Submit or Track your Manuscript LOG-IN

Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1

 

Life Sciences International Journal Issue 7 Volume 1
...ted the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these strains have shown homology with previously characterized strains from Pakist...

Sehrish Kanwal, Ali Saeed, Muhammad Munir, Memoona Arshad

 

British Journal of Virology
...ted the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these strains have shown homology with previously characterized strains from Pakist...

Souvik Ghosh, Nobumichi Kobayashi

British Journal of Virology
...VAs. 

...

Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1

British Journal of Virology
...ted the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similarity was determined between the representative strains. Furthermore, these strains have shown homology with previously characterized strains from Pakist...

El-Sayed M. Abdelwhab, Jutta Veits and Thomas C. Mettenleiter

Avian Influenza H5N1 in Egypt: What we Know and What we have to Know?
... the hemagglutinin (HA) protein which improved the binding affinity to human receptors but simultaneously retained its specificity for avian-receptors. Vaccines were applied nationwide to control the disease in poultry. Meanwhile, the viruses accumulated several point mutations in the HA immunogenic epitopes resulting in antigenic drift and the establishment of infections in vaccinated poultry. The Egyptian H5N1 viruses remain susceptible to oseltamivir, but g...

David N. Livingstone, Dealing with Darwin. Place, Politics, and Rhetoric in Religious Engagements with Evolution, Johns Hopkins University Press, 2014, 265 pp., ISBN 13: 978-1-4214-1326-6

Reviewed by Francisco J. Ayala, University Professor & Donald Bren Professor of Biological Sciences, University of California, Irvine, email: fjayala@uci.edu

Science, Religion and Culture
..., Theodosius Dobzhansky wrote in 1973 that “Nothing in biology makes sense except in the light of evolution.” But it was only in the middle decades of the twentieth century that Darwin’s theory of evolution by natural selection became generally accepted by biologists and other scientists. How was Darwin’s On the Origin of Species received by his contemporary scholars, particularly by theologians and religious authors? That is the subjec...

Kathryne E. Taylor1 and Karen L. Mossman1,2*

...ture regarding the ICP0 protein from herpes simplex virus is complex and frequently contradictory, meaning that although this protein has been implicated in a wide variety of diverse functions, the mechanisms through which it produces these effects continue to be elusive. Recent investigations into the ability of ICP0 to block the activation of antiviral signaling have revealed a potential explanation for some of this confus...

Xingdong Yang and Lijuan Yuan

...disease models for human rotavirus, human norovirus and human enterovirus 71 using neonatal gnotobiotic pigs. The differences between germ-free and normal animals in the maturation status of immune systems caused by the lack of gut microbiota can be minimized by establishing human-gut-microbiota transplanted gnotobiotic pig models. Given the advantages of gnotobiotic pig models, it is expected that they will be used more widely in biomedical research for studi...

Qin Zhao1,2, Yani Sun1,2, Gaiping Zhang1,3, Frederik Widen4, En-Min Zhou1,2,*

zhouem@nwsuaf.edu.cn

...

...

Weili Kong1, Guangpeng Ma2 and Jinhua Liu1*

... non-structural 1 (NS1) protein plays a crucial role in moderating the virulence of influenza virus by multiple mechanisms. Due to C-terminal ‘tail’ (CTT) truncation of NS1, there are length variation types of NS1 in different subtype influenza viruses. CTT functions in several ways to defeat the cellular innate immune responses. Here, we discuss those different effects of CTT truncation or elongation of NS1 prot...

Lawrence Krauss

...illings and by the mass protests throughout the Islamic world to the bittersweet cover published the week following that tragedy.

...

Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4

...e analysis of the nucleoprotein (N) gene, the PPRV has been classified into four lineages. Serological investigations in Tanzania indicate that peste des petits ruminants (PPR) was introduced in 2004 in Ngorongoro district bordering Ken- ya before official confirmation of the disease in most districts of Northern Tanzania in 2008. In 2011, the presence of PPRV in goats of southern Tanzania district of Tandahimba bordering Mozambique was reported. The aim of th...

