growth Regulators (IGRs) against jassid (Amrasca devastans Dist.) on eggplant crop. The crops were grown in a Randomized Complete Block Design (RCBD) with three replications, each have five treatments inclusive of control. The recommended doses of Nitenpyram, Clothianidin, Momentum (comb...
Syed Muhammad Hassan Raza1*, Syed Amer Mahmood1, Veraldo Liesenberg2 and Syed Shehzad Hassan1
...iotemporal changes in temperature are a main cause for a shift in crop phenology as well as failure of crop calendar. Yellow stem borer (YSB) is an insect pest of rice crop that may reduce rice yield about 20% due to the use of insecticide at inappropriate times and unsuitable locations following the crop calendar. The purpose of this research was to delineate the vulnerable zones for YSB attacks on rice crop using satellite...
Muhammad Shaheer1*, Asad Aslam Khan2, Nasir Ahmed3, Tehseen Mahmood Mahju4, Ummarah Rasheed5
... RNFL thickness. OCT was performed by researchers and findings were recorded accordingly. The retinal nerve fiber layer thickness was measured in superior, inferior halves and total average thickness. Pre- and post-injection OCT were conduced and macular thickness were documented.
Results:The mean retinal nerve fiber layer thickness was decreased in superior and inferior...
Naveed Akhtar1, Humaira Zareen2* and Rubina Sarmad3
...utritional status of any person. Modification of these habits in the adolescent period can prevent malnutrition resulting in prevention of many non-communicable diseases. Additionally, with best eating habits female doctors can be a role model for their patients.
Objectives: This study was designed to access the dietary habits, nutritional status and their association in young adolescent female medical stu...
Fouzia Hadi Ali1, Farhat Naz2, Aban Abid Qazi3
...v>Abstract | Work performance (WP) in the healthcare sector has hither to remained an underexplored area of research. Despite the fact that the implications of WP in the healthcare sector context are far more expensive for both doctors and hospitals, the predictors of WP among the healthcare practitioners appear to have contextual nuances. One of the significant factors and increasi...
Maaz Ahmad1*, Mussab Ahmad2 and Tehreem Munir3
...ract | Functional dyspepsia (FD) is a set of relapsing or chronic dyspeptic symptoms in the absence of structural organic lesions. Approximately 15-20% of the general population in many developed countries suffers from dyspeptic symptoms at any time in a year, whereas in Pakistan, 14-22 % of general population suffers from FD.
Ob...
Taimoor Akram Khan1*, Anam Farooq2, Amna Farooq3, Muhammad Nasir1, Gohar Khan4 and Ali Akram Khan1
...ent (OPD) database retrospectively in order to determine the age, gender and organ system wise distribution of various diseases. Secondary data was collected from standard OPD register in which all patients that presented in the outpatient department of the facility during a period of 6 months from 1st January, 2017 to 30th June, 2017 were included and no patient was excluded.
Results:
Rana Khurram Aftab1*, Farhat Ijaz2, Samia Jawed3
...ip between obesity and hypertension has long been recognized. Overweight and obesity are disorders of balance of energy affecting people of various ethnic groups, age and socio–economic statuses. It has been found that obesity is closely associated and correlated with hypertension. Preventive strategies for obesity may offer a cost-effective approach towards lowering blood pressure.<...
Farhat Ijaz1, Rana Khurram Aftab2*, Samia Jawed3
...
Abstract | Type 2 diabetes mellitus (T2DM) and insulin resistance (IR) are linked to each other. Obesity and T2DM are states of low-grade chronic inflammation, which result in increased levels of inflammatory markers such as C-reactive protein (CRP), interleukins 6 (1L-6) and tumor necrosis factor alpha (TNF-α). Relation of TNF-α with obesity induced IR and T2DM is unclear as results obtained from different studies are very controversia...
Muhammad Kashif Munir1*, Sana Rehman1, Rizwan Iqbal1, Muhammad Saqib Saeed2, Muhammad Aasim1
...apid detection of such type of tuberculosis is necessary for timely control of the disease. GeneXpert test has already been implemented by World Health Organization to diagnose the infection on urgent basis.
Objectives: This study was designed to apply GeneXpert MTB/RIF assays for the detection of rifampicin resistant tuberculosis and validation of assays by comparing wi...
Quratul Ain Tahira1*, Sidrah Lodhi1 and Sajid Abaidullah2
...inal (FT) tests where FT pertained to six cognitive domains. Statistical testing for IRAT and FT scores and performance in early and advanced domains were performed taking p-value < 0.05 as significant.
Results: A total of 53 RDs including 58.49% HOs and 41.51% PGRs participated in the study with similar distribution among mTBL and LBL groups. The mean IRAT scores for...
Sahar Naz1, Farhan Rasheed2, Muhammad Saeed3*, Shagufta Iram4 and Ambereen Anwar Imran5
...possess significant therapeutic challenges.
Objective: This study was carried outto evaluate the efficacy of Colistin against MβL producers.
Material and Methods: This cross-sectional study was conducted in Microbiology Laboratory,Allama Iqbal Medical College,Lahore, Pakistan from 1stJuly 2016 to 25th February 2017. A total of 12126 clinical samples were collected from patients presenting to Jinn...
Munir Ahmad1, Aisha Hameed2*, Saba Khaliq3, Hamid Saeed Malik4 and Shahida Mohsin5
...alignancies in the developed countries. Numerous chromosomal aberrations have been observed in ALL including translocations which result in the production of fusion genes (BCR-ABL, TEL-AML1, and MLL-AF4). These chromosomal rearrangements have great prognostic and therapeutic significance. Amongst these, TEL-AML1 fusion gene represents a subgroup of ALL cases, which are associated with many clinically important paramet...
Zartasha Anjum1*, Rakhshindah Bajwa2 and Munazza Hassan3
...rted the anti-tumoral properties of statins by exhibiting anti-proliferative properties in HMG-CoAR positive breast carcinomas. Increased efficacy has also been observed when these were used as combination therapy along with tamoxifen in estrogen receptor (ER) and HMG-COAR positive breast carcinomas. However, in our local population, expression of HMG-COAR is not investigated. The objective of our study was to examine the ex...
Muhammad Nusrullah*1, Muhammad Younus2 and Yasir Nasir3
...(p-value <0.0001), respectively.
Conclusion: A strong correlation was found among ABG’s and VBGs in patients presenting with COPD.
...
Faisal Masood*1, Ranjit Kumar Sah2 and Ahmad Humayun Sarfaraz3
... of closed reduction and percutaneous pinning (CRPCP) in management of volar Barton’s fracture by Faisal Technique.
Methods: A total of 10 cases of volar Barton’s fracture fulfilling our inclusion and exclusion criteria were included in our study from August 2015 to August 2016. These cases, presented at our department, were managed with closed reduction under image intensifier by dorsiflexing the wrist and reducing the fragment ...
Shumaila Irum1, Muhammad Zafar Iqbal*2 and Fatima Naumeri3
...al environment heavily depends upon benefits to learners and this further facilitates the learning processing. The most commonly used tool, to measure it, is Dundee Ready Educational Environment Measure (DREEM).
Objective: This study was designed to evaluate the perceptions of medical students in pre-clinical years about educational environment in a public sector medical college of Pakistan and to compare ...
Naveed Rashid*1, Muhammad Aamer2, Uzma Malik3, Nimra Arif4, Muhammad Waqar Akram5 and Ayesha Irshad6
...e and practice in some aspects of the of the AVF care. Knowledge scores when compared between different age groups, greater proportion of patients between age of 45-65 (p<0.017) possessed good knowledge as compared to age groups of 25-45, 65-85 years.
Conclusion: Despite good understanding and adequate attitude, few practices were not being followed in parallel to the knowledge acquisition. Therefore, regular reminder and
Muhammad Younus1*, Sabah Usman2 and Samia Jawed3
... of all the subjects was performed on Spirolab iii. Correlation between FVC, FEV1, FEV1/ FVC ratio and body mass index, waist circumference, and waist to hip ratio was measured by Pearson coefficient. A p value <0.05 was considered as significant.
Results: In this study mean age of subjects was 28.92 ± 6.34 years. The mean FVC in obese cases was 3.18 ± 0.92 L and in non-obese cases was 3.68 ± 0.93 L with p value...
Mumtaz Akhtar, Iffat Naheed, Khadija Waheed* and Amna Khanum
... after administration of per rectal misoprostol in females undergoing normal vaginal delivery. The study was conducted at the Department of Obstetrics and Gynaecology, Teaching Hospital, Lahore from 02-09-2014 to 03-03-2015. Non-probability and purposive sampling techniques were used. A total of 220patients undergoing normal vaginal delivery at term after administration of per rectal misoprostol were enrolled with 95% confid...
Muhammad Anwar Iqbal1, Habib Rehman2, Ali Hussain3,*, Faiza Jabeen4, Ijaz Ahmad2, Kamran Ashraf5, Muhammad Irshad Arshad6 and Omaima Khan7
...5 days to the birds of experimental groups, B, C and D, respectively. Results showed that the birds of group C were heavier (P < 0.05) during 2nd and 3rd weeks compared to the other groups. Feed conversion ratio was not affected by the dietary supplementation except on week 2, which was more (P < 0.05) in the group B liken with the group A. Birds of group B had higher relative weights of liver (P =...
Bo Wu1, Hui Zhang2, Kun Li2, Khalid Mehmood2,7, Yan Zhao1, Bin Jiang1, Chengjun Xue3, Muhammad Tariq Javed6, Fazul Nabi2, Zhaoqing Han5,* and Houqiang Luo4,*
...am optimization of serotype O of FMD through ELISA and IHA in pigs in Zhejiang. A total of 368 serum samples were collected from June to July in 2016. Out of these samples, 23 (6.79%, 95% CI 4.4-9.9) pigs were found positive for FMD antibodies with the further distribution of 9.09% (95% CI 4.6–15.7), 6.90% (95% CI 2.6–14.4), 5.49%, (95% CI 1.8-12.4) and 4.35% (95% CI 0.9-12.2) from Wenzhou, Lishui, Jinhua and Ningbo counties, res
Ayesha Noreen1, Dilara A. Bukhari2 and Abdul Rehman1,*
...div>The reactive oxygen species (ROS) can be generated by intake of environmental pollutants, smoke, tobacco, xenobiotic, drugs, medical materials, radiations, pesticides, industrial solvents and ozone. The processes running in the cell membranes, peroxisomes, mitochondria and endoplasmic reticulum also generate ROS. ROS can be activated by numerous external factors, and play an important ...
S. Jalbani1, N. T. Narejo2,*, P. Khan2 and Y.M. Jalbani3
...nt plasma viscosity and specific gravity of the erythrocyte is responsible for different ESR values.
...
Maryam Javed*, Farwa Saghir, Naveera Aziz, Maham Saeed, Asif Nadeem and Wasim Shehzad
...territory protection, competition for resources like water, food, offspring and mating probabilities. It is an antisocial behavior having strong genetic relation. Current study focused mainly on the screening of genetic marker V158M located in COMT gene for its relation to physical aggression in the four domestic bovine species of Pakistan, which are normally less aggressive. Selected animal spe
Xia Lin Zheng1, Zhen Hua Xian1, Zhen De Yang2, Xiu Hao Yang3 and Wen Lu1,*
...>Damaging effect of two species of gall midges (Diptera: Cecidomyiidae) have been investigated on Castanopsis hystrix Miq. (Fagales: Fagaceae) in Pubei County of Guangxi, China were investigated from December 2012 to December 2013. Jaapiella sp. damaged leaves, while Contarinia sp. damaged stems and leafstalks. The damage ratio and the index of Jaapiella sp. in December 2012, March, July and December 2013 were 9.7±2.0%, 14.8&...
Irshad Ali1, Mohammad Masood Tariq2,*, Abdul Waheed2, Ferhet Abbas Yousafzai1, Farhat Abbas Bokhari1, Majed Rafeeq1, Muhammad Ali1, Muhammad Adnan Attique1, Shahid Amin3 and Tahir Hameed1
...e data on morphology and performance of 1020 Bhag Nari (BN) cattle were collected from Bhag Nari cattle Farm, Usta Mohammad Baluchistan during 2015-16 and its surrounding areas. Some distinct characteristics have been found exclusively in Bhag Nari breed. These characters are rare in other local breeds of the area such as tick resistance, tolerance against > 50oC temperature in the hot weather nevertheless stil...
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
... k-CN band only appeared in buffalo’s milk. The αS2-CN was found to be absent in camel milk whereas merged in buffalo and sheep with αS1-CN. Electophoretic mobility of αS1-CN in goat and sheep milk was higher than buffalo milk. Examining the SDS-PAGE of whey proteins of these species, β-Lg was found to be the major protein in sheep and buffalo milks, while ...
Azmat Hayat Khan Khattak1, Muhammad Nauman ul Islam1, Muhammad Shakir Khan1, Muhammad Iqbal1, Imtiaz Ali Shah1,Sheeraz Ghani1, Amjad Ali2, Zubina Hameed1, Mohammad Farooque Hassan3 and Tariq Ali1,3,*
... to compare their growth performance and economics. The experiment was performed at Livestock Research and Development Station (LR&DS), Surezai, Peshawar for a period of 12 weeks. The calves were fed with milk replacer (10% of their live body weight) in two equal doses, one in the morning followed by an evening dose, until the end of 8th w...
Ansar Ahmed Abbasi1,*, Kathrin Blasius2-4, Imtiaz Ahmed6, Hao Hu7, Sylvie Picker-Minh2-4,8, Muhammad Nasim Khan5, Khalid Hameed1, Aneela Gulnaz1, Zahid Latif5, Abdul Rauf5 and Angela M. Kaindl2-4,8
...in volume that affects especially the neocortex, and intellectual disability. To date 17 genes have been linked with this disease. Biallelic mutations in the abnormal spindle-like, microcephaly associated gene ASPM causes MCPH type 5, the most common MCPH subtype. In the current study we recruited two families from Sialkot region of Pakistan which were assessed by whole exome sequen...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1, Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
...a cluster of six member species. However, literature is not available regarding the causative agents of CCPP in sheep and goats in Northern Pakistan. The current study was thus aimed to identify relative abundance of members of MM in small ruminants suspected of CCPP in Northern region of Pakistan. A total of 300 samples, (150 sheep and 150 goats) were randomly collected from nasal discharge, pleural fluid and lung tissues, ...
Jahangir khan* and Abbas Ullah Jan
...s willingness to pay for pesticides-free fresh fruits, produced locally, such as Apple. For data collection, a sample of 200 households was randomly selected from urban and rural region of Peshawar district of Khyber Pakhtunkhwa Province. Sampled households were interviewed face to face. An open-ended CVM question was designed to elicit households’ willingness to pay (WTP) and a linear regression analysis conducted to ...
Laiba Shafique1,*, Muhammad Afzal1, Syed Zakir Hussain Shah2, Mehroze Fatima3, Huma Naz4, Qaisra Saddique1
... fingerlings. Five experimental diets were prepared containing organic acid (0%), malic acid (2%), citric acid (2%), formic acid (2%), lactic acid (2%) and designed as “OA1, OA2, OA3, OA4 and OA5”, respectively. Eight weeks experimental trail were performed. Water quality characterist...
Rafa Almeer1,*, A. Alqarni1,2, S. Alqattan3, S. Abdi4,*, S. Alarifi1, Z.Hassan5 and A. Semlali6
...ed for its anticancer properties. However, its mechanism of action remains unclear. The present study evaluated the effect of two varieties of natural honey (Sidr and Wild) on a human breast adenocarcinoma (MDA-MB-231) cell line. The MDA-MB-231 cell lines were treated with Sidr honey (H1) and Wild honey (H2) for 6, 24, or 48 h followed by cell morphology evaluation. Cell viability was examined by MTT assay and gene expression of three tissue inhibitors of meta...
Abdur Rehman and Zahir Shah
...d and nutrient uptake of pea [Pisum sativum L.] under silt-loam alkaline soil conditions. Treatments were arranged in randomized complete block design (RCBD) with three replications. The required Fe and Mo as [(NH4)6Mo7O244H2O] and FeSO4.7H2O respectively were applied to soil followed by thorough mixing before sowing. Both Fe and Mo induced significant increases in fresh pods pea yield and...
Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla3
...ign: justify;">Peste des petits ruminants (PPR) is an endemic disease in Hail, Saudi Arabia where outbreaks are regularly reported. This study was carried out to analyze nucleoprotein (N) gene of PPRV from fatal infections in small ruminants. For this purpose, RNA was extracted from suspected animal samples (n=18) and were screened by real time-PCR. Additionally, to assess the phylogenomics, the N gene was amplified and sequ...
Matiyar Rahaman Khan1,*, Sabayasachi Pal2, Amit Singh2, Ashok Dhananjaybhai Patel3, Bhagubhai Ambaram Patel3, Tushar Manohar Ghule2 and Victor Phani1
...corded and the nematode species was authentically identified as Meloidogyne indica Whitehead, 1968 which was first time described on citrus from Delhi, India. The species is further characterized based on detailed morphological, morphometric descriptions and beta-esterase phenotyping. The present study elucidated information on M. indica for its easy detection, diagnosis, dimension of damages on citrus, and Bt-...
G. Venkatesan* and Amit Kumar
...ir products. Unique and specific virulence genes located at termini of ORFV genome with their encoded products are attributed to host immune evasion, short-term immunity both in natural infection post-vaccination in target species and repeated host susceptibility. However, these genes are variable among ORFV isolates/strains as they are not located in central part of genome and some of the...
Mudassar Javed1,Muhammad Zeeshan Majeed1,*, Muhammad Sufyan1, Sajjad Ali2 and Muhammad Afzal1
...r, okra production is hampered by the incidence of many insect pests. Particularly, okra shoot and fruit borer (Earias vittella) and okra fruit borer (Helicoverpa armigera) cause substantial quantitative and qualitative losses to okra crop. In this study, 18 pesticides including conventional and new-chemistry synthetic insecticides and different botanical extracts were screen...
Tanveer Hussain1,*, Masroor Ellahi Babar1, Marcos De Donato2, Abdul Wajid1, Asif Nadeem3, Zahoor Ahmad3, Waqas Ahmad Khan4, Sunday O. Peters5 and Ikhide G. Imumorin6
...in Pakistani cattle as expected, with only 26 individuals showing nucleotide changes. Only 5 point mutations were present in multiple individuals (SNP), but one was specific for indicine cattle. Two Lohani and 5 Nari Master cattle showed nucleotide changes specific to taurine cattle. Of the changes found, only three produced amino acid changes in the protein sequence. The UPGMA tree showed...
Kamran Khan1, Sarzamin Khan2, Nazir Ahmad Khan2,* and Naseer Ahmad2
...upplementation on growth performance, carcass yield and meat quality of rabbits. Sixty indigenous rabbits were divided randomly into five treatment groups. The control group was fed on standard concentrate basal diet, whereas in the treated groups, the basal diet was supplemented with low (3.5%; LCF) or high (7%; HCF) level of crushed flaxseed and low (1.5%; LFO) or high (3%; HFO) level of flaxseed oil until slaughtering (day 90). Carcass fat deposition was gr...
Rana Zeeshan Habib1, Muhammad Afzal1, Syed Zakir Hussain Shah2,*, Mahroze Fatima3, Muhammad Bilal4 and Syed Makhdoom Hussain5
... meal based diet. Nine experimental diets were prepared by supplementing CA (%) and PHY (FTU/kg) at the level of 0, 0 (control); 0, 1000; 0, 2000; 1.5, 0; 1.5, 1000; 1.5, 2000; 3, 0; 3, 1000; 3, 2000 respectively. Chromic oxide was used as inert marker in diets to estimate mineral digestibility. Fish fed on PHY supplemented diet showed higher apparent digestibility coefficient (ADC%) of Ca, P, Na, K, Mg, Fe, Cu, Mn, Zn. Simi...
Wang-Dui Basang1, Tian-Wu An2, Luo-Bu Danjiu3, Yan-Bin Zhu1, Shi-Cheng He3, Xiao-Lin Luo2, Wei-Wei Ni4, Xiao Wang4, Shu-Zhu Cheng4, Jian Wang4 and Guang-Xin E4,*
...mportant for the Tibetan people. In this study, we investigated the diversity and phylogeography of four geographic ecotype populations of the Naqu yak (133 individuals) using an 811-bp mitochondrial DNA D-loop region sequence. In total, 57 polymorphic sites, including 54 single-nucleotide polymorphisms and 3 single-nucleotide copy number variants, and 59 haplotypes were detected. The numb...
Riaz Aziz Minhas1,*, Muhammad Nasim Khan1, Muhammad Siddique Awan1, Basharat Ahmad1, Syda Shaista Bibi1, Mohsin Hanif1 and Afsar Mian2
...ese monkeys might have experienced a genetic isolation or inbreeding. We assessed the level of genetic diversity and genetic isolation of different langur populations using Randomly Amplified Polymorphic DNA (RAPD) genetic markers. We collected 86 different samples (feces 64, hair 13, blood 5, tissues 4) from 5 geographic langur populations of Pakistan and Azad Jammu and Kashmir (AJK) and succeeded in extraction of DNA from 23 samples, which were used for furt...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
...ot-knot nematodes, one repelled nematodes, and two were neutral. The attraction intensity was directly proportional to time and based on the nutrients provided by the nematodes. In this experiment, the nematophagous fungi Arthrobotrys oligospora, A. superba, A. musiformis, Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata, Lecanicillium muscarium,
Jingen Xu1, Yang Liu2, Erhui Jin1, Youfang Gu1, Qin Zhang3 and Shenghe Li1,*
...hire pigs with different peripheral blood T lymphocyte subsets. The results showed that 2050 differentially expressed transcripts were identified, with 1554 up-regulated and 496 up-regulated in high and low T lymphocyte groups, respectively. Among differentially expressed genes, IL1B, IL17F, IL6R, CXCL2, CCL20 and CCL25 were selected based on their immunological functions and CD8B and CD81 may con...
Zhu-Mei Ren1,*, Xu Su2, Carol D von Dohlen3 and Jun Wen4,1,*
... Rhus gall aphid species Nurudea zhengii Ren, sp. nov. collected from the Mountain Qixing in Shangrao County, Jiangxi Province, China is described and illustrated from alate viviparous female. The new species differs from the other Nurudea species in the length and proportion of antennal segments, the structure of antennal secondary sensilla, and the flower-like sha
Ayesha Aihetasham, Saira Shariq and Javed Iqbal Qazi*
...dentification of fungal species from cadavers of notorious subterranean termite, Heterotermes indicola. Virulence of Rhizopus stolonifer isolate and resultant variations in food consumption of H. indicola workers were evaluated over a period of one month by employing surface culture method. Following different time exposures, R. stolonifer significantly produced epozootics on the tested insects, w...
Muhammad Sarfraz*, Shahida Hasnain
...was conducted on 11,725 specimens collected from hospitalized and non-hospitalized patients from July 2013 to June 2016. API 20E system has been used to identify K. pneumoniae and E. coli; preliminary screening for AmpC beta-lactamase production was done by cefoxitin disc followed by inhibitor based confirmatory method. Antibiogram was performed following CLSI guidelines 2013. Of 11,725 clinical s
Zainab Saeed, Abdul Majid Khan*, Ayesha Iqbal, Muhammad Amin
... are described in this paper. The specimens comprise mandibular fragment and isolated teeth. The specimens are on the basis of rigorous comparison ascribed to Gazella lydekkeri, a late Miocene antelope. The Dhok Pathan Formation is late Miocene to early Pliocene in age.
...
Muhammad Khalid1,2 and Muhammad Naeem2*
...oximate analysis implies percent composition of moisture, protein, lipids and carbohydrates. The purpose of this study was to affirm the proximate composition and nutritious status of Ctenopharyngodon idella. Standardized methods were used to determine the proximate composition of 72 samples. On wet weight basis, mean percentage for water was 80.76 %, ash 3.40 %, 4.31 % for fat and 11.53 % for protein in C. idella. Percent w...
Fiaz Ahmad1, Mumtaz Hussain2, Ghulam Abbas1, Muhammad Jawad Asghar1 and Muhammad Rizwan3*
...fferent abiotic stress especially lead and water stress. Therefore, present study was conducted with the aim to investigate the response of two mungbean varieties to three different Pb2+ concentrations under two water stress conditions. Different morpho-physiological and yield traits were studied. Both varieties showed gradual reduction in morphological traits at increasing concentration of lead and water stress. Moreover, morphological traits were more severe...
Md. Abu Affan1,*, Abdulmohsin Al-Sofyani1, Adnan Jaman Turki2 and Mohammed S.B. Hariri3
...issolved oxygen (DO), temperature, salinity, pH, ammonia, turbidity, pesticides, toxins, and diseases. The study was carried out to find out the reasons of sudden fish killing. Therefore, physico-chemical and biological parameters, and postmortem, especially the gills and gut content of dead fishes were studied. The dead Tilapia tilapia (Tilapia), Chanos chano (Milkfish) and ...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
...he soil.
...
Qudsia Yousafi1,*, Muhammad Afzal2, Muhammad Aslam3 and Allah Ditta Abid4
...tacked by several insect pests, but brinjal shoot and fruit borer (BSFB), Leucinodes orbonalis G. is the most important insect pest attacking almost all the plant parts except roots. The effect of removal of BSFB infested brinjal shoots and use of light trap was studied for management of this insect pest. The study was conducted on spring sown crop during 2013 in Sahiwal, Pakitan us...
Wei Meng1,3, Tianyan Yang2,*, Yunguo Liu1, Mahmut Halik1 and Tianxiang Gao2
...ariation existed within species and the sample from Kaidu River in South Xinjiang might be a cryptic species or subspecies of G. dybowskii. The phylogenetic analyses from 12 concatenated H-strand-encoding protein genes were conducted by Neighbor-Joining method to reveal the evolutionary relationships within subfamily Schizothoracinae. Three different grades of schizothoracine fishes...
Mutassim M. Abdelrahman1,*, Ibrahim A. Alhidary1, Gamaleldin M. Suliman1,2, Abdullah H. Alyemni3, Mohamed Y. Al-Saiady3, Faisal A. Alshamiry1,Mohsen M. Alobre1 and Riyadh S. Aljumaah1
...BA (0.55 and 0.67 kg, respectively), while the kidney knob and channel fat (KKCF) was significantly lower for lambs fed TMR2. In conclusion, feeding growing lambs a total mixed ration (TMR) with around 30% NDF improve the general performance and most of the required meat quality measurement.
...
Syed Aun Muhammad1, Muhammad Soaib Said2, Shams Ur Rehman2, Muhammad Dawood2, Muneer Ahmed Qazi3 and Nighat Fatima2,*
...ffective against these superbugs and there is an urgent need for discovery of novel drugs with selective potential. In this study, we illuminate the binding mode of pimarane diterpenes (diaporthein A and diaporthein B) to the NMD-1 by molecular docking. A computational ligand-target docking approach was used to analyze structural complexes of enzyme target with diaportheins. Auto Grid model showed the most energetically favo...
Ai Guo1,2,3, Jiaguang Xiao4, Binbin Shan4, Tianxiang Gao5 and Yongdong Zhou3,*
...n C. mystus S, respectively, containing the standard metazoan set of 22 transfer RNA genes, 2 ribosomal RNA genes, 13 protein-coding genes and non-coding regions. The mitogenomes of C. mystus N and C. mystus S shared the identical structural organization and gene arrangement with those of other Coilia fishes. Both lineages of C. mystus showeda similar features in not only the strand-specifi...
Dilshad Ahmad1*, Muhammad Irfan Chani1 and Muhammad Afzal2
...tural formal credit, cropped area, labor force participating in the agriculture sector, trade openness has been quantified through various econometric approaches in the study. Autoregressive Distributed Lag (ARDL) Bound testing approach has been applied to analyze the long run cointegration among variables, obtaining annual time series data from 1973 to 2014. An empirical estimation of ARDL approach has indicated the evidenc...
Fazal Munsif1, Muhammad Zahid1, Muhammad Arif2, Kawsar Ali3 and Ijaz Ahmad1
...delay planting can be compensated by increasing the cropping intensity on same field. A field experiment was carried out during the year 2015-16 at Palatoo Research Farm of Amir Muhammad Khan Campus Mardan, The University of Agriculture Peshawar. The experiment was consisted of traditional cultivation of sugarcane both in winter season (20th September, 10th October, 30th October and 20th N...
Mohammed Al Mahish*
...-align: justify;">This paper aims to examine the effect of wage increase on the U.S. lettuce market by using Equilibrium Displacement Model. The paper estimates lettuce demand using Rotterdam demand model. The results show that the demand for lettuce is price and income inelastic, and lettuce is a necessity good. The results of the supply model show that the supply of lettuce is price inelastic, and wage increase has a negat...
Mohammed Zaki Fathy*
...ory rates, and rectal temperature were recorded. Blood samples were collected at 0, 20, 40, 80 minutes and 12 hours after administration for detection the hematological changes. Results showed that the onset, duration and total recovery times of anesthesia were 7.33±3.05 min and 3.33±1.53 min, 26.33±3.51 min and 45±3.00 min and 64±4.58 min and 86.67±6.11 min in G1 and G2 respectiv...
Raphael Olanrewaju Babatunde, Adeyemi Esther Omoniwa and Miriam Ukemenam
...walls of the classroom especially in rural areas. This research assessed how inequality in gender as it regards schooling among children affects the income as an indicator of livelihood of farming households in Kwara state, Nigeria. A sampling technique comprising of three stages was used to randomly select 200 farming households in the study area. Data were collected using questionnaire and were analyzed using the Gini-coefficient and the Ordinary Least Squar...
Shahen Shah1*, Manzoor Hussain1, Arshad Jalal1, Mohammad Sayyar Khan2, Tariq Shah1, Muhammad Ilyas1 and Muhammad Uzair3
...ell as soil health. An experiment was performed to investigate the impact of nutrients management and application time over the yield and yielding attributes of wheat at the Agronomy Research Farm in the University of Agriculture, Peshawar, Pakistan during winter 2014-15. The experiment was designed in RCBD with split plots arrangement, replicated four times. Three levels of nitrogen (N) (...
Irfan Ali Sabir1, Saeed Ahmad1*, Muhammad Nafees2, Ahmad Sattar Khan1, Maryam3 and Ishtiaq Ahmad2
...aracters and sensorial aspects. Diverse seventeen commercial and noncommercial indigenous and exotic mango varieties were selected to collect and analyze fruit morphological data under randomized complete block design (RCBD). There was significantly high fruit weight and pulp contents in ‘Kensington Pride’. Total soluble solids (TSS) were higher (21.9 B°) in ‘Chaunsa’, while, titratable acidity (TA) was lowest in ‘Lambay Alfan...
Muhammad Siddiq1*, Sahib Alam2, Hamid Ullah Shah2, Zafar Iqbal2, Kalsoom Siddiq3 and Taufeq Ahmad4
...ips were evaluated for appearance, taste, texture, color and overall acceptability. The results indicated that the highest average scores for appearance (6.90), taste (7.57), texture (8.00), color (7.67) and overall acceptability (7.56) were obtained by potato chips that were fried in 10:90% olive/palm oil blend whereas the minimum scores for the aforementioned parameters were recorded with 60:40% blend. The frying frequency...
Ansaar Ahmed1, Imtiaz Hussain2*, Ibni Amin Khalil3, Subhanulla3, Gulzar Ahmed3, Imtiaz Ahmad3 and Muhammad Imtiaz2
...nfestation, there was 30 percent lower maize grain yield with zero till planted maize in comparison with bed planting and farmer practice. Zero till drill planted wheat after maize crop had higher grain yield in comparison with mechanized bed planting and farmer practice of broadcasting in 2014-15 and 2015-16 wheat season. Because of higher maize grain yield, maize–wheat system productivity was significantly higher with bed planting and farmer practice i...
Sadiqa Begum1, Murad Khan2* and Noor Pao Khan1
...kgs. Total cost of wheat per acre in district Peshawar was more than that of district Mardan. The net revenue from per acre wheat production was high in district Peshawar as compared to district Mardan. The results revealed that all the inputs including seed, irrigation, labor, fertilizer, pesticides and tractor used in production of wheat were having positive relationship with the product...
Muhammad Amir Maqbool1*, Muhammad Aslam1, Waseem Akbar2, Muhammad Waheed Anwar3 and Ehtisham Shakeel Khokhar1
... proteins (MIPs) of chickpea (Cicer arietinum L.), barrel medic (Medicago truncatula L.) and maize (Zea mays L.) were targeted in current studies. Amino acid sequences of major intrinsic proteins of chickpea, barrel medic and maize were retrieved from NCBI database followed by BLASTP. Pairwise and multiple alignment of sequences was done by using ClustalX software, and phylogenetic trees were constructed by using MEGA5 softw...
Muhammad Haroon Hullio1,4, Abdul Ghani Lanjar2, Abdul Rahman Dhuyo3, Imran Khattri4 and Agha Mushtaque Ahmed4*
...y;">White-backed planthopper (WBPH) Sogatella furcifera is one of the most important insect pests of rice throughout the Asia. The recent abundance of pest in Pakistan is in ascending order that requires high attention. Therefore, this study was designed to observe the emerging suitation of WBPH in Sindh province which is the main stack holding area of rice. Three different ecological zone...
Amino Acid and Fatty Acid Composition of Freshwater Mussels, Anodonta pseudodopsis and Unio tigridis
Hülya Şereflişan and Beyza Ersoy Altun*
...is (8.63%, 0.77%, respectively), whereas the situation was vise versa for fatty acid compositions. The proportions of Omega-3 (n3) were higher than those of Omega-6 (n6) in both of the mussels. n6/n3 ratio, which was 0.90 for A. pseudodopsis and 0.99 for U. tigridis, is an index for comparing the relative nutritional value of seafood oil.Leucine and lysine were the most important proportions of the essential amino ...
Azmat Hayat Khan Khattak1, Abdul Wasay2, Tariq Ali1,*, Muhammad Iqbal1, Khisrao Kalim1, Mohammad Farooque Hassan3, Muhammad Mobashar2, Nazir Ahmad2, Abid Iqbal2 and Muhammad Nauman ul Islam1
...aning ages on the growth performance of cattle calves to reduce ECM. Nine calves (Achai crossed Jersey) were randomly distributed into three weaning age groups viz., A = 90, B = 70, and C = 110 days. In group A, calves were fed with whole milk at 10% of live body weight (LBW) for 4-7 days after initial colostrum feeding at 10% of LBW. From 8-30 days they received milk at 10% LBW + calf starter ration (CSR). During 31 to 63 days, milk at 10% LBW + CSR + ...
Safia Rehman1, Nazish Mazhar Ali1,*, Gerald B. Pier2, Iram Liaqat1 and Bushra Mazhar1
...elected antibiotics (meropenem, imipenem, piperacillin, amoxicillin, amikacin, gentamicin, tobramycin, kanamycin, clarithromycin, clarithromycin, cefepime, cefixime, levofloxacin, and ciprofloxacin), Lactobacillus strains and metal nanoparticles (copper, ferric and zinc). P. aeruginosa isolates showed in vitro resistance against 11 o...
Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3,*
...e mito-genomes of three species (O. lacepedii, O. rebecca and Odontamblyopus sp.) were sequenced, their genomic structure examined, and their genome organization, arrangement and codon usage analyzed. Phylogenetic Bayesian and ML analyses were conducted, using a concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenom...
Habib-ur-Rehman1*, Saima Mirza1*, Mansoor-ul-Hasan2, Qurban Ali3, Hafiz Abdullah Shakir4, Muhammad Yasir5
... aimed to evaluate the repellent potential of Ricinus communis (L.), Jatropha curcas (L.) and Citrus paradise (MACF.) against Tribolium castaneum (Herbst). Plant materials (50 g powders of each of the plant was extracted on rotary shaker using four solvents viz.; methanol, chloroform, petroleum ether and n-hexane separately. Periodic analysis for the repe...
Farah Rauf Shakoori1,*, Tanzeela Riaz2, Uzma Ramzan1, Anum Feroz1 and Abdul Rauf Shakoori2,3,*
...larvae of a stored grain pest, Trogoderma granarium. The LC50 values of esfenvalerate for 4th and 6th instar larvae of Phosphine and deltamethrin-susceptible population was 34.29 and 28.05ppm, respectively, while 39.30 and 32.67ppm were for the 4th and 6th instar larvae of Phosphine and deltamethrin-tolerant population, respecti...
Hafiz Manzoor Ahmad1,*, Hamad Bin Rashid1, Muhammad Arif Khan1, Asim Khalid Mahmood1, Muhammad Ijaz1, Shahid Hussain Farooqi1, Muhammad Rafi Ullah2 and Usman Ghani1
...of 20 ducks presented at pet center University of Veterinary and Animal Sciences Lahore were divided into 2 equal groups each carrying 10 birds. The birds were monitored for various physiological parameters before and after anesthesia. The birds of K+X group were given ketamine hydrochloride (15 mg/kg) and xylazine (5 mg/kg), while K+X+D group were given ketamine hydrochloride (15 mg/kg), xylazine (2.5 mg/kg) and diazepam (2.5mg/kg) cocktail, res
Adem Aksoy1, Yakup Erdal Ertürk2, Selim Erdoğan3, Ecevit Eyduran3 andMohammad Masood Tariq4,*
... an association of beekeepers (member and nonmember), other activities except for beekeeping (yes and no), number of full beehives, bee race (Caucasian, Carniolan, Italian and Crossbred), and frequency of changing queen bee. MARS outperformed multiple linear regression, and CART in honey yield per hive. No solution for CHAID was generated. In CART algorithm, the highest honey yield
Jam Ghulam Mustafa Sahito1*, Tajwer Sultana Syed1, Ghulam Hussain Abro1 and Inayatullah Rajper2
... attacked by many insect pests and most of them have developed resistance against the synthetic pesticides. Therefore, this study was conducted to determine the influence of green manure (Trifolium alexandrinum L.) and conventional IPM on population of sucking insect pests of cotton during 2013. The population of sucking insect p...
Muhammad Sajid Mahmood1*, Muhammad Ashraf1, Ijaz Ahmad2, Muhammad Khubaib Abuzar3, Sohail Latif4 Muhammad Aqeel Sarwar5 and Waqas Ahmad6
...nation with low doses of pendimethalin (pre-emergence) for weed control in mungbean during summer season, 2009. The treatments were: Control (weedy check), Hand weeding (30 and 45 DAS), Pendimethalin herbicide @ 1.5 kg a.i. ha-1 (recommended dose), Barley W.E. @ 12 L ha-1 (20, 30, 40 and 50 DAS), Barley W.E. + pendimethalin @ 12 L ha-1 + 1.0 kg a.i. ha-1, Barley W.E. + pendimethalin @ 12 L...
Muhammad Mobashar1, Muhammad Tahir1, Shahbaz Javaid2,*, Muhammad I. Anjum2, Insha Gul3, Nazir Ahmad1 andAbdul Sami1
...as 5.4, 6.8 and 6.19, respectively. Intake of Acid Detergent Fibre (Kg/day) was higher in ration II while lower in ration I. Acid Detergent Lignin intake (Kg/day) in three rations ranged from 2.26 to 2.61. In vitro DM digestibility (%) significantly increased (P<0.05) in ration II compared to ration I and III. Intake of minerals (g/day) of Calcium and Magnesium did not vary significantly, however intake of Manganese, Cop
Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2
Saima Siddiqui1*, Ghulm Hussain Abro1, Tajwar Sultana Syed1 and Abdul Sattar Buriro2
...lation of sucking insect pests and their heteropteran predatory bugs was determined in cotton crop. Millet, maize and sunflower were grown as trap crops in cotton (cv CRIS-342) croping the experimental area of Entomology section, Agriculture Research Institute, Tandojam during 2011 and 2012. There was significant effect of trap crops on population reduction of jassid, thrips and white flyin cotton intercrop
Nevran Eylem Akman Gündüz1,* and Özgür Özcan2
... 50 and 200 mg/L with respect to the control group. The lipid level of hemolymph fluctuated among the tested GA3 concentrations. It was significantly reduced at 5 and 10 mg/L, but increased at 50 and 200 mg/L. GA3 application also enhanced the carbohydrate level at 50, 100, 200 and 1000 mg/L and the glycogen content at 100 and 200 mg/L.
...
Kiran Aqil1, Muti-ur-Rehman Khan2, Asim Aslam2, Aqeel Javeed5, Rizwan Qayyum1, Farooq Yousaf,1 Farkhanda Yasmeen1, Muhammad Luqman Sohail3 and Sajid Umar4,*
...PPR.
...
Jam Nazeer Ahmad1,2,*, Rashid Mushtaq1, Samina Jam Nazeer Ahmad1,2, Sumaira Maqsood3, Ishita Ahuja4 and Atle M. Bones4
...tuidae) is a destructive pest of various field crops and vegetables in Pakistan. Development of biopesticide is an attractive strategy to minimize the problems of pest resistance, environmental pollution and human health concerns. The isolates of S. litura nucleopolyhedroviruses (SltNPV) were collected from infected larvae fed on natural cotton crops. The NPV was isolated from the l...
Xiaqing Chen, Yü Huang and Zhen Huang*
...ue up to 80% and 90%, respectively. An apparent increase in mycelial growth inhibition in a dose-dependent manner was observed when ethyl acetate extract and carbendazim were applied individually. The EC50 of T. hamatum ethylacetate extract or carbendazim in mycelial growth inhibition of S. shiraiana was 6.6 μg/ml or 39.5 μg/ml under laboratory condition, respe
Ghulam Abbas1, Khalid Pervez Akhtar1, Muhammad Ahsan2, Muhammad Jawad Asghar1, Fiaz Ahmad1 and Muhammad Rizwan3*
... mung × mash interspecific recombinants. In this study, 72 mung × mash interspecific recombinant genotypes and a susceptible mungbean variety Mung Kabuli were screened against Yellow Mosaic Disease (YMD) using disease severity ratings by visual scoring of symptoms to calculate percent disease index (PDI). Tested recombinants responded differe...
Dan Yü, Chuchu Li, Yü Huang and Zhen Huang*
... The cell-free culture supernatant and ethylacetate extracts from T. hamatum inhibited mycelial growth of S. sclerotiorum, with EC50 value of 0.54 µl/cm2 and 2.99 µg/ml, respectively. The sclerotia production of S. sclerotiorum decreased when treated with ethylacetate extracts. The level of additive inhibition on S. sclerotiorum using both fungal ethylacetate extr...
Malik Muhammad Yousaf1*, Muhammad Zeshan1,2, Mumtaz Hussain1, Muhammad Mohsin Raza1, Muhammad Jahangir Shah1, Bashir Ahmed1 and Sabir Hussain Shah3
...ign: justify;">A field experiment was conducted to examine the efficacy of the source of N and its placement timings on growth and yield of raya. The experiment was laid out in the factorial arrangement within randomized complete block design (RCBD). Two sources of nitrogen i.e. urea and calcium ammonium nitrate (CAN) and three nitrogen placement timings i.e. ½ at rauni + ½ at flowering (T1), ½ at sowing...
Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
...measures and design therapeutics against most prevailing resistant and virulent strains. With this background, this study was designed to characterize Staphylococcus aureus, the most common pathogen,using conventional microbiological and molecular methods. The agar disc diffusion method was used to evaluate the antibiotic susceptibility. Virulence-associated genes were detected using PCR while association analysis was used to test the likelihood of stra...
Binbin Shan, Yan Liu, Changping Yang, Shengnan Liu and Dianrong Sun*
...nscriptome of Penaeus penicillatus from four combined tissues (eyestalk, muscle, intestinal and viscus) using High-seq sequencing technology. A total of 65,703,216 high-quality clean reads were generated to produce 27,850 non-redundant transcripts with a mean length of 918 nt using Trinity and Tgicl software. For homological alignment, 13,083 unigenes had significant hits in Nr database. And then, 10,467 unigenes were annotated into three ontologies: bi...
Adem Aksoy1, Yakup Erdal Ertürk2, Ecevit Eyduran3 and Mohammad Masood Tariq4,*
...on of Turkey. Predictive performances of Multivariate Adaptive Regression Splines (MARS) and Chi-Square Interaction Detector (CHAID) were evaluated comparatively in the definition of significant factors and interaction effects between the factors. Before the definition process, the data on socio-economic (age, province, educational level, experience, social security, lands and the reason at ranching of the animal breeders) a...
Ali Karabayir1,*, Nazan Arifoğlu2 and Mustafa Öğütcü3
...king water on the growth performance of three different chicken strains, Plymouth Rock, Australorp and Village (local mix-breed village chickens) was evaluated in the present study. Supplementation of disinfectant clearly improved the microbiological quality of chicken drinking water, by reducing the total bacteria, coliform and E.coli counts. On the other hand, disinfectant addition decreased feed and water intake of all chicken strains. Furthermore, t...
Ali Sher1*, Khalid Naveed1, Gulzar Ahmad2, Ayub Khan1, Muhammad Saeed1 and Shah Masaud1
...of Zn in wheat plants. Experiments were conducted at the Cereal Crop Research Institute (CCRI) Pirsabak, Noweshera, Khyber Pakhtunkhwa, Pakistan during 2014-15 and 2015-16 to study the response of wheat to N, Zn and Fe application. Treatments included three levels of N (90, 120 and 150 kg ha-1), three concentrations of Zn and Fe (i.e. 1, 2, 3 kg ha-1) each along with two controls i.e. no micro nutrients no water (control-I) and no micro nutrients + water (cont...
Iqra Arooj1,* and Shahida Hasnain2
...veloping and under-developed countries. Some of their risk factors are smoking, obesity, diabetes, family history, high blood pressure etc. Previous genome wide association studies have identified association of large number of loci with risk of CHD in different populations. The purpose of this study was to determine the association of 6q25.1/rs6922269 and 9p21.3/rs1333049 loci with risk of CHD in a population of Punjab province of Pakistan. A total of 645 sub...
Muhammad Ishfaq1*, Nadeem Akbar1, Imran Khan1, Shakeel Ahmad Anjum1, Usman Zulfiqar1, Muhammad Ahmad1, Mumtaz Ahmad2 and Muhammad Umer Chattha1
...ce. Farmer field-based experiment comprised two soil moisture regimes at the time of sowing: (M1 = Sowing in moist (field capacity) condition, M2= Sowing in dry condition) in main plots, while three different row spacings (S1: broadcasting, (no defined row spacing) S2: 11.25 cm row spacing, S3: 22.50 cm row spacing) were assigned to sub-plots. The experimental results revealed that treatment S3 (22.50 cm row spacing) took mi...
Naeem Ahmad1,* and Zulqurnain2*
...as to compare the growth performance of two GIFT strains (GIFT-Th, imported from Thailand; GIFT-Tw, obtained from a local hatchery) in two earthen ponds, fed with commercially available feed. Similar feeding regime and physical conditions were maintained for both treatments. It was found that there was no significant difference in final total length (TL) and standard length (SL) of the fish in both treatments (P>0.05). However, average monthly weight gain, ...
Majid Hussain1, Syed Makhdoom Hussain1,*, Razia Iqbal2, Arshad Javid3, Muhammad Mudassar Shahzad1,4 and Muhammad Zubair-ul-Hassan Arsalan1
...digestibility and growth performance of Catla catla fingerlings. MOLM based diet was sub-divided into one control diet (0% CA) and five test diets, each supplemented with 1%, 2%, 3%, 4% and 5% CA, respectively. Chromic oxide as an inert marker was added in the diets to determine nutrient digestibility. The fingerlings were fed twice daily at the rate of 5 % of live wet body weight on their res...
Gokhan Sahin1, Ecevit Eyduran2,*, Mete Turkoglu3 and Fatma Sahin2
...um of global irradiation per square meter and Hm: average annually sum of global irradiation per square meter), several predictors viz. ESTLOSTEMP (estimated losses due to temperature and low irradiance), ESTLOSANGREF (estimated loss due to angular reflectance effect), and COMPVLOSS (Combined Photo Voltaic system losses) were calculated. Estimation of global irradiation parameters was made...
Shoukat Ara1, Sheikh Adil2,*and Manzoor Ahmad Khan3
... biochemistry and laying performance layer chicken, a study was conducted on 240 key stone golden layer chicks which were randomly assigned into five groups having three replicates of 16 each. Birds in control (T1) group were fed the basal diet, where as other groups the groundnut cake was replaced with 5 (T2), 10 (T3), 15 (T4) and 20% (T5) Azolla. The results revealed that inclusion of Azolla
Asinamai Athliamai Bitrus1*, Olabode Mayowa Peter2, Muhammad Adamu Abbas3 and Mohammed Dauda Goni4
...he early 1940-ties, when penicillin resistant S. aureus was first reported. Ever since, this pathogen has gain global notoriety as the most common cause of nosocomial, community and livestock associated infection. The mechanism of resistance development in bacteria involved the integration of a complex systems that included the efflux pump, alteration of drug target site, enzymatic inactivation and, mutation in drug target site and gene acquisition of resistan...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2 and Mujahid Iqbal3
...group was comprised of experimental group (to whom a set of advisory instructions were sent by mobile phone) and other was control (face-to-face). Two- population independent t-test was applied for comparison of the two methods of instructions. The results of the study revealed that both methods were equally applicable and effective regarding timely transfer of information or knowledge to the farmers for aphid attack on whea...
Rida Zainab1, Sana Elahi1, Afshan Kaleem2,*, Daniel C. Hoessli3, Mehwish Iqtedar2, Roheena Abdullah2, Faiza Saleem2, Shanza Khan1, Anusha Ijaz1, Shagufta Naz2 and Abdul R. Shakoori4,5,*
...ical disorder in which a person suffers from emotional and intellectual disturbances. First generation antipsychotics for Schizophrenia were replaced with by second generation ones with less side-effects like Parkinsonism and Hyperprolactinemia. A novel, computer-based drug designing technique, has emerged to develop more efficient drugs. One of the computational methods becoming increasingly popular to develop new drugs is ...
Junaid Akhtar1,2, Sidrah Saleem1, Naveed Shahzad3, Abdul Waheed1, Iqra Jameel1, Farhan Rasheed4 and Shah Jahan5,*
...otics predominantly carbapenems, are considered as last treatment option against multi-drug resistance GNR infections. However, the emergence of carbapenemases particularly metallo β-lactamases (MBLs) in bacteria have severely mitigated the efficiency of carbapenems. MBLs producing gram-negative bacteria have been reported from various hospital settings, worldwide. However, data is la...
Aftab Khan, Shahid Ali, Syed Attaullah Shah and Muhammad Fayaz
...ecasted the effect of temperature and precipitation on net revenue of maize growers across Northern, Eastern, Central and Southern zones of Khyber Pakhtunkhwa, Pakistan. 200 maize growers were randomly selected through multistage sampling technique. Primary data on net revenue from maize crop was collected through an interview schedule and secondary data on temperature and precipitation was collected from Regional Metrologic...
Ashraf Khan1*, Suliman Shah2, Maid Zaman3 and Komal Habib2
...d to be the most noxious pest of almost all species and varieties of citrus and its infestation found throughout the world. It is becoming serious threat to the brightening future of citrus growing areas of Pakistan. Thirteen different insecticides were usedfor effective control against citrus psylla under field conditions. Population density of pest was recorded as number of adults
Muhammad Faheem Jan1*, Asad Ali Khan1, Waqas Liaqat1, Haseeb Ahmad1, Muhammad Dawood Ahmadzai1 and Wazir Rehan2
...ctivity. Field trial was performed at Agronomy Research Farm of The University of Agriculture Peshawar during summer 2016. Two factors were studied i.e. hybrids (DK-Garanon, Pioneer-3025, WS-666, and Pioneer-3164) and potassium ratios (Organic vs inorganic). The organic source includes poultry manure (PM) while inorganic source includes sulphate of potash (SOP). Potassium (K) was applied to field in such an arrangement that 100, 80, 60, 40, 20 and 0% K was obt...
Iqbal Javed1*, Amar Razzaq2, Mudassar Yasin3, Muhammad Ali Imran4, Haroon Javaid5, Iftikhar Nabi6, Anum Sardar1 and Shahbaz Ahmad7
...rsquo;s meat industry is performing well however, there is more potential in the sector of livestock and hence for the exports of meat to all over the world. The study in hand is designed to explore the current performance and competiveness of meat industry of Pakistan. Keeping the importance of the meat industry of Pakistan, the study in hand is conducted to explore the mutton exports fro...
Madiha Naz1, Qudrat Ullah Khan1*, M. Jamil Khan1, Obaid Ullah Sayal2, Asim Afridi3 and Aziz Ullah Sayal3
...gn: justify;">Tomato are perishable fruit and its growth, yield and quality depends on the management practices. Tomato attributes were studied under controlled condition using manures and pressmud incombination with foliar spray of macro-nutrients and naphthalien acetic acid (NAA) and compared with inorganic soil applied fertilizers. The results of the study showed significantly higher number of branches, chlorophyll conten...
Dilara A. Bukhari1,*, Naureen Fatima1 and Abdul Rehman2
...and leaf litter soil, respectively. So, these isolates have a great potential to grow into a biopesticidal formulation for control of mosquitoes.
...
Nusrat Habib1*, Asim Zubair2 and Aisha Siddiqua3
...variables such as total operational holding, sunflower yield and sale price of sunflower. In case of determining yield of sunflower use of DAP and organic manure were significant and positively correlated. ...
Saif Ullah and Mohammad Akmal*
...ntial to review. Field experiment was conducted at Agronomy Research Farm, the University of Agriculture Peshawar during summer 2016. Nitrogen (40, 80 and 120 kg ha-1), P (30, 60 and 90 kg ha-1) and S (10, 20 and 30 kg ha-1) were compared in a randomized complete block design in three replications. Plot (4m x 4.2m) with six rows were made and planted at 0.7m spacing on ridges. Results revealed that N 120 kg ha-1 resulted in the maximum days to flowering, leaf ...
Muhammad Javed Iqbal and Muhammad Naeem*
...P (T3) and 40%CP (T4). Experiment was designed to replace enriched fish meal diets with cheaper plant origin crude protein diets in fish culture. A total of 15 aquaria having 20 samples each were arranged in triplicate for 90 days to study the effect of five feeding groups on Length-weight relation and external morphometric variants of Labeo rohita. A total of 75 fish samples @ 5 fish samples pe
Safina Naz1, Khushbo Hussain1, Muhammad Asif Zulfiqar2* and Syed Atif Hasan Naqvi3
...y;">Luffa possesses its specific value and importance among the summer vegetables. Research comprising of in-vitro and field trials was conducted to define the efficacy of growth promoting substances which showed that foliar application of Naphthalene Acetic Acid, Salicylic acid (SA), combination of Naphthalene Acetic Acid & salicylic acid and orange oil extract on physical and chemical parameters gave significant response. NAA promotes vine length upto 12...
Mian Noor Hussain Asghar Ali, Liaquat Ali Jamali, Shakeel Ahmed Soomro*, Shakeel Hussain Chattha, Khalil Ahmed Ibupoto, Naseer Ahmed Abbasi and Noor Mehdi Qumi
...t methods i.e. one kept open and other covered with sugarcane trash. The samples of sugarcane were taken at an interval of 24 hours to determine different quality parameters i.e. cane weight, brix, pol/sucrose, purity, fiber and commercial cane sugar. The results revealed that weight loss and fibre content throughout increased with increasing storage period. However, a decrease was observed with increasing storage
Shabana*, Saleem Ullah Shahid and Shahida Hasnain
...ani obese patients are hyperlipidemic except for HDL, which is low in obesity. The anthropometric traits were significantly different between dyslipidemic obese subjects and nondyslipidemic non obese subjects. In conclusion, obesity is accompanied by a dyslipidemic profile and increased weight and/or BMI. The progression of clinical forms of obesity can be assessed by the strong predicting indices, including weight, BMI, low HDL and high TC.
...
S. Jalbani1, P. Khan2 and N.T.Narejo2,*and Y.M. Jalbnai3
...
...
Zain ul Abidin1, Aisha Khatoon2, Abdul Whab Manzoor1,*, Nida Arooj1, Sajjad Ali1 and Muhammad Numan1
...uding humans. Incubation period of this infection is quite variable ranging from a few days which can last up to one year in few cases. This case report presents the diagnosis and screening of suspected rabies samples of cow and mule. Clear behavioral changes along with paralysis of tail and hind legs were noticed in the mice of both groups between 11-15 days post inoculation while all the mice were found dead between 15-18 ...
Imran Taj1,*, Ferhat Abbas1, Zafar Ahmad1, Mohammad Kamran Taj1, Deedar Ahmad2, Zahoor Ahmed2, Ghulam Mohammad2, Ajaz-ul-Haq1, Farooq Shahzad1 and Sabiha Azam3
...alence of Clostridium perfringens type D in small ruminants. A total of 204 fecal samples were collected from sheep and goats suffering from seasonal diarrhea. C. perfringens type D was identified through different biochemical tests and PCR. Antibiograms and lab animal trials were also carried out on local isolates of C.
In-vitro Anticancer Activity of Copper (II) and Zinc (II) Complexes with Derived Schiff Base Ligands
Qaisar Jamal1,Salman Ahmad1, Nazma Habib Khan1, Sobia Wahid1, Muhammad Ikram2, Sadia Rehman2, Syed Basit Rasheed1 and Akram Shah1,*
...imino] methyl}phenol) Copper(II) and NM-4 (Tetrakis (2-{(E)-[(2- {[(Z)-(2-hydroxynapthyl) methylidene] amino}phenyl)imino]methyl} phenol) zinc(II)), against human THP-1 leukemia cell line in-relation to miltefosine (standard chemotherapy). Mean % inhibition for NM-3 against THP-1 was higher than NM-4, although both were less effective than miltefosine. IC50 for miltefosine, NM-3 and NM-4 against THP-1was 0.000347µM, 44.9µM and 119µ...
Iqbal Ahmad Alvi, Muhammad Asif, Rabia Tabassum, Zaigham Abbas and Shafiq ur Rehman*
...nd IttPL, at distinct temperatures for complete one year is described. Our results indicated that storage of bacteriophages at 4oC was most appropriate, followed by storage at -20oC and -80oC as no drop in viral titer was witnesses in bacteriophage samples stored at 4oC for up to one year. The results of this research indicated, that a standard refrigeration is suitable and economical means of long term storage with ...
Impacts of Climate Change on Livestock and Livestock Produces: A Case Study of Banke District, Nepal
Anish Shrestha* and Samata Baral
...remote areas. No sector, person or region is free from impacts of climate change and neither is livestock sector. This study was carried in Banke district to find out impacts of climate change on livestock and its productivities. Result showed that farmers perceived the climate change as change in rainfall pattern, rainfall duration, onset of the monsoon, and changes from summer and winter etc. Some farmers realized the chan...
Tariq Aziz1, Iftikhar Hussain Khalil1, Quaid Hussain1,3*, Tariq Shah2,3, Nazir Ahmad1 and Amir Sohail1
...2013-14. All wheat genotypes (8 parents and 12 F3 populations) showed significant differences for all traits. Cultivar Janbaz had maximum spike length (13.9 cm) and maximum number of grains spike-1 (89.2). Parental line B-IV(N)5 had maximum single spike weight (4.6 g), 100-grain weight (4.6 g) and grain yield (32.0 g plant-1). F3 population B-RF7 × Janbaz had 100-grain weight (4.5 g) and grain yield (31.9 g plant-1). Similarly, F3 population B-RF1 ×...
Amtur Rafeh, Rana Manzoor Ahmad, Ayesha Iqbal, Abdul Majid Khan*
... and discussed in this paper. The dental remains comprise isolated upper and lower molars. The antilopine genus Gazella has great diversity from Middle Miocene to Pliocene from Africa to Eurasia. The morphological characteristics indicate this genus as a conservative bovid with simple morphology.
...
Wajid Ali1,*, Asma Karim1, Muhammad Irfan2, Hafiz Abdullah Shakir3*, Ghulam Mustafa4, Zeeshan Shafique1, Ijaz Anwar1
...oup contains six fish. Experimental groups viz. A, B and C were exposed to 25, 50 and 75% of LC50, respectively for four days. Blood samples for biochemical analysis (blood glucose, cholesterol and total protein) and gills for histology were taken after 96 hrs. After acute exposure to pesticide, significant changes were observed in serum biochemistry and histology. Serum ...
Muhammad Abu Sufyan Ali, Syed Attaullah Shah*, Ghaffar Ali and Muhammad Fayaz
...al use creates a value expectation and it capitalizes into farmland price. The value, however, does not influence farmland rents. For control in loss of fertile agricultural land, the study recommends the imposition of progressive taxes on residential and commercial properties and diversion of funds for development of agricultural infrastructure. Provision of subsidized inputs could help in raising farmer’s return from...
Rahim Dad Brohi1,*, Amir Bukhsh Kalhoro1, Allah Bux Kachiwal1, Illahi Bux Kalhoro1, Dildar Hussain Kalhoro1, Sarfaraz Ahmed2, Farhan Anwar Khan3, Hira Sajjad Talpur1, Zia-ur-Rehman1 and Dinesh Bhattaria4
...opofol (6 mg/kg) and thiopentone sodium (8 mg/kg) administrated intravenously after premedication with xylazine hydrochloride (0.02 mg/kg) has been studied on six healthy female sheep using a crossover design. During xylazine therapy the pulse rate was significantly (P<0.01) decreased, but respiratory rate remained unchanged. The administration of anesthesia on the other hand caused a significant (P<0.01) increase in the pulse rate and a significant (P&l...
Lamiaa Elsayed Mokhtar Deef
...gypt (Gebel Elba). This species is greatly distributed across central and eastern Africa. The exact identification of species is fundamental for an efficient assessment of changes related to the appearance of non-native species in an environment. The biometrics and molecular markers were used to confirm the identification of A. albiventris at the ...
Faxiang Wang, Yan Chen, Sai Chen, Xianghong Li, Jian Yu, Jianhui Wang and Yongle Liu*
...ge on composition and properties of grass carp protein. The results show that muscle proteins of grass carp were degraded and underwent conformational changes when stored at 4 °C, and significant changes of the proteins content, as shown by the SDS-PAGE fingerprint, was observed after 6 days of storage. Protein’s surface hydrophobicity and total SH content increased during the first 4 days and then decreased gradually up to 10 days. The Ca2+
Qaisar Mehmood1*, Muhammad Riaz2, Maqbol Hussain Sail1 and Muhammad Moeen1
...f wheat. Variety, seed type, date of sowing, sowing mode, Urea fertilizer, DAP fertilizer, irrigation mode, numbers of irrigations and number of weedisides sprays are chosen as input factors. Descriptive statistics, multiple linear regression model and analysis of variance techniques are used which show that variety, sowing mode, nitrogen fertilizer and phosphorous fertilizer have significant effect on the wheat yield. Irrigation mode and weedisides spray also...
Sana Rana1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1
...ign: justify;">In this experiment toxic effect of deltamethrin(DM)+endoslfan(END) mixture on catalase (CAT) activity in gills of carnivorous fish Channa striata was observed. Fish were exposed to sub-lethal concentration (1/3rd of LC50) of DM+END mixture for 14-day. CAT was partially purified by using ammonium sulphate precipitation technique and kinetic characterization was also performed against different pH and tem
Safina Naz1, Muhammad Akbar Anjum1, Syed Atif Hasan Naqvi2*, Bushra Siddique3 and Muhammad Asif Zulfiqar4
...moisture contents in Lycopericon esculentum (93.7%), protein in Spinacia oleracea (2.23g/100g), fats and fiber in Abelmoschus esculentus (0.44g/100g and 3.27g/100g, respectively), ascorbic acid in Spinacia oleracea (84.5mg/100g) and carbohydrate and energy values in Daucus carota (11.25g/100g and 55.80 cal, respectively). While, higher mineral contents were recorded for phosphorous (P) in ...
Abdur Rehman1* and Shad Khan Khalil2
...15-16 and 2016-17. The experiment comprised of four moisture levels (optimum water, 10%, 20% and 30% reduced irrigation water), three chemicals (salicylic acid 0.5mM, potassium nitrate KNO3 1% and methanol 20% v/v basis) applied at three different stages (bud formation, 20% flowering and 20% pod formation). The experiment was laid out in RCB design with split plot arrangement having three replications. Moisture levels were a...
Shamsher Ali1, Zakir Ullah Jan1*, Zahir Shah2, Muhammad Jamal Khan2, Farmanullah Khan2, Inayat ur Rahman3 and Shah Fahad3
... study the production competition of hybrid (CS-200, cv) and local variety (Azam cv.) under the same application of fertilizer treatment and dozes during summer 2015. The field experiment was laid out in randomized complete block design with split plot arrangements having two maize varieties in main pot and six levels of fertilizer treatments in sub pots repeated four times. Fertilizers tr...
Yasir Ali1*, Muhammad Aslam Khan1, Muhammad Atiq1 and Muhammad Hussain2
...mics caused by leaf, stripe and stem rust have significant threat to agro-ecosystems and worldwide food security. Semi-dwarf wheat varieties with major gene resistance could not continue for longer period due to emergence of new rust races. However, genotypes such as Inqilab-91, Bluebird, Kenya Plume and Hope developed...
Ejaz Ashraf1*, Bushra Hassan2, Nadeem Anwar2, Hafiz Khurram Shurjeel3 and Shafique-ur-Rehman4
...conomic welfare of rural people. It involves uplifting of certain indicators of development and satisfying the needs of fragile groups of rural communities. This study examined socio-economic factors of rural life which contribute in economic prosperity. A list of union councils and villages in tehsil Sargodha was obtained from local district office of the Population Welfare Department. All rural families live in tehsil Sarg...
Yang Liu1,2,3, Baimei Liu1,2,3, Chenchen Li1,2,3 and Meiwen An1,2,3,*
...gen from FM.
...
Haozhen Liu1, Xiangfu Li2, Yinong Wang1,*, Xun Liu3,4, Li Wang1, Dong Liu1, Chen Chen1, Jinjing Li1, Haifeng Jiao5 and Zhongjie You1,5
...mental variables that shape their spatial patterns. The environment of the study area has significant spatial heterogeneity. Environmental variables of sediment and water column were studied to provide models for spatial patterns of macrobenthic assemblages. Result showed that most of variation in macrobenthic spatial patterns were explained by the studied environmental variables. Sedimentary sulfide, sedimentary total phosphorus, dissolved oxygen and water co...
Li Lv1, Liuan Li1,*, Ruibo Zhang1, Zhichao Deng1, Tianming Jin1 and Gaimei Du2
...omly divided into four experimental groups and fed a basal diet supplemented with selenium enriched yeast at differing levels: 0.0 mg/kg (control group), 0.3 mg/kg (low-dose group), 0.6 mg/kg (medium-dose group) and 1.2 mg/kg (high-dose group). Each experimental group had four cohorts and each cohort had 10 hens. Experimental diets were fed for 28 d and daily egg production was recorded. E...
Muhammad Asam Riaz1, Javeria Choudhary1, Muhammad Zeeshan Majeed1*, Muhammad Afzal1, Sohail Ahmed2 and Muhammad Sajjad Khalil1
...s, i.e. deltamethrin and permethrin and one biological insecticide, spinosad, were performed on these strains of T. castaneum. Toxicological studies demonstrated that Fsd-, Jh- and Swl- strains exhibited higher tolerance ratio of 26.5-fold, 21-fold and 18.6-fold respectively relative to Sgd-strain against deltamethrin, whereas, these strains did not have significantly higher tolerance rati...
Xiaojie Ding, Xiling Sun, Zuien Wang, Qiusheng Zheng, Xiaofei Yu, Wenjin Hao, Kejun Wang, Wenjuan Xu and Zhengping Dong*
...l has a significant therapeutic effect on IBS-D.
...
Raza Ullah Khan*, Ahmad Khan, Mohammad Zameer Khan, Fayyaz Hussain and Sonia Saba
...xt-align: justify;">An experiment was carried out in glasshouse to evaluate effect of phosphorus (P) applied either through soil or foliar or proportional combination thereof. Treatments consists of whole P applied as soil (PS =100%), foliar (Pf=100%) or different combination (PS75:Pf25, PS50:PF50, PS25:Pf75) to wheat grown in 5 kg soil in plastic container. Data on plant growth parameters (plant height, biomass and grain yield) was collected at the end of the...
Qiang Li1,2, Guo Qiao2, Li Wang1, Jipeng Zhang1, Ruijun Li1, Ping Ni1, Yi Guo1 and Shigen Ye1,*
...d fugu (Takifugu rubripes) in northeastern China from January to December in 2014. The main clinical signs included fin ulceration, skin darkness, hepatohemia and intestinal hydrops. Totally, 104 diseased live fish were collected and 70 strains isolated from naturally diseased T. rubripes. Most isolates were obtained in May, September and December. The isolates were identified through 16S rRNA gene sequence ana...
Ali Murad Rahoo1, Tariq Mukhtar2,*, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
...gical control agents of specific target insects depends on their level of infectivity and reproductive capacity. Nematodes with higher levels of infectivity and reproduction within a specific target host may be more effective in controlling a particular insect under field conditions. The production of infective juveniles (IJ) from Galleria mellonella cadavers may differ among differ...
Şehriban Çek Yalnız 1,* and Erdal Yilmaz2
...tic mature oocytes was hypertrophied and persisted to form the interstitial cells, whereas the granulosa cells were regressed and disappeared. Erythrocytes and leukocytes were also detected at the advance stage of atresia. Apoptosis in the granulosa cells were clearly detected. The chromatin condensation against the nuclear envelope, cell shrinkage, surf...
Peng Xu1, Bin Liu1,2, Yongqiang Zhao3, Shicheng Lv3 and Changhu Lu1,*
...at significance for the species protection and management. Here, based on the annual maximum population size of red-crowned crane wintering in Yancheng Nature Reserve (YNR) from 1981 to 2016, we tested the correlation between population size and the climate variables. The results showed that mean air temperature in wintering period showed a linear upward trend. Annual maximum wintering cra...
Amar Razzaq1, Abdur Rehman4*, Abdul Hassan Qureshi2, Iqbal Javed3, Raheel Saqib5 and Muhammad Nadeem Iqbal6
...ductivity. In order to cope with this situation, it is imperative to make use of available water resources more efficiently through high-efficiency irrigation systems (HEIs). The present study aimed to conduct the economic analysis of high efficiency irrigation systems in Punjab province of Pakistan. We also measured and compared the water productivity of modern and conventional-irrigated farms. We used primary data collecte...
Sajad Ali1*, Syed Asghar Ali Shah2, Jaffar Ali3, Muhammad Nadeem Iqbal4, Arshadullah Jadoon5 and Farmanullah6
...port of the country. The pea’s cultivators and also market agents were quizzed by using structured questionnaires in two related districts that is Haripur and Mansehra in the year 2013-14. The data were analyzed by using SPSS Package version 22 for calculating marketing marginal analysis and cross-tabulation were also been employed. The studied statistics of the land size of chosen pea’s farmers fluctuated amongs...
Soumble Zulfiqar1, Khuram Shehzad1, Sana Tahir1, Khalid A. Al-Ghanim2 and Abdul Rauf Shakoori1,2,3,*
...plications.
...
Saima Shahzad Mirza1,*, Hafiz Muhammad Qamer2, Hafiz Abdullah Shakir3,*, Rana Shoaib Akram4
...ospital Lahore in an OPD pediatrics. For this purpose, cross sectional survey data of 34 conservative mothers was analyzed, obtained by means of questionnaire. Initiation of weaning process at proper time is found to be somewhat finance limited factor. Total 17 and 1 out of 34 cases were sufficiently and well literate, respectively and aware about weaning process. In our study 47, 39 and 1...
Nimra Naseer, Adeela Fatima and Imran Sajid*
...cter spp., extended spectrum β-lactamases (ESBLs) producing strains of Escherichia coli, Klebsiella spp., Pseudomonas spp. and Proteus spp. In this study, a collection of nineteen actinomycetes strains isolated from Cholistan Desert, Pakistan, were screened biologically and biochemically for their potential bioactive secondary metabolites against MDR bacterial pathogens. The identification of strains was done by morp...
Fan Shuli1*, Ameer Hussain Jarwar1,3, Xiaoyan Wang2, Long Wang1 and Qifeng Ma1
...According to an estimate per capita usage of edible oil in the country is 15 kg, this is even higher than the consumption in countries with same economic status of economical evolution. Overall requirements for this purpose in 2028–30 is estimated at approximately 5.30 million/tons from which domestic share could be only 1.99 million/tons. Generally, the genetically modified cotton (Bacillus thuringiensis) was acquaint in Pakistan during the first decade...
Merica Slišković1, Meta Povž2, Marina Piria3,*, Goran Jakšić4, Ana Gracanin5 andGorana Jelić Mrčelić1
... Slovenia. In total, 14 specimens were sampled by fishermen using sport fishing techniques. The age, condition, length-weight relationship (LWR), 20 morphometric and four meristic traits, were analysed. Fulton condition coefficient and LWR value indicated that sichel specimens’ were well adapted to the environmental conditions. Positive allometry in both males and females were observed (W = 0.004 L3....
Asad Ullah1, Umar Sadique Khattak2, Sultan Ayaz1, Muhammad Subhan Qureshi2, Imad Khan1, Ibad Ullah Jan2, Irfan Khattak1, Raheela Taj3, Sahar Nigar4, Naimat Ullah Khan1,Mumtaz Ali Khan5 and Muhammad Luqman Sohail6,*
...on. Three primary signs (persistent cough, weight loss and fever) were recognized by 4.7% of respondents including herd owners, herders and animal handlers. This study calls for instant measures for disease control among the animals and humans of the study area, and highlight the need for farmer education regarding bovine tuberculosis.
...
Qudrat Ullah1,*, Huma Jamil1, Zafar Iqbal Qureshi1, Muhammad Saqib2 and Heinrich Neubauer3
...m animals kept at the respective livestock farms. An indirect-Enzyme Linked Immunosorbent Assay (iELISA) was used to detect anti-C. burnetii antibodies in the serum. Serological analysis revealed overall flock-level sero-prevalence of 92.3% which varied from 88.88% in sheep and 100% in goat, while individual level sero-prevalence was 15.6% in sheep and 15.0% in goats, the difference being non-significant. A significant (P<0.05) association was...
Zulqarnain and Zafar Iqbal*
... to identify the fungal species with their potent antifungal activity against the Fusarium wilt of tomato. Six distinct fungal species including Penicillium sp., Aspergillus niger, Aspergillus flavus, Trichoderma harzianum, Alternaria solani and Pythium aphanidermatum showed growth inhibition (%) against the pathogen. Penicillium sp. showed maximum growt...
Bushra Qadir1, Muhammad Asim2 and Mohammad Akmal1*
...sue. Treatments of the experiments were four alfalfa varieties (i.e. UCD, Dura, Vernal and Cuf 101) whose seed were treated with overnight in bio-extracts solution made of perennial tree leaves. The study compares early growth performance of alfalfa varieties for forage biomass production. The seed was soaked overnight (14 h) in extracts made from dry powdered leaves of Bakayn (Azadir acht...
Bata Shalangwa Ishaku1*, Maimadu Abdullahi1, Dakwang Nalong1, Rengkat Jonah1 and Olabode Mayowa2
...nce based on the animal species (P=0.023; odds ratio=7.688) screened in the study. In pigs, T. gondii seropositivity was found to be higher (46.2%) and about five times more likely to occur in males than in females (33.3%) (P=0.016; Odds ratio=5.15; 95%CI=1.040-1.844). The seropositivity was also found to increase with age. The prevalence was higher (44.1%) in animals older than 2 years than in those below 2years (31.3%) (P=0.022; OR=4.58). In sheep and goats,...
Moorthy S. Muthuswamy
...s have popularized the appealing theme of sharia as all-encompassing “divine law” to advance radical Islamist agendas. By identifying sharia as the theme and religious leaders as its enablers, such an explanation facilitates our understanding of the causes and backers of this religious radicalism.
...
Muhammad Israr1*, Saeed Ullah1, Shakeel Ahmad2, Asif Yaseen3, Urooba Pervaiz4 and Nafees Ahmad5
...Pakistan by studying the perceptions of the farmers about the different dimensions of agriculture LD with the construction of LD index. For achieving this primary data was collected by proportionate random sampling techniques form 90 sampled farmers through face to face interview survey method by filling a questionnaire. Farmer’s perceptions on agriculture LD were measured through the extent of severity scale in terms ...
Abid Hussain1*, Muhammad Azeem Khan2, Muhammad Anjum Ali Buttar3, Umar Farooq4, Muhmmad Islam5 and Zahid Ullah Khan1
...ubsidy and supplying inexpensive feed gas for fertilizer industry. Currently, cash subsidy on urea is costing Rs. 12 billion to national exchequer and total tax relief (all products inclusive) costing around Rs. 40 billion to the national exchequer, respectively. Thus, total financial implication of subsidy and tax relief is Rs. 52 billion. In the existing tax regime tax rates vary greatly from 3.55% (SSP) to 11.73% (NPK). D...
Muhammad Luqman1, Raheel Saqib2*, Mujahid Karim1, Khalid Nawab2, Abdur Rehman3 and Muhammad Yaseen1
...d. Majority (65.6%) were perceived as poor (having monthly income >7000 PKR). Regarding impact of agro forestry on rural household food security “good source of fuel wood” ranked first (mean=2.95). Small land holding was one of the major constraints (mean=2.62). Decrease in soil loss was the main advantage of agro-forestry as perceived by majority of respondents. There was highly significant relationship betwe...
Arshad Iqbal1*, Syed Mehar Ali Shah1, Hidayat ur Rahman1, Faiza Aman2 and Aziz-ur-Rahman1
... and AUP-322 showed best performance for primary panicle branches (13) and secondary panicle branches (41.3), respectively. High broad-sense heritability estimates were observed for all the studied characters, number of days to maturity (99.6%), culm length (99.4%), flag leaf area (98.9%), days to heading (95.9%), secondary branches panicle-1 (88.3%), panicle length (70.7%) and primary branches panicle-1 (60.6%), res
Song Jiang1,2, Fa-lin Zhou1, Qi-bin Yang1, Jian-hua Huang1, Li-shi Yang1 and Shi-gui Jiang1*
...v>...
Yuan Li1, Liyan Zhang2, Karhoe Loh3, Ji Feng1, Xinqing Zheng1, Puqing Song1 and Longshan Lin1,*
...te, and two major haplotype lineages were detected that were differentiated approximately 0.3 million years ago. These two haplotype lineages differed significantly in frequency distribution of Chinese and Malaysian populations, showing an imperfect geographical pedigree structure. Results of AMOVA also showed that the genetic differentiation was mainly ...
Neelima Gupta
...e 24%, intensity 2 to 18 per fish). Light and Scanning Electron Microscopy (SEM) were conducted to demonstrate the surface anatomy of the worm. The worm is slender, elongated and cylindrical. The mouth is slit-like, surrounded by two lateral rows of somatic papillae, cephalic end was conical with 12 labial papillae arranged in two circles of 6 papillae each. Scanning electron microscopy on attachment structures revealed that the inner papillae had narrow bases...
Ocheme Julius Okojokwu1*, Maryam Bisola Adebayo2, Bashiru Shafa Abubakar3, Ibrahim Abubakar Yusuf2 and Joseph Aje Anejo-Okopi1
...al status, occupation, type of marriage, number of children, history of blood transfusion and trimester of pregnancy were statistically associated with prevalence of IgG antibody (p ≤ 0.05). There was a significant association (χ2 = 12.571; p = 0.028) between age group and IgG antibody. The age group > 40 years old had the highest prevalence of IgG antibodies while the age group 21 – 25 years (p ≤ 0.05) had the least (39.3%). Similarly, ther...
Inzimamul Haq1*, Shahid Sattar1, Bashir Ahmed1, Qamar Zeb2 and Amjad Usman3
...sitoid in the integrated pest management of Chilo partellus in maize field, basic studies on the efficacy of some insecticides against Chilo partellus in Jalal variety of maize and selectivity for the bio-control agent, T. chilonis were carried out under field conditions at Agricultural Research Institute, Tarnab Peshawar during 2016. Treatments viz Proclaim (Emamectin benzoate® 1.9 EC) + T. chilonis, Confidor® (Imidacloprid 200 SL) + T. chilonis, Chlo...
Saeed Ahmad Shah Chishti1, Mudassar Iqbal1*, Nusrat Parveen1, Kashif Nadeem1, Muhammad Iqbal1, Umbreen Shahzad2, Rana Husnain Shabbir1 and Muhammad Najeebullah1
... adapted and bold-seeded pea variety was evolved by hybridizing two varieties Meteor and Lampo at Vegetable Research Institute, Faisalabad Pakistan. The variety was tested in replicated varietal/ station yield trials and multi-locational trials from 2001 to 2014. Sarsabz gave higher green pod yield (8.52 t/ha) than existing pea varieties i.e. Pea-2009 (7.51 t/ha) and Meteor (6.86 t/ha) and Climax (6.94 t/ha) on average basis...
Ali Muhammad*, Yasser Durrani, Majid Suhail Hashmi, Ihsan Mabood Qazi, Muhammad Ayub and Saifullah
...onal and beneficial therapeutic properties, which are indispensable for the functional and nutritional properties of foods. The aim of the study was to neutralize whey by addition of NaOH (0.1 and 0.01N) and NaHCO3 (0.1 and 0.01N) for fortification and enrichment of foods. However, addition of these solutions results in an increase in total solids and as...
Shaista Naz1*, Noor Paio Khan1, Naveed Afsar2 and Ashfaq Ahmad Shah3
...agement have not been properly explored yet. To fill in the gap, the present research study was carried out to determine women’s participation in the types of livestock rearing, their livestock possession, participation in livestock activities, and the major faced constraints in livestock management in Khyber Pakhtunkhwa province of the country. For this, a sample size of 117 women respondents was selected through mult...
Asif Nawaz* and Muhammad Zafarullah Khan
...vel of climate change competencies, their training needs and influence of demographic characteristics on the climate change competencies of Field Assistants of the Agriculture Extension Department, Khyber Pakhtunkhwa. A sample of 234 out of total 543 Field Assistants were selected with the help of Sekaran Sampling Technique and the respondents were distributed in four Agro-ecological zones of the province with the help of pr...
Monsif Ur Rehman1*, Hidayat-ur-Rahman1, Muhammad Iqbal2, Iftikhar Hussain Khalil1 and Zahir Shah3
... ability and grain yield performance of S1 lines derived from ten maize populations. These populations were crossed in half diallel design and the resulting 45 cross combinations were further explored for their use as source of elite inbred line development in a line × tester experiment conducted at Cereal Crops Research Institute, Pirsabak and Maize and Millet Research Institute, Yousaf wala during Kharif 2016. A tota...
Sher Nawab Khan* and Ghulam Hassan
Aneel Salman1, Muhammad Iftikhar ul Husnain1, Inayatullah Jan2*, Muhammad Ashfaq2, Mudassar Rashid1 and Usman Shakoor1
... agriculture sector is imperative as it contributes 20 percent to the GDP and supports directly or indirectly about 68 percent of the population for their sustenance. Farmers’ perception about climate change, current adaptation measures, and decision-making process is important for farmers’ successful adaptation strategies. Using data of 205 ...
Amjad Ali1, Abbas Ullah Jan1, Lal Almas2, Noor Piao Khan1 and Khurran Nawaz Saddozai1
... to agricultural trade experts Pakistan need to reduce cost of production in order to compete in the international market. At national level food group exports decline from 3,439.4 million US$ during 2015 to 3040.7 in 2016. Increase in productivity and efficiency has been the major concern for agricultural researchers and policy makers in Pakistan. In current study allocative efficiency of sugarcane growers in district Chars...
Ambrin Rajput*
...xt-align: justify;">Chickpea is one of the largest and highly cultivable pulse crops which plays a major part in fulfilling the nutritional requirements of human. Limited research has been done on chickpea concern with potassium (K) fertilizer application. A field study was carried out to determine the effect of K on chickpea using cultivar Benazir having three fertilizer treatments; 0:0:0...
Mushtaq Hussain Lashari1*, Fozia Afzal1 and Umer Farooq2
...nd 48.74±3.15, respectively. MCH, eosinophils and monocytes showed significant difference. Hb, PCV, RBC, MCV MCHC, heterophils, basophils and lymphocytes values showed non-significant difference. Furthermore, some of the hematological parameters are altered by T. gondii but not all. In literature a little information is present regarding the hematological changes due to T.gondii in chickens of Cholistan, Bahwalpur, Pakistan.This is pilot study one of a ...
Waqas Ali* and Mudasser Habib
...dy, 336 strains of serotype O (n = 178), A (n = 82) and Asia 1 (n = 76) were downloaded from NCBI database that mainly belonging to Pakistan, along with three vaccinal strains. Phylogenetic analysis (maximum likelihood) showed that lineages Pan Asia II, An Iran-05, and Group VII within serotype O, A and Asia 1 are causing majority of the outbreaks in the Pakistan during recent years. Moreover, only one residue of VP1 region ...
Sabahat Noor*1, Shaukat Ali1, Hafeez-ur-Rahman1, Farhatullah2 and Ghulam Muhammad Ali1
...f this crop and require special attention to rectify the production loss. Among various abiotic stresses, drought and soil salinity have the most adversarial effect on wheat production. In this study the T2 transgenic (At-DREB1A) and non-transgenic line of lasani-08 from single transformation event was exposed to 15 days drought and different levels of salt concentrations separately. Four parameters i.e. sugar contents, proline contents, chlorophyll contents a...
Mehwish Aftab, Tariq Mahmud*, Muhammad Asim Raza Basra, Aqsa Gulzar, Sumaira Basharat and H.M. Junaid
...ub>O, to afford their respective complexes. FTIR, 1H NMR, UV-Vis and ICP techniques were used the characterization and structure elucidation of the prepared Schiff base and its La (III) and Ce (III) complexes. The proposed geometries of the complexes were established on the basis of metal ligand ratio through ICP. Schiff base showed antioxidant activity against diphenylpicrylhydrazyl (DPPH). The results showed that metal complexes are good antioxida...
Naila Chand1, Shamsullah1, Rafiullah1, Rifat Ullah Khan2, Muhammad Mobashar3, Shabana Naz4,*, Ebrahim Rowghani5 and Murad Ali Khan2
...ride (MOS) on the growth performance, weight of lymphoid organs and intestinal histomorphology of broilers during starter phase. A total of 180 day-old broiler chicks were distributed into 3 treatments, designated as MOS-0, MOS-50 and MOS-100 having MOS at the rate of 0, 50 and 100 g/kg respectively. Each treatment was further replicated 3 times having 10 chicks per replicate. Treatment MO...
Kiran Aftab1,*,Muhammad Asim2, Muhammad Khalil Nawaz2, M. Adeeb Babar2, Muhammad Akbar Khan2 and Zaheer Ahmed3
...s about newly recovered specimens of small sized giraffids from Dhok Bun Amir Khatoon and Kund. These Middle Miocene localities are found within the Chinji Formation of the Lower Siwalik Subgroup in northern Pakistan. Our reports include isolated teeth, maxilla and mandible fragments of Giraffokeryx punjabiensis and Giraffa priscilla, which exhibit some primitive features for the Lower Siwalik giraffids. This pape<...
New Diallel Cross Designs Through Resolvable Balanced Incomplete Block Designs for Field Experiments
Ijaz Iqbal1, Maqsooda Parveen1 and Zafar Mahmood2*
...justify;">Designing of experiment has a key role in laying out the experiment in agriculture sciences. In this paper an investigation is made of a special kind of incomplete block design known as the resolvable balanced incomplete block design. An algorithm is presented to construct diallel cross design through resolvable balanced incomplete block design...
Shagufta Naz*, Saima Sharif, Hafsa Badar, Syeda Fareeha Tauheed
...e main purpose of such type of research was directed to find the prevalence of Macular corneal dystrophy in the families of Lahore. The techniques used for the diagnosis of MCD were visual Acuity test by Snellen chart, phoropter, slit lamp biomicroscopy, topography, keratometer and pachymetry. In this study, 50 patients of MCD were identified among which 40 were males and 10 were females, including 9 cases with family history. Main complaint was drop in visual...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
... Among Pleurotus species (P. nebrodensis, P. sepidus, P. spodoecus), P. spodoecus expressed best statin formation i.e., 9.1±1.4 mg/g. Four physical parameters including temperature, pH, inoculums size and fermentation time (each at five levels) were optimized using central composite design (CCD) design in 30 triplicate experimental runs. The maximu...
Mohsin Iqbal1, Farid Asif Shaheen1*, Farah Naz2, Muhammad Usman Raja2, Muhammad Fiaz3 and Muhammad Nadeem1
... most destructive insect pests of chickpea in storages and renders the grains unfit for human consumption. In current studies, entomopathogenic fungi, Metarhizium anisopliae and Beauveria bassiana were used as the bio-control agents against this economic pest and proved good alternatives to chemicals. Less number of eggs (2 per grain), more number of hol...
İnan Kaya1,*, Muhitdin Yılmaz2, Müge Mavioğlu Kaya3,Abdulsamed Kükürt4 and Mahmut Karapehlivan5
...-D and 20 mg/L 2,4-D, respectively. The blood and liver samples were taken from the fish for biochemical studies at the end of the study period. Oxidative stress index (OSI) in plasma were evaluated as well as AST and ALT levels in the liver. Plasma OSI and liver AST levels in the groups with carbaryl and 2,4-D were compared with the control group, and they were found to be significantly higher. As a result, it was concluded...
Fehmeeda Fatima, Asif Nadeem* and Maryam Javed
.../i>) is a vulnerable subspecies of wild goat (Capra aegagrus), which faced serious population threats. In the present study, HSP70.1 gene has been partially sequenced (1344 bp) to study genetic diversity and evolutionary characteristics of Sindh ibex. In this research, samples of Sindh ibex were collected from Kirthar National Park, Sindh, Pakistan, the gene of interest was amplified, PCR products were sequenced and data was analyzed. The results of gen...
Muhammad Babar Khawar1, Muddasir Hassan Abbasi2*, Zillay Mariam1, Nadeem Sheikh1,2*
...0 diluted leachate intra-peritoneally. After 24 hours of the injection, animals were euthanized and blood was drawn for further studies. Data were analyzed using one way ANOVA. Serological analysis of both Group 1 and Group 2 showed a significant decrease of various components including Cl- (P=0.0023), K+ (P=0.0002), Na+ (P=0.0001), total proteins (P<0.0001) and albumin (P<0.0001) when compared against control. Similarly,...
Muhammad Zahid1, Aneela ZameerDurrani1, Muhammad Ijaz1, KhushiMuhammad1,Muhammad Usman1,*, Muhammad Husnain1 and Nadeem Kamal2
...affected as compared to open housed animals. When comparative efficacy of diagnostic tests was done then the results of RT-PCR was found significant (P>5), than complement fixation test.
...
Mouslim Bara1,2,* and Luciano N. Segura3
...ied the effect of air temperature and water depth on bird abundance and two ecological diversity indices (Shannon and Shannon E). Significant inter-annual fluctuations in bird abundance were recorded. Maximum values were always recorded during autumn. Water depth correlated positively with bird abundance and Shannon index. Field samplings indicated that bird abundance was frequently higher than 1000 individuals, which suggests that this site is an important re...
Ashraf M. Mounir, A.N. El shahat* and A.M. Abdul Azeem
... stress, inflammation, hyper-lipidemia and increase cardiac marker enzymes. Treatment of rats with GFAE (45 mg/kg/day) prior to injection of ISO provide significant cardio-protective effects evidenced by an obvious reduction in the level of cardiac marker enzymes, inflammatory factors and lipid contents with marked improvement in the cardiac antioxidant status and reduction of lipid peroxidation relative to untreated ...
Tahira Batool1*, Nabila Roohi1, Athar Mahmud2
...-6th week, respectively (3-phased) to group C. These birds were placed in Randomized Complete Block Design (RCBD) with a factorial arrangement of 3(lysine regimens) × 4 (varieties) × 20 (replicates) with one bird in each replicate under standard conditions of house management. For slaughter and carcass characteristics at the age of eighteen weeks, 72 birds including 18 from each variety with 6 from each group were randomly selected ...
Umair Riaz1*, Muhammad Ali Kharal2, Ghulam Murtaza3, Qamar uz Zaman4, Sana Javaid4, Hina Ahmed Malik3, Humera Aziz3 and Zafar Abbas1
...ds that help plants to cope with stress conditions by reducing the intensity of stress through enhancing antioxidants activities, detoxifying toxic ions, regulating the uptake of nutrients and by mediating the transport and distribution of different hormones. Caffeic acid is actively involved in plant physiology and mechanisms of stress tolerance primarily utilized by plants for the synthesis of lignin which ultimately thickened cell walls and plant become res...
Asma Sohail1*, Kashif Sarfraz Abbasi1, Maryum Arif2 and Fatima Najam1
...pkin seed oil (Cucurbita pepo). Pumpkin seeds contain many active ingredients including polysaccharides, vitamins, proteins, essential amino acids, carotenoids, fatty acids like linoleic acid and linolenic acid, lignans, minerals and various phytochemicals. Due to the presence of two unsaturated fatty acids, these oils can reduce their biological activity on heating, volatilization, and other parameters like oxidation and UV rays. This limits the commercial ap...
Shoaib Nawaz1, Muhammad Razaq1, Zahid Mahmood Sarwar1*, Muhammad Sajjad1*, Syeda Aneeza Ubaid1, Muhammad Asif Zulfiqar2 and Usman Haider1
... Ghanaians diet. Sucking pest jassid become major problem on okra in tropical and subtropical regions and cause heavy losses. Neonicotinoid insecticide, like nitenpyram was used on calendar basis and ETL basis. Data was recorded on weekly basis. In first week jassid population in control and ETL treatments was equal with non-significant difference between them while in calendar treatment population was significantly low. ETL and calendar base treatments give m...
Saleh S. Alhewairini
...onditions. The mortality percentages of O. afrasiaticus were 61.79, 73.58 and 82.90%; 62.87, 73.77 and 83.32%; 71.70, 82.23 and 92.37% after one week of exposure to the quarter recommended dose (QRD), half recommended dose (HRD) and recommended dose (RD) of oxamyl only and with the recommended dose (RD) of Injo200 or 1000ppm of Huwa-SanTR50, respectively. The percentages of larvae h...
Muhammad Arshad*, Sabeeta Jan, Sundas Awan, Samra Azam, Shiguftah Khalid and Muahmmad Ayub Khan
... justify;">Locally developed twenty four sunflower hybrids were appraised for different agronomic traits to assess genetic specifications, genetic divergence, and correlation coefficient, direct and indirect effects of eight characters towards seed yield under field condition. Experiment was conducted according to RCBD design at NARC (National Agricultural Research Centre), Islamabad durin...
Adem Aksoy1, Yakup Erdal Ertürk2, Ecevit Eyduran3 and Mohammad Masood Tariq4,*
...luence of dam age, genotype, birth weight, year, sex and birth type at lambing, weaning weight, weaning age, grazing period and weight at the end of the grazing period on pasture revenue, which is defined as the obtained revenue per lamb from weaning period to the end of the grazing ...
Muhammad Latif2, Muneer Abbas1*, Faisal Hafeez2 and Dilbar Hussain2
...na are major devastating pests of our summer vegetables especially brinjal and okra. Six insecticides viz. spinetoram 120 SC, spinosad 240 SC, bifenthrin 10 EC, cypermethrin 10 EC, chlorantraniliprol 20 SC and flubendiamide 480 SC were applied on brinjal and okra against these pests with five replications. Data was recorded after 24 hrs. 72 hrs. 7 and 10...
Ejaz Mahmood Ahmad Qureshi1,*, Amtul Bari Tabinda2, Seemal Vehra3 and Atif Yaqub4
...enomenon responsible for persistence of the viruses during inter-epidemic period (s) of the disease. In the present study, distribution and seasonality of horizontally transmitted dengue viruses in Aedes mosquitoes was investigated in the metropolitan city Lahore, Pakistan during 2011, 2012 and 2013. Adult Aedes aegypti, were captured from nine towns and one Cantonment Board of the city using back-pack mechanic...
Ghazunfar Rashid1, Muhammad Avais1, Syed Saleem Ahmad1, Muhammad Hassan Mushtaq2, Rais Ahmed3,*, Mahboob Ali1, Muhammad Naveed-ul-Haque4, Mehtab Ahmad5, Mumtaz Ali Khan1 and Naimat Ullah Khan6
...ljam) and Brassica Campestris (Sarson) were estimated twice a day i.e. early morning and afternoon. The fodder samples were collected from different villages of Okara, Pattoki and Ravi areas of the Province Punjab. Nitrate contents of different parts of the fodder plants were estimated qualitatively through the Diphenylamine Filed Test (DFT) and quantitatively by spectrophotometry. The nitrate levels were highe...
Jafar Aqeel Naqi1, Abdul Mateen1, Dilawar Hussain2,*, Hafiz Muhammad Tahir2, Sajjad Hussain1 and Abuzar Tabasum1
...eed ingredient on growth performance and immune response in Nile tilapia (Oreochromis niloticus). A total of 150 juvenile’s tilapia were taken randomly and divided into five experimental units (10 fishes per unit) with three replicates. Fish was hand feeded containing five different levels of garlic (T1, control) 2.5 (T2), 5.0 (T3), 7.5 (T...
Tariq Mahmood1,*, Ijaz Ahmad1, Faraz Akrim1, Abdul Hamid1, Muhammad Waseem1, Abid Hussain1 and Muhammad Sajid Nadeem2
... breeding season of the species starts from February: peak breeding months being March and April, during which frequent breeding calls were heard. The calling frequency ranged from 0.15 per minute to 0.3 per minute. Six active nests of Chukor were found at five different sampling sites; nest location was mostly on sloping areas under sanatha Dodonaea ...
Tevfik Ceyhan1,*, Osman Samsun2 and Okan Akyol1
...from 26.6 to 177.2 g, respectively. Female: male ratio was 0.3:1. The LWR parameters (a, b, r2) were computed as 0.0009 ± 0.50, 3.040 ± 0.32 and 0.902 ±0.40, respectively. The age of garfish was between 1 and 4 years. The estimated von Bertalanffy growth parameters with standard errors were L∞= 55.74 ±26.75 cm, K= 0.28 ±0.42, and t0=-1.68 &plusm...
Muhammad Mohsin1, Dai Guilin1,*, Chen Zhuo1, Yin Hengbin1 and Muhammad Noman2
...ommercially hunted fish species. In this study maximum sustainable yield (MSY) of Carangoides fishery from Sindh, Pakistan is estimated by using catch and effort data. For data analysis, two specialized fishery software CEDA (catch and effort data analysis) and ASPIC (a stock production model incorporating covariates) were employed. Three surplus production models (SPMs) viz., Fox Model (FM), Schaefer Model (SM) and P...
Sajid Ali Khan1, Mazhar Hussain Ranjha1, Azhar Abbas Khan2,*, Muhammad Sagheer1, Amjad Abbas1 and Zeshan Hassan2
...rsquo;s most destructive pests of cereals, oilseed, malting, and other foodstuffs. Current studies were aimed to investigate the effect of essential oils of two different medicinal plants (Dhatura alba and Calotropis procera) against two different strains of T. granarium. Plant extracts were obtained by Rotary Shaker apparatus by using acetone as solvent. Four different concentrations 5%, 10%, 15% and 20% were prepared by diluting in aceto...
Saba Irshad*, Aruba Muhammad, Ammara Muazzam, Farah Sarfraz Anmol and Rehman Shahzad
...41 bp, 418 bp, 230 bp respectively. Xmn1 restriction site was present at 158 bp upstream of the Gamma globin gene on chromosome 11 of positive patients (GenBank KY927385). Fetal hemoglobin level in Xmn1 (-/+) and (+/+) was 59.1% and 19% respectively which minimize their transfusion frequency to 30 days in comparison to 7-15 days in Xmn1 -/- patients. Hematological analysis of thalassemic patients revealed low Hb, WBCs and pl...
Zafar Iqbal*, Farah Ansar, Zil-e-Huma
...longing to 10 different species were examined for parasitic, fungal and bacterial infection. The fish species studied were; Carassius auratus and its six varieties (shubunkin, comet, black moor, oranda, double tail and fantail); molly Poeciliasphenops; platy Xiphophorus maculates; sword tail Xiphophorus helleri; guppy Poecilia reticulata; tiger oscar Astronotus ocellatus; koi ca...
Nadia Khan1*, Abdul Waheed1, Farrukh Siyar Hamid1, Naveed Ahmed1, Zafar Iqbal2, Seemab Ali1, Madiha Bashir1 and Hina Gul3
...ytopathogenic bacterial species (Clavibacter sp. and Xanthomonas sp.) and a human pathogenic bacterium (Escherichia coli) in 2016. Experiment was carried out by using complete randomized design with three replications in vitro. Phytochemical analysis reveals that the methanolic fraction of oil possesses metabolites like carbohydrates, amino acids, alkaloids, flavonoids and glycosides. To test the antibacterial activity of th...
Muhammad Aqeel Sarwar*1, Shahid Riaz Malik1, Waqas Ahmad2, Muhammad Sajid Mahmood3, Muhammad Jawad1, Muhammad Asadullah1, Ijaz Ahmad4 and Muhammad Imran1
... time and suitable genotype for rainfed conditions of the area. The treatments were five sowing dates (15 June, 25 June, 05 July, 15 July and 25 July) and two promising genotypes (NM-11, NCM-2013). Experiment was laid out in randomized complete block design (RCBD) with split plot arrangement by using three replications. Data regarding growth, yield attributes and yield were collected and a...
Syed Atif Hasan Naqvi1*, Ummad-ud-Din Umar1, Ammarah Hasnain2, Ateeq ur Rehman1 and Rashida Perveen1
... glass house and field experiments to determine their efficacy against Xanthomonas oryzae pv. oryzae. In vitro and in vivo studies under different conditions showed significant response of Mentha piperita, Azadirachta indica and Aloe vera either tested individually or in combination of two or more than two decoctions against the bacterium in question. When used individually, M. piperita de...
Muhammad Kashif Asghar1, Muhammad Aqeel Sarwar1,2*, Shahid Riaz Malik2, Waqas Ahmad3, Sumaira Zareen4, Safdar Ali5 and Abid Ali6
... as a source of B. The experiment was laid out in randomized complete block design with factorial arrangement in triplicate run. Results from the experiment revealed that all the seed treatments significantly improved achene yield, yield attributes and oil contents of sunflower. However, seed priming with 1 mM B solution was the best treatment in improving achene yield and oil contents of sunflower hybrid. While in case of h...
Zubina Hameed1, Muhammad Azim Malik1, Safdar Ali1*, Muhammad Ansar1, Farina Shaheen1, Ijaz Ahmad2 and Khisrao Kalim3
...ce kind of farming and dependence on rainfall, people are reluctant to do expenses on chemical control of weeds in wheat. Similarly, due to lack of awareness, they use wheat weeds as animal fodder and the hand weeding affects crop stand and its tillering which ultimately reduces the wheat yield of the pothwar region. So, chemical control of weeds was hypothesized to be the best solution fo...
Tünay Kontaş Aşkar1,*, Şinasi Aşkar1, Olga Büyükleblebici2 and Murat Güzel3
...sceral leishmaniasis was performed by the immune fluorescence antibody test with antibody titter ≥1:128 and lymph node smear examination. In blood samples of dogs with visceral leishmaniasis, levels of malondialdehyde, total antioxidant capacity, glutathione, nitric oxide, myeloperoxidase, adenosine deaminase and cytokines (TNF-alpha, IL-1β) were determined and compared with the healthy controls. Significantly high l...
Amjad Islam Aqib1,*, Shagufta Nighat2, Rais Ahmed3, Saba Sana3, Muhammad Ameen Jamal4, Muhammad Fakhar-e-Alam Kulyar2 , Naimat Ullah Khan5, Mian Saeed Sarwar5, Muhammad Asif Hussain5, Asadullah5, Attaur Rahman5 and Sadeeq ur Rahman5,*
...g susceptibility against penicillins, cephalosporins, macrolides and other drugs showed that 50% of CPS and 30% of CNS were found multi-drug resistant-exhibiting resistance against more than two or more than two classes of drugs. None of the CPS while 20 % from CNS isolates were 100% susceptible to all kinds of drugs tested. Finally, age, grazing system, use of beta-lactam antibiotics, parity, and poor hygiene were potential risk factors. Altogether, the study...
Nizam Uddin Jamali1, Asmatullah Kaka1,*, Pershotam Khatri1, Moolchand Malhi2, Muhammad Naeem3, Akeel Ahmed Memon1, Rameez Raja Kaleri4, Habibullah Janyaro5 and Dildar Hussain Kalhoro6
... membrane integrity and sperm concentration, post chilling for motility, morphology, live dead ratio, membrane integrity and frozen thawed for motility, morphology, live dead ratio and membrane integrity. Semen volume and colour were determined by visual examination, pH was determined by digital pH meter. Motility was determined under microscope at10x magnification, morphology and live dead ratio was assessed using eosin nig...
*Nageen Fatima1, Sadia Murawwat1 and Syeda Ameena Rizvi1
EVALUATION OF IMAGE COMPRESSION TECHNIQUES: AN IMPLEMENTATION OF TRUE COMPRESSION ON 2-D IMAGE
...Per-Pixel (BPP) ratio as performance parameters. Image compression by Huffman encoding, Embedded Zero tree Wavelet (EZW) and Set Partitioning in Hierarchical Trees (SPINT) technique is performed. The result showed that lossy techniques are reliable to save hardware memory consumption but having low CR ratio. In lossless techniques, CR ratio is higher and it uses more space to store compressed image. Proposed comparison betwe...
*Muhammad Waseem1, Dost Mohammad Baloch1, Ghulam Khaliq1,
M. Rashid1, Qurban Ali2 and Mustajab A. Khan3
INTENSIFICATION IN BAMBOO (Bambusa bambos L.) TRAITS IN RESPONSE TO ORGANIC AND CHEMICAL NITROGEN ALONG THE COAST OF ARABIAN SEA
... bamboo traits a field experiment was conducted during 2014-15. Experiment were carried out using randomized complete block design (RCBD) with square system of transplanting which was consist of 3 repetitions contained a net field size of 4.5m to 4.5m. Experimental sites were 20 km away from the Arabian Sea with an altitude of 2m. The bamboo (Bambusa bam...
*Irum Javed1, Muhammad Asgher2, Sadia Noreen1, Humara Naz Majeed1 and Tanzila Sahar1
SOLID STATE FERMENTATION OF ASPERGILLUS NIGER FOR CITRIC ACID PRODUCTION USING AGRICULTURE RESIDUE AS SUBSTRATE
...tion of citric acid by Aspergillus niger using agro-industrial wastes. In the first step of study the liquid state fermentation (LSF) and solid state fermentation (SSF) by Aspergillus niger was compared using molasses based medium and the different carrier substrate. In a second set of study wheat bran was utilized for citric acid production via fermentation parameters was optimized. The results showed significant (P≤ 0.0...
Sadia Murawwat1, *Nageen Fatima1, Qandeel Iqbal1, Syeda Ameena Rizvi1 and Mehak Fatima1
ELECTRICAL ENGINEERING BEYOND CLASSROOM: CHALLENGES AND ANTICIPATED RESOLUTIONS
...ducation (EE) plays an imperative role in the development of any country via improving the standard of life. This article highlights key issues, challenges and anticipated resolutions of Electrical Engineering Education in Pakistan. Data analysis imitates following problems relating to EE: dearth of professionalism in academia, insufficient educational capitals, not as much of hardware research laboratories at post graduate level, insufficient practical traini...
Nadia Sharif1, *Neelma Munir1 and Shagufta Naz1
MICROBIAL PRODUCTION OF ALGINATE
...e. Alginate favorable properties like ease of gelation and biocompatibility promote its applications in engineering and bio medical science....
M. Tariq Javed1, Nazir Ahmad2, Gulbeen Saleem3, Haleema Sadia4, Farkhanda Manzoor5 and Ghulam Hussain Dilbar
EFFECT OF AGE AND SEASON ON SEMEN CHARACTERISTICS OF BUFFALO BULL - A REVIEW
... literature on various aspects of semen parameters in buffalo bull at different age and in different seasons has been published with conflicting reports. An effort is made to review the literature gathered from different sources on semen characteristics in buffalo bulls which will be helpful to researchers and allied professionals in future research or policy planning. The review is bifurcated in different sections for easy understanding of the facts. The revi...
Muhammad Akram and Faheem Aftab
THIDIAZURON INDUCES IN VITRO BUD BREAK AND SHOOT DEVELOPMENT FROM NODAL EXPLANTS OF ORTHOTROPIC SHOOTS OF MAIDENHAIR TREE (GINKGO BILOBA L.)
...hoots were further developed, rooted and acclimatized to glasshouse conditions. We demonstrated that axillary buds of G. biloba could be initiated and proliferated with TDZ under in vitro conditions....
Nazish Mazhar Ali1, Saiqa Andleeb2, Bushra Mazhar1, Anum Imtiaz1, Shaukat Ali2*
Assessment of antibiogram and resistogram of pathogenic bacteria isolated from irrigated wheat field water
...d biochemical tests were performed to identify and characterize bacterial pathogens. Among isolated strains, two belong to genus Staphylococcus spp., other two were Pseudomonas spp. and one strain belonged to genus Salmonella spp. Effect of various parameters such as temperature and pH on growth of pathogens were also studied. Antibiogram and resistogram analysis were carried out through agar disc and agar well diffusion met...
Hareem Mohsin, Azka Asif*, Warda Fatima, Sarooj Nadeem, Anjum Nasim Sabri
Assessment of biocalcification by the water absorption test using microorganism from oil contaminated site
...ater absorption test was performed to check the presence of a protective layer that provides resistance to water penetration and corrosion to cement. The samples treated with calcium and urea for one hour were found better as shown by less absorption of water compared with the untreated samples. Application of Bacillus pasteurii on the cement or the cement based materials has the potential to conserve such materials and inc...
Hafiz Muhmmad Tahir1*, Rabia Yaqoob2
Comparing the efficiency of Taq DNA polymerase and PuRe Taq Ready-To-Go PCR beads in amplifying 12S and 16S ribosomal genes
...red with the newly developed amplification method, PuRe Taq Ready-To-Go PCR beads. One hundred seventy samples, including both fresh and up to five years old tissue samples, were compared. Taq DNA polymerase was found to be less efficient compared to the PuRe Taq Ready-To-Go PCR beads for amplification of the 12S rDNA gene. However, difference in the efficiency of both procedures was not statistically significant for the 16S rDNA gene. Furthermore, Taq DNA pol...
Phong Huy Pham
Nesting biology of a spider wasp Auplopus sp. (Hymenoptera: Pompilidae) in Vietnam
...cells, one of which was open. Each closured cell was provisioned with a single prey spider whose legs were amputated. The prey spiders were immatures of a species of the genus Heteropoda, family Sparassidae. Developmental time of egg, larva, pre-pupa, pupa, and pre-adult was 6 - 7, 13 - 14, 5 - 7, 41 - 43, and 3 - 4 days, respectively. The duration of egg to adult development ranged from 6...
Tanzeela Riaz*†, Farah Rauf Shakoori, Syed Shahid Ali
Toxicity of phosphine against tolerant and susceptible populations of Trogoderma granarium collected from Punjab, Pakistan
...ne of the most notorious pests of stored grains. This study was aimed to evaluate the toxicity of phosphine to 4th, 6th instar larvae and adult beetle in phosphine resistant populations viz.,
Sumera Siddique1,†, Hafiz Abdullah Shakir1, Javed Iqbal Qazi1*, Amtul Bari Tabinda2, Muhammad Irfan1
Screening of some agri-wastes for economical cultivation of Candida tropicalis SS1
... different fruit’s peels. The C. tropicalis SS1 was cultivated in media containing 2% pulverized peels of apples, mangoes, water melon and bagasse singly as well as in eleven different combinations. The media were inoculated with 1% (w/v) suspension of 24 h old yeast cultured in nutrient broth. The strain grew best in water melon (WM) at pH 7.0 and 37 °C under non agitation condi...
Muhammad Babar Khawar, Nadeem Sheikh*
Effect of paper industry leachate on various serological indices and serum proteins of wistar rats
...stify;"> Pulp and paper industry consumes more resources as compared to any other industry around the globe. The toxicity of waste water (leachate) resulting from paper processing has become a serious issue now a day. So, current research was aimed to assess various toxic aspects of pulp and paper industry waste water. Study design involved the divi...
Mian Azhar Ahmad1†*, Nawab Mohammad Khan2, Asmatullah3
Anatomical variations of hepatobiliary triangle in patients operated laparoscopically for gallbladder diseases from Lahore and Sahiwal
...ic gallstones during the period 2011 to 2015. All the patients irrespective of their age, sex, past history of acute cholecystitis and obesity were subjected to Laparoscopic cholecystectomy. Patients’ age was between 18-70 years, gender ratio was 1:3.5 with female dominance, mean operative time 99.6 minutes and patients remained admitted for 1–3days. The procedure was
Muhammad Tahir Waseem, Muhammad Awais Sarwar, Rana Manzoor Ahmad, Abdul Majid Khan*
Newly discovered fossil remains of Selenoportax vexillarius from Hasnot, locality of Siwaliks of Pakistan
.../p>...
Tahir Abbas*1, Khawaja Raees Ahmad2, Asmatullah3, Khalid Pervaiz Lone4, Muhammad Ali Kanwal2, Sadia Suleman2
Reno-hepatic protective effects of Jambul against chromium induced anomalies in mice
...nvironmental toxicants especially Cr+6 is novel and cheapest; that should be sponsored for ethno-medicinal purpose....
Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2*, Muhammad Khalid Mukhtar1, Arshad Ali3, Zafar Iqbal Kahan4, Kafeel Ahmed4
Intra- and inter-specific foraging in three scorpion species
...> Intra- and inter-specific feeding behaviour of three scorpion species: Mesobuthus tumulus (Fabricius, 1798), Odontobuthus odonturus (Pocock, 1897), and Androctonus finitimus (Pocock, 1897) inhabiting Punjab, Pakistan, was studied under laboratory and field conditions. Results of the study revealed that all three scorpion species were cannibalistic. Mesobuthus tumulus attacked and f...
Tasleem Akhtar, Nadeem Sheikh*
Induction of acute phase in response to tacrolimus induced hepatotoxicity
...(tacrolimus). Aqueous suspension of tacrolimus powder (3 mg/ml) was orally given to four experimental groups of wistar rats. Control group was provided with normal drinking water and dissections were done after 6, 12, 24 and 48 h of tacrolimus dose. Densitometric analysis revealed considerable elevated level of some positive acute phase proteins, specifically C-reactive protein, haptoglobi...
Hamda Azmat1, Waqas Ali2, Arshad Javid2, Ali Hussain2, Syed Makhdoom Hussain3, Zara Saeed1,Syed Shafiq Hussain Bukhari4
Chromium contamination in water, sediment and its bioaccumulation in Indian major carps in River Chenab, Pakistan
... the fish....
Riffat Mehboob1*, Sami Ullah Mumtaz2, Zoya Manzoor3, Sajid Abaidullah2, Fridoon Jawad Ahmad1
Deranged biochemical and hematological profile of septicemia patients in Mayo hospital, Lahore
...enal function tests were performed for all patients. Patients were divided into 3 age groups on the basis of age: 30-50, 51-70 and 71-90 years. In Liver function Tests, ALT (37.62%), AST (50.49%) and ALP (99%) were elevated, Bilirubin was normal in majority of patients while total protein was in normal range in 97.02% patients and the trend of albumin was towards low (44.55%).In Renal function tests, urea was elevated in 71.29% and creatinine in 51.48% patient...
Saiqa Andleeb* , Shaukat Ali
RNA interference; A tool for treatment of human diseases
... RNA fragments degraded specific homologous mRNA. RNAi technology used as an essential tool in several model organisms such as invertebrates, mouse and fly to explore the role of individual gene. In recent era, RNAi is directly used in therapy of various infectious and non-infectious diseases. Variety of human diseases like cancer, viral and neuromuscular has been controlled through RNAi. Some vectors and inducible systems are available now to treat numerous d...
Shagufta Andleeb*
Teratogenic potential of pyrethroids: a review
...nsive data on multiple aspects of genotoxicity, carcinogenicity, mutagenicity, reproductive toxicology and neurotoxicology is available except teratogenicity. This review concludes the teratogenic potential of sublethal doses of different types of pyrethroids in various groups of animals in systematic way. On line available data interpretation through Pubmed Central NCBI, Google Scholar and Google was done to achieve the tar...
Muhammad Zafar*1, Muhammad Khalil Ahmad Khan2, Asmatullah3
Efficacy of methamidophos, fenpropathrin and metasystox against aphid population within the response of Brassica campestris at Multan
...opulation on Brassica campestris. The experiment was conducted during October 2013 to April 2014. Crop season following a randomized complete block design (RCBD) with four replications and six treatments in the research farm of Babar Agricultural Farm at Old Shuja Abad Road, Multan. Different insecticides showed different mortality of aphid population. Of the three insecticides tested, methamidophos resulted in more than 80%...
Durr-e- Samin Tahir*, Waqar Nasir, Sarah Bushra, Fatima Batool
Height trends in the population of Rabwah, district Chiniot, Pakistan and comparison with WHO standards
...ights. The comparison of percentile curves of local height trend and WHO curves indicate
that local height trends are significantly lower than the WHO standard. The 50th percentile curve of the local
population was found in the range of 25th percentile curve of WHO standard....
that local height trends are significantly lower than the WHO standard. The 50th percentile curve of the local
population was found in the range of 25th percentile curve of WHO standard....
Tasneem Ikram1, Asmat Salamat2, Muhammad Akbar Khan2, Muhammad Adeeb Babar*2, Khalid Mahmood2, Rabia Shahid2, Muhammad Akhtar2
Additional Fossils of Sivalhippus perimensis (Mammalia, Equidae) from the Late Miocene Siwaliks of Pakistan
...scussed in the present paper have been recovered from the Dhok Pathan Formation of the Middle
Siwaliks in the Chakwal district, Punjab, Pakistan. The material was observed, compared with referred material and
identified as Sivalhippus perimensis.The material consists of isolated molars and premolars, which reflects all the
morphological features of Sivalhippus perimens...
Siwaliks in the Chakwal district, Punjab, Pakistan. The material was observed, compared with referred material and
identified as Sivalhippus perimensis.The material consists of isolated molars and premolars, which reflects all the
morphological features of Sivalhippus perimens...
Haji Muhammad1, Zafar Iqbal1, Tanveer Akhlaq2
Length-weight, length-length relationships and condition factor of fishes of family cyprindae from the Indus River, Pakistan
...ition factor (K) in 926 specimens belonging to 20 freshwater fish species of family cyprinidae. Fish samples were
collected on a monthly basis from August 2013 to July 2014 at Taunsa barrage from the Indus River, Punjab,
Pakistan. The values of parameter b for LWRs ranged from 2.16 – 4.10 suggesting the isometric and allometric
growth pattern in fishes of family cyprinidae. The results of K factors...
collected on a monthly basis from August 2013 to July 2014 at Taunsa barrage from the Indus River, Punjab,
Pakistan. The values of parameter b for LWRs ranged from 2.16 – 4.10 suggesting the isometric and allometric
growth pattern in fishes of family cyprinidae. The results of K factors...
Mohammad Salim1, Arshad Javid2*, Ali Hussain2, Faiz-ur-Rahman3, FarmanUllah4, Hamidullah5
Distribution records of fruit bats Cynopterus sphinx and Rousettus leschenaultii from Khyber Pakhtunkhwa, Pakistan
...eatures of the captured specimens were compared with
available literature. Baculum morphometry is one of the key features in identification of bat species and was applied
for species confirmation of R. leschenaultii. R. leschenaultia has been already reported while C. sphinx being
reported for the first time from the study area. Pteropus giganteus is another new record...
available literature. Baculum morphometry is one of the key features in identification of bat species and was applied
for species confirmation of R. leschenaultii. R. leschenaultia has been already reported while C. sphinx being
reported for the first time from the study area. Pteropus giganteus is another new record...
Muhammad Mohsin Ahsan1, Hafiz Muhammad Tahir2, Muhammad Khalid Mukhtar1
Effect of lunar cycle on active population density of scorpions, their potential prey and predators
...ities of three scorpion species, Hottentotta tamulus,
Odontobuthus odonturus, and Androctonus finitimus, and their potential prey and predators were observed in the
field. The result showed that H. tamulus and A. finitimus were more active during dark nights compared to moonlight
nights; however, there was no obvious effect of the lunar cycle on the activity of O. odonturus. Young (Immature)
individuals of all scorpion s
Odontobuthus odonturus, and Androctonus finitimus, and their potential prey and predators were observed in the
field. The result showed that H. tamulus and A. finitimus were more active during dark nights compared to moonlight
nights; however, there was no obvious effect of the lunar cycle on the activity of O. odonturus. Young (Immature)
individuals of all scorpion s
Studies on amylase and lipase activity in fishes fed with diet containing different feed ingredients
Mirfa Murtaza1, Sajid Abdullah1, Wardah Hassan1*, Khalid Abbas1, Huma Naz1, Muhammad Anjum Zia2
Studies on amylase and lipase activity in fishes fed with diet containing different feed ingredients
...;2×2 ft) for each species and ten fish in each
aquarium. Fish in one aquarium were fed on rice polish and fish in second aquarium were fed on corn gluten @ 3 %
of their wet biomass for 70 days. Results showed that fish wet weight varied significantly between the rice polish and
corn gluten fed fishes. The corn gluten fed fish showed significantly better growth performance than fish fed with rice
aquarium. Fish in one aquarium were fed on rice polish and fish in second aquarium were fed on corn gluten @ 3 %
of their wet biomass for 70 days. Results showed that fish wet weight varied significantly between the rice polish and
corn gluten fed fishes. The corn gluten fed fish showed significantly better growth performance than fish fed with rice
Mohammad Salim1, Arshad Javid2*, Ali Hussain2, Faiz-ur-Rahman3, Hamidullah4
First provincial record of desert yellow bat Scotoecus pallidus (Dobson, 1876) from Khyber Pakhtunkhwa, Pakistan
...at (Scotoecus pallidus) specimens were captured using mist and hand nets. The morphological features of the captured specimens were compared with available literature. This paper documents first record of S. pallidus from Khyber Pakhtunkhwa....
Nasir Raza Zaidi1, Mian Waheed Ahmad1, Mahesh Gautam1, Riffat Mehboob2*
Risk factors for multiple sclerosis in Pakistani population- A crosssectional study
...indings of MS were retrospectively evaluated. Mean age of the patients
was 43.07±13.88 years, with youngest patient as 18 years old and eldest as 65 years. Our study depicted 19% cases
of MS were smokers. 8% of the patients had positive history for viral infections. 8 % of the patient had low level of
serum vitamin D and 30% of the patients had positive family history. Current study shows viral infections, smoking,
and hypovi...
was 43.07±13.88 years, with youngest patient as 18 years old and eldest as 65 years. Our study depicted 19% cases
of MS were smokers. 8% of the patients had positive history for viral infections. 8 % of the patient had low level of
serum vitamin D and 30% of the patients had positive family history. Current study shows viral infections, smoking,
and hypovi...
Muhammad Moosa Abro1, Ali Murtaza Dharejo2, Muhammad Munif Khan2, Nadir Ali Birmani2, Saima Naz2*
Description of first record of Petasiger exaeretus Dietz, 1909 (Trematoda: Echinostomatidae) in avian host from Pakistan.
...bsp;The aim of present paper is to describe first record of genus Petasiger which was collected during systematic study of
helminths of Little Cormorant, Phalacrocorax niger of District Sanghar, Sindh, Pakistan. Petasiger exaeretus (Dietz,
1909) were identified from the intestine of Little Cormorant, Phalacrocorax niger on the basis of morphological
features including pear shape<...
helminths of Little Cormorant, Phalacrocorax niger of District Sanghar, Sindh, Pakistan. Petasiger exaeretus (Dietz,
1909) were identified from the intestine of Little Cormorant, Phalacrocorax niger on the basis of morphological
features including pear shape<...
Muddasir Hassan Abbasi1, 2, Noor Fatima1, Syed Shahid Imran Bukhari1, Asma Rashid khan3, Nadeem Sheikh2*
Variations in proteins and transaminases following experimental induction of Bisphenol A in mice
...ative analysis between experimental and control samples revealed protein fractions (KDa) of 149, 132, 101,
72, 75 and (163, 114, 91, 75, 72, respectively. Conclusively, it can be stated that extensive use of BPA in various
application cause serious health hazards, as noted by changes in serum proteins and transaminases. Therefore,
further investigation of its toxicity is necessary in order to consider it...
72, 75 and (163, 114, 91, 75, 72, respectively. Conclusively, it can be stated that extensive use of BPA in various
application cause serious health hazards, as noted by changes in serum proteins and transaminases. Therefore,
further investigation of its toxicity is necessary in order to consider it...
Saima Naz*, Adil Ali Rajpar, Abdul Hameed Chandio
New Records of some Phthiraptera (chewing lice) of birds from urban areas of Hyderabad, Sindh, Pakistan
...dae and Philopteridae respectively were reported from different localities of Hyderabad city.
It was the first chewing lice survey that has been carried out in the region, which reported eight species of
Menoponidae and eleven species of Philopteridae. These species were Campanulotes compar (Burmeister, 1838),
Colpocephalum turbinatu...
It was the first chewing lice survey that has been carried out in the region, which reported eight species of
Menoponidae and eleven species of Philopteridae. These species were Campanulotes compar (Burmeister, 1838),
Colpocephalum turbinatu...
Abbas Ali1, Muhammad Altaf2*, Muhammad Samar Hussain Khan3
Winter survey of birds at Keti Bunder, district Thatha, Pakistan
...f 49 winter season bird species belonging to 33 genera
and 21 families were recorded. A total of 4280 birds were recorded dedicated survey effort from the Keti Bunder.
Dominance (D), Shannon-Wiener diversity Index (H’), Simpson Index (S), Evenness (E) and Margalef (R) were
observed form the study area as; 0.06, 3.23, 0.94, 0.52 and 5.74 respectively. During the surveys noted that most
abunda...
and 21 families were recorded. A total of 4280 birds were recorded dedicated survey effort from the Keti Bunder.
Dominance (D), Shannon-Wiener diversity Index (H’), Simpson Index (S), Evenness (E) and Margalef (R) were
observed form the study area as; 0.06, 3.23, 0.94, 0.52 and 5.74 respectively. During the surveys noted that most
abunda...
Abir Ishtiaq, Muhammad Naeem*
Length-weight relationships and condition factor for farmed Catla catla (Hamilton, 1822) from southern Punjab, Pakistan
...lusmn;14.55 g,
respectively. For LWRs, specimens of C.catla were collected from fish ponds and grouped into three categories on
the basis of the feed offered to them which contained 15%, 20% and 25% crude protein (CP). The regression
estimates for LWRs were highly significant (P <0.001) with coefficient of determination, r2-values being >0.930 in the
three...
respectively. For LWRs, specimens of C.catla were collected from fish ponds and grouped into three categories on
the basis of the feed offered to them which contained 15%, 20% and 25% crude protein (CP). The regression
estimates for LWRs were highly significant (P <0.001) with coefficient of determination, r2-values being >0.930 in the
three...
Jhan Zeb, Muhammad Javed
Forecasting percentage contribution of plankton biomass towards increase in fish yield under composite culture conditions
...ere five different fish species in
each of the triplicate group viz. Labeo rohita, Catla catla, Cirrhina mrigala, Ctenopharyngodon idella and
Hypophthalmichthys molitrix in the ratio of 27:10:10:07:13, respectively. Each triplicate group of fish T1 to T6 were fed
supplementary diets at varying protein level viz., 22, 24, 26, 28, 30 and 32% digestible protein (DP), respe
each of the triplicate group viz. Labeo rohita, Catla catla, Cirrhina mrigala, Ctenopharyngodon idella and
Hypophthalmichthys molitrix in the ratio of 27:10:10:07:13, respectively. Each triplicate group of fish T1 to T6 were fed
supplementary diets at varying protein level viz., 22, 24, 26, 28, 30 and 32% digestible protein (DP), respe
Zafar Iqbal*, Hafiza Madhia Imtiaz
Parasites of double tail goldfish, Carassius auratus L. imported to Pakistan
...auratus. A total of 25 experimental fish were examined for parasitic infection. One fish
specimen showed head lesion (1x1cm). Eight different species of parasites were observed on the fish.
The gills showed 100% infection by Dactylogyrus sp. and mean intensity was 35.4. Fins of the fish also
showed high infection (68%) and mean intensity (13.82) by Gyrodactylus sp. Arg...
specimen showed head lesion (1x1cm). Eight different species of parasites were observed on the fish.
The gills showed 100% infection by Dactylogyrus sp. and mean intensity was 35.4. Fins of the fish also
showed high infection (68%) and mean intensity (13.82) by Gyrodactylus sp. Arg...
Asma Karim1, Wajid Ali1*, Noreen Ahmad1, Muhammad Irfan2, Hafiz Abdullah Shakir3
Histological and biochemical study of liver of silver carp (Hypophthalmichthys molitrix) after acute exposure to pyrethoride (deltamethrin)
...Deltamethrin is a broad spectrum synthetic pyrethroid pesticide. It is considered less toxic as compared to organochlorine and organo-phosphate pesticides. Deltamethrin was selected to study the biochemical and histological
alterations in liver of silver carp. The LC50 1.6 μg/L was determined. Fish (n=6) were dividing into 4 groups A (control)
B, C and D (ex
alterations in liver of silver carp. The LC50 1.6 μg/L was determined. Fish (n=6) were dividing into 4 groups A (control)
B, C and D (ex
Dilara Abbas Bukhari1, Abdul Rehman2*
Isolation of bioactive compounds from exudate of edible fungus, Pleurotus ostreatus
...yer chromatography, high performance liquid chromatography and gas chromatography/mass spectrometry, were employed to study fungal exudate. A total of fifteen different metabolites were detected in the sample by GC/MS. The detected metabolites could be classified into chemical groups of 2 esters, 4 alcohols, 3 benzoic acids, ketone, aldehyde, phenyl and amide groups containing compounds. Some of these may be classified into ...
Hafiz Muhammad Awais Sarwar, Muhammad Tahir Waseem, Abdul Majid Khan*, Rana Manzoor Ahmad
Propotamochoerus hysudricus remains from late Miocene deposits of Hasnot, Pakistan
...sil remains of the Suid species, Propotamochoerus hysudricus are described in this paper on the basis of
their morphometric characters. This is perhaps the only known species of the genus Propotamochoerus in the
Siwaliks. The specimens are collected from the outcrops of Hasnot typ...
their morphometric characters. This is perhaps the only known species of the genus Propotamochoerus in the
Siwaliks. The specimens are collected from the outcrops of Hasnot typ...
Sadaf Niaz1, Masroor Ellahi Babar2, Tanveer Hussain2, Asif Nadeem1, Misbah Hussain1, Riffat Mehboob3*, Fridoon Jawad Ahmad3
Mutation analysis of RING1 domain of Parkin in early onset of Parkinson’s disease in Pakistani patients-a pilot study
...arkin
protein was performed in a sample set of 30 patients (selected from different areas of Punjab, Pakistan) to find out
any Single Nucleotide Polymorphism (SNP).No SNP was detected in RING1 domain that could be related to the
disease. The data suggests that no genetic predisposition in RING1 domain may be responsible for the occurrence of
disease in local population. It may be due to genetic changes in any other part of the gene ...
protein was performed in a sample set of 30 patients (selected from different areas of Punjab, Pakistan) to find out
any Single Nucleotide Polymorphism (SNP).No SNP was detected in RING1 domain that could be related to the
disease. The data suggests that no genetic predisposition in RING1 domain may be responsible for the occurrence of
disease in local population. It may be due to genetic changes in any other part of the gene ...
Bushra Siyal1, Sanjota Nirmal Das1, Rafia Rehana Ghazi2, Aly Khan3
Heterotestophyes gibsoni sp.n. (Trematoda: Heterophyidae) from the bird little tern (Sternula albifrons) in Sindh, Pakistan
...rasites of birds, a new species of trematode genus Heterotestophyes gibsoni
sp. n. was recorded from the intestine of little tern (Sternula albifrons) collected from Jamshoro, Sindh, Pakistan. The
new species is characterized by having small body, maximum width attained at the level of mid body region and
twisted at the level of pharynx. Oral sucker terminal, rounded and broader than long. Esophagus long...
sp. n. was recorded from the intestine of little tern (Sternula albifrons) collected from Jamshoro, Sindh, Pakistan. The
new species is characterized by having small body, maximum width attained at the level of mid body region and
twisted at the level of pharynx. Oral sucker terminal, rounded and broader than long. Esophagus long...
Haniya Mazhar1, Naaz Abbas2, Zahid Hussain3, Amir Sohail4, Syed Shahid Ali4*
Extracellular lipase production from Bacillus subtilis using agro-industrial waste and fruit peels
...10.00 and 16.23 U/ml, respectively. The lipase production by B. subtilis using peels of different fruits, including banana, orange, water melon and melon as carbon source, was 27.17, 21.37, 10.57 and 8.43 U/ml, respectively. The corn cob produced 12.27 U/ml while waste oils of various industries produced 16.17 U/ml (Shan oil), 13.67 U/ml (automobile), 13.37 U/ml (unbranded waste cooking oi...
Muhammad Babar Khawar1, Muddasir Hassan Abbasi1, 2, Sana Fatima3, Khawaja Abdul Mujeeb2, Nadeem Sheikh1
Alterations in proteins and transaminases activity induced by thioacetamide in albino rats
...24h group. Each
experimental group (12h and 24h) was administered 300 mg/ kg TAA intraperitoneally (i.p) while control received
same volume of normal saline solution. Rats of 12h and 24h group were killed after 12 and 24h of TAA administration
respectively. Blood was obtained; livers were excised and processed for protein profile and transaminases activity
analy...
experimental group (12h and 24h) was administered 300 mg/ kg TAA intraperitoneally (i.p) while control received
same volume of normal saline solution. Rats of 12h and 24h group were killed after 12 and 24h of TAA administration
respectively. Blood was obtained; livers were excised and processed for protein profile and transaminases activity
analy...
Anam Javed, Javed Iqbal Qazi*
Skin health implications of Chemical detergents and importance of biodetergents
...modifications in every aspect of life are continuously occurring. No doubt, these modifications are improving life standards but among them some are harmful for our health. Along with numerous benefits, side effects of formulated synthetic chemicals are needed to investigate further to develop alternatives with ideally no or at least less side effects. This review highlights a wide range of dermal disorders which are produced due to synthetic detergents. It ha...
Shaukat Ali1,*, Sundas Nasreen1, Sobia Safeer1, Saiqa Andleeb1, Mubashir Ejaz1, Saira Bano2, Hafiz Abdullah Shakir3
Medicinal plants as therapeutic agents for cancer treatment
...nts and are used as therapeutic agents in worldwide. Technical
strategies based on the natural yield of drug innovation, ethnomedicines and traditional pharmacology is reemerging
to caring good base as striking discovery train. The current declined in the number of new molecular entities from the
medicinal industry, unique anticancer agents are being required from traditional medicines. According to recently
published data, this art...
strategies based on the natural yield of drug innovation, ethnomedicines and traditional pharmacology is reemerging
to caring good base as striking discovery train. The current declined in the number of new molecular entities from the
medicinal industry, unique anticancer agents are being required from traditional medicines. According to recently
published data, this art...
Maleeha Manzoor1,2*, Ruijuan Ma2, Hafiz Abdullah Shakir1, Fouzia Tabssum1, Javed Iqbal Qazi1
Microalgal-bacterial consortium: a cost-effective approach of wastewater treatment in Pakistan
...ay prove technically cheaper and advance technology. It will finally help in dealing
the dual mission of producing valuable metabolites and pollutants/nutrients removal from wastes/wastewaters.
Agricultural wastes/residues generated abundantly in energy deficient countries like Pakistan, having enormous
energy potential, are not utilized efficiently and considered as wastes only. The present review focuses on the current
research on...
the dual mission of producing valuable metabolites and pollutants/nutrients removal from wastes/wastewaters.
Agricultural wastes/residues generated abundantly in energy deficient countries like Pakistan, having enormous
energy potential, are not utilized efficiently and considered as wastes only. The present review focuses on the current
research on...
Zubair Ahmed#, Muhammad Farhanullah Khan, Habiballah Rana*
Toxicological effects of Haloxylon recurvum Bunge ex Boiss (Khar Boti) whole plant extract and novel insecticide chlorantraniliprole against maize weevil, Sitophilus zeamais Motschulsky
... variety of stored grain pests attack stored commodities at storage facilities.
Among these, maize weevil, Sitophilus zeamais is one of the most threatening
pests. Botanical insecticides derived from plants have increased popularity in
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
...
Among these, maize weevil, Sitophilus zeamais is one of the most threatening
pests. Botanical insecticides derived from plants have increased popularity in
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
...
Hafiz Muhammad Tahir1*, Zafar Iqbal Khan2, Saira Batool2, Kafeel Ahmad2, Salma Begum2
Residual effect of lambda-cyhalothrin on abundance of insect pollinators in marigold field patch
...ecorded. In semi-field experiment, honey bees were exposed to insecticide treated
plants for one hour. The mortality rate of honey bees in the control and insecticide
exposed group was compared. Overall, a significant decline in plant pollinators was
observed after application of lambda-cyhalothrin on the patch of marigold plants.
Lambda-cyhalothrin caused significant mortality (15/20=75%) in honey bees in
semi-field ex
plants for one hour. The mortality rate of honey bees in the control and insecticide
exposed group was compared. Overall, a significant decline in plant pollinators was
observed after application of lambda-cyhalothrin on the patch of marigold plants.
Lambda-cyhalothrin caused significant mortality (15/20=75%) in honey bees in
semi-field ex
Waqas Ali, Arshad Javid, Ali Hussain, Syed Mohsin Bukhari
Public attitude towards amphibian and reptiles in district Kasur, Punjab, Pakistan
...o
document public perceptions towards amphibians and reptiles in district Kasur,
Pakistan. A total of 200 respondents, 50 from each tehsil were interviewed from all
the four tehsils namely Pattoki, Chunnian, Kot Radha Kishan and Kasur. The
people of the study area used to prepare traditional medicines from body parts of
Bungarus caeruleus, Naja naja, Ptyas mucosus, Eryx johnii, Varanus beng...
document public perceptions towards amphibians and reptiles in district Kasur,
Pakistan. A total of 200 respondents, 50 from each tehsil were interviewed from all
the four tehsils namely Pattoki, Chunnian, Kot Radha Kishan and Kasur. The
people of the study area used to prepare traditional medicines from body parts of
Bungarus caeruleus, Naja naja, Ptyas mucosus, Eryx johnii, Varanus beng...
Mohsin Arshad1, Muhammad Irfan*2, Asad-Ur-Rehman1, Muhammad Nadeem3, Zile Huma3, Hafiz Abdullah Shakir4, Quratulain Syed3
Optimization of medium and substrate for CMCase production by Bacillus subtilis-BS06 in submerged fermentation and its applications in saccharification
...atic and with agitation speed of 140 rpm. The whole
fermentation experiments were carried out in 250ml Erlenmeyer flask. Different
agricultural wastes such as sugarcane bagasse, wheat straw, rice husk, defatted
soybean meal, corn cobs and wheat bran were exploited for CMCase production
using different media (medium 1 (M1), medium II (M-II), medium III (M-III) &
medium IV (M-IV)).Of all ...
fermentation experiments were carried out in 250ml Erlenmeyer flask. Different
agricultural wastes such as sugarcane bagasse, wheat straw, rice husk, defatted
soybean meal, corn cobs and wheat bran were exploited for CMCase production
using different media (medium 1 (M1), medium II (M-II), medium III (M-III) &
medium IV (M-IV)).Of all ...
Madeeha Arshad, Asmatullah, Chaman Ara
Embryotoxic effects of sodium arsenate in Mus musculus
...
a result of zinc and copper smelting and pesticide usage. Inorganic arsenic
(sodium arsenate) other than general lethality additionally can be a teratogenic
agent. Present research work is focused on the teratogenic impacts of sodium
arsenate given to gravid mice (Mus musculus). Different doses of sodium arsenate
18.25, 37.5 and 75mg/kg B.W. were administered orally at day 6 of gestation
(...
(sodium arsenate) other than general lethality additionally can be a teratogenic
agent. Present research work is focused on the teratogenic impacts of sodium
arsenate given to gravid mice (Mus musculus). Different doses of sodium arsenate
18.25, 37.5 and 75mg/kg B.W. were administered orally at day 6 of gestation
(...
Hafiz Muhammad Umer Qaisar1, Tanveer Ahmad2, Muhammad Rizwan3*, Muhammad Saqib1
Antimicrobial efficacy of combination of lincomycin and spiramycin (Lispiracin™) as systemic dry cow therapy for controlling bovine mastitis
...tis through systemic dry period therapy,
present study was designed. A total of 20 dry pregnant cows were selected
randomly at the end of lactation and divided into two equal G1 and G2 groups.
Group G1 was treated with lincomycin@ 5mg/kg (IM) and spiramycin@ 10 mg/kg
(IM) (Inj. lispiracin®) at end of lactation and at 14th day pre calving while group G2
was kept as control. Samples of milk were collected aseptically at dry...
present study was designed. A total of 20 dry pregnant cows were selected
randomly at the end of lactation and divided into two equal G1 and G2 groups.
Group G1 was treated with lincomycin@ 5mg/kg (IM) and spiramycin@ 10 mg/kg
(IM) (Inj. lispiracin®) at end of lactation and at 14th day pre calving while group G2
was kept as control. Samples of milk were collected aseptically at dry...
Zafar Iqbal1, Muhammad Farooq Nasir1, Imran Bodlah1*, Rahmatullah Qureshi2, Ayesha Aihetasham3
Notes on three morphs of Bulaea lichatschovii (Hummel) (Coleoptera: Coccinellidae) from Northern Pakistan
...s well as pollinivorous species
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given wit...
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given wit...
Ihsan Ali1#, Asim Aslam1*, Habib-ur-Rehman2, Beenish Zahid3, Ishtiaq Ahmed1
Effect of fish oil on growth performance and immune response in experimentally infected broiler chicken with avian influenza virus H9N2
...
histopathology, growth performance and antibody response in H9N2 challenged
broilers. A total of 80 chicks were divided in to 4 groups A, B, C & D. Group A and
B were challenged with AI virus (H9N2) on 21 day of age, group B and C were
treated with 3% FO while group A and D were treated with cooking oil. For isolation
of virus, 21 samples were collected, out of which 8 (40%) were positive for H9. The
virus titer was ran...
broilers. A total of 80 chicks were divided in to 4 groups A, B, C & D. Group A and
B were challenged with AI virus (H9N2) on 21 day of age, group B and C were
treated with 3% FO while group A and D were treated with cooking oil. For isolation
of virus, 21 samples were collected, out of which 8 (40%) were positive for H9. The
virus titer was ran...
Muhammad Asghar Hassan1, Imran Bodlah1* , Ayesha Aihetasham2
First record of the oriental species, Saltella setigera Brunetti, 1909 (Diptera: Sepsidae) from Pakistan
...p>...
Halil Erhan Eroğlu
The comparison of the Felidae species with karyotype symmetry/asymmetry index (S/AI)
...easurement of the karyotype
symmetry/asymmetry index. Especially in higher animals and humans, it is
important to know the values of the karyotype symmetry/asymmetry, so that
species, genera, families and orders can be compared. Also the evolutionary
relationships of higher organisms can be determined. The symmetry/asymmetry
symmetry/asymmetry index. Especially in higher animals and humans, it is
important to know the values of the karyotype symmetry/asymmetry, so that
species, genera, families and orders can be compared. Also the evolutionary
relationships of higher organisms can be determined. The symmetry/asymmetry
Khurram Shahzad1*, Muhammad Naeem Khan1, Farhat Jabeen2, Nasreen Kosour3, Muhammad Sohail1, Muhammad Khalil Ahmad Khan1, Munir Ahmad1
Bioaccumulation of manufactured titanium dioxide
...
nanoparticles suspensions T0 (no dose administration), T1 (0.5 mg/L), T2 (1.0
mg/L) and T3 (1.5 mg/L) for 14 days. After 14 days, animals were slaughtered and
organs (gills, liver and muscles) were freeze dried. Freeze dried tissue samples
were digested with the help of nitric acid (HNO3) and perchloric acid (HClO4). Acid
digested samples were analyzed by Inductively Coupled Plasma Mass
nanoparticles suspensions T0 (no dose administration), T1 (0.5 mg/L), T2 (1.0
mg/L) and T3 (1.5 mg/L) for 14 days. After 14 days, animals were slaughtered and
organs (gills, liver and muscles) were freeze dried. Freeze dried tissue samples
were digested with the help of nitric acid (HNO3) and perchloric acid (HClO4). Acid
digested samples were analyzed by Inductively Coupled Plasma Mass
Muhammad Khalil Ahmad Khan1*, Muhammad Zafar2, Munazza Perveen3, Munir Ahmad3, Asia Iqbal4, Asmatullah3
Efficacy of malathion and carbosulfan against crop invadedaphid types Aphis craccivora (Koch) and Aphis gossypii (glover) on bean and brinjal plants
...nt crop infesting aphid species Aphis gossypii
(Glover) and Aphis craccivora (Koch) were reared on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii w...
(Glover) and Aphis craccivora (Koch) were reared on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii w...
Anber Naqvi1*#, Abdul Qadir1, Adeel Mahmood2, Mehvish Mumtaz3, Iqra Aslam1, Gan Zhang4
Assessment of polychlorinated biphenyls (PCBs) in maternal blood serum from selected districts of Punjab, Pakistan
...>
and Hexa-CBs(11%), respectively. Spatial distribution of PCB homolog reflected
the higher prevalence of lower chlorinated PCBs in urban population descending
towards rural population. The mean TEQ concentration of eight dioxins like PCBs
was recorded as 0.03 ng/g l.w. Analysis of Σ34PCBs and socio-demographic
parameters reflected significant results for milk intake. The study findings
suggested a need for regulating ...
the higher prevalence of lower chlorinated PCBs in urban population descending
towards rural population. The mean TEQ concentration of eight dioxins like PCBs
was recorded as 0.03 ng/g l.w. Analysis of Σ34PCBs and socio-demographic
parameters reflected significant results for milk intake. The study findings
suggested a need for regulating ...
Siddra Tayyab Akhtar, Anjum Nasim Sabri
Twitching, swimming, swarming in biofilm forming strains in response to chemical and physical factors
... agar medium and then by performing
ring test. By 16S rRNA sequencing, bacterial strains were identified as
Exiguobacterium aurantiacum, Bacillus subtilis, Bacillus megaterium, Bacillus
endophyticus, Pseudomonas fragi and Bacillus subtilis. The optimum temperature
and pH for swimming, swarming and twitching motilities was 37°C and pH 7. All the
bacterial strains showed reduction in diam...
ring test. By 16S rRNA sequencing, bacterial strains were identified as
Exiguobacterium aurantiacum, Bacillus subtilis, Bacillus megaterium, Bacillus
endophyticus, Pseudomonas fragi and Bacillus subtilis. The optimum temperature
and pH for swimming, swarming and twitching motilities was 37°C and pH 7. All the
bacterial strains showed reduction in diam...
Zafar Iqbal
A review of fisheries education in University of the Punjab, Lahore, Pakistan
...10-2015) 3187 research papers were published in journals with impact
factors by university’s teaching faculty. In last eight years (2008-2015) 1153
scholars were awarded PhD degrees by the University. The zoology department
was established in 1921 and is now ranked among top departments. Significant
contributions have been made by some past faculties and alumni of zoology
department in development of fisheries sector in...
factors by university’s teaching faculty. In last eight years (2008-2015) 1153
scholars were awarded PhD degrees by the University. The zoology department
was established in 1921 and is now ranked among top departments. Significant
contributions have been made by some past faculties and alumni of zoology
department in development of fisheries sector in...
Sobia Faisal1*,Qurat-ul-Ain Ahmad2, Maleeha Manzoor3, Madiha Manzoor4, Faisal Rifaq5
Socio-psychological factors related to tuberculosis diagnostic test seeking behavior in Pakistan
...ad been reviewed for the period of 1998 to 2013.
Emphasis was laid to review all studies conducted in Pakistan however where
needed reference from other countries with similar socio-demographic
characteristics was also included. The four key components of Health Belief
Models; perceived susceptibility and severity and perceived benefits and barriers
expla...
Emphasis was laid to review all studies conducted in Pakistan however where
needed reference from other countries with similar socio-demographic
characteristics was also included. The four key components of Health Belief
Models; perceived susceptibility and severity and perceived benefits and barriers
expla...
Abdul Majid Khan*
Review report on mammalian dental defect (enamel hypoplasia) in different groups of mammals
...iduous as
well as permanent dental material of modern, archeological and palaeontological
animals belongs to multiple orders of class Mammalia and also provides a road
map for comparative analysis of dental health in different mammalian taxons....
well as permanent dental material of modern, archeological and palaeontological
animals belongs to multiple orders of class Mammalia and also provides a road
map for comparative analysis of dental health in different mammalian taxons....
Muhammad Asghar1*, Mirza Muhammad Qadeer Baig1, Sanaullalh Chaudhary1 and Muhammad Anjum Ali2
...ign: justify;">The study pertaining to the control of brown leaf spot (BLS) disease on rice crop by using different combinations of fungicide (difenoconazole) with various concentrations of sprayable formulations of macronutrients (NPK) was conducted during Kharif 2012 to 14 at Adaptive Research Farm, Gujranwala, Pakistan. The experiment was conducted on a promising basmati rice cultivars Supe...
Haniya Mazhar1, Naaz Abbas2, Tehseen Zamir3, Zahid Hussain1, Syed Shahid Ali4*
...mum pH was 8 and best temperature was 40oC for the reported strain. Addition of divalent Mg2+ and Ca2+ ions resulted in 2-fold increase in enzyme activity while SDS completely inhibit the lipase activity to zero.
...
Masab Umair Khan, Syed Mehar Ali Shah, Hidayat-ur-Rahman, Arshad Iqbal* and Ezaz Aslam
...fy;">Evaluation of genotypes for yield and its associated traits is an essential step towards the development of a crop variety. Crop breeders mostly practice selection for the desired traits to identify superior genotypes. This research was conducted to assess the performance of 20 maize hybrids along with two checks at The University of Agriculture Pes...
Muhammad S. Waqas, Ali A.Z. Shoaib, Xinlai Cheng, Qianqian Zhang, Asem S.S. Elabasy and Zu-hua Shi*
...an invasive, polyphagous pest species. Reproductive biology of this mealybug species is poorly known, which hinders the development of an effective management program. In this study, the reproductive mode, male’s mating capacity, influence of female’s age and density on male’s mating capacity, as well as the influence of copulation on female’s longevity were investi...
Atiq-ur-Rehman1,2,*, Abida Latif1,*, Rukhsana Anwar1, Nasir Abbas1, Sajid Nawaz2 and Hamid Turab Mirza3
...ay. Assessment of anti-hyperglycemic potential of the most active chloroform fraction exhibiting in vitro α-amylase inhibition was carried out in Wistar albino rat models. Changes in postprandial levels of blood glucose in rat models (normal and diabetic) were examined after starch load with or without chloroform fraction. Chloroform fractions (250 mg/kg and 500 mg/kg b.w.) dose levels were administered to the rats and the samples of blood were ta...
Hina Abrar1,2, S.N.H. Naqvi1,*, Muhammad Rashid Ahmed3, Asma Basharat Ali3 and Hina Yasin1,2
... including arrhythmia, hypertension, portal hypertension and oesophageal varices. The study was undertaken in rabbits to investigate the effect of propranolol to reduce hepatoxicity of carbamazepine (CBZ). Animals were divided into three groups; control, CBZ administered group (200 mg/Kg for 10 days) and CBZ plus propranolol (30 mg/Kg for 10 days) treated group. Liver function test and histological evaluation by H and E stai...
Faheem Ali1*, Muhammad Naeem Arbab1, Abdul Basit2, Muhammad Kashif Khan1, Gulzar Ahmad1 and Muhammad Amir1
...esults in lagging Volt-Ampere-Reactive (VARs), which must be balanced by the same number of leading VARs in order to ensure unity power factor, thus avoiding penalties on agricultural industry. Switched Capacitors and Voltage Regulators are used to cope with such a situation. Regulators results in higher line currents thus resulting in excessive losses in addition to voltage sag problems. ...
Muhammad Shahzad Akbar, Muhammad Zeeshan Majeed* and Muhammad Afzal
...ic subterranean termite species in Indo-Pak region. Label-recommended dose rates of insecticides were tested against worker termites using modified filter paper disc method according to completely randomized design. All insecticides caused significant mortality of termites as compared to control treatment. Formulations of chlorantraniliprole, chlorfenapyr and pyriproxyfen exhibited maximum termite mortality, ranging from 31....
Muhammad Iqbal1, Khalid Usman2*, Muhammad Arif1, Shakeel Ahmad Jatoi3, Muhammad Munir4 and Imran Khan1
...ria Mol. Standley) genotypes were evaluated for their fruit physico-chemical characteristics and yield behavior at Faculty of Agriculture, Gomal University, D.I. Khan (Pakistan) during 2013 and 2014. The genotypes of bottle gourd were Hazarvi, Anmol, Amber, King, Advanta-205, Surbhi, Royal, Nobel, Sharmic and Louki (local check variety). The experiment was laid-out in randomized complete b...
Khush Bukhat Zahid1*, Ghaffar Ali2, Samina Sabir1 and Mohammad Fayaz2
...-align: justify;">This paper aims to test the impact of climate change on agricultural productivity of major crops, including rice, wheat and maize, in specific districts of Pakistan. This is done by observing year-to-year fluctuations in rainfall and temperature in relation to agricultural productivity for the period 1981-2009. For estimation purposes, ...
A.M. Abdul Azeem, A.N. El Shahat* and Ashraf M. Mounir
... activity of pomegranate peel powder as well as to evaluate the effect of gamma-irradiated pomegranate peels extract (GPE) against biochemical alterations of lead induced testicular and hepato-toxicity in rats. From the results, it was obtained that gamma irradiation induced significant increase in the total phenolic content and antioxidant activity of p...