Masood ur Rahman1*, Zahid Mahmood2, Taj Ali2, Muhammad Aziz Irfan Mufti3, Jehangir Khan Seyal4, Munir Ahmad5

E-mail | masoodra@hotmail.com

 

Sarhad Journal of Agriculture, Vol. 31, Iss. 1
...f-propelled locally made rotary hoe to overcome a problem of frequent transmission failure. The machine is used for mechanical weed control and hoeing. It was observed that the worm gear used in its transmission often failed due to surface wear of gear teeth. Worm gears made from three different copper alloys were tested against soil resistance in sandy loam soil bin. The gears were formed of commercial gun metal (Cu 87.76%, Sn 7.74, Zn 1.52%), gun metal (Cu 8...

Qingzhong Yu

 

...ing a green fluorescent protein (GFP) gene upstream from the GE sequences of the viral genes and subsequent quantitative measurements of the GFP fluorescence intensity, we have concluded that the P and M junction region is the optimal insertion site for a high level of foreign gene expression by a NDV vector.

...

Malik Ikram Ullah1, Abdul Aziz Khakwani1*, Muhammad Sadiq1, Inayatullah Awan1, Muhammad Munir2, Ghazanfarullah1

...dry matter yield, crude protein, crude fiber and ash percentage were significantly increased with increase nitrogen levels (200, 240, and 280 kg N ha-1). However, highest benefit-cost ratio was estimated when 240 kg N ha-1 was applied which was found best compromise between forage yield and quality for maize cultivar Kissan under the agro-climatic conditions of Dera Ismail Khan, Pakistan. The study also indicates that crude prot...

Shen Yang1, Guang-Zhi Tong1, 2*

...he development of novel protective vaccines. In this review, we discuss the innate immune responses against HP-PRRSV infection and suggest new areas of investigation into this important interface between pathogen and host.

...

Huaichang Sun

... compromises the immune protection of conventional vaccines. RNA interference (RNAi) has becoming a feasible strategy against various virus infections. Recently, a significant advance in RNAi technology is the use of artificial microRNAs (amiRNAs) to fight virus infections. However, different strategies are needed to prevent virus variation or mutation escape. This review is intended to present the current situation of antiviral roles of amiRNAs, against varia...

Asma Noshad1, Mudassar Iqbal1*, Zafar Iqbal1, Hamida Bibi2, Saifullah3, Salma Bibi4, Hamid Ullah Shah1

...ltrate obtained from Pleurotus ostreatus also known as the oyster mushroom. The percent mortality of Macrosiphum rosae (rose aphids) and the LC50 values were calculated and used as an indicative of insecticidal potential. The maximum mortality of aphids was achieved at 80 µg mL-1 and the LC50 for the fruit body extract after 24 HRS was calculated as 12.83μg mL-1, followed by the extract from the fermentation...

Marcus Mann

... the new atheists claim protects it. Following Harris’s example, evolutionary biologist Richard Dawkins published his book, The God Delusion, cognitive philosopher Daniel Dennett came out with Breaking the Spell and journalist and literary critic Christopher Hitchens concluded the movement’s must-read canon with God is Not Great. While these four polemics are indicative of each author’s expertise, they are united in their claim that organized...

Rodolfo Villagra-Blanco1*, Gaby Dolz1, Danilo Montero-Caballero2, Juan Jose Romero-Zuniga2

...zed regions (Central, Chorotega, Atlantic Huetar, North Huetar, and Central Pacific) determining regional seropositivity between 63.5% and 100.0%, as well as an overall prevalence of 80.8 %. The within flock seropositivity percentages ranged between 0% and 100.0%. Flocks with the highest seropositivity were found in low altitude regions close to the coast. Risk and protective factors determined in the present study were not ...

Shumaila Manzoor1, Afshan Ahmed1 and Muhammad Abubakar2*

... log10 (for serotype Asia 1), 1.99 log10 (for serotype A) and 1.53 log10 (for serotype O) in ELISA while in SNT, antibody titers were found to be 1.86 log10 (for serotype Asia 1), 2.26 log10 (for serotype A), 2.11 log10 (for se

Claudia Kohl*, Andreas Nitsche, Andreas Kurth

Email: kohlc@rki.de

... our developed TUViD-VM protocol and selected other approaches regarding their suitability in metagenomics. We provide an overview on the difficulties, challenges and opportunities that developed alongside metagenomic virus discovery. The field of metagenomics from clinical specimens promises the identification of novel, yet unknown, infectious diseases and etiologies.

...

 Shubhada K Chothe, Bhushan M Jayarao and Suresh V Kuchipudi

...ich can escape the anti-protein environment in the virus infected cells and are likely to be conserved across the species. Here, we summarize our current knowledge about the role of lncRNAs in influenza virus infection and the exciting prospect of exploiting lncRNAs as targets to develop novel anti-viral therapies.

...

Muhammad Imran1*, Muhammad Mobashar2, Muhammad Irfan3, Shazia Hanif4, Sumaira Hanif5 and Muhammad Abubakar6

...nts, the value of crude protein (CP) digestibility coefficient was high (P<0.05) in treatment MLM4 as compared to MLM1. Similar trend was also observed in case NDF among treatments. Daily milk yield and 4 % FCM has increased (P<0.05) in buffaloes fed treatment MLM3 and MLM4 as compared to other treatments. While there was no significant (P>0.05) difference of percentage of fat, protein, lactose, ash, total solids an...

Corey McCal

...elf, beginning with the Protestant Reformation and extending through the first half of the nineteenth century. The book begins with Martin Luther and his critics, proceeds through discussions of Spinoza and the English Dissenters, Voltaire and the French Enlightenment, and, finally, to Darwin’s Victorian religiosity and the German Left Hegelians (Feuerbach and Marx in particular).

...

Shahid Ali1, Habib Akbar2, Mohammad Tariq Jan2, Mohammad Jamal Khan3 and Abdul Bari4

...hed (stored canes-frost protected), cane portions and setts placement methods on the attributes of sugarcane were assessed at Sugar Crops Research Institute, Mardan-Pakistan. The experiment was conducted in RCB Design with split plot arrangement, over years (2012-13 and 2013-14). Planting sources i.e. standing (fresh canes frost exposed) trenched (stored canes frost protected) and canes portions top, middle, bottom and mixed...

Kang-Seuk Choi

...ising only viral capsid proteins mimic the naive configuration of authentic IBD virus particles. The VLPs show intrinsic immunogenicity and a high safety profile.  Thus, VLPs are considered one of the most promising approaches to vaccine development and are an alternative to inactivated IBD vaccines. In addition, VLP technology has many applications. This paper reviews the potential of VLPs as an alternative to IBD vaccines, along with their specific appl...

Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6

...ises highly conserved neurotropic non-segmented negative strand RNA-virus variants causing neurological and behavioral disorders in a wide range of mammalian animals, possibly including humans. Viral persistence in the brain has been frequently observed, however, the exact mechanisms behind BDV’s ability to establish persistence despite a prominent immune response are not known. Here we have used in situ proximity ligation assay (in situ PLA), a selectiv...

Yongfeng Li, Mo Zhou, Xiao Wang, Libao Xie, Hua-Ji Qiu*

...ntly tracking the viral proteins in live cells as well as improving diagnostic methods and vaccines for classical swine fever.

...

Mohammed A. Rohaim1*, Rania F. El Naggar2, Ahmed M. Helal3, Hussein Ahmed Hussein1 and Neil LeBlanc4

... site of the fusion (F) protein indicated the emergence of PPMV-1 in Egypt. Phylogenetic analysis of the F and haemagglutinin-neuraminidase (HN) genes indicated that the isolate clustered with the PPMV-1 strains recently reported from Israel within subgenotype VIb. Our findings report the emergence of PPMV-1 in Egyptian pigeons and the potential role these wild birds can play in the transmission and evolution dynamics of PPMV-1.

...

Moustafa Kardjadj

... disease. Currently, 3 serotypes of FMD virus (O, A and SAT-2) and 06 lineage are circulating in the North Africa, of which serotype O is responsible for most of the outbreaks. However, the rapid spread of SAT2 and other exotic FMDV lineages in Libya and Egypt demonstrated the need for a robust surveillance system to detect and respond effectively to exotic infections. Emergenc...

Qaizar Ahmed1, Fida Mohammad2, Hidayat-ur-Rahman2, Sheraz Ahmed2* and Fakharuddin2

Amitha Reena Gomes1, Belamaranahally Muniveerappa Veeregowda2, Sonnahallipura Munivenkatappa Byregowda1, Vinayagamurthy Balamurugan3*

...technology, recombinant protein based vaccines and/or diagnostics are being tested in various heterologous systems across the globe for development of vaccines and/or diagnostic antigens. The recombinant viral proteins, virus like particle based vaccines, bivalent/multivalent vaccines, recombinant viral vectored vaccines, RNA interference as a therapy, suicidal DNAs, synthetic epitopes and peptides, reverse genetics, anti id...