Muhammad Muddassir Ali1,2 and İbrahim Hakkı Ciğerci1,*
...icines are used for therapeutic purposes all over the world. Many endemic plants all over the world have magical therapeutic potential. These could be explored further for medicinal purposes and hence can be preserved for their proper propagation. Thermposis turcica is endemic to Turkey. It’s general anti-oxidant and anti-cancerous activities are explored, but no study has bee...
Akshay Sharma*, Mohit Mahajan, Madhumeet Singh and Pravesh Kumar
...edian raphe, scrotal and penis impression. With the aid of ultrasonography and color Doppler technique, it is possible to determine the twins’ zygosity and viability. ...
Abid Muhammad Shah1, Safdar Ali1*, Ijaz Ahmad2, Gulzada Wazir1, Obaidullah Shafique1, Muhammad Amir Hanif1, Bashir Ahmad Khan3 and Sumaira Zareen4
...he said issues a field experiment was conducted at University Research Farm, Chakwal Road, Rawalpindi during 2015-16 to investigate the effect of different herbicides and sowing methods on wheat productivity and population dynamics of weeds. Different wheat sowing methods (S) were Broadcasting, Line sowing, Ridge sowing, Bed sowing and herbicides used were Ally Max, Clean wave, Starane M. and Buctril Super 60 Ec. The ex
Saman Fatima* and Shazia Iram
... pathogens that ruin the peal of Citrus reticulata Blanco (kinnow) in order to improve its quality. About twenty six sampled fruits of Citrus reticulata having damaged skin were obtained from the orchards of Sargodha. The samples were classified into groups on the basis of physical appearance of lesions on peal and the disease severity was then identified. Both classical and molecular meth...
Ali Zohaib1*, Saima Yousaf1,2, Shakeel Ahmad Anjum1, Tahira Tabassum1, Tasawer Abbas3, Wardah Muzaffar1 and Wasiq Ikram2
...trient losses. A field experiment was conducted to evaluate the effect of seed inoculation viz. control (no treatment), Rhizobium japonicum (nitrogen fixing bacteria) and Pseudomonas fluorescens (phosphorus solubilizing bacteria) on growth, allometric traits and dry matter yield of different soybean genotypes viz. EBR4V4, Freedom and Swat-84. Seed inoculation significantly improved the total chlorophyll content, leaf area in...
Umair Talib1, Ijaz Ashraf2, Robert Agunga1 and Saleem Ashraf3*
...sociated problems faced/ perceived by resource-poor farmers and ways adopted to mitigate them. The specific objectives of study were to determine farm damages of resource-poor farmers under environmental degradation; explore mitigation strategies available for resource-poor farmers; and examine the implications for extension educations in Pakistan. The survey of 120 farmers was conducted in the Punjab Province of Pakistan, c...
Misbahullah, Shad Khan Khalil, Asim Muhammad*, Afza Tabassum and Shah Fahad
...50% at emergence + fifty percent at tillering). Herbicide sole, weeded by hand and un weeded plots used for comparison. Results showing that concentration of sorghum and appliance point considerably increased days to heading, anthesis, physiological maturity, area of flag leaf, tillers number m-2 and spikelets per spike and decreased weed density in wheat. Sorghum extract sprayed at 1:3 gave more days to anthesis (123.4), da...
Neelum Andaleeb1*, Munir Khan1, Syed Attaullah Shah1 and Rahmat Ullah2
...ck farm households with special reference to women’s participation in livestock farming. A multistage sampling technique was used to collect a sample of 274 livestock farm households from six union councils of district Mardan. Data were collected through face to face interviews from female members of the selected livestock farm households in 2015-16. Data were analyzed by ordered logit model to determine factors affecting households welfare, measured as ...
Aiguo Zhou1,3,4, Shaolin Xie1,4, Zhenlu Wang1, Lanfen Fan1, Yanfeng Chen2, QiaoYe1, Fang Zeng1 and Jixing Zou1,*
...thern snakehead, white type Channa argus is one of the most important economic and conservational fish in China, but an uncertain classification has existed for many years. In present study, mitochondrial Cyt b gene was used to analyze the relationships and genetic diversity of two color morphs of northern snakehead. For the Chnannidae family, the average genetic distances of Cyt b gene was 0.171 (ranged 0.000 to 0.248) with the inter-s
Shagufta Nighat1, Muhammad Sajid Nadeem1,*, Syed Israr Shah1, Amber Khalid1, Tariq Mahmood2, Ayesha Aihetasham3 and Muhammad Asif4
...easured cadmium (Cd), copper (Cu) lead (Pb) and zinc (Zn) concentrations in bat tissues through atomic absorption spectrophotometer. Our findings showed that metals were more concentrated in the liver and kidneys, Zn and Pb showed high mean values as compared to other metals but these values were below the lethal levels. Within the regions and sexes no significant variations were found in metal concentrations; however within...
Ajmal Khan* and Rehan Ullah
...ence of malaria and its specific aetiologic agents in suspected patients reported to various laboratories of Agency Head Quarter Hospital Khar, Bajaur Agency. In this study, a total number of 9720 suspected individuals were examined; among which 1273 (13.1%) were found to be positive for malaria infection with different Plasmodium species in their...
Faiz Muhammad1,2, Canfeng Dou1, Zhen-ming Lü1,*, Li Gong1, Xun Du1 and Muhammad Shafi3
... ATPase 6, thirty haplotypes and 140 polymorphic sites were noted, whereas (0.740, 0.048) high and low haplotype and nucleotide diversity observed. The data was further tested with AMOVA that validates 91.24% variation among populations and 8.76% within population. Genetic fixation index was also calculated as 0.91243*. The neighbor-joining phylogenetic analysis revealed three lineages. The Dongshan population distinctl...
Jun Yan Bai1,*, Yong Gang Zhao2 and Yu Qin Wang1
...n. Polymorphism of goat species was tested by sequencing technology. Results demonstrated that there are two mutation sites (SNP loci) of the primer GHRL-2 in black goat and Yaoshan goat, which are G447C site and T498C site. At G447C site, gene frequencies of G and C in black goat and Yaoshan goat were detected 0.621/0.379 and 0.793/0.207, respectively. In black goat and Yaoshan goat, G is the dominant allele in G447C. At T4...
Qingling Hu1,2,3,* and Jinian Feng3
... IX.
...
Muhammad Ijaz1, Shahid Hussain Farooqi1, Rahmatullah2, Amjad Islam Aqib1, Sadaqat Ali3,*, Awais Ghaffar1, Ahmad Ali1 and Sehrish Saleem1
... diarrheic foals of all species. The sodium, calcium, copper, iron and lithium concentrations significantly (p < 0.05) decreased while the potassium concentration significantly (p < 0.05) increased in diarrheic foals. Hence, this can be concluded that diarrhea in foals have significant correlation with PCV, serum electrolytes, and trace and ultra-trace elements.
...
Muhammad Kashif Maan1, Ghulam Mustafa1, Munibullah2 and Sajid Umar2,*
...protruded through the palpebral fissure and infiltrate the entire eye ball. Diagnosis was made based upon the clinical and histopathological examination of the tumor sample. In all cases, tumor resection was performed followed by cauterization of the remaining surface with silver nitrate. No postoperative complications or local recurrence were reported by owner of each case.
...
Chao Zhao1,2, Juan Feng1, Haidong Xu1, Lihua Qiu1,2,*, Qibin Yang1, Zhenhua Ma1 and Jian G. Qin3
...onodon in the 36 h experimental period was not significantly affected by the water pretreatment (P > 0.05). However, the bacteria communities were significantly affected by water pretreatment (P < 0.05). Heterotrophic bacteria and vibro counts in the formalin treatment were significantly lower than UV treatment and untreated group (P < 0.05). Based on the results obtained in the present stud...
Mirza Imran Shahzad1, Hina Ashraf2,*, Muhammad Arshad3, Sabeeha Parveen4, Amna Aslam4, Nargis Naz4, Zahid Kamran1, Sumbul Gohar Khalid5, Sajid Hameed1, Muhammad Ashfaq6 and Muhammad Mukhtar7
...ract of Achyranthes aspera was found most effective with IC50 3.125μg and the extract of Oxystelma esculentum, was found least effective with IC50 60μg in the series. The current study has established the fact that Cholistani plants are rich source of anti-NDV agents and can be used in purified or in crude form.
...
Muhammad Shahzad Khattak1*, Amjad Khan1, Mahmood Alam Khan1, Waqas Ahmad2, Shafiq ur Rehman3, Mohammad Sharif4 and Sajjad Ahmad1
...logical stations for the period 1962-2011. A drought spell starting from 1999 and ending in 2002 was observed for all stations and is considered to be the worst drought in the history of Pakistan. Analysis of historical streamflow data indicated an increased occurrence of droughts in the last 12 years, which may be attributed to climate change. Extreme drought events were observed at Tarbela during October-September and at M...
Fouzia Tabssum1, Qamar uz Zaman2*, Yinglong Chen3,4, Umair Riaz5*, Waqas Ashraf6, Ambreen Aslam2, Nusrat Ehsan2, Rab Nawaz2, Humera Aziz7 and Shamim ul Sibtain Shah8
...asting salt tolerance: Super basmati (salt susceptible) and Shaheen basmati (salt tolerant) in both nursery and field conditions. For pot experiment, salinity stress was imposed by applying 50 mM of NaCl solution to the soil daily for three continuing days, and applications of proline (0, 25, 50, 75 and 100 mM) was applied 25 DAS. For field experiment, the same cultivars were grown in a sa...
Muhammad Amir Iqbal1, Nabila Roohi1*, Ahmad Qureshy2
...ofile induced by overt hyperthyroidism as well as its subclinical form. A total of 179 subjects comprising both genders and fulfiling the exclusion and inclusion criteria were recruited for this prospective investigation. Sixty healthy controls, thirty four subclinical, fifty overt hyperthyroid and thirty five follow-up subjects having 3 months of anti-thyroid therapy were recruited. Comme...
Zhongquan Zhao*, Tianyuan Yang, Lei Qiao, Qijie He and Zinuo Dai
...5.0±27.5 days, respectively. Estrous cycle was 20.1±0.5 days. The duration of the natural estrous period of Dazu black goat (41.4±8.6 h) was longer than these reported goat breeds and was not significant difference among the different litter sizes does in the breed. The semen quality was high in different seasons. Dazu black goats might have shorter gestation period (1...
Mubashir Ahmad Khan*, Nazakat Nawaz, Muhammad Arshad, Muhammad Ayub Khan, Tahira, Doulat Baig, Ihsan Ullah Khan and Shamim ul Sibtain Shah
...t-align: justify;">The experiment comprised 98 local sesame genotypes including a standard cultivar (TS-3), was conducted during the Kharif seasons of 2011 and 2012 in the research fields of Oilseeds Research Program, Crop Sciences Institute, National Agricultural Research Center, Islamabad, Pakistan. Data were recorded on days to flower initiation, days to flower completion, reproductive pe
Muhammad Salman Wazir and Mohammad Akmal
...n timing effect on wheat performance as sole or intercrop with other selected species. The study was conducted at Agronomy Research Farm, the University of Agriculture, Peshawar, during winter 2015-16. Treatments included cropping pattern viz. sole and intercrop of lines with 1:1 ratio i.e. one wheat row followed by one other crop species and 2:1 ratio i.e. two wheat rows followed by one o...
Fatih Korkmaz1, Veysel Parlak2, Özgür Kaynar3, Arzu Ucar2, Gonca Alak1,* and Muhammed Atamanalp2
...terobacteriaceae), lipid peroxidation (TBARS), total volatile basic nitrogen (TVB-N) and pH values on quality during 12 days. The decrease in bacterial growth activity, physicochemical values (TVB-N, TBARS and pH) and prolonged shelf life in a natural preservative dependence were observed in the fillets. Generally all the test parameters, such as microbiological, physicochemical as well as the lowest mean values were identif...
Yan-Guo Han1, Xiao-Li Peng1, Kai Li1, Yu-He-Tian Zhao1, Xun-Ping Jiang2, Guang-Xin E1, Yong-Ju Zhao1, Jun-Hua Ye3, Li Xu3, Qin-Tao Zhao3 and Yong-Fu Huang1,*
...g effect of the fusion type of CpG motifs on SS DNA vaccine and growth of ram lambs. In this study, we constructed the ptS/2SS-asd plasmid, pCpG plasmid and the CpG-SS fusion type recombinant plasmid named ptCS/2SS-asd. Twelve ram lambs were randomly divided into three groups, namely, the treatment (Group T1, ptCS/2SS-asd; Group T2, pCpG + ptS/2SS-asd) groups and the control (Group C, pVAX-asd). The vaccine (1 mg/ram)...
Daniel Zaborski,1,* Muhammad Ali,2 Ecevit Eyduran,3 Wilhelm Grzesiak,1 Mohammad Masood Tariq,2 Ferhat Abbas,2 Abdul Waheed4 and Cem Tirink5
...weight - LW) and seven dependent (output) variables (services per conception - SPC, service period - SP, lambing interval - LI, twinning rate - TR, gestation length - GL, breeding efficiency - BE and fertility rate - FR) were used. A 10-fold cross-validation was applied to train and evaluate the models. The highest correlation coefficients (r) were found for LI (0.18 - 0.29; P≤0....
Abderraouf Chouaib Rebbah1, Mohcen Menaa2,*, Salah Telailia3,Menouar Saheb1 and Mohamed Cherif Maazi2
...ribution among habitat types (oak woodlands, pine woodlands and oak-pine mixed woodlands). A total of 69 species were observed. One species was recorded only in mixed oak-pine forests, six were found exclusively in oak woodlands and 17 species were found only in pine woodlands. We noted 20 protected species, only one e...
Shaher Bano1, Sarah Ghafoor1,* and Nadia Naseem2
...tor-α is a mitogen peptide performing diverse cellular functions and is immunolocalized in ductal epithelium of salivary glands. The development of salivary glands is under the influence of various hormones including Triiodothyronine hormone (T3). Submandibular gland of rat is an excellent model to study salivary gland organogenesis. The study is designed to understand T3-mediated regulation of TGF-α expression d...
Farhat Iqbal1, Mohammad Masood Tariq2,*, Ecevit Eyduran3, Zil-e-Huma4, Abdul Waheed5, Farhat Abbas2, Muhammad Ali2, Nadeem Rashid2, Majed Rafeeq2, Asadullah2 and Zahid Mustafa2
...h Bayesian inference. Gompertz, Logistic, Brody and Von Bertalanffy models were fitted to average monthly body weight data of (n = 412) Mengali sheep from birth to 24 months of age for both sexes (male and female) and type of births (single and twin). The overall goodness of fit was checked by calculating Deviance Information Criteria (DIC) and the square of correlation (R2) between observed body weight and...
Xiao-Ying Ren1, Di Zhang2 and Wan-Long Zhu1,*
...s were the inherent species in Hengduan Mountains region, which had special status in Microtus, Arvicolinae. In order to investigate the geometric morphometrics of the craniums and mandible in nine species of Eothenomys (E. fidelis, E. melanogaster, E. chinensis, E. proditor, E. custos, E. cachinus, E. eleusis, E. miletu...
Radek Aulicky1,*, Vaclav Stejskal1 and George Opit2
...ase DDVP strips from the perspective of increasing the human safety. Therefore, we determined efficacy of 1-, 6-, and 24-h DDVP (evaporation rate: 0.15 ± 0.02 g.day-1) strip exposures on 5 stored-product pests, namely, Tribolium castaneum, Oryzaephilus surinamensis, Cryptolestes ferrugineus, Rhyzopertha dominica ...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...div>...
Ghulam Ali1,3, Wopke van der Werf2 and Just M. Vlak1,
...ial as biological insect pest control agents. However, slow speed of kill relative to chemicals and continued feeding following application limit their effectiveness in preventing crop losses. Here we studied the food consumption and weight gain of the cotton leafworm Spodoptera litura following application of two viral doses of Spodoptera litura nucleopolyhedrovirus (Pakistan isolate SpltNPV-Pak-BNG). Infected larvae...
Mujib ur Rahman1, Munir Khan2*, Himayatullah Khan2, Malik Muhammad Shafi2 and Haidar Ali2
...s of the country. Profit per month of Chadar and Suit cloth in the local market was found Rs. 7,800/- and Rs 6,552/-, respectively. While selling these products in other cities per month profit was Rs. 13,650/- and Rs. 12,636/-, respectively. The overall profit in the business is low. Profit is higher for those producers who sold their products in other ...
Amara Amjad Hashmi1,2,*, Maqbool Hussain Sial3, Waqar Akram4 and Maaida Hussain Hashmi5,6
... quantify the welfare of people in Pakistan through measuring the food insecurity, malnutrition during last decade (2005-14). This study takes lead from earlier studies, in a sense; it covers two food price hike periods (2007 and 2011). So, it is important to understand, how food insecurity status and nutrition are affected by these shocks during this period. Thus, we use nationally repres...
Muhammad Tahir Amin, Khalid Usman*, Muhammad Waqas Imam Malik and Nishter Ali
...: justify;">Exploring proper phosphorus level and irrigation interval which enhances cotton production and lint quality was the basis of this research. A field study was conducted in Dera Ismail Khan, Pakistan during 2016 to assess the impact of irrigation interval and phosphorus rates on cotton grown under reduced tillage system (one tiller followed by one rotavator at 7–10 cm depth). Five irrigation intervals (7th, 10th, 13th, 16th and 19th day) and ph...
Nighat Seema1*, Muhammad Hamayun1, Husan Ara1 and Raham Sheer Khan2
...fy;">Endophytic fungi cooperate more meticulously with their host plants and may be more capable to solubilize nutrients from soil and provide it to their hosts. In current study, endophytic fungi inoculation significantly affected the soil properties such as soil texture, organic matters, EC and pH with or without 8% PEG induced drought stress. Upon ino...
Syed Said Badshah Bukhari1*, Ghulam Ali Bajwa2 and S. Shafiqur Rehman1
... manifested in rising temperature, erratic changes in precipitation and other climate variables. To assess such impacts, climate-growth response function of the Blue pine (Pinus wallichiana) was studied in Galies Forest Division -Abbottabad, Khyber Pakhtunkhwa, Pakistan, for the time period 1962-2011. Time function response and impacts of changing climate were estimated on the basis of annual ring-width and intra-ring wood f...
Nadejda Lukanova1*, Radka Vlaeva2 and Boriana Ivanova3
...r. The study refers to a period of 19 years, from 1997 to 2016. The aim of the recent study is to examine some reproductive traits of trotter mares – gestation length depending on foal gender and gestation length depending on the month of covering, and duration of covering estimated in days. We calculated duration of covering, length of gestation, gestation length in accordance with ...
Muhamad Jawad*, Shahid Riaz Malik, Muhammad Aqeel Sarwar, Muhammad Asadullah, Israr Hussain and Rabia Khalid
.... For this purpose, an experiment was conducted to evaluate the genetic diversity among 36 lentil genotypes for mechanized harvesting. Analysis of variance for qualitative and quantitative traits showed significant variability among the genotypes. Correlation analysis indicates negative correlation of yield with lowest pod height and highly significant correlation between lowest pod height...
Sahar Shibli1,2*, Farzana Siddique1, Saeeda Raza2, Zaheer Ahsan3 and Irum Raza4
...stify;">Three indigenous peanut cultivars from Pakistan specifically Local-334, Bard-92 and Bard-479 were investigated in the study for compositional quality and peanut butter development. Chemical composition of peanut cultivars indicated 5.53±0.20 to 5.93±0.02 % moisture, 2.00±0.11 to 2.17±0.05% ash, 49.80±3.54 to 50....
Asim Faraz1,*, Muhammad Younas2, Abdul Waheed1, Muhammad Yaqoob2 and Kashif Ishaq3
...i, to examine the growth performance and hair mineral status of Marecha calves (Camelus dromedarius) reared under intensive (IMS) and semi-intensive management systems (SIMS). Twelve Marecha calves were randomly allotted to two comparable groups of 6, (3 ♂ and 3 ♀). First group animals were reared under IMS, fed concentrate @ 1 kg/h/d plus crop residues of gram (Cicer arientinum) ad lib while in second group, calves were reared under S...
A.H. Shahzad1, A. Sattar1,*, A. Husnain1, I. Ahmad2, N. Ahmad1, D. Nak3 and Y. Nak3
... received GnRH shot and open cows received remaining Ovsynch protocol. Blood was collected on d14,d16 and d30 for P4 profile. Cross-sectional area of luteal tissue was measured on d30 in pregnant animals in both groups. In experiment II, both control (n=64) and resynch (n=54) groups were similarly treated as in experiment I, without P4 profile and luteal cross-sectional area ...
Jair Millán-Orozco1,*, Jersson Millán-Orozco2 and Luz María Tejada-Ugarte3
...rom those reported in temperate sheep breeds. However, scarce information has been generated on this topic, thus the present study was conducted to analyze the grazing behavior of Saint Croix sheep at 18º N in Mexico. The present study was carried out using ten adult ewes, 32.8±5.1 kg, stocked on a Taiwan grass (Pennisetum purpurem) pasture maintained at a sward surface height of 30 cm. Observations were conducted during daylight hours (06:0...
Mahboob Ali1, Muhammad Avais1, Muhammad Ijaz1, Memoona Chaudhary2, Riaz Hussain3, Amjad Islam Aqib1, Naimat Ullah Khan4, Muhammad Luqman Sohail5,*, Madiha Khan6, Mumtaz Ali Khan1, Mehtab Ahmad7, Muhammad Sajid Hasni2, Imran Qaiser8, Ghazanfar Rashid1, Ikramul Haq1 and Ikramullah Khan8
...e (48.18% and 46.09%, respectively). S. aureus was isolated from 53.03% of the milk samples, with significantly higher (P<0.05) prevalence in Cholistan desert (66.10%) as compared to Suleiman range (57.98%). Blind quarter prevalence of S. aureus subclinical mastitis was 8.46% and 11.59% (P<0.05) in Cholistan desert and Suleiman range, respectively. The non-parametric statistical analysis sho...
Muhammad Saqib Shahzad1, Amina Arif1,*,Saeeda Kalsoom2, Javed Iqbal3, Shahnam Shafique2, Muhammad Shahid Nadeem4 and Rafique Ahmed5
...was to evaluate the therapeutic effectiveness of combined ribavirin (RBV) and interferon (IFN) therapy in hepatitis C virus (HCV) patients. Overall, 590 HCV patients were evaluated pre and post combined drug therapy during the period 2015-2017. Distribution of HCV genotypes, age groups, viral load and alanine aminotransferase (ALT) values were recorded and analyzed for rapid virologic resp...
Menderes Cenet
...nus level and 20 at the species level) belonging to 34 families were identified. Astragalus sp., Trifolium sp., Myrtus communis and Castanea sativa were the predominant taxa in the unifloral honey samples. Antimicrobial effects of eight honey samples proved the most effective inhibitors against Bacillus megaterium and Staphylococcus aureus. Honey samples (H07 and H08) showed significant antifungal effects on Candida...
Mudassar Javed, Muhammad Zeeshan Majeed*, Muhammad Luqman and Muhammad Afzal
...-intensive) module developed by selecting through in-situ evaluation and incorporating the most effective pest control options along with the biological (parasitoid Trichogramma chilonis egg cards) and cultural techniques against okra lepidopterous borers. According to results, maximum shoot and fruit infestations (i.e. 19.86 and 15.63%, respectively) by okra borers were recorded in contro...
Muhammad Furqan1, Usman Ali1,*, Anjum Ara1, Muhammad Mudassar Shahzad2, Muhammad Siddique Awan3, Riaz Aziz Minhas3, Khawaja Basharat Ahmad3, Qamar Zaman Qamar4 and Naeem Iftikhar Dar5
...ian grey mongoose (Herpestes edwardsii) 18 localities were sampled from 3 zones created in Mirpur district (Azad Jammu and Kashmir). Random transects of fixed length were laid and number of active burrows counted and habitat analysed using quadrat method. Mongoose was distributed with average population density of 9.8 animal/km2, with highest (17.8 animal/Km2) density at Kalyal and lowest (3.5 animal/km2) at Panyam. Most...
Effect of Seed Inoculation with Plant Growth Promoting Rhizobacteria on Yield and Quality of Soybean
Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6
...o crop plants. A field experiment was carried out to determine the effect of seed inoculation with PGPRs on yield and quality of different genotypes of soybean. Seed inoculation treatments [control (no treatment), nitrogen fixing bacteria (Rhizobium japonicum) and phosphorus solubilizer (Pseudomonas fluorescens)] were applied to three different cultivars of soybean (EBR4V4, Freedom and Swat-84). The results showed that seed ...
Babar Tasim1, Tariq Masood1*, Zafar Ali Shah1, Muhammad Arif2, Ata Ullah1, Ghazal Miraj3 and Muhammad Samiullah4
...chemical and physical properties which depend on the type of the initial material used. Agricultural residues of different types (e.g., Sesbania stems (Sesbania punicea, SS), Chickpea plant (Cicer arietinum, CP), Maize cobs (Zea Mays, MC), Wheat straw (Triticum aestivum, WS), Sugarcane (Saccharum officinarum) bagasse (...
Masaud Khan1*, Muhammad Jamal Khan1, Tahir Sarwar1 and Muhammad Jamal Khan2
...itrate leaching also dropped by 70%. Based on the above results, it can be concluded that deficit irrigation with low nitrogen doses can be used to minimize nitrate leaching. HYDRUS-ID can be effectively used for simulating Nitrate leaching. ...
Muhammad Ilyas*, Sardar Ali Khan, Shahid Iqbal Awan and Shafiq-Ur-Rehman
...onditions which clearly specified that non-additive gene action was present. Results indicated that the said breeding material might be better suited for heterosis breeding under drought prone semi-arid areas. ...
Ali Bakhsh1*, Mashal Rehman1, Said Salman1 and Rehmat Ullah2
...under threat so, it is imperative for plant breeders to develop cotton lines that can grow on minimum water availability. In this study performance of 23 cotton genotypes was compared for seed cotton yield and fiber quality traits under water stress and non-stress conditions. All the genotypes depicted significant differences for days to first square for...
Salman Ali*, Inamullah, Muhammad Arif, Mehran Ali, Muhammad Owais Iqbal, Fazal Munsif and Arsalan Khan
...vailable form. A field experiment was, therefore established at Agronomy Research Farm the University of Agriculture Peshawar-KP to evaluate the response of maize toward different K levels under varied irrigation frequencies, during Autumn, 2015. Randomized complete block design with split plot arrangement was used with a subplot size of 3m × 2m. Treatments consisted of six irrigation frequencies; I0 (no irrigation), I1 (irrigation at V1 stage), I2 (two ...
Zakiullah1, Muhammad Farid Khan1*, Muhammad Mohibullah3, Muhammad Iqbal2, Irfanullah3, Faheemullah3, Madiha Urooj1 and Uzma Arif1
...Six maize (Zea mays L.) open pollinated varieties (OPVS) viz; PSEV-3, Azam, Sarhad white, Jalal, Iqbal and Pahari were used in this experiment to determine their combining ability through 6 x 6 diallel mating design. The research was laid out in randomized complete block design with three replications at Cereal Crop Research Institute (CCRI) Pirsabak, Nowshehra (K.P.K) Pakistan during the year 2015. The results displayed hig...
Raza Ullah1* and Jamal Shah2
...isks including rising temperature, changes in rainfall patterns, floods, droughts and heavy rains etc. Farmers adopt available risk coping tools to minimize the impacts of such risks at farm level however, these adoptions require farmers to incur cost or forgo part of the potential benefits from agricultural production. These costs (explicit or implicit) are referred to as the cost of risk management. Previous studies on risk management in agriculture however ...
Shamesa Maryam1, Ajaz Ahmad Sandhu1, Imran Bodlah2*, Muhammad Asif Aziz2, Ayesha Aihetasham3
...nce, Pakistan. Total 12 species namely; Aphis craccivora, Aphis fabae, Aphis gossypii, Aphis nerii, Rhopalosiphum padi, Lipaphis erysimi, Macrosiphum euphorbiae, Myzus persicae, Pentalonia nigronervosa, Sitobion avenae, Greenidea (Trichosiphum) psidii and Cinara (Cupressobium) tujafilina have been recorded for the first time from t...
Farheen Shaikh*, Saima Naz, Nadir Ali Birmani
...t-parasite interaction depends on the environmental and ecological conditions that cause different biological and pathological problems. Chewing lice have a high capability to develop host specificity. In present study the chewing lice (Phthiraptera: Insecta) were examined for their population and rate of infestation on Common quail Coturnix coturnix (Aves: Galliformes: Phasianidae) from Jamshoro and Hyderabad Distric...
Syeda Beenish Bukhari1, Sidra Khalid1*, Shahid Bashir1, Riffat Mehboob2, Humaira Waseem2
Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Ummad-ud-Din Umar1, Muhammad Irfan Zafar1, Faqeer Hussain2, Muhammad Asif Zulfiqar3 and Azhar Ali Khan3
... morning, evening and temperature positively in both of the rust disease. Fungicidal application showed great reduction in the management of the disease. ...
Liaqat Ali Shahid1*, Nadeem Amjad2 and Muhammad Abdul Hanan Siddhu3
...uation of a tractor PTO operated of Chinese Wood Chipper Shredder was conducted at a farmer’s field in Dera Ghazi Khan Area for processing of Eucalyptus tree top-trimmed mixed waste material with leaves. The average machine throughput capacity was found to be 503 kg.h-1 with an average machine efficiency of 89 percent. Total average fuel consumption and labour requirement (un-skilled...
Shumaila Nazeer1, Iqbal Javed1*, Allah Bakhsh2, Mudassar Yasin2, Haroon Javaid3 and Kaniz Fatima1
...SA. According to data properties and suitability, multiple regression analysis technique is used for UAE and binary logistic regression technique was used for USA market. According to the finding, gross export margin for USA market is Rs. 30644 per ton and percent export margin is 70 percent while Net export margin is found as Rs. 14076.074
Sabi-ur-rehman1, Farooq Azam1, Shaheed Ur Rehman2, Tasbeeh Ur Rahman3, Ayeza Mehmood4, Afshan Gohar5 and Abdul Samad5*
...ed about its botanical aspects, phytochemistry, traditional uses as well as therapeutic potential of Conocarpus erectus. This plant was selected due to its great medicinal importance like its leaves and fruits have been using traditionally as antipyretic, anti diabetic, anti malarial and for the treatment of conjunctivitis, syphilis, gonorrhea, orchitis, diarrhea, anemia, prickly heat and swellings etc. The plant has also re...
Muhammad Asad Saleem1,*, Mirza Abdul Qayyum1, Mudssar Ali1, Muhammad Amin2, Muhammad Tayyab1,3 and Sumaira Maqsood4
... (RPW) is a very serious pest of oil palms, coconut palms and date palms in many parts of the world. The present study was carried out to study RPW biology and development under laboratory conditions and survival against sub-lethal doses of B. bassiana and biorational insecticide (Nitenpyram). Sugarcane sets as alternate to date palm stem were successfully used as diet for rearing RPW. Combination of entomopathogenic fungus (Bb) and Nitenpyram (Nit) wer...
Aqeel Mehboob, Syed Muhammad Zaka*, Muhammad Sarmadand Maryam Bajwa
... of the most destructive pests of various crops cultivating in Pakistan. Larvae of S. litura at early stages attacks on the leaves and later stage larva fed almost every part of plant. Due to environmental pollution and the incapability of toxic agents in controlling the target pests at the recommended doses of synthetic pesticides, alternative methods like botanical extract in the ...
Muhammad Shabir Shaheen1, Shahid Mehmood1, Athar Mahmud1, Jibran Hussain1, Ahmed Sultan Jatoi2, Muhammad Yaqoob3, Sohail Ahmad1 and Arshad Javid4,*
...lectricity Bulb). Growth performances, blood glucose, cholesterol level and economic appraisal in term of running cost / Kg of live meat were recorded. The results revealed that all strains generally but Ross 308 particularly maintained on floor heating system (FH) exhibited significantly (P<0.05) better FCR, EEF and livability along with higher glucose and lower cholesterol level in blood with better immune response that led to higher profit margin. All th...
Mujahid Niaz Akhtar* and Amjad Farooq
... are exploited to manage pest population. The objective of present study was to find relationships between predator’s Coccinellid septempunctata, Lynx spider and preys Helicoverpa armigera, Pectinophora gossypiella, Earias vitella populations found on cultivated cotton crops (government approved varieties) in Southern Punjab, Pakistan. Data was collected after ten days of interval during crop season from 2014 to 2016 randomly....
Tamoor Azeem1,*, M. Yasin Tipu1, Asim Aslam1, Sajjad Ahmed2, Salman Ahmed Abid1, Abdullah Iqbal3, Naeem Akhtar4, Muhammad Saleem4, Aamerzish Mushtaq4 and Sajid Umar4
...Trypanosoma, Dipetalonema, Babesia, and Anaplasma. The current study was executed to investigate haematobiochemical alterations in camels during haemoparasitism. Blood samples were collected from 200 camels of either sex and different ages from district Attock. Samples were processed for haematobiochemical analysis and thin smear stained with Field stain according to standard procedure. Out of 200 camels 46% of them have blood paras...
Muhammad Tufail1, Naila Chand1, Rafiullah1, Shakoor Ahmad2, Rifat Ullah Khan2, Muhammad Mobashar3 and Shabana Naz4,*
...osaccharide (MOS) on the performance and gut morphology of broiler chicks (Ross 308) during the finisher phase. A total of 180 of 22 days broiler chicks were distributed into 3 treatments with 3 replicates having 20 chicks per replicate. One group was kept as control and the birds in this treatment were fed on basal ration without alteration in feed contents while the other treatments MOS-50 and MOS-100 represented 50 and 10...
Khwaja Tariq Ziad1, Umar Hayat1, Muhammad2 and Muhammad Suleman Bacha3*
...ant natural resources, especially vast agricultural resources on account of its fertile irrigated land, four seasons and glorious history of old traditions of farming. The current study is designed to analyse the response of participants an informal and formal supply chains for small-scale dairy farmers in Pakistan. The study aimed at explaining the costs of the chosen supply channels and their transaction costs, the role of the mid-agent opportunistic behavio...
Shamsher Ali1*, Muhammad Jamal Khan2, Zahir Shah2, Naveedullah3 and Abdul Jalal1
...salt tolerant crop genotypes of species on salt affected lands is an effective tool for getting desirable productivity. A two-factor experiment using complete randomized design with three replications in pots having silt loam soil was carried out on April 03, 2016 to examine three maize genotypes (Iqbal, Jalal, and Azam) under different salinity levels i...
Muhammad Huzaifa Mehmood1, Muhammad Ahmad Iqbal2, Muhammad Daood1, Muhammad Rizwan Tariq3*, Khubaib Ali3
...n. The quality of meat depends upon the nutritious value, texture profile, taste and flavour. Mostly dieticians recommend rabbit meat due to low in caloric value then other traditional meats. To enhance the quality of rabbit meat oat is used as feed for rabbits, because oat is good source of dietary ingredients. In this study 2-4% oat seeds were used to investigate their dietary response. The range of oat that is used in this research will improved the blood l...
Mehran Ali1*, Inamullah1, Muhammad Bilal2, Salman Ali1, Farooq Nawaz1 and Muhammad Owais Iqbal1
...;">Organic manures if properly incorporated in soil with suitable tillage implement might better enhance grain yield and soil fertility. To investigate the influence of tillage systems and nitrogen (N) sources incorporation on soil physical properties, total N and maize productivity, a field experiment was conducted at Agronomy Research Farm, The University of Agriculture Peshawar during s...
Muhammad Amin1, Aftab Ahmad Khan2, Abida Perveen1, Zareen Rauf1, Sher Shah Hassan2*, Muhammad Arif Goheer2 and Muhammad Ijaz2
...cts spatially varies. Misperception on drought and its features is common in defining policies and caused delays in its prevention (Gore, 2002). Pakistan is one the counties which is affected badly by drought. In near Past, Pakistan faced one of the worst drought span drought in 50 years from 1998 to 2003 which harshly affected socially and economically. The present study was conducted on dry land areas of Punjab-Pakistan. The satellite data for NDVI were acqu...
Ajmal Khan Kassi1*, Humayun Javed1 and Tariq Mukhtar2
...ly resistant against the pest. The correlation between fruit infestation and larval population and different environmental factors was also studied. Average relative humidity was found positive and significantly correlated with fruit infestation. Average precipitation showed positive but non-significant correlation in case of all the cultivars except Singhnath 666 which was positive and significant. On the other hand, average tempe
Rahat Afza, Muhammad Afzal, Muhammad Zeeshan Majeed and Muhammad Asam Riaz*
...re found stronger and competitive than larvae and adults of C. transversalis during IGP. Higher IGP of C. septempunctata on C. transversalis was linked to its larger body size. Moreover, sublethal concentrations of insecticides (lambda-cyhalothrin, cypermethrin, thiamethoxam, imidacloprid, profenophos and chlorpyriphos) significantly affected the IGP of coccinellids beetles and their aphid consumption. T...
Pingping Cang1, Mingming Zhang1, Guo Qiao1,Qirui Sun1, Dehai Xu3, Qiang Li1, Xinghua Yuan4 and Wenbin Liu2,*
...ive mudflat aquaculture species, was used to evaluate the effects of biofloc technology (BFT) on growth, nutrition and economic profitability in mudflat fish aquaculture. A 60-d experiment was conducted in zero-water exchange BFT system. The results demonstrated that weight gain (WG), specific growth (SG) and survival in BFT group were 133.94%, 1.20% day-1 and 90.0%, res
Muhammad Waqas Imam Malik1, Khalid Usman1*, Tahir Amin1, Muhammad Riaz2, Zafar Iqbal3 and Fiaz Hussain1
... quality of cotton genotypes. An experiment was managed in a split plot, randomized complete block design, replicated thrice at the Agricultural Research Institute, Dera Ismail Khan. The experiment was conducted in 2016 using treatments irrigation intervals (10, 15, 20 and 25 days) and Bt cotton varieties (MNH-886, CRIS-342, and CRIS-134) as main- and sub-plots treatments, res
Sumaira Maqsood1,*, Muhammad Afzal2, Muhammad Saleem Haider1, Hafiz Azhar Ali Khan1, Muhammad Ali1, Muhammad Ashfaq1, Muhammad A. Aqueel2 and Muhammad Irfan Ullah2
...are potential biological pest controller which can regulate an extensive range of bollworms larvae in both Agricultural and Horticultural crops. Spodoptera litura is a commercial pest of diverse field crops comprising cauliflower (Brassica oleracea var. botrytis). Current inspections were carried out to determine their impact on larval mortality, pupal and adult emergence by ...
Zhen-li Li1,2, Hui-fang Zhou2,*, Bo-ru Zhou2, Bei Liu2, Xiao-fei Jiang2 and Jian-ya Xu2
...pristone on sex hormones persist after drug discontinuation, possibly leading to luteal phase defect (LPD) and infertility. Recent studies revealed that mifepristone not only affects the ovary and uterus, but also the pituitary, resulting in LPD. Bu Shen Zhu Yun formula (BSZYF) was developed by Professor Guicheng Xia, a “great master in TCM.” It effectively cures LPD, while its effect on the pituitary is unclear....
Jian Wang1,*, Zhi Liu2, Sheng Xu2, Mei-Fen Hu2, Xiao-Rui Liu1 and Wen-Jie Cai1
...A in neutrophils were respectively measured by ELISA and PCR. The house keeping gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal reference, the ratio of lgcDNA/lgGAPDH was regarded as the extreme level of CXCL8 mRNA. The serum level of CXCL8 and expression of CXCL8 mRNA in neutrophils of the chronic renal failure were (128.892±17.101) pg/mL and (1.332±0.138) lgcDNA/lgGAPDH. There was no significant difference compare...
Bei Liu1, Yanli Hong1, Huifang Zhou1,*, Zhenzhen Cao1, Shuang Zhang1, Jing Jin1, Miao Jiang1, Cunsi Shen2 and Jianjian Ji2
...s were detected in the supernatant of each group. The mRNA and protein levels of GnRHR, the hub genes and key transcription factors in the downstream cAMP-PKA signaling pathways in RPC cells were also detected. The secretion and transcription levels of FSH and LH in Cetrorelix group were significantly decreased, while the expression of GnRHR was significantly increased compared to the blank group (p<0.05). Use of CSF with BSZYD alone showed no signif...
Peng Song1,2, Wei Feng2, Haiying Shi2,Jinsheng Zhao3, Renmin Liu3 and Wei Xu2,*
... the inhibition action appeared at 7% NaCl. The maximum decolorization concentration of the Amaranth reached 1450mg/L. Mg2+ and Fe3+ could accelerate Amaranth decolorization, and Cu2+, Zn2+, Co2+ showed inhibition of Amaranth decolorization. Compared with the traditional method dissolving oil-soluble dye in DMSO, HP-β-CD was used to monitor the decolorization rate of the sudan I and appropriate molar ...
Hao Gu*, Zhi Yang, Weiqiang Yu, Kan Xu and Yuan-fei Fu*
...cin extracted from chili peppers were selected to explore the antibacterial activity against the four cariogenic bacteria in terms of acid producing and biofilm. The antibacterial activity of capsaicin was evaluated by the minimal bactericidal concentration, change of pH in the first 12 h and OD values of biofilms. Besides, fluorescent images of exopolysaccharides and living bacteria of Streptococcus mutans were measu...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Nosheen Fatima1, Raheel Babar3 and Ikramul Haq4
...vely aware of regarding species diversity; however, they do not know the modern techniques to uphold crop and species diversity. Biodiversity concept of farmers is at very basic level and they know only limited conventional ways to maintain it. The statistical analysis showed weak significant association between factors responsible for biodiversity loss and two types of biodiversity since ...
Hamidullah1,*, Arshad Javid2, Basit Rasheed1,Jehan Zeb3, Abidullah1 and Muhammad Iftikhar Khan1
... 40.11±2.24mm, respectively. The greatest length of skull of these species was 11.75±0.35mm, 13.69±0.25mm, 12.48±0.34mm, 11.83±0.30mm and 15.00±0.15mm, respectively while their total bacular length was 1.58mm, 3.81±0.01mm, 3.82±0.47mm, 2.11±0.707mm and 5.83±2.15mm, respectively. The sh...
Aisha Siddiqua1*, Munir Ahmad1 and Nusrat Habib2
...-align: justify;">This paper assesses the effectiveness of adaptation in enhancing the wheat yield in Pakistan, and incentives that promote adaptation to climate change. We perform a counterfactual analysis and Multinomial Endogenous Switching (MES) regression model to analyze and compare the impact of different adaptation strategies in isolation or in combination on yield. The primary data of ‘Climate Change Impact Su...
Muhammad Naveed Afzal1, Muhammad Tariq1*, Muhammad Ahmad1, Khuram Mubeen2, Muhammad Ayaz Khan3, Muhamamd Umer Afzal4 and Shakeel Ahmad5
... and associated fiber properties. In this RCBD split plot experiment, two planting densities (8.88 and 4.44 plants m-2) were assigned to main plot and four nitrogen rates (0, 50,100 and 150 kg N ha-1) were kept in sub plots with three replications. The PD was maintained by altering the within plant spaces keeping the row spaces (75 cm) constant. The results indicated that significant PD X N interaction was observed for plant...
Syed Amjad Kamal Jan* and Naushad Khan
...ch affect the production per acre of rice and analyze the problems and constraints faced to rice grower in the study area. The universe of the study was Lower Dir District which consist of seven tehsil while on the basis of more production only two tehsils Balambat and Lalqila were purposively selected The total rice growers number in this district was37557, Balambat 6121 and Lalqila 5167which make total in both tehsils 11228. Through Yamani Formula 100 sample...
Najeeb Ullah1, Niamat Ullah Khan2*, Abdul Aziz Khakwani1, Muhammad Safdar Baloch1, Ejaz Ahmad Khan1, Farkhanda Khan3 and Zaki Ullah4
... cotton varieties. The experiments were laid out in RCBD with split-plot replicated thrice. Sowing dates i.e. March 15, April 01, April 15, May 01, May 15, and June 01 were kept in main and cotton varieties (CIM-602, CIM-616) in sub-plots. Results showed that April 15 sowing produced highest bolls per plant, boll weight-g, seed cotton yield, staple length, strength and micronaire amongst the other sowing dates. Results furth...
Sonia1, Khuram Nawaz Sadozai1*, Noor Paio Khan2, Abbas Ullah Jan1 and Gulnaz Hameed3
...riables that includes temperature, precipitation and humidity was also inquired through this research. Panel data of wheat crop’s input and aforesaid climatic variables for the period of thirty years (1985-2015) was employed to figure-out the major findings. Econometric diagnostic tests were used to verify the model stability. Therefore, LM test was encompassed to detect the serial correlation. The result of Hausman te...
Huseyin Cetin1,*, Oner Kocak2, Emre Oz1, Samed Koc1, Yesim Polat1 and Kalender Arıkan2
...y, this insect has developed resistance in many regions/countries of the world. The use of synergistic substances to overcome insecticide resistance is widespread. Piperonyl butoxide (PBO) is used as a synergist in combination with SPs for the control of houseflies. The aim of this research was to determine the effect of SPs (cypermethrin, permethrin and...
Mehwish Akram1,2,* and Naeem Rashid1
...ators of cell function depending on the cell type of where they are expressed. They are involved in regulation of cell membrane resting potential, potassium homeostasis and control a variety of cellular functions including metabolism. In this study we determined that a regulator of Pigment dispersing factor, PDF-immunoreactive neurons in the Drosophila melanogaster adult brai...
Ali Murad Rahoo1,*, Tariq Mukhtar2, Barkat Ali Bughio3 and Rehana Kanwal Rahoo4
....2, 15.2 and 11.4 IJ, respectively) than those of H. bacteriophora (2.8 IJ each per G. mellonella and T. molitor medium and 3 IJ per T. molitor small). Contrarily, there was greater emergence of IJ of H. bacteriophora than S. feltiae in all the treatments. The mean numbers of H. bacteriophora emerging from G. mellonella larvae were 27...
Zhi YiJin1, Shao MingQin1,*, Cui Peng2 and Chen Bin1
...ts of sex and ambient temperature on how time was budgeted, and activity rhythms were established in wintering Mandarin Ducks (Aix galericulata). This was done using instantaneous scan sampling in the Poyang Lake watershed in the Jiangxi province, China. The results showed that the Mandarin Ducks’ predominant behaviors were resting (36.56%), swimming (21.75%), foraging (20.88%), and maintenance (15.58%), indicating that during the winter, Mandarin...
Kalimullah Khan1,*, Hafsa Zaneb2, Zia Ur Rehman3, Hamza Maris4 and Habib ur Rehman1
... gain during the whole experimental period. Application of phytasefailed to exert any influence on the weights of gizzard, provetriculus, heart, liver, spleen and empty intestine. The weights and lengths of the small intestine were highly significant (P > 0.05) in the treatment groups. This study showed the potency of phytase to enhance the growth performance in broilers and it will lay...
Tongliang Wang1, Lele Jia1, Xiaofei Zhai1, Jianguo Cui2 and Jichao Wang1,*
...tivity should match the spectral character of calls, suggesting that sender calls and receiver auditory systems have co-evolved. However, studies provide mixed evidence, and in some species, this match is imprecise. Here, we analyzed the acoustic characteristics of male calls and both male and female hearing sensitivity in an explosive-breeding toad Duttaphrynus melanostictus to test the matched filter hypothesis.Male...
Samiah Shahid1,Jawaria Shaheen1, Wajeehah Shahid2, M. Waheed Akhtar1,3 and Saima Sadaf1,*
...nary, quantification was performed through real time PCR in eight samples. The geNorm algorithm and comparative delta Cq method were used for selection of suitable reference gene out of the three candidate genes. The validation studies were, thereafter, performed on 112 samples including 87 patients and 25 normal healthy controls. The geNorm algorithm exhibited circulating mir-16-5p with the highest expression stability demo...
Dur-E-Shahwar1,2, Riaz Ahmad Sheikh1, Nazia Jamil2*
... several applications in petroleum, pharmaceutical and agricultural industries. Produced water is a major waste water stream of petroleum industry which is produced during petroleum extraction from subsurface in which hydrocarbons are found as a main environmental pollutant. Present study is focused on production of biosurfactants from indigenous bacteria, isolated from produced water and ...
Saira Zaheer1, Abrar Hussain1*, Aqsa Khalil1, Muhammad Mansha1, Muhammad Lateef2
...arasite worms have developed multiple resistances against the synthetic anthelmintics. Hence, various biological controls, vaccines and local medicinal plants are being explored to control the parasitic worms. The aim of this study was to evaluate the anthelmintic potential of two local plants, Albizia lebbeck L. and Camellia sinensis L against H. contortus using Adult Motility Assay (AMA). Crude Ethanolic Extracts (CEE)of drie...
Ali Awais, Charassri Nualsri and Watcharin Soonsuwon*
...he two upland rice genotypes Dawk Pa-yawm (white rice) and Dawk Kha 50 (red rice), in Thailand. Seeds of the potential genotypes has been treated with varying EMS concentrations. With the increase in concentration, there was a continuous decrease in germination, shoot and root lengths respectively. Data have been subjected to regression analysis and effective doses of EMS were recorded for...
Noor ul Ain*, Malik Muhammad Shafi and Haidar Ali*
...,336.66 during the study period. The results showed that on average the quantity demanded of Spinach was 4.1993 Kgs, Pea 4.0767 Kgs, Potato 6.65 Kgs and 4.95 Kgs of Cabbage-Cauliflower. Results showed that Spinach was a compliment of Pea. Results indicated that household size was highly significant and had a positive relation with the quantity demanded. The study showed that household size is highly significant for all the selected vegetables, indicated that a...
Rizwan Ullah Shah* and Iqbal Munir
...ptible to the present experiment applied phytohormones ...
Omer Baris Ince*
...Foot and Mouth Disease depends on the disease control policies and epidemiological status of the country. In countries where the disease is endemic, protective vaccinations are performed with inactive vaccines of suitable serotype and measures are taken in order to reduce the prevalence of the disease. In this study, blood samples were collected from clinically healthy sheep and bovine in ...
Ummad-ud-Din Umar1, Syed Burhan-ud-Din2, Muhammad Fahad Khan1, Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Muhammad Asif Zulfiqar3, Azhar Ali Khan3 and Naila Ilyas1
...oviruses diseases have appeared as irresistible problem in different crops of Pakistan. The research was carried out to estimate the probable role of induced systemic acquired resistance in mungbean against Mungbean yellow mosaic virus (MYMV) disease. Exogenous use of Salicylic acid (SA) and Benzothiadiazole (BTH) as elicitors enhanced the resistance in mungbean plants by triggering the SA pathway. Induced resistance was assessed by evaluating the ap
Naseer Ahmed Abbasi1, Mian Noor Hussain Asghar Ali1*, Bilawal Abbasi2, Shakeel Ahmed Soomro1, Najeeb Ahmed Khan Nangraj1, Jam Ghulam Mustafa Sahto1 and Sajjad Ahmed Morio1
...dy able to provide grade performance suitability of lands for agricultural purposes; it could be more helpful for farmers of the research area. Fuzzy AHP methods could be beneficial for future studies for land suitability. The study finding have capabilities of different methods combined with fuzzy analytic hierarchy process (AHP) and the potential time and cost saving methods can assess the suitability of land. Finding shows that the fuzzy set method is diffe...
Hina Ali*, Iram Shaheen and Feroza Hamid Wattoo
...aim of this study was to perform physico-chemical and microbial analysis of drinking water samples of different areas of Rawalpindi. The water samples were collected into sterile containers from the different localities of Rawalpindi such as Dhokekala khan, Morgah, Scheme-III, Gulshandadan khan, Satellite town, Dhoke kashmirian, Pandora, Bahria town, University campus (Mehr water) and Air Port. The pH of PMAS-AAUR campus water ( Mehr Water) was found within WH...
Zhiwen Zou, Jianfei Xi, Fen Chen, Rui Xu, Tianrong Xin and Bin Xia*
...more than 1,500 nominal species. However, the relationships of this subfamily was confused. In order to improve the classification system of Amblyseiinae, the mitochondrial CO1 gene sequence of seven Amblyseiinae species, collected from four provinces of China, were sequenced, and another seven Amblyseiinae species mt CO1 gene sequenced were download from GenBank. And the phylogenetic rela...
Juan Augusto Hernández-Rivera1, Jaime Molina-Ochoa2,*, Luis Jorge García-Márquez1, Omar Francisco Prado-Rebolledo1, Rafael Julio Macedo-Barragán1, Arturo César García-Casillas1 and Muhammad Irfan Ullah3
Jam Nazeer Ahmad1,2,*, Muhammad Jafir1, Muhammad Wajid Javed1, Sumaira Maqsood3 and Samina J.N. Ahmad1,2,*
...ug, Oxycarenus hyalinipennis (Hemiptera:Lygaeidae) is difficult because of its close resemblance to other bugs of genus Oxycarenus. Molecular identification and characterization of dusky cotton bug (DCB), Oxycarenus hyalinipennis (Oxycarenidae: Hemiptera) was done through Polymerase chain reaction and sequencing. In PCR, mitochondrial cytochrome oxidase I (COI) gene based primers were used for identification of...
Muhammad Aslam Rajput1,3, Imtiaz Ahmed Khan2, Rehana Naz Syed3 and Abdul Mubeen Lodhi3*
...nt of smut disease. It appears that disease expression was significantly influenced by pathogen inoculation method. The infection caused by S. scitamineum and subsequent whip smut development has also been greatly varied with the inoculation method. Injection method followed by wound+paste method and dipping method produced maximum disease incidence, highest number of whips, more tillering and less germination. While, other inoculation techniques, including so...
Muhammad Ali1,2*, Norsida Man2 and Farrah Melissa Muharam2
Rehmat Ullah* and Khalid Nawab
...terview schedule through personal interview method whereas binary logistic regression model was utilized (binary responses (1 if exists 0 otherwise) both of dependent and independent variables) to find out the effect of precautionary measures and Personal Protection Equipment on self-reported acute poising cases. Binary logistic regression analysis depicted highly significant negative asso...
Shakeel Ahmad Anjum1, Muhammad Mohsin Raza2, Sami Ullah1, 3*, Malik Muhammad Yousaf2, Ahmad Mujtaba1, Mumtaz Hussain2, Muhammad Jahangir Shah2, Bashir Ahmad2 and Ijaz Ahmad4
...lanted maize crop. The experiment was conducted in summer, 2014 at Agronomic Research Area, University of Agriculture Faisalabad, Pakistan in a randomized complete block design (RCBD) with four replications. Net plot size was maintained 7.0 m × 3.6 m. Different tillage practices, i.e., deep tillage, conventional tillage, minimum tillage, simple cultivation flat sowing, simple cultivation ridge sowing, zero tillage dibbling and zero tillage drill were
Rafiullah1*, Abdur Rahman2, Khalid Khan1, Anwar Ali1, Arifullah Khan2, Abdul Sajid3 and Naimatullah Khan3
...resent study two animal species (cattle and buffalo) were selected. A total of 800 samples were collected from different areas of District Lakki Marwat and District Peshawar. All the samples were processed through different diagnostic techniques, including Microscopy, ELISA and Real-time PCR for diagnosis of Theileria parva at Veterinary Research Institute Peshawar. The overall prevalence for Theileriosis was 27.75% through Real-time PCR, followed by Indirect ...
Liqin Liu, Maoting Wang, Zhenming Lü, Li Gong*, ChangWen Wu, Baoying Guo and Lihua Jiang
... In this study, we developed twenty-one microsatellite loci for S. pharaonis through next-generation sequencing technology. A total of 100 alleles were detected, and the number of alleles per loci ranged from 2 to 9. The observed and expected heterozygosities per loci ranged from 0.000 to 0.531 and from 0.031 to 0.751, res...
Ahmed Samy1*, Hala Mohamed Nabil Tolba2, Gamelat Kotb Farag3 and Ahmed Abd El Halim1
...t-align: justify;">Genotype VI Newcastle disease viruses (NDV), that designated pigeon paramyxovirus 1 (PPMV1) commonly isolated from pigeons (family Columbidae). PPMV1 not only represent a potential threat to pigeon but also it can infect chickens and its virulence enhanced upon passaging in chickens causing clinical signs and deaths. In the present study brain samples were collected from twelve pigeon flocks exhibiting signs of nervousness and diarrhea in a ...
Nasira Khatoon1, Aly Khan2,*, S.S. Shahid3, Z.S. Saify4, M. Arshad Azmi1 and Wali Khan5
...ical University were grouped into five categories based on their age at the first visit. The diagnosis was based on detailed history and clinical examination which included scraping of papillae or burrow to confirm the diagnosis. To test the incidence in various age groups and body parts a chi-square (χ²) test of association (R × C contingency test) was performed. The association of body parts and age g...
Muhammad Usman Asif*, Raza Muhammad, Waseem Akbar, Mubasshir Sohail and Muhammad Awais
...of eighteen cotton genotypes to sucking complex (thrips, jassids, and whiteflies) and bollworms (spotted and pink) were assessed in the experimental field of Nuclear Institute of Agriculture, Tandojam. The experiment was conducted under Randomized Complete Block Design (RCBD) with three replications. The result of overall mean revealed that NIA-M-20 had comparatively greater resistance to ...
Khalid Khan1, Saima Liaqat2*, Somaiya Rasheed1 and Ihsanullah Kakar3
...he economy and improving people’s living conditions. The study used primary data which were composed via well-regulated questionnaires from one hundred livestock farmers of diverse Tehsil/Union Council of District Lasbela. The findings of the study exhibited that trivial farm holders widely used livestock for income generation. Furthermore, livestock have a predominant role to accomplish the rudimentary needs of the households. Moreover, livestock offer ...
Ali Raza Jahejo1,2, Nasir Rajput2, Wen-xia Tian1,*, Muhammad Naeem2, Dildar Hussain Kalhoro2, Asmatullah Kaka2, Sheng Niu1 and Fa-jie Jia1
...g/kg supplementation, respectively. Improvement of intestinal villus seen in basil supplementary group (P>0.05), and significant increase in the absorption of crude protein (CP), crude fibre (CF), and metabolized energy (ME). However, the values of red blood cells and packed cell volume were non-significant whereas white blood cells, haemoglobin, and new castle disease antibody titer were significantly higher in basil supplementary group. The weight gain an...
Fariha Latif* and Muhammad Javed
...re. Fish from different species has diverse ecological needs and respond differently to the environmental stress conditions. Thus, the sensitivity, bioaccumulation and antioxidant capacities of three major carps Catla catla, Labeo rohita and Cirrhina mrigala towards metals mixture (Cd+Cr+Cu+Pb) were determined during present research work. Sensitivity of the three fish species (120-day old) towards metal...
Wen Chao Liu1,2, Kwan Sik Yun3 and In Ho Kim2,*
...erol (1,3-DAG) on growth performance, blood lipids profiles, relative organ weight and meat quality of broilers. A total of 512 male, one-d-old Ross 308 broilers with an average initial BW of 45.28 ± 0.81 g were randomly allotted to 4 treatments. Each dietary treatment consisted of 8 replicate cages, with 16 birds per replicate. The 4 dietary treatments were corn-soybean meal-based diets and supplemented with 0, 0.05,...
Muhammad Usman Ahmadand Ikram-ul-Haq*
...ved oxygen at pH 7.5, temperature 37°C, 25mM lactate as H+ donor after 20 min. This strain was later on confirmed by 16S ribotyping procedure. Oxyrase was used for improved cultivation of anaerobic bacteria by employing Hungate Technique where its antioxidant potential was compared with common reducing agent Cysteine-HCl (Cys-HCl). Four anaerobic bacterial strains (Anaerobaculum hydrogeniformans OS1, Akkermansia muciniphila, Bil...
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...ultivars. Similarly, the pest produced significantly more eggs and larvae on comparatively susceptible cultivars as compared to comparatively resistant ones. As comparatively resistant okra varieties viz. Bhindi Punjab Selection, Arka Anamika and Bhindi Sabazpari suffered less damage and yielded more and are therefore, recommended for cultivation to avoid damage by Helicoverpa armigera.
...
Abdul Wahaab1, Muhammad Ijaz1,*, Syed Saleem Ahmad1, Umair Iqbal2, Abdul Tawaab1 and Iahtasham Khan3
...y of 97.92% and 100%, respectively; Oxyclozanide was 2nd most effective with efficacy of 96.87% and 97.05% % whereas Nitroxynil remained at last with efficacy of 93.47% and 92.15% at 21st day post-medication. A slight increase of egg counts was observed in positive control groups of both animal categories. Blood parameters of healthy and Fasciola infected animals (cattle’s and buffaloes) were compared; spe
Muhammad Hidayat Rasool1,*, Muhammad Zaheer1, Muhammad Farooque Hassan2, Muhammad Shafique1 and Muhammad Usman Qamar1
...eat concern worldwide. Especially increasing resistance to 3rd and 4th generation cephalosporin and carbapenems is an issue of high importance. Present study was aimed to determine the frequency and antimicrobial susceptibility patterns of MBL producing carbapenem-resistant Gram-negative rods (GNRs) isolated from clinical specimens....
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
... resulted in three genotypes of AA, GA and GG. Association analysis demonstrated that the liver ChREBP mRNA expression level was significantly positive or negative effect on serum total protein (TP), albumin (Alb), triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) (P<0.05 or P<0.01). The g.247075G>A mutation was significantly association with these measured serum bio...
Hafiz Abdullah Akbar, Zafar Iqbal, Waqas Raza*, MuhammadUsman Ghazanfar and Salman Ahmad
Ayesha Chaudhary1, Fouzia Mumtaz1, Muhammad Yaseen2* and Muhammad Younis Afzal3
...bsp;to all countries independent of their size or stage of development. In Asia, particularly, the agricultural production might decrease by an alarming rate up to 5-30% to 2050. The main reason for this is increasing the earth’s temperature. The decrease in crop yield will cause another associated issue of food insecurity in the continent and emerge severe problem for a human to survive. Climatic change is defini...
Shahid Yousaf1*, Salman Khurshid1, Saqib Arif1, Hafiza Mehwish Iqbal1, Qurrat ul Ain Akbar1, Najmus Sahar1 and Ghulam Rasul2
... 0.96, 0.83 and 0.73, respectively. Three consecutive measurements of test weight, moisture and gluten contents by using NIR and referenced methods shown to have average repeatability of 0.2%, 0.3%, 2.4% and 0.1%, 0.7%, 1.5% respectively. The information is useful for maintaining the quality of wheat intended for milling and ultimate products.
...
S. Justin Carlus1,*, Atiyeh M Abdallah1,2, Abdulhadi H. Al-Mazroea1, Mazen Khalid Al-Harbi3 and Khalid M Al-Harbi1
...sociated, and maternal hyperhomocysteinemia is an independent risk factor for CHD. In Saudi Arabia CHD represents one of the most important health problems. Here we examined the association between methylenetetrahydrofolate reductase (MTHFR) gene polymorphisms and CHD and DS co-inheritance in patients from Al Madinah, Saudi Arabia. MTHFR rs1801133 and rs1801131 polymorphisms were genoty...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
...s vittatus were two species of colorful coral reef sweetlips which distribute in the areas of Indo-Western Pacific. The two species have long been considered as a synonym (oriental sweetlips) in morphology. In order to investigate the validity of two species at the molecular level, complete mitochondrial genomes of the two species were first determin...
Sakhra Mahmood1, M. Younus1, A. Aslam1, A.A. Anjum2, S. Umar3, Aamerzish Mushtaq3 and M.L. Sohail4,*
...o get optimum production performance from livestock and poultry, proper detoxification of AFB1 in feed is mandatory. This study was designed to analyze the biological detoxification potential of Saccharomyces cerevisiae (SC) in experimental quails fed with AFB1 added diets. For this purpose 180 quails, divided in 3 groups were reared and fed with 3 different ex...
Osman Ergene1,*, Isfendiyar Darbaz1, Serkan Sayiner2 and Selim Aslan1
...trasonography (TRUS) was performed on all cows on days 30 and 40 after AI. Measurements were carried out on 9 cows whose pregnancy was confirmed and 9 cows whose embryonic mortality (EM) was determined. In PAG-Serum, there was a statistically significant difference (P <0.05, P <0.01) between the measurements on 40th day when EM was detected and on the 28th and 32nd days of pregnancy. In the PAG-Milk and PSPB-serum tests, there was a...
Sabi-Ur-Rehman1, Anwar Khalid2, Qazi Najam Us Saqib3, Farooq Ahmad1, Shaheed-Ur-Rehman4, Neelam Zaman3, Ayeza Mehmood5 and Abdul Samad6*
...nd fungal strains were Aspergillus. niger, A. flavus, and D. turcica. The maximum zones of inhibition, 23.00±0.56 mm and 25.00±0.50 mm was given by ethyl acetate fraction of leaves against P. fluorescens and A. niger respectively. The crude saponins isolated from leaves did not give significant results against the tested bacterial strains where as it was significantly active against fungal strains. The results ...
Hande Küçükönder1, Pınar Çelebi Demirarslan1,*, Aykut Burgut2 and Mustafa Boğa3
...ltry house on production performance in a commercial poultry enterprise with a hybrid approach. In accordance with this purpose, the hybrid approach has two main objectives: i) Determination of the effective period for which the output factors [(chicken survival rate (%), egg yield (%)] are optimized at the same time and the appropriate value ranges for the input factors [temperature (
Umar Farooq Gohar1, Hamid Mukhtar1,*, Ali Nawaz1, Ikram-ul-Haq1 and Asad Mehmmood2
...iv>The present study was performed to optimize physical parameters for the maximum production of antibiotic (cephalosporin) by isolated fungal strain Acremonium chrysogenum (IIB-10). The strain IIB-10 was cultivated on medium containing (%, w/v): Baker’s flour, 1.5; corn meal, 2; Methyl oleate, 1.6; calcium carbonate, 0.3 and ammonium sulphate, 0.1. The cultural conditions such as incubation temperature (30°...
Effect of Two Microecological Preparations on the Breeding of White Leg Shrimp, Litopenaeus vannamei
Song Jiang, Fa-Lin Zhou, Jian-Hua Huang, Qi-Bin Yang* and Li-Shi Yang
...ess resistance of Litopenaeus vannamei larvae, different amounts of Bacillus and Lactobacillus bacteria were added to the L. vannamei aquaculture water during seeding. Seven groups were established and the microecological preparations were added every 5 d. Bacillus concentrations in the Y1, Y2 and Y3 groups were 10 ppm, 15 ppm and 20 ppm, respectively, and the Lactobacillus concentra...
Aisha Khalid1, Muhammad Tayyab1,*, Abdual Rauf Shakoori2, Abu Saeed Hashmi1, Tahir Yaqub3, Ali Raza Awan1, Muhammad Wasim1, Sehrish Firyal1, Zaheer Hussain4 and Munir Ahmad5
...2500 µmoles/min respectively with the specific activity of 12464 Umg-1, using carboxymethyl cellulose as substrate. The deinking potential of recombinant cellulase to remove ink from the paper makes this enzyme a suitable candidate for its use in paper Industry. We are reporting a new member of M42 Family of amino
Liyan Zhang1,2, Zhidong Zhou1,3, Haiping Li1,2, Yanlong Qiao4, 5 and Yueping Zhang1,3,*
...ographical range of the species. However, no phylogenetic structure corresponding to geographic location was observed from the neighbor-joining (NJ) tree and haplotype network analyses, and gene flow and exact P test results revealed that a wide range of gene flow occurred among the four S. japonicus populations. Analysis of molecular variance (AMOVA) and Fst analysis showed that genetic varia...
Doğukan Ölmez1 and Gonca Alak2,*
...ethods at different time periods using different trout byproducts. In this study, two different groups (viscera and muscles) of trout processing wastes were hydrolyzed by enzymatic method based on specific time periods (0, 30, 60, 90, 120 and 180 min) for this purpose. Protein profiles, molecular size and distribution changes of the obtained hydrolysates were calculated using SDS-PAGE and ...
Marian Kuczaj1, Ewa Czerniawska-Piątkowska2,*, Alicja Mizera1, Renata Pilarczyk2, Bogumiła Pilarczyk3 and Patryk Barton1
...div>The purpose of the paper was the analysis of the impact of selected breeding and environmental factors on the results of rearing heifers of the phf red-white variety. The research included 133 cows and heifers and their offspring, i.e. 116 calves only from single pregnancies. The calves were weighed and the zoometric measurements were carried out on the day of birth, at the age of 1 month and 6 months, and daily increments were calculated in the ana...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...control method was developed for camel tick (Hyalomma dromedarii Koch) and cattle tick (Hyalomma impeltatum Schulze & Schlottke), to replace the widely used traditional acaricides. Huwa-San TR50 is a formulation of hydrogen peroxide, stabilized by the addition of a small quantity of silver and is extensively used as a disinfectant. Both tick spe
Iqra Bano1,*, Moolchand Malhi2, Pershotam Khatri3, Saeed Ahmed Soomro2, Hira Sajjad4, Ambreen Leghari5, Muhammad Awais2, Safia Kandhro6 and Shakeel Ahmed Lakho5 and Munaza Soomro7
...issues.
...
Mohammad Wasiullah Khan1*, Abdur Rab1, Roshan Ali2, Muhammad Sajid1, Faiza Aman1, Imran Khan3, Iqbal Hussain3 and Akhtar Ali3
...uring winter 2014. The experiment was laid out in randomized complete block design using three replications. Four K levels (00, 90, 120 and 150 kg ha-1) and three levels of Zn (00, 05 and 10 kg ha-1) were used. The various parameters studied during experiment were tuber yield (ton ha-1), total soluble solids (TTS), specific gravity and starch content. Potassium and zinc application at vari...
Muhammad Zulfiqar1*, Irshad Abbasi2, Himayatullah Khan1, Arjumand Nizami3, Abdul Hakeem4, Jawad Ali3 and Muhammad Jamal Khan1
...il). In general, monsoon period is dry, and only 18% of total annual precipitation occurs during the months of July-October. Burgay watershed is situated upstream of Satpara Dam. Water from this watershed is distributed among the communities according to historically agreed distribution patterns. Water availability vary from season to season. The objective of the instant study was to assess the glaciers/snow water dependence...
Ayesha Khan*, Zubair Ahmad Khan, Urooba Pervaiz And Mehmood Iqbal
...sion agents having job experience of more than 20 years. The main sources of information for the majority (79%) of extension agents were extension publications and training. Extension agents viewed that poverty (49%), expensive inputs (21%) and illiteracy (16%) were the main adoption constraints faced by farmers. Majority (86%) extension agents reported that the extension services are farmer friendly. The most appropriate te...
Tanweer Ahmed*, Kashif Saeed Khan and Mohammad Naeem
...he impact of government spending on agricultural growth in Pakistan. The relationship among agriculture value added per worker and public spending on education, health, road length, the number of tube wells in the agriculture sector, improved seed distribution has been estimated through various econometric approaches in the study. Pakistan’s agriculture growth has registered mixed tr...
Catherine J. Allen
... notions of well-being experienced in the socio-culturally diverse communities of the Andean region? I begin by focusing on inhabitants of Sonqo, a rural Quechua-speaking community in the highlands of southern Peru, where I have carried out research since 1975. I explore notions of well-being through vocabulary drawn from Southern Peruvian Quechua, including allin kawsay (well-being), pacha (world), <...
James Maffie
... total destruction. They perceived human beings’ hold on life in these circumstances as inescapably “slippery” and thus fraught with hardship, pain, suffering, sorrow, hunger, disease, and death. Stubbornly refusing to surrender to despair, Aztec philosophers (tlamatinimeh) responded with what they called toltecayotl or “the art of living wisely and well.” Toltecayotl enjoined huma...
Brian Yazzie Burkhart
...from it. It is from this perspective of being that this essay tries to articulate a framework for understanding well-being that is both rooted in the land and in reciprocal kinship relationship with it. This essay examines Diné, Lakota, and Jalagi stories and language concepts for their rootedness in land in more than a material sense in order to provide a framework for a theory of well-being that...
Tahira Moeen Khan* and Amat ul Mateen
...nly known as dharaik) a species of family Meliaceae and Morus nigra (commonly known as Shahtoot) family Moraceae were used for bio reduction of copper ions to CuO nanoparticles in place of harmful and expensive chemical/physical methods. A cheaper, simple to perform method giving high yield without by produ...
Kamran Zakaria1*, Noreen Munawar1 and Shafqat Ejaz2
...of global wavelet power spectra. Records from 52 rain gauges were studied and the outcomes of the whole power spectra exhibited a low annual frequency all over the basin; whereas additional frequencies are present with major significance that indicate changes in the rainfall system. While, the calculated global wavelet power spectra showed variable frequencies, they presentedodd patterns (...
Temel Göktürk1,* and Göksel Tozlu2
...pini L.) and the European pine sawfly (Neodiprion sertifer) can cause epidemic, around the globe. Recently, an outbreak has been reported in young Scots pine (Pinus sylvestris L.) forest in Artvin - Borçka, Turkey. In order to propose effective control measures, this study was conducted to estimate the effectiveness of two biopesticides against D. pini ile N. sertifer larvae. Different ...
Madeeha Khalid and Amtul Jamil Sami*
...allele frequencies of respective SNPs. Genomic DNA from blood was extracted, and the selected region was amplified using PCR. Sequencing of the amplified product was performed using Sanger sequencing, and the resulting sequence was analyzed. We have recorded 11 SNPs in total that occur in the VDRE region, 5’ UTR and untranslated region of exon 1. A greater number of the SNPs were observed to coincide with the reported ...
Naveed Ahmad1,*, P.J.A. Siddiqui1, Amjad Ali1, Khan Mir Khan2, Rafaqat Masroor3, Noor ul Akbar4, Muhammad Amin5 and Mohammad Attaullah6
...es.
...
Zhen-Yang Wu1, Guang-Xin E2,*, Hui Ran1, Da-Hui Wang1 and Tian-You Yang1
...ive sites, and 18 haplotypes were detected. The number of haplotypes within populations ranged from one (WS and DJ) to six (JK). Haplotype diversity ranged from 0.000 (DJ and WS) to 0.793 (JK). The largest amount of nucleotide diversity was found in the SQ population (0.03111 ), whereas the smallest amount was in the DJ and WS (0.00000) populations. Phylogenetic analysis revealed that thes...
Luo Lei1, Xingxing Deng1, Dengyue Yuan2, Zonglin Zheng1, Chengke Zhu1, Hui Luo1, Baohai Li3, Hua Ye1,* and Chaowei Zhou1,3,*
...te the mechanism of neuropeptide Y (npy) gene in feeding in gibel carp, we cloned and identified the npy cDNA sequence. Furthermore, we examined the npy mRNA distribution in 21 tissues and investigated the effect of its expression at different nutritional levels. Herein, we found that gibel carp npy has an Open Reading Frame (ORF) containing 291 bp. Moreover, the expression of npy wa...
Dilshad Ahmad1* and Muhammad Afzal2
...mer. Empirical findings specified a cropped area, seed, labor, fertilizer and irrigation were the significant variable of increasing cotton production of Bt farmers while pesticides, irrigation and extension services more significant in increasing the Non-Bt cotton farmers production. Age of farmers, educational status, credit access and agriculture extension services access have significa...
Zafrullah Khan* and Shah Alam Khan
... crop in Pakistan. Myzus persicae is an insect pest of potato, feeding on phloem tissues of leaves of potato plant and significantly reduces the yield of potato. Antixenosis experiments were performed to assess the resistance potential of eight different potato cultivars against M. persicae under glasshouse conditions ...
John Ogunsola1*, Richard E. Antia2, Benjamin O. Emikpe2 and Olajumoke A. Morenikeji3
...e scanty in literature especially in an African setting. The understanding of challenges and prospects of captive breeding will aid conservation of zoo animals especially those endangered. This report evaluates unaided, sporadic, captive breeding of zoo animals over a 10-year span. Clinical records of observed gestation or egg-laying, as well as successful or failed parturition or hatching...
Irfan Ullah*, Abbas Ullah Jan, Muhammad Fayaz, Amjad Ali and Atta Ullah Shah
... Fourteen food groups as per HIES including milk, meat, fruits, sugar, vegetables, beverages, wheat and wheat flour, rice, other cereals, pulses, oil and fats, tea and coffee, backed products and other food were considered for the study. The data given in the survey regarding commodity prices, quantity consumed, households’ food expenditures and demographic characteristics were considered for analysis. The uncom
Aqsa Khan1, Sabyan Faris Honey2*, Babar Bajwa2, Nelofer Jamil1 and Muhammad Sohail Mazhar2
... one of the major insect pest for apple growers in Balochistan province, Pakistan. To mass rear codling moth in the laboratory for different research purposes, three artificial diets with different compositions were evaluated for codling moth larvae. Two diets containing wheat germ in their composition as major protein source and one diet without wheat germ were used. Addition of wheat germ in the diet composition for larvae resulted in significantly high
Alexus McLeod
...bsp;
...
Jesse Butler
...gether on planet Earth. Specifically, I will argue that contemporary philosophers Viola Cordova and Tu Weiming exhibit ecological self-understanding as an epistemic virtue in their conceptions of human existence. Ecological self-understanding (ESU) is veridical acknowledgement of human beings as embodied agents in the world, fundamentally situated within interdependent relations between self and environment. As contemporary ...
Seth Ligo
...nd ancient space it is imperative not only to know one’s extended family, one’s community, and one’s history, but also the history of the city more broadly, the stories that are mapped onto it, and all the neighbors — both visible and invisible — one might encounter or call upon within the city’s sacred territory. This essay explores the role of invisible or metaphysical neighbors who are ...
Christine Jeske
...tly overlooked factor in people’s estimation of their own well-being: whether they and their surrounding social networks deem their life circumstances to follow a moral trajectory. Because multiple standards of morality compete within societies, this element of well-being is subject to constant negotiation. Attaining well-being depends not merely on having a certain bundle of resourc...
Kathryn Phillips and Katherine L. Schaefer
...ly accommodating with respect to the good life by focusing on what people take to be good for themselves. Some popular Western philosophical views attempt to do so by focusing on the subjective phenomena of desires and preferences, thereby ostensibly avoiding complicated questions about metaphysical commitments; similarly, clinical conceptions aim to be metaphysically neutral. We test these notions of well-being by investiga...
Seth Robertson
...term that indicates an expert facility in social interactions and especially the ability to interpret and utilize indirect communication with ease and alacrity. In this paper, I introduce and discuss the concept of nunchi with a focus on two main senses in which it is used: as a skill and as a burden. Then, I discuss the relation of nunchi to well-being and flourishing, both in s
Tung-Yi Kho
... in China’s feted Special Economic Zone of Shenzhen, I examine here two competing visions and practices of the “good life” in contemporary China. I have labeled these the Modernist and the Relationist practices of the good life respectively. Although Chinese conceptions of the good life at the level of the state and of the general populace are today explicitly dominated b...
Sasha S. Euler
...ws cultural practices or perceptions regarding what happiness is and how it can be achieved. Mainly research on Subjective Well-Being (SWB) has identified many cultural differences in the pursuit of happiness, often described as East-West splits along categories such as highly expressed affect vs. quiet affect, self-assertion vs. conformity to social norms, independence vs. interdepen...
Jason Shepard1 and Tyra Turner2
...RD populations, leaving open the question whether this relation holds for non-WEIRD populations. We conducted three studies using big data methods to test whether the relation between future-oriented thought and well-being generalizes to non-WEIRD cultures. We found evidence that the relation between future-oriented thought and well-being was robust across cultures, including when analyzing a general trend across 64 countries (Study 1) and when examining s
Syed Atif Hasan Naqvi1*, Sidra Mushtaq1, Muhammad Tariq Malik2, Ummad-ud-Din Umar1, Ateeq ur Rehman1, Shoaib Fareed3, Muhammad Asif Zulfiqar4
...esham decline syndrome especially die back and wilt in Indian sub-continent. A diversity of plant pathogenic fungi has been identified and isolated from the various affected sheesham trees from Indian sub-continent, yet the actual cause of the diseases is still controversial. It is pertinent to mention here that no viruses or any bacteria has been reported from a singly tree in whole of the Indian sub-continent. Although the...
Dilshad Ahmad1* and Muhammad Afzal2
... questionnaire was developed for the collection of data 320 cotton farmers’ respondents for the year of 2015-16 including 160-credit user and 160 non-credit users. The study employed stochastic production frontiers function for the empirical estimates of credit on cotton production. Empirical estimates of study have denoted, significant and positive coefficient of credit has positive impact on the production of cotton in both districts Rahim Yar Khan and...
Syed Turab Raza1,*, Zhu Bo1,*, Zulfiqar Ali2 and Tang Jia Liang3
...al crops (wheat straw, rapeseed) and animal manure (pig manure, cow dung) is becoming an important issue in rapidly growing population. Vermicomposting by earthworms (Eisenia fetida) is useful technique to recover nutrients of plants such as NPK (nitrogen, phosphorus, calcium). A vermicomposting system using the earthworm species (Eisenia fetida) and treating it with cattle dung, pig manure and biochar with cro...
Adile Tatliyer1,*, Sinan Bas1 and Serdar Yagci2
...lambs at three different periods (average 11 days after birth, weaning and at the beginning of grazing) using factor scores in multiple linear regressions to remove multicollinearity problem. Morphological data obtained from 159 lambs were subjected to Kaiser-Meyer-Olkin (KMO) and Bartlett’s Sphericity tests to ascertain the suitability of factor score analysis. A result showed that implementation of factor analysis was appropriate for the studied...
Shafique Ahmed Memon1,6, Arif Ali1*, Mehar-un-Nisa Narejo2, Ghulam Khaliq3, Imran Ali Rajput4, Muhammad Adeel1, Khalil Ahmed Memon5, Dzolkhifli Omar6, Muhammad Rashid7 and Abdul Rasool5
...tability of three aphid species on the pre-imaginal development of three species of green lacewings. Developmental stages of three different species of green lacewings, Chrysoperla nipponensis, Plesiochrysa ramburi and Apertochrysa sp. were provided with three different prey species,...
Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2
...lony forming units (cfu) per gram of soil and seed were determined and capability of previously characterized M. phaseolina isolates to cause the disease was tested on HO-1 variety. Additionally, most virulent isolate was characterized through sequence and phylogenetic analysis. There was significant variation (Df= 54, F=7.4, P=0.0000) among cfu per gram of M. phaseolina in soil samples collected during field survey at diffe...
Muhamamd Naeem1 and Murad Khan2*
...inary survey showed 127 operational poultry farms scattered over in the study area. Out of total farms, 60 firms were selected randomly. To capture the seasonal variation and effects of different factors on seasonal fluctuations in the poultry industry, a descriptive statistic as well as OLS technique was used. The main cost of winter season consists of feed cost, lighting cost, the price of day old chicks, breeding cost, medication and vaccination cost. These...
Salman Anwar1, 2*, Farhan Anwar Khan3 and Atta-ur-Rahman4
...ustify;">This research paper analyses the impact of Karakoram Highway (KKH) on land use and agricultural development of Gilgit-Baltistan, Pakistan. Pakistan is gifted with a lot of natural resources in the shape of fertile agricultural lands, water resources and minerals. Agriculture is the backbone of Pakistan’s economy. About 70% of its population is directly or indirectly associated with this sector. Gilgit-Baltista...
Arjumand Nizami1, Jawad Ali1 and Muhammad Zulfiqar2*
...he knowledge in the area pertaining to the Disaster Risk Reduction under overall domain of adaptation to climate change. Understanding occurrence and impacts of hydro-meteorological disasters on people’s well-being and which livelihood assets are significant for identifying coping strategies to deal with disasters are important ingredients to increased resilience of communities living in disaster prone areas. This stud...
Muhammad Arshad1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Yasir Iftikhar2, Samina Khalid3, Zahoor Hussain4, Jaime Molina-Ochoa5,6 and John E. Foster6
... is a destructive insect pest of citrus nurseries as well as orchards in Pakistan. The aim of this study was to assess the effectiveness of some synthetic insecticides and essential oils against citrus leafminer larvae. Two laboratory bioassays, leaf dip bioassay (LDB) and topical bioassay (TB) were developed to check the efficacy of tested chemicals and essential oils. As seen from results, abamectin showed significant mort...
Amna Younus1,3, Mariam Faiz2 and Abida Yasmeen1,*
...: 88%), grade II tumor type (47%), -ve estrogen receptor/ progesterone receptor (-ER/PR: 35%) and negative human epidermal growth factor receptor 2 (-ve Her2: 53%) hormonal status. Results also depicted that FokI and TaqI genotypic frequencies were significantly (P<0.001) distributed among women with different tumor grades and ER/PR status. FokI genotypic distribution was significantly associated (P<0.001) with different Her2 status ...
Zhi Yijin and Shao Mingqin*
...ned for this endangered species. The Xiuhe, Fuhe and Raohe river systems exhibited large steady populations, with the maximum size ranging from 25 to 68 individuals for each river. Restoration and maintenance of suitable habitats for the scaly-sided merganser is imminent as the species is at risk of extinction due to its small population size. The total sex ratio of the merganser during the study pe<...
Abdul Khaliq1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Akhlaq Ahmad2 and Yasir Iftikhar3
...p> Food spoilage of perishable and other grains are seriously proliferated during storage by stored grain insect pests under variable conditions. Resistance development in insect pests against fumigants is a serious threat to effective commercial use of fumigants in various quarantine treatments. Therefore, resistant strains of Tribolium castaneum (Herbst), Rhizo
Xu Lijie, Obaid Ullah, Liu Haixing, Ihsan Ali, Zhongshu Li* and Nan-Zhu Fang*
...tion of reactive oxygen species (ROS) is one of the reasons for the slow growth of mammalian preimplantation embryos. Peroxisome proliferators-activated receptor gamma (PPARγ) functions in the nuclear regulatory factor 2 (Nrf2) antioxidant pathways by binding to the promoters of antioxidant genes and regulates the expression of genes that associate with NADPH oxidase. To understand the role of PPARγ in the development of early embryos and define th...
Azam Ali* and Amjad Farooq
...tion dynamics of sucking pests on Bt cotton varieties (Lalazar, IUB-33, Sitara-009and MNH-988) and one non-Bt (NIAB) varieties in Multan Southern Punjab, Pakistan. During 2014 to 2016, eggs count and adult population of five different sucking pests (dusky bugs, jassid, thrips, white flies and mites) were recorded from sowing to harvesting seasons. Predators (Chrysoperla, Geocoris...
Farhana Gul1*, Dawood Jan1 and Muhammad Ashfaq2
...act on net farm returns, per capita income and poverty rates of wheat producers using extensive farm survey data from 150 farmers from different climatic zones of Khyber Pakhtunkhwa, Pakistan were measured in this study. TOA-MD model was used to measure the impact of climate change adaptation strategies. Adjustment in sowing time, improved fertilizer application method and increasing sowing densities were three-major adaptation practices whose benefits were an...
Saeed Ullah1, Muhammad Israr1*, Shakeel Ahmad2, Nafees Ahmad3 and Asif Yaseen4
...d all areas of human prosperity. This research contributes to this end by analysing the perceptions of farmer and its socio-economic influences towards LD in four purposively selected union councils i.e. Toru, Ghari Kapoora, Lund Khwar, Katlang-1 of district Mardan. A total of 90 farmers were selected through proportionate simple random sampling from 857 register farmers. Primary data were collected through structured questi...
Saqib Bashir* and Bashir Ahmad
...xt-align: justify;">An experiment was conducted at Newly Developed Research Farm of the University of Agriculture Peshawar to observe the effect of pigeon pea green manuring on performance and subsequent nitrogen fertilizer requirement of wheat crop during 2013 and 2014. The experiment was carried out in randomized com...
Manzoor Hussain1, Muhammad Awais2, Farhatullah3, Saiqa Bibi1, Muhammad Rameez Khan3, Afifa Khalid1 and Sajid Ali3*
...ines introduced from Europe along with local check, under natural field conditions at District Mansehra, Pakistan. Data on crown rust severity and host reaction was taken at three scoring dates to assess partial resistance using area under rust progress curve, infection rate, co-efficient of infection and final rust severity. A moderate crown rust pressure was observed during oat season 2015-16, with relatively late crown rust onset after mid of April. Based o...
Shaher Bano1, Nadia Naseem2 and Sarah Ghafoor1,*
...alpha;) is a mitogen polypeptide that regulates the pre and post-natal development, structure and function of salivary glands. The localization of TGF-α in post-natal submandibular gland (SMG) of rats and humans is well-studied.However, less is known regarding post-natal sublingual salivary gland (SLG) development and expression of TGF-α. The comparison of TGF-α expression in SLG with that of its expression in SMG during post-natal rat saliva...
Huma Naz1,*, Sajid Abdullah2, Khalid Abbas2 and Muhammad Anjum Zia3
...romium (Cr) mixture on superoxide dismutase (SOD) from kidney of Labeo rohita exposed to sub-lethal concentration for 14 days was evaluated. After purification, specific activity of enzyme was 1750.13 and 1272.72 U mg-1 in kidney of metal exposed and control fish, respectively. The enzyme from metal exposed kidney was 2.68 fold purified with 58.73 % age recovery. Results ...
Jawaria Shaheen1, Samiah Shahid1, Sabahat Shahzadi2, M. Waheed Akhtar1,3 and Saima Sadaf1,*
...st aggressive known subtype of breast cancer due to absence of estrogen, progesterone and HER2 receptors. We aimed to identify a panel of circulating miRNAs which can act as diagnostic and prognostic biomarkers specifically for TNBC. The blood samples were collected from 37 TNBC diagnosed patients and 34 age-matched non-TNBC controls to investigate the expression of miRNA panel. Plasma was isolated by standard protocol of ce...
Abdul Maalik1, Shahzad Ali1,*, Anam Iftikhar1, Muhammad Rizwan1, Haroon Ahmad2 and Iahtasham Khan1
...om farmers were animal type, breeds, urbanicity, age (years), teat washing, bedding area, lactating stage and previous exposure of mastitis. Initially surf field mastitis test (SFMT) was applied for screening subclinical mastitis followed by bacteriological techniques on positive milk samples for confirmatory isolation of Staph. aureus as a bovine mastitis causing agent. These Staph. aureus isolates were further tested for antibiotic susceptibili...
Saleha Gul1,2, Muhammad Khisroon2, Ajmal Khan2, Attaullah1, Saira Gul3 and Gul Nabi Khan1,4,*
...ects of tobacco smoke on peripheral lymphocytes of active and passive smokers. Blood samples were isolated from 100 males’ including 25 active-, 25 passive- and 50 non-smokers. Alkaline comet assay was done and classes were defined on the basis of comet tail length. Significant differences were found in total comet score (TCS) among different groups (p˂0.05). The TCS value of active smokers were significantly increased with other narcotics like c...
Muhammad Arshad Hussain1 and Tariq Mukhtar2,*
...y of root-knot nematode species associated with okra in the major vegetable growing districts of the Punjab province of Pakistan. The overall incidence of 39%, prevalence of 85% and severity of 4.1 in terms of the galling index was recorded throughout the province. Differences in the incidence of root-knot nematodes were recorded from all the districts ranging from 11% to 70%. The incidence was found to be the maximum (70%) in districts of Bahawalnagar and Rah...
Sohaib Afzaal1, Usman Hameed2, Nasir Ahmad3,*, Naeem Rashid3 and Muhammad Saleem Haider1
...1 mg/mL) was produced by pediococci. These LAB strains are being studied for their probiotic properties and good quality indigenous starter cultures from them are anticipated to be employed in food industry....
Huma Khalil1*, Muhammad Afzal1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Sajjad Khalil1, Farghama Khalil2 and Hafiz Khurram Shurjeel1
...inae), 12 genera and 16 species were collected. Out of them, two genera and 12 species were recorded for the first time from this area. Aphidiinae contains 1,107 individuals which showed that it’s a dominant braconid subfamily while Opiinae (209) was the least dominant. The richness of braconid parasitoids in different localities of Sargodha was also investigated. Braconid parasitoid populations were higher in the mont...
Jie Yang
...als, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs (PGLYRP1, PGLYRP2, PGLYRP3 and GLYRP4). They are secreted proteins expressed in different tissues. It is significant to make a study of human PGLYRP1 because neutrophils are a more dominant mechanism in human host defense. Related research results show the functions of human PGLYRP1 in the innate immunity of neutrophils is to conducive to th...
Iram Maqsood1,2,3 and Ke Rong *1,2
...y two crocodile’s species has been enjoying this universe, and one of them is Chinese alligator (Alligator sinensis) who is at the edge of extinction in nature. Approximately, 130-150 individuals left in wild. Habitat loss is considered as a major source of population decline of this precious species. Consequently, for the sake of A. sinensis conservation, China took steps with the top priority of habitat...
Bata Shalangwa Ishaku1, Batim Turdam1, Maimadu Abdullahi1, Waziri Ibrahim Anjili2 and Mayowa Olabode2
...f 0.57, 0.20 and 0.50 respectively. The prevalence ranges between 22.2% and 48.9% across the types of management practice with those managed extensively having the highest (p=0.001). Gastrointestinal nematodes infection was significantly associated with the body condition of the donkeys with the highest prevalence in those with poor body condition (p=0.03). Of the blood samples collected, 108 (36.0%) were positive for hemopa...
Attaur Rahman1, Sadeeq ur Rahman1,*, Ashfaq Ahmad2, Abdul Sajid1, Muhammad Asif Hussain1, Mian Muhammad Salman1, Niamat Ullah Khan1, Kamran Khan3, Fazli Rabbani1, Muhammad Akbar Shahid4, Irshad Ahmad5 and Shakoor Ahmad6
...> Pathology of hydropericardium syndrome (HPS) induced by fowl adenovirus-4 (FAdV-4) in ostriches was compared with that of broiler chicken kept as standard. A 106.25/ml/bird (chicken lethal dose 50 (CLD50)) was injected to ostriches and broiler (control) and were clinically observed for 7 days. Our results showed that a peak cloacal temperature was recorded on d...
Asad Sultan1, Rabia Ali1, Rifat Ullah Khan2,*, Sarzamin Khan1, Naila Chand1 and Ambrina Tariq3
...i-nutritional factors hamper the bioavailability of nutrients and need to be addressed to avoid compromised birds’ performance. The present study assessed the impact of phytase on enhancing the nutrient retention and phosphorus utilization in two different sorghum cultivars fed to broiler. In an open sided house, a total of 160, 14-days-old broilers were allotted to four dietary bioa...
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
...B. melitensis, respectively but B. abortus (causative agent of bovine) may cross the species barrier to infect the small ruminants which may complicate the control measures of brucellosis because most of the control programs rely on serological screening of brucellosis rather than molecular assay which could confirm the particular species circulating in ruminants. In this stu...
Fazal Abbas1, Muhammad Ijaz1,*, Zunaira Akhtar1, Khalid Mehmood2, Muhammad Zeeshan Hyder3 and Umair Iqbal4
...er one month of age irrespective of cause of diarrhea was selected from different livestock farms located in the outskirts of Lahore. The result showed that there was increased in packed cell volume (%) in their blood profile. The sodium and potassium concentration in ppm significantly increased (P< 0.001) while the calcium, copper and iron concentration in ppm significantly decreased (P< 0.001) in the calves having di...
Guo-hai Wang1, Zai-xi Yang1, Pan Chen1, Wei-ning Tan2 and Chang-hu Lu1,*
...rsers....
Tazeen Jamil, Saba Ijaz, Rabia Arif*, Faiza Akram and Muhammad Saleem
...i> harsh South facing slope and neutral North facing slope. Retroelements profiles were generated in order to detect retrotransposons. Strains from South facing slope exhibited more copy number of Ty3-gypsy, LINEs and Ty1-copia as compared to strains from North facing slope. In total, 52 fragments of Metaviridae (Ty3-gypsy), 104 fragments o...
Faiz-ul Hassan1,*, Muhammad Sajjad Khan1, Muhammad Saif-ur-Rehman1, Syed Muhammad Raihan Dilshad2 and Muhammad Amjad Ali3
...and scoring of bands was performed. Phylogenetic tree was constructed by UPGMA method to determine the genetic similarity among the horse breeds. Thoroughbred and Arab horse breeds showed a higher similarity with Pakistani indigenous breeds, suggesting that these two exotic breeds had contributed significantly in the development of indigenous horse breeds of Pakistan. One set of primers OPL-7 revealed a polymorphic band at 450 bp which was present in DNA bulk ...
Ihsan Ullah Khan*, Muhammad Arshad, Muhammad Ayub Khan, Muhammad Ashraf, Ashiq Saleem, Sundas Awan, Samra Azam and Shamim Ul Sibtain Shah
...hree replications. The experimental material consisted of nine hybrids, six inbred lines and a commercial check (Hysun-33). The recorded data on days to flowering initiation (DFI), days to flowering completion (DFC), days to maturity (DM), plant height (PHT, cm), stem thickness (ST, mm), head diameter (HD, cm), 100-grain weight (100-GW, gm), oil content percentage (OC %) and seed yield (SY, kg ha-1) revealed statistically si...
Amer Mumtaz2*, Muhammad Suhail Ibrahim1, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Masooma Munir2, Aqsa Qayyum2, Sahar Shibli2 and Muhammad Khalid Ibrahim3
...ood industries being inexpensive and green technology. The technology has wide range of application in food industry. Ultra-sonication, thermo sonication, man osonication and man othermosonication are used in food industries for various objectives. Sound waves produce acoustic effect and when bubble produced bursts it results in mechanical energy responsible for inactivation of the pathogenic organisms present in food by poration and DNA fragmentation. Ultraso...
Mahroze Fatima1*, Muhammad Afzal2 and Syed Zakir Hussain Shah3
... fingerlings. Five experimental diets were formulated to contain one control (VE0), two adequate levels of vitamin E supplementation, i.e. 100 and 150 mg/kg diet (VE100, VE150) and two high levels of vitamin E supplementation, i.e. 1000 and 1500 mg/kg diet (VE1000, VE1500). At the onset of feeding trial, 375 fish of nearly uniform initial body weight (3.58±0.04 g) were distributed ...
Ahmed Ali Samejo* and Riffat Sultana*
...consumer and destructive pest to the useful plants. Morphology and morphometry of immatures of desert locust in relation to gaining of body length and weight at each consecutive stage was carried out for the purpose of investigating the role of immatures in destruction of plants in Thar Desert, Sindh. Hatchlings of solitarious S.gregaria were light green at the time of emergence, but turned over to black with yellow strips after two hours of hatching, w...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...RAF/MAPK pathway. Wild type KRAS is associated with EGFR-signalling activation. In normal physiological conditions, it is activated by upstream signals when the GTP is exchanged with GDP. Playing an important role in regulation of differentiation and cell growth, RasGTPases behave as genetic switches. This transient process of GAP-mediated GTP hydrolysis becomes altered when the Kras gene is mutated. The most common Kras mutations are found in codon 12 and 13 ...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
...ing a search for highly specific and more stable enzyme. In the present study the gene consisting of 972bp coding for 323 amino acids was PCR amplified from Geobacillus thermodenitrificans DSM-465 was PCR amplified and recombinant plasmid pET22b-Asn was prepared. L-asparaginase was produced in BL21 (DE3) RIL codon plus strain of E. coli as heterologous protein under 0.3mM IPTG. The recombinant enzyme was purified by DEAE-Sephadex colum based anio...
Faiza Jabeen1,*, Bushra Muneer2 and Javed Iqbal Qazi3
...both strains were rod-shaped, stained Gram positive and formed endospores. The isolates were able to utilize sugars like fructose, Maltose, mannose, xylose, sacchorose, sorbitol, mannitol, Arabinose and polysaccharides like gelatin and starch. Phylogenetic analysis based on 16S rRNA gene sequences revealed that both isolates belong to the same specie Anoxybacillus rupiensis with 99% similarity under Accession number K...
Sumreen Hayat1,6, Muhammad Hussnain Siddique2, Bilal Aslam1, Habibullah Nadeem2, Asma Ashraf3, Muhammad Saqalein1, Mohsin Khurshid4, Naveed Shahzad5 and Saima Muzammil1,*
...act infections (UTIs) in pediatric and adult population. The ESBL producing K. pneumoniae present an alarming situation for clinicians by limiting the treatment options. We aimed to determine the antibiotic resistance pattern and characterization of ESBL producing K. pneumoniae isolated from children of different age groups. K. pneumoniae isolated from blood and urine samples were identified through API® 20E kit. Antibiogram...
Ragia S. Mohamed1, Rania F. El Naggar2, Mamdouh. M. Hamoud1, Mohamed M. Hamoud3, Abdulrhman M. Gamal1, Samah E. Laban1, Shimaa A.E. Nasr1, Manal M. Zaki1, ElShaimaa Ismael1, Osama K. Zahran1*
...with different NDV genotypes, raising the importance of the relationship between vaccines and field strains. The aim of the current work is to evaluate the effect of moisture percentage and pH on the persistence of velogenic NDV genotype VII in the poultry manure which considers a major threat to the Egyptian poultry industry since 2011 onwards. In the p...
Ping Zhang1,2, Yabin Pu1, Yu Zhang2, Jia Chen2, Kunfu Wang3, Qian Li3, Yujiao Sun3, Yuehui Ma1, Shuqing Jiao2,* and Weijun Guan1,*
... muscle and provide an experimental evidence for clinical application. The skeletal muscle tissue were studied from fetal sheep, and the stepwise digestion by XI collagenase and trypsin was used to isolate MDSCs and were purified by differential attachment technique. Cell morphology were observed using an inverted microscope, and MDSCs proliferation pattern were determined through growth curve analyses. MDSCs were identified...
Muhammad Nasir1,*, Ata-ul-Mohsan2, Shafqat Saeed3, Munir Ahmad2, Muhammad Asif Aziz2 andMunir Ahmad4
...dy different diapause temperature (-2-0 ºC), (1-3 ºC), (4-6 ºC) and duration (two and three months) showed the highest survival rate of the queens after diapause period of two months at 1-3 ºC. Highest colony initiation rate was observed at 1-3 ºC for three months duration. Early pre-oviposition period and early emergence of the first worker in a colony was also ob...
Zhaochao Deng1, Jingchen Chen1, Na Song2, Yongzhen Li3 and Zhiqiang Han1,*
...tained defining 7 haplotypes in the South China Sea population. Contrary to heterogeneous expectation, AMOVA and pairwise FST values showed that the genetic differences in this region were all non-significant. The pattern of population demography showed a stable model in this species in the South China Sea population. To reveal its population structure within the large-sc...
Zhaochao Deng1, Na Song2, Yongzhen Li3, Tianxiang Gao1 and Zhiqiang Han1,*
...ividuals from three archipelagos (Xisha, Zhongsha and Nansha) in the South China Sea and 107 polymorphic sites were obtained defining 39 haplotypes. Based on the NJ tree, two distinct lineages were detected, with strong frequency differences in the geographical distribution. Both lineages were found in Xisha and Zhongsha archipelagos, but only one lineage (lineage B) was detected in Nansha...
SiRui Wang1,2, Fekede Regasa Joka1,2, XiaoLong Wang1,2,* and SuYing Bai2,*
...nce (Mx) gene has broad-spectrum antiviral effects. This gene is particularly important for the prevention and treatment of avian influenza. Currently, this gene is more studied in poultry, and studies in wild birds are rare. To understand the antiviral site of the Myxovirus-resistance (Mx) protein in the evolution of different wild birds, 10 wild bird species, including Anas formosa, Anas crecca, Anas stre<...
Ashfaque Ahmed Nahiyoon1,*, Shahina Fayyaz2 and Nasira Kazi2
...entification of one new species of soil nematode viz., Acrobeloides gossypii n. sp., along with three new record species viz., Tylenchorhynchus ewingi Hopper, 1959; T. crassicaudatus Williams, 1960 and Pratylenchus pseudofallax Café-Filho & Huang, 1989. Description, measurements and illustrations of these spe
Muhammad Nasir1,*, Ata-ul-Mohsan2, Munir Ahmad2, Shafqat Saeed3, Muhammad Asif Aziz2, Muhammad Imran4 and Umer Ayyaz Aslam Sheikh4
...ect of five different temperatures (24 ºC, 26 ºC, 28 ºC, 30 ºC and 32 ºC) was studies on different colony characteristic of post-hibernated queens of Bombus terrestris during flight activity period and solitary phase of development. Results showed that survival rate and colony initiation rate of the queen was highest at 28 ºC and 30 ºC. Different parameters in the initial stage of co...
Tianlong Cai1, Falk Huettmann2, Kisup Lee3 and Yumin Guo1,*
...ha) is a vulnerable species. However, its stopover habitat receives little attention and is not well known or protected even. Here, we present the spatial distribution of the stopover habitats for hooded cranes in the East Asia. A machine learning modeling algorithm of maximum entropy (MaxEnt) weas applied and evaluated with Stochastic Gradient Boosting and Random Forests based on 115 every year used occurrence points (1990-2013) and 14 environmental layer...
Saud Khan and Inamullah*
...rus (P) if applied in proper quantity in soil with appropriate tillage implement may enhance oil and grain yield of sunflower. In this regard, an experiment was conducted to evaluate the impact of phosphorus (P) levels and tillage instruments on grain and oil yield of sunflower at Agronomy Research Farm of the University of Agriculture Peshawar (Pakistan) during summer 2017. Split plot arrangement of the Randomized Complete ...
Qaizar Ahmed1, Fida Mohammad2, Sheraz Ahmed2*, Sultan Akbar Jadoon2, Imtiaz Ali2 and Ajmalud Din2
...r were considered as independent environments: Mardan 2008 as environment-1; Mansehra 2008 as environment-2; Mardan 2009 as environment-3 and Mansehra 2009 as environment-4. Field trials were conducted using randomized complete block design in four replicates. Data for all traits were subjected to Griffing and Hayman analyses of variance to get critical comparison of the results obtained through both models. Griffing analysis revealed additive ty
Fukuan Du1,2, Yongkai Tang1, Juhua Yu1, Shengyan Su1, Fan Yu1, Jianlin Li1, Hongxia Li1, Meiyao Wang1 and Pao Xu1,2,*
...>.
...
Fady Samir1, Rania F. El Naggar2, Mohamed M. Hamoud3, Manal M. Zaki1, Abdulrhman M. Gamal1, Samah E. Laban1, Shaimaa A. E. Nasr1, El Shaimaa Ismael1, Osama K. Zahran1*
.../heterologous vaccines especially the live ones. The aim of the current work is to estimate the persistence time for velogenic Newcastle disease virus (NDV) of genotype VII in poultry manure in compare to LaSota vaccine strain as a model of genotype II. Velogenic NDV of genotype VII are a major threat to the Egyptian p...
Muhammad Khalil Nawaz, Sayyed Ghyour Abbas, Muhammad Akbar Khan, M. Adeeb Babar*, Muhammad Asim, Rabia Shahid and Muhammad Akhtar
...
...
Huma Naz1,*, Sajid Abdullah2, Khalid Abbas2, Wardah Hassan3, Moazama Batool4, Shakeela Perveen5, Sadia Maalik4 and Sajida Mushtaq4
...tioxidant enzymes viz. superoxide dismutase, peroxidase, catalase and glutathione S-transferase in different organs (liver, gills, kidney, brain, heart and muscle) of fish, Labeo rohita. The LC50 of chlorpyrifos+endosulfan mixture was calculated as 1.95±0.02 μgL-1 for 96 h with the 95% confidence limits. The fish expose to the mixture (1:1) for 96-h. The results obtained from this study...
Fan Yi1,2, Xiaobin Yang1, Shigen Ye1, Hua Li1 and Ruijun Li1,*
...ally divided into four experimental groups: basal diet feeding group, 0.5% HCT continuous feeding group, 1% HCT feeding group, and 1% HCT interval feeding group. Three replicates were set for each treatment, and 25 fish were stocked on each replicate. The results of continuous feeding experiments showed that the continuous addition of 0.5% and 1% HCT feed for 28 days could very markedly increase pe
Aisha Khalid1, Muhammad Tayyab1,*, Abu Saeed Hashmi1, Tahir Yaqub2, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Sehrish Firyal1 and Abdul Rauf Shakoori3
...ction time, effect of temperature and pH were examined for the maximal production of recombinant cellulase. The effect of supplementation of LB medium with additional carbon and nitrogen sources was also analyzed for maximal production of recombinant protein. Higher level enzyme activity was recorded at 25°C, pH 7.0 when the cells were induced with 0.5 mM IPTG with 22h post induction incubation. Supplementation of LB medium with 1% glucose and yeast...
Fakhra Soomro1,*, Riffat Sultana2 and Muhammad Saeed Wagan2
...v>Nymphal stages of two species of genus Sphingonotus Fieber viz. S. savignyi Saussure and S. rubescens rubescens (Walker) were studied exclusively form Sindh during the 2014-2016. Both species passed through six instars larvae. Emergence of larval instars in both species was started from the month of July just after monsoon rainfall, whereas, S. savignyi
Muhammad Adnan Islam1,2*, Muhammad Iqbal2, Zia-ul-Haq2,3, Muhammad Mohsin Ali1, Hafiz Sultan Mahmood1, Shabbir Ahmed Kalwar1, Liaqat Ali Shahid1, Badar Munir Khan Niazi1 and Muzammil Husain1
...of cotton, wheat growing period is delayed and the farmers sown wheat in the December and January due to long process of field preparation by conventional method. Zone disc tiller machine developed in the department of Farm Machinery and Power, was employed for sowing wheat instead of conventional tillage in cotton stubble to avoid further late sowing of wheat. Zone disc tiller drill sows crop in strips. Strip tillage of soi...
Javed Asghar Tariq1*, Bashir Ahmed2, Manzoor Ali Abro2, Muhammad Ismail1, Muhammad Usman Asif1 and Raza Muhammad1
...aim to search out such type of antagonistic bacteria from rice crop. For this purpose, soil was collected from rice growing areas of Tando Jam. The isolation from rhizospheric soil was done by dilution plate technique. Among isolated isolates, 6 representative colonies were purified, multiplied and characterized using light microscopy and other biochemical tests. The bacteria were tentatively identified as Pseudomonas, Streptomyces, Bacillus and Micrococus. Th...
Abdul Kabir1, Laiba Uroog2*, Naushad Ahmad3, Fawad Ahmad3, Muhammad Saqib3, Noor Badshah4 and Taj Ali Khan3
...environmental bacterial species. In Pakistan, it is the major disease of different dairy animals including bovines. However, only a little information is available about bacterial profile of the disease. A cross-sectional study was conducted to find the Etio-prevalence of bacterial species causing subclinical mastitis in a cohort of buffaloes at Khyber Pakhtunkhwa. 120 quarter samples were collected from sus
Syed Atif Hasan Naqvi*
...ng resistant varieties appears to be better option for the disease’s management. Evidence from my laboratory suggest that biological control is the best option having ecofriendly activities for the management either using botanicals or through some biological agents. Formulations of various botanicals along with biological agents may be commercializing to help farmers to combat the disease. There is a need to use environmentally safe approaches to overco...
Gulnaz Saleem1, Aijaz Hussain Soomro1*, Nouman Rashid2 and Mehar un Nisa Narejo3
...tritional and sensory properties of biscuits produced from wheat; lentil flour was investigated in this study. This study showed significant (P<0.05) variation in physico-chemical characteristics of four lentil varieties. The NIA-Masoor variety showed higher values for ash, fat and fiber (3.02%, 3.02% and 10.99%) respectively. Whereas; PM-09 possessed higher moisture (13.89%); though Masoor-93 was higher in protein conten...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...eld and nutraceutical properties of juice processing industry, degumming of fibre plants and maximum oil recovery. These enzymes break down complex polysaccharide polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin was purified by salting out with ammonium sulfate, gel filtration on Sephadex G-75 column and ion exchange on Q-Sepharose column chromatograph...
Anum Khursheed1, Malik Muhammad Shafi2 and Haidar Ali2*
Arshad Farooq* and Muhammad Zafarullah Khan
...p;complex process dependent upon application and arrangement of various factors such as land, labor, finance and management practices etc. This article assessed the knowledge gap of improved cane management practices in Khyber Pakhtunkhwa-Pakistan. Sugarcane growers were selected randomly and Data were collected through interview schedule from 285 respondents in D.I. Khan and Mardan districts during sugarcane cropping season, 2018. Knowledg...
Aziz Ur Rahman* and Syed Mehar Ali Shah
...onducted to assess genotype by environment interaction (GEI) for yield and yield related traits in rice. The genetic material comprised 87 rice F5:7 recombinant inbred lines (RILs) along with three check cultivars namely Pakhal, Kashmir Basmati and Fakhr-e-Malakand. The genetic material was planted in alpha lattice design using three replications across different locations namely Peshawar, Swat, Manshera and Charsadda of the Khyber Pakhtunkhwa province of Paki...
Hafiz Umar Farid1, Muhammad Zubair2, Zahid Mahmood Khan1, Aamir Shakoor1*, Behzad Mustafa1, Aftab Ahmad Khan3, Muhamad Naveed Anjum4, Ijaz Ahmad5 and Muhammad Mubeen6
...c return, deployment of operator, literacy status, farming mode, pumping mechanism, backup support, system type, energy source, tenancy status, farm location, groundwater quality and farming experience because these parameters have significance coefficient values of 0.471, 0.342, 0.169, 0.163, 0.142, 0.110, 0.076,0.071,0.046, -0.037, -0.116, -0.212, respe
Bushra Siddique1,*, Muhammad Tariq1, Muhammad Naeem1 and Muhammad Ali2
...een prey and host plant species. Recent studies exhibited that the use of natural enemy is an ecofriendly measure to control pests. The Seven spotted ladybird beetle, Coccinella septempunctata play a prominent role in aphid management. It exploits several different cues released by plants to increase the efficiency of foraging. Aphid endoparasitoid, Diaeretiella rapae (McIntosh) (Hymenoptera: Braconidae) have a...
Rıfat Ertekin1*, Mete Ozkurt1, Gokhan Kus2 and Selda Kabadere1
...ate cancer is a common type of cancer. Contemporary treatment modalities require that new, effective methods or chemicals should be developed. Tolfenamic acid (TA) is a nonsteroidal anti-inflammatory medicine stimulating apoptosis in cancer cells like pancreas, oesophagus and lungs. This study aims to determine the role of TA in cell viability and apoptosis in glioma cells (T-98G) and androgen-sensitive human prostate cancer...
...kistan has exploited the peer-review process in the Journal of Zoology by generating fake reviewers email addresses. This led to an in-depth investigation by the Editorial Team and Executive Council of Zoological Society of Pakistan. The editorial team had written confidentially to all the reviewers at their official addresses, the list of which was provided by the corresponding author at the time of online submission of the manuscript. The editorial team was ...
Muhammad Rehan1, Asim Aslam1, Muti-ur-Rehman Khan1, Muhammad Abid2, Shakeel Hussain3, Javeria Umber4, Ahsan Anjum1 and Altaf Hussain2*
...ortant disease of avian species and continuously cause outbreaks in commercial poultry throughout the world. Despite intensive vaccination, ND is endemic in Pakistan and locally known as Ranikhet. Wild birds are considered natural reservoirs of Newcastle disease virus (NDV) and some common resident or migratory wild birds are associated with outbreaks of ND in commercial poultry in Pakistan. Continuous isolation of new genotype<...
Hamid Ali, Muhammad Arshad, Ibad Ullah Jan, Muhammad Zamin*, Junaid Khan, Ikram Ullah and Mushtaq Ali
...important ornamental and perfumery plant. The research was conducted at University of Swabi during summer 2018 to evaluate the performance of tuberose under various concentrations of gibberellic acid and micronutrients. Experiment was laid in Randomized Complete Block Design (RCBD) using two factors i.e. gibberellic acid and micronutrients with three replications. Both the factors gibberel...
An Empirical Analysis of Livestock Activities of the Model Farm Service Center in Khyber Pakhtunkhwa
Tariq Shah1*, Umar Hayat1, Muhammad Suleman Bacha2 and Muhammad3
...f livestock activities especially related to extension work and explore the knowledge of farmers and their linkages with government as well private sector for livestock improvement in Khyber Pakhtunkhwa (KP) province. A total of 480 respondents from four districts, namely Swat, Mardan, Abbotabad and Dera Ismail Khan were randomly selected for interview purpose. Descriptive statistical techniques along with independent sample...
Muhammad Nasrullah1*, Liu Chang1, Khurram Nawaz Saddozai2, Asaad Osman Khalid1, Rachel Bayisenge1 and Gulnaz Hameed3
...erent practices were grouped into five parts. Land rent of the respondent area was 61,750 rupees per hectare; nursery raising cost was estimated at 11,828 rupees per hectare. The bed preparation cost for tobacco is 12,300 rupees per hectare while p...
Shahid Ali1*, Asim Khan1, Aftab Khan1 and Bakhtawar Riaz2
...anatory variables except pesticides have significant effect on tomato production. The results showed that a 1% increase in seed rate, labor, tractor hours, urea, DAP and irrigation increases output by 0.81, 0.02, 0.28, 0.14, 0.25 and 0.02 percent, respectively. Mean technical efficiency score was found 95% ranges from 86% to 99%. This means an average farmer can increase tomato output by 4...
Farhat Iqbal1, Abdul Waheed2,*, Zil-e-Huma3 and Asim Faraz2
...ight of farm animals. Gompertz, Brody, Von Bertalanffy and Logistic growth models were employed on the basis of nonlinear least squares and Bayesian methods. Using the monthly body weight data of 2070 weight records of Thalli sheep from birth to 24 months of age for both sexes (male and female) and type of births(single and twin), the estimates of parameters and their credible intervals were obtained from posterior distribut...
Abid Hussain1,2, Farida Ahmed3, Shyamali C. Dharmage4, Shafiq ur Rehman1, Muhammad Shahbaz Aslam5 and Zaigham Abbas1,*
...ion patterns. This retrospective study was designed to study allergy patients attending Allergy Centre, National Institute of Health, Islamabad. All enrolled patients were screened for set of allergens using skin prick test (SPT). Based on results of SPT, out of total 50550 allergen sensitized patients, 89.28% had aero-allergen sensitization while remaining 10.72% had food sensitization. Significantly higher prevalence of both aero- and food allergen sensitiza...
Emel Banu Buyukunal1,*, Rojan Ibrahim Albazaz1 and Mehmet Ali Bal2,3
...illin-clavulanic acid, piperacillin-tazobactam, ceftazidime, cefotaxime, ceftriaxone, cefpodoxime, aztreonam, ciprofloxacin, amikacin, ertapenem, imipenem, meropenem, trimethoprim-sulfamethoxazole by disk diffusion method. Double-disk synergy test (DDST) was also performed for detection of Extended S
Muhammad Ijaz, Sayed Rashad Ali Shah*, Muhammad Izhar-ul-Haq and Amir Afzal
... worldwide. LLS is the imperative factor while developing resistance varieties along with agronomic characteristics. In total, 153 groundnut botanically different genotypes namely Virginia, Spanish, and Valencia were screened under filed conditions and detached leaf assay against LLS pathogen. Most of genotypes during three years of study at early assessments under field conditions showed ...
Fraza Ijaz1*, Umair Riaz2, Shazia Iqbal3, Qamar uz Zaman4, Muhammad Furqan Ijaz5, Hina Javed1, Muhammad Amjad Qureshi1, Zuhra Mazhar3, Ahmad Hassan Khan6, Hassan Mehmood7 and Ijaz Ahmad8
... symbiotic association especially with leguminous forages and form special structure, i.e., nodules, with 90% of Fabaceae family and displayed all possible means for improving the fertility of soils. Rhizobium also forms a symbiotic association with non-legumes because of their great colonizing capability and helps in improving crop growth. Physiological precursors are also used in association with rhizobium because of their...
Muhammad Sohail1*, Asad Sultan2, Said Sajjad Ali Shah3, Muhammad Sajid1 and Adnan Khan4
...y were investigated. Fat percentage and metabolizable energy was higher in maize (4.1% and 17.04 MJ/kg). The protein levels in wheat varieties were 12.15 and 11.89% which were more than that of both of corn (8.21 and 8.05% respectively) and sorghum varieties (10.41% and 9.89% respectively). The bioavailability of crude protein was higher in maize followed by wheat and sorghum. The phytic a...
Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4
...ol. The method relies on periodically thermo cycling heating and cooling of DNA in presence of certain chemical reagents. In order to detect and differentiate parapox infections from those induced by pox virus. A new parapox specific and sensitive PCR assay based on amplification of B2L gene was applied against conserved gene of Orf virus. Crusted scraps and biopsies from different portion of skin and blood were taken as sam...
Senol Celik
...vely evaluate predictive performances of multivariate adaptive regression splines (MARS), chi-squared automatic interaction detector (CHAID), exhaustive CHAID and classification and regression trees (CART) data mining algorithms in predicting live body weight as a continuous response variable by means of morphological measurements i.e. live body weight (LBW), body length (BL), withers height (WH), rump height (RH), belly girth (BG) and chest girth (CG) ...
Ailing Huang, Lingyu Meng, Wei Zhang, Junyan Liu, Guangyao Li, Huihua Tan, Wen Lu and Xialin Zheng*
...v>...
Shengjie Zhou1,2, Pengfei Wang1,2, Chao Zhao1,2, Mingjun Fu3, Jian G. Qin4, Lihua Qiu1, Zhenhua Ma1, 4,* and Maoshang Lin1
...o.
...
Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2
...t-align: justify;">The experiment was conducted on effect of artificial diets and ornamental plants on parasitoid performance. Among artificial diets tested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental pla...
Sheng Niu1, Ali-Raza Jahejo1, Fa-jie Jia1, Xin Li1, Guan-bao Ning1, Ding Zhang1, Hai-li Ma1, Wei-fang Hao2, Wen-wei Gao1, Yu-jun Zhao1, Shi-min Gao1, Jian-hui Li1, Gui-lan Li1, Fang Yan1, Rong-kun Gao1, Huan-chun Chen1,3 and Wen-xia Tian1,*
...ns (AvBDs). Host defense peptides (HDPs) are important effector molecules in innate immunity. In this study, thiram has been used to induce tibial dyschondroplasia (TD) and the chickens were injected with different doses of recombinant glutathione-S-transferase A3 (rGSTA3) proteins. We explored the responses of HDPs in erythrocytes to thiram-induced TD and rGSTA3 protein by quantitative real time PCR (qRT-PCR). The results showed many HDPs expressions were sup...
Muhammad Ahmad, Zohaib Noor*, Karim Johar Khan, Waqar Younas and Ajmal Hussain
... system.
...
Nursinatrio and Rudy Agung Nugroho*
...aily weight gain (DWG), specific growth rate (SGR), feed conversion ratio (FCR), feed efficiency (FE), protein efficiency ratio (PER), survival rate (SR) and carcass proximate of red tilapia were measured. The results showed that HCFM up to 12% could be used as supplementation and showed positive effects on all growth parameters. Supplementation of HCFM above 6% in the red tilapia diet inc...
Faraz Akrim1,2, Tariq Mahmood1,*, Muhammad Sajid Nadeem3, Siddiqa Qasim1, Shaista Andleeb1 and Hira Fatima1
...readth of two carnivore species; Indian grey mongoose (Herpestes edwardsii) and small Indian mongoose (Herpestes javanicus) occurring in the north-eastern Himalayan region (Azad Jammu and Kashmir) of Pakistan with a view to compute the niche overlap between the two species. The Indian grey mongoose was recorded at 15 different sampling site...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
...50 day feeding trial was performed to investigate the effect of stocking densities on growth performance, serum biochemical parameters, digestive enzymes activity and antioxidant status of largemouth bass (Micropterus salmoides) reared in an in-pond raceway system (IPRS). Fish (initial average body weight: 35.68±2.12g) were randomly allotted to in-pond raceways (26.2m×5m×2.5m) stocked at two stockin...
Sun Hong1, Zhang Yifeng1, Wang Baishi2, Li Yangwei1, Xu Wenbo1, Mao Runkun1 and Wang Zhenglong1,*
...ubterranean rodent that spends its entire life underground in burrow systems, having to endure a hypoxic environment. In this study, we used the embedded artificial tunnel method in a natural burrow system to measure oxygen (O2) and carbon dioxide (CO2) concentrations and the temperature and humidity in the underground burrows of mandarin voles in Xinzheng, Henan Province, China during the spring and su...
Khan Sher1*, Muhammad Nisar2 and Muhammad Subhan1
...ic. At average 2 alleles per locus were identified. The size of all alleles ranged from 210bp to 630 bp. Major allelic frequency fluctuated from 54.0% to 96.0%. An overall, the total No. of alleles per locus extended from 22 (PVBR 20) to 49 PvM053. Similarly, the frequency values oscillated from 0.06 of PVBR 20 to 0.14 of PvM053. The PIC values were ranged from 0.295 of PVBR 20 to 0.831 of PvM053. The Two Way Cluster dendrog...
Aliya Ayaz, Gohar Ayub, Maqsood Khan* and Syed Aizaz Ali Shah
...awar, during 2016. The experimental design was Randomized Complete Block Design (RCBD) with two factors, replicated three times. Factor A was gibberellic acid concentrations i.e. 0, 20, 40 and 60 mgL-1, while factor B was comprised of dipping durations i.e. 0, 6, 12, and 18 hours respectively. Gibberellic acid concentrations and dipping durations had significant effect on the growth and yield of bitter gourd. Gibberellic aci...
Asim Khan1, Shahid Ali1*, Syed Attaullah Shah1, Aftab Khan1 and Raza Ullah2
... under maize, maximum temperature, minimum temperature and precipitation, respectively. For statistical analysis, panel data record for twenty years (1996-2015) across five districts of the province were scrape together from Development Statistic of Khyber Pakhtunkhwa, Pakistan Bureau of Statistic and Pakistan Meteorological Department, Khyber Pakhtunkhw...
Ayat Ullah* and Ayesha Khan
...tural control methods of pest with differences in the frequency of extension-farmers’ contacts. With the increase in extension-farmers’ contacts the farmers’ level of knowledge on chemical, biological and cultural control methods of pest increase and vice versa. The study recommends that the rain-fed farmers need reasonable extension services for increasing knowledge on pe
Abdur Rehman1*, Iqbal Javed2, Zhang Nannan3, Muhammad Niamatullah1, Raheel Saqib4 and Allah Bakhsh5
...his study focuses on the perspective of information to explore the development of agricultural modernisation and to provide the theoretical reference for the development of agricultural informatisation in Hebei province China. The relevant literature and the results of the research have been collected to understand the agricultural informatisation in Hebei province and adopted the system analysis method to focus on the exist...
Hassan Naveed1,2, Kamran Sohail2 and Yalin Zhang2*
...-align: justify;">Three species in the leafhopper subfamily Deltocephalinae, Changwhania terauchii Matsumura (1915) n. rec., Linnavuoriella arcuata Hamilton (1980) n. rec. and Paralimnellus cingulatus Dlabola (1960) n. rec. are reported for the first time from Pakistan. All species are described and illustrated with habitus photographs. ...
Kubra Siddique*, Ghaffar Ali, Irfan Ullah, Atta Ullah Shah and Muhammad Fayaz
...-align: justify;">This paper aims to estimate the expenditure, own and cross price elasticities of meat in Pakistan. Working-lesser model is used to estimate elasticities using cross-sectional data from Household Integrated Economic Survey of Pakistan for the year 2013-14. Economic factors such as food commodities prices, households’ income and their socioeconomic characteristics are included in the model. The results ...
Iftikhar Ud Din* and Qamruz Zaman
Zahin Anjum1*, Farhat Shehzad1, Amina Rahat1, Hamid Ullah Shah2 and Saleem Khan3
...vy metals in different types of marinated meat, such as beef, chicken, mutton and fish, and different grilling techniques were applied to see their effectiveness in lowering the levels of these toxicants. Polyaromatic Hydrocarbons and heavy metals refer to a large group of chemicals that may be present in the environment as pollutants and can enter the food chain and might be carcinogenic to humans. The lead content was found high in fish with the mean value o...
Muhammad Shahid1*, Mehmood Shah2, Adiqa Kiani3 and Farhat Parveen4
... sector. This research paper debates on livestock implications in raising labour productivity by taking time series data from 1984 to 2017 and Auto Regressive Distributive lag model (ARDL) has been applied to conclude the results. The other econometric test CUSUM and CUSUM sum of square were conducted to check the stability of the model. The results of the study reveal statistically significant positive impact of livestock and on labour productivity while the ...
Abid Ali1*, Hidayat ur Rahman1, Farhatullah1 and Zahir Shah2
...eeding strategies. The experimental material comprised three white maize (Zea mays L.) inbred lines which were developed at Cereal Crops Research Institute (CCRI), Pirsabak, Nowshera-Pakistan. Parental inbred lines were crossed with each other to get six F1s during kharif 2015 which were selfed to develop F2s and backcrossed with their parents to obtain backcrosses BC11 and BC12 generations during spring 2016. The total ex
Bingbing Gao1, Na Song1, Zhonglu Li2, Tianxiang Gao3 and Liqin Liu3,*
...servation. The ponyfish species Nuchequula mannusella is a dominant species along southern coast of China with important economic and ecological value, and little of its population genetic structure has been known. We use mitochondrial DNA markers to investigate the genetic structure of the species along southern coast of China. The complete sequences of Cytochrome b (Cytb...
Hayat Zada and Ahmad-ur-Rahman Saljoqi*
...cropping (Brassica campestris, Brassacicacae), Glycine max, leguminacae), Trifolium alexandrinum, Fabaceae) and Triticum aestivum, Poaceae) in the apple orchard were a substantial effect on the management of C. pomonella (L). Minimum mean fruit drop were recorded for the intercrop Apple + Trifolium (2.87) which were significantly lower than all other intercrops including control (Apple sole). Likewise, minimum
Hayat Zada1, Ahmad-Ur-Rahman Saljoqi1,*, Ijaz Ali2, Bashir Ahmad1, Abdul Waheed Khan2 and Shabeer Ahmad2
...he most important insect pest of apple production in Pakistan. Genomic DNA was extracted from 30 overwintering larvae of each population of Matta, Madyan and Kalam regions. Out of 30 tested primers, 21 amplified 157 polymorphic bands in three populations. The mean gene frequency (f), genetic distance (I) and Shannon’s information index (h) for three populations were 1.336, 0.304 and 0.437, respectively. Nei’s unb...
Wang Zaigui1,*, Guo Panpan1, Ye Miao1, Sun Linghong1, Zhang Hongfu2 and Liu Chaoliang1,*
.../mL added to the feed. Experimental diets were fed in three phases: 3rd instar, 4thinstar and 5th instar. Furthermore, 3 replications were maintained and 250 silkworm larvae were reared in each replication. Different growth parameters and cocoon parameters were measured at each stage of silkworm. With the aim to investigate the supplemental effects of B.subtilis on growth performances, c...
Mehboob Arslan* and Xin Yang
...trategies to manipulate specific cellular metabolic pathways that aid the production of viral particles. Viruses need to breach a complex network of metabolic intrinsic factors and microenvironment established within the host cells. The pressure exerted by invading pathogen disrupts the internal balance and dictate the host-pathogen niches. For absolute survival, proliferation, and propagation inside the host cell, viruses modulate certain metabolic pathways t...
Iram Gull*, Muhammad Shahbaz Aslam, Imran Tipu, Roohi Mushtaq and Muhammad Amin Athar
...pping of the sequences especially those derived from authenticated native sequences. Certain forbidden sequences do appear at junction of spliced genes whenever efficiency of gene fusion is improved by inserting GC rich sequences. In this study, reliable scar-less gene fusion with the insertion of sequence of choice at junction sites has been described by optimization of various parameters of overlap extension PCR. The fusio...
Sher Bahadar Khan1,2,*, Zou Geng1, Cheng Yu-ting1, Asad Sultan3, Mumtaz Ali4,5, Irshad Ahmad6 and Rui Zhou1
...), and 80 samples from super- and wet-markets (each 20 meat and liver) collected both in summer and winter. Isolates were tested for 15 antibiotics (CRO, AMX, GEN, STR, TET, CHL, CLR, LVX, OFX, GAT, CIP, SXT, AMP, LIN and AZM) according to the disc diffusion method and antibiotic resistant genes {tet(A), tet(B), tet(C), strA/strB, aadA, aac(3)IV), aadB, sul1, sul2 and sul3, blaCMY-2, blaTEM and blaSHV} using mPCR. Resistance for LIN was the highest in overall ...
Wali Khan1,*, Mudassar Iqbal2 and Israr Khan2
...orally once a time. Eggs per gram of faeces were counted in each group before and after treatment. The % efficacy of albendazole (bendazol) and albendazole (zentel) against ancylostomiasis, ascariasis, taeniasis and amoebiasis were reported 92 and 83, 83 and 96, 74 and 81 and 84 and 74%, respectively. EPG counts amongst children in both the groups before and after treatment was not significant (P>0.05). Present study was ...
Shamsudin Bojang1, Idris Abd Ghani2, Jugah Kadir1, Adamu Saidu Paiko1, Yasir Iftikhar3 and Muhammad Kamran3,4,*
...y growth and chlorotic appearance of the greens. A total of 36 soils and roots sample were collected. Scanning electron microscopy (SEM) was used to identify the parasitic nematode. Both the field symptoms and SEM micrographs confirmed that the nematode isolate was M. graminis. Since this nematode has been known to damage the greens and other plants in other part of the world then the probability for the specie to ada...
Iqra Jaffar, Zainab Sehzadi, Muhammad Adeel, Khalid P. Lone and Mehwish Faheem*
...) and by measuring lipid peroxidation (LPO). Catalase activity increased significantly in liver and gills of fish exposed to 10μg/l of DBP. Level of GSH and LPO increased significantly in gills while a non-significant decrease was recorded for GSH and GST in liver. These results showed that exposure to low concentrations of di-n-butyl phthalate are capable of inducing oxidative stress in vital organs of fish that may cause detrimental effects on the fish he...
Sagir Hussain, Erum Iqbal* and Shahina Fayyaz
...rdm;C).
...
Abid Hussain Shahzad1, Abdul Sattar1,*, Nasim Ahmad1, Ijaz Ahmad2, Deniz Nak3 and Yavuz Nak3
...erts for 5 or 7 days, respectively. Pregnancy was diagnosed using ultrasonography on d30, d60 and d90 post AI. Ovulatory follicle diameter was measured at timed AI and progesterone profile (ng/mL) on d30 and d60 post AI. Pregnancy rate was analyzed by Chi-square procedure while ovulatory follicle diameter and Progesterone profile by one way ANOVA (α=0.05). Ovulatory follicle diameter (Mean±SEM) was 15.19±0.17 (OVP0), 15.30±0.21 (OVP5...
Muhammad Shoaib Saleem* and Muhammad Faheem Akbar
...al insecticides in plant pest management in perspective of the public concern over the level of pesticide residues in food and environment causing health and ecological problems. The indiscriminate use of synthetics insecticides in crop protection has also led to development of resistant strains of pests and have adver...
Ghulam Murtaza1*, Razia Sultana2, Muhammad Arshad Malik3, Sibtain Afzal4, Mubashar Hussain5, Shahid Bashir6
...and its consumption is expected to increase further in future. This article focuses on the increase of nicotine consumption in Pakistan and how people can get rid of smoking habit using the latest method such as transcranial direct current stimulation.
...
Abdur Rauf Nizami*
...ract | The present paper focuses on “Faunal Assemblages of the Middle Jurassic Samana Suk Formation, Chichali Gorge Section, Surghar Range, Sub-Himalayas-Pakistan”. The Samana Suk Formation is a carbonate sequence of the Middle Jurassic age and is widely distributed in the Upper Indus Basin, northern Pakistan. This formation belongs to the Baroch Group and is mainly comprised of limestones, which were thought...
Lichao Feng1,2, Shaoqing Zhang4, Dianyuan Chen2, Sina Adl3 and Donghui Wu1,4*
...nsect in cropland landsacpe. The larva of click beetles (Agriotes fuscicollis Miwa) known as the wireworm is a serious underground pest in farmlands. The distribution of adults and larvae alternated between flower and corn growth stages in the field because food resources and foraging behaviors stimulated and restrained the acquisition of supplemental nutrients as a strategy for reproduction. To evaluate their food ch...
Xiaona Cao1,3-5, Yuanyuan Ren2-5, Xiaoteng Cui2-5, Baoxin Qian2-5, Chunyan Zhao 2-5, Jie Yang2-5, Chao Su2-5,* and Xingjie Gao2-5,*
...ress granules (SGs), a type of RNA foci, were formed in the cytoplasm of eukaryotic cells upon some unfavorable environmental stress. Previously, we found that Tudor domain containing 1 (SND1)-containing SGs actively communicate with the nuclear and cytosolic pool of HeLa cells. Here, we are interested to investigate the dynamic distribution of three nuclear proteins, including heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), Hu Antigen R (HuR) and T cel...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and Cheng-Kai Zhai1, *
...ed the relative level of peroxisome proliferators-activated receptor γ (PPARγ) and suppressed the sterol regulatory element-binding protein 1c (SREBP-1c) protein expression in rats’ tissues. Compound whole-grain ameliorates diet-induced obesity and hyperlipidemia by enhancing PPARγ and reducing SREBP-1c in rats.
...
Bo Zhang1, Changbo Zhu1, Zihao Meng1,4, Baosuo Liu1, Lian Zhong3, Guiju Huang1, Jiaqi Su1, Sigang Fan1 and Dahui Yu1,2,*
... bivalves.
...
Jun Yan Bai*, Shuai Yang, You Zhi Pang, Xiao Hong Wu and Guang Lu Li
...ght, long end and egg shape index of Korean quail are significantly higher than those of Beijing white quail and China yellow quail (P<0.05). The short end, yolk height, yolk width and yolk weight of Korea quail and China white-feather quail are significantly higher than those of China yellow quail (P<0.05), the yolk index of China yellow quail is far higher than those of Korea quail and Beijing white quail (P<0.05), the protein height of Beijing whit...
Waqar Akhtar1*, Munir Ahmad2, Nadeem Akmal1, Hassnain Shah1 and Asif Ali Mirani2
...-align: justify;">This paper investigates resource use efficiency in dates production at three farm size levels by using primary and secondary data for the year 2015-16 by employing Policy Analysis Matrix (PAM) methodology. Relevant indicators were employed to gauge and compare resource use efficiency of two dates products (fresh dates and dried dates) produced by farmers. The finding of positive Private Profitability and Private Cost Ratio (PCR) value less th...
Asghar Khan1,*, Aneela Zameer Durrani1, Arfan Yousaf2, Jawaria Ali Khan1, Mamoona Chaudhry1, Mumtaz Ali Khan3, Habibunnabi4 and Amjad Khan5
...entry and validation was performed through Epi-Data. Data analysis was performed through SPSS. Chi-square and regression analysis were conducted. An overall prevalence of 67.3% was found. On multivariable logistic regression several health (lactation stage, number of lactations, body mass index, udder shape and milk yield), management (udder preparation and teat dipping) and bio-security (...
Songhao Zhang1, Yiwen Gong1, Jian Xu1, Mou Hu2, Peng Xu3 and Yanliang Jiang1,2,4,*
... skin color and purse-shaped body form. However, the underlying genetic basis is less studied. In the present study, we utilized the powerful approach of comparative transcriptome analysis via high throughput sequencing, and examined transcriptome profiles of purse red carp by comparing with Yellow River carp, of which the skin color and body shape are quite similar to wild carp. A total of 434 million reads was generated, r...
Mohsan Iqbal1, Farid Asif Shaheen1, Rashid Mahmood2,*, Muhammad Khalid Rafique2, Imran Bodlah1, Farah Naz3 and Muhammad Usman Raja3
... most destructive insect pests of Cicer arietinum (Chickpea) in storages and renders grains unfit for human consumption. In the present study, synergistic effects of entomopathogenic fungi (EPF), Beauveria bassiana and Metarhizium anisopliae and entomopathogenic bacteria (EPB), Photorhabdus temperata and Xenorhabdus nematophila were studied as bio-control...
Riffat Sultana
...hizocomicus of the superfamily Schizodactyloidea is described from Tharparkar district, Pakistan. Hind spure of this new genus look like table tennis racket, broad distantly and narrow from one side while from the other side these are elongated. Wings are completely absent. The body is light yellowish with black patches dorsally and brown ventrally.
...
Muamber Shah1, Muhammad Subhan Qureshi1, Rifat Ullah Khan1, Muhammad Mobashar1, Mubashar Ali Khalique2, Irfan Khattak3, Ambrina Tariq4, Ijaz Ahmad1 and Shabana Naz5,*
... high in Friesian bull. Sperm concentration and motility were significantly (P<0.05) high in Jersey bull while live sperm percentage was significantly (P<0.05) high in Jersey bulls and sperm abnormality was significantly (P<0.05) high in Sahiwal and Friesian-Sahiwal cross. In addition, semen quality was improved in all the breeds after supplemen...
Essossinam Ali*
...-align: justify;">This paper analyzes farmers’ attitudes towards climatic risks and assesses farmers’ risk aversion behavior on inputs use focusing on fertilizer, drought tolerant seeds (DTS) and labor allocation. Multi-stage sampling technique was used to collect data from 704 farm households in three regions (Central, Kara and Savannah) in subsistence agriculture in Northern Togo. Tobit and linear regression models were used to analyze the effect...
Hashim Ullah1, Abdur Rahman1, Rifat Ullah Khan2, Shakoor Ahmad2 and Ambrina Tariq3, Shabana Naz4,*
...iv>The present study was performed to investigate the effect of breed, sex and body condition score (designated as weak, medium and healthy with BCS 2, 3 and 4, respectively) on the meat cholesterol, fat, crude protein, ash, moisture and dressing percentage of WaziriandMazaisheep. A total of 36 mature sheep of Waziri and Mazai were selected and processed for dressing ...
Yan-Guo Han1,2, Jun-Hua Ye1, Qin-Tao Zhao1, Yong-Jie Huang2, Kai Li2, Yong-Fu Huang2 and Li Xu1,*
...re orally vaccinated, respectively SS-14 (Group T1) and SS-28 (Group T2) DNA vaccines fused tPA signal peptide and CpG adjuvant and delivered by attenuated Salmonella choleraesuis at weeks 0, 3 and 6 of the study, and rats in control group (Group C) was orally given empty vector vaccine. Blood samples were collected before primary immunization and at weeks 3, 5 and 7 after primary im...
Zhengfei Wang*, Dan Tang, Xuejia Shi, Huayun Guo, Xiuping Chen, Daizheng Zhang and Boping Tang*
...ost common and abundant species and predators at the top of food chain in the hydrothermal vent ecosystem. However, the genetic basis for the adaptation of hydrothermal vents crabs to the harsh environment remains poorly explored.The objectives of this study were to increase our understanding of the mechanisms of hypoxia adaptability in vent crabs and to confirm if there is a correlation between mitochondrial protein coding genes (PCGs) and adaptation to the e...
Shakeel Ahmad Anjum1, Sami Ullah1*, Muhammad Mohsin Raza2, Mohsin Raza1, Muhammad Abbas3, Ijaz Ahmad4, Malik Muhammad Yousaf2, Muhammad Zeshan5, Adeel Abbas1, Mehmood Ali Noor1 and Mohsin Nawaz1
... stages of wheat crop respectively. Results revealed that B application at the rate of 0.05 M solution substantially increased plant height, productive tillers, 1000 grain-weight and final grain yield. It was observed that 0.05 M B applications at delayed growth stages after booting is less effective in improvement of yield attributes of wheat crop as compared to booting stage. Economic analysis revealed that 0.05 M B application gave highest net income and be...
Mehran Ahmad, Syed Attaullah Shah and Shahid Ali*
...ly, 2018. Cobb-Douglas type production function was used to estimate effect of important determinants on tomato yield. Results showed that the estimated coefficient of net farming (dummy) is 0.25; implies that tomato yield with net farming is 25 percent more than traditional production technology. DAP, Nitrate and Urea, labor and FYM had positive significant effects on tomato yield. Estimated allocative efficiencies of DAP, ...
Hong Ma*, Bo Fu, Liang Wang, Zhong-qiu Li and Di Liu*
...i>15.9 ± 4.3%, respectively). However, blastocyst cell number was not different between groups. Furthermore, proto-oncogene was reported to play roles in embryo development, thus we assessed c-Fos, c-Jun, Raf-1, and c-Myc mRNA expression in HSPC117 transgenic and pcDNA 3.1 blastocysts. It was revealed that over-expression of HSPC117 mRNA in blastocysts up-regulated c-Fos, c-Jun, Raf-1, and c-Myc...
Muhammad Afzal1, Nighat Sultana1, Ali Hassan1, Syed Zakir Hussain Shah2,*, Mahroze Fatima3, Syed Makhdoom Hussain4, Muhammad Bilal5 and Majid Hussain2
...oject studies the growth performance, muscle proximate composition and nutrient digestibility performance by rohu (Labeo rohita) juveniles fed citric acid (CA) acidified phytase (PHY) pretreated soybean meal (SBM) based diet.Basal SBM based diet was supplemented with two levels of CA (0 and 2%) and two levels of microbial PHY (0 and1000 FTUkg-1) in factorial arrangement resulting in the formulation of four ...
Junli Sun1,2,3, Lin Bai1 2, Xiaogan Yang1,2, Yangqing Lu1,2, Shengsheng Lu1,2,* and Kehuan Lu1,2,*
...v>...
Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Luqman and Muhammad Zeeshan Majeed
...tera), a damaging insect pest of a large number of agricultural and horticultural crops in South East Asia. In spite of extensive applications of conventional synthetic pesticides, citrus farmers are unable to get rid of this pest. In order to find out alternate biorational pesticides, this laboratory study was carried out to evaluate few selected novel ...
Imdad Ali Mahmood1, Muhammad Imran2, Muhammad Sarwar1, Matiullah Khan1, Muhammad Aqeel Sarwar2, Shoaib Ahmed1 and Shahid Riaz Malik2
...ign: justify;">A field experiment on lentil was conducted to see the effect of Zn application alongwith PGPR on growth and yield under rain-fed conditions at National Agricultural Research Centre (NARC), Islamabad during 2016-17. Split plot design (main plots with and without inoculation and Zn application in sub-plots) with three replications was followed. Agronomic data i.e., plant height, pods per
Rabia Khalid1, Saleema Bashir Shams1, Bibi Nazia Murtaza1,*, Gaitee Joshua1, Saira Mushtaq1, Hassan Al-Talhi2 and Abdulaziz Al-Amri2
...me were evaluated. The experimental and laboratory values for BMI, total cholesterol (TC), total triglycerides (TG), high density lipoproteins (HDL), low density lipoproteins (LDL) and fasting blood glucose (FBG) were used to demonstrate the incidence of metabolic syndrome. Overall, 39.025% of bank employees and 22.53% of randomly selected control individuals have metabolic syndrome. Among the bank employees, prevalence of obesity was 67.53% and in general pop...
Syeda Shazia Bokhari*, Ghashia Qayyum, Uzma Rafi and Aisha Waheed Qurashi
...sing crop productivity especially in agriculture based countries like Pakistan.Vermicomposting is an ecofriendly approach theoughwhich earth worms mediate the process for improving soil fertility. The present study was undertaken for the improvement of soil fertility using microbes isolated from internal and external parts of Lumbricus terrestris Isolates were identified through different biochemical tests and morphological characterization. Bacterial s...
Xiaohui Yu, Shuai He, Liqiang Wang, Mengyang Kang, Yanjiao Zhu, Shuhui Wang and Xiuzhu Sun*
...gle addition.
...
Iram Liaqat1,*, Nazish Mazhar Ali2, Najma Arshad3, Riffat Iqbal1 and Zain-ul-Abideen1
... that causes bacteremia, periodontitis and abdominal infections. Ten soil samples were collected and screened by morphological and biochemical study. Only one strain DUV1 was confirmed by 16S rRNA gene sequencing as D. vulgaris (accession number: KY698020). It showed significantly reduced biofilm formation (52%; p<0.05) by test tube method compared to liquid interface coverslip assay (35%) and congo red assay. D. vulgaris was treated with vari...
Muhammad Yasin1, Romana Shahzadi1, Muhammad Riaz2, Mahideen Afridi2, Wajya Ajmal3, Obaid Ur Rehman2, Nazia Rehman3, Ghulam Muhammad Ali1,3, Muhammad Ramzan Khan1,2,3*
...one and valve margin, respectively. The present study was envisaged to isolate the orthologs of SHPs and FUL from local canola “Pakola” and “Punjab Sarsoon 3”, and to study expression patterns of their transcripts. Morphological data revealed significant difference between pod wall thicknesses, seeds per pod and pod length between the two cultivars. PCR amplification and sequencing revealed that two p...
Tahira Jatt1, Ghulam Sarwar Markhand1, Lane Rayburn2, Ray Ming3, Mushtaque Ahmed Jatoi1 and Ameer Ahmed Mirbahar1,4*
...cot and dioecious plant species having uncertain diploidy levels because of scarcity of cytogenetic knowledge. Khairpur district in Sindh is known as the biodiversity center of date palm. Investigations were carried on the chromosome number and karyotype one of the seven indigenous commercial date palm varieties and four wild type date palm of Sindh province, Pakistan by using the traditio...
Amany Adel, Wesam Mady*, Zienab Mosad, Fatema Amer, Asmaa Shaaban, Dalia Said, Marwa Ali Abdel Maged, Abdel-Satar Arafa, Mohamed Kamal Morsi, Mohamed Khalifa Hassan
... in poultry production especially with a co-infection with other circulating pathogens. In this study, 1026 confirmed positive H9N2 cases by RT-PCR out of 23182 different examined samples of different species and sectors in Egypt, with a prevalence rate 4.4% by the year 2015/2016. However, the LPAI H9N2 showed a wide range distribution with high geo-prevalence rate in 2015/2016 (96.3%) as positive cases were recorded in 26 g...
Fazal Wahab1, Naila Chand1, Rifat Ullah Khan1, Nazir Ahmad1, Urooba Parvez2, Zia ur Rehman3 and Shabana Naz4,*
...ity of Rhode Island Red spent layers. A total of 60 spent Rhode Island Red layers were assigned to 4 treatments; FS-0, FS-0.5, FS-0.75, and FS-1 with 3 replicates, each with 5 birds. Birds were kept in cages for 28 days in open sided house. FS-0 was kept as control while treatments FS-0.5, FS-0.75 and FS-1 were provided with fenugreek seed powder in the ration at the rate of 0.5, 0.75 and ...
Wafaa M. Hikal1,2,* and Hussein A.H. Said-Al Ahl3
...es and medical devices especially in dental units and dialysis machines. It poses a threat to public health as it is responsible for human infection. In inappropriate conditions, it forms cyst with high levels of resistance to disinfection methods. The aim of this study was to isolate the pathogen from the dental units and hospital water network and treatment of Acanthamoeba with Trachyspermum ammi essential oi...
Zhimin Yuan1, Yan Yu2, Yanmei Wang1, Yanzhen Bu1,* and Hongxing Niu1,*
...stribution in China, and people are in frequent contact with these bats. However, assessing the gut microbiota, especially the potential pathogens, is needed for public health. Thus, this study aimed to explore the microbial diversity of the gastrointestinal tract of H. alaschanicus and to estimate the risk to humans caused by the hosted pathogenic bacteria. The 16S rRNA gene V1−V2 regions were sequenced ...
Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Asam Riaz and Muhammad Zeeshan Majeed
...f the destructive insect pests of many agricultural and horticultural crops including citrus. Extensive and injudicious use of conventional synthetic insecticides against D. mangiferae have led to many environmental and health problems urging to seek out environment-friendly and safe alternate strategies to control D. mangiferae. To this end, the present study evaluated the methanolic extracts and essential oils of eight indigenous plant s
Hala Mohamed Nabil Tolba1, Naglaa Fathy Saeed Awad1*, Gamelat Kotb Farag Kotb2, Amany Adel3
...ting in Egypt during the period of 2017 - 2018. Sixteen pooled bursal tissue samples were collected from IBD suspected (9 Egyptian balady and 7 broiler) chicken flocks located in different localities at Sharkia governorate, Egypt. These samples were subjected for direct detection of a 620 bp hypervariable region in the VP2 gene using Reverse transcriptase polymerase chain reaction (RT...
Ghalia Nawal1, Muhammad Irfan2*, Saira Ashfaq3, Hafiz Abdullah Shakir1
...y prominent stance. The specificity of lipases is far-fetched for their point selection and kinds of reactions they undergo on their discernible substrates. Most suitable production plan involves Sub-merged liquid fermentation in fed batch manner using agricultural wastes. Bacterial lipases are preferred due to their extra cellularity, easy step down approach and practicability of increased productions via technological modifications. They have wide- rang...
Mohammed Anas Chowdhury1, Md. Abdul Karim1, Md. Tayfur Rahman1, Shoaibe Hossain Talukder Shefat1, Ashikur Rahman1, Mohammad Amzad Hossain2*
... present status of fish species diversity of Surma River at Sylhet Sadar, Northeast Bangladesh. A total of 51 fish species belonging to 16 taxonomic families has been identified. The most abundant family was recorded as Cyprinidae covering 36%, while the least abundant family was Gobidae and Plotosidae comprising 1%. A Shannon-Weaver diversity index was fluctuated between 2 to 2.5 with mean value 2.30±0.14, which reve...
Amany Adel, Wesam Mady*, Zienab Mosaad, Fatma Amer, Asmaa Shaaban, Dalia Said, Marwa Ali, Abdel-Satar Arafa, Mohamed Kamal Morsi and Mohamed Khalifa Hassan
... in poultry production especially with a co-infection with other circulating pathogens. In this study, a total of 23182 cloacal and tracheal samples were collected from suspected cases between 2015 and 2016 and submitted to the Reference laboratory of veterinary quality control on poultry production (RLQP) from different poultry sectors and bird species which are distributing all over t...
Kamran Aziz1*, Aamir Saleem1 and Arshad Mahmood Malik2
...ion was estimated by trapper technique. Under Cedrus deodara and Pinus wallichiana canopy, the leaf litter was collected and brought back to laboratory for the further chemical analysis. The Total annual litter fall production of Cedrus deodara was 4.2209t/ha/annum while the Pinus wallichiana was estimated 4.6097t/ha/annum. It showed that there is more litter fall in Pinus wallichiana as compared to Cedrus deodara. The P. wallichiana has greater decay rate as ...