Mohammad Mushfiqur Rahman1, Rokshana Parvin1, Ataur Rahman Bhuiyan1, Mohammad Giasuddin2, Shah Md. Ziqrul Haq Chowdhury3, Mohammad Rafiqul Islam1, Emdadul Haque Chowdhury1*

 

...e partial sequence of N protein.The recent Bangladeshi isolates are somewhat divergent from the earlier Bangladeshi isolate, indicating that the PPRV strains in Bangladesh are continuously changing their genetic character.

...

Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4

...stitutions in the nucleoprotein (NP) gene. Genetic variations within NP gene, and possibly in other proteins which are essentially mediating protective immunity, may explain the extreme infectious nature of the virus and its host-specific pathogenesis. Moreover, understanding the nature of such circulating field viruses is essential to underpin the endemic potential of PPRV and its possibl...

Muhammad Siddiq1* and Hamid Ullah Shah2

 

...or index (CI) and beta carotene (BC) value of the oils. The results showed considerable variations in all the studied parameters tested in different blends under various stress conditions. Maximum PV (10.76%), FFA (2.44%), AV (2.29), IV (77.09) and CI (0.609) were recorded in sole olive oil, while minimum PV (9.69%), FFA (0.65%), AV (0.88), IV (53.40) and CI (0.146) were noted in sole palm oil. The samples kept in sunlight showed maximum PV (12.82%), FFA (1.32...

 Ishfaq Ahmed, Ihsan Mabood Qazi and Suraiya Jamal

... was found that percent protein (8.93–12.25%), ash (0.52–1.01%) and moisture contents (4.47–7.09%) showed significant (P < 0.05) increase, while fat content (1.41-1.17%) showed significant (P < 0.05) decrease by blending WF with BRF. Similarly, water solubility index (WSI), water absorption index (WAI) and swelling power (SP) showed significant (P < 0.05) decrease as the concentration of wheat flour in the blends increases. The value...

 Zahir Shah, Shakoor Ahamd, Mian Saeed Sarwar, Murad Ali Khan and Javid Ali

...ify;"> Hernia is a protrusion of an organ or tissue through an opening. The present study describes a typical case of hernia in four weeks old cross Holstein Friesian dairy breed calf with hanging mass in the umbilical region. Tentative diagnosis was made through clinical sign and physical examination; the area was incised under local anesthesia. After surgical procedure site was closed by applying mattress sutures. Adjunct therapy of broad-spectrum antib...

 Zafar Khan, Asad Sultan, Rajwali Khan, Sarzamin Khan, Imranullah and Kamran Farid

 
... of the main sources of protein but if contaminated by toxic heavy metals will cause a harmful effect on human health. The concentration of heavy metals (Pb, Cd, Cr, Fe, Mn and Zn) present in poultry egg and meat were determined in the following three districts; Peshawar, Dir Lower and Malakand of Khyber Pakhtunkhwa by using atomic absorption spectrophotometer. In all the three districts the egg albumen was found to contain significantly higher levels of Pb, C...

 John G. Bruno and Jeffery C. Sivils

...that the aptamers bound proteins of the correct molecular weights for intact outer membrane proteins (OMPs), intimins and SLT-2. Some bands on the aptamer Western blots were shared between the “Big 6” non-O157 Shiga toxin-producing E. coli (STEC), E. coli O157 and related Gram negative bacteria. However, unrelated Gram positive bacteria exhibited very few, if any, bands in common with those identified on the E. c...

 Muhammad Nawaz Kandhro, Qamaruddin Jogi, Mahmooda Buriro, Aijaz Ahmed Soomro, Ghulam Mustafa Laghari and Ali Nawaz Khaskheli

 

...rvensis (L.) and Cyperus rotundus (L.) was undertaken during summer 2011. The study was conducted at Department of Agronomy, Sindh Agriculture University, Tandojam, Pakistan. The experiment was laid out in three replicated completely randomized design. The treatments consisted of control (untreated), eucalyptus water extract at 10, 20 and 30 ml kg-1 soil, eucalyptus powder at 10, 20 and 30 g kg-1 soil, eucalyptus powder at 10 g kg-1 soil+water extract at 10 ml...

Mian Shamas Murtaza1, Aysha Sameen1, Nuzhat Huma1 and Fatma Hussain2

...reased the moisture and protein content. The addition of gums further augmented the moisture level owing to owing to their water retention properties. The melt-ability, flow-ability and yield of cheese decreased significantly (p < 0.05) on reducing the fat level, as anticipated. However, the addition of gums gradually improved these aspects with higher values for cheese containing guar gum as compared to xanthan gum. The full fat cheese showed the minimum (...

Muhammad Khurshid, Muhammad Nafees, Inam-ur-Rahim and Wajid Rashid

...azing pattern in term of rotational grazing and open mobility within the pastures. This led to decrease herding venues 43.7% mobility routs 37.5% and herd size by 60.4% for both groups respectively. Analysis of gender-based family labor distribution during past 30 years shows that herding labor (male and female) of age 14 to 60 significantly (P<0.01) reduced during past 30 years and partly shifted to cropping. The male herding labour reduced 40.2% in semi-n...

 Shaoling Lin and Jiamiao Hu

...fy;"> The tegument protein pUL23 of human cytomegalovirus (HCMV) plays an important in the virus pathobiology, however, its role in viral assembly and replication is poorly defined. In this study we demonstrated that HCMV pUL23 interacts with an essential component of capsid, the minor capsid protein (mCP, pUL85). Interaction was determined and confirmed with yeast two-hybrid, GST pull-down and co-immunoprecipitation an...

Wan-Long Zhu* and Gao Wenrong 

...crease in mitochondrial protein contents and COX activity both in liver and brown adipose tissue, suggesting that A. chevrieri was more sensitive to cold than that of photoperiod. Together, these data suggested that A. chevrieri mainly depend on increasing thermogenic capacity to cope with cold or winter condition.

...

Zuhao Huang1, Feiyun Tu2 and Dianhua Ke1*

... bp and comprises of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and two control regions CR and CCR, which was first reported in the order Coraciiformes. The overall A+T content for the mitogenome is 52%, and the GC and AT skews are -0.400 and 0.108. Unlike to many other birds, no extra base is inserted at certain position relative to ND3. Interestingly, a 484bp repeated sequence appears in both CR and CCR. Genetic distance shows that the difference...

Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1

...ydrogenase (LDH), total protein, total bilirubin, hepatic glutathione (GSH), nitric oxide (NO), superoxide dismutase (SOD) and lipid peroxides (LP) levels were estimated. Moreover these biochemical parameters were confirmed by histopathological examination using hemotoxylin and eosin (H&E) and Mason trichrome stains (MTC). Immunohistochemical investigations for the expression of the proapoptotic protein (Bax) and the exp...

Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3*

... concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii, O. rebecca

Metin Duru1*, Asuman Arslan Duru1, Köksal Karadaş2, Ecevit Eyduran3, Harun Cinli4 and Mohammad Masood Tariq5

...e the effect of dried carrot (Daucus carota) leaf powder at different amounts on some external and internal egg characteristics of Hy-line white laying hens as a commercial type through two-way ANOVA, to estimate the Pearson correlation between pairs of egg external and internal characteristics and to predict each of egg internal characteristics from egg external characteristics, treatment and week through CHAID analysis. A ...

Asma-ul-Husna1, Muhammad Sajjad Ansari2, Bushra Allah Rakha3, Rabea Ejaz1, Nemat Ullah1 and Shamim Akhter1*

...in extender for its cryoprotective effect on post-thaw quality of buffalo bull semen. For this purpose, two consecutive ejaculates were collected from three Nili-Ravi buffalo bulls using artificial vagina at weekly intervals for a period of three weeks (three replicates). Qualifying semen ejaculates were diluted (50×106 motile spermatozoa ml-1) in tris citric acid extender with melatonin at 0 (control), 0.1, 0.5, 1, and 1.5 mM. Diluted semen was cooled t...

Ambreena Hafiz1, Tanzeela Riaz2 and Farah Rauf Shakoori1*

... was found that soluble proteins, glucose contents and free amino acids increased, whereas glycogen and lipid contents were reduced in all deltamethrin-resistant populations as compared to deltamethrin-susceptible population. Soluble Proteins were significantly elevated (79, 100 and 37%) in 4th and 6th instar larvae and adult beetles of Gujranwala, (14, 24 and 14%) in Okara and (14, 13 and 2%) in D.G Khan populations, respec...