Fatima Tufail1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3
... due to extensive use of pesticides in agriculture. The exposure of aquatic animals to these pesticides results in acute and chronic health effects. Fresh water fish species such as Channa striata serve as important bio-indicators for aquatic contamination to access the changes caused by human activities effectively and reliable monitoring bio-system to recognize and predict hazardo...
Huma Naz1*, Sajid Abdullah2, Khalid Abbas2, Muhammad Rizwan Tariq3, Laiba Shafique4, Ghazala Nazeer5
...e to control. Aduration-specific damage to DNA was observed in RBCs of C. catla.
...
Arshad Mahmood Malik1*, Khalid Mahmood Mughal2 and Abdul Saboor3
...pment is changing the shape of production systems all over the world. A Cobb Douglas type hydroponics production system was developed for estimation of production elasticity of hydroponics in Pakistan. Return to scale was calculated by adding all betas, which indicate the stage of production function of hydroponics system. Domestic resource cost indicates relative efficiency of hydroponics...
Muhammad Naveed Sheas1, Haris Rasool2, Muhammad Nouman Rafique2, Muhammad Rizwan Tariq1*, Abid Muhammad1, Khubaib Ali1
...D, Catalyze, Glutathione peroxidase were performed that shows significantly high levels in the blood than the group that was treated with nicotine and shows a positive correlation with the days at which the rat’s groups were given a supplemented feed. Total antioxidant capacity and antioxidative stress shows significant results by the selected treatment.
...
Farah Bilal*, Abdulmohsen Alhejaily, Shahida Husnain
...ations as potential therapeutics target for NSCLC in non-smokers.
...
Sehrish Ashraaf1, Hafiz Muhammad Tahir1, Muhammad Akram Qazi2, Shaukat Ali1*
... as a marker to delimit species. Based on morphological identification and sequencing of CO1 gene, a total of 22 species of spiders belonging to five families were investigated and compared within each species and among families for nucleotide frequency distribution of all species collected. We had found non-significant difference in frequenc...
Mohsen M. El-Sherbiny1,2,*, Reny P. Devassy1, Erinn M. Muller3, Abdulmohsin A. Al-Sofyani1 and Ali M. Al-Aidaroos1
...mesozooplankton taxon, Copepoda was studied with respect to the prevailing hydrographic conditions along the coastal waters of Gulf of Aqaba, Saudi Arabia during the summer period. Conspicuous stratification was evident in the water column while nutrient distribution highlighted the oligotrophic nature of the region. Nitrate showed a notable increase in the deepe
Abdul A. Mirani1,2*, Chee H. Teo2, Adel A. Abul-Soad3, Ghulam S. Markhand1, Tahira Jatt1, Ameer A. Mirbahar1,4, Najamuddin Solangi1
...tage were screened for type and nature of phenotypic abnormalities. Six phenotypic abnormalities were detected: 1) dwarfism, 2) excessive vegetative growth, 3) production of deformed offshoots and twisted inflorescence, 4) abnormal frond growth, 5) low levels of fruit setting and 6) inflorescence absent. Among the six different variant phenotypes, complete reversion of phenotypic abnormalities for the phenoty
Rana Waqas Arshad1, Asim Aslam1, Muhammad Saeed Imran1, Kamran Ashraf2 and Raheela Akhtar1,*
...l disease (IBD). Three experimental groups, each having 100 broiler birds were placed in the same environmentally controlled house. Samples of blood and bursa of Fabricius were collected from slaughtered birds after every 7 days till the end of experiment (35 days). The size of bursas and the bursa/body weight ratios were significantly greater in live vector vaccine group than other vaccinal groups. ELISA revealed high antib...
Amjad Ali1*, Wiqar Ahmad1, Muhammad Zeeshan1, Farmanullah Khan2 and Muhammad Motasim Billah1
...t status and chemical properties after maize harvest in Summer 2016. Particle sizes in the above order showed 3, 2 and 2% increase in soil pH over the control (7.63) and 15, 10 and 6% increase in soil EC over the control (125 mS cm-1), respectively. Their OM contents (1.73, 1.68 and 1.67%) registered 98, 93 and 91% increase over the OM in the control (0.87%), respectively. Amonium bicarbon...
Shumaila Sadiq1,2*, Abdul Saboor2, Fouzia Jamshaid3, Abdul Qayyum Mohsin2 and Azeem Khalid2
...may be encouraged for cooperative farming. Climate change vulnerability monitoring may be beneficial for policy makers in policy formulation and implementation processes to develop zone specific sustainable adaptation strategies particularly to improve farmers’ food security, economic situation and education in Pakistan. ...
Asad Ullah Khan1, Wiqar Ahmad1*, Amir Raza2, Farmanullah Khan3 and Muhammad Sharif3
... variability among genotypes of a plant is responsible for variation in growth, yield and nutrients uptake performance. This research investigated the survival and growth efficiency of the 10 wheat (Triticum aestivum L.) genotypes under sand culture including Batoor-2007, Barsat (NRL 0320), Fakhr-e-Sharhad-99 (FS-99), Tatara-96 (WS 395), Paktunkhwa-15 (PR-103), NIFA Lalma (NRL 0517), Pirsa...
Muhammad Affan Khan* and Abdur Rab
... 2012-13. The research experiment was conducted using RCB Design with 2 factors and 3 replications. Five okra varieties viz. Sabz Pari, Arka Anamika, Pusa Sawani, Punjab Selection and Green Star were grown at three plants spacing i.e. 20, 30 and 40 cm and were evaluated for growth and seed production. Variety Arka Anamika had the maximum plant height (136.8 cm), number of branches per plant (1.42), number of pods
Xuefeng Cao1, Guangneng Peng1, Xiaobin Gu1, Changliang He1, Guizhou Yue2, Jun Shi3,* and Zhijun Zhong1,*
...es (CPV) or canine distemper virus (CDV) without nuclear acid extraction, we established a direct amplification TaqMan real-time (RT)-PCR method (DARPM) to detect CPV and CDV in clinical samples. We compared this new method against real-time PCR/(RT)-PCR and it showed no cross-reactivity with other pathogens. Sensitivity testing showed the minimum detection limits of real-time (RT)-PCR were 7.44×101 copies·μL-1 (CPV) and 4...
Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan
...t represented 588 NDV suspected flocks were collected from poultry farms showing respiratory manifestation and/or drop in egg production during 2015-2018. Out of 588 NDV outbreaks 95 flocks were confirmed positive NDV by rRT-PCR using genotyping primers, with a prevalence rate of 16.2%. NDV outbreaks were recorded in 16 governorates, from total of18 investigated governorates and the recorded geo-prevalence of 89 %. Twenty-five samples were selected for further...
THIRTY SIXTH PAKISTAN CONGRESS OF ZOOLOGY
Proceedings of Pakistan Congress of Zoology
..., 2016
All the papers in this Proceedings were refereed
by experts in respective disciplines
THIRTY SIXTH PAKISTAN CONGRESS OF ZOOLOGY
held under auspices of
THE ZOOLOGICAL SOCIETY OF PAKISTAN
at
DEPARTMENT OF ZOOLOGY, UNIVERSITY OF SINDH, JAMSHORO, PAKISTAN
FEBRUARY 16 – 18, 2016
...
Proceedings of Pakistan Congress of Zoology
..., 2015
All the papers in this Proceedings were refereed by experts in respective disciplines
THIRTY FIFTH PAKISTAN CONGRESS OF ZOOLOGY
held under auspices of
THE ZOOLOGICAL SOCIETY OF PAKISTAN
at
CENTRE OF EXCELLENCE IN MARINE BIOLOGY, UNIVERSITY OF KARACHI, KARACHI, MARCH 1 – 4, 2015
...
Proceedings of Pakistan Congress of Zoology
...RNATIONAL) Allama Iqbal Open University, Islamabad, Pakistan...
Umar Hayat1, Khalid Khan2, Saima Liaqat3* and Balach Rasheed2
... that low rains over the period of time have adversely affected the production, employment, and supply chain of crops. Furthermore, to avoid the adverse effects of climate change in the future, it is suggested to plant more trees and arrange different types of awareness campaign through print media and electronic media. It is also recommended to conserve water through the construction of dams and pro...
Jie Zhang1,2,*, Baradi Waryani3,4 and Qihai Zhou2,*
...hkeii is an endemic species in East Asia. It has a wide range of distribution in Chinese waters including coastal waters, inland lakes, and outflowing rivers south of the Yangtze River and its delta. In order to maintain stable high production of salangids, fertilized eggs from native or introduced populations of icefish were frequently introduced to various types of water throughout China mainland except for Tibet ...
Jing Hu1,2, Yan Liu2,3, Gang Yu1,2, Changping Yang2,3, Binbin Shan2,3, Shengnan Liu2,4 and Dianrong Sun2,3,*
....6mm); Neural arch developed earlier than haemal arch, while haemal spine earlier than neural spine, consistent with the ossification; The development and ossification of neural arch and neural spine occurred in the backward order, while haemal arch and haemal spine from central tail to bothsides, Whatʼs more, all ossification occurred from proximal to outward; Along with the development of vertebral column, urostyle curved on 15-17DPH(SL4.0-5.0mm, NL2.9...
Jingchen Chen, Zhaochao Deng and Zhiqiang Han*
...sequence of Ammodytes personatus, and compared with Sanger sequencing results. Three samples belonging to two lineages of A. personatus mitochondrial DNA (mtDNA) were used in the study. Based on the complete mtDNA sequence, the genetic distance between the two lineages is 0.064. Results show that the total sequence lengths of the three samples of A. personatus mitochon...
Lusha Liu1,*, Lei Cheng2, Xingqi Zhang3, Yulong Li1 and Jianping Jiang1,*
...v>...
Tariq Mukhtar1,* and Muhammad Arshad Hussain2
...m level and therefore, appeared to be negatively correlated with the latter. It was also observed that the reductions in moderately resistant cultivar were significantly lower as compared to the highly susceptible at all inoculum levels. It is concluded that the plants of moderately resistant cultivar Sanam suffered less damage and suppressed nematode infections at all inoculum levels and therefore, recommended for cultivation in root-knot nematode infested fi...
Uzma Jabeen1, Irfan Khan2, Nadia Naeem2, Asmat Salim2,* and Waseem Ahmed1
... commonly used chemotherapeutic drug. Oxidative stress plays an important role in DOX-induced toxicity. This study was aimed at analyzing the expression levels of genes that are induced in response to oxidative stress in heart and liver tissues following DOX administration to rats. In this study, DOX was administered to rats intraperitoneally (i. p.) at 3 mg/kg at alternate days for two weeks. Heart and liver tissues were ha...
Zeynep Soyer Sarıca1*, Meryem Eren2 and Meryem Senturk2
...vels and activities of superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GSH-Px) enzymes were estimated in the brain tissues of the Sprague Dawley rats. Compared to the control groups, a significant increase in the brain tissue MDA level of the group which received only 10 mg/kg K2Cr2O7 was observed, whereas no statistically significant change was detected in SOD, CAT and...
Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2
...on in maintaining the proper diet of human beings. Especially Okara has been gained more importance due to its nutritional value. According to the U.S. Department of Agriculture (USDA) 100 grams of okra contains about 1.93g, 0.19 g, 7.45 g 3.2 g and 1.48 g of protein, fat, carbohydrates, fiber and sugar, respectively. As well as one gram of okra contain 31.3 mg and 299mg of vitamin K and p...
Sadaf Rahim and Mudassar Iqbal*
...increased or decreased depending on growth conditions. For these reasons a Trichoderma harzianum was selected for its growth optimization conditions and extraction of insecticidal compounds effective against two major insects pests including Diuraphis noxia and Tribolium castaneum. The pure fungal strain of Trichoderma was grown using two different nutrient media including Glucose Peptone Yeast Broth (GPYB) and Potato Dextro...
Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah
... used as food. Present experiment was conducted under natural environment to evaluate the effect of PGPR on biomass production, nitrogen and proteins percentage of four mung bean varieties under different NaCI levels in sand culture after 5,7 and 9 weeks of sowing. Both inoculated and uninoculated plants were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry...
Yasir Ali1,2*, Bashir Ahmad1, Naqeebullah Jogezai3 and Adil Hussain1
... justify;">The study was performed to isolate cold active alkaline protease and alkaline active lipase producing psychrotrophic bacteria from water and soil samples collected from different glaciers of Karakorum Range of mountains, Pakistan. Serial dilution and plating approaches were exploited for bacterial isolation and the isolates were qualitatively screened for proteolytic and lipolytic activity with skim milk and Tributyrin agar (TBA plate) assay method....
Usman Zubair1*, Anjum Shehzad2, Muhammad Ishaque Mastoi3 and Khalid Mahmood1
...he most serious economic pests of fruits and vegetables around the world. The objective of this paper is to present taxonomy and new records of fruit flies. This manuscript deals with distribution records presented for species of fruit flies from Poonch Division of Azad Jammu and Kashmir. Taxonomic issues with specimen are discussed. The s
Shaikh Abdul Lateef, Zhou Lin, Wu Jian, Junjie Qian, Jonathan Hartanto Tan and Zheng Shusen*
...y mechanisms, immune escape strategies, disease epidemiology and preventive measures associated with HBV. The current antiviral therapeutics are not providing adequate protection against HBV. It is mandatory to characterize and devise novel antiviral therapies to control the spread of hepatitis ...
Wesam Mady*, Nahed Yehia, Mohammed Hassan Elhussieny, Azhar Gaber Shalaby, Moataz Mohamed El Sayed, Neveen Rabie Bakry, Asmaa Shaaban, Abdel Satar Arafa, Afaf Abdel Baset Mahmoud and Wafaa Mohammed Hassan
...vices), Egypt during the period from May 2017 to August 2018. 11 positive cases were confirmed in seven governorates with a prevalence rate of 0.93% and the positive samples were mainly located in Upper Egypt. The sequence of partial HA gene was performed for 10 positive samples and they were genetically characterized as HPAIV H5N8 belongs to clade 2.3.4.4b. Except three isolates in 2018 b...
Umar Hayat1*, Tariq Shah1, Muhammad Suleman Bacha2 and Muhammad3
...tan. It contributes 42.3 percent of the labour force and 18.9 percent to GDP of the country. Since its inception, Pakistan’s economy is planning to achieve agricultural-led growth to promote economic stability in the country. The present study is an attempt to examine and analyse the nexus of various sub-sectors of agriculture and their contribution to agricultural growth in the country. Data on key variables such as a...
Saeed Murtaza1,*, Nazir Ahmad2, Muhammad Asif Raza3, Muhammad Saleem Akhtar1, Muhammad Mazhar Ayaz4, Muhammad Ali5 and Rais Ahmed6
... normal rams and bucks appeared homogeneous and moderately echogenic. Mediastinum testis was seen as a centrally located hyperechoic line in longitudinal images and by an almost circular hyperechoic area in the middle of the organ in transverse images. The epididymal head and body were less echogenic than the testis and were homogeneous; the epididymal tail was heterogeneous, but less echo...
Munazza Yousra1*, Sair Sarwar1, Muhammad Mahmood Ul Hassan1, Muhammad Zameer khan1, Abdul khaliq2, Shahbaz Ahmad1 and Shamim Ul Sibtain Shah3
...ubation and greenhouse experiments were conducted at National Agricultural Research Centre, Islamabad during 2015-2016 to evaluate the response of maize to different rates of ZnSO4.7H2O and Zn-EDTA in sandy loam soil. Treatments included Zn @ 0, 2, 4, 6, 8 mg kg-1 as ZnSO4.7H2O and Zn-EDTA, arranged in completely randomized design with three replications. In Incubation study, the soil was incubated at 29ºC and field capacity was maintained to compare the ...
Hakim Shah1*, Noor Jehan2, S. Shafiqur Rehman1 and Syed Said Badshah Bukhari1
...anges thereof during the period 1965-2015, and their impacts on ring-widths of Spruce (Picea smithiana), along with comparison of the results inter se the two Forest Divisions. Results indicated that KFD and KaFD had significantly different climate regimes of temperature and precipitation. Mean annual maximum and minimum temperatures and mean annual tempe
Ammara Saeed* and Noor-ul-Amin
... Complete Block Design experiment was laid with split plot arrangement at Ornamental Horticulture Nursery, Department of Horticulture, The University of Agriculture Peshawar during 2014 and 2015. Cut flower rose cultivars were tested with treatments of 3 levels of phosphorus (30, 60 and 90 kg ha-1) and potassium (20, 40 and 60 kg ha-1) each as well as combined. Results showed that when plants were supplied with phosphorus at 60 kg ha-1 and potassium at 40 kg h...
Gulzhan Аubakirova1,*, Zhanat Adilbekov2, Assylkhan Inirbayev2 and Tanatar Dzhamanbayev1
...lity if regulated and properly managed intensive-type lake farms are created.
...
Tian-Yi Zhao1, Zi-Qing Liu2, Bo Yang1, Qiao Gao1, Hong-Yu Zhang1, Pei-Yu He1, Ming-Hua Duan1* and Yu-Li Yan1*
... and hemoglobin level in peripheral blood were measured using a fully automatic blood cell counter. Flow cytometry was performed to detect the changes in red blood cell counts and number of T cells in peripheral blood and the spleen. Western blotting was performed to detect Stat5, Bcl-2, and Cyclin D1 protein expression in pe
Tuncay Ateşşahin1,* and Mehmet Cİlbiz2
...r a total of 48 fishing operations between May 2013 and April 2014 and again from January 2015 to December 2015. Fishing activities were carried out using fishing gear with three spinner colours (yellow, blue or red), three hook sizes (No. 2: 2 cm; No. 3: 3 cm; or No. 4: 4 cm) and in different seasons (spring, summer, autumn or winter) by three anglers. At the end of the study, 336 rainbow trout, 13.2–56.5 cm in length and 28.6–2,174.6 g in weight,...
Syed Makhdoom Hussain1*, Nisar Ahmad1, Azhar Rasul1, Muhammad Mudassar Shahzad2, Muhammad Latif3, Muhammad Zubair Ul Hassan Arsalan1, Muhammad Umair1 and Hafiza Hina Shafqat1
... size possesses novel properties regarding absorbance and surface activity, so the aim of research was to estimate the impact of Cr nanoparticles on growth performance, nutrient digestibility and hematological parameters of C. catla fingerlings fed nano- Cr particles supplemented sunflower meal based diets. The experiment was consisted on seven test diets on the basis of supplementa...
Wen-Feng Li1, Rong-Yue Zhang1, Chun-Hua Pu2, Jiong Yin1, Zhi-Ming Luo1, Xiao-Yan Wang1, Xiao-Yan Cang1, Hong-Li Shan1 and Ying-Kun Huang1,*
...
...
Shafqat Husnain Khan1, Shah Jahan2, Irshad Ahmad3,4, Sadeeq ur Rahman5,* and Tayyab ur Rehman4,*
...creasingly reported carbapenem resistance due to carbapenemases is highly worrisome. Literature regarding incidence of class B metallo-β-lactamases (MBLs) - producing E. coli has not yet judiciously been addressed. In this study, we investigated the occurrence of carbapenemase- and MBLs-producers among a collection of 100 carbapenem resistant...
Nazia Qamar* and Sher Khan Panhwar
...agitta otoliths of five species Scomberoides commersonnianus (414), S. lysan (15), S. tala (8), S. tol (344) and Megalaspis cordyla (277) were collected from the commercial catches from July 2013 to March 2015. Fish length and otolith length for five species recorded as S. commersonnianus TLcm = 16.3−88.4, OLcm = 0.3−0.9; S. lysan TL=23.2&minu...
Waqas Raza*, Muhammad Usman Ghazanfar and Muhammad Imran Hamid
...-24.4% and 39.3-28.6% respectively with district Okara recording the maximum (39.3%) and district Jhang the minimum incidence (24.4%) for both the years. Similarly, disease severity ranging from 19.3-16.1% and 21.1-17.4% during the year 2016 and 2017 was recorded with Okara recording the maximum (21.1%) and Sahiwal the lowest blight severity (16.1%). The results clearly depicted that this disease is present in all the surveyed districts of the Punjab during bo...
Naheed Ikram and Nafisa Shoaib*
...ve isolated 5 different species of fungi Aspergillus niger, Aspergillus flavus, Rhizopus stolonifer, Penicillium sp. and Fusarium sp. from 14 different genera of commercially important marine fishes Acanthopagrus sp. Parastromateus niger, Nemipterus sp., Pampus argenteus, Ilisha sp., Alepes djed...
Muhammad Shahid1, Iram Amin1, Samia Afzal1,*, Zareen Fatima1 and Muhammad Idrees2
...% were PCR positives, respectively. This immunological and genomic study reveals that there were more seropositive patients than RNA positive ones. Serotype-2 remained the main causative serotype of the outbreak of dengue viral infection, started in the commencement of year 2013 and continues to infect Pakistani population till now.
...
Aly Khan1,*, Khalil A. Khanzada1 and S. Shahid Shaukat2
...e locality. Most common species in maize fields was found to be Pratylenchus zeae that occurred in 5 out of eight localities, one-way of variance was performed for those nematodes that occurred in two or more localities. With one exception, the density differed significantly among the localities.
...
Ayub Khan* and Ghaffar Ali
... the livelihood of local people. Agriculture and tourism, the main sources of livelihood of the inhabitants in the area, have been severely hit by this problem. Human activities, such as deforestation, overgrazing and extensive agriculture have made soil resource more vulnerable to rain and flood water. Programs at government and society level are required to control soil erosion. The objectives of this study are to seek the farm household willingness to pay (...
Yan-Bin Zhu1, Wang-Dui Basang1, Zhan-Dui Pingcuo1, Yang-Ji Cidan1, Sang Luo1, Dun-Zhu Luosang1, Yang-La Dawa1 and Guang-Xin E2,3,*
...the present study was to perform genetic diversity and population structure estimation on 382 individuals from seven Chinese Tibetan ecotype yak population using twenty-one microsatellites. The results revealed that the HO ranged from 0.4854±0.0194 in NNV to 0.6086±0.0267 in YRY, and the NA ranged from 3.86±1.98 in XMY to 6.05±3.37 in NNV. The least number of markers which deviated from Hardy-Wein...
Shujjah Haider1,*, Ayesha Maqbool1, Tariq Pervez1, Saima Parveen1, Arfan Ahmad2, Zahid Iqbal3, Javed Iqbal3, Shahid Mehmood3, Amanullah Khan4 and Sajid Umar5
...as 29.88 % and 20.67% respectively. Moreover, age-wise study revealed high prevalence of MG in 24-31 weeks old layers (44.17%) as compared to 55-63 weeks old layer flock (14.49%). The study of seasonal effect revealed highest MG prevalence in December (44%) while lowest in October (20%). Furthermore, higher prevalence was recorded in layer flocks with large number (4000-5000) as 33.33% than flocks with small number of birds (1000-2000) as 24.28%. In addition, ...
Aqsa Javaid and Nageen Hussain*
... the possible mutation especially in FOXP3 gene exon 1 that may clarify the reason of reduction of T regulatory cells (Tregs) due to HIV/AIDS. A total of 25 HIV patients were chosen from the Institute of Public Health on the basis of confirm HIV infection and 25 healthy controls as well. First genomic DNA was extracted from the peripheral blood and then amplified by using specific d...
Arif Jan*, Abdul Rab, Haroon, Rooh Ullah, Tauheed Ullah and Ikram Ullah
...e.
...
Qudrat Ullah1,8,*, Huma Jamil1, Laeeq Akbar Lodhi1, Zafar Iqbal Qureshi1, Shakeeb Ullah1, Tariq Jamil2, Iahtasham Khan3, Shahbaz Bashir4, Qudratullah5, Inamullah Wazir6, M. Abdus Sallam1 and Muhammad Zubair7
...% by RBPT and iELISA, respectively. Previous history of animal reproductive disorders was found to be significantly associated (P=0.0056) with seropositivity of the infection. Age, sex, parity, lactation and pregnancy status of the animal were not found significantly associated. Routine herd screening, consumtion of pasteurized milk and public awareness programmes would be helpful for control and prevention of zoonotic transmission.
...
Hui Wang1, Lin Wang1, Xuanlu Li1, Shanshan Li1, Yongqiang Zhao2, Shicheng Lv2, Xinrong Xu1, Guang Yang1 and Bingyao Chen1,*
... a result, 34 protected species among the 4975 individuals were sighted, including 127 red-crowned cranes (Grus japonensis) and 868 common cranes (Grus grus). The overall density of protected species, winter migratory species, and resident birds was 1244.60 individuals/km2, 396.88 individuals/km2 and 758.94 individuals/km2 res
Asima Azam1, Asma-Ul-Husna2, Saima Qadeer3, Qaisar Shahzad4, Rabea Ejaz1, Nemat Ullah5, Tasneem Akhtar4 and Shamim Akhter2,*
...o culture (IVC). The percentage of embryos capable of crossing 8-16 cell block and reaching morula stage were higher (P < 0.05) in Group II and Group III compared to other treatments. Both treatment groups were equally effective (P > 0.05). Results also indicated that synthetic oviductal fluid (SOF) medium was found better than M199 when co-cultured and conditioned with buffalo oviductal epithelial cells for culturing buffalo embryos. Conditioned SOF...
Zil-e-Huma1, 2, Abdul Malik Tareen3, Kaleem Ullah3, Tauseef M Asmat4,Abdul Samad4, Asim Iqbal2, Mohammad Zahid Mustafa3*,Irshad Ahmad5 and Sadeeq ur Rahman6
... problems in under developed countries. In Pakistan, diarrheal cases are treated empirically and, rarely, specific investigations are made. This study was designed to identify the prevalent strains of Escherichia coli among children of less than five years of age in Quetta, Balochistan, Pakistan. A total of 200 samples were collected from children suffering with diarrhea. E. coli was isolated using standard bio...
Aftab Shaukat1,*, Khalid Medmood3, Irfan Shaukat2, Tauseef ur Rehman3, Muhammad Ahsan Naeem1,5, Ashar Mehfooz1, Muhammad Ijaz Saleem1, Zia-ud-Din Sindhu1, Shahid Ali Rajput4, Mubashar Hassan1,4, Saqib Umar1, Muhammad Ali Jamil1, Rao Zahid Abbas1 and Anas Sarwar Qureshi1
...province, Pakistan. Therapeutic efficiency of Oxytetracycline-Imidocarb dipropionate combination was compared with Enrofloxacin-Imidocarb dipropionate against Anaplasma marginale (A. marginale). For this study, the blood samples of three hundred and sixty nine cattle were collected. Giemsa stain of blood smears showed 10.84% infection of cattle with Anaplasma. A. marginale positive cases were further confirmed through PCR. Among risk facto...
Salahud Din1,*, Saima Masood1, Hafsa Zaneb1, Habib Ur Rehman2, Saima Ashraf1, Imad Khan3, Muqader Shah4 and Syed Abdul Hadi1
... tarsal bones in twenty specimens of male and female adult chinkara (Gazella bennettii). The tarsus of chinkara comprises of five bones both grossly and radiographically, settled in three transverse rows viz, tibial and fibular tarsal in the proximal, central and fourth fused tarsal in the middle row, while, the first, second and third fused tarsal in the distal row. The fibular tarsal is the largest and longest bone of the hock, situated on the lateral...
Attaullah Khan Pathan1, Imran Ali Rajput1*, Agha Mushtaque Ahmed2, Muhammad Waseen Kalroo1, Muhammad Munir Shahid4, Abdul Qadir Baloch3 and Faheem Ahmed Rajput2
...t-align: justify;">The experiment on documentation of braconid parasitoids of pink bollworm on cotton crop at lower Sindh was conducted during the cotton season 2016. The results found that maximum parasitoid mean population 175.85±0.16 was recorded from Sanghar and lowest population 139.42±0.45 from Umerkot district. The highest population was recorded in the month October. Highest number of Bracon gelechiae found than other in all selected dist...
Khalid P. Loneand Irfana Liaqat*
...ping, maturing and developed, ripe and running, post spawning and spent-regressed. The testis in Labeo rohita were unrestricted and lobular. The maximum GSI (2.89±0.25) was seen in June when the photoperiod and temperatures were highest, while the lowest GSI was seen in October (0.09±0.01). The sta...
Raja Imran Hussain* and Iqra Yousaf
...uridae) are an important pest and their uncontrolled dispersal threatening yields of various crops including wheat. The goal of this study was to evaluate the shifts of rodent abundances among five sets of three different habitat types (human dwellings, agricultural and non-agricultural land). It was also expected that trapping in non-agricultural land a...
Unal Kilic1*, Abdiwali Mohamoud Abdi1 and Deniz Ekinci2
...ent additives and lignin peroxidase (LiP) enzyme on the in vitro gas production and methane production of some straws. The study involved 8 groups for each forage, 3 different straws (wheat straw, soybean straw, sorghum straw), which comprise of 2 different LiP enzyme treatments (Available –Not Available) and 4 different treatment groups (control, 4% urea, 10% molasses and 14% urea+molasses (4% urea, 10% molasses). Hohenheim gas test was used in <...
Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Gul Bahar Khaskheli2, Allah Jurio Khaskheli3, Arshad Ali Khaskheli4, Abdul Samad Magsi5, Ghulam Shabir Barham2, Arab Khan Lund5 and Maqbool Ahmed Jamali4
...sed significantly bottom percent of crude fiber. Acacia nilotica and Alhagi maurorum though were statistically similar to each other but found prominently rich in total carbohydrate content. It could be concluded that the thatta district possessed significant influence on most of the nutrients, whereby negative effect on the moisture content and positive on the dry matter was noted. Overall, no considerable influence on nitrogen free extract and total carbohyd...
Ghaleb Adwan*, Sami Bdir and Kamel Adwan
...icrocercous cercaria, respectively. Phylogenetic analyses based on sequences of the ITS2 region of the nuclear rDNA revealed that C. melanopsi palestinia I belongs to the family Lecithodendriidae Luhe, 1901, and it could be placed in the genus, or closely related to known Lecithodendrium. Analysis of ITS1 rDNA indicates that Cercaria melanopsi palestinia III belongs to the family Opecoelidae Ozaki, 1925....
Riyadh S. Aljumaah1, Mutassim M. Abdelrahman1,*, Moez Ayadi1 and Abdullah H. Alyemni2
...rns.
...
Nida Zia1, *, Ayesha Maqbool2, Muhammad Safdar3, Umm-I-Habiba1, Altaf Mehmood4, Muhammad Usman5, Zahid Iqbal6, Javed Iqbal6, Shahid Mehmood6, Amanullah Khan7 and Sajid Umar8
...es.
...
Mujahid Niaz Akhtar* and Amjad Farooq
...Punjab), Pakistan. The experimental data was collected from spring 2014 to fall 2016. Eggs and adults count of these bollworms were counted throughout the cropping season. Statistix (Version 8.1) were used to analyzed the data statistically. The mean values were compared at the significance level of 5%. Bollworms (PBW, SBW, and ABW) population was lowest in April and May whereas the highest values were observed in September and October. Correlation between abi...
Comparison of Yolk Fatty Acids in Market Available Black-bone Chicken Eggs and Ordinary Chicken Eggs
Suhu Duan, Liuan Li*, Zaiqiang Li, Mengran Qin, Zhenzhen Fan, Keyan Zhang, Qian Wang, Zhongmou Zhang, Bailiang Yang
...A ratio.
...
Asad Abdullah, Muhammad Irfan Ullah*, Abu Bakar Muhammad Raza, Muhammad Arshad and Muhammad Afzal
...mically important insect pest in global agriculture. Suitability of host plants is critical for the efficient management of this economically important insect pest. We studied the effect of various host plants on the growth, development and fecundity of S. litura. The larvae of S. litura were offered leaves of cabbage, alfalfa, sesbania and, maize in comparison to artificial diet under laboratory conditions (32...
Muhammad Waheed Mushtaq1,*, Muhammad Waqar Younas2, Jamil Anwar2, Syed Mustansar Abbas3 and Shahid Bashir3
...a-amylase, cellulase and pectinase) from aqueous system has been studied by applying novel concept of unidirectional freezing. To separate the enzymes from their aqueous system, directional freezing was applied horizontally through synthetic enzyme contaminated water samples, called radial freezing. After complete freezing, the samples were collected from various sections of the frozen mass and concentration of enzymes was determined. It was found that more th...
Naimat Ullah1, Sarzamin Khan2, Muhammad Mobashar3, Shahbaz Javaid4*, Tarique Tonio1 and Asif Mahmood5
...ductive and reproductive performance, and semen quality of Friesian Sahiwal crossbred bulls during summer season. A total of 24 Friesian Sahiwal crossbred bulls at nearly similar age and body weight were selected and allotted erratically into 3 treatment groups, denoted as A, B and C for a period of 2 months (May and June). Each group was assigned 8 bulls. Bulls in group A were not fed with any dietary fat (control group) wh...
Emre Barlas1 and Elif Yamaç2,*
...f the cave-dwelling bat species are under threat, because of destruction of caves such as filling or converting for other uses, human disturbance and loss of foraging habitats. In this study, cave-dwelling bat species and habitat preferences were investigated in Northwest of Central Anatolia in spring, summer and winter. Investigations were performed in 26 caves hosting (15) and not hostin...
Jae-Kang Lee, Hyun-Su Hwang, Tae-Kyung Eom and Shin-Jae Rhim*
...emus agrarius, A. peninsulae, and Myodes regulus were significantly different between sessions. Monthly captured adults and juveniles of A. agrarius and A. peninsulae were significantly higher in the post- than in the pre-thinning session. Population sizes were dramatically increased in the post-thinning session. Ground and understory vegetation coverage and number of downed trees ha-1
Ali Mujtab Shah1,2,3, Muhammad Naeem2, Muhammad Giasuddin Shah2, Muhammad Haaroon2, Quanhui Peng1 and Zhisheng Wang1,*
...eeding methods on growth performance, and immunity of Holstein Friesian (HF) calves. The applied feeding methods were stomach tube (ST), nipple feeder (NF) and natural suckling (NS). A total of 15 newly born HF calves were selected randomly from the available stock and divided into 3 groups, each of 5 calves. The median birth weight (kg) ± S.D of calves fed by ST, NP and NS were recorded as 28.68±1.16, 28.44±0.67 and 28.56±1....
Azeem Haider1, Muhammad Mohsin Alam2*, Azhar Ali Khan3 and Muhammad Asif Zulfiqar3
...ates to treat pulp and paper industrial effluent on a shake flask were studied. In the shake flask studies, Pleurotus ostreatus (L.) decolorized the effluent 69.68 %, on 7th day of incubation. Various cultural conditions including different glucose concentrations, nitrogen sources, pH, temperature and incubation period influence on biomass and different enzymes viz; xylanase, CMCase and la...
Muhammad Usman Ghazanfar, Muhammad Imran Hamid, Mubashar Raza, Waqas Raza*, Misbah Iqbal Qamar
...iquitous in almost all type of soils and their species promote growth of the plants and commercially used as bio-fungicide against soil borne plant pathogens. The present study was conducted with the aim to determine the efficacy of Trichoderma species using dual culture and pot assays against Phytophthora infestans (late blight) and Fusarium oxysporum (wilt) of tomato on different compost...
Xiaopeng Tang1, Wen-qin Su1 and Re-jun Fang1,2,*
...b>C-1). The experiment consisted of 1 control treatment and 5 levels of CT treatments (1×10-12 to 1×10-8 mol/L), and each treatment has 6 replications. Cell proliferation was determined by the MTT method. Cell morphology and phosphorus concentration in the cell supernatant were measured after 24 h of CT treatment. The NaPi-IIb protein expression was determined by Western Blot, and...
Constance Obiageli Ejilibe1, Helen O. Nwamba2, Ifeanyi Chinedu Atama3,*, Chiamaka Lynda Ani2, Ifeanyi Oscar Aguzie3, Josephine C. Madu3 and Christopher Didigwu Nwani3
...widely used agricultural pesticides, Butaforce® and Termex®. The Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and total protein (TP) concentrations in homogenized muscle samples was determined by standard procedures. ALT, AST and ALP increased significantly in response to concentrations of Butaforce® (7.00, 9.00 and 11.00 µgL-1) and Termex®
Hafiz Suboor ul Hassan and Saira Malik*
...
...
Rashid Iqbal1,2, Mathias Neumann Andersen1*, Muhammad Aown Sammar Raza2, Muhammad Adil Rashid1 and Salman Ahmad2
...s well as yield. A pot experiment was carried out to evaluate the effects of various irrigation strategies i.e. Full (FI), deficit (DI) and partial root-zone drying (PRD) on physiological, water relations, water use efficiency (WUE), and yield related attributes of wheat. These irrigation treatments were started at anthesis stage and maintained for 30 days. For FI and DI, 100 and 50% of evapotranspiration (ET) was replaced by irrigating the entire pot surface ...
Zubaria Malik, Zahir Shah* and Muhammad Tariq
...tility and other soil properties. However, the effects of biochar on soil biota specifically arbuscular mycorrhizal fungi (AMF) have received less attention. This study was therefore executed to assess the effect of biochar amendment on AMF in soil and roots of wheat and maize crops in a rotation experiment involving cereals {wheat (Triticum aestivum), maize (Zea mays L.)} and legumes {chi...
Muhammad Tariq Adnan Khan*, Tariq Mukhtar and Muhammad Saeed
...lpa and Singh Nath 666 appeared moderately susceptible. Five cultivars viz. Round Black, Short Purple, Brinjal PPL, Global Brinjal PPL and Namyal Ratchburi behaved as susceptible. All the cultivars behaved differently regarding formation of galls, egg masses, number of eggs per egg mass and reproductive factor. Maximum galls, egg masses, eggs per egg mass and reproductive factors we...
Zakirullah1, Hamayun Khan1, Ali Gohar2, Haq Amanullah1,*, Muhammad Younas1, Muhammad Tarique Tunio3, Muhammad Saleem Khan4, Ibrar Muhammad Khan1 and Noushad Khan5
...c breed) amount to the experimental material at Government Cattle Breeding and Dairy Farm Harichand, Charsadda. Separate artificial vagina was utilized for semen collection from either breed, maintained at 42°C temperature. Gross and microscopic examination was carried out subsequent to the semen collection. Semen specimen with more than 70% motile characteristics were used for further...
Muhammad Noman, Yong Tong Mu*, Muhammad Mohsin, Aamir Mahmood Memon and Muhammad Talib Kalhoro
...est. In this study, two specialized fishery software’s viz. CEDA (catch and effort data analysis) and ASPIC (a stock production model incorporating covariates) are used to analyze the fishery output (FO) and fishery input (FI) data of Scomberomorus spp. to evaluate their fishery stock status in Pakistani marine waters from Balochistan coastline.Three surplus production models (SPMs) viz. Fox (F-M), Schaefer (S-M) and Pella-Tom...
Xiaopeng Tang1,2, Rejun Fang3,4,*, Guochang Pan1,2 and Kangning Xiong1,2,*
...o provide a appropriate operation time for Ussing chamber test. Then, a total of 20 Loman laying hens with similar weight (1.25±0.13 kg) were divided into 1 of 5 treatments: i) control group (0 ng/mL EGF), ii) 50 ng/mL EGF group, iii) 100 ng/mL EGF group, iv) 150 ng/mL EGF group, and v) 200 ng/mL EGF group for using chamber test. The results showed that (i) the LDH activity of isolated intestine increased (P < 0.05) sharply during 30 min,...
De-Yong Zhang1, Xiao-Lu Xu1,*, Qin Ruan2, Xiu-Ying Shen3 and Yin Lu1
...ticular observation and spermatogenesis evaluation. PFOS ≥ 11 mg/kg (accumulative dosage) resulted in visible histopathological changing in testis, including disorder and vacuolization of spermatogenic cells. Changed testicular organ coefficient (for dosage ≥ 55 mg/kg), decreased sperm concentration (for 110 mg/kg dosage), decreased motility (for 110 mg/kg dosage) and increased s
Abd El-Nasser Ahmed Mohammed1,2,*
...ion of hypothermia and hyperglycemia due to general anesthesia. Seventy-five albino female mice (21.74 ± 0.19) were distributed into three groups; control (G1; N=25; not receive N. sativa oil) and two N. sativa oil groups supplemented with either 1.0% (G2; N=25) or 2.0% (G3; N=25) for 30 days. Changes of body temperature, heart rate, blood parameters (RBCs, WBCs, hematocrit, hemoglobin, glucose and total...
Kun Wang1,2, Yinglin Cui2, Xu Zhao2 and Changjiang Hu1*
... in China with good therapeutic effect. As very little is known about the mechanism of action of XN, the purpose of this project was to investigate the neuroprotective effect of XN on ICH model rats and to explore the underlying mechanisms of this therapy. In this study, experimental ICH was induced by the administration of stereotaxic collagenase type VII into the caudate nucleus. XN (at ...
Qihang Liu1,2, Yueli Jiang1, Jin Miao1, Zhongjun Gong1, Tong Li1, Yun Duan1 and Yuqing Wu1*
...ion caused by the use of pesticides to control locusts, alternative methods such as photo-induced traps are elusive. In this report we investigated locusts visual sensitivity to different spectral lights after orange light stimulation. Results showed that after 10, 20, and 40 min of 1000 lx post-orange light stimulation, locusts visual response intensity was stimulated by green, violet, and blue lights. However, post-64600 l...
Muhammad Saeed1,2,*, Tariq Mukhtar1 and Malik Abdul Rehman3
...tode (Tylenchulus semipenetrans) in a production area is required for the assessment of damaging potential of the nematode to citrus, identification of key factors that influence population densities, and to devise effective management strategies. In the present study, seasonal fluctuations in the population densities of T. semipenetrans were studied in two citrus orchards naturally infested with citrus nematod...
Qiuxia Lei1, 2, Haixia Han1, 2, Jinbo Gao1, 2, Yan Zhou1, 2, Wei Liu1, 2, Chunlei Wang3, Jie Liu1, 2, Dingguo Cao1, 2, Huimin Li1 , Baohua Huang1,* and Fuwei Li1, 2, *
...eria comprising several species; and the third kept as the control without adding any bacteria. The results showed that decomposition started earlier in the treated batches than in the control group. During the fermentation period, there was no influence between the internal temperature of the plies and the addition of bacteria. After adding strains, the time to reach the fermentation tem<...
Chukwuemeka Calistus Okolo1*, Ikenna Onyema Ezeh2, Chinelo Nnenna Uju3 and Nwakaego Ernestina Nweze1
...--F) were used for the experiment. Supplementation with multi-strain probiotics was started in groups A--C from day 0 post-supplementation (PS). On day 7 PS all experimental groups (A--E) were challenged with 1x106 trypanosomes intraperitoneally except the uninfected control (F). When parasitaemia peaked, groups A and B received 7mgKg-1 and 3.5mgKg-1 of ...
Obaidul Islam*, Shameema Khatun and Mustasim Famous
...(DVH), Sylhet during the period from 22 September to 18 October 2018 at CVH, 20 October to 18 November 2018 at CVASU and 26 February to 21 March 2019 at DVH. The prevalence was analyzed on the basis of location, age, breed and sex. Among the clinical cases infectious diseases occupied the highest prevalence in CVASU (62.85%), CVH (61.53%) and DVH (61.53%). Prevalence of difference in clinical diseases was not significant (P>0.05). In case of parasitic disea...
Muhammad Amin1,2*, Khalid Mahmood2 and Imran Bodlah3
...istan, yielded 24 aphid species in 14 genera, representing subfamilies, Aphidinae, Lachninae, Calaphidinae, Hormaphidinae and Chaitophorinae, infesting 28 tree species in 22 genera, 17 families and 12 orders. Genera Aphis, Cinara and Myzus had 7, 3 and 2 species, respectively. Hoplochaitophorus quercicola (Monell, 1879) and Pterocomma beulahense (Cocker...
Zeshan Siraj1*, Amjad Farooq1 and Zahid Mehmood2
...climatic factors (air temperature, relative humidity and rainfall) on different cultivars of Bt. cotton from May-November 2011 -May-November 2013 at cotton research institute, Multan, Pakistan, Jassids appeared in 21st Standard Meteorological Week(SMW)and attain its peak in 36th SMW. Maximum and minimum mean population of jassids (4.19±0.16 and 0.03±0.13
Durr-e-Nayab*, Iftikhar Hussain Khalil, Fida Mohammad and Shad Khan Khalil
...lete Block design. Genotype × environment interac tion across the two environments was significant for spikes plant-1, spikelets spike-1, grains spike-1, spike density, 1000-grain weight and grain yield plant-1. Line × tester interaction effect was also highly significant for all traits under both normal as well as late plantings. There was general reduction in mean performance of genoty...
Haidar Ali1, Malik Muhammad Shafi1*, Himayatullah Khan1 and Hamra Haidar2
...arm households who were operating farm size up to 1 acre (74.88 hours/week) were performing more off-farm employment followed by farm size more than one (1) but less than or equal to two (2) acres land (59.32 hours/week), more than two (2) acres but less than or equal to three (3) acres land (41.86 hours/week), more than three (3) acres but less than or equal to four (4) acres land (33.97 hours/week) and more than four (4) ...
Hafiza Mehwish Iqbal1, Shahid Yousaf1, Salman Khurshid1*, Qurrat Ul Ain Akbar1, Saqib Arif1, Nasreen Fatima2 and Ali Murad Rahoo3
...en not been addressed properly. This study has been attempted to assess the quality of citrus in terms of postharvest physiological disorders and organoleptic properties in relation to the occurrence of pathogenic diseases. Fruit samples (injured and healthy) were taken from the three different local markets of Karachi. Some of the fungal species viz. Aspe
Sikander Ali1, Muhammad Kamil Malik1, Muhammad Zubair1*, Muhammad Jawad Saleem2, Kanwal Hanif2 and Saira Azmat3
...ing the crop from insect pests infestation. Scientists are continuously striving their best for improving the quality of the produce. Therefore, the present study was conducted during 2014-15 to evaluate the efficacy of different insecticides against the mustard aphid; responsible for huge yield losses in Brassica juncea. Maximum mortality of mustard aphid was caused by nitenpyram (96.24%) followed by carbosulfan (94.69%) and pyriproxyfen (90.85%). Resu...
Jam Nazeer Ahmad1*, Taiba Sharif3, Samina J.N. Ahmad2, Sumaira Maqsood4 and Fariha Zafar3
...c analysis of collected specimens indicated that sequences of B. dorsalis, B. cucurbitae and B. zonata have 99-100% similarity with fruit flies reported from other countries. This is the first report of molecular identification and characterization of Tephritid fruit flies infesting fruits in Punjab, Pakistan.
...
Adel E.M. Mahmoud1, AdamCieślak2, Paulina Szulc2, Anna Łukomska3 and Małgorzata Szumacher-Strabel2,*
...ed dried sugar beet pulp percentage in rations, with significant differences in D2, D3 and D4. Content of NDF was significantly higher in all experimental groups when compared with control group, whereas non-fibrous carbohydrates content decreased in all groups as the effect of corn grains replacement by dried sugar beet pulp. Complete substitution of yellow corn by sugar dried beet pulp in D4 significantly increased number ...
Nouf Alharbi*, Mai Elobeid and Promy Virk
...model. There were four experimental groups with 6 rats in each: Group I control orally received normal saline, Group II orally administrated cadmium chloride (5 mg/kg bw/d), Group III orally administrated cadmium chloride (5mg/kg bw/d) and treated with low dose of quercetin (50 mg/kg bw/d), Group IV orally administrated cadmium chloride (5mg/kg bw/d) and treated with high dose of quercetin (70 mg/kg bw/d). Experimental
Rizwan Ahmad and Muhammad Zulfiqar*
...stigating farmers’ perceptions and adaptation about change in climate and impact of change in climate on wheat productivity in Lakki Marwat. A combination of multi-stage sampling and simple random sampling used to select five Union Councils (UCs), one village council from each UC and one village from each village council. Out of 611 households (HHs), 180 head/elders selected through random sampling process were interviewed. The secondary data, spread ove...
Sanaullah and Urooba Pervaiz*
...erview schedule; through personal interview method. Result showed that 63.9% of the respondents were illiterate, 31.3% respondents were in age group between 25-35 years. Yield, income, plant spacing, seed rate, irrigation interval, and use of pesticide before and after training were computed with the help of paired sample t-test. Results revealed that in maize there is a significant decrease for seed rate (-11.6743 kg/acre) ...
Application of Water Quality and Pollution Tolerance Indexes as Effective Tools for River Management
Joyce Osarogie Odigie*
...ate, as they are fully dependent on it for agricultural and domestic use, bringing its ecological integrity to question. These anthropogenic effects result in the deteriorating quality of the water, which hampers the distribution of benthic macroinvertebrates and may be hazardous to the health of the inhabitant that consumes it on a daily basis. The goal of this study was to assess the effectiveness of WQI and PTI indexes as...
Zara Ahmad1*, Fazli Rabbi2, Muhammad Zamin3, Bushra Kiran2, Tariq Shah2 and Shahzad Kouser4
...-align: justify;">This paper empirically quantifies vegetable production (off-season and on-season) in terms of economic returns. The data on bitter gourd (Momordica charantia) is considered for analysis. The primary data was collected from a sample of 110 farmers in the district of Faisal Abad, Punjab Pakistan. The data was analysed using Ordinary Least Square (OLS) technique. The results show that there is a significant difference between the on-season and o...
Muhammad Waqas, Shahid Ali*, Syed Attaullah Shah and Ghaffar Ali
...re 0.447 and - 0.116, respectively and statistically significant. Long and short run elasticities due to chick pea price were - 0.19 and - 0.15, respectively and statistically significant. Long and short run elasticities in response to area under unirrigated wheat were 1.10 and 1.79, respectively and statistically insignificant. Elasticity of unirrigated...
Aftab Khan1, Shahid Ali1, Murtaza1, Sufyan Ullah Khan2 and Syed Attaullah Shah1
...schedule. Cobb-Douglas type production function was modelled to estimated allocative efficiencies of individual inputs used in maize production. The estimated allocative efficiencies of Urea and DAP were 3.24 and 2.04, respectively. This implies that these inputs were underutilized that might be due to poor farming skills of the sampled respondents, lack of information regarding application of such inputs and lack of availab...
Muhammad Ashfaq* and Inayatullah Jan
...vince of Pakistan over a period of thirty years from 1986 to 2015. According to the ecological landscape, KP is divided into three climatic regions; the northern climatic region, the central climatic region, and the southern climatic region. The study uses Autoregressive Distributed Lag (ARDL) model for maize crop in KP. This study reveals that the impacts of climatic variables are increasing from the southern climatic regio...
Mehwish Kiran1, Muhammad Saleem Jilani1, Kashif Waseem1*, Muhammad Sohail Khan1, Fazal Haq2, Muhammad Amjad Nadim3, Ghazanfar Ullah3 and Salma Shaheen4
....Khan, during 2011-13. Experiments were conducted in pots using completely randomized design, comprising 6 treatments (control, NPK + FYM, NPK + PM, NPK + GM, NPK + PrM and NPK + SS) and 3 replications. Data for leaves’ count plant-1, leaf length (cm), leaves weight (g plant-1), root size (length & diameter), root weight (g plant-1), total biomass (g plant-1), root yield (t ha-1) were collected and analysed. Results showed significant improvement in ...
Naveed Afsar* and Muhammad Idrees
...done to know the farmers perceptions about agricultural extension services in disseminating climate change knowledge in Khyber Pakhtunkhwa. Data was collected from the 400 farmers of the two purposively sampled districts as these two were the highly vulnerable areas from climate change. The major source of climate change information of the majority of farmers was electronic media and the overall regression analysis of the climate change <...
Muhammad Arshad1, Muhammad Irfan Ullah1*, Muhammad Afzal1, Mian Anjum Murtaza2, Ejaz Ahraf3, Zahoor Hussain4, Syed Muhammad Ali Zahid1 and Maryam Riaz1
...among the serious insect pests attacking citrus plants in Pakistan. The study was conducted to quantify the leaf area damage of eight citrus cultivars caused by mining activity of CLM during summer 2016. The total leaf area and mine area per leaf were calculated by the image analysis method using Sigma Scan Pro 5.0 software. The results of the present study showed that CLM generated larger mines; 1.64 cm2 on Gra
Tanzeela Riaz1, Farah Rauf Shakoori2,*, Hareem Mansoor1, Sana Khan1 and Mushtaq A. Saleem1
... most destructive insect pests of many amylaceous stored products. Its control has become difficult due to the emergence of resistance against almost all the known insecticides and fumigants. The development of resistance can be delayed by using binary combinations of insecticides. Keeping in view the importance of synergism as well as the concerns about environmental hazards and emergence of resistance against these insecticides, the current project was desig...
Gul Afshan1,2,*, Soumble Zulfiqar2, Sumaira Mehboob2, Muhammad Tahir Javed Khan1 and Abdul Rauf Shakoori2,*
...by utilizing HCV3a envelope glycoprotein E2. HCV3a E2 gene was amplified and cloned first in cloning vector pTG19 and subcloned in expression vector pET21a. E2 protein, expressed in insoluble form, was purified by repeated sonications, followed by denaturation and refolding through fractional dialysis with urea. Multiple alignment with other sequences showed nucleotide variations of HCV3a E2 compared with already repo...
Chen-Yu Sun, Wen-Chao Liu*, Mei Xiao, Zhi-Hui Zhao and Li-Long An*
...els of betaine on growth performance and intestinal morphology in Chinese indigenous young yellow feather broilers. A total of 360 male, one-d-old Huaixiang chickens with an average initial BW of 44.52 ± 1.07 g were randomly allotted to 4 treatments. Each dietary treatment consisted of 6 replicate cages, with 15 birds per replicate. The 4 dietary treatments were corn-soybean meal-based diets and supplemented with 0, 5...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1, Muhammad Faheem Malik3 and Muhammad Idrees4
...ith members of Orthohepevirus B species. However, Pak aHEV strains were highly divergent from other known members within Orthohepevirus B suggesting as novel aHEV strains circulating in the population of layer chickens in the country. Detection of HEV in layer chickens may pose public health risk in context of zoonosis and food borne transmission if aHEV emerges as zoo...
Syed Muhammad Hassan Raza1*, Syed Amer Mahmood1, Syeeda Areeba Gillani1, Syed Shehzad Hassan1, Muneeb Aamir1, Muhammad Saifullah1, Mubashar Basheer1, Atif Ahmad1, Saif-ul-Rehman2 and Tariq Ali1
...e Department along with open source satellite datasets. We downloaded three images of each year (2008-2018) from Geological Survey of United States and applied geometric corrections. All the spectral wavelengths were transformed to Top of Atmosphere reflectance and processed the bands in infrared and red wavelengths to generate Ratio Vegetation Index (RVI) and Normalized Difference Vegetation Index (NDVI) datasets. The annua...
Muhammad Saleem Hanif1, Khalid Javed Iqbal1,*, Arshad Javid3, Noor Khan2, Irfan4, Hamid Majeed5, Muhammad Altaf3
...d Punjnad and Taunsa, respectively. Fishermen maximum yearly income at both study sites were in the range of 70,000 - 80,000 PKR (Pakistan rupees). The study had confirmed most of the fishermen were living in poor conditions which accounts 60 and 80 % of head Punjnad and Taunsa, respectively. However, most of them were dependent on tap as well as tube we...
Sajjad Ali1, Atta-ur-Rahman1 and Sher Ali2*
...ber Pakhtunkhwa, for the period of 1985-2015. Spatial techniques like Geographic information system and remote sensing are used to detect land use changes. This study is carried out at three levels; initially the whole tehsil is studied for land use change analysis by comparing 1985 and 2015 Landsat images. Secondly, four sample union councils were targeted for medium level analysis. Thirdly, seven sample villages are targeted for micro level. The Landsat imag...
Abir Ishtiaq and Muhammad Naeem*
...em was conducted. Four experimental diets containing graded levels of protein (15, 20, 25 and 30%) were tested. Triplicate groups of C. catla stocked in outdoors earthen ponds at 2000 fish/acre were fed at 4% of body weight, 2 times a day, for 180 days. The investigation was spread over three different sites, each providing four earthen ponds. The results revealed that the survival rate, mean individual harvesting weight, feed conversion ratio (FCR) and produc...
Muhammad Ilyas* and Fida Mohammad
...t-align: justify;">Genotype by environment (GE) interaction complicates selection process of desirable genotypes. Therefore, newly developed germplasm or genotypes needs to be evaluated in multi-environment trials (METs) to know yield potential and adaptability. This experiment was designed to interpret GE interaction ...
Salma Javed1, Muhammad Fiaz Khan1, Irfan Ullah2, Sadia Tabassum1,*
... with a high burden of type II diabetes, with approximately 8 million (6.72%) people suffering from it. The present study was carried out to assess the prevalence and the possible risk factors of type II diabetes in Hazara region Khyber Pakhtunkhwa, Pakistan. The total area was divided into six clusters, and the data was collected randomly from different hospitals, clinics, and different l...
Wajid Khan* and Raziuddin
...year to feed 220 million people. This situation demands serious efforts to develop new lines/ hybrids with better yields. Rapeseed is the second largest contributor in domestic edible oil industry. Keeping in view the lower yield of rapeseed in Pakistan especially in Khyber Pakhtunkhwa this study was conducted to investigate genetic variability and heter...
Maliha Ayub1, Muhammad Javed1, Fariha Latif 1*, Faiza Ambreen2, Komal Sabir1
...nst the reactive oxygen species (ROS) and their harmful effects. This study was aimed to evaluate the effects of sub-lethal concentrations of manganese on antioxidant activity in the fish, Labeo rohita. Fish were acclimatized for two weeks in the cemented tanks prior to the start of experiment. Four groups (n=10) of one year old fingerlings of Labeo rohita were exposed to 96-hr LC50 and sub-lethal co...
Mustasim Famous*, Obaidul Islam, Shameema Khatun, Mohammed Mustafizur Rahman and Tania Ferdoushi
...actice, problems and prospects of turkey farming in different turkey farms of Sylhet district of Bangladesh. Data were collected from 6 turkey farms under the Sylhet region. The observation was taken of status of farmers, source of technical support, the turkey flock size (according to age variation), feed intake, housing system, feeding system, quantity of feed supplied to each turkey/day, floor space, feeder space, waterer space uses in turkey marketing age,...
Matiullah Khan*, Shameemul Sibtain Shah, Atiqullah Khan, Muhammad Sarwar and Shoaib Ahmed
...align: justify;">Field experiments were conducted during 2015-16 at National Agricultural Research Center Islamabad to evaluate the availability of P from different particle size of Hazara rock phosphate (HRP) by manual preparation of Single Super Phosphate (SSP) through the procedure already established by the author and testing its efficacy in comparison to DAP on rainfed wheat. Almost 50 bags of SSP were prepared using fo...
Exogenous Application of Calcium Improved the Vegetative Attributes and Corm Production in Gladiolus
Masood Ahmad* and Abdur Rab
...for its quality plants especially cut flowers. Gladiolus is commercially propagated by corms. The quality and health of corm is one of the important factors that affect the production and quality of gladiolus florets and spikes as well as corm production. Keeping in view, the significant role of calcium in plants and its potential effects on vegetative attributes and quality production of gladiolus corms, an experiment was c...
Muhammad Sharif1*, Sadullah1, Ghulam Rasool2, Muhammad Nasir Khan1, Zubair Rehman1, Ahmed Khan2, Ijaz Ahmad3 and Khalid Hussain4
...m which improves soil properties, environment friendly and provide sufficient crop yield. Conservation tillage system is successfully practiced worldwide as a resource conserving techniques. Therefore, an experiment was conducted under the treatments, i.e. conventional tillage (CT), Zero tillage (ZT) and Chisel plough (CP) during the year 2016 at the field research area of Balochistan Agriculture College, Quetta. The study w...
Muhammad Ishaque Mastoi1*, Ibtasam Riaz2, Syed Muneeb Haider2, Arfan Ahmed Gilal3, Anjum Shehzad4, Ahmed Zia4 and Abdul Rauf Bhatti4
...lts confirmed that both species of coccinellid showed feeding potential against eggs and nymphs of P. minor. Comparatively, M. sexmaculata showed higher feeding than C. septempunctata on various immature stages of M. minor. Moreover, both the species showed relatively more preference on eggs of P. minor than nymphs. Therefore, both the species can be exploited in field conditions against P...
Zijuan Li1,2, Rong Ma2, Muhammad Khan3*, Chenchen Liu2, Xiaolin Cui2 and Yongming Li1,2*
...ent which could be developed into lead for osteosarcoma treatment as a single agent or in combination with CDDP.
...
Abdul Waheed1,2, Sidrah Saleem1, Naveed Shahzad3, Junaid Akhtar4, Muhammad Saeed5, Iqra Jameel1, Farhan Rasheed6 and Shah Jahan7,*
...from different clinical specimens, collected from Jinnah Hospital Lahore during January-December 2015. Majority of the GNRs were isolated from urine samples (55%) followed by pus (28%), blood (7%), sputum (6%), Broncho-alveolar lavage (2%), fluid (1%) and from tips (1%). The isolated organisms were Escherichia coli (n=60), Klebsiella pneumoniae (n=20), Enterobacter cloaca (n=09), Enterobacter aerogenes (n=02), Proteus mirabilis <...
Fiza Asif1,*, Muhammad Siddique Awan1, Nasra Ashraf1, Nuzhat Shafi1, Abdul Rauf1, Khizra Bano1, Muhammad Razzaq2 and Naeem Iftikhar Dar2
...ue. A total of 23 plant species were observed during summer and 15 plant species during winter season. During both the seasons Indian or Himalayan Chestnut Aesculus indica was found as the dominant plant species in the diet having relative importance value (RIV) 8.36 and 10.92 in summer and winter, respectively. Diet breadth of all the plant s
Muhammad Zeeshan Manzoor1*, Ghulam Sarwar1, Mukkram Ali Tahir1, Noor-Us-Sabah1, Ayesha Zafar1 and Sher Muhammad2
...oil and water salinity depends upon climate, soil characteristics, topography and management strategies. Water, even may be saline, is becoming more precious natural resource. Hence, there should be more crops and jobs per drop while conserving the quality of present terrestrial and groundwater. Saline water has been used for production of fodder and forages in many countries. Managing soil and water salinity under prevailin...
Muhammad Ali1*, Norsida Man2 and Farrah Melissa Muharam2
...ural risk from the field perspective. However, less attention has been paid to examine the influence of subjective norms on ICT usage among farmers for the management of agricultural risk in Malaysia. Therefore, the present study was designed to meet the objective. The research data were collected through a field survey in which 360 farmers were interviewed through the multistage cluster sampling technique. The subjective no...
Huaisheng Zhang1, Pengfei Li2, Huajun Wen2, Guangming Tian1, Hui Chen1, Lu Zhang1 and Jianqiang Zhu1,*
...us). It is a unique species in China, which has been extinct in China for nearly 200 years. In 1980, the Milu was reintroduced into China and has now become a first-class protected animal in the country. Moreover, research on the Milu has begun. After 30 years of breeding and development, the Milu population has formed stable captive or wild populations in Beijing, Dafeng, Shishou and Dongting Lake. It has become a typical example of the successful reintro...
Muhammad Khalid Rafique1, Rashid Mahmood1,*, Ziyad Abdul Qadir1,Imran Bodlah2 andFarid AsifShaheen2
...bserved as calculated by percentage of secluded queen cells vs. grafted larvae over the study interlude. The highest larval acceptance 80.85 ± 0.64 and 81.25 ± 2.05 was observed by addition of royal jelly in March and April and lowest 42.05 ± 0.69 and 48.21 ± 2.02. The shortest pre oviposition period by addition of royal jelly in March and highest was by addition of distilled water droplet during ...
Huma Sattar1, Sehrish Firyal1,*, Ali Raza Awan1, Habib-Ur -Rehman2, Muhammad Sajid Hasni3 and Amjad Islam Aqib4*
...gene was amplified with specific primer and sequenced to get the full-length sequence of this gene. A total of nine changes including transition (n=6) and transversion (n=3) were found at the different position of this gene. Due to these changes, the amino acid is changed that leads to significant change in the folding of 3D protein structure of clinical sample, while in subclinical samples, showing the same variation in overall 3D protein structure analysis o...
Mumtaz Ali Khan1,*, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Ikramul Haq4, Kashif Prince1, Asad Ullah5, Muhammad Shoaib2, Shahid Zaman6, Amjad Islam Aqib7, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4,Imad Khan5, Naimat Ullah4 and Muhammad Shahid8
...y against Clostridium perfringens type D epsilon toxin in goats to sort out better immunogenic approach. This study was conducted on total of 36 healthy animal of equal number of rabbits and goats. Each species was divided randomly into three equal (n=6) groups. Group A was supplemented vitamin E and group B was without vitamin E supplementation in both spe<...
Yacheng Hu1,2, Xueqing Liu1,2, Jing Yang1,2, Kan Xiao1,2, Binzhong Wang1,2 and Hejun Du1,2,*
...e report 17 novel cross-species microsatellite markers for Dabry’s sturgeon via next-generation sequencing from Chinese sturgeon (Acipenser sinensis). The 17 microsatellites were polymorphic with 3 to 6 alleles per locus and the total number of alleles is 80. The mean expected heterozygosity (HE, 0.506 to 0.781), observed h...
Laiba Shafique1,*, Muhammad Afzal2, Syed Zakir Hussain Shah3, Mahroze Fatima4, Huma Naz5, Saif ur Rehman1, Youchuan Wei1 and Qingyou Liu1,*
... D3 on growth performance and muscle proximate analyses of grass carp (Ctenopharyngodon idella). Four experimental diets viz. FD1, FD2, FD3 and FD4 having formic acid (%) and vitamin D3 (IU/Kg) 0, 0; 2, 0; 0, 5000 and 2, 5000, respectively were prepared. Fish were fed with experimental diets for 90 days. Growt...
Uzma Rafi*, Asmat, Muqaddes Niaz, Syeda Shazia Bokhari and Aisha Waheed Qurashi*
...iv>Many bacterial species are harbored by cockroaches on the external and internal surfaces. These harbored species have great public health concern. There is a variable tendency of these microbes to adhere to various abiotic and biotic surfaces showing chances of infection. Present study aims to check biofilm formation and auto aggregation potential of the bacteria associated with cockroaches. For this purpose, cockro...
Muhammad Suleman1,*, Abu ul Hassan Faiz2, Muhammad Shahbaz2 and Ayesha Riaz3
...f UV irradiation of Aspergillus niger at different concentrations of wheat bran as carbon source (2.5, 3.0, and 3.5 %) on the production of xylanase. Submerged fermentation was carried out in 500 ml Erlenmeyer flasks using vogel’s medium at 35°C for five days. UV irradiated A. niger has significantly increased the xylanase production as compared to parent strains. Twenty minutes exposure of A. niger was considered suitable for th...
S. Jalbani1, N.T. Narejo2,* and P. Khan2
...days. The juveniles of experimental fish with mean initial body weight 6.40 ± 1.6 g were procure from local fishing community of River Indus near Jamshoro. Feed regime like live small fish (tilapia), tubifex larvae, chopped chicken viscera and dead small fish (tilapia) were used as live and prepared feed with control. It was observed that the experimental fish fed with chop
Irfan Irshad1, Asim Aslam1,*, Muhammad Yasin Tipu1, Kamran Ashraf2, Beenish Zahid3 and Abdul Wajid4
...ndemic in Pakistan and repeated outbreaks are continuously being reported with high mortality in poultry and non-poultry avian species. In this study, five AAvV-1s have been pathotyped and genetically characterized from vaccinated birds collected between 2013-14. A phylogenetic analysis revealed that all the isolates belonged to sub-genotype VIIi with hi...
Lin Qi, Lu Li, Danyang Chen, Mingxiao Liu, Yan Wu and Wei Hu*
...olated a novel monomeric peptide from antler plate polypeptide (APP-1) of sika deer which inhibited the growth of both Gram-positive and Gram-negative bacteria. The molecular mass and purity of this polypeptide was determined by ultra-performance liquid chromatography (UPLC) and Bruker micOTOF OllQ TOF mass spectrometr...
Zia-ud-Din1, Muhammad Nauman Aftab2, Tanveer Hussain3,*, Irfana Iqbal4 and Asma Zafar5
...i) was fed for 42-days experimental period on antibiotic and probiotic supplemented ration. The results showed that the female growth, weight gain, FCR and economics varied significantly for feed supplements as well as for chicken varieties (P<0.05). The chickens given feed with probiotic (@1g/kg of feed were of more economic value than those fed on antibiotic supplemented feed and control with highest live body weight of...
Min Li1,2, Jingjing Wang3, Suxian Hu3, Philip Stott4, Baoqing Lin5, Lianshan Li5, Hui Liu1, Heng Bao1, Duoying Cui6 and Guangshun Jiang1,*
...gies to map land cover types. We linked cover types to avian species richness, evenness, and Shannon’s diversity using a stepwise linear regression model and regressions of proportions of cover types at different spatial scales. We recorded 109,026 sightings comprising 94 species, and found that avian diversity i...
Jinfeng Liu1,2, Yanhong Cao3, Tong Feng1, Laiba Shafique1, Chan Luo1, Peng Zhu1,4,* and Qingyou Liu1,*
...eotides that encodes 394 peptides bond. The BMP15 gene was observed to be expressed in cumulus tissue, granular tissue, hypophysis, genital ridge and tissues of ovary and testis. Moreover, QRT-PCR results showed that BMP15 was expressed in the whole process of embryogenesis and folliculogenesis, early high level and then down regulated. It was significantly expressed higher level in COCs of middle diameter sized follicles than that of small and l...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Shahid Nabeel1 and Abu Saeed Hashmi2
...ties and obtain a better perspective of quantitative traits that play key roles in development and regulating growth. The present study was conducted to characterize genetic variability in the growth hormone (GH) and growth hormone receptor (GHR) of Camelus dromedarius. GH is secreted and synthesized from somatotroph cells of the anterior pituitary lobe and plays significant role in growth, development, metabolism, la...
Saleh S. Alhewairini
...ose, the adult mortality percentages were 66.67, 73.33 and 100% for acetamiprid and 23.33, 60 and 96.67% for sulfoxaflor after 1, 24, and 48 h, respectively, whereas the larvae mortality percentages were 63.33, 73.33 and 100% for acetamiprid and 46.67, 73.33 and 96.67% for sulfoxaflor after 1, 24, and 48 h, respectively. Moreover, live RPW (larvae and ad...
Shanshan Cai1, Tianxiang Gao2, Binlun Yan3, Aiyi Zhu1 and Xiumei Zhang1,2,*
...recovery, yet lack of proper methods hinders the precision and accuracy of such assessment. The swimming crab, Portunus trituberculatus is a commercially important species in Chinese fishery industry. However the natural resources of swimming crabs are declining and enhancement programs are being conducted for resources restoration for decades. In this study, 524 female broodstock from 10 hatcheries and 547 recaptured...
Scale of Illegal Killing and Trade Associated with Indian Pangolin (Manis crassicaudata) in Pakistan
Muhammad Waseem1, Ahmed Raza1, Hamera Aisha1, Muhammad Naeem Awan1, Tariq Ahmad2, Rabia Nazir2 and Tariq Mahmood2,*
...he rampant trade of the species, and has been listed as endangered since 2014 and also included in Appendix-I of CITES. The IUCN estimates indicate a decrease of ≥ 50% in the global Indian pangolin population over the next 21 years, highlighting the need for protecting the species against illegal trade. In the current study, we investigated the scale of its poaching and illegal trade in...
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
... biomarkers.
...
Abdulkareem Mohamed Matar1, Moez Ayadi1,2, Hassen Mohamed Sbihi3*, Imeddine Arbi Nehdi3, Mutassim Mohammad Abdelrahman1 and Riyadh Saleh Aljumaah1
...cid profile, physical properties, and tocopherol contents of milk fat from dairy ewes. Sixty-four multiparous Najdi ewes were selected, randomly distributed into four groups (n = 16), and fed four different diets. The diets were composed of traditional feed (TF, barley and alfalfa hay) and three complete feeds with different compositions (CF1, CF2, and CF3). Twenty-four Najdi ewes were randomly divided into four groups (n = 6) ...
Mahdi Khojastekey1, Majid Kalantar1, Jam Zaheer Ahmed2, Samiullah Khan3, Muhammad Altaf Hussain4, Rajwali Khan5 and Sayed Haidar Abbas Raza6*
...romotion of reproductive performance and economic indices performance of Zandi ewes under an accelerated lambing system (3 times lambing in two years). A total of 289 ewes from 3 to 4 years old, with mean body weight of 50±5 kg and BCS range from 2.5 to 3, were randomly allocated between two experimental groups as follow:1) in control group 98 ewes were exposed to rams all year-roun...
Biomarkers for Pathogenic Clostridium perfringens in Small Ruminants of Khyber Pakhtunkhwa, Pakistan
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Naimat Ullah Khan3, Muhammad Asfandyar Khan2, Kashif Prince1,*, Mahboob Ali1, Ghazunfar Rashid1 and Azmat Ulah Khan2
...olates of Clostridium perfringens were identified in lambs and kids population from non-vaccinated dams of selected districts of Khyber Pakhtunkhwa province, Pakistan. Samples were obtained from non-vaccinated lambs and kids with the signs of enterotoxaemia. The isolates were initially identified by colony characteristics, Gram staining, biochemical tests and CFU/g. Clostridium perfringens was isolated from 43....
Rais Ahmed1,2,*, Muhammad Khalid Mansoor1,2, Iftikhar Hussain1, Muhammad Saqib3, Muhammad Hammad Hussain4, Amjad Islam Aqib5, Haleema Sadia6, Javed Muhammad7, Asma Irshad8, Kashif Prince5, Muhammad Zain Saleem9 and Abdul Whab Manzoor10
...progressive weight loss, persistent diarrhea and finally death. Due to zoonotic nature of the disease, workers in slaughterhouses are at a high risk of infection. In this study, the status of paratuberculosis was assessed in a slaughterhouse located in district Faisalabad, Pakistan. A total of 455 blood samples were collected from slaughtered cattle and buffaloes at random and then tested by a commercially available ELISA kit for the detection of antibodies ag...
Mohammed Al Bratty1,*, Hassan A. Alhazmi1,2, Desam Nagarjuna Reddy3, Abdul Jabbar Al-Rajab3, Sadique A. Javed1 and Zia ur Rehman1,4
...tty acid esters, while E-pentatriacont-17-ene and 2,4-dimethylpentane were identified as predominant aliphatic hydrocarbon compounds. The propolis extract has exhibited remarkable antimicrobial activity against certain strains of bacteria and yeasts. In general, significant antimicrobial activity was recorded against gram positive bacteria (zone of inhibition: 16.3±0.35–30.6±0.11 mm; MICs: 1–4 μg...
Abdul Hanan1, Talha Nazir1, Abdul Basit1, Shahbaz Ahmad2 and Dewen Qiu1,*
...against different insect pests is important due to their eco-friendly nature. The virulence potential of 3 different isolates of Lecanicillium lecanii formerly recognized as Verticillium lecanii (V-2, V-3 and V-5) with different bioassay materials (conidia, filtrate and the binary combination of conidia + filtrate) were evaluated against green peach aphid (Myzus persicae
Yue Ren1, Peng-Fei Liu2, Wan-Long Zhu1,*,Hao Zhang1 and Jin-Hong Cai1
...roles of altitude and temperature on body mass regulation in Eothenomys miletus from different areas of Hengduan mountain region in different seasons. Body mass, resting metabolic rate (RMR), nonshivering thermogenesis (NST), food intake, serum leptin levels and hypothalamic neuropeptide Y (NPY), agouti aelated peptide (AgRP), pro-opiomelanocortin (POMC), cocaine and amphetamine reg...
Muhammad Zameer Khan1, Sair Sarwar1*, Ahmad Khan1, Razaullah Khan1, Munazza Yousra1 and Muhammad Ilyas2
...oratory and greenhouse experiments were undertaken to study the response of applied K in prominent soil series of Potohar Plateau of Pakistan and to correlate soil extractable K with yield components, N, P, K concentration and uptake by wheat. Two extractants namely, AB-DTPAand NH4OAc were tested for K extraction from soils. The results showed a high positive correlation between AB-DTPA and NH4OAc extractable K, plant growth and yield par...
Ihsanullah*, Muhammad Subhan Qureshi, Sohail Akhtar and Syed Muhammad Suhail
...on economic traits with special emphasis on postpartum resumption of ovarian activities. Reproductive and productive records of crossbred dairy cows were analyzed at a large-scale state dairy farm from 1997 to 2013. Genetic groups consisted of HF 50.0%, HF 62.5%, HF 75.0% and HF 87.5%, having the respective levels of Holstein Friesian blood were studied in different seasons of the year. No significant differences were found ...
Muhammad Mudassar Shahzad1*, Syed Makhdoom Hussain2, Afia Muhammad Akram1, Arshad Javid3, Majid Hussain5, Syed Zakir Hussain Shah4 and Asma Chaudhary1
...stibility in the body. Experimental diet was divided into six groups and were supplemented with graded levels (0, 300, 600, 900, 1200 and 1500 FTU kg-1) of phytase. Cr2O3 was incorporated in all diets at the rate of 1% as a non-digestible marker. The fingerlings were fed at the rate of 4% of live wet weight twice a day and faeces were collected from each tank. On the basis of results it was noted that phytase supplementation sh...
Li-na Li1, Sheng Li2, Ping Gui3, Jing-hui Li1, Fen Ai4,* and Li-li Cai1,*
...v>...
Aqsa Pervaiz1*, Rukhshanda Afridi1, Zahra Pervaiz1, Rabia Masood1 and Hira Pervaiz2
...073 mg/L in tap water respectively. The fish exhibited tail and fin disruption, bulging of eyes, scales erosion, mucous secretion, hemorrhage, color change, slow down swimming, lake of balance, restlessness, swimming side-wise, retardation of opercular movement and quick sudden movements. The fish was anesthetized and liver were removed after 48 and 96 hours for histopathologicalstudies. The histopathological changes observe...
Nazish Mazhar Ali1, Asma Ashraf 2*, Iram Liaqat2, Bushra Mazhar2, Shaukat Ali2 and Saiqa Andleeb3
...erent kinds of honey was performed against the isolated bacterial pathogens. The antibacterial activity of leaf extract of Azadirachta indica (Neem Plant) was also checked against the pathogenic bacterial isolates. The bacterial pathogens isolated from eye infections were identified as Staphylococcus sp., Streptococcus sp., Neisseria sp., and Bacillus sp. These bacteria commonly caused corneal infections. All the pathogenic bacterial isolates sho...
Naveed Ahmed1*, Abdul Waheed1, Farrukh Siyar Hamid1, Imtiaz Ahmed1, Muhammad Abbas Khan1, Sohail Aslam1, Muhammad Adil Younis2, Seemab Ali1, Nadia Khan1 and Madiha Bashir1
...>.
...
Muhammad Raza Khan1, Tariq Mahmood1,*, Hira Fatima1, Faraz Akrim2, Shaista Andleeb1 and Abdul Hamid1
..., is one of the largest species of Canid family; it occurs in various parts of the country including upper Swat area. Reportedly, species population is declining in its range, however, data on its ecological aspects are scanty in the country. In the current study, we investigated distribution and diet of grey wolf and the level of its human conflict in M...
Muhammad Aslam Farooqi*, Bakhtawar Irsa, Sajjad Ali, Asif Sajjad, Muhammad Waqar Hassan and Sohail Akhtar
...control different insect pests of major crops in Punjab-Pakistan. The experimentation was performed under laboratory conditions (28±2°C and 65±5% R.H). Four different concentrations (i.e. 50 ppm, 100, 200 and 400 ppm) of each insecticide were evaluated against A. mellifera as derived from their recommended field doses. Mortality of A. mellifera was re...
Manzoor Hussain*, Marie Maňasová, Miloslav Zouhar and Pavel Ryšánek
...onsidered to be the main pests in vegetables and crops. The problem is being increased due to lack of our farmer’s knowledge, repetition of the same crop in field, and non-awareness of pesticides applications. Ten isolates from seven different fungi, Arthrobotrys oligospora, Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoan...
Ambreen Leghari1,2, Asghar Ali Kamboh2,*, Shakeel Ahmed Lakho1, Faiz Muhammad Khand1, Kanwar Kumar Malhi2,3, Iqra Bano Chandio4, Seema Baloch5 and Jan Mohammad Shah4
...ntly (P< 0.05) higher percentage in >4 parity than 1 parity or 2-4 parity, having 4-8 liters/d milk production than those having 2-4 or >8 liters/d, and in late stage of lactation than early or mid-stage. In brief, BTB is prevailing in both Hyderabad and Tando Allahyar districts; however it is relatively higher in Hyderabad district than Tando Allahyar district. Infected animals shed more M. bovis in nasal secretions (3/4; 75%) as compared to m...
Muhammad Usman Akhtar1,2, Abdul Qayum3, Anshan Shan1,*, Shuli Chou1, Hyeonsoo Jo4, Syed Waqas Ali Shah4 and Ishfaq Muhammad5
...five groups (seven goats per group) in a randomized complete block design. Five isocaloric and isonitrogenous diets were formulated to contain 30, 40, 50, 60 and 70% RDP of dietary protein represented as 30RDP, 40RDP, 50RDP, 60RDP and 70RDP, respectively. Feed intake was recorded, nutrient digestibilities (DM, CP, ADF and NDF) were determined and blood samples were taken at 3, 6, 9 and 12 h post feeding, and examined for BUN...
Qudsia Yousafi1*, Muhammad Aslam2 andShahzad Saleem1
...irala were used in the experiment. The number of aphids and ladybeetles were recorded at weekly intervals from October 15 to March 1, both years. Aphid numbers were recorded on three leaves per plant and four plants per plot and averaged per leaf. Numbers of ladybeetles were recorded from the whole plant by sampling three plants ...
Ahmad-Ur-Rahman Saljoqi1, Imtiaz Khan1*, Bashir Ahmad1, Fazal Maula2 and Sardar Hussain1
... against aphid, Myzus persicae (Sulzer) and its associated natural enemies at Agricultural Research Institute (ARI) Mingora Swat, during the growing season 2017. The tomato cultivars include Swat local, Rio-Grande early, U-Grande, Rio-Grande late, Tomato BSS-30, 87-5 China and Roma VF. These varieties were sown in Randomized Complete Block Design with three replications. Results of this research showed that aphid population remained constant on differen...
Muhammad Mansoor1, Khalid Usman2*, Shahid Hameed Khan Khalil3, Abdul Mateen Khattak4, Muhammad Ehsan Elahi1, Muhammad Waqas Imam Malik2 and Amir Hamza2
...>Traditional methods of open sun curing were used for postharvest processing of dates but, the desired quality of fruit could not be achieved due to adverse effects of dust storms and rain spells at ripening and curing stage of fruits. Covering fruit bunches with bags were also not productive and profitable; therefore, the growers switched to solar tunnel drying but couldn’t get the ...
Muhammad Ramzan1, Unsar Naeem-Ullah1*, Muhammad Ishtiaq1, Ghulam Murtaza2, Mirza Abdul Qayyum1 and Faisal Manzoor1
...e weather parameters (temperature, humidity and rainfall on two cotton genotypes; Bt (MNH-992) and Non-Bt (Cyto-124). The four natural enemies i.e. ladybird beetle, green lace wing, syrphid fly and spider were studied. The population of the natural enemies remained active throughout the studied period. The population of green lace wing and ladybird beetle were maximum ...
Mubasshir Sohail1,2,*, Raza Muhammad1 and Qadeer Ahmed Soomro1
...green lacewing, Chrysoperla carnea Stephens (Neuroptera: Chrysopidae) has a key role in integrated pest management (IPM) strategies for many crop pests. The influence of different prey types has been studied to strengthen the C. carnea. Current in-vitro study was made to figure out the effects of different prey on mortality and certa...
Faleye Temitope Oluwasegun Cephas1,2*, Adewumi Moses Olubusuyi1, Olayinka Olaitan Titilola3 and Adeniji Johnson Adekunle1,3
...ifty-nine cell culture supernatants (CCS) (collected between 2016 and 2017) from RD and L20b cell-culture-tubes with NR-CPE, were analyzed. The tubes had been previously inoculated with stool suspension from children (<15 years) in Nigeria with acute flaccid paralysis (AFP). All CCS were screened for Enteric Adenoviruses (EAVs) and group A Rotavirus (...
Ping Jiang1 , Zhihui Zhao1, 2, Xiaohui Li2, Mengyan Wang2, Lixin Xia2, Yang Cao3, Runjun Yang2 and Xibi Fang2*
...in. As a member of the superfamily of ABC transporters, ABCA1 can transport lipids and cholesterol across cell membranes. To further verify the relationship between the ABCA1 gene and milk fat metabolism of Chinese Holstein dairy cows, we exploited transient transfection mediated-RNA interference technology to specifically knockdown expression levels of the endogenous gene ABCA1 in bovine mammary epithelial cells (BMECs) to ...
Adewumi Moses Olubusuyi1, Ogunsakin Temitope Rachael1, Ogunrombi Sefiu Babatunde1, Ojeamiren Iduda1, Olawole Alaba Samuel1, Faleye Temitope Oluwasegun Cephas1,2* and Adeniji Johnson Adekunle1,3
...ce of enteroviruses in supernatants of cytopathic effect (CPE) negative RD and L20B cell culture tubes in which faecal suspension from acute flaccid paralysis (AFP) cases were cultured. Samples analyzed were collected in 2017 as part of the AFP surveillance program in Nigeria and declared negative for enteroviruses because they did not produce C
Himanshu Mishra, Vikas Kumar and Ashish Kumar*
... March 2018. Thirty two species of birds were observed during the field investigation. The line transect method was employed for population estimates. During the field survey, we recorded a significantly higher number of migratory birds at the end of early winter (December) and at the commencement of middle winter (January). Red crested pochard (Netta rufina), Common coot (Fulica atra) and Gadwall (Mareca strepe...
Shad Mahfuz1,2, Shuyuan Wang1, Mo Chen1, Fei Zao1, Dong Zhen1,
Zhongjun Liu4 and Hui Song1,3*
...of increasing production performance has led to human health hazards. A driving force for the interest of using natural herbs is to eliminate the use of low-dose antibiotics in poultry production. Therefore, the aim of this study was to examine the effectiveness of Flammulina velutipes stem waste (FVW) inclusion in laying hens diet on production performance, egg quality and serum me...
Muhammad Khaled Siddiq1, Fatima Yousuf Dar1,M. Akbar Khan1, Muhammad Adeeb Babar1,*, Sayyed Ghyour Abbas1, Asra Ghaus1, Musdassir Iqbal1 and Muhammad Akhtar2
...yielded fossils of antelopes. The remains are referred to Kobus porrecticornis, Reduncini gen. et sp. indet. Antilope sp., Sivatragus cf. bohlini, Damalops sp., Caprinae gen. indet. (aff. Capricornis) roylei. These new findings allowed to calibrate the exact stratigraphic position of the species. Sivatragus bohlini, previouslyr...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Umar Mumtaz1, Muhammad Zafarullah Khan3 and Abdul Naveed4
... conducted to assess the perceptions of senior farmers for their advisory role in capacity building of young farmers in Sargodha district-Punjab, Pakistan. As per list obtained from District Officer Agriculture Extension, Sargodha, tehsil Sahiwal was randomly selected. Sahiwal comprises of 17 union councils; four union councils were randomly selected and two villages per union council were...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Rashid Mahmood2, Ziyad Abdul Qadir2, Muhammad Arshad1 and Mubasshir Sohail3
...t-align: justify;">The experiment was conducted at University College of Agriculture, University of Sargodha, Sargodha during 2015. The apiary had 20 Langstroth standard colonies of Apis mellifera naturally infested with Varroa destructor. Varroa destructor (Anderson and Trueman) is the most destructive pest of honeybees and a major threat to beekeepers in different areas of the world. Man...
Sameera Arshad1*, Arshad Mahmood Malik2 and Iftikhar Hussain3
...ikes occurred during the period (July-October), then in (March-June) and least during the winter period (November-February).Relationship between meteorological and bird strike data suggested that there was a significant positive correlation between bird strikes and maximum temperature (r=0.452, p=0.000), minimum temperature (r=0.422, p=0.000), and rainfa...
Tasleem Akhtar1,2,Ghazanfar Ali1,*, Nuzhat Shafi2 and Abdul Rauf2
...racinae containing four species distributed in the north and north-east Himalayas was investigated based on the complete mitochondrial 16S rRNA gene sequences. The average nucleotide length of 16S rRNA in 45 samples ranged from 1527 to 1552 bps. Five haplotypes (h) were observed, with haplotype diversity (Hd) 0.5323±0.080. Among 5 haplotypes, 2, 2...
Zhijun Zhong1, Rui Tu1, Xichun Wang2, Yi Geng1, Qicheng Xiao1, Yinan Tian1, Bin Wei1, Jiaming Dan1, Ya Wang1 and Guangneng Peng1,*
...regarding brucellosis in pet dogs caused by B. canis is limited. In the present study, we conducted a comprehensive molecular, pathological, and immunohistochemical analysis to detect this pathogen in pet dogs. Molecular methods, combining three types of PCR assays, identified two strains isolated from two pet dogs as Brucella canis. Histop...
Qi Ren, Shufeng Sun, Chen Niu, Yuhong Li, Yingzhi Chong, Biao Li, Guoying Zheng and Fumin Feng*
...hydrogenase assay kit; superoxide dismutase (SOD) activity and malonaldehyde (MDA) concentration were detected by a total superoxide dismutase test kit and a malondialdehyde test kit. Genomic DNA and RNA were extracted from cells; Methylation was inhibited by treating HL7702 cells with 5-aza-2’-deoxycytidine (AZA), and the level was analyzed via the methylation-specific PCR (MSP) met...
Lin Sun1, Xiaofang Bu2, Jian Wang1*, Xiaorui Liu1 and Zhanyi Kong2
... levels of CXCL8 mRNA in peripheral blood of the children with severe illness were significantly higher than those in light cases (P<0.05). Intravenous infusion of Erythromycin was provided in the acute phase for seven to ten days, and followed by the use of sequential therapy of Azithromycin for about three to four weeks, the children’s condition were gradually from acute stage to recovery stage. CXCL8 and its mRNA levels in
Taimoor Khalid*, Asad Ullah and Mussawar Shah
...n forest management (independent variable) and forest governance (dependent variable) were measured on three level likert scale. Chi-square test was applied to test the association between the study variables. The results show that poor forest governance had highly significant association with people cut trees by legal permits (P=0.000), due to illegal f...
Muhammad Zeeshan Majeed1*, Imtiaz Sarwar1, Muhammad Afzal1, Muhammad Rehan Khalid1, Muhammad Yahya1 and Khurram Shehzad2
...practices and land-use types and these edaphic arthropod communities can provide valuable information about the prevailing status of soil quality. The present study was aimed to evaluate the population abundance and diversity of edaphic arthropod groups in different land-use types and categories in different localities of District Sargodha (Punjab, Pakistan). Moreover, the quality status of soils under these land-use ty
Muhammad Izhar Shafi* and Muhammad Sharif
...n soils. An incubation experiment was conducted during 2017 to evaluate the impact of various P fertilizers applied with and without humic acid on P availability. Three different rates of humic acid as 0, 5 and 10 kg ha-1 with three different P sources as nitrophosphate (NP), single superphosphate (SSP), and di-ammonium phosphate (DAP) at a recommended rate of 90 kg P2O5 ha-1 were ...
Shagufta Naz1, Ayesha Javed1, Ayesha Saleem1, Khadija Murtaza1, Rukhama Haq1, Akbar Hayat2 and Neelma Munir1,*
...analyzed for different aspects like microflora, moisture, fat, ash, fiber, phenolic content, sprouting inhibition, physiological weight loss, pyruvate analysis and sugar contents. Gamma radiation affected these parameters at higher doses but at 0.5 kGy no significant change was observed. 0.5 kGy prouting was inhibited and microflora was reduced at this dose without affecting its nutritional and sensory qualities. So, it was proved to be the best optimized dose...
Muhammad Siddique1, Muhammad Shafique2,*,Abdul Mateen3, Naveed Shahzad4, Bilal Aslam2, Nasir Ahmad1 and Muhammad Usman Qamar2
...f HCV vaccine. HCV genotypes are helpful for analyzing disease severity and start of therapy. Therefore, this study was designed to determine the genotyping of clinically isolated HCV from a Liver Center Faisalabad, Pakistan. A total of 3200 clinical samples were screened for the presence of anti-HCV antibodies by ICT method. Among positive samples, confirmation was carried out by RT-PCR and clustered into four groups (acute, chronic, cirrhotic and hepatocellu...
Yating Cheng1, Wenlong Shi1, Xue Xiao2, Qirong Zhang2, Qihao Zhang1, Zhijian Su1, Qi Xiang1,2* and Yadong Huang1,2
...re composed of three polypeptides, and hydroxylation of proline residues is vital for the stability of this triple-helix. Prolyl-4-hydroxylase (P4H) is an enzyme with an α2β2 tetramer arrangement that functions to post-translationally hydroxylate proline residues in the collagen chain. The α subunit (P4Hα) of the P4H α2β2 tetramer contains the catalytic site, whereas the β subunit (PDI) maintains the solubility and activi...
Muhammad Zubair1, Sagheer Ahmad2*, Awais Rasool1, Muhammad Asad Farooq1 and Ibni Amin Khalil3
...rum officinarum L) genotypes that combine high yield and stability across environments via Genotype and Genotype × Environment (GGE)-Biplot Technique to identify best potential varieties of sugarcane for a region. Nineteen varieties of sugarcane were assessed in seven environmentally different locations of Pakistan for their yield response. Experim...
Po Bunnika, Khalid Khan and Guo Xiangyu*
...is study estimates the expediency of Technical Efficiency (TE), Allocative Efficiency (AE), Overall Efficiency (OE) and Scale Efficiency (SE) for 183 cooperatives in Battambang, Cambodia. Typically, each cooperative is well-organized vis-à-vis TE, AE, and OE correspondingly. The results of the study indicated that around 66.77%, 20.20%, and 13.11% of the coo...
Rafiq-ur-Rehman1*, Zahoor Ahmad1, Wiqar Ahmad2, Muhammad Mansoor3 and Shah Masaud1
... Pakistan. The current experiments were carried out in a randomized complete block design with split plot arrangements replicated four times. The effects of different Rhizobium strains were found significant on yield parameters of the crop. Inoculation with rhizobium strain NARC-BK strain showed the maximum and significantly (p<0.05) higher number of branches, pod clusters plant-1, pods plant-1 and pods cluster-1,&nbs...
Abdul Majeed1*, Muhammad Anwar-ul-Haq2, Abid Niaz3, Abid Mahmood4, Naeem Ahmad1 and Hafiz Muhammad Walyat Ali Khan1
.../div>...
Riaz Shah1* and Margaret Appleby2
...caricides. Some low-risk pesticide options are available and included in IPM. In this study, contact and residual toxicity of selected low-risk pesticides were tested against TSSM adult females and three commonly available predators (Phytoseiulus persimilis Athias-Henriot, Neoseiulus fallacis McGregor and Stethorus punctillum Weise). TSSM adult females and adults of TS...
Azra1* and Shaukat Hussain2
...v>Thirty-six maize genotypes were evaluated under artificial epiphytotic of southern corn leaf blight during Kharif season 2015 and 2016 to find out new sources of genetic resistance in maize genotypes against southern corn leaf blight. The experiment was laid out as randomized complete block design with three replications. Data on disease severity and grain yield were recorded. There were...
Sadreddin Tusun*
...mandibles, abdomen and types of sensory receptors are described and illustrated.
...
Zahra Eftekhar1, Morteza Naderi2,*, Mohammad Kaboli3, Hamid R. Rezaei4 and Nematollah Khorasani3
...of patterns of arboreal species adaptation to the glacial oscillations. Ancient Hyrcanian forests, as one of the old-growth relicts of the temperate deciduous forests, have been recently documented as an important refugium during the last glacial maximum (LGM). More investigations based on skull and mandible morphological assessments revealed considerable intraspecific evolutionary diverge...
Hande Kucukonder1, Pinar Celebi Demirarslan1*, Sezai Alkan2 and Özgür Baris Bırgul3
...od were used. The time-dependent growths of mixed sexes broilers were analyzed in the aspects of testing the parallelism of female and male growth samples, determining the best fitted growth model and designating the biological meaningful parameters (inflection point age, weight and growth rate) of growth functions. Analyses showed that the growth profiles of female and male chicks found not to be parallel using profile anal...
Zelle Huma1*, Ahmad-Ur-Rahman Saljoqi1 and Farman Ali2
...s collection. For this experiment, Galleria mellonella larvae were reared in the laboratory. When samples soil were collected from different regions of Khyber Pakhtunkhwa for nematodes collection G. mellonella larvae were left in sampling jar and were collected back after 2-3 days’ post application. Dead larvae were then put on the white trap and EPNs has then collected afterward. It is concluded on the basis of results that EPNs is p...
Wiqar Ahmad1*, Farmanullah Khan2, Muhammad Sharif2 and Muhammad Jamal Khan2
... yield (by 9 and 13%, respectively) was noted over the RD whilst both showed statistically similar crude protein content. Compared to the control, INM significantly (p<0.05) improved the wheat and lentil yield by 128 and 87%, respectively, and the crude protein by 17%. Yield improved by 13% for wheat in intercrop over the wheat after maize and by 46% for lentil after maize over the lentil in intercrop. The INM treatment s...
Muhammad Qasim1*, Said Qasim2, Muhammad Naeem1, Amir Nawaz Khan3 and Shahid Iqbal4
...nkhwa, Pakistan. Three types of fishers were selected for the study i.e. farming fishers, fishing farmers and occasional fishers, through two stage cluster sampling. Livelihoods asset pentagons were used for the analysis. Considerable decline in physical and economic assets were noted among all the three types of fishers, whereas the total value of livelihood assets for farming fishers det...
Tahsin Razzaq*, Muhammad Fareed Khan and Shahid Iqbal Awan
...valuated resistant genotypes against NCLB under agro-climatic condition of Rawalakot and assessed the yield loss due to impact of NCLB. Maize plants were artificially inoculated at four to six leaf stages. Thirty genotypes were screened in first field trail in June 2016. Genotypes had significant differences for NCLB severity and reactions and were classified into resistant, susceptible an...
Rakhshanda Kousar1, Tahira Sadaf1*, Muhammad Sohail Amjad Makhdum2, Muhammad Amjed Iqbal1 and Raza Ullah1
...quo;s comparative and competitive advantage in production of top three fruits, namely mango, citrus and dates by using Revealed Comparative Advantage, Revealed Symmetric Comparative Advantage, Relative Export Advantage Index and Log of Relative Export Advantage Index. For this purpose, time series data has been collected for the period 2001-2018 from Food and Agricultural Organization Statistics, International Trade Centre m...
QihangLiu1,2, YueliJiang2, Tong Li2, Jin Miao2, Zhongjun Gong2, Yun Duan2, and YuqingWu2*
...e visual and thoracic temperature responses of locusts. Our results showed that ultraviolet (UV), violet, and orange light stimulated the visual system of the locust and resulted in increases in thoracic temperature, orange light stimulated the visual response the most, violet light triggered the strongest response, and UV light resulted in a response of the longest duration. In terms of the impact on thoracic tem
Shou-Hong Zhang1*, Ying Zhang1, Kun-Ming Wen2, Wei Wu3 and Wen-Yan Li3
...xamined with MR-PWI. The perfusion parameters of PWl were compared with the fibrosis stage. The total fibrous tissue in the liver of rats treated with HGF was lower than that in control group. The time-signal intensity curve (TIC) peak of liver parenchyma of rats with hepatic fibrosis was characterized by a slow wash-in –out. A correlation was found between the perfusion parameters a...
Beenish Zahid*1,2,7, Javed Iqbal Qazi2, Amir Zohaib2, Asim Aslam3, Raheela Akhter3, Haleema Sadia4, Qurat ul Ain5, Razia Sultana6, Irfan Irshad3 and Sobia Alyas7
...ls of Sheikhupura during period (May to July 2017). NDV was isolated from field samples by inoculating the suspected samples into embryonated eggs of 9-11 days. Isolated virus was confirmed through haemagglutination and haemagglutination inhibition test. Virus isolation rate of NDV from cloacal swab was 12% (6/50) and from oropharygeal swab was 8% (4/50). The 238-bp region of F gene of NDV was amplified by using s
NaseemZahra1,2,*, Nadia Jamil1, Sajid Rashid Ahmad1, Imran Kalim2, MuhammadKhalid Saeed2, Ijaz Ahmed2, Qurat-ul-ain Syed2 and Soniya Munir1
...or Aflatoxin M1 using competitive ELISA kit method. Branded samples (n=40) were collected from different shops in Lahore city of Punjab Province while non-branded samples (n=40) collected from four selected towns of Lahore. Overall 58% and 100% of aflatoxin contamination in branded and non-branded milk samples were found, respectively. The quantities of AFM1 in 58% of branded milk samples and 95% of non-branded milk samples ...
Jiaxin Guo1, Xiumei Zhang1,2, Xiaoyan Wang2, Liqin Liu2 and Tianxiang Gao1,*
... alleles, observed and expected heterozygosity per locus ranged from 2 to 8, 0.083 to 0.922 and 0.042 to 0.866, respectively. The PIC ranged from 0.04 to 0.829. These markers will be useful in evaluation germplasm and genetic composition in the further research.
...
Ahmed Zia1*, Iqtidar Hussain2, Sardar Azhar Mehmood2, Shabir Ahmad2, Muzaffar Shah3 and Abdul Rauf Bhatti1
...richness, abundance and species complex of Odonata. It revealed four families, fifteen genera and twenty-six species. Among recorded fauna, family Libellulidae appeared to be a dominant group representing 19 species, followed by family Coenagrionidae with 5 species and family Calopterygoidae and Aeshnidae representing ...
Illahi Bux Bhatti1, 2*, Imran Khatri2, Maqsood Anwar Rustamani2 and Riffat Sultana3
...garcane growing areas. Experiment was conducted on integration of different control methods i.e. cultural, biological, yellow sticky traps and chemical against sugarcane whitefly during February 2016 at PARC-NSTHRI, Thatta, experimental field. The result revealed that lowest number of whitefly (0.38 nymphs + puparia per cm2 per leaf) with highest % morta...
Asma Hassan*, Zuhair Hasnain, Shahzada Sohail Ijaz, Muhmmad Ansar, Muhmmad Rasheed, Ajaz Ahmad, Lubna Ayub Durani and Muhmmad Bilal Ali
...ly valuable for former depends on sufficient nutrient supply and satisfactory soil and climatic conditions. Moldboard plough (MP) (control), tine Cultivator (TC) and minimum tillage (MT) as main treatment, Crops sequence as subplot included were fallow–wheat (Triticum aestivum), (FW, control), mungbean (Vigna radiata)–wheat (MW), sorghum (Sorghum bicolor)–wheat (SW), green manure–wheat (GW) and mungbean-chickpe<...
Muhammad Khuram Razzaq1,2*, Saeed Rauf1, Mohsin Khurshid3, Shahid Iqbal1,4, Javaid Akhter Bhat2, Ayaz Farzand5, Adeel Riaz1,6, Guangnan Xing2 and Junyi Gai2
...s production, thus genotypes also reduce the reserve mobilization for tapetum cells which induce the significant reduction in pollen fertility. Therefore, pollen fertility index can be exploited to discriminate resistant and susceptible genotypes under abiotic stresses. High heritability in the segregating generation warrants good selection response. Moreover, magnitude and ty
Sohaib Afzaal1,4*, Usman Hameed2, Nasir Ahmad3, Klas Udekwu4, Paulina Pastuszek4 and Muhammad Saleem Haider1
...s and starter culture properties. Thermostability of starter cultures is a key factor for food product development. Current study was planned to test the thermodurability of seven strains of Ln. mesenteroides using pasteurization treatments. Both types of pasteurization treatments including High Temperature Short Time (HTST) and Low Temperature Long Time...
Muhammad Irfan Ullah1*, Muhammad Arshad1, Muhammad Imran Khan1, Muhammad Afzal1, Azhar Abbas Khan2, Syed Muhammad Ali Zahid1, Muhammad Saqib1, Asad Abdullah1, Saba Kousar1 and Maryam Riaz1
...uidae) is a major insect pest in cotton crop and is being the most noxious one in cotton growing areas of the world. Knowledge about how water stress modifies the ability of plants to resist against insect feeding is an interesting and important component in an integrated pest management program. In the present study, water stress was applied to field grown cotton with two Bacillus thuringiensis transgenes (CIM-602 and CIM-5...
Muhammad Shahzad Akbar*, Maria Aslam, Muhammad Rehan Khalid, Shahid Iqbal, Muhammad Luqman and Muhammad Zeeshan Majeed
...termites are destructive pests and cause massive damage to agricultural crops, forest plantations, wooden infrastructures and other cellulosic products. Their control is usually done by the application of highly persistent synthetic insecticides which often cause different non-target effects such as environment contamination. This laboratory study evaluated the toxicity of methanolic extracts of eight flowers i.e. Mexican ma...
Matiullah Khan1*, Motsim Billah2, Shoaib Ahmad1, Raza Ullah Khan1 and Muhammad Sarwar1
...align: justify;">Field experiments were conducted for two seasons to investigate the direct and residual effect of phosphorus enriched compost (PEC) prepared by composting poultry litter (PL) with rock phosphate (RP) and inoculating with effective microorganisms (EM) on the wheat during 2010-11. Both experiments were conducted consecutively, in the same ...
Ahmad Ali1,2,* and Aleem Ahmed Khan1
...s technique to capture superior (migratory) falcons. Animals used as lure in biological traps were pigeon (Columba livia), quail (Coturnix coturnix), sparrow (Passer domesticus), myna (Acridotheres tristis), dove (Streptopelia senegalensis) and mice (Mus musculus). While the percentage use of quill, mice, d...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Abu Saeed Hashmi1, Ghulam Yasein2 and Ghulam Abbas1
...or-1 (IGF-1) is secreted peptide growth factor, that involved in a variety of physiological processes such as somatic growth, metabolism, tissue repair, lactation and reproduction. It controls differentiation and maintenance of different function in various and specific tissues. The liver is the primary source of IGF-1 and considered as candidate genes for growth because they play a significant role in development and growth...
Mo Chen1, Shad Mahfuz1, 2, Yan Cui1, Liying Jia1, Zhongjun Liu3 and Hui Song1, 4*
...luate the antioxidant properties of serum and egg yolk in ISA Brown layer hens fed with mushroom (Flammulina velutipes) stembase (FVS). A total 150 hens of 30 wk old were grouped into 5 equal treatments with 5 replications of 6 hens each. Dietary treatments included basal diet as a control group; control diet including antibiotic (0.05% flavomycin) as an antibiotic group; 2% FVS fed group;...
Memis Ozdemir
... Prl/RsaI specificpolymorphic site is on exon 4 in Bos taurus cattle breeds, but have been not detected the RsaI restriction enzyme digestion site in Prl gene exon 3 region reported by many literature and, these results also have been approved by blasted at the NCBI Genbank.
...
Nosheen1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1
...ystem. Therefore, this experiment was planned to assess the acute affect of lead (Pb+2) on peroxidase (POD) activity in tissues viz. liver, gills, kidney, muscle, heart and brain of fish Catla catla exposed for 4-day. After each sampling (24-hr interval) fish were dissected and required organs were obtained. Results showed that the POD activity was augmented in all selected organs of Pb+2 exposed fish in relation to control....
Riaz Hussain Pasha1*, Muhammad Zubair Anjum2, Imran Ullah2, Muhammad Akram Khan3, Adnan Ali4, Saif-Ur-Rehman5, Sana Batool2 and Arslan Emmanuel2
...hes of both sexes (n= 12 per season; 9 female and 3 male) were collected in different seasons of 2016-17. Preparatory phase of reproductive cycle was observed in spring with having thick tunica albuginea and rapid spermatogenesis in testes while appearance of cortical alveoli or yolk vesicle in cortex of cytoplasm in ovaries. Gonads attain maximum size and weight in spawning phase during s...
Aamir Saleem1, Arshad Mahmood Malik2*, Najam Ul Hassan1 and Imtiaz A. Qamar3
... regarding rain fall, temperature, pan evaporation, sunshine and wind speed for interpreting results along with their statistical analysis as fixing legume with grass has improved the forage quality. Overall, these results has suggested that grass-legume mixtures can improve livestock and pasture productivity, sustainability and as well as to fix atmospheric nitrogen and this may improve soil N status also. These mixtures we...
Muneer Abbas1*, Muhammad Ramzan1, Niaz Hussain1, Abdul Ghaffar1, Khalid Hussain1, Sohail Abbas2 and Ali Raza3
...ct population. Funnel shaped light traps were used in mungbean and gram crops throughout the year. Effects of light traps were assessed by daily night collections in relation with abiotic factors based on marginal cost benefit ratio. Results indicated that total 32415 insect’s captures were made with >26 insect species including 4 species of bio control agents. Helicoverpa armiger...
Muhammad Abdul Rahman1*, Abdul Saboor1, Gulnaz Hameed1, Ghulam Bilal2 and Farooq Tanwir3
...imate change scenario. Expert Judgment approach is employed to identify and then rank most significant CEHFs that are related to emerging security hazards to dairy system. These CEHFs are then stitched with existing body of literature to consolidate our findings. Results comprised key CEHFs affecting occurrence of security hazards to dairy production in the scenario of changing climate. Experts ranked lack of genetic researc...
Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4
...D3 and D4 (clipped after 20, 40, 60 and 80 days, respectively) were studied. The response variables were morphological characters (plant height, tiller density and herbage yield) of Blue panic grass. With the advance in maturity of clipping stages, plant height and no. of tillers in the grass increased (P<0.05). Herbage yield showed (fresh biomass yield, dry matter yield) significant differences (P<0.05) at e...
Ahmed Zia*
... potentially threatened species whose habitat and ecology was never known. To date, there is no information available for its male and immature stages. It is second species for the genus to be recorded from Pakistan. Distributional details along with important taxonomic characters and habitat information is discussed in detail to facilitate readers of this document. A key to the known spec...
Wajid Shah Yousafzai1, Irfan Ullah1*, Amjad Ali1, Mahmood Iqbal2 and Salman Khan1
...hemical fertilizer (kg), pesticide/weedicide (ml), and irrigation numbers have positive effects on onion production in the research area. Allocative efficiency estimates showed that tractor hours, FYM, chemical fertilizer, and pesticide/weedicide are under-utilized having ratios of 22.15, 8.65, 5.49 and 34.69 respectively. Similarly, seed rate and irrigation numbers are over utilized havin...
Muhammad Azam Niazi1* and Umar Farooq2
...er price was negative as per expectations. Tubewell availability had a positive effect on Basmati production. The Basmati rice had a speed of adjustment of 42 per cent showing that any deviation from the equilibrium would be corrected by 42 per cent in the current period. It is sugge...
Muhammad Saleem1*, Ehsan Elahi1, Allah Wadhayo Gandahi1, Saleem Maseeh Bhatti1, Hajra Ibrahim2 and Muhammad Ali3
...g ha-1. The outcome of experiment had revealed that with the increasing level of S, the sunflower plant growth and yield attributes were significantly improved. The application of sulphur at 20 kg ha-1 was superior in enhancing overall growth, achene yield and oil content % of sunflower. ...
Hina Fatima1*, Abdul Jabbar2 and Khurram Nawaz3
...on was 0.78 and 0.74, respectively. The result of the study revealed that those farmers cultivated the wheat crop after Non-BT cotton were technically more efficient compared to those who cultivated wheat after BT-cotton. The major factors that were found to be compliant for improved wheat production in study area were operational holding under wheat crop, which was cultivated after Non-BT or BT cotton, date of sowing, numb...
Arifa Khan1*, Shazia Erum2, Naveeda Riaz1, Abdul Ghafoor2 and Farhat Ali Khan3
...xt-align: justify;">An experiment comprising of 11 exotic genotypes were evaluated for yield and baking quality traits at National Agriculture Research Center Islamabad, Pakistan during autumn 2016-2017. The experiment was carried out in randomized complete block design with three replications. Data were recorded on sprouting, plant height, number of tubers pe
Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2
...ully cloned into three types of overexpression constructs i.e. pBinAR_NtSAT4 (targeted to cytosol), pBinAR-TKTP_NtSAT4 (targeted to plastids) and pBinAR-SHMT_NtSAT4 (targeted to mitochondria). For stable transformation of B. napus floral-dip and tissue culture based approaches were tested using different formulations of phytohormones for calli, shoots and roots induction in a variety of genotypes. While false positive lines ...
Muhammad Naeem Khan* and Asad Jan
...y against Xanthomonas campestris and Pseudomonas aeruginosa causing 12.6±0.54 mm and 20.6±0.53 mm zone of inhibition, respectively which was analogous to that of cefixime, used as standard drug. In case of antifungal activity MCE hindered the growth of Fusarium oxysporum effectively, causing 19.3±0.41 mm zone of inhibition, while the activity of other solvent was moderate. ...
Jahangir Khan*, Syed Attaullah Shah, Khurram Nawaz Saddozai, Muhammad Fayaz, Shahid Ali, Abbas Ullah Jan and Ghaffar Ali
... such as color, size, shape, freshness and external defect. The data were analyzed using hedonic pricing model. Results show that Consumers have strong preferences for apple freshness, size, color and juiciness and their willingness to pay for these attributes are significantly greater than zero. On the basis of these findings the study recommends that apple growers should focus on best quality apple varieties and should maintain post harvest quality of their ...
Yousaf Noor*, Zahir Shah and Muhammad Tariq
...domized complete block experiment with split plot arrangement was used. Methods of application (Soil and Foliar) were assigned to main plots while micronutrients (Zn @2.5 kg ha-1, B @ 2.5 kg ha-1 and Zn plus B) were kept in subplots. The results showed that Zn, B and Zn + B and their methods of application significantly affected the yield attributes of citrus in both years. The combined application of Zn and B increased flower (12118), fruit set (8.3%), fruit ...
Jahangir Khan1*, Abbasullah Jan1, Kar Ho Lim2, Syed Attaullah Shah1*, Aditya R Khanal2 and Ghaffar Ali1
...ingness to pay (WTP) for pesticide-free locally produced fresh fruits in Khyber Pakhtunkhwa, Pakistan. A Contingent Valuation Survey Method (CVM), constructed with a double-bounded WTP elicitation format, was used to interview a randomly selected sample of 600 households. Survey data revealed that households were willing to pay on average rupees 26 more per kilogram of
Saifullah* and Ihsan Mabood Qazi
...mposition, functional properties and microstructure of fine wheat flour (FWF) and whole wheat flour (WWF) of the selected varieties. These varieties were collected from different research stations located in the province. The grains were milled using laboratory scale flour mill. Part of the flour of each variety was passed from mesh to remove the bran and get fine flour. Both whole and fine flour of the selected wheat varieties were subjected to qualitative st...
Muhammad Abdul Qayyum1*, Farhat Bashir2, Muhammad Mudassar Maqbool3, Anser Ali3, Saqib Bashir1 and Qaiser Abbas4
...ested four linseed genotypes showed an overall germination rate of 86-94% at 100 mM NaCl (T2) and 78-84% at 200 mM NaCl (T3) and seedling survival rate of 80-90% at T2 and 40-60% at T3. Seedling survival was related to seedling vigor and tolerance to salinity, as salt tolerant genotypes with healthy seedlings showed better survival and growth rate under salt stress conditions. The minimum relative growth rate was recorded as...
Raheel Saqib1*, Muhammad Luqman2, Iqbal Javed3, Abdur Rehman4, Muhammad Yaseen2, Saleem Ashraf5 and Muhammad Zeeshan Majeed2
... highly influenced and depends upon income level of households as majority (67.0%) of the poor people with low income level had low level of financial capital. The preference or choice of livelihood strategies by different income groups was measured through chi-square test of independence (χ2=122.770) which shows that majority (79.3%) of low income households used to adopt only farming...
Umar Hayat1*, Shahid Ali1, Abdul Mateen2 and Hazrat Bilal2
...overty, but still its proper measurement is scarce in studies. To examine and analyze the nexus between agricultural growth and poverty in Pakistan, the present study has been organized. Data on key variables including agricultural growth and poverty head count ratio are taken from different authentic sources, such as: Pakistan Economic Survey (PES), International Financial Statistics (IFS...
Sibgha Noreen*, Sumrina Faiz, Muhammad Salim Akhter, Kausar Hussain Shah
.... The amount of hydrogen peroxide and Malondialdehyde were elevated by 170.3% and 68.7%, respectively while enhanced by 54% and 47.4% by spray of proline under salinity. Significant reduction in K+ uptake with concurrent increase in Na+ content was observed under NaCl salt stress, while the foliar application of proline increased the amount of K+ at vegetative growth under stress and non-stress conditions. The biological yie...
Fazle Akbar and Sahib Alam*
... (ZON), trichothecenes type-A (i.e. T-2 and HT-2) and trichothecenes type-B (i.e. DON, 3-ac DON, 15-ac DON) production in maize grains. Water activity of the grains was adjusted to 0.85, 0.90 and 0.95 aw and the samples were stored at 25°C for 45 days. The control samples were kept without any aw modification. At 15 days interval, the samples were analyzed for the aforesaid parameters. The data showed that aw and storage...
Shahid Ali1*, Farhan1, Murtaza1, Neelum Andaleeb2 and Amjad Ali1
...060, 0.223 and 0.056, respectively. The estimated results of SFP model-2 revealed that household’s education level was having negative and significant effect on technical inefficiency. Among the sampled respondents owners were technically more inefficient as compared to the tenants. Farm size was having negative and significant effect on inefficiency while age and farming experience of the sampled respondents were stat...
Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh*
...transgenic potatoes is imperative to investigate various gene functions as well as to develop robust potato varieties resistant to different biotic and abiotic stresses, specially in diploid potato and to redirect the breeding program away from tetraploids to the diploids. We aimed to develop the protocol for transformation of Solanum chacoense diploid M6 potato using tetraploid S. tuberorsum cv. Desiree as a control using f...
Muhammad Asghar Hassan1, Imran Bodlah1*, Ayesha Aihetasham2,Muhammad Adnan Bodlah3, Khadim Hussain4
...ion of Punjab. In this paper the detailed taxonomic note on Baccha maculata Walker, 1852, supplementary photographs, habitat information, previous distribution and remarks are provided.
...
Hanif Ullah1, Muhammad Inayat Ullah Khan2, Suleman3, Sawar Khan1,Salma Javed4, Abdul Qadeer1, Mohsin Nawaz1, Sardar Azhar Mehmood4
...lciparum are common species. The current study was designed to investigate the prevalence of malaria infection in District Lower Dir Pakistan. A total of 1750 blood samples were collected from seven tehsils of District Lower Dir (January to December 2013). The data were analysed tehsils wise, month wise, gender wise, age wise and species wise. Thick and thin smear were prepared and examined under microsco
Olufisayo Bamidele* and Safiriyu Idowu Ola
...nRHa in Ovaprim®, respectively. Blood samples were collected pre injection and at 60 and 120 minutes post insemination. Data recorded were Plasma LH levels, kindling rate, total kit born, total born alive, still born, weight of kits at birth and gestation period (days) and were analyzed using Analysis of variance of the General Linear Model procedure and t-test where appropriate. The plasma LH for the AI groups
Muhammad Furqan Shahid1*, Tahir Yaqub1, Muhammad Yasin Tipu2, Asim Aslam2, Saima Yaqub1, Aziz-ul-Rahman3, Muzaffar Ali1
...er birds were infected experimentally at the dose of 106 EID50 by using these three isolates. Results revealed that onset of clinical signs was started at 2nd day post infection (DPI) followed by severity in redness and swelling of eyes, sneezing and lacrimation at 3rd DPI that lasts up to 5th DPI. Cross reactivity of antiserum response toH9N2 was compared among reference isolates when challenged in broile...
Shaukat Ali1,*, Sadia Batool2, Fatima Javed Butt2, Sundas Nasreen1, Hafiz Muhammad Tahir1
...d. Advances in chemotherapeutic agents, various radiological techniques and bio-nanoparticles treatments (i.e., green synthesized metallic nanoparticles) attracted many researchers to conclude a novel cancer treatment strategy. Unluckily every strategy had some working limitations as a result of which cancer remained a catastrophe for humanity. The present review article devised the modern cancer treatment paradigm which proposed directions towards probiotics ...
Khaled Kaboudi*
...vian influenza H9N2 subtype virus is considered among important respiratory pathogens in poultry worldwide. It was isolated from many species of domestic and wild birds. Infection in commercial poultry flocks causes important economic losses, related to high mortality, decrease in animal performance and aggravation of infection by other pathogens. Although H9N2 is endemic in many regions o...
Shwe Yee Win1, Lat Lat Htun1, Myint Myint Hmoon1, Hla Myet Chel1, Yu Nandi Thaw1, Nyein Chan Soe1, Htet Lin Oo3 and Saw Bawm2*
...as 60.5% (121/200). Six species of gastrointestinal parasites were observed as Capillaria spp. (30.0%, 60/200), Ascaridia galli (24%, 48/200), Eimeria spp. (20.5%, 41/200), Raillietina spp. (17%, 34/200), Strongyloides spp. (2.5%, 5/200) and Subulura brumpti (2.0%, 4/200). Mixed infection rate was 54.5% while single infection rate was observed as 45.5%. The highest occurrence of gastrointestinal parasites (66.0%) was observed in Nyaung U Township followed by Z...
Ankur Abrol, Madhumeet Singh, Akshay Sharma* and Pravesh Kumar
...So, the most important aspect in successful management of uterine torsion lies in the correct and efficient diagnosis which can mainly be achieved by anamnesis, vaginal and rectal examination. However, prognosis of uterine torsion is mainly dependent on the degree and duration of condition and can be categorised into 3 successive stages i.e. stage of positive prognosis, stage of less positive prognosis and stage of negative ...
Hafiz Muhammad Arsalan1, Maria Altaf1, Zeemal Seemab Amin1, Muhammad Khalil Ahmad Khan2, Anum Shahzadi1, Hina Mudasser1, Iqra Maqsood1, Nazia Gulshan1, Saira Naseem3
... patients and 50 healthy persons were included in this study. 5 ml Blood was drawn and serum was separated. Anti-Oxidant Biomarkers, Serum micronutrients, serum Electrolyte balance was measured through spectrophotometric procedure. Serum MDA level jump high in patients (14.19) as compared to normal subjects (3.26). Serum Glutathione declined in disease persons (0.56) from healthy subjects ...
Fizza Anwar1, Muddassar Zafar1*, Zahid Anwar1, Raja Tahir Mehmood2
...pus stonolifer, Aspergillus niger, Aspergillus fumigatus and Aspergillus terreus were tested for the production of antimicrobial agents. The produced antimicrobial metabolites included Aflatrem, Monacolin K, Fusarubin and Tautomycetin. Different fermentation parameters were optimized to produce antimicrobial agents using Response Surface Methodology (RSM) and best ...
Tanzeela Riaz, Fiza Sana-Ullah Khan, Farah Rauf Shakoori
...U/ml in quantitative, respectively.These best producers were further selected for optimization of cultural conditions for mannanase production. They all produced maximum mannanase units in M1 medium after incubation of 48 hours. The MBL-CW01 was best mannanase producer at 35oC, pH 6.0 at 1% substrate concentration while MBL-GN02 produced maximum enzyme at 35oC, pH 4.0 with 0.5% substrate concentration. The MBL-SP02 produced maximum enzyme...
Muhammad Ramzan1*, Muhammad Nadeem1, Masood Maqbool1, Ghulam Murtaza2
...e thrips.
...
Nadia Saeed1, Mian Sayed Khan2, Habib Ahmad3, Muzafar Shah4*
...s avenae, Tylenchus species, Pratylenchus species, Psilenchus species, Meloidogyne species and Trichodorus species. Carbofuran (inorganic) and poultry manure (organic) in recommended amounts were used for management and results showed that both were effective against phytonematodes. Valu...
Naila Riaz1, Hafiz Muhammad Tahir2, Muhammad Khalid Mukhtar1, Ali Hassan2, Shaukat Ali2, Shafaat Yar Khan1
... were 36kDa and54kDa, respectively. The doses of venom fractions used during the study ranged from 10-30µg/ml. Both venom fractions significantly inhibited the activity of AChE. However, 30µg/ml dose of both scorpion venom caused 100% mortality in adult M. domestica. . It was concluded that the venom of scorpions contains peptides fractions that may be used as potential bio-pe
Sobia Nazir1, Muhammad Irfan1*, Muhammad Nadeem2, Hafiz Abdullah Shakir3*, Muhammad Khan3, Shaukat Ali4, Quratulain Syed2
... and 5ml) and incubation period (3, 4, 5 days) to observed the maximum activity of cellulase using Box-Bhenken design of response surface methodology. Maximum activity of CMCase (0.700 IU/gds/min) and FPase (0.260 IU/gds/min) was observed on 4th day with inoculum size of 1% and medium volume of 1ml (for 5g substrate). The proposed model was highly significant as depicted by ANOVA. The results recommended that seed pods of Bombyx ceiba play im...
Hafiz Muhammad Tahir*, Palwasha Jabeen, Chand Raza, Shaukat Ali
... Spider silk varies in types and functions according to the gland producing them. The silk in mulberry and non-mulberrys silkworms also varies from each other. Spidroin is the protein found in spider silk while silkworm silk is made up of an inner core of fibroin and outer layer of sericin protein. After the removal of sericin, silk is non-immunogenic and non-allergic. It is a renowned biomaterial due to its biocompatible nature. Silk proteins have been found ...
Hafiza Sadaf Zahra1, Asia Iqbal2, Sayyeda Hira Hassan1, Hafiz Abdullah Shakir1*, Muhammad Khan1*, Muhammad Irfan3, Chaman Ara1, Shaukat Ali4
...progression of BC. DNA hypermethylation of promoter CpG islands inhibits transcriptional activity by methyltransferase enzyme which results in inactivation of tumor suppressor genes (TSG), while in hypomethylation, demethyltransferase enzyme causes the activation of oncogenes by promoting transcriptional activity. Contrary to DNA methylation, histone acetylation and deacetylation results in chromatin opening and closing, res...
Rimsha Munir1, 2*
... system. HCT-116 cells coped better with metabolic stress in 2D system while HepG2 in 3D system.
...
Mehwish Faheem1*, Maleeha Rafeeq1, Aisha Majeed1 and Saba Khaliq2
...ly affect aquatic life especially, fish population. Effect of acute exposure of low concentrations of BPA (10, 100, 1000 µg/l) on liver cyp1a1 and heat shock proteins mRNA level was evaluated using real time qPCR. Results revealed that exposure to bisphenol A caused decrease expression of cyp1a1 in a concentration dependent manner. Exposure to graded concentrations of bisphenol-A resulted in significant i...
Haq Aman Ullah1,*, Aneela Zameer Durrani2, Muhammad Ijaz2, Aqeel Javeed3, Muqadder Shah1 and Ikramul Haq1
...logical biomarkers with special reference to udder health and serum parameters of lactating goats. Thirty two lactating Beetal goats of 3-4 y age, weighing 40.91±0.285, were randomly selected, and equally divided into four groups. Group A was kept as control while animals of groups B, C, and D were individually fed daily with 30µg, 40µg and 50µg of AFB1, respectively, through naturally contaminated c...
Abu ul Hassan Faiz1,*, Fakhar-i-Abbas2, Mehboob ul Hassan3 and Lariab Zahra Faiz1
... abundance of vertebrate pests in District (Bagh), Azad Kashmir. The study was conducted in three areas (Harighel fields, Grid colony fields and Iqbal colony fields during mid April to mid December 2017 by selecting 5 model plots of maize. On each study site, line transect method for small mammalian pest, for large mammals spot light count and for birds point count methods were used to determine abundance of each s
Muhammad Shoaib1,3*, Arif Ismiyev2,Khudaverdi Ganbarov3, Aygun Israyilova3 and Sajid Umar4
....
...
Shahid Sherzada1,2,4,*, Muhammad Naeem Khan4, Masroor Ellahi Babar2, Muhammad Idrees3, Abdul Wajid2, Muhammad Nauman Sharif3, Muhammad Shahzad Iqbal3, Iram Amin3 and Muhammad Shahid3
...mily, Indian major carp species (Labeo rohita, Cirrhinus mrigala, Catla catla)are very suitable fish species for culture in Pakistan. However, the identification and phylogeny of these fish species are of much interest today. DNA barcoding is used as a bio-identification tool for the organism globally. The current study was also conducted for the fast and accurate identification of ...
Syed Maaz Nadeem1*, Muti ur Rehman Khan1, Asim Aslam1, Ali Ahmad Sheikh1, Arfan Ahmad1* and Muhammad Anees2
...d molecular analysis of specific regions overlapping VP1-VP2 and VP2-VP3 genes of CAV strain from outbreaks in broiler flock (n=45) were undertaken in the Punjab Province of Pakistan. The phylogenetic analysis clustered study strains of CAV in group II similar to those reported previously from China. These findings are helpful for an understanding of currently circulating strains of CAV; however, they require further analysis to intervene in necessary strategi...
Chaman Ara1*, Asmatullah1, Sehrish Kanwa1, Asma Chaudhary2, Ayesha Siddiqua1
...floxacin (LFX), a broad spectrum fluoroquinolone antibiotic of third generation, is widely used to treat respiratory and genitourinary infections. Keeping in view the controversy about its toxicity, current study was conducted to assess the levofloxacin induced hepatotoxicity, nephrotoxicity and its likely noxious effects on spermatogenesis in mammals. Forty mice, randomly categorized into four groups (N=10) were administere...
Chaman Ara1*, Asmatullah1, Zainab Riaz1, Memoona1, Asma Chaudhary2, Shagufta Andleeb2
...osuidal spaces, portal hypertension, glomerulosclerosis, abnormal vascular pole in liver and kidney respectively. But when turmeric powder was coadministered with BP, these damages were reversed to a great extent. So, this study has proved the protective role of turmeric against toxicity induced by BP in female albino mice.
Novelty Statement | Curcumin, an active component of turmeric al...
Peng Chen1,2, Zuhao Huang3,Chaoying Zhu1, Yuqing Han1, Zhifeng Xu1,
Guanglong Sun1, Zhen Zhang1, Dongqin Zhao4, Gang Ge1 and Luzhang Ruan1*
...sianus chirurgus, respectively. The base compositions were A > C > T > G in 73 species complete mitochondrial sequences in Gruiformes and Charadriiformes. The total AT content in the 73 species was larger than that of GC. The start codons in protein-coding genes (PCGs) included ATG, GTG, ATT, ATC and ATA, while its stop codons included TAA, TAG, AGG, AGA and the incomplete cip...
Mahnoor Pervez and Farkhanda Manzoor*
...ed with an aim to assess pesticide risk toward honeybees (Apis mellifera L.) by detecting pesticide residues in pollen and nectar samples collected from various agricultural areas of Pakistan through high performance liquid chromatography analysis. Pollen and nectar were collected from 2016 to 2017 from different agricultural areas of Pakistan during a field survey. Pollen was collected by...
Turab Ali Kaurajo1*, Huma Rizwana1, Gulbahar Khaskheli2, Muhammad Haroon Baloch1, Muhammad Naeem Rajput1, Asad Ali Khaskheli3 and Mohsin Solangi1
...e 3-5 and 12-22 years respectively in females. Duration of estrus cycle in camel varied from 16-22 days. Average hair production of 1.63, 1.62, 1.47 and 1.36 kg was noted for Kharai, Dhatti, Larri and Sakrai breeds respectively. Average daily milk production of Dhatti, Sakrai, Kharai and Larri camels were recorded as 6.40, 5.23, 4.90 and 5.20 liters respectively while the lactation yield w...
Imran1*, Amanullah1, Muhammad Arif1, Zahir Shah2 and Abdul Bari3
...d cash crops. Minimizing pest losses in addition to better crop management is a way toward narrowing the yield gap and ensuring food security. The present study was carried out to investigate the impact of peach (Prunus persica L.) residues and soil application of Trichoderma (soft-rot fungi) along with seed inoculation of phosphate solubilizing bacteria (PSB) (Pseudomonas) and phosphorus ...
Sana Munir1, Muhammad Kamran Qureshi1*, Ahmad Naeem Shahzad2, Ismat Nawaz3, Muhammad Shahzad Anjam4, Sumaira Rasul4 and Muhammad Asif Zulfiqar5
...ity various cotton genotypes, inter and intraspecific hybrids were assessed for yield, yield contributing and fiber traits using various multivariate analysis such as principle component analysis and linkage cluster analysis. Principle component analysis (PCA) exhibited that first four PC out of nineteen PC, with eigen value >1, contributed about 80.326 % of total variability. Positive contribution towards PC1 was given b...
Manzoor1*, Ahmad Khan1, Amir Sohail2, Shahzad Ali1, Fawad Ali Shah3, Junaid Iqbal3, Muhammad Owais Khan4 and Sultan Nawaz4
... critical to know the proper irrigation timing that would maximize yields and profits. The objective of this study was to evaluate the effects of water stress imposed at low and high sensitive growth stages (six leaves, twelve leaves, flowering and grain filling stages) and role of different planting methods (Ridge, Flat and Broadcast) in soil moisture conservation for maize crop. The research was carried out using RCBD with split plot arrangement having 4 rep...
Javeria Zafar1, Asif Nadeem1*, Maryam Javed1, Fehmeeda Fatima1, Wasim Shehzad1, Ghulam Abbas1, Rajput Zahid Iqbal2 and Muhammad Muddassir Ali1
...onship with other capra species. Blood samples were collected from Kirthar National Park, Sindh, Pakistan. PCR product was sequenced bi-directionally using dideoxy chain termination method after mitochondrial ATPase8/6 genes amplification. Polymorphism, Genetic diversity and Phylogenetic analysis were carried out by the MUSCLE, DnaSP and MEGA6 tools. Total of 20 variations at different positions were found in aligned sequence results. Sequence conservat...
Qaisar Jamal*, Akram Shah, Syed Basit Rasheed and Muhammad Adnan
...logy and various morphotypes of the promastigotes were noted. Acquisition and propagation of axenic amastigotes was assessed. During promastigote culture, log, mid-log, and late-log phases were observed respectively on day 4, 5 and 6. The stationary phase was observed on day 7. The day following inoculation, most of the promastigotes were nectomonads having long and slender bodies with roughly uniform width from anterior to ...
Aftab Shaukat1,2,*, Tauseef ur Rehman3, Rizwan Shukat4, Shahid Ali Rajput5,
Shadab Shaukat6, Muhammad Ahsan Naeem2,5,8, Mubashar Hassan2,5, Tabassam Fatima2,5,
Fayyaz Ahmad1, Muhammad Usman Saleem7, Fatima Arooj1, Ashar Mehfooz2 and Anas Sarwar Qureshi2
...flushing on reproduction performance (kidding type and fertility percentage) and production performance (birth weight, weaning weight of offspring and health of does). Eighty teddy does were randomly divided into two groups (n=40) viz T1 and T2 as control group and test group, respectively....
Barkat Ali1,2, Wasim Sajjad1,2,3, Imran Khan1, Muhammad Rafiq1, Sahib Zada1, Aamer Ali Shah1 and Fariha Hasan1,*
...a. Seven different types of antibiotic discs were used to check the intrinsic resistance of all the isolates to various antibiotics. Interestingly, most of the isolates were found resistant while only a few were susceptible, however, the isolates Lysinibacillus spp. N40 and Brevundomonas spp. P20 showed no activity at all. Increased levels of resistance to heavy metals such as; iron, arsenic, cadmium, chromium, and nickel were shown by strain...
Jam Nazeer Ahmad1,2*,Mujahid Manzoor1, Zubair Aslam3 and Samina Jam Nazeer Ahmad1, 2
... group of insecticide (Cypermethrin). Cytochrome P450 genes have been associated with insecticides resistance. Field collected population of R. ferruginous from different provinces of Pakistan was investigated for insecticides resistance development against P450 gene. Insect bioassay indicated highly significant level of LC50 values among laboratory reared and field collected population against Cypermethrin. The labor...
Iffat Nawaz1*, Farhatullah1, Fida Muhammad1, Sajid Ali2 and Ghulam Muhammad Ali3
... for seed color, seed shape and seed coat pattern. Twenty-nine different colours of common beans were observed in these 96 accessions with pre-dominance of red colour. Four different seed shapes were observed i.e., Cuboid, oval, truncate fastigiated and kidney shape. Cuboid seed shape was predominant with a frequency of 46.8%. Seed coat pattern was absen...
Arjumand Nizami1, Jawad Ali2 and Muhammad Zulfiqar3
... on empirical data on temperature and rainfall change from Khyber Pakhtunkhwa region of North-West Pakistan to illustrate that climate change is no longer theoretical. It is real and becoming self-evident. Climate assessment 1981-2010 and future scenario 2010-2040 for KP noted little shifts in the annual average rainfall. However seasonal shifts are rather significant. In all the districts, spring and summer rains are showing an increasing trend whereas fall a...
Syeda Naila, Muhammad Ibrar, Fazal Hadi* and Muhammad Nauman Khan
... was conducted on Oxalis pes-caprae L. (Family Oxalidaceae) to analyze its morphological and pharmacognostic features. The results revealed that it leaves are compound, perennial and summer deciduous with upper epidermis followed by mesophyll region with vascular bundle and the lower epidermis. The leaf features showed that palisade ratio was (7.35), vein islets number (9), and vein termin...
Fariha Latif1*, Muhammad Javed2, Hammad Ahmad Khan2 and Khalil-Ur-Rehman3
...al processes and is very persistent in the aquatic environment. The main objective of this study was to assess the time and dose dependent effects of Pb on bioaccumulation and oxidative stress in the liver, kidney, gills, muscles and brain of Cirrhina mrigala. The 120-days old fish were exposed to 1/4th (11.81mgL-1) and 2/3rd (31.49mgL-1) of 96-h LC50 of water-bor...
Sanaullah1, Fazli Rabbi2*, Shahid Ali2, Zeeshan Khan3 and Muhammad Zamin4
...-align: justify;">This paper is based on a Contingent Valuation (CV) survey conducted in Kalam valley, which is a famous tourist and biodiversity hot spot. The valley has remained underdeveloped in terms of infrastructure, tourists’ information facilities, telecommunication, affordable public transport system, and comfortable accommodation for the tourists. In the past few years, the development of this tourists’...
Rana Manzoor Ahmad1,2, Abdul Majid Khan2*, Ayesha Iqbal2, Amtur Rafeh2, Muhammad Tahir Waseem2 and Muhammad Ameen2
...
...
Ghulam Hussain1, Muhammad Asrar1, Dilbar Hussain2, Khurum Zia3, Abdul Rashid4*, Hina Anwar5, Muhammad Azeem1, Saddam Hussain1 and Sabeen Asghar1
...e commercially available pesticides and indigenously available plant extracts. The efficacy of following insecticides and plant extracts viz. Cascabela thevetia leaf extract @ 300ml/acre, Azadirachta indica @ 300ml/acre, Profenofos @600ml/acre., Crown 70WS @125gm/acre, Match 50EC@250ml/acre, Helmat 40EC@600ml/acre and Confidor 20SL@ 250ml/ acre were evaluated on cotton against 3rd instar cotton mealy bug. Data was collected after 3,6,12,24 and 48 hours. Maximu...
Qamar Zeb1*, Silvia I. Rondon2, Hayat Badshah,1 and Arsalan Khan1
...gn with three replicates per treatment/cultivar. Population of aphids, and numbers of parasitoids and predators were recorded at weekly intervals. Rhopalosiphum padi Linnaeus, Schizaphis graminum Rondani, and Sitobion avenae Fabricius were the predominant aphid species (Homoptera: Aphididae). Two species of parasitoids Aphidius ervi L. and Aphidius colemani
Zübeyde Kumbıçak1,* and Hatice Poyraz2
...ng method. We collected specimens from different populations in Nevşehir and used totally fourteen male spiders. The two Drassodes species had karyotypes comprising 10 pairs of autosomes plus sex chromosomes which were X1X20 (♂) type. All chromosomes including sex chromosomes were telocentric and relative lengths of autoso...
Sumaira Abbas1, Muhammad Sultan Haider2,*, Fatima Kafayet1, Sana Ashraf2, Atifa Masood3 and Moazma Batool4
...sius auratus. Citrus peels were collected from local market dried and grinded. Organic solvent extraction was carried out by hexane and acetone mixture (1:1 v/v). Carotenoid concentration was determined by thin layer chromatography (TLC) and found satisfactory. By mixing fish meal, sunflower meal and rice polish four treatment diets, T1, T2, T3, were prepared and citrus peel powder was ad...
Tanweer Kumar1, Sahib Zada2,3,Muhammad Irfan4,*, Huma Batool5 and Wasim Sajjad2,6
...lts showed a higher male percentage than that of the female. The total HBV prevalence was recorded at 4.5% in all populations comprising both male and female. It was concluded that the highest prevalence of HBV was found in male and female in the age group 16-25, and then followed by the age group that lies between 26-55.
...
Saman Muhsin Abdulkareem* and Nadir Mustafa Nanakali
...day and 20 mg/kg/day, respectively by gavage dissolved in corn oil for 90 days. At the end of the study, animals were sacrificed and their liver were removed for biochemical analysis including the level of oxidative stress biomarkers, liver enzymes, and the expression of CYP1A1 gene. The results of this study indicated that exposure to TCDD (10µg/kg/day) could significantly increase liver oxidative stress biomarkers and serum liver enzymes (p<0...
Zekeriya Demir1 and Hatice Kaya2*
...BP) supplemented diet on performance, egg quality and some blood parameters of laying hens. A total of 96 Lohmann layers, 28 weeks of age, were randomly allocated to four dietary treatments and fed a control diet (Pol-0), basal diet plus 0.5% (Pol-1), 1.0% (Pol-2) and 1.5% (Pol-3) bee pollen. The present study lasted for twelve weeks. During the experimental period, the hens were fed ad...
Hüseyin Erdem* and Ibrahim Cihangir Okuyucu
...rmine the effects of dry period length (DPL), average daily milk yield (ADMY), parity and calving season on some colostrum quality traits in Holstein cows. The material of the study consisted of 51 Holstein Friesian cows. The specific gravity of colostrum, fat, non-fat dry matter (NDM) and protein percentages were measured for colostrum produced at 2, 24, 48 and 72 h after birth. The s
Hafiz Abdullah Shakir1*, Javed Iqbal Qazi2, Abdul Shakoor Chaudhry2, Muhammad Irfan3, Muhammad Khan1, Shaukat Ali4 and Saima Shahzad Mirza5
...um (Cd), nickel (Ni), copper (Cu), manganese (Mn), mercury (Hg), lead (Pb), zinc (Zn) and iron (Fe) in fish scales. A study was conducted on total 216 fish specimens, comprised of 3 fish species (Catla catla (thaila), Labeo rohita (rohu) and Cirrhinus mrigala (mori)) from river Ravi during two flow seasons at four sampling locations including upstream Lahore Siphon = A, Shahdera = B, Sunde...
Urooba Pervaiz1*, Madeeha Iqbal1 and Dawood Jan2
...vailability of extension personal, result and method demonstration, farm/home visit and personal meetings. Whereas, the rest were not satisfied with radio programs, television programs, exhibitions, pamphlets, and farmer day. It was concluded that production of maize in the study area was increased up to 910 kg/acre after extension recommendations. In case of wheat production was increased from 1177.50 kg/acre after extensio...
Rahat Naz*, Mussawar Shah, Asad Ullah, Intikhab Alam and Younas Khan
... the study variables the perception of climate change effect on human life was indexed and cross tabulated with local response to agricultural production at bi-variate level, using chi-square test statistics. The study found that climate change effects on human life had a highly significant association (P=0.000) with greenhouse gases has decreased the agricultural productivity; climate change has reduced the production of crops(P=0.000); soil erosion and lands...
Hassnain1, Abdul Basit1*, Mehboob Alam1, Imran Ahmad1, Izhar Ullah1, Noor Alam2, Inayat Ullah3, Muhammad Areeb Khalid1, Muhammad Shair4 and Noor ul Ain1
...) with two factors and repeated three times in a control (Glass house) environment. Different concentrations of chitosan (0, 50, 100,150 mg L-1) and various water stress intervals (3, 6, 9 and 12 days) were given to tomato plants from 15 days after transplantation. Results showed that various application of chitosan and water stress interval had a significant (P< 0.01) effect on almost all studied parameter. Tomato plants treated with 6 days water stre...
Roshan Ali1, Afsar Ali2, Shamsher Ali2, Muhammad Arshad Khan3*, Haroon Shahzad3, Noman Latif3, Muhammad Waheed4, Ashraf Khan5 and Murad Ali6
...ed strategies. A field experiment was conducted at Agriculture Research Institute (ARI) Mingora Swat, Khyber Pakhtunkhwa in summer 2016 aiming the effect of silicon fertilizer applied to acidic soil on yield of paddy as paddy is mostly affected through lodging in Swat valley. The treatments consisted of control, 50 kg silicon ha-1, 100 kg silicon ha-1 and 150 kg silicon ha-1. Field had 12 plots with size of 12 m× 6 m = 72m2. The ex<...
Awais Bin Shahid1, Moolchand Malhi1,*, Saeed Ahmed Soomro1, Muhammad Giasuddin Shah2, Nazeer Hussain Kalhoro3, Asmatullah Kaka4, Rajoo Mal1, Muhammad Awais Soomro1, Saba Parveen Samo1 and Muhammad Nawaz Sanjrani5
...;C. The glutathione peroxidase (GSH-Px) activity increased (P < 0.05) in ruminal epithelium of SY goats compared to C. The present study demonstrated an improvement in ruminal fermentation, and hyperplasia and enhanced GSH-Px activity in the ruminial epithelium of goats fed SY supplemented diet compared to control that were fed diet without SY supplementation.
...
Khursheed Ahmed, Shoaib Freed*, Rana Fartab Shoukat and Kanwar Waqas Ahmad
...ug, Oxycarenus hyalinipennis has appeared as a serious insect pest of various crops including cotton. The present study was carried out to evaluate the combined effect of some isolates of Beauveria bassiana, Metarhizium anisopliae and Isaria fumosorosea and six synthetic insecticides i.e., triazophos, imidacloprid, bifenthrin, nitenpyram, pyreproxifin and...
Nazir Ahmad Khan1,*, Mudassir Alam1, Rafiullah khan1, Kamran Khan2 and Sadeeq ur Rahman3
...sion level and cost of expensive protein ingredients. This study quantified the chemical composition and amino acid profile of grains from newly developed QPM hybrids and evaluated the effect of replacing conventional maize (CM) with QPM in broiler feed on bird’s performance, diet digestibility, nitrogen retention, meat amino acids profile and farm profitability. Grains of QPM200 and...
Asima Rani1,*, Syed Kashif Nawaz2 and Muhammad Arshad3
...n the Plasmodium species responsible for the infection. Allele specific PCR was employed for the amplification of rs8177400 polymorphism. Results of genotyping were confirmed via PCR-RFLP strategy. Presence of GG genotype decreases the susceptibility of malaria (OR: 0.544, CI: 0.331 to 0.894, p=0.053), mild malaria (OR: 0.472, CI: 0.274 to 0.815, p=0.024) and P. vivax infecti...
Hazrat Ali1,2,*, Ezzat Khan1,* and Muhammad Jamal Nasir3
...ents and different fish species of River Shah Alam, a tributary of River Kabul in Khyber Pakhtunkhwa, Pakistan. The different environmental samples were collected from the river, downstream the city of Peshawar, and analyzed for the selected heavy metals by atomic absorption spectrophotometry. Heavy metal accumulation was studied in muscles of six fish species collected from the river. Hea...
Ammara Blouch1, Ata ul Mohsin2, Muhammad Naeem2 and Rashid Mahmood1*
...fficacy of commercial biopesticides under controlled environmental conditions. Bio pesticides are important alternates for chemical control of economically damaging insect pests like leaf worm, Spodoptera litura Fabricius. In this study, two commercial products including Dipel with Bt sub speciess kurs...
Chiping Kong1,2, Yongheng Wu1,2, Shangling Lou1, Benping Chen3, Simon D. Dowell4 and Yiqiang Fu1*
...earch of this secretive species.
...
Awais Ahmed Khan1*, Zafar Iqbal1 and Muhammad Atiq2
...hanced the activities of peroxidase (POD), Superoxide dismutase (SOD), and total phenolic contents. Salicylic acid showed highest POD activity (8.4 U/min g protein), SOD (6.96 U/ min g protein) and TPC (3.21 mg GAE/ 100g of sample) as compared to control where POD (1.13 U/min g protein), SOD (1.46 U/ min g protein), and TPC (1.14 mg GAE/ 100g of sample). Amount of hydrogen peroxide (H2O2),...
Shazia Akhtar1, Abdul Samad1*, Afshan Gohar1, Muhammad Munir Shahid2, Muhammad Ishtiaq1, Arslan Sarwer1, Adnan Khan1 and Karam Ahad1
... aimed at development of pesticides residues monitoring system in Pakistan, a semi-structured questionnaire survey consisting of 40 sub questions was evaluated by interviewing the peach growers in Swat, Malakand. The current survey described the knowledge, behavior, agricultural practices and pesticides toxicity symptoms among the field workers. Over all 72 orchards from 26 Union Councils ...
Noorullah Khan1*, Farrukh Siyar Hamid1, Fayaz Ahmad1, Sabaz Ali Khan2, Imtiaz Ahmed1, Muhammad Abbas Khan1, Shamsul Islam1, Abdul Waheed1, Basharat Hussain Shah1 and Hussain Shah3
... hormones. The present experiment was designed with the objectives to find the optimal concentration of IBA for better rooting and survival rate of seedlings from kiwi cuttings. The experiment was laid out according to randomized complete block design with three replications and 20 four budded branch cuttings of “Hayward” kiwifruit cultivar. The cuttings were treated with different concentration of IBA (0, 1000, ...
Fayyaz Hussain*, Raza Ullah Khan, Asim Hayat, Humair Ahmed and Ahmad Khan
...align: justify;">Field experiments were conducted on farmers field at two locations aimed at exploring the response of phosphorus (P) applied to rice at different growth stages.Phosphorus was applied in three interval i.e. at transplanting (0 DAT), 15 days after transplanting (15 DAT), and 25 days after transplanting (25 DAT), in addition to control (no P), and farmer fertilizer practice (FFP).Results show that mean paddy yield across both sites range from 2.9...
Huanxin Zhang1,2, Hongshuo Tang3, Jun Chen1, Yu Zang1,2, Xuexi Tang1,2,* and Ying Wang1,2,*
...on. Researches have been performed on the evolution in many species, but the evolutionary characteristics of African hunting dog TLR genes are scared. The available genome sequence of African hunting dog offers us the way to examine the innate immunity of this endangered carnivore. 10 TLR genes (TLR1-10) were initially identified from the African hunting dog and lesser panda. The results showed that most of the TLR genes wer...
Hu Liu1,2, Qifang Yu1,2, Xiaopeng Tang1,2, Chengkun Fang1,2, Sijia Chen1,2 and Rejun Fang1,2,*
...d selenium yeast (SY) on performance, egg quality, selenium concentration in eggs and serum antioxidant capacity in laying hens. Seven-hundred and twenty 21-week-old healthy Roman laying hens with a similar laying rate were randomly divided into 5 groups with 6 replicates of 24 hens. The experiment was designed by 2 × 2 factorial arrangement with two sources of Se and two levels of Se. The hens in control group were fe...
Mubasher Ahmad Malik1, Samina Jam Nazeer Ahmad2, Muhammad Jalal Arif1 and Jam Nazeer Ahmad1,*
...lidae) is a cosmopolitan pest, infesting the cruciferous crops worldwide. It has developed resistance against chemical insecticides. To overcome this problem there is dire need to explore alternative control measures which are safer to the environment and compatible with human health. The present study was conducted to investigate the insecticidal properties of native isolated Plutella ...
Honghua Wang1,2, Summia Perveen1,2, Shucheng Shao1,2, Kun Wang1,2 and Fei Yin1,2,*
...omatography-tandem mass spectrometry (LC-MS/MS) technique was applied and all identified proteins were categorised using a bioinformatics approach. The results showed that 3,472 proteins were identified with a theoretical molecular weight of 11.53–610.90 kDa and an isoelectric point of 4.13–11.77. A total of 63.07% or 50.09% proteins were annotated by Kyoto Encyclopaedia of Genes and Genomes (KEGG) or Gene Ontology (GO) terms, res
Detection and Phylogeny of Infectious Bursal Disease Virus (IBDV) during Field Outbreaks in Broilers
Umm-i-Habiba1,*, Ayesha Maqbool2, Muhammad Safdar3, Nida Zia1, Altaf Mehmood4, Muhammad Usman5, Mehwish Sharif6, Amanullah Khan7 and Sajid Umar8
...characterized based on hyper-variable region of the VP2 gene. IBDV strains were grouped into two distinct clusters on the basis of nucleotide sequences of hyper-variable region of the VP2 gene. According to phylogenetic analysis, 5 IBDV strains showed characteristic amino acid signatures in the VP2 gene (A222, I242, I256, I294, S299) and classified as vvI...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...confirm the functional aspects of rs112445441 and other variants involved in NHL pathogenesis.
...
Jawad Ali*, Ibad Ullah Jan and Hidayat Ullah
...iameter, number of fruit per plant and 1000 seed weight. Visually reduction in vegetative and yield parametric quality okra plant okra were significantly alleviated by the foliar application of Se under drought stress. Se application of 3 mg L−1 significantly increased the number of leaves, plant height, number of branches, stem dry weight, root dry weight, fruit diameter, number of fruit per plant and 1000 seed weight...