Misbah Riaz1, Qaiser Mansoor2, Maleeha Akram1, Muhammad Ismail2, Parveen Akhtar3, Shakeel Mirza4, Mazhar Qayyum1, Afzaal Ahmed Naseem1, Faheem Tahir5 and Syed Shakeel Raza Rizvi1*

...fy;">The signaling of G protein-coupled receptor 54 (GPR54) is a key regulator of secretion of gonadotropin-releasing hormone (GnRH), whereas GnRH is a crucial neurohormone regulating the secretion of follicle stimulating hormone (FSH) and luteinizing hormone (LH) at puberty. The deficiency in release or action of GnRH leads to hypogonadotropic hypogonadism (HH) characterized by low FSH, LH and testosterone (T) and absent or impaired sexual development at pube...

Siyu Yang1, Fukuan Du2 and Pao Xu1,2*

... This SS cDNA encodes a protein with 114 amino acids that contains the SS14 sequence at its C-terminus. This putative peptide is identical to that generated by the SS1 gene in other vertebrates. Tissue distribution of C. nasus SS1 mRNA was analyzed by real-time polymerase chain reaction (PCR), which demonstrated high expression level in the brain. During embryogenesis, SS1 mRNA was detected during early-stage embryonic development, decreased during subsequent ...

Wenmin Cheng1,2*, Weirong Pan1,2, Yubo Qing1, Yingchao Liu1, Xingqin Zha1,2, Yan Huang2, Jige Xin1,2, Hongjiang Wei1 and Yangzhi Zeng2

...m) is the most abundant protein in the nucleus of oocytes which can promote in vitro nucleosome formation. In this study, to improve the efficiency of SCNT in Banna Mini-pig Inbred Line (BMI), we obtained the recombinant nucleoplasmin (Npm) by using a prokaryotic expression system and compared the difference on the developmental effects between exogenous Npm and its structural analog, polyglutamic acid (PGA). We chose the pMD18-T vector for Npm expression and ...

Giselle R.R. Ayres* and Brandão P.E

...code for non-structural proteins (nsps) that are enrolled in viral transcription, replication and pathogenesis. The last 3’ one-third of the genome codes the four structural and accessory proteins. Nsps act in a complex replication process, made possible by the special characteristics of AvCoV genome. This manuscript aims to present an overview of the main aspects of the current knowledge on the main AvCoV replicase ge...

Abdur Rahim1, Ghulam Abbas1, Muhammad Naeem2, Sara Ferrando3, Lorenzo Gallus3, Noor Khan4, Muhammad Hafeez-ur-Rehman4, Abdul Ghaffar5 and Abdul Mateen6

...erent units showed that protein contents were 50.51% – 61.26% and energy was determined as 4042.0 cal/g – 4558.0 cal/g. Dry mater was calculated as 87.43% – 93.13% and fat was noted as 15.29% – 26.23%. Ash was found to be 12.32%–18.32% and fiber remained as 7.52% – 13.12%. Phosphorus was found as 0.21%–1.8%. In fish meal preparation, 24 species belonging to different families were noted in which the most abundantly use...

Muhammad Hafeez-ur-Rehman1, Farzana Abbas1, Muhammad Ashraf1, Naeem Tariq Narejo2, Khalid Javed Iqbal3, Ghulam Abbas4* and Syedah Andleeb5

...fed on 40%, 35% and 30% protein diet @5% of their live body weight. In 40% protein diet treatment, male fish was injected 1st dose with ovaprim + HCG (0.3+0.3ml) and female fish was given 2nd dose after 24 hrs of intervals with ovaprim (0.2ml), while 1st dose ovaprim (0.7ml)+HCG (1.0ml) and 2nd dose ovaprim (0.7ml) was given to the females. The treatment which was given 35% protein diet re...

Tasnim Farasat*, Saima Sharif, Farkhanda Manzoor, Muneeza Zafar and Shagufta Naz

...emale. High density lipoprotein (HDL), both systolic and diastolic blood pressure, cholesterol level and serum insulin were significantly higher (p< 0.05) in proliferative group of diabetic retinopathy, while triglyceride level, HbA1c (%), and low density lipoprotein (LDL) were non-significantly higher (p> 0.05) in diabetic retinopathy groups. To conclude high prevalence of diabetic retinopathy was observed among newly...

Abdul Mannan Babar1* and Abdul Hannan Nagi2

...s been made. Recently a prototype rabbit ear keloid model has been produced by the authors by giving Transforming Growth Factor Beta 1 injection, and then skin punch excision on rabbit ear. In the present follow-up study consisting of eight refind techniques, best Keloid was produced by the technique where Transforming Growth Factor Beta 1 injection was followed by ventral skin, ventral perichondrium, cartilage, and dorsal perichondrium punch excision, leavin...

John G. Bruno

...n the various captured serotypes, each of the anti-LPS aptamer candidates showed a preference for its cognate E. coli serotype. Results suggest that these aptamers may be useful for enriching specific E. coli pathogens during aptamer-magnetic separation in food samples, leading to a greater ability to detect these serotypes if coupled with genetic identification techniques such as PCR or g...

Dilawar Hussain* and Abdul Mateen

...iciency ratio (FER) and protein efficiency ratio (PRE), irrespective the addition of the 4TX in the diets. Among different dietary groups of the fish, % survival was not affected significantly (p<0.05). T1 showed maximum NWG (45.49±3.85), FER (0.739±0.02) and PER (36.36±1.83) when compared to other dietary treatment groups. The addition of 4TX clay in the diets at both 2 and 4 ppm AFB1 concentrations have almost the same effect on the g...

Wang Tian1, Huayong Zhang1,*, Jian Zhang2, Lei Zhao1, Mingsheng Miao3 and Hai Huang1

... the lake, including 17 protozoa, 36 rotifera, 12 cladocera and 11 copepods species, respectively. Zooplankton species richness changed slightly in the four seasons but varied a lot in different positions. Protozoa was absolutely dominated in zooplankton abundance and its mean value ranged from 2710.2 ind./L in winter to 4259.5 ind./L in spring. Annual average biomasses of p

Xiangxing Zhu1, Junyu Nie1, Shouneng Quan1,2, Huiyan Xu1, Xiaogan Yang1, Yangqing Lu1, Kehuan Lu1 and Shengsheng Lu1*

... carrying a fluorescent protein (DsRed) reporter gene regulated by the 2.2-kb human glial fibrillary acidic protein promoter (hGFAP-DsRed). This study characterized transgene expression in such transgenic Guangxi Bama mini-pigs and their offspring. Our findings indicate that the hGFAP promoter contains matching regulatory elements for directing specific expression in porcine astrocytes. However, the practical application of ...

Abdur Rahim1, Ghulam Abbas1*, Lorenzo Gallus2, Sara Ferrando2, Muhammad Hafeez-ur-Rehman3, Abdul Ghaffar4 and Abdul Mateen5

...ith diet comprising 40% protein and 20% lipid for 75 days. Higher percent weight gain (% WG), best feed conversion ratio (FCR) and specific growth rate (SGR) were recorded at ration level from 2.5 to 4.5% BW d−1 and feeding frequency of three to four times daily. The moisture, protein and ash contents of whole body of the fish were not significantly (P>0.05) affected by feeding frequency. The highest lipid contents ...

Salma Shaheen, Mumtaz Khan, Muhammad Jamil Khan, Saleem Jilani, Zarina Bibi, Muhammad Munir and Mehwish Kiran

 

...er, vitamin C and crude proteins were also increased in spinach with pressmud + EM application. It was concluded that EM-inoculated pressmud has higher potential to increases soil fertility as well as stimulate spinach growth and quality. Therefore, warrants further testing under field conditions.

...

Aqila Shaheen and Nadia Sabir

...ter wheat-maize cropping rotations significantly responded to tillage, residues and organic and inorganic fertilizers. These results suggest that deep tillage has the potential to increase crop yield and WUE of wheat-maize cropping system in mountainous and sub-humid conditions.

...