Asim Munawar1,2*, Farooq Ahmad1, Aqsa Arshad1, Muhammad Ishaque Mastoi3 and Chengjuan Liang4
...lesser grain borer, Rhyzopertha dominica and red flour beetle, Tribolium castaneum are considered most destructive pests of storages commodities worldwide. Unfortunately, due to multiple applications of synthetic pyrethroids and fumigants some major pests of stored grains has develops resistance against them. Resistance mechanisms in R. dominica and T. castaneum against these control agent...
Kadry A. El-Bakry1, Lamiaa E.M. Deef1*, Lotfy Z. Habbak1 and Samia S. El-Naeli2
...ale rats. Rats were intraperitoneally (i.p) injected with PAT in a single dose (3.75mg/kg body weight). Rats were treated with ginger in a dose (100 mg/kg-1 body weight) for 4 weeks and 8 weeks. Blood samples for biochemical analysis and liver tissues were collected and fixed in 10% formalin for histopathological studies. The present study showed that, PAT causes elevated alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities and signif...
Muhammad Muneeb1, Muhammad Ayub1, Sher Bahadar Khan2,*, Amjad Sohail1, Farkhanda Jabeen1, Mumtaz Ali Khan3, Amjad Khan4, Kashif Prince3, Asghar Khan5 and Irshad Ahmad6
... (0%). On same Agar high percentage for Escherichia coli was observed in samples from Hashtnagri (40%) and on tryptose agar results were quite high for Salmonella as compared to E. coli. In physiochemical analysis high pH was observed in samples taken from Warsak Road (6.84) followed by Hashtnagri. High moisture content was observed in samples taken from Saddar Bazaar (51.70%) followed by Tehkal Region (50.94%) while the high Ash content w...
Erum Iqbal*, Nasir Mehmood, Nasira Kazi and Shahina Fayyaz
...lant parasitic nematode species viz., Paratylenchus manilkarii n. sp., P. sindhicus n. sp.,and Pratylenchus kralli Ryss, 1982 as a new record species. P. manilkarii n. sp., is characterized by the lateral field with four incisures; stylet 28-29 µm long; vulval lips protruding with vulval flap; lip region rounded or truncated without submedian lobes, tail ventrally curved with pointed or acut...
Romaan Hayat Khattak1,3, Hussain Ali1, Ejaz Ur Rehman1 and
Muhammad Ali Nawaz1, 2*
...div>Blue sheep is a key species and found in Tibetan Plateau and the bordering massif through Central Asia. In Pakistan the distribution range of species is restricted to higher altitude areas of Northern Areas including Khunjerab and Shimshal. The present study was conducted from 25 September 2014 to 23 October 2014, to estimate the population size of blue sheep in Shimshal and Socterabad Community Controlled Hunting Areas,...
Umer Iqbal1,* and Tariq Mukhtar2
...entration of 150 ppm. Copper oxychloride at a concentration of 50 ppm gave the minimum inhibition (12.50%). Concentrations also had significant inhibitory effects on the growth of the fungus. All the fungicides caused maximum inhibition of the growth of the fungus at a concentration of 150 ppm. With a decrease in the concentration, the inhibition in the growth also decreased. The inhibition of growth was found to be directly proportional to the concentration. ...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4
...stication in 2018. This species is freshwater fish native in Indonesia and has a high price in the markets. This study investigated the effect of stocking density on growth performance, body carcass composition and biometric indices of juvenile gurami sago in the synthetic sheet pond. Fish were stocked at densities of 10, 15 and 20 fish/m3 in synthetic sheet pond with three replicate. Fish were fed with commercia...
Sajida Rasool1, Saba Irshad1*, Neelam Saba1, Mehak Fiaz1, Muhammad Sajid Hussain2, MuhammadWajid Hussain3 and Peter Nürnberg2
...r limbs spasticity and upper motor neuron degeneration. BICD2 is an adaptor protein which regulates the cellular trafficking of cargo molecules crucial for motor neuron growth and maturation. In present study, a Pakistani family of HSP penetrating in autosomal recessive pattern was ascertained. Patients presented spasticity and stiffness of upper and lower limbs, severe microcephaly, dysph...
Mustafa Koyun1*and Şenol Çelik2
... in eyes selected as independent variables. To estimate the MARS algorithm, goodness of fit statistics were examined. In order to determine the most suitable for each individual MARS model, different second, third and fourth-degree interactions were tried. In order to determine the most suitable model, it was taken into consideration that the cross-validity coefficient (GCV), square of error squared mean (RMSE) and Akaike Information Criteria (AIC) statistics ...
Muhammad Sohail1*, Imtiaz Hussain2, Maqsood Qamar2, Sikander Khan Tanveer2, Syed Haider Abbas2, Zeshan Ali1 and Muhammad Imtiaz3
...text-align: justify;">Temperature and drought stresses are generally considered main wheat yield limiting factors in rainfed environment, especially during reproductive growth stages. However, variability might exist among wheat genotypes in response to stressful conditions. The objective of the study was to test the climatic adaptability potential of the wheat genoty...
Muhammad Akbar Ali Shah1, Gamze Özel2, Christophe Chesneau3, Muhammad Mohsin4, Farrukh Jamal5* and Muhammad Faheem Bhatti6
...ng Service (CRS) for the period of last 10 years (2005-2014) containing 516 cases and 14,964 observations. Two different multiple linear regression (MLR) models are applied to study the relationship between the yield of rice (dependent variable) and the various factors (independent variables) which are affecting the rice crop production. The Model I is based on monthly average tem
Ghulam Murtaza1*, Ghulam Sarwar1, Noor-Us-Sabah1, Mukkram Ali Tahir1, Fakhar Mujeeb2, Sher Muhammad3, Muhammad Zeeshan Manzoor1 and Ayesha Zafar1
... summer, 2018. In this experiment water of 3 different types was applied coupled with addition of organic matter at 2 different rates. The experiment comprised of 9 treatments having 4 replications; T1 = canal water, T2 = saline water having EC value 2 dS m-1, T3 = saline water having EC value 3 dS m-1, T4 = T1 + organic matter @ 5 Mg ha-1, T5 = T2 + organic matter @ 5 Mg ha-1, T6 = T3 + o...
Muhammad Sohail Memon1*, Khadim Ullah1, Altaf Ali Siyal1,2, Naimatullah Leghari1, Ahmed Ali Tagar1, Khalil Ahmed Ibupoto1, Syed Tahir Ata-ul-karim3, Muhammad Tahir4 and Noreena Memon1
...the Physical chemical properties before and after the trial. Irrigation water was measured through cutthroat flume at each irrigation interval and the total water consumed by ridge ground was 500 mm. The solute transport and soil water content in the root zone was also simulated by HYDRUS-2D. The results reveal that the salts moved upward to the top (upper layers) and concentrated at the center of the ridge for treatments T2...
Muhammad Qaisar Nawaz*, Khalil Ahmed, Ghulam Qadir, Muhammad Rizwan, Muhammad Faisal Nawaz and Muhammad Sarfraz
...ntists to evolve a site-specific crop production technology which not only increases production per unit area but also ensure the quality of daily dietary crops. For this purpose, a series of field experiments were conducted during 2013 to 2015 with objective to optimizing the different levels of nitrogen and the cost-benefit sowing methods for turnip production under moderately salt-affec...
Basharat Hussain Shah*, Farrukh Siyar Hamid, Shams ul Islam, Naveed Ahmed, Fayaz Ahmad, Noorullah Khan and Qamar uz Zaman.
...e-130 and Line-140 developed in the background of Basmati-385 by Department of Genetics, Hazara University Mansehra Pakistan were evaluated along with check variety Swat-1 for yield and yield components. Experiment was conducted at National Tea and High Value Crops Research Institute (NTHRI), Shinkiari Mansehra during the rice growing season of 2017. Data were recorded on various growth parameters like plant height, tillers ...
Saleha Ashfaq1, Manzoor Hussain1, Nazish Bibi2, Jan Alam1, Muhammad Junaid2 and Sabi-Ur-Rehman3*
...or bacteria and fungi respectively. The cytotoxic assay results showed that methanolic extracts of stem and root of H. gilesii had toxic effects on brine shrimp larvae with LD50 values of 116.72 µg/ml and 168.16 µg/ml respectively. The antimicrobial and cytotoxic parameters reported can be considered as quality standards of H. gilesii in herbal industry. ...
Muhammad Asim1*, Asghari Bano2, Sikander Khan Tanveer3 and Muhammad Umair Aslam4
... using data of six genotypes, grown in four sowing windows over six years. The rainfed wheat productivity is predominantly determined by environmental conditions, particularly rainfall induced moisture availability. Hence, the best match between sowing time and the environment prevailed at that time emerged as an important yield determining factor. Overall, grain yield varied between 2.5-4.9 t/ha in these genotypes, between ...
Ibrahim Tapki1*, Huseyin Bahadir Ozalpaydin2, Nuran Tapki3, Mehmet Aslan4 and Muhammet Hanifi Selvi1
.../l oregano essential oil per kg milk respectively. The amount of the milk offered on daily basis was calculated as 10% of each calf live weight and was given in two meal times. All calves were kept in individual pens during experimental period. Calves got weaned following the consumption of daily 900 g of concentrate f...
Nihat Tekel1, Ilkay Baritci1, Halit Deniz Sireli1, Muhittin Tutkun1, Ecevit Eyduran2 and Mohammad Masood Tariq3,*
...nvestigate the fattening performance and carcass characteristics of Awassi x (Romanov x Awassi) G1 crossbred male lambs. In the study, seven male lambs whose weaning weights were almost similar were included in the experiment. The lambs were weaned at 2 months of age. They were fed with ad libitum concentrated feed and 100 g/day wheat straw was given to each animal during the fattening pe<...
Sameh S. Tawfik, Ahmed A. Elkady* and Ehab T. Mohamed
...se (CAT) and glutathione peroxidase (PGx) activities and reduced-glutathione (GSH) content and significantly limited the elevation in serum tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) levels when compared to irradiated rat group. The histopathological-findings of renal tissues in the irradiated-group, showed nephrotoxicity; the renal cortex showed massive necrotic changes, the convoluted tubules showed...
Naglaa M. Hagag1*, Mervat E. Hamdy1, Mary A. Sargious1, Sara M. Elnomrosy1, Nahed A. Ahmed1, Ayman A. Hamed1, Ahmed R. Habashi1, Essam I. Ibrahiem1, Mahmoud A. Abdel-Hakim2 and Momtaz A. Shahein1
...ion indicates that serotype SAT2 is widespread (in 96 cases), while only four cases of Serotype O were detected. Phylogenetic analysis of the study sequences indicates that the circulating FMDV serotype SAT2 viruses were homogeneous and related to Topotype VII. Importantly, the newly emerged viruses were closely related to strains isolated from Libya in ...
Nurlybay Kazhgaliyev1*, Talgat Kulmagambetov2, Dulat Ibrayev1, Saule Bostanova1 and Zhanat Titanov1
... among different animal species.We describe here the rationale and economics of adaptation of Aberdeen Angus and Hereford beef-producing animals brought from Canada and the Netherlands to Northern Kazakhstan. In order to investigate common zootechnic methods, daughters of imported Aberdeen Angus and Hereford cows were grouped at the age of 18-19 months with a live weight of no less than 350 kg. Groups were constituted using ...
Bamigboye Olutoyin Omolara1, Fapohunda Funmilayo Omotoyosi1, Oladipo Elijah Kolawole1,2, Oni Mattthew Olujenyo1, Ajibade Oluwatosin Akinola1, Kaka Mary Oluwatosin1*
... ± 1.27 years, respectively. Only six samples out of ninety-three HIV-positive samples were positive to HBsAg while fifty-four samples (58.1%) were positive for HBcAb however, HBeAg marker was negative among all samples. Interestingly, the prevalence of the HBV infection was more in females (66.6%) compared to the male counterparts (33.3%) within the overall screening. In conclusion, the current study describes the prevalence of HBV infection amongst HI...
Muhammad Rehan3, Asim Aslam3, Javeria Umber4, Muti-ur-Rehman Khan3, Waqar Azeem3, Hassan Aftab5, Ahsan Anjum3, Muhammad Abid6, Abdul Hameed Khan3, Hafiz Hasnain Ayoub5, Altaf Hussain2 and Muhammad Farooq Khalid1*
...ponse and anti-microbial peptides (AMPs) production which boost innate immune response. Hypovitaminosis D is a significant risk factor for infectious and non-infectious diseases however its exact mechanism is still unknown, but low levels of vitamin D has been detected in different diseased cases. Recent investigations have reported various cells of body exhibiting vitamin D receptors and CYP27B1 which is capable of converting inactive form vitamin D into biol...
Monica Paula Marin1, Elena Narcisa Pogurschi1*, Iuliana Marin2 and Carmen Georgeta Nicolae1
...ers. The natural, less expensive methods for improving the milk quality are the most studied by farmers and researches. Clinoptilolite, natural zeolite added to dairy cows diets, has been proven to be an efficient and economic solution. Starting from the fact that natural zeolites are recognized as having beneficial effects on the animal organism, being detoxifiers, immunomodulators, regulators of the internal pH, we studied the effect of using volcanic stuff ...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
... Glycoproteins (PAGs) in peripheral blood for early pregnancy identification in cattle, buffalo, goats and sheep. A total of 120 blood were taken from jugular vein of different breeds of cattle (Achai, Achai x Jersey, Holstein Friesian and Jersey), buffalo (Nilli Ravi, Aza Kheli and non-descript), goats (Beetal, Teddy and non-descript) and sheep (Bulkhi, Karri and non-descript). In cattle, the average sensitivity, specificit...
Anam Tariq, Alina Gul, Majida Atta Muhammad, Samia Falak and Naeem Rashid*
...the 19 amino acid signal peptide was cleaved between Ala19 and Gly20. It seems probable that the signal peptide of TK0522 can be used for secretion of other recombinant proteins produced in E. coli.
...
Ahsan Anjum1, Asim Aslam1, Raheela Akhtar1, Tahir Yaqub2, Muti-ur-Rehman Khan1, Rizwana Sultan3, Saba Usman1, Aneela Zameer Durrani4 and Muhammad Usman4*
...area) were seen in 34.69 percent lung samples, chronic type pleurisy in 97.96 percent, maximum aggregate pathological lesion score in 65.31%, while 48.98% lung samples had 6-10 numbers of sequestra. Besides, infiltration of inflammatory cells, congestion, hemorrhages, necrosis and other degenerative changes were observed in tissue samples of infected cattle. Significantly higher (P<0.05...
Yan-Guo Han, Yu-Qing Han, Jia-Yuan Wu, Jia Guo, Ri-Su Na, Yan Zeng, Guang-Xin E, Yong-Ju Zhao and Yong-Fu Huang*
... 6 or 9 of lactation, respectively. Serum SS, prolactin (PRL), growth hormone (GH) and insulin-like growth factor 1 (IGF-1) concentrations were detected by radioimmunoassay. The offspring lambs in T group showed significantly lower serum SS and higher PRL concentrations than those in the control group, and there were no difference between T group and the control group in terms of serum GH and IGF-1 concentrations. There was a significant negative correlation b...
Imdad Ullah Khan1, Shehla Gull Bokhari2, Mumtaz Ali Khan3, Ikramul Haq3*and Naimat Ullah Khan4
...ium, and replaced in the pelvic canal. The rectum and anal orifice were then reconstructed using the cruciate flap incision technique at the anal site.Finally, the urachal duct was identified at the apex of the urinary bladder, and excised after ligating itclose to the bladder wall. The calf recovered uneventfully after a post-operative antibiotic and antipyretic cover for 7 days.
...
Asim Faraz1*, Abdul Waheed1, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1 and Muhammad Shahid Nabeel2
...o compare the effect of open grazing/browsing system (OGS) and feeding green fodder in the stall-feeding system (SFS) as cut and carry system on the growth of male camel calves. Fourteen Marecha male camel calves were either grazed/browsed (n=7) on natural pasture and were offered seasonal green fodder (lucerne) ad lib in the manger (n=7). The calves were kept on these treatments for 4 months. Initial body weights of the calves were recorded at the star...
R. Yasmeen1*, S. Shaheen1, B.N. Khan2, S.S. Bokhari1, U. Rafi1 and A.W. Qurashi1
...Flame Atomic Absorption Spectrometery (FAAS) for four heavy metals such as Pb, Cd, Zn and Cu. The results showed all the metals were in safe range in feed samples, a very negligible amount was present in water samples and small concentrations were noticed in soil samples. The amounts of Zn and Cu in feed were reflected in fecal samples; however, higher amount of Pb and Cd were noticed in fecal samples compared to feed, water and soil. This showed inhala...
Abdul Samad1, Raheela Asmat2, Muhammad Naeem1, Hamida Ali3, Mohammad Zahid Mustafa1, Ferhat Abbas1, Jannat Raza1,3 and Muhammad Tauseef Asmat1*
... identify the prevalent species and genes associated with virulence. Only 10 (1.25%) samples were found contaminated with Listeria monocytogenes. Milk samples were the most contaminated as 4 samples collected from retail shops or dairy farm were found positive for Listeria. While 2 samples of each beef, chicken meat and salad were contaminated with Listeria. The virulent genes inlA, inlB, prfA, hlyA, a...
Jun Zhang, Kui Zhang, Zuozhi Chen*, Yane Jiang, Yancong Cai, Yuyan Gong and Wenming Yu
...ominant coral reef fish species in the South China Sea. The specimes were collected by hand-line in the lagoons of five representative coral reefs during June 2013 to September 2018. According to FishBase, this study provides first report on LWR of six studied species and practically available parameters on LWR for three species. The estimated b v...
Shahzad Khan1*, Inayatullah Jan1 and Syed Fahad Shah2
...veal that skillful and experienced tenants were given preference by the landlord. But due to non-availability of extension department and its trainings, illiterate and untrained tenants are involved in agricultural practices. The physical inputs and investment efforts lead to long term duration for the tenants which usually make interest of the landlord to offer the land on fixed tenancy contracts. Thus, tenants are unable to provide pro<...
Muhammad Bakhtiar Khan1 and Jangraiz Khan2*
...It was found that output per acre in tunnel was significantly higher than that of without tunnel. All the three vegetables viz tomato, cucumber and bottle gourd gave higher revenue, however tomato gave the highest return. Growing vegetables through tunnel farming involve higher cost in the shape of structure installation and inputs. Tunnel-farming is scientific farming and the growers need to be prop...
Yanyan Yu1,2,3, Yizhong Hu1, Qipeng Zhang1, Rongquan Zheng1,4,*, Bing Shen1, Shenshen Kong1 and Ke Li1
...rded and analysed the properties of 756 advertisement calls from 40 males at five reproductive stages and conducted single-stimulus phonotaxis experiments to estimate female preference for different acoustic parameters. Our studies have shown Q. spinosa may have female mating preferences and possible variations in calls at five reproductive stages (from April to September). Correlations were established between certai...
Haroon1,2, Yu-Feng Meng1, Zahid Khan1, Farzana Perveen2, Muhammad Ather Rafi3, Sayed Waqar Shah4, Xiao-Hong Su1 and Lianxi Xing1,*
...akistan. A total of 506 specimens collected out of which 252/506 were belonging to family Nymphalidae, 217/506 from family Pieridae, family Papilionidae represented only 37/506 individuals. With their abundance Danauas chrysippus (F130, F314 and D3 24.11), followed by Junonia orytha (F121, F310 and D3 11.86), while Papilio polytes, Junonia hierta and Euthalia garuda showed minimum (F12, F 31 and D3 0.2) of each s
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
..., mouse, and chicken, respectively. It showed that MC1R gene had a high conserved type among different species. The goat MC1R protein has a molecular mass of 34.65 ku, an isoelectric point of 8.70, which is weakly alkaline, and contains seven transmembrane domains typical of cell membrane receptor proteins. Sequencing analysis of the black, brown and white different color MC1R genes of Nub...
Anand Kushwaha, Amit Kumar, Aparna Madhavan, Durga Goswami, Golmei Poulinlu and Gnanavel Venkatesan*
...e in the development of specific and sensitive diagnostic assays and also effective vaccine candidates which are vital elements in control and eradication of any infectious disease from an endemic country. In this review, we describe different structures of mature pox virion with reference to vaccinia virus (VACV), list of immunogenic candidate genes presents in CaPV genome and their potential use in diagnostic/vaccine developments. ...
Majid Khan, Naveed Jehan*, Muhammad Zahoor and Nadia Naz
...verty Gap index were 8.3 percent and 0.016 percent for the Virginia tobacco growers and 42.52 percent and 0.076 percent for the non-tobacco growers, respectively. This shows that the Virginia Tobacco growers poverty status was better. Therefore, tobacco is recommended as cash crop in Charsadda District to reduce the po...
Ajmalud Din1*, Munir Ahmad2, Fahad Masoud Watto2, Sheraz Ahmed1, Imtiaz Ali1 and Muhammad Kausar Nawaz Shah2
...ptability of wheat genotypes to drought stress is an important objective in wheat breeding. This study was carried out to understand the effect of drought stress on growth and development, and to identify drought tolerant wheat genotypes. Thirty wheat genotypes of diverse genetic makeup were assessed in transparent polythene bags (6 × 27 inches), and filled them with sterile, homogen...
Kalpana Polisetty1* and Kiran Kumar Paidipati2
...at production during the period 1980-2016. Consequently, Sen’s slope estimator has been used to measure the magnitude of the trend for wheat production and their significances examined through Mann Kendall (M-K) test. The analysis provided a clear idea about the trends of wheat production over India. The results exhibit that all the states showed the raising trends. The notable observation is that the trend of Madhya P...
Tariq Mahmood Khalil1,2*, Muhammad Ajmal2, Taj Ali Khan2, Zia Ul Haq2, Muhammad Shahzad Khattak2 and Abdul Malik2
...omponents. The hydraulic performance of these drip emitters may affect the efficiency of irrigation schemes if not conforming to specified standards. The main objective of this study was to investigate the hydraulic characteristics including average flow rate, emitter exponent, distribution uniformity, emitter discharge coefficient of variation, and statistical uniformity of locally available drip emitters. These indices wer...
Muhammad Ramiz Murtaza1, Tahir Mehmood2*, Aziz Ahmad2 and Uzma Arshad Mughal3
...xport of Mango. About 80 percent of Mango exports come from Punjab province. Muzaffar Garh district stands at third position in producing good quality mangoes in Punjab followed by Multan and Rahim Yaar Khan. Present research was done to check the economics of mango production with and without intercropping and determined various factors that affect mango production in Muzaffar Garh. Simple random sampling technique was used to select 110 mango growers from 4 ...
Asif Yaseen1, Muhammad Israr2*, Allah Bux Khan1, Ahsan Javed3, Nafees Ahmad4 and Zia Ullah5
...es of greater importance pertaining to famers’ selection of high value market channels in the Pakistani citrus industry. The study employed survey technique to collect data from 300 citrus farmers in Punjab, and multinomial treatments effects were used to analyze the data. The results indicated though participation in traditional marketing channels (with intermediaries) is still profitable, high value marketing channels appe
Saleem Ashraf1, Raheel Saqib2*, Zakaria Yousuf Hassan3, Muhammad Luqman4 and Abdur Rehman5
...ors limiting benefits as perceived by the respondents. Correlation analysis unveiled that most of constraints impeding growers’ benefits were inter-correlated. This implies that resolving one barrier could limit another. This study urges a need to regulate middleman in marketing system through legislation and government should develop systematic marketing channels and support to develop fruits industry or value additio...
Gulfam Hassan1*, Ijaz Ashraf2, Muhammad Qavi Irshad3, Shafiq-ur-Rehman Zia2 and Muhammad Idrees4
... area and production, respectively. Peri-urban vegetable production is gaining importance in all over the world as it helps the farmers to access inputs and market outputs easily. Lack of sufficient training and low technical efficiency are some common barriers in low productivity of vegetables in Pakistan. This study assesses strengths and weaknesses of trainings conducted by public sector extension in peri-urban areas of F...
Yousaf Ali1, Muhammad Zamin1*, Ibadullah Jan1, Shahen Shah2, Muhammad Mazhar Hussain3, Fazli Rabbi4 and Muhammad Amin5
...xt-align: justify;">An experiment on the “Impact of different media on germination and emergence of tomato genotypes)” was conducted at National Agriculture Research Council (NARC) Islamabad, during June to August 2018. The experiment was laid out in Randomized Complete Block Design (RCBD) consisting of four planting medium treatments (compost, mixture, clay and sand) and six t...
Anwar Ali1*, Muhammad Irfan Ashraf2, Saeed Gulzar2 and Muhammad Akmal2
...oxberghii) an important species of subtropical pine ecosystems in the Himalayas. Data was collected through destructive sampling of 32 sample trees growing in subtropical pine forests of Hazara Forest Region, Khyber Pakhtunkhwa (KP), Pakistan. Diameter at Breast Height (DBH) of the selected sample trees ranged from (12-93 cm) and height (H) varied between 9.50-40.10 m. Allometric equation was developed through testing differ...
Hamoudi Naoual1, Alloui Nadir2*, Barberis Abdelhak2 and Boudaoud Amine2
...ify;">Migratory birds, especially Anseriformes, are a primary reservoir and the first source of the avian influenza virus (AIV) introduction. In 2016, following the first official detection of the H9N2 subtype circulation in broiler flocks in Eastern Algeria, a preliminary descriptive study is conducted to identify and enumerate in wetland areas, migratory bird species, known to carry the ...
Muhammad Usman* and Sajjad Ahmad
...o study this subfamily. Specimens were collected from different ecological zones of Khyber Pakhtunkhwa province of Pakistan in 2018. In this paper, Chablisea imbiba and Chablisea condimenta are described for the first time from Pakistan. Morphological description is provided and elucidated with digital images. ...
Faisal Azeem Abbassi1, Atta Ullah2, Muhammad Saim Hashmi1, Khadim Hussain1* and Nasim Akhter1
...vealed that district has performed best on physical capital (index value 0.63) and human capital (index value 0.59) dimensions. It was found that foreign remittance is the most popular livelihood strategy (29% of households’ main source of income) in the district. Apart from this, livelihood strategies are fairly diverse in different tehsils (sub-divisions) of the district. Results of Multinomial Logit Model demonstrate that human capital has the stronge...
Peng Ren1, Xian-Qing Liu1, Chao-Wu Yang2,3, Hua-Rui Du2,3, Xiao-Song Jiang2,3 and Yi-Ping Liu1*
...lele frequency and genotype frequency of SNP4 (A4812316G) were found to be significantly different (P<0.05) between the case and control groups. However, no significant differences were found in the haplotypes of SNP1 and SNP2 (P>0.05). These results suggest that SNP4 (A4812316G) in the 3’-UTR of the MyD88 gene is linked to genetic resistance to Salmonella Pullorum infection and may pr...
Tanveer Ahmad1, Tariq Mehmood1, Muhammad Shahid1, Adnan Ahmad1,2, Muhammad Asim Raza Basra1, Muhammad Zia-ur-Rehman3* and Munawar Ali Munawar1
...se tolerance test (OGTT) percentage analysis on Sprague Dawley (SD) rats at the dose of 20mg/kg using glibenclamide (GC). Among these synthesized pharmacophores, six compounds exhibited percentage reduction (20.47±2.54 to 44.97±2.16 %) and (20.79±1.55 to 37±2.94 %) in blood glucose level at 20mg/kg dose compared to glibenclamide (74±3.10 % reduction) 50mg/kg dose of glibenclamide after 2 an...
Muhammad Asif Gondal, Qazal Waheed, Sana Tariq, Waseem Haider, Aisha Khan, Qudsia Rasib and Haroon Ahmed*
...ributes like diversity, species richness and equitability of freshwater gastropods are important due to various reasons like intermediate hosts for many trematodes and bio-indicator. Snails are cosmopolitan in distribution and diversity of habitat to perform ecological performance is abosolute. The freshwater malacological information is sparse within Pakistan spe<...
Erum Yawar Iqbal1*, Ashfaque Ahmed Nahiyoon1, Shahnaz Dawar2 and Shahina Fayyaz1
...ure such as, cell-free supernatant, crude cell extract, bacterial culture and methanol extract in in vitro and green house condition have been exploited. The results have shown that different formulants of EPB produced significant effects on Aphid mortality, change in population density, population reduction and fecundity. Cell-free supernatant of new EPB species Xenorhabdus stei...
Yun-Feng Liu, Yong-Mei Guan, Dan Chen, Jia-Le Chen, Chen Jin, Wei-Feng Zhu, Lu Wu and Li-Hua Chen*
... by in vitro skin permeation were observed. The penetration quantity, infiltration rate and skin retention quantity of paeoniflorin in co-administrated with SSE were increased significantly (P<0.05). In the skin and brain, the peak concentration (Cmax) and the area under the concentration-time curve (AUC0→t) of brucine and strychnine in co-admini...
Dilara Abbas Bukhari*, Mehwish Faheem, Shamoona Arshad and Khalid P. Lone
... daily food intake for a period of 4 weeks. After 4 weeks, both male and female mice were sacrificed and kidneys were taken out. Biochemical parameters e.g., lipid peroxidation (LPO), catalase (CAT), glutathione-S-transferase (GST), reduced glutathione (GSH) were determined to evaluate oxidative stress while urea and creatinine, was used to evaluate kidney function. It was found that there was an increase in weight (p<0.0...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool4, Laraib Liaquat3, Fatima Ahmed5, Asra Khan1, Tahira Perveen3, Mirza Jawad ul Hasnain6, Saima Khaliq7 and Saad Bilal Ahmed8
...ken meat over a six-week period. Plasma levels of tumor necrosis factor alpha (TNF-α) and alpha-fetoprotein (AFP) were estimated before and after the administration of different meals. After the experiment, the liver samples were weighed and histopathologically evaluated using a knodell score to assess portal hypertension and liver damage. Animals fed with commercial chicken meat and...
Nahed H. Ghoneim, Maha A. Sabry, Zeinab S. Ahmed and Esraa A. Elshafiee*
... An additional 50 stool specimens were collected from individuals in contact with the examined chickens. Eleven Campylobacter isolates were recovered through bacteriological examination. Campylobacter spp. were identified by polymerase chain reaction (PCR) as C. jejuni (63.6 %) and C. coli (36.4 %) through the detection of the Map A and Ceu E genes, respectively. The antibiotic resis...
Bhandari Jyoti1,2, Yasen Shali3, Zhang Zehua4, Yao Xiaoho5, Deng Jiang3, Zhang Yaling5, Wang Cuiling5, Li Yang5, Lei Xueping5, Wang Wenfeng5, Mohammad Farooque Hassan6 and Li Can1,*
... of the most destructive pests in Tibetan region. To effectively control their spreading, a clear understanding on the species traits is necessary. In this study, the population dynamics, life history and spatial distribution pattern of L. m. tibetensis Chen were explored on meadow and farmland of the Tibetan plateau during 2012. The first objective of this study was to investigate the population dynamic and life hist...
Muhammad Afzal1, Mahroze Fatima2, Aasma Qamar1, Muhammad Farhan1 and Syed Zakir Hussain Shah3,*
...ta juveniles. Four experimental diets were prepared by supplementing citric acid (0 and 2%) and phytase (0 and 1000 FTU/kg) in 2×2 factorial arrangements. Total 180 juveniles (3.45±0.013) were distributed to 12 tanks having triplicate tank for each test diet. Weight gain of each replicate was recorded on weekly basis. Results showed that growth of L. rohita juveniles was significantly improved by the supplementation of CA and PHY. Impro...
Ramazan İlgün1*, Nilgün Kuru2, Ferhan Bölükbaş3 and Fatih Mehmet Gür4
...ed using a light microscope the tissues and papillae of the tongue were examined with a the scanning electron microscope, and photos of the general histologic structures were taken. The tongue was triangular shaped, and consisted of apex, corpus, and radix sections. The dorsal and ventral surfaces of the tongue were covered by a keratinised stratified sq...
Gasem Mohammad Abu-Taweel
...actation through weaning period. Overall, mercury chloride administration had direct influence on the social behavioural and blood parameters in the mice offsprings.
...
Nafeesa Batool1*, Javed Iqbal Qazi1, Nida Aziz1, Ali Hussain2 and Syed Zawwar Hussain Shah3
...42.2, 56.66 and 40 %, respectively. The volatile solids reductions were 82, 79, 59 and 71 % for MCC, FW, DM and FW + DM, respectively. These results indicate that FW and DM are very desirable substrates for AD and their Co-AD upturns the biogas generation efficiency. Thus, we can conclude that BMP assays are extremely useful to determine the amount of bio-methane and bio-degradability of the organic substrates and would faci...
Elmas Ulutaş1,*, Abdullah Eryavuz2, Aziz Bülbül2, Abdur Rahman3,*, İsmail Küçükkurt4 and Cangir Uyarlar5
...ntaining 31.76 ppm Zn, experimental group 1 fed with basal diet supplemented with 500 ppm Zn, experimental group 2 fed with basal diet supplemented with 750 ppm Zn and experimental group 3 fed with basal diet supplemented with 1000 ppm zinc sulphate. The investigation was started after 15 days of adaptation period and lasted for 30 days. On days 15 and 3...
Jam Nazeer Ahmad1,2*, Rashid Mushtaq1, Samina Jam Nazeer Ahmad1,2*Mubasher Ahmad Malik1, Mujahid Manzoor1, Muhammad Tahir2, Zubair Aslam4, Sumaira Maqsood5, Ishita Ahuja3 and Atle M. Bones3
...used against destructive pests such as S. litura. This strategy also has a great potential in insecticide resistance management (IRPM) against such pests in vegetable and major crop growing areas of Pakistan.
...
Peng Peng1,3, Xiaopeng Tang2*, Dun Deng3, and Rejun Fang1*
...guar meal (GM) on growth performance of meat ducks, to explore the possibility of GM as an alternative protein resource in meat duck diets. Firstly, the chemical composition, dry matter (DM) digestibility, metabolic energy (ME) were determined. Secondly, a total of four hundred eighty 15-day-old Shuanggui-tou meat ducks were divided into 4 treatments, 1) Control group (0% GM in the diet), 2) 3% GM group (3% GM in the diet), 3) 6% GM group (6% GM in the di...
Dilawar Khan1*, Arif Ullah2, Zainab Bibi1, Ihsan Ullah1, Muhammad Zulfiqar4 and Zafir Ullah Khan3
...-align: justify;">This paper forecasts guava area and production in Pakistan using time series data over the period 1997-98 to 2014-15. The study used the Box Jenkins approach and forecast was made up to the period 2029-30. The order of ARIMA model was identified using autocorrelation function (ACF) and partial autocorrelation function (PACF). Suitable model for area and production of guav...
Malak Atiq Ullah Khan1*, Fida Mohammad2, Fahim Ullah Khan3, Sheraz Ahmad2, Mian Ahmad Raza1 and Tariq Kamal1
...ess the pattern of genotype by environment interaction (GEI) effects on yield using multiple stability models viz. Additive Main effect and Multiplicative Interaction (AMMI), GGE biplot analysis and stability parameters. Eighty-one wheat genotypes were evaluated during three consecutive years (2013/14, 2014/15 and 2015/16) across nine environments (sites × year combination) in Khyber Pakhtunkhwa, Pakistan. Graphical st...
Saba1, Shahnaz Akhtar1, Waqar Khalid2* and Saifullah Khan3
...e engaged for 4.81 hours per day in the livestock management practices. The multiple regression results illustrated that women’s education, family size, and livestock income significantly affect women’s participation; however, women’s age and herd size insignificantly affect women’s inclusion in the livestock farming operations. The findings of this study recommend that the importance of rural women&r...
Iqbal Javed1, Abdur Rehman2*, Farhana Khaliq1, Amar Razzaq3, Mudassar Yasin4, Ghulam Mustafa5, Allah Bakhsh6 and Raheel Saqib7
...text-align: justify;">Competitiveness is defined as the ability of a country to offer commodities that encounter domestic and worldwide quality standards and provide satisfactory returns on the resources which is used in production of a commodity. Nominal protection coefficient (NPC) is projected for the time period of 2003 to 2016 for using as a dependent variable in the current study. To...
Mohammad Aquil Siddiqui1*, Muhammad Tahir Khan1, Ghulam Shah Nizamani1, Shafquat Yasmeen1, Imtiaz Ahmed Khan1, Abdullah Khatri1 and Nighat Seema Soomro2
...of the plants as an indispensable tool for crop improvement. This field study was initiated to evaluate three potential mutant lines of lentil against their parent (M-85) and two check varieties (NIA-Masoor-05 and NIA-Masoor-16). The pooled data of the crop, after two years of evaluation, indicated the earliest maturity in the mutant AEL-40/30 (92.0 days). Plant height was observed to be low in all the studied mutant lines (AEL-40/30, AEL-13/30 and AEL-12/30) ...
Nihat Yeşilayer*
...conducted on three fish species to investigate the relationship between total carotenoid concentration (TCC) and flesh colour, determined by visual and colorimetric methods, of three fish species. Linear relationships were observed between CIELAB colour measurements (lightness-L*, redness-a*, yellowness-b*, hue-H°ab and chroma-Cab), DSM SalmoFan card scores and TCCs. The redness (a*) was mostly correlated with TCC...
Nadeem Munawar1,2*, Tariq Mahmood2, Paula Rivadeneira1, Ali Akhter2 and Saqib Mehmood2
...cture and complexity, temperature, rainfall, crop productivity, predation, trampling and grazing, surrounding landscape, and succession of the natural wild vegetation. Livestock grazing, cutting, harvesting (for fuel wood and animal feed) and burning of field boundary vegetation are common practices that affect rodents and their habitat. During crop season, local farmers in the Pothwar agro-ecosystem in Pakistan do not manag...
Muhammad Ilyas1, Sardar Ali Khan1, Shahid Iqbal Awan1, Shafiq-ur-Rehman1, Waqar Ahmed1, Muhammad Riaz Khan2, Raja Mohib Muazzam Naz2, Muhammad Mohib Ullah Khan3 and Sumaira Hafeez1*
...easurement of phenotypic performances of certain quantitative traits on as many as possible plant individuals in basic experimental generations. Initially, 108 inbred lines of maize were planted in two separate trails under water deficit and normal irrigation conditions in the experimental field of Department of Plant Breeding and Molecular Genetics. Selection of parents for further study ...
Tanweer Ahmed1*, Kashif Saeed Khan1, Zilakat Khan Malik1, Fazal Wahid1 and Muhammad Nadeem Iqbal2
...se the impact of public spending on economic growth in Pakistan. Various econometric techniques have been applied to estimate the relationship among public spending on education, health, road length, defence, trade openness, worker remittances, total cropped area and economic growth. Pakistan’ economic growth rate fluctuated from 1972 to 2014. Duri...
Tian-Yi Zhao1, Zi-Qing Liu2, Shu-Fei Ma3, Bo-Yang1, Fan-Fan Guo1 and Ming-Hua Duan1*
...ether, biatractylolide appeared to be a useful agent for the treatment of Aβ-related pathologies in the central nervous system, and can be considered for therapeutic application in AD-affected patients.
...
Su-Hu Duan, Liu-An Li*, Zai-Qiang Li, Meng-Ran Qin, Zhen-Zhen Fan, Qian Wang, Ke-Yan Zhang, Zhong-Mou Zhang, Bai-Liang Yang and Tian-Ming Jin
...est samples, totally 7 types of SFA, 7 types of MUFA, and 8 types of PUFA were detected. Specifically, no significant difference was found in the content of C14:0~C18:0 (P>0.05). The content of C16:0 in the yolk of both native eggs and ordinary eggs was high; in the yolk of native eggs of the three brands, the content of C14:1 and C16:1 was bot...
Abdüssamet Aydın1 and Ş. Canan Bölükbaşı2*
...vestigate the effects of pennyroyal extract supplementation at different levels (0, 32.5, 65 and 130 mg/kg) and 50 mg/kg BHA (Butylated hidroxyanisole) into diets of laying hens on performance, egg quality traits, thiobarbituric acid reactive substans (TBARS) of yolk, the contents of malondialdehyde (MDA), superoxide dismütase (SOD) and glutation pe...
Mingsan Miao*, Hui Zhao, Jiaojiao Jia, Xiaoyan Fang and Yanyan Miao
... the cerebral ischemia-reperfusion mice model and to assess the protection mechanism of cerebral ischemia-reperfusion injury. The repeated cerebral ischemia-reperfusion mice model was used where bilateral common carotid artery was targeted to block blood flow, reperfusion and then re-blocking the arteries. Brain tissue...
Ju Zhang1,2, Dong-Sheng Jia3, Shi-Hao Zhao1,2, Xiao-Liang Xie3, Hong Chen4 and Hai-Feng Li4,*
...escence assays in wild-type C. elegans N2. Calorie restriction pathway was detected by pharyngeal pumping rate assay and lifespan examination in sir-2.1 mutant nematodes. The antioxidant activity of HGQ was investigated by determining reactive oxygen species (ROS) level, paraquat-stress survival rate, malondialdehyde (MDA) content as well as superoxide dismutase (SOD), catala...
Chen Shi, Jianlong Zhang and Guanghui Teng*
...ly. In this study, the experiment adopted a management and data acquisition system based on LabVIEW, which automatically acquired and recorded the body measurements and body weights of 30 pigs during 90-day grower-finisher stage. Three body ratios between two each body measurements showed that the body length and width were the major parts of growth and development of pigs during 70 to 110 days old. The growth stages of grower and finisher were divided by thre...
Guoan Yin1,2, Lei Wang1, Xiaoyu Zhao1, LangchaoYu1, Liwei Guan1 and
Dapeng Huang1,2*
...s or free pens during pregnancy and lactation. Total 12 gilts were reared in three types of environments randomly during pregnancy and lactation, including gestation pens and farrowing crates (PC), gestation pens and farrowing pens (PP), or gestation rates and farrowing crat...
Masaud Khan1*, Muhammad Jamal Khan1, Shahab Ahmad2, Asad Ali3, Numan Khan3 and Muhammad Adnan Fahad4
Muhammad Ilyas1*, Sardar Ali Khan1, Shahid Iqbal Awan1, Shafiq-ur-Rehman1, Muhammad Riaz Khan2 and Sumaira Hafeez1
... indicating a dominant type of gene action. Heterosis was high for both crosses along with high inbreeding depression. All these results exhibit that the hybrid breeding is the best option for inbreds to exploit their potential. ...
Mudassar Rashid1, Zuhair Husnain2, Usman Shakoor1* and Muhammad Iftikhar ul Husnain1
...uctivity are: rise in temperature, heavy rainfall, precipitation, floods and drought etc. This paper has empirically examined the effect of climatic variations on cotton productivity in Pakistan. In order to evaluate the climate change, three climatic variables (rainfall, max. temp and min temp) and three non-climatic variables (technology, fertilizer and area) had been used for analysis. Historical climate data from 1981-20...
Haidar Ali1*, Malik Muhammad Shafi1, Himayatullah Khan1 and Hamra Haidar2
...-align: justify;">This paper examines the comparison of off-farm employment among developed and under developed villages in Peshawar Valley of Khyber Pakhtunkhwa-Pakistan during February 15 to July 27, 2018 by using research tools such as interview schedule. A sample of 298 small farm households were selected using random sampling technique for this study. Analysis showed that small farmer...
Sanaullah1*, Urooba Pervaiz1, Shahid Ali2, Mohammad Fayaz2 and Aftab Khan2
...tiple regression and independent sample t-test. Results indicated that extension visits, involvement in agriculture, adoption of recommended farming practices, irrigation and HYVs had significant effect, while disease, fertilizer and pesticide had non-significant effect on maize yield. Nevertheless, adoption of recommended technologies were low due to some constraints in the study area out of which low income of the families...
Derya Kocamaz* and Elif Oruc
...then left to depurate in pesticide-free water for 7 days. Results showed that acetyhcholin-esterase, catalase and estradiol/testosterone levels decreased, while the amount of etoxyresorufin-O-deetylase (EROD), superoxide dismutase (SOD), glutathione S-transferase (GST), glutathione (GSH) and protein carbonil (PCO) increased in comparison to the control. After the recovery period, EROD, GST...
Irfan Shahzad Sheikh, Masroor Ahmad Bajwa, Nadeem Rashid, Muhammad Zahid Mustafa, Mohammad Masood Tariq*, Majed Rafeeq, Abdul Samad, Tauseef M Asmat and Asad Ullah
...ulators on the immune competence of broiler chickens. In three experiments (n=240 chicks in each), the immune modulators vitamin C (500 mg/l), vitamin E (200 mg/l), dietary nucleotides (100 mg/l) and DNA (100 mg/l) extracted from chicken liver were separately offered on days 1-21, 1-42 and 22-42 in experiments 1, 2 and 3, respectively. Under standard bro...
Sana Aslam1, Wayne Thomas Shier2 and Imran Sajid1*
...te profiling using ultra performance liquid chomatography and mass spectrometric (UPLC-MS) analysis suggested the presence of a variety of bioactive compounds including totarol, kifunensine, talaromycin and clausine F. These results indicated that Kallar Kahar Lake harbors a significant diversity of actinobacterial strains which are able to produce a diverse range of biotechnologically and pharmaceutically potent compounds. ...
Sevil Demirci*, Aydın Demirci and Emrah Şimşek
...om 6.90 and 150.99 g, respectively. Length-weight relationship parameters were calculated for all individuals as a= 0.0106 and b= 3.09, and isometric growth was determined. The population constituted five age-classes (0–IV years). Four growth models used to identify the growth characteristics were von Bertalanffy, Logistic, Richards, and Gompertz growth models. Growth type<...
Muhammad Faheem Akbar1,*, Muhammad Abdul Haq2, Imtiaz Ahmad1, Vasileva Viliana3 and Amjad Sultan1
...event adverse effects of pesticides on human, it is a must to establish control measures in order to ensure maximum residue limits (MRLs) to be respected. Considering the concerns about pesticide residues in food and their environmental impacts, this study designed to find out the biological degradation of conventional and bio pesticides sprayed on cauli...
Using Smartphone Application to Estimate the Defoliation Caused by Insect Herbivory in Various Crops
Muhammad Irfan Ullah1*, Muhammad Arshad1, Sajjad Ali2, Asad Abdullah1, Samina Khalid3, Hafiz Muhammad Aatif4, Syed Muhammad Ali Zahid1, Muhammad Afzal1 and Jaima Molina-Ochoa5
... damage are relatively expensive and are mainly dependent on complex and state of art devices and instruments. Instead, smartphone application may be a good source to measure the foliar damage. In this study, foliar damage of Spodoptera litura Fab. (Lepidoptera: Noctuidae) on sunflower and soybean crops was measured using BioLeaf android application. The infected leaves due to citrus canker were also tested using BioLeaf for...
Stanley Uchenna Onwudike* and Vivian Chizoba Edoziem
...me variations in soil properties and inorganic phosphorus forms within the rhizosphere of three annual crops, viz groundnut (Arachis hypogea), bean (Phaseolus vulgaris) and okra (Abelmoschus esculentus) on a loamy sand, typic haplustult soil. The work was sited at the research farm of the University during 2016 planting season and the region lies within the latitude of 5° 38¹N and longitude 6° 97¹ E. At 10 weeks after planting, both the rhizo...
Mahfooz Khan* and Himayatullah Khan
...ample size constituted 5 percent of total farm households in selected villages of district Peshawar. A multinomial logistic regression model was used for choice of alternative energy sources for cooking purpose. Results of the study showed that income of farm households, education level of household head and cooking cost had significant effect on the use of electricity, firewood and natural gas as against animal dung cakes for cooking purpose which was the bas...
Abdul Kabir¹, Amjad Hussian Mirani¹, Jam Kashif1, Shumaila Manzoor2, Abdullah Iqbal3*, Ihsan Ullah Khan4 and Muhammad Abubakar2
...) of sheep and goats. Competitive ELISA was performed to evaluate sero-prevalence of PPR in goats and sheep. The swab and tissue samples were collected from the surrounding areas from suspected sheep and goats to confirm the PPRV. Out of total 246 sera, 144 (58.54%) samples were found seropositive for PPRV. PPR was more prevalent in sheep (61.82%) as compared to goats (55.88%). In sheep po...
Muneer Abbas1*, Muhammad Ramzan1, Khalid Hussain1, Abdul Ghaffar1, Niaz Hussain1, Muhammad Irshad1, Mudassar Khaliq1 and Sohail Abbas2
...e.
...
Kanwal Nisa1, Sadaf Ashraf1, Masood Ahmed Siddiqui1*,Naila Taj1, Habib-Ur-Rehman1, Arifa Bano1 and Naeem Rashid2
...ictly anaerobic sulfur dependent archaeon that grows optimally at 85oC by a fermentative type metabolism. An extremely thermostable bifunctional enzyme, which exhibits pyruvate ferredoxin oxidoreductase (POR) and pyruvate decarboxylase (PDC) activities, was purified to an apparent homogeneity from this archaeon. The purified enzyme exhibited optimal activities at 95oC for POR and 90oC for PDC...
Abdurakhim Kuchboev1, Mehmonjon Egamberdiev2, Rokhatoy Karimova1, Oybek Amirov1 and Mitsuhiko Asakawa3,*
...e total number of larvae per snail varied from 8 to 110 individuals. Alignment of the first four sequences of 28S rDNA was revealed a 99-100% similarity to D. dendriticum. Larvae from P. sogdiana snails were 98% similar to Brachylaima sp. In this study, it was confirmed that 2 species of terrestrial snail, X. candacharica and A. gereliana, act as the first intermediate hosts of D. dendri...
Jun Yan Bai*, Hong Deng Fan, You Bing Yang, Xu Wang, Heng Cao, Xue Yan Fu and Yu Qin Wang
...i fatty tailed sheep, dorper sheep, hu sheep all have two mutation sites (C155T and C624T). For locus C155T, allele frequencies of C in large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep and hu sheep were 0.73, 0.83, 0.54, 0.69 and 0.68 respectively, which indicated that C was the dominant allele in five sheep populations. For locus C624T, allele frequenc...
Jun Yan Bai*, Xiao Hong Wu, Shuai Yang, You Zhi Pang, Heng Cao, Hong Deng Fan, Xue Yan Fu, Kun Peng Shi and Xiao Ning Lu
...stigate the early growth performance of French giant quails and Savimito quails.In this study, body weight, tibia length, chest depth, chest width, sternum length, body length and tibia circumference of 3-5 weeks old meat quails were measured.The results showed that the at 3-5 weeks of age, the body weight, chest depth, body length, shank length, and sternum length of the French giant female quail were significantly higher than those of the Savimite female qua...
Mounir R. Abi-Said1, Mohammad Al Zein2, Mohammad A. Abu Baker3 and Zuhair S. Amr3,4*
...Arabia. 112 regurgitated pellets yielded 203 individual prey items representing at least eleven rodent species, unidentified bird(s), at least one scorpion, and other unidentified insects. Prey items were dominated by rodents (91%) which were found in 96.4% of the pellets. Birds, scorpions, and other insects constituted 2.46, 5.91, and 2.96% of the diet, respe
Kadir Seyhan1,*, Nimet Selda Başçinar2, Nadir Başçinar3 and Umar Khan3
... was fed with commercial pellets under similar conditions to avoid the ingress of any other variable such as temperature and dietary energy density. Their stomach contents were sampled at predetermined postprandial times, and were dried at 60° C to constant weight. The course of GE in both sizes of S. fontinalis fry was best described by the square root model. The relationship between GER and body mass was then de...
Muhammad Younis Laghari1,2, Zixia Zhao1, Yiwen Gong3, Punhal Lashari1,2, Shangqi Li1, Jian Xu1 , Ateeque Rahman Khooharo4, Jiongtang Li1,* and Yan Zhang1*
...t important aquaculture species in the world. In China, due to the geographical isolation of Hainan island from the mainland, the genetic diversity in Hainan island is different to that in the mainland. One of fifty sequences isolated from SINE element was polymorphic, including six haplotypes with an average sequence divergence of 11.03% (SE = 0.78%). Four haplotypes (MF177501-MF1775...
Savas Atasever*, Huseyin Erdem and Ibrahim Cihangir Okuyucu
...e and a 1 to 4 scale, respectively, where lower points indicate thin body condition or relatively empty rumen. Animals were examined in two subgroups by parity (1= lactation number 1 and 2; and 2= lactation number ≥ 3) and stage of lactation (1=≤121 d, and 2= ≥122 d). While both BCS and RFS were not affected by non-genetic factors (farm, parity and stage of lactation), moderate correlation coefficient (r=0.536) was calculated between two traits. ...
Jun Yan Bai1*, Xiao Ping Jia2, Xiao Hong Wu1, Guang Lu Li1, Heng Cao1, Xue Yan Fu1 and Kun Peng Shi1
...397, 0.500 and 0.426, respectively. One SNPs mutation site (C219T) was detected from the exon 9, C allele frequencies of C219T in Beijing white quail, China yellow quail and Korean quail were 0.125, 0.250 and 0.000, and the T allele frequencies were 0.875, 0.750 and 1.000, respectively. Two SNPs mutation sites (A39G and A41T) were detected from exon 7, A and G allele frequencies of A39G in Korean quail, Beijing white quail a...
Chandragouda M. Patil, Shashikant S. Udikeri* and Shreeshail. S. Karabhantanal
...>Koch population from grapevine orchard indicated considerable survival on dicofol 18.5 EC, fenpyroximate 5 SC, diafenthiuron 50 SC, sulphur 80 WP, abamectin 1.9 EC, hexythiazox 5.45EC, spiromecifen 240SC, propargite 57% EC, ethion 50EC, fenazaquin 10%EC treated leaves. Field populations had high degree of resistance to Sulphur 80WG with LC 50 of 17769.72 ppm against 651.17 ppm for a laboratory susceptible strain. Thus 27.30 fold resistance ratio wa...
Muhammad Rasheed*, Tayyaba Naseer, Asma Hassan, Fayaz ul Hassan, Rifat Hayat, Ghulam Jilani, Samman Gul Vaseer and Muhammad Bilal Ali
...h of legume crops. The experiment was conducted to access the effect of isolated bacteria from nodules on growth and nodulation of the lentil cultivars. Different cultivars were used in this experiment; Markaz 2009, Masoor 2009 and NIA 2005 treatments were used viz BS0 (control), (Pseudomonas stutzeri), BS2 (Lysinibacillus pakistanensis) and BS3 (Pseudomonas stutzeri + P2O5@40kg/h). Application of BS3 enhanced the plant heig...
Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui2
...ication of any new genotype through traditional practices requires interminable period of time. Eight sugarcane genotypes viz. NIA-2004, SPF-234, NIA-2012, BL4, AEC92-1208, Thatta-10, Gulabi-95 and NIA-1026-P7 were subjected to tissue culture using four different combinations of shoot induction media and three disparate recipes of rooting media. It was s...
Jun Yan Bai*, Hong Deng Fan, Shuai Yang, Xue Yan Fu, Heng Cao, Xiao Hong Wu, You Zhi Pang and Kun Peng Shi
...put and short production period. To recognize molecular markers of egg quality of quail, SNP in control regions of cytogenin gene (MyoG) 5’ in China yellow quail, Beijing white quail, Korean quail detected by PCR-SSCP method in this study. Moreover, correlations of control regions of MyoG 5’ with egg quality of quail were analyzed. Results demonstrated that: In egg quail group, six genotypes were detected in Locu...
Amna Shoaib*, Zoia Arshad Awan and Naureen Akhtar
...aflatoxins producer Aspergillus minisclerotigenes and Aspergillus flavus are morphologically similar species that belong to the Aspergillus section Flavi. A. minisclerotigenes and A. flavus were isolated from soybean and okra seeds, respectively. The isolated s
Wen Xiong1,2*, Qitao Zeng2, Dangen Gu1 and Yinchang Hu1*
...re and our investigation pertaining to Gambusia affinis and G. holbrooki. The value of the slope b ranged from 2.44 for male G. holbrooki in Tajan River (Iran) to 3.81 for combined G. holbrooki in reservoirs of Segura River basin (Spain). The mean value of b was 3.11 (SD =0.30), which significantly higher than 3 (t-test, p<0.05). The median value of b was 3.15 and 50% of th...
Fatima Hashim Abbas1,2* and Alaa Tareq Shakir Al-Hassnawi1
...s study. Levels of lipid peroxidation (MDA level), catalase activity (CAT), total antioxidant capacity (TAC) and reactive oxygen species (ROS) were measured in the serum of all studied groups. MDA levels were significantly higher (p≤0.05) in aborted women with T. gondii compared to negative control. MDA levels were also significantly higher (p≤0.05) among aborted women with Cytomegalo virus compared to negative ...
Farzana Rashid1, Rabia Masood1 and Mariam Faiz2*
..."font-size: small;">Carbapenem resistance conferred by metallo-β-lactamase (MBL) has increasingly being reported worldwide among Enterobacteriaceae. In this study, 240 non repetitive gram negative clinical isolates were studied for antimicrobial resistance. Presence of bla NDM was determined by polymerase chain reaction. Among 240 strains, prevalence of MBL in K. pneumoniae, P. aeruginosa, E. coli and Acinetobacter S
Mubashra Salim1, Omeira Ibrahim1, Hugo Vilhena2,3,4, Carla Maia5, André Pereira5, Maria Shahzeen1, Shabana Kalsoom1, Asim K. Mahmood6 and Furhan Iqbal1*
...s collected from various pet clinics in Pakistan, by Polymerase Chain Reaction (PCR), using 16S rDNA as the target sequence. Clinical and epidemiological data was collected in all animals included in the study. M. haemofelis and C. Mycoplasma haemominutum DNA was detected by PCR respectively in 6.8% (10/148) and in 18.2% (27/148) of cat blood samples. Of these, two animals were co-infected with both agents. Seq...
Ahsan Numan1,4, Khadija Irfan Khawaja2, Abdul Basit Qureshi3, Muhammad Shahbaz Yousaf4, Imtiaz Rabbani4, Hafsa Zaneb5 and Habib Rehman4*
...n previously diagnosed Type-2 diabetic subjects in Lahore, Pakistan during April, 2013 to June, 2013. The DSP was diagnosed using the Michigan Neuropathy Screening Instrument Score. Blood was collected during the examination for the determination of various serum biochemical determinants. Prevalence of DSP was found to be 31.48% when 2,290 diabetes mellitus Type-2 subjects were screened. The patients with DSP were older (p &...
Asim Faraz1,*, Abdul Waheed1, Riaz Hussain Mirza1, Muhammad Shahid Nabeel2 and Hafiz Muhammad Ishaq1
...nagement, Barela camel appears as a camel breed with a good dairy potential. Moreover, according to its gross composition (fat, protein, lactose, SNF and total solids percentages being 4.26, 3.62, 4.84, 9.02 and 13.28, respectively), Barela milk appears particularly rich compared to literature data. A long term monitoring, notably throughout the lactatio...
Veli Sel1, Isa Yilmaz2,* and Mete Yanar3
...t when the milker is the person from the household. The udder cleaning before milking was a significant factor (P <0.001), SCC was 66.330±2.570 cells/ml for the producers that applied hygiene and was 125.860±9.500 cells/ml for the ones that did not. Season was determined to be significant factor (P <0.001) and SCC values were 52.290 ± 5.653 cells/ml, 69.990 ± 3.557 cells/ml and 104.810 ± 6.258 cells/ml for winter, sprin...
Tasbihullah1, Sadeeq ur Rahman2,*, Tariq Ali3 , Umer Saddique1, Shakoor Ahmad1, Muhammad Shafiq4, Sultan Ayaz2, Hamayun Khan1, Ijaz Ahmad1 Asadullah2, Raheela Taj5, Hafiz Nidaullah6 and Alamgir Khan7
...e incidence of extended spectrum β lactamase (ESBL) - producing Escherichia coli in table eggs and human with history of close association with table eggs. For this purpose, a total of 200 table eggs and 50 stool samples from human were analyzed. Results showed that out of 80 E. coli isolates recovered from eggs, 20 (25%) were found to be ESBL-producers, while, of the 17 human-isolates, 4 (23.5%) were ESBL producers. PCR revealed that bla...
Saeed Murtaza1, Abdul Sattar1*, Nasim Ahmad1, Muhammad Ijaz2, Maqsood Akhtar3 and Muhammad Shahzad4
...le="font-size: small;">Repeated use of exogenous oxytocin in newly calved buffalo has made buffalo breeder anxious about its reproductive and productive performances. Moreover, misconceptions about its harmful effect on public health are increasing day by day during postpartum period when animal has been already in stress. To know effect of oxytocin injection on cervix, uterus and milk com...
Nazia Qamar1,2*, Sher Khan Panhwar2 and Wang Ping1
...: small;">In this study, periodic changes of population dynamics of high valued shrimp species Exopalaemon styliferus (112), Metapenaeus monoceros (265), Parapenaeopsis stylifera (688) collected from September 2017 to April 2018 by Estuarine Set Bagnet are discussed. High linearity (>0.8) among parameters was estimated by fitting ...
Ahmet Ozer Sehirli1,2, Serkan Sayiner3*, Ayliz Velioglu-Ogunc4, Nedime Serakinci5, Emel Eksioglu-Demiralp6, Berrak Yegen7, Feriha Ercan8 andGoksel Sener2
...d NAC were applied intra-peritoneal alone or in combination. Blood pressure and heart rate were monitored at weekly intervals over a period of six weeks. Serum creatinine, blood urea nitrogen (BUN), lactate dehydrogenase (LDH) activity, cytokines (TNF-α, IL-1β, IL-6) concentrations, urinary volume, creatinine, and both serum and urinary electrolyte levels were measured. In addition, the apoptosis rate of white blo...
Babar Khan1,2 *, Nazir Javed1, Sajid Aleem Khan1, Nasir Ahmed Rajput1, Muhammad Atiq1, Abdul Jabbar1, Abdul Rehman3, Anam Moosa1 and Muhammad Amjad Ali1*
...st several soil dwelling pests. The following research demonstrates the reproductive potential of EPN specie Steinernema kraussei against last instar larvae of four lepidopteran insects, wax moth (Galleria mellonella), pink bollworm(Pectinophora gossypiella), eggplant fruit borer (Leucinodes orbonalis) and armyworm (Spodoptera litura)at 27±2°C under laboratoryconditions. The resu...
Weigeng Wen1,2,3, Xu Chen1,2,3, Wang Zhao1,2,3, Qibin Yang1,2,3, Jian G. Qin4 and Zhenhua Ma1,2,3,*
...us three-year breeding experiment. After unilateral eyestalk ablation, the relationships of egg and nauplii at the first spawning event and female bodyweight were evaluated. At each spawning, a female could produce 120000-1250000 eggs which hatched into 80,000-950,000 nauplii. The egg hatching rate at each spawning varied from 27.4% to 86.3% without particular patterns of correlation with female body weight. The fecundity of pond-reared female P. monodon
Sumaira Akram1, Sajid Aleem Khan1*, Nazir Javed1 and Saeed Ahmad2
...eld (MG) is an important pest of cereal crops. In Pakistan the yield of wheat is extremely low as compared to many other developing countries. Among several factors, responsible for low crop yield, MGis an emerging threat. In vitro hatching percentage of MG was evaluated that was varied significantly at different concentration of chemicals, bio control agents and plant extracts. Among chemicals, cartap was most...
Jiao Qin,Qian-Qian Su and Quan-Sheng Liu*
...ield rat is one of major pests in eastern and southern Asia, causing considerable losses in rice, vegetables, and other crops. The more serious situation was that R. losea has developed high resistance to anticoagulants with repeated and long-term application of anticoagulant rodenticides in southern China. Fertility control is considered as an alternative strategy for management of...
Reda Mohamed1, 2
...ac artery originated independently, while in few cases it originated by a celiacomesenteric trunk with the cranial mesenteric artery. The branches of the celiac trunk in ruminants varied and originated either directly or indirectly according to the species. The right ruminal artery originated either from the splenic, left gastric or celiac arteries. The epiploic branch detached either from the splenic, celiac or right rumina...
Asmaa A. Darwish
...hich disappoint our therapeutic programs and frustrate our expectation for curing. This work aimed to assess the most important clinicopathological alterations related to sheep pneumonia, arthritis and enteritis and spot the light on MMP-2 and MMP-9 diagnostic and prognostic accuracy in these conditions. 80 barki lambs were divided into four groups control group (CG), pneumonic group (PG), arthritic group (AG) and enteric gr...
Kenneth Nnamdi Anueyiagu*, James Jingmang Kopmut, Chrysantus Achi Lagi and Kelly Nkem Okoh
...Samples were enriched in peptone water broth, incubated at 37oC for 24 hours, and sub-cultured onto Mannitol Salt Agar and thereafter standard bacterial procedure continued. A total of 83 (51.9%) S aureus isolates were identified, 54 (33.8%) MRSA, and 15 (9.4%) Methicillin Susceptible Staphylococcus aureus (MSSA). The study showed a statistical association between the prevalence of MRSA in livestock and students. This could lead to cross infection of MRSA from...
Shazia Mansoor1, Muhammad Sohail2*, Saima Aslam3 and Muhammad Nauman ul Islam4
...e weight gain and growth performance of Balkhi lambs and pregnant Balkhi ewes at The University of Agriculture, Peshawar Dairy Farm Malakandair. Balkhi sheeps (n=30) were purchased from the market. They were kept for ninety days including 10 days for adaptation. Animals were divided into three groups such that each group contain ten animals i.e. group A (NRC recommended diet), group B (4% more CP and 2% more TDN), and group C (conventional grazing). Weekly bod...
Mustafa Boğa1, Kerim Kürşat Çevik2* and Aykut Burgut3
...e were organized by an expert in establishing classification data. The expert determined the classes of the outputs data (average milk) through the input data (calving age, milking days, number of lactation and insemination). Applying deep neural networks, we established that average classification success of the system was 69.23% as a result of 6-Layers Cross-Verification Test which is commonly used in the literature for sm...
Riffat Sultana1, Nuzhat Soomro1,*, Santosh Kumar2, Ahmed Ali Samejo1 and Samiullah Soomro1
...ll;">The egg-pods of 04 species viz: Oxya hyla hyla Serville, 1831, O. velox (Fabricius, 1787), O. fuscovittata (Marschall, 1836) of genus Oxya and Oxyina bidentata (Willemse, 1925) of Oxyina were examined under laboratory conditions. Significant differences were found in the sizes and shapes of the pods. Beside this, number of eggs in each egg pod, distribution pattern and weight, l...
Anila Naz Soomro1*, Hiroshi Suzuki2, Sadaf Tabassum Qureshi3 and Wazir Ali Baloch1
.../i> and its co-existing species C. typus. Entire continuum of stream was divided into five stations (St.1, St. 2, St. 3, St. 4 and St. 5). Monthly sampling was carried out using a scoop net (1 × 1 mm) via the sweep method, sweeping efforts were counted. The results revealed that C. sakishiemnsis was restricted atSt. 1 only, a few juveniles of C. sakishiemnsis were recorded at St. 3, St. 4. The length frequency histograms showed the o...
Aouicha Djebroune1*, Aissa Mokabli1, Miloud Hammache2 and Gahdab Chakali2
...red as being redoubtable pests of potato crop and are subject to strict quarantine regulations in several countries. In Algeria, the potato crop is the most important food crop widely cultivated in different agricultural areas. In this investigation, the response of three potato varieties; Kondor, Spunta and Desiree to the evolution of populations of Globodera spp. was studied. Final population of cysts, eggs and juveniles / kilogram of soil increased s...
Daniel Cocan1, Vioara Mireşan1, Florentina Popescu1, Radu Constantinescu1, Aurelia Coroian1, Călin Laţiu1, Romulus Valeriu Flaviu Turcu3, Alexandru Ştefan Fărcăşanu3 and Cristian Martonos2,*
...study we analysed the shape and topography of venomous glands in Brown bullhead (Ameiurus nebulosus) through MRI investigations. The main reason of this investigation was to provide a better understanding of the defence mechanism of this species. The presence, topography and structure of venomous glands made brown bullhead one of the top invasive species spreading its habitat worldw...
Zhi Yi Jin and Shao Ming Qin*
...rovince, China at landscape and micro-habitat scales, from November 2017 to March 2018 and November 2018 to March 2019. At landscape scale, the main foraging habitats of this species include woodlands and farmlands. The largest proportion of woodland in the habitats was 88.70%. Proportion of shoals in foraging habitats at 500-m, 1000-m, 1500-m and 5000-m scales were larger than that in con...
Syed Basit Rasheed*, Ahmad Yar, Farrah Zaidi and Qaisar Jamal
...k method. A total of 19 species representing 11 genera and three subfamilies namely Formicinae, Myrmicinae and Dolichoderinae were identified during the present study. Myrmicinae was the most diverse subfamily with five genera (Crematogaster, Meranoplus, Messor, Monomorium and Pheidole) and 11 species (Crematogaster subnuda, Meranoplus bicolor, Messor instabilis, Monomorium aberrans, Mo. dichroum, Mo. indicu...
Godwin Ikechukwu Ngwu1*, Maria Ifeyinwa Ngwu2, Fabian Chukwuemenam Okafor1, Aruh Ottah Anaga3 and Christopher Didigwu Nwani1
...indicate concentration dependent mortalities and significant differences (P<0.05) in the mean percentage mortality between the laboratory-reared and field-collected Aedes mosquitoes. The mortality rate due to the extract was found to be less in the field collected A. aegypti (LC50 = 2.81 ± 0.14; LCI = 2.55; UCI = 3.11) than the laboratory-reared ones (LC50=1.24±0.09; LCI =...
Mehtap Bayir*
...le="font-size: small;">Superoxide dismutases are the best-known enzymatic antioxidants because of their central role in the antioxidant defense system. In this study, the phylogeny, gene structure, and conserved gene synteny of sod1 and sod2 genes in fugu—a model organism—were determined. Maximum amino acid similarity identity was found between putative fugu Sod1 and Sod2 proteins and their orthologs from teleost fish and tetrapods. P...
Boxin Dou, Ying Liu*, Yumeng Liu, Lili Fan, Yongqiang Ma, and Yanguo Shi
...elected commercial antihypertensive pharmaceutical. A new peptide with ACE inhibition properties was obtained by using alkaline protease to enzymatic hydrolysis of RB crude protein purified by ultrafiltration, size exclusion chromatography and RP-HPLC. Using consecutive chromatographic techniques successively, the acidic hydrolysates of RB proteins were fractionated and the new ACE inhibit...
Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Muhammad Ibrahim Khaskheli2, Gul Bahar Khaskheli3, Allah Jurio Khaskheli2 and Arshad Ali Khaskheli1
...while moisture content appeared vice versa to dry matter. Organic matter contents in Senegalia senegal (94.05%) followed by Calligonum polygonoides (93.80%) and Acacia jacquemontii (92.45%) appeared considerably high. Capparis deciduas (22.41%) and Suaeda fruticosa (21.21%) both possessed relatively similar crude protein contents and found considerably high and Cordia sinensis Linn. ...
Meriem Msaad Guerfali1,*, Heitham Hamden1, Salma Fadhl1, Wafa Djobbi1, Lotfi Sillini1, Wafa Marzouki1 and Mohammed Ammar2
...method. Malathion upon repeated and prolonged use may cause resistance. In an attempt to reduce the insecticide residues in fruit, the government is trying to introduce the application of spinosad that was also reported to cause resistance under extensive use. The aim of this work was to monitor the susceptibility to malathion after prolonged use in wild caught tunisian Ceratitis
Jiantong Feng, Xueping Wen, Yahong Guo, Yingying Ye*, Jiji Li and Baoying Guo
... economically important species in the coastal regions of China. In order to characterize the genetic diversity and population structure of M. lamarckii, a 750 bp region of mitochondrial COIII gene and an 822 bp region of 12S rRNA gene were sequenced and analyzed for 118 and 105 individuals from five populations (ZS, WZ, ZP, ST and ZJ) in the Southeast coastal areas of China, respectively. Results revealed that 33 hap...
Housh Muhammad Solangi1, Javaid Ali Gadahi1*, Mansoor Tariq2, Bachal Bhutto1, Zubair Ahmed Laghari1, Jamila Soomro3, Taufeeq Ahhmed Khosa1 and Abdullah G Arijo1
...plore the immunogenic properties of H. contortus crude proteins (HcCP). Protein profile of HcCP was checked by SDS PAGE and immunogenic proteins were recognized by the antisera produced by using the HcCP as antigen. Infective stage of the H. contortus (L3) was used for the challenge infection. Protein band pattern ranging from 10 to 170 kDa was observed and protein bands at 10-20 kDa, 24, 26 and 40-60 kDa were recognized by the antibodies against...
Gulnaz Afzal1, Ghulam Mustafa2*, Shakila Mushtaq3 and Amer Jamil4
..., we distinguished five species of spiders using their CO1 gene sequences and compared them with 40 earlier published sequences, retrieved from GenBank on the bases of maximum similarity index. The sequences of gene encoding CO1 of all five spider species were deposited in GenBank. Out of five spiders in this study, three species i.e. Leucauge decorata, Oxyo
Muhammad Waseem, Tariq Mahmood*, Abid Hussain, Abdul Hamid, Faraz Akrim, Shaista Andleeb and Hira Fatima
...;m above sea level. The species, in many areas of its range, is in conflict with humans, however, data on its population and economic losses are scanty in the country. We investigated its occurrence, population and human conflict in Mansehra District during 2016-2017. A total of 66 indirect signs of Asiatic black bear were recorded with an altitudinal variation of habitat ranging from 1511m to 2570m elevation including 17 dens and 44 scats of the bear from 10 ...
Yunfang Tian, Zeqin Fu, Jiantong Feng, Yahong Guo, Yingying Ye*, Jiji Li and Baoying Guo
...ing planktonic larval dispersal. The clam, Meretrix meretrix, is an important aquaculture species in the coastal regions of China. However, the previous studies of genetic information about M. meretrix were vague. None integrated research to reveal the population genetic and structure of M. meretrix in China from north to south. In this study, we investigated the genetic variation of seven location sampl...
Amit Sharma1* and Pankaj Sood2
...unctional damage to the spermatozoa leading to reduced motility, viability, impaired transport and fertility. Caprine sperms are extremely sensitive to cryopreservation compared to other species which is mainly attributed to the compositional variation of the sperm plasma membrane. Different factors affect affects the semen cryopreservation viz. s
Lei Gao1, Gong-xue Jia2, Zheng-yuan Huang1, Ming-xing Yue3, Chao Zhang1, Shi-en Zhu1 and Xiang-wei Fu1,*
... embryo developmental competence and DNA double-strand breaks (DSBs) in mouse oocytes and resultant early embryos. Germinal vesicle (GV) oocytes were first cultured to monitor the progression of germinal vesicle breakdown (GVBD) and polar body extrusion (PBE) during in vitro maturation (IVM), then the harvested metaphase II (MII) oocytes were parthenogenetically activated to evaluate pronuclear (PN) formation of parthenogenetic embryo and embryo develop...
Seval Dernekbasi* and Emin Karatas
...acid profiles and growth performances of rainbow trout. Seven trials were implemented; fish oil trial [FO; continuously fed by diet with fish oil (FO)], canola oil trial [CO; continuously fed by diet with canola oil (CO)], safflower oil trial (SFO; continuously fed by diet with safflower oil (SFO)], mixture oil trial (CSFO; continuously fed by diet containing both %50 CO and %50 SFO), alternate cycled feeding trial [(FO/CO; fish fed by diet with CO for 2 weeks...
Muhammad Yahya1, Muhammad Afzal1, Muhammad Zeeshan Majeed1*, Imtiaz Sarwar1, Khurram Shehzad2, Muhammad Luqman3 and
Sher Muhammad Shahzad2
...size: small;">Land-use types exert a differential impact on soil quality and on the dynamics of edaphic (soil-dwelling) arthropods. This study determined the quality status of soils under different land-use categories (i.e. agricultural crop land, orchard land and natural uncultivated land) and different land-use types (i.e. sugarcane, fodder and rice-wheat fields, intercroppe
Asim Faraz*
...gn. After 120 days trial period the mean body weight and average daily gain (ADG) of male and female calves was significantly increased (P<0.05) in IMS as 80.8±2.7, 77.8±2.7 kg and 0.67±0.02, 0.65±0.02 kg/d than EMS as 64.7±2.6, 52.3±2.6 kg and 0.54±0.02, 0.44±0.02 kg/d of male and female calves. Intake of crop residues (P<0.05) was found to be 6.9±0.45 and 6.4±0.45 kg/d in male and fe...
Ihsanullah Kakr1, Sarwar Khan2, Khalid Khan3* and Sajjad Ahmed1
... questionnaire was developed for survey of Camel farmers and information regarding the age of respondent, experience, type of community, feeding/watering pattern of camels, prevailing camel diseases in the area, treatment facilities, traditional remedies used by them against various diseases in camels and economic losses were collected. A total of one thousand and forty (n=1040) camel owne...
Muhammad Asif Farooq1*, Muhammad Jalal Arif1, Muhammad Dildar Gogi1, Bilal Atta2 and Ahmad Nawaz1
...gn: justify;">Integrated pest management (IPM) relies on a merger of rational practices and always considered as an effective and environment-friendly approach to managing pests. The present study was conducted at different locations in the Multan District, Punjab Province, Pakistan for two consecutive years 2016-17 to devised four IPM modules (PRMM-1, PRMM-2, PRMM-3, and PRMM-4) for mango to evaluate their impact on insect ...
Hamza Rehman*, Nida Ahmad Khan, Asad Ali, Warda Batool and Kanwal Razzaq
...ategorized as notorious species, an extended standing species around the world and at the same time it is perceived among the world’s 100 most essential intrusive species. Thiamethoxam and imidacloprid are Neonicotinoids with a minute toxicity and they have no teratogenic effects on grains, therefore both are used as cereals protectant against stor...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mahreen Hanif, Muhammad Nadeem, Mirza Abdul Qayyum, Muhammad Javaid
...serious and cosmopolitan pest for crops and vegetables especially cauliflower all over the world. The larvae feed on foliage and cause severe damage. Present study was carried out under laboratory conditions to elicit information about every stage like egg, larva, pupa and adult of Plutella xylostella on natural diet. The study revealed that incubation period of eggs varies from 3.2-4.3 ho...
Bo Gao1,2, Fengmei Yang3, Wei Chen2, Xiaojia Song4, Xiaobo Liu5 and Dongmin Li1*
... time, through receiver operating characteristic (ROC) curve analysis, their diagnostic threshold values were calculated. MDR1 expression levels were the highest in malignant tumor tissues, followed by adjacent tissues, and the lowest in non-cancerous tissues. Differences in expression level between varying degrees of differentiation and/or lymphatic metastasis, as well as variations in negative and positive expression between survival and recurrence times, we...
Savas Atasever*, Ali Vaiz Garipoglu and Huseyin Erdem
...cow (NMC), calf suckling period (CSP)). Average F (3.144±1.931%), P (3.022±0.448%), L (4.475±0.669%) and logSCC (5.386±0.529) values were within acceptable ranges. The present investigation revealed that feeding practices had an important role on both milk quality and quantity of Jersey crossbred cows. Therefore, it is suggested that procedures including proper feeding implementations should exact...
Muhammad Rizwan Ashraf1, Asif Nadeem1,2, Eric Nelson Smith3, Maryam Javed1, Utpal Smart3, Tahir Yaqub4, Abu Saeed Hashmi1 and Panupong Thammachoti3
...us animals with over 40 species of venomous snakes found in Pakistan. One such group of snakes belongs to genus Echis is saw scaled viper (Ehcis carinatus). Molecular techniques have made it easy to elucidate phylogenetic relationships and evolutionary histories of different groups of organisms. This study is the first attempt to find the phylogenetic relationship and diversity through mitochondrial genes in saw-scale...
Ali Asghar1*, Tariq Mukhtar1, Muhammad Usman Raja1 and Asim Gulzar2
... of galls and egg masses per root system in response to both the pathogens applied individually and in combinations. Maximum numbers of galls and egg masses were observed where nematode was applied alone. Significant reductions in galls and egg masses were recorded where nematode and the bacterium were applied in combinations. At higher densities of both the pathogens, the reductions in these parameters were the maximum. The first wilt ap...
Peimin Yang*, Zongyun Hu, Yixin Liu, Guanghai Jin and Lei Wang
...size: x-small;">Amur sleeper (Perccottus glenii), is a remarkable invasive species in Euroasia, is natively distributed in Northeast Asia and has been recognized as a candidate for aquaculture in northeast China. To investigate the genetic variability and population structure of this species in its native range, we analysed variation in the mitochondrial cytochrome b (Cyt b) ...
Wenping Hu1, Xiangyu Wang1, Xiaodi Sun2, Ran Di1, Qiuyue Liu1, Zhangyuan Pan1, Xiaofei Guo1, Xiaohan Cao1, Jinyu Wang2, Yingjie Zhang3, Mei Jin4, Yuze Yang5 and Mingxing Chu1*
...es of C327T/G1803A genotype distributions in five different sheep breeds, it did not relate with the year-round estrus. The relationship between these polymorphisms of TAC3 and the litter size of Small Tail Han sheep was not found.
...
Larysa Kladnytska1, Anatoliy Mazurkevych1, Natalia Bezdieniezhnykh2, Oleg Melnyc1, Sergiy Velychko3, Mykola Malyuk1, Vasyl Danilov1, Yuriy Kharkevych1 and Magdalena Gryzinska4*
...ane proteins, which are specific to proliferating cells. Proliferation index in adipose-derived stem cells culture was significantly greater at the IVth passage – 1.90±0.02, compared to cells the Xth passage – 1,52±0,04 ** (P <0.01). DADSCs at the IVth passage are characterized by a maximum level of expression of pan cytokeratin – 299 ± 0.6, actin – 299 ± 0,58, vimentin &nd...
Amjad Usman1*, Arshad Khan1, Ruidar Ali Shah2 and Toheed Iqbal3
...orsalis is a devastating pest of tomato. The objective of this study was to screen commercially available tomato genotype and to identify the morphological plant characters responsible for resistance against S. dorsalis. For this purpose, five commercially cultivated tomato genotypes (Riogrande, Riogrande H, Bombino, Roma VF and Roma) were evaluated against thrips (S. dorsalis) at A.R.I. T...
Saima Asad1*, Irfan Ahmad Baig2, Abdul Saboor3 and Rashid Mahmood4
...al and multidimensional spectrum in agro-climatic zones of Punjab and their representative districts by using cross sectional data of HIES/PSLM of last 10 years from 2005-2006 to 2015-16. By developing an axiomatic framework 3 most widely used inequality measures (Gini-coefficient, Atkinson Measure and Generalized Entropy Index) have been estimated for uni-dimensional inequality while a single measure of Araar (2009) is used for the assessment of multidimensio...
Arjumand Nizami1, Muhammad Zulfiqar2*, Jawad Ali1, Naushad Khan2 and Imran Sheikh3
...s met through tube well operation. The result from before and after AWD technology and laser land leveling technology adaption shows that 24.24% tube well operation time was reduced at the head, 19.4% reduced at middle and 24.4% reduced at tail. The reduction of hours in operating tube well results in dual benefits of savings in the quantity of irrigation water extraction particularly keep...
Bahadar Sher Khattak1, Muhammad Kaleem1, Waqas2*, Humaira Naz1 and Muhammad Yasir3
...rview schedule was developed to collect data which was pre-tested before starting the actual process of data collection. The total sample size of the study area was 150, randomly selected for interviews. After the data analysis, it was found that the majority of the respondents (83.3%) who were small farmers acquired and utilized micro-credit in establishing income generating entrepreneurs, purchased quality seeds, fertilizers and small scale modern technology...
Hina Maryam1, Muhammad Ather Rafi2, Ahmed Zia1, Ghulam Rasul3, Muhammad Kamal Sheikh3*, Muhammad Qasim4 and Gulnaz Parveen5
...s during apricot blossom period (early March) from Gilgit, Ghizer, Hunza-Nagar and Skardu. Total 18 species of 14 genera under seven families of orders Diptera, Hymenoptera and Lepidoptera were identified. Order Diptera was represented by family Syrphidae with four species under three genera. Order Hymenoptera represented four families i.e. Apidae with six spe
Muhammad Zeeshan Nazar*, Ayyan Umer, Zahid Mahmood Sarwar, Faiz Ullah Faiz and Sikandar Hussain
...d to control 3047/ml, respectively. Afterwards, THC were rapidly decreased and THC were recorded 1928/ml (3rd day) and 344/ml (4th day). The results also exhibited the morphological changes of silkworm i.e., infected larva fully filled with B. thuringiensis spores with flaccid body and haemolymph liquid impelled leading to mortality. Provide the required temperature and humidity with appro...
Shilong Chen1,2, Shifeng Xiao1,2, Shao Wang1,2, Fengqiang Lin1,2, Xiaoxia Cheng1,2, Xiaoli Zhu1,2, Dandan Jiang1,2, Shaoying Chen1,2* and Fusong Yu3*
...sis mechanisms of cross-species transmission, retardation and beak atrophy are still needed to be elucidated. ...
Jing Zhang1,2, Xin Wang2, Yun Zhao2, Yongcheng Jin2, Yongfeng Zhou2, Junmei Wang2, Yurong Fu2, Rui Wang2, Ruihua Li2, Hengtong Fang2 and Hao Yu2,*
...icroflora had changed, especially the Lactobacillus had increased significantly. Our study showed that short-term ZEA exposure led to resistive increase of colonic probiotics in mice, especially the increase of lactobacillus can reduce intestinal mucosal immunotoxicity.
...
Muhammad Zamin1*, Abdullah Khan1, Ibadullah Jan1, Fazli Rabbi2, Shahen Shah3, Rashid Ali1, Kaleem Ullah1 and Muhammad Amin4
...ion. To investigate the performance of gladiolus at different application rate of nitrogen and potash, a study was conducted at National Agriculture Research Council (NARC) Islamabad, in May to August 2018. The experiment was laid out in Randomized Complete Block Design (RCBD) with 10 treatment combinations of nitrogen (0, 100, 200, 400 kg ha-1), Potash (0, 100, 200, 400 kg ha-1) and other combinations (200N + 100K kg ha-1,...
Gong Ga1,2 and SuoLang Sizhu2,*
...sp;farming of different species of domestic animals are consumed traditionally. In this study, 173 serum samples of Tibetan swine were tested for anti-HEV IgM and IgG antibodies by the ELISA. HEV RNA were measured in feces (n=173), serum (n=173) and tissue ((including liver, spleen, kidney and intestine, n=21) by nested RT-PCR and qRT-PCR. HEV antigens were detected in tissues by immunohistochemistry analysis. Overall, we found that that eight serum sampl...
Xuhui Zhang1, Zhiyuan Sun2, Jinfeng Cai1, Guibin Wang1, Zunling Zhu1, Linguo Zhao3 and Fuliang Cao1,*
... fermentation using Aspergillus niger on growth, antioxidant capacity and meat quality of broilers. Three hundred day-old commercial Arbor Acres (AA) broiler chicks were randomly allocated into 5 dietary treatments including five variations: control group, fed with the basal diets; NF group, the addition of 3 g/kg NF products; FR1, FR2 and FR3 groups, addition of FR products 1 g/kg, 3 g/kg and 6 g/kg, respectively. Th...
Aftab Shaukat1,*, Sana Hanif2, Irfan Shaukat3, Muhammad Ahsan Naeem4,5, Shadab Shaukat6, Rizwan Shukat8, Shahid Ali Rajput9, Imran Shaukat10, Mubashar Hassan4, Khalid Mehmood7, Saqib Umar11 and Muhammad Ali Jamil1
...A target. By utilizing experimentally validated targets, the search of further targets via bioinformatics tools help to predict gene target site. Keeping this in view, a study has been planned to investigate PDCD1 gene regulatory miRNA targets, their sequences and their seed location in human using online server miRDB. We have identified 26 specific
Celalettin Gözüaçik1,*, Mustafa Güllü2, Ayda Konuksal3, Reşat Değirmenci3 and Ercan Akerzurumlu3
...miner, Syringopais temperatella Lederer (Lepidoptera: Scythridae) is an important pest in barley and wheat in Northern Cyprus. This study was carried out to identify the larval parasitoids and to determine the parasitism rate of S. temperatella. These studies were conducted in 42 cereal fields of 18 villages in Lefkoşa, Girne, Güzelyurt, Gazimağusa and İskele township...
Dongping Liu1, Guogang Zhang1, Chao Wang2, Baoping Qing2 and Jun Lu1,*
...l China, on the south slope of the Qinling Mountains. During 2004-2005, 23 crested ibises were experimentally reintroduced to an isolated basin in Qinling Mountains, where they and their offspring exhibited breeding variation never observed in wild population in the following 9 breeding seasons. Crested ibis has been considered a monogamous species, and breeding pair is solitary and territ...
Aftab Khan1, Shahid Ali1*, Asim Khan1, Muhammad Waqas1 and Sufyan Ullah Khan2
...can increase yield by 33 percent with existing technology. Technical inefficiency effect model identified that education and farming experience has negative and significant effect on farmers’ inefficiency. It is recommended that maize farmers need to be provided with formal as well as informal education, agricultural trainings and credit on easy terms for purchase of costly inputs. ...
Rehman Ullah Khan* and Muhammad Ayub
...reatments were packed in pet bottles and stored at ambient conditions for six months. The results revealed significant decline in pH from 4.51 to 3.47, ascorbic acid from 120.42 to 51.48 mg/100gm, total phenolic content from 32.43 to 11.47mg gallic acid equivalents/100g and antioxidant capacity from 76.02 to 33.23TE/100g while significant increase was observed in total soluble solids from 5.05 to 6.210Brix, total acidity from 0.62 to 1.11 during six months sto...
Yan-Guo Han, Jia-Yuan Wu, Ri-Su Na, Wei-Jiang Si, Yu-Qin Han, Yan Zeng, Yong-Ju Zhao and Yong-Fu Huang*
...for the detection of kisspeptin antibodies and testosterone by indirect enzyme-linked immunosorbent assay. Scrotal circumference was detected from week 0 to week 14 after primary immunisation, and the testes were weighed at week 14 after primary immunisation after slaughter. The concentrations of 4-methyloctanoic acid and 4-methylnonanoic acid in waist subcutaneous adipose tissue were detected using gas chromatography. Immunisation of oral and plasmid-injected...
Muhammad Farhan1, Ghulam Murtaza1, Muhammad Ramzan2, Muhammad Waqar Sabir3, Muhammad Arsalan Rafique2, Saif Ullah2
...t-align: justify;">Chrysoperla carnea is a major predator of soft bodies insects like aphid, white fly and thrips. The feeding potential of Chrysoperla carnea larvae on different nymphal instars of Myzus persicae was investigated in ambient laboratory conditions at University of Agriculture, Faisalabad. Chrysoperla carnea was found very active and consum...
Pushpa1, Nighat Seema Soomro1, Shahla Karim Baloch2, Mehmooda Buriro1, Aijaz Ahmed Soomro1, Muhammad Tahir Khan3, Qamar Uddin Jogi1*, Muhammad Nawaz Kandhro1 and Farheen Deeba Soomro1
...squo; infection which compete for water, nutrients and sunlight. This study was conducted to determine the allelopathic effect of weed species on germination and seedling traits of wheat (Triticum aestivum L.). Wheat varieties Amber and TJ83 were subjected to powder of Chenopodium album, Convolvulus arvensis and Avena fatua under three different treatments i.e. 25, 50 and 75g. The effect of these weed powders on seed germina...
Muhammad1*, Muhammad Suleman Bacha2 and Syed Akhtar Ali Shah1
...e of poverty. This study performs a focalized analysis and investigates the influencing factors of urban farmers’ Willingness to Pay (WTP) for organic fertilizer in District Mardan, Pakistan. The Contingent Valuation Method (CVM) was used and data were randomly collected from 384 heads of the household of urban farmers. Data was set in SPSS software version 22.0 and analyzed using descriptive statistics and Logit Model. The study revealed that a major pr...
Ejaz Ashraf1*, Anam Sarwar2, Muhammad Junaid1, Mirza B. Baig3, Hafiz Khurram Shurjeel4 and R. Kirby Barrick5
...ssessing the existing competencies and the training needs of EFS in the scenario of climate change. A descriptive survey research method was employed in this census study. There were 147 working EFS and 130 of them participated in the study. A well-defined structured interview schedule was designed for data collection. The Borich Needs Assessment Model was applied on Microsoft Excel sheets to identify the training needs of EFS, and Statistical Package for Soci...
Saeed Ahmed Shah Chishti1, Saba Aleem1*, Iram Sharif2, Kashif Nadeem1, Nusrat Parveen1 and Muhammad Najeebullah1
...Flowering in Solanum lycopersicum L. is sensitive to low-temperature as it inhibits the fuit growth and causes poor fruit setting. The present experiment was conducted to improve the fruit growth and fruit set in tomato during low-temperature stress conditions by the use of growth regulator 4-chlorophenoxy acetic acid. Seven different 4-chlorophenoxy ace...
Humayun Saleem1, Faisal Sohail Fateh2*, Zia-Ur-Rehman1 and Muhammad Abu Bakar Siddique1
...rs that can withstand temperatures as low as -30 ° C. The apricot has been used as a treatment for various diseases in Folk medicines. Shot hole which is a fungal disease caused by Wilsonomyces carpophilus is one of the diseases that target apricot. The purpose of the current study was to record the prevalence of shot hole disease on Islamabad’s Federal Capital Territory markets. The frequency and severity of shot hole disease was estimated from mark...
Mohammad Ejaz1, Salma Javed2, Muhammad Hamza1, Sadia Tabassum2, Muhammad Abubakar3, Irfan Ullah4*
...n of various different types of bioactive molecules. These bioactive molecules can be used as antimicrobial, antibacterial and anticancer agents. Fungal endophytes like Taxomyces andreanae isolated from Yew plant have the potential to produce an anti-cancer compound called Paclitaxel. Other different fungal endophytic species produce various other types of anticancer compounds like ...
Noor-us-Sabah1*, Mukkram Ali Tahir1, Ghulam Sarwar1 and Sher Muhammad2
...l was studied in a pot experiment conducted at research area of University of Sargodha in year 2017-18. A saline sodic-soil with desirable characteristics (SP = 40.35, ECe = 5.17 dS m-1, pHs = 8.71, SAR = 18.80 (mmol L-1)1/2, bulk density = 1.49 g cm-3) was selected for present study. After chemical analysis, different organic amendments were used in the study. Following treatments were applied in three replicates i.e. T1- control (recommended NPK), T2- &frac1...
Attique Ahmed1, Tariq Sultan1, Ghulam Qadir2, Obaid Afzal2*, Mukhtar Ahmed5, Shamim-Ul-Sibtain Shah3, Muhammad Asif4, Safdar Ali2 and Muhammad Zeeshan Mehmood2
...nagement practices genotype and environmental conditions may also affect the growth and nutrient uptake. PGPR and phosphate solubilizing bacteria (PSB) in combination with synthetic fertilizers can enhance crop productivity and soil fertility. Present experiment aimed to investigate the effect of PGPR and PSB inoculation with T1 Control (Recommended NP), T2 (PGPR-1 + PSB + ¾ N + ¾ P),T3 (PGPR-2 +PSB +¾ N...
Arfan Ahmed Gilal1*, Lubna Bashir1, Muhammad Faheem2, Asad Rajput1, Junaid Ahmed Soomro1, Saifullah Kunbhar1, Abdul Samad Mirwani1, Tanzeela-ul-Zahra1, Ghulam Sarwar Mastoi3 and Jam Ghulam Mustafa Sahito4
...rm (FAW) Spodoptera frugiperda (Smith) (Lepidoptera: Noctuidae) is an invasive polyphagous pest, particularly damaging to corn. Although native to American continents, it has spread in various African and Asian countries. However, no confirmed report of its presence has been made from Pakistan as it has already been reported from its neighbors India and China. So, this study was conducted in 15 corn growing areas of Sindh, P...
Fazli Ahad1, Raziuddin1, Nazir Ahmad1,2*, Muhammad Nauman1, Touheed Iqbal3, Nabeel Khan1, Fazli Hameed4 and Quaid Hussain2
...ficient in a set of 31 rapeseed genotypes, comprised of 10 parental lines and their 21 F3 populations. These genotypes were evaluated in a randomized complete block design at The University of Agriculture-Peshawar-Khyber Pakhtunkhwa-Pakistan with three repeats. Significant differences were recorded for days to 50% flowering, plant height, primary branche...
Rehman Ali Keerio1, Nighat Seema Soomro1, Aijaz Ahmed Soomro1, Mohammad Aquil Siddiqui2, Muhammad Tahir Khan2, Ghulam Shah Nizamani2*, Muhammad Nawaz Kandhro1, Maryum Siddiqui4, Hajra Khan3 and Farheen Deeba Soomro1
...ower variety HO-1. The experiment was conducted at field of Oil Seeds Section, Agriculture Research Institute (ARI), Tandojam, Sindh using RCBD design with three replications. The maximum plant height (203.33 cm), stem girth (11.67 cm), head diameter (19.71 cm), number of seeds head-1 (1300.0), seeds weight head-1 (62.74 g), seeds index (60.12 g), seed yield (1927.8 kg ha-1) and oil content (41.92%) were observed under 2.00% Zn, while and minimum plant height ...
Adewumi Olubusuyi Moses1,2*, Faleye Temitope Oluwasegun Cephas,1,3, Ope-Ewe Oludayo Oluwaseyi1, Ibitoye Ibipeju Henrietta1, Arowosaye Abiola Opeyemi1, Adelowo Oluwatosin Deji1 and Adeniji Johnson Adekunle1,2,4
... to detect non-polio EV Species C (NPESC) members in stool samples. In all, 20% (8/40) of all the samples screened had NPESCs and 50% (8/16) of the EVs detected were NPESCs. However, the RD cell line missed all N
Zulfiqar Ali Abbasi1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1, Naimatullah Leghari2, Muhammad Ibrahim Keerio3, Ahmed Naqi Shah1 and Musrat Begum Abro1
...andojam, Pakistan. The experiments were a randomized complete block design in factorial combination, replicated three times. An experimental unit was accommodated with three factors i.e. seed priming sources (No seed priming, seeds priming with canal water, seed primed with 1.0% Urea, and seed primed with 0.2% ZnSO4), planting geometries (i.e. 55 x 35 cm, 65 x 30 cm, 75 x 25 cm, and 85 x 20 cm), and sunflower varieties (HO-1...
Nadia Mangrio1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1, Nihaluddin Mari3 and Zia-ul-Hassan Shah2
...er sugarcane yield and superiority. Experiment was conducted under field condition during 2016-17 and repeated in 2017-18 at Sugarcane Research Institute, Tandojam, Sindh, Pakistan. Crop in 1st year was planted on an experimental field by shifting on another adjacent field in 2nd year, which was fallow. The sugarcane variety PSTJ-41 was used for the stud...
Qaisra Siddique1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3
...ract | This work was performed to evaluate glutathione S-transferase (GST) activityand total protein contents (TPCs) in tissues viz. brain, gills, kidney, heart, muscle and liver of Labeo rohita kept under sub-lethal dose (4.13 µgL-1) of chlorpyrifos. Fish was kept under chlorpyrifos stress for two months and samples were collected on weekly basis. It was noted that GST level varied significantly with duration. The GST level was rai...
Waqas Ahmad Shams1*, Gauhar Rehman1, Khurshaid Khan1, Ibrar Ahmad1, Saima Bibi1, Saif Ul Islam2, Dawood Safi1, Saba Gul Ayaz1
...were looked over, over a period of three years extending from June 2013 till June 2016, collected at different sampling points. Extensive surveys were conducted for three years at different timings during the active periods of crab life. To have a comprehensive study of the crab fauna of Buner District, nine different localities were selected for conduction of survey. The results showed that there were two crab s
Mubashar Hussain1*, Misbah Younas1,Muhammad Faheem Malik1, Muhammad Umar1, Maimoona Kanwal1, Moazama Batool2
...sofSialkot during 2016. Specimens were collected by hand picking and cattle dung baited pitfall traps. Sixteen species representing three guilds i.e. Paracoprid (10 species), Endocoprid (4 species) and Telecoprid (02 species) were recorded. Onitis excavatus (27.68 %)and Onitis crassus (9.59 %)showed maxim...
Ahmad Naeem Shahzad1, Muhammad Kamran Qureshi2, Samee Ullah1, Muhammad Latif3, Shakeel Ahmad1 and Syed Asad Hussain Bukhari1*
... weight were severely hampered by salt stress. The absence of necrosis in cotton leaves under salt treatments indicated that growth was primarily restricted by the osmotic component of salt stress. Activities of antioxidant enzymes (superoxide dismutase, peroxidase and catalase) in plant leaves were increased in response to salt stress. Treatment of stressed plants with trehalose considera...
Tahira Moeen Khan*, Irum Riaz, Shahida Hameed and Bushra Khan
...time= 30mins, agitation speed= 150 rpm, pH= 5, adsorbent dose= 0.1 g). While 85% removal efficiency was observed for Raw date seed husk RDS (time= 45mins, agitation speed=250 rpm, pH= 4 and adsorbent dose= 0.5 g). The adsorption isotherms (Freundlich and Langmuir) and adsorption dynamic kinetic studies were also conducted. The comparison between the FTIR, EDX and SEM of RDS and LMDS revealed that with lemon juice microwave...
Daniel Kerr Baines
...nd countries are closed, people are on lock down, people are dying due to a lack of medical supplies and the world seems on the verge of collapse; not just medically but also socially and economically.
...
Maria Khalid1, Tanveer Hussain1*, Zahid Farooq2, Kamran Abbas1 and Masroor Ellahi Babar1
...dentified. The boot strapped Neighbor joining tree constructed from MEGA7 explained the genetic relationships of A.chukar with related members of Phasianidae family. The phylogenetic analysis also showed the genetic positioning of A. chukar with respect to other different reported species as well. The study gave us useful genomic information about genetic diversity in A. c...
Muhammad Sarmad, Syed Muhammad Zaka* and Syed Muhammad Tahir Abbas Shah
...a) had become a critical pest of cotton crop. Dusky cotton bug feeds on leaves, stems and seeds of host plants. Being a serious pest of many important crops, the present work will study on biology and bionomics of O. laetus on three different hosts Gossypium hirsutum, Abelmoschus esculentus and Helianthus annuus. Shorter nymphal duration was observed on Gossypium hirsutum
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
... past decade millions of people in several continents like Asia, Africa and some islands of Indian Ocean have faced the major outbreaks of Chikungunya virus because of its travel associated febrile nature. An inexplicable paralyzing disease has trapped thousands of people in Karachi region of Pakistan and the symptomatology among suspected cases was comp...
Hifzulrahman1, Muhammad Abdullah1*, Muhammad Uzair Akhtar2, Jalees Ahmed Bhatti3, Muhammad Saadullah1 and Muhammad Naveed-ul-Haque2
...randomized design with a period length of 120-d. The treatments were 1) Ctrl = basal diet without supplementation of fat, 2) Ca-FA = basal diet with calcium salts of palm fatty acids supplementation. The Ca-FA treatment increased the 3.5% fat-corrected milk yield by 11.0% compared with the Ctrl, whereas, the actual milk yield remained unaffected. The Ca-FA treatment increased the concentration of milk fat and milk fat yield by 3.5 and 11.2%, res
Renlong Lv1*, Ken-Ichi Horiguchi2, Shin-Ichi Tagawa3, Shoichi Ichihara4 and Norio Yoshida5
...ted jatropha meal. The experiment was performed twice (experiment I and II). The subjects were 6 wethers. They were divided into two treatments (rapeseed diet and jatropha diet) randomly and were tested by using a cross over method. Rapeseed meal and jatropha meal were relaced to the feed as a concentrate with proporti...
Grigory Antonovich Nozdrin1*, Regina Gabdrahmanovna Utkina2, Anastasia Aleksandrovna Lelyak2 and Yana Viktorovna Novik1
...igospora in birds. The experiments were performed on two-days-old goslings and ducklings which were divided into four experimental groups and a reference group. The fowls in experimental groups were supplemented with preparation once with dosages (2,000 µl/kg, 3,000 µl/kg, 4,000 µl/kg, and 5,000 ml/kg) while the fowl in the reference gr...
Expression Analysis of BMPR1B, BMP15, GDF9, Smad1, Smad5, and Smad9 in Rams with Different Fecundity
Weihao Chen1,2, Zhilong Tian2, Lin Ma2, Shangquan Gan3, Wei Sun1,4,* and Mingxing Chu2,*
...s, but BMP15 was specifically expressed in the epididymis. Further study indicated that the expression of BMPRIB in the brain, hypothalamus, pituitary, epididymis, and adrenal gland was significantly higher in Sunite sheep than in Small Tail Han sheep (p <0.05, p <0.01); the expression of BMP15 in the epididymis was significantly higher in Sunite sheep than in Small Tail Han sheep (p <0.01); the expression of ...
Jie Yang
...most common tumours subtype in thyroid cancers. Substantial amount of data have indicated that miR-16 is an important regulator of various tumours; however, the molecular functions of miR-16 in papillary thyroid cancer remained largely elusive. In order to investigate the regulation of miR-16, human papillary thyroid carcinoma cells are transfected with miR-16 mimics or inhibitors. Targeting miR-16 and using dual-luciferase reporter assay, qRT-PCR and Wes...
Peer Sikandar Shah1, Ghulam Nabi1, Maqsood Khan*1,2, Saddam Hussain1 and Jawad Ali Jan1
...motic regulation This experiment was conducted at Agriculture Research Institute Tarnab, Peshawar during spring season (March-june) 2016. Randomized Complete Block Design was used with split plot arrangement having three replications. The sponge gourd Luffa acutangula cultivars (Jaipuri and Dharidhar) were allotted to the main plot while organic and inorganic regimes (i.e. Control, NPK (Nitrogen, Phosphorus and Potassium), FYM (Farmyard manure), FYM (half) + ...
Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan2
...rough culture and PCR respectively. The zoonotic spread of M. bovis infection was established in the study area. The data determines that animal food products in Pakistan are common reservoirs of mycobacteria and may pose great risk to the public. Bovine tuberculosis (bTB) is found one of the neglected zoonotic disease (NZD) caused by Mycobacterium bovis with public health significance and appear as a life threatening infect...
Amjad Ali1*, Lal Almas2, Syed Attaullah Shah1, Hina Fatima3 and Asim Khan1
...d to gather data with respect to inputs utilization and socio-economic characteristics of selected sample of sugarcane growers. Using Stochastic Frontier Approach (SFA), mean technical efficiency of sugarcane crop in KP was around 70 percent ranging from minimum 53 to maximum possible efficient level of 98 percent. Results of study indicate that on average with same technology and resource...
Qingzhan Ma1, Bo Wu1, Jianping Jiang2 and Zhaobin Song1,3*
...gosity (Ho) and expected heterozygosity (He) in the eight populations ranged from 0.504 (POPH) to 0.767 (POPG) and from 0.6 (POPD) to 0.781 (POPA), respectively. The results showed that the eight populations possess considerable genetic diversity. The largest genetic differentiation (FST) among the eight populations was 0.233 (between POPB and POPD) and the lowest FST was 0.0...
Quratulain1, Ata-ul-Mohsin1, Muhammad Naeem1, Ghulam Shabir1, Muhammad Khalid Rafique2 and Rashid Mahmood2*
...mportant foliage feeding pest of vegetables crops of Pakistan. For this research Ten onion accessions Early red, Phulkara, Chiltan, Saryab red, Swat-1, Hazara, Nasarpuri, Red imposta, VRIO-7, VRIO-8 were evaluated during rabi season of 2017-18 at Chak Shahzad, Islamabad (33o 40 N and 73o 08 E), for their susceptibility to onion thripsunder field conditions. Seeds of different onion varieties were obtained from Ayub Agriculture Rese...
Muhammad Rafay1,*, Ghafoor Ahmad1, Tahira Ruby2, Muhammad Abdullah3, Fahad Rasheed4, Muhammad Abid1, Sohail Akhtar5, Zulfiqar Ahmad6 and Riaz Hussain7
...tember, 2014. The cup shaped nests were made of dry grass and roots by a group of individuals of jungle babbler on Albizzia species having an average clutch size of 4 eggs. Average peripheral and core diameter, depth of nest was 13, 9 and 7 cm, respectively. Breeding completed in 36 days including incubation, nestling, post nestling and fledgling ...
Saeed Fatima1, Khalid Javed Iqbal1, Usman Atique2,3*, Arshad Javid4, Noor Khan2, Sonia Iqbal2, Hamid Majeed5, Hamda Azmat2, Bakhat Yawar Ali Khan6, Irfan7, Muhammad Tausif Shahid1, Gulnaz Afzal1
... aquatic biota for their persistence, bioaccumulation and biomagnification across the globe.This study presents the first hand data of toxic trace metals in edible fish muscles, sediments and water sampled from Head Punjnad (HP), Pakistan during 2017. The likely reason for the selection of HP as a study target was its emergent prominence as an irrigation hub and holidaymakers spot largely for angling and feasting. The investigated five fish s
Muhammad Shuaib Khan1, Shakeeb Ullah1, Nisha. A.R2, Muhammad Umar3, Muhammad Inamullah Malik1*, Syed Muhammad Kamal Shah1, A. Zaman1, Shakir Ullah1, Imdad Ullah1, Sumera Ali Khan4
...liver many farm duties especially in the Punjab province, anterior Sindh, KP, Gilgat-Baltistan and Baluchistan. In the hilly areas men and women of the rural community use the donkeys for daily practice work like fetching water, collection of firewood for domestic use and sale in the nearby local market to cope their daily needs. The present study was carried out in three different rural towns of Dera Ismail khan district of...
Asim Faraz1*, Abdul Waheed1, Annamaria Passantino2, Ayman Balla Mustafa3, Nasir Ali Tauqir4, Naeem Ullah Khan5, Muhammad Shahid Nabeel6
...g/dL) with G1 and G2, respectively. The concentration levels of cholesterol, triglycerides, urea, creatinine, albumin, total-protein, glucose, Ca and P were found significantly (P<0.05) varied among groups. Regarding hair mineral profile, concentrations of Cu and Mn were found non-significantly (P>0.05) varied among the groups while concentrations of Ca, Mg, Zn and Fe were found non-significantly (P>0.05) varied between groups fed with ration I and II...
Asim Faraz1*, Abdul Waheed1, Muhammad Mudasser Nazir2, Aneela Hameed3, Nasir Ali Tauqir4, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal5
...al. OT also improves the persistency of lactation. Receptor blockade of oxytocin causes milk ejection inhibition. OT injections cause increased OT blood levels which results in the prolonged myoepithelial and alveolar contractions that ultimately increase milk yield. Milk composition especially protein, fat, lactose and mineral concentration are influenced by exogenous OT administration. It affects the cell maintenance and m...
Anila Kousar, Muhammad Naeem* and Samrah Masud
...ia (GIFT). It is a developed strain of Nile tilapia (Oreochromis niloticus). In the whole wet body weight of GIFT, the mean percentages for water, fat, ash, protein and organic content were observed as 79.13, 3.74, 2.75, 14.43 and 18.12 (T1,15% crude protein CP level); 80.85, 2.62, 3.27, 14.00 and 16.62 (T2, 20% CP) and 78.48, 2.82, 3.30, 15.39 and 18.22 (T3, 25% CP) respectively. Proximat...
Muhammad Shakeel1,2*, Salik Nawaz2, Yasar Saleem3, Shazia Shafique2, Ateeq Tahir2 and Muhammad Riaz2
...d has created needs to expend its cultivation spectrum in Pakistan. Present studies conducted during 2016-17 and were designed to understand socio-economic and agronomic constraints associated with adoption of broccoli in Pakistan. Growers and other stakeholders were contacted by personal visits, telephone calls and distribution of the structured questionnaire. Information was collected fr...
Stock Assessment of Two Parrotfish, Hipposcarus harid and Scarus ferrugineus in Jeddah, Saudi Arabia
Ahmad Osman Mal1 and Mohamed Hosny Gabr1,2,*
...69 year-1, respectively for H. harid and 0.77, 0.299, 0.471 year-1, and 0.61 year-1 respectively for S. ferrugineus. The maximum yield per recruit at the current fishing mortality was 108.1 g for H. harid and 137.6 g for S. ferrugineus. The biological reference points: Fmax = 0.401 year-1 and F0.1...
Salahud Din1,*, Saima Masood1, Hafsa Zaneb1, Habib ur Rehman2, Saima Ashraf1, Imad Khan3, Muqader Shah4 and Syed Abdul Hadi1
... For this purpose, after performing postmortem examination, the carcass of adult Chinkara of known sex and age was buried in the locality of the Manglot Wildlife Park and Ungulate Breeding Centre, Nizampur, Pakistan, after a specific period of time the bones were unearthed. Gross morpohological features and various osteometric parameters of the skull were studied in the University of Veter...
Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad1
... This research study was performed at Agricultural Research Institute, Tarnab, Peshawar-Pakistan. Different biochemical tests were conducted to confirm stem rot pathogen. Boron was applied at the rates of 1.97, 2.96 and 3.95 g seedbed-1. Plant extracts were neem (Azadirachta indica) and ghwaraskay (Dodonaea viscosa). Morphological traits such as plant height, maximum number of fruits plant-1 and yield were observed and severity of disease was investigated for ...
Rabia Iqbal, Muhammad Naeem*, Samrah Masud and Abir Ishtiaq
...mposition analysis. Mean percent water, ash, fat and protein contents were ranged 80.55±0.94 to 80.55±0.94; 2.23±0.13 to 2.23±0.13, 5.85±0.55 to 6.63±0.97 and 10.59±1.67 to 11.93±1.67 in wet body weight of hybrid fish (Labeo rohita ♀ and Catla catla ♂), respectively, reared under different treatments. Mean water and fat contents showed highest ...
Muhammad Safdar Hussain1*, Muhammad Farrakh Nawaz2, Muhammad Ayyoub Tanvir2 and Noor-E-Hira1
...ress. Therefore, a pot experiment was carried out with three treatments: Well-watered, 25% and 50 % drought to achieve said objective. It was found that drought negatively affected plant growth. The mean heights of E. camaldulensis and T. aphylla were maximum (38.16 and 34.7 cm, respectively) at control irrigation while minimum height was found (17.1 and 24.9 cm, respectively) at 50% droug...
Umar Hayat1, Khalid Khan2, Saima Liaqat3 and Guo Xiangyu4*
...ess, physical capital, experience, and age of the farmers have an adverse effect on rice production. Conclusively, it is proposed that the government should introduce precise programs for the upgradation of water systems, farmers’ training, input, and credit accessibility to enhance spur rice productivity. ...
Mubashir Mehdi1*, Muhammad Bilal Ahsan1, Burhan Ahmad1, Khuram Nawaz Sadozai2, Gulnaaz Hameed3 and Muhammad Asif4
...e more potential and prospective to improve the livelihood of the on-farm workers. Education included as schooling years was found major regressor for the income of on-farm laborers. In ceteris paribus conditions, coefficient of education indicates that there is a positive relationship among education of labor and Income. Credit facility at farm level was also incorporated as dummy variable under economic context of decent work to assess its regressing level w...
Akbar Hayat*, Muhammad Nawaz Khan, Ehsan Ul Haque, Ahmed Raza, Faheem Khadeeja
...eight, fruit size, juice percentage and yield obtained in T1 Troyer citrange and T2 Cox mandarin as compared to local root stock rough lemon. Results depict that exotic citrus root stock Troyer citrange and Cox mandarin performed well with Feutrell’s early in the local climatic conditions of Sargodha Punjab, can be used to overcome the smaller size of Feutrells early along with added edge of better results in various o...
Cornelius Arome Omatola*, Samson Daniel Iyeh, Shedrach James Abuh, Charles Kehinde Mofolorunsho, Martin-Luther Oseni Okolo and Phoebe Queen Akoh
...4.0%), 5(2.0%) and 0% respectively. Women who were married, unemployed, aged 15-35 years and of low-income earners had a higher prevalence of STIs. Factors such as a history of STIs in women and husbands, blood transfusions, genital ulcers and trimesters were significantly related to a higher predisposition to STIs. Conclusively, a high prevalence of STIs was observed among asymptomatic pregnant women in the study area. Our findings highlight a concern with ec...
Indigenous Soilless Substrate Compositions Affect Growth, Yield and Quality of Cut Antirrhinum majus
Aqsa Ahmad1, Iftikhar Ahmad1* and Malik Fiaz Hussain Ferdosi2
...f cut antirrhinum. Two experiments comprised of seven substrate compositions with variable ratios of saw dust (SD), peanut hulls (PH) and sugarcane pressmud (a by-product of sugar industry, which is rich in nutrients) or coco-coir (CC), rice hulls (RH) and sugarcane pressmud (PM) were used. Seeds were sown in plastic plug trays containing CC, silt (soil extracted from canal) and PM (1:1:1; v/v/v) substrate for seedling devel...
Gulnaz Hameed1, Abdul Saboor1, Khuram Nawaz Sadozai2*, Ghaffar Ali2, Dawood Jan2 and Mansoor Rasheed3
...ties and education. To cope-up with deprivations through various facet, series of rural/community development programs have been launched for long times. The research gap needs to be addressed is an empirical analysis of contribution of such initiatives in the welfare of masses through poverty reduction in the area. This research endeavor is designed to figure out the impact of one of such projects named as Azad Jammu and Kashmir Community Development (AJKCDP)...
Min Lv1, Hui Gan2, Zhide Ruan1, Huizan Yang1, Rui Wang1, Laiba Shafique3, Huma Naz4 and Huawei Ma1,*
...ish-day throughout the experiment. Samples were collected between mid-March and October 2016, and we monitored the Cd, Cr, and Hg concentrations in gills, large intestines, small intestines, intestine contents, longitudinal muscles, and body wall, and in suspended particles and sediment in the ponds....
Daniel Masood1, Noor Khan1*, Khalid Javed Iqbal2, Sadaf Dogar1, Abdul Hanan1, Sadia Nazir1, Sheeza Bano1, Azra Anwar2, Sameul A.M. Martin3 and Chris J. Secombes3
... fish diets with the cheaper alternative plant protein moringa meal (Moringa oleifera) on growth and body composition of Labeo rohita fingerlings. L. rohita (average weight 190.25±00g) were stocked randomly in glass aquaria for a 90 day feeding trial. Fish were fed twice daily with four different iso-nitrogenous diets at a feeding level of 3% of total biomass. The diets contained 26% crude protein in which moringa meal substituted s...
Muhammad Usman Saleem, Nadeem Iqbal, Shawaiz Iqbal*, Usama Bin Khalid, Adila Iram, Muhammad Akhter, Tahir Latif and Tahir Hussain Awan
...e water, high cost of pumped groundwater, high labor costs, and drudgery in manually transplanted rice (TPR) have motivated researchers to develop alternated technology such as direct seeded rice (DSR). About 30% of total water used in rice cultivation is consumed for puddling of soil (land preparation) and transplanting operations. Physical properties of soils are deteriorating due to con...
Ali Uzun* and Bilgenur Yasa
... study, the effect of temperature and the total number of individuals of coot Fulica atra on group formation and dispersal on the lake surface was studied. Coots form large groups in winter (as many as 11,500 individuals). The total number of individuals has no effect on dispersal on the lake surface and grouping behavior of the species (p>0.05...
Bilal Atta1*, Muhammad Rizwan1, Arshed Makhdoom Sabir1, Muhammad Dildar Gogi2, Muhammad Sabar1, Bakhtawar3, Faizan Ali3 and Mehran Sarwar3
...is one of the key insect pests of stored grains. Due to export regulations and zero-tolerance for alive insects in trade commodities, synthetic pesticides are often used to eliminate pest infestation in consignments. Phosphine is currently one and the only acceptable chemical used in stored grains, but due to their overuse, stored grain pests become resi...
Khalid Khan* and Guo Xiangyu
...results indicate that 42 percent of the rice producers are technically efficient and have significant potential for technical efficient rice production. Therefore, there is a great potential to increase the per acre productivity of a typical farmer in the district to a greater extent by achieving the technical efficiency. Moreover, the additional amount of rice obtained with help of technical efficiency improvements can also...
Urosevic Milivoje1, Matejevic Milosava2*, Drobnjak Darko1 and Ozkanal Umit3
...nd differences in them depending on gender, age or place of origin. However, the premise of this research is that there are several different varieties of Tazi, depending on the proportions of the body. Measurement results of 19 morphometric parameters showed that there are statistically significant differences between three sub-populations of Tazi, one with a format index greater than 100, the other with a format index less...
Ghulam Akbar1*, Muhammad Anjum Zia1, Ali Ahmad2, Neha Arooj1 and Shahneela Nusrat1
...origin enzyme produced especially by Streptococcus bacterial spp. Therefore, it is antigenic in nature due to microbial source which restricts its use. However, it is necessary to truncate antigenic regions present in the SK gene for the removal of streptokinase antigenicity. The basic goal of this research work is to highlight antigenic regions founded in streptokinase molecule and to give strategy to remove these antigenic sites. ...
Şükrü Önalan1*, Muhammed Arabacı1and Haşmet Çağırgan2
...d, bright, round and S-type colonies with smooth margins were seen in TSA medium. They were alive during native examination without movement. It was observed that morphologically all isolates were Gram (+), α-hemolytic (BA), oxidase and catalase negative and were reproduced under 21, 37 and 45 °C temperatures with 0–6.5 % NaCl salinity. As a result of the examination of biochemical pro
Faisal Hafeez, Asad Aslam*, Ayesha Iftikhar, Afifa Naeem, Muhammad Faheem Akhtar and Muhammad Jawad Saleem
...aving minimum population per leaf (0.35, 0.23 and 0.31 in 2018 and 0.53, 0.33 and 0.42 in 2019 after 1, 3 and 7 days of spray), followed by Chlorfenpyr both years. However, Acephate was ineffective to control jassid population. Moreover, the order of percentage population change/reduction is as under: Chlorfenpyr Thaimethoxam>Thiacloprid>Acephate. In addition to this, economic analysis of both years exhibited the simil...
Fazal Haq*, Asia Parveen, Safdar Hussain and Arshad Hussain
... maximize the net profit per year. The research study deals with statistical facts and figures so quantitative method of research is approached. The growers of the major crops were the targeted population and random sampling technique is used to select the sample. Self made questionnaires, filled through interviewed process from the random selected farmers were used as a tool for collecting primary data. The raw data is tabulated and analyzed using Microsoft E...
Aamir Mushtaq1,2, Rukhsana Anwar1 and Mobasher Ahmad1,2,*
...ale albino mice were grouped into seven groups. Mice were subjected to elevated plus maze, hole board and light dark paradigm on (day 7th and 8th), for behavioral studies after which their brain were removed by decapitation for biochemical assessment. Results indicated the existence of total phenols (170.14 ± 1.16 mg of GAE/g of extract), flavonoids (87.67 ± 0.67 mg of RE/g of extract), tannins (194.04 ± 1.79 mg of TA...
Yan Xu1, Jia Zhou1, Guangfu Lv2, Yuexin Liu1, Xintong Zhao1, Xin Li1, Doudan Ye2, Xiaobo Qu1,* and Xiaowei Huang1*
... body toxic reactions, especially cardiac toxicity. This article explores the effects of pilose antler peptide (PAP) on DOX-induced myocardial injury and related mechanisms through in vitro experiments. Different concentrations of DOX were used to treat H9c2 cells for 6, 12, 24, and 48 h, respectively, to determine the IC50. Different concentr...
Alicja Kowalczyk1, Marian Kuczaj2, Anna Szul3 and Ewa Czerniawska-Piątkowska4*
...of frozen-thawed bovine spermatozoa. In this study, ten Polish Holstein-Friesian bulls with an average age of 3.5 ± 0.5 years were housed individually in pens. From each bull, two ejaculates were collected using an artificial vagina. Semen samples that showed more than 60% motility and 60% viability were selected for this experiment. To the four diluted samples were added 0µg/...
Ke Zhang1, Shuai Liu2, Qiu Chen1, Yu Wang1, Li Liu1, Bingjie Li1, Kai Ma1, Xiaoya Wei1, Aijun Li3 and Junyan Li2*
...rts have described dual specificity phosphatase 3 (DUSP-3) in parasites as an antigen. We successfully screened four potential antigens and found that DUSP-3 is a potential novel antigen for ticks.
...
Ambrin1*, Ghulam Dastagir1, Jehan Bakht2 and Muhammad Adil1
...al activity against Aspergillus niger, Penicillium notatum. Minimum MIC value was shown by ethyl acetate and ethanolic extracts of Z. mauritiana against Aspergillus fumigatus and Aspergillus niger. The ethyl acetate and ethanolic extract of O. biennis revealed maximum antifungal activity against Aspergillus niger, As...
Muhammad Asim1, Zaheer Ahmad2, M. Akbar Khan1, M. Adeeb Babar1, Sayyed Ghyour Abbas1,*, Muhammad Khalil Nawaz1, Kiran Aftab3 and Muhammad Akhtar4
...i>salmontanus. This species is well represented in the Middle Siwaliks but has not been previously reported from the Middle Miocene Chinji Formation of the Lower Siwalik Subgroup. The present evidence of T. cf. salmontanus in the Middle Miocene Chinji Formation of Pakistan extends the time range for the species from the Middle Miocene to the Late Miocene of Pakistan.
...
Iqbal Javed1, Abdur Rehman2*, Iftikhar Nabi3, Amar Razzaq4, Raheel Saqib5, Allah Bakhsh6, Muhammad Mohibullah7 and Muhammad Luqman8
...">The main aim of this paper is to review and evaluate the performance of Pakistani basmati to international markets and to estimate the impact of different factors on basmati export from Pakistan. For this purpose, panel data of eleven markets are collected from 2003 to 2016. Independent macroeconomics variables used in the study are exchange rate of Pakistan, exchange rates of trading pa...
Sajjad Ali1,*, M. Irfan Ullah2, Asif Sajjad1, Muhammad Zeeshan Majeed2, M. Aslam Farooqi1, M. Shahid Rizwan3, Qaiser Shakeel4, Sohail Akhter1,Muhammad Raheel4 and Muhammad Arshad2
...oint of their integrated pest management. Helicoverpa armigera (Noctuidae; Lepidoptera) -being highly polyphagous- is the pest of many crops and exhibits high fecundity and migrating efficiency. The present study aimed to evaluate its physicomorphic responses towards different host plants. The highest larval and pupal weights were observed when fed on gram, Cicer arietinum (L.). The maximum (97.23%) larv...
Asmaa Abdallah Darwish
...eep diseases. So, this paper aimed to assess the antioxidant vitamins (E, A, D3 and C) levels in some sheep physiological and pathological conditions. For this purpose, 200 barki ewes were divided into control group, inflammatory diseases groups (pneumonic group, arthritic group, enteric group), late pregnant groups (normal late pregnant group, pregnancy toxemia group), postpartum groups (normal postpartum group, endometric group, mastitic group and non-inflam...
Hui-Ying Chen1,2*, Ping-Chuan Yin1,2, Ya-Nan Lu1,2, Hai-Yun Li1,2*and Yang Shan3
...preventive anti-tumor properties. Aspirin is considered to be partially mediated by the induction of apoptosis in cells. However, the underlying molecular mechanisms of aspirin in the prevention of cancer are yet to be fully elucidated. In the current study, the GSE115660 microarray dataset was downloaded from the Gene Expression Omnibus database to identify key genes in aspirin-damaged yeast cells following redox injury. Differentially expressed genes (DEGs) ...
Lei Wang1, Lu Yang2, Lei Luo1, Yaqi Gao1*, Jian Gao1 and Ping Liu1
...mina RNA-Seq was used to perform massive sequencing of 18 cDNA samples derived from male adults, female adults, and pupa of A. cinerarius in southern and northern Xinjiang. We extracted total RNA from 18 samples and synthesized cDNA via reverse transcription. Then, Illumina sequencing was performed and unigenes were identified after assembly and clustering. The resulting unigenes were then compared to homologous seque...
Yuhong Li1, Dongxue Wu1, Xue Wang1, Mi Zhang1, Hanyu Zhu1, Zhe Shi1 and Fumin Feng1,2*
...omly divided into four experimental groups and one baseline group. The drug groups were orally administered with isoniazid (H), rifampicin (R), pyrazinamide (Z), and combination of these three drugs (HRZ) at 3, 5, 7, 10, and 15 days, respectively. Liver tissue pathologies and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities changed, indicating the occurrence of liver injury. Compared with the ba...
Riffat Sultana*, Nuzhat Soomro and Muhammad Saeed Wagan
...ont-size: small;">A new species Oxya kashmorensis (Oxyinae: Acrididae: Orthoptera) from Kashmore, Sindh, Pakistan is described and illustrated. We provide a comparison of Oxya kashmorensis sp.nov. and O. nitidula which is recorded from Pakistan for the first time. Comparative information on the female genitalia of both species is provided. Further, a note on the ecology and distribution of both...
Sana Khan1, Raheela Taj1, Noor Rehman2, Asad Ullah3, Imad Khan3 and Sadeeq ur Rahman3,*
...ity pattern of extended spectrum β-lactamases producing C. freundii clinical isolates. A total of 2950 clinical samples were collected from both hospitalized and non-hospitalized patients of Khyber Teaching Hospital (KTH), Peshawar, and processed by for isolation of C. freundii followed by phenotypic detection of β-lactamases and antimicrobial susceptibility profile. Our results indicated that a total of 130(4.40%;130/2950...
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...size: small;">Transition period in ruminants is defined as a phase of 3 weeks preceding and post parturition. It is characterized by metabolic stress, reduced feed intake, intense mobilization of energy reserves, increased nutritional requirements and changes in dams’ metabolism. Yeast Supplementation has been found to increase the production performance and nutrient digestibility in ruminants. However, when compared w...
Muhammad Saeed Imran1, Asim Aslam1*, Muhammad Yasin2, Tahir Yaqoob2 and Beenish Zahid3
... dose of NDV and IBV, respectively. The hosts were divided into six groups of 35 birds each. These were groups A (NDV-challenged), B (IBV- challenged), C (NDV+IBV-challenged), D (IBV+NDV challenged), E (NDV and IBV- challenged) and F (negative control). Mild to moderate clinical presentations were observed in most of the co-infected birds of groups C, D and E. Tissue samples collected at 2nd, 4th and 6th days of post infection ...
Fermín López-Uriostegui1, Jesus T. Ponce-Palafox2*, Fabiola Lango-Reynoso1, María R. Castañeda-Chávez1, Itzel Galaviz-Villa1, Sergio Castillo-Vargasmachuca2 and Arturo Ruiz Luna3
...f different levels of temperature (23, 26, 29, and 32ºC) and salinity (0, 5, and 10‰) on growth performance and survival of Macrobrachium americanum was studied under controlled laboratory conditions. Sub-adult’s prawns (10.29 ± 0.27 g) were reared in these conditions for 72 days. Each experimental group contained 25 prawn...
Mahvish Rajput1, Abdullah G. Arijo1, Muhammad Bachal Bhutto1, Rehana Shahnawaz Buriro2, Javaid Ali Gadahi1, Muhammad Naeem3 and Zubair Ahmed Laghari1*
...rphologically identical species indicating the only species infecting rumen. Further, it was found that the infection was prevalent in all months sampled but the highest infection rate was observed in November (56%) followed by October (38%), September (34%) and was observed lowest in August (22%). While, the infection rate in both sexes varies but the statistically non-significant difference in the prevalence among females ...
Murtala Muhammad, Ting Zhang, Siyu Gong, Jing Bai, Jiansong Ju, Baohua Zhao* and Dong Liu*
...ection of cultured fish species is in an alarming trend, due to the possible emergence of antibiotic resistant strains. The bacteria was responsible for the disease outbreak that caused massive mortality of Chinese sturgeon (Acipenser sinensis) in 2016. We isolated the pathogenic bacteria (HNM-1) from the infected A. sinensis and identified its identity by conventional physiological, biochemical, and molecular ...
Arifa Savanur1,*, Tallat Naz1,2, Tayyaba Hamid1,3, Syed Abid Ali4, Mian Jahangir1,3 and Muhammad Abdul Azeem4
...e: small;">Mechanical properties of a muscle have traditionally been described on the basis of the characteristics of parallel elastic component (PEC), series elastic component (SEC) and contractile element (CE). Reptiles in general and Uromastix in particular have been less investigated regarding the mechanical responses and the characteristics of elastic elements of their visceral...
Sohail Ahmed1,*, Muhammad Waseem Saleem1, Abid Ali1, Muhammad Shahid Nisar2, Rashad Rasool Khan1 and Abdul Rashid3
...unctata and Chrysoperla carnea, spray of Neem Seed Kernel Extract (NSKE) 5% and spinosad 240 SL (Tracer) were integrated in all possible combinations, thus, making a total of 15 treatments including separate application of each above and a control where none was applied except water only. Results showed significant difference amongst treatments (p <0.05). Application of spinosad alone and in combination with other control methods proved to...
Omer Draz1, Xijun Ni2, Khizar Samiullah1,*, Riffat Yasin1, Rana Mehroz Fazal1, Sakeela Naz1, Saleem Akhtar1, Mahpara Gillani1 and Muzammil Ejaz1
...ssemblage represents 16 specimens belonging to seven species of order artiodactyla which are Selenoportax vexillarius, Pachyportax latidens, Dorcatherium minus, Dorcatherium majus, Gazella lydekkeri, Hippopotamodon sivalense and Propotamochoerus hysudricus. The bovids are more prominent here as compared to all other artiodactyls. The suggested age of recovered species is Late...
Muhammad Anwarullah1*, Aneela Zameer Durrani1, Muhammad Ijaz1, Aftab Ahmad Anjum2, Ghulam Mustafa3, Muhammad Husnain1 and Muhammad Usman1
... study is conducted on experimentally challenged rabbits to observe the efficacy of amikacin and cinnamon. A total of 40 SPF (specific pathogen free) rabbits were selected at the age of two months. Rabbits were given experimental challenge with oral inoculum of pure culture of MAP. These rabbits were divided into four groups; three test and one control group. Histopathological lesions were...
Ghulam Mohi Uddin Paracha* and Yasser Durrani
... stability at ambient temperature (25 ± 5°C) of blended pulp of peach and persimmon. Effect of preservatives on physico-chemical parameters (total soluble solids, pH, titratable acidity, total phenolic compounds, ascorbic acid content and antioxidant activity) and sensory evaluation of blends was carried out. The treatments in this study included BPo [pe...
Bala Gambo Jahun1,2*, Muhammad Yamin2,3, Desa Bin Ahmad2, Muhammad Razif Mahdi2, Shamsuddin Suleiman4 and Salihu Ahmad Abdulkadir5
...tractor’s forward speed and tractor’s PTO speed in predicting mulching depth. Four blades with lifting angles of 0°, 60°, 120°, and 150°; 02 tractor’s PTO speeds of 540 and 1000 RPM and 03 tractor’s forward speeds of 1, 3, and 5 km/h were assessed for determining the effect on mulching depth in oil palm plantation....
Anila Latif, Zaheer Abbas, Farhatullah and Ghulam Muhammad Ali*
...fferent chemicals and biopesticides. DBM has shown resistance against 12 different strains of Bacillus thuringiensis (Bt) and 91 active ingredients of agricultural chemicals globally. Alternative ways should be explored to control DBM. Berberine is an insect toxic alkaloid and produced by plants of family Berberidaceae. Berberine Bridge Enzyme (BBE) gene involved in the synthesis of berberine was isolated from Berberis lyceum and over expressed in Arabidopsis ...
Muhammad Usman Ghazanfar1, Waqas Raza1*, Waqas Wakil2,3, Imtiaz Hussain4 and Misbah Iqbal Qamar1
... Bary and sucking insect pests of potato (Solanum tuberosum L.) with application of salicylic acid (SA) and β-aminobutyric acid (BABA). Concentration of SA and BABA (2, 4 and 5 mM) were applied to foliage. Application of both resistance inducers suppressed disease development by 54.1% and 67.4%, for SA and BABA, respectively, 5 days after pathogen inoculation. Numbers and size of lesions pe
Hasnain Alam1*, Jabar Zaman Khan Khattak1 and Taoufik Saleh Ksiksi2
...owards using indigenous species for sustainable landscaping. In this study, we evaluated the germination response under osmotic stresses for four native species i.e. Atriplex leucoclada, Senna italica, Tetraena mandavillei and Tephrosia apollinea. Two osmotic agents (OA) i.e. NaCl and PEG 6000 and four osmotic levels (OL) i.e. 0, -0.2, -0.4 and -0.6 MPa ...
Ahmad Kiani1*, Shapour Zarifian1, Hosein Kouhestani1 and Hosein Karimzadeh2
...ral industries are one type of rural industries and it’s so important in Iran because of major potential of agriculture in Iran and also other developing countries. According to the statistics in Tehran province by the end of 2013 about 135 units of Agricultural industries were active but there is still the gap between urban regions and rural regions and many immigrants from rural regions to urban regions have been recorded. So, this research tries to pr...
H. Liu1, X.P. Tang1, R.J. Fang1,*, F.Yi2, C. Zhang2, R.Q. Yang1, F. Sun1 and S.Y. Zhou1
...of different level of copper amino acids complex on growth performance and serum Cu-Zn SOD activity in piglets. A total of 288 (144 castrated males and 144 females) healthy post-weaned at 23-day-old piglets (Duroc × Landrace × Yorkshire) with an average body weight of (8.79±1.15) kg were randomly divided into 6 groups with 8 replicates in each group, and 6 piglets (3 castrated males and 3 females)
Xiuqing Hao1, Zhe Hong2, Huili Gao1, Fumin Tian1, Hongke Zhang3, Yu Zhou3, Yuming Guo3, Guang Yang1,* and Bingyao Chen1,*
...duals/km2, respectively in Beihai and Shatian. The coefficient of variation value of 20.42% and 25.43% showed moderate accuracy. The Beihai and Shatian seabird communities had similar fixed kernel home range. Seabirds’ distribution largely overlapped with various vessels’ concentrated area, possibly due to abundant local fishery resources and forging behavior of seabirds. The MaxEnt model with the area...
Sara Zafar* and Asmatullah
...of a commonly used antihypertensive drug, atenolol during gestation and ameliorative effect of pomegranate juice against its toxicity. Dose was administered to pregnant mice by gavage. The high dose contains Atenolol 2.5 µg/g body weight (B.wt.) of treated mice and low dose contains 1.65 µg/g B.wt. The dose was administered from the 6th -12th day of the gestation period for seven days. Many congenital abnormaliti...
Tingting Li, Shuangshuang Geng, Long Xie, Huiyan Xu, Aolin Luo, Pengwei Zhao, Huan Yang, XingWei Liang, YangQing Lu, XiaoGan Yang* and KeHuan Lu*
... in the reproduction of spermatogonial stem cells (SSCs). To date, commercialized murine and human GDNF have typically been used for the in vitro culture of SSCs from domestic animals. However, whether endogenous GDNF is superior to xenogenic GDNF in SSC culture in vitro remains unclear. To answer this question, the buffalo GDNF gene was cloned and integrated into the PiggyBac eukaryotic expression vector, whic...
Rabia Saeed1, Muhammad Naveed1, Muhammad Razaq2*, Muhammad Rafiq1, Muhammad Tahir Jan1, Syed Ishfaq Ali Shah1, Shabana Wazir1 and Fahad Munir3
...) has become destructive pest of cotton since 2011. The pest causes severe lint staining and seed germination reduction problems. Antilochus coquebertii (Fabricius) (Heteroptera: Pyrrhocoridae) is significant predator of the genus Dysdercus and other members of the pyrrhocoridan family. In the present annotation, we record for the first time A. coquebertii in cotton growing areas of Dera Isamil Khan, Muz...
Khayyam1*, Muhammad Zahid1, Naiz Ali2 and Qadeem Khan3
...(p=0.041, 0.025respectively) but follicle stimulating hormone was significantly low (p=0.0007) in female HT patients. Follicle stimulating hormone and Luteinizing hormone concentrations were higher than normal range in both male and female Grave’s disease patients. Prolactin and serum gonadotropin showed fluctuations in Hashimoto’s thyroiditis patients but in Grave’s disease patients only the gonadotropins showed abnormal values...
Shaheen Rahman1, Kafeel Ahmad1*, Niaz Ali2, Muhammad Idrees3 and Waqar Ali4
...terial cells were rod shaped having rounded ends. The strains were Gram positive. Results confirmed the pathogenicity of the isolated strains as shown by development of tumours on carrot and potato discs. The pathogenic potential of the isolated strains demand for proper management and control measurements to spread and prevent infections of A. tumefaciens.
...
Tehreem Usman1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qaisra Siddique1
...main objective of this experiment was to see the behaviour, catalase (CAT) activity and total protein contents (TPC) in Ctenopharyngodon idella under binary mixtures of insecticides viz. endosulfan(ES)+chlorpyrifos(CPF) and endosulfan(ES)+bifenthrin (BIF). The fish behaviour was observed from both treated and control groups. Fish under exposure of insecticides mixtures exhibit abnormal behaviour and tried to jump out from water, come to surface and gulp...
Abdur Rehman1*, Sajjad Ahmad1, Ahmed Zia2, Asad Ali3, Kiran Shahjeer4, Abdul Latif1 and Taimur Khan1
.... The study revealed 23 species from 15 genera under 3 families. The abundant family was recorded as Libellulidae that was comprised of 19 species belonging to 11 genera, family Gomphidae included 3 species belonging to 3 genera and family Aeshnidae included one species belonged to one genus. Detailed description of each spe
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Saliha Khalid1, Rana Manzoor Ahmad1,2, Ayesha Iqbal1, Muhammad Ameen1
...igations of Boselaphine specimens belonging to genera Pachyportax and Selenoportax. The available information on both taxa is scanty and only few specimens are known for both genera especially Pachyportax. The members of both genera have medium to large sized body with strong hypsodonty of teeth representing grazing on coarse grasses and shrubs in the Late Miocene Siwa...
Muhammad Tariq Rasheed1, Imran Bodlah1*, Ammara Gull e Fareen1,2, Muhammad Shakeel Khokhar1
...wood (1840) is a species rich genus in subfamily Myrmicinae. Many species of this genus are reported from various parts of the world including neighbouring countries of Pakistan. Members of this genus are considered as generalized foragers and cryptic in nature. Collected material was verified using most recent and available literature provided by Bharti and Akbar (2014). He...
Dil Afroza Khanom1, Amirun Nesa1, Muhammad Abu Sayed Jewel1, Muhammad Ayenuddin Haque1, Alok Kumar Paul1, Sonia Iqbal2, Usman Atique2,3*, Lubna Alam4
...mercially valuable fish species viz. Gudusia chapra and Eutropiichthys vacha, for the muscular tissue bioaccumulation of selected heavy metals (Pb, Cd, Cr, Zn, Cu, and Mn) and their human health risks. A total of 50 fish species (25 individuals each) were examined from the Padma River, Bangladesh, and subjected to heavy metals presence and loads by detection after wet digestion of samples. T...
Afzal Nimra1, Zulfiqar Ali1*, Safdar Sidra 2, Rida Ahmad1
...ated in the Orthopaedic Operation Theater (OOT), Orthopaedic Wards (OW) and Orthopaedic Emergency Rooms (OER) of six hospitals, in Lahore, Pakistan. Overall, the average levels of Cd, As and Ni (31, 20, and 37 ng/m3) were lower indoors as compared to outdoors (39, 21, and 51 ng/m3) except Pb. The high indoor levels of Pb (113 ng/m3) as compared to outdoors (85 ng/m3) suggested pronounced indoor sources. The average i...
Abid Khan*, Mukhtar Alam and Yousaf Jamal
...rtilizers. The current experiments were conducted on “Effect of bio-priming, organic and inorganic nitrogen sources and beneficial microorganisms on growth and biochemical traits of wheat” for two years at Agricultural Research Station Buner, Khyber Pakhtunkhwa, Pakistan. The experiments were laid out using three factors factorial Randomized Complete Block Design (RCBD) with three replications. Bio-aab was used a...
Muhammad Medrar Hussain*, Asad Jan* and Sayyar Khan Kazi
...ssed in Oryza sativa subspecies indica variety Swat-1. Through Agrobacterium mediated transformation, OsTZF8 gene (pBIG-Ubi-OsTZF8) was successfully transferred to rice calli. From these rice calli transgenic plants were regenerated and established in greenhouse. For the evaluation of OsTZF8 gene role in drought stress tolerance, two weeks old rice seedling were subjected to drought stress. OsTZF8-OX transgenic indica line A and B displayed 69% and 64% surviva...
Arshad Farooq1*, Muhammad Zafarullah Khan2, Abdul Hassan1, Muhammad Ishaq3 and Asif Nawaz2
...rea. Data were collected personally through face to face interview schedule from 285 sample respondents randomly selected from eight villages of the eight selected union councils. The empirical results indicated that farmers of district Mardan had 41 percent knowledge gap with cane yield 58387 kgs/hectare and sample farmers of district Dera Ismail Khan had 33 percent knowledge gap with 821...
Muhammad Younis1, Shahen Shah1*, Inamullah1, Rozina Gul2, Arshad Jalal1, Farhan Khalil1, Iqbal Hussain1 and Muhammad Adnan Fahad3
...low, inadequate and improper fertilizers management. Among the various factors influencing crop production, phosphorus (P) and sulphur (S) boost its yield and quality. A field trial was conducted in summer 2012 using phosphorus @ of 0, 25, 50 and 75 kg ha‑1 and sulphur @ of 0, 15, 30 and 45 kg ha‑1, respectively on the yield contributing parameters of sesame. Pods plant‑1, grain yield, plant height, and harvest index (...
Muhammad Salim1*, Ayhan Gökçe1, Muhammad Nadir Naqqash1 and Orkun Ersoy2
...us is one of the serious pests of cereal crops worldwide. To control this pest, diatomaceous earth (DE) formulation consisted of diatoms, obtained from Niğde Province, Turkey, was tested against adults of the granary weevil, Sitophilus granarius (L.) under laboratory conditions (25±1°C, 60±5% RH). Diatomaceous earth was applied to wheat grain at the rates of 100, 250, 300, 500, 750, 1000, 1500 and 2000 mg/...
Filza Fatima Rizvi1, Muhammad Umair1, Muhammad Kahlid Jamil2*, Masooma Hassan2, Komal Qayyum1 and Syed Mohsin Raza Kazmi3
...n. This region has no proper irrigation system due to its topography. Additionally, potential of renewable energy in Pothohar region that includes solar, wind and biogas has been calculated from the data, taken from different sources. Based on the analysis, it is estimated that the solar energy potential in Pothohar region is ~ 97321 MW, only ~ 126 MW (0.12 %) is used in Agriculture sector for different farm operations. Like...
Gulnaz Parveen1*, Salma Gul2, Muhammad Ather Rafi3, Ashfaq Ali Khattak4 and Hikmatullah Jan5
...omato plant. Tomato (Lycopersicum esculentum) plant is highly susceptible to root rotting fungi causing huge losses each year in Pakistan. Acacia nilotica used as a biofertilizer and Significant (p< 0.05) enhanced the growth of tomato plants. Infection % of all test fungi included Fusarium solani, Fusarium oxysporum, Macrophomina phaseolina and Rhizoctonia solani was significantly controlled by leaf powder (LP) and shoot powder (ShP) when applied alone and ...
Muhammad Ali1*, Norsida Man2, Farrah Melissa Muharam2 and Siti Zobidah Omar3
...n, which was followed by perceived behavioral control and lastly the subjective norms. Thus, using TPB in this context would be helpful for other researchers and academia to understand the influence of each construct in the model. ...
Jaffar Hussain1*, Syed Farman Ali Shah1, M. Zeenat Ali1 and Javad Ahmad Shah2
...d about 80% population depend upon agriculture. Soil is an important medium on which crops grow and obtain nutrients for their growth and improvement. For determination of macro-micronutrients and some physico-chemical properties of soil, samples were collected from different area of Jamshoro (Soman, Murad, Abadnear Kotrai Jamshoro). These nutrients are so important for crops yield and human being. The results explain that s...
Samman Gul Vaseer1, Muhammad Rasheed1*, Muhammad Ansar1, Yamin Bibi2, Saqlain Shah1, Asma Hassan1, Lubna Ayub Durani1, Muhmmad Asif3 and Zuhair Husnain1
...) was adopted for this experiment, where Cobalt nitrate (Co (NO3)2) was applied at the rates of 10ppm, 20ppm, and 30ppm in combination of inoculation on mung bean three verities Chkwal-06, NM-16 and NM-11. Analyzed data was recorded related to mungbean growth and development parameters Mungbean have maximum response with inoculated 30ppm cobalt nitrate + slurry treatment in respect to growth, yield attributes, nodule number,...
Bilal Saeed Khan1*, Muhammad Afzal2, Muhammad Asif Qayyoum1, Imran Ali3 and Abdul Ghaffar3
...jab, Pakistan. The holotype female (male unknown) of the new mite species Pseudostigmaeus sorghumus sp. nov was collected from city Dera Ghazi Khan on Sorghum bicolor (L.) and described. Fifteen paratypes were also collected from same collection data and seven were from Muzaffargarh. ...
Aurang Zeb, Abdur Rab and Shujaat Ali*
...ign: justify;">The lab experiment was conducted on “Effect of location on physico-chemical composition and storage duration of Sweet orange” at The University of Agriculture, Peshawar in 2016. Complete Randomized Design and three replications were used. Sweet orange was collected from four different locations i.e. location-1 (Torwarsak, Buner), location-2 (Rabat, Lower Dir), location-3 (Wartair, Malakand) and location-4 (Palai, Malakand) stored u...
Ahmad Khan1*, Raza Ullah Khan1, Sadia Khan2, Muhammad Zameer Khan1 and Fayyaz Hussain1
...align: justify;">A pot experiment was conducted in experimental area of National Agricultural Research Centre, (NARC),Islamabad to see the effect of plant derived humic substances (PDHS) on chickpea crop grown in 5.50 kg soil container, consisting seven treatments, whereby HS was given either as soil applied (at the rate 0, 15,30,45,60 mg l-1) and as foliar ( 100,150 mg l-1) The ex
Shah Nawaz Khuhro1*, Irshad Ali Junejo1, Muhammad Haroon Hullio1, Sultan Ahmed Maitlo2, Javeed Shabir Daar3 and Shahjahan Rajput1
...ost excellent integrated pest management approach to prevent problems from increase of whitefly population in the brinjal crop. Further is suggested that these traps are extremely not expensive and simple they can be posted by any unqualified labor. ...
Shah Nawaz Khuhro1*, Irshad Ali Junejo1, Muhammad Haroon Hullio1, Mohammad Farooque Hassan2, Sultan Ahmed Maitlo3 and Mukhtiar Ahmed Shaikh4
... and practices regarding pesticide application by the vegetable growers in Dadu canal irrigated area carried out on targeted vegetable farmers in three Districts Shikarpur, Larkana, and Dadu of northern Sindh, Pakistan. The effect of pesticides on human health and the environment is a main public health issue in Pakistan. These negative effects of pesticides can be minimized by awareness t...
Md. Zubael Islam, Rukhsana Amin Runa and Md. Mahmudul Alam*
...56.52%) compared to the open pack housing system (43.48%). This study highlights the prevalence and potential risk factors of bovine foot diseases in certain areas of Sirajgang district. It is recommended that further robust studies are required to address the foot disease burden in lactating cows. ...
Mian Adnan Kakakhel1, Faryal Gohar1, Zahid Anwar2, Raza Ullah1, Muhammad Attaullah3, Shahbaz Ahmad4, Aamir Khan5, Kalimullah5*
...ii infection in pet dogs. To evaluate the main associated risk factors related with T. gondii exposure to this region. A total of a hundred number of blood samples (72 males and 28 females) were collected from Peshawar, Pakistan. The serum samples were analyzed for IgG and IgM by using enzyme-linked immunosorbent assay (ELISA), and statistical analysis c...
Muhammad Iqbal1, Sami Ul-Allah2*, Muhammad Naeem1, Muhammad Ijaz2 and Muhammad Qadir Ahmad3
....05% for different genotypes. Cultivar into irrigation interaction was significant and genotypic variability declined under water stress conditions relative to irrigated conditions. Fresh and dry shoot weights were positively correlated with all seed traits. The highest correlation (0.94) was observed between seed weight and fresh shoot weight under irrigated condition followed by correlation of dry shoot weight with seed weight (0.89) under irrigated conditio...
Ayesha Zafar1, Ghulam Sarwar1*, Muhammad Sarfraz2, Muhammad Zeeshan Manzoor1, Sher Muhammad3 and Ghulam Murtaza1
... low osmotic potential, specific ion effect, and nutritional imbalance. The fertilizer behavior in salt stress conditions is quite different as compared to the normal soils. Linseed is an important oil seed crop. Its 50 % yield reduction occurs at ECe 5.9 dSm-1 and ESP value of 25-30. A field experiment was conducted on saline sodic soils to determine fertilizer requirement of linseed. The selected field was saline sodic in ...
Ghani Akbar
...thods. Therefore, this paper is aimed to investigate the key agricultural issues and to identify strategies for utilizing the full potential of agriculture for improving livelihood in this region. This study indicated that climate change induced hazards of land degradation and water scarcity due to frequent floods and droughts, decline in traditional springfed Kuhl (gravity channel) irrigation system, low productivity of crops and horticulture, less productive...
Application of MATLAB for Designing and Simulation of High-Efficiency Center Pivot Irrigation System
Filza Fatima Rizvi1*, Waqar khan2, Syed Mohsin Raza Kazmi3 and Muhammad Umer4
...orld. Water availability per capita in Pakistan is dropping very alarmingly. Against a dismal supply of 191 million-acre feet, the demand for water is projected to escalate to 274 MAF by 2025, culminating into a deficit of 83 MAF. Pakistan has the world’s fourth-highest rate of water use and is already the third most water-stressed country in the world. Being an Agricultural country, more than 90 percent of Pakistan&rs...
Muhammad Jan1*, Safdar Hussain2, Muhammad Anwar ul Haq3, Javed Iqbal4, Ilyas Ahmad4, Muhammad Aslam4 and Aiman Faiz3
...nce started from the independence and many of the cultivars were introduced and evolved. But the fiber quality and seed cotton yield up to now till is poor in quality as compared to other developed countries. A judicious combination of manures and fertilizers depending upon the availability, the type of the soil and crops to be grown would not only maxim...
Muhammad Mohibullah1*, Mehran1, Sundas Batool1, Muhammad Amin1, Zakiullah1, Muhammad Ilyas2, Irfanullah1, Abdur Rehman1 and Sardar Ali3
...r arietinum L. genotypes atAgriculture Research Institute, D. I. Khan, Pakistan. Sixteen chickpea genotypes including 14 accessions along with 2 check varieties (Bhakkar-2011 and Bittle-2016) were grown and evaluated according to (RCB) design in three blocks. High variation were noted in the chickpea germplasmsin days to germination, days to 50% flow...
Noor Islam1*, Rashid Mahmood1, Ghulam Sarwar1, Sarfaraz Ahmad2 and Saleem Abid3
...onsumption rate (71.90 g per colony), maximum sealed worker brood area (1562.0 cm2 per colony), mean highest maximum (12 frames covered with bees per colony), and higher (9.2 kg Zizyphus spp. honey per colony) as compared with control (D 5) and other tested diets. Honey bee colonies fed over Diet 2 gave a maximum economic return followed by Diet 4, Diet ...
Iram Fatima1*, Imran Pasha1, Ambreen Saddozai2, Shahid Nadeem3, Amer Mumtaz4 and Saqib Jabbar4
...hat the need for proper implementation of food safety legislation at this low scale patronage. ...
Wajiha Anum1*, Liaquat Ali1, Umair Riaz2*, Abid Ali1, Nadia Manzoor3, Laal Hussain Akhter4, Asad Ur Rahman5, Naeem Maan6 and Ijaz Ahmad7
...ent uptake by crop, an experiment was conducted to appraise the effect of various P placement methods and fertilizer rates on wheat. The fertilizer treatments were F1=150-00-60 NPK kilogram/hectare, F2=150-30-60 NPK kilogram/hectare, F3=150-60-60 NPK kilogram/hectare, F4=150-90-60 NPK kilogram/hectare, F5=150-120-60 NPK kilogram/hectare. While the placement methods were M1=Line sowing + Band application of phosphorus, M2=Line sowing +Broadcast application of P...
Ghani Akbar*, Muhammad Asif, Zafar Islam and Shahid Hameed
...hod, has been adopted, especially for row crops but decision support guidelines for their appropriate installation and management is very limited, thus potential benefits of furrow beds are yet to be achieved on Pakistani farms. Consequently, water productivity of major crops is below global average in general and neighbouring countries of Pakistan in particular. This study has illustrated some key guidelines for the appropriate installation and management of ...
Muhammad Rasheed1*, Zafar Ullah1, Muhammad Ansar1, Asma Hassan1, Shahzada Sohail Ijaz2, Muhammad Hussain Shah4 and Muhammad Arshadullah3
...othowar region. Field experiment was conducted to evaluate forage growth and yield of oats (Avena sativa) and vetch (Vicia sativa) grown in mixture stands under conservation and conventional tillage systems. The highest number of tillers plant-1 (11) for Oats was recorded in oats-vetch mixture under conventional tillage (CT) while comparing minimum tillage (MT) to zero tillage (ZT) 43 percent higher yield of oats was obtain...
Neelam Pery*, Nayab Batool Rizvi, Muhammad Imtiaz Shafiq
..."font-size: small;">Therapeutic options for rheumatoid arthritis have increased tremendously over the last two decades. The persistent monopoly of the conventional disease-modifying anti-rheumatic drugs over the drug platform has been taken over by a number of biologics including TNFα inhibitor...
Majeeda Rasheed1*, Tanveer Akhtar1, Nadia Mukhtar2, Muhammad Furqan Shahid2, Muhammad Imran3, Saima Yaqub2
...-size: small;">Peste des petits ruminants (PPR) caused by PPR virus (PPRV), is a contagious disease of domestic and wild small ruminants. The disease is endemic in developing countries of African and Asian worlds including Pakistan, where several clinical cases in small ruminants (sheep and goat) have been frequently reported. Despite PPRV is endemic in Pakistan, information on disease serosurveillance of prevailing strains in Gilgit-Balitistan (GB) terri...
Saira Saleemi1*, Zafar Iqbal1, Abdul Nasir Khalid2
... in freshwater fishes. Aspergillosis is a fungal disease of fish. This study was designed to examine a fungal infection in silver carp, Hypophthalmichthys molitrix. The infected fish showed clinical signs such as: eroded gills, damaged fins and lesions all over the body. The fish specimens showed mild to severe infection. The infection caused by fungus was confirmed by isolating the pathogenic fungus from affec...
Hina Nazli, Abida Butt*
...ccessfully manage insect pests. Along with insect pests, many predators of these pests are also present in crops and affected by these management activities. Spiders are the most abundant predators of insect pests in the agroecosystem. The present study was designed to assess and compare acute and residual toxicity of two insecticides i.e Spiromes...
Fehmina Ashraf1*, Muhammad Irfan2, Hafiz Abdullah Shakir1, Shaukat Ali3, Muhammad Khan1
...C 1.10.3.2) are multi-copper polyphenolic oxidases that oxidize many phenolic and non-phenolic aromatic compounds such as amino or methoxy monophenols, syringaldazine, ABTS and amino or methoxy monophenols. They have been depicted in various species of bacteria, plants and in different genera of fungi. Laccases have been purified by various methods. It involves in di-oxygen to water reduction and 1e- oxidation of phenolic an...
Md. Al-Amin Tan1, Mst. Antora Akter1, Md. Sabuj Rahman1, Marzia Rahman2 and Md. Mahmudul Alam1*
...ation that leads to postoperative complications. Although preoperative skin preparation is a standard surgical practice to prevent SSI, the choice of skin disinfectants and methods of skin preparation is still aberrant in veterinary practice. The study was, thus, conducted to standardize pre-surgical skin preparation with various formulations of Chlorhexidine gluconate, Chlorxylenol, and Povidone-iodine (PI) in goat. Seven s...
Ayesha Iqbal1, Ghulam Sarwar1, Abdul Majid Khan1*, Muhammad Tahir Waseem1, Ayesha Iqbal1, Rana Manzoor Ahmad1,2, Muhammad Ameen1
...e between the different species of wild and domesticated suids. The studied material comprises of the three skulls. The straighter snouts and slenderer crania manifests that specimens under study were wild while the sex of species was determined by the permanent canine teeth morphology, as in females the upper canines ...
Zubair Aslam and Ali Ahmad*
...trients deficiency, an experiment was conducted in Riverm Kompost Vermikompost Tarım Hay. Mak. San. ve Ltd. Şti. Suleymanpasa, Tekirdag, Turkey under field conditions. In field four different states of fertilizers [F0: Control (No fertilizer application); Fvc: Solid vermicompost @ 5 ton/ha; Fvt: vermi-tea @ 6 %; Fc: Chemical fertilizers (N and P) @ 120-100 kg/ha were applied in maize hybrid P30B74. The plants were harvested 45 days after sowing and the evalu...
Korkmaz Bellitürk1, Zubair Aslam2, Ali Ahmad2* and Sami ur Rehman2
... The objective of this experiment was the chemical and physical analysis of raw material of goat manure, cow dung, sheep manure and their vermicompost products. The earthworms for vermicomposting, Eisenia fetida (an epigeic species), were used as the test species. The samples were collected from prepared vermicompost and raw material for chemical and physical examination. For these samples...
Hasaan Aziz*, Fariha Altaaf, Attia Bashir, Abdul Basit, Syed Anam Masood Gardazi and Farah Haider
...: justify;">Canine distemper (CD), caused by canine distemper virus (CDV), is highly contagious disease of carnivores and is quite prevalent in Pakistan. The CDV is known to exist as 11 distinct clades around the globe; however, as to what prevail in Pakistan to devise appropriate diagnostics and control strategies is yet to be known. Despite the use of modified live vaccine to dogs, occurrence of disease is not uncommon. He...
Anurag Sharma*, Naresh Kumar, Geetanjali Singh and Anika Sharma
...uired for many of them especially for animal use. The phyto-pharmacological research on these two natural products show a ray of hope for the discovery of new active compounds with a novel structure that has potential to serve as a natural lead compound for the development of new nutraceuticals and galactagogue for animal health. ...
Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5*
...uman rotavirus VP4 genotype detected in Moroccan children fully vaccinated with Rotarix™. After RNA virus extraction, the rotavirus VP7 and VP4 genes were amplified. The DNA was purified, sequenced and genotypes were determined using the RotaC online classification tool. A phylogenetic tree was constructed using the Maximum Likelihood method applying the Tamura 3-parameter model in MEGA 6.06 package and statistically s...
Olotu Titilayo Mabel*, Adeosun Idowu Jesulayomi, Kaka Mary Oluwatosin and Oladipo Elijah Kolawole
...immunodeficiency virus type 1 (HIV-1) has been shown to be relevant to HIV-1 pathogenesis and disease. HIV-1 genome has nine genes; gag, pol, and env genes are common in all replication-competent retroviruses, and the pol gene is very unique encoding the enzymes for replication. Our objective is to describe the relatedness of these HIV-1 pol genes with each other and its antiviral drug susceptibility which will provide more ...
Muhammad Rafiq1, Muhammad Tariq Mahmood2*, Mushtaq Ahmad2, Imtiaz Ali3, Muhammad Saleem1, Irfan Rasool1 and Zeshan Ali4
...vere constraint for chickpea productivity across the globe. In Pakistan, it is primarily cultivated in drought-prone regions and marginal lands where moisture stress is a major limiting factor for chickpea production. In order to identify drought resilient chickpea genotypes, a field experiment consisting of 16 elite g...
Zia-Ur-Rehman1, Faisal Sohail Fateh2*, Humayun Saleem1 and Muhammad Abu Bakar Siddique1
... justify;">Peach (Prunus persica L.) after plum is a major stone fruit in Pakistan. It belongs to the Rosaceae family. In Pakistan, peach with production of 72536 tonnes is grown on an area of 14350 hectares. A variety of diseases infect the peach tree. Among these diseases, brown rot disease is very important that reduces yields primarily by decaying the fruits on the tree ...
Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1*
...the feeding behavior and performance of sheep and goat. The animals were fed on Maize, Sorghum, and Millet. For this purpose, a total of 90 animals (n=45 sheep) and (n=45 goats) were randomly assigned into six groups (n=15) each under 2x3 factorial arrangement. All groups of both species were fed maize, millet and sorghum randomly. Results indicated that goat spent more time to eat than sh...
Joseph Anejo-Okopi1*, Ocheme Julius Okojokwu1 and Onyemocho Audu2
...t of easy to use and inexpensive molecular methods for accurate diagnosis. The sub-Saharan Africa HCV genotypes distribution are diverse, but genotype I is the most common. This review highlights the need for more robust surveillance studies with introduction of opt-in testing at all clinics for better epidemiology the HCV disease burden more accurately. ...
Muhammad Abu Bakar Siddique1, Faisal Sohail Fateh2*, Zia-Ur-Rehman1 and Humayun Saleem1
...e incidence and severity percentage. However, the presence of black scurf disease in the market shows that in Pakistan the consumers do not consider it as a threat, because it remains in potato peel only. ...
Naseem Zahra1* and Shajia Jabeen2
... not be left undamaged depending upon the hulling process. Brown rice may become white rice when the bran layer is exposed of in the milling process. In present era where diseases are common and people are in search of nutritious diet containing minerals and essential compounds, brown rice is found to be healthiest and minerals rich food commodity. Due to its appearance, color and texture ...
Hafiz Abdul Ghafoor1*, Muhammad Afzal1, Muhammad Luqman2, Muhammad Arshad Javed2, Syed Wasim Hasan3 and Muhammad Zeeshan Majeed1
... destructive sap-feeding pest of a number of horticultural and agricultural crops in Indo-Pak region. It has been an emerging threat to citrus industry in Pakistan and is considered as hard-to-control pest. This study evaluated some selected pest control options against the infestation of D. mangiferae under field conditions. The treatments included some most effective conventional and nov...
Jawad Ali Jan1, Ghulam Nabi1, Maqsood Khan1,2*, Shehzad Ahmad1, Peer Sikandar Shah1, Saddam Hussain1 and Sehrish1
...utritional value. This experiment was conducted at Agriculture Research Institute (ARI) Tarnab, Peshawar during summer 2016. Two factors i.e. Chilli varieties (Magma and High fly) and humic acid levels (0, 25, 50, 75 and 100 g L-1) were applied in the field during experiment. The results of the experiment showed that High fly variety took minimum days to produce flowering (33 days), maximu...
Muhammad Usman Asif1*, Sadam Hussain Soomro2, Raza Muhammad1, Sikandar Ali Soomro2
...d high dose (160 ml), respectively. After 72 hours, 83.33% mortality was observed in Voliam Flexi on its recommended dose whereas percent mortality was reached to 100% on its high dose. Uniron 10 EC was also found effective and statistically at par with Voliam Flexi 300 SC causing 100 % mortality at its recommended dose after 96 hours of exposure. However, Bio CareTM 16000 IU/mg consisting of Bacillus thuringie...
Yasir Iftikhar1, Mustansar Mubeen1,2*, Waqas Raza1, Qaiser Shakeel3, Waseem Abbas1, Shehzad Iqbal1 and Ashara Sajid1
...antly correlated with temperature (max and min), and relative humidity (RH). Whereas, disease severity in moderate resistant varieties also showed a significant correlation with temperature. However, disease severity in the moderate resistant varieties were significantly correlated with the temperature and relative humidity. Highest disease incidence (39.33 %) was recorded at maximum tem
Khalid Khan1, Marguerite Wotto2, Saima Liaqat3, Gulawar Khan1, Balach Rasheed1, Sara Rafiq4 and Guo Xiangyu5*
...technical efficiency and performance of the farmers. The study results disclosed that all explanatory variables have a positive impact on the farmers’ technical efficiency apart from pesticides. Additionally, the average technical performance of the farmer was 85% which shows that on average a farmer can spur the tomato production by 15 % by using the existing resources. Moreover, th...
Hafiz Muhammad Imran Javed* and Mushtaq Ahmed
...tide long with a single open reading frame encoding 526 amino acids. Similarly, the ORF of F gene was 1641 nucleotide long which encoded 547 amino acids. Upon phylogenetic analysis of the country isolates with the vaccine strains, it was revealed that isolates were clustered within lineage IV (Asian Lineage) closer to Indian isolates. On the other hand, a number of substitutions were observed at sites considered important for the structural and functional inte...
M. Hammouchi1*, G. Sebbar1, N. Touil2, C. Loutfi1, Y.S. Malik3, M. El-Harrak1 and O. Fassi-Fehri4
... sheep (Timahdid) were experimentally infected using the protocol previously validated for Alpine goats. The infected animals showed mild or no clinical signs of disease, with low levels of viral RNA detectable in swabs and fecal samples taken at the peak of infection. The transmission of the disease to animals (Timahdid breeds) brought into contact without manifestation of clinical signs, may indicate that local breeds of s...
Paul Oludare Adetunji* and Safiriyu Idowu Ola
...valuate the reproductive performance of three plumage varieties of Noiler cocks, with a view to helping both the farmers and breeders in selecting the best performing variety for rearing and further genetic improvement. Eighteen cockerels of three plumage colours (brown, black and barred) were divided into 2 replicates with 3 birds per replicate. The study lasted for 38 weeks (Feb.-Nov., 2...
Pravin Mishra1, Md. Muket Mahmud2, Md. Ahosanul Haque Shahid2, Alamgir Hasan2, Vivek Kumar Yadav3 and Moinul Hasan1*
...lth-workers, and general people regarding the situation of antibiotic resistance. As maggot helps in the reduction of bacteria, this can be used as medical therapy in the case of a different wound. ...
Imad Hassan1, Bilal-ur-Rehman2, Muhammad Amir2, Faheem Ali2*, Salman Ilahi2 and Amjad Ali3
...d efficiency analysis. Experimental evaluation of the proposed ESP design is carried out for the removal of particulate matter from a biomass combustor. The results shown in this paper are promising and exhibit that a simple solution can achieve above 90% efficiency. The average particulate collection efficiency of our proposed ESP reached its peak stable value of 99.1% when tested with ap...
Amjad Ali1, Awais Salman1, Gul Daraz Khan1, Aftab Ahmad Khan2, Sher Shah Hassan2*, Muhammad Arif Goheer2, Mahmood Alam Khan3 and Sajjad Ahmed3
...m emphasizing production per unit area towards maximizing the production per unit of water consumed. This field experiment was carried out to assess growth and yield responses of turnip to different deficit irrigation levels and sowing dates at Research Farm situated at The University of Agriculture, Peshawar. The experiment was laid out in Randomized Co...
Rana Shahzad Noor1,2*, Fiaz Hussain2, Muhammad Umair2, Waqas Aslam2, Muhammad Ameen4, Muhammad Adnan Islam3 and Muhammad Sheraz2
...age systems on main crop peanut and wheat + second crop peanut in order to evaluate crop yield, fuel consumption and to perform economic analysis. Two years study results showed that the main crop peanut yields changed between 4331.0 kg ha-1 and 5486.6 kg ha-1, while second crop peanut yields changed between 2670.6 kg ...
Salman Khan, Irfan Ullah*, Shahid Ali and Murtaza
...g 2018. A Cobb-Douglas type production function was used to approximate effect of determinants on potato yield. Major shares of the input cost per acre incurred in the study area were seed (Rs. 18720), followed by land rent (Rs.15890) and labors having an estimated cost of Rs. 14965 respectively. The analysis showed that on average per acre yield of pota...
Abdus Salam* and Muhammad Zafarullah Khan
...alyze the farmers’ perceptions regarding use of information and communication technologies (ICT) in agriculture extension at three selected districts of Khyber Pakhtunkhwa. Based on the multi-stage sampling technique, population for the current study, 3 zones from 5 were purposively selected on the basis of their different agricultural condition. Selection of sample size was made using Yamane formula. The number of respondents as
Biomass Allometric Equations of Naturally Growing Cedrus deodara in Dry Temperate Forests Ecosystems
Abdul Raqeeb1,3, Syed Moazzam Nizami2,4*, Aamir Saleem3, Lubna Ansari3, Saeed Gulzar3, Basit Ali3, Masooma Saleem5
...ical data of particular species for a specific forest ecosystem is of utmost importance. In the present study volume and biomass allometric of naturally growing Cedrus deodara tree in dry temperate regions of Himalaya has been developed from the empirical data collected from four different locations with three sites each as representative of its naturall...
Javed Iqbal1, Ali Zohaib1*, Muzzammil Hussain1, Adnan Bashir1, Muhammad Hamza2, Wardah Muzaffer3, Muhammad Tahir Latif1 and Naeem Faisal1
...ed the emergence (plants per m2), number of productive tillers per m2 and grain yield (3-7%) of all wheat varieties although productive tillers per plant, number of grains per spike and 1000-grain weight was decreased. Faislabad-08 performed better regarding grain yield and related components among all varieties. Seed ...
Ehsan-Ul-Haque1, Akbar Hayat1*, Muhammad Asim1, Sajjad Hussain2, Muhammad Shakeel Hanif3, Muhammad Zubair1, Muhammad Abdullah Jamil1 and Faheem Khadija1
...for extension in storage period and shelf life. Various fungicides and salts are incorporated in wax to limit postharvest fruit decay and fungal attack. In the present study two salts were incorporated in commercial wax to control postharvest decay in Willow leaf mandarin (Citrus reticulata Blanco) and Kinnow mandarin (Citrus reticulata Blanco). Sodium bicarbonate and Potassium sorbate incorporated (6% w/v concentration) in wax were used to compare with commer...
I. Erum, K. Nasira, H. Sagir, S. Raza and Firoza, K.
Description of Discolaimus miniodontii n.sp. and Laevides hunderansis n. sp. with notes on Discolaimoides spatilabium (Nematoda: Dorylaimida) from District Ghizer, Gilgit-Baltistan, Pakistan
...ew and a known nematode species of the order Dorylaimida viz., Discolaimus miniodontii n. sp. and Laevides manilkarii n. sp.; and a new report of a known species Discolaimoides spatilabium from District Ghizer, Gilgit-Baltistan, Pakistan. Discolaimus miniodontii n. sp., is characterized by having smallest odontostyle (9-10µm); relatively smaller and slender body (L=1.0-1.14mm; a= 38.5-45.8); sclerotized odontostyle, it...
Kajol, A. H. Bhat, Aasha and A. K. Chaubey
Biochemical and molecular characterization of Photorhabdus akhurstii associated with Heterorhabditis indica from Meerut, India
...as longer than the topotype populations. Analysis of ITS-rDNA sequences showed 1 nucleotide base pair difference in aligned data with type description, however, no nucleotide base pair difference was seen in the D2D3 domain. The associated bacterial symbiont of the DH3 strain was identified as Photorhabdus akhurstii based on phenotypic, biochemical and 16S rDNA data. Most of the biochemical tests were negative and only three...
A.N. Ashfaque1, F. Shahina1 and S. Dawar2
Diversity of nematode fauna associated with cotton fields of high temperature areas of Sindh, Pakistan
...ir occurrence in high temperature cotton growing areas of Sindh by using Euclidean distance has been estimated. The fauna obtained in June2017 and June 2018 surveys of cotton fields of five Districts Sanghar, Mirpurkhas, Umerkot, Mitiari and Tando Allah Yar of Sindh where temperature in May to July raised up to 40ºC -50ºC.The data was subjected to construct the dendrogram for interpretation on the basis of their pr...
S. Ahmed† , L. Yue, Q. Liu and H. Jian
Evaluation of media for mass production and fermentation of Pseudomonas spp. for integrated management of cereal cyst nematode (Heterodera avenae)
...gen sources in various types of media compositions was made to optimize the fermentation and mass production of Pseuodomonas spp. Among all the media compositions, the suitable media containing carbon and nitrogen sources were found as media No.9 (Corn flour 50g/L, Glucose 8g/L, Soybean Cake Powder 20g/L, Wheat bran 20g/L, NaCl 4g/L) followed by No.10 (Corn flour 40g/L, Soybean Cake Powder 30g/L, Yeast Extract 5g/L, Wheat bran 20g/L, NaCl 4g/L, KH2PO4 5/L, MgS...
U. A. Al-Karim, A. A. Alshimaysawe, A. E. Mohammed† , W. A. R. Aljaafri and F. A. Al-Fadhal
Evaluation of biological seed treatments for management of Rotylenchulus reniformis on cotton
...ify;"> Greenhouse experiments were conducted to assess the effectiveness of potential biological control products to manage and evaluate the development of Rotylenchulus reniformis on cotton. Tests included seeds treated with the Abamectin, ILeVo, and a non-treated control. Results showed that seed treatment with Abamectin and Burkholderia sp., suppressed the numbers of R. reniformis eggs significantly. Seeds treated with Abamectin and bacteria had fewer ...
A. S. M. El-Nuby1† , S. A. Montasser2 and I. A. El-Khadrawy
Control of root-knot nematodes using wild plants colonized Sinai, Egypt
...temisia judaica, A. monosperma, Bassia muricata, Cornulaca monacantha, Salsola kali and Zygophyllum album with different dilutions (25%, 50%, 75% &100%). The potent nematicidal efficacy observed in the extract of A. judaica followed by A. monosperma. In vivo trial post inoculation treatments were effective than pre one, the maximum reduction in nematode population was recorded by A. judaica (87.0%) followed by A. monos
H. Soofi†1 , N. A. Birmani1 , A. M. Dharejo1 , A. R. Abbasi2 , G. S. Ghachal1
Description of new nematode species Rhabdochona (Rhabdochona) sindhicus of genus Rhabdochona (Railliet, 1916) from Indus River Pakistan
...fy;"> New nematode species of genus Rhabdochona collected form host catfishes Rita rita of Indus River, Jamshoro, Sindh, Pakistan. Collected nematodes were processes with standard method for feature research. New species Rhabdochona (Rhabdochona) sindhicus differs from other species of genus with body shape and size, buccal capsule sha
K. Abbasi 1 , R. Wick2† and D. Zafari1
Chitinase activity of biocontrol fungi cultured from the golden potato cyst nematode, Globodera rostochiensis
...rmine the optimum pH, temperature, and reaction time. Zymography was also used to demonstrate the chitinase activity of the four isolates. The biocontrol potential of 10 selected isolates was assayed in water-agar in vitro and under greenhouse conditions. L. muscarium had the most potential and Fusarium solani was the least based on the number of parasitized juveniles and eggs in water-agar. Greenhouse trials showed T. atroviridae and B. bassiana had the highe...
K. Osei1† , A. I. Adama1 , E. C. Tagoe2 and J. Sackey-Asante1
Biochar effect on nematodes and insects population density, soil improvement and yield of okra
...emical fertilizers are expensive and when applied continuously, degrade agricultural lands (Savci, 2012; Bhattacharyya et al., 2015). Biotic factors such as plant parasitic nematodes (PPN) and foliar insects have been implicated as major constraints to okra production (Asare-Bediako et al., 2014b). The attack of root-knot nematodes (Meloidogyne spp.) has been reported as the most serious, widespread and alarming which causes tremendous yield losses (Hussain et...
M. M. A Youssef and W. M. A. El-Nagdi †
Effect of some temperature changes on the population density of some plant parasitic nematode species
...matic changes such as temperature, and most stages of nematodes may be killed when exposed to temperatures above 40°C (Santmayer,1955). Hence, during the study, the effect of temperature changes during a year representing the all four seasons (autumn, spring, summer and winter) on the numerical fluctuations in the population density of some parasitic nematodes on plants viz., date palm...
Sahib Khan1, Muneeza Wahid2, Muhammad Abeer Irfan1, Muhammad Naeem3, Asma Gul4, Muhammad Haseeb Zafar2
ROW LEVEL IMAGE FORGERY DETECTION TECHNIQUE USING EMBEDDED DIGITAL SIGNATURES
...ols and software. This paper is presenting a new technique to detect any changes made in digital images. This technique ensures the integrity of digital image at row level and using embedded digital signatures. Using message digest 5 algorithm, digital signature is generated from selected pixels of each row using selected pixels for and embedded in the least significant bits of selected pixel of the corre- sponding row of digital image. The proposed technique ...
Gulzar Mehmood1*, M. Zahid Khan1, Haseeb Ur Rahman1, and Sohail Abbas2
AN EFFICIENT AND SECURE SESSION KEY ESTABLISHMENT SCHEME FOR HEALTH-CARE APPLICATIONS IN WIRELESS BODY AREA NETWORKS
... Area Network (WBAN) is special breed of Wireless Sensor Network (WSN). Due to the increasing
interest and the tremendous advancement in miniaturization and sensor technology, WBAN has emerged as an active
filed of research. WBAN has many unique applications especially in medical and health-care. This kind of network
provides support in on-the-spot decision making and therape
interest and the tremendous advancement in miniaturization and sensor technology, WBAN has emerged as an active
filed of research. WBAN has many unique applications especially in medical and health-care. This kind of network
provides support in on-the-spot decision making and therape
Tajwali Khan1*, Ihtzaz Qamar1, Feroz Shah2, Kareem Akhtar2, Rehman Akhtar3
MODEL FOR FUEL DROPLET EVAPORATION IN COMBUSTION CHAMBER OF LIQUID PROPELLANT ROCKET ENGINES
...ete burning of liquid propellants droplets is very important to avoid combustion instability and to get higher
specific impulse from liquid rocket engines. Combustion takes place in gaseous phase and reaction is fast. So, the
time consumed by a droplet for complete burning is the time taken by a droplet to get evaporated. An analytical
mono component fuel droplet evaporation model is develo
specific impulse from liquid rocket engines. Combustion takes place in gaseous phase and reaction is fast. So, the
time consumed by a droplet for complete burning is the time taken by a droplet to get evaporated. An analytical
mono component fuel droplet evaporation model is develo
Ahmad Hussain1*, Syed Murtuza Mehdi2, Amjad Ali3, Muhammad Adeel3, Mohammed Hassan Jabal4, Farid Nasir Ani4
INVESTIGATION THE TRIBOLOGICAL CHARACTERISTICS OF CASTOR OIL WITH MINERAL OIL BLENDS
... possible substitute for petroleum-based products for many applications and is the focus of
research in this study. Besides being a renewable energy resources with instant and perpetual availability, vegetable
oil based products can also have the potential for reducing carbon dioxide and hydrocarbon emission, when used in
such applications as lubricant in internal comb...
research in this study. Besides being a renewable energy resources with instant and perpetual availability, vegetable
oil based products can also have the potential for reducing carbon dioxide and hydrocarbon emission, when used in
such applications as lubricant in internal comb...
Muhammad Alam Zeb Khan1*, Muhammad Ali Kamran1, Khan Muhammad2, Khizar Azam1
IDENTIFICATION OF THE OPTIMAL OPERATING PARAMETERS OF LOCALLY AVAILABLE COAL FOR USE IN PAKISTANI INDUSTRIES
... quantify the combustion performance by measuring the furnace temperature. Mesh size 200 was found to
be readily combustible within the operating ranges, while tight control of the operating parameters was required
to combust coal at mesh size 150. Optimum ranges of primary air and Air-Fuel Ratio are suggested for effective
combustio...
be readily combustible within the operating ranges, while tight control of the operating parameters was required
to combust coal at mesh size 150. Optimum ranges of primary air and Air-Fuel Ratio are suggested for effective
combustio...
Muhammad Ismail1, Shahid Maqsood1*, Abdul Shakoor2, Feroz Shah2
DESIGN AND COST ANALYSIS OF MOLD MAKING FACILTY AT GHANI GLASS INDUSTRY: A CASE STUDY
...reduce their costs and expenses to maintain a sustainable
position in the global marketplace. Selecting the right manufacturing strategy and planning is a critical decision
for production managers in the industry. The layout problems generally exist in the manufacturing industries. In the
industries the layout problems deals with the facilities like departments, machines etc. As a case study, this paper<...
position in the global marketplace. Selecting the right manufacturing strategy and planning is a critical decision
for production managers in the industry. The layout problems generally exist in the manufacturing industries. In the
industries the layout problems deals with the facilities like departments, machines etc. As a case study, this paper<...
Muhammad Qasim Khan1, Syed Athar Masood1
PRODUCTIVITY MEASUREMENT AND ANALYSIS OF A PUBLIC SECTOR AUTOMOBILE REBUILD ORGANIZATION
...r
organizations especially in developing countries. Despite gigantic budgetary allotments, public sector rebuild organizations
remain non-productive, ineffective and inefficient as they are not exposed to aggressive market competition
and profitability. These organizations are administered by government rules and procedures unlike private sector organizations
which are driven solely on profitabili...
organizations especially in developing countries. Despite gigantic budgetary allotments, public sector rebuild organizations
remain non-productive, ineffective and inefficient as they are not exposed to aggressive market competition
and profitability. These organizations are administered by government rules and procedures unlike private sector organizations
which are driven solely on profitabili...
Muhammad Amjad*1, Abdur Rafai1, Saeed Badshah1, Rafi Ullah Khan1, Sajjad Ahmad1
FINITE ELEMENT ANALYSIS OF THE REAL LIFE LOADINGS ON THE TI-27NB HIP BONE IMPLANT
... The objective of this paper is to investigate the real life loading on the Ti-27Nb hip bone
implant by using FEA. The model of the implant was generated using CREO PARAMETRIC software. Two weight
categories 75Kg and 100 Kg with four different daily life activities stand up, sit down, knee bend and walking were
considered in this study. The FEA analysis was performed using commercial FEA software ANSYS. ...
implant by using FEA. The model of the implant was generated using CREO PARAMETRIC software. Two weight
categories 75Kg and 100 Kg with four different daily life activities stand up, sit down, knee bend and walking were
considered in this study. The FEA analysis was performed using commercial FEA software ANSYS. ...
Mahmood Alam Khan1, Muhammad Yaseen1, Mujahid Khan*2, Amjad Khan1
TEMPORAL VARIATION IN GROUND WATER QUALITY DUE TO URBANIZATION. CASE STUDY: DISTRICT PESHAWAR, PAKISTAN
..., 469.60%, and 59.47% respectively, while total dissolved solids (TDS), turbidity, total alkalinity, total hardness,
calcium (Ca++), HCO3-1 and Magnesium (Mg++) were decreased by 6%, 10.51%, 37.39% and 11.52%, 22.21%,
37.56% and 21.19% respectively. Results revealed that changes in water quality have occurred due to over population
of Peshawar and remedial measures are needed in future....
calcium (Ca++), HCO3-1 and Magnesium (Mg++) were decreased by 6%, 10.51%, 37.39% and 11.52%, 22.21%,
37.56% and 21.19% respectively. Results revealed that changes in water quality have occurred due to over population
of Peshawar and remedial measures are needed in future....
Muhammad Nafees Khan1, Iftikhar Hussain2, Muhammad Tahir3, Misbah Ullah2, Shehzad Ali Jamshed4
THE EFFECTS OF TANGIBLE AND INTANGIBLE ASPECTS ON EMPLOYEES’ PERFORMANCE
...istan is facing tough competition from national & international organizations. In such
a competitive environment, organizations can compete effectively by utilizing the potential of its human resource. While
managing human resources, it is important to provide such facilities to the employees which result in yielding best
employees’ p...
a competitive environment, organizations can compete effectively by utilizing the potential of its human resource. While
managing human resources, it is important to provide such facilities to the employees which result in yielding best
employees’ p...
Kifayat Ullah*1, Tahir Mahmood2, Naeem Jan3, Zeeshan Ali4
A NOTE ON GEOMETRIC AGGREGATION OPERATORS IN T-SPHERICAL FUZZY ENVIRONMENT AND THEIR APPLICATIONS IN MULTI-ATTRIBUTE DECISION MAKING
...nties of more than one aspect is a hot research topic in fuzzy mathematics. Atanassov’s
intuitionistic fuzzy set (IFS) and Cuong’s picture fuzzy set (PFS) are two featured fuzzy concepts. Recently, a novel
framework of T-spherical fuzzy set (TSFS) and consequently spherical fuzzy set (SFS) are developed for handling
those problems where uncertain situations have more than two as
intuitionistic fuzzy set (IFS) and Cuong’s picture fuzzy set (PFS) are two featured fuzzy concepts. Recently, a novel
framework of T-spherical fuzzy set (TSFS) and consequently spherical fuzzy set (SFS) are developed for handling
those problems where uncertain situations have more than two as
Riaz Muhammad1*, Naseer Ahmeda, Abdul Basit2, Rizwan Alim Mufti2
EXPERIMENTAL INVESTIGATION OF FRACTURE TOUGHNESS, HARDNESS AND LOAD-INDENTATION DEPTH RESPONSE OF TI-64 USING VICKERS INDENTATION TECHNIQUE
...ysical and mechanical properties which have made them appropriate
for aerospace, chemical, and biomedical industries services. Preeminent strength-to-density ratio, reduced
density, incomparable corrosion resistance and tremendous properties at elevated temperature are the main attribute
of titanium alloys. These alloys also exhibit low modulus of elasticity, making it...
for aerospace, chemical, and biomedical industries services. Preeminent strength-to-density ratio, reduced
density, incomparable corrosion resistance and tremendous properties at elevated temperature are the main attribute
of titanium alloys. These alloys also exhibit low modulus of elasticity, making it...
Mujahid Khan1*, Mohammad Tufail2, Muhammad Fahad1, Hazi Muhammad Azmathullah3, Muhammad Sagheer Aslam1, Fayaz Ahmad Khan4, Asif Khan5
EXPERIMENTAL ANALYSIS OF BRIDGE PIER SCOUR PATTERN
...dge piers needs to be properly designed for scouring
around its piers. For proper design of bridge piers, appropriate investigation of scouring patterns is extremely
important for various sizes and shapes of such piers. Without having research based knowledge of such patterns,
it becomes extremely difficult to predict/minimize the scouring effects ultimately leading to...
around its piers. For proper design of bridge piers, appropriate investigation of scouring patterns is extremely
important for various sizes and shapes of such piers. Without having research based knowledge of such patterns,
it becomes extremely difficult to predict/minimize the scouring effects ultimately leading to...
Zeeshan Al Hameed1, Junaid Saleem2*, Syed Sajid Hussain1, Ahsan Abdul Ghani2, Hira Lal2
STUDY OF INDIGENOUS FLUORSPAR AS METALLURGICAL FLUX
...be fed as part of slag. Specifically, it contains only trace amount of apatite as compared to
global Fluorspar. The composition of indigenous Fluorspar was compared with standard specifications and a detailed
characterization was carried out including chemical, mineralogical, and spectroscopic analysis. Further, indigenous
Fluorspar was applied as flux in the ladle ref...
global Fluorspar. The composition of indigenous Fluorspar was compared with standard specifications and a detailed
characterization was carried out including chemical, mineralogical, and spectroscopic analysis. Further, indigenous
Fluorspar was applied as flux in the ladle ref...
Zulfiqar Ali Soomro1*
NOISE CONTROL FILTRATION OF LATERAL AND YAW DYNAMICS FOR RAILWAY VEHICLE WHEELSET ON TRACK
...eranged railway vehicle speed in any direction of basic
degree of freedom. In this paper, Brief applicable mathematic is used framed for necessary modeling. The estimation
of perturbations for the movement by wheels and velocity of train in lateral and yaw phases are enumerated.
Here dual bucy kalman estimator is implemented to decrease the influence of the noise cause...
degree of freedom. In this paper, Brief applicable mathematic is used framed for necessary modeling. The estimation
of perturbations for the movement by wheels and velocity of train in lateral and yaw phases are enumerated.
Here dual bucy kalman estimator is implemented to decrease the influence of the noise cause...
Younis Jamal1, Asad Naeem Shah1, Wasif Amin Butt1, Ahmad Naveed1*, Muhammad Usman1
EXPERIMENTAL INVESTIGATION OF THE EFFECTS OF FUEL INJECTION PARAMETERS ON DIESEL ENGINE PERFORMANCE AND EMISSIONS
...nd increase in global temperature are the key factors that have mainly amplified the exploration
studies of changing fuel injection and other constraints of compression ignition (CI) engines for the abatement
of exhaust emissions. In current study, a direct injection (DI), CI engine was run on a test bench for the performance
and emission analyses using different nozzles and injection timings. During the...
studies of changing fuel injection and other constraints of compression ignition (CI) engines for the abatement
of exhaust emissions. In current study, a direct injection (DI), CI engine was run on a test bench for the performance
and emission analyses using different nozzles and injection timings. During the...
Daulat Khan1*, Khizar Azam2, Noor Muhammad Khan1, Muhammad Israr1, Naeem Ejaz3
ASSESSMENT OF WASTEWATER FOR DISPOSAL IN ACCORDANCE WITH NEQS CRITERIA AND ITS REUSE FOR IRRIGATION WITH DILUTION
...>PA) 1997, “No person shall discharge or
emit or allow the discharge of any effluent or waste in an amount, concentration or level which is more than the
National Environmental Quality Standards(NEQS)”. Even in the presence of this act there are many housing societies
and Industrial zones, which are continuously disposing off their untreated wastewater to the natural water bodies. In
this study Laboratory investigati...
emit or allow the discharge of any effluent or waste in an amount, concentration or level which is more than the
National Environmental Quality Standards(NEQS)”. Even in the presence of this act there are many housing societies
and Industrial zones, which are continuously disposing off their untreated wastewater to the natural water bodies. In
this study Laboratory investigati...
Samreen Fatima1*, Mudassir Uddin1
COMPARISON OF ASYMMETRIC GARCH MODELS WITH ARTIFICIAL NEURAL NETWORK FOR STOCK MARKETS PREDICTION, A CASE STUDY
..., for example: Asia, Europe and Australia etc. But no frequent research has been done for the SAARC
countries stock markets. Therefore, bench mark Index of Pakistan; Karachi Stock Exchange (KSE-100) and Bombay
Stock Exchange (BSNSE) of India are selected as case study. They are not only the member of SAARC but also sharing
the common border, due to this they are also involving in bilateral trading. We used closing indices of daily share
countries stock markets. Therefore, bench mark Index of Pakistan; Karachi Stock Exchange (KSE-100) and Bombay
Stock Exchange (BSNSE) of India are selected as case study. They are not only the member of SAARC but also sharing
the common border, due to this they are also involving in bilateral trading. We used closing indices of daily share
Shafiullah1*, Mohammad Nafees2
MUNICIPAL WASTEWATER TREATMENT BY COAGULATION/ FLOCCULATION PROCESSES VIA OPTIMIZATION OF INOCULATION DOSE AND SETTLING TIME
...n attempt to identify proper treatment measures. The
drain under study was observed for three months. In total 45 samples were collected from five different sites at the
rate of three samples per day (Morning, Afternoon and Evening). Each sample was a composite of three grab samples
collected with four hours intervals. All Samples were analyzed for physico-chemical characteristics. On comparison
w...
drain under study was observed for three months. In total 45 samples were collected from five different sites at the
rate of three samples per day (Morning, Afternoon and Evening). Each sample was a composite of three grab samples
collected with four hours intervals. All Samples were analyzed for physico-chemical characteristics. On comparison
w...
Sahib Khan1, Muhammad Naeem2, Tawab Khan3, Nasir Ahmad4*
4LSB BASED DATA HIDING IN COMPLEX REGION OF DIGITAL IMAGES AND ITS EFFECTS ON EDGES AND HISTOGRAM
...o be detected. In this paper, the effect on image edges
and histogram is investigated when subjected to true edge based 4 least significant bits (4LSB) steganography. The
true edge based 4LSB steganography technique has been found very efficient, creating no significant effect on edges
and undetectable histogram differences. Which prove this technique immune to histogram difference steganalysis. The
quality of the edges is preserved...
and histogram is investigated when subjected to true edge based 4 least significant bits (4LSB) steganography. The
true edge based 4LSB steganography technique has been found very efficient, creating no significant effect on edges
and undetectable histogram differences. Which prove this technique immune to histogram difference steganalysis. The
quality of the edges is preserved...
Nasir Ahmad1*, Jehad Ali2, Khalil Khan3, Muhammad Naeem4, Usman Ali5
ROBUST MULTIMODAL FACE RECOGNITION WITH PRE-PROCESSED KINECT RGB-D IMAGES
...tion algorithm.
Experimental results reveal that the accuracy of face recognition can be increased by combining RGB and depth
images and applying pre-processing on depth maps which mitigate the effects of covariates such as holes and noise
in the depth maps. ...
Experimental results reveal that the accuracy of face recognition can be increased by combining RGB and depth
images and applying pre-processing on depth maps which mitigate the effects of covariates such as holes and noise
in the depth maps. ...
M. Ihsan Ul Haq1, Ahmad Hussain2*, Farzana Yasmeen3, Shafiq R. Qureshi4
LIFE CYCLE COSTING AND PAYBACK PERIOD EVALUATION OF A SOLAR THERMAL DESALINATION SYSTEM
...pment. About 1.8 billion people will be living in absolute water scarcity by
2025.Non availability of safe drinkable water is the major source of diseases in the different regions of the world
especially remote rural and coastal areas. About 97% of water on earth is comprised of seawater. Desalination of
saline water is a prominent approach to handle the problem of water scarcity. Conventional desalinati...
2025.Non availability of safe drinkable water is the major source of diseases in the different regions of the world
especially remote rural and coastal areas. About 97% of water on earth is comprised of seawater. Desalination of
saline water is a prominent approach to handle the problem of water scarcity. Conventional desalinati...
Naseem Ahmad1, Sahar Noor1, Rehman Akhtar1*, Misbah Ullah1, Khizar Azam2
PERFORMANCE IMPROVEMENT OF COMPRESSOR TO RECOVER FLARE GAS USING DESIGN OF EXPERIMENT TECHNIQUES
... to deploy engineering experimental design techniques to recuperate large
quantity of flare gas with the help of a new proposed plant process. Some factors responsible for disturbing routine
of compressor are categorized and pertinent information is togethered from various resources. The information is
thoroughly studied to enhance factors pe
quantity of flare gas with the help of a new proposed plant process. Some factors responsible for disturbing routine
of compressor are categorized and pertinent information is togethered from various resources. The information is
thoroughly studied to enhance factors pe
Rafiullah Khan1, Sakhi Jan1*, Muhammad Amjad1, Saeed Badshah1, Sajjad Ahmad1
CRACK CLOSURE AND FIBRE BRIDGING CONTRIBUTION IN THE STRESS-RATIO EFFECT ON DELAMINATION GROWTH UNDER FATIGUE
...>The objective of this paper is to investigate the contribution/role of the crack closure and the fibre bridging effects
in stress-ratio influence in mode I delamination growth in carbon/epoxy composite laminates. The crack closure effect
has been assessed by the identification of the non-linearity in the compliance curve of the double cantilever test
specimen after the delamination extension. The effect...
in stress-ratio influence in mode I delamination growth in carbon/epoxy composite laminates. The crack closure effect
has been assessed by the identification of the non-linearity in the compliance curve of the double cantilever test
specimen after the delamination extension. The effect...
Muhammad Aamir1*, Riaz Muhammad1, Naseer Ahmed1, Muhammad Sadiq2, Muhammad Waqas3, Izhar1
MECHANICAL PROPERTIES OF LEAD FREE SOLDER ALLOY FOR GREEN ELECTRONICS UNDER HIGH STRAIN RATE AND THERMAL AGING
...o its good mechanical properties and no
harmful effect on environment. The current work is focused on the examination of thermal aging and strain rates
on mechanical properties of Sn96.5-Ag3.0-Cu0.5 (SAC305) LFS alloy. The selected thermal aging temperatures are 60
°C, 100 °C and 140 °C. Strain rates are measured at 10/s, 20/s, 30/s and 40/s. The microstruc...
harmful effect on environment. The current work is focused on the examination of thermal aging and strain rates
on mechanical properties of Sn96.5-Ag3.0-Cu0.5 (SAC305) LFS alloy. The selected thermal aging temperatures are 60
°C, 100 °C and 140 °C. Strain rates are measured at 10/s, 20/s, 30/s and 40/s. The microstruc...
Waqas Javaid1*, Adnan Tariq1, Iftikhar Hussain2, Sahar Noor2
AN EVOLUTIONARY APPROACH FOR CMS DESIGN
...proaches have been developed by researchers to handle
the Cell Formation Problem (CFP). Among these, a large number of approaches consist of Artificial Intelligence
(AI) based techniques. The main advantage of such approaches is their ability to handle the CFP effectively both in
terms of accuracy and computational effort. Following the same trend an evolutionary algorithm has been developed
durin...
the Cell Formation Problem (CFP). Among these, a large number of approaches consist of Artificial Intelligence
(AI) based techniques. The main advantage of such approaches is their ability to handle the CFP effectively both in
terms of accuracy and computational effort. Following the same trend an evolutionary algorithm has been developed
durin...
Muhammad Shahzad Khattak*1, Barkatullah1, Ayesha Aziz1, Jamil Ahmad2, Mohammad Sharif3, Mukand Singh Babel4, Muhammad Fahad5
IMPACTS OF CLIMATE CHANGE ON CROP WATER REQUIREMENT UNDER MULTI - REPRESENTATIVE CONCENTRATION PATHWAYS DURING MID-CENTURY: A CASE STUDY OF D. I. KHAN
.../>
the comparison of temperature and precipitation data projected by different GCM with the observed data. The delta
change and ratio method was used to obtain the corrected value of temperature and Precipitation (PPT) for the
future. The ETo calculator of Food and Agriculture Organization was used to calculate evapotranspiration. The CWR
of wheat and maize crops was computed using CROPWAT 8.0. Results ...
change and ratio method was used to obtain the corrected value of temperature and Precipitation (PPT) for the
future. The ETo calculator of Food and Agriculture Organization was used to calculate evapotranspiration. The CWR
of wheat and maize crops was computed using CROPWAT 8.0. Results ...
Muhammad Naeem1*, Sahib Khan2, Nasir Ahmad3
A DISTRIBUTED GENETIC ALGORITM AND A-PRIORI ALGORITHM FOR THE HUB AND FACILITY LOCATION PROBLEMS
...
implemented. The performance of the algorithm has been evaluated with standard benchmark problems for USAHLP
and UFLP. Results have been found encouraging....
implemented. The performance of the algorithm has been evaluated with standard benchmark problems for USAHLP
and UFLP. Results have been found encouraging....
Razaullah1*, Iftikhar Hussain1
A TWO-WAREHOUSE SUPPLY CHAIN NETWORK DESIGN AND OPTIMIZATION WITH CROSS-ROUTE COSTS AND BUDGET, MAXIMUM FLOW AND CAPACITY CONSTRAINTS
...ve efficiency. In this paper, a systematic
approach is presented for the facility placement, optimal production planning and product transportation across
network arcs. An optimization formulation is developed for the determination of production size, locations of network
nodes and optimal supply chain. The objective function considered the minimization of transportation cost, production
cost and ...
approach is presented for the facility placement, optimal production planning and product transportation across
network arcs. An optimization formulation is developed for the determination of production size, locations of network
nodes and optimal supply chain. The objective function considered the minimization of transportation cost, production
cost and ...
Nabeel Maqsood1,2*, Afzal Khan1, Muhammad Khalid Alamgir2, Shaukat Ali Shah1, Muhammad Fahad3
PTFE THIN FILM COATING ON 316L STAINLESS STEEL FOR CORROSION PROTECTION IN ACIDIC ENVIRONMENT
... corrosion resistance properties in different mediums. 316L SS shows poor corrosion
behavior in HCL. Hard coating is often required for protection of 316L SS from wear and corrosion. In this research
paper polytetrafluoroethylene (PTFE) was coated on 316L SS by spin coating technique to modify their corrosion
resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion pro
behavior in HCL. Hard coating is often required for protection of 316L SS from wear and corrosion. In this research
paper polytetrafluoroethylene (PTFE) was coated on 316L SS by spin coating technique to modify their corrosion
resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion pro
Khizar Azam1*, Abdul Shakoor1, Shahid Maqsood2, Muddasar Habib3, Muhammad Fahad4, Akhtar Zaib1
IDENTIFICATION OF SITES FOR ESTABLISHING PHOTOVOLTAIC SOLAR FARMS IN PAKISTAN USING SOLAR GEOMETRY
...r />
Therefore, it is imperative to identify most viable sites that have a high solar radiation. We utilized solar geometry
and the Google Earth, a geographical information program to identify optimal sites for Pakistan. These sites should
also include basic requirements for a PV plant such as availability of local grid, barren land, roads, water, and good
climatic conditions. The Average solar intensity (I) was calculated by using solar ...
and the Google Earth, a geographical information program to identify optimal sites for Pakistan. These sites should
also include basic requirements for a PV plant such as availability of local grid, barren land, roads, water, and good
climatic conditions. The Average solar intensity (I) was calculated by using solar ...
Ebtisam Mirza1, Nadeem Ehsan1
DEVELOPMENT OF PROJECT EXECUTION COMPLEXITY INDEX
...ject constraints i.e. scope, time and cost is still missing. In this research, a
model has been developed to compute PECI (Project Execution Complexity Index) for various categories of projects
considering varying levels of complexity, i.e. PECI(R) for R&D/Technolog...
model has been developed to compute PECI (Project Execution Complexity Index) for various categories of projects
considering varying levels of complexity, i.e. PECI(R) for R&D/Technolog...
Misbah Ullah1, Rehman Akhtar1, Sikandar Bilal Khattak1, Khawar Naeem1 and Khizar Azam2
FACTORS IDENTIFICATION FOR COAL BRIQUETTES MANUFACTURING USING STATISTICAL EXPERIMENTAL DESIGN APPROACH
... statistical design of experiment in general and factorial
design in particular is vital in identifying these significant factors in comparison to the conventional techniques. This
paper provides a statistical approach towards manufacturing of coal briquettes in Northern Province of Pakistan.
Binder composition, pressure, particle size, and coal type are analyzed for h...
design in particular is vital in identifying these significant factors in comparison to the conventional techniques. This
paper provides a statistical approach towards manufacturing of coal briquettes in Northern Province of Pakistan.
Binder composition, pressure, particle size, and coal type are analyzed for h...
Bibi Safia Haq1,2, Hidayat Ullah Khan3, Abdul Shakoor4, Shahnaz Attaullah5, Kausar Shaheen1, Khan Alam3
TWO-PHOTON FLUORESCENCE EXCITATION CROSS-SECTIONS OF PHOTOSENSITIZER THIOXANTHONE TO FABRICATE CELL SCAFFOLD FOR BIOMEDICAL APPLICATIONS
...
obeys the square-law dependences. Also when the Photo-Sensitizer was excited at different wavelengths (800nm,
400nm), it was found that Fluorescence Emission Profile did not change but variations occurred only in Fluorescence
Emission Intensity. ...
400nm), it was found that Fluorescence Emission Profile did not change but variations occurred only in Fluorescence
Emission Intensity. ...
Waqas, A. Imtiaz1, Yousaf Khan1, Syed Waqar Shah2
COST VERSUS RELIABILITY ANALYSIS OF NEW TREE-BASED HYBRID PROTECTION ARCHITECTURE FOR OPTICAL CODE DIVISION MULTIPLE ACCESS SYSTEM
...main. Therefore, it is imperative to design an economical system
that should be able to provide fault detection and restoration at both feeder and the distribution level. This paper
focuses on design and analysis of a novel tree-based hybrid protection architecture for OCDMA system in order to
make it economical and reliable for deployment at the access domain. It is observed that the proposed protection...
that should be able to provide fault detection and restoration at both feeder and the distribution level. This paper
focuses on design and analysis of a novel tree-based hybrid protection architecture for OCDMA system in order to
make it economical and reliable for deployment at the access domain. It is observed that the proposed protection...
Rafiullah Khan1, Waseem ur Rahman1, Misbah Ullah2, Kamran Afaq3, Muhammad Amjad1, Sakhi jan1
AGE EFFECT ON THE MECHANICAL PROPERTIES OF HIP JOINT BONE: AN EXPERIMENTAL INVESTIGATION
...tance. The mechanical properties of bone varies with age. In this paper, the
effect of age on various mechanical properties of hip joint bone was investigated experimentally. For this purpose
hip joint bone specimens of male bovine of different age groups were tested for fracture toughness, young modulus<...
effect of age on various mechanical properties of hip joint bone was investigated experimentally. For this purpose
hip joint bone specimens of male bovine of different age groups were tested for fracture toughness, young modulus<...
Bibi Safia Haq1,2, Hidayat Ullah Khan3, Abdul Shakoor4, Shahnaz Attaullah5, Ishrat Rahim1
PROJECTION ETCHING OF KERATIN THIN FILMS FOR FABRICATION OF SKIN STRUCTURE USING ARF EXCIMER LASER
...n square mm areas
per pulse was used even though the maximum repetition rates are typically an order of magnitude slower. Keratin
samples with different film thicknesses were ablated with different pulses. The depth of the ablated keratin layers with
different pulses were also measured by scanning the sample using a Dektak KLA-Tencor and the surface statistics of
the ablated keratin sample have be...
per pulse was used even though the maximum repetition rates are typically an order of magnitude slower. Keratin
samples with different film thicknesses were ablated with different pulses. The depth of the ablated keratin layers with
different pulses were also measured by scanning the sample using a Dektak KLA-Tencor and the surface statistics of
the ablated keratin sample have be...
Kulsoom Iftikhar1, Shahzad Anwar1, Izhar Ul Haq1, Muhammad Tahir Khan1 and Sayed Riaz Akbar1
AN OPTIMAL NEURAL NETWORK BASED CLASSIFICATION TECHNIQUE FOR BREAST CANCER DETECTION
...y of {cell size, cell shape}, marginal attachment and
radius of circle enclosing the abnormality) are nominated as input features to the ANN to predict the benign or
malignant breast carcinoma. The network is trained, tested and validated on data bases that comprises of a set of
previously extracted features provided by Wisconsin and Essex Universities. For the established neural networks comparative
analysis is
radius of circle enclosing the abnormality) are nominated as input features to the ANN to predict the benign or
malignant breast carcinoma. The network is trained, tested and validated on data bases that comprises of a set of
previously extracted features provided by Wisconsin and Essex Universities. For the established neural networks comparative
analysis is
Bibi Safia Haq1,2, Shahnaz Attaullah3, Abdul Shakoor4, Hidayat Ullah Khan5, Khan Alam5, Kausar Shaheen1
CHARACTERISTICS AND EFFICACY OF ULTRAFAST LASER PULSES FOR BIOMEDICAL APPLICATIONS
...r characterised here is Spectra
Physics, Hurricane X. This is a complex laser system consisting of a seed laser and a regenerative amplifier. It is
important to have knowledge of these characteristics to be able to predict the transport of the beam through various
optical elements and also to analyse the subsequent interaction with materials. The whole optical intensity profile in
two dimensional space of a laser beam i.e. across th...
Physics, Hurricane X. This is a complex laser system consisting of a seed laser and a regenerative amplifier. It is
important to have knowledge of these characteristics to be able to predict the transport of the beam through various
optical elements and also to analyse the subsequent interaction with materials. The whole optical intensity profile in
two dimensional space of a laser beam i.e. across th...
Aqeel Nawaz1, Muhammad Ali Kamran1
PARAMETRIC SENSITIVITY ANALYSIS OF CONVEX STAR PORT PROPELLANT GRAIN FOR SOLID ROCKET MOTOR
...ble grain design. This paper is
restricted to the study of convex port star grain geometry and describes parametric evaluation to assess the effects
of seven independent and defining geometric variables of the star and other ballistic factors including density of
propellant and characteristic exhaust velocity on the burn pattern and pe
restricted to the study of convex port star grain geometry and describes parametric evaluation to assess the effects
of seven independent and defining geometric variables of the star and other ballistic factors including density of
propellant and characteristic exhaust velocity on the burn pattern and pe
Khuram Rashid1, Saroosh Danish2, Muhammad Akram Tahir3
EXPERIMENTAL INVESTIGATION ON UTILIZATION OF WASTE RUBBER TIRES AS FILLER IN CONCRETE
...ent friendly solution. Experiments were designed
by incorporating coarse and fine rubber content as partial substitution of conventional aggregates. Seven mixtures
were proportioned; one mixture with conventional aggregates was the control specimen, three mixtures were casted
by replacing fine aggregate by waste rubber tires powder and remaining three were proportioned by replacing coarse
aggregat...
by incorporating coarse and fine rubber content as partial substitution of conventional aggregates. Seven mixtures
were proportioned; one mixture with conventional aggregates was the control specimen, three mixtures were casted
by replacing fine aggregate by waste rubber tires powder and remaining three were proportioned by replacing coarse
aggregat...
Ghani Akbar1, Muhammad Munir Ahmad1, Abdul Ghafoor1, Matiullah Khan1, Zafar Islam1
IRRIGATION EFFICIENCIES POTENTIAL UNDER SURFACE IRRIGATED FARMS IN PAKISTAN
...the main reasons of poor performance.
Addressing these issues, the three surface irrigation systems were evaluated on thirteen fields under routine farmer
management in Pakistan. Irrigation performance including application efficiency (AE), Potential Application Efficiency
(PAE), Adequacy (AD) and distribution uniformity (DU), of 17 irrigation events were evaluated and further potential
for improv...
Addressing these issues, the three surface irrigation systems were evaluated on thirteen fields under routine farmer
management in Pakistan. Irrigation performance including application efficiency (AE), Potential Application Efficiency
(PAE), Adequacy (AD) and distribution uniformity (DU), of 17 irrigation events were evaluated and further potential
for improv...
Yasir Irfan Badrashia1, Qaisar Alia1, Mohammad Ashraf1, Muhammad Rashid1
SEISMIC DESIGN CHARACTERIZATION OF RC SPECIAL MOMENT RESISTING FRAMES IN PAKISTAN-FIELD SURVEY TO LABORATORY EXPERIMENTS
...parities between design specifications and construction practices. The effect
of these disparities was studied using quasi-static cyclic testing on two exterior beam-column connections; EJ-1A
(code-compliant) with no deficiencies and EJ-2A (non-compliant) incorporating all identified deficiencies. Damage
patterns and hysteretic force-deformation behavior of these models is presented and the performance o...
of these disparities was studied using quasi-static cyclic testing on two exterior beam-column connections; EJ-1A
(code-compliant) with no deficiencies and EJ-2A (non-compliant) incorporating all identified deficiencies. Damage
patterns and hysteretic force-deformation behavior of these models is presented and the performance o...
Tehmina Amjad1, Ishfaq Ahmad1, Muhammad Akram Shaikh2, Nabila Naz1
VARIATION IN CITATION BASED FRACTIONAL COUNTING OF AUTHORSHIP
...r />
authors. In this paper, we propose variation in citation based fractional Vf -index which not only consider the number
of authors but also the variation factor in the number of citations. Vf -Index considers the consistency in received
citations of publication in addition to their quality and quantity for indexing. We have used Co-efficient of quartile
deviation for calculation of variation in received citations because it is sensiti...
of authors but also the variation factor in the number of citations. Vf -Index considers the consistency in received
citations of publication in addition to their quality and quantity for indexing. We have used Co-efficient of quartile
deviation for calculation of variation in received citations because it is sensiti...
Nazish Huma Khan1, Mohammad Nafees1, Adila Bashir1, Farooq Ahmad1
STUDY OF POLLUTION LAOD IN PAPER MILL EFFLUENTS AND ITS RECYCLING BY SUNDRY PLANTS AT HAYATABAD INDUSTRIAL ESTATE, PESHAWAR
...oncept of recycling of paper mill effluents at Hayatabad Industrial Estate,
Peshawar. The objective was to reduce pollution load of paper mill effluents via recycling of sundry plants. For this
purpose a detail study was conducted at paper mills and sundry plants at Hayatabad Industrial Estate. The plants
were examined for operation ...
Peshawar. The objective was to reduce pollution load of paper mill effluents via recycling of sundry plants. For this
purpose a detail study was conducted at paper mills and sundry plants at Hayatabad Industrial Estate. The plants
were examined for operation ...
Muhammad Ibrahim1, ShahidMaqsood1, Rafiullah Khan2, Muhammad Amjad2, SakhiJaan2
OPTIMIZATION OF GAS TUNGSTEN ARC WELDING PARAMETERS ON PENETRATION DEPTH AND BEAD WIDTH USING TAGUCHI METHOD
...>The objective of this paper is the optimization of the gas tungsten arc welding parameters on penetration depth
and bead width. Taguchi L25 orthogonal array was used for the design of experiments. Welding experiments were
performed on stainless steel specimens. Pilot e...
and bead width. Taguchi L25 orthogonal array was used for the design of experiments. Welding experiments were
performed on stainless steel specimens. Pilot e...
Sajjad Ali1, Muhammad Shahzad Khattak1, Daulat Khan1, Mohammed Sharif2, Hamad Khan1, Asmat Ullah3,
Abdul Malik1
PREDICTING FUTURE TEMPERATURE AND PRECIPITATION OVER PAKISTAN IN THE 21ST CENTURY
...y (2070–2099) time periods. An open source web tool
namely “climate wizard” was used to obtain temperature and precipitation departures projected by three different
GCMs under A1B, B1 and A2 emission scenarios. To ensure the maximum possible spatial coverage, a total of 16
climatic stations in Pakistan were selected. Results indicated a tem
namely “climate wizard” was used to obtain temperature and precipitation departures projected by three different
GCMs under A1B, B1 and A2 emission scenarios. To ensure the maximum possible spatial coverage, a total of 16
climatic stations in Pakistan were selected. Results indicated a tem
Shabana Rafique1, Shahnaz Parveen Khattak1, Tanveer Hussain2, Faiza Tauqeer1, Bashir Ahmad3
EVALUATION OF FLEXURAL RIGIDITY AND ABRASION RESISTANCE OF POST AND META-FINISHED PIGMENT DYED P/C FABRICS
...gment dyed fabrics in deeper shades is doubtful, hence needed further exploration.
The effect of various parameters i.e. finish type and concentration were taken in to consideration along different modes
of application on the abrasion resistance and flexural rigidity of fabrics. As regards the type of finish, the effect of
U-V absorber and Pekoflam OP flame retardant (...
The effect of various parameters i.e. finish type and concentration were taken in to consideration along different modes
of application on the abrasion resistance and flexural rigidity of fabrics. As regards the type of finish, the effect of
U-V absorber and Pekoflam OP flame retardant (...
Farid Ullah Khan1, Muhammad Iqbal1
DEVELOPMENT OF A TESTING RIG FOR VIBRATION AND WIND BASED ENERGY HARVESTERS
... the most versatile, inexpensive
and easy to operate, however, due to their fixed displacement, single frequency and sinusoidal behavior, usage of
these shakers is limited. The less known electro-hydraulic shakers are more robust, but due to their high forces and
high velocities, these are usually utilized to characterize heavy samples. Electromagnetic shakers are the most reliable
and accurate an...
and easy to operate, however, due to their fixed displacement, single frequency and sinusoidal behavior, usage of
these shakers is limited. The less known electro-hydraulic shakers are more robust, but due to their high forces and
high velocities, these are usually utilized to characterize heavy samples. Electromagnetic shakers are the most reliable
and accurate an...
Muhammad Masood Tahir1, Ayyaz Hussain2, Saeed Badshah3, Qaisar Javaid2
RULE-BASED IDENTIFICATION OF BEARING FAULTS USING CENTRAL TENDENCY OF TIME DOMAIN FEATURES
...
requirement of expensive training of conventional classifier. A test rig is used to acquire vibration data from bearings
having localized faults, and various TDFs are extracted. It is worth mentioning that fluctuations in random vibration
signals may alter the feature values. Therefore, each of the TDFs is processed statistically to approximate its reliable
central values (CVs) against the respec...
requirement of expensive training of conventional classifier. A test rig is used to acquire vibration data from bearings
having localized faults, and various TDFs are extracted. It is worth mentioning that fluctuations in random vibration
signals may alter the feature values. Therefore, each of the TDFs is processed statistically to approximate its reliable
central values (CVs) against the respec...
Zahoor Ahmed Baloch*
IMPLEMENTATION OF TAST CODES IN DS-CDMA COMMUNICATION SYSTEM
...de and DS-CDMA are retrospectedand
their integrationare studied and analyzed. Simulation results show that a substantial improvement in bit error rate
(BER)can be achieved in CDMA networks by integratingTAST codes in it. ...
their integrationare studied and analyzed. Simulation results show that a substantial improvement in bit error rate
(BER)can be achieved in CDMA networks by integratingTAST codes in it. ...
Salman Saeed*, Akhtar Naeem Khan**, Rashid Rehan*, Sikandar Hayat Sajid**, Muhammad Sagheer Aslam*, Khan Shahzada**
COST AND PERFORMANCE OPTIMIZATION OF PRECAST POST TENSIONED PRE-STRESSED GIRDER BRIDGE SUPERSTRUCTURES
...ost of a
bridge depends on key geometric variables such as bridge width, number of lanes, number and length of spans,
slab thickness, number and spacing of girders. Some of these variables are dictated by traffic demands and highway
geometry, while others are related to structural demands. Typically, designing a bridge usually involves experience
and expert judg...
bridge depends on key geometric variables such as bridge width, number of lanes, number and length of spans,
slab thickness, number and spacing of girders. Some of these variables are dictated by traffic demands and highway
geometry, while others are related to structural demands. Typically, designing a bridge usually involves experience
and expert judg...
Faisal Shabbir*, Naeem Ejaz*, Daulat Khan**, Naveed Ahmad*, Jawad Hussain*, Muhammad Fiaz Tahir*
INVESTIGATION OF USING PAPER INDUSTRY WASTE (HYPO SLUDGE) IN CONCRETE MIX
...e utilization of waste paper sludge ash (WPSA) in concrete. WPSA was partly replaced in the ratios of 5, 10, 15 and 20 percent of cement. Specimens were tested for initial setting time, final setting time, mechanical strengths (i.e. compressive and tensile strength) and dry density, and results are compared with ordinary concrete (without WPSA).The results showed that WPSA can be replaced ...
Rahim Haider*, Al Mustaan Kakar*, Sikandar Bilal Khattak*, Safi ur Rahman**, Shahid Maqsood*, Misbah Ullah*, Rehman Akhtar*, Aamir Sikandar*
DEVELOPMENT OF OPTIMIZED MAINTENANCE SYSTEM FOR VEHICLE FLEET
...odel incorporates the inspection
method by using checklists and maintenance schedules. The system is capable to provide the basis for an advance
system development. ...
method by using checklists and maintenance schedules. The system is capable to provide the basis for an advance
system development. ...
Asif Ali Khan*, Laiq Hassan*, Salim Ullah*
OPEN MP-BASED PARALLEL AND SCALABLE GENETIC SEQUENCE ALIGNMENT
...hm is quadratic. It is imperative to
use parallelism and distributed computing techniques in order to speed up this process. In this paper, we discuss and
evaluate an OpenMP based implementation of SW algorithm. All the experiments have been performed on a Linux
...
use parallelism and distributed computing techniques in order to speed up this process. In this paper, we discuss and
evaluate an OpenMP based implementation of SW algorithm. All the experiments have been performed on a Linux
...
Farid Ullah Khan*, Tashfeen Ali*, Khubroo Jamil*
DEVELOPMENT OF A LOW VOLTAGE AC TO DC CONVERTER FOR MESO AND MICRO ENERGY HARVESTERS
... is widely used for the operation of wireless sensor nodes. Most of the energy harvesters generated
voltage levels are sinusoidal or random in nature, moreover, the output voltage levels these produce are in
low (in mV range). For sensor operation, in order to convert this low AC voltage levels into relatively high DC
voltage DC, a three stage Cockcroft Walton converter is develo...
voltage levels are sinusoidal or random in nature, moreover, the output voltage levels these produce are in
low (in mV range). For sensor operation, in order to convert this low AC voltage levels into relatively high DC
voltage DC, a three stage Cockcroft Walton converter is develo...
Anwar Ullah*, Sabir Islam*, Sikandar Bilal Khattak*, Safi Ur Rahman**, Shahid Maqsood*, Misbah Ullah*, Rehman Akhtar*, Rashid Nawaz*
MAINTENANCE SYSTEM FOR HEAVY EARTH MOVING EQUIPMENT
... such equipment is developed. Heavy equipment
availability is mandatory on site. Their movement is critical and usually limited. The data collected includes both
manufacturer and operator requirement. Usually such equipment is treated as normal machine irrespective of the
rough environment it works in. The analysis includes segregation, Pareto analysis and Five Why ana...
availability is mandatory on site. Their movement is critical and usually limited. The data collected includes both
manufacturer and operator requirement. Usually such equipment is treated as normal machine irrespective of the
rough environment it works in. The analysis includes segregation, Pareto analysis and Five Why ana...
Suhaib*, Shahid Maqsood*, Sikandar Bilal Khattak*, Misbah Ullah*, Rehman Akhtar*, Rashid Nawaz*, Iftikhar Hussain*, Abdul Shakoor**, Khizar Azam**
SINGLE FACILITY LOCATION SELECTIONPROBLEM FOR A PAKISTAN BASED ICE CREAM COMPANY: A CASE STUDY
...timumsolution. In this paper, an optimization technique median method is applied to a
real world problem of a multinational ice cream company’s factory located in Lahore, Punjab (province) Pakistan,
with an objective of minimum overall cost between a warehouse and destinations. The company wanted to locate the
warehouse in Khyber Pakhtunkhwa (KPK), province in order to meet the demand in KPK on time and reduce the
travelling c...
real world problem of a multinational ice cream company’s factory located in Lahore, Punjab (province) Pakistan,
with an objective of minimum overall cost between a warehouse and destinations. The company wanted to locate the
warehouse in Khyber Pakhtunkhwa (KPK), province in order to meet the demand in KPK on time and reduce the
travelling c...
Hamza Tariq1, Imran Hayat1, Saima Rafiq1*, Aqsa Qayyum2 and Sohrab Qayyum1
... (90 days) at ambient temperature for consumer acceptability. An increase in titratable acidity, vitamin C, total phenolics and antioxidant activity was observed with increasing the concentration of autumn olive in the beverage blends while a decreasing trend was observed for pH, reducing sugars, non-reducing sugars and total sugars. Organoleptic parameters such as color, flavor, taste and overall acceptability significantly (p < 0.05) influenced. The TSS, ...
Imran Shehzad1, Ghulam Sarwar1*, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Sher Muhammad2 and Ghulam Murtaza1
...limit of the crop. The experiment consisted of 4 treatments replicated four times and randomized complete block design (RCBD) was used to make layout. Treatments were; T1 = canal water, T2 = water of EC 2.0 dS m-1, T3 = water of EC 3.0 dS m-1 and T4 = water of EC 4.0 dS m-1. Maize was sown as test crop. Pre and post-harvest soil analysis was carried out for different physical and chemical characteristics. Soil samples were collected from all the plots and anal...
Numan Ahmad, Shahid Bashirand Shahid Rauf
DESIGN OF MINITURISED MIMO ANTENNA WITH W-LAN BAND NOTCHED FOR ULTRA WIDE BAND (UWB) APPLICATIONS
... WLAN (5.15GHZ-5.85GHZ) operating band. A ‘spider’ shape structure is etched on the ground as a decoupling structure to obtain impedance matching as well as desired isolation. W-LAN notched band in the entire Ultra Wide band is obtained by etching a couple of straight line on the ground plane. A very compact UWB-MIMO antenna with overall dimension of 20×20 mm2 has been pr...
Muhammad Asad Ali, Mirza Jahanzaib, Muhammad Ahsan Ul Haq
ANALYZING THE EFFECT OF SQUEEZE CASTING PROCESS PARAMETERS ON MECHANICAL PROPERTIES OF OVERCAST AL-ALLOY JOINT USING RSM
...ed via squeeze casting depend on mechanical properties such as ultimate tensile strength and yield strength. Mechanical properties depends upon the input casting parameters named as squeeze pressure, pressure duration and melt temperature. Response surface methodology (RSM) was employed to analyze the effect of above m...
Waqas Anwar, Iftikhar Hussain
COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...istic support, insecure operating environment, difficult terrain, dearth of previously existing infrastructure, centuries old traditional cultural underpinnings, non-availability of skilled manpower / plant and machinery, non-acceptability of allied contractors, and larger operating distances of sites from base camps.
The paper identifies dynamics and variables in order of preferen...
Mujahid Badshah, Saeed Badshah, Sakhi Jan
HYDRODYNAMIC DESIGN OF TIDAL CURRENT TURBINE AND THE EFFECT OF SOLIDITY ON PERFORMANCE
...was validated with the experimental data and a good agreement was achieved. The designed turbine has a 3 bladed rotor of 4 meters diameter and rated mechanical power of 20 kW. Performance metrics of the rotor for steady and uniform flow was simulated at flow speeds from 0.5-3.5 m/s. The turbine achieved its rated power at a tip speed ratio (TSR) 5.7 with a pe
Waqas Anwar, Iftikhar Hussain
COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...istic support, insecure operating environment, difficult terrain, dearth of previously existing infrastructure, centuries old traditional cultural underpinnings, non-availability of skilled manpower / plant and machinery, non-acceptability of allied contractors, and larger operating distances of sites from base camps.
The paper identifies dynamics and variables in order of preferen...
Mahmood Alam Khan, Afzal Munir, Muahmmad Shahzad Khattak, Daulat Khan, Muhammad Ajmal
GROUNDWATER RECHARGE QUANTIFICATION FROM RAINFALL IN PESHAWAR DISTRICT-KHYBER PAKHTUNKHWA
...from rainfall events. As per the data provided by Pakistan Metrological Department, Peshawar, average annual rainfall in district Peshawar during 2002-2011 was 486.1 mm. The weighted curve number (CN) was found to be 82.0. Mean annual runoff produced was estimated to be 217.0 mm where as mean annual recharge to the groundwater was calculated and found to be 269.1 mm. Different water conservation techniques are recommended to increase water recharge in the stu...
Tahir Mahmood, Kifayat Ullah, Murad Ullah, Naeem Jan, Irfan Deli, Qaisar Khan
SOME AGGREGATION OPERATORS FOR BIPOLAR-VALUES HESITANT FUZZY INFORMATION BASED ON EINSTEIN OPERATIONAL LAWS
...le is based on Einstein operations for bipolar-valued hesitant fuzzy sets (BVHFSs). We extend the concept of Einstein operators for BVHFSs by defining bipolar-valued hesitant fuzzy Einstein weighted averaging (BPVHFEWA) operators and weighted geometric (BPVHFEWG) operators. Similarly, we define ordered weighted averaging ope
Numan Habib, Naseer Ahmed, Riaz Muhammad, Himayat Ullah, Muftooh Ur Rehman, Kareem Akhtar
ANALYSIS OF CHIP PRODUCED IN FREE MACHINING OF TI-6AL-7ZR-3NB-4MO-0.9ND AND TI-5AL-7ZR-7NB-0.7ND ALLOYS
...ause of its chemical properties but also because of its excellent properties including, high strength to density ratio, withstand with high stresses, better fatigue and corrosion properties and ability to resist high temperatures. However, all these properties of this alloy results in poor machinability, hence, make ...
Muhammad Shahid1, Adiqa Kiani2* and Mahmood Shah3
Livestock Tackles the Major Sector Fluctuations in Agrarian Sector and Raises Economic Performance: A Study of Pakistan
...ustify;">This research paper focuses the ambiguous analysis of livestock sector in raising the level of economic performance. The study reveals implications of livestock in tackling seasonal fluctuations, inputs shocks and failure of crops in major sector by taking time series data from 1984 to 2017. Auto regressive distributive lag (ARDL) econometric technique was applied to conclude empirical results. Further, cumulative s...
Hafiz Khurram Shurjeel1, Muhammad Anjum Aqueel2, Ejaz Ashraf3*, Asad Ali4 and Arooba Rubab5
Effect of Insecticides on the Longevity of Apis mellifera L. (Hymenoptera: Apidae)
...hemical insecticides for pest management. The present experiment was therefore, designed to look for the effect of some new insecticides (cyhalothrin, nitenpyram, emamectin benzoate) applied at flowering stage of sunflower (variety Hysun-33). After three days of pesticides application, Apis mellifera was exposed to insecticides, placing three honey bee colonies in the center of each plot i...
Azra1*, Muhammad Afzal2 and Dilawar Khan1
Factors Influencing Inflation and Economic Growth in Pakistan: An Econometric Analysis
...-align: justify;">This paper made an econometric investigation of inflation and economic growth in Pakistan for the period 1990-2017. Money supply, imports, exchange rate and budget deficit were the major causes of inflation. Growth in GDP is expected to lead to a reduction in inflation. To combat inflation, unwarranted growth of money supply is checked and the exchange is stabilized. It i...
Asif Nawaz1*, Muhammad Zafarullah Khan1, Rehmat Ullah1, Arshad Farooq2 and Abdul Hassan2
Assessment of Weed Management Competency of Field Assistants in Khyber Pakhtunkhwa, Pakistan
...ield Assistants to be competent in providing extension services to the farming community regarding weeds management. Thus, this study was conducted to assess the weeds management competency level of Field Assistants of Khyber Pakhtunkhwa Agriculture Extension Department. Data from 234 randomly selected Field Assistants were collected through pre-tested and validated interview schedule to achieve study objectives. Results sho...
Kemi F. Omotesho*, Adedamola V. Adetayo, Adeniyi F. Akinrinde and Deborah A. Olabode
Challenges to the Adoption of Agricultural Innovations: The Case of Yam Minisett Technology in Kwara State, Nigeria
...isett Technology (YMT). Specifically, the study assessed the level of adoption of the technology; identified the areas of training need in its use; identified the reasons for non-adoption by non-adopters as well as the constraints faced by adopter farmers in its use. The determinants of farmers’ adoption were also investigated. A four-stage sampling procedure was used to select 205 respondents on whom an interview schedule was administered. Descriptive s...
Inamullah Khan1*, Amjad Usman2 and Rahamdad Khan2
The Mortality Rate of Pupae and Adult of Fruit Fly Bactrocera cucurbitae Coquillett (Diptera: Tephritidae) Affected by Different Submerging Time and Soil Types under the Laboratory Treatment
...stify;">Three separate experiments were carried out to investigate the effect of submerging time under water, pupal age and soil types on mortality and rate of emergence of fruit flies pupae to adult stage. Pupae of Bactrocera cucurbitae Coquillett at different ages by hour i.e., 12, 24, 48, 72 and 96 (hrs) were submerged underwater for (1 and 24 hrs). The rate of pupal emergence to adult stage and mortality was investigated...
Shaista Naz1*, Noor P. Khan1, Himayatullah Khan1 and Azra2
Does Women’s Participation in Livestock Management Enhance their Empowerment? An Insight from the Tribal Belt of Pakistan
...data were analyzed using percent participation, descriptive statistics, and Decision Making Index (DMI). The results showed that the decisions related to livestock management were mostly taken by both women and men jointly (44%), followed by men alone (27 %) and women (25%) independently. It has been found that six kinds of livestock management activities such as milk/by-products and its marketing, milk handling and processi...
Parsa Riaz and Muhammad Naeem*
Digestive Enzymes Activity with Gut Morphometric Parameter of Carnivorous Fish Wallago attu (Siluridae, Siluriformes)
...uld be investigated as dependent variable. These variables were selected on the basis of multicollinearity and principle component analysis interpretations. Present study mainly reported on overall activity of lipase, amylase and protease of Wallago attu. To the best of our knowledge, this is the first study on Wallago attu related to gut morphometrics that evaluated digestive enzymes with reported literature behalf of their spe...
Hina Fatima1*, Sania Shaheen2, Lal Khan Almas3 and Sehrish Haroon4
Profit Efficiency among Transplanting and Direct Seeded Rice Producers (Case Study of Certain Rice Growing Areas of Province Punjab, Pakistan)
...ducation, age, farming experience, extension service facility and land tenancy considerably effects profit efficiency of rice producers. Therefore, the efficiency of rice farmers can be improved through increase in the number of educated people in farming system, and the enrichment of extension services in the rural areas....
Muhammad Naveed Anjum1, Abdur Rehman1*, Muhammad Niamatullah Khan1, Raheel Saqib2, Mohammad Fayaz3 and Iqbal Javed4
Impact of Microfinance on Socioeconomic Status of Farmers in District Dera Ismail Khan
...rofinance institutions especially from Khushhali Bank limited through a well-designed structured questionnaire. The descriptive, inferential statistics, chi square statistics and simple linear regression models were used. The results of the study highlighted that 72.2% of the farmer’s incomes increases due to microcredit’s facility and due to increase in income, the farmers are able to get more access to the health facilities than before. 82.2% far...
Muhammad Zamin1*, Fazli Rabbi2, Shahen Shah3, Muhammad Amin4, Haroon Ur Rashid5, Hasnain Alam6 and Sabahat Ali1
Performance of Lilium (Lilium elegans L.) Genotypes using Different Planting Media
...o investigate the best type of planting medium and selecting a particular genotype for District Swabi climatic conditions, an experiment was conducted in the horticulture nursery, University of Swabi, Pakistan in the year 2019. Five Lilium genotypes viz., Star gazer, Star fighter, BomiYellow, Red carpet and Yena were t...
Sajjad Haydar*, Zunaira Asif*, A. A. Bhatti**, Obaidullah Nadeem***, Ghulam Hussain*, Nadeem Abbas*
EFFICIENCY OF WASTEWATER TREATMENT PLANT IN THE PUNJAB TANNERY SECTOR: A CASE STUDY OF DADA TANNERY
...udy aims to evaluate the performance of wastewater
treatment plant (WWTP) of a local tanning industry. Raw wastewater showed high concentration of organic matter
and Chromium. Phosphorous concentration was found deficient for satisfactory biological treatment. WWTP showed
overall removal efficiency of 88.81, 84.54 and 62.31% for total suspended solids (TSS), five day biochemical oxygen
Ihsan Rabbi*, Sehat Ullah**, Aftab Alam**
MARKER BASED TRACKING IN AUGMENTED REALITY APPLICATIONS USING ARTOOLKIT: A CASE STUDY
...and orientation) with respect to the real world objects. In
existing vision-based augmented reality systems, marker-based technique is widely used approach to track the video
camera pose. In this paper, we present an analysis of marker-based tracking using ARToolKit. We investigate the
effect of marker size, distance between markers and camera, the speed...
Wisal Shah*, Muhammad Nafees**, Muhammad Iqbal***
EVALUATION OF MARBLE SLURRY WASTE FOR PREPARATION OF COMMERCIAL GRADE CEMENT
...Physical and chemical properties of both cements and
mechanical properties of their concrete specimens were tested according to American Society for Testing Materials
(ASTM) standards. The test results showed that the cement prepared from marble slurry waste have similar properti...
Farid Ullah Khan*, Atal Khattak*
DEVELOPMENT OF A POWER MANAGEMENT CIRCUIT FOR MICROENERGY HARVESTERS
...t power sources for the operation of a wireless sensor nodes
(WSNs). The main components of the circuit are resistors (carbon film), capacitors (electrolytic), inductors (ferric
bead, axial leaded), and a DC voltage regulators (TPS62100DRC-BRR). The layout of the circuit is patterned on
a printed circuit board (PCB) using PCB fabrication technology. To the circuit three different types of ...
Muhammad Nafees*, Asim Nawab*, Wisal Shah**
STUDY ON THE PERFORMANCE OF WASTEWATER TREATMENT PLANT DESIGNED FOR INDUSTRIAL EFFLUENTS
... conducted to assess the performance of the treatment plant installed on the main effluent drain
of Hayatabad Industrial Estate (HIE) for reducing pollution load. The objective of the study was to know about the
pollution removal efficiency and suggest changes in the existent treatment plant, if required. For this purpose, samples
were taken from the effluent, before and after it went through the treatment plant. It was found ...
Muhammad Usman Shafi*, Syed Muhammad Ali**, Syed Akhtar Ali Shah***, Kamran Ahmed****
DEVELOPMENT OF DATABASE OF HEAVY TRUCK LOAD DATA IN PESHAWAR, PAKISTAN
...on
of each type of truck. To determine load data, a portable weighing station was designed keeping in view the size of
each truck tire, the maximum deflection and economy. Weighing plates were made of steel which is easily available,
cheaper as compare to the aluminum plates that are being employed in most of the weighing machines. Movable
weighing station comprises of two rect...
Sikandar Afridi*, Muhammad Irfan Khattak**, Nasim Ullah***, Gulzar Ahmad**, Muhammad Shafi**
PERFORMANCE ENHANCEMENT OF FACE RECOGNITION SYSTEM USING PRINCIPAL COMPONENT ANALYSIS MERGED WITH DISCRETE WAVELET TRANSFORMS
...shown by comparing the experimental results of conventional PCA and the proposed technique in this paper.
...
Akhtar Nawaz*, Sahar Noor*, Iftikhar Hussain*, Afzal Khan*, Shahid Rashid**, Rehman Akhtar*
METHODOLOGY FOR POSITIONING MULTIPLE DECOUPLING POINTS IN HYBRID MANUFACTURING SUPPLY CHAIN SYSTEM
...
the challenge of competitive market. The delivery time is one of the most critical factors which influence management
of the supply chain networks and cost of the product. To respond to a given lead time, manufacturing firms need to
adjust their supply chain networks and design an effective interface for decoupling points in the supply chain based
on the cost to be incurred. In this pape<...
Faisal Shabbir*, Muhammad Fiaz Tahir*, Naeem Ejaz*, Daulat Khan**, Naveed Ahmad*, Jawad Hussain*
EFFECT OF COCONUT FIBER AND MARBLE WASTE ON CONCRETE STRENGTH
...th tests using different percentages of cement, CF
and MD. It has been found that the combination affects the strength of concrete. It was observed that a total of 5%
replacement of cement with CF and MD produced an increase in strength. More replacement results in a decrease in
strength. Results showed that CF and MD can act as partial cement replacement, when used in specific proportions...
Asif Ali Khan*, Nasru Minallah*, Shahbaz Khan**
ON THE PERFORMANCE OF SUPERVISED CLASSIFIERS FOR CROP IDENTIFICATION AND ESTIMATION USING MULTI-SPECTRAL IMAGERY
...5 satellite imagery. We specifically considered
tobacco as our pilot crop and compared the obtained results with manually delineated calculations. For
this research SPOT-5 imagery of 2.5m spatial resolution, was provided by Space and Upper Atmosphere Research
Commission (SUPARCO), space agency of Pakistan. After preprocessing, which is a preparatory step in analyzing
and classi...
Numan Ahmad1, Shahid Bashir1*, Shahid Rauf1
DESIGN OF MINITURISED MIMO ANTENNA WITH W-LAN BAND NOTCHED FOR ULTRA WIDE BAND (UWB) APPLICATIONS
... WLAN (5.15GHZ-5.85GHZ) operating band. A ‘spider’ shape structure is
etched on the ground as a decoupling structure to obtain impedance matching as well as desired isolation. W-LAN
notched band in the entire Ultra Wide band is obtained by etching a couple of straight line on the ground plane. A
very compact UWB-MIMO antenna with overall dime...
Muhammad Amjad1,*, Saeed Badshah1, Muhammad Adil Khattak2, Rafi Ullah Khan1, Muhammad Mujahid1
CHARACTERIZATION OF NICKLE FREE TITANIUM ALLOY TI-27NB FOR BIOMEDICAL APPLICATIONS
...>The objective of this paper is the mechanical characterization of TI-27Nb. Tensile, hardness, microscopy and scanning
electron microscope tests were conducted on TI-27Nb specimens. The tensile strength and young modulus of TI-27Nb
were lower than commonly used Titanium alloy i.e Ti-6Al-4V. The SEM results show mixed brittle-ductile surfaces.
It is concl...
Muhammad Asad Ali 1*, Mirza Jahanzaib1, Muhammad Ahsan Ul Haq1
ANALYZING THE EFFECT OF SQUEEZE CASTING PROCESS PARAMETERS ON MECHANICAL PROPERTIES OF OVERCAST ALUMINIUM-ALLOY JOINT USING RESPONSE SURFACE METHODOLOGY
...ed via squeeze casting depend on mechanical properties such as ultimate tensile strength
and yield strength. Mechanical properties depends upon the input casting parameters named as squeeze pressure,
pressure duration and melt temperature. Response surface methodology (RSM) was employed to analy...
Waqas Anwar1*, Iftikhar Hussain1
COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...istic support, insecure operating environment, difficult
terrain, dearth of previously existing infrastructure, centuries old traditional cultural underpinnings, non-availability
of skilled manpower / plant and machinery, non-acceptability of allied contractors, and larger operating distances
of sites from base camps.
The paper identifies dyn...
Mujahid Badshah*1, Saeed Badshah1, Sakhi Jan1
HYDRODYNAMIC DESIGN OF TIDAL CURRENT TURBINE AND THE EFFECT OF SOLIDITY ON PERFORMANCE
...was validated with the experimental data and a good agreement
was achieved. The designed turbine has a 3 bladed rotor of 4 meters diameter and rated mechanical power of 20
kW. Performance metrics of the rotor for steady and uniform flow was simulated at flow speeds from 0.5-3.5 m/s.
The turbine achieved its rated power at a tip speed ratio (TSR) 5.7 with...
Mahmood Alam Khan1*, Afzal Munir1, Muhammad Shahzad Khattak1, Daulat Khan1, Muhammad Ajmal1
GROUNDWATER RECHARGE QUANTIFICATION FROM RAINFALL IN PESHAWAR DISTRICT-KHYBER PAKHTUNKHWA
...from rainfall events. As per the data provided by Pakistan Metrological Department, Peshawar,
average annual rainfall in district Peshawar during 2002-2011 was 486.1 mm. The weighted curve number (CN) was
found to be 82.0. Mean annual runoff produced was estimated to be 217.0 mm where as mean annual recharge to the
groundwater was calculated and found to be 269.1 mm. Different water conservation techniques are recommended
Tahir Mahmood1, Kifayat Ullah2, Murad Ullah3*, Naeem Jan4, Irfan Deli5, Qaisar Khan6
SOME AGGREGATION OPERATORS FOR BIPOLAR-VALUED HESITANT FUZZY INFORMATION BASED ON EINSTEIN OPERATIONAL LAWS
...le is based on Einstein operations for bipolar-valued hesitant fuzzy sets (BVHFSs). We extend the concept
of Einstein operators for BVHFSs by defining bipolar-valued hesitant fuzzy Einstein weighted averaging (BPVHFEWA)
operators and weighted geometric (BPVHFEWG) operators. Similarly, we define ordered weighted averaging o
Muhammad Amir*1, Syed Waqar Shah1, Michael J. Pont2
FAULT-MANAGEMENT ON SYSTEM’S LEVEL IN CONTROLLER AREA NETWORK BASED “SHARED-CLOCK” ENVIRONMENTS
...e/fault-manageable but expensive protocols such as the Time-Triggered Protocol (TTP)
and FlexRay. Looking at the cost-effective nature of CAN and its widespread use, we started working on making
such SC architectures more flexible and fault-manageable on embedded level as demonstrated by our previous work
“Improving flexibility and fault-management in CAN-based “Shared-Clock” architectures”, published...
Numan Habib1, Naseer Ahmed1, Riaz Muhammad1*, Himayat Ullah2, Muftooh Ur Rehman1, Kareem Akhtar3
ANALYSIS OF CHIP PRODUCED IN FREE MACHINING OF TI-6AL-7ZR-3NB- 4MO-0.9ND AND TI-5AL-7ZR-7NB-0.7ND ALLOYS
... chemical
properties but also because of its excellent properties including, high strength to density ratio, withstand with high
stresses, better fatigue and corrosion properties and ability to resist high temperatures. However, all these properties
of this alloy results in poor mach...
Sajjad Hussain1*, Nisar Mohammad1, Zahid Ur Rehman1, Noor Mohammad1, Ishaq Ahmad1,
Naseer Muhammad Khan2 and Salim Raza1
EXTRACTION OF GOLD AND SILVER BY AGITATION CYANIDATION PROCESS FROM COMPLEX ORE OF SHOUGHUR AREA CHITRAL, KYBER PAKHTUNKHWA PAKISTAN
...of cyanidation process depends on dosage of each parameter. In present research work the extraction
of gold and silver by cyanidation process from shoughur area of district Chitral, Khyber Pakhtunkhwa was carried
out at laboratory scale. The three representative samples ground at time 25, 30 to 35 minutes and roasted at 650 oc
for 1 hour were subjected to agitation cyanidation process at varying dosage of pH from 10 to 11.13...
Muhammad Irfan*, Saeed Gul*, Mohammad Younas*, Babar Nawaz*, M. Ishfaq*, M. Amir Durrani*, Abid khan*
FERMENTATION OF SUGARCANE MOLASSES BY SACCHARAMYCES CEREVESIA: EFFECTS OF OPERATING PARAMETERS ON ETHANOL PRODUCTION
... The effect of various experimental parameters such as fermentation time, molasses solution concentration and its pH during ethanol recovery from sugarcane molasses has been investigated. The interaction effects, optimum conditions, and
Nisar Mohammad*, Mohammad Mansoor Khan* Noor Mohammad*
CHARACTERIZATION OF TALC-CARBONATE ROCK OF MINGORA EMERALD MINES, DISTRICT SWAT, KHYBER PAKHTUNKHWA, PAKISTAN
...ls and the debris are dumped after excavation and extraction of emerald crystals. Present research work was undertaken for devising a suitable and commercial processing technique for the said talc carbonate rocks. Thorough investigations were conducted...
Khizar Azam*, Abdul Shakoor*~ Afzal Khan*, Riaz Akbar Shah*~ Shaukat Ali Shah·
IDENTIFICATION OF VITAL VEHICLE MECHANICAL DEFECTS CAUSING ROAD TRAFFIC ACCIDENTS IN PAKISTAN
...sian: normal;">This paper presents the quantitative analysis of RTA
Tabassum Yasmin*, Muhammad Sadiq*
IMPACT OF LANTHANUM DOPING ON SAC305 LEAD FREE SOLDERS FOR HIGH TEMPERATURE APPLICATIONS
...n-3.0Ag-0.5Cu (SAC305) appeared as a strong candidate. However, due to the coarse microstructure and formation of hard and brittle Inter-Metallic Compounds (IMCs), a number ofreliability problems are hindering its use in high-tem<...
Fcroz Shah*~ Mohammad A. Irfan**, Rizwan Gul*~ Abdul Shakoor*
ALGORITHM DEVELOPMENT AND IMPLEMENTATION FOR NUMERICAL DETECTION OF HOT SPOTS IN CASTING GEOMETRY
...ian: normal;">point depending upon magnitude and direction of the average value of all the vectors. After few iterations the point converges inside the geometry which is
Farid Ullah Khan·
PERFORMANCE ENHANCEMENT OF VIBRATION-BASED ELECTROMAGNETIC ENERGY HARVESTER DUE TO REDUCED AIR DAMPING
...his work presents on the performance enhancement ofvibration-based electromagnetic energy harvesters (EMEHs) due to reduced air damping. Fabrication and characterization of Copper foil-type EMEH-l and polydimethylsiloxane
Muhammad Khurram Ali*, Raft Javed Qureshi**, Mirza Jahanzaib***
SELECTING FACILITY LOCATION USING HYBRID METHODOLOGIES IN GLOBAL PERSPECTIVE: A CASE OF CEMENT PLANT
...mally have to face two types ofscenarios: exploring and prioritizing the factors affecting the location decision and selecting an appropriate optimization methodology,- compatible to the said problem. This paper addr...
Abdul Malik*, Abdul Sattar Shakir**, Muhammad Jamal Khan***, Muhammad Latif**, Zia-ul-Haq*
YIELD RESPONSE AND WATER USE EFFICIENCY OF SUGAR BEET IN SEMI-ARID ENVIRONMENT UNDER DIFFERENT DEFICIT IRRIGATION REGIMES
...onduct the experiment and three replications were applied. Four levels of irrigations, designated as full irrigation, 20% deficit irrigation, 40% deficit irrigation and 60% deficit irrigation were tested. Results showed that for all deficit irrigation treatments the root yield was low but the sugar content and water use efficiency were improved. Average root yield for full irrigation was found as 59.75 tonnes ha-J where for 60 % deficit irrigation ...
Farid Ullah Khan*, Sheraz Ali Khan*
A SMART STARTUP AND SHUTDOWN SYSTEM FOR DOMESTIC ELECTRIC POWER GENERATORS
...user convenience. This paper looks at the design and evaluates the results ofa prototype smart system, developed to control the startup and shutdown operations ofa typical household electrical generator. An ATMEL 89C51 microcontroller, relays, voltage regulators, current amplifier, automatic switching relay and step down transformers are used in the prot...
Nisar Mohammad٭, Mohammad Mansoor Khan٭, Noor Mohammad٭
EXTRACTION OF HIGH QUALITY TALC FROM TALC-CARBONATE ROCK OF MINGORA EMERALD MINES BY FLOTATION AND LEACHING
...ls and the debris are dumped after excavation and extraction of emerald crystals. Controll of environmental threat caused by these rock dumps is an additional benefit of the research. Two step froth flotation process with AF65 (Poly propylene Glycol, Cyanamid) as frother, Sodium hexa metaphosphate as depressant for carbonates, equal mixture of oleic acid and kerosene oil as collector gave encouraging results. It was found that talc can be separated as flo...
Syed Asif Ali Shah*, Iftikhar Hussain*
PERFORMANCE OF THE MANUFACTURING SECTOR OF PAKISTAN AND ITS COMPETITIVENESS CAUSE AND REMEDY
...ating employment. This paper reviews the performance of Pakistan’s manufacturing sector and highlights its importance in economic development of the country and analyses the reasons behind the sectors apparent lack of competitiveness. It also discusses the standing of the Pakistani manufacturing sector and its capability of producing high-tech products and its share in the global exp...
Shahida Nasreen Zakir*, Samina Siddiqui**, Nasreen Ghaffar*
MAJOR ELEMENTS CONCENTRATIONS IN CALCAREOUS SOILS
... with Atomic Absorption Spectrophotometery and UV-VIS Spectormetry. Total Ca content in loess soils is 12% thus categorized in calcareous soils whereas alluvium and piedmont alluvium soils with Ca content ranged from 0.9 to 5.2% hence are classified into moderate and non-calcareous. There was an inverse relationship between Ca and P concentrations in calcareous soils. Calcium content is around 12% whereas P content is 0.0000...
Farid Ullah Khan*
MINIATURE VIBRATION SHAKER FOR MEMS-SCALE VIBRATION-BASED ENERGY HARVESTERS APPLICATION
...-align: justify;">This paper describes the design and fabrication of miniature electromagnetic-type vibration shaker for generating sinusoidal vibrations. Conventional machining is used to produce different parts of the vibration shaker. The shaker’s table is supported by zig-zag planar beams and a copper wound coil is contained at the lower portion of the shaker’s table. Alter...
Saeed Gul*, Muhammad Irfan*, Hazrat Bilal*, Atta-ur-rehman*, Umair Khan*, Sadaqat ullah khan*
RECYCLING OF USED ENGINE OIL USING SOLVENT EXTRACTION AND DISTILLATION
... toluene. The effect of operating parameters on the recycling process has been investigated for optimal conditions. The process parameters considered were agitator speed for blending, boiler temperature and solvent to used oil ratio. The maximum recovery for refined oil was 72% using solvent to used oil ratio of 9:1 at a boiler temperature 120° C and...
Khizar Azam٭, Abdul Shakoor٭, Riaz Akbar Shah٭, Afzal Khan٭, Shaukat Ali Shah٭,
Muhammad Shahid Khalil٭٭
COMPARISON OF FATIGUE RELATED ROAD TRAFFIC CRASHES ON THE NATIONAL HIGHWAYS AND MOTORWAYS IN PAKISTAN
...gue-related. The average percentage of fatigue related RTC on Motorways was 28%, however on National Highways (N-5) it was found to be 10%. Fatigue-related RTC is thus more prevalent on the Motorways. It was also discovered that fatigue-related RTC result in mostly fatal accidents on the Motorway (54%) and serious injuries on N-5 (41%).
...
Gul Rukh*, Iftikhar Khan* M. Naeem Arbab*, Uzma Nawaz*
DESIGN AND IMPLEMENTATION OF AN EFFICIENT MICRO-HYDROELECTRIC SCHEME FOR LOW HEADS
...-align: justify;">This paper presents a design of a hydroelectric scheme specially proposed for low head applications. After carefully studying the hydrology and geographical conditions of the site, turbine is designed for the heads of 3 to 10 meters obtainable from streams and irrigation channels. The low efficiency in already existing hydroelectric scheme used is addressed and compared with the existing scheme. Using the s...
Farid Ullah Khan*
ACTUATION ENHANCEMENT OF A MICRO BIMORPH THERMAL ACTUATOR
...rs, atomic force microscope probe tips, membranes of micro pumps and micro valves, etc. This research is focused on enhancing BTA actuation characteristics. The mathematical model for BTA is used to study the behaviour of a spectrum of material combinations. Although a silicon-aluminum (SiO2-Al) BTA exhibits superior characteristics over a limited operat...
Shaukat Ali*, Shah Khusro*, Laiq Hasan**, Asif Ali Khan**
A SURVEY OF MOBILE PHONES CONTEXT-AWARENESS USING SENSING COMPUTING RESEARCH
...ation platforms for performing individual's daily activities but have turned them into global sensing devices as well. Mobile phones sensing is a novel mobile phones context-aware computing paradigm enabling mobile phones to discover and capture peoples' contextual information, paving the way for the development of cutting-edge context-aware applications. Mobile phone sensing is old wine in a new bottle, ...
M. Rizwan Gul*
COMPARISON OF THE OF MECHANICAL AND WEAR BEHAVIOURS OF DIFFERNT TYPES OF POLYETHYLENES AND THE EFFECT OF RADIATION CROSS-LINKING ON THESE BEHAVIOURS
...e of applications and properties. They are sometimes cross-linked to improve their properties such as high temperature resistance and wear behavior. Radiation cross-linking using high energy electron beam or g-radiation constitutes one of the most convenient methods. This study explores the difference in mechanical and wear behavior of different polyethylenes, and compares the effect of ra...
M A Khalid*, A R Ghumman**, H. N. Hashmi**, E. Tanveer*
INVESTIGATION OF PERFORMANCE AND SEDIMENT TRANSPORT OF LOWER BARI DOAB CANAL
...y countries world-wide depends upon irrigated agriculture. The performance of irrigation system having large network of canals fed from rivers is influenced by many parameters. Inequitable water distribution, Shortage of water during peak crop water requirements, tempering of insufficient funds for proper maintenance a...
Muhammad Waseem*, Irshad Ahmad**, Rawid Khan**, Bashir Alam**, Khan Shahzada**, Muhammad Javed**
STABILITY ANALYSIS OF SOIL SLOPE IN SWABI, PAKISTAN
...tify;">In this study, slope stability analysis for a particular type of soil in Swabi area was carried out using the method of slices. Gravity load and seismic load were considered in the stability analysis. SLOPE/W and SIGMA/W software of Geo studio package were used for analysis under both dry and completely saturated conditions. Pseudo-static approach...
Syed Farasat Ali Shah*, Amjad Naseer**, Rashid Rehan**
USE OF RUBBER WASTE IN CONCRETE TO REDUCE ENVIRONMENTAL POLLUTION- AN OVERVIEW
...omestic activities is dumped in open spaces. However dumping of solid waste in open spaces is hazardous to environment; therefore researchers have explored new means to effectively manage such waste. Tyre wastes have no exception; it cannot be readily recycled or reused. They are dumped in open grounds around the world...
M. Nafees*, Bushra Khan*, Robina Naz*
STUDY OF OCCUPATIONAL HEALTH SAFETY IN STEEL RE-ROLLING MILL WITH REFERENCE TO HIGH NOISE LEVEL AND TEMPERATURE
...exposure to noise and temperature in a steel re- rolling mill. The measured noise and temperature values were then compared with international standards set by Occupational Safety and Health Administration (OSHA). Our results indicate that temperature level was high at two places of the mill i.e. furnace and re-rolling mill sections with the average value of 67 °C and 39°C res
Azam Khan*, Irshad Ahmad**
TIME HISTORY ANALYSIS OF SEISMICALLY ISOLATED FIXED BASE OFFSHORE PLATFORM
...-align: justify;">This paper presents an overview of the application of seismic isolation to a fixed-base offshore platform. A series of nonlinear time history analyses has been undertaken for the Platform A to assess structural integrity under Ductility Level Earthquake (DLE) design events. A full nonlinear time history analysis (including soil and foundation modelling) has been undertaken using finite element software SAFJAC for an extreme earthquake records...
Azam Khan*, Irshad Ahmad**
IN-PLACE ANALYSIS OF JACKET OFFSHORE STRUCTURE UNDER STORM CONDITIONS
...-align: justify;">This paper presents the details of In-place analysis of fixed jacket Platform BD. The numerical model is prepared using ANSYS ASAS structural analysis computer system. Beam stick model has been used, with multi-level sub-structuring technique, to model the whole structure. Appropriate dead load, live loads and quasi-static action of 100 yr storm have been applied to the structure. The structure-pile interaction analysis has bee...
Muhammad Imran Ahmad*, Nan Zhang**, Megan Jobson**, Muhammad Younas*, Kamran Ghani***
DELUMPING PROCEDURE FOR PREDICTION OF DISTRIBUTION OF PRODUCTS IN DISTILLATION USING A SHORT-CUT MODEL
...ptions for separation of petroleum fractions at conceptual design stage. A methodology for prediction of detailed product distribution for distillation processes using short-cut calculations of distillation is developed in this work. The proposed delumping procedure is explained in this paper, and an illustrative example is presented to elucidate the application in mode...
Tahir Usman*, Khan Muhammad*
MODELING OF BLASTING COST AT DEEWAN CEMENT QUARRY, HATTAR USING MULTIVARIATE REGRESSION
...;a cement quarry. This paper presents the development of a prediction model for blasting cost per ton at Deewan cement quarry operations, located in Hattar, Pakistan. The dataset primarily consisted of a total of 12 parameters which has been analyzed using Principal Component Analysis (PCA) to account for most significant parameters. These parameters were then subsequently u...
Muhammad Qasim*, Mohib Ahmad*, Mohammad Inayatullah Babar*, Shahid Bashir*,
Farah Mahmood*, Zeeshan Sabir*
INVESTIGATING THE EFFECTS OF VARIOUS PARAMETERS ON EFFICIENCY OF PHYSICAL LAYER DEPLOYED FOR WIRELESS SENSOR NETWORK
...ss sensor networks with special emphasis on performance and efficiency of physical layer. The role of physical layer is clearly evident from the fact that it plays an important role in determining the overall quality of data communication. The issue of quality is also important in the context of saving energy of nodes involved in wireless sensor network communication. Poor quality of communication puts co...
Gulzar Ahmad*, Sahibzada Faheem*, Amjad Ullah*, Waqar Shah*, S.M. Majid Ashraf*
COMPARATIVE STUDY OF RELAY PROTOCOLS USING SIMULATION
...text-align: justify;">Cooperative communication has gained a lot of interest due to its ability to exploit the spatial diversity or antenna diversity. The implementation of the cooperative relaying systems involves less hardware and low complexity but gives comparable performance and diversity gains to the actual multiple antenna systems. The aim of this pa
Naeem Ejaz*, Daulat Khan**, Usman Ali Naeem*, Muhammad Ali Shamim*, Muhammad Fiaz Tahir*, Faisal Shabbir*, Jawad Hussain*
DETERIORATION OF ORDINARY PORTLAND CEMENT AND FLY-ASH BASED GEO-POLYMER CONCRETES DUE TO SULFATE ATTACK UNDER THE ACTION OF SULFURIC ACID AND WASTEWATER
...erally, deterioration happens due to sulfuric acid reaction with treatment units and sewer materials. Geo-polymer binders especially fly ash (FA) is an acid resistant and can be used as a substitute binder for sewer construction. This research work highlights the laboratory results of fly ash based geo-polymer concrete and effects on its durability under sulfuric acid exposure. Class ‘F’ fly ash&nb...
Muhammad Naeem*, Sohail Asghar**
A REVIEW OF FEATURE SELECTION TECHNIQUES IN STRUCTURE LEARNING
...as well as theoretical aspects of various feature selection evaluators, their corresponding searching methods under six well known scoring functions in K2 which is a notable structure learning technique in Bayesian belief network. We have come up with some useful findings for overall computationally efficient approach among eleven evaluators. This analysis is useful in inducing better structure from the given dataset in imparting improved <...
Inayat Ullah*, Shah Khusro**, Saeed Mahfooz**, Azhar Rauf**
IMPACT OF NETWORK SCALABILITY ON THE PERFORMANCE OF RIP AND IGRP FOR EMAIL SERVICES
...f distance vector while Open Shortest Path First (OSPF) and Intermediate System to Intermediate System (IS-IS) are link-state routing protocols. Both RIP and IGRP are using different metrics to evaluate best route to a destination in the network. RIP uses a simple metric value of hop-count while IGRP uses a composite metric. A composite metric consists of several attributes like bandwidth, delay, reliability, Maximum Transmission Unit (MTU)...
Muhammad Irfan*, Saeed Gul*, Mohammad Younas*
SOLAR STILL PERFORMANCE FOR SEA WATER PURIFICATION: A STATISTICAL AND EXPERIMENTAL STUDY
...in still, average day temperature and average water temperature in still were studied experimentally and verified statistically though ANOVA (analysis of variance). It was found that the water temperature in the still is the most significant parameter that largely affects the evaporation rate. The fresh water with 240 mg/L dissolved salt h...
Zeeshan Sabir*, M. Inayatullah Babar*, Saeed Ur Rehman**, Amjad Ullah Khattak * Syed Riaz Ul Hassnain*
EVALUATING PERFORMANCE OF DIFFERENT ROUTING PROTOCOLS IN MANET ENVIRONMENT BASED ON TCP WINDOW SIZE EVALUATION
...f the MANETs primarily depends upon the protocol running at the backend for routing the packets between the mobile nodes of the network. Each of these protocols has its own pros and cons in different scenarios. In this paper we have simulated an environment of MANETs consisting of a few Mobile nodes that tend to form a network amongst eachother during their random mobile behaviour. The environment has been&nbs...
Muhammad Tahir Manzoor*, Javed Iqbal*, Mohammad Inayatullah Babar*, Zeeshan Sabir* Khizar Azam*
MULTI HOP CLUSTER DESIGN IN WIRELESS SENSOR NETWORKS
...y of sensor nodes depends on the size of the cluster and the amount of information send over the network. An inherent problem with the WSN is the consumption of battery power since when the cluster size is increased depending on application it is designed for, battery life of sensor nodes gets reduced with this extra consumption of energy due to the expanded size of the cluster. In this pa
Amjad Ali*, Amir Nawaz Khan*, Atta-ur-Rahman*, Muhammad Saeed*
ANALYSIS OF SITE, SITUATION AND THEIR IMPACT ON RESETTLEMENT OF PROPOSED NEW BALAKOT TOWN, PAKISTAN: AN EX POST EVALUATION OF 2005 KASHMIR EARTHQUAKE
...new Balakot town. This paper attempts to carry out the analysis of site, situation and their impact on resettlement of proposed new Balakot town, Pakistan. The site analysis provides details of vulnerability to hazards, civic utilities and services. The new Balakot is a planned town and have low vulnerability to seismic hazards. The situation analysis explores the potential growth and development of the new town which is measured in term of econ...
Mumtaz Shah*, Hashim Nisar Hashmi* Naeem Ejaz* Abdul Razzaq Ghumman*
PERFORMANCE EVALUATION OF AQUATIC MACROPHYTES FOR MUNICIPAL WASTEWATER TREATMENT
...on and comparison of the performance of three aquatic macrophytes regarding sewage treatment. A bench scale laboratory model was developed and used for experimentation. Six experimental runs were conducted and each run laps over thirty (30) days. In each experimental runcontinuous monitoring of municipal sewa...
Hazrat Hussain*, Muhammad Ibrahim**, Navid Ahmed***, Zia ul Haq**, Bashir Alam***
ASSESSMENT OF SEDIMENT TRANSPORT LOAD FROM GOAML RIVER AND ITS IMPACT ON THE GOMAL ZAM DAM LIFESPAN
...-align: justify;">This paper estimates the sediment load transported by Gomal River at Khajuri Katch and Kot Murtaza on yearly-basis. An eight years sediment data (1981-88) compiled by the surface water hydrology division of WAPDA was analyzed. Based on the available data and using regression analysis a model is developed to establish a correlation between water discharge and sediment load. The model is an att...
Asif Nawaz*, Muhammad Zafarullah Khan, Rehmat Ullah, Khalid Nawab and Urooba Pervaiz
Investigation of Professional Competency Level and Training Needs of Field Assistants in Khyber Pakhtunkhwa
...ations to investigate competency level of their staff so that training can be provided to them for successful execution of extension tasks. Hence, this study was designed with objective to inspect professional competency level and training needs of Field Assistants of Agriculture Extension Department Khyber Pakhtunkhwa. A sample of 234 respondents was selected and ...
Shahid Ali1, Habib Akbar2, Shamsher Ali3*, Adnan Nasim1, Muhammad Ismail1, Nur Ul Haq1 and Muhammad Usman4
Effect of Planting Sources, Cane Portions and Setts Placement Methods on Sugarcane Yield Attributing Traits
...-align: justify;">This experiment was performed to find out the best sugarcane plantation source between trenched and fresh stocks, efficient method of setts placement, selection of paramount cane portions and the interaction of yield and yield components. The effect of planting sources (i.e. sugarcane fresh seed and the one obtained from stock buried underground), cane portions and setts placement methods on sugarcane yield...
Tanveer Sultan1, Anwaar Ahmed1, Aqsa Qayyum2*, Amer Mumtaz2 and Naeem Khalid3
...pplementation was more appealing for taste, color and texture. The study postulated that buckwheat could be used as a potential source of gluten-free bakery products. ...
Fazli Rabbi1*, Muhammad Idrees2, Shahid Ali1, Muhammad Zamin3 and Hazrat Bilal4
Farmers Perceptions and Adoption of Information and Communication Technologies (ICTs) in Peach (Prunus persica L.) Production and Marketing
...rs from apple growing to peach (P. persica L.) production in the Swat valley of Khyber Pakhtunkhwa during the last couple of years. However, these peach growers face various contraints in peach marketing. The farmers are reverting to the use of Information and Communication Technologies (ICTs) to overcome marketing hurdles. This research investigates the...
Sajad Ali1*, Jangraiz Khan2, Arshadullah Jadoon3, Muhammad Riaz4 and Abid Khan1
Evaluation of Farmers Socioeconomic Characteristics Influencing Tomato Output in District Peshawar, Khyber Pakhtunkhwa, Pakistan
...n: justify;">Tomato (Lycopersicon esculentum L.) is one of the most important and widely distributed horticultural vegetable crops in the world. It is economically attractive to farmers, due to its short duration for ripping which increases productivity. Thus, it is becoming an indispensable source of farmer’s income in Pakistan. The production of tomato has been decreased considerably during the last five years. The p...
Sitara Nawaz1, Shamaila Irum1, Haroon Ahmed2, Shazia Shamas1, Sadia Roshan1, Muhammad Ather Rafi4, Irfan Ullah5*, Gulnaz Parveen3*
...i was most abundant specie and a strong positive linear correlation exists between sandflies collected and the patients reported from the area. It was observed that as the number of sandflies increased, the number of patients with Leishmaniasis increased, and as the number of sand flies decreased, the number of patients decreased. The most affected age group was 1-10 years. The disease was more prevalent in males (57.26) as compared to females (42.74) beca...
Sumaira, Ali Mujtaba Shah*, Ghulam Asghar Solangi, Ifra Anwar, Qudratullah Kalwar
...obtained from different species including sheep, ass, horse, yak, goat, bison and camel while the 80 % milk is produced by cows. Milk of camel plays an essential part in the diet of human. Additionally, camel milk comprises numerous fatty acids and enzymes. Hence camel milk has many beneficial effects, such as antiviral, antibacterial, anti-diabetic, anti-carcinogenic and anti-ageing. Besides, camel milk contains abundant proteins which are conductive to impro...
Zarish Yaqoob1, Saleema Bashir Shams2, Gaitee Joshua2 and Bibi Nazia Murtaza2,3*
...Overall, seventeen fish species were recorded in the study areas indicating a decrease in the number of species in Ravi. The results have shown that the water of Ravi is unsafe for aquatic life and irrigation. Metal concentration in the fish meat is higher than the recommended dietary allowance (RDA) parameters indicating a serious health threat to both, the fish and human population.
...
Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1
Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...ic relationship of this species with other reported species of this genus. Pathogenic potential of the isolate was verified by artificially inoculating the spores of pathogen in healthy plants. Appearance of same symptoms and re-isolation of N. rubicola from infected tissue confirmed Koch’s pathogenicity postulates. Association of N. rubicola causing stem rot in potato is never repor...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Saima Sadaf1, Adnan Ahmad1, Usman Rafique1 and Muhammad Arshad Javed1
An Assessment of Farmers’ Awareness Level Regarding Integrated Farming System in District Sargodha, Punjab, Pakistan
...ng system (IFS) holds a special position with the central concept that nothing is supposed to be wasted here. It is an integrated approach to farming compared with existing monoculture approach. It passes on to an agricultural system that integrates crop production and livestock. IFS helps small scale farmers to increase cash income, improve quality and quantity of food produced by methodical exploitation of resources. Purpose of the study was to assess the aw...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Saima Sadaf1, Adnan Ahmad1, Usman Rafique1 and Muhammad Arshad Javed1
An Assessment of Farmers’ Awareness Level Regarding Integrated Farming System in District Sargodha, Punjab, Pakistan
...ng system (IFS) holds a special position with the central concept that nothing is supposed to be wasted here. It is an integrated approach to farming compared with existing monoculture approach. It passes on to an agricultural system that integrates crop production and livestock. IFS helps small scale farmers to increase cash income, improve quality and quantity of food produced by methodical exploitation of resources. Purpose of the study was to assess the aw...
Muhammad Khalid1,2, Samrah Masud2, Zara Naeem2, Muhammad Munir Shahid3, Ammar Danyal Naeem2, Abir Ishtiaq2 and Muhammad Naeem2*
Length-weight and Length-length Relationships of Farmed Catla catla during Winter Season from Muzaffargarh, Pakistan
...atla catla, thirty fish specimens were collected from a fish farm located at Muzaffargarh, Pakistan during January, 2019. Total length (TL), standard length (SL), fork length (FL) and body weight was taken of each fish specimen. Mean TL and body weight (W) of studied fish specimens of C. catla was found 49.14±1.58 cm and 1775.29±191.18 g, respe...
Saba Iqbal1*, Muhammad Luqman1, Hafiz Muhammad Nasrullah1, Asmat Ullah1 and Hafiz Muhammad Akram2
Response of Cotton to Application of Organic and Inorganic Source of Nutrients in Semi-Arid Climate
...t of inorganic nutrients per unit area. This study was executed to quantify the best possible combination of integrated nutrients application for cotton crop. The effect of different combination of mineral/inorganic nitrogen (N), farm yard manure (FYM: comprised of cow dung) , poultry manure and slurry (waste product of biogas plant that uses manure of all kind of farm animals to produce biogas) were investigated to figure out the best possible combination for...
Mohammad Aslam Khan*, Samiullah* and Zulfiqar Ali*
DYNAMICS OF URBAN SPATIAL GROWTH AND PLANNING: A CASE STUDY OF PESHAWAR
...-align: justify;">This paper traces the spatial growth of Peshawar, one of the major cities of Pakistan. Data and information for the study were collected from historic maps, documents and satellite images. The analysis shows that the city has been growing at a rapid pace adding about 500 ha of land annually in recent years and in the absence of planning control has seen tremendous urban sprawl. The pattern of development of urban sprawl in Pesh...
Waheed-ur-Rehman*, Amjad Naseer*, Rashid Rehan*, Mohammad Ashraf* and Muhammad Ibrar*
PERFORMANCE OF BRICK MASONRY CAVITY WALLS WITH DIFFERENT WALL TIES
...-align: justify;">This paper presents a study about the behavior of brick masonry cavity walls. Three types of cavity walls were tested, each having two wythes of 4½ inches thickness and 2 inches cavity between the two wythes. The first type did not have any ties, the second types had I-shaped ties whi...
Asadullah Saleem* and Nadeem Ehsan*
STATUS OF PERFORMANCE MEASUREMENT SYSTEMS IN INFRASTRUCTURE CONSTRUCTION FIRMS OF PAKISTAN
...ion sector,even in developed countries, is criticized for sub-optimal performance. The situation is no different in case of Pakistan construction industry. Being regarded as an answer to challenges framed by globalized competitive environment, performance measurement discipline has received much attention among researchers and construction...
Usman Ghani*, Naeem Ijaz* and Daulat Khan**
NUMERICAL SIMULATION OF MEANDERING OPEN CHANNEL FLOWS
...oss to human life and property. There is an ever increasing danger of floods due to global warming. The overbank flow studies are important for understanding flow behavior and bed shear stresses during floods and for devising flood protection strategies. This study is based on three dimensional numerical simulation of overbank flows in meandering channels. Four different flow cases were considered. The cases vary from each other in the sens...
Naeem Ejaz*, Daulat Khan**, Usman Ali Naeem*, Muhammad Ali Shamim*, Usman Ghani* and Muhammad Fiaz Tahir*
INVESTIGATION TO CHECK THE FEASIBILITY OF COMPOSTING FOR SMALL CITIES IN DEVELOPING WORLD: A CASE STUDY OF TAXILA CITY
...m each of these zones respectively. Solid waste samples are collected from the selected sites for a week on daily basis, which are then analyzed to find their composition and are recorded accordingly for each zone. The analyses of collected samples indicated that almost 60-70% of generated communal waste from all three zones is organic in nature and that the composting option for such communal waste could be a more sustainable and economica...
Feroza Arshad*, Aftab Ahmed Memon**, Muhammad Aslam Uqaili** and Arshad Habib Malik*
SYNTHESIS OF A NOVEL ROBUST INTELLIGENT CASCADED REACTIVITY CONTROLLER FOR CANDU REACTOR
...ign: justify;">In this paper, a Novel Intelligent Cascaded Reactivity Controller (NICRC) is synthesized for a CANadian Deuterium Uranium (CANDU) -type Nuclear Power Plant (NPP) operating in Pakistan. The designed NICRC is a cascaded configuration of reactor power and moderator level controllers composed of five sub-controllers. The proposed NICRC is designed using intelligen...
Shahrukh Khalid* and Athar Mahboob**
A SURVEY ON AUTO-CONFIGURATION MECHANISMS FOR MOBILE AD-HOC NETWORKS (MANETS)
...d problems of MANETs are peculiar in nature. Current networking software stacks and services are based on TCP/IP model which is IP address centric. All nodes which want to communicate must have unique IP addresses. Auto-configuration refers to assignment of unique IP addresses to the nodes of MANETs. Due to characteristics of MANETs, assignment of IP addresses to nodes is a non-trivial problem and renders itself as an o
Abroon Jamal Qazi*, Afzal Khan*, Muhammad Tahir Khan*, Muhammad Ali Kamran* and Khizar Azam*
A NOVEL APPLICATION OF PARTICLE SWARM OPTIMIZATION TECHNIQUE IN SEMI-ACTIVE SUSPENSION SYSTEM CONTROL
...-align: justify;">This paper is based on the quarter car semi-active suspension system. Semi-active suspension system proves to be a better choice in comparison with the passive and active systems keeping in view the inherent benefits of better performance, light weight and cost effective design. The semi-active system is driven by a fuzzy logi...
Sikandar Khan*, Afzal Khan*, Muhammad Tahir Khan*, Muhammad Ali Kamran* and Abdul Shakoor*
DYNAMIC MODELING AND STARTING BEHAVIOR OF A SMALL HORIZONTAL AXIS WIND TURBINE
...the coastal areas, wind speeds available in various areas of Pakistan are low to medium, especially in the northern areas. It is possible to produce significant power from a small wind turbine at low wind speeds provided the turbine can be started. In this paper “BEM function” and “Aerodynamic function” are used bas...
Muhammad Shaheen
APPLICATION OF LABELLED K MEANS CLUSTERING FOR GIS CONTRACT AUTOMATION
...ans Clustering is an unsupervised classification technique which is suitable for the dataset which do not have any class labels. The absence of labels constrained its application on different text data sets. Labelled K Means clustering generate labels for the clusters obtained from K Means Clustering which makes this technique more decisive for text data sets. A novel application of Labeled K Means Clustering for automation of technical part of GIS contracts i...
Faheem Ali1, Muhammad Amir1, Muhammad Iftikhar Khan1, Muhammad Naeem Arbab1, Abdul Basit2, Muhammad Kashif Khan1, Gulzar Ahmad1
AN SVC BASED POWER QUALITY IMPROVEMENT MODEL FOR CONSUMERS CONNECTED TO WEAK BUSSES IN DISTRIBUTION SYSTEMS
...hed capacitor banks to cope with low power factor but the limitation is step-wise reactive power injection which does not meet the changing load requirements. Real time improvement requires constant monitoring and real-time injection of Volt-Ampere-Reactive (VAR) which is possible with the help of a Static VAR Compensator (SVC). An SVC based Power Quality Improvement (PQI) is pro...
Mehreen Ijaz
COMPARATIVE ANALYSIS OF TENSILE STRENGTH OF MULTIFILAMENT SILK AND VICRYL SUTURES USED IN SURGERY
...chanical and physical properties of sutures are crucial requirements to make an informed decision for their appropriate use in surgery. This study was aimed at determining and comparing the tensile strength of sutures made with silk and vicryl materials in straight and knot pull. An experimental study was conducted. Samples of sutures made with silk and vicryl used for surgery were collected from various pharmaceutical ...
Amjad Hussain1, Ata Ur Rehman2, Zia Ur Rehman Tahir3, Aftab Ahmad1, Fahad Noor3, Qasar Wasique Ahmad1
INVESTIGATION OF EMPLOYEES’ PERCEPTION ABOUT LEAN IMPLEMENTATION
..."text-align: justify;">especially how employees interact with each other’s and what’s their attitude towards their jobs. Literature reveals that employee’s behaviour towards lean implementation is controversial; some perceives this positive and others take this negative. This study aims at investigating varying employees’ perceptions towards lean because of their po...
Behram Khan1, Amir Nawaz Khan2, Said Qasim3, Atta-ur Rahman4
ANALYSIS OF HUMAN PERCEPTIONS AND ADAPTATIONS TO FLASH FLOODS IN KHYBER AGENCY, FATA
...ims to analyse the human perceptions and adaptations to recurrent devastating flash floods in Khyber Agency, FATA. The study is mainly based on both primary data sources including field observations, structured questionnaire survey and focus group discussions supported by secondary data sources. Three hundred adult residents in five sample villages along Chora River and its tributaries were interviewed by using a structured questionnaire which covered approxim...
Gulzar Ahmad1, M. Inayatullah Babar2
AN EFFICIENT PATCH ANTENNA WITH IMPROVED BANDWIDTH FOR FUTURE APPLICATIONS
...that is known as Preperm L-450. Dielectric constant of this mentioned material is 4.4 and its height or thickness is 1.64mm. Different methods were engaged to expand its bandwidth from 9.07GHz to 13.13GHz. The reflection coefficient of -45dB at the central frequency, a gain of 7dBi and total efficiency of 0.99 have been demonstrated by this proposed design of the patch antenna. This novel structured wide band and high efficient antenna can ...
Shahid Hussain Abro
ROLE OF MN ATOMS ON TENSILE PROPERTIES OF LIGHT WEIGHT CHQ STEEL
...change the mechanical properties and each element plays his role. The present work has been performed to reveal the role of Mn atoms on tensile properties of experimental steel. Two steels were chosen A and B, in steel A no Mn was present but in steel B Mn was present. Both steels were heat treated at 850°C and 1175°C for 1hr holdi...
Uzma Nawaz1*, Muhammad Iftikhar Khan1, Muhammad Naeem Arbab1
TECHNO-ECONOMICS OF UPS SYSTEM AS BACKUP POWER SOURCE DURING LOAD SHEDDING
...creases since batteries operate charge at low efficiency, and have undesirable impact on consumer loads. In this work a survey highlighting the technical and economic issues with UPS system is described that allowed obtaining a cost model based on useful service life of battery, which have also been investigated with the local brands of batteries. The results showed the battery useful life as a function of charging/discharging cycles. In pa...
Qazi Salman Khalid1, Muhammad Abas1, Mudassar Rauf2, Mirza Jahanzaib2, Shahid Maqsood1
HYBRID PARTICLE SWARM ALGORITHM FOR SCHEDULING IN CELLULAR MANUFACTURING SYSTEM- A CASE STUDY
...evaluate two conflicting performance measures; minimization of work in process (WIP) and maximization of average machine cell utilization. Implementation of proposed algorithm had increased the utilization from 65% to 82 % while minimized the WIP to 6 parts from 25parts....
Sikandar Bilal Khattak, Iftikhar Hussain, Rashid Nawaz
EVALUATING THE SOCIAL ASPECT OF SUSTAINABLE CONSTRUCTION FOR PAKISTAN VIA ANALYTICAL HIERARCHY PROCESS
...ety. This makes social aspect (society) to be of prime importance. This paper focuses on the social aspects of the sustainable construction. Most of the sustainability studies are carried out through questionnaire or interviews. Similarly, this papers also uses the questionnaire for data collection. The collected data is analyzed with Anal...
Saman Shahid1, Shahid Ali1, Muhammad Abdullah Ahmad1, Sarfraz Munir2
RE-DESIGNING AND OPERATIONAL ANALYSES OF THE SEDIMENT TRANSPORT CONTROL IN IRRIGATION CANAL NETWORK
...s work, where engineers spend months to design canals. Over the years, engineers and agriculturists in the Punjab have been trying to find a solution to the sediment transport problem which occurs in existing irrigation system. To address these problems, the canals can be analyzed to point out the flaws in design and operation mechanism. This study used a Physics based mathematical model, which can aid the engineers to desig...
Majid Ashraf, Mohammad Haseeb Zafar, Tariqullah Jan
EFFICIENT ROUTING SCHEME FOR UNIDIRECTIONAL LINKS IN MULTI-HOP NETWORKS
...: justify;"> This paper presents an efficient routing scheme for Multi-hop Network in the presence of unidirectional links. The distinct feature of this routing scheme is the capability to actively provide routing paths even though a large number of unidirectional links are present in the network. The results depict that the routing scheme is able to reduce the delay and routing overhead compared with the already available routing scheme like AO...
Muhammad Qasim Khan1*, Syed Athar Masood1 and Shahzad Naeem Qureshi2
REFORMULATION OF PRODUCTIVITY IMPROVEMENT MODEL FOR PUBLIC SECTOR AUTOMOBILE REBUILD ORGANIZATIONS
...ize their profit. This paper attempts to identify reasons for low productivity and reduced output of public sector automobile rebuild organizations of Pakistan. Input in this research was sought primarily from top, middle and lower management of public sector automobile rebuilt organizations. Data from a total of two hundred and sixty-two respondents representing twenty-one different automobile rebuild organizations was compiled through quantitative surve...
Muhammad Shahzad1, Arif Iqbal Umar1, Syed Hamad Shirazi1, Muhammad Tariq Pervez2*, Zakir Khan1, Waqas Yousaf1
HCDP: HEPATITIS C DATA BANK OF PAKISTAN
...trand and circular in shape. The hepatitis C virus is substantial threat to the public health and its frequency is increasing rapidly all over the world. Approximately 5 online databases are available related to Hepatitis C virus. All these databases mainly concerned their national level/specific demographic region strains for analysis. No HCV database available to find the HCV prevalence and distribution in P...
Ahmad Khan1*, Yasir Mehmood2
RESOURCE MANAGEMENT FOR MACHINE TYPE COMMUNICATION AND INTERNET OF THINGS IN MOBILE NETWORKS
... importance of Machine Type Communication (MTC) in many fields, massive increase in (MTC) data traffic is anticipated in future. Different wireless communication technologies can be used for interconnecting MTC devices (MTCDs), but the cellular mobile networks are almost available everywhere and therefore it is considered the best mean for interconnecting MTCDs. The cellular mobile networks are primarily designed for providing broadband ser...
Nashitah Alwaz1, Safdar Raza1*, Sadaqat Ali1
A COMMUNICATION-FREE SIGNAL GENERATING TECHNIQUE FOR REACTIVE POWER CORRECTION IN ISLANDED MICROGRID
...adly due to the feeder impedances and uncontrollable power coupling issues. Many techniques have been proposed to share power accurately, most of them rely on communication
link. In this work a localized/communication free signal generating mechanism is proposed. The mechanism injects the transient reactive power in frequency droop characteristics by observing the changes in microgrid. This injection dist...
Zawar Hussain Khan1*, T. Aaron Gulliver2, Khizar Azam3, Khurram Shehzad Khattak4
MACROSCOPIC MODEL ON DRIVER PHYSIOLOGICAL AND PSYCHOLOGICAL BEHAVIOR AT CHANGES IN TRAFFIC
...ant encompasses the perception, awareness, attitude, and reaction of a driver. The proposed model is evaluated for changes in traffic flow caused by an inactive bottleneck. The results are compared with those for the Payne-Whitham (PW) model. This shows that the temporal and spatial evolution of traffic with the proposed model is more realistic.
...
Sikandar Bilal Khattak1*, and Iftikhar Hussain1
ASSESSMENT OF ENVIRONMENT CONSCIENCE CONSTRUCTION PRACTICES IN PAKISTAN USING SIGNAL TO NOISE RATIO
...sp;like Pakistan. This paper identifies and quantifies the environmental conscience factors, respectively. The data is then analyzed through Taguchi Signal to Noise Ratio (SNR) to rank the factors. The results indicate that factors such as type of soil, which has some economic benefits or factors such as clean water, which are client requirements, are mostly considered, wher...
Shakil Rehman Sheikh1*, Zafar Ullah Koreshi1, Nouman Ghafoor1, Muhammad Shahid Khalil1, Muzzamil Ghaffar1
MITIGATING CO2 EMISSIONS OF ACADEMIC BUILDINGS IN PAKISTAN USING ENERGY CONSERVATION TECHNIQUES
... using an in-house developed metering device that recorded the electric consumption data on hourly bases. Building energy simulations were also carried out using TRNSYS© software for validating and comparing the actual energy consumed and optimal energy consumption resulting from building energy simulation of the existing and re-designed building. The
results highlighted that if the building had been designed ...
Shakir Azim1*, Sahar Noor1, Rehman Akhtar1, Qazi Salman Khalid1, Tufail Habib1, Usman Ghani2
SETTING OF PROCESS PARAMETERS AND EFFECT OF MOULD QUALITY ON SURFACE ROUGHNESS OF PHARMACEUTICAL CUP OF POLYPROPYLENE
... weight and quick for shape framing, along these lines making them more in vogue than the metallic products. As a result of mounting plastics applications, growing customer increased, the quality prerequisites of injection molded items have turned out to be progressively extreme. The setting and optimization of key process parameters are acknowledged as important means to deal with liven up the quality of the molded items. Inappropriate or ...
Altaf Hussain Rajpar1, Abdul Hameed Memon1, Mohammad Akram Shaikh2, Weimin Zhang3
HAND-EYE COORDINATION FOR OBJECT GRASPING TASK OF HUMANOID ROBOT (BHR-02)
...eye model was developed to adjust the position and orientation error for object grasping task. In the hand-eye model world coordinate system was set on right shoulder joint. The position and orientation of the hand was obtained through coordinate transformation from left eye coordinate system to end-effector coordinate system. The results presented in this paper justify the effectiveness of the proposed m...
Riaz Sayed1, Khizar Azam1, Waqar Shah1, Inayat Babar1, Hamidullah1, and Sahar Noor1
A REVIEW OF DRIVING UNDER THE INFLUENCE OF FATIGUE
...f highway crashes over rupees one hundred billion (over US$ 1.6 billion) for Pakistan. This paper provides a comprehensive review of the previous literature regarding driver fatigue and drowsiness research, the present state of research and the future trends. Various factors that may contribute to driver fatigue and drowsiness, Fatigue related countermeasures from various sources along with their merits are&nb...
Nisar Mohammad1, Mohammad Mansoor Khan1
RECOVERY OF TALC FROM TALC- CARBONATE SCHIST OF SWAT EMERALD MINES, NWFP, PAKISTAN
...nary investigations like petrographic study, grain size evaluation and chemical analysis were undertaken on talc bearing rock of Swat emerald mines, aiming at finding some suitable processing technique to recover talc. A few processing tests using flotation, gravity separation and leaching methods were conducted to see the amenability of talc to enrichment by these techniques. Analysis of seven talcum powder products available in the local ...
Asad Naeem Shah1,2, GE Yun-shan1, HE Chao1,3
MACROSCOPIC SPRAY CHARACTERISTICS OF DIESEL AND BIODIESEL-DIESEL BLEND: AN EXPERIMENTAL COMPARISON
...tify;">The qualitative aspects of the fuel spray particularly spray length and cone angle play a significant role not only in the temporal sequence of clean and efficient combustion, but also in the control of engine exhaust emissions and efficiency optimization. This paper investigates the effect of injection duration and ambient pressure on spray development, spray tip pen...
Abdul Shakoor1, R.A. Sayed2, Khizar Azam2
KNOWLEDGE BASE TECHNOLOGIES AS A NEW PARADIGM IN DATA DRIVEN MANUFACTURING SYSTEM
...>The maximization of prospects for substantial benefits and projecting the industry to fulfill the competitive needs in globally oriented business environment requires wide-ranging information based decision support system. The knowledge sharing framework requires an extensive research to improve inter-operatiability of cross-functional systems and subsequently provide the b...
Amjad Ali1, Hong Luo1, Khalid Saifullah Syed2, Muhammad Ishaq2
A PARALLEL DISCONTINUOUS GALERKIN CODE FOR COMPRESSIBLE FLUID FLOWS ON UNSTRUCTURED GRIDS
...omputing architectures, specifically considered cost effective compute clusters, composed of mass-market-commodity-off-the-shelf (M2COTS) computer hardware components interconnected via Ethernet. The parallelization is based on computational domain partitioning, making use of the well-known graph and mesh partitioning package METIS. Single Program Multiple Data (SPMD) message passing parallel programming model has been employed, by making u...
Adnan Tariq,1 Iftikhar Hussain,2 Abdul Ghafoor,3 Sahar Noor2
AN EVOLUTIONARY ALGORITHM FOR JOB-SHOP SCHEDULING
...;">It has been a general perception that the hardness level of job-shop scheduling problems is comparatively high and that is why effective, efficient and accurate procedures for scheduling are required to substantiate its usefulness. Therefore, in this paper a hybrid approach, primarily based on Genetic Algorithm (GA), is presented to handle the problem of scheduling job-shop that consists of m number of mach...
Iftikhar Ahmad1, Sahar Noor1
CHARACTERIZATION OF CERAMICS WALL TILES USING LOCAL TALC AS A FLUXING AGENT
...gradual increase in talc percentage which drastically boosted fired strength, stabilized thermal shrinkage, thermal expansion to an optimum level and controlled the excessive water absorption. All these properties variations are in favor of good and free of defects wall tiles. The use of talc indicated that a normal strength (200-220 kg/cm2) can be acquired using 20% talc even at lower tem
Laiq Khan1, Sidra Mumtaz2, Kamran Javed3, S.W. Shah4, M.I. Khan Babar5, S.R. Akbar6
GENERATORS MAINTENANCE SCHEDULING USING HARMONY SEARCH ALGORITHM
...economical and reliable operation of a power production system. This paper presents the application of harmony search (HS) algorithm for solving generators maintenance scheduling problem. HS algorithm is quite efficient, because, the convergence rate of this algorithm is very fast. HS algorithm is based on the concept of music improvisation process of searching for a perfect...
Arshad Ali1, Hashim Nisar Hashmi2
TREATMENT FEASIBILITY OF THE BLEACHING EFFLUENT OBTAINED FROM NSSC PULP AND PAPER MILL IN A UASB REACTOR
...ned from NSSC pulp and paper mill at mesophilic temperature and neutral pH. Methanol as a source of an easily biodegradable substance along with an activated carbon of effective size 1.5-2.5mm was added to the reactor R-I to evaluate its efficiency. It was observed that corresponding to an OLR of 2.14kg-COD/m3-day the overall COD removal efficiency of the reactors R-I and R-II was 83% and 64%, res
Farah Mahmood1, Mohammad Inayatullah Babar1, Syed Waqar Shah1, Hamid Ullah1, Riaz Akbar Syed1
GPS ASSISTED HANDOFF IN OVERLAPPING IPv6 WLAN WITH MULTIPLE CoA
...s delays. In this paper we present a unique approach for handoff when mobile node moves into a foreign network. We have utilized GPS (Global Positioning System) for gathering location information and multiple care of addresses handoff assistance.
...
Faizullah Mahar1, Syed Saad Azhar Ali1, Abid Karim1
DESIGN OF FIXED ORDER ROBUST CONTROLLER USING H∞ -NORM AND EVOLUTIONARY TECHNIQUES: COMPARISONS AND PERFORMANCE ANALYSIS
...ome this problem, this paper proposes the use of evolutionary techniques (i.e. genetic algorithm and immune algorithm) for the designing of a low, fixed order robust controller. To check the effectiveness of the proposed approach, resulting controller parameters are evaluated for performance analysis via extensive simulations. Simulation results and performance comparisons d...
Muhammad Naeem Khan Khattak1, Hamidullah1, Shehryar2
PROBLEMS, ANALYSIS AND RECOMMENDATIONS OF THE AUTOMOTIVE VENDOR INDUSTRY OF PAKISTAN—I
...ustry of Pakistan this paper presents very useful analysis and comprehensive recommendations for solution of major problems of the automotive vendor industry. The problems of automotive vendor industry are identified as a result of interviews with vendors of the industry. The problems of car vendors are divided into five major categories: processes/ operations, supply chain, resources, testing & quali...
Adnan Ali Khan,* and Shahrukh Khalid**
CAPACITY ESTIMATION OF SIMO SYSTEMS IN THE PRESENCE OF CO-CHANNEL INTERFERENCE
...-align: justify;">This paper presents a new approach for evaluating the performance of single-input multiple-output (SIMO) cellular mobile communication systems in interference limited environment. The performance is analyzed by calculating the ergodic capacity and hence the spectral efficiency for Rayleigh fading SIMO channel in the prese...
Arshad Habib Malik*, Aftab Ahmed Memon** and Muhammad Rafiq Khan***
DYNAMIC MODELING AND CONTROLLER DESIGN FOR NUCLEAR POWER PLANT
...d Heavy Water Reactor)-type nuclear power plant is presented in this paper. The nonlinear dynamic model of PHWR power reactor is developed based on reactor, logarithmic amplifier, moderator level control valve and reactivity system. The nonlinear model is characterized by 15 state variables and one input. This higher order nonlinear model is linearized at full power o
Muhammad Shaheen*, Muhammad Shahbaz*, Zahoor ur Rehman* and Sajid Mehmood*
A METHOD OF DATA MINING FOR SUSTAINABLE HYDROCARBON EXPLORATION
...d been agreed by world experts in a summit held in South Africa in 2001. These indicators will have different values for different countries depending upon the economy, energy reserves, living standards and social conditions. Depending upon these values, a methodology is proposed in this paper to find optimal hydrocarbon exploration rate t...
S.W. Shah*, M.I. Babar*, L. Khan**, M.N. Arbab*, H. Ullah*** and R.A. Syed***
RELIABLE MULTICAST IMPLEMENTATION IN JAVA
...-align: justify;">This paper describes the implementation of reliable group communication in Java. The underlying delivery mechanism for multicast is presently based on User Datagram Protocol (UDP) that provides a “best effort” delivery service. Best effort implies that IP packets are treated with essentially equal weight, and while IP makes an effort to deliver all packets to their destination, packets may occasionally be delayed, l...
Rafi Javed Qureshi* and Iftikhar Hussain**
INTERNATIONALIZING MANUFACTURING SMEs IN A DEVELOPING REGION: AN EXHAUSTIVE CDA-BASED EXPLORATORY APPROACH
...tyles of inward/outward operations is sought by innovative and risk seeking entrepreneurs. Exporting remains the dominant mode of internationalization and entry to foreign markets by SMEs in both developing and developed economies. When data on SMEs attributes and entrepreneur’s characteristic is categorical, single methodology to analyze factors influencing exporting are far from sufficient. A mult...
Rashidullah*, Irshad Ahmad**
SEISMIC HAZARD ANALYSIS OF ISLAMABAD
...an (NESPAK) for the period of (1505-2006) has been used. All Quaternary faults in the vicinity of Islamabad have been considered for deterministic hazard analysis. Seismic zoning map of NESPAK has been utilized in the research. Earthquake catalogue contains total of 11,149 events. Earthquake events of moment magnitude (Mw>4.0) are taken for developing the recurrence relationships of selected four (04) seismic source zones. The attenuatio...
Muhammad Waseem*, Irshad Ahmad**, Muhammad Asif Khan**
DETERMINISTIC SEISMIC HAZARD ANALYSIS AND SELECTION OF TIME HISTORIES FOR DYNAMIC ANALYSIS FOR A SITE IN SWABI
... a hundred thousand people and monitory losses of about five billion US dollars. After this earthquake, most of research activities were directed to define earthquake hazard. However, amongst other problems in those studies, one hard decision is the use of attenuation relationship as no such equation is developed for Pakistan. These studies either do not consider the newly develop...
Kadir Karakuş1, Turgut Aygün2, Şenol Çelik3, Mohammad Masood Tariq4*, Muhammad Ali4, Majed Rafeeq4 and Farhat Abbas Bukhari4
...(MARS). Effects of genotype and some environment factors such as birth type, dam age, lamb’ age in control and live weight on testis characteristics were also researched. The furthest importance sequence was obtained for testis length (TESLENG) (100%), followed by age, testis diameter (TDIA), age in control (DAGE), birth weight (BW), around scrotum (SCC), scrotum length (SCL) and birth type
Parakriti Gupta1, Kapil Goyal2 and Mini Pritam Singh3*
Hepatitis E Virus and Zoonosis
... in developing and developed nations. HEV is a single stranded RNA non-enveloped virus belonging to the family Hepeviridae. Globally, HEV is known to cause approximately 20 million infections per annum with a mortality of 44,000. The virus is endemic in developing nations and the outbreaks occur mainly in the post monsoon season when the drinking water g...
Zeeshan Ahmad Bhutta1,2*, Muhammad Fakhar-e-Alam Kulyar3*, Muhammad Shoaib4, Wangyuan Yao3, Muhammad Asif5, Shah Nawaz6, Moazam Ali7 and Ayesha Kanwal8
Exploratory Study on the Psychological Impact of COVD-19 on Students
...ort of online learning experience. Students were willing to join the volunteer force (82.3%) if they were asked in case of emergency. During COVID-19 outbreak, students should be provided individual social support and urge to obey the precautionary measures to avoid pandemic....
Mohammad Enamul Hoque Kayesh1,2*, Mohammad Tufazzal Hussan3, Md. Abul Hashem2,4, Mohammad Eliyas5 and A.K.M. Mostafa Anower1
Lumpy Skin Disease Virus Infection: An Emerging Threat to Cattle Health in Bangladesh
...rized by fever and the appearance of nodular lesions in the skin covering all parts of the body. LSD is currently endemic in many African countries and causing significant economic losses. LSD has recently spread out of Africa into the Middle East region, and still continuing to spread other territories of the world. In September 15, 2019 the first occurrence of LSD outbreak in Bangladesh has been reported to the OIE (World Organization for Animal Health). LSD...
Dibyendu Biswas1*, Shib Shankar Saha2, Shankar Biswas3 and Md. Abu Sayeed4
Outbreak of Lumpy Skin Disease of Cattle in South-West Part of Bangladesh and its Clinical Management
... questionnaire was developed and data were collected from the two upazila (Monirampur and Abhaynagar) at Jessore district. A total of 52 small house-holds and 183 cattle were observed the study period from 15 June to 15 August 2019. LSD was diagnosed on the basis of present clinical signs guided by the OIE manual. All data were analyzed by Epi Info 7 and SPSS statistical software. Analyzed data revealed that young female cat...
Mehwish Liaquat1*, Arshad Mahmood Malik1, Muhammad Ishaq1, Hafiz Muhammad Qasim Ashraf2 and Ismara Naseem1
...n: justify;">Tomato (Lycopersicon esculentum L.) is an important vegetable crop of Pakistan. Tomato is most edible and nutritious vegetable crop. The study was performed at the Institute of Hydroponic Agriculture PMAS Arid Agriculture University Rawalpindi to check the growth and germination behaviour of different tomato (Lycopersicon esculentum L.) varieties grown under hydroponic conditi...
Javed Iqbal1, Ali Zohaib1*, Muzzammil Hussain1, Iftikhar Ahmad1, Adnan Bashir1, Wardah Muzaffer2, Naeem Faisal1, Muhammad Tahir Latif1 and Sami Ullah1
...ion by fluctuation in temperature regimes during sowing season of crop. However, different varieties could differ in their potential for yield formation in response to sowing time. This 3-years study was conducted to ascertain impact of sowing dates on grain yield and critical yield component of different wheat varieties. Wheat varieties (Lasani-08, Faislabad-08, Millat-11, AARI-11 and Punjab-11) were sown on different sowing dates (November 01, November 15, N...
Markus I. Francis1*, Paul I. Ankeli2, Clara N. Kwanashie1, Jibril Adamu1, Lushaikyaa Allam1, Mashood A. Raji3, Godwin O. Egwu4, Flavio Sacchini5 and Massimo Scacchia5
Detection of Mycoplasma bovis from Cattle Presented for Slaughter in Adamawa and Taraba States, Northeastern Nigeria
...wa and Taraba States, respectively Samples were processed based on standard laboratory protocols. An overall Mycoplasma bovis isolation rate of 0.83% (4/480) was obtained. Based on the states studied, 1 (0.35%) and 3 (1.53%) M. bovis were isolated from Adamawa and Taraba States, respectively with an insignificant association between M. bovis infection and the states sampled (P>0.05). Based on organs/site sampled, 2 (5.40%...
Sikander Hiyat1, Nazim Hussain1, Muhammad Ishaq Asif Rehmani2*, Muhammad Nasir Abbas2, Smana Raza3, Javed Shabbir Dar4 and Tauqeer Ahmad Yasir5
...d. The present study was performed to investigate the effects of growth regulator (mepiquat chloride) and row spacings on growth and yield attributes of cotton. The experiment was conducted on randomized complete block design (RCBD) with split plot arrangement. Three levels of row spacing (25 cm, 50 cm, and 75 cm) were arranged in main plots, whereas, mepiquat chloride treatments (control, MQC0), mepiquat chloride 0.61 liter...
Hina Imtiaz1*, Salma Khalid2, Kashaf Riaz1, Muhammad Arshad Ullah3 and Zubair Rehman4
...the hazardous impact of open waste dumping on water quality and its subsequent effect on people living in the vicinity of Nullah Lai stream. Water samples were collected from different points of the stream and tested for basic parameters like color, odor and turbidity while EC, pH and TDS were checked on-site by portable water quality meter. The assessment of heavy metal concentrations i.e. Lead (Pb), Cop
Uzma Arif1, Sadar Uddin Siddiqui2, Muhammad Fareed Khan1, Muhammad Arshad3 and Shakeel Ahmad Jatoi2
...-ageing for different temperatures and incubation time during 2016 at Seed Preservation Laboratory, Bio-resources Conservation Institute, NARC, Islamabad. Forced seed ageing was carried out at 25, 30, 35 and 40°C for Day-one (D1) through day-six (D6) of incubation period. Observations were recorded for percent germination, shoot length (cm), root length (cm), fresh seedling biomass (g)...
Sinan Uzundumlu1, Yesim Buyukates1,*, Murat Yigit2, Musa Bulut2, Rıdvan Kaan Gurses1 and Barbaros Celikkol3
...dy was conducted in a copper alloy cage fish farm to observe the environmental properties of the marine system. Water quality parameters such as temperature, salinity, pH and dissolved oxygen, total suspended solids, chlorophyll-a and inorganic nutrients such as NO2+NO3, NH4, PO4 and SiO2 were observed between ...
Fang Liu*
...0 exerts concentration dependent functions in angiogenesis and hypothalamic axon guidance. At lower concentration of 100ng/ml, FGF10 promotes angiogenesis in chorioallantoic membrane endothelial capillaries (CAMs), but FGF10 does not alter the endothelial growth significantly at higher concentration (500ng/ml, P>0.05). Simultaneously, FGF10 exerts a graded action, at lower concentration FGF10 attracts both magnocellular and parvocellular axons; but at highe...
Ming-Yan Shi2, Xu-Liang Yan1, Ping-Ping Han1, Yu-Jie Tang1 and Hui-Xia Li1*
...ogy and the Kyoto Encyclopedia of Genes and Genomes database showed that these differentially-expressed miRNAs were involved in several pathways and were target genes that could regulate SMSC differentiation into adipocytes. Our study provided an overview of the expression profile of miRNAs, and demonstrated interactions between miRNAs and target genes, which improve our understanding of the important role that miRNAs play in SMSC adipogenic differentiation.
Muhammad Mazhar Iqbal1*, Ijaz Ahmad2, Shahzad Maqsood Ahmed Basra3, Abu Baker Ijaz4, Zahid Hassan Tarar5, Muhammad Ansar6, Umer Iqbal7, Tayyaba Naz4, Bilquees Fatima8, Muhammad Akram9, Allah Wasaya10, Asif Iqbal11, Shakeel Ahmed Anwar12, Khalid Saif Ullah Khan13, Azeem Khalid14, Asif Aziz15 and Rashid Mehmood16
...text-align: justify;">Temperature is a very important factor that affects crop yield. Maize, a monoecious plant, is adversely affected by high temperature during anthesis. Asynchronous fertilization and pollen desiccation reduce maize yield by reducing grain number and their size. Spray of hydrogen peroxide (H2O2), salicylic acid (SA) and ascorbic acid (AsA) may induce heat stress toleranc...
Ghulam Murtaza1, Ghulam Sarwar1*, Muhammad Ashraf Malik2, Muhammad Zeeshan Manzoor1, Ayesha Zafar1 and Sher Muhammad3
...n water of 3 different types (canal water and saline water of electrical conductivity values 2 and 3 dS m-1) were used alone and with farmyard manure (FYM) at 5 and 10 Mg/ha. This trial comprised of 09 treatments which were; T1 = irrigation of canal water, T2 = irrigation of EC 2 dS m-1 water, T3 = irrigation of EC 3 dS m-1 water, T4 = T1+ FYM at 5 Mg/ha, T5 = T2 + FYM at 5 Mg/ha, T6 = T3 + FYM at 5 Mg/ha, T7 = T1 + FYM at 10 Mg/ha, T8 = T2 + FYM at 10 Mg/ha a...
Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh
...odder oats variety developed at Fodder and Forage Research Program, National Agricultural Research Centre (NARC) Islamabad, Pakistan. This variety was selected from material imported from New Zealand for better agronomic characters and improved fodder yield. For initial two years (2006-07 and 2007-08) selections were made, and head-to-row method was used to reduce hetrozygosity. In 2009-10 and 20010-11, this line was evaluated in preliminary yield trials, wher...
Zahid Hassan Tarar1, Muhammad Salik Ali Khan2*, Shahzada Munawar Mehdi3, Raza Salim4, Irfan Ahmad Saleem1, Saima Nazar5, Munir David2, Tahir Majeed6, Muhammad Sufyan Mughal7, Muhammad Saleem8, Umer Iqbal9, Muhammad Mazhar Iqbal10 and Muhammad Khalid Shaheen3
...ution could be the site-specific nutrient management after assessing the micronutrient status at a particular site. This study was conducted to quantify and visualize the spread of plant available micronutrients in district Mandi Bahauddin. Total 1194 georeferenced soil samples were collected at a depth of 0-15cm maintaining a sampling grid cell size of 10-acres (40469 m2) throughout the sampling area. These samples were analyzed for plant available Zinc (Zn),...
Guang-Hui Tan, Yi-Yu Zhang*, Yuan-Yu Qin, Lei Wu and Jie-Zhang Li
...eostasis. This study was performed to investigate the effect of the polymorphisms of CYP7A1 gene on lipid traits in Tianzhu Black Muscovy (Cairina moschata). We detected two novel silent mutations, CDS 216 A>G and CDS 681 T>A in exon 2 and exon 3 of CYP7A1 gene, respectively, and both SNPs changed DNA single strand conformation. The A and T allele of CDS 216 A>G and CDS 681 T>A was dominant allele, and its...
Zakeer Ahmed Khan Abbasi* and Allah Nawaz
...ale and forms . In developed countries, climate change awareness is much advanced therefore, their climate change adaptations are also far better than those employed by farmers in the developing countries like Pakistan. The climate change awareness obviously determines the nature, quality and strength of climate change adaptations. The current study measures the impact of climate change awareness on climate change adaptation and climate change adaptation issue...
Matiullah Khan1*, Humera Arif2, Muhammad Rasheed2, Motsim Billah3 and Shoaib Ahmad1
...ce by preparing Single Super Phosphate (SSP). The spatial variation in minerology of Hazara RP might have an impact on the availability of phosphorus from these rocks. The experiment was therefore planned to revisit the formulation of SSP for various Hazara locations’ rock, for obtaining maximum available P. Three main locations’ rock phosphates; Guldania, Kakul and Paswal was collected and ground at 160 mesh lev...
Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu1
... soluble sugar, hydrogen peroxide (H2O2), malondialdehyde (MDA), ascorbate (AsA) and reduced glutathione (GSH), activities of superoxide dismutase (SOD) and peroxidase (POD) in leaves of ‘Hull Thornless’ were investigated. In the treatment group, water stress significantly increased EL, and the accumulation of photosynthetic pigments, protein, soluble sugar, H2O2 and MDA. After...
Roni Koneri1*, Meis Nangoy2 and Pience V. Maabuat1
...s of agricultural insect pests. Dragonflies can be used as bioindicators for evaluating environmental changes in long-term studies (biogeography) and short-term studies (conservation biology). This research study was aimed to analyse the composition and diversity of dragonflies in Tunan Waterfall area, North Sulawesi, Indonesia. Sampling was conducted from March 2018 to May 2018 at at three types of habitat, namely primary f...
Faruk Çolak1 and Ferhat Matur2,3,*
...ead drumming, to convey species-specific information. The lesser blind mole rats (Nannospalax sp.) are obligate subterranean rodents known for their remarkable chromosomal variation. In the present study, we investigated whether the structure of seismic signalling is different between the two species found in Turkey, Nannospalax leucodon and the N. xanthodon and whethe...
Magbolah Salem Helal Alzahrani
...here are many different species of chamomile, the two most common being German chamomile (Marticaria chamomilla) and Roman chamomile (Chamaemelum nobile). The use of chamomile has been associated with calming and anti-inflammatory properties. The plant’s healing properties come from its flowers, which contain volatile oils including bisabolol, bisabolol oxides A and B, ...
Mumtaz Ali Khan1, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Kashif Prince1*, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4, Asad Ullah5, Naimat Ullah4, Muhammad Shoaib2 and Said Sajjad Ali Shah2
...arkers in Clostridium perfringens (CP) infections in Balkhi breed of sheep in Khyber Pakhtunkhwa, Pakistan. Study was conducted on 184 sheep suspected of having enterotoxemia and 107 sheep were identified to be infected with Clostridium perfringens. Genotypic Analysis of all isolates from infected sheep was performed. Results showed, 53.27%...
Cheng Zhao1,2, Jianghong Ran2*, Bin Wang2,3, Qin Shi4 and Marwan M.A. Rashed1
...mmals in the world. The species has experienced declines in its habitat and population due to human disturbance. To protect this species, we investigated the relationship between giant panda habitat use intensity and human disturbance density in the Daxiangling Mountains. The results indicated that, among multiple kinds of disturbances, roads affected the giant panda habitat use significan...
Olga Mikhailovna Blinnikova1*, Vadim Anatolyevich Babushkin1, Lyudmila Gennadievna Eliseeva2 and Galina Severyanovna Usova3
Modeling a Formulation and Assessment of the Consumer Properties of the Special Purpose Starch Drink
...ation of the optimum recipes capable to provide the optimum level of adequacy of a complex of properties of foodstuff to the normalized sizes of contents macro and micronutrients, energy and requirements of the consumer. Using of a hydrolyzate of collagen as a component of the enriched foodstuff opens unlimited opportunities of production of the goods for functional, medical preventive and...
Syeda Farzana Bibi* and Siraj-ud-Din
Fluorescence Analysis, Extractive Values and Cytotoxic Screening of Crataeva adansonii DC Leaf and Bark through Brine Shrimp Larvae Assay
...in water (23% and 15% respectively) followed by methanol (15% and 6% respectively. The leaf part showed greater extractive values as compared to the bark. The cytotoxic study revealed that the ethanolic extract crude drugs of each part dose-dependently exhibited cytotoxic activity. At higher concentration (100-1000 μg/ml) the leaf and bark ethanolic extracts showed cytoto...
Kamran Ghasemi1*, Mostafa Emadi2, Asghar Bagheri3 and Mehdi Mohammadi1
Casing Material and Thickness Effects on the Yield and Nutrient Concentration of Agaricus bisporus
...ckness are so important operational steps in button mushroom production potentially leading to the variation in yields and nutritional characteristics of mushroom. Four casing layers comprising commercial casing soil (CCS), spent compost (SC), coco peat (CP) and vermicompost in three thicknesses (2, 4 and 6 cm) were evaluated in this study for production of Agaricus bisporus. The...
Waqar Majeed1, Naureen Rana1, Elmo Borges de Azevedo Koch2* and Shahla Nargis1
... estimated and study was performed on monthly basis for a whole year. The arthropods were collected by sweep net, direct hand picking, forceps. For each sampling day in each month, 20 sweeps were randomly taken in each block. The insects at rest or on shrubs were manually collected. Overall, 5867 individuals were recorded pertaining to 152 species. Among the arthropods collected from two f...
Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood4
...ld increment in yield respectively as compared to control. The use of these plant products at variant concentrations showed an increase of antioxidant activity by upgrading superoxide dismutase activity (64.42 U mg-1 protein), peroxidase activity (1.90 µmol min-1 g-1 protein), catalase activity (37.81 nmol-1 g-1 protein) and protein (6.28 mg g-1 fresh weight) contents. These commerci...
Mahak Fatima1, Memoona Syed1, Rabia Zeeshan2, Farah Rauf Shakoori3, Naveed Shahzad4, Moazzam Ali1 and Zeeshan Mutahir1*
... cells with MTH1 specific validated siRNA. Successful transfection of siRNA and consequent cytotoxicity in MCF7-R cells was confirmed by qRT-PCR, western blotting and cell viability assay. As a result of siRNA transfection, MTH1 protein was knockdown to approximately 77% in the transfected sample and resulted in a 1.75-fold increase in sensitivity of MCF7-R cells to gemcitabine. Moreover, higher expression of p21 protein was also observed in transfected...
Maryam Yousaf1, Naveed Shahzad2, Zeeshan Mutahir1 and Moazzam Ali1*
...d knockdown of Rab21 was performed. Results showed that the knocking down of Rab21 decreased the drug efflux ability of PC-3/Res cells, possibly by altering the surface localisation of MRP-1. These results suggest that interruption in MRP-1 trafficking to the plasma membrane by Rab21 is a potential strategy to overcome multi drug resistance in cancer cells.
...
Anum Feroz1, Abdul Rauf Shakoori2 and Farah Rauf Shakoori1*
...ions was studied on the specific activities of esterases in the 4th and 6th instar larvae of susceptible laboratory strain (Lab-S) and deltamethrin resistant population (GUW) of stored grain pest, Trogoderma granarium. After exposure to LC20 of bifenthrin, chlorpyrifos and their combinations of 3:1 and 1:3, the activities of total esterases, cholinesterase and carboxylesterase i...
Ayesha Noreen1, Amina Elahi1, Dilara Abbas Bukhari2 and Abdul Rehman1*
... 3.1S, isolated from pesticide industry effluent, showed maximum growth at pH 7 at 37 °C in LB medium after 24 h of incubation. The strain tolerated As3+ up to 40 mM and also showed resistance against Pb2+ (8mM), Cd2+ (6mM), Cr6+ (6mM), and Cu2+ (10mM). The arsenite oxidase is responsible for the conversion of arsenite (As3+) into arsenate (As5+) and the predominant form of ar...
Hamed A. Ghramh,1, 2, 3,Zubair Ahmad 1, 2, 4, Khalid Ali Khan1, 2, 3*and Farhat Khan4
...Characters of these new species and their affinities with related species are discussed.
...
Mah Jabeen and Amjad Farooq*
...font-size: small;">Four species of Brassica viz,. B. napus, B. juncea. B. compestris and B. rapa were studied for their relative resistance/susceptibility against aphids, under field conditions for three consecutive crop seasons i.e., 2009-2010, 2010-2011 and 2011-2012. The data on the incidence of aphids were recorded at weekly interval. Host plant susceptibility indices were also calculat...
Muhammad Khan1, Tehmina Ameer Khan1, Aziz Ud Din2, Muhammad Fiaz Khan1, Irfan Ullah3,*, Kalim Ullah4, Sadia Tabassum1,*
...le="font-size: small;">Hypertrophic cardiomyopathy is a condition in which the myocardial muscles become thickened without an apparent cause. It exhibits the prevalence of 1/500 globally. Eighteen samples from four families of maternally inherited HCM were collected, based on their clinical records. Three mitochondrial encoded genes 16S-rRNA (MT-RNR2), tRNAIle (MT-TI) and tRNALeu (MT-TL1) were targeted for analysis of mutation. Gen...
Zubair Ahmad1, 2,5, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Kavita Pandey4 and Farhat Khan5
...t-size: small;">Two new species viz., Chelonus (Areselonus) caeruleus sp. nov. and Chelonus (Areselonus) lithocolletiscus, sp. nov., are described as new to science from the northern part of India. These two species were reared from Acrocercops caerulea (Meyrick) and Lithocolletis virgulata (Lepidoptera: Gracillariidae). Materials about other sp...
Kui Li1, Lijun Li1, Jialun Fu2, Yi He2, Zhaohui Song2, Shuiping Zhou2, Luobu Gesang1* and Rui Liu2*
...day, during the research period. AMS was further diagnosed when headaches and LLSS≥ 3 were present. A total of 54 subjects completed the study and no significant difference was observed in the number of individuals with AMS between the groups. However, during the whole observation period, the LLSS values for comprehensive AMS symptoms in the group receiving CDDPs indicated lower occurrence than those in the placebo (CON) ...
Abdul Waheed*, Asim Faraz, Hafiz Muhammad Ishaq
...ched to highlight some aspects of this farming system prevailing in southern Punjab. For this reason data was collected from 30 households and was subjective to descriptive statistical analysis. The farmer’s family size averaged 6.4±1.6 with average monthly income of Rs. 14322.6±3026.4. These rural household had on the average 11.4±4.5 hens, 2.1±1.1 cocks, 6.9±4.5 chicks, and 4.5±3.4 laying hens. Majority of them...
Murtaza1, Syed Attaullah Shah1*, Shahid Ali1, Amjad Ali1 and Asia Baig2
Economic Analysis of Maize Production in Central Khyber Pakhtunkhwa, Pakistan
...mal education, farming experience and level of involvement in agriculture and combined family structure as important factors significantly reducing inefficiency in maize production. The study recommends formal education and agricultural training for maize growers, provision of subsidy for hybrid seeds and chemical fertilizers and price support for their produce during harvest season....
Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1
Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...fy;">Twenty seven plant species of the Papilionaceae were collected from Dir Upper, with elevation ranges from 1200-4000 meters during 2015-2017. They were taxonomically determined with the help of key characters, the uses of these native plants were recorded such type of study was concluded for the first time in the selected area of Dir (Upper). In view...
Muhammad Rizwan1*, Bilal Atta1, Ana Maria Marino de Remes Lenicov2, Roxana Mariani2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Misbah Rizwan4, Muhammad Sabar1, Ch. Muhammad Rafique1, Muhammad Afzal5
...l;">Diversity of planthoppers and their host plants were studied in the “Kallar” tract of the Punjab, Pakistan (an important growing area of the world for producing Basmati rice). Planthoppers are considered the most important pests of rice. Delphacidae and Cixiidae are families of planthoppers with the most harmful s
Shagufta Parveen1*, Kousar Perveen1, Muhammad Afzal1, Syed Amir Gilani2, Muhammad Musadaq3
...t or guardian of each respective infant and recorded in the questionnaire. Weight and height of each infant was measured in kilograms and cm, respectively, and recorded. Data was entered in SPSS version 26 and analyzed for results. A total of 200 infants were included in the study, of which 94 (47%) of infants were less than 6 months old, and 106 (53%) were 6-12 months old. 102 infants (51%) were male and 98 (49%) were femal...
Erum Bughio1, Ahmed Sultan Jatoi1*, Jibran Hussain2, Muhammad Hayat Jaspal3, Shahid Mehmood2, Hafiz Muhammad Ishaq4, Reema Bughio5 and Athar Mahmud2
Comparative Study of Carcass Traits in Four Strains of Japanese Quail (Coturnix japonica) at 3 to 6 Weeks of Age
...-align: justify;">This experiment was designed to evaluate the carcass characteristics of 4 different strains of Japanese quails at 3 to 6 weeks of age. In total, 2160 quail chicks were studied with 108 experimental units of each 20 chicks were applied. Birds had free access to clean and fresh drinking water through automatic nipple drinkers all the times. There was a provision of ad-libitum broiler-quail ration feeding as <...
Oluwatoyin Olagunju1* and Luqman Abiodun Akinbile2
Farmers Perceptions of the Effect of Rural Transportation Systems on Farming Income in Ondo State, Nigeria
... This study examined the perceived effects of rural transportation systems on farmers’ income in Ondo State, Nigeria. A structured interview was used in eliciting information from 120 farmers in rural communities across the two local governments in the study area using a two-stage random sampling technique. Data used for the study were analyzed using descriptive statistics and inferential statistics such as chi-square and Pearson Product Moment Correlati...
Tehmina Aslam, Shagufta Saeed*, Muhammed Tayyab, Huma Mujahid, Ali Raza Awan, Sehrish Firyal and AbuSaeed Hashmi
...ical parameters was also performed. Highest yield of PHB was obtained by fermentation of 4% (w/v) wheat bran after 48 h of incubation with 4% (v/v) inoculum volume at pH 7.0 and 37oC. Among different nitrogen sources tested, 0.2% peptone gave the better yield (285 mg/100 mL), while yeast extract decreased the amount of PHB. The outcomes of the present data indicate that agricultural wastes can be used for the prod...
Jam Nazeer Ahmad1,*, Samina J.N. Ahmad1,2,*, Mubashir Ahmad Malik1, Abid Ali1, Muhammad Ali3, Ejaz Ahmad1, Muhammad Tahir2 and Muhammad Ashraf2
... as short horned grasshopper is one of the most dangerous agricultural pests worldwide. There are various important species of large swarms forming of desert locusts found in different regions of the world. In early 2020, in Pakistan, huge swarm of desert locust infestation was observed in different provinces of Pakistan. Precise and correct identification of any p...
Zhi Yijin, Shao Mingqin* and Li Quanjiang
...sed. A total of 38 bird species, including 4 class I and 3 class II Chinese nationally protected bird species were identified. Of six habitats, 64% (15,435 individuals) of the total number of wading birds counted occurred in water-covered areas. The common crane Grus grus has the widest habitat niche (0.727), utilizing grasslands and farmland after crops were harvested, where it ate vegetation (roots) or seeds. Shoreb...
He Wenyun, Zhi Yijin and Shao Mingqin*
...dicated that water flow speed, distance to village, river width, vegetation cover, distance to mine factory and shoal proportion were the main factors for habitat selection. The results suggested that safety was the primary factor in habitat selection. The main foraging method was up-ending (61.54%); the duration of each up-ending foraging behavior was 1.92±0.83 s and foraging frequency was 14.67±4.43 times/min. This foraging strategy may be dete...
Gregory Ejikeme Odo1,*, Juliana Ekenma Agwu1, Nkechi Nweze2, Clara Ikegbunam2,Felicia Ekeh N1, Vincent Ejere1, Ngozi Ezenwaji1, Reginald Njokuocha2, Godwin Ngwu1 and Fabian Okafor1
...ce between control and experimental groups. Group A served as control in which no leaf extract was administeredwhilegroupsB,Cand Dwere
Tao He1,2,3, Cheng-jing Chen4, Jian-guang Qin3, Yun Li1,2, Rong-hua Wu1,2 and Tian-xiang Gao4,*
...variation of sagittal shapes to discriminate L. haematocheilus stocks. The sagitta variation of five L. haematocheilus stocks was examined using nine shape indices (Roundness, Circularity, Form-factor, Rectangularity, Ellipticity, Radius ratio, Feret ratio, Aspect ratio and Surface density). Multiple comparisons on shape indices show...
Andrei V. Tanasevitch1 and Yuri M. Marusik2,3,4,*
...ont-size: small;">A new species, Carniella nepalensis sp. n., is described from eastern Nepal. The male of new species is most similar to C. forficata (Gao and Li, 2014) and clearly differs by the shape of the embolus. The type locality of new species is northwesternmost for the genus in Asia.
Honghai Zhang1,*, Yao Chen1, Xiaoyang Wu1, Shuai Shang2, Jun Chen2, Jiakuo Yan1, Qinguo Wei1, Xibao Wang1, Yongqiang Lu3 and Huanxin Zhang2
...important role in animal performance and the environment. We collected fresh feces of the Tibetan wild ass (Equus kiang) from the Jinan Wildlife World and Qinghai - Tibet Plateau Wild Animal Park. And we divide the sample into Group A (the low altitude area) and Group B (the high altitude area). we studied the basic structure of the gut microbiota by sequencing high throughput sequencing of the 16S rRNA gene V3-V4 hype
Shouguo Yang1, Fen Cheng1, Xiangyu Wu1, YiXuan Xing1, ZhiFeng Gu2 and Xianming Tang1,*
...t times throughout the experimental period. The length-weight relationship can be expressed as Wt = 0.0734×SL2.7817 (R2 = 0.9924) and width-weight can be expressed as Wt = 0.5763×SW3.036 (R2 = 0.974). The correlation coefficients between morphometric traits and total weight reached the significant level. With the increasing of a...
Fei Wang1, Xianlai Zhang1, Youbao Zhong2, Xiaoen Tang3, Xiaofen Hu1,
ShanShan Yang1, Shengwei Zhong1, Zuohong Zhou1, Jin Liu1, Xu Yuan1
and Yong Li1*
...ts vasoactive intestinal peptide (VIP) was detected by immunohistochemistry staining and RT-qPCR. In present results, the intestinal mucosa epithelium is a single layer of columnar epithelium, other structures are relatively complete, and the intestinal villi and glands are distinct in each part of intestine. The localization of VIP is extensive in the intestinal wall, but most typical in the lamina propria and muscular layer; VIP in mucosal epithelium is main...
Muhammad Jan1*, Tanveer ul Haq2, Hina Sattar3, Madiha Butt4, Abdul Khaliq5, Muhammad Arif6 and Abdul Rauf7
...ns like heat waves, dry spell, sustained drought and precipitation adversely reducing the crop productivity and these are considered as an alarming issue for the crop production in rainfed areas. Chick pea is deemed to be regarded as a drought sensitive crop. The low water and fertilizer demand and its ability to grow on marginal land is an excellent choice for the farming community. The field trial was conducted with the as...
Muhammad Riaz Gondal1,2*, Aqib Riaz4, Sultan Ahmad Rizvi2, Bushra Zulfiqar2, Waqas Naseem2, Humara Umar3, Ahmad Hussain1 and Mazher Iqbal3
...ium, C. dactylon, S. halepense, B.decufeedipedia.org. and P. hysterophorous) in multi-cut sorghum sudan grass hybrid (S.S. Hybrid). Four herbicides namely Clodinafop-propargayl (Clodinafop) @ 0. 25 and 0.375 kg ha-1, Paraquat and Glyphosate @ 1.5 and 2 L ha-1 and Fenoxaprop-p-ethyl (Puma super) @ 1.0 and 1.5 L ha-1 were applied on Pak Sudac variety of S. S. Hybrid and compared their contro...
Amar Iqbal Saqib1, Khalil Ahmed1*, Abdul Rasul Naseem1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Muhammad Khalid2, Imtiaz Ahmad Warraich3 and Muhammad Arif4
...ring the deteriorated properties of salt-affected soils. For addressing this objective, a study was undertaken to investigate the ameliorative effect of humic acid (HA) with gypsum on rice-wheat crops under saline-sodic condition (ECe = 4.71 dS m-1, SAR = 31.82, pHs = 9.10). Different combinations of gypsum and humic acid tested were: T1 - control, T2 - gypsum @ 100 % GR, T3 - gypsum @ 75 % GR+ HA @ 15 kg ha-1, T4 - gypsum @ 75 % GR+ HA @ 30 kg ha-1, T5 - gyps...
Shikun Ge1, 2, Yanli Yang3, Brindha Chelliappan4, 5, Antonysamy Michael5, Fagang Zhong1 and Xiaoying Zhang1, 2, 3, 4*
...esistance to trypsin and pepsin, four different IgY purification methods (PEG extraction, water dilution method, the effect of liquid egg yolk and egg yolk powder preparations) on the activity of IgY antibodies was investigated. The results showed that IgY was stable below 70 oC, and the activity was significantly lost when it exceeded 70 °C; IgY was relatively stable in the...
Feng-Mei Yang1, Rui Li2, Xiu-Xue Hu3, Yong Liang4, Bo Gao3* and Wei Chen3*
...ificant dose- and time-dependent effects of UVB. UVB treatments inhibit cell growth and promote apoptosis in a dose-dependent and time-dependent manner, and high level as well as prolonged UVB irradiation lead to NHSFs senescence.
...
Ashfaque Ahmed Nahiyoon1*, Nasira Kazi2 and Shahina Fayyaz2
...all;">A new and a known species belonging to the family Belondiridae are described from Sindh, Pakistan. Amphibelondira sindhicus n. sp., is characterized by having reduced anterior genital branch, more slender body, smaller neck length and expanded part of pharynx, smaller spicule and clavate tail with distinct radial striae. Belondira paraclava Jairajpur, 1964 is reported for the first time from Pakistan during the present studies on cotton.
Aribah Naz1*, Uzma Badar1,Afsheen Arif2*, Zaid Qureshi1, Sondas Saeed1,Erum Shoeb1, Maqsood Ali Ansari1 and Obaid Yusuf Khan1
...bream fish.Isolation, temperature optimization for growth and luminescence, growth curve, MTC for heavy metals and antibiotics were determined. Morphological, Biochemical and 16S ribosomal RNA gene sequencing have been done for the identification of the strain. 16S region was amplified by PCR and subjected to DNA sequencing. The sequence data analysis of the isolated strain showed 98% homology with Vibrio harveyi spe
Safia Arbab1, Rehana Buriro1, Shams Uddin Bhugio1, Atta Hussain Shah2, Jamila Soomro3,Qudratullah Kalwar4, Saqib Ali Fazilani1 and Waseem Ali Vistro5*
...were used. During this experiment, total 50 wound samples were collected from donkey wounds. All 50 samples were found contaminated with different bacterial organism, among all those 45, 35, 33, and 25 were recorded positive for S. aureus, E. coli, Shigella and Salmonella spp respectively. However, out of 50 sample, 34 (68%) were found to have different bacterial species and ...
Sumaira1, Syed Mohsin Bukhari1, Maqsood Iram2, Arshad Javid1, Ali Hussain1, Waqas Ali1, Khalil Ur Rehman3, Shahla Andleeb3, Irfan Baboo4 and Nimra Khalid1
...ndian rock python. Ten experimental animals were observed in captivity and it was noted that ecdysis was more rapid during summer compared to winter. Furthermore, ticks and mites were recorded during both the seasons while internal parasite species belong to genus Pseudomonas, Staphylococcus and Streptococcus were recorded from Python molurus. Higher temperature...
Duo Jing Qiu1,2,3, Xin Yu1,2,3, Mao Jun Zhong1,2,3 and Long Jin1,2,3*
...leads to variation in temperature, food availability and duration of breeding season in amphibians. Here, we examined differences in somatic condition and testis mass of male Duttaphrynus melanostictus distributed in two altitudes (120 m and 1673 m above sea level) in Hunan and Yunnan Province, southwest China. We found that D. melanostictus displayed significant differences in body mass and relative testis mass between low- and high-altitude pop...
Zengwen Huang1,2, WuReliHazi Hazihan2*, Baheti Bodai2, Kadyken Rizabek3, Nuralieva Ulzhan3, Omarova Karlygash4, Juan Zhang1 and Yaling Gu1*
...Hα on the breeding performance of YM sheep, providing a novel strategy to improve their reproductive capacities.
...
Huma Abbas1*, Nazir Javed1,Muhammad Kamran2, Sajid Aleem Khan1, Hira Abbas3, Ehetisham-ul-Haq2, Abdul Jabbar1, Mehwish Naz1 and Ihsan Ullah4
... portion (93.7, 80.7) respectively. In soil drench treatment, a significant higher reduction in the nematode reproduction parameters was observed in all the chemicals as compared to root dip method. Efficacy of all the chemicals was also tested in microplots already infested with nematode. Significant suppression in nematode population was observed in all the tested chemicals when applied in infested microplots. The results of the present investigation suggest...
Yan Zhou1,2, Hai Xia Han1,2, Qiu Xia Lei1,2, Jin Bo Gao1,2, Wei Liu1,2, Fu Wei Li1,2, Jie Liu1,2 and Ding Guo Cao1,2*
... in chickens, the haplotypes and diplotypes based on three genetic mutations (NC_006127.2:g.8467G>A, NC_006127.2:g.12321G>A and NC_006127.2:g.13876A>G) were constructed, and the associations of diplotypes with reproduction traits were assessed, their effects on gene expression were evaluated also. As a result, three haplotypes H1 (G-G-A), H2 (G-...
Arifa Khan1*, Danish Anwar2, Shazia Erum3, Naveeda Riaz1, Shahid Riaz4, Tariq Rafique3 and Zafer Iqbal2
Screening of Exotic Potato Germplasm against Potato Virus PVX, PVY and PLRV through Biological and Serological Test (ELISA)
..., 30 exotic potato genotypes were screened against the PVX, PVY and PLRV in field conditions during two seasons 2015-2016. Results showed that all the genotypes had resistance against PVX and PLRV however four genotypes (CIP-3, CIP-9, CIP-11 and CIP-14) were susceptible to PVY. Results regarding yield and tuber external quality showed that CIP-30 was taller genotyp...
Shahzad Malik* and Ayesha Khan
Gap Analysis of Farmers’ Capacity Building by Public and Private Agriculture Extension Sectors in Central Plain Valley of Khyber Pakhtunkhwa, Pakistan
...nces V.20 (SPSS). Simple percentages and percentages were calculated whereas paired t-test was applied to compare gap/differences between capacity building of farmers offered by public and private extension services. It was found that the respondents praised private sector in capacity building regarding farm management (59.2%), selection of varieties (54.4%), selection of fertilizers (56.3%), and harvesting techniques (57.4%...
Muhammad Ismail1, Tufail Ahmad2, Shamsher Ali2*, Shahid Ali1, Nur Ul Haq1 and Naveedullah3
Heavy Metals (Pb and Ni) Pollution as Affected by the Brick Kilns Emissions
...3.11 and 14.7 mg kg-1 respectively. The concentration of Pb and Ni at this stage is not in toxic range however with the continuous addition may pose a severe threat in future. Similarly, soil sample analysis revealed AB-DTPA extractable Pb and Ni for chimney A and B as (0.11- 0.13, 14.2 and 15.0 mg kg-1) respectively. Here again the Pb and Ni do not show toxicity, yet it cannot be ignored for future with
Debunking Myths about COVID-19, Paranoiac Misconceptions, Recent Developments and its Current Stance
Zumama Khalid1, Muhammad Abrar Yousaf2, Abeedha Tu-Allah Khan1, Farah Rauf Shakoori2, Muhammad Munir3 and Abdul Rauf Shakoori1*
...nformation about every aspect of this disease as possible. Also, a clear difference is prevalent in different regions of the world about the rate of deaths and survivals. Therefore, the current comprehensive review has been written in view of all these aspects so as to present a complete picture of where the world stands, how can the disease be coped, what myths have been develo
Zubair Ahmad1, 2, 4, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Farhat Khan4 and Shujauddin5
... best examples of inter-specific mutualism between species that produces net benefits for the participants. In this paper, the interaction between aphid M. sacchari and their attending ants on sugarcane (Saccharum officinerum) was studied. The presence of ants, especially, Crematogaster subnuda Mayr. and Camponotus compressus ...
Yan Wen1, Liu Lian2, Zhuang Xun3, Murong Jiaying4, Cui Shuyi1, He Wanwen1, Mai Guanghuai5, Huang Wenzhu1, Chen Gang1,* and Wang Zhijun1,*
...r rehabilitation program performed in a garden setting for elderly patients affected with chronic obstructive pulmonary disease (COPD). The elderly patients suffering from COPD were randomly divided into an observation group (n=30) and a treatment group (n=30). Accordingly, the patients in the observation group were given a medication-assisted treatment plan for stable COPD based on established guidelines and indoor rehabilitation training for pulmonary functi...
Ishrat Perveen1, Yasar Saleem2 and Javed Iqbal Qazi3*
...high proteinaceous food specifically in cooked meats is a point of great concern for the health risk factor of Pakistani community. Ready-to-eat (RTE) chicken kabab samples of four commercially available brands (K, S, D and B) were analysed for the simultaneous determination of HCAs i.e. 2-amino-3-methyl-imidazo[4,5-f] quinoline (IQ), 2-amino-3,8-dimethylimidazo [4,5-f] quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenylimidazo [4,5-b] pyrid...
Aamir Khan1, Rabia Noushin2, Mohammad Attaullah3, Shahid Naiz Khan1, Rafiqe Hussain4, Farman Ullah Dawar1, Faiz Ur Rehman1, Muhammad Ijaz1 and Kalim Ullah1*
...ected from clinically suspected cattle in span of one year. All blood samples were examined through microscope. Overall incidence of babesiosis was 54.80%.B. bovesshowed high prevalence (35.46%) than B. bigemina (19.33%). Females were more prone as compared to male cattle for both B. bovesandB. bigemina. Cattle having age less than two years showed high positivity for bothB. boves (4...
Israr Yasin1, Ismail Qureshi1*, Shahjahn Qaimkhani1, Gulam Mustafa Solangi3, Ismail Qaimkhani1, Ismail Brohi1 and Abdul Ahad Soomro2
A Perspective on Household Dairy Farming in District Naushahro Feroze, Sindh, Pakistan
...hold dairy farming with special reference to management of livestock, milk production and marketing as well as role of livestock in household income in district Naushahro Feroze of Sindh-Province Pakistan. Six hundred households were selected from 40 villages in four out of nine Talukas (administrative units) using multistage clustering method. Estimates of the study revealed that 54% of the households possessed buffaloes. Average number of buffaloes was estim...
Muhammad Qaisar Nawaz1, Khalil Ahmed1*, Ghulam Qadir1, Amar Iqbal Saqib1, Muhammad Rizwan1, Muhammad Faisal Nawaz1 and Imtiaz Ahmad Warraich2
Impact of Fertilizer and Planting Geometery on Garlic (Allium sativum L.) Yield in Saline-Sodic Soil
...aline environment. The experimental design was split-plot with three repeats. Three planting geometry (10cm x 20cm, 15cm x 20cm and 20cm x 20cm) and four phosphorus levels i.e. (i) control (no phosphorus), (ii) P (60 kg ha-1) recommended dose (RD), (iii) 125% P of RD (75 kg ha-1) and (iv) 150% P of RD (90 kg ha-1) were used. Observations included were; plant height, bulb mass, bulb diameter, cloves bulb-1 and bulb yield. Dat...
Muhammad Yaseen1*, Syed Amir Zia Abid1, Muhammad Luqman1, Syed Wasim Hasan2, Muhammad Aqeel Pitafi3, Muhammad Tariq Chaudhry4 and Muhammad Ameen5
Training Needs Assessment of Training Professionals Working in Agricultural Training Institutes in Punjab, Pakistan
...ssionals affecting their performances. Collected data were analyzed with the help for SPSS, results revealed that majority of the were included training professionals did not get any training at national/ international level. Moreover, they were facing many constraints, which affect their performance like limited of financial resources and lack of linkage with research. The most emerging training needs were; recent developme...
Muhammad Ahsan Naseer1, Mehdi Maqbool1, Saima Rafiq2*, Noosheen Zahid1, Abdul Hamid1 and Syed Zulfiqar Ali Shah1
Comparative Analysis of Physical and Biochemical Attributes of Edible Fig (Ficus carica L.) Collected from Three Districts of Azad Jammu and Kashmir Located at Different Elevations
...l as well biochemical properties. Maximum fruits weight (6.24 g), fruits diameter (24.09 mm), and neck length (9.51 mm) was observed in fruits harvested from Arja location of Bagh District, while the minimum fruit weight (2.48 g), fruit diameter (16.69 mm), and neck length (2.81 mm) was observed in fruits harvested from Khoiratta location of District Kotli. Similarly, in terms of biochemical quality attributes, maximum titratable acidity (0.30 %), total solubl...
Amir Afzal, Muhammad Ijaz and Sayed Rashad Ali Shah*
Determination of Suitable Growth Stage for Application of Fungicide against Stripe Rust in Wheat
... grain in the world. Stripe rust (Puccinia striiformis f. sp. tritici) of wheat is severely detrimental disease. Improvement of crop through incorporation of resistance is practiced enormously. However, a wheat variety that has been recommended for cultivation may not remain resistant for long because of fluctuating nature of pathogen. Therefore, an alternative management strategy to control diseases is application of suitable fungicide at appropriate growth s...
Khalil Ahmed1*, Amar Iqbal Saqib1, Abdul Rasul Naseem1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Muhammad Khalid2, Imtiaz Ahmad Warraich3 and Muhammad Arif4
Use of Hyacinth Compost in Salt-Affected Soils
...ving the deteriorated properties of saline-sodic soil. Treatments included were; T1, control, T2, gypsum @ 100 % GR, T3, gypsum @ 50 % of GR, T4, hyacinth compost @ 15 t ha-1, T5, gypsum @ 50 % of GR + hyacinth compost @ 5 t ha-1, T6, gypsum @ 50 % of GR + hyacinth compost @ 10 t ha-1, T7, gypsum @ 50 % of GR + hyacinth compost @ 15 t ha-1. At start of study, soil had pHs (pH of soil saturated past) = 8.91, SAR (sodium adsorption ratio) = 44.24, ECe (electrica...
Adnan Arshad1*, Huma Qamar2, Ristina Siti-Sundari3, Zhang Yue1, Muhammad Zubair2, Muhammad Ali Raza4, Muhammad Habib-ur-Rehman5 and Lizhen Zhang1*
Phenotypic Plasticity of Spineless Safflower (Carthamus tinctorius L.) Cultivars in Response to Exogenous Application of Salicylic Acid under Rainfed Climate Conditions
...ged droughts, rise in temperatures, and erratic rainfall are common factors affecting crop productions in rainfed areas worldwide. This research intended to identify spineless Safflower (Carthamus tinctorius L.) performance in acclimating changing climate, as safflower has gained prominence as an oilseed industry due to its hardiness in nature. A two-factor factorial experiment using compl...
Shereen Zulfikar1, Zulfikar Ahmed Maher2, Attaullah Khan Pathan4, Imran Ali Rajput3*, Din Muhammad Soomro1, Muhammad Akbar Lashari1, Arsalan Memon3, Sibghatullah5 and Mir Zehri Khan5
Population Fluctuation and Weight Losses Caused by Khapra Beetle, Trogoderma granarium Everts on Different Wheat Varieties
...an be avoided through proper control measures and selection of resistant varieties. During the present study, the different wheat varieties were screened against T. granarium. The initial weight of healthy grains of each variety was recorded properly. The losses caused by pests were categorized on the basis of grain weight loss (%), powder weight (mg) and population of
Ummad ud Din Umar1, Syed Atif Hasan Naqvi1*, Ishfaq Ahmed1, Ateeq ur Rehman1, Muhammad Asif Zulfiqar2, Sibghat Ullah3, Shah Pasand4, Zehri Khan3 and Abdur Rehman5
Prevalence and Serological Detection of Spiroplasma citri, a Cause of Citrus Stubborn Disease in Southern Punjab, Pakistan
...d “5.66%” respectively while least incidence was observed in District Bhakkar (03%) and District Khanewal with (02%) incidence. Sweet orange and grape fruit depicted themselves as susceptible ones showing maximum disease with “18.33” and minimum “02%” respectively. Kinnow mandarin and feutral’s early appeared as ...
Iram Bilqees1, Yasir Iftikhar1, Mustansar Mubeen1,2*, Qaiser Shakeel3, Ashara Sajid1, Zahoor Hussain4, Aqleem Abbas2, Muhammad Aamir Sohail2, Judith Jeruto Kiptoo5 and Shehzad Iqbal2
Use of Nutrients and Plant Extract to Manage Okra Yellow Vein Mosaic Disease (OYVMD) in Sargodha, Punjab, Pakistan
... and 9.05±1.06 respectively, as compared to control. These two treatments also reduced the disease severity with the mean value of 1.23 ± 0.12 and 2.00 ± 0.21 respectively. In conclusion, the cultivars Indian Rachna were resistant to OYVMV and its vector. The growers are advised to apply micronutrients along with the plant extracts to control these diseases to enhance the okra production....
Kanwar Muhammad Raheel Mehboob1, Rashid Iqbal2*, Muhammad Israr3,4, Jaweria Shamshad5, Umair Riaz6, Muhammad Habib-ur-Rahman7,8, Fawad Ali9, Arif Nawaz10, Maliha Sarfraz11, Abdul Waheed12, Muhammad Tahir Khan13 and Muhammad Aslam2
Assessment of the Consequences of Heat Changes on Cotton Cultivars Growth, Phenology and Yield at Different Sowing Regimes
...text-align: justify;">Temperature is the main climatic factor that influences the yield just as entire development of farming crops. All periods of phenology of crops are temperature sensitive. Hence, information on appropriate temperature for best yield is significant so as to get maximum production. In current examination, a field test was directed to ...
Olugbenga Omotayo Alabi1*, Ayoola Olugbenga Oladele2 and Ibrahim Maharazu3
Profitability Analysis and Marketing Efficiency of Soyabean (Glycine max) Value Chain among Actors in Abuja, Nigeria
...This study was designed specifically to achieve the following objectives: describe the socio-economic characteristics of soyabean marketers, determine the marketing cost, marketing margin, and marketing efficiency of soyabean, analyze the costs and returns of marketing soyabean, evaluate factors influencing or affecting marketing efficiency of soyabean, and identify problems or constraints influencing marketing of soyabean. Data obtained were collected from on...
Hafsa Naheed* and Hidayat-Ur-Rahman
Genotype by Environment Interactions of Vegetative Growth Traits of Bread Wheat Genotypes
...ning the amount of genotype by environment interaction (GEI) is an important step in identifying high yielding and stable genotypes for cultivar development. Keeping in view the significance of genotype and environment, a multi environment study was conducted to evaluate the response of genotypes to different cropping systems and environments. The
Abid Khan*, Mukhtar Alam, Yousaf Jamal and Hidayat Ullah
Appraisal of Yield and Yield Components of Wheat with Integrated Management of Nitrogen Sources
...op productivity. Field experiments were conducted to evaluate the effect of integrated management of nitrogen sources on yield and yield components of wheat at Agricultural Research Station Buner, Khyber Pakhtunkhwa, Pakistan during 2015-16 and 2016-17. Experiments were laid out using RCBD with 3 replications. Winter wheat variety Pirsabak-2015, as a test crop, was sown on 12th November at same piece of land following same r...
Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3
Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
...xt-align: justify;">Chickpea is the most important pulse legume that serve as dietary protein source for poor farmers in the developing countries. Yield and production severely challenged by biotic stresses. Wilt complex is the major biotic factor that contribute significantly in yield loss. Wilt complex is caused by various pathogens, including diverse type of Fusarium species. Molecular ...
Malik Muhammad Yousaf1, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahmad1, Rao Wali Muhammad1, Sami Ullah2, Adeel Abbas3, Ijaz Ahmed4 and Muhammad Zeshan5
Effect of Balance Use of Fertilizers on Performance of Wheat Under Arid Climatic Condition
... and productivity. The experiment comprised of 10 treatments. The results showed that compared with control, addition of nutrients significantly increased plant height and the highest plant height (86.5 cm) was observed at 86:58:62.5 kg NPK/ha treatment. Maximum tillers/plant (3.1), spikelet’s/plant (2.9), and spike length (8.9 cm) was found in 86-58-62.5-3 kg NPK + Zn/ha treatment. Furthermore, highest grains/spike (83.4), 1000 grain weight (4.3 g), and...
Talib Hussain Solangi1, Bhai Khan Solangi1*, Muhammad Saleem Sarki2, Muhammad Akbar Lashari1, Mubeena Pathan3, Velo Suthar4, Barkatullah Qureshi4, Mitha Khan6, Razzak Amin Shah5 and Aeman Afzal6
Varietal Preference of Sucking Insect Pests on Mustard Varieties, Sindh, Pakistan
...t-align: justify;">The experiment was conducted at experimental field of Entomology Section, Agriculture Research Institute, Tandojam during the season 2017-18. Using eight mustard varieties such as S-9, Sindh Raya, P-21, Early Raya, Bard-2, P-4, P-78 and Toria Selection to compare the resistance of varieties against sucking insect pests, and To compare the yield of Mustard varieties. The ...
Safina Naz1, Syed Atif Hasan Naqvi2*, Bushra Siddique3, Muhammad Asif Zulfiqar4 and Abdur Rehman5
Exogenous Application of Selected Antioxidants and Phyto Development Directors Influenced the Development, Output and Biochemical Attributes of Tomato (Lycopersicum esculentum Mill.)
...emical attributes of Lycopersicum esculentum fruits during 2014 and 2015. Foliar spray of GA3(100 ppm) and 2-hydroxybenzoic acid (200 parts/million and 100 parts/million) give rise to significantly taller plants and greater leaf area while, shorter plants and lower leaf area was recorded in control. Greater leaf number per plant was obtained with application of GA3(100 ppm). This was followed by salicylic acid (200 ppm). Lea...
Safina Naz1*, Muhammad Akbar Anjum1, Bushra Siddique2, Syed Atif Hasan Naqvi3*, Sajid Ali1, Hassan Sardar1, Sakeena Tul Ain Haider1, Muhammad Asif Zulfiqar4, Hajra Azeem3, Sibghat Ullah5, Shah Pasand6 and Zehri Khan5
Effect of Sewage Water Irrigation Frequency on Growth, Yield and Heavy Metals Accumulation of Tomato and Okra
...nt study was aimed to inspect the efficiency of different sewage water irrigation frequency treatments on growth, yield and heavy metals accumulation of tomato and okra during 2012 and 2013. A statistical randomized complete block design was applied in the field to perform experiments having three replicates while 03 sewage water irrigation frequency treatments i.e., 5, 10 and 15-days inte...
Rana Shahzad Noor1,2, Fiaz Hussain2, Irfan Abbas3, Muhammad Umair2, Abu Saad2, Muhammad Umar Farooq4 and Yong Sun1*
Assessing Sustainability of Rainfed Wheat (Triticum Aestivum) Production under Various Soil Tillage Systems: An Energy and Economic Analysis
...ems for wheat sowing, respectively. Results interpretation indicated that the highest (2,300 kgha-1 and 40.56 lha-1) and lowest (1,930 kgha-1 and 8.97 lha-1) wheat yields were measured in CT and ZT farming treatments, respectively. The maximum and lowest energy values were calculated in PT (6.03) and CT (5.14), respectively. The maximum specific energy m...
Tong Zhang1,2, Feng Xu1,*, Ming Ma1 and Peng Ding3
...cked cranes in different periods and places. The results indicate that the diurnal time budgets of cranes in autumn in breeding area are more like the wintering budget in wintering area than breeding season in breeding area. Cranes changed their diurnal time budget and behavior rhythm to adapt the environmental and social changes.
...
Sehrish Firyal1,*, Ali Raza Awan1, Muhammad Umair Latif1, Muhammad Tayyab1, Muhammad Wasim1, Shagufta Saeed1 and Imaad Rashid2
...geon. Cytb haplotype for local domestic breed was developed. Homology analysis of Cytb gene revealed Columbia livia as closest homologue of Pakistani Lathy pigeon with five novel SNPs. Phylogenetic analysis of domestic lathy pigeon indicated the monophyletic relation with C. livia. We are reporting for the first time, the novel SNPs in the Cytb gene of local domestic pigeon breed that might...
Shahid Ali*, Aijaz Ali Channa, Waqar Ahmad, Rafia Akram and Imbasat Yousaf
...e stress because of intemperate bilateral abdominal distension. Trans-rectal palpation revealed a taut uterus (bulged, tense and inelastic) and alive fetus. Subsequently upon induced cervical dilatation, 60-70 L of amniotic liquid was expelled out and dam delivered completely developed alive male calf with a gross anomaly (presence of a hole in the skull) which could not survive and died s...
Chao Zhao1,2, Sigang Fana2 and Lihua Qiua2,3,*
Muhammad R. Khan1, Bushra A. Rakha1,* and Muhammad S. Ansari2
...e, mean, standard error, percentage of various parameters in total length and head length were estimated. The meristic characters showed very limited or no variation in all four species. A total of 28 specimens, including 6 species belonging to genera Schizothorax and Schizothoraicthys were investigated. The species fo...
Hari Prasad Sharma1*, Shova Adhikari1, Yogesh Rai1, Rajkumar Sijapati1, Sapana Chand1, Manisha Karki1, Rubina Thapa Magar1, Ashik Husain1, Khadka Bahadur Khatri1, Melina Karki1, Samiksha Badu1, Sushila Bajracharya1, Somika Pathak1, Rachana Shah2 and Chiranjibi Prasad Pokheral2
...ce, geographically rare species, attractive species, trafficked animals seized by the authorities, and injured and orphaned animals. The presence of visitors and their activities affect the behavior of animals in the zoo due to the structural design and the attractiveness of animals. The more attractive bird, ostrich Struthio camelus in Central Zoo of Nepal is suffering from visitors’ activities. Both male and f...
Muhammad Shakeel1*, Mudussar Nawaz1, Zahid Naseer1, Muhammad Fiaz1, Asghar Khan1, Muhammad Imran Khan1, Awais Ur Rehman1, Ahmad Yar Qamar2 and Ali Raza3
Caprine and Ovine Serological Evidence of Brucellosis in Five Districts of Punjab, Pakistan
... affects various animal species. Amongst different Brucella species, Brucella melitensis has the greater zoonotic aspect, hence, it is considered an occupational hazard for small ruminant handlers as well as Veterinarians. The present study reports the seroprevalence of brucellosis in different sheep and goat breeds in five districts of Punjab, Pakistan. A total of 1239 serum samples were ...
Arif Alam1*, Faridullah2, Ikram Shah1, Shahzad Khan3, Noor Elahi1 and Ehsan Inamullah1
Estimation of Farm Level Technical Efficiency in Maize Production at the High Mountain North Region of Pakistan
... low yields of different peasants were due to inefficiency. The overall average technical efficiency of maize farmers was estimated 73.6%. It was inferred that the productivity can be enhanced by reducing the inefficiency from the ecological factors, peasants’ personal characteristics and farming conditions....
Inam Ullah1, Mahfooz Khan2*, Munir Khan2, Himayatullah Khan2 and Azra3
Factors Affecting Different Wheat Varieties Yield in District Peshawar, Khyber Pakhtunkhwa, Pakistan: A Comparative Analysis
...ee wheat crops varieties per hectare. Primary data were collected from 150 selected respondents randomly in district Peshawar. For this purpose, the effect of various inputs was separately analyzed using multiple regression model. The empirical results show that for Pirsabaaq-5 wheat variety, the effect of (weedicides) was insignificant. While for Pirsabaaq-8 wheat variety irrigation was found insignificant and for Pirsabaaq-13, wheat variety the effect of see...
Dilshad Ahmad1* and Muhammad Afzal2
An Empirical Analysis of Economic Efficiency and Farm Size of Cotton Farmers
...-align: justify;">This paper attempted to analyze the impact of farm size on the economic efficiency of cotton farmers in southern Punjab of Pakistan. Farm-level allocative, economic and technical efficiency of samples of 240 small, medium and large-scale cotton farmers was estimated using Stochastic Frontier Approach of district Rahim Yar Khan Punjab, Pakistan. Empirical findings of the study indicated that medium farm size cotton farmers were more allocative...
Amit Sharma1* and Pankaj Sood2
Sonographic Assessment of Ovarian Follicular Dynamics during Breeding and Non-Breeding Season in Gaddi Goats
....05), along with shorter persistence of dominant follicle (DF, 9.25±0.45 versus 12.02±0.44, P<0.001) and early attainment of DF during first three waves was observed during B compared to the NB season. Whereas, significantly higher maximum diameter of DF (7.66±0.10 versus 7.11±0.14 mm, P<0.05) and longer Inter wave interval (IWI) between 2nd and 3rd wave (5.81±0.46 versus 4.28±0.28 days) were observed during NB s...
Abdiaziz Idiris Mohamud1, Yonis Abukar Mohamed2, Osman Sheikh Ali Jama3, Pravin Mishra4* and Mohamed Idiris Mohamed5
Prevalence and Major Pathogens Associated with Clinical and Subclinical Mastitis in Dairy Camel (Camelus dromedarius) in Benadir Region of Somalia
...15% on quarter basis, respectively. The hind quarters were more frequently affected than the fore-quarters. The bacteriological inspection of milk samples revealed that Staphylococcus spp. was the primary etiological agent in both clinical and subclinical mastitis in camels (38.88%), followed by Streptococcus spp. (18.51%), Enterobacterium spp. (14.81%), Corynebacterium spp. (14.81%), Micrococcus spp. (5.55%), Pasteurella sp...
Md. Aminul Islam1*, A.N.M. Aminoor Rahman2, Mohammad Shah Alam3 and Md. Taimur Islam4
Gastrointestinal Nematodiasis in Quail in Bangladesh
...ggs in the feces. Five types of nematode eggs found on different farms. The overall prevalence of gastrointestinal nematodiasis were (17.5%), which could consider relatively higher. The highest rate of infection found for Heterakis gallinarum (7%) and the lowest rate of infection found for Trichuris spp. (1.5%). A significant difference in nematodiasis in different farms has not observed (p > 0.05). These findings help to undertake preventive measures for c...
Pankaj Kumar Jha1,2*, M. Golam Shahi Alam1 and Farida Yeasmin Bari1
Pregnancy and Lambing Rate Following Laparoscopic Artificial Insemination with Two Different Types of Diluent and Frozen-thawed Sperm Dose in Ewes
...cts with two different types of diluent (commercial Triladyl® and home-made tris based) and number of frozen-thawed ram sperm (100 × 106 and 50 × 106 sperm dose) on pregnancy and lambing rate following laparoscopic artificial insemination (LAP-AI) in indigenous ewes in Bangladesh were studied. A total of 78 non- pregnant ewes were synchronized for oestrus with two doses of ...
Paul Oludare Adetunji* and Safiriyu Idowu Ola
Comparative Productive Performance among three Plumage Varieties of Noiler Hens
...e breed of chicken developed in Nigeria to meet national demands for food supply. The objective of this study is to compare the productive performance among three prominent plumage varieties of Noiler hens. For this purpose, a total of 90 pullets with three plumage colours (brown, black and barred) were divided into 3 replicates with 10 birds per replicate in each of the variety. Data were...
Arshad Ali Essani1, Bhai Khan Solangi1, Muhammad Ilyas Abro2, Sultan Ahmed3, Karim Bakhsh Sial3, Muhammad Saleem4, Ali Asghar Gola5, Ghulam Ali6, Moula Dad6, Mujeeb ur Rehman6, Habibullah Kakar6 and Mitha Khan6*
Comparative Efficacy of Botanical Pesticides against Sucking Insect Pests of Mustard Crop
...t-align: justify;">The experiment was conducted at experimental field of Entomology Section, Agriculture Research Institute, Tandojam during the season 2018-19. Maximum reduction in thrips population (30.3%) was observed in plot sprayed with neem seed extract followed by plot sprayed with neem oil (24.47%), tobacco extract (22.00%) and akk plant extract (19.83). Neem seed extract showed higher efficacy (81.01%) against thrip...
Malik Gul Hassan Awan, Shahzada Sohail Ijaz, Muhammad Ansar, Adeel Anwar, Umber Abbasi and Hashmat Mahmood
Influence of Foliar Application of Mineral Nutrients on Biological Nitrogen Fixation of Rainfed Soybean
...ghest number of pods (74 per plant) was recorded for Ajmeri-1 with foliar application spray. Increase in biomass yield with foliar application of nutrients was 18 % to 112%. The highest biomass yield was 4.8 t ha-1 from Rawal-1 with nutrients application. Increase in grain yield with foliar application of nutrients ranged between 19.5% and 132%. The highest seed yield was produced by NARC-2 (2.19 t ha-1) with foliar application of nutrients. The study clearly ...
Mohsin Ali Alias Mehran Khan Solangi1, Gulfam Ali Mughal1, Asad Ali Khaskheli1*, Turab Ali Korejo3, Nazeer Ahmed Rajput2, Qurban Ali Memon3 and Maqsood Ahmed Kumbhar4
Influence of Camellia sinensis on Broilers Performance
...: justify;">Research was performed on 192 broiler chicks at experimental poultry farm, Sindh Agriculture University Tandojam. The birds were distributed into 4 groups A, B, C and D containing 48 chicks in each. Birds of group A were supplemented with 5g/L Camellia sinensis, group B with 10g/L, group C with 15g/L, while group D was control. The findings of the current study revealed higher feed intake (4480g/b), water intake ...
Tabassum Yaseen1*, Shehzad Ahmad1, Khushnood Ur Rehman2, Fayaz Asad1, Abdul Waheed1, Rani Gul3, Hussain Gulab4 and Naveed Akhtar2
Arbuscular Mycorrhizal Fungal Spore Density and Root Colonization in Weeds of Carrot field at Charsadda, Pakistan
...pheric soil of 15 weeds species belonging to 12 families were collected from Carrot field of District Charsadda and was investigated for the sporulation and root infections types. From the recorded results the highest spore density was found in Melilotus indica having spore number 276 which is followed by Malva neglecta and Sonchus asper having spore number 244, 214 res
Rao Wali Muhammad1, Hafiz Muhammad Wasif Ali2*, Amir Hamza1, Muhammad Qadir Ahmad2, Abdul Qayyum2, Waqas Malik2 and Etrat Noor2
Estimation of Different Genetic Parameters in Various Safflower (Carthamus tinctorius L.) Genotypes under Field Condition
... no. of primary branches per plant, no. of secondary branches per plant, pods per plant, 1000-seed weight and yield per plant of 200 safflower accessions. Analysis of variance and principal component analysis were carried out to estimate the extent of variability for studied parameters and to partition the germplasm into various cluster groups on basis o...
Muhammad Arsaln1, Sair Sarwar2*, Rizwan Latif1, Junaid Nawaz Chauhdary3, Munazza Yousra2 and Shahbaz Ahmad2
Effect of Vermicompost and Microbial Inoculants on Yield, Soil Fertility and Economics of Wheat under Rainfed Conditions
...PSB were tested in the experiment using various combinations of vermicompost (VC) @ 4t ha-1 and phosphorus solubilizing bacterial (PSB) as microbial inoculants along with recommended dose of NPK fertilizers (RDF) were applied at the time of sowing. The combined application of VC, PSB and RDF increased the wheat yield 2684 kgha-1 and 3179 kgha-1 while the yield recorded in control was 572 and 887 kgha-1 for two consecutive years. Same trend was observed in othe...
Rabab Rafaqat1, Habib Ahmed Rathore1, Tariq Masud2, Imran Hayat1* and Imtiaz Hussain1
Determination of Different Chemical Constituents of Fruit, Leaves and Oil of Olea cuspidata (Wild Olive) Grown at Rawalakot, Azad Jammu and Kashmir
...d for physicochemical properties like refractive index, specific gravity, pH, free fatty acid, peroxide value, iodine value, saponification number and unsaponifiable matter. Results indicated that fruit and leaves of wild olive grown at Rawalakot Azad Jammu and Kashmir had moisture content (48.33±1.6 and 53.33±1.4 %), crude fiber (4.40±0.3 and 10.0±0.9 %), crude...
Abdul Jalal, Abdur Rab* and Naveed Ahmad
Aloe Vera Gel Coating Retains Persimmon Fruit (Diospyros kaki) Quality during Storage at Room Temperature
...ly decreased the loss of persimmon fruit quality during storage at room temperature. Storage at room temperature (26±2 °C) resulted in significant decline in fruit firmness, percent acidity, and ascorbic acid content with a concomitant increase in total soluble solids (TSS), organoleptic quality (Taste) score and decay incidence. Coating of
Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi3
GIS Applications in Surveying and Mapping of Rice Weeds in Guilan Province, Iran
...(GIS) technologies for a period of three years (2014-2016). Echinochloa crussgalli was the more important species in 10 regions of Guilan province. The Langarud and Rudsar regions each with 47 species and Anzali and Shaft with 25 species (with 71.2 and 37.9 percent, respectively) had...
Joseph Anejo-Okopi1*, Obinna Oragwa Arthur2, Ocheme Julius Okojokwu1, Sarah Joseph1, Geoffrey Chibueze1, Joshua Adetunji1, Joseph Ameh Okwori3, David Ochola Amanyi4, Otobo I. Ujah5 and Onyemocho Audu6
Seroprevalence of Rift Valley Fever Virus Infection among Slaughtered Ruminants in Jos, North-Central, Nigeria
...n information on animal species, sex, and localities of origin. The blood samples were screened for RVFV antibodies using competitive Enzyme Linked-immunosorbent Assays (C-ELISA) to detect anti-RVFV IgG/IgM. Eleven out of 100 samples tested positive for anti-RVFV antibodies (prevalence=11%). Seropositive cases were more among cattle (16.0%) than goats (6.0%) (P=0.001). Seropositivity was also higher among the animals from Ya...
Iram Sharif1*, Amna Nazir1, Eram Shahzadi2, Shahid Munir Chohan3 and Ghulam Sarwar4
Influence of Sowing Dates on Cotton Growth (Gossypium hirsutum), Yield and Fiber Quality
...es. The set of six genotypes was sown in two different dates viz., 10th April and 10th May in split plot design with three replications by allotting sowing dates in main plot and varieties in sub-plots. The results indicated that crop sown on 10th April produced more seed cotton yield (2881.1 kg ha-1) than sown on 10th May with (2212.9 kg ha-1). Comparing the average varietal performance in both sowing dates, FH-6071 produce...
Huma Abbas1, Muhammad Azhar Iqbal2, Muhammad Kamran3, Muhammad Umar Shahbaz3*, Haseeb Ullah Kamber1, Nazir Javed1, Muhammad Junaid1, Hira Abbas4 and Muhammad Ehetisham ul Haq3
Evaluation of Advanced Mung Bean Germplasm against Cercospora Leaf Spot and its In-vitro Management by Different Fungicides
...gram is one of the short period legume and poor man protein source along with carbohydrates and vitamins. Cercospora Leaf Spot is a devastating threat to the crop caused by Cercospora canescens, affects the whole crop and 95% yield losses may be attributed in severe conditions. To manage the diseases through tolerant germplasm and with environmentally safe fungicides is a cost-effective approach. The present study was aimed to find the resistant germplasm agai...
Ghulam Sarwar1*, Muhammad Rizwan1, Jehanzeb Farooq1, Muhammad Farooq1,2, Hafiz Ghazanfar Abbas1, Farrukh Ilahi1 and Muhammad Asif1
Fiber Quality Studies with Respect to Different Cotton Insect Pests using Multivariate Analysis
...y;">Fifteen cotton genotypes were exploited to study the impact of insect pests on different fiber quality traits. The ANOVA results depicted considerable variation in almost all traits. Fiber length was greatly influenced by the population of thrips, jassid, whitefly, pink bollworm and dusky cotton bug. Fiber fineness was influenced by the population of jassid, pink bollworm and dusky cotton bug while fiber strength was sli...
Shahid Nadeem1*, Taj Naseeb Khan1, Mushtaq Ahmad1, Adnan Younis2 and Iram Fatima3
Influence of Plant Growth Regulators by Foliar Application on Vegetative and Floral physiognomies of Gladiolus
...olor and days to floret open were decreased (96.47, 101.20 and 105.77 respectively) with 1.75mM salicylic acid. However, the results showed the positive impact of GA3 and SA on vegetative as well as floral physiognomies of gladiolus plants....
Attiq ur Rehman1,2*, Iftikhar Hussain Khalil3 and Ihtisham Ali4
Genetic Diversity and Traits Association in Tetraploid and Hexaploid Wheat Genotypes in Khyber Pakhtunkhwa Province of Pakistan
...mprovement program. An experiment containing 16 wheat genotypes (8 durum and 8 spring wheat) was conducted in crop season of year 2015-2016, at The University of Agriculture, Peshawar. The experimental design used was a Randomized Complete Block Design (RCBD) with three replications. The parameters under study were days to heading, days to maturity, flag leaf area, plant height, tillers m-...
Yasir Arafat1*, Syeda Nabahat2, Hafiz Ullah3, Afaq Ali Muluk4 and Azra5
An Analysis of Energy Supply and Oil Price Shocks on Agricultural Productivity of Pakistan
...he correlation between dependent and independent variables. In order to know the stationarity of variables, unit root test is used by employing Augmented Dickey Fuller (ADF) test. It is found that energy supply and foreign direct investment affect agricultural productivity positively and significantly while oil prices negatively affect the productivity in Pakistan. It is also observed that Pakistan lacks behind in using mode...
Zahir Shah1*, Saima Munawar1, Ihsan Ullah2, Taif Shah3, Haq Aman Ullah1, Saqib Nawaz1, Farhan Anwar Khan1 and Manoj Kumar Shah4
Combined Physico-chemical and Analgesic Effects of Electroacupuncture Plus Clonidine in Goats
...cro;g/kg of clonidine respectively, while 5th and 6th groups were treated with EA and EA plus 10µg/kg of clonidine, respectively. Pain threshold, cardio-respiratory effects, rectal temperature, hematological and biochemical variables were assessed in all groups. Clonidine at the dosage of 20µg/kg increased the pain threshold, and decreased cardio-respiratory rates and rectal te...
Tahseen Ullah* and Noor ul Amin
In Vitro Antibacterial Activity of Medicinal Plant Extracts
...terial investigation was performed in three replicates using disc diffusion technique using Nutrient Agar Media for the growth of B. subtilis and E. coli bacteria. The ANOVA for inhibitions zones indicates the effect of plants, bacteria strains, and concentration on growth of bacteria in the bacteria growth culture medium and their interactions. The plants crude extracts were having significant effects on the bacterial growth in bacteria growth medium while ba...
Qurrat ul Ain Akbar*, Saqib Arif, Shahid Yousaf, Salman Khurshid and Najmus Sahar
Effects of Flour Particle Size on Farinographic Properties of Wheat Dough
...using farinograph. Two types of wheat (Triticum aestivum L.) on the basis of hardness, hard and soft wheat, were analysed in this study. Each type of flour was fractionated separately into coarse (1000 to 1500µm), medium (500 to <1000 µm) and fine (<500 µm) fractions on the basis of particle size. All the farinographic parameters (except dough development time) were influenced by particle size of whea...
Shahzad Khan*, Munir Khan, Inayatullah Jan, Mahfooz Khan and Fida Muhammad Khan
Determinants of Sugarcane Yield in District Charsadda, Pakistan
... survey was conducted to perform an economic analysis and to investigate determinants of sugarcane crop in district Charsadda in the year 2018. Three villages viz. Kamran Kalay, Aspandehri, and Sarfaraz Kalay were selected purposively. Primary data were collected with face to face interview method from 41 randomly selected sugarcane growers through structured questionnaire. The selection of farmers was based on proportional allocation technique in the selected...
Shaiza Rasool1, Iftikhar Ahmad1*, Khurram Ziaf1, Irfan Afzal2, Muhammad A.S. Khan1, Muhammad Aashir Sajjad1 and Muhammad Zain Ali1
Seed Conditioning Effects on Germination Performance, Seedling Vigor and Flower Production of Zinnia elegans
...Two initial laboratory experiments evaluated the timing and frequency of seed magnetic stimulation to select the most promising treatments for field production testing and flowering. In the first experiment, a 3% moringa leaf extract (MLE) showed the earliest (2.8 d) and the highest germination rate (90%) with an average root length of 4.2 cm. Hydro-priming resulted in the largest seedling fresh weight (0.8 g), seedling shoo...
Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4
Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...tant element of a landscape garden. It is placed among top ten cut flowers in floriculture industry. Quality production of cut flowers for market depends upon bulb size and growing medium. To investigate the best type of planting medium and suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, ...
Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4
Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...tant element of a landscape garden. It is placed among top ten cut flowers in floriculture industry. Quality production of cut flowers for market depends upon bulb size and growing medium. To investigate the best type of planting medium and suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, ...
Ateeq Ahmad1, Umar Hayat2, Shahid Ali2*, Hazrat Bilal3, Naveed Ali2, Khan Mir Khan4 and Khalid Khan4
Descriptive Analysis of Water Resources in Pakistan: A Perspective of Climate Change
... Data on rainfall and temperature was taken from (PMD) Pakistan Metrological Department for the period of 1980-2011. The data was analyzed through descriptive statistical tolls and Arc GIS 9.8. Result suggests that climate change has severe implications on variation in temperature and rainfall of Pakistan. The after effects of climate change are variation in tempe<...
Moazam Ali1, Wajid Ali2, Ayhan Ceyhan2 and Zeeshan Ahmad Bhutta3*
Pigmentation Genome Influence in Animals and Human Interventions in its Course of Action
...protection, camouflage appearance in wild, and identification. Pigmentation is a complex and multi-factorial regulated process to produce the melanin from melanocytes. Melanin amount, size, shape, and distribution control the color pigmentation of fiber, coat, and hairs in animals. Melanin production in an intricate course is under the control of Melanocortin 1 Receptor, alpha Melanocyte stimulating hormone and Agouti signal...
Muhammad Zahid Mengal1, Hamida Ali2, Raheela Asmat3, Muhammad Naeem1,4, Ferhat Abbas1, Abdul Samad1, Mohammad Zahid Mustafa1, Jannat Raza2 and Tauseef M. Asmat1*
...s New Roman";">GeneXpert MTB/RIF has revolutionized the tuberculosis diagnosis by simultaneous detection of Mycobacterium tuberculosis and resistance to RIF (rifampicin), a surrogate marker for multidrug-resistant TB in less than two hours. The RIF-resistance pattern in Balochistan, Pakistan, is not documented. This study was aimed to detect RIF-resistant TB and mutations in RNA polymerase beta (rpoB) gene of M. tuberculosis within 81...
Nadeem Abbas Shah1*, Ejaz Ashraf1, Hafiz Khurram Shurjeel2, Zaheer ud Din Mirani3, Usman Rafique1 and Raees Abbas Shah4
Assessing Perceptions of the Households-heads Regarding Food Security Status in Drought-hit Areas of District Tharparkar, Sindh, Pakistan: A Case Study for Agricultural Extension
...Most of the population depends on agriculture to earn their livings and to meet the desired level of food security. Despite all the progress the country has made so far, its population combating with the threat of food insecurity. Tharparkar, (the largest desert area not only in Pakistan but also in the South Asian region) is considered at the front line district in the country about food insecurity and malnourishment. The purpose of this study was to assess t...
Muhammad Yaseen1*, Xu Shiwei2, Yu Wen2, Ejaz Ashraf1, Muhammad Luqman1, Muhammad Ameen3 and Sadia Hassan4
Farmers Behavior to Participate in Public Sector Agricultural Extension Services: Comparative Analysis of Pakistan and China
... help of validated and expert reviewed interview schedule. The results revealed that the household head’s average age is 47 years in Pakistan and 53 years in China. The old aged household head’s participation in extension services in Pakistan is less (36%) than China (43%). Similarly, household head’s education is 9 years schooling in Pakistan accounting less participation (25%) in agricultural extension services while 7 years schooling in Ch...
Khan Sher1*, Muhammad Subhan1, Muhammad Nisar2, Ali Hazrat2, Zahid Fazal1, Gul Rahim2, Imran Ahmad1, Riaz ul Haq1 and Shamia Bibi1
Genetic Diversity in Common Beans (Phaseolus vulgarus L.) Collected from Different Ecological Zones of Malakand Division (A Part of the Sino Japanese Region of Pakistan)
...f diversity like seed shape was determined by two alleles, seed color was defined by 13 numbers of alleles and four alleles were responsible for flower color. Similarly, the quantitative traits showed 73% diversity in the parameters studied. However, it was different in individual characters. In overall, 59% of the yield contributing traits showed significant level of correlation in the present germplasm. The dendrogram in one-way cluster analysis distributed ...
Malik Abdul Rehman1, Shafqat Ali1, Muhammad Babar Shahzad Afzal1, Muhammad Nawaz Khan1 and Mujahid Ali2*
Efficacy of Chemicals and Botanical Extracts to Control Citrus Canker on Kinnow in Sargodha Region
...ied), Neemsol @ 5 ml, copper oxychloride @ 3 g, streptomycin sulphate @ 1 g, potassium acetyl benzoic acid @ 10 ml, difenoconazole @ 0.5 ml, extracts of Acacia nilotica @ 10 ml, Datura alba @ 10 ml, and Allium cepa @ 10 ml. These treatments were used by mixing in 10-liter water. The foliar spray was applied four times a year, i.e. March-April and August-September. The results showed that copper oxychloride controlled the dis...
Muhammad Imran1,2*, Shahbaz Talib Sahi1, Muhammad Atiq1 and Amer Rasul3
Brown Leaf Spot: An Exacerbated Embryonic Disease of Rice: A Review
...d losses upto 6 to 90% depending upon the disease triangle. It has become a great concern for the rice-growing areas to find better management strategies under the fluctuation of the climate conditions. Different management practices (cultural, biological, chemical, induce resistance, nutrient management, natural byproducts, and resistant cultivars) are used by farmers in different field areas of the world. The use of the resistant source is the simple, reliab...
Zulnorain Sajid1*, Muhammad Ramzan2 and Noreen Akhtar1
Foraging Behavior and Pollination Ecology of Bumble Bee and Honey Bee in Pakistan; A Review
...cially. Honey bee can dispense 80% in insect pollination and considered as a best pollinator towards crop pollination, Bumblebee are more efficient and competent pollinator due to their buzzing behavior, efficiency to forage at low temperature, vibration to burst the pollen sac, high speed to flower visitation at low tempe...
Md. Sahidur Rahman
Origin and Spillover of Coronaviruses: Prospects of One Health Action
...irus originate in avian species. Domestic animals also play a critical role in disease transmission as they are found seropositive against different coronaviruses. At least seven coronaviruses are known to have been spilled over from animal to human. SARS-CoV-2 is the recent one that showed pneumonia-like syndrome named COVID-19. It was assumed that SARS-CoV-2 was initially a spillover from bats due to its genomic similarity with Bat-CoV-RaTG13, where pangolin...
Christian Marco Hadi Nugroho1 and Jeanne Adiwinata Pawitan2,3,4*
Production of Antibody for Direct Fluorescence Antibody Assay against Avian Influenza H9N2
...apid and sensitive, but specificity is influenced by antibody production methods. Therefore, the aim of this review was to describe various antibody production methods, which might be used in developing DFA assay to diagnose H9N2 infection in humans or chickens, and we discussed avian influenza H9N2 virus, immunogens, various H9N2 antibody production, and principle of DFA assay.
...
Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2
Description of Seven New Species and One New Record of Plant-Parasitic Nematodes (Nematoda: Tylenchida) Associated with Economically Important Crops of Kashmir Valley, Jammu and Kashmir (Part-1 of the series)
... and Kashmir, seven new species and one new record of following species were recovered: Helicotylenchus siddiqii sp. nov. from soil around roots of Glycine max L. Miller, from Kashmir University Campus, Hazratbal, Srinagar, Kashmir; H. fotedariensis sp. nov. from soil around roots of Brassica oleraceae var. botrytis L. from Zadibal, Srinagar, Kashmir; H. harwaniensis sp. nov. from soil around roots of Lyco
Yawar Iqbal Erum*, Hussain Sagir, Kazi Nasira and Fayyaz Shahina
Compendium of the Genus Psilenchus de Man, 1921 (Tylenchida: Psilenchidae)
...-align: justify;">The compendium of the genus Psilenchus de Man, 1921 comprised of 19 species based on the characteristics of the total body length, ratio of a, b, c, c’, V%, stylet, MB, head shape, tail length, DGO, oesophagus, excretory pore, spicules and gubernaculum. The allometric and morphometric characteristics were derived from the original descriptions. An updated list of va...
Bushra Ismail Khan1, Shamim Akhter1, Sanwal Aslam2* and Rabea Ejaz1
...; 106 motile sperm ml approximately at 37°C in Tris-citric acid extender supplemented with different concentrations of PVP (0.01, 0.05, 0.1mM). The extender without PVP was kept as control. Semen was stored at 4°C for a period of 2 h and kept at 4°C for 4h. Semen was filled in 0.5 ml French straws using suction pump at 4°C, plunged and stored in liquid nitrogen (-196°C). Semen straws were rewar...
Asmat Ullah1,2, Shahid Iqbal1,2 and Furhan Iqbal2*
...f extract on selective aspects of albino mice behavior in a gender specific manner. Seven week old female and male albino mice were used as experimental animals. Mice were orally supplemented either with 300 mg/ml solvent/Kg of body weight Bauhinia variegata’s leaf extract or with saline solution (0.9% NaCl) for 17 days. Behavioral observations were made by applying a series o...
Gulzhan Aubakirova1*, Zhanat Adilbekov2, Assylkhan Inirbayev2, Assel Zhamanova2 and Aibar Akhmetov3
...er bodies was within the permissible concentration, however, a decreased permanganate oxidation was noted, which indicates a satisfactory state of water quality. Widespread infection of fish with postdiplostomatosis was revealed in assessing fish safety; in rare cases, diplostomosis and ligulosis were detected. The incidence of fish with bacteriosis was not observed, with the exception of isolated cases of aeromonosis. Excee...
Aatif Amin1,*, Zakia Latif2, Arslan Sarwar1, Basit Zeshan1 and Mushtaq A. Saleem1
...ylogenetic analysis were performed for the characterization of isolates as Bacillus sp. AZ-1 (KT270477), B. cereus AZ-2 (KT270478), B. cereus AZ-3 (KT270479) and Enterobacter cloacae ZA-15 (KJ728671). Phylogenetic relationship on the basis of merA nucleotide sequence confirmed 51-100% homology with the corresponding region of the merA gene of already reported mercury resistant Gram positive bacteria. Restriction...
Mikail Arslan1, Orhan Yilmaz2, Bahattin Cak2* and Ahmet Fatih Demirel2
...quo; survival and growth performances. A total of 200 Kivircik ewes and 15 Kivircik rams were used. Ewes were subjected to a system of lambing every 8 months. Ewes were mated in August (summer), April (spring) and December (winter), respectively. Ewes were synchronized using FIS (intravaginal flourogestone sponges) for 14 days. Additionally, 600 IU eCG (equine chorionic gonadotropin) was administered intramuscularly at spong...
Muhammad Tahir Khan1, Shahid Mehmood2*, Athar Mahmud2, Khalid Javed3 and Jibran Hussain2
... on quails’ growth performance, carcass yields, blood biochemistry, and immune antibody response. A total of 1200 newly hatched quail chicks (Coturnix coturnix japonica) were randomly allocated to five treatment groups. Each treatment group contained 40 birds and experiments were replicated six times using a completely randomized design (CRD). The experimental diets consisted ...
Blood Biochemical and Hair Mineral Profile of Camel Calves Reared under Different Management Systems
Asim Faraz*
...ntained at CBRS in semi-open housing system while the third group owned by the camel herders in the close vicinity. All the calves had access to water twice daily. In blood biochemicals analyses the levels of hemoglobin, cholesterol, triglycerides, total protein, albumin, calcium and phosphorus were found to be significantly different higher in IMS compared to SIMS and EMS. The levels of urea, creatinine and glucose were found to be varied (P>0.05) among gr...
Rabea Ejaz1*, Saima Qadeer2,Muhammad Sajjad Ansari3, Bushra Allah Rakha4, Shazia Shamas5, Iram Maqsood1, Asma Ul Husna6, Asima Azam1 and Shamim Akhter6
...f cryopreserved buffalo spermatozoa by addition of arachidic acid in semen extender. For this purpose, semen was collected from 3 adult buffalo bulls (Bubalus bubalis) of same age by artificial vagina keeping temperature at 42°C for a period of 5 weeks (replicates; n=30). Ejaculates were mixed in tris citric acid extender having 0.0 (control), 20.0, 25.0 and 30.0 ng/mL of...
Joseph Anejo-Okopi1*, Dorcas Yilger Gotom1, Noble Allison Chiehiura1, Julius Ocheme Okojokwu1, David Ochola Amanyi2, John Otumala Egbere1, Joshua Adetunji1, Otobo Innocent Ujah3 and Onyemocho Audu4
The Seroprevalence of Zika Virus Infection among HIV Positive and HIV Negative Pregnant Women in Jos, Nigeria
...ross-sectional study was performed at Plateau State Specialist Hospital in Jos, North Central Nigeria from August to December 2020. We enrolled a total of 90 (45 HIV positive and 45 HIV negative) pregnant women aged ≥18 and ≤50 years attending antenatal clinic. Ethical approval was obtained and approved by the Health Research Ethics Committee of the hospital. Detection of ZIKV IgG antibodies was done using a commercial...
Abida Parveen1, Sajid Aleem Khan1, Nazir Javed1, Anam Moosa1*, Khushboo Javaid1, Hina Safdar1 and Asma Safdar2
...o tomato (Solanum lycopersicum L.) production. In this study, the inhibitory effect of Moringa oleifera L. (MO) extracts and Steinernema kraussei Steiner (SK) as stand-alone treatments and in combination was assessed to suppress the reproduction and development of MI. Highly susceptible variety of tomato cv. ‘Money Maker’ was tested for the invasion and development of MI. Aqueous and ethanolic MO extracts were tested in combina...
Dalal H. Sary and Rama T. Rashad*
A Comparative Study on the Impact of Compost, Humate, and Silicate on the Nutritional Characteristics of Calcareous Soil Cultivated by Soybean
...n: justify;">Two field experiments have been carried under the calcareous soil conditions during the summer seasons of 2018 and 2019. Their aim was to compare the effects of compost, K-humate, and K-silicate applied at 50% and 100% of the recommended dose (compost: 7.81 t ha-1, potassium silicate: 16.67 L ha-1, potassium humate: 15.63 kg ha-1) on soil nutritional status regarding macro-nutrients (N, P, and K) and soybean yield and quality. Treatments were dist...
Kubilay Ucar1, Sait Engindeniz1* and Jozef Palkovic2
Risk and Return Analysis of Open-Field Tomato Grown in Turkey: A Monte Carlo Simulation Approach
...e risks associated with open-field tomato grown in Izmir province of Turkey in 2011-2017 period. Statistical data used in the study have been obtained from FAOSTAT, Turkish Statistical Institute and Turkish Ministry of Agriculture and Forestry. According to the results of the study, the average production costs of tomato was determined to be 4,940 US$ ha-1. Average gross and net return were calculated to be 4,282 US$ ha-1 an...
Oluwatoyin Adenike Fabiyi1*, Olubumi Atolani2 and Gabriel Ademola Olatunji3
Toxicity Effect of Eucalyptus globulus on Pratylenchus spp. of Zea mays
...nual yield is largely hampered by nematode infestation, especially the Pratylenchus spp. Experiments were conducted in a screenhouse and under field conditions to evaluate the toxicity of fractions and essential oil of Eucalyptus globulus (Myrtaceae) against Pratylenchus spp. infecting Zea mays. The phytochemical basis of the plant was partly established using Infrared (IR) s
Sher Bahadar Khan1, Mumtaz Ali Khan2,*, Hameed Ullah Khan3, Sher Ali Khan4, Shah Fahad5, Faheem Ahmad Khan6, Irshad Ahmad7, Nighat Nawaz8, Sidra Bibi9 and Muhammad Muneeb10
...: small;">Campylobacter species are one of the most important food borne zoonotic pathogens. A total of 1260 poultry meat samples were collected from four different regions of Khyber Pakhtunkhwa province and processed for isolation of campylobacter species. A total of 182 (14%) Campylobacter jejuni were isolated using enrichment and plate media followed by confirmation through multiplex PCR. Isolates were tested for 1...
Muhammad Nauman, Unsar Naeem-Ullah*, Mehreen Hanif, Hafsah Ghaffar, Muhammad Shahid and Syed Haroon Masood Bokhari
Management of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) by using Microwave Oven
...taneum (Herbst) and Rhyzopertha dominica (Fabricius) adults. Grain samples of 20 g in each petri dish were infested with both adults and exposed to microwaves for 0, 10, 20, 30 and 40 sec. For germination determination 25 seeds from each treatment were selected. Results indicates that increase in exposure time also increase the mortality but it reduces the germination capability of the grains. 20 sec exposure time of microwa...
Umar Hayat1*, Ibrar Hussin2, Aftab Alam3 and Khalid Khan4
Time Series Analysis of Child Mortality in Pakistan: An Application of Bootstrap ARDL
...tus of masses along with per capita income. This study aims to empirically test the hypotheses of Modernization Theory (MT) and the Social-Democratic Theory (SDT) related to child mortality in Pakistan. The study adopts the framework of Ferreira and Schady (2009) and Baird et al. (2011) to carry out empirical estimation via ARDL and Bootstrap ARDL. Confirming the co integration relationship, the study identifies that real GDP pe...
Asif Ali Abro1* and Iqbal Ahmed Panhwar2
Impact of Various Factors on Crop Diversification Towards High Value Crops in Pakistan: An Empirical Analysis by using THI
...-align: justify;">This paper is based on empirical evidence from Pakistan for 1981-2018. To analyze the impact of various factors on the diversification of crops towards high value crops, the Herfindahl Index (HI) was used to check the level of concentration or diversification in the structure of crops in Pakistan. The values of the Herfindahl index obtained as a result of the analysis indicate a high level of crop concentration and need to be diversified towa...
Saeed Ahmad1, Abdul Ghaffar1, Muhammad Habib ur Rahman1,3*, Tanveer-ul-Haq2, Mahmood Alam Khan4 and Arshad Mahmood5
Evaluation of Different Production Systems in Combination with Foliar Sulphur Application for Sunflower (Helianthus annuus L.) under Arid Climatic Conditions of Pakistan
.... To reduce the import expenses and meet country’s demand, there is a need to increase area under oilseed crops without disturbing the cropping systems. Climate variability is another emerging threat for current production and cropping systems especially in south regions of Pakistan having high arid climatic conditions. A study was conducted in South Punjab (30°1575 N, 71°5249 E) to evaluate the
Sajid Amin Sarmad1, Muhammad Zeeshan Majeed1*, Muhammad Luqman1, Muhammad Asam Riaz1, Sohail Ahmed3 and Sylvain Nafiba Ouédraogo2
Development and Laboratory Evaluation of a Slow Release Formulation of Fipronil against Subterranean Termites (Odontotermes obesus Rambur)
...icultural and structural pests. A wide range of insecticides with different modes of action are being used against these termite pests including organochlorines, organophosphates and pyrethroids. However, pesticidal control of termites is usually not persistent and long-lasting due to rapid decomposition and loss of insecticidal molecules active against ...
Safiullah1, Azmat Ali Awan2, Mohammad Ilyas3, Fahim Ullah Khan3, Arshad Iqbal3*, Muhammad Adil3 and Asad Ullah1
Effects of Different Concentrations of Naphthalene Acetic Acid on Rooting of Various Olive Varieties
...lara and Sevallino) an experiment was conducted at Agricultural Research Institute (ARI) Tarnab, Peshawar during 2016. The trial was performed using two factorial RCBD. Cuttings were collected from mature olive orchard. The cuttings were treated for ten seconds in required concentration of NAA solutions. According to the experimental results, minimum days to root ap
Mehnaz Safdar and Urooba Pervaiz*
Constraints in Accessing Agricultural Extension Services by Rural Women: Evidence from Khyber Pakhtunkhwa, Pakistan
...rrying out agricultural operations, 128 women respondents from each district were randomly selected and interviewed through pre-designed interview schedule in 2018. Results indicated that 47% respondents were in middle age category (31-40 years), 59% were illiterate, 91% women respondents were married and 75% households were headed by male. It was observed that local famers/colleagues were the main source of information for 41 % respondents, while no fem...
Ghulam Akbar1*, Ali Ahmad2, Neha Arooj1, Muhammad Anjum Zia1, Aamna Rafique1, Sania Riasat1, Mohsin Raza1, Mahpara Qamar1, Shahneela Nusrat1 and Shakila Hanif1
Critical Update for the Treatment of Anemia by using Advanced Genome Editing Crispr Cas Technology
...women, children and aged people. Anemia associated with numerous infectious and continual problems such as persistent kidney disease, cancer, ischemic heart ailment and inflammatory bowel disorder. However, with the development in generation at genome editing level have made feasible to accurate mutations in human genome. A site oriented specific break in double stranded DNA is induced by ...
Muhammad Ilyas1,2*, Imran Khan2*, Muhammad Umer Chattha2, Muhammad Umair Hassan2, Muhammad Zain3, Wajid Farhad4, Sana Ullah1, Ateeq Shah5, Safeer Ahmed6, Bismillah Khan1 and Muhammad Adeel1
Evaluating the Effect of Zinc Application Methods on Growth and Yield of Wheat Cultivars
...t cultivars, Galaxy-2014 performed better than the Punjab-2011 and Millat-2011 in terms of growth and yield components. In conclusion, Zn application (seed priming, foliar and soil application) can be an imperative approach to improve the growth and productivity of wheat crop under semi-arid regions....
Ashraf Ismail Afia1 and Ahmed Soliman Mohmed El-Nuby2*
Soybean Genotypes Response to Root-Gall Nematode
...bean (Glycine max) genotypes were evaluated for susceptibility to root-gall nematode (RGN), Meloidogyne incognita race 2, under greenhouse conditions. Significant differences among the genotypes resistance degrees were achieved. Substantial variations existed among the soybean genetic resources with regard to the evaluated parameters. According to reduction percentage in reproduction facto...
Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4
Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...infestation on chilies. Species were identified based on perineal pattern morphology. M. javanica was identified as predominant species of the study area. RKN tropical species was found on M. incognita 37%, M. javanica 38% and M. arenaria 28% sites parasitizing vegetable crops. Host preference of M. javanica and M. incognita was detected in mixed field c...
Rubina Munir1,2*, Muhammad Zia-ur-Rehman3, Muhammad Makshoof Athar1, Noman Javid1,4, Ayesha Roohi2 and Syeda Fatima Razavi2
... have been confirmed by spectral techniques including FT-IR, 1H-NMR, 13CNMR, and mass spectroscopies. The purity of compounds has been established by elemental analysis. Free-radical scavenging activity of these compounds has been carried out by DPPH assay that showed these compounds to be effective radical scavengers. The compounds 7a, 7b, 7d, 7f and 7h have exhibited radical scavenging activity better...
Muhammad Awais Nazir1, Khalid Mahmood Anjum1, Junaid Naseer1, Ahsan Anjum2, Aneela Zameer Durrani3, Saba Usman2, Muhammad Asif Munir1, Omer Naseer4 and Muhammad Usman3,*
...d randomly into twelve experimental tanks (50 fish per tank). Four isoenergetic and isonitrogenous feed diets were allocated to each treatment, with three replicates/treatment (12 fish/replicate). FM and fish oil were replaced gradually by SBM in the four diets. The inclusion of SBM in diets 1-4 was at the following respective levels of 0% (control), 29%, 35% and 51%. Growth
Ammara Gull-E-Fareen1, 3, Imran Bodlah1*, Muhammad Tariq Rasheed1, Yasir Niaz2, Muhammad Adnan Bodlah2, Muhammad Asif4 and Nasir M. Khokhar5
...es. Aphids (serious crop pests) can be divided into myrmecophilous and non- myrmecophilous. The main objective of this study was to determine trophic associations of ants associated with aphids on various host plants in Pothwar. For this purpose, seven ant species were selected, identified as Camponotus compressus (Fabricius, 1787), Formica fusca Linnaeus, 1758, Formica clara Forel, 1886, Lepisiota fr...
MA Liman1, QI Yongxiao1, Wang Wenji2* and Zhong Qianyi3*
...en reported to have therapeutic effects on some tumors, but its antiangiogenic effects in zebrafish has not been evaluated. Here we investigated the antiangiogenic of G-Rh2 using the zebrafish angiogenesis model. Morphological observations of the G-Rh2-treated wild-type embryos were performed to evaluate the toxicity of the compound. Tg(fli1-EGFP) transgenic zebrafish with fl...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
...ong the known root-knot species, Meloidogyne incognita is by far the most destructive, widely distributed and the most dominant and prevalent. In the present study, the efficacy of a biological control agent, Trichoderma harzianum and an antagonistic plant, Azadirachta indica was tested against M. incognita on tomato. The antagonistic fungus and plant caused significant hatching inhibition and larval mortality of M. incognita...
Muhammad Umer Khan1,2*, Muhammad Farooq Sabar1, Atif Amin Baig3, Arif-un-Nisa Naqvi4 and Muhammad Usman Ghani1
...l ancestry portrait of a person’s genetic pin code. Overall knowledge of mtDNA profiles of worldwide populations can benefit population genetics and forensic sciences. Consequently, this study was designed to establish the mtDNA profiles of the Shin ethnic group in Gilgit-Baltistan, the northern most territory of Pakistan. Phlebotomy was performed for a total of 79 maternally unrelated Shin volunteers. Genomic DNA was ...
Sehrish Ashraaf1, Hafiz Muhammad Tahir1* and Sajida Naseem2
...predators of many insect pests and preferred as they are carnivores. In the present study we identified the cursorial spiders of different families using DNA barcoding as it is very helpful in identifying species where morphological identifications can be difficult e.g., delimitation of juvenile stages. Standard barcode region of CO1 gene of 64 samples was amplified. The sequences of 658 base pairs were recovered from 62 sam...
Nihat Tekel1, Seyrani Koncagül2, İlkay Baritci1, Halit Deniz Şireli1, Muhittin Tutkun1, Ecevit Eyduran3 and Mohammad Masood Tariq4*
... (0-300 days of age), respectively. Pearson correlation coefficients between the observed and predicted weight values of the Awassi lambs were found as 0.9417, 0.9255 and 0.9203 for 0-90 days of age, 0.9741, 0.9501 and 0.9634 for 0-180 days of age and 0.9824, 0.9765 and 0.9790, for 0-300 days of age, respectively. Brody, Negative Exponential and Bertalanffy models were found to be useful models to describe the growth of Awas...
Asma Rashid Tariq1,2*, Saadia R. Tariq2, Tariq Mahmud1 and Misbah Sultan1*
Selective Capture of CO2 from Mixture of Different Gases using Cellulose Acetate, Polyimide, Polysulfone and some other Polymers based Mixed Matrix Membranes: A Review
...polyimides, polysulfone, pebax, polybenzimidazole, polymer of intrinsic porosity, polyurethane, chitosan and many more. Likewise, along with other fillers, Metal organic frame works have also been tested as additive for the mixed matrix membranes as they offer several advantages over other fillers. This review majorly presents use of three polymers viz. cellulose acetate, polyimides and polysulfone, for fabrication of mixed matrix membranes. All of these polym...
Hassam Ud Din1*, Huma Rizwana1, Rameez Raja Kaleri2, Kaleem Ullah2 and Muhammad Din2
Evaluation of Production Performance and Marketing of Small Ruminants in District Dukki, Balochistan
...information on various aspects was collected from the small ruminants farmers of five union councils i.e. Vialla Dukki, Thal, Nana Sahib, Sadar and Nasar Abad of district Dukki of Balochistan. The sample size was composed by producer (50), wholesalers (50) and retailer (50) for convenient sampling contribution of each selected producer involved in the business area. The result showed that in the study area (60.00%, 24.00% and 16.00%) farmers have kacha, pacca ...
Muhammad Nazar1, Chaudhary Muhammad Ayyub2, Mujahid Ali3*, Malik Abdul Rehman4, Shoib ur Rehman5 and Saqib Ayyub2
Amelioration of Thermo-Tolerance Ability in Spinacia oleracea L. Cultivars by Foliar Application of Chitosan
...are many techniques to cope with these stresses but foliar application of chitosan was a very significant tool. Three cultivars of spinach (All Pure Green, Desi Local, and Lahori Palak) were grown at normal temperature 18/20°C (day/night temperature) and then after four weeks after emergence 40/32°C (day/night temperature) was given by gradually ...
Imtiaz Hussain1, Azhar Mahmood Aulakh2, Muhammad Sohail1*, Khalid Hussain2, Ansaar Ahmed3, Abdul Hamid3 and Muhammad Imtiaz3
Impact of Zero Tillage on Productivity of Traditional Mung Bean-Wheat Cropping System of Punjab, Pakistan
... by Rs. 6236 ha-1 and helped farmer to earn additional Rs. 25601 ha-1 in terms of annual net returns than prevailing conventional tillage system. The benefit-cost ratio under zero tillage was calculated as 2.19 whereas 1.84 under traditional tillage practice. The results confirmed that new initiative (zero tillage) proved to be economical and resource conserving compare to conventional tillage.
...
Amir Aziz1*, Mukkram Ali Tahir1, Noor-us-Sabah1, Ghulam Sarwar1 and Sher Muhammad2
Effect of Rice and Wheat Straw and K-Silicate Application on Maize Growth
...ssium silicate), a pot experiment was conducted at College of Agriculture, University of Sargodha, Pakistan in 2017. Different treatments including T1= control, T2= wheat straw (deficient @ 200 mg kg-1 of soil), T3 = wheat straw (adequate @ 400 mg kg-1 of soil), T4= rice straw (deficient @ 200 mg kg-1 of soil), T5 =rice straw (adequate @ 400 mg kg-1 of soil), T6 = K-silicate (deficient level @ 2 mg kg-1 of soil) and T7 = K silicate (adequate @ 400 mg kg-1 of s...
Muhammad Ramzan1, Muneer Abbas1*, Sohail Abbas2, Niaz Hussain1, Muhammad Aslam1, Javed Anwar Shah1, Muhammad Irshad1 and Mudassar Khaliq1
Incidence of Different Aphid Species on Various High Yielding Wheat Varieties
...of Pakistan. Among other pests aphid is a major one which contributes towards low yield on wheat farms. Different wheat developmental periods, i.e., seedling (SS), tillering (TS), stem elongation (SES), heading (HS), dough (DS) and ripening (RS) were studied. Through evaluating, seven varieties i.e. Sahar-2006, Faisalabad-2008, Punjab-2011, Galaxi-2013, Gold-2016, Fakhr-e-Bhakkar-2017 and ...
Zulekha Zameer, Samreen Mohsin, Ammarah Hasnain, Asma Maqbool* and Kauser Abdulla Malik
Influence of Explant Sources on in vitro Callogenesis and Regeneration in Maize (Zea mays L.)
... maize tissue culture, especially the immature embryos. However, the manipulation of immature embryos as explants is hampered due to its unavailability throughout the year and low regeneration response. The present study is aimed to investigate the effect of various explants sources for callogenesis and regeneration in maize (Pioner 3025). The main explants under consideration were: three parts of germinated seedlings, matur...
Muhammad Siyar1, Anwar Saeed Khan2*, Fazlur Rahman2 and Muhammad Jamal Nasir2
Spatio-temporal Assessment of Reliability in Pehur Main Canal System, Khyber Pakhtunkhwa, Pakistan
...econdary sources were tapped for data acquisition. An extensive field survey was undertaken in Rabi 2012-13 and Kharif Miana 2013 to acquire actual flow data of individual outlets. The reliability is measured on a scale of 0-1, 1 for complete reliable and 0 for unreliable services. The analysis shows the majority of reliability values closer to 0. Rabi season has better reliability than the Kharif Miana. The spatial reliability in different sections of the sys...
Malik Abdul Rehman1*, Hafiz Muhammad Ehsan2, Tehseen Ashraf2, Zulfiqar Ali Gurmani3, Sajjad Khan3 and Mujahid Ali2
Effect of Growing Media on Plant Growth of Rough Lemon (Citrus jambhiri Lush.) and Poncirus (Citrus trifoliata)
...luence of growing media (peat mass, compost, soil, silt, sand, sawdust and leaf manure) in 14 different combinations of growth media to check for plant growth of rough lemon and poncirus rootstocks. Five plants per treatment were growing in black polythene bags filled with the required media using a Completely Randomized Design with three replications. Data of stem length stem diameter, number of leaves, leaf area, and survi...
Muhammad Yaseen1*, Muhammad Luqman1*, Zahoor Hussain2, Usman Saleem3, Asif Nawaz1, Tahir Munir Butt4 and Muhammad Umer Mehmood1
Assessment of Knowledge Level and Information Sources of Vegetable Growers regarding Tunnel Farming in District Sargodha
... import of vegetables, especially from the neighboring countries. To at least minimize those expenditures tunnel farming to a maximum level can give us a way forward. This transverse study has the Sargodha district as its universe. All the vegetable growers who used to grow off-season vegetables were the population of the study. The snowball sampling technique led us to have 8 off-season vegetable growers in Sargodha tehsil,...
Hong Hu1, 2, Li Qian1, Yuanlang Wang1, Chaodong Wu1, Xiaodong Zhang1, Yueyun Ding 1*, Li Wang1, Xudong Wu1, Wei Zhang1, Dengtao Li1, Jian Ding1, Min Yang1 and Zongjun Yin1*
...i and Yorkshire pigs, respectively. Most reads were located in exonic region, while less reads were located in intergenic and intronic regions. There were 2601 upregulated genes, but 284 downregulated genes in Yorkshire pigs compared with those in Anqingliubai pigs. The top 10 most significant Gene Ontology (GO) terms included catalytic activity, binding, cell, cytoplasm, positive regulation of multicellular organismal process, biological regulation, cellular ...
Shakeel Ahmed* and Sarwat Jahan
...S), an anorexigenic neuropeptide was first discovered in rat brain. It is a ligand for receptor FM4/TGR-1 which is also called as NMU receptor type II (NMU2R). Mainly it is expressed in SCN and involved in regulation of food intake and dark light circadian rhythms. In rodents and higher primates its stimulatory role in HPG axis is reported. Growth hormone (GH) is released from anterior pituitary and directly or indirectly pl...
Sadaf Aslam1,2*, Abdul Majid Khan2 and Muhammad Akhtar2
... remains of the extinct species Hyotherium pilgrimi described. The known stratigraphic range of Hyotherium is about 14 to 11 million years. This species is closer to its smaller European relative H. soemmeringi. The studied material includes isolated premolars and molars. This paper provides new insights of morphology of an extinct s...
Syeda Farzana Bibi* and Siraj ud Din
Unraveling the Bioherbicidal Potential, Elemental Analysis and Nutritional Evaluation of Crataeva adansonii Dc Leaf and Bark
...rough atomic absorption spectrophotometry to detect ten essential macro and microelements, including Na, Ca, Co, Cd, Cu, Mn, Zn, Pb, Ni, and Fe. In the bark part, the highest percentage of relative standard deviation was observed for Co, Cd, and Na, which is 175.6, 22.86, and 5.58%, respectively. The leaf part’s elemental analysis revealed the highest pe
Taqi Raza1*, Sergio de Los Santos Villalobos2, Muhammad Shehzad3, Shakeel Imran4 and Derly José Henriques da Silva5
PGP Characterization of Rhizobacteria Associated with Apple Gourd (Praecitrullus fistulosus L.)
... quantitative tests were performed to characterize the PGPR abilities of isolated rhizobacteria. Lab study indicated that isolated bacterial strains have morphologically different colonies, shapes, and colors. The isolated strain mostly belonging to Coccus, Bacillus, and Spirillum. Nearly, 63% belonging to Coccus, 23% to Bacillus, and 14% to Spirillum. Only 18% of strains gave the gram positive staining results and 14% strai...
Shahid Ahmed1,2*, Huiqing Su1, Xuqian Sun1, Peng Feng1, Yongpan Chen1, Liang Yu1, Qian Liu1 and Heng Jian1
Performance of Cereal Varieties against Cereal Cyst Nematode (Heterodera avenae)
...anked as resistant genotypes while 9 wheat and 3 oat lines were ranked as moderately resistant and 1 wheat line and the local check were highly susceptible to H. avenae. These genotypes need to be exploited in breeding program to introduce the resistance gene pool in local cereal cultivars for resistance to H. avenae in China....
Atef Mohamed El-Sagheer
Status of Phytonematodes in a Main Commercial Banana Production of Upper Egypt
...vernorate at middle of Upper Egypt. The encountered phytonematodes were identified during the survey belong to sixteen genera comprising sixteen genera belonging to nine families viz., Criconemella, Criconemoides, Ditylenchus, Helicotylenchus, Heterodera, Hoplolaimus, Longidorus, Meloidogyne, Paratylenchus, Pratylenchus, Radopholus, Rotylenchulus, Rotylenchus, Tylenchorhynchus, Tylenchus and Xiphinema. It was observed that there was variability in population d...
Taqiur Rahman1, Tabassum Yaseen1*, Ali Mujtaba Shah2, Samiullah3, Ghulam Jelani3, Gul Nawaz1,Qudratullah Kalwar2
...on traditional values, expertise and skills; the methodologies and methods used to treat diseases, maintaining animal health and its importance to ethnobotany and Pharmacogonosy.The objective of the present study is to identify the leading medicinal plants used by local communities for the treatment of animals and document the threatened herbal knowledge from the elder formers (R1, R2 and R4) this study labels the ethno veterinary practices in different villag...
Hamida Sarwar1, Kousar Perveen1,Rida Mazhar2, Muhammad Afzal1, Syed Amir Gilani3
... on the mental health of people all across the globe, generally, and healthcare workers, particularly. This report is a cross-sectional study comprising statistical data and mental health measurements from HCW including doctors, nurses, and paramedics from DHQ Hospital, Jhelum, Punjab Pakistan during the period April 24, 2020, to May 09, 2020. Healthcare professionals in hospitals equipped...
Tehreem Zahra1, Muhammad Irfan1, Muhammad Nadeem2, Misbah Ghazanfar1, Qurratulain Ahmad3, Shaukat Ali4, Farzana Siddique5, Zarina Yasmeen6, Marcelo Franco7
...substrate concentration, peptone and KH2PO4 were optimized at three levels. The optimum carboxymethylcellulase (CMCase) activity and filter paper cellulase (FPase) activity was obtained after 96 hours of incubation with optimum conditions of media containing 5% substrate concentration, 0.05% peptone and KH2PO4 concentration of 0.5% with pH ...
Samreen Khan, Tabassum Ara Khanum, Nasira Kazi, Salma Javed* and Shahina Fayyaz
Description of Aphelenchoides acacia n. sp. and Aphelenchoides naurangiensis n. sp. (Nematoda: Aphelenchoididae) with Observation on Aphelenchoides saprophilus Franklin, 1957 from District Lakki Marwat, Khyber Pakhtunkhwa, Pakistan
...lign: justify;">Two new species belonging to genus Aphelenchoides viz Aphelenchoides acacia n. sp. retrieved from soil sample of kikar (Acacia nilotica L.), ber (Ziziphus muritiana L.) and paper flower (Bougainvillea spectabilis L.) and Aphelenchoides naurangiensis n. sp. recovered from soil samples of wheat (Triticum aestivum L.), thoroughly described and illustrated from District Lakki M...
Majid Shahi Bajestani1, Esmat Mahdikhani Moghadam2*, Reza Aghnoum3 and Hamid Rohani2
Study of Plant Parasitic Nematodes and Description of New Record (Rotylenchus alius) Associated with Barley (Hordium vulgare L.) in Khorasan Razavi Province, Northeast Iran
...rical identification 18 species were recorded belonging to nine genera. Among these species, Rotylenchus alius was found as a new record from Iran and Basiria gracilis, Boleodorus thylactus, Ditylenchus apus and Meloidogyne arenaria were reported as new host record from barley fields of Iran. Meloidogyne arenaria, was selected for detailed investigation at molecular level. Molecular traits on Meloidogyne arenaria s
Muhammad Javaid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1, Mirza Abdul Qayyum1 and Muhammad Arslan Khan1
Role of Nanotechnology in Crop Protection and Production: A Review
...d food industry i.e. nanopesticides to manage insect pests of different crops, nanofungicides to control pathogens, plant diseases and nanoherbicides for the management of weeds. It also facilitate in precision farming, targeted use of inputs i.e. nanofertilizers and to overcome the environmental stress seed treatments with nanoparticles, to improve the crop yield use of smart gene delivery system. This technology can also b...
Kui Zhang1,2, Ping Geng1, Sher Khan Panhwar3, Khadim Hussain Memon4 and Zuozhi Chen1,2,*
... commercial marine fish species in Pakistani waters. Most commercial fish species lack assessments of maximum sustainable yield (MSY) and allowable catch, a situation that hinders effective fisheries management. A Catch–MSY model based on statistical catch data and prior information on population parameters was applied to assess the total allowable catch (TAC) and MSY values for 24 commercial marine fish groups, and th...
Muhammad Aamir Naseer1, Amjad Islam Aqib2*, Ambreen Ashar3, Muhammad Ijaz Saleem1, Muhammad Shoaib4, Muhammad Fakhar-e-Alam Kulyar1, Khurram Ashfaq1, Zeeshan Ahmad Bhutta1 and Shagufta Nighat5
...tment approach, and therapeutic drug use were significantly (p<0.05) associated with rise in S. aureus in dairy milk. All the tested isolates were found 100% resistant to Cefotaxime, Fusidic acid, and Ampicillin while 60-80% of these isolates were found sensitive to Cefoxitin, Gentamicin, Trimethoprim + Sulphamethoxazole, and Oxytetracycline. Except Trimethoprim + Sulphamethoxazole, non-significant differences (p>0.05) of isolates at...
Ayesha Talib1,2, Khanzadi Nazneen Manzoor1, Wajahat Ali1, Maria Saeed1, Muhammad Asif Gondal1, Malik Badshah3 and Abid Ali Khan1*
... possibilities exist. Copper nanoparticles (CuNPs) have been synthesized from the aqueous fruit extracts of Ficus sycomorus and their physico-chemical properties as well as antimicrobial activity against Multidrug Resistant (MDR) bacteria is evaluated. The total formation of the Cu nanoparticles was observed visually with a color change and confirmed by the appearance of
Fanrong Xiao, Jichao Wang and Haitao Shi*
...hips between morphology, performance and ecology is central to understand how morphology influences fitness. Previous work has already shown that two sympatric turtles, the Keeled box turtle Cuora mouhotii and the Flowerback box turtle C. galbinifrons, have divergent morphologies and occupy different microhabitats (steep, rocky hillslopes vs gentle, less rocky hillslopes). Ho...
Babar Zahoor, Basharat Ahmad*,Riaz Aziz Minhas and Muhammad Siddique Awan
...280 kg and 149300 kg, respectively. The total estimated cost of damages due to crop raiding (grains & fodder) during 2013-2015 was $22042.31, and the crop raiding intensity during 2015 was significantly higher than 2013 and 2014 (χ2=376.16; df=2; p≤0.001). Among livestock (n=304), goats, sheep and cattle were reported killed between 2013 and 2015. The total estimated cost of livestock killings during 2103-2015 was $38260 and estimated cos...
Kecheng Zhu1,2,3, Peiying He1, Baosuo Liu1,2,3, Huayang Guo1,2,3, Nan Zhang1,2,3, Liang Guo1,2,3, Shigui Jiang1,2,3 and Dianchang Zhang1,2,3,*
...;">Myomaker is a muscle-specific membrane protein that is essential for myoblast fusion. Myomaker is regulated by myoblast determination protein (MyoD), a muscle-specific basic helix-loop-helix (bHLH) transcription factor in higher vertebrates. However, the transcriptional regulatory mechanism of the myomaker gene has not been explored in marine fishes. In the present study, molecular cloning, bioinformatic analysis a...
Yihong Tian, Yongmei Qi*, Sajid Naeem, Ke Gao and Yingmei Zhang*
...effect and mechanism of spermidine have been reported, the role of spermidine-induced autophay in cancer cell survival has not been fully elucidated yet. In the present study, we aim to investigate the effect and toxic mechanism of spermidine on cell survival using Hela cells, a cervical cancer cell line as a model. Cell viability was assessed by MTT assay. LDH leakage was determined using...
Yasir Sharif1, Saba Irshad1*, Ammara Muazzam1, Muhammad Hamza Tariq1, Ambreen Kanwal1, Sana Rasheed1, Mabel Baxter Dalrymple2 and Anam Tariq1
...iver function tests were performed. Secondary complications were assessed by physical examination of pallor, splenomegaly, ascites, and hepatomegaly. The average±SD values of patients’ CBCs and liver enzymes were: red blood cells 3.07x 1012±0.769x 1012/L, white blood cells 8.89x 109±2.849x 109/L, hemoglobin 8.01± 1.027 g/dL, platelets 321.68x 109±1.027x 109
Fan Sigang1, Guo Yihui1* and Xu Youhou2
...the ovary and testis, respectively. Reproduction-related genes, including vasa, nanos, and vitellogenin, and sex-determining genes, such as FoxL2, Dmrt, and sox9, were detected. Transcriptome comparison revealed 2,842 differentially expressed genes (DEGs), of which 591 exhibited biased expression in the ovary and 2,251 exhibited biased expression in the testis. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (...
Zhi Chen1, Toshifumi Minamoto2, Longshan Lin3 and Tianxiang Gao4,*
...ndance study of aquatic species. DNA extracting was an indispensable process to employ this method. In eDNA extracting of macro-organisms, DNeasy Blood and Tissue Kit was commonly used, but its price was about 80 RMB/sample, which was too expensive. Cheaper eDNA extraction kit was a potential aspect for improvement to ...
Asim Faraz1*, Abdul Waheed1, Ayman Balla Mustafa2, Nasir Ali Tauqir3, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal4 and Muhammad Shahid Nabeel5
...are moving towards urban/peri-urban areas of arid and semi-arid environment. This study was planned to check its production potential in extensive management system (EMS) and semi-intensive management system (SIMS). The mean milk yield and range of Marecha she-camel was found to be 5.6±0.3, 6.1±0.2 and 3-8, 5-9 kg under EMS and SIMS, respectively. The fat, protein, lactose, SNF and total solids
Neelam Pery1*, Fatima Ijaz1, Nayab Batool Rizvi1, Munawar Ali Munawar1 and Muhammad Imtiaz Shafiq2*
... the world. Several therapeutics with different modes of action are available to deal with the disease but have failed to produce universal response leaving a large proportion of patients untreated. This is due to complex pathogenesis comprising a network of signaling pathways. By controlling one pathway, the pathogenesis continues through complementary pathways. Janus kinase and bruton’s tyrosine kinase regulates a number of T-cell and B-cell mediated s...
Shazia Rasheed1*, Javed Mustaquim2 and Khalil Hasni1
...small;">In the present paper, size at sexual maturity was determined by relative growth (functional) as well as by examining the condition of gonads (physiological) in both sexes of Portunus pelagicus. During the study it was observed that the physiological and functional maturities occur almost at the same size which was from 68 to 75 mm short carapace width or 86 to 94 mm long carapace width. Male P.
Gautam Patra1*, Ana Sahara2, Sonjoy Kumar Borthakur1, Parthasarathi Behera3, Subhamoy Ghosh1, Apurba Debbarma4 and Seikh Sahanawaz Alam5
...t b gene in various species of wild birds (Upupa epops, Passer domesticus, Pycnonotus cafer, Bubulcus ibis). The birds were captured by netting system. After blood was collected from wing veins, birds were released from the cages. Blood samples were examined after staining with Giemsa stain. The positive samples were used for amplification of cyt b gene of Plasmodium relictum. Cloning and sequencing of the amplifie...
Comparative Analysis of Muscle Development in Zebrafish with Different Intermuscular-Bo nes Patterns
Jian Yang1, Guangxiang Tong2, Zhipeng Sun2, Xianhu Zheng2, Weihua Lv2, Dingchen Cao2, Xiaowen Sun2 and Youyi Kuang2*
...ng expression of muscle-specific genes and muscle structure. Five muscle-specific genes including myod, myog, myf5, mef2ca and sox6 were selected to test and verify the expression differences in embryonic development stages (3 hpf, 6 hpf, 12 hpf, 24 hpf, and 72 hpf) and post-embryonic stages (15 dpf, 30 dpf, 45 dpf, 60 dpf and 75 dpf). Compared to the wild-type
Faiqah Ramzan1,2,*, Irfan Zia Qureshi2 and Muhammad Haris Ramzan3
...small;">Discovery of kisspeptin and its receptor has enhanced our understanding of the neurobiological mechanisms that govern the pituitary-gonadal-axis. However, in sexually immature male mammals, the maturation of gonads is not clear yet. The current study tested the hypothesis that continuous kisspeptin administration suppresses gonadotropin and testosterone release and spermatogenesis....
Turgay Şişman1,*, Muhammet Çağrı Keskin1, Hatice Dane1, Şeymanur Adil1, Fatime Geyikoğlu1, Suat Çolak2 and Esra Canpolat1
...nuclear abnormalities of peripheral erythrocytes and lung, liver, and kidney histopathologies were evaluated in marsh frog (Pelophylax ridibundus) in agricultural areas. The most prominent histopathological alterations observed in lung tissue were noted as epithelial hyperplasia, thickness of alveolar septa, dilatations and congestions of blood capillaries, and melanomacrophage accumulation. An increase in the number ...
Tasleem Akhtar1, 2, Ghazanfar Ali1,* and Nuzhat Shafi2
...the present study, four species of Schizothorax had been found, in which three species were already reported (S. esocinus, S. plagiostomus and S. progastus) and one new species (S. niger) was found first time in AJK. One hundred and fifty-nine specimens of S. plagiostomus, 74 specimen...
Faryal Saad1,3, Zia Ur Rahman2, Aamir Khan3, Rabia Noushin4, Irfan Ullah5, Farman Ullah Dawar3,Shahid Naiz Khan3, Rafiqe Hussain6, Kenza Javed2, Abid ur Rehman7, Amna Fayaz3, Zohra Saifullah3 and Kalim Ullah3*
...us and pregnant women respectively. Proper in-time diagnosis of CMV is the most effective way to control this disease. Lack of health care facilities and proper screening of pregnant women for various congenital infections in the Sothern districts of Khyber Pakhtunkhwa, making the situation more worst. Therefore, this preliminary study was set to assess the seroprevalence and molecular det...
Xia Li1*, Xueliang Zhan1 and Xinjie Shi2
...ECOPD complicated with type II respiratory failure. A total of 180 patients treated in our hospital due to AECOPD complicated with type II respiratory failure were enrolled in the study and divided into study group and reference group, each with 90 patients. The study group was treated with ulinastatin and ambroxol, while general routine treatment was implemented in the reference group. The treatment outcomes were compared b...
Feng Xu1,2,3*, Weikang Yang1,2,3*, Ming Ma1,2,3 and David A. Blank4
...ator, season, traits of species and numbers of others factors were thought to have significant impacts on vigilance. Here, in this study we considered only three of them: group size, disturbance, and predation vulnerability and their impact on the vigilance of the Demoiselle crane (Antropoides virgo). Our results showed that group size, human disturbance, and predation vulnerability significantly affect Demoiselle crane’s vigilance. With increasin...
Yujun Zhao and Jianping Fan*
...i> <0.05) in a dose-dependent manner. Hence, this can be concluded that Kanglaite injection can effectively inhibit the proliferation and induce apoptosis of SW480 cells, which may be correlated with the inhibition of Bcl-2 expression, the promotion of Bax expression and the enhancement of caspase activity.
...
Amna Arshad Bajwa1, Saher Islam1, Muhmmad Imran1, Karman Ashraf2, Arman Khan1, Muhammad Farhan Khan3, Imran Rashid2, Muhammad Yasir Zahoor1, Waseem Ahmad Khan4 and Wasim Shehzad1*
...n of wild ungulates is imperative and critical, particularly for juveniles. Accurate gender determination is important for studying ecology and conservation biology. Therefore, a simple molecular technique, that is precise with non-invasive sampling approaches such as faeces, would be valuable. In the present study a set of molecular markers was developed exploiting the AMLx/y gene to assess gender of Punjab urial population...
Mudussar Nawaz1, Iahtasham Khan2, Muhammad Shakeell*, Arfan Yousaf1, Zahid Naseer1, Munibullah1, Ali Zohaib3, Riaz Hussain4 and Qudrat Ullah5
...rough MRT and i-ELISA respectively. Commercial production and old age were important risk factors for spread of brucellosis both in goats and buffaloes. A history of abortion was significantly associated (P<0.05) with Brucella positive MRT and milk i-ELISA tests. In contrast, history of stillbirth had no significant association with anti-Brucella antibody titers. In conclusion, brucellosis is prevalent in Islamabad Capital Territory.
Yahui Wang1, Ling Ren1, Yishen Xing1, Xin Hu1, 2, Qian Li1, Lingyang Xu1, Junya Li1* and Lupei Zhang1*
...sion level of adipocyte-specific genes also increased significantly in BMP4 or rosiglitazone treated cells. The result indicated that BMP4 and rosiglitazone could promote adipogenesis and be applied in adipogenic differentiation of fetal bovine derived progenitor cells.
...
...e: small;">The present paper is the first confirmed finding of the pronghorn lobster, Panulirus penicillatus in the southern coastal waters of Oman of the Arabian Sea. A single specimen was captured using a bottom set gill net at a depth of 12 m on 26 March 2019. It was male measuring 42.0 cm in total length, 17.2 cm in carapace length and weighed 3.15 kg. Description of morphologic...
Muhammad Zeeshan Majeed1*, Muhammad Shahzad Akbar1, Muhammad Afzal1, Muhammad Mustaqeem2, Muhammad Luqman3, Ijaz Asghar4 and Muhammada Asam Riaz1
...of ten indigenous plant species were evaluated for their insecticidal and repellency potential against the subterranean termite Odontotermes obesus Ramb, a destructive insect pest of wooden infrastructures, agricultural crops, orchards and forest plantations. Standard filter paper disc method was used for both toxicity and re...
Muhammad Zeeshan Majeed1*, Muhammad Afzal1,Muhammad Asam Riaz1,Kanwer Shahzad Ahmed1, Muhammad Luqman2, Mehar Zubair Shehzad1, Muhammad Bilal Tayyab1, Mujahid Tanvir1 and Saadia Wahid1
...ts (10%) of forty plant species were evaluated against Asian citrus psyllid (Diaphorina citri), armyworm (Spodoptera litura), house mosquito (Culex quinquefasciatus) and subterranean termite (Odontotermes obesus) using twig-dip, leaf-dip, aqueous exposure and filter paper-dip bioassay methods, respectively. Results revealed that the extracts of Mentha longifo...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mudssar Ali and Hasan Riaz
...i>described in current paper will lead to proper management practices during peak reproductive period of insect to avoid pest outbreak.
Tafail Akbar Mughal1, Shaukat Ali1*, Hafiz Muhammad Tahir1, Shumaila Mumtaz1, Samaira Mumtaz1, Ali Hassan1 and Syed Akif Raza Kazmi2
...le="font-size: small;">Hyperlipidemia is a condition in which blood is overloaded with lipids. This condition is challenging for living beings. There are many ways to solve this problem but herbal medicines take on paramount importance in this regard. The purpose of the current research was to inspect the effects of an aqueous extract of Berberis lycium Royleroot bark on lipid profiles of Swiss albino mice in which di...
Mehwish Saleem Khan
Evaluation of Changes in Zinc Levels in Patients Suffering from Cancer
...ore than 200 different types of cancer. Tobacco use is the cause of about 22% of cancer deaths. Another 10% are due to obesity, poor diet, lack of physical activity or excessive drinking of alcohol. Other factors include certain infections, exposure to ionizing radiation and environmental pollutants. In this study zinc level in serum of cancer patients was observed. For this purpose, the blood of 50 cancer patients was taken from MAYO HOSPITAL Lahore. The pati...
Agustine Christela Melviana1, Rizkita Rachmi Esyanti1*, Roy Hendroko Setyobudi2, Maizirwan Mel3, Praptiningsih Gamawati Adinurani4 and Juris Burlakovs5
Gene Expression Related to Steviol Glycoside Synthesis Produced in Stevia rebaudiana (Bert.) Shoot Culture Induced with High Far-Red LED Light in TIS RITA® Bioreactor System
...’s antidiabetic properties, hence a large number of plant source is required to supply the industry. To overcome the hindrances in the propagation of Stevia plants using in vivo methods, an alternative technique of propagation using in vitro methods is needed. The micropropagation method with the RITA® (Recipient for Automated Temporary Immersion System) is used in the production of a large amount of stevia biomass in approximately a short
Samia Ikram1*, Riaz ur Rehman1, Farwa Batool2 and Atyab Amjad3
Evaluation of Bird of Paradise for Commercial Flower Production by using Organic Manures
...ith a distinct flower shape of a bird and is an important commercial crop of tropical area. The present research work was designed to investigate the effect of different organic manures on the growth of Bird of paradise as commercial crop in agro metrological conditions of Islamabad during 2016-2018. Following four treatments were designed: T1 (control), T2 (Top dressing with FYM), T3 (Top dressing with leaf manure), T4 (Top dressing with sewage sludge). Maxim...
Mohammad Mohsin Faqeer1, Muhammad Aquil Siddiqui2*, Nighat Seema Soomro1, Shameem Raja3, Muhammad Tahir Khan2, Ghulam Shah Nizamani2, Fareen Deeba Soomro4 and Muhammad Mahran Aslam2
Impact of Row Spacing on the Growth and Yield Parameters of Lentil (Lens culinaris L) under Semi-arid Region of Pakistan
...ties. Three lentil genotypes (M-85, NIA Masoor 2005 and NIA Masoor 2016) were evaluated at three spacing treatments (15, 30 and 45 cm) under the RCBD. The morphological characteristics of lentil genotypes depicted that maximum germination, plant height, number of branches plant-1, number of pods plant-1, weight of 1000 seeds, seed yield, and early days to maturity were observed at 30 cm row spacing. Interaction of varieties ...
Jianjun Fu1, Shili Liu2, 3, Wenbin Zhu1, Yongyi Jia2, 3, Lanmei Wang1, Yufen Yang4, Zhimin Gu2, 3*and Zaijie Dong1*
... In this study, we developed three multiplex PCR panels, including twelve microsatellite loci for C. alburnus, and applied parentage analyses using 36 candidate parents and 136 offspring from four independent artificial breeding pilots. Based on allele frequency analysis using 36 candidate parents, the number of alleles ranged from 7 to 22, observed heterozygosity ranged from 0.39 to 0.75, and ex...
Mumtazur Rahman1, Farhan Anwar Khan1,*,Umar Sadique1, Ijaz Ahmad1, Shakoor Ahmad1, Faisal Ahmad1,2, Hayatullah Khan1,3, Muhammad Saeed1, Faiz Ur Rehman1, Ibrar Hussain1, M. Faraz Khan1, M. Izhar ul Haque1 and Hanif-ur-Rehman1,3
...se of small ruminants, especially goats. It is an economically important disease, causing high morbidity and mortality in goats. More recently Mccp Pakistan strain has been identified and isolated by our laboratory. Alarmingly, antimicrobials in animals are inappropriately using and resultantly leading to antimicrobial resistance (AMR) including mycoplasmas, which are causing serious infections in ruminants. Since the growth curve of our local strain and its s...
Xiaopeng Tang1,2* and Kangning Xiong1,2
...duced by LPS. It can be speculate that EGF repaired the injured cells by reducing cell permeability and increasing the absorption of glutamine and glucose.
...
Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo
The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...oduction of proteins and peptides to manage root-knot nematode. Mi gene resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transproteins toxic to different plant parasitic nematodes can be expressed i...
Zubia Rahim1, Gulnaz Parveen1*, Salma Gul2 and Khushnood-ur-Rehman3
Ameliorating Effects of Salt Stress (KCl, NaCl) on Growth and Germination Parameters of Pearl Millet (Pennisetum americanum)
...rowth. This research was performed to assess the effects of NaCl, KCl, a mixture of NaCl + KCl in various concentrations on the growth and germination of Pearl millet (Pennisetum americanum), locally named as Bajra. Five seeds sown in petri dishes to observe the radical, plumule length and germination percentage after treatments to 100, 150, 200 and 250mM concentration of above mentioned s...
Arifa Khan1*, Arsalan Bashir1, Shazia Erum2, Jabar Zaman Khan Khatak1 and Aish Muhammad3
Effects of 6-Benzylaminopurine and Indole-3-acetic Acid on Growth and Root Development of Banana Explants in Micropropagation
...y;">The purpose of the experiment was to find out the impact of various combinations of growth regulators 6-Benzylaminopurine (BAP cytokinins family) and Indole-3-acetic acid (IAA auxin family) on growth and root induction of banana explants micro-propagated in vitro. Explants were obtained from young suckers of 8818-william, Pisang and Brazilian varieties. The explants were cultured in vitro containing MS media and different BAP and IAA combinations. The resu...
Muhammad Abdullah1, Syed Attaullah Shah1, Khurram Nawaz Saddozai1, Jahangir Khan1*, Mohammad Fayaz1, Irfan Ullah1* and Sabeeh Ullah2
Analysis of Agricultural Land Price Determinants and Policy Implications for Controlling Residential and Commercial Encroachments: Facts from District Swabi (Pakistan)
...ricultural land prices depends on agricultural and location attributes and this is consistent with the Ricardian’s Land ‘Rent’ and Von Thunan’s ‘Land Location’ theories. Based on these findings, the study recommends that agricultural land must be protected through laws from residential and commercial encroachments. Investment in development of agricultural infrastructure and provision of subsidized on important inputs could ...
Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman
Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
...gn: justify;">The insect pests of stored food commodities are not only the pests of bulk grains but also of many value-added food products in mills, processing plants and storage facilities where these products are stored. The residual efficacy of spinosad was assessed by exposing the Oryzeaphilus surinamensis, Tribolium castaneum and Trogoderma granarium to the treated commodities (wheat, maize, rice and oats) at concentrat...
Sajid Khan* and Shahnaz Akhtar
Effect of Farm Labor Transformation on Households Income in Central Districts of Khyber Pakhtunkhwa, Pakistan
...tan. Data on different aspects of farm labor transformation were collected through a well-designed and pre-tested questionnaire. Nine village councils from three districts were selected through random sampling techniques. The data were collected from 393 sample households and were analyzed by using paired sample t-test through Statistical Packages for Social Sciences (SPSS) and descriptive statistics, percentages, and rank o...
Masoud Hassani1* and Omid Madadgar2,3
Serological Evidence of Bluetongue in Iran: A Meta-Analysis Study
...CI= 20.8–71.5), respectively. The estimated pooled odds ratios between abortion history and bluetongue infection estimated among sheep (OR=1.75, 95 % CI= 0.84 to 3.68) and goat (OR=2.93, 95 % CI= 1.26 to 6.80). A well-defined control strategy for preventing and controlling BTV spread in Iran should be based on further studies on BT epidemiology and BTV serotypes, vector control, animal movement restrictions and vaccina...
Abdul Majid Khan1,*, Muhammad Tahir Waseem1, Rana Manzoor Ahmad2, Ayesha Iqbal1, Hafiza Imrana Naz1, Amtur Rafeh1 and Muhammad Ameen1
...e: small;">The present paper reports the first record of Eotragus noyei from the late Miocene deposits of Dhok Pathan Formation, Chakwal, Pakistan. The sample comprises maxillary and mandibular fragments along with isolated upper and lower teeth. The morphometric analysis of the dental specimens led us to recognize the sample as belonging to Eotragus noyei, which has been con...
Yaqiu Liu1, Zhijian Wang 2, Xinhui Li 1*, Jianrong Zhao2 and Weitao Chen 1
... were selected for the experiment. The experimental specimens were separated into three modes: control group (n = 50) without any stress treatments; inhibited group (n = 50) with gut respiratory inhibition; and an air-exposed group (n = 50) with gill respiratory inhibition. After a 7 d acclimation for the inhibited and air-exposed groups, individuals were returned to the same conditions as...
Muhammad Mohsin1, Yin Hengbin2,* and Zhang Luyao3
...in Shandong, China, is experiencing overexploitation or not by estimating its stock status. For this purpose, long data series, 2006-2016, comprised of catch and effort figures was statistically analyzed to know maximum sustainable yield (MSY) of this resource and its ongoing regime. In total, three surplus production models (SPMs) were used in this study, viz., Fox (FM), Schaefer (SM) and Pella-Tomlinson (PTM) with the help of two famous fishery statis...
Ye Ge1,2,3, Qiucheng Yao1, Hongliang Chai3, Yuping Hua3* and Guohua Deng2*
...e ability to cross interspecific barriers and have the potential to infect mammals. We analysed the level of cytokine expression in response to four H6 AIVs in CEFs and DEFs using real-time PCR. The results showed that the viruses from wild birds could induce a higher level of cytokine expression in CEFs than in DEFs. These findings suggested that H6 AIV in wild birds, especially migratory spe...
Inga Kowalewska-Łuczak1 and Ewa Czerniawska-Piątkowska2,*
...iety). Analysis of genotypes of individual species was carried out using the PCR-RFLP. The frequency of the most occurring alleles for the individual polymorphisms studied was the following g.18174 A>G NCF4 gene A-0.807;
Syed Zakir Hussain Shah1*, Muhammad Afzal2, Mahroze Fatima3, Syed Makhdoom Hussain4 and Tanveer Ahmed5
...e: small;">A factorial experiment under completely randomized design was conducted by using citric acid (CA) supplementation (3 levels) and phytase (PHY) supplementation (3 levels) as the main effects. CA was supplemented at 0, 1.5 and 3% and PHY was added at 0, 750 and 1000 FTU/kg diet in a 3 × 3 factorial arrangement. All the nine test diets were contained 37.6% crude protein and 4.72 kcal/g gross energy. Results showed improved (p<0.05) dry ...
Jin-Juan Wan, Mei-Fang Shen*, Hui Xue, Hong-Yan Liu, Mei-Qin Zhang, Xi-He Zhu and Chong-Hua Wang
...ding frequency on growth performance, antioxidant status and immunity of juvenile red swamp crayfish Procambarus clarkia (average weight: 3.01±0.02 g). Crayfish were randomly assigned to one of five feeding frequencies (1,2,3,4 and 5 times/day, F1, F2, F3, F4 and F5) following the same ration size for 60 days. After the feeding trial, fish were challenged with white spot syndrome virus (WSSV) and cumulative mortality was recorded for the next 4 d...
Yonghua Liu*, Xianhua Li, Xiongfei Yan and Gang Li
...rtricidae), is a serious pest on fruit trees in North China. Under laboratory conditions (temperature 25 ± 1ºC, 80 ± 5% relative humidity, photoperiod 14L:10D), the effect of the 4 host plants Armeniaca vulgaris (apricot), Malus pumila (apple), Prunus salicina (plum), and Amygdalus persica (
Xuya Zhou1, Ying Liu1, Deqin Xu1, Jie Bao1, Yaru Cao2 and Yong Jin3*
...vascular side effects. Type 2 diabetic rat model was induced through feeding with fodder containing high sugar and lipid and intraperitoneal injection of streptozotocin. The adjuvant-induced arthritis model was established by Paraffin/BCG. We used western blot to explore the protein expression levels of COX-2 and cytochrome P450 (CYP) 4A1. The expression of CYP4A1 was detected by immunohistochemistry. Enzyme-linked immunosor...
Muhammad Jamal Nasir*, Atiq Ur Rahman and Anwar Saeed Khan
Assessment of Irrigation Development in the Small Dams Command Area: A Case Study of Palai Dam, District Charsadda
...million hectares have no permanent water for agriculture and mostly dependent on rainfall for irrigation. The development and management of water resources are of extreme importance for the sustainable development of agriculture specifically in rain-fed areas. Palai dam is a small irrigation dam, constructed on River Jindi, some 40 km north of Charsadda town. The present study is an attemp...
Inam Ur Rahman1, Syed Faizan Iftikhar2, Sanam Wagma Khattak3*, Wajahat Ali1, Azra4 and Sajad Ali1
South Asian Experience of Trade Liberalization: Implications for Food Security
...th Asian economies for a period of 24 years by utilizing the fixed effect and random effect estimation techniques. The trade liberalization link has been explored separately with each dimension of the food security. The empirical results show that the trade liberalization have negatively affect the food availability, accessibility and stability in the case of South Asia, while the food utilization is found to be positively associated with trade liberalization....
Syed Muhammad1*, Badar Naseem Siddiqui2, Farhat Ullah Khan1 and Nawab Khan3
Self-perceived Constraints of Extension Field Staff Affecting their Working Efficiency in Khyber Pakhtunkhwa, Pakistan
...purpose to find out self-perceived main constraints, affecting the efficiency of EFS in the province of Khyber Pakhtunkhwa, Pakistan. Five districts out of 26 were randomly selected one each from eastern, western, northern, southern, and central districts of the province. At second stage, two tehsils were randomly selected from each selected district for data collection. Data was collected personally through validated and pr...
Ghulam Murtaza1*, Muhammad Ramzan2, Amna Razzaq4, Muhammad Numan3, Rukhsar Beanish4, Ayesha Zafar4, Muhammad Shan Latif3 and Muhammad Adnan3
Screening of Brinjal (Solanum melongena) Varieties against Jassid, Amrasca bigutulla bigutulla
...h results necrosis. An experimental study was conducted by using randomized complete block design (RCBD) during 2018 to check the resistant brinjal varieties (Nirala, Dilnasheen and Bemisal) against jassid (A. bigutulla bigutulla). The highest population of jassid was recorded on 5 November while lowest on 2 December on all tested varieties. The population density was lowest in December on all varieties such as Nirala (1.0), Dilnasheen (2.1) and Bemisal (1.2),...
Asifa Kamal1*, Ghazala Noreen1 and Muhammad Amin2
Trends and Determinants of Fertility in Pakistan: Multivariate Decomposition Analysis (PDHS 1990-91 to PDHS 2012-13)
... both spouses and survey periods (2006-07, 2012-13) has significantly negative effect on the total children ever born to women in Pakistan. Child mortality (yes), husband’s desire for children (more than wife), ideal number of children, marital duration and ever use of contraceptives has significant positive contribution towards women fertility in terms of number of children ever born to women. A significant decline in fertility is observed for the two <...
Adeen Kiran1, Umar Farooq Gohar1*, Ayesha Farooq1, Malik Muhammad Asif2 and Hamid Mukhtar1
Redressal of Antibiotic Resistance using Plant Extracts
...recent years different experimental approaches highlighted the importance of phytochemicals present in plants and its ability to kill these pathogens and microbial inability to develop resistance against these pathogens. Therefore, the trend has been shifting from using synthetic or semi-synthetic antibiotics to the use of medicinal plants which are the part and parcel of traditional medicines. Thus, this review article explains the different mechanisms adopte...
Yifan Ni1, Jian Liu1, Fen Wu1, Jianfeng Cai1, Jinzhi Zhang1*, Jianqing Hua2 and Jiping Fu2
...sed to examine the genotypes, and DNA sequencing method was employed to detect the potential SNPs in this study. There were two SNP loci found in these genes totally. One mutation (G→A) was detected in exon 1 of MDR1 gene, which caused a synonymous mutation of amino acid (Leu→Leu), the other one (T→A) in exon 7 of OPN gene, resulting in a non-synonymous mutation (His→Gln). The association analysis indicated that the GG genoty<...
Yongmei Gao1, Peihong Gao2, Yanjun Wang3, Jinhua Han4 and Yang Shu1*
...ndomly divided into an experiential group and a control group, each containing 80 patients. The experiential group was treated with mifepristone and Guizhifuling capsule, and then subjected to high quality nursing. In contrast, the control group was treated with only mifepristone therapy and applied with routine nursing measures. The therapeutic and nursing effects of the two groups were c...
Saima Siddique1* and Zarrien Ayub2
... and management of this species in Northern Arabian Sea.
...
Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Shehzadi Saima4, Muhammad Suhaib2, Muzammil Husain3, Haris Khurshid1 and Shahid Ali Khan1
Effect of Temporal Application of Gypsum on Mineral Uptake and Economically Important Morphometric Traits in Groundnut (Arachis hypogea L) under Rain-fed Conditions
...t the time of sowing and pegging compared with Check (T0). Results showed significant differences among treatments for yield and related agronomic traits as well as mineral concentration in response to gypsum application. The highest pod yield (3522.2kg/ha), root biomass (9.03g/ plant), and nodules (382/ plant) were observed in treatment T3. The calcium concentration (0.80 %) in shoots of T3 was the highest. In the present study application of gypsum at the ti...
Muhammad Iqbal1, Muhammad Ehetisham ul Haq1*, Muhammad Kamran1, Muhammad Idrees1, Shahid Nazir2, Ihsan Ullah3, Sumera Naz1, Shaukat Ali1 and Muhammad Zafar Iqbal2
Morpho-Molecular Characterization of Xanthomonas Axonopodis Pv. Citri Associated with Kinnow (Mandarin) and its Management
...ns of dollars have been spent annually on quarantines, prevention, eradication and management programs around the globe. The present study was coined to record the incidence of the disease in the Sargodha districts of the Punjab province. Furthermore, isolated bacterium from diseased samples was characterized morphologically and molecularly. The relative efficacy of commercially available antibiotics against the pathogen was evaluated in the lab and in field c...
Arshad Mahmood Malik1*, Hafiz Muhammad Tayyab1, Muhammad Arshad Ullah2 and Muhammad Talha Bilal3
Dynamics of Salinity and Land Use in Punjab Province of Pakistan
...nity in the country. The percent area under wheat crop has inverse relationship with salinity indicating strength of wheat cultivation against salinity. It is therefore three prong strategy is recommended with different roles and responsibility on the part of Farming community, public sector and research institutions. Results of the study have important implications for planners and policy makers in developing projects to mitigate salinity in the country....
Luqman* and Zahid Hussain
Impact of Tillage Tools and Weeding Regimes on Nutritive Values of Maize Grains
..., 6.7, 1.0 and 92.5%, respectively) in the full season weeded treatments, followed by weeding for 12 weeks and so on. Similarly, lowest crude protein content, fat content, ash content and dry matter content (12.3, 4.6, 0.85 and 87.1%, respectively) were found in the full season weedy treatments, followed by weedy for 12 weeks, and so forth. For the interaction between tillage and weeding regimes, the maximum crude protein co...
Anjali Khadka1*, Subodh Raj Pandey2, Subarna Sharma Acharya3, Amrit Poudel4 and Sushma Adhikari1
Morphological Evaluation and Multivariate Analysis of Soybean Glycine max (L.) Merrill Genotypes in Western Mid-Hills of Nepal
..., the varietal trial was performed at Regional Agricultural Research Station (RARS), Lumle, Kaski, Nepal. Sixteen soybean genotypes were placed out in a randomized complete block design with three replications. According to mean performance, the genotypes F778817, G-1873 and KAVRE performed better and were found high y...
Ahmed Weli Hussein Osman1,2, Rakibul Islam1, Md. Bazlar Rashid1, Abdiaziz Idiris Mohamud2,3* and Pravin Mishra4
Nanoparticle Tactics for the Oral Delivery of Insulin in Alloxan-Induced Hyperglycemia in Rat (Rattus norvegicus domestica) Model
...tify;">Administration of peptide drugs like insulin through the oral avenue specially the gastro-intestinal tract represents the great challenges. Polymeric nanoparticles are suitable colloidal carriers for insulin delivery. The current study was carried out to evaluate nanoparticle tactics for the oral delivery of insulin in the alloxan-induced hyperglycemia in rat model. Twenty male rats...
Shafii Abdullahi Mohamed1, Abdiaziz Idiris Mohamud2*, Yonis Abukar Mohamed3, Pravin Mishra4 and Osman Sheikh Ali Jama5
Assessment of Knowledge, Attitude, and Practices of Population Towards Brucellosis in Benadir Region, Somalia
...alth care workers and respective government bodies must take action to increase the level of awareness and considerate by providing programs or any other technique that can be helpful....
Abdul Hameed1*, Ihtsham ul Haq Padda2 and Abdul Salam3
Estimating Food Consumption Patterns in Pakistan by Using Ideal Demand System
...;">The purpose of this paper is to examine the behavior of national and regional food consumption and purchasing power to develop food security policies. This study estimates the demand for food in Pakistan through indirect expenditure and price utility functions, using integrated household economic survey 2015-16 data and the nonlinear quadratic almost ideal demand system. The paper findi...
Muhammad Ali Shah, Faiz Ur Rehman, Abbas Mehmood, Fareed Ullah, Sayed Irfan Shah and Syed Majid Rasheed*
Combining Ability, Heritability and Gene Action Assessment in Rapeseed (Brassica napus L.) for Yield and Yield Attributes
...ied traits. General and specific combining ability analysis revealed non-significant results for the traits under consideration, suggesting the involvement of non-additive type of gene action. A higher broad sense heritability estimate was evident. It was concluded from the combining ability analysis of the present study that genotype 2702 was best general as well as a s
Sidra Shehzadi, Sher Bahadar Khan*, Umar Sadique and Saqib Nawaz
Isolation and Molecular Identification of Clostridium perfringens Type D in Goats in District Peshawar
...a, caused by Clostridium perfringens Type D, is a disease of domestic animals particularly sheep and goat widespread in Pakistan due to endemic outbreak in every spring season; therefore the current study was conducted for isolation and molecular identification of new strains of C. perfringens Type D for effective diagnosis, treatment and vaccinati...
Ghulam Rabbani1, Uzma Javed1*, Javed Iqbal2, Ruqeah Mustafa3, Ghulam Shabbir2 and Fida Hassan Shah4
Barani Mash a Newly Developed Disease Resistant and High Yielding Mash Cultivar for Rainfed Areas of Punjab, Pakistan
...s process as older genotypes become increasingly susceptible to biotic and abiotic stresses. The newly developed mash cultivar “Barani Mash” is an elite mash cultivar with yield potential of 1743 kg/ha. This cultivar has resistance against diseases and lodging, the pod size is medium and 100-seed weight is 4.73 g. It has been developed through screening from the local material....
Muhammad Shahzad Akbar, Farrukh Sajjad, Muhammad Afzal, Muhammad Luqman, Muhammad Asam Riaz and Muhammad Zeeshan Majeed*
Field Evaluation of Promising Botanical Extracts, Plant Essential Oils and Differential Chemistry Insecticides against Subterranean Termites Odontotermes obesus (Isoptera: Termitidae)
...termites are destructive pests of agricultural crops, forest and orchard plantations and wooden infrastructures. A wide range of persistent synthetic chemicals are employed to prevent and control the infestations of subterranean termites. Most of these chemicals have high mammalian toxicity and environmental hazards. This study was, therefore, aimed to evaluate the efficacy of some promising botanical extracts (Dodonaea visc...
Muhammad Luqman1*, Roshan Hussain1, Muhammad Yaseen1, Muhammad Umer Mehmood1, Ijaz Asghar2 and Usman Saleem1
Comparative Analysis of Dietary Intake Patterns of Rural and Urban Communities of Southern Punjab, Pakistan
...f the respondents were dependent upon business and farming as their livelihood source. Among rural communities, food group of fats and sugars was much popular and urban community of study area was much inclined towards the food group of carbohydrates. Specifically, in breakfast both of the communities prefer proteins with fats and sugar commodities. In lunch rural community is much attracted towards carbohydrates and dairy p...
Amjed Ali1, Rafi Qamar1*, Muhammad Ehsan Safdar1, Salman Saleem2, Sami Ullah3, Muhammad Arshad Javed4 and Syed Wasim Hasan5
Development and Growth: Influence of Sowing Dates on Performance of Cotton Cultivars
...e, this one-year field experiment was performed to assess the result of varying cultivars and sowing dates on developmental and allometric traits of cotton (Gossypium hirsutum L.) under the agro-ecological conditions at Sargodha, Punjab, during Kharif season, 2015. The study consisted of i) three cultivars viz. Bt. FH-142, Bt. MNH-886 and FDH-170 and ii) three sowing dates viz. 21st April, 5th May and 20th May. Cultivars and...
Sajid Ali1, Abdul Basit1,3*, Abdul Mateen Khattak1, Syed Tanveer Shah1, Izhar Ullah2, Noor Alam Khan3, Imran Ahmad1, Kamran Rauf1, Salman Khan1, Irfan Ullah1 and Intizar Ahmad1
Managing the Growth and Flower Production of Zinnia (Zinnia elegans) through Benzyle Amino Purine (BAP) Application and Pinching
...ays to flowering, flower persistency, branches, leaves and flowers plant-1 and stem thickness. While in case of untreated and un-pinched plants maximum flower diameter, fresh and dry flower weight, and height of plant were reported. Hence, it is concluded form the research study that BAP application (@100 mg.L-1) reduced height of plant, enhanced number of flowers per plant and also lateral branching in zinnia plants. Moreov...
Shujaat Ali1,2*, Tariq Ahmad Jan3, Khalil Ur Rahman3, Shah Masaud Khan2, Ijaz Hussain2, Waseem Ahmad2, Qasim Ayub2, Muhammad Abbas1 and Israr Ahmad1
Effect of Room Condition on Sweetening and other Chemical Components of Different Cultivars of Potato in Swat District
...ign: justify;">The lab experiment was conducted in 2016-2017, to evaluate the influence of storage at room condition on sweetening and other chemical components of potato tubers in Swat District, Pakistan. Tubers of the three cultivars, Desiree Diamont and Kruda were stored at room condition in three replications for 90 days. Data was recorded at 0 day (fresh) and at 15 days interval on Reducing Sugars (RS), Total Sugars (TS), Dry Matter (DM), Total Starch (TS...
Ali Zohaib1*, Habib Ullah2, Shakeel Ahmad Anjum2, Tahira Tabassum2, Muzzammil Hussain1, Mohsin Nawaz3, Ghulam Abbas4 and Sohail Irshad5
Effect of NPK Fertilization Strategies on Growth, Yield, Nutrient Use Efficiency and Economic Benefits of Relay Intercropped Wheat in Cotton
.... This 2-years study was performed to investigate the influence of different strategies related to NPK fertilization timing viz. T1 (control, no NPK application), T2 (all PK at sowing, ½ N at tillering and ½ at booting), T3 (½ PK at sowing, ½ NPK at tillering and ½ N at booting), T4 (all PK at sowing, ½ N at sowing and ½ at tillering), T5 (all PK at tillering, ½ N at tillering and ½ at booting), T6...
Muhammad Saeed Shah1, Fazal Nasir2, Sana Ul Haq1 and Muhammad Tahir Khan2*
...mful antigens. In this paper, the concept of biological immune system, idiotypic network theory and clonal selection theory are applied in multi-robot cooperation. Idiotypic network theory governs the stimulation and suppression of an antibody in response to an antigen. Clonal selection theory represents how immune cells mutate and proliferate into memory cells. The methodology presented in this pape...
Numan Habib1*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2
Thermal Simulation of Grain During Selective Laser Melting Process in 3D Metal Printing
...ign: justify;">In this paper, effect of laser scanning speed and grain size of powder of three different materials Aluminum 7075, AM100A Magnesium and UNS C85500 yellow brass are investigated. A Gaussian distribution type laser having 100-watt power and 100 m spot size is used. Simulation is carried out on a single grain, directly exposed to the laser. The prime goal of this study is to in...
Imran Ahmad Rana*, Muhammad Ali Yab and Ch. Abdul Rehman
Quality Engineering Tools Implementation a Comparison of Indian and Pakistani Business Organizations
... business organizations operating in South Asia (India and Pakistan) and highlight such dimensions which contribute to the success. Instrument used for survey was built on quality engineering and management system elements. Study has yielded key outcomes which highlight that social dimension in use to practice SS in both of countries like behaviors and quality roles were varied. Moreover, results obtained from regression analysis display that there are also di...
Muhammad Amir1*, Syed Waqar Shah1, Salman Ilahi1 and Michael J. Pont2
Integrating TTC-SC5 and TTC-SC6 “Shared-Clock” Protocols
...hitectures we have developed two new SC protocols based on star topology. In both bus and star-based designs, the Controller Area Network (CAN) protocol was used for network communications. Previously we have demonstrated that both new protocols in their individual capacities have the potential for addressing issues relating to Time-Triggered Cooperative (TTC) scheduling, Time Triggered bus-based CAN networks and the Single ...
Muhammad Shaheen
Mining Patterns from Complex Energy Dataset: A Case Study of Pakistan’s Energy Sector
...guarantees long-life prosperity of a nation include energy sector. The role of energy in social, economic and environmental factors defines its prominence in sustainability. To ensure sustainable energy development the consumption and production patterns may comply with each other and may also comply with the conditions of sustainability. This paper reviewed the current state of energy in Pakistan and proposed an automated i...
Muhammad Kashif Khan1*, Muhammad Wasim Jan Khan2, Kaleem Ullah Jan Khan3, Muhammad Ishaq Khan4, Muhammad Faheem Jan Khan5 and Abdul Salam Lodhi6
Impacts of Construction Risk Attributes on Organizational Performance of Registered Construction Companies in Khyber Pakhtunkhwa, Pakistan
...rs on the organizational performances. The relationships between risk factors in the fields of Site Conditions, Resources, Project Parties, and Project Features and organizational performances including Profitability and Cost Risk Impact are developed through regression analysis using SPSS software. It is hoped that this research work will inform all con...
Mohammad Adil1*, Muhammad A. Khan2, Naveed Ahmed1, Edward Bromhead3, Muhammad A. Arshad1, Muhammad Fahad1, Shahid Ullah1 and Khan Shahzada1
Numerical Investigation of the Effect of Column Staggering in Flat Slabs Systems
...affecting the structural performance of the slabs as well as columns. Wide parking and halls could be constructed and architects will have more freedom and flexibility in their designs with reduced reliance on structural design. This study is focused on the basic flat slab analyses and design with the help of finite element software along with manual method of analyses and design called “yield line method” applied to staggered column arrangement. T...
Mehreen Ijaz
Effect of Weave Type on Tensile Strength of Cotton Fabrics
...re made with different types of fibers and yarns for multiple reasons. It is very crucial to choose the right and appropriate type of construction technique for various functional purposes. Because it plays an important role in determining the performance behavior of finished fabric. Weaving is one of the commonly used technique and different types of we...
Jun Yan Bai1*, Ren Tao Di Wu2, Qiang Zhang2, Di Bao2, Le Ma Dao2 and Xing Hua Tian3
... body length of AB genotype labeled LCA33 was significantly higher than that of AA genotype (P<0.05), and the chest circumference, tube circumference and body weight of AB genotype were significantly higher than those of AA genotype and AC genotype (P <0.05). The chest circumference and body weight ...
Muhammad Faisal Ayoob1,2, Zaheer Ahmed Nizamani1, Asghar Ali Kamboh3, Mansoor Ayoob4, Waseem Ali Vistro3 and Abdul Sattar Baloch3*
...gy and transmission of experimental velogenic viscerotropic newcastle disease (VVND) in Japanese quails and mynas. Both birds were divided into Q1, Q2, Q3, M1, M2 and M3 group each of four bird. The birds of group Q1, M1 and Q2, M2 were administered with 0.3ml of VVND virus (1.8×109 EID 50)via intramuscular and oral routes, respectively, whereas, birds of group Q3 and M3were kept in contact exposu...
Haseeb Nisar1, Usman Pasha1, Kiran Hanif1, Rizwan Abid1, Rehan Ahmad Khan Sherwani2, Haja N. Kadarmideen3 and Saima Sadaf1*
...d in several studies, we performed the systematic literature search on IL-6 -572 G/C polymorphism (rs1800796 SNP) and assessed its association with RA in the overall world population, and in the subgroup analysis of Asian and Caucasian populations. The results showed that in overall population, IL-6 -572 G/C shows a significant association towards increased risk of RA in allelic (OR=0.8130, 95%CI=0.708-0.932, p=0.003), co-dominant and dominant models; same hol...
Zhilong Tian1, 2, Yuqin Wang2, Jishun Tang1,3 and Mingxing Chu1*
...say was applied to genotype SNP loci of the SYNE2 gene. In this study, four SNPs were identified and that SNPs were identified that involved in amino acid changes. Population genetic analysis indicated that SYNE2 gene g.73310578G>A, g.73312791A>G showed moderate polymorphism (0.25<PIC<0.5) in Small Tail Han sheep. Furthermore, g.73310578G>A and g.73312791A>G loci were closely linked in STH (r2 > 0.33). Association ...
Q. Sun1, Q. Liu1, R. Di1, Y. Wang1, S. Gan2, S. Liu2, X. Wang1, W. Hu1, X. Cao1, Zh. Pan1, X. Guo1, Y. Yang3, H.E. Rushdi4* and M. Chu1*
...imal and food source for people worldwide. The fat tail/rump is considered as an adaptive selection under harsh challenges which serves as a fat store for the animal. Thyroid hormone responsive (THRSP) is a crucial protein for cellular de novo lipogenesis. THRSP gene encodes a nuclear protein which regulates fatty acid synthesis in lipogenic tissues. Identification of single nucleotide polymorphisms (SNPs) of sheep THRSP gene and their ass...
Sukhpreet Kaur Sidhu*, Gurkirat Singh Sekhon, Randeep Kaur Aulakh and Tejdeep Kaur Kler
...hydrological system; and perform diverse roles in the biosphere. The present study on ponds was carried out on avian diversity and its services of composition in relation to vegetation distribution to understand their biodiversity. Four natural ponds and one man-made pond were surveyed at three locations viz. Ludhiana (location I), Ropar (location II) and Ferozpur (location III) falling in three agro climatic zones. A total of 51 bird s
Saima Yaqub1, Tahir Yaqub1*, Muhammad Zubair Shabbir2, Asif Nadeem3, Aziz-Ul-Rahman1, Muhammad Furqan Shahid1, Zarfishan Tahir4 and Nadia Mukhtar4
...uences representing subtype A (n = 12; 46.15%), CRF02_AG (n = 6; 23.08%), subtype C (n= 5; 19.23%) and subtype G (n = 3; 11.54%). Subsequent to genotyping resistance interpretation algorithm, one major (M46L) and two accessory (N88D, L89V) PIs mutations in the protease region while four NRTI (D67T, K70R/Q, M184V and T215F) and four NNRTI (V108T, E138A, V179I and Y181C) mutations in the rev...
Chaojie Yang1,2,3, Haishan Wang1,2,3, Le Ye1,2,3 and Zhi Chen1,2,3,*
...">The identification of species constitutes the basic step in phylogenetic studies, biodiversity monitoring and conservation. The morphological descriptions and DNA barcoding study about Muraenesocidae in the East China Sea were old, rough and deficient. Morphometric measurements and meristic counts were taken for all collected Muraenesocidae samples in our present study. Teeth characters that are conclusive for the species ...
Salim Raza1*, Khan Gul Jadoon2, Sajjad Hussain1, Zahid ur Rehman1, Saira Sherin1 and Noor Muhammad1
Mitigation Plan for Identified Problems Faced by the Marble Industry in Khyber Pakhtunkhwa
... and US etc., have developed their marble sectors on scientific grounds by applying modern techniques. Pakistan also hosts huge reserves of different qualities of marble but this sector could not developed to the international standards due to a number of difficulties. As a result of these problems, the raw marble excavated from quarries carries less economic value and could not compete in...
Mardan Aghabey Turghan1, Roller MaMing1*, Li Weidong2, Di Jie1 and Xu Guohua1
...dated checklist of bird species that occur in the Arjin Mountain Nature Reserve and its adjacent areas, including parts of Kunlun Mountain, Qimantagh and Kumkul Basin, is provided as part of the basic data for a second nation-wide field survey of wildlife resources of China (2010-2020). The information provided is based on field observations made from 2010 to 2017. A total of 172 bird species belonging to 95 genera of 42 fam...
Jiawei Zhang1,2, Thomas Quirke1, Shibao Wu2*, Shaoshan Li2 and Fidelma Butler1
...ont-size: small;">This paper describes an assessment of the Impact of weather changes and human visitation on behavior and activity level of Humboldt penguin (Spheniscus humboldti) in captivity. The study is based on activity time-budgets from a flock of over 20 birds at Fota Wildlife Park, Cork, Ireland, gathered during daytime observations over a six month period. The results show...
Muhammad Nawaz Kandhro1*, Zulfiqar Ali Abbasi1, Aijaz Ahmed Soomro1, Naimatullah Leghari2, Muhammad Ibrahim Keerio3, Ahmed Naqi Shah1, Ghulam Murtaza Jamro4, Nadia Mangrio1 and Shazia Parveen Tunio5
Evaluation of Irrigation Frequencies and Seed Priming with Plant Nutrients on Growth and Yield of Sunflower (Helianthus annuus L.) Genotypes
...justify;">The role of proper irrigation frequency is very essential to obtain optimum yield potentials. Seed priming by water and different nutrients enhances the germination, establishment of seedling, growth and ultimately yield of crop. The experiment was conducted at Students’ Experimental Farm, Sindh Agriculture University, Tandojam during autumn 2017 and 2018 for two consecutiv...
Zohaib Ahmad Hassan1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Usman Saleem3, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz4, Khurshid Ahmad Mufti5 and Aamer Sattar2
Toxic Effects of Sodium Bicarbonate (NaHCO3) on Growth and Yield of Rice
...n Ratio (SAR) were developed in the normal soil. This experiment comprised of 7 treatments that were repeated three times according to Completely Randomized Design (CRD). These treatments included; T1= Control, T2= 15 SAR, T3= 20 SAR, T4= 25 SAR, T5= 30 SAR, T6= 35 SAR and T7= 40 SAR. Subsequently NaHCO3 was added to the soil as per treatment plan and ad...
Bilal Pervaiz Khan1, Neelam Ara1, Shujaat Ali1,2*, Kamran Khurshid Baigh1 and Abdul Wahab1
Effect of Seed Priming on Radish with Different Nutrients at Various Soaking Durations
... radish. The result of experiment showed that the highest germination percentage (86.4 %), percentage of survival (83.6 %), minimum days to emergence (9.1), tallest plant height (41 cm), yield of leaves plant-1 (14.4), leaf area (295.8 cm2), root length (20.6 cm), root weight in g (522.4) root diameter in cm (4.51), and total yield (23.8 tones ha-1) were obtained when seeds were soaked in ...
Li Yao1,2,3, AnQing Zhang1,2,3, HaiYan Zhang2, Jian Shao1,2,3, Ming Wen2,4, ChangAn Wang5, HaiBo Jiang1,2,3,* and Ming Li6,*
...queous extract on growth performance and nutritional composition of rainbow trout (145.56 ± 4.12 g) (Oncorhynchus mykiss) fed five different diets, including 0 (EUO-0), 5 (EUO-5), 10(EUO-10), 20 (EUO-20) and 40(EUO-40) g kg-1 EUO bark aqueous extract. The muscle lipid of fish in EUO-40 was significantly higher than that in other groups (p < 0.05), and fish in EUO-0 showed significantly lower muscle crude lipid content than th...
Adnan Khan1, Rifat Ullah Khan1, Muhammad Subhan Qureshi2, Muhammad Mobashar3, Ali Gohar4, Shakoor Ahmad1, Kamran Khan5, Hamayun Khan1 and Shabana Naz6*
...ity parameters. Highest sperm progressive motility, sperm plasma membrane integrity were observed in T2. It reflects high damages at T3 and T1 due to cryo shock and oxidative stress respectively. Sperm DNA integrity and pH were increased linearly from T1 to T3. The dead sperm percent...
Yuan Xing, Congming Tan, Yan Luo and Wenjun Liu*
...t cells, smooth muscle hyperplasia, airflow obstruction, hyperactivity enhanced, ultra-structural remodeling, and airway mucus production. The current experimental study was aimed at scrutinizing quercetin’s inhibitory effect on airway inflammation in mice and its possible mechanism of action. The mice received varying doses of quercetin from 22-30 days (1, 10 and 50 mg / kg, p.o.) a...
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
...ng the jugular vein in eppendorf comprising EDTA as anticoagulant coated tubes for the detection of Theileria piroplasms. DNA was extracted from collected samples and subjected to PCR amplification to determine ovine and caprine theileriosis. Through a questionnaire, the data regarding animals as well as herds characteristics were gathered to define the risk factors favors the spread of Theileria spp. infection. 24% and 8.5% Theileria infection identified thro...
Noor Ayaz1*, Faiza Aman1, Sidra Saleem1*, Maqbool Rehman1 and Muhammad Fahim2
Olive Cuttings as Affected by Different Concentrations of Indole Butyric Acid
...to rooting, and survival percentage. Significant differences (P≤0.01) were observed among olive cultivar treated with different IBA concentrations for days to 50% sprouting, days to rooting, and survival percentage, while non-significant differences were observed for the number of leaves cutting-1, number of sprouts cutting-1 and sprouts length cutting-1. The cuttings treated with IBA @ 3000 mgL-1 took fewer days to sprou...
Said Sajjad Ali Shah1*, Muhammad Ilyas Khan1, Aziz Ullah1, Hayat Ullah2 and Faisal Ahmad2
Coprological Examination of Small and Large Ruminants in Central Zone of Khyber Pakhtunkhwa
...">Parasitic infections especially gastrointestinal parasites are a major constraint for blooming dairy industry of Pakistan, because it limit, the productive performance of animals. Aim of the project was to find out the prevalence of internal parasites in small and large ruminants in central zone of Khyber Pakhtunkhwa. For this purpose, a total of 1700 fecal samples were received from central districts and processed for cop...
Zarqa Khalid1*, Muhammad Asad ur Rehman Naseer1, Raza Ullah1 and Shahzad Khan2
Measuring the Global Trade Competitiveness of Pakistan’s Cotton Crop
...s to assess the trade competitiveness of cotton crop for the world’s 10 leading cotton exporters using revealed comparative advantage indices and relative competitive advantage indices such as Revealed Comparative Advantage (RCA), Revealed Symmetric Comparative Advantage (RSCA), Relative Import Advantage (RMA), Relative Export Advantage (RXA) and Relative Trade Advantage (RTA). The data were taken from the Internationa...
Sanaullah1*, Abdul Basit2 and Inayat Ullah3
Challenges and Prospects of Farm Mechanization in Pakistan: A Case Study of Rural Farmers in District Peshawar Khyber Pakhtunkhwa
...ck of trained machinery operators (4.27), access of roads to the farm (4.45), adequate capital (4.00) and costly inputs (3.80) were some of the challenges plaguing the use of agricultural mechanization in the rural area. It was established that agricultural mechanization has significant role in boosting farm productivity, improving farmers’ livelihood, ensuring economic growth, availability of off-seasonal farm produce, increasing income generating oppor...
Chibuzo Uzoma Izuogu1*, Robert Ugochukwu Onyeneke1, Loveday Chukwudi Njoku1, Gillian Chidozie Azuamairo1 and Mary Chikerenma Atasie2
Repositioning Nigeria’s Agricultural Extension System Towards Building Climate Change Resilience
...-align: justify;">This paper focused on redefining agricultural extension practice in Nigeria in response to the challenges of climate change. We reviewed 58 articles from research databases that were in line with our inclusion criteria for adequate understanding of the current state of agricultural extension practice in Nigeria and climate change concerns. The review identified the effects of climate change on agricultural extension practice, ascertained the ...
Arnab Tanveer, Shabana Naz*, Azhar Rafique and Asma Ashraf
...ahawalnagar. Freshly dropped fecal sample were collected once before treatment with anthelminthic drug and twice after treatment and brought to laboratory for qualitative and quantitative analysis. Direct smear method and fecal floatation technique was used for isolation and identification of endo-parasites. Modified McMaster technique was used to calculate Eggs per gram. The data was subjected to ANOVA and Tukey-HSD (post h...
Hongqun Li1*, Xiaoli Liu2*, Zongxian Han1, Shabin Wu1 and Changlei Cao1
...leaved forest, mid and upper slope location, and gully while day-roosting habitats by ridge, upper slope location, and sunny slope. The foraging sites utilized by the birds also featured higher altitude, steeper slope, bigger tree heights and diame...
Ehsan Kashani1, Hamid Reza Rezaei2*, Morteza Naderi3 and Nematolah Khorasani4
...ersity of the mammalian species and their plasticity in ever-changing environments is emphasized by scientists and conservation biologists. Central deserts and steppes of Iran host a different kind of insectivores like hedgehogs; however, their ecology and genetic properties are rarely documented. For species of hedgehogs that are included in the subfami...
Muhammad Shafiq1,2,*,Rajwali Khan1, Ilyas Ali3, Sadeeq Ur Rahman4, Saif Ullah3, Shah Jan Mohammad2, Mohammad Jan2 and Jinhu Huang2
...effect of cattle breed type on (a) cow serum IgG and serum total protein concentration (b) colostrum immunoglobulin level and (c) their respective calves’ serum immunoglobulin and serum total protein concentration. Three breeds of cattle were observed: Jersey, Holstein Friesian (HF) and local Pakistani cow breed Achai. To assess serum IgG, sodium sulphite precipitation technique was used while IgG in colostrum w...
Chen Zeng1,2, Baosuo Liu1,4, Kecheng Zhu1,4, Liang Guo1,2, Huayang Guo1,4, Nan Zhang1,4, Quan Yang1,3, Jing Wen Yang1,4 and Dianchang Zhang1,4*
...ear models, logistic, Gompertz and Bertalanffy, were used in the study to fit and analyse the body height, body length, full length and body weight growth curves of the fish at the age of 2-8 months. The results showed that the three nonlinear curves could fit the body height, body length, full length and body weight growth curves of the P. teira well, and the fitting degree was above 0.99. Considering various factors of the models, the Gom
Mohsin Ali1, Nargis Haider Kakar2, Rida Dawood3,4, Qurat-ul-ain Fatima5, Zunera Tanveer2, Shoaib Ahmad Malik6, Tauseef Muhammad Asmat1, Asadullah1, Muhammad Masood Tariq Kiani1 and Mohammad Zahid Mustafa1*
...lities in 224 DM (both type 1 and type 2) patients. The parameters of age, duration of diabetes and type of treatment were measured. Venous blood was taken to investigate the thyroid profiles. Out of 224 patients examined, 67.85% showed the normal thyroid profile and thyroid abnormalities were seen in 32.15% of subjects. There were 10 patients with clinical hypothyroidism, 54 patients had ...
Zaka ur Rehman1*, Kashif Akbar1, Altaf ur Rehman1, Hassan Waqas1, Alif Khan1 and Asad Ali2
Development and Storage Stability of Diet Mango Juice
...s were stored at room temperature for physicochemical analysis (Total soluble solids, ascorbic acid, pH, percent acidity, and sugar-acid ratio) and organoleptic evaluation (appearance, taste, flavor, overall acceptability) for three months. These were prepared with sweeteners, numbered as (T0) pure mango juice (control sample), (T1) mango juice+2.5g sucralose, (T2) mango juice+2.5g cyclama...
Shawaiz Iqbal1*, Nadeem Iqbal2, Usama Bin Khalid1, Muhammad Usman Saleem1, Adila Iram1, Muhammad Rizwan1, Muhammad Sabar1 and Tahir Hussain Awan1
Growth, Yield and Economic Analysis of Dry-Seeded Basmati Rice
...method is an important aspect of production technology for the maximum resource utilization by crops per unit area. Dry-seeded rice (DSR) is a contemporary resource saving crop establishing technique, which enables farmers to harvest economical rice production. Field study was conducted at Rice Research Institute, Kala Shah Kaku, Pakistan in 2014 and in 2015 to evaluate the different planting methods. Three dry-seeded rice (...
Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3 and Waqas Raza1*
Influence of Resistance Inducers on Nitrogen, Phosphorus and Potassium Contents of Susceptible Chickpea Cultivars after Inoculation with Ascochyta rabiei
...amage. Nevertheless, no specific rule exists that how a specific nutrient can alter the severity of the disease. Normally, plants are stressed by different environmental confines may be weakened and susceptible to disease and these include nutrient scarce plants. Tissue contents of potassium, nitrogen, and phosphorus of above parts of the ground of plant in three cultivars of chickpea (&ls...
Mehar Ul Nissa Rais1*, Tahmina Mangan1, Jam Ghulam Murtaza Sahito1 and Naeem Ahmed Qureshi2
A Trend Analysis: Forecasting Growth Performance of Production and Export of Chilli in Pakistan
...roduction, export growth performance and forecasting of chilli in Pakistan. Annual time series data of 38 years (1981-2018) of chilli production and export was employed for this study. Overall, chilli production of the Pakistan exhibited a positive growth of 1 percent over the time; however, in Pakistan negative growth was recorded during 2001-02 and 2011-12, these losses can be attributed to major floods, diseases attack, p...
Delower Hossain1,5, Shuvo Singha2,5, Chelsea Marie Van Thof3, Sanna Gough3 and AHM Musleh Uddin4,5*
Effect of Somatic Cells on Milk Quality and Human Health
...tic tool for dairy farm operations in order to improve the milk quality. Broadly dimension of SCs of milk well represents the comfort and welfare of dairy cows and helps deciding efficient mastitis control strategies. Again, the safety margin evaluated though SCs ensures safe and healthy milk at consumer level devoid of bacterial presence in milk. This review highlights a brief overview of the importance and demand of estimating somatic cell count (SCC) and it...
Ambreen Akhtar Saddozai1, Amer Mumtaz2, Naseem Rauf1, Saeeda Raza2, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Sahar Shibli2, Muhammad Suhail Ibrahim3*, Muhammad Akhtar4 and Muhammad Saad Rehan5
Preparation and Quality Evaluation of Soymilk Carrot Blend
...died at two different temperatures to improve its pro vitamin A profile. Soymilk being potential source of protein was used as a carrier of pro- vitamin A. Carrot powder was blended in soya milk at three different concentrations levels 2%, 4% and 6% and packed in sterilized bottles. The product was kept at two different temperatures (ambient and refrigerated temperature) for 14 days to ass...
Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Mushtaq Ahmad1, Muhammad Saleem2, Ali Aziz2, Irfan Rasool2, Zeshan Ali3 and Muhammad Amin2
An Update on Biology, Extent of Damage and Effective Management Strategies of Chickpea Pod Borer (Helicoverpa armigera)
... drastic decline in chickpea productivity across the world. Management of H. armigera is of prime importance to achieve sustainable chickpea yields. Its life cycle passes through egg, larvae, pupae and adult stages in about 4-5 weeks. 1st to 3rd instar larvae generally feed on leaves, twigs and flowers. In later stages larger larvae (4th to 6th instar caterpillars) shift to developing pods by making holes/bores and consume e...
Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Sher Muhammad3, Usman Saleem4, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz5 and Aamer Sattar2
Impact of NaCl Toxicity on Yield and Yield Components of Rice (Oryza sativa) Grown in Aridisol
... plants. A pot study was performed to assess the poisonous impact of NaCl salinity on rice growth parameters. Selection of soil with customary characteristics was done. Various levels of salinity; < 4, 4, 6, 8, 10, 12 and 14 dS m-1 were established using NaCl salt. Soil was left for appropriate period for accomplishment of salinity. Completely randomized design (CRD) was used for layout of the exp...
Zaheer Ahmed Deho*, Saifullah Abro and Muhammad Rizwan
Assessment of Stability for Seed Cotton Yield of Cotton Genotypes Across Different Environmental Conditions of Sindh Province
...tability analysis (genotype x environment interaction) was performed. The pooled analysis of variance for seed cotton yield, showed highly significant (P< 0.05) differences for varieties, locations and varieties × location interaction. The analysis depicted the significance of both the linear and non-linear components which showed the presence of individually expected and un-ex
Muhammad Rizwan1*, Jehanzeb Farooq1, Muhammad Farooq1,2, Aqeel Sarwar4, Abid Ali3, Farrukh Ilahi1, Muhammad Asif1 and Ghulam Sarwar1
Quantitative Studies in Upland Cotton (Gossypium hirsutum L.) using Multivariate Techniques
...pon development of genotypes having better yield, tolerance with respect to abiotic and biotic stresses and enhanced fiber quality. Forty five elite lines of cotton were used to evaluate the genetic variability for fifteen parameters viz., plant height (cms), days taken in 50% flowering, monopodia plant-1, sympodia plant-1, boll weight (g), No. of bolls plant-1, ginning out turn (%), lint index(g), seed index(g), 2.5
Fangqing Liu1, Jared Atlas2, Chaohao Du1, Anoop Das3 and Longying Wen1*
...ength of males and wind speed (P=0.017). Conversely, body weight, body length, wing length and tail length in males were significantly negatively correlated with air temperature (P<0.05). Many measures of body size (wing length and tail length for males; tail length for females) increased with latitude after controlling for altitude, indicating that the body size of this spe
Abid Mahmood Alvi1*, Naeem Iqbal1,2, Javid Iqbal3, Kazam Ali4, Muhammad Shahid1, Waqar Jaleel5,6,7, Hafiz Azhar Ali Khan8 and Tiyyabah Khan8
...pulation of both sucking pests was more on variety BS-70 as compared to BS-15 cotton variety. Thrips and whitefly populations varied significantly in three row spacings (P<0.01) with the maximum population recorded in line spacing of 30 cm without mapiquate chloride (9.12-11.15 thrips/leaf and 9.18-7.83 whitefly/leaf), followed by line spacing of 75 cm without mapiquate chloride (8.65-9.12 thrips/leaf and 5.97-5.06 whitefly/leaf) and 30 cm with mapiquate ch...
Yasin Altay1, Saim Boztepe2, Ecevit Eyduran3, İsmail Keskin2, Mohammad Masood Tariq4*, Farhat Abbas Bukhari4 and Irshad Ali4
...ession tree diagram was specified based on Bonferroni adjustment within the scope of the prediction of wool fineness as a response variable. Also, Multivariate Adaptive Regression Splines (MARS) was implemented for the WF prediction. In the prediction of wool fineness (WF), sex, dam age (DA), birth weight (BW), birth type (BT), live body weight (LBW), greasy fleece weight (GFW), staple len...
Ahmad Sadiq1, Muzafar Shah2*, Habib Ullah1, Irfan Ali1, Amir Alam3,
Navid Jalil1 and Muhammad Khan3
... be at greater risk of hypertension and lipid abnormalities, which are the main cause of cardiovascular diseases (CVD). The present work revealed the role of glycated hemoglobin (HbA1c) for the detection of lipid profile and CVD. In recent study 108 (56 males and 52 female) type 2 diabetes (T2DM) subjects were diagnosed at Hayatabad Medical Complex (HMC) Peshawar and private diabetic clinic “Khattak Medical Centre&rdqu...
Wentao Wang1,2, Xu Lin3, Jianshu Zhuo3, Dongjie Zhang2, Xiuqin Yang3* and Di Liu1, 2*
...from human and mouse, respectively. The splicing variants were produced by exon skipping, alternative 5’ and 3’ splice sites alone or in combination. Minigene analysis showed that the splicing of porcine E2F3b is complicated. E2F3b isoforms are expressed in all tissues studied with high level in spleen and muscle. Both of isoforms V1 and 2, containing functional domains of E2Fs, were localized throughout cells. No functional nuclear localization se...
Nadia Islam1, Khalil Ahmed1,*, Maisoor Ahmed Nafees1, Mujtaba Khalil2, Ishtiaq Hussain3, Muhammad Ali1 and Raja Imran1
...t Misto uch, the mean temperature was 9.7°C and 15.4°C, turbidity was 0.44 NTU and 0.67 NTU, electric conductivity was 147.4 µS/cm and 226.7 µS/cm, total dissolved solids was 99 mg/l and 118 mg/l, pH was 6.8 and 6.8 and total phosphorus was 48.3 µgP/L and 64.3 µgP/L in both the seasons. Whereas Bar spring the mean values in both the seasons were 10.8oC and 16.0oC for tempe
Zhen-Yang Wu1, Li Li1, Yu-Hua Fu2, Sheng Wang3, Qing-Ming An1, Xiao-Hui Tang4, Xiao-Yong Du3,5,* and Fei Zhou6,*
...production of Tibetan carpets and its coat color as one of important economic traits which can affect wool price directly. In this study, to investigate the functional roles of genes in Tibetan sheep skin with different coat colors, we sequenced genes from six skin samples using Solexa sequencing. The RNA-Seq analysis generated 63,283,784 and 63,644,062 clean reads in black and white skin, respectively. A total of 60 differe...
Minghao Gong1*, Shiliang Pang2, Zhongyan Gao2, Wanyu Wen1, Ling Zhang3, Gang Liu1, Huixin Li1, Fawen Qian4 and Wenfeng Wang2
...migration distance, and specialized diet. We examined climate change-induced RCC habitat shifts and suggested some purposeful, resolute and crucial improvements needed to protect appropriate areas that ensure the RCC’s long-term survival. Based on monitored data of nesting locations and climate variables gathered from 2014 to 2017 around Zhalong Reserve on the Songnen Plain in northeast China, we used four General Circulation Models in Maxent modeling to...
Ayesha Alam1,* and Labeeb Ali2
...sector as it is highly dependent on recycled water for irrigation purposes due to the shortage of fresh water resources. In this study viruses in untreated and treatedwastewater has been reviewed to evaluate the health threats to the people. It has been cited that viruses such as Rotavirus, Norwalk virus, adenovirus, and Hepatitis A virus, are common mediators of the diseases in human beings. Including respiratory disorders,...
Muhammad Shahbaz1,*, Nosheen Farooq1, Abu ul Hassan Faiz1, Arshad Javid2, Irfan Baboo3, Misbah Shoukat1 and Muhammad Aslam Khan4
... and Kashmir, during the period May 2017 to October 2017. The specimens were identified under the binocular microscope by following the taxonomic keys of Christophers (1933), Barraud (1934) and Rueda (2004). A total of 2895 specimens of mosquitoes were collected from the study area, belonging to family Culicidae and two subfamilies, Anophilinae and Culic...
Jun Yan Bai*, Zhi Hao Dong, Hui Rong Gong, Xiao Ning Lu and Zi Heng Li
...Beijing white quail, the pectora weight and pectoral muscle rate of CC genotype was significantly higher than that of CT and TT genotype(P<0.05). Among Korean quail, the body weight and carcass weight of CC genotype were significantly higher than that of CT and TT genotype(...
Shikang Deng1,2, Yan Jin2, Jing Xu2, Xiufang Zhu2, Pinghai Hu2, Jiao Li2, Li Zhang2 and Jianzhong Tang2,*
... showing concentration-dependence. In conclusion, 5-FU may have a role in inhibiting bile duct scars. One of the mechanisms may be related to its ability to inhibit the expression of TGF-β1, cyclinD1, and CDK4 in bile duct scar fibroblasts.
...
Somia Shehzadi1, Sana Javaid Awan2, Maryam Javed1*, Asif Nadeem1 and Tahir Yaqub3
...ugh. For this purpose proper medium and supplements are required, which contain suitable growth factors for viability of ATFs. Fetal bovine serum (FBS) is used extensively in cell culture but being expensive and scarce in availability, its alternatives are needed. This study proposed autologous equine serum (AES) and adult bovine serum (ABS) to be evaluated as alternative to FBS. ATFs were cultured in DMEM-HG and supplemente...
Pengfei Liu1*, Hongxia Liu2 and Jiajia Xiao1
...We employed reflectance spectrometry to determine the plumage coloration in these two species in the hand. PL with dull plumage, the males had brighter head plumage than females, there was no significant difference in coloration of wing and breast plumage between two sexes. EL appeared relatively bright and polychrome plumages, and the males had extremely significantly higher carotenoid ch...
Muhammad Shoaib1, Imran Rashid1*, Haroon Akbar1, Ali Ahmad Sheikh2, Shahid Hussain Farooqi3, Muhammad Asif3, Mumtaz Ali Khan4, Shakeel Mahmood5 and Farhan Anwar Khan6
... all study districts, respectively. The difference in prevalence of tick infestation was non-significant among the breeds with the exception of crossbred cattle in which it was found significantly (p<0.05) high. Sex and age of the cattle were non-significantly (p>0.05) associated with prevalence of tick infestation. However, the male and young animals were affected more as compared to female and adult animals. Body regions wise distribution of tic...
Maria Syafiqah Ghazali1, Azlan Che’ Amat2 and Nor Azlina Abdul Aziz1*
...us threat to endangered species. The present study was conducted to observe the occurrence of gastrointestinal parasites in large felines in a Malaysian zoo. Ten faecal samples were collected from pumas (Puma concolor, n = 5), African lions (Panthera leo, n = 3), a spotted leopard (Panthera pardus, n = 1), and a black panther (Panthera onca, n = 1). All faecal samples were examined for parasite eggs, larvae, and oocysts by simple fa...
Hannan Nasib Hamid1,*, Muhammad Rais1, Muhammad Arif2 and Rubina Noor2
...present study reports herpetofauna of Sheikh Buddin National Park for the first time which could be used as a baseline. The national park features arid climate and two main vegetation types: tropical thorn forest and sub-tropical broad-leaved ever green forest. The data were gathered from July, 2017 to August, 2018, from major habitat types of the national park using visual encounter surve...
Jun Yan Bai*, Kun Peng Shi, Xiao Ning Lu, Xiao Hong Wu, Xue Yan Fu, Heng Cao, Hong Deng Fan, Meng Ke Chen and Yong Kang Ma
...lar markers of slaughter performance of quail, SNP in control regions of cytogenin gene (MyoG) 5’ in French giant quail, and Savimit quailwas detected by PCR-SSCP method in this study. Moreover, correlations of control regions of MyoG 5’ with slaughter performance of quail were analyzed. Results demonstrated that: In meat quail, three genotypes (AA, BB and AB) wer...
Rabia Riaz1, Khushi Muhammad1*, Masood Rabbani1, Muhammad Amjad Iqbal2, Aamir Riaz Khan2, Sadia Sarfaraz1, Mudassar Naseer3 and Khalid Majeed1
...s) and O-MG vaccines, respectively. Serum samples were collected on 21, 28 and 35 days post vaccination for anti-MG-ELISA antibody titer. Cumulative mean anti-MG-ELISA antibody titer of birds to G-MG, O-MG, G-MG+NDV, O-MG+NDV and control was 80.30, 137.49, 91.59, 169.76 and 0.15 units respectively on 35 days post-vaccination. It is concluded that NDV has insignificant immunomodulatory effect on antibody response of birds to ...
Qianbao Wang, Zhengyang Huang, Shoufeng Li, Huayun Huang, Chunmiao Li and Zhenhua Zhao*
....5 and 115.5 g/d diet respectively with ME 2770 kcal/kg and CP 15.4% from 23 wk of age. Fertility trials were conducted in another three groups of F line hens with 20 hens in each group. A significantly positive interaction between dietary quantity and semen volume was observed (p<0.05) which showed that males fed with 135.5 g/d diet produced much more semen. Except for semen volume, there was no difference in semen concentration, s...
Aamer Sharif1,*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2
...tex. This study is the experimental analysis of novel runner which has the ability to maximize output power and efficiency. Computational fluid dynamic (CFD) is carried out on novel runner and ANSYS (CFX) was used to numerically analyze the water flow over the channel and formed water vortex in a conical basin. The experimental analysis was absorbed by measuring the rotational speed (rpm),...
Gulzar Ahmad*, Muhammad Bilal Khan, Junaid Bahadar Khan and Faheem Ali
...rials to investigate its performance for its employment in future higher frequencies wireless applications in general and 5G cellular applications in particular. In the past, researchers employed different dielectric substrates to analyze microstrip patch antenna in low frequency range. In the presented research work three different dielectric materials were investigated in the higher frequency range starting from 12GHz as the scientists consider these higher ...
Oluwatobi Emmanuel Olaniyi1,2*, Chukwudiemeka Onwuka Martins2, Mohamed Zakaria2
...4 lakes of PIW and PW respectively. Significant differences (p<0.05) existed in the encounter rate and effective detection radius of PPI and AP between PIW and PW. Both wetlands had low site occupancy, an unevenly distributed and non-significantly relative abundance (p>0.05) of PPI and AP. PW recorded the higher estimates of site occupancy, naïve occupancy and detection probability by PPI and AP. The findings implied that PW is more abundant ...
Sana Mehmood1, Hafiz Muhammad Tahir1*, Muhammad Summer1, Sher Muhammad Sherawat2, Shaukat Ali1*, Sajida Naseem3
... We identified 38 morph-species, representing 22 genera and 8 families. Accuracy of morphological identification was confirmed by barcode analysis of tissue samples. A standard barcode sequence of COI (Cytochrome c Oxidase I) was recovered from 90 specimens of spiders. Percentage accuracy of morphological identification was 92.10%. Four morphologically misidentified spiders were allotted to correct taxon after molecular iden...
Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3
Application of Nanotechnology for Insect Pests Management: A Review
...e is various size and shapes of nanoparticles to be synthesized by using the naturally occurring biomolecules. These biomolecules acting as a driving force for the designing of greener, safe and environmentally benign protocols for the synthesis of nanoparticles. Insect pests are main density dependent factors that deteriorate the quality and production of various crops i.e. vegetables, fr...
Inam Ullah1,2, WU Qing-Ming1*, Ruqia Bibi2 and Najam Un Nisa2
Comparison of Nesting Site Preferences and Breeding Ecology of Red-Vented Bulbul, Baya Weaver, and Grey Bush Chat in Sheikh Badin National Park Dera Ismail Khan, Pakistan
...etween a bird and plant species is considered to be the central aspect of wildlife and biodiversity , which makes the nesting behavior a vital factor when investigating the life of birds. This study was conducted to know the trees used for nesting by avifauna species of Sheikh Badin National Park. The current study was conducted at Sheikh Badin National Park from October 2018 to September ...
Rahat Afza, Muhammad Asam Riaz*, Muhammad Afzal and Muhammad Zeeshan Majeed
Adverse Effect of Sublethal Concentrations of Insecticides on the Biological Parameters and Functional Response of Predatory Beetle Coccinella septempunctata (Coleoptera: Coccinellidae) of Brassica Aphid
...veness of natural insect pest predators. Herein, the effect of insecticides at their sublethal concentrations was assessed on the biological parameters and functional response of Coccinella septempunctata. All insecticides significantly reduced the fecundity, TPOP (total pre-oviposition period), larval weight and increased the life span of C. septempunctata relative to control. Thiamethoxam and lambda-cyhalothrin non-signifi...
Sabina Noor1*, Fatimah Abang1 and Hamady Dieng2
Biology of an Exotic Butterfly Acraea terpsicore (Linnaeus, 1758) (Nymphalidae: Heliconiinae), in a Newly Invaded Region, Sarawak, Borneo
...r) relative to habitat types, phenotype, and gender in Sarawak, Borneo. The nymphalid butterfly tawny coster is widely distributed throughout the Indian and Sri Lankan region and has expanded its distribution range southward through Southeast Asia and Australia. Currently establishing its population in Kalimantan, it was firstly detected in Sarawak in 2013. Comparative observations on the life-cycle were conducted in relatio...
Shishir Sharma* and Laxmi Prasad Joshi
Current Insights on Stemphylium Blight of Lentil with its Management Strategies
...tion and delineation of species is inevitable as high complexity is seen due to environmental concerns and contrasting morphological characteristics among species. The frequency and intensity of this disease depends on environmental and climatic factors that are mainly favored by high humidity, temperature greater than 220c, and cloudiness. The pathogen ...
Eslam Moradi-Asl1*, Behnam Mohammadi Ghalehbin2, Kamran Akbarzadeh3, Jafar Mohammad-Shahi4, Hajar Afshin4
... when fly larvae infect open wounds. We describe an old male with wound myiasis by agent of Lucilia cuprina, who had a history of diabetes and also blind that reefed to hospital in 13 September and was admitted to date 18 September 2019.Larvea extracted manually from thumb finger of left foot and sent to Medical Entomology Laboratory of the School of Public Health, Ardabil University of medical Sciences for identification. This case is a first time was ...
Luka Anthony*, Olugbenga Omotayo Alabi, Elizabeth Samuel Ebukiba and Vandi Gamba
...t;0.01) and, marketing experience ((P<0.05). The value of Gini- Coefficient calculated was 0.91429. The observed inequality in income distribution among small-holder rural rice farmers was a reflection of inefficiency in the market structure for rice. The results of Double-Log Regression model revealed that quantity of rice output harvested was positively and significantly influenced by farm size (P<0.05), the quantity of seed planted (P<0.01), the vo...
Alam Zeb* and Amanullah Jan
...ons with higher yield. Experiments on “response of sesame to sowing methods, nitrogen and sulphur levels” were carried out in Agronomy Research Farms, The University of Agriculture, Peshawar. During two consecutive Kharif growing seasons of 2013 and 2014, respectively. Three sowing methods (flat, ridges and raised bed) were kept as main plot factor, whereas four nitrogen levels (00, 60, 120, and 180 kg ...
Vijay Lal and Muhammad Naeem*
...pon jarbua have been performed. Therefore, the current analysis was carried out to analyze the proximate composition of T. jarbua. 70 samples of T. jarbua ranging from 18.00-29.90 cm in length and 119.60-429.50 g in body weight were collected from Fisheries Harbour, Karachi Pakistan. The mean percentage of constituents were found to be for water 73.22%, ash 6.72%, fat 3.45% and protein 16.62% in the whole w...
Muhammad Riaz Gondal1*, Sultan Ahmad Rizvi1, Aaqib Riaz2, Waqas Naseem1, Ghulam Muhammad1, Mazher Iqbal3, Humara Umer3 and Inam ul Haq3
Apposite Sowing Techniques to Optimize Productivity and Profitability of Berseem
...nd palatable fodder in repeated cuttings. Gap in its yield is required to be addressed, which is aim of the current study. This study was carried out to select an appropriate sowing technique for optimization of fodder and seed yield as well as to maximize the net return. The experiment was conducted using five sowing techniques viz., broadcast, different row sowing with spacing of 15 cm, 30 cm, 45 cm and 60 cm. Sowing was d...
Tofique Ahmed Bhutto1, Mahmooda Buriro1, Niaz Ahmed Wahocho2, Safdar Ali Wahocho2, Muhammad Iqbal Jakhro3*, Zulfiqar Ali Abbasi1, Reema Vistro1, Fehmeeda Abbasi1, Sanam Kumbhar1, Fateh Muhammad Shawani4 and Nadar Hussain Khokhar5
Evaluation of Wheat Cultivars for Growth and Yield Traits under Agro-Ecological Condition of Tandojam
...raits. The highly varied performance of crop cultivars of the same species for growth and yield-related attributes is well documented. The present investigation investigated the performance of wheat cultivars under Tando Jam conditions. For this study, two-year field experiments were performed during October 2015-2017 ...
Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Fazal Yazdan Saleem Marwat3, Hamida Bibi4, Farhan Ahmad1, Wajia Noor5 and Bibi Sadia5
Yield and Nutritional Status of Mungbean as Influenced by Molybdenum and Phosphorus
... three replicates. The experimental findings revealed that all the nutritional attributes and yield were significantly influenced with molybdenum and phosphorus addition except potassium uptake by grains and straw. Higher seed yield (772.45 kg ha-1) and harvest index (26.18 %) with application of 1.5 kg ha-1 molybdenum while more protein content (21.91 %), carbohydrates (60.36 %), nitrogen content in grain (3.76 %) and straw (1.10 %), phosphorus uptake i...
Bina Khanzada1, Arfan Ahmed Gilal1*, Bhai Khan Solangi1 and Imtiaz Ahmed Nizamani2
Effect of Morphological Characters of Indigenous Sugarcane Varieties on Population of Chilo infuscatellus (Snellen) and its parasitoid, Cotesia flavipes (Cameron)
...al enemies, Cotesia flavipes Cameron has been widely used in different regions of the world for its management. Considering the significant role of morphological characters of sugarcane varieties on infestation of C. infuscatellus, thus, on parasitism of C. flavipes, this study was conducted in 2013 and 2014. Ten sugarcane varieties i.e., NIA-98, NIA-2004, Thatta-10, Gulab-95, BL-4, L-116, SPS-26, AEC86-223, AEC82-1026 and L...
Zafar Abbas1*, Shahzada Munawar Mehdi2, Muhammad Nasir3, Muhammad Ashraf4, Salma Kausar5, Nadeem Iqbal6, Muhammad Zahid Khan Nazar7, Iftikhar Ahmad3, Ghulam Murtaza1 and Ijaz Ahmad8
Evaluation of Best Dose of Micronutrients (Zinc, Iron and Boron) to Combat Malnutrition in Brinjal (Solanum melongena L.)
...uality of brinjal. The experiment was laid out in Randomized Complete Block Design (RCBD) with three replications. Five different levels of micronutrients were applied. The treatment T5 i.e. (100-60-50)+ Borax (0.2) + ZnSO4 (0.5%)+FeSO4 (0.5%) exhibited maximum plant height, fruit weight, total yield, number of fuits plant-1 and survival percentage except number of leaves plant-1 which were maximum in T4 i.e. (100-60-50)+ Zn...
Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz3, Abid Niaz2, Khurshid Ahmad Mufti4 and Muhammad Arif2
Deleterious Impact of Sodium Chloride (NaCl) Toxicity on Chemical Properties of Soil and Ionic Composition of Rice
...-align: justify;">This experiment was conducted to assess the deleterious impact of NaCl salinity on rice growth parameters. Selection of soil with customary characteristics was done. Various levels of salinity; < 4, 4, 6, 8, 10, 12 and 14 dS m-1 were established precisely using NaCl salt. Soil was left for appropriate period (30 days) for the accomplishment of salinity. Completely Randomized Design (CRD) was used for lay...
Saba Aleem1*, Mehvish Tahir2, Iram Sharif3, Muqadas Aleem4, Muhammad Najeebullah2, Ali Nawaz1, Amina Batool1, Muhammad Imran Khan1 and Waheed Arshad1
Principal Component and Cluster Analyses as Tools in the Assessment of Genetic Diversity for Late Season Cauliflower Genotypes
... of germplasm is an indispensable assist for crop improvement strategies. Multivariate analyses such as cluster and principal component analysis measures the amount of genetic diversity in respect of several charaters and asseses the relative contribution of different traits to the total variation. In the present study, nineteen genotypes were evaluated for presence of genetic diversity th...
Inam Ul Haq1*, Humara Umar2, Naeem Akhtar3, Muhammad Azhar Iqbal2 and Muhammad Ijaz1
Techniques for Micropropagation of Olive (Olea europaea L.): A Systematic Review
...opagation of olive may expedite the development of important characteristics like biotic and abiotic resistance with high yield and premium quality olive oil. However, the commercial micropropagation of olive trees is currently not enough because of production cost and globally; it is mostly used for research and development on various aspects of olives. In this review, efforts are made to document the different techniques f...
Hafiz Hammad Ahmad1, Mukkram Ali Tahir1*, Noor-us-Sabah1, Ghulam Sarwar1, Sher Muhammad2, Muhammad Aftab3, Muhammad Zeeshan Manzoor1 and Aneela Riaz4
Growth and Yield Response of Sunflower to Organic Amendments in Aridisol
...godha during 2018. The experiment was laid out in a Completely Randomized Design (CRD) with eight treatments replicated thrice. The treatments consisted of T1 = NK + P0 (Control); T2 = NPK (Recommended dose); T3 = NK + Rock phosphate at 7 g pot-1; T4 = NPK + Rock phosphate at 7 g pot-1; T5 = NK + Rock phosphate at 7 g pot-1 + Wheat straw at 14 g pot-1; T6 = NK + Rock phosphate at 7 g pot-1 + Wheat straw at 28 g pot-1; T7 = NK + Rock phosphate at 7 g pot-1 + Ri...
Muhammad Umair Hassan1, Muhammad Aamer1, Muhammad Nawaz2, Abdul Rehman3, Talha Aslam3, Ubaid Afzal4, Bilal Ahmad Shahzad3, Muhammad Ahsin Ayub5, Faryal Ahmed1, Ma Qiaoying1, Su Qitao1 and Huang Guoqin1*
Agronomic Bio-Fortification of Wheat to Combat Zinc Deficiency in Developing Countries
... deficiency in humans, especially in developing countries. The deficiency of Zn causes many irregularties in both plants and humans. The Zn deficiency considerably reduced the plant growth, tillers production, chlorophyll synthesis, and crop yield. Moreover, in the case of humans’ Zn deficiency causes blindness, lower intelligence quotient (IQ) levels, weaker immune system, and impaired physical and mental development. Wheat crop play a chief role in dai...
Muhammad Farooq1*, Elham Azadfar2, Zohre Bahrami3, Mahniya Sharifi3, A. Shakoor4, Shabir Ahmed5, Iftikhar Ahmed Solangi1, Muhammad Noman Khan6, Memona Siddique7, Naila Ilyas8*, Muhammad Bakhtiar9, Mohamed El-Fatieh Ismael1 and Wang Yunyang1
Optimization of Drying Process of Rambutan by Combined Method of Osmosis Ultrasound and Complementary Drying of Hot Air
...dried in an oven at a temperature of 70°C. The characteristics of solid gain, water and weight loss, shrinkage and rehydration were evaluated. The obtained results showed that by increasing the concentration of weight and water loss, solid gain increased. Accordingly, in a higher concentrated osmotic solution, the osmotic pressure, which is a key factor in mass transfer in the osmotic dehydration process, increases by increasing concentration, the
Hillary M.O. Otieno
A Review of White Mango Scale (Aulacaspis tubercularis Newstead; Hemiptera: Diaspididae) in Sub-Saharan Africa: Distribution, Impact and Management Strategies
...s tubercularis Newstead) pest is threatening mango production in Sub-Saharan Africa (SSA). Being a new pest, there are no clear adaptable management practices ready for farmers to implement. This has caused farmers to rely on nature and sometimes adoption of crude and ineffective traditional control methods. Farmers capable of using pesticides apply very toxic products that are not only ha...
Muhammad Farooq1*, M. Javed Iqbal2, Rizwan Shukat2, Qayyum Shehzad3, Shabir Ahmed4, Elham Azadfar5, Abdul Saboor6, Ibrar Ahmad7, Iftikhar Ahmed Solangi1, Kaleem Kakar8, Shoaib Khan9 and Wang Yunyang1
Development of Onion Powder by using Egg Albumin as a Foaming Agent by Foam-Mat Drying Process
...fy;">Vegetables are very perishable agricultural produce with high amount of water content. Preservation by different means has been a keen interest of peoples to enhance the shelf life and to make sure the availability of these vegetables for longer period of time without quality deterioration. Drying is most common and old process for the preservation of foods which contain high moisture...
Keke Liu, Yuanhao Ying, Yuxin Xiao, Jing Yan, Mengzhen Zhang and Yonghong Xiao*
...ont-size: small;">A new species, Otacilia dadongshanica Liu, sp. nov. (♂♀) is firstly described from Jiangxi Province, China. The new species is diagnosed and illustrated with photographs. A distribution map is also given.
...
Muhammad Umar1, Muhammad Arshad2, Mubashar Hussain1*, Moazama Batool3 and Muhammad Faheem Malik1
...int and for a fixed time period in such a way that the Sun was always behind the observer. A total of 37,082 birds belonging to eight orders, 11 families, 28 genera and 37 species visited the wetland in 2010, whereas in 2011, 21,302 birds belonging to six orders, nine families, 20 genera, and 28 species. Twenty two bird species were observed to be common...
Xiaopeng Tang1,*, Lei Chen1, Kangning Xiong1, Dun Deng2 and Peng Peng2,*
...les (DDGS) on the growth performance of meat ducks. To this end, a total of 450 Shuanggui-tou meat ducks with comparable body weights were treated with increasing concentration of DDGS. Compared to mock-treated group, the average daily gain (ADG), average daily feed intake (ADFI) and feed to meat ratio (F:G) were measured. It was revealed that the addition of DDGS up to 24% in the diet remained ineffective for ADFI, ADG and F:G. However, there a tendency of de...
Ashara Sajid1, Muhammad Usman Ghazanfar1, Saeed Rauf 2, Zahoor Hussain3, Salman Ahmad1 and Yasir Iftikhar1,*
...chy mottle, lopsided unripe fruits, and aborted seeds were observed. The highest incidence of 26% was recorded in Kot Momin, while the lowest incidence of 4.6% was found in Sahiwal. Among the cultivars, the highest disease incidence in mosambi (C. sinensis)and Kinnow (C. reticulate)was recorded 26% in Kot Momin and 23% in Bhalwal, respectively. Leaves samples were collected from the diseased trees to isola...
Umair Faheem1*, Qaisar Abbas1, Saghir Ahmad2, Ghayour Ahmad2, Abdul Karim2and Mussurat Hussain1
...cking and chewing insect pests during its growth, which results in the significant reduction of the cotton yield. Among these insect pests, Amrasca biguttula biguttula ‘Jassid’ are the most destructive ones. Beside these insect pests, environmental factors also affect the cotton production as well as population fluctuations of insect pe
Ghulam Sarwar1, Amna Nazir1*, Muhammad Rizwan1, Eram Shahzadi2 and Abid Mahmood3
...nd cluster analyses were performed to estimate genetic diversity in 25 cotton genotypes. Correlation analysis revealed that days to first square, flower and boll opening were positively associated with seed cotton yield. Staple length and CLCuV % were negatively associated with fiber fineness and yield respectively. In principal component analysis, four ...
Faiza Altaf1, Shamim Gul1,2*, Tasawar Ali Chandio3, Gul Bano Rehman1, Attiq-ur-Rehman Kakar4, Sami Ullah4, Naqeebullah Khan4, Umbreen Shaheen5, Muhammad Naeem Shahwani6, Muhammad Ajmal7 and Misbah Manzoor8
... 20% amendment rates (respectively, 900 g soil + 100 g mixture and 800 g soil and 200 g mixture of poultry manure and biochar in 1:1 mixture ratio). After harvest of tomato, lettuce was grown in the same soil. As compared to control, amendments of biochar-poultry manure mixtures had a significantly positive influence on growth of both crops. There was ~ 254.49% - 871.9% (~3.5 – 9 fold) increase in aboveground biomass of tomato and 25.67% – 94.59% i...
Abdul Rauf Bhatti1*, Ahmed Zia1, Falak Naz2, Amjad Usman3, Rukhshanda Saleem4, Ghulam Sarwar5 and Amad Ud Din6
...i> P. limbatus. The species were recorded from walnut (Juglans regia) trees and Khabbal Grass (Cyanodon dactylon), which highlight their importance. Keeping in view topographic gradients, ecological complex in Pothohar plateau and pest status of curculionid weevils, further surveys are suggested to unveil more important records from the area.
...
Imran Haider1, Muhammad Aown Sammar Raza1*, Rashid Iqbal1, Salman Ahmad1,2, Muhammad Usman Aslam1, Muhammad Israr3, Umair Riaz4, Maliha Sarfraz5, Nasir Abbas6, Salman Haidar Abbasi7, Zafar Abbas8 and Muhammad Aamer9
...ction across the globe especially in arid to semi-arid regions. Overcome this, various management practices are used one of them is the use of a growth enhancer. In the present study drought ameliorating effects of amino acid and yeast on wheat (Triticum aestivum L.), development and yield were observed. A field experiment was performed at Agronomic Research Area, Faculty of Agricul...
Muhammad Muhsin1, Muhammad Nawaz2, Imran Khan1, Muhammad Bilal Chattha3,Sadia Khan4, Muhammad Talha Aslam1, Muhammad Mahmood Iqbal5, Muhammad Zubair Amin6, Muhammad Ahsin Ayub7, Usman Anwar8, Muhammad Umair Hassan1 and Muhammad Umer Chattha1*
...of wheat owing to low temperature during emergence and early growth. Seed size has an appreciable potential to improve stand establishment, growth, and yield under late sowing conditions. Therefore, the present study was performed to assess the impact of diverse seed sizes (SS) on the growth and yield of wheat crop under late sowing conditions. The study was comprised of different sowing dates (SD), SD1: 15th...
Mansoor Qadir1*, Yousaf Khan2, Shahid Khan3, Djamaleddine Djeldjli3 and Muhanned Ismael Ibrahim Al Firas4
...th maximum security and spectral efficiency. This paper aims to design and analyze 2 dimensional OCDMA based coding scheme and corresponding network architecture to support high capacity Gigabit Passive Optical Network (GPON). The coding scheme is proposed by deploying diagonal eigenvalue unity (DEU) scheme at the frequency domain (X-axis) in combination with double weight zero cross-correlation (DW-ZCC) code at the time dom...
Nasir Rashid1,2*, Javaid Iqbal1,2, Umar Shahbaz Khan1,2, Mohsin Islam Tiwana1,2 and Amir Hamza1,2
...the user to regulate the peripheral devices with electroencephalogram (EEG) signals. These signals are recorded from the surface of the brain called the scalp. The acquired EEG signals are further processed using feature extraction approach and finally classified into movements using classification techniques. This research article mainly focuses on classification of motor movements recorded in the form of EEG signals of four limb movements. The database used ...
Nowsher Yousaf1*, Bushra Khan1, Dennis Flanagan2 and Ishaq Ahmad Mian3
...itored through erosion pipes over the period from 2016 to 2017 in three different vegetation density zones i.e. dense forest, moderate forest and agriculture land. Results showed that the amount of rainfall, soil texture and soil infiltration capacity were important factors affecting soil erosion. The sandy clay loam soils of dense forest lands had a relatively small intensity of erosion (2.1 mm.yr-1) due to mean ...
Abdul Hafeez1*, Akhtar Nawaz Khan2 and Zahid Ullah3
...ocessing. This entails expediting the decision-making process as well as to instill intelligence in the approach to reduce subjectivity to a greater extent. To harness the high computational power offered by commodity graphics processing units (GPU) and accomplish the decision-making in real-time has gained traction in a gamut of recent biomedical applications. This review article investigates the use of state-of-the-art GPUs to benefit the biomedical communit...
Tariq Mahmood Khalil1,2*, Muhammad Ajmal3, Iftikhar Zeb1,4 and Muhammad Azeem Khan1,5
...farmers in these areas especially in the developing countries are using saline water for irrigation. This laboratory scale study was aimed to investigate the effects of saline water irrigation on development of total water potential within coarse and fine textured soils using a novel method based on water potential dynamics. Chilled mirror dew point hygrometer accurately captured the water potential dynamics when soil samples were irrigated with saline water. ...
Shahid Hussain Abro1*, Mohammed N. Alghamdi2, Muhammad Sohail Hanif3, Hazim Moria2 andHamza Suharwardi1
...inuous heating phenomena performed at lead bath-quenching in which austenitic development morphology investigated. The CHQ steel analyzed in the context of Advanced Optical Microscope of Olympus GX51, SEM and Thin-film X-ray Diffracto-meter, with high-intensity mode have been deployed in order to examine the kinetics behavior of austenitic development at CHQ steel. On several quenching expe
Abdul Nabi Jatt1,2*
...ed bacterial communities perform a crucial role in organic material degradation by producing extracellular hydrolytic enzymes and are considered as key components in global carbon cycle. The aim of this study was to screen marine snow associated bacterium, Citrobacter freundii B1 for the production of QS-signals particularly acyl-homoserine-lactones (AHLs) and their i...
Jia Shi
...e based on the HBV genotype. 5 Studies in which most patients (>90%) had C genotype were compared with 3 studies with D genotype dominant study population. Again a high heterogeneity was observed in both genotype C and D dominant (I2=92% and 95%, res
Shuanping Zhao, Lei Xu, Hai Jin and Yutang Jia*
...ere identified and genotyped in our population (n=298). Genetic diversity analysis showed that g.1500G>A and g.1694T>A belonged to an intermediate level of genetic diversity (0.25<PIC<0.5), and SNP g.2213C>G belonged to a low polymorphism level (PIC<0.25). LD (Linkage disequilibrium) analysis showed that SNP g.1694T>A and g.2213C>G had a strong linkage (r2>0.33), a total of four different haplotype...
Ghazanfar Ali and Riffat-un-Nisa Awan*
...nder wise differences in perceived level of CTIPs, CTS and AA in favor of female students. Students of physics were found better in CTS and students of chemistry were found better in academics. Teachers of chemistry were employing CTIPs more frequently than the other departments. The results also revealed that CTIPs had good predictability of CTD of science students while CTS and CTD had significant effects on AA of undergraduates. The results of data analyses...
Humza Sami1, Mahnoor Sagheer1, Muhammad Amir Altaf1, Javaid Iqbal2 and Muhammad Zubair1,*
...small tumors. The prototype hardware setup uses two Vivaldi antennas, one as transmitter and other as receiver for scanning. The distance between phantom and antennas is kept almost 20 cm. The scattered signals from the high contrast objects emulating the tumor characteristics have been processed through an open-source imaging algorithm, known as MERIT, to construct the image. To get the best results, images are constructed ...
Javeria Afzal, Muhammad Abid, Faisal Hussain* and Alia Abbas
...0%) of these five plant species were made for the experiment. All selected plant species inhibited egg hatching and caused larval mortality. Maximum reduction (24.3%) in egg hatching was recorded in C. album stem extract at 2% concentration. The minimum reduction (0.33%) was observed in the leaf extract of A. viridis at 10% concentration after 48 hours of exposure time. In la...
Faiz Muhammad Khand1,Allah Bux Kachiwal2, Zubair Ahmed Laghari2, Shakeel Ahmed Lakho1, Pershotam Khattri2, Saeed Ahmed Soomro2, Nazar Ali Korejo2 and Ambreen Leghari1*
...e throughout gestational period and fetal sexing can be diagnosed at 7th week of gestation period in teddy goats.
...
Huan Yang1, Tingting Li1, Huimin Zhao1,2, Xiaoyuan Zhang1, Huiyan Xu1, Yangqing Lu1, Xingwei Liang1, Shengsheng Lu1, Xiaogan Yang1*and Kehuan Lu1*
...yle="font-size: small;">Spermatogonial stem cells (SSCs), a class of primitive germ cells located on the basement of the seminiferous tubules of the testes, are the only kind of adult stem cells that can pass their genetic material to offspring and are also capable of proliferation and differentiation, ensuring the efficiency of passing transgenes from parents to subsequent generations. In this research, to understand the growth characteristics of buffalo SSCs...
Ming-Yue Zhang*, Bo Yuan, Xiao-Hui Zhang, James Ayalaand Rong Hou*
...pandas. The increase in specific behaviors and the reduction of abnormal behaviors are considered to be important indicators of the physical health of giant pandas, and the ideal result of environmental enrichment is to make captive giant pandas appear close to nature. To understand the effect of Pinus koraiensis bark substrate on the behavioural responses of captive giant pandas, we selected 6 adult female giant pand...
Faheem Ahmed Khan1*, Sarzamin Khan2, Qurat-ul-Ain3, Saqib Ishaq1, Muhammad Salman1, Abdul Rehman1, Ikram Ullah4, Kalsoom5 and Johar Jamil5
...Citrus sinensis), grapes (Vitis), and peach (Prunus persica), respectively. Utilizing yeast extract, peptone and dextrose maximum biomass was produced by S. cerevisiae isolate recovered from peach (SCP-1) i.e. 4.83 g/l. Using isolate SCP-1 higher bioma...
Amjad Ali, Kafeel Ahmad*and Shaista Rahat
...zymes known as extended spectrum β-lactamases which render broad spectrum cephalosporins and penicillins inactive. This study reports antibiotic susceptibility pattern, multiple antibiotic resistance (MAR) index and prevalence of extended spectrum β-lactamases among clinical isolates of P. aeruginosa collected from tertiary care hospital...
Małgorzata Dzierzęcka1, Sławomir Paśko2, Marcin Komosa3, Karolina Barszcz1, Bartłomiej Jan Bartyzel1 and Ewa Czerniawska-Piątkowska4*
...isting of sinusoidal stripes preceded by a Gray code sequence, to perform the measurements. This method enabled the first objective assessment of the distribution of angles between the coffin bone parietal surface and the ground, which had not been possible using other imaging methods. The angle between the coffin bone parietal surface and the ground was found to be correlated with age, with a 0.27 correlation coefficient at...
Qin Liu1,2, Bin Wang1,3, Yu Xu1,4, Xiuyue Zhang1, Tao Zeng1* and Jianghong Ran1*
...o chromatic Galliformes species, is an endangered bird endemic to western China. Previous studies suggested that it had the behavior of facultative cooperative breeding, which was rarely reported in Galliformes. In this study, we isolated 17 tetra-nucleotide microsatellite loci to test parentage and kinship for a wild population with 29 individuals from 10 different families (A-J). The 17 loci with the mean polymorphic infor...
Abdul Waheed Solangi, Lei Zhang, Yunxia Cheng and Xingfu Jiang*
...e: small;">Environment experienced by mothers can influence many of the characteristics of their offspring also apply resource-related maternal effects through differential egg provisioning; we investigated impact of flight on female egg production and longevity in the oriental armyworm Mythimna separata (Walker) and whether this contributed to making difference in considered suite of life-history traits on progeny growth i.e. developmental time, larva...
Muhammad Umar1, Mubashar Hussain1*, Muhammad Faheem Malik1, Muhammad Naeem Awan2 and David C. Lee3
...nd Vatala. In total, 52 species were recorded, which included the globally threatened sociable lapwing. The most abundant species were asian green bee-eater, red-vented bulbul, house sparrow and common myna, and no species was unique to a single site in the DVNP. Highest abundance, richness and diversity was recorded in Deva, with lowest community measures recorded in Barmala. S
Muhammad Mohsin Raza1*, Hera Gul2, Malik Muhammad Yousaf1, Sami Ullah3, Ghulam Sabir Hussain4, Mumtaz Hussain1, Jahangir Shah1, Bashir Ahmad1, Rao Wali Muhammad1, Ijaz Ahmad5 and Muhammad Zeshan6
...atoon of sugarcane genotype SPSG-394 was determined under field condition throughout the year 2017-18. Planting patterns under study comprised 100 cm spaced 30 cm wide single row ditches, 100 cm spaced 60 cm wide double row ditches, 100 cm spaced 90 cm wide triple row ditches, 100 cm spaced 100 x 100 cm, pits, 90 cm spaced single rows and 90 cm spaced double row strips. The quadruplicated experiment already laid out accordin...
Muhammad Ayub1*, Munir Hussain2, Sher Ahmad2, Syed Arif Hussain Rizvi3, Shahid Hussain1, Muhammad Qasim2, Muhammad Din2, Muhammad Ishaque Mastoi4 and Tajudin2
... most destructive insect pest damaging potato tubers and causes economic loss of Gilgit-Baltistan. The study was conducted with an aim to develop eco-friendly management of white grub. Fermented extracts of four herbs Sophora alopecuroides, Artemisia sieversiana, Peganum harmalla and Tagetes minuta were evaluated against white grub under field conditions for two consecutive growing seasons during 2018 an...
Muhammad Hamayoon Khan*, Niaz Hussain Khuhro, Muhammad Awais, Muhammad Usman Asif and Raza Muhammad
...ruit flies are the major pests of horticultural crops across the globe. In Pakistan, two fruit fly species, Bactrocera zonata (Saunders) and B. dorsalis (Hendel) cause severe qualitative and quantitative damages to various fruits. The present study was executed to record the population dynamics of these fruit fly species in guava and mango orchards with res
Malik Muhammad Yousaf1*, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Jahangir Shah1, Rao Wali Muhammad1, Sami Ullah2,3, Hera Gul4, Ijaz Ahmad5 and Muhammad Zeshan6
...">Among arid zone plant species, Jojoba (Simmondsia chinensis), being an evergreen, perennial, multi-stemmed, and multipurpose plant has attracted wide attention due to its economic value, potential by-products and ability to withstand vagaries of the desert environment. By realizing the economic importance of this high-value desert plant, a pioneer study on seed germination response to various agro-climatic factors w...
Mashal Malik and Mudassar Nawaz Khan*
...tions, Single sequence repeat (SSR) markers were used. The line B20G16 showed the highest morphological growth parameters of plant height, total number of leaves, leaf width, leaf length and leaf weight, while line B29G11 revealed the lowest. The maximum plant height (128.03 cm) was found for line B20G16. A maximum number of 48 leaves with leaf width of 2.34 cm, leaf length of 3.34 cm leaf and leaf weight of 156.11 mg were recorded in line B20G16. The line B29...
Arsalan Khan1, Aminullah Khan2, Dil Fayaz Khan2, Sajid Khan1, Anjum1, Waqar Ali3, Habib Akbar1 and Ahmad Khan1*
...ogy and crop stand, an experiment was conducted at Agriculture Research Station Perdal Khel, Bannu (South part of Khyber Pakhtunkhwa, Pakistan) during 2016-17. The soil of the experimental area was Loamy sand with Haplic yermosols soil series based on FAO classification. The experiment comprised of three tillage practices i.e. Shallow tillage (ST), Conventional tillage (CT) and Deep tillag...
Muhammad Zubair1, Habib Ahmad2*, Brian E. Hemphill3, Muhammad Tariq4 and Muzafar Shah5
...f different parts of KP, peninsular India prehistoric samples of Indus valley Central Asia and South Asia. Inter sample affinities based upon pair wise MMD values were examined with neighbor-joining cluster analysis and multidimensional scaling. The results remained highly consistent throughout different data reduction techniques. The consistency in phenetic affinities was even evident when they were considered in the backdrop of living ethnic groups of
Naveed Akhtar1*, Muhammad Fiaz Khan1*, Sadia Tabassum1,
Munawar Saleem Ahmad2 and Khan Dil Badshah3
...rent concentrations of cypermethrin on hematological parameters, biochemical components of blood, histopathological changes in different organs and DNA damage in Chirruh snow trout Schizothorax esocinus. WBCs, RBCs, hemoglobin, hematocrit, MCV, MCH, MCHC and platelets were significantly decreased in all treatedgroups compared to control. Monocytes showed significant increase in all experimental groups. Lymphocytes cou...
Wenyou Huang1, Dan Yü1, Song Huang1,2, Jian Xiao2, Ping Qi2, Anhua Song2* and Zhen Huang1*
... fungi to be applied for pest control in field applications is often hampered by negatively active abiotic factors including high temperature, desiccation and UV irradiation. Selecting isolates with high UV tolerance and virulence is important in improving the efficacy and utility of fungal insect pathogens as insect biological control agents for use under field conditions. UV-irradiation ...
Wali Muhammad1*, Humayun Javed1, Munir Ahmad1 and Tariq Mukhtar2
...of March. Similarly, the percentage of damaged fruit was higher (54.1%) on crop sown at 30th of April at Rawat while the minimum damage of 49.6% was observed on the crop sown on 20th of March. At URF Koont, the percentage of damaged fruit was statistically at par among all the four treatments. Yield losses were statistically at par at URF Koont ranging from 24.6% to 25% in all the treatments. However, t...
Syahruddin Said1*, Widya Pintaka Bayu Putra1 and Dani Nur Arifin2
...association with service per conception (S/C) of Pasundan cows of West Java, Indonesia. Total of 147 Pasundan cows were used in this study. The PCR-RFLP analysed three genotypes of CC (0.11), CT (0.57) and TT (0.32) were detected in the Pasundan bLHR/HhaI gene with T allele as the dominant allele (0.61). Observed (Ho) and expected (He) heterozygosity had simila...
Ye Ge1, Chunmiao Zhao1, Weitian Xie2, Ying Liu2,* and Chunhou Xu1,*
...bility to resist high temperature and hereditary stability. The results showed that RH-3 was a perfect protoplast from which 48 strains were obtained through regeneration, with a sporogenic rate of 69.1% and a colony number of 2.7×105 CFU/mL after an 80 °C high-temperature treatment. After 7 generations of fermentation, the average pH value was 4.47. The average number...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
...defense system and lipid peroxidation play a key role in drought tolerance. The current study was intended to investigate physiological adaptations for drought tolerance in different wheat varieties. Three weeks old seedlings of each wheat cultivar were challenged with drought stress by skipping irrigation. After the drought stress of two weeks, plants were subjected to morphological, biochemical and physiological investigations. Drought stress reduced the bio...
Muhammad Younis1, Muhammad Irfan-ur-Rehman Khan1*, Mustansar Abbas1, Ali Murtaza1, Imran Mohsin2, Muhammad Shahzad3 and Muhammad Zahid Tahir1
...plusmn;0.2 days long, respectively. Estrous cycles had either three or four follicular waves; 3-wave cycles were more frequent than 4-waves (87vs.13%; p≤0.05, respectively). In 3-wave cycles (n=14), follicles (≤ 3mm) emerged on Days 0.7, 5.2 and 10.5. In 4-wave cycles (n=2), follicles emerged on Days 0.1, 4, 8.5, and 11.5. The maximum diameter of preovulatory follicle and corpus luteum was 5.4±0.3 and 10....
Muneer Abbas1*, Dilbar Hussain2, Muhammad Saleem2, Abdul Ghaffar2, Sohail Abbas3, Niaz Hussain1 and Abdul Ghaffar1
...emies and environment. Experiment was conducted in three guava, citrus and mango producing districts of Punjab i.e. Faisalabad, Sargodha, Toba Tek Singh with five treatments. Each experimental unit comprised of 1 ha area. Five treatments viz. A=sanitation, B=MAT, C= protein based baits, D= plant extracts and E= A+B+C+D were used during 2015-16. Data of % infested fallen fruits, total flies/trap, total flies cap...
Kamal Al-Samawi1, Mohamed Al-Hassan2, Hussein Migdadi3,4*, Megahed Ammar5 and Salem Alghamdi3
... Pregnancy detection was performed by US on 23, 35, and 60 days post NM. Serum P4 concentration was significantly higher in pregnant than non-pregnant goats at 15, 23, 35, and 60 days post NM. Relative expression of mRNA of ISG15 and ISG17 was significantly higher in pregnant goats at 7, 15, and 35 days post NM. ISG15 and ISG17 were not significantly different compared to P4 and US in the pregnant and non-pregnant goats. The accurac...
Ijaz Haider1*, Muhammad Akhtar1, Ali Noman2 and Muhammad Qasim3
...ion fluctuation of five species of rice pests namely white stem borer Scirpophaga innotata (Walker), yellow stem borer Scirpophaga incertulas (Walker), rice leaffolder, Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Pyralidae), whitebacked planthopper Sogatella furcifera (Horvath) (Homoptera: Delphacidae), and pink stem borer Sesamia inferens (Wal...
Guofang Wu1,2, Xingxing Xue1, Wenjuan Shen1, Lei Wang1,2*, Yuhong Ma1 and Jiping Zhou1
... of time-of-flight mass spectrometry (TOF-MS) to identify the locations of four new microsatellites in Qinghai Bamei pig (n=256), an indigenous breed of Chinese pig. TOF-MS demonstrated that the L1-(GT)n locus had three alleles: 152 bp, 164 bp, and 166 bp. The three other loci, L2-(AC)n, L3-(TC)n, and L4-(TGA)n, all had two alleles. Alignment of our sequencing data with the Sus scrofa reference genome (Sscrofa...
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Abdul Ghaffar2, Ayesha Iqbal1 and Rana Manzoor Ahmad1,3
...s of three hipparionine species from Dhok Pathan Formation (late Miocene) has been utilized in this study to reconstruct the palaeodiet and palaeoecology by using stable isotope analyses of carbon and oxygen of tooth enamel carbonate. A gradual increase in hypsodonty and complexity in plications indicate the drier environments with hard and tough food available during the late Miocene. The late Miocene hipparionines were ex<...
Ying Liu1, Shankun Liu1, Hui Wang2 and Weihua Su2,*
...otocin (STZ) single intraperitoneal injection was used for the induction of diabetes. The rats were received the various dose of caffeic acid. After the pregnancy (19 day) the blood sample was collected via puncturing the retro arbital and collecting the fetus from all the groups. The rats, fetus weight and placental weight were calculated. The blood glucose level, serum, lipids, antioxidant, cytokines and C-peptide was reco...
Ahmad Kamran Khan1, Muhammad Hamid Bashir2*, Shanza Ahmed3, Muhammad Amjad Bashir1, Shahbaz Ali1, Syeda Amber Hameed4, Munaza Batool5, Irfan Ahmed6 and Muhammad Naeem Khan7
... low variability with respect to evenness had been found in two different types of soil. The highest diversity of soil inhabiting Prostigmata were recorded in undisturbed type of soil in the month of June at Faisalabad locality (H’=1.33) and lowest (H=0.00) in disturbed soils in October, December at Gujranwala and Chakwal. The highest values of family richness (S=04) was reported in ...
Muhammad Aman Ullah Khan1*, Muhammad Talha Aslam1, Abdul Rehman1, Muhammad Nawaz2, Muhammad Jahanzaib Khan1, Muhammad Ahsin Ayub3, Arbaz Ahmad Khan1, Muhammad Adil Rehman1, Bilal Ahmad Shahzad1, Sajid Hussain1, Muhammad Umair Hassan1 and Riaz Ahmad1
.... This investigation was performed to determine the ratooning potential of diverse clones of sugarcane under different trench spacing. The study was comprised of different trench spacing i.e., 90, 120, 150 and 180 cm and diverse sugarcane clones i.e., US-272, US-658, US-127 and US-704. The study was conducted in a randomized complete block design with split plot arrangement having three replications. The findings depicted that trench spacing and clones signifi...
Saleem Maseeh Bhatti1*, Aslam Khan Gadehi1, Inayatullah Rajpar1, Muhammad Nawaz Kandhro2, Mukesh Kumar Soothar1 and Zohaib Ur Rehman Bughio1
... normal;">A greenhouse experiment was executed to quantify the response of spinach (Spinacia oleracea L.) genotypes (English and Sindhi) against a range of NaCl salt-waters (EC 2.0, 4.0, 6.0 and 8.0 dS m-1) and canal water (EC 0.3 dS m-1). Spinach plants were irrigated with defined EC levels at 80% field capacity of a clay loam, non-saline soil. Results indicated that the growth and yield ...
Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Haris Khurshid1, Muzamil Hussain2 and Shahid Ali Khan1
... great need to develop superior varieties and lift its production. Germplasm characterization plays a vital role in improved cultivars’ development. The current study was conducted to estimate genetic variability, traits association, and path coefficient analysis in eleven groundnut advanced breeding lines together with check vis BARD-479, using randomized complete block design with three replications at National Agricultural Research Centre, Isla...
Muhammad Bilal Anwar1, Mirza Azhar Beg1, Amjad Rashid Kayani1, Muhammad Sajid Nadeem1*, Syed Israr Shah1, Sajida Noureen2,
Muhammad Mushtaq1 and Tariq Mahmood3
...n the diet of three owl species in an uncultivated area with rapid urbanization all around to better understand their ecological significance. Regurgitated pellets of three owl species (n = 434) were collected seasonally from the study area. The food of the spotted owlet and eurasian eagle owl was found significantly different (P< 0.05) across seasons whereas no seasonal d...
Eman A. Al-Shahari1,2, Abdelhalim A. Alkhazendar3, Eman R. ElBealy4 and Abeer A. Alm-Eldeen3*
...herefore, this study was performed to examine the possible role of quercetin in modulating aging-induced testicular damage. Samples from 30-months old rats’ testis were examined before and after 200 mg of quercetin/Kg administration. Before quercetin administration, they showed an increase in the lipid peroxidation and 8-hydroxy-2’-deoxyguanosine while showed a decrease in the supe...
Baochao Liao1,2, Xiujuan Shan2,3* and Yunlong Chen2,3
...a population-level on a species to be examined. The present study applied a DEB-ABM to the Japanese anchovy Engraulis japonicus. The DEB-ABM accurately captured energy acquisition and allocation throughout the anchovy lifecycle (egg, yolk sac larva, exogenous feeding larva, juvenile, and adult) and predicted how individual-level processes affect energy dynamics at higher levels of biological organization. We estimated primary model parameters (e.g., ene...
Muhammad Qayash Khan1,2, Muhammad Zubair Anjum2, Muhammad Adnan3, Abbas Khan1, Hafsa Zahid1, Javed Nawab4, Sher Zaman Safi5, Muhammad Ishaq Ali Shah6, Atif Kamil7 and Abid Ali1*
...ng closely related fish species the taxonomic ambiguities arose as a result of morphological similarities which not only conceal the genetic diversity but also pose problems in fisheries management and conservation practices. The purpose of the present study was a molecular characterization of fish species of economic importance belonging to the genus Schizothorax, Tor and Mystus collected from various rivers o...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2, Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6
.../i>Gallinarum,is a host specificpathogenic bacterium of fowl typhoid, one of the most important diseases of poultry that increases the death rate and reduction in eggs production. Bacteria forms the complex structural colonies enclosed in a sticky matrix known as biofilm. Various antimicrobial approaches used to treat gastrointestinal infections are usually ineffective due to biofilm formation. The purpose of this study was to (1) compare biofilm formation of ...
Muhammad Akram Muneer1, Khalid Munir1, Ghulam Abbas1’*, Isra Munir1, Mumtaz Ahmad Khan1, Asif Iqbal1, Munsoor ud Din Ahmad1, Muhammad Arshad Javid2, Zareen Fatima1 and Maria Arshad1
...red responsible for high percentage of (around 30%) of common cold/flu cases. Viruses causing SARS, MERS and COVID-19 are members of family Coronavirdae. World Health Organization (WHO) reported that the novel Cov-19 virus infection was first diagnosed in Wuhan, Hubei Province, China during December 2019. Initially the virus was named as nCoV-19 and later disease due to this virus was named as COVID-19, and recently named as Severe Acute Respiratory Syn...
Natalija Grittner1, Radomir Mandić2,* and Milivoje Urošević3
...ont-size: small;">This paper presents animal genetic resources of Serbia. Breeds of horses, donkeys, cattle, buffalo, sheep, goats, pigs, chickens, geese, turkeys, ducks, guinea fowls, dogs and bees were analyzed. The number of populations these indigenous breeds in Serbia has been shown in this paper. It is proposed that 15 breeds (13 breeds and 2 strains), which are not protected by the Decree of the Ministry of Agricultur...
Laura Alejandra Arriola-Mosqueda1, Yadira Jiménez-Lara2, Eugenia del Carmen Prieto-Avella1, Carlos Ricardo Cruz-Vazquez3, Roberto Montesinos-Matias4, Mauricio Valencia-Posadas2, Ana Martha Cruz-Avalos5, Jaime Molina-Ochoa6,7 and César Andrés Angel-Sahagún2,*
... and 89.5–100%, respectively. The average radial growth ranged from 2.3–3.3 mm per day. The pathogenicity results for eggs and larvae showed 100% mortality for both biological stages. The Ma4 strain showed an outstanding LC50 value with 1.78 × 10E6 conidia mL-1. M. anisopliae is effective for controlling R. sanguineus, and that the radial growth characteristics and germin...
Ammara Gull-e-Fareen1,2, Imran Bodlah1,*, Muhammad Adnan Bodlah3, Muhammad Tariq Rasheed1, Habib Ali4 and Muhammad Asif5
...a Holarctic genus; some species of Callaspidia attack the larvae of order Diptera and Coleoptera. Callaspidia notata (Boyer de Fonscolombe, 1832) (Hymenoptera: Figitidae: Aspicerinae) is reported with colour variations like scape, pedicel and basal part of antennal segment 3 slightly darker than remaining segments, scutellum and mesopleura mostly dark reddish with some darker...
Iftikhar Hussain1, Sardar Azhar Mehmood1, Muzafar Shah2*, Mohammad Salim3, Shabir Ahmed1, Sana Ullah1,Sidra Batool4, Nadia Saeed1 and Khalid Usman1
...ristics of the captured specimens were compared with literature. C. sphinx is being reported form the study area for first time. Morphometry of all captured C. sphinx showed that head and body length was 77.13 mm, ear length 19.51 mm, forearm length 65.49 mm, length of tibia 26.61 mm, length of hind foot 17.95 mm and length of tail 7.35 mm. Phylogenetic analysis was performed on the bases of CO1 gene seq...
Rao Muhammad Ramiz1, Arfan Ahmad2*, Aamir Ghafoor2, Muhammad Avais3, Qurat-ul-Ain1 and Muhammad Zahid Iqbal3
...ular characterization respectively. In this study, animals of group A (32.5%) showed significantly greater seropositivity (P<0.05) against BLV than group B (16%). Furthermore, exotic breeds of cattle showed significantly greater seropositivity (18.75%) compared to the local breeds of cattle (5.5%). Nested PCR on each of the 10% seropositive and negative samples confirmed BLV infection in three seropositive exotic animals (30%). Phylogenetic analysis reveale...
Rashid Mahmood1*, Muhammad Abu Bakar2, Muhammad Fahim Raza3, Ziyad Abdul Qadir1 and Muhammad Yahya2
... addition, we in vitro experiment, five different essential oils were evaluated against Varroa mites. Maximum mite mortality was observed in eucalyptus oil (96 ± 2.89%) followed by winter green oil (79 ± 2.89%), mustard oil (70 ± 2.1%), neem oil (61 ± 1.83%) and orange oil (54 ± 1.62%).x
...
Nosheen Basharat1, Usman Waheed2,3*, Muhammad Arshad1, Noor e Saba4, Iram Masood1, Akhlaaq Wazeer1, Ahmad Farooq1, Sadaf Moneeba1, Abdul Rauf5 and Hasan Abbas Zaheer2,3
...ient. TTV is a non-enveloped small virus of 3.8 kb containing a circular single-stranded negative-sense DNA genome. TTV represents the first circovirus-like virus found in humans. The study was conducted to assess the molecular epidemiology of TTV in healthy blood donors and find its relationship with hepatitis B and hepatitis C seropositivity. The study was conducted at the Department of Pathology and Transfusion Medicine, Shaheed Zulfiqar Ali Medical Univers...
Riffat Sultana1*, Nuzhat Soomro2, Santosh Kumar3 and Ahmed Ali Samajo2
...he mating behavior of 4 species of Oxyinae: Oxya hyla hyla Serville, 1831, O. velox (Fabricius, 1787), O. fuscovittata (Marschall, 1836) and Oxyina bidentata Willemse. In trials carried out in laboratory we verified the following mating sequence: (1) sexual recognition by antennation; (2) courtship with male turning his abdomen towards the female performing mediolateral antennae vibration and jerk...
Tanveer Hussain, Masroor Ellahi Babar*, Akhtar Ali and Fiaz Hussain
...r further analysis. Dual peaks/heterozygous conditions were identified at positions c.36 (A/C), c.87 and c.225 (Y, T/C). The phylogenetic tree was constructed through MEGA 6.1 software package using the Neighbor Joining method with a bootstrap value of 1000. Finally, the dromedary camel sequences from Pakistan were compared with corresponding genetic sequences of other animal species available on NCBI including Euro
Eman Khalifa1*, Riad Khalil2 and Haitham Elaadli3
...2) to determine the therapeutic efficacy of the various antimicrobials (9 types) on the isolated M. bovis by using different antimicrobial sensitivity plate method. A total number of 100 samples of mastitic milk from native lactating buffaloes’ breed were collected aseptically from 4 private farms in Cairo-Alexandria desert road in the north part of the Egypt and subjected to bacteriological and molecular examin...
Junyan Bai*, Zhihao Dong, Youbing Yang, Ziheng Li, Xiaoning Lu and Huirong Gong
...ere -0.425 and 0.176, respectively, and the correlation coefficients of cooking loss with crude protein and drip loss were 0.272 and 0.179, respectively.
...
Rahmat Ullah Khan, Asif Sadam and Sajid Mahmood*
...s 2) rocky vegetation slopes and 3) grassy mountainous slopes near agricultural fields. The average monthly population density was 0.198±0.04/ha by line transect method. During the period June, July, September and October 2017, significantly (P<0.05) high population density was recorded as compared to the population density recorded during May, August, November and Decembe...
Ahmad Ur Rahman Saljoqi, Muhammad Salim* and Iftikhar Ahmad
... the year 2017-18. The experiment was laid out in Randomized Complete Block Design having two factors with three replications and six treatments. Treatments Emamectin 1.9 EC @ 750 ml ha-1, orange (Citrus aurantium L.) peel extract @ 5%, neem (Azadirachta indica) seed extract @ 5%, neem oil @ 3%, green lacewing, Chrysoperla carnea @ 3 eggs plant-1,...
Sana Khan1*, Faiza Aman1, Muhammad Ismaeel2, Zafar Ali2, Mehboob Alam1, Sadeed Iqbal1 and Taimur Khan3
...ne-height: normal;">An experiment was carried out to evaluate the effect of varying levels of phosphorus on growth and yield parameters of pea (Pisum sativum L.) cultivars at Agricultural Research Station, Swabi-Pakistan, during the year 2016-17. The plots were prepared according to Randomized Complete Block Design (RCBD) with split plot arrangement that were replicated three times. Phosphorus levels (0, 30. 60, 90, a...
Dabesa Wegari and Fikiru Temesgen Gelata*
...schedule, site visit and personal observation. Data analysis was made using descriptive and inferential statistics. In the study areas, the major beef cattle value chain actors were input suppliers, producers, traders, fatteners, processors, retailers, consumers and governmental and non-governmental institutions. The core functions of the chain actors were input supply, production, marketing/trading, processing, retailing and consumption of the product.Therefo...
Faiza Aman1,*, Neelam Ara1 and Syed Mehar Ali Shah2
...">A total of fifty-seven pea (Pisum sativum L.) genotypes including 50 accessions and seven varieties were evaluated for the nine quantitative traits to assess the variability and association patterns for the characters under study. The genotypes were grown in plots using Randomized Complete Block Design (RCBD) at Horticulture Research Farm, The University of Agriculture Peshawar du...
Saba Shabeer1, Riffat Tahira2 and Atif Jamal3*
...than 1.5 million fungal species exist in the world, amongst them pathogenic species can attack plants at different stages causing considerable damage amounting to millions of rupees. One of the plant pathogenic fungi is Fusarium spp. Fusarium species are very well-known soil-inhabiting fungi that cause many economically important diseases o...
Hafiz Hammad1, Mukkram Ali Tahir1, Noor-Us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Aneela Riaz3, Abid Niaz4 and Muhammad Arif4
...odha in year 2018. The experiment was laid out in a complete randomized design (CRD) with eight treatments which were replicated four times. The treatments plan includes T1 = NK + P0 (Control); T2 = NPK (Recommended rate); T3 = NK + RP at 7 g pot-1; T4 = NPK + RP at 7 g pot-1; T5 = NK + RP at 7 g pot-1 + Wheat straw at 14 g pot-1; T6 = NK + ...
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
...bad. In this regard an experimental plot of one acre area was established in the field area of RRI, NARC, Islamabad. Grass tuft of sized 15 cm was collected from the grass nursery of range land Research Institute (RRI) and plantation was carried out in one acre in barani condition. The area was laid down and plant to plant distance was 60 cm and row to row distance 90 cm kept in the research study area in RRI, NARC. The parameters of this ex
Kartika Noerwijati1*, Sholihin Sholihin1, Tinuk Sri Wahyuni1, Rohmad Budiono2, Nguyen Van Minh3, Roy Hendroko Setyobudi4, Zane Vincēviča-Gaile5 and Lulu Husna6
...luster that consisting superior clones were cluster 4.
...
Grace Okongor, Chukwudi Njoku*, Pauline Essoka and Joel Efiong
...e, Nigeria. Rainfall, temperature, sunshine and relative humidity (1976-2016), as well as yam yield data (1990-2016) were considered. Results revealed that climate elements fluctuated steadily during the period with a marginal increase in yam yield. The projections from the Time Series Modeler showed that relative humidity will decrease slightly while yam yield will increase by an additional 265 metric tons in 2026. Although...
Muhammad Tariq Chaudhary1, Saleem Ashraf 2, Muhammad Yaseen3 and Muhammad Luqman3
...ernment of the Punjab as perceived by the Diploma in Agricultural Sciences (DAS) holders. who were recruited in agriculture department during 2017. This study was quantitative and data were collected through questionnaire from 300 respondents who were recently appointed as Field Assistants (FAs) in Agriculture Department. Total 237 questioners returned by the respondents were found complete, thus, sample size was reduced to 237. Effective Schools Model present...
Sana* and Abbas Ullah Jan
...lysis revealed that 34.7 percent of children of the sampled farm households were full-time involved and 41.9 percent were part-time involved in different agricultural activities. The most frequent of them were animals grazing, fodder cutting and carrying, crops weeding, harvesting and firewood collection. Multinomial Logistic analysis revealed that a child’s age, gender (male) and school distance (more than walkin...
Raheel Saqib1*, Muhammad Luqman2, Saleem Ashraf3, Tahir Munir Butt4, Abdur Rehman5, Imtiaz Hussain6 and Muhammad Umer Mehmood2
...ty situation and uplifts people’s living quality. All the rural farm families residing in district Mansehra served as the population for the study. In order to have a representation of the entire population, female respondents from the study area were drawn randomly. A total sample size of the study was 110 respondents (rural female engaged in different farming activities). Data were collected through pre-tested interview schedule and analyzed using SPSS...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
...ne-height: normal;">An experiment was carried out in plots during 2016 and 2017 to evaluate the effect of different levels of selenium application in irrigation water and foliar spray on physicochemical parameters of tomato hybrid Salar F1 grown in simple plastic tunnels using randomized complete block design. The data showed that plant height in centimeter, buds, flower, leaves and leaflets in numbers per plants with a rang...
Dilara Devranoglu, Ilksen Tavaci, Gonul Filoglu and Ozlem Bulbul*
...and electrophoresis were performed. The multinomial logistic regression model statistics is applied for eye color prediction. We observed allele and locus drop-outs on both bloodstains stored for five years and UVC exposed samples. The brown and blue eye colors were correctly predicted for reference and degraded samples. The intermediate eye colors were predicted to be brown or inconclusive. The degradation by aging bloodstains or UVC exposure, is differently ...
Muhammad Ihtisham1, Noor Amjad2, Muhammad Nauman3, Asghar Ali3, Khawar Riaz3, Muhammad Sajid3, Muhammad Owais Shahid*3
... However, several plant species have water-impermeable hard seeds which take a long time to germinate. The hard seed coat can be scarified successfully through acid treatment. Sophora is a beautiful ornamental plant and its seeds have the same issue. In this experiment, seeds of Sophora secondiflora were treated with H2SO4 and then sown at different dates. Both H2SO4 scarification and sowi...
Muhammad Yaseen1, Xu Shiwei2, Yu Wen2, Muhammad Luqman1*, Raheel Saqib3, Muhammad Ameen4, Sadia Hassan5 and Tahir Munir Butt6
... A well-structured and expert reviewed interview schedule was used to collect data from farmers from Huailai county. A total of 122 interviews were conducted for the collection of data. Data were recorded using EpiData software program and a logistic regression model was applied using the computer-based statistical program “STATA”. The findings indicate that media (electronic media and print media) was the key information source for the farmers and...
Yuanyuan Zhang1*, Liping Song1, Hui Guo2, Jun Wu1, Xiaoli Wang1 and Fangbin Yao1
...>We evaluated the growth performance and the hepatoprotective and antioxidant effects of curcumin against carbon tetrachloride (CCl4)-induced liver injury in common carp Cyprinus carpio. A 10-week feeding trial was carried out. A basal feed was supplemented with 0 (control), 30, 60, 120 and 240 mg/kg curcumin to formulate five experimental feeds. At the end of the feeding trial, the growth
Jiawei Hong1,2, Mingqiang Chen 1,2, Zhenghua Deng1,2, Youning Li1,2 and Yu Wang1,2*
...rtion of Tenericutes slumped to 3.85%. At the genus level, the relative abundance of Mycoplasma, dropped down from 58.38% to 3.85%, and Vibrio increased (from 15.23% to 40.8%) to become the dominant genus. The hierarchical clustering heat map analysis and principal component analysis (PCA) showed that the microbial community of the high dosage group (10 mg/L) was clearly different from the other two groups. Ove...
Waseem Khalid1, Ali Ikram1*, Muhammad Rehan2, Farukh Adeem Afzal1, Saadia Ambreen1, Marryam Ahmad3, Afifa Aziz1 and Anam Sadiq1
...ties of seeds as well as peels that have been discarded. These seeds contain high functional and nutritional potential compounds. It is the most exported and consumed fresh fruit and the residues like seeds and peel are commonly thrown out. It is cultivated in many countries and has high financial value worldwide and all this is due to adaptation to climate and various types of soil., Melo...
Sadaf Javaria1, Anum Marwat1, Muhammad Nadeem2, Mehwish Zerlasht1, Aiman Kareem3, Iqra Rubab1 and Masooma Munir4*
...resh fruit utilization especially in the children. The present investigation was designed to standardize the formulation of apple peach mixed fruit leather. Exact formulation has very important role in producing an acceptable and admired food product and the product grab more market. Therefore, the formulation of apple peach mix fruit leather was standardized by different treatments i.e. a...
Salman Ali1*, Ayaz Ali2, Riaz Ali Rind2, Majid Ali3, Zulfiqar Ali Mastoi2, Shagufta Naz3, Muhammad Shakir3, Rashid Ahmed Qaim Khani1
...owave T3 = respectively, and treatment were arranged in CRD with the repeats. The results revealed that the cooking in methods were significantly varied (LSD<0.05) for different parameters. The fish cooked in microwave resulted average value of moisture 65.03%, titratable acidity 1.78%, pH value 6.26, protein 24.07%, fat 3.76%. Whereas, the fried fish resulted moisture 62.16%, titratable acidity 1.39%, pH value...
Asima Batool1, Ghulam Abbas2*, Zuhair Hasnain3, Nasira Perveen4 and Muhammad Naeem Akhtar5
...response against high temperature / heat stress at Botany Department, Agriculture University, Faisalabad. Germinated maize seedlings / plants were placed in the glass fitted canopies, where canopy temperature was found 7-10°C higher than ambient temperature along with light reflection was enough for optimum photosynthesis. The
Ahmad Abrar Khan* and Muhammad Idrees
...ained through frequency, percentage and multiple regression with a dummy variable model. The majority (46.2%) apricot growers cultivated apricot on 01 kanal of land and major group (31.8%) were getting 51-70 Kg yields per tree. Moreover, 68.9% of apricot growers used chemical fertilizers, and Farm Yard Manure (FYM) application was also in practice by 62.9%. Apricot growers in major cases (59.1%) irrigated their crops in drou...
Tariq Ali Mastoi1, Zulfiqar Ali Mastoi2*, Zahoor Ahmed Khetran3, Ghulam Hussain Alizai2, Binish Baig4, Mitha Khan2 and Syed Jahangir Shah1
...ondents were interviewed personally and necessary data were collected through structured questionnaire. The research revealed that majority of the respondents i.e. 50% were in the age limit between 31-40 years. Almost 36.25% respondents had elementary level education. Further, it is reported that 28.75% respondents had 30 acres landholding, while 28.75% of the farmers having upto 20 acres landholding. Land tenure system of the respondents were examined and fou...
Javaria Sherani1,2*, Muhammad Saleem Jilani1, Tanveer Ahmad2, Sohail Kamaran3, Abdul Manan2, Tehseen Ali Jilani2 and Mateen Sajid2
...uirements hence, it is imperative to search for alternate food sources. Ber could be very handy alternate food crop if its yield and quality is enhanced. Grafting is a widely used technique to improve yield, disease resistance and fruit quality. This work aims to assess the effect of grafting on production, fruit ripening, physical and chemical properties, and nutritional quality of the fr...
Tasneem Shah*, Muhammad Tariq and Dost Muhammad
...m a 4 years long field experiment were collected to assess the effect of added biochar (0, 50, 90 and 130 t ha-1) and chemical fertilizers (viz., urea for N, single superphosphate for P and potassium chloride for K) on soil respiration and N mineralization during lab incubation experiment under wheat-mungbean and wheat-maize cropping systems. The rate of CO2 evolution...
Shakeel Ahmed Soomro1,2, Sikandar Almani3, Lal Bux4, Khalil Ahmed Ibupoto2, Muhammad Sohail Memon2, Farman Ali Chandio2, Shakeel Hussain Chattha2, Zaheer Ahmed Khan2, Zubair Ahmed Soomro5,Babar Mustafa Ansari6 and Kunjie Chen1*
...of drying on physical properties of Nanjing 9108 paddy variety using response surface methodology. A mathematical model was used predicting the effects of indicators i.e. temperature (40.86, 45, 55, 65 and 69.14 ºC) and time (4.11, 30, 92.5, 155 and 180 min) each with five levels on observed parameters. The suitability of quadratic model for present study was described by the responses having acceptable R2 an...
Muhammad Nawaz Kandhro1*, Nadia Mangrio1, Aijaz Ahmed Soomro1, Zia-ul-Hassan Shah2, Ghulam Sughra Mangrio3, Nihaluddin Mari4, Zulfiqar Ali Abbasi1 and Shazia Parveen Tunio5
...very important to use proper doses of balanced fertilizers to exploit the maximum yield potential of cane crop. This study focused on hypothesis that application of suitable planting methods and NPK level play a major role in improving sugarcane yield and quality. Experiment was performed under field conditions at Sugarcane Research Institute, Tandojam, Sindh, Pakistan (located at 250 25.1...
Md. Sabbir Ahamed1, Md. Rayhan Chowdhury1, Md. Atik Mas-ud1, Sujat Ahmed2, Md. Shahadat Hossain1 and Mohammad Nurul Matin1*
...illed and unfilled grain per panicle (FGPa, UFGPa), and primary branch (PB) obtained significant variation in case of treatment. The genotypic variance (σ2g) obtained maximum for grain per panicle (2918.83) and the lowest value of
Yongyun Zhang1, 2, Xinyang Fan1, Fangting Zhou1, Weizhen Li3, Yina Ouyang1,4 and Yongwang Miao1*
...cing. The CDS for both types of buffalo was the same in length, which contained 645 nucleotides and encoded a peptide composing of 214 residues. A total of 5 single nucleotide polymorphisms (SNPs) was identified in two types of buffalo. Among them, c.516T>C and c.578C>T were observed only in river buffalo, while c.175A>G, c.580T>C and c.609T>G were found only in swamp buffal...
Muhammad Ajmal1, Saima Mustafa1, Fizza Ibrahim Bajwa1, Cheng Zhou2, Guangdong Wen2, Soe Lwin Myint2, Syed Irfan Raza3, Ihtasham Bukhari4, Mubashir Hassan5, Muhammad Faisal6 and Furhan Iqbal1*
...cessive form of total alopecia, characterized by hair loss soon after birth and the development of papular lesions of keratin-filled cysts over extensive areas of the body. Two consanguineous families were enrolled from Basti Mochi Wala, Mouza Gulab Shah in Muzaffargarh District of Punjab (Pakistan) having multiple siblings suffering from alopecia. The aim of this study was to find out the genetic mutation(s) in hairless (
Hazrat Ali1, 2* and Ezzat Khan1*
...lso investigated tissue-specific accumulation of these metals in M. armatus at one site of River Panjkora. Concentrations of Cr, Ni, Cd and Pb in the fish muscles ranged from 10.2 ± 3.5 to 29.8 ± 17.3, 24.7 ± 13.1 to 104.5 ± 27.1, 0.77 ± 0.17 to 2.4 ± 0.12 and 7.5 ± 5.3 to 75.2 ± 41.0 mg kg−1 wet weight, respectively. The order of metal accumulat...
Kamran Baksh Soomro1*, Sina Alaghmand2, Sanyogita Andriyas3, Muhammad Rehmatullah Khan4, Naveedullah5 and Amin Talei6
...tific inquiry. A field experiment was conducted during 2018-19 to study the impact of saline water on the economics of bitter gourd yield and soil salinity after the end of the crop. Two irrigation treatments including freshwater (IT1 EC 0.56 dS.m-1; control condition) and saline groundwater (IT2 EC 2.56 dS.m-1; experimental condition), in two consecutive seasons, were used under t...
Muhammad Ilyas Khan*, Ihsan Mabood Qazi and Mohammad Ayub
...unctional and pasting properties. Where, in second phase of the study flour of low and high amylose rice varieties were blended in various ratios (100:00, 80:20, 60:40, 40:60, 20:80 and 00:100) and were studied again for functional and pasting profile. Results indicated that colour, moisture, water solubility index (WSI), water absorption index (WAI), swelling power (SP) and pasting profile of selected varieties of rice flour were significantly (p < 0.05) d...
Chen Tongde1, Fakher Abbas1, Jiao Juying1, Shahzada Sohail Ijaz2*, An Shoshan1, Muhammad Ansar3, Qaiser Hussain2, Mah-Noor Azad2 andAyaz Ahmad2
...ted to investigate the types and characteristics of soil erosion, land use types and soil and water conservation measures, from April 16 to 20, 2019. Map interpreted in the early stage was manually recorded and Ovi interactive map APP was used for location photography to record the land use situation of each map spot in the survey unit. The land use situation was revised based on ArcGIS in the later stage. The overall soil e...
Haseeb Khattak1, Imran Ahmad1, Abdul Basit1*, Izhar Ullah1,2, Syed Tanveer Shah1, Humaira Wasila3, Inayat Ullah4, Intizar Ahmad1 and Noman Ahmad1
...: normal;">Diverse genotypes of cucumber under different cropping patterns may signify to examine the potential of best and desired selection for quality crop. The study was carried out to evaluate cucumber genotypes (IT-145, Damaz, Yayla, Eva, Chinese Slanger, Poinsett-76, SCM-01 and SCM-03) under various gardening patterns (Horizontal and Vertical) at Vegetable Directorate, HRI, NARC, Islamabad-Pakistan. It was observed th...
Umair Riaz1*, Shazia Iqbal2, Muhammad Irfan Sohail2, Tayyaba Samreen2, Muhammad Ashraf1, Fatima Akmal2, Ayesha Siddiqui3, Ijaz Ahmad4, Muhammad Naveed5, Naveed Iqbal Khan5 and Rao Masood Akhter6
...s and accounts for 44.35 per cent and 53.13 per cent of world trade in terms of value and volume, respectively. Following the leading role of China with 1.48% share in MAPs exports, India is second largest exporter of MAPS with 8.75% share in Asian trade of MAPs. Various biomass and leftover produced with these plants production, as the MAPs cultivation withstands a huge economic potential...
Roland Eric Yessinou1*, Alain Richi Kamga Waladjo2, Nestor Noudeke1, Ignace Dramou3, Justin Adinsi1, Victorien Tamègnon Dougnon4, Elsie Yélognisê Sangnidjo5, Razack Osse5, Alfred Dansou6 and Souaïbou Farougou1
...cts two to three million people in West Africa. A retrospective was conducted review through literatures search using the AGORA, PubMed, Science Direct, Scopus, Researchgate and Google Scholar Databases on Lassa fever (LF) from West Africa. A total of 34 articles were studied from 11 countries. Studies were categorized by host and country, and analysis conducted to determine pooled prevalence estimates for each category Anal...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
...nd showed to be of genotype VII. Eight NDV viruses were isolated from vaccinated commercial broiler flocks showing respiratory manifestation in Menofia governorate, Egypt during 2019. Those viruses showing deaths and haemorages of inoculated SPF ECE eggs, harvested allantoic fluids showed haemagglutination activity by using 1% RBCs and also haemagglutination inhibition in case of using NDV reference antiserum, As well as realtime polymerase chain reaction by u...
Ryan Septa Kurnia1* and Radiana Dhewayani Antarianto2
...nology that can be developed in tissue engineering techniques for reconstruction to mimic the microenvironment in respiratory tissue engineering.
...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
...xt-align: justify;">Chickpea (Cicer arietinurn L.) is a rich source of plant protein. A number of diseases attack chickpea crop but wilt disease is the principle one. In mineral contents i.e. nitrogen, phosphorus, potassium, calcium, magnesium, sodium, zinc, iron and copper were decreased in chick
Hafiz Imran Iqbal1*, Zahir Ahmad Zahir2, Obaidur Rehman1, Rizwan Khalid1*, Abdul Waheed1, Raja Abad Raza1, Shahid Saleem1, Muhammad Rashid1, Sarosh Tariq Alvi1 and Asia Munir1
...e growth of plants. An experiment in pot was conducted to assess the effect of combined use of rhizobia and plant growth promoting rhizobacteria (PGPR) (containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase) on the growth and yield of maize under salt affected conditions. In pots three levels of salinity were developed i.e. 1.2 (original), 6 and 12dSm1 by sodium chloride (NaCl) salt. The inoculants being us...
Sohail Akbar1*, Muhammad Shafiq2, Muhammad Yaqoob2, Muhammad Farooq Iqbal2, Kashif Ishaq2, Muhammad Kamran2, Shazia Shamas3, Arbab Sikander4 and Muhammad Hashim5
... production in animals especially reared in tropical and sub tropical area. Exotic dairy cows are more prone to environmental stress as they have more heat of metabolism. Moreover, they are high producer and high producer animals are more susceptible to heat stress. Heat Stress has harmful impact on production, reproduction, metabolism and immune status of animal. Semen quality of exotic cattle is also affect by heat stress. Similarly, fertility decreases duri...
Caner Öztürk1*, Mücahid Onay1 and Neşe Hayat Aksoy2
...ellular contents of the sperm cells are important in the spermatological studies. Since homogenization processes reveal the intracellular contents of the sperm cells, we aimed to examine the optimal sonication procedure and the protective effect of the antioxidants against sonication. Four merino rams (2–3 years old) were used for semen collection, and the ejaculates were pooled and ...
Asma Chaudhary1, Qurat-ul-Ain Ahmad1, Afia Muhammad Akram1, Sadia Roshan2 and Javed Iqbal Qazi3*
...us aerius AsCh-A7 respectively. Six probiotic bacterial isolates of known enumeration (C.F.U.ml-1) showed growth antagonism for the fish pathogen with inocula comprising of less number of C.F.U.ml-1. Highest survival rates i-e 63.5 and 70.17% were expressed by Sphingomonas sp.AsCh-P3 and B. aerius AsCh-A7 respectively by mixing in formulated fish feed, drying and storing in refr...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
...Various factors such as species, breeds, lactation stage and location affect milk composition. We evaluated the composition of Kilis goat milk in two different seasons on the basis of alcohols, ketones, aldehydes, esters, indoles, carboxylic acids, aromatic hydrocarbons and terpenes. Milk samples were collected at the early and late lactation periods from Hatay and Kilis, Turkey. During bo...
A.E.S. Patrick1,*, S. Kuganathan2 and U. Edirisinghe3
... growth patterns of 380 specimens belonging to 10 species, 9 genera and 5 families of local fish in Vavuniya reservoir, Sri Lanka during January, 2013 to August, 2014. The regression coefficient value ‘b’ from LWR and statistical comparison from the ideal value (b=3) were used to find the growth patterns. Most of the local species showed isometric growth except
BamideleAkinsanya1, Isaac O Ayanda2,*, Benson Onwusa1 and Joseph K Saliu1
...thod. Only one parasite species, Teneuisentis niloticus, an acanthocephalan was recovered. There was 72% infection prevalence. The result also revealed that both BTEX and PAHs were accumulated in the body of the parasite. Two components of BTEX, (1,2-dichlorobenzene and 1,3-dichlorobenzene) and five PAH congeners-Acenaphthylene, Phenanthrene, benz(a)anthracene, benzo(a)pyrene and 7,12-dimethylbenz(a)anthracene were not detected in the parasite. Total BT...
Ibrar Muhammad Khan1, Dezhi Xu1, Zubing Cao1, Hongyu Liu1, Adnan Khan2, Sajid Ur Rahman3, Jam Zaheer Ahmed4, Muhammad Akmal Raheem5 and Yunhai Zhang1*
... related to reproductive performance. Hence, the antioxidants agents(L-cysteine and vitamin E) were added into semen diluent and assessed the freeze-thawed semen quality parameters. The ejaculates were collected from two crossbred groups (Sahiwal × Holstein-Friesian), and (Achai × Jersey) and, split into seven aliquots while extended with three different concentration (5, 7.5 and10 mmol) of L-cysteine diluents and followed by other th...
Ahsan Numan1,4, Abdul Basit Qureshi2, Fehmeda Farrukh Khan3,Faisal Masud3,Ijaz Ahmad4, Kamran Ashraf5, Nisar Ahmad5, Muhammad Shahbaz Yousaf 4, Imtiaz Rabbani4, Hafsa Zaneb6 and Habib Rehman4*
...n of diabetes mellitus type-2 on the electrophysiological characteristics of sensorimotor nerves in patients with clinical diabetic polyneuropathy (DSP). Clinical diagnosis of DSP was assessed with the Michigan Neuropathy Screening Instrument. The diagnosed patients with DMT2 were randomly distributed into 2 groups. Group-I (n= 79) included the patients with DSP having <10 years of duration of DMT2, called short duration, while DSP patients of Group-II (n= ...
Hagar E. Mohammed1, Ranwa A. Elrayess2 and Heba N. Gad El-Hak2*
...ons of Artemisia monospermia with Mentha piperita on male fertility.Treated rats with different doses of A. monosperma or M. piperita alone induced severe testes histopathological lesions and histochemical alteration associated with a reduction in epididymis weight, abnormality in the sperm ...
Amjad Ali1*, Pirzada Jamal Ahmad Siddiqui1, Naveed Ahmad2,Shabir Ali Amir3, Rafaqat Masroor3,Seema Shafique1 and Zaib-un-Nisa Burhan1
...ned. A total of 58 fish species in 33 genera and 24 families were recorded at 10 different dive sites. High diversity occurred at Churna Island following Mubarak Village and Astola Island. Majority of the recorded fishes were planktivorous. Compare to Churna and Mubarak Village, physico-chemical parameters at Astola Island were found in limits as preferred by fish and coral communities for their proper growth. Fish accumulat...
Muhammad Moosa Abro1*, Nadir Ali Birmani2 and Muhammad Bachal Bhutto3
...thic examination of two species of freshwater fishes, Mastacembelus armatus and Oreochromis niloticus collected from the Indus river of Sindh Pakistan, revealed presence of subgenus Spirocamallanus of genus Procamallanus. The subgenus was characterized by the presence of spiral thickening in buccal capsule. The prevalence of subgenus was higher in Mastacembelus armatus (33.33%) than Oreochromis niloticus (7.69%). There...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
...ne-height: normal;">The specific proteins induced by sublethal-temperature are molecular chaperons that positively regulate plant growth and development that govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-tempera...
Joseph Anejo-Okopi1*, Jennifer Ifeoma Okpara1, James Mogoret Dabol1, Joshua Adetunji1, David Adeniyi2, David O. Amanyi3, Otobo I. Ujah4, Veronica David1, Patience Omaiye5 and Onyemocho Audu6
...DV infection, which is imperative for policy makers and health care providers to strengthen the prevention measures for HDV, including the use of HBV prevention vaccine. Also, it is important to screen chronic HBV patients for HDV for early detection to avert subsequent development of end stage liver disease. Furthermore, larger studies are needed to gain better understanding of the HDV infection among chronic hepatitis B patients in endemic regions and other ...
Suwati Suwati1, ErniRomansyah1,*, Syarifudin Syarifudin1, Yahya Jani2, Agus Heri Purnomo3,
Damat Damat4 and Erkata Yandri5,6
... The methods were used experimentally in the field and laboratory. And the data were analyzed using simple linear regression to formulate a trend of reduction in the weight of seaweed while drying. The results showed that the weight reduction in seaweed by the natural method can be illustrated by the simple regression linear equation Y = -2.385 3x + 943.65 with R² = 0.985 9, which means a reduction in weight of seaweed i.e. 2.385 3 g min&ndash...
Saad A. Moussa1, Ahmed F. Afify1*, Suzan Salah2 and Ayman Hamed3
...tified by TEM and immune-peroxidase technique. Betacoronavirus 1 was detected by ELISA in 6 out of 20 fecal samples (30%), PCR detected 4 out of 6 ELISA positive samples at specific M.W. band of 236 bp by electrophoresis, and one sample was sequenced and submitted on Genbank with acc.no. MW173144, further phylogenetic sequence analysis revealed high percentage of identity with reference st...
Bram Brahmantiyo1,*, Henny Nuraini2,3, Astari Wibiayu Putri3, Maizirwan Mel4,5 and Cecep Hidayat6
...s to characterize phenotype of Hycole and Hyla rabbits to evaluate their adaptability in tropical environments. Research were held at Indonesian Research Institute for Animal Production, Ciawi, Bogor, Indonesia using 79 adult rabbits (20 does and 20 bucks of Hycole, 14 does and 12 bucks of Hyla, and five does and eight bucks of New Zealand white). The age of the rabbits evaluated in this experiment was rabbits with age 20 wk...
Praptiningsih Gamawati Adinurani1,*, Sri Rahayu1, Endang Dwi Purbajanti2, Devi Dwi Siskawardani3, Karina Stankeviča4 and Roy Hendroko Setyobudi5
... each main plot. Three types of rhizobia applications viz., soaking (A1), spraying (A2), soaking and spraying (A3) and four levels of mycorrhizae doses viz., 0 g plant–1 (M0), 10 g plant–1 (M1), 15 g plant–1 (M2), 20 g plant–1 (M3). The results indicated that the application of Rhizobium at various doses of mycorrhizae together had a significant effect on plant height 70 d (A2M1 = 53.96 cm), l...
Titin Herawati1,*, Indra Adiwiguna1, Ayi Yustiati1, Iis Rostini1, Roy Hendroko Setyobudi2, Hafizan Juahir3 and Asep Sahidin1
... fish in Cimanuk River, specifically upstream and downstream Jatigede Reservoir. Field observation method and census sampling technique were applied. Research commenced from November 2017 to January 2018. Parameters measured are diversity index, dominance index, equitability index, and water quality. Data analysis employed comparative-descriptive method by mapping the species and comparing the diversity of fish living in bot...
Haris Setiawan1, Aris Winaya1,*, Herwintono Herwintono1, Mulyoto Pangestu2 and Yayuk Kholifah3
...reezing process reduces sperm quality due to membrane damage. Antioxidants protects the membrane of spermatozoa. This study aimed to observe the effects of Snakehead Fish (Channa striata [Bloch 1793]) Extract (SFE) supplementation in tris Egg-yolk extender on mortality and motility of spermatozoa of Limousin bull (Bos primi...
Uwem E. George1, Oluwadamilola A. Arowolo2, Oluseyi A. Olayinka3, Ijeoma M. Ifeorah4, Temitope O.C. Faleye3,5, Bolaji Oluremi6, Arthur O. Oragwa7, Ewean C. Omoruyi8, Emmanuel E. Udoh9, Oluwadamilola G. Osasona1,10, Emmanuel Donbraye11, Olufunke P. Adeniji12, Olubusuyi M. Adewumi3,13* and Johnson A. Adeniji3,13,14
...s were pooled, then resuspended in phosphate-buffered saline. Subsequently, nucleic acid was extracted from the suspension and Illumina sequencing performed. ARGs in the raw reads were determined and assembled using the KmerResistance tool v2.2. From the 2,763,954 reads generated, 14 ARGs with statistically significant reads were identified. Precisely, 90.5% (12/14) of the ARGs detected ta...
Anwar Ali1,5*, Horia Shaukat2, Munir Ahmed3,5, Ahmed Bostani4 and Syed Ashiq Hussain3
...ched to reduce the time spent in the muscle and his fatigue. It is also found to enhance meat tenderness and to boost meat sensory attributes. But it may also have adverse effects on some meat quality characteristics like holding capacity of water and other one is color. To get the desirable effects from electrical stimulation, it should adequately along with other methods. In spite of a wide exploration and study on electrical stimulation, the fact that it ha...
Faheem Aslam1,*, Aneel Salman2, Inayatullah Jan3 and Sarah Siddiq Aneel4
... and industrial growth depends on the kind of water systems and policies a country develops and implements. Due to its value and importance in all aspects of life, water is a highly political issue. The purpose of this study is to explore the water policies of Pakistan (2017) and India (2012) through quantitative analysis of textual data. The text mining of these water policies enables to analyze the massive amounts of infor...
Shehzadi Saima1, Maqsoda Perveen2, Muhammad Nawaz1, Khalid M. Ahmad1,* and Haider Sultan1
...s used for plantation. Experiment was carried out in complete randomized design (CRD) with four replications and three fertilizer treatments (control, 2g/pot with side dressing, 2g/pot with foliar spray). Results revealed that foliar spray of potassium enhanced most of parameters i.e. length of stalk, fresh weight of stalk, dry weight of stalk, number of florets per plant, diameter of stalk, fresh and dry weight of le...
Dara Jaff1,2* and Michael C. Jarvis2
...al;">Barley genotypes selected by farmers or breeders for dry climates need to cope with wide variation in rainfall from year to year. Vigorous vegetative growth is needed for yield when drought terminates growth early, but this character can lead to lodging in years with above average rainfall. Barley cultivars and landraces bred adapted to these conditions have thinner straw than higher-yielding cultivars adapted to...
Wahyu Widodo1,*, Imbang Dwi Rahayu2, Adi Sutanto3, Apriliana Devi Anggraini4, Harum Sahara4,
Sara Safitri4 and Abubakar Yaro5,6
... feed additive towards super kampong chicken (Indonesian native/local chicken - Gallus gallus domesticus Linnaeus, 1758) and to determine the most effective level of curcuma xanthorriza for the chicken. Completely Randomized Design (CRD) was used in this research through experimental design. Treatments in this research covered T0: Curcuma xanthorriza as feed additive 0.0 % (parameter), T1: Curcuma xanthorriz...
Chaogang Yao, Daxin Pang, Chao Lu, Aishi Xu, Peixuan Huang, Hongsheng Ouyang* and Hao Yu*
...stigate the roles of the peroxisome proliferator-activated receptor (PPAR) and fatty acid metabolism signaling pathways in determining the IMF contentin the longissimus dorsi (LD) muscle of pigs. The expression profile of candidate genes involved in the PPAR and fatty acid metabolism signaling pathways were detected in the LD muscle of two pig breeds with different IMF contents (Large White and Min) by a quantitative real-time reverse-transcription polymerase ...
Jun Yan Bai*, Zhi Hao Dong, Yu Chen, Jing Yun Li, Ying Lei, You Bing Yang, Kun Peng Shi and Xue Yan Fu
...R2=0.833), respectively. The best regression equations of the total egg weight of Beijing white quail, Korean quail and Chinese yellow quail to week-age were: Y=-142.558+21.406X-0.037X3 (R2=0.991), Y=-180.768+38.405X-1.508X2 (R2=0.888) and Y=-150.305+34.794X-1.362X2 (R2=0.882), respectively. The best regression equations of laying rate of Beijing wh...
Masood Sadiq Butt1, Sadia Aslam1,2, Rizwan Shukat1,*, Syed Qamar Abbas1, Muhammad Issa Khan1, Shadab Shaukat3 and Muhammad Shahid4
... reaction conditions (temperature, time, pH and enzyme to substrate ratio) for enzymatic hydrolysis of fish proteins. The optimum reaction conditions for degree of hydrolysis (DH) using flavorzyme enzyme were temperature 46.37oC, time of hydrolysis 116.91 min, [E]/[S] ratio 1.97% and pH of 7.99. The experimental value of DH at optimized conditions was 50.13% while the statistica...
Saima Siddiqui1, Ghulam Hussain Abro1, Tajwar Sultana Syed 1, Abdul Sattar Buriro2, Sohail Ahmad3, Muhammad Zeeshan Majeed4 and Muhammad Asam Riaz4*
...many chewing and sucking pest. Chemical insecticides are used abundantly to suppress the pest population. The use of host-plant resistance is an alternative tool to control cotton insect-pests. The current research was aimed to identify the cotton physio-morphological marker to manage pressure of sucking pests such as jassid (Amrasca bigutulla bigutul...
Basharat Ahmed1, Muhammad Hamza Azhar2, Farah R. Shakoori1 and Abdul Rauf Shakoori1,3,*
...n 23.1 kb to 2.0 kb. grouped into seven different plasmid patterns. The plasmids (23.1 Kb) could only confer tetracycline resistance to the competent cells of drug sensitive and plasmid-less Campylobacter strains. A plasmid-borne tet(O) gene were the main resistance mechanisms for tetracycline.
...
Canan Vejselova Sezer*
...ly less and highly developed countries. Two of the leading causes of the death of cancer are lung and breast cancers among males and females, respectively. A variety of drugs are in use for cancer treatment but their recruiting properties are limited because of the developing resistance and/or finiteness of bioavailability. Current research is aimed at synthesis of a new effective agent of...
Muhammad Farhan Qadir1, Xin-Yu Han1, Meng-li Qiao1, Ying Wang1, Ding Zhang1, Yu-hai Bi1,2, Ali Raza Jahejo1,Qian-qian Cheng1 and Wen-xia Tian1,*
...stern blot analysis were performed to identify the expression levels of PG-related genes (COX-2, GSTA3, PTGDS, PTGES, PTGER3 and PTGER4) in erythrocytes of H9N2 infected chickens at time intervals of 0, 2, 6 and 10 h and P < 0.05 was considered as statistically significant. Expression levels were increased significantly in case of COX-2 at 0 and 6 h, GSTA3 and PTGDS at 0 h and PTGER4 at 2 h of infection, while decreased expression was observed in cas...
Rukhsar Ali* and Ali Muhammad
...hin one month of storage period. Different treatments preserved with food chemical preservatives were statistically significant during storage period of six months at (p <0.05). From this research work, it has been accomplished that the effect of collective dosage of chemical food preservatives i.e. 0.033% PS, 0.033% SB, and 0.01% KMS on treatment MLBPr7 and MLBPr6 of mango loquat blended pulp sample...
Aysha Riaz* and Said Wahab
... and 34.60 and 75.15% respectively. The farinograph water absorption and mixing tolerance index of wheat-moringa composite flour increased whereas the dough stability decreased with increasing the proportion of moringa leaves powder. Width and spread ratio of the biscuits decreased and the thickness of the biscuits increased with increasing the enrichment level of moringa leaves powder. The moisture content of the biscuits was in the range of 3.99 to 4.13%, pr...
Naveed Ali1, Umar Hayat1*, Shahid Ali1, Muhammad Imad Khan1 and Sanam Wagma Khattak2
...rsquo;s economy, it is imperative to analyze the sources of agriculture productivity of the SAARC countries. This endeavor examines the impact of financial development on agricultural productivity in case of SAARC countries for the period of 1996 to 2019. Moreover, this study introduces trade openness, human capital, and income as important control variables of agriculture value-added. To ...
Muhammad Farooq1*, Allah Rakha2,Jawad Ul Hassan2, Iftikhar Ahmed Solangi1, A. Shakoor3, Muhammad Bakhtiar4, Muhammad Noman Khan5,Shoaib Khan5, Ibrar Ahmad6, Shabir Ahmed7 andWang Yunyang1*
...;">At global level many species of eatable mushrooms have been used for diet and medication purposes. In addition to its dietetic value mushroom have many medicinal importance because mushroom is used against several viral, bacterial and cancer diseases. Mushroom powder also used to reduce blood pressure and increase resistance of person against many diseases. Keeping in pers
Iftikhar Alam1, Atta Ulllah Jan1, Muhammad Ali2 and Muhammad Farooq3*
...decision making on the types of research in nutrition is tough both for researchers and health policy makers. Defining research priorities is important for proper planning in nutrition. The objective of the present study was to identify most important nutrition research areas of the highest priority in order to be more focused on decision making issues concerning nutrition research promotion. This study was descriptive in na...
Oluseyi A. Olayinka1, Temitope O.C. Faleye2, Oladipo O. Omotosho3, Oladapo A. Odukaye3, Bolaji Oluremi4, Ibipeju H. Ibitoye1, Oludayo O. Ope-Ewe1, Uwem E. George5, Oluwadamilola A. Arowolo6, Ijeoma M. Ifeorah7, Ewean C. Omoruyi8, Emmanuel Donbraye9, Olufunke P. Adeniji10, Olubusuyi M. Adewumi1,11* and Johnson A. Adeniji1,11,12
...est Nigeria. Three fecal pellets were randomly picked from the floor of unit pens containing a minimum of three pigs per unit in selected piggery in Ibadan, Nigeria. The samples were pooled and resuspended in phosphate buffered saline. The suspension was then subjected to nucleic acid extraction, cDNA synthesis and Ill...
Atilla Yıldız
...nvironment that affects sperm survival and determines the ability of cows to become pregnant. Insemination based on cervical mucus characteristics may increase pregnancy rate. Therefore, this study’s aim is to evaluate the extent to which the scores specific to the changes in physical properties of cervical mucus predict the probability of conception at insemination time. Cervical mu...
Saira Batool1, Safdar Ali Shirazi1 and Syed Amer Mahmood2*
...y, topographic-length-slope, crop management and conservation factor reveal interesting results and are in accordance with the local estimations that agree with each other well. The output maps indicate that the approximated total possible soil loss annually of about 92.6 million tons is equivalent to the calculated sediments of 148 tons/ha. Chakwal watershed is acutely facing severe erosion due to its soil characteristics and topography. The outputs generated...
Arshad Bhat1*, Masudul H. Wani1, Shabir A. Wani2, Abid Qadir3, Iqra Qureshi4 and Abid Sultan2
...se of indiscriminate pesticides have severe negative impacts on human health, biosphere and ecological web-chains. Easy access and availability of pesticides has opened the sphere of choices to the growers, but the recognition of standard and sub-standard pesticides has made the growers very much perturbed and they...
Tanay Dineshkumar Shah
...s of India. However, the per capita consumption of mushroom in India is very less as compared to other countries though mushroom has many health benefits as compared to other regular diets a normal Indian consumes. Gujarat is one of the states of India where the consumption of mushrooms is less. The paper concentrates on finding out the probable reasons for the people of Gujarat who are no...
Uzma Ayaz1,* and Muhammad Fareed Khan2
...y following cotton and rapeseed. Twenty-five local and imported hybrid seeds along with two check hybrids (Hysun-33 and NKS-278) collected from National Agriculture Research centre Islamabad were field tested at Rawalakot Azad Jammu and Kashmir during July and August 2019. The cultivation was carried out in three replications uniformly by applying randomized complete block design (RCBD) by maintaining R x R space of 75 cm and plant to plant space of 20 to 25 c...
Monoar Pallab*, Moktadir Reza and Debashish Sarker
...nd continuous sutures respectively. The animal recovered without any complications three weeks post-operatively....
Mustasim Famous1*, Asim Chakrabartty Aditya2, Shahabuddin Ahmed3 and Sabuj Sutradhar2
...ductive and reproductive performance of Sahiwal × Local (SL× L), Friesian × Local (F×L), Sindhi× Local (S×L) crossbred during the period of July 2019 to January 2020. A total of 162 crossbred dairy cows under 3 genotypes were studied on the basis of productive and reproductive performances. The average age of puberty o...
Md. Ariful Islam, Md. Badol Ashraf and Md. Mahmudul Alam*
...Veterinary Hospitals, respectively. Different environmental factors and seasons influenced the prevalence of surgical affections. Heavy rainfall and high humidity have made this region a vulnerable place for the prevalence of surgical affections in calves. This study has correlated between different variables and the prevalence of surgical affections in Mymensingh district. Variables like sex, breed and season have found to be influenced the abundance of surgi...
Memoona Tehseen1, Sajila Hina2*, Alim-un-Nisa2 and Naseem Zahra2
...ng oxidation in terms of peroxide value, free fatty acid value, iodine value, conjugated dienes, conjugated trienes and para-anisidine value. Spinach extract with maximum concentration showed significant effectiveness in oxidative stabilization of the sunflower oil. ...
Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2
...nt extracts. Wheat genotypes (Triple dwarf-1, Aas-2011; Faisalabad- 2008) were exposed to critical drought stage. The plants were exposed to normal irrigation, application of bio stimulants like 2µM ABA, 10 mM SA, 15% MLE and 10% MBLE were applied at grain filling stage but skipping irrigation. Maximum growth related parameters were observed by applying full irrigation. Comparing the bio stimulants application, the application of ABA significantly increa...
M. Javed Iqbal1, Rizwan Shukat1, Muhammad Farooq2*, Iftikhar Ahmed Solangi2, Naila Ilyas3, Rahman Ullah4, A. Shakoor5, Muhammad Bakhtiar6 and Faraz Ahmed7
...ay drier at different temperatures (55°C, 65°C and 75°C) with 3mm sheet thickness of onion foams. Effect of different concentration of foaming agent and drying temperature was studied on moisture loss drying rate of onion paste. Increase in concentration of foaming agent significantly increased the drying rate from 0.422± 0.169 (Control) to 0.744± 0.169 (soy protein). Foamed onion paste were dried f...
Ijaz Ahmad* and Bakhtiar Gul
...roduction....
Naveed Wahid Awan1, Asif Ali Abro2* and Ahmed Raza ul Mustafa3
... tube-wells and their respective prices. It was observed that Punjab province holds tops position with respect to the factors analyzed in the study. In regression analysis, the climatic index was found negative and significant, whereas agricultural accessories are positive and have a significant relationship with dependent variables. This study recommends to rationalize the use of fertiliz...
Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3, Waqas Raza1* and Mahmood Ahmad Randhawa4
...C-44 and Bittle-98) chickpea cultivars increased after induction and stress of A. rabiei and comparatively higher than induced unstressed plants. The increase was more evident in case of Bion treatment as compared to all other treatments with SA and KOH. Similar trend was shown by plant extracts where in neem extract induced higher amino acid contents. The cultivar C-44 responds efficiently as compared with other two cultivars. The results of the current study...
Ali Zaman1, Nabila Roohi1 and Muhammad Irfan2*
...ltocida (P. multocida) type B:2 and its immunogens, i.e., lipopolysaccharide (LPS) and outer membrane protein (OMP) on Nili Ravi buffaloes. Prepubertal Nili Ravi female buffaloes (N=18) of 10-12 months age in good health condition were divided into five treatment groups (n=3 each) and a control group (n=3). Treatment groups’ animals were exposed to P. multocida bacterial culture and its immunogens, i.e., LPS (oral and intravenous) and OMP (oral and subcu...
Salma Javed and Samreen Khan*
... Agar (PDA). Two fungal species Fusarium oxysporum and Aspergillus niger were examined for their aptitude to assist the population rate of the said species. Nematodes were collected from soil around the rhizospheres of sponge gourd (Luffa cylindrical L.) field in the vicinity of National Nematological Research Centre, University of Karachi and further processed by Cobb’s sieving and ...
Aurang Zeb1, Abdur Rab1, Shujaat Ali1,2*, Ijaz Hussain2, Shah Masaud Khan2, Israr Ahmad1, Bilal Pervaiz Khan1, Shakila Umer3 and Muhammad Abbas1
...ign: justify;">The lab experiment was conducted to evaluate the influence of location on quality attributes and storage performance of Sweet orange (Blood red). The Sweet oranges were collected from four different locations i.e. location-1 (Torwarsak, Buner), location-2 (Rabat, Lower Dir), location-3 (Wartair, Malakand) and location-4 (Palai, Malakand), which were stored in three replications at room condition for 48 days an...
Aamer Sattar1, Sadia Sultana1*, Abid Niaz1, Muhammad Aftab1, Ghulam Sarwar2, Irfan Rasheed3, Muhammad Shoaib4, Raheela Naz1, Amina Kalsom1, Nisa Mukhtar1, Farah Rasheed1, Arfan ul Haq1, Munazza Rafique5, Muhammad Arif1, Sarfraz Hussain1 and Jafar Salim6
...soil physico-chemical properties, this long-term study was planned and conducted at Soil Chemistry Section, Ayub Agricultural Research Institute, Faisalabad. Four treatments (sub plots) viz; 0 fertilizer, 50% of recommended fertilizer, 75% of recommended fertilizer and 100% of recommended fertilizer were applied under split plot design repeated thrice with 3 major plots (methods of residues management) i. traditional practic...
Khaliq Dad1, Muhammad Nawaz2*, Rumsha Hassan2, Kainat Javed2, Asma Shaheen2, Fengliang Zhao3, Muhammad Imran4, Syed Tansir Hussain Shah4, Muhammad Faraz Anwar5 and Muhammad Aurangzaib6
...siology of plants. The experiment was conducted to study the impacts of biochar on the growth and physiology of tomato grown in Cd contaminated soil and activity of biochar in the contaminated soil. In this study different treatments of Cd were applied in the presence of certain portion of biochar. The order of treatments was 0 mg Cd as control with biochar (12%), low Cd (10mg), high Cd (15mg), low cadmium + biochar (10mg+12%) and high cadmium + biochar (15mg+...
Arshad Mehmood Khattak1, Saleem Ullah1*, Farida Anjum2, Hamid U. Shah1 and Sahib Alam1
...xt-align: justify;">Chickpea (Cicer arietinum) are an important source of nutrient and can be eaten either as salad or cooked as leafy green and their grain can be consumed as curries. Samples of tender leaves, green pods, green grains, Mature pods and Mature grains of seven different Chickpea cultivars KK-1, KK-2, KK-3, Chattan, Lawaghir, Sheenghar, Fakhar-e-Thal, were obtained from Karak Research Station Ahmad Wala and eva...
Muhammad Musa1*, Muhammad Riaz Gondal2, Aaqib Riaz3, Sikander Hayat2 and Iftikhar Haider1
...nd palatable fodder in repeated cuttings during winter and early summer. However, its seed yield per unit area in Pakistan is relatively low as compared to other countries. The present study was aimed to evaluate the influence of climate on fodder production, seed vigour, seed yield and total income ha-1 of three berseem varieties and to enhance the production through management of harvesting at Fodder Research Institute, Sa...
Raza Ullah Khan1*, Ahmad Khan1, Mohammad Zameer Khan1, Fayyaz Hussain1, Zafar Islam2 and Muhammad Asad Hameed2
...sing techniques such as spectrophotometer, High Performance Liquid chromatography, Fourier transform infrared spectroscopy and atomic absorption spectrophotometer. The analysis showed the presence of hydrophobic and hydrophilic sites. The Fourier infrared spectroscopy analysis showed spectrum bends at different wavenum...
Syed Mazuan, Syed Mohamed, Insyirah Ishak, Dzolkhifli Omar and Norhayu Asib*
...come susceptible towards pests and diseases. Studies showed the major leaf defoliator of oil palm in Malaysia is the bagworm, Metisa plana. Various spraying methods had been developed for controlling the bagworms. A ground study was conducted in FELDA Gunung Besout 04, Perak, with its main focus on mistblower application towards bagworms. Stihl SR420 mistblower was characterised by having 1.2L / min flow rate, produced volum...
Saleem Maseeh Bhatti1*, Muhammad Aslam Panhwar1, Zohaib ur Rehman Bughio1, Muhammad Saleem Sarki1, Allah Wadhayo Gandahi1, and Niaz Ahmed Wahocho2
...y required. In a field experiment, the impact of foliar Zn fertilization was quantified on growth, yield, and Zn concentration in strawberry (Fragaria x ananassa cv. Silder) at Nasarpur, Sindh, Pakistan during 2015-16. The foliar rates comprised of 33, 66, and 99 mg Zn L-1 (equivalent to 100, 200 and 300 mg ZnSO4 L-1) and distilled water (control treatment) and sprayed to strawberry plants before flower initiation. A continual increase in number of leaves, num...
Muhammad Arslan Ibrahim1*, Aneeqa Aleem2, Farkhanda Manzoor2, Shahbaz Ahmad1, Hafiz Muhammad Zahid Anwar1, Talia Aroob2 and Mansoor Ahmad3
...ustify;">Spodoptera frugiperda (J.E. Smith), commonly known as maize destructor is an exotic pest that has been migrated to Pakistan recently. In the present investigation, a total of 198 corn fields from different localities of Lahore and Kasur region of Pakistan, were surveyed after the published reports of fall armyworm presence in other parts of the country. Out of the total spots observed, the fall armyworm occurrence w...
Mehwish Saleem1*, Maria Tahir1, Maryam Ilyas2 and Aqsa Malik2
...e most frequent cancer type among males is blood cancer. Electrolytes are minerals carry vital charge. These are essential for maintaining or carrying vital body function. These carry out cell functions i.e hydration, muscle contraction, heart beating and conduction of nerve impulse. These include calcium, magnesium, sodium, potassium, chloride etc. Calcified body parts like teeth and bone contain calcium, which firm the bony parts and important factor in bloo...
Manzoor Hussain Memon1, Khalid Khan2, Anjum Parvez3, Sarfaraz Ahmed Shaikh4, Khan Mir Khan2, Guo Xiangyu5*, Mohammad Nasrullah6 and Saima Liaqat7
...value and provide an inexpensive and economical source of meat for the masses. Globally, the poultry industry has shown exponential growth and profitability in the sector is considerably higher. However, in the case of Pakistan both producers and consumers are unable to reap the benefits. Consumers and poultry farmers, the two extreme of value chain are in surplus loss because of no. of agents in the supply chain. Keeping in view the importance of poultry indu...
Ch. Muhammad Rafiq1, Qasim Raza1*, Awais Riaz1, Misbah Hanif2, Wajiha Saeed2, Shawaiz Iqbal1, Tahir Hussain Awan1, Syed Sultan Ali1 and Muhammad Sabar1
...ld conditions greatly hampers its large-scale adaption. To address subordinate germination issues, we investigated the effects of five salicylic acid (SA) concentrations (0, 75, 150, 225 and 300 ppm) on polyethylene glycol (PEG) induced drought stress conditions (0, -0.2, -0.4, -0.6 and -0.8 MPa). Highly significant (p < 0.01) effects of drought, SA and their interactions were observed ...
Fazal Wahid1, Arif Ullah Shah1, Muhammad Rahim2*, Fazal Dad1, Nadir Khan1, Saqib Ullah1, Yasir Ali1 and Sayed Ashfaq Ali Shah3
...r, Fe, Ni, Pb and Co, respectively. Increasing order of these heavy metals in soil samples were found as: Plum’s farm soil Co < Cr< Ni < Pb < Fe, Peach’s farm soil as Co < Cr < Pb < Ni < Fe, Tomato’s farm soil as Co < Pb < Cr < Ni < Fe, soil of the ridge gourd farmas Co < Pb < Cr = Ni < Fe, soil of the lady fingers farm as Co < Pb < Ni < Cr < Fe while soil of the wheat farm was found in...
Aneeqa Saleem1, Muhammad Islam1, Hamid Saeed1* and Mehwish Iqtedar2
...ithiatic effects of both peel and pulp extractives of Cucumis melo L., in mice model of nephrolithiasis. Extractives of peel and pulp were obtained using hot and cold methods. Ethylene glycol (0.75% V/V) was used IP for 10 days to develop mice model of nephrolithiasis. Extracts were administered at a dose of 400 µg/g for 11 – 21 days. Outcome measures included serum creatinine, uric acid and BUN levels. Si...
Asim Faraz1*, Abdul Waheed1, Hafiz Muhammad Ishaq1 and Muhammad Shahid Nabeel2
...future food production especially in arid and semi-arid areas of Pakistan. Research work on production potential of Marecha camel is scanty. In the current study, 10 male Marecha calves (Camelus dromedarius) around 300±30 days of age were weaned at 9 months age and used in 90 days trial to study their growth rate. Calves were raised in two groups with 5 each under stall-fed conditions (intensive management system, IMS). They were offered roughage...
Li Shengqing1,2,3, Zhang Xiyun2,3, Liu Shengcai2,3, Hu Guoyuan2, Fan Yuxia2,Liu Huaixin2, Wang Tingting2 and Zhang Yanming1*
...e feasibility of using type D botulinum toxin as a novel, environmentally friendly biological rodenticide for the population control of rodents in plateau pastoral area. The toxin is subjected to toxin component, DNA sequencing, and bioinformatic analyses. The lethal median dose (LD50) values of intragastrically and orally administred type D botulinum toxin in wild plateau pikas, plateau zokors, and Microtus fu...
Alamaary Mohaammed Saad1,3, Abd Wahid Haron1*, Mohamed Ali2,
Mark Wen Han Hiew1 and Lawan Adamu1
...yle="font-size: small;">Spermatozoa are susceptible to the oxidative stress OS during cryopreservation. The excessive reactive oxygen species (ROS) and the capacity of the antioxidants could affect the OS level in the frozen semen. This study was to determine the addition of different concentrations of antioxidants to evaluate oxidative stress and fertility of frozen semen in horses. Seven stallion were used for semen collec...
Jing Yu1*, Jiangmei Mao1,2 and Dongliang Wang1,3
...re fishery waters. The paper adopted the inversion analysis of the primary productivity (PP) in the Daya Bay, China applying the vertical generalized production model (VGPM) with ocean color and sea surface temperature (SST) provided by MODIS-Aqua. On the basis of modified VGPM model, fishery resources in the Daya Bay were evaluated according to the Tait model, Cushing model, and trophic dynamics model. Results showed that t...
Xinjian Wang1,2, Eryan Yang1,2 and Lizhi Zhou1,2*
...ehavior in the wintering period, followed by rest behavior and vigilance behavior. In daily activity rhythms, the trough and peaks of foraging behavior appeared in the morning (09:00-10:00 h) and evening(16:00-17:00 h), which is just contrary to the rest behavior. Foraging and rest behaviors showed highly significant differences among all the daily time intervals (P<0.01). During the wi...
Ahmed Saud Alsaqufi1, Sheikh Mustafizur Rahman2,3*, Roshmon Thomas Mathew2, Yousef Ahmed Alkhamis1,2, Md. Moshiur Rahman3,4 and Muhammed Aslam Pathiri2
..."font-size: small;">Photoperiod and shelter have direct or indirect effects on phenotypic traits expression in different fish species. The present study was, therefore, intended to explore whether these light and shelter could influence some phenotypic traits of African catfish larvae under laboratory condition. Newly hatched larvae were stocked in plastic aquaria (10L) at a rate of 5 individuals/L and reared for one month u...
Hesham Saeed1*, Manal Abdel-Fattah1, Ahmad Eldoksh1, Farid S. Ataya2 and Manal Shalaby3
...="font-size: small;">Theopen reading frame encoding interferon alpha (IFNα) of the camel liver, Camelus dromedarius was isolated and cloned using reverse transcription-PCR. Sequence analysis of that gene showed a 564-bp encoding a protein of 187 amino acids with a predicted molecular weight of 21 kDa. Basic local alignment search tool (BLAST) sequence analysis revealed that C. dromedarius IFNα gene shares high sequence identity with I...
Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Naeem Iqbal3, Muhammad Idrees3, Muhammad Nawaz4, Muhammad Yasir Nawaz5, Muhammad Kashif Munir6, Ahmad Kamal1, Ehsan Ullah1, Muhammad Ahsan Jamil1, Yousuf Akram1, Tanveer Abbas1 and Muhammad Mohsin Aziz1
...es the core ideas from experiments performed by expert researchers on vermicomposting. Vermicompost is a finely decomposed peat like material having good aeration, high drainage, good water holding capacity, microbial activity, superior in nutrient status and buffering capacity therefore having the amiable required phy...
Arsalan Rasheed1, Tahir Usman2,*, Sadaf Niaz1, Irfan Khattak2, Saira Gul2, Nawab Ali1,Naimat Ullah Khan2, Hazrat Ali2, and Mian Saeed Sarwar2
...viruses have large enveloped +RNA. First human corona viruses, causing respiratory diseases, were identified in 1960s, but they were not considered highly pathogenic to humans until severe respiratory syndrome broke out in China during 2003. Middle East Respiratory Syndrome, Severe Acute Respiratory Syndrome, and novel Corona Virus Disease (nCOVID-19) or Severe Acute Respiratory Syndrome-2 have increased the interest in this viral family. The Coronavirus-19 is...
Chaman Ara1*, Asmatullah1, Saima Hanif1, Shagufta Andleeb2, Beenish Zahid3 and Madeeha Arshad4
... to investigate the therapeutic potential of onion extract against aluminum (Al) induced toxicity in male albino mice, Mus musculus. Eighty, 8-9 week old mice were divided randomly into eight groups, each containing 10 mice and exposed to three sub-lethal concentrations (37.5µg/g; 18.7µg/g; 9.37µg/g B.W) of aluminum, with and without onion extract. Control and antidote groups were treated with distilled water and onion equous extract, ...
Frederic Ndihokubwayo and Atakan Koç
...ore (BDS) and teat end hyperkeratosis score (TEHS) on milk yield and quality in Holstein-Friesian (HF) cows were determined. In the study, a total of 432 cows raised in 9 different dairy cattle farms in Aydın Province, Turkey, were inspected. In addition to measure milk yield (MMY, kg), the milk samples were taken from these cows during the morning milking for the determination of fat content (FC, %), non-fat dry matter con...
Abdul Muhaimin Wahab1, Basit Zeshan2,*, Naveed Ahmed2, Muhammad Afzal2 and Muhammad Naveed2
... is the most common species for majority of human enteritis cases. The present study was conducted to determine the prevalence of C. jejuni, risk factors associated with the occurrence, identification control and preventive measure to reduce the prevalence in broiler chicken farms in Kelantan state located at east coast region of peninsula Malaysia. Eighty cloacal swab samples were collected from 4 different broil...
Muhammad Junaid*, Musharaf Ahmad and Saifullah
...3 and 1.77kg plant-1, respectively). Thus, it was concluded, that the application of green manure compost (used in 1% and 5% V/V concentration) to the soil, suppress the disease more and produced more yield than FYM-treated plants, however, the higher concentration i.e., 10% soil amendments had negative effect. ...
Hira Soofi, Abdul Rasool Abbasi and Arifa Bhutto
...-align: justify;">A new species Contracaecum malhi collected from catfish Wallago attu Bloch and Schneider, 1801 of Indus river of Sindh, Pakistan. Totally, 41 specimens of host were collected. The host specimens were dissected longitudinally, viscera put into petri dishes for examination of nematodes and were process through standard method of temporary...
Salma Javed, Samreen Khan*, Nasira Kazi and Tabassum Ara Khanum
...: justify;">Three known species belonging to order Rhabditida were recovered from sewage and stagnant water with sediments from different location of Karachi, Sindh, Pakistan. In this study, two genera, Rhabditidoides and Butlerius and three species identified as Rhabditidoides stigmatus, Butlerius micans and Demaniella basili were recorded for the first time in Pakistan. The percentage oc...
Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2
...mu and Kashmir, ten new species including two new genera of following were recovered: Fotedaronema kashmiriensis gen. n. sp. nov., from soil around roots of Pyrus communis L. from Sonamarg, Parasicagutter chitwoodi gen. n. sp. nov., from soil around roots of Pyrus malus L. in Pattan, Kochinema pahalgamiensis sp. nov., from soil around roots of Brassica oleraceae from Pahalgam, Kochinema kanganiensis sp. nov., from soil around roots of Lyco
J.Y. Bai1,*, R.T.D. Wu2,*, Q. Zhang2, D. Bao2, L.M. Dao2 and X.H. Tian3
...re 0.6283 and 0.5546, respectively. Observational heterozygosity, expected heterozygosity and polymorphic information content of Qinghai Bactrian camel were all higher than those of the other three varieties, being 0.8922, 0.6490 and 0.5813, respectively, so Qinghai Bactrian camel was of rich genetic polymorphism. Average gene flow of the microsatellite markers was 12.3188 and average Fst ...
Fuhua Zhang, Yishuang Yu and Shibao Wu*
...ubs 102 and 123 days, respectively, after B-ultrasound detection; pangolin MJ-X4 did not give birth to a cub. This study showed that B-ultrasound can accurately diagnose pregnancy in Sunda pangolins and detect the developmental status of their embryos and fetuses. As a method of pregnancy diagnosis, B-ultrasound is not only easy to operate, safe, and noninvasive, but also very intuitive and efficient compared with hormone de...
Naimat Ullah Khan1*, Muhammad Hassan Saleem2, Aneela Zameer Durrani2, Nisar Ahmad2, Muhammad Shafee3, Ayesha Hassan2, Mumtaz Ali Khan2 and Nadeem Rashid3
... from goats, 120 samples per month from each of 3 districts for twelve months. Identification of oocysts was done through conventional acid fast ZN staining. Prevalence in District Bannu was 48/480 (10%) followed by District Lakki Marwat12.08 % and in Kohat 19.16 %, respectively. Overall prevalence in three Districts was 13.75%. The highest month wise percent prevalence was recorded during...
Hamed A. Ghramh1,2,3, Zubair Ahmed1,2,4 and Khalid Ali Khan1,2,3*
...spacing: -0.1px;">A new species viz., Stantonia hayati Ahmad, sp. nov., is described and illustrated from India, while S. hammersteini Enderlein, 1908is recorded from Saudi Arabia. Affinities of the new taxa with related species have also been discussed. The genus Stantonia is also recorded for the first time from Saudi Arabia.
...
Saba Afzal1, Sohail Raza1,*, Masood Rabbani1, Sehrish Firyal2, Imran Altaf1 and Zahra Naeem1
...ts use as anti-PPRV therapeutics.
...
Rida Haroon Durrani1*, Fareeha Akhtar1, Ali Ahmad Sheikh1, Munazzah Maqbool1, Aleena Kokab1, Kiran Imtiaz2 and Muhammad Ilyas Riaz3
...he effects of storage temperature associated with bacterial spoilage of fish meat. A total 24 samples were procured during three different seasons from local retail shops (n=12) and supermarket (n=12) in order to observe the bacteria which are associated with meat spoilage. Total viable count of aerobic psychrophilic, mesophilic and thermophilic bacteria was performed through selective enr...
Khurram Goraya1,*, Qais ALRawahi1, Sultan ALBalushi1, Hani ALSaadi1, Sami ALRahbi1, Zahir ALAlawi1, Muhammad Hammad Hussain2 and Madad Hussain1
...marica). These antelopes are only kept in a few countries worldwide. Therefore, only limited information is available on their husbandry requirements and diseases occurring in these species. This study aimed to evaluate the causes of mortalities at WWR. During July to October 2019, fifty mortalities were observed at WWR. These mortalities consisted of 10 Arabian oryx and 40 Sand gazelles. All carcasses were subjected to ...
Celalettin Gözüaçık1, Ecevit Eyduran2 and Mohammad Masood Tariq3*
... of alfalfa weevil, Hypera postica (Gyllenhal) (Coleoptera: Curculionidae)laying in alfalfa fields at late fall. Totally, the infected 675 alfalfa plants were evaluated with the objective to predict height of eggs laid by the alfalfa weevil at the plant stem from plant height, number of eggs per cluster, number of egg clusters at the plant stem, and location as potential predictors. In the prediction of height of eggs...
Aiguo Zhou1,2, Di Sun1,2,Shulin Liu 1,2, Yongyong Feng1,2, Yue Zhang3,
Yanfeng Chen4, Shaolin Xie1,2* and Jixing Zou1,2*
...identification for fish species, which has a fast evolutionary rate. And thus, in the present study, investigation of genetic comparison was performed based on the complete sequences of mtDNA control region for “Bicolor” and “White” types of northern snakehead (Channa argus) due to an uncertain classification of them. The results showed that the genetic dista...
Saqib Nawaz1, Sher Bahadar Khan1*, Umar Sadique1, Muhammad Israr2,
Mumtaz Ali Khan3, Hameed Ullah Khan4, Muhammad Irshad5, Ihsan Ali1 and Haq Aman Ullah1
...caused by Clostridium perfringens type D from sheep. For this purpose, a total of 272 fecal samples were collected from sheep and lambs from four different zones of district Peshawar. Isolates were morphologically, biochemically and molecularly confirmed through Gram staining, gelatin liquefaction test (GLT) and polymerase chain reaction (PCR), respectively. Out of total, 85 (31.3%)...
Bushra Baig and Saeeda Yousaf*
...ides i.e. Neem and Black pepper were evaluated against the insect pests (whitefly and aphid).The methanolic extracts of Black pepper and Neem were analyzed for identification of phytochemicals by using Gas Chromatography-Mass Spectrometry. The result showed that Alkaloids, Flavonoids...
Imran Ullah Khan*, Noor Ul Amin, Sayyed Hamad Ahmad Shah, Maqsood Khan, Shehzad Ahmad and Syed Aizaz Ali Shah
...-align: justify;">This experiment was performed in Ornamental Nursery at the Department of Horticulture, The University of Agriculture Peshawar during 2016. The experiment was laid out on Randomized Complete Block Design (RCBD) with split plot arrangement and replicated three times. Seedlings of Zinnia cultivars (Dahlia, Candy Cane, and Dream land) were tested against five different levels...
Syed Muhammad Aun Naqvi1, Sara Tahir1, Tanveer Ahmed2*, Huma Naz3, Amara Gilani4, Atif Liaqat5
...vealed maximum values of percent moisture compared to the W2 and W3. Fish of the W3 weight group showed higher levels of crude protein and lipid percentage compared with W1 and W2. Highest ash (percentage) was measured in the gills of the weight group W3 as compared to W1 and W2. Generally, total carbohydrates are determined by the difference of the entire proximate body composition indice...
Muhammad Yousif Jakhrai1, Ahmed Nawaz Tunio2, Ali Mujtaba Shah1*, Tarique Ahmed Khokhar1, Muhammad Mohsen Rahimoon1
...btained from published papers of last twenty years via research gateways such as; PubMed, Scopus and Google Scholar. Small ruminant anesthesia, local anesthesia in ruminants and high epidural analgesia in sheep and goats were key points for this review. However, these research papers were included in this study, were published between from 1999 to 2017. The bibliographies of these references were also used for reviewing the ...
Muhammad Afzal1, Muhammad Irfan Ullah1*, Muhammad Hamid Bashir2, Shah Najaf Mukhtar1, Muhammad Arshad1, Nimra Altaf1
...out the world, and some species are important pests of fruit crops, field crops, vegetables, and weeds. In the present study, extensive sampling was done to assess mites’ biodiversity in different citrus orchards of Kinnow, Musambi, and Feutrell’s early at tehsil Sahiwal Sargodha, Sillanwali, and Bhalwal of district Sargodha. Sampling was done at fifteen days interval to record the population dynamics and identif...
Imrana Khushk1, Abdul Nabi Jatt2, Abdul Sattar Qureshi1*, Choudhary Haider Ali3, Muhammad Aqeel Bhutto1, Imran Ibrahim Khaskheli1, Sartar Iqbal Panhwer1
...or lactic production, respectively. All the microbial strains were inoculated on wheat straw hydrolysate and were monitored with regular interval until stable cell growth, glucose consumption, and, ethanol and lactic acid production. Fermentation performance of the adapted strain improved over parental strains. Ethanol and lactic acid yield reached to 90% and 75%, respectively, when using ...
Aioub Sofizadeh1, Ehsan Allah Kalteh2, Shahin Saeedi3, Mulood Mohammadi Bavani4*
...on the scorpion’s species in Golestan Province, Northeast Iran. Scorpions were captured during day and night using rock rolling and ultra violet methods from May to September, 2019. Then, the specimens were put into a 75% alcohol-containing plastic bottle. Finally, the specimens were identified using a valid identification key. Distribution maps were prepared using ArcGIS (Ver 10.4.)...
Jabeen Farheen1,2*, Simeen Mansoor1 and Maria Abid1
...zine, and fast green, respectively. The use of evaluated FCAs especially allura red in foodstuff, cosmetics, and skincare products can cause cancer in humans....
Attaullah Jan1*, Saleem Khan2, Iftikhar Alam1, Farzeen Khan3 and Muhammad Farooq4*
...orrelation analyses were performed to establish relation between anthropometrics and nutrients intake. A p-vale<0.05 was considered as significant. Children of the current study belonged to low-middle socioeconomic class. Prevalence of malnutrition as indicated by any of the three indicators was: underweight 16.8%; stunting 27.7%; thinness 9.8 %. Correlation between age and protein and energy intake, and weight and energy and protein, showed that protein en...
Umar Farooq1, Muhammad Akmal1, Qadeer Ahmad2, Zahid Akram2, Adnan Arshad3, Huma Qamar4*, Hafeez Ullah5, Muhammad Zubair4 and Muhammad Rizwan Khurshid4
...utes like number of pods per plant, plant height; seed yield per plant and improved the quality by increasing iron concentration in grains. The pH and electrical conductivity (EC), organic matter and NPK of the soil were also significantly affected through Fe-enriched organic amendments....
Shujaa Arshad1, Muhammad Umair1*, Rana Shahzad Noor1, Chaudhry Arslan2, Arslan Afzal1 and Zafar Islam3
...cooling system was developed with 3 feet length, 2 feet width and 2 feet height and tested for local environmental conditions of Pakistan. Pakistan has blessed with an abundance of solar energy in most parts of the country and desiccant cooling technology in an environment as well as user-friendly technology. The objective of this study was to test the developed system for local conditions of Pakistan so that this technology...
Fayaz Ahmad, Noorullah Khan, Farrukh Siyar Hamid, Abdul Waheed, M. Abbas Khan, Imtiaz Ahmad, Shamsul Islam, Basharat Hussain Shah, Sohail Aslam and Qamar uz Zaman
...y and genetic advance as percent of mean for various growth attributing traits of fifteen early flushing tea (Camellia sinensis L) clones. The experiment was laid out in randomized complete block design (RCBD) with three replication and 100 plants per replication. Data were recorded on plant height (PH), number of branches per plant (NBP), number o...
Muhammad Adnan Islam1*, Zia-Ul-Haq2, Rana Shahzad Noor2, Matiullah Khan4, Muhammad Mohsin Ali1, Zulfiqar Ali3, Asif Ali Mirani3, Hafiz Sultan Mahmood1, Muzammil Husain1 and Badar Munir Khan Niazi1
...for wheat had been developed and its performance was evaluated at farmer’s fields. This drill places DAP fertilizer near the seed that is about 5 cm away and 5 cm deeper than the seed due to which phosphorus use efficiency has increased. Experiments conducted at farmer’s fields showed excellent results of fertilizer band placement drill even ...
Saima Naz1*, Ahmad Manan Mustafa Chatha2, Saba Saeed1
...ntrations) for two fish species viz. Labeo rohita and Cirrhinus mrigala was determined in this study. During metal stress trials both species were kept at constant temperature (32°C), pH (7) and hardness (250 mg L-1) of water. Physico-chemical parameters of test medium were monitored regularly. The observed mean LC50 and lethal concentrations for Cirrhinus mrigala were 55.85 ± 2...
Halil Erhan Eroglu
...-align: justify;">Karyotype asymmetry is one of the most widely used approaches in cytotaxonomic studies. The symmetry/asymmetry index (S/AI) is used to determine karyotype asymmetry in higher animals and humans. The formula designed by the number of chromosome types is S/AI = (1 × M) + (2 × SM) + (3 × A) + (4 × T) / 2n. The S/AI value varies from 1.0000 (full symme...
Safia Bibi1, Saima Naz1*, Saba Saeed1, Ahmad Manan Mustafa Chatha2
...Ni and Cd in different type of fishes and it would be useful for the scientific community to restore different metals contaminating water.
Novelty Statement | Histopathological alterations in target fish organs functioned as fundamental indicator to assess metal toxicity in different fish species as it provides accurate data on effects of different contami-nan...
Mohammed Akinlabi Rufai1*, Abideen Akinkunmi Wahab2, Kamil Ayo Fasasi1, Quadri Olusegun Adeshina1 and Mary Tolulope Awotidebe1
...erilized and kept into experimental plastic plates labelled as A, B, C, D, and E. This was further divided by weight into five equal portions labelled as A1-A5, B1-B5, C1-C5, D1-D5, and E1-E5, respectively. The observation was done after every twelve hours for five iterations, and the death rate was recorded. The death rates of armyworms in each soil sample after 72 hours were noticed to achieve biocidal efficacy. Maximum mo...
Md. Alal Hossen1, Mohammad Amzad Hossain1*, A.K.M. Munzurul Hasan1,2, Bipresh Das1, Sohel Mian1, Mohammed Mahbub Iqbal1
...ater condition in order specify optimal dose of synthetic hormones in induced breeding. The synthetic GnRHa was used as induction agent where male injected half of the doses of female and a control without S-GnRHa was assigned. The stages of embryonic development were observed under a photomicroscope. Average fertilization and hatching rates varied from 74.33% to 83.89% and from 72.33% to 85.11% resp...
Shapon Kumar Bashak1, Alok Kumar Paul1, Md. Akhtar Hossain1, Usman Atique2,3*, Sonia Iqbal3, Md. Najim Uddin1, Asrafi Mohammad Farhaduzzaman4, Md. Mojibar Rahman5, Md. Shahanul Islam6
...eight, net weight gain, specific growth rater (SGR), fish survival rate, and net yield. The final body weight varied significantly from 274.53 ± 1.93 in T3 to 349.40 ± 1.58 in T1, while the SGR difference was recorded from 0.45 ± 0.00 in T3 to 0.58 ± 0.01 in T1. However, the cuchia survival varied between 76.07 ± 0.75 in T3 to 85.14 ± 0.51 in T1 with the means difference of net yield as 5878.40 ± 40.93 from T1 t...
Muhammad Furqan1*, Zulfiqar Ali1, Usman Ali2, Muhammad Mudassar Shahzad3, Bushra Nisar Khan1, Waqar Ahmed1, Zakir Hussain1, Mian Amman Ullah1, Nimra Afzal1 and Anjum Ara2
...ian grey mongoose (Herpestes edwardsii Hilaire, 1818) is a small carnivore, controls the population of reptiles, ground birds, small mammals, insects, distributed in plain areas of Pakistan and southern AJ and K. The present study aimed to investigate conflict of Indian grey mongoose with human beings. Field surveys were conducted from April 2015-March 2016 in 18 localities of Mirpur, AJ and K. Human mongoose conflict was evaluated following stru...
Imran Tarique1*, Muhammad Ghiasuddin Shah1, Illahi Bux Kalhoro1,
Zaheer Ahmed Nizamani2, Mansoor Tariq 2, Jamil Ahmed Gandahi1,
Saqib Ali Fazlani3 and Benazir Sahito3
... and reticular fibers. Superficial dermal papillary layer was located beneath the epidermis, whereas dermal reticular layer deeper above the hypodermis. The papillary and reticular dermis was well developed in adult male age group with abundant areolar and dense irregular connective tissue all skin regions. Skin appendages (sebaceous and sweat gla...
Ayse Haligur* and Sema Ozkadif
...als and off the waste of people, thus having a close association with people. Anatomical knowledge of the red fox is very poor and we aimed to investigate the branches of the plexus brachialis in the red fox. We used six male red foxes that were died in traffic accidents. The right plexus brachialis was formed by the cervical spine nerves, C6, C7, and C8, and the thoracic spine nerve, T1 of the rami ventralis in four animals...
Tariq Mahmood1*, Luqman Ullah Khan1 and Muhammad Naeem2
...ximately more than 2060 species of birds. In Pakistan, there are more or less 660 bird species belonging to 23 orders and 74 families. The abundance and diversity of avian species in a specific habitat can serve as a useful measure of their ecological status. In response to land use changes, 20-25% of pre-agricultural birds have vanished. In the current ...
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...tion of reactive oxygen species increased in a dose-depend manner. Cellular concentrations of oxidative damage markers were positively correlated with applied LPS concentrations. Total antioxidant capability and the activity of superoxide dismutase (SOD) increased with increasing LPS concentrations. Gene expression of antioxidants including SOD, NADPH-quinone oxidoreductase 1, and hemeoxyg...
Xuhai Wang1,2, Xin Li1, Fangyuan Yuan1, Chaocheng Li1, Bin Jia1* and Song Jiang1*
...nfection in livestock, especially in sheep, the immunohistochemistry, in-situ hybridization was used to study the relationship and the distribution between miR-216b and IL2RB in the intestine tissue of kazakh sheep with resistant and non-resistant MHC haplotypes after oral infection with E. granulosus eggs. The results demonstrated that miR-216b negatively regulated IL2RB in the cystic echinococcosis intestinal tissue...
Jen-Hong Chu1, Ya-Wen Lan2, Shyn-Shin Sheen3 and Angela Chien3*
...ize: small;">A feeding experiment investigated the effects of dietary lipid levels on the growth, muscle composition and digestive enzyme of 0.28 g Laevistrombus canarium. Five semi-purified diets containing 0% (L0), 2% (L2), 4% (L4), 6% (L6), and 12% (L12) lipids were formulated. Each diet was randomly assigned to three replicate groups of L. canarium larvae. The final weight, weight gain percentage and s
Muhammad Nawaz1*, Muhammad Dawood1, Kainat Javaid1, Muhammad Imran2, Fengliang Zhao3, Shahzadi Saima4 and Syed Tansir Hussain Shah2
...ter as control were used periodically. At both harvests, maximum growth and physiological functions were recorded at 0mg/L treatment while, reduction was recorded at 15mg/L....
Talat Farid Ahmed1*, Shamim-ul-Sibtain Shah1, Ashfaq Ahmed Sheikh2, Hashim Nisar Hashmi3, Muhammad Atiqullah Khan1 and Muhammad Azeem Afzal1
... of constructing main dispersion distributor and management structures for equitable distribution in the Pachad area i.e. the plain area in the foot hills of Koh-e-Suleiman has been investigated. Management solution are proposed with design aspects without causing damages to prevailing infrastructure, without stoppage of Canal breaches, minimized damages to standing crops in command area, and will ensure improved irrigation ...
Muhammad Ashraf Sumrah1*, Muhamad Jan1, Azhar Hussain2, Shoaib Akhtar1, Hussain Nawaz1, Muhammad Afzal3 and Humara Umar1
...ive to evaluate varietal performance of table olives i.e. Ascolana, BARI Zaitoon-1, Earlik, Gemlik, Hamdi, Hojiblanca, Manzanilla and Picual at Barani Agricultural Research Institute (BARI), Chakwal. Eight olives varieties were evaluated for their growth and yield under Pothwar region of Punjab, Pakistan. The trial was conducted with experimental design following randomized complete blocks design (RCBD) with three replicatio...
Muhammad Afnan Rabbi, Iqtidar Hussain*, Ejaz Ahmed, Muhammad Saad and Aitezaz Ali Asad Shahani
..., rice and sugarcane, compel the growers to sowing late wheat and due to this wheat production becomes low. A foremost challenge for crop production is to increase its economic yields in an endurable manner by improving fertility of the soil. Many struggles have been done to enhance the wheat productivity since last decade. Use of synthetic plant growth regulators with nitrogen supply seems to be fruitful in this regard. So, an expe
Syed Ismat Hussain1, Muhammad Ramzan Asi1, Habbib Anwar1, Faqeer Ahmad1, Ateeq ur Rehman2*, Muhammad Shahid3, Syed Atif Hasan Naqvi2*, Ummad ud Din Umar2, Muhammad Asif Zulfiqar4, Memuna Ijaz1 and Hafiz Usman Shakir1
...e a critically important pest of cotton all over the world. Field trials were conducted in different districts; Vehari, Rajanpur, and Mianwali, of Punjab-Pakistan during 2017 to evaluate efficacy of synthetic sex pheromone [ZZ/ZE-7, 11-Hexadecadiene-1-yl-Acetate] impregnated ropes by using PB rope L dispensers at @ 100/acre, at first pin square stage to ...
Qaiser Shakeel1*, Rabia Tahir Bajwa1, Yasir Iftikhar2, Mustansar Mubeen2, Muhammad Luqman3, Waqas Ashraf1 and Ifrah Rashid4
...gn: justify;">In-vitro experimentation consisting of crude extracts of different plants and fungicides were performed for determination of antifungal activity against Penicillium digitatum, a plant pathogenic fungi responsible for ginger soft rot. Petri dish were used to conduct bioassay through poisoned food technique with triplicates. The crude extract of all the plants showed a better inhibitory effects on the pathogen&rs...
Tanweer Fatah Abro1, Asif Ali Kaloi1, Jay Kumar Sootaher1*, Piar Ali Shar1, Tarique Ahmed Baloch2, Tanveer Ali Soomro1, Muhammad Saleem Chang3, Kirshan Kumar Menghwar1 and Waqar Hussain Shah4
...ere observed among genotypes, parents, F4 populations and parents x F4 populations for all the studied attributes which articulated greater genetic variation in the breeding material. Heritability estimates were moderate to high for all the traits. The F4 population CRIS-134 x FH-113 displayed the highest heritability estimates for plant height (95.24%). The maximum heritability for sympodial branches plant-1 (85.30%) and seed index (82.02%) were exhibited by ...
Arjun Bastola1*, Sachet Subedi2 and Malatee Bastola3
...ld attributes of maize, open pollinated varieties and hybrids were compared to the local varieties in Nepal, as the adoptability of these cultivars will cause variations in maize productivity. A total of 10 maize genotypes were evaluated in randomized complete block design with three replications during summer season 2019 in Chitwan, Nepal. Out of 10 maize genotypes, 8 (TX-369, CP-808, Pio...
Asim Faraz1*, Abdul Waheed1 and Nasir Ali Tauqir2
...a camels housed in half-open pens were studied. They were fed gram straw adlibitum with 8 to 10 hours grazing/browsing along with twice watering on daily basis. In hair minerals analyses, the levels of minerals including calcium, magnesium, copper, zinc, iron and manganese were determined via standard lab procedures. Data collected was analyzed statistically by applying t test (α=0.0...
Imtiaz Ahmed*, Naveed Ahmed, Abdul Waheed, Muhammad Abbass Khan, Noorullah Khan and Fayyaz Ahmed
...xt-align: justify;">An experiment on “Impact of growing methods and direction of sowing on the growth and seed production of ridge guard (Luffa acutangula Roxb)” was conducted at PARC-National Tea and High Value Crops Research Institute, Shinkiari, Mansehra, Pakistan during the months of April-September, 2019. The experiment was laid out in Randomized Complete Block design (RCBD) with split plot arrangement havin...
Mahwish Munawar1, Xu Shiwei1, Yu Wen1 and Muhammad Luqman2*
...mic, and social shocks depend upon available resources and capabilities. Families belonging to different vicinities and socio-economic groups have different earning and utilising earnings to fulfil their basic needs. Households need various interventions for well-being. While keeping in view the situation, this study planned to deepen insight into rural households’ food consumption system. Food consumption score and ho...
Muhammad Adnan Fahad1, Muhammad Jamal Khan1, Sheraz Ahmed2* and Imtiaz Ali2
... and cutthroat flume, respectively. Farmers were interviewed to find out the effect of watercourse improvement on crop productivity and water management practices using questionnaire proforma. The losses in five improved watercourses (lined sections) were 9, 28, 5, 11 and 20% per 1000 meter, respectively while that of unlined sections of the same watercourses were 23, 30, 50 and 21 %
Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sher Muhammad3, Muhammad Latif4, Ayesha Zafar1, Imran Shehzad1, Sarfraz Hussain5, Aneela Riaz6 and Abid Niaz2
...iorates soil physical properties and all related chemical processes in the soil. To overcome this issue, organic matter is added to these soils in so many forms like Farm Yard Manure (FYM), compost, green manure, rice husk and poultry manure. All these practices are favoured to enhance soil productivity level. Keeping in view the current scenario of country, this experiment was conducted. Expe...
Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1
...he global increase in temperature, heat stress has become a great threat for the crops production worldwide. This research was conducted to assess the genotypic variability and relationship of accumulation of glycine betaine, proline, chlorophyll contents, and cell membrane thermostability with yield in different cauliflower varieties under heat stress. Heat stress was imposed by early sowing of genotypes (in July as compare...
Taqi Raza1*, Kashif Nazir Qureshi2, Shakeel Imran2, Neal Samuel Eash3 and Imma Bortone4
...d via atomic absorption spectrophotometry. Results showed that the highest pH (11.06) was recorded in textile effluent while EC (7.89mS/cm), TSS (1185.55mg/L) and TDS (6317.33mg/L) were found highest in chemical industrial effluents. Heavy metals contents were determined through atomic absorption spectrophotometer. The mean comparison of heavy metal concentration (mg/L) showed the concentration of Cd, Cr and Ni were within t...
Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sarfraz Hussain3, Ayesha Zafar1, Imran Shehzad1 and Aneela Riaz4
...the soil affects soil properties and processes. The adequate carbon level of the soil is 1.29 % but in Pakistani soils carbon is less than the adequate level because of high temperature and low rainfall. Different sources of organic matters such as farm yard manure, poultry waste, rice husk etc. can increase productiveness of soil. Combined usage of poultry waste material and chemical fertilizer improved maize growth and hea...
Iqra Muzammil1, Muhammad Ijaz Saleem1, Amjad Islam Aqib2,*, Ambreen Ashar3, Syed Ashar Mahfooz1, Sajjad ur Rahman4, Muhammad Shoaib4, Muhammad Aamir Naseer1, Imran Khan Sohrani1, Javeed Ahmad1, Razaullah Saqi1, Fizzah Laeeq Lodhi1 and
Qaisar Tanveer5
...-51.69). Earthen floor type (OR=1.75, p=0.0996), poor drainage system (OR=7.33, p=0.002), pond as source of drinking water (OR=2.05, p=0.179), stall feeding (OR=7.27, p<0.001), 4-6 years of age of goat (OR=4.2, p=0.0874), and teat injury (OR=13.74, p<0.001) were potential risk factors for subclinical mastitis. The in-vitro findings of current study revealed 100% sensitivity of S. aureus against gent...
Yahong Guo1,3, Zeqin Fu1,3, Jiantong Feng1,3, Chengrui Yan1,3, Yingying Ye1,3*, Kaida Xu2 and Baoying Guo1,3
...ain aquaculture bivalve species in Southeast China Sea, and excellent growth characteristics. For mussel breeding, farmers use wild individuals to multiply the cultured populations. However, blind selection of wild parents has inevitably resulted in inbreeding and decreased genetic variation. In this study, four wild specimens groups (ZSW, WZW, NNW, and FZW) and four cultured specimens gro...
Muhamamd Rizwan1*, Muhammad Arshad2, Muhammad Kashif3, Aneela Zameer Durrani4, Asghar Abbas5, Tanveer Ahmad6, Muhammad Nadeem7 , Kinza Khan8
... DNA into its genome at specific site termed as CRISPR locus. Insertion of viral DNA at CRISPR locus allows to remember, diagnose and clear the viral infection by the mechanism of sequence specific Adaptive Immunity. CRISPR Cas system is sustainable to combate with the mutation developed in viral genome that help viruses to escape from bacterial CRISPR C...
Muhammad Khalid Mukhtar*, Sania Waliat, Shafaat Yar Khan, Naila Amjad
...y (Musca domestica) is a pest that acts as a vector of various diseases. Chemical insecticides are used on large scale for the effective and quick management of this pest but it has developed resistance against various insecticides in many countries of the world. This study was designed to check the resistance in M. domestica against selected insecticides from Bhalwal as no previous work h...
Saima Maher1,3*, Shahina Fayyaz2, Nadra Naheed3 and Zarbakth Dar1
.../ml of (VA4 and VA7), respectively found to be significantly effective than compounds VA5 (LC50 = 0.1575 μg/ml), VA 6 (LC50 =0.1575 μg/ml), VA2 (LC50 = 0.6269μg/ml and VA3 (LC50 = 0.25) VA1(LC50 = 0.3969μg/ml). The findings indicated that the constituents of V. album have a natural potential to use as nematicides and introduction in eco-friendly management strategies....
Allah Bakhsh1, Attiq Akhtar1*, Fiaz Hussain1 and Shabbir Ahmed2
...ficant yield loses to grapes yield every year. Fruit Zone Leaf Removal (FZLR) is a canopy management technique that provides a cost-effective and high-quality grape yield. In order to boost grape quality and minimize disease incidence in the King’s Ruby variety, FZLR was used for two seasons in a row. Total leaf removal was used before bloom, during full bloom, and four weeks after b...
Suman Bhattarai1*, Subodh Raj Pandey2, Jaya Prakash Dutta3, Meghnath Timalsena4 and Rajendra Bam5
...accomplished among beekeepers in 2019 to investigate the determinants and resource use efficiency of honey production at Chitwan, Nepal. The information was primarily collected through 60 Apis mellifera beekeepers registered in bee zone, Chitwan. They were selected for interview by simple random sampling technique. Interview using semi-structured questionnaire schedule was carried out for primary data. Cobb Douglas productio...
Muhammad Suhail Ibrahim1*, Asif Ahmad1, Anwaar Ahmed1, Amer Mumtaz2, Muhammad Javaid Asad3, Saqib Jabbar2, Ahmad Mujtaba1 and Muhammad Nadeem4
...alth issues. Diarrhea is perhaps the most important problem that is responsible for more than half of the global burden of food borne diseases, causing 550 million people to fall ill and 230,000 deaths every year. Children are at particular risk of food borne diarrheal diseases, with 220 million falling ill and 96000 dying every year. There is a persistent rise in the health ex
Mukkram Ali Tahir1, Noor-us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Abdul Moeez1, Muhammad Zeeshan Manzoor1 and Aneela Riaz3
...le in plant growth and especially strengthening of plant defence system is well documented particularly upon exposure to salt stress. Present research was performed using wheat variety Punjab-2011 with Randomized Complete Block Design (RCBD) under field conditions using three treatments and each replicated three times. Treatments were wheat florae were developed in plots having normal soil...
Mukkram Ali Tahir1, Noor-Us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Abdul Moeez1, Humaira Ramzan1, Mudassar Hafeez1, Muhammad Zeeshan Manzoor1, Aneela Riaz3, Sher Muhammad4 and Muhammad Latif4
...dwide. This research was performed in the research zone of Department of Soil and Environmental Sciences during the summer, 2018 in College of Agriculture, University of Sargodha, Sargodha, Pakistan. In the present study growth response of rice under normal and saline soil conditions was checked using Randomized Complete Block Design (RCBD) under divided plot arrangements with nine treatments and three replications was used. Rice plants were grown in plots hav...
Qudsia Nazir1, Muhammad Aftab1*, Ghulam Sarwar2, Aneela Riaz3, Sarfraz Hussain1, Ifra Saleem1, Amina Kalsom1, Noor-Us-Sabah2, Mukkram Ali Tahir2, Ateeq-ur-Rehman4 and Muhammad Arif1
...s (paddy) yield. Three types of urea were prepared including Zn coated, bio-activated Zn coated and Zn blended urea at the 1.5% rate of formulate. The bio-activated Zn coated urea was prepared by inoculating the powdered organic material with Zinc solubilizing bacterium and then this material was mixed with ZnO. This bio-active Zn was coated on urea at 1.5% rates to formulate. Moreover, Zn blended urea was prepared by mixing powder ZnO with urea. The comparati...
Muhammad Rafique1, Inam Ul Haq1*, Humara Umar2, Muhammad Jan2 and Muhammad Azhar Iqbal2
... in olive cultivation, especially in those regions where wild olive groves exist particularly in Punjab (Pothwar), Khyber Pakhtunkhwa and Balouchistan. Few areas of these regions are considered suitable for its commercial cultivation, where minimum temperature occurs between 10oC and 12oC during end March before olive flowering. In recent past, mass scale olive plantation over an area of 10,000 acres was done in these parts ...
Hajira Nur-ul-Islam1, Ahmed Zia2*, Khurshaid Khan1, Hirad Ali3 and Abdul Aziz3
...text-align: justify;">Sympetrum hypomelas (Selys, 1884) is added to the Anisoptera fauna of Pakistan by reporting it from district Swabi of Khyber Pakhtunkhwa province. Out of 33 sampling sites, specimens of S. hypomelas were found from a single locality of the district. Identification of the specimens was done at National Insect Museum, Islamabad. Detailed description including synonyms, ...
Muhammad Ahsan1*, Aneela Ramzan1, Muhammad Nafees1, Adnan Younis2, Muhammad Amin1, Gulzar Akhtar3, Khansa Saleem1 and Azka Sabeeh1
...st be enjoyed for longer period of life. Current experiment was performed to discover the comparative consequence of various vase solutions to improve the post-harvest qualities and extend vase life of Rosa hybrida cv. Freedom. The research was performed at the research area of Department of Horticultural Sciences, The Islamia University of Bahawalpur. T...
Alim-un-Nisa1*, Sajila Hina1, Imran Kalim1, Mohammad Khalid Saeed1, Ijaz Ahmad1, Naseem Zahra1, Sania Mazhar1, Shahid Masood1, Muhammad Ashraf1, Qurat-ul-Ain Syed1 and Rabia Shad2
...eet dye and candies were performed at different storage conditions 4oC, 25oC, 45oC for eight weeks. Betanin content (%) was measured to evaluate the stability of color which showed the maximum retention of betanin content in red beet dye and candies stored at 4°C while lowest %age of betanin content was observed at 45°C showing that at higher temperatures the color is deteriorated. Stability in pH of red beet dye was...
Muhammad Shakil Ahmad1*, Muhammad Afzal1, Sylvain Nafiba Ouedraogo2 and Muhammad Zeeshan Majeed1
... is a highly polyphagous pest of food, forage, vegetable and horticultural crops. This sporadic species is becoming an emerging threat to the potato crop in central Punjab and is being evidenced infesting potato crop in Sargodha, Faisalabad and Okara districts. This in-vitro study assessed the comparative feeding preference, food consumption and utilization rates and larval development of S. litura on different white and red...
Mohammad Tariq Aziz* and Ayesha Khan
...ric, 45.5% had farming experience of 1-10 years while 67% have knowledge about agriculture extension department. All the respondents have knowledge about ICTs in which mobile phone was owned by 42.8% respondents in the research area followed by TV (25%) and radio (17.0%) while respondents who have telephone was recorded as 15.2% as a ICT tool. In the research area 7.1% of the respondent avail information through TV program, 9.9% through radio broadcasts, 13.4%...
Habiba ur Rehman, Muhammad Usman Ghazanfar and Waqas Raza
...days after treatment, respectively. The application of Success @ 6mM was also good but lowers than the Nativo. The poor performance and maximum disease incidence and disease severity were recorded from the controlled pots. Among all the treatments the application of Nativo @ 6 mM had given maximum control of charcoal rot. So, it suggested that the application of Nativo @ 6 mM may be best for the control of charcoal rot....
Chala Hailu Hussen and Fikiru Temesgen Geleta
...ured questionnaire using personnel interview. On top of this, the focus group discussion was carried out on particular topics to supplement primary data source discussions. Both descriptive statistics and a probit regression model was employed for analysis. The descriptive statistics revealed that 127 sampled farmers participated in cluster crop production, while the remaining 33 were not. On the other hand, the result of probit model regression had shown that...
Amjed Ali1, Kamran Arooj1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Imran1,2, Muhammad Ehsan Safdar1, Muhammad Mohsin Amin1, Amir Aziz3 and Muhammad Fraz Ali4
...g time is an important aspect that can affect the gowth and yield of any crop. So, a research trial was planned at Research Area, College of Agriculture, University of Sargodha, Pakistan to investigate the impect of different sowing dates on growth and yield on mungbean cultivars. The research trial was arranged out in randomized complete block design (RCBD) under split plot arrangement followed by 3 replicas. In this study ...
Maqsood Ahmad1, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha2*, Faqir Hussain Anjum3, Sadia Afzal4, Muhammad Faran1, Fiaz Hussain3, Muhammad Talha Aslam1, Abdul Jabbar5, Muhammad Sultan Ali Bazmi5, Mahnoor Mehmood6 and Muhammad Umair Hassan1
...ulture Faisalabad. The experiment consisted of different sowing dates (SD); 25th April, 5th May and 15th May and variable mungbean cultivars Azri Mung-2006, NM-2011 and NM-2006. The maximum plant height (52.67 cm), pod length (11.39 cm), pods/plant (22.11), seed yield (1300.22 kg ha-1) and biological yield (4439.56 kg ha-1) was recorded in crop sown on 25th April and minimum plant height (43.67 cm), pod length (9.92 cm), pods/plant (18.33), seed yield (1975.22...
Khan Tamoor1*, Hafsa1 and Hanif Maryam2
...luate the nematicidal property of four indigenous medicinal plants viz., Ferula oopoda, Zataria multiflora, Achillea santolina and Nepeta cateria against Meloidogyne incognita at banana orchards of District Lasbela, Balochistan, Pakistan. Crude extracts, essential oils and fixed oil of these selected plants were tested separately. The crude extracts of Z. multiflora and F. oopoda showed higher mortality as compared to A. san...
Muhammad Iqbal1, Muhammad Mahmood Iqbal1*, Saghir Ahmad1, Athar Mahmood2, Muhammad Akram1, Hammad Husnain1, Muhammad Shahid1, Saeed Ahmad1, Ali Raza1, Ansar Hussain3, Allah Ditta Abid4, Qaisar Abbas5, Mussarrat Hussain5, Muhammad Akram6 and Muhammad Umair Hassan2
...justify;">Cotton is an imperious cash crop of Pakistan and change in climatic conditions are continuously limiting its production across the globe. Sowing time is an important agronomic consideration which should be optimized to ensure better cotton yield and quality. Therefore, this study was performed to determine the potential of cotton genotypes under varied planting times at cotton re...
Muhammad Waqas1*, Muhammad Shoaib2, Muhammad Saifullah1, Adila Naseem4, Sarfraz Hashim1, Farrukh Ehsan1, Irfan Ali3 and Alamgir Khan1
...ne by the Sen’s slope and Mann–Kendall (MK). Decreasing trends annually and seasonally found in MK and Sen’s Slope tests. The highest decreasing trend of -2.23 was observed in Autumn at Narran station, while the lowest change of -0.09 annually observed at Garhi Habibullah station at 95% of the significance level. The flow duration curves (FDCs) of all basin stations showed that DTF ...
Muhammad Irfan Ullah1*, Sana Majeed1, Muhammad Arshad1, Nimra Altaf1, Muhammad Luqman2, Asad Abdullah1 and Muhammad Afzal3
... been used in integrated pest management for various insect pests. Here we tested the effect of emamectin benzoate 1.9% EC alone and with botanicals; Parthenium hysterophorus L. and Moringa oleifera L. on the digestibility indices and survival of Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). The P. hysterophorus extract at 50 mg concentration was comparable to the alone application of emamectin benzoate in terms of...
Sadaf Aslam1*, Abdul Majid Khan1 and Muhammad Akhtar2
...Pliocene of Middle and Upper Siwaliks are described.Hippohyus sivalensis is a common suid of late Miocene to Pliocene rocks of Tatrot/Hasnot area of Pakistan. The molar resemblance with equids indicates their grazing feeding habits. This species migrated to Potwar land when grasslands became established. It has typical suine characters with hypsodont dentition and complex infolding of enamel surfaces. The descr...
Zhi Wang1*, Wenhua Liu2 and FadaoTai3
...red with other squirrel species. Still, its circadian activity patterns and time budgets in different behaviors remain unclear. Using artificial population of the animal bred in a simulated natural environment, activity patterns and time budgets were investigated. The results showed that the species was clearly nocturnal but varied greatly in the number of daily activity bouts showing bimodal patterns in winter, trimodal pat...
Bin Liu1,2, Libo Wang2, Dandan Xue2, Peng Xu1, Yuting An2 and Changhu Lu1*
...uality habitat for this species, and birds pass this location quickly in search of other suitable habitats.
...
Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2, Muhammad Azmat Ullah Khan3, Muhammad Naveed1 and Abdul Rauf Shakoori4
...silico analyses were performed on HIV-1 from isolates of the Punjab area of Pakistan. The main objective in the current study was to study the hypervirulence of SNPs in the Gag-Pol proteins by molecular modeling approaches. Mutational analysis in our study revealed S61A, S61M, S61Y, S61G, S61Q and M90L as the most hypervirulent mutations. This induces a selection pressure and a rate of...
Sajid Ali1, Muhammad Avais1*, Aneela Zameer Durrani1, Kamran Ashraf2, Saira Jabeen1, Sajid Hameed3, Muhammad Awais1, Jawaria Ali Khan1 and Imtiaz Ahmad4
...eness than cows kept in open sheds. Moreover, prevalence of lameness was significantly associated (P<0.05) with the seasons of the year; highest in wet summer while lowest in spring. Among the hoof and claw lesions, sole ulcer was significantly (P <0.05) more prevalent than white line disease, sole hemorrhage or inter-digital dermatitis. It was concluded that lameness and hoof lesions are important health problems in studied commercial dair...
Guangyu Wang, Xu Tian, Lintao Liu, Junyang Liu, Bo Zhang and Jingming Dong*
...um hyaluronate. The therapeutic effects were compared between the two groups. Comparison of Lysholm knee score scale, WOMAC score, and joint VAS score between the two groups showed that the study group had a significant advantage over the reference group after treatment, p<0.05. Comparison of synovial fluid inflammatory factors before and after treatment between the two groups indicated more obvious improvement in the study group than in the reference group...
Muhammad Yamin1*, Usama Ali Zafar1, Ghulam Usman2, Muhammad Nauman1, Muhammad Rizwan3, Muhammad Nadeem1, Muhammad Azhar Ali1 and Usman Haider1
...nmental factors using temperature, humidity and soil moisture sensors. Two of three tunnels were fit with control units of exhaust fans and air heaters and a water pump for controlling the temperature and soil moisture. During the testing and validation of the system, temperatures recorded through DHT-21 sensor and thermometer in tunnel 1, 2 and 3 had strong correlations of 0.9986, 0.998 a...
Rahat Rukhsana1, Shahnaz Rashid2, Asma Fatima2, Owais Iqbal Khan3, Syed Babar Hussain Shah4, Mumtaz Ali4 and Ghulam Abbas2*
... ammonia, alkalinity, temperature, nitrate, salinity, nitrite, pH, total hardness, dissolved oxygen (DO), chlorophyll-a and phytoplankton-density during the period from March, 2015 to June, 2016. The chlorophyll-a concentration was determined by using the acetone extraction technique. Ponds water sample (50 liters) was filtered through plankton net of 20 µm pore size and preserved in 4% formaldehyde for the analysis of...
Mian Muhammad Arif* and Malik Muhammad Shafi
...ises, which is grossly dependent on resources utilization. This study was carried out to determine the profitability of different size of commercial broiler poultry farms in central region of Khyber Pakhtunkhwa. A total of 105 sample broiler poultry farms were selected through random sampling technique and data were collected for 483 flocks by means of interview schedule. Descriptive statistics was used for general analysis, while budgetary technique was used ...
Fazal Subhan1,2, Abdul Malik1, Zia Ul Haq1 and Tariq Mahmood Khalil1,3*
...ed irrigation. A field experiment was performed at Mardan region, Khyber Pakhtunkhwa, Pakistan, during 2018-19 with the objectives to evaluate the effect of different furrow irrigation techniques and deficit irrigation on cauliflower yield and water use efficiency (WUE). Three furrow irrigation techniques; alternate furrow irrigation (AFI), fixed furrow irrigation (FFI), and conventional furrow irrigation (CFI) techniques wi...
Kiran Shahjeer1*, Gauhar Rehman1, Khurshaid Khan1 and Toheed Iqbal2
...udy revealed that three species belonging to genus Lepisiota as a major outcome of this taxonomic study. The species include L. frauenfeldi, L. simplex, L. opaca and its sub-species L. o. pulchella. Among them two species viz., L. simplex, L. opaca and a subspecies of L. opaca i.e. L. o. pulchella are reported as first...
Rabia Iqbal and Muhammad Naeem *
...otein) prepared from cheaper plant proteins, to keep minimum use of fish meal, on growth performance, survival and production of hybrid fry (Labeo rohita♀ x Catla catla ♂). The hybrid fry of mean 1.05±0.08 g body weight and 4.36±0.40 cm mean length were acclimatized and transferred to 8 X 6 X 3 ft. hapas. Fry were fed with fish meal at the rate of 10 % of body weight during acclimatization
Sajid Ali, Shahen Shah* and Muhammad Arif
...oting stage and their respective half dosages at the tillering stage + half at the booting stage) along with one unsprayed check were used in the experiment. All the treatments’ combinations and a control {(4 x 4 x 3) +1} were laid out in a randomized complete block design having three replications. The plot size was 12 m2 accommodating ten rows. The recommended wheat cultivar ‘Pirsabaq 2013’ was sown by us...
Muhammad Ibrahim Kubar1, Fahad Nazir Khoso1*, Imran Khatri1, Niaz Hussain Khuhro2 and Arfan Ahmed Gilal1
...Coquillett) is a serious pest of many vegetables, especially cucurbits. To manage this notorious pest, the experiments were designed to evaluate the most effective method of pest control. The field experiments in bottle gourd, sponge gourd, Indian squash and bitter gourd were designe...
Summara Abbasi* and Khalid Nawab
...population i.e 2-3 heads per household, for dairy production. A structured and pretested interview schedule was used to collect the primary data from randomly selected 333 respondents. For analysis of data descriptive statistics and binary logistic model was used through the Statistical Package for Social Sciences (SPSS) and STATA. Information about dairy practices was studied and percentages recorded, about 70% of the farme...
Misbah Ali1, Safdar Ali1, Muhammad Ahmad Zeshan2*, Rana Binyamin3, Nadeem Ahmed4, Muhammad Usman Ghani5 and Awais Ahmed Khan2
...the above ground parts especially leaves. In the present study, four fungicides (Aliette, Cabrio Top, Nativo, and Melody Duo) were evaluated against C. graminicola under in-vitro and in-vivo conditions. The poisoned food technique was used for in vitro trials with three concentrations (150 ppm, 200 ppm, and 250 ppm). The most effective concentration of fungicides from laboratory experiment was used in field conditions agains...
Weenghar Ali Chandio1, Tajnees Pirzada1*, Abdul Majid2 and Farzana Rashid3
...confirmed by UV-Visible spectroscopy and characterized by spectral features obtained by using different techniques such as X-ray diffraction (XRD), Fourier transform infrared (FTIR), and scanning electron microscopy (SEM). Finally, the effect of extracted humic acid on wheat seed germination profile including root/shoot length, germination and fresh/ dry weight was investigated by applying varied concentrations of HA (0, 5, ...
Mehnaz Safdar1, Urooba Pervaiz1* and Dawood Jan2
... 4.12, 4.00 and 3.94, respectively. Due to male dominant society, 62.8% of the decisions were taken by spouse. Results of Chi-square analysis showed a significant association for age and decision making which means with increasing age of the women, their involvement in decision making increases, majority of the rural women were either not taking interest or not given the opportunity of decision making process of farming and family matters. Rural women have les...
Shahinshah Khan1*, Aijaz Ali Khooharo1, Zaheeruddin Mirani1 and Velo Suthar2
...commendations were developed for public and private sector for quality supply of seed to the farmers of Balochistan.
...
Barış Bayraklı
...ucine and isoleucine, respectively. On the other hand, among the non-essential amino acids (NEAA), aspartic acid and glutamic acid were the highest each month followed by glycine and alanine, respectively. The mean DHA/EPA ratio was calculated as 0.52±0.031. Moreover, the ratio of ω-6:ω-3 ratio was determined as 1:2.92. AI, TI, PI, h/H, and FLQ indexes were calculated as 0.30, 0.22, 1.97, 3.52, and 25.50, ...
Maria Qibtia1, Muhammad Wasim1, Farzana Chowdhary1, Muhammad Tayyab1, Sehrish Faryal1, Ahmed Mansouri2, Zeeshan Ahmad2, Muhammad Hamid3 and Ali Raza Awan1,*
...ize: small;">Lactose non-persistence (LNP) develops due to the downregulation of the lactase-phlorizin hydrolase (LPH) enzyme. LPH is encoded by the LCT-gene located on chromosome 2q21. In this study, 50 patients with LI were investigated for the identification of mutations in the LCT-gene. In comparison of 30 subject with lactose persistence (LP) considered as healthy group. A total of 13 genomic mutations wer...
Assefa Tessema Tecklie1*, Abebe Getahun Gubale1, Seyoum Mengistou Yilma1, Tadesse Fetahi Hailu1 and Eshete Dejen Diresilign2
...n the Nile tilapia fish species in Lake Hayq. A total of 198 fishermen selected randomly from Kebeles bordering Lake Hayq were used as respondents for structured questionnaires. In addition to this, 30 fish traders and 8 fish hotel owners specialized in fish dish were used as key informants. The average age of fishermen was around 36 which were in active force age group (< 65 years). Most (97%) of the fishermen used gilln...
Shuang Yang1,2, Huiting Zhao3, Xuewen Zhang2, Kai Xu1, Lina Guo1, Yali Du1 and Yusuo Jiang1,*
...s, 1758), is a notorious pest of honey bee colonies that has negatively affected the global apicultural industry. Olfactory cues influence the behavior of wax moth, where males attract females, making them an ideal candidate for pheromone studies. However, the molecular mechanism of chemoreception in G. mellonella pertaining to sex pheromone recognition has not been elucidated. In this study, transcriptome sequencing ...
Hassan Naveed1*, Kamran Sohail2, Gul Zamin Khan3 and Yalin Zhang2
...fy;">The Oriental leafhopper genus Parallygus Melichar, 1903 is reported for the first time from North Western Part of Pakistan with redescription of habitus and male genitalia of Parallygus rameshi Viraktamath and Webb, 2012. A worldwide checklist with distribution for species of genus Parallygus Melichar is also provided....
Muhammad Qaddafi Khan Wali, Arif Alam* and Ikram Shah
... Azad Jammu and Kashmir, people practice subsistence agriculture. As the output from agriculture very low, the mountain zones experience the ill effects of food insecurity. This study scrutinizes food security status in the mountainous territories of Azad Jammu and Kashmir and proposes actions to achieve food security. A contextual investigation of 3 tehsils, situated in all the Haveli area, was led and an all-out number of ...
Md. Mukthar Mia1 and Mahamudul Hasan2*
...family Parvovirinae that pertains to the genus Protoparvoviorus with a high genomic replacement unlike other DNA virus; the organism is primarily segmented into three forms acknowledged as (CPV-2a, CPV-2b, and CPV-2c), which resembles to be liable for the infection’s statewide spread. For transmission, the fecal-oral pathway is deemed the most obvious route than other permissible routes. Moreover, spreading through con...
Sagir Hussain*, Qamar Abbas, Abdur Razzaq and Sher Wali Khan
...tan, four cyst nematode species viz., Heterodera avenae Wollenweber, 1924; H. mani Mathews,1971; H. schachtii Schmidt, 1871 and H. zeae Koshy, Swarup and Sethi, 1971 were detected from all four districts....
Muhammad Tariq Mahmood1*, Muhmmad Akhtar2, Kaiser Latif Cheema2, Mushtaq Ahmad1, Muhammad Jahanzaib Khalid2, Afzal Zahid2, Muhammad Kashif3 and Zeshan Ali4
...ance strains is highly imperative for crop genetic improvement programs. The research aimed to determine the yield stability of sixteen advance chickpea strains was carried out at eleven diversified locations across the Punjab province of Pakistan during cropping season 2019-20. GGE biplot and mega environment analysis were employed to identify the most stable and high yielding chickpea ad...
Amar Iqbal Saqib, Khalil Ahmed*, Muhammad Khalid Bhatti, Ghulam Qadir, Muhammad Qaisar Nawaz, Muhammad Ashfaq Anjum, Abdul Rasul Naseem, Aftab Ahmad Sheikh and Belqees Akhter
... farming community is compelled to use underground brackish water. Therefore, a lysimetric study was undertaken to remediate hazardous effects of brackish water on rice-wheat crops through practicable and economical methods in two different textured soils. Treatments were: (A) Types of soils. 1) sandy loam, 2) clay loam, (B) Remedial strategies, 1). canal water, 2) saline-sodic tube well water (continuous), 3) three irrigati...
Ayaz Ahmed* and Muhammad Zulfiqar
...useholds in three JFM (experimental group) and nearby three non-JFM (control group) villages, located in the same forest-ecological and socio-economic settings. The study analyzed the effects of JFM on local livelihood by using binary logistic regression. Odds ratio analysis of the social and natural assets data showed that the Joint Forest Management approach had significantly increased the social and natural assets of the participants. In terms of financial ...
Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1
...arbs, glume awn, lemma type and awn color, length of the rechilla hairs, lemma color, auricle pigmentation, photoperiod sensitivity and stem pigmentation. Variation was observed in these qualitative traits through frequency distribution. In quantitative traits maximum variation was found for plant height ranging from 36cm to 50cm, days to flowering range from 130 to 133 days), while 100 seed weight ranged from 36 to 86 g and...
Shaista Shafi* and Amjad Farooq
...t-align: justify;">The experiment was carried out to highlight the outcome of planting date on the emergence of aphids in different species of brassica at Agricultural College of Bahauddin Zakariya University Multan, Punjab (Pakistan) during 2014-2015 and 2015-2016. Four brassica species (B. carinata, B. rapa, B. napus and B. juncea) were seeded from October to November at different dates ...
Tahseen Ullah* and Noorul Amin
... Kora in hilly area of upper Swat is an important medicinal plant. An investigation to find out the effect of rooting hormones and types of stem cutting on the rooting of Berberis (Berberis lycium L.) was conducted at Horticulture Research Institute, National Agriculture Research Centre, Islamabad, Pakistan during the year 2016-2018. The experiment was laid out in Complete Randomized Desig...
Muhammad Sarfraz1*, Muhammad Amjad Qureshi2, Muhammad Arshad Ullah3, Shahzada Munawar Mehdi4, Abdul Rasool Naseem1, Sarfraz Hussain1, Muhammad Qaisar Nawaz1 and Muhammad Rizwan1
...deteriorated physical properties were improved with inorganic and organic amendments. Field studies were conducted at Kot Murad (district Hafizabad) to evaluate the different management practices for saline water in salt affected soils. Results suggested that the canal water with soil GR produced the maximum yields of rice and wheat trailed by the application of saline water with GR of soil and irrigation water. Soil analysis at harvest showed that soil was im...
Gulnaz Parveen1*, Naila Mukhtar2, Shumaila Irum3 and Nain Bukhari4
...e handled. Hence, the proper identification of the causal pathogen is important before appropriate treatment can be made to control the pathogens. Therefore, In the present study, Alternaria alternata, Alternaria, Rhizopus, Mucor, Aspergillus niger, Aspergillus flavus, Cladosporium, Botrytis cinerea, Fusarium moniliforme, Drechslera, Penicillium, and Geotrichum candidum were identified amo...
Samra Aftab1, Saleem Ullah1 and Farida Anjum2*
...ed highest colonies of Aspergillus sp. (8 CFU × 104g-1) followed by Penicillium sp. and Trichoderma sp. (7 CFU × 104g-1 and 5 CFU × 104g-1), while the lowest colonies were noted for Candida ablican and Saccharomyces cerevisiae. The screening test of these microbes for cellulose degradation showed higher degradation for Trichoderma sp. (6 % and 8 %) followed by Penicillium sp. (4 % and 4.5 %) in both of the samples (saw dust and sugarcane baga...
Hussan Ara Begum1, Muhammad Hamayun1, Noor Shad1, Waqar Khan3, Jawad Ahmad1, Muhammad Ezaz Hasan Khan2, David Aaron Jones2 and Kishwar Ali2*
...sativa L. were placed in petri plates, and were exposed to UV light for 30, 60 and 120 mins daily. The source of UV light was a UV box having a UV Tube. The UV exposure on the seeds reduced the germination percentage in both species. The germination percentage in control was recorded as 19.35%, while it was 18.65% in 30min and 19.00% in 120min exposures....
Abdul Hameed1*, Ihtsham Ul Haq Padda1 and Abdul Salam2
... at the national level experience calorie deficiency (less than recommended calories). The corresponding figures for the urban and rural areas are 40.5% and 36.7%, respectively. Households experiencing deficiency in caloric intake in Balochistan and Sindh provinces are comparatively higher. Nutritional deficiencies in terms of essential macro and micronutrients indicate that 40% of househo...
Saddar Faheem1,2, Hameeda Kalhoro1, Naeem Tariq Narejo1*, Muhammad Hanif Chandio3, Memon Samina4, Shahnaz Rashid5 and Ghulam Abbas5*
...stan. Fish samples (100 specimens for each sex) were collected during two seasons i.e., summer: March to May, 2017 and winter: November, 2017 to January, 2018. Haematological characteristics of the fish specimens were considered season and sex wise separately. Results showed that erythrocytes (2.09 × 106 to 2.26 × 106), leucocytes (164.90 × 103 to145.55 × 103) and haemoglobin (10.34 g/100 ml to 7.06 g...
Shafaq Fatima1,*, Farkhanda Manzoor1, Humaira Amman1, Zakia Kanwal1, Asma Latif1, Zeeshan Ali2, Hamid Iqbal Gondal2, Sumera Sajjad1 and Raja Shahnawaz Janjua3
...or 31 days at ambient temperature. The control group was fed with soybean based commercial diet. No significant effect of diet A and C was observed on fish growth and profile of n-3 and n-6 PUFA in total liver lipids. However, the treatment group fed with diet B showed a significant increase in K (1.75 ± 0.14 %), FCR (0.97) and HSI (0.62 ± 0.1%) as compared to those in the control group. A high profile of DHA (C22:6) was observed in to...
Majed Rafeeq1,*, Nadeem Rashid1, Muhammad Masood Tariq1, Irfan Shahzad Sheikh1, Muhammad Zahid Mustafa1, Muhammad Shafee1, Khalid Mehmood1, Rana Muhammad Bilal2 and Tauseef Asmat1
...sia scoparia) on the performance of broiler chickens. The study used 120 unsexed Hubbard one day old broiler chicks randomly divided into three groups of 40 chicks that were each further divided into four replicates of ten chicks. Extracts were introduced at 200 mg/Kg as feed supplement to two groups of broilers and the third group was kept as control (C) and offered a basal diet. The chicks were reared in floor pens bed...
Muhammad Mohsin1, Yin Hengbin2*, Qian Chong3 and Bohyun Kim4
...e fisheries a victim of open access phenomenon. Under the influence of this ongoing regime, it becomes necessary to estimate overexploitation risk and understand ongoing economic implications of particularly important fishery resources. Thus, this study is the first-time attempt to evaluate very important fishery resource, i.e., Penaeus shrimps of Pakistan by considering these aspects. A long catch and effort (CE) dat...
Asif Sadam*, Rahmat Ullah Khan and Sajid Mahmood
...xpansion of urban landscape causes shift in biodiversity. This study aimed to identify the traits that enable bird species to become urban exploiters i.e. to colonize and become abundant in highly urbanized areas. Bird species were identified in point counts without distance estimation, in three habitats: urban area, residential area, and agricultural area. Twelve sampling sites were selec...
Ghulam Raza1*, Maqsood Anawar2, Muhammad Akbar1, Muhammad Ali1, Alamdar Hussain1, Azhar Hussain3 and Tanveer Hussain4
...x sibirica) is a subspecies of Capra ibex, and is evenly distributed throughout the upper comparatively dry mountains of Gilgit-Baltistan, Pakistan. It is categorized as a Least Concern species globally as well as in Pakistan, however its presence in the Karakorum mountain plays a significant role in the economy of the region as dozens of trophy hunting of this s
Hesham M. Abd El Halim1, Maysa M. Hegazy1,2, Aishah Alatawi3, Imtiaz Ali Khan4 and Munawar Saleem Ahmad5*
...ainst Spodoptera frugiperda Sf9 cell line. Also, changes in gene expression levels of chitinase genes (SFch-1, SFch-2) and fibroblast growth factor receptor gene (SFbtl) were demonstrated. Cell sensitivity assay (MTT) showed that golden piller was more toxic than galangal in cell viability tests and more potent in the cell growth inhibition. The calculated LC50 were 120 µM and 200 µM for golden piller and galangal, res
Nilgun Dogan1,* and Hakan Adanacioglu2
...o determine the economic performance of the beekeeping farms. For this purpose, a survey was done in Kelkit County, in northeastern Turkey. The performances of the beekeeping farms were evaluated by cost, profitability and efficiency analysis. The cost of a unit of honey was US$3.16 and the average price paid to the beekeepers was US$6.78. The absolute and relative profits were calculated ...
Sana Ilyas1, Muhammad Hidayat Rasool1,*, Muhammad Javed Arshed2, Muhammad Usman Qamar1 and Bilal Aslam1
...>harboring the extended-spectrum-β-lactamase (ESBL) are a serious threat to public health particularly in developing countries. The study was aimed to investigate the prevalence and genomic characterization of ESBL producing E. coli from poultry, environment and poultry farm workers in Islamabad and Rawalpindi Pakistan.A total of 250 poultry samples, 92 poultry environmental samples, and 50 poultry farm worker’s urine samples were scre...
Zeynep Sonmez1 and Memis Ozdemir2,*
.../i> genes by HRMA, genotype and allele gene frequencies of polymorphic regions were determined. Hardy-Weinberg equilibrium test generally shown that the distribution of genotype frequencies in polymorphic regions is in genetic equilibrium.
...
Xiangzu Wang,1,2 Jifeng Xi,1,2 Bin Jia,1,* Yongsheng Zhang,1 Chaocheng Li1
...gulate apoptosis. This experiment adopted the real-time fluorescence quantitative technique to test ZFX, Bcl-2, and BAX expression in mice kidney tissue on 1 d, 7 d, 14 d, 21 d, 42 d, and 90 d after birth. The results showed that with the maturation of mouse kidney, the cell proliferation activity decreased, and the expression of ZFX, Bcl-2, and BAX were down regulated. The ZFX gene may participate in the developmental process of the kidney through the balance...
Rahma Mohamed, Sara Nader, Dalia Hamza and Maha A. Sabry*
... pathogen among immunocompetent individuals. There are no epidemiological data on the prevalence of this fungus in donkeys. The current research was conducted to investigate the possible role of the Egyptian donkeys in the epidemiology of such pathogen. Bacteriological analysis of nasal swabs of 52 diseased and healthy donkeys at different localities in Egypt revealed that the overall occurrence of Cryptococcus spp. was 11.5%. The highest proportion was...
Kai Huang1,2, Wancai Xia1,2, Yi Fu3, Yaqiong Wan4, Hao Feng2, Ali Krzton5, Jiaqi Li4,* and Dayong Li1,2,*
...mon in social mammals, especially primates. The formation of social hierarchies is conducive to solving the problem of the allocation of scarce resources among individuals. From August 2015 to July 2016, we observed a wild, provisioned Yunnan snub-nosed monkey (Rhinopithecus bieti) group at Xiangguqing in Baimaxueshan National Nature Reserve, Yunnan Province, China. Aggressive and submissive behaviors were used to investigate dominance hierarchies betwe...
Arshad Ali1, Muhammad Nasir Khan Khattak2*, Muhammad Ali Nawaz3 and Shoaib Hameed3
...m of economic loss to property and infrastructure, damage to crops, and depredation on livestock. In northern Pakistan where large carnivores like common leopard (Panthera pardus), snow leopard (Panthera uncia), Asiatic black bear (Ursus thibetinus), Himalayan brown bear (Ursus arctos isabellinus)), grey wolf (Canis lupus), and lynx (Lynx lynx) often encounter humans and contribute to significant economic losses. The p...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Muhammad Umair Sial2, Naeem Iqbal2 and Shafqat Saeed2
... plants grown for landscape and medicinal purposes in various regions and also known for absorbing various toxic pollutants from the environment. Several insect pests like thrips, whiteflies, mealy bugs and caterpillars attack on these plants. Among them, leaf eating caterpillar, Trilocha varians (Lepidoptera: Bombycidae) is serious insect pest for these precious plant s
Huma Qamar1, Mariam Hassan1, Muhammad Zubair1*, Adnan Arshad2, Muhammad Qusain Saeed3, Muhammad Umar3, Sundas Shahzad1, Tariq Mahmood1 and Muhammad Aftab1
...ign: justify;">Pakistan spends a major part of expenditure on import of the edible oil owing to significant rise in demand. Main aim of the study was to analyze the 18 genotypes of Brassica juncea L. for correlation and their path co-efficient analysis. Mean square for five traits was constructed which was highly significant except plant height. Correlation in plant’s height and bran...
Muhammad Usman Aslam1, Muhammad Umer Chattha1, Imran Khan1, Rizwan Maqbool1, Muhammad Bilal Chattha2*, Fiaz Hussan3, Muhammad Nawaz4, Muhammad Shakeel Hanif5, Muhammad Ahsin Ayub6, Muhammad Talha Aslam1, Mina Khan7 and Muhammad Umair Hassan1
...) source also plays an imperative role to increase the crop production and decrease N losses. Therefore, this investigation was aimed at to determine the effect of various N sources and organic mulches on productivity of wheat grown in semi-arid area. The experiment was comprised of different organic mulches, i.e. M1 = no mulch (control), M2 = maize straw mulch (5 t ha-1), M3 = wheat straw mulch (5 t ha-1), M4 = sorghum stra...
Ahmed A. Kheder
...ues. Virus incidence was performed in different locations in five governorates during 2018-2020. Forty-one samples out of 693(5.94%) reacted positively to SLRSV. Specifically, the percentages of infection were 7.3, 6.7, 5.4, 5.16 and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia governorates respectively. SLRSV was mechanical...
Mohammed Bashar Danlami1*, Basiru Aliyu1, Abbas Bazata Yusuf1, Bashar Gulumbe Haruna1 and Asmau Nono Mahe1
...i. The study was a retrospective review of all Conventional Papanicolaou smear registry data of women who underwent a cytological examination at the cytology unit of the FMC Birnin Kebbi spanning a period of 10 years (2009-2019). The study used a hospital-based archive that covers the entire Kebbi State without any well-defined population to collects data on all Pap smear cases presenting to the hospital for possible diagnos...
Sehrish Khudadad1, Muhammad Ather Rafi2, Ahmed Zia3, Mian Sayed Khan4, Gulnaz Parveen5, Muhammad Kamal Sheikh6*, Falak Naz7, Muhammad Qasim8 and Syed Waqar Shah9
...rs, pollinators, seed dispersal/ orchid seed removal agent and scavengers. Ants can be both prey and predators for the crops and various insects. They also spread human diseases. Ant fauna is poorly known in Pakistan. As Pakistan occupies an important biogeographic position and the taxonomic studies on ants of Pakistan are badly needed. During this study ant specimens were collected from different localities of district Mans...
Muhammad Shahzad1*, Syed Amer Mahmood2, Athar Ashraf3, Amer Masood2 and Saira Batool4
...ensitivity of the landscape to regional neotectonics. DD exposed the neotectonic activity preserved in the Quaternary era in the surroundings of NPS. The TSR maps revealed that North-North-East (NNE), North-West (NW), South-West (SW) f the investigation region and segments parallel to the Sassi Raikot Fault (SRF), Sassi-Jaglot-Bunji (SJB) sector of Nanga Parbat Syntaxis as active tectonic zones. The areas which include, Shawar, Haramosh, Kachura, Astak Nala, G...
Iftikhar Jan* and Sahib Alam
...characterize different Aspergillus section Flavi isolates in search for nonaflatoxigenic strains for use as biocontrol agent. A total of 434 isolates of A. flavus were isolated from soil and stored maize grain samples collected from four agroecological zones (AEZ) i.e., AEZ-A, AEZ-B, AEZ-C and AEZ-D of Khyber Pakhtunkhwa (KP) province of Pakistan. The mycological analysis of the samples demonstrated that the highest population of Aspe<...
Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*
...ive selected wheat genotypes. The five cultivars, namely, Pir Sabaq (PS)-15, Bakhtawar-92, PS-2000, National Agriculture Research Council (NARC)-11 and Zam-04 were grown in 12 replicate plots (6 m × 10 m), that were blocked in three fields according to Randomized Complete Block Design. Uniform field preparation, irrigation, weeds control and standard agronomic practices were applied to all plots. For forage yield, morphological and quality evaluation, sa...
Fahrauk Faramayuda1,2*, Totik Sri Mariani3, Elfahmi1,4 and Sukrasno1
...ia can proceed to the suspension culture stage because it showed brighter fluorescence spot than other callus and plant extracts, especially for rosmarinic acid. This research provides new information about secondary metabolites in callus derived from two varieties of O. aristatus on various growth media....
Shahzad Khan1*, Munir Khan1, Arif Alam2, Ikram Shah2, Mahfooz Khan1 and Fida Muhammad Khan1
...s study was conducted to perform economic analysis and to elaborate the determinants of wheat crop in district Charsadda, Khyber Pakhtunkhwa, Pakistan in the year 2018. Three villages, namely, Aspandehri, Kamran Kalay and Sarfaraz Kalay, were purposively selected. A sample size of 41 wheat growers from farm households was chosen from these villages for data collection. Thus, selection of the farmers was based on the proportional allocation technique. However, ...
Ying Yang 1,2,3, Tietao Zhang 1,2,3, Min Rong 1,2,3, JiaPing Xu 1,2,3 and Xiumei Xing 1,2,3*
...he complete dry power respectively. Mink were voluntary feed intake was found to be dependent upon dietary energy content. Body weights were regulated by energy intake tended to increase at first and then decreased as the energy level was increased. The growth rate and voluntary feed intake regression coefficients for energy and the growth responses from weaning to the age of 26 weeks were studied in male and female mink rec...
Ramadan, F. Abbas1;H.M.Salem1; M.H. Belal2, and A. M. M. Abd-Alla3*
...iv>
and 28000 g respectively, resuspend the pellet in Tris buffer, sterile by
0.45-μm syringe filter and inject to house fly adults maintained in
laboratory colony, leads to the detection and isolation of this virus from
Egypt. Injection of filtrate induced SGH symptom in 60% injected flies.
The salivary gland symptom was similar to ...
Muhammad Akhtar1, Muhammad Tariq Mahmood2*, Kaiser Latif Cheema1, Mushtaq Ahmad2, Muhammad Jahanzaib Khalid1, Amir Amin1, Javed Anwar Shah1, Zeeshan Qadeer1 and Zeshan Ali3
...nant cultivation of chickpea under residual soil moisture condition are major causes of drastic decline in chickpea productivity in Pakistan. Systematic breeding efforts are required for evaluation of available genetic material to evolve drought tolerant chickpea cultivars for drought prone regions of the country. For this purpose, a research experiment ...
Ain-ul-Abad Syed1*, Zaheer Ahmed Khan1, Shakeel Hussain Chattha1, Irfan Ahmed Shaikh2, Mian Noor Hussain Asghar Ali1, Zohaib ur Rehman Bughio3, Shahzad Hussain Dahri2 and Ghous Bakhsh Buriro4
...lly. Two treatments were performed, each with two replications. The treatments included hydroponic (soil-less) and geoponic (soil) spinach seed cultivation. The seed was initially grown in a seedling tray before being transferred onto a prepared plot and a hydroponic model, respectively. All the standard materials (made of plastic) needed for a perfect low-cost hydroponic model, obtained f...
Ghulam Murtaza1*, Muhammad Ramzan2, Assad Ullah3, Abid Ali5, Ayesha Zafar3, Rukhsar Beanish3, Ahmad Ali4, Ghulam Mustafa4 and Mudassar Aslam4
...s) is the most important pest in different regions of the world. Due to cosmopolitan in nature, it causes huge losses in various fruits and vegetables production throughout the globe. The current experiment was designed at Insect Rearing Laboratory, MNS. University of Agriculture, Multan to evaluate host and oviposition preference of Bactrocera zonata on different fruits under laboratory conditions. Infested fruits were coll...
Ahmed F. Afify1, Mohamed A. Shalaby2, Ahmed A. El-Sanousi2 and Amal S. Gaber1
...eritis virus from field specimens. A total of
548 samples were collected from governmental and private studs of Arabian horses
and also foreign horse breeds, including 540 serum samples, among these, 4 EDTAblood
and 4 semen samples. Serologically, indirect ELISA was performed on 540
serum samples. 130 samples were clearly strong positive at a pe<...
NawalM. Abdulla1, M. Haroun1*,Mohamed A. Shalaby2and Ahmed A. Elsanousi2
... captivated falcons(Falcoperegrinusperegrinus)
in Qatar.Virus cultivation in specific pathogen free (SPF) embryonating chicken eggs
(ECE),haemagglutination (HA), haemagglutination inhibition (HI) and mean death time
(MDT)used in the investigation to reveal virus identity and pathogenicity. Both NDV
isolates were found to be velogenic strains....
El-Habbaa, A.S.
... of skin lesions from suspected 30 sheep
and 10 goats from different areas of Qaliubeya governorate were subjected
tovirusisolation on embryonated chicken eggs (ECE), antigen detection using agar gel
immune-diffusion test (AGIDT) and indirect-Immunofluorescence assay (IFA) and
molecular detection of viral DNA using PCR. Positive results were showed in 36 of
samples (28/30 of sheep samples and 8/10 of ...
Ala’audin Hakami,1AusamaA Yousif,2* Mohamed Zaki,3 Mahmoud Ismail,4,5 Ahmed Al-Ali,5 Abdu-Rahman Al-Ankari5
...elected 19 clinically-suspect
and 153 apparently-normal birds collected from 10 locally-bred and
imported Psittaciformes. Specimens were collected between 2008 and
2010. A replicase-associated protein (Rep) gene-specific PCR was used to
amplify a 603 bp region of the viral genome. PBFDV was detected in
31.6% of clinical cases (3.5...
Asmaa A.M. Abd El-Ghani *; Ahmed B.M.; Abdel-Raouf A. ; Nagwa S. Ata* and H.A. Hussein
...lic extract of Salvadora persica(L.)
roots was investigated on bovine herpes-1 (BHV-1) infection in vitro. An ethanolic
extract of Salvadora persica was used in two concentrations. MDBK cells grown on
Minimum Essential Medium (MEM) were used for virus propagation and titration. The
effects of two concentrations of Salvadora
El-Dougdoug K.A.1, Sofy A.R.2, Rehab A. Dawoud3 and Korkar H.M.4
... concentration at low temperature. Shoot tips and
subculture 1st of banana plantlets were preservedsuccessfully for 12 months on
storage MS medium supplemented with 40, 50, 60 and70 gL-1 at 10, 15 and 20ᴼC.
The highest survival percentage 100% with recorded with 40 and 50gm sucrose
concentrations at 10, 15 and 20°C while 70 gL-1at 20°C recorded the lowest
...
Mandour, A. M. 1, Abdel Maksoud, H. M. 2, Amal, A. Khalil 3 and Mohga, A. El-Tahlawey 4
...maize crop in Egypt. The percentage
of infection differs from one location to another. MDMV was isolated from
naturally infected maize plants at El-Monfia. These samples were checked
for virus presence using Indirect ELISA. A number of cultural practices were
evaluated as control measures against MDMV to minimize the virus
infection in maize crop.
...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef*
... (P.nigronervosa) using specific primer
of DNA-1 for BBTV. The results showed that amplified PCR product with the
expected size 476 bp for both infected banana and aphid. PCR was used to detect
component 6 of BBTV-DNA using specific primer at expected size 813 bp.The
isolated component was cloned into PCR&t...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
...irty three tested plant species, and
cultivarsbelonging to six different families. It was transmitted mechanically and not
transmitted by seeds or aphids. The isolated virus was inactivated by 10 min exposure
to 95°C, but not at 97°C, at a dilution of 10ˉ3,and at3 weeks storage at room
temperature. The BBMV was tested serologically against antibodies of Broad bean
Abeer A. Feisall; B.A. Othman2; Kh.A. El-Dougdoug2 and H.S. Shalaby1
...v>A lytic bacteriophage specific for Salmonellatyphimurium was isolated from
sewage water and designated St-1. The isolated phage formed identical clear
circular single plaques, without halo of 3 mm in diameter. Electron microscopy of
Salmonella bacteriophage particles (St-1) indicated that the phage particle has an
isometric head of about 69.6 nm in diameter and non contractile tail of 243.5 nm in
le...
Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.
...s a valuable ornamental species widely planted in Egypt. The
Phytoplasma associated witches‟-Broom has been detected on symptomatic hibiscus
plants. Samples of hibiscusleaves were collected from El Giza, Alexandria, Qlubia,El-
Fayom, and El-Mansouragovernoratesand analyzed for phytoplasma infection.The
collected hibiscus plants showed characteristic symptoms for Phytoplasma associated
witches‟-Bro...
D. N. Abd-elshafy1, 2 and M. M. Bahgat2, 3
...ake up to two weeks to appear making it not easy to detect presence of virus. the present work aimed to study effect of inhibiting HepG2 cellular proteases on replication rate of the virus. Plaque infectivity count assay was carried out using safe concentrations of the cocktail protease inhibitor MixG and its five components: ABESF, aprotinin, E-64, leupeptin and EDTA. Also quantification of the activities of both intracellu...
Mai A. Kilany1; Hanaa H.A. Gomaa1; Yousry E. Abo El-magd2 and Nermin Raafat2.
...in humans with a high propensity for chronicity. If untreated, chronic hepatitis C can progress to cirrhosis and hepatocellular carcinoma (HCC) in a subset of patients. HCC is a prevalent disease in many populations worldwide. It causes many financial problems in treatment modalities with high mortality rates. In develop-ing countries, the major concern in HCC frequently belongs to HCV long lasting in-fection. Chronic HCV infection mostly leads to hepatic cirr...
Amal Mahmoud1&2 and Medhat H. Hashem3
...itis B virus (HBV) genotype C is a leading risk factor for hepatocellular carcinoma (HCC). Eight HBV isolates from Sohag governorate, Egypt were confirmed by polymerase chain reaction (PCR), resulted in 1110 nt correspond to partial sequence of polymerase (pol) and envelop (env) genesTwo HBV isolates were associated with HCC (Sohag1 and 7). Phylogenetic analysis of the nucleotide sequence and the amino acid of the pol or env genes revealed that 7 out of the 8 ...
Enas K. Abo-Elmagd,Kouka S. Abd El-Wahab,Azza H. El- Salakawy
...o compare the diagnostic performance of Lateral flow immuno-chromatography assay (LFICA) as a rapid test for detection of RV antigen in stool specimens collected from Egyptian infants and young children with ELISA, and nested reverse transcription polymerase chain reaction (RT-PCR). Furthermore, to study the frequency of RV infection in Egyptian infants and young children during the summer season 2012 and the effect of certa...
Nader M. Sobhy,1 Sunil K. Mor,2 Mohammed E.M. Mohammed,1
Iman M. Bastawecy,3 Hiam M. Fakhry,4 and Sagar M. Goyal2
...r amplification of FMDV specific genomic fragment and also copying specific serotypes O, A and SAT2 nucleotide sequence. In this work FMDV serotype O, A and SAT2 were isolated from cattle clinical samples (foot lesions). RNA extracted from clinical samples was subjected to reverse transcriptase polymerase chain reaction( Rt. PCR) nucleotide of FMDV ID an...
Hiam M. Fakhry and Assem A.A.
...heep continuous with the permissible protective level is (0.280) Delta Optical Density till 8th for zeolite and oil vaccine vaccine while till 10th week post vaccination with foot and mouth disease zeolite + oil vaccine. The humeral immune responses were monitored in different tested groups that revealed the immune responses in sheep vaccinated with trivalent foot and mouth disease vaccine adjuvanted with zeolite similar to results of trivalent foot and mouth ...
RehamM. El-Bakrey1, Shimaa M.G. Mansour2, Mohammed A. El Sisi1 AndAmal A.M. Eid1
...fficacy was evaluated by percentage of protection from mortality, morbidity and reduction in virus shedding from respiratory and/orintestinal tracts. Despite the H5 antibody responses in vaccinated chickens with program I (rFP-AI-H5" vaccine then Re-5) being significantly lower prior to challenge, it provided good protection (73.3%) against the lethal A/chicken/Egypt/SHAH-1403/2011 (H5N1) AIV challenge, with no evidence of virus shedding. Keeping in mind ...
Yasser F. Elnaker 1, Mohamed El-Tholoth 2, Sahar Saber 3, Amira A- Elsaid4, Mohamed A. Saad 3, Emad E. Younis 5
...showed clinical signs suspected to be lumpy skin disease, despite vaccination of dams 4 months before parturition with sheep poxvirus vaccine (Kenyan strain). The diseased calves showed localized or generalized skin nodules with or without fever. Skin lesions were collected from clinically diseased calves for virus isolation in embryonated chicken eggs for three passages followed by ten successive passages in Madin Darby Bovine Kidney (MDBK) and identification...
Walaa Abd El-Fatah S. Metwally1, Ismail M. Reda2, Ahmed A. El-Sanousi2, Mohamed Abd El-Khalek Ali2
...G varied in the HA units per dose and also differed in the ratios between two reassortant strains (Chicken and duck strains) of AI. The results of testing humoral immunity revealed that the prepared vaccines with Montanide ISA70VG containing 350 HA unit/dose were high in antibody titer than vaccines containing 256 and 100 HA unit/dose. The prepared vaccines with Montanide ISA 70VG containing 256 HA unit/dose gave high antibody titer than vaccines containing 10...
Ebtisam, A. Abouel yazeed1; Yanni, M.I.1 and Hanan A. Fahmy2
Hanaa A. Ahmed1 and Eman M. AboHatab2
... time PCR for rapid and specific detection of LSDV, sixteen out of the twenty one nodular samples were confirmed positive by molecular methods. Eleven out of twenty one nodular samples were positive by (IFAT) in CAM, which prove that PCR and Real Time PCR are much sensitive and rapid diagnostic tool of LSD reflecting their importance in controlling the rapid spread of disease in Egypt....
Yanni, M. I1; Hanaa A. Ahmed2; Lamyaa, A. Ahmed1; Hanan, A. Fahmy3 and Ibrahim, E.M.4 Aggour, M. G.3
... 55,000 deaths worldwide per year. More than 95% of these deaths occur in Asia and Africa. In our study, three Arabian horses from Cairo, Egypt, were died after nervous manifestation expecting Rabies. Brain tissues were sent for direct fluorescent antibody technique and isolation on tissue culture using BHK cells. Direct confirmation was performed by Real time RT- PCR and gene sequencing w...
Afaf. A. Khedr*, Ekram Salama*, A. A. Samy**, Abdella, Y.A.*** and Suzan. K. Tolba***
...adjuvanted vaccine was superior as shown in mean antibody titers against Avibacterium paragallinarum serovar A, B and C and infectious bronchitis. In addition, Montanide ISA-70 is lesser in viscosity that makes it easily injected, so, it is better to use for control of infectious coryza and infectious bronchitis diseases in chickens....
Fawzy Rania1, AboElkhair M.1, Bazid A.M.1, Sultan H.2, Hussien A.H.3
...g IBV which called quasispecies. Serotypic and or genotypic classification of IBV is mainly based on the S1 subunit of Spike (S) gene. In the present study, thirty tracheal samples of broiler flocks suspected to be infected with IBV were collected from different Egyptian governorates during 2012. Isolation and genetic characterizations were carried out for only ten samples which were positive for IBVs. Multiple nucleotide an...
1Mona A. El-Manzalawy, 2Abeer A. Boseila , 3Hanan M. El Zahed
...ulation adjuvanted by Peppermint oil (PMO) with Aluminum hydroxide gel (Alum gel) or without Alum gel, then ensure the safety and sterility of these vaccines and compare between them with the local RVF vaccine with Alum gel alone in sheep. This peppermint formulation including Alum gel adjuvant was the best of choice as it induced higher immunological enhancement. In addition, synergistic ...
Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3
... of 376 serum samples in percentage 42.8% were positive for FMD non structure proteins( NSP) antibodies which indicated the natural infection. ELISA kit used for FMDV antigen detection for the epithelial suspension from 42 field samples collected from various geographic locations 10 governorates are ( El-Sharkia,Giza, Port Said, Assuit, Suize, Kafre El-Shake, Qina, Al-Gahrbia, Domiatte and Alexandria) Serotyping and molecula...
Nashwa M. Helmy1 and Ahmed S. A.2
...s. There are seven serotypes of FMD virus (FMDV), namely O, A, C, SAT 1, SAT
2, SAT 3 and Asia 1. Tests for antibodies of FMDV nonstructural proteins (NSPs) are
useful in providing evidence of previous or current viral replication in the host,
irrespective of vaccination status. NSPs, unlike structural proteins are highly conserved
and therefore are not seroty
El-Bagoury, G.F., El-Nahas, E.M., El-Habbaa, A.S.
Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc
... (16) families and (23) species. The serum samples were examined using IDEXX MultiS-screen AI Antibody ELISA kit coated with AIV nucleoprotein and hemagglutination inhibition (HI) test against H5 and H9 antigens. The overall results using both ELISA and HI tests revealed that the prevalence of AIV antibodies was 12.6% (18/143). The seropositive samples represented 5/143 and 15/108 for ELISA and HI, respectively. The detectio...
Nelson D. Zambrano1, Wilber Arteaga1, José Velasquez2 and Dorys T. Chirinos1*
...cked by different insect pests, therefore it is produced with frequent pesticide applications. Research was conducted to evaluate the effect of lambda cyhalothrin + thiamethoxam on the incidence of insect pests and its associated natural enemies. Results revealed that populations of B. tabaci were higher in plots treated with lambda cyhalothrin + thiamethoxam associated with low levels of ...
Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2
...st HSV-2....
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1
...ing both degenerate and specific oligonucleotide primers. SLCV (bean isolate) was
transmitted from naturally infected common bean onto twenty two species and varieties
belonging to six different families i.e. Moraceae, Solanaeae, Cucurbitaceae,
Leguminoceae, Chenopodiaceae, and Malvaceae using viruliferous whitefly (Bemisia
tabaci). Results revealed that SLCV could be transmitt...
Allam A. Megahed1; Hoda M.A. Waziri2; Khaled A. El-Dougdoug3; Badawi A. Othman3; Sirag M. Lashin1; Mohamed D. Hassanin1 and Mahmoud A. Ibrahim4
.......
Samah A. Mokbel1, Ashraf A. Abd El-Mohsen2
...3% of PVX-free tubers respectively. Moreover, no effects on the survival rate of tubers were detected. High percentage (93.1% or 76%) of PLRV- or PVX-free plantlets was achieved with meristem tip excision (0.1-0.2mm) from thermo-treated tubers at (38ºC) with survival rate 96.6% or 83.3% respectively. DAS-ELISA method was applied to the tubers directly, in vitro cultures and young accl...
Hanaa H. A. Gomaa1; Entsar A. A. Nassar2; K. A. El-Dougdoug3
... (HSV1)....
Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed
...by indirect ELISA using specific
antiserum and confirmed by Reverse Transcriptase-Polymerase Chain Reaction (RTPCR)
using virus-specific primers. The molecular characterization for the Egyptian
isolate has been performed through cloning and sequencing for the OYDV CP gene
which amplified by RT-PCR then cloned and sequenced in the TOPO cloning...
K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2
...The PVY isolate-infected pepper plants confirmed by DAS-ELISA and isolated on
Chenopodium amaranticolor L. where gave chlorotic local lesions. Eleven potato cultivars
(Solanum tuberosum) mechanically inoculated with PVY isolate under greenhouse condition
were divided to three categories, resistant (Diamond, Execusa, Hermes and Valor), tolerant
(Sisi, Lady Balfor, Nikola, Ditta ...
Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2
...ous viruses affecting grapevine, tomato and other hosts. The virus was isolated from infected grapevine which was characterized by ring spots, mottling and shortening of internodes. And from tomato exhibiting necrotic rings and sinuous lines symptoms. The virus was checked in the suspected samples by ELISA using the specific antiserum. Anatomical and ult...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1
... Leaf Curl Virus (SLCV) specific primers. All bean varieties grown in
surveyed governorates were found susceptible to Geminivirus infection and the dominant
Geminivirus affecting bean fields was SLCV. Percentage of infection was higher at Nili
season than that at the summer season. Six different commercial varieties of common
bean were evaluated for SLCV infection at three different growth stages. The evaluation<...
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2
...-PCR) and a
specific antiserum for BSV. IC-PCR indicated the episomal presence of BSV in
Williams and Pradica banana varieties. In addition, IC-PCR analysis on vitroplants
collected from tissue cultures (TC) showed the significant role of TC in spreading out
of BSV. PCR amplicons for the reverse transcriptase and RNaseH motifs of ORF III
for four BSV isolates were cloned, sequenced and submitted to Ge...
A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2
...trast the thickness of upper and lower epidermis layers were reduced. Also the
thickness of midrib zone was slightly reduced. Moreover, vascular tissues lost their
normal shape and arrangement as xylem arms. The most interesting finding, lengths
of both , protoxylem and metaxylem were reduced while their widths were increased.
Ultrathin sections of symptomatic leaf tissue showe...
Mohamed I. Azzam1, Safaa M. Ezzat1, K. A. El-Dougdoug2, Badawi A. Othman2
...eight phage isolates, respectively. Out of fifteen tested
sites, two only (El-Rahawy drain outlet and Sabal drain outlet) were found to be polluted
with enteroviruses with rate of 3.6X104 and 3.4X104 gene copies per microliters (GC μl-
1), respectively using rt-qRT-PCR.
...
Rehab A. Dawood1; Entsar A. Nassar2; and K.A. El-Dougdoug 3
...-1 at 210C. The survival percentage was recorded 85.1, 81.2 and 50.8 for 50, 60 and70 gl -1 respectively for 12 months at 210C. All survival plantlets revealed viability and resumed growth on fresh medium within three weeks. PVY was eliminated from infected potato plants using osmotic potential (Osmotherapy) applied 50 , 60 and 70 gl -1 sucrose at 210C with 73 , 89 and 92 % respectively . ...
Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³
... plants growing in the experimental fields of Giza Agricultural Research Station showing mottle and distortion of leaves. The identity of the virus was confirmed biologically, serologically and by light and electron microscopy. It was found that BBMV reacted systemically with 12 species belonging to Fabaceae and locally with 2 species belonging to Chenopodiace. It was transmitted mechanica...
Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4
... isolated from Cucurbita pepo cv. Eskandarani cultivated in the open field showing severe systemic symptoms. The isolated virus has wide host range belonging to 4 families resulting systemic and local symptoms. Stability of the isolated virus in vitro was found as 55 oC for TIP, 10-4 for DEP and LIV 4 days. The characteristic spectrophotometric data of the highly purified virus showing tha...
Aly M. Abdel-Salam
...wn SCBV; indicating the special nature of the Egyptian SCBV isolates.
Close serologic relationship between SCBV and BSV from Egypt was detected. The
Egyptian antiserum of BSV captured SCBV antigens in leaves and insect vectors in
Immunocapture (IC) PCR analysis. The present study represents the first record of
SCBV presence in Egypt.
...
Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1
...s and identified with a specific antiserum (Loewe Biochemica GmbH) using Double Antibody Sandwich ELISA (DAS-ELISA). Virus survey was carried out during 2013 - 2014 in different locations on commercial strawberry fields. The percentages of infection were 3.7, 4.5, 15.7 and 20% in El-Behera, El-Kalubeia, El-Ismalia and El-Menofia respectively. SLRSV was transmitted either by Xiphinema ameri...
Elharony, S.B.1,3, SaharA.Youssef2 and Richard F. Lee3
...ethod does not require expensive
and environmentally hazardous reagents and equipment. It can be
performed even in low technology laboratories. The amount of tissue
required by this method is ∼50–100 mg. The quantity and the quality
of the nucleic acid extracted by this method is high enough to
perform hundreds of PCR-ba...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1
...mato plants (Solanum lycopersycum L.), and to identify and classify the phytoplasma
involved. A detection of infected tomato plants, which showed symptoms of big bud,
witches'-broom and phyllody, in all regions of the screened governorates, reacted
positively when assayed by nested polymerase chain reactions (PCR) using universal
phytoplasma-specific primer pairs P1/P7 and R16F...
Samah A. Mokbel, Soad H. Taha, Mahmoud M. Abd-El Hamid, Ali H. Hamed
...t potential as phytotherapeutic source to produce quality and health plantlets for rapid and large scale in vitro production....
AdlyAbd-Alla1,2, MahaNada3, Francois Cousserans1, and Max Bergoin1
...is an important economic pest in Egypt and in
many countries around the world and requires control management measures. During the
establishment of a N. viridulacolony in Egypt, a significant reduction in the insect
productivity and high mortality rate were observed. Electron microscopy examination of dead
insects homogenate revealed the presence of paraspherical virus like-particles with diameter
of ...
Aly M. Abdel-Salam1 and Samah A. Mokbel2
...r to those produced from peach and apricot isolates of NRSV-infecting stone
fruits. Dot blotting immuno-binding assay (DBIA) showed positive reaction between
NRSV-infected apple sap and an Egyptian antiserum for NRSV. Purified preparation
from infected leaves, using the electro-elution technique yielded nucleoprotein which
had Amax and Amin at 260 and 240 nm respectively. Elect...
M. A. Kararah1, Om-Hashem M. El-Banna1, Salwa N. Zein2 and Abd-Elrehiem, A.F.3
...was first reported on cowpea
(Vignaunguiculata (L.) Walp).PMV was isolated from naturally infected
cowpea plants, showing mosaic and choloratic ring spot symptoms, which
had been grown in the experimental fields of Giza Agricultural Research
Experimental Station (A.R.E.S) in 2008. Identification studies bas...
Arshad Abdulkhalq Yaseen1,2* and Mária Takácsné Hájos1
...e plant leaves of both experiments by 4% in 2019 and 20% in 2020. In both experiments, the significantly influenced factors on the bioactive compounds (total polyphenols and vitamin C) were mainly due to the plant varieties and the interaction of 6% MLE and plant varieties. In our experiments, physical parameters like relative chlorophyll content, normalized difference vegetation index (ND...
Sadiq Haladu1*, Taiwo Oladoye Akande2 and Mudassir Nasir3
...ying birds with 15 birds per treatment arranged in 2x3+1 factorial. Samples of blood and egg yolk taken were analyzed for serum components, haematological indices and lipid profiles. The results of plasma lipid profile showed that diet 4 (78.76 mg/dl) is significantly low in HDL compared to other dietary treatments. Egg total cholesterol showed significant reduction in diet 5 (254.65 mg/dl) observed when compared to the control diet (314.56 mg/dl). The result ...
Maryam Yousaf1, Salman Ahmad1*, Romana Anjum2 and Muhammad Zeeshan Majeed3
...ifications in tomato Lycopersicum esculentum nursery seedlings in response to tomato wilt disease caused by fungus Fusarium oxysporum f. sp. lycopersici (FOL). Two months old tomato seedlings were grown under normal conditions in green house and were artificially inoculated with FOL conidial suspension of 1×106 conidia/mL by drenching method. Untreated plants served as control. First...
Magdy, Mariam1 ; Abou ElHassan D.G. 2 ; and Salem, S.A.H 3
...
onwards. FMDV serotype (O) was the most prevalent until serotype (A) appeared in 2006 then
during April and May 2012, six outbreaks of FMD serotype (SAT 2) were reported in Egyptian
governorates. This study based on evaluation of vaccinated animals by detection of antibodies
against seroty...
Sherif .M. Ibrahim*, Abd El-Razek. B. Abd El-Razek*. Hanan. M. El-Zahed Amal. A. Fatouh* and Ayatollah. I. Ibrahim*
...ioallentioc membrane of specific pathogen free (SPF) embroynated chicken egg (ECE) showing the characteristic pock lesions for each strain with titers reached 4.5 and 3.5 log10 EID50/ml at 5th passage for FPV and PPV isolates, respectively. The isolated strains were further identified using the specific hyper-immune sera for each virus by virus neutrizat...
Sahar Abd El Rahman1; Mohamed Eladl2 and Mohamed M. El-Diasty3
...cted from dairy farms suspected from clinical investigations to be infected by bovine ephemeral fever virus. The virus was isolated intracerebrally in suckling mice then successfully identified by indirect immunofluorescence technique in the brain sections of positively inoculated mice. Reverse transcriptase polymerases chain (RT-PCR) reaction was performed directly on buffy coat samples for molecular identification of the v...
Safaa M. Mohammed*, Shahira A. Abdelwahab**,Fetaih,H⃰ ⃰ ,Neveen,R⃰ ,Abdel satar ,A⃰ and Mohamed S. Elshahidy**
...ain reaction .Two main types of TKPV infection were observed in examined flocks ,cutaneous and diphtheritic forms. Morbidity rate ranged from 5-15%with no mortalities .75% of examined serum reacted positive to TKPV .All TKPV isolates were amplified using specific P4b primers and visualized by gel electrophoresis at 578bp....
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...udy focuses on The envelope glycoprotein D of EHV-1 (EHV-1gD) due to its essential role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins .A wave of Abortions has been recorded in El Zahraa stud for Arabian Horses ,collected samples were either aborted fetal tissues either Lung and livers ...
Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1
...s....
Amir M. Walaa1 ; Ausama Yousif1; Walid H. Kilany2; Magdy El-Sayed1; Ahmed A. El-Sanousi1
...its ability to protect experimental broiler chickens against challenge with wild ND and IB viruses. Two hundred and eighty commercial one-day-old broiler saso chicks were divided into 8 groups (35 birds each). Groups 2, 3, 4&5 were vaccinated at one-day-old with live hitchner + IB Primer. Then all groups at 7 days old were boosted with inactivated combined NDV+IBV vaccines with different adjuvants except for group 1 & 2. Group 1 was kept as unvaccinate...
Megahed, A.A.1; Kh. A.El-Dougdoug2 and B.A. Othman2
...rent Governorates, which performed by examination 915 plant samples from 149 fields in two seasons (2009/2010 and 2010/2011) symptomatology. During survey, 464 of naturally infected sugar beet plants showing distincted for one or more viruses were collected from 73 fields in season 2009/2010, while from 76 field, the total of examined plants were 451 through the second season (2010/2011), upon external symptoms. All samples were distributed in 8 symptomatic gr...
Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2
...necrotic spots on flower petals .The virus was biologically purified from single local lesion formed on Chenopodium quinoa. The isolated virus was identified on the basis of symptomatology, transmissibility, serological tests and molecular technique. The virus was identified serologically by direct ELISA, dot and tissue blotting immune-binding assay using authentic and induced antiserum for PNRSV.RT-PCR with specific PNRSV p...
Badr, A. B. 1, Abou-zeid, A. A2. and Al-Naggar, A. M1.
...thy plant....
Hanan M. El-Zahed, Hanaa A. Mostafa, Nermeen M. El Sayed and Lamiaa M. Omar
... forming three subgroups per each group. It is clearly observed that a relatively high levels of CAV ELISA antibody titers in all the vaccinated chicken subgroups at 4th WPV with either DW or S/C CAV vaccine indicating that the two CAV vaccines were immunogenic; Also, by measuring H5N1 HI titers within the 6 weeks post vaccination with AI vaccine in the sera of different chicken subgroups using HI test. It is clearly observed that AI HI antibody mean titers in...
Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2
...oplasma....
Amany Adel1, Abdelsatar Arafa1, Hussein A. Hussein2 and Ahmed El-Sanousi 2
...between different avian species. PL motif ESEV was found in 6 isolates from chicken and ducks circulating in such population whereas 17 viruses have ESKV similar to those reported in human in 2006. Based on NS1 sequence analysis of the H5N1 Egyptian viruses, neither geographic nor species signature were reported. This study indicates independent evolution of NS1 gene in Egyptian viruses th...
Serageldeen Sultan1, Nabila Osman2
...lence increased as age dependent and most commonly occurred among broiler breeder flocks (10/24). In conclusion, the occurrence of avian HEV was confirmed for the first time among chicken flocks in Egypt....
Eman A. Ahmed1, Osama Y. shalaby2, Emad F. Dwidar2, Samah A. Mokbel1 and Ahmed K. El-Attar1
...eristics of stem, flower petiole and leaves of infected tomato with phytoplasma with healthy ones in order to reveal anatomical modifications caused by the infection process. The results obtained showed that infection of tomato plants with phytoplasma led to an increase in stem diameter by 10.23% as well as greatly increase in measurements of the other stem components while the diameter of pith was decreased by 38.46%. This infection was led to an increase in ...
Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3
...und between cultivars. Super strain and super merman were found to be more susceptible than any other cultivar tested which showing 90% infection. Basil essential oil and ethanolic extract of Plantago major leaves was used as antiviral to reduce the infection with TSWV at three concentrations levels (500,1000 and 2000 μg/ml and 50,125,250 μg/ml, respectively).Viral infection was redu...
Ramy A. Qabel1; Tarek F. El-Arabi2; Adel A. Shoukry1; Hassan H. Elsebaay1; Abdel-Aziz F. El-Hamahmy1
...gume plants. While no temperate phages were detected, two groups of phages were determined based on their virulence. Highly virulent phages designated as group V showed clear plaques and were able to infect many of Rhizobium species and strains. The other group of phages was less virulent and showed turbid plaques implied as group L. This was also determined by one-step growth experiment. ...
Radwa M. Shafie 1 and Soha S. M. Mostafa2
...ltrates gave the highest percentages of inhibition. Lower inhibition effect was produced by culture filtrate of N. muscorum and S. platensis, respectively in particular in plants treated with algal filtrates by mixed with virus inoculum immediately before inoculation. Spraying plants with the algal filtrates 24 hrs. before inoculation produced a higher inhibitory effect against BYMV than that obtained by spraying 24 hrs. aft...
Lala Rukh1, Muhammad Nadeem1, Tusneem Kausar1, Mian Anjum Murtaza1, Muhammad Luqman2*, Muhammad Bilal Shahid1 and Amal Shaukat3
...th good digestibility properties. Date pit powder and soy protein isolate incorporation enhanced the total antioxidants and DPPH activity in soy date bars however, decreasing trend was observed in total antioxidants and inhibition of DPPH radical activity during 90 days of storage. Based on the results, it has been suggested that date bars may be considered as a source to meet the energy requirements of health-conscious consumers. Moreover, date pit powder and...
Shahida Sabir1, Anwar Ali Shad1, Tariq Masood1*, Zafar Ali Shah1, Nasiruddin2, Yaseen Ahmad1 and Syed Sartaj Alam3
...100% colonization, yield per bag and % bio-efficacy of Pleurotus eryngii. It was found that maximum 20 and 34 days were taken by 50% and 100% colonization, respectively on 25% supplemented B. lycium substrate compared to control treatment (17 days). The yield and bio-efficacy of mushroom was observed around 596.7 g per bag and 99% respectively at 25% sup...
Rafia Ahsan1, Saif Ullah1, Ijaz Yaseen1, Faisal Sohail Fateh1, Muhammad Fayyaz1, Shahzad Asad1, Atif Jamal1, Muhammad Sufyan2 and Muhammad Zakria1*
... was 35%, 50% and 21% respectively, and severity ranged from 0-80%, 0-70% and 0-70% respectively. In KP 3 rice growing areas were surveyed. In Mansehra the disease incidence (37%) and severity (0-70%) was lower compared to Swat and lower Dir. In comparison to Punjab and KP, BLB was less prevalent in Sindh. Highest disease prevalence was recorded in Badin (13%) followed by 10% in Shikarpur. In total, forty seven diseased leaf...
Asfand Raheel1, Syed Zulfiqar Ali2, Muhammad Waris2, Muhammad Basharat2, Basheer Ahmed2, Muhammad Arshad Ullah3, Syed Ishtiaq Hyder4 and Taqi Raza4*
...al sensors with partial specificity and an appropriate pattern-recognition system, capable of recognizing simple or complex odors. In the food industry, electronic nose is popularly used to detect smells and flavors of a wide range of food items. Latest steps are required for postharvest management through which the economy of horticultural products around the globe is almost at minimal losses. This review is highlighting the basic but truly important postharv...
Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed
... technique (IFAT) using specific hyper immune serum against LSDV. Further identifications were carried out by polymerase chain reaction (PCR) and clinco-pathological investigation. Results: The results showed that 11/30 biopsies were positive by AGPT, 19/30 by IFAT and 30/30 by PCR. While results of sero-diagnosis showed that 45/100 from apparently healthy non vaccinated cattle and 68/100 from vaccinated cattle were positive...
Lamya A. F. Ateya1, Said A. Ahmed 2, Mansour H. Ayman3, Khamees K. Ashraf 4, Heba A. Abdel-Hady 5
... technique (IFAT) using specific hyper immune serum against Lumpy Skin Disease Virus. Further identifications were carried out by polymerase chain reaction (PCR). Results: 15 samples were +ve for LSDV by conventional PCR.The results showed that 11/23 biopsies were positive by IFAT. Molecular identification of LSD virus by using RT-PCR, revealed positive for amplification of bands at the predicted molecular size (1926bp). Neu...
Lamya A. F. Ateya1 , Said. A .Ahmed2, Khamees K.S. Ashraf3, Heba A. Abdel-Hady4
...nes using solid phase competitive ELISA 2,4,8,and 10 weeks post vaccination(wpv). Results were 45(24.2%), 65(34.9%)2 WPVand 55(29.5%) ,68(36.5%) 4WPV- 58(31.2%),71 (38.2%) 8WPV and 58(31.2%), 69(37.1%) 10 WPV for serotype A.For serotype (O):55(29.5%) ,58(31.2%)2WPVand 60(32.3%), 62(33.3%) 4WPV and 62(33.3.5%) , 62(33.3%) 8 WPV 60 (32.3%),63(33.9%)10 WPV.For serotyp...
Ola Youssef 1; EL-Deeb A.H.2 Nassif S.A.1 and Ahmed A. El-Sanousi 2.
...0 logs 10 copies / ml respectively. The result of in- house ELISA was
not significant for H5 gene detection and titration using polyclonal H5 serum. The HVT titer in CEF
was 3045, 3200, 3400, 3750 & 4000 PFU/dose for batch A, B, C, D, and E respectively. The selected
batches safety was satisfactory by 10 fold field doses injection in SPF chicks. The challenge test results
r...
Aly M. Abdel-Salam
...e mostly of the yellow-type disease symptoms. Previous observation indicated that co-infection of cucurbits with these viruses was very common and may lead to severe problems in virus diagnosis. Objectives: The purpose of this study is to characterize biologically, serologically, and molecularly one Crinivirus viz. Cucurbit yellow stunting disorder virus (CYSDV) and one Ipomovirus viz. Cucumber vein yellowing virus (CVYV) from infected cucurbits. Further, the ...
Ehab M. El-Nahas1, Hemat S. El-Sayed2, Sawsan S. El-Basuni3, Gabr F. El-Bagoury1
...tion and the challenge experiment for H120 vaccinated broiler chickens were also performed. Results: Egypt/Qal/014p had close relation with that of the Massachusetts prototypes. Comparisons nucleotide and amino acid sequence of partial S1 gene showed that the recent isolate had 98.2% and 95.2% nucleotide similarities and 96.8% and 91.4% amino acid similarities with the commonly used IBV va...
Salama M. El-Saghir1, 2
... and, molecularly using specific primers for PVS.
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3&rsq...
Salama M. El-Saghir1, 2
...ontinuous observation of peach trees previously known to be infected with PNRSV, additional
suspected symptoms of phytoplasma infection were detected. These involved leaf yellowing and
withering, reduction in fruit size, malformation of fruits (where two or three fruits were attached
together), and tree death were observed.
Objective: The objective of this study is to character...
Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2
...ns in Egypt. Methods: Suspected virus isolates on embryonated chicken eggs was detected by Hemagglutination (HA) test and identified using hemagglutination inhibition (HI) test. F protein encoding gene of NDV was amplified using Reverse Transcription-Polymerase Chain Reaction (RT-PCR) then subjected for nucleotide and amino acid sequence detection. Results: NDV Giza 2014 isolate and NDV Qualubiya 2014 were characterized as velogenic and lentogenic strains, res...
Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and Mohammed A. Shalaby2
... Evaluation of Peste des petits ruminants (PPR) vaccine is a matter of concern to ensure
releasing of safe, effective and potent product.
Objective: To use of some molecular techniques as conventional reverse transcriptase polymerase
chain reaction (RT-PCR) and real time RT-PCR in identity test of PPR vaccine.
Methods: Four batches of PPR vaccines that produced in Egypt by Veterinary Serum and Vaccines
Muhammad G. Khodary1, Ayman H. El-Deeb2, Mohamed M. Emara2, Othman E. Othman1, Hussein A. Hussein2
... positive samples were typed by conventional reverse
transcriptase polymerase chain reaction (RT-PCR). Sequencing and phylogenetic analysis of 6
representative samples were performed.
Results: Testing of 80 collected samples of Oropharyngeal, oral epithelial tissue and/or vesicular
fluids by real time Reverse transcriptase polymerase chain reaction (rRT-PCR) revealed 65 out of ...
Naglaa F.S. Awad1, Gamelat K.F. Kotb2
...CR positive samples were performed, also these
positive RRT-PCR samples were purified and directly partial sequenced for C-terminal VP60 gene.
Results: Only two samples were positive for partial C-terminal VP60 amplification. The first positive
sample was collected from non-vaccinated young rabbit (45-day old) and designed here as SHAH
2015, whereas the second sample was collected from non-vaccinated adult dam (n...
Lamiaa M. Omar, Mohamed A. Abdrabo, Dali M. Omar, Nermeen A. Marden
... for detection AI virus specific nucleic acids such as (rRT-PCR).
Methods: Titration of the HPAI virus for infection of SPF chicken. The tracheal swabs were collected
from diseased chicken for virus isolation and quantification by ECE inoculation and rRT-PCR.
Results: the titer of original HPAI virus was 1010.3 EID50/ml. The AI titers after experimental
infection of chicken and...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...Citrus limon) to healthy periwinkle (Catharanthus roseus)
by dodder (Cuscuta reflexa Roxb) and Lemon (Vollka marina) plants by eye bud grafting.
Cytopathological detection referred to Diene's stain was used to differentiate the phloem tissues of leaf
petiole sections from infected trees. The phytoplasma was detected in the sieve tubes and parenchyma
cells of leaf midribs by Tra...
Ahmed A. Azab, Wesam H. Mady, Ali Zanaty, Mahmoud Samir
...>
was isolated in specific pathogen free (SPF) embryonated chicken eggs ECE), chicken embryo kidney
cell (CEK) and in Vero cell line and was confirmed for IBV detection by Reverse Transcriptase Real
time PCR (RRT-PCR) using IB specific primers. Comparison of different isolation methods was done
by generating a standard curve by real time PCR.
Results: The results revealed...
Ashraf S. Khameis, lamya F. Atteya, Ayman H. Mansour, Heba A. Abdelhady, Ashraf A.
Saad
...s of the RPO30 gene and open reading frame (ORF) 103 genes. The sequences
designated Sheep pox virus was submitted to GenBank under accession number of MF443334.
Conclusion: The molecular techniques based on the RPO30 and ORF 103 genes are efficient for the
characterization and differentiation of Capripox viruses. This finding may provide new information on
the epidemiology of SPV in El Menofiya governorate.
Dina N. Abd-Elshafy
... and is transmitted from person-to-person
through contaminated food or water. A number of travelers arriving from Egypt were found
infected with HAV upon return to their home countries, for this Egypt Travel made warned
tourists traveling to Egypt to avoid eating under cooked or raw food (especially meat and
eggs) or raw vegetables and drinki...
Maha A. El-Abhar1, Moustafa A. Elkady1, Khaled M. Ghanem2, Hussieny A. Bosila3
...ction of thirteen plant species and cultivars belonging to four families (Amaranthaceae,
Solanaceae, Fabaceae and Laminaceae) to AMV infection was demonstrated. The presence or
absence of the virus was verified by back inoculation onto healthy indicator host plant and/or ELISA
test. AMV was readily transmitted by mechanical means and by Myzus persicae with pe
Dina A. Abdulrahman1, Ayman H. EL-Deeb2, Momtaz A. Shaheen1 & Hussein A. Hussein2
... cattle showing signs suspecting of FMD.
The samples were tested by real time RT-PCR using universal primers for detection of all seven
serotypes of FMDV. The positive-resulted samples were then tested using conventional PCR and pan
FMD primers. The same samples were tested again using serotype-specific primers to ampl...
Abdou Nagy1, Fatma Abdallah1, Kareem Sweed2, Ahmed Salama3, Mohamed Omar4
...Aim: This study aimed to perform seroprevalence of aMPV for non-vaccinated chicken and duck
flocks from six provinces of Egypt (Ash Sharqiyah, Ismailia, Qalyubia, Menufia, Sohaq and North-
Sinai) and determine its economic effect.
Methods: Serum samples were collected from non-aMPV vaccinated apparently healthy 40 chicken
(23 broilers and 17 layers) and 8 duck (6 Pekin and 2 Muscovy) flocks and then, tested with<...
Maha M. Khedr1, Reem A. Suliman1, Marwa F. Mohamed1, Mounir D. El Safty1, Hussein A.
Hussein2
..., mainly infecting the upper respiratory tract, in humans,
domestic pigs, horses, and numerous bird species. Maternal derived antibodies could interfere with the
efficacy of vaccination against avian influenza in early age in chicks.
Methods: Eight groups of one-day old commercial broiler chicks were kept in isolators along the whole
period o...
Shimaa M. Mansour, Reham M. ElBakrey, Ahmed Orabi, Haytham Ali, Amal A. Eid
...>three chickens (3/18) appeared diarrheic. All clinically affected chickens showed varied postmortem
lesions that almost associated with ARV infections. Further molecular detection of ARV within the 18
clinically affected samples (n=18) by RT-PCR using a specific primer set targeting a conserved
sequence within ARV- sigma C protein revealed 7/18 positive samples. All positive samples (7/18...
Hussein A. Hussein, Maha Khedr, Reem A. Suliman, Marwa F. Mohamed, Mounir D. El
Safty
...v>
days of age; respectively. A group 7 was positive challenged control and group 8 negative challenged
groups. All chicken groups were maintained at isolators along the experiment study. Blood samples were
collected for weekly for 4 weeks and antibody titers were determined by HI test. All vaccinated groups
were challenged 4 weeks post vaccination and tracheal and cloacal swabs were...
Dalia M. Omar1, Nermeen A. Marden1, Lamiaa M. Gaafar1, Elham A. El-ebiary1, Khalid El-Dougdoug2, Badawi Othman2, Abd Elsattar Arafa3, Hussein A. Hussein4
... was identified and subtyped antigenically by serological test as
Haemagglutination inhibition (HI) using standard AI antisera for H5 antigen and genetically by RTPCR
using specific primer for H5 gene and it was confirmed to be H5N1 and grouped according to the
year of isolation as 2016 isolate strain.
Results: According to the phylogenetic a...
Nermeen A. Marden1, Lamiaa M. Gaafar1, Hussein A. Hussein2
...v>
methods for 8 types of AI vaccines (5 batches for each) to evaluate their efficacies were done.
Methods: The invivo method, was done through the vaccination-challenge pathway of SPF chickens
to estimate the protection percent of each vaccine against both classical and variant HPAI viruses.
While, the invitro method was done by the direct detection of the viral content and viral id...
Arslan Mahmood Ahmad1, Muhammad Ameen Jamal1, Abdul Sattar1, Aamir Ghafoor2, Aqeel Javeed3 and Amjad Riaz1*
...ts indicated that higher percentage of activation of mouse oocyte was achieved with 10mM and 15mM for period of 3 h and 6 h compared to the control group (P<0.05). To examine the toxic effect, 10mM SrCl2 with 3 h exposure showed minimal detrimental effect on embryo development. Collectively, our findings revealed that 10mM concentration of SrCl2 for 3 h exposure was appropriate for oocyte activation ...
Asma Kaouachi1, Mohcen Menaa1*, Abderraouf Chouaib Rebbah2 and Mohamed Cherif Maazi1
...s. In the near past the species populations have increased significantly in Algeria. In order to better comprehend the ecology and vital needs of the wood pigeon and to help with our results in the process of conservation management of wood pigeon, a study of the diet of this pigeon was undertaken from October 2015 to April 2017 within the Souk Ahras region, in North-eastern Algeria. This work was carried out by using a combination of digestive-contents analys...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
...of A1/A2 β-casein type in Cholistani cattle breed of Pakistan. Blood samples of Cholistani Cattle were collected from Government Livestock Farm, Jugait Peer, Bahawalpur. Genomic DNA was extracted from whole blood by organic method. PCR primers were designed and optimized according to respective melting temperatures. PRALINE tool, MEGA 6.0 and POPGENE tool were utilized for phylogeneti...
Abdullah Sheikh1,*, Faisal Almathen1,2 and Hairul Islam Mohamed Ibrahim3,4
... dromedarius) phenotypes from Saudi Arabia. The four camel groups included were white, diluted (light brown, creamy and fawn), black and dark brown representing eumelanin and pheomelanin coat colors. Generally, the TYR gene expresses less in non-pigmented than the pigmented species. The results of our study showed that the mRNA from skin biopsies has low expression in white dromedary camels while higher expression...
Coronavirus Disease (COVID-19) with Special Reference to Pakistan: A Review on its Different Aspects
Sahar Mubashar*, Tariq Mukhtar and Nasir Ahmad Khan
Roheela Yasmeen1*, Nida Mobeen1 and Samia Chaudhry2
...l injury. This virus can persuade cardiac damage, arrhythmias, severe coronary syndrome and venous thromboembolic complications. Patients of COVID-19 having already cardiovascular problems showed severe symptoms of this disease and have greater chance of death. This review article especially pays attention on cardiovascular symptoms of COVID-19 and its enhanced effect on patients with already existing cardiovascular diseases...
Zain-Ul-Aabdin Abro1*,Naheed Baloch1, Raza Muhammad Memon2 and Niaz Hussain Khuhro2
...pulation dynamics of the peach fruit fly, Bactrocera zonata (Saunders) and oriental fruit fly Bactrocera dorsalis (Hendel) were monitored from January to December 2018 in guava orchards of the Sindh Pakistan. The investigations were done at different localities of Hyderabad and Larkana using Steiner type traps incorporated with methyl eugenol. The trap catches of B. zonata and B. dorsalis in both ...
Nehafta Bibi1,2, Faiq Jan3, Munawar Saleem Ahmad4 and Haitao Wang1,5,*
...great majority of avian species is diurnal and thus endures variation in light intensities, associated with daily, seasonal or lunar cycles. These diurnal birds search their food in light abundant environment and raise their broods in dark cavities. However their visual performance in dim light conditions is largely unknown. Here, we compared light intensity threshold of activity in two groups of passerines, i.e. seco...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
...direct ELISA and PCR, respectively. Two major surface protein genes (MSP1a and MSP4) sequence were compared with cattle isolates from different origins. Phylogenetic analysis of local isolates showed a close homology with the isolates from Australia, Brazil, Turkey and Japan. It was found that aged, exotic and crossbreed cattle were more susceptible to A. marginale infection in summer season compared to the younger and indigenous...
Zahid Mahmood Sarwar1*, Ayub Iqbal Malik1, Maryam Suhail2, Shafqat Saeed3, Muhammad Umair Sial3, Waqar Jaleel4, Muhammad Nadir Naqqash5 and Qamar Saeed1
... taxonomic study of new species of the genus Spodoptera i.e. Spodoptera hirsutus is very similar to the Spodoptera litura but easily distinguish on the basis of different characters of genitalia. Specimens of this genus were identified on the base of their genitalia characters. This new species Spodoptera hirsutus was collected from Muzzafarghar with the help of...
Wen-Feng Li, Rong-Yue Zhang, Jiong Yin, Hong-Li Shan, Xiao-Yan Cang, Zhi-Ming Luo, Xiao-Yan Wang, Jie Li and Ying-Kun Huang*
...e sugarcane borer is a type of pest that severely damages sugarcane. To explore and seek effective and environmentally friendly control technology for sugarcane borers, promote environmentally friendly control for sugarcane pests, new sex pheromone trap of sugarcane borers, Abamectin•Bacillus thuringiensis and Tebufenozide were selected and applied for control of Sesamia inf...
Syed Maaz Nadeem1,*, Muti ur Rehman Khan1, Asim Aslam1, Ali Ahmad Sheikh2, Arfan Ahmad2, Syed Nadeem Mansoor3 and Muhammad Anees4
...d examined under microscope. Results showed a significant difference between the cellularity of normal and CAV-infected birds. While comparing healthy and infected chicken bone marrow, we observed a decreased mean erythroid cell percentage (39.95 versus 17.95%), myeloid cell percentage (57.29 versus 21.98%) and the mean M/E ratio (1.43 versus 1.22), respe
Junyan Bai1*, Zhihao Dong1, Rentaodi Wu2, Lema Dao2, Di Bao2, Qiang Zhang2, Xinghua Tian3 and Hui Cao1
...982, 0.972 and 0.914, respectively. The S growth models of body height, body length, chest circumference and tube circumference were Y=e(5.219-0.520/X), Y=e(5.140-0.601/X), Y=e(5.473-0.615/X), Y=e(3.006-0.674/X), respectively. The cubic model and S model of the body weight of Alashan Bactrian camel had the best fitting effect (R2 = 0.979, 0.974), the cubic growth model o...
Abeera Razzaq1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qingyou Liu3
...tion of reactive oxygen species (ROS). These ROS can interact with nucleic acids and cause oxidation of DNA. The potential of ROS to damage DNA has become a topic of significant interest for environmental toxicology studies. Thepresent research was conducted to assess the genotoxic potential of cobalt (Co) and chromium (Cr) mixture to fish Labeo rohita by using micronuclei assay. Fish were exposed to the four sub-lethal doses (26.61, 13.30, 19.98 and 7....
Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2
...on microscopy (EM) on suspension of cell culture passage of the virus, Serological
identification was done by serum neutralization test ( SNT ) using reference antisera which confirm
presence of LSDV . By nucleotide sequences and genetic characterization was conducted on (G-PCR)
gene segment of these isolates.
Results: 93 samples were positive for LSDV by using conventional PCR direct from nodular lesion, 4
...
Nagwa K. Meselhy1, Mohamed A. Abo El-khair1, Basem M. Ahmed2, Sherif A. El-Soally3,
Abdelhamid M. Fares1, Mohamed A. Nayel1 and Hussein A. Hussein2
...iv>Background: Equine herpes virus 1 (EHV-1) has a significant economic impact on equine industry. It
is a highly contagious pathogen, mainly transmitted by inhalation of aerosols of virus laden respiratory
secretions especially with high population during equestrian events. Reactivation of virus in nonsymptomatic,
latently (silently) infected horses is the main cause of circulation of suc...
Hanaa A. Elsamadony1, Laila A. Tantawy1, Sabry E. Omar2 and Heba A. Abd Alah1
...d CAV/Nobilis®P4) respectively. The high percentage of similarity of
nucleotides identity with Egyptian isolates and our strain were with Egypt I/Giza 2009, Egypt
II/Fayoum I, Egypt III/Fayoum II that was 86% for all, as well as amino acid identity was 86%, 87%
and 86% respectively.
Conclusion: The obtained results indicate that our circu...
Othman N. O. Mansour 1, Naglaa Hagag 2, Momtaz A. Shahein 1, Sayed S. Hassan 1 Ahmed
A. EL-Sanousi 3 and Mohamed A. Shalaby3
...naviridae family which appeared firstly in Kingdom of Saudi Arabia. MERS affects the lower
respiratory tract of human. There are many researches which emphasized that camels are carrier for
MERS-CoV.
Objective: This study aim to know the extent of prevalence of new Exotic diseases like MERS among
imported camels from some endemic countries in Africa, and to check our local breeds of camels in
differen...
Rana A. Rabiea1, Mohamed Fawzy2, Mohamed H. Khodeir3 and MokhtarM. EL-Tarabili2
...l
diseases depends on the implementation of well-designed vaccination programs using highly potent
and safe vaccines.
Aim: The present study investigated the effect of simultaneous administration of inactivated AI
vaccine and live attenuated TRT vaccine on the immune response of turkey chickens.
Methods: Four groups of bronzy turkey chickens were used in this study; group-1 received live
a...
Ayman S. El-Habbaa1 and Mervat E. Radwan2
... endemic in Egypt with repeated periodic outbreaks.
Objective: To investigate strain detection and genetic analysis of BEF virus among suspected cattle in
August 2017, Qualyubia, Egypt.
Methods: Partial sequence was generated after detection by reverse transcription-polymerase chain
reaction (RT-PCR) and subsequent gel purification of the amp...
Mohsen M. Elsharkawy1, Salem H. Homayed1, Mohamed M. Elsawy2 and Amr A. Khedr1
...iv>Methods: The fan was operated two times per day (8:00 am and 18:00 pm, each time for 30 min).
Moreover, cucumber plants were treated with cell free filtrate (CF) of GF 19-1 at 1 day before virus
inoculation.
Results: The wind velocity (2.6 m/s) resulted in decreased virus severity and titer compared with the
control. However, the potential of wind velocity lower or higher th...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
... set of different plant species.
Electron Microscopy was used to examine the virus morphology. The cytopathic effect of the virus on
tissue ultrathin section was examined by transmission electron microscope (TEM). Finally, the PVM
isolate was detected using reverse transcription-polymerase chain reaction (RT-PCR) in the sprouts
after dormancy breaking for the harvested potato t...
Samira M. Bolis1, Magda Mahmoud2, Salah E. Gumma3, Naser E. Bilal1 and
Isam ElKhidir4
...ound: Focal epithelial hyperplasia (FEH) is a common oral infection which is usually missed
in the diagnosis because it is symptomless and its lesions can regress by time. On the other hand there
is no cell culture for Human papilloma viruses (HPVs).
Objective: Detection of HPV genotypes assocciated with FEH in childern aged three to fourteen years
old.
Methods: Fou...
Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2
...mission electron microscope for rapid diagnosis, host reactions, serological
double-antibody sandwich (DAS)-ELISA, reverse transcription (RT)-PCR and nucleotide
sequence determination. Ultra-structural responses of basil leaf cells infected with a
morphologically distinct RNA virus, AMV, were studied. Molecular characterization and
phylogenetic analysis were performed for the A...
Riham H. Bassam, Hussein A. Hussein, Mohamed M. Amer, Basem M. Ahmed and Ahmed A. El-Sanousi
...ferent ages, different type of raising which were housed in different Governorates in Lebanon
including, broilers, layer hens of breeders, backyard chickens and ducks for serosurveillance and
molecular characterization. Also; sequence analysis of the same IBV-positive samples.
Results: flocks had shown high discrepancy of CV% values with regard to ELISA results against IB
virus. Out of 60 flocks tested; 12 were p...
Riham H. Bassam, Hussein A. Hussein, Mohamed M. Amer and Ahmed A. El-Sanousi
... of avian influenza subtype H9N2 (AI
H9N2) in 2006 in Lebanon; a lot of pathological changes and mortalities were seen among chicken
flocks suggesting the influence of the AI H9N2 virus.
Objective: this study reports the circulation of H9N2 associated with mortalities in broiler sector and
decrease egg production in layer hens and breeders in Lebanon.
Methods: A total of 22 poultry flocks have been te...
Aml S. El-Saadany1, Ayman H. El-Deeb2 and Hussien A. Hussien2
...on the sequence of the hyper variable
region of VP2 gene was carried out.
Methods: Forty field bursa samples were collected from different localities. IBDV was detected using
RT-PCR. Sequence analysis of the variable region of VP2 gene purified from the PCR product.
Comparative phylogenetic analysis based on the sequence of the hyper variable region of VP2 gene as
w...
Mohamed F. ElKersh1, Fatma M. Abdalla2, Gamilat K. Farg2, Soad A. Nasef3, Ahmed A. Ali2
...V) from Different Avian Species that would be useful to detect the current strains present in Egypt to use it in vaccination program. Methods:In this study, we collected 122 sample representing 12 different area in Egypt and seven different species of poultry produced and traded in Egypt. These samples were isolated on SPF eggs, detected for AIV infection Via HA, RT-PCR and gene sequencing. We analyzed the sequence on gene b...
Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2
...in flower nurseries and open filed in Giza governorate, it was transmitted from naturally
infected Gazania to healthy periwinkle and other ornamental plants by dodder (Cuscuta reflexa ), and
the leaf hopper (Empoasca decipiens). Free hand sections stained with Diene's stain was used to detect
and differentiate the phloem tissues of leaf sections from inf...
Hanan Sayed1, Mohamed S. Madkour1, Hussein A. Hussein2, Mounir Mohamed Elsaft 3,
Marwa F. El saied3, Ahmed A El-Sanousi2
...accine based mainly on repetition of challenge.
Methods: We prepared formalin inactivated combined vaccine for Avian Influenza (H9N2N),
Newcastle (La), and IB (M41 and Var 2) by using montanide 71 adjuvant. The prepared vaccine was
injected intramuscularly in specific pathogen free and commercial layer chicken, the injection was
repeated as a...
Hanan Sayed 1, Mohamed S. Madkour 1, Hussein A. Hussein 2, Ahmed A El-Sanousi 2
... tests and
repetition of challenge test.
Methods: We prepared formalin inactivated combined vaccine for Avian Influenza (H9N2N),
Newcastle (La), and IB (M41 and Var 2) by using montanide 71 adjuvant. The prepared vaccine was
injected intramuscularly in specific pathogen free and commercial layer chicken, the injection was
repeated...
Ahmed M. Soliman
...lates (cucumber, tomato, pepper and watermelon) using biological, serological and molecular assays.
Methods: Survey of some vegetable crops exhibiting mosaic, yellowing, blisters, shoestring leaf, mottling and stunting in different regions of Al-Ahsaa at Eastern Province in Saudi Arabia was conducted during the spring of 2016 and 2017. The viral isolates were biologically isolated by single chlorotic local lesion...
Mohsen M. Elsharkawy1, Sara E. Hanbal2, Samir A. Sidaros1, Mohamed M. Elsawy2, Ali H. Hamed2
...GF19-1 and Trichoderma asperellum SKT1 as a sustainable method to control the invasion of BYMV in faba bean plants.
Methods: Faba bean plants were treated with PGPF isolates at 2 days prior to BYMV inoculation. Disease severity and virus titer were estimated at 1, 2 and 3 weeks after virus inoculation. The transcription profile related to defense genes was evaluated at 1, 2 and 3 weeks after BYMV inoculation by quantitative real-time PCR analysis.<...
Youssef A. Elgharbawy1, Mervat M. Ali1, Ayman H. El-Deeb2, Mohamed A. Shalaby2
...D vaccine but it has stopped due to the seriousness of the disease's return to its virulence and the post vaccinal reaction of the vaccine so we prepare inactivated LSD virus(LSDV) vaccine to immunize the cattle with safe vaccine .Ismailia isolate of LSD was propagated and titrated on Madin Darby Bovine Kidney Cells (MDBK) till reach the highest titer (10 5.5 TCID50/ml). The inactivation process was performed using Bromoethy...
Abdelaziz A. Yassin, Ayman H. El Deeb, Abeer E. Mansour, Hussein A. Hussein
...e ELISA. Results reveled peaks of IL-4 at 7th day, IFN-γ at 14th day and IL-2 at 21st day post vaccination. Lymphocytic proliferation assays demonstrated the continuous response of lymphocytes started at the 3rd day till reaches peak at 28th day post vaccination then start to decline. Whereas the peak titers for antibodies were reported at the 28th day post vaccination. Indeed, the s...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...und: Tomato (Solanum lycopersicon) is affected by many biotic and abiotic stresses which
became major limiting factors for growth, fruit yield quality and quantity. Tomato ringspot virus
(ToRSV) is considered one of the most devastating members of the genus Nepovirus and distributed in
most parts of the world and can infect herbaceous, ornamental and woody species including tomato,
...
Wesley D. Nafarnda, Japhet H. Baraya, Olatunde H. Olabode, Malang K. Simon
...ases that
hampers poultry productivity. Oral Newcastle Disease (ND) vaccination has been documented as a
method for control of the disease with varied effects in scavenging rural poultry especially in Nigeria.
Aim: This cross sectional study was conducted to establish the impact of V4 thermostable ND
vaccination on rural poultry productivity using corn bran (dusa) as alternativ...
Hadeer M. Mossa, Ausama A. Yousif, Emad A. Aboelsoud, Mahmoud El Gamal, Ahmed El-
Sanousi
...nt> was appeared
after 72 hours as cell rounding, cell aggregation and cell degeneration with titer of 105.5TCID50/ml,
DNA extraction and PCR for the candidate strain was performed using universal and specific primers
for virus identification and confirmation. The size of the produced amplicons was 192 pb for the
universal prim...
Ahmed A. ElWakil1, Ausama A. Yousif2 , Adel A. Fayed3, Ibrahim M. elsabagh2, Mahmoud
El Gamal2, Omnia H. Refaei3
...flies and, African tick species play a role in
LSDV maintenance and transmission. Mechanical transmission of LSDV is well documented;
however, evidence of transovarian and transstadial transmission is a tick warrants an investigation into
the replication capacity of the virus in ticks. Transstadial occurs when virus remains with vector from
one life stage to the next and transovarian is transmission of virus from...
Mohamed M. Mashaly1, Ayman H. El-Deeb2, Momtaz A. Shahein1, Hussein A. Hussein2
...ic preparations mainly depend on the proper culture used.
Objective: Our aim was to study the growth kinetic of recent LSDV isolate to determine the culture
properties of recent LSDV isolated from skin nodule that could be useful in the attempts to develop
more effective LSDV vaccine and diagnostic purposes.
Methods: In order to isolate the L...
Soad, E. Elsayed 1, Mohammed A. Shalaby2, Ausama A. Yousef2, Abu bakr A. Agor1,
Sherouk E. Aly1
...ity of
developed formula when compared to the conventional one. Challenge test revealed high protection
levels that reached 90% of the Guinea pig vaccinated by nano emulsion.
Conclusion: Our findings suggest that we aimed to enhance immunity through nano emulsion of
Montanide ISA 206 is well achieved.
...
Shourok E. Aly 1, Karim Zaki1, Soad E. Elsayed2, M. Elgamal2, Ausama A. Yousef1, Mohamed A. Shalaby1
...rol of RVF in Egypt is dependent on vector control and
yearly vaccination of livestock using an aluminum hydroxide gel-adjuvanted inactivated Rift Valley
fever virus (RVFV) vaccine.
Objective: Herein, we aimed to enhance the immunogenicity of the conventional vaccine by
developing a smaller particle size vaccine formulation through ultrasonic dispersion of aluminum
...
Karim M. Selim1, Abdullah A. Selim1, abdelsattar Arafa1, Hussein A. Hussein2, Ahmed A. El-Sanousi2
...kground: Different genotypes of Avian avulavirus 1, also known as Newcastle disease
virus (NDV) and formerly known as Avian paramyxovirus 1(APMV-1), are circulating in
many parts of the world. Currently, the used vaccine strains (mainly genotypes I and II) are
three to seven decades old and are genetically distant from the currently circulating virulent
Newcastle disease virus ...
Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder
...formation. Detection was performed
depending on the presence of specific antibodies against CMV, and isolation from local lesions on
Chenopodium amaranticolor as a local lesion host. Eleven plant species belonging to four families
were used to confirm the presence of CMV in the inoculum. Detection of the coat protein g...
Moazama Batool1*, Sajid Abdullah2, Huma Naz3, Mubashar Hussain4, Sadia Maalik1, Sajida Mushtaq1, Tanveer Ahmed5 and Laiba Shafique6
...was to assess the growth performance and bio-accumulation of metals in Channa marulius and Wallago attu exposed to 1/3rd of LC50 of chromium (Cr) and cadmium (Cd) for 8-week. In both treatments statistically significantly, variable responses viz. wet weight gain (WG), feed intake (FI), feed conversion ratio (FCR) and specific growth rate (SGR) were determined. The control fish (unstressed) had significantly higher WG followe...
Md. Abdullah Al Mamun1,2*, Shamima Nasren1,3, Sanjay Singh Rathore1 and Kavalagiriyanahalli Srinivasiah Ramesh1
...e skin, fins, head, and operculum. Based on the morphology of the specimens, the parasites were identified as Argulus japonicus. Moribund fishes were examined and up to 350±50 lice were hand-picked from a single fish. Microscopic examinations of A. japonicus revealed that most of these were at juvenile stages. Infested fish were transferred to the glass aquaria (60 L) and treated with 4 treatments for 15 days: I) Pota...
Gulnaz Ismaylova
...In order to identify the pests of mulberry, which is the main food source for the silkworm, in 2018-2020, monitoring of existing and newly planted mulberry orchards was carried out. Orosanga japonica first recorded on Morus sp. in the Sheki-Zagatala region located in the northwest, and then in the Khachmaz region, located in the northeast of Azerbaijan. Representatives of this family have not yet been registered in Azerbaijan. Besides of mulberry, the
Aliya Munir1, Sajid Abdullah1*, Huma Naz2*, Khalid Abbas1, Tanveer Ahmed3 and Zahid Farooq2
...ify;">The application of pesticides has been increased in agriculture to improve crop production all over the world. This may leads to existence of pesticides and their metabolites in freshwater bodies. Pesticides can trigger stress in organisms by increasing the number of reactive oxygen species. Oxidative stress biomarkers like antioxidants enzymes have been successfully used in ecotoxic...
Anila Kousar, Muhammad Naeem*, Samrah Masud, Abir Ishtiaq, Zara Naeem and Rabia Iqbal
...FT) fingerlings, a developed strain of Nile tilapia (Oreochromis niloticus). Feed preparation criteria was based on cost effectiveness and local availability of cheaper plant protein feed ingredients. Ten specimens were randomly selected from each treatment hapa for evaluating the concentrations of selected essential and non-essential elements in GIFT fingerlings fed with dietary protein l...
Nadeem Anwar1, Muhammad Luqman2*, Shaoib Nasir3, Moazzam Sabir1, Hafiz Bashir Ahmad4 and Saleem Ashraf5
...ects the profit earned especially by the small farmers. The results of inter-correlation analysis of variables, which are considered to be a constraining factor in citrus production confirms that most of the variables are interrelated and by resolving one, may lead to the resolution of other accompanying factors. ...
Zainab Iftikhar, Muhammad Arif, Iqbal Munir and Sajid Ali
...8 and a subset of better performing 108 hybrids were selected and assessed for subsequent assessment. During the first experiment of preliminary testing of 416 Chinese wheat hybrids along with 5 local checks tested during 2017-18, significant variability (P<0.01) was observed for days to jointing and booting, the parameters related to crop duration. The overall impact was negative on the crop duration, resulting in select...
Bakhtiar Gul*, Saleetha Rabial and Haroon Khan
...xt-align: justify;">An experiment was conducted in summer, 2016 at the Department of Weed Science, The University of Agriculture Peshawar to investigate the effect of herbicides on the management, growth and reproduction of duckweed (Lemna minor). The experiment was laid out in Completely Randomized Design (CRD) with three replecations and various herbicidal treatments. Duckweed was collected from fresh water bod...
Muhammad Nasir1, Muhammad Usman Asif2*, Abdul Hayee Abid1, Qurat ul Ain Haneef1 and Muhammad Awais2
...rvey of different insect pests of cotton and leaf curl virus (CLCuV) in relation to weather parameters was conducted in four tehsils viz. Alipur, Jatoi, Kot Addu and Muzaffargarh of district Muzaffargarh (Punjab, Pakistan). In each tehsil pest scouting was conducted in 40-50 spots (five acres each) per week selected randomly starting from 1st June to 30th October each year. Hot spots (
Ramazan Erdogan1*, Mikail Tel2, Vedat Cinar2 and Ragip Pala2
... exhaustion exercise was performed on the last day for acute exercise. It was observed that ATGL, GLUT-4, IRS-1 and ZAG levels increased and FAS level decreased in the ZP group compared to the control group. Compared to the control group, the exercise groups were found to have a decrease in the FAS level with both AE and CE, and an increase in the GLUT-4 and ZAG parameters. There was no change in ATGL and IRS-1 with AE, but an increase in ATGL IRS-1 level with...
Ayesha Manzoor1, Muhammad Saqib Naveed1, Sayed Rashad Ali1, Danish Ibrar2, Sairah Syed1, Sharmin Ashraf1 and Rafiq Ahmed1*
... foundation of any crop species. Root to seed method is widely used in Pakistan for radish seed production but still low and inferior quality seed is being produced that cause a significant loss in yield due to lack of standardization of seed production technology.Therefore, to improve seed yield and quality, present research was conducted toevaluate the effect of steckling size on plant growth and seed yield of radish.Steckling of different lengths (5cm, 10cm...
Ibadullah Jan1*, Iqbal Munir2, Inamullah Khan3, Syed Muhammad Suhail4 and Aqib Iqbal2
... carrageenan in a dose-dependent way, with the highest levels at 40 and 80 mg/kg. Dosiflavone showed excellent (p<0.05) analgesic activity with anti-nociceptive effect in hot plate test in a dose-dependent manner. Dosiflavone showed significant anti-nociceptive activity and decreased the number of writhes instigated by one % ethanoic acid. Dosiflavone dosages (20, 40, and 80 mg/kg) were relative to the placebo, there was ...
Pukhtoon Yar1*, Salman Khan2, Du Ying1 and Muhammad Israr3
Ameer Hamza1, Mukkram Ali Tahir1, Noor Us-Sabah1, Ghulam Sarwar1 and Muhammad Luqman2,*
...of good quality water compels the farmers to use brackish water. Use of saline water along with leaching fraction could be useful by keeping low concentration of salts in the root surrounding area. This study assessed the role of leaching in alleviating the negative effect of saline water on soil characteristics. Results of the studies indicated that 6.57% reduction in soil pH (7.6), 46.06% reduction in EC (1.3 dS m-1), and 46.41% reduction in SAR (5.3) while ...
Shakeel Ahmad1, Muhammad Israr2*, Muhammad Amin3, Muhammad Sadiq Hashmi4, Nafees Ahmad5 and Rasheed Ahmad6
...impacts on ecosystems, especially in district Shangla. Real-time monitoring and assessment are essential to understand such changes in LULC. In the current study, spatio-temporal changes of LULC were obtained from MODIS (MCD12Q1) product from 2001–2018 to examine LULC in the district Shangla of Khyber Pakhtunkhwa-Pakistan. LULC types were classified into seven major classes: evergreen forest, savannas, grasslands,
Md. Sahidur Rahman1*, Tishita Ape1, Md. Islam1 and Sharmin Chowdhury2
...onal study to assess the perspective of dairy farmers regarding antibiotic use as well as its residual and resistance effect. We collected data from 101 dairy farmers in Chattogram, Bangladesh. The results revealed that ceftriaxone, gentamicin, streptopenicillin, amoxicillin, and sulfur drugs were the most frequently used antibiotics in the study area. Among the participants, 99% did not f...
Khawaja Adeel Tariq1*, Hadhi Hassan Khan2, Shuja Zaib Afghan3 and Arslan Raza4
... Bypass. The research is performed to identify the existing and future traffic operations at theses intersections. The selected intersections are mostly used by traffic coming to Gujranwala City or moving towards neighboring cities of Daska and Sialkot. The Gujranwala City is also connected with neighboring cities of Lahore and Gujrat through GT Road. The increase in population and vehicles has resulted in traffic congestion...
Jehan Dastagir, Muhammad Amir*, Bilal Ur Rehman, Shahid Hameed and Majad Ashraf
...ates. The work in this paper directly investigates possible attainment of optimized TCP congestion control over wired networks through a proposed modification done to one of the existing TCP protocols. Firstly, the proposed approach looks into various queue limits e.g. Drop Tail and RED. Evidently, a comparison of these two queue limits vividly demonstrates that RED demonstrates a better performance when it comes to attainme...
Mian Ibad Ali Shah*, Yasir Saleem Afridi and Laiq Hasan
...e analysis in particular performs best to achieve this strategy. Descriptive analysis comprising of various methods and factors have been used to infer conclusions from data. Some important factors like, stringency index, number of tests, etc. have been utilized in this paper to achieve the aforementioned goals.
...
Iftikhar ud Din* and Yousaf Hayat
...n most of agricultural experiments, analysis of variance (ANOVA) is the widely used statistical methods for assessing the differences among the means of more than two treatments by considering single trait independently. In reality these traits are not independent and appropriate techniques for analyzing multiple traits simultaneously, is the multivariate analysis of variance (MANOVA). Thi...
Ghani Akbar*, Muhammad Asif and Zafar Islam
...ain-fed area is highly dependent on resource efficient practices under the current anthropogenic and climate change induced challenges in Pakistan. There is urgent need to adopt improved technologies capable of producing more with less water and to ensure continuous food supply throughout the year. For this purpose, growing off-season vegetables under plastic tunnel have elevated importance, because of comparatively less capital cost and skills requirement. Ke...
Nusrat Habib
...collecting women’s perspectives. Flash floods, temperature rise, erratic rainfall, and land sliding were the main climatic hazards perceived by women. During the risks, the most vulnerable people were women and children. Women’s household activities burden doubled during the disaster days comparing with the...
Song Jiang1,2,3, Xianbin Mo1,2, Falin Zhou2,3, Jianhua Huang2,3, Qibin Yang2,3, Lishi Yang2,3 and Shigui Jiang2,3*
...eraction effect of genotype and environment. The results showed that the average body weight and survival rate of P. monodon in Diet A group were higher than those of Diet B group, and the heritability of P. monodon in Diet A and Diet B group was 0.53±0.12 and 0.39±0.09, respectively, which belonged to high heritability, and the heritability of survival after transformation was 0.38 and 0.22, res<...
Yongmin Li1,2, Huabin Zhang1, Xiaoyou Wu1, Dongwei Li 2, Peng Yan1 and Xiaobing Wu1*
...nced and other reported species to assess phylogenetic relationships of Ranoidea. Phylogenetic analyses using maximum likelihood (ML) and Bayesian inference (BI) methods supported the sister-group relationship between ((Rhacophoridae + Mantellidae) + Ranidae) and Dicroglossidae. Within Rhacophoridae, two species of the genus Rhacophorus (R. schlegelii and R. dennysi) were clustered together with the repr...
Bingjie Zhou1, Hitesh Bhagavanbhai Mangukiya1, Siva Bharath Merugu1, Fakhar-un-Nisa Yunus1, Yuchen Fan1, Zhenghua Wu1,* and Dawei Li1,2,*
... overexpressed in many types of cancer cells and also detected in extracellular space of solid tumor interstitial fluids. The intracellular AGR2 is critical in protein folding while secreted AGR2 function as a paracrine signal promoting tumor microenvironment formation. Beside cancer progression and drug resistance, the abnormal expression of AGR2 is also involved in diseases like asthma and inflammatory bowel disease. Studies on the role of AGR2 in tumor micr...
Jing Yu1*, Yao Lu1,2, Zhaojin Lin1, Pimao Chen1 and Yuting Feng1,3
...including Sea Surface Temperature (SST), Sea Surface Salinity (SSS) and water Depth from Digital Elevation Model (DEM) were used to build the Habitat Suitability Index (HSI) model, based on Maximum Model (MAXM), Minimum Model (MINM), Arithmetic Mean Model (AMM), and Geometric Mean Model (GMM). Results showed that the accuracy of the HSI model was 80%. HSI model built for fish-egg density during April, May and June based on GMM and MINM had the highest accuracy...
Syed Ismat Hussain1, Khalid Mehmood2, Mudassar Khaliq3, Habib Anwar1, Syed Muhammad Zaka4, Ateeq ur Rehman5*, Muhammad Shahid6, Syed Atif Hasan Naqvi5*, Ummad ud Din Umar5 and Muhammad Asif Zulfiqar7
... of the most destructive pests of cotton. Observations were recorded about pest infestation. Metrological data was collected of each district’s head quarter on daily basis for the year 2017. For accumulation of degree days model, Huber’s method was adopted and data for calculation of generations by accumulating progressive degree days was observed highly significant i.e., P>0.0001. In the present study, the ac...
Muhammad Rafique1, Muhammad Azhar Iqbal2, Inam Ul Haq1*, Muhammad Ramzan Anser2, Humara Umar2 and Muhammad Ashraf Sumrah2
...shifting, rooted cutting percentage and callus percentage were collected under four different treatments. Cutting under the only green net (5944 lux), white net (11428 lux) only upper side white net (8484 lux) and both green and white net (5538). The results were found significant regarding the interaction between varieties and treatments; however, non-significant variation in varieties wa...
Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2
...e effect of herbs on the performance of broiler chickens challenged with coccidiosis. A total of 450 broiler chickens were allotted into 6 groups (n = 75/group). Group A controlled without supplementation, Group B, C and D were supplemented with Aloe barbadensis (5ml/L), Ferulafoetida regal (500mg/L), Tamarindus indica (50mg/L), respectively. Group E and F were supplemented with a mixture of all 3 herbs/plants at 2ml/L; mixe...
Rupinder Kaur1,2*, Pretty Bhalla3, Jubin Kumar Saini4 and Sayeeduzzafar Qazi5
...re on both public sector performance and organizational role stress is silent on various stressors associated with the role of government agricultural extension officials, which is one of the most important components of the entire agricultural system. The purpose of this exploratory study is to fill this gap with the identification of potential work stressors for this profession. The paper also aims to investigate whether ...
Hina Afzal*, Sarfraz Hassan, Muhammad Khalid Bashir and Asghar Ali
...ctor productivity growth period from 1973-2020. Results indicated that the overall economy average TFP growth rate is higher from 1981 to 1990 in the agriculture sector of the country. The TFP growth of agriculture sector was higher in this decade. Comparison between the TFP with other sectors like industrial and services, having 1.51%, 4.01% and 4.12%. TFP has been lowest in the agriculture sector as compared to other sectors as pe
Aamer Abbas1, Jabbar Khan1*, Mir Abid Hassan2, Asif Qayyum3 and Hamed Shafiq4
..., the normal process of spermatogenesis and quality of semen. Moreover, metals can lead to decreased or no production of prostaglandin, seminal fluid and endocrinology of reproductive process and thus results in male infertility. It was also here attempted to characterize the drastic effects of heavy metals on male infertility, the hormone analysis and genetic determination of SRY gene as some of infertile human had smaller sized testis. Blood and semen...
Guan-bao Ning1, Sheng Niu1, Yue-jian Li1,2, Xiao-xiao Lu1,3, Shi-xiong Yang1, Ali-Raza Jahejo1, Ding Zhang1, Wei-fang Hao4, Wen-wei Gao1, Yu-jun Zhao1, Jian-hui Li1, Fang Yan1, Rong-kun Gao1, Yu-hai Bi1,5, Wen-xia Tian1* and Ling-xia Han6*
...ated, oncogenic alpha herpesvirus that causes Marek’s disease (MD) in chickens. Chicken erythrocytes are nucleated cells of myeloid origin which contribute to gases exchange, transportation and immunity. The objective of this study was to reveal the immune responses of MDV-infected erythrocytes of chicken by transcriptome analysis. Twenty specific pathogen-free (SPF) chickens were divided into two groups as control and...
Asma Chaudhary1, Qurat-ul-Ain Ahmad1, Afia Muhammad Akram1, Mehwish Iqtedar2 and Javed Iqbal Qazi3,*
... control-C2 as well as experimental groups was challenged with V. anguillarum intraperitoneally. Probiotic treated feed with antibacterial potential against V. anguillarum was administered to experimental fishes in different groups; G1 (soon after challenge for 30 days), G2 (for 15 days prior and 30 days after challenge) and G3 (for 15 days prior to challenge). The survival r...
Dilan Ozmen Ozgun1, Gonca Alak2, Arzu Ucar2, Sinan Bilginer3, Halise Inci Gul3, Mahmut Kocaman2, Cem Yamalı3, Veysel Parlak2, Muhammed Atamanalp2, Ahmad Maslat4 and Telat Yanık2*
.../b>B4, for 7h at first experiment. Effects of B4 on antioxidant enzymes of gill and liver, and changes in hematological parameters were determined in rainbow trout. For this purpose, rainbow trout alevins were exposed to 0, 0.25, 0.5, 1 and 2.5 mg/L of B4 and 1 ml of DMSO for 96 hours. Blood samples were collected for hematological analyzes and mortalities were recorded daily. Exposure to B4 caused significant changes in antioxidant enzymes of gill and liver o...
Jie Gao1, Guannan Wang1, Chuang Zhou1, Megan Price2, Jinnan Ma1, Xiaohong Sun1, Benping Chen3, Xiuyue Zhang2 and Bisong Yue1*
...ithin the babblers and superfamily Sylvioidea. F. cinereiceps’ mitogenome is typically circular, 16,969 bp in size with a rich A+T content (52.7%), 13 protein-coding genes (PCGs), 22 tRNAs genes, 2 rRNA genes, a control region (CR) and a non-coding region (NC). We found strong support for F. cinereiceps being placed within Sylviidae (superfamily Sylvioidea)and for babblers being separated into two familie...
Donglai Li1,Mei Han1,Huw Lloyd2, Linyu Jin1, Lei Zhang1, Jiangxia Yin1 and Dongmei Wan1*
...ocially monogamous bird species may be faced with providing costly care for unrelated offspring when nests have extra-pair young (EPY). Theoretical models predict that cuckolded males should lower their parental investment as the likelihood of paternity decreases. However, empirical data are not always in support of this prediction.Here, we explore parental behaviours within the context of extra-pair patenity (EPP) in a population of the varied tit Parus va...
Muhammad Noman Koondhar1, Asghar Ali Kamboh1,*, Muhammad Ammar Khan2, Riaz Ahmed Leghari3 and Parkash Dewani4
...rachi, Pakistan. Three types of meat samples were collected viz., muscles, lymph nodes and minced meat (n=25 each). The samples were packaged aseptically and transported to laboratory within 4-6 hs of collection in cooling conditions. The samples were examined for Salmonella contamination; isolation and identification of Salmonella serovars was done using th...
Hassan Shahzad Khan1, Muhammad Tariq1*, Tariq Mukhtar2 and Asim Gulzar1
... alternatives such as biopesticides which are environmental friendly and economical. Therefore, in the present study, the toxicity of eight plant extracts and their green synthesized nanoparticles was evaluated against A. albopictus. The maximum mortality of 88% of 3rd instar larvae of A. albopictus was caused by datura extract followed by neem and clove. On the other hand, neem and clove extracts caused the maximum mortality (8...
Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1,
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
.... canis infection in pet dogs in Wenzhou, China. Serum samples were obtained from animal hospitals were examined for antibodies by commercial rapid in-clinic ELISA kits. Ticks were collected from dogs and molecular detection methods were used to identify the tick species and CME by amplification of the cytochrome oxidase subunit I and disulfide oxidoreductase gene, respectively. The re...
Wenjuan Yan1, Qunlan Zhou2, Bo Liu2,3*, Cunxin Sun2, Huimin Zhang3 and Changyou Song2
.... cicadae) on growth performance and meat quality of giant freshwater prawn (Macrobrachium rosenbergii). The prawns were fed with five isonitrogenous (40.54% crude protein) and isolipid (6.16% crude lipid) diets with different I. cicadae levels (0, 100, 200, 400, and 800 mg Kg-1). Results revealed that I. cicadae significantly increased specific growth ratio (SGR) and protein efficiency ra...
Song Jiang1,2,3, Ming-ge Zhuang1,2,3, Fa-lin Zhou1,2, Qi-bin Yang1, Jian-hua Huang1, Li-shi Yang1 and Shi-gui Jiang1*
...ely related terrestrial species of N. succinea, had the best effect on maturation of parent shrimps. The highest gonad weight increase rate of 1845.28% and the largest consecutive spawning rate with average value of 70.66% were both in groups fed on P. tschiliensis, with no significant difference from the groups fed on N. succinea combination bait. The dynamics of VTG mRNA level were observed in hepatopancreas and ovary of P. monodon
Muhammad Khaled Siddiq1, Muhammad Adeeb Babar1,2*, Muhammad Akbar Khan1, Muhammad Umar Ijaz3,Sayyed Ghyour Abbas1, Muhammad Asim1, Asif Mahmood Qureshi4, Mahboob Iqbal4 and Muhammad Akhtar4
...font-size: small;">The Upper Siwalik (Pleistocene) outcrops known as Pabbi Hills are well-exposed in the vicinity of Sardhok village, Gujrat, Punjab, Pakistan. The locality yielded the typical Pleistocene fauna of the Siwalik Group in Pakistan. The fossils of Bubalus platyceros described in this article were excavated from the Pleistocene of Sardhok. The collected specimens represent some of the rarest anatomic...
Phytochemical and Antimicrobial Potential of the Roots of Berberis brevissima Jafri. (Berberidaceae)
Zain Ullah1*, Anwar Ali Shad1 and Saqib Ali2
...d Pakistanine (3) using spectroscopic analysis, including mass, 1D, and 2D NMR data techniques. The antibacterial assays of the obtained six oil sub-fractions (H-1 to H-6) were accomplished against S. epidermis, E. coli, and S. aureus bacterial strains and the results ranged from 10-18 mm zone of inhibition. The GC-MS analysis of the six oil sub-fractions (H-1 to H-6) confirmed the existence of linoleic acid, palmitic acid, and oleic acid in the highest amount...
Haroon Ur Rashid1*, Nazia Tahir2, Muhammad Zamin3, Naveed Shehzad4, Aman Ullah2, Bibi Zainub5 and Farooq Azam6
...ars 2014 and 2015. The experiment was laid out at silt loam soil in Randomized Complete Block Design (RCBD) with a split plot arrangement having three (03) replications. Different tillage regimes namely minimum, conventional, and deep tillage regimes were assigned to main plots (Factor A) and various allelopathic plants [Sorghum {Sorghum bicolor (L.) Conard Moench.}, Sunflower (Helianthus annuus L.) and Parthenium (Parthenium hysterophorus L.)] residues as sur...
Muhammad Jan1*, Muhammad Ashraf Sumrah1, Shoaib Akhtar1, Inam Ul Haq2, Muhammad Ramzan Anser1 and Iqra Yasmin1
...o Olive orchards in a proper dose. Olive intensification for new orchard enhanced fertilizer use especially Nitrogen (N), Phosphorus (P) and Potassium (K) and in micronutrients especially Boron (B) to control alternate bearing of olive. In Pakistan, olive plantation is an initiative to minimize the Olive import, and to maximize olive plantation in Pothwar area as well as control climate ch...
Sana Javeid* and Khalid Nawab
...ation, frequency counts, percentages through Statistical Package for Social Sciences (SPSS). To measure the poverty level of apple orchard growers, poverty score card was employed. In addition, bivariate analysis was used to examine relationship between various extension practices and poverty. Results of the study revealed that majority (60.1%) of the respondents were non-poor, out of which 90.8% received extension services. Furthermore, out of the non-poor ca...
Nianhong Huang, Yan Wu, Yuanyuan Li* and Jinhong Zhao*
...yle="font-size: small;">Species of the genus Hepatozoon are the most common haemoparasites infecting snakes. High parasitemia of Hepatozoon can negatively impact snake fitness, growth rate and reproductive output. Given that snakes are a valuable source of traditional Chinese medicinal materials and food consumption, stresses the importance of conducting a study on snakes and its parasites. The present study investigated three kinds of snakes,
Maimoona Imran1,2, Soumble Zulfiqar2, Hafsa Saeed2 and Farah Rauf Shakoori1*
...In the current study, copper resistant Klebsiella pneumoniae strains KW and CC were investigated for their bioremediation potential. Maximum uptake of Cu++ by mid log phase cultures of KW and CC was 19.26 and 28.77µg per mg cell dry weight, respectively. The strains also exhibited efflux ability; KW possessed more efficient efflux system as it ex