Sana Irshad Khan1*, Zafar Iqbal2, Hamid Ullah Shah2 and Shaukat Hussain3

...a, i.e. Potato Dextrose Broth (PDB) and Glucose Nutrient Broth (GNB) media for active secondary metabolites. Ethyl acetate (EtOAc) extract of PDB medium gave significant results against selected phytopathogens compared to GNB medium and selected for further study. Crude (1 µg.mL-1 ) obtained from PDB medium showed 2.50 ± 0.64 mm and 1.97 ± 0.21 mm inhibition zone against X. campestris and C. michiganensis...
Muge Aliye Hekimoglu*, Kgrşat Fırat, Şahin Saka, Cüney Suzer, Aysun Kop and Yaşar Durmaz
...g-1). Total carotenoid content of fish skin was determined at30-day intervals. At the end of the experiment the highest weight gain was found to be 1.73±0.37g in Group B, whereas the lowest performance (1.29±0.38 g) was received in Group C. The best feed conversion ratio was found in at Group B. The total carotenoid content of skin of fish were found to be 0.77±0.61 µg.g-1 on ...
Farkhanda Manzoor1, Iram Amin2,*, Muhammad Shahid2,Samia Afzal2,Hania Ramzan1, Tahir Rehman Samiullah2 and Muhammad Idrees3
...was the most prevalent serotype. DENV-1 was not found in any pool. While all pools of Aedes albopictus were negative for dengue virus. Our study showed that the main cause of spreading of dengue virus was Aedes aegypti. Serotype DENV-2 was dominant in the field collected larvae of Aedes aegypti in Lahore and Sheikhupura, Pakistan. 
...
Sameera Akhtar1*, Muhammad Akram Muneer1, Khushi Muhammad1, Muhammad Yasin Tipu1, Muhammad Anees2, Imran Rashid1, Raza-ur-Rehman3 and Irshad Hussain1
...DV strains. The NDVs, a prototype of Avian Paramyxoviruses (APMV-1), have been reported previously both in chicken and feral birds (natural reservoirs) in Pakistan; however, their molecular characterization is largely inadequate and requires continuous evaluation. In this study, sequencing and molecular analysis of fusion (F) and hemagglutinin (HN) genes of NDV strain isolated from an outbreak in a peacock flock was undertaken. Prot

Gabriela Mansano do Nascimento, Helena Lage Ferreira and Clarice Weis Arns

 

... susceptible cells. The protection ability of ISGs to safeguard chicken cells against the virus could be potentially applied for vaccine production, better vaccination protocols and infection control in the future.

...
Sidra Ilyas1, Abdul Rehman1* and Qasim Ilyas2
... treatment, whereas non-protein thiol levels were higher after Cd and As treatment followed by those of Pb, Cr and Cu treatment. Candida sp. PS33 was able to remove 78% (Cd), 70% (As), 82% (Cu), 65% (Cr) and 87% (Pb) from the medium after 8 days of incubation. This multi-resistant yeast can be used efficiently for the removal of toxic metals from the wastewater.
...
Jehangir Khan1,2*, Inamullah Khan3, Ijaz Ali2, Aqib Iqbal2 and Muhammad Salman4
...DNA of the four dengue serotypes. Six out of 35 (17.14%) adult mosquito pools were found positive for dengue virus with type-2 (77.77 %) and type-3 (11.11 %) while a single (11.11%) pool of concurrent infection with type 2 & 3 was also detected. The adult Ae. aegypti belonging to Shuba Bazaar showed 33% positivity for DENV with minimum infection rate (MIR) 11.1 while that of Wazir Bagh showed 16.67% positivity with MIR 5.5. Similarly, the Ae. alb...
Muhammad Afzal1,Naveeda Akhtar Qureshi1,*, Khalid Zamir Rasib2 and Irfan Hussain1
...erranean termite, Heterotermes indicola Wasmann is among the most devastating species causing significant loss annually in South Asia. Feeding deterrence of H. indicola among 10 different woods species were evaluated in choice and no-choice assays conducted under laboratory and field conditions. Visual rating according to (AWPA, 1997) scale, mass loss, wood consumption per termite and mortality rate were determined to evaluate resistance of wood ...
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
...erground water. The bio-protectant potential of mycorrhizal fungus (Glomus mosseae) and neemex® (Azadirachtin) against invasion and development of Meloidogyne incognita was tested in eggplant roots in greenhouse pot trials. Neemex (5 g, 10 g and 15 g) and G. mosseae (100 g, 150 g and 200 g) were applied as protective treatment. The roots of eggplant were inoculated with 1000 second stage juveniles of...
Abdur Rahim1, Ghulam Abbas1,*, Sara Ferrando2, Lorenzo Gallus2 and Abdul Ghaffar3
...d with artificial diet (protein 42%, lipid 20% and energy 25.2 kJ g-1) for 120 days in three equal meals. On the other hand, control ponds remained without additives. During the whole study period, water quality parameters of the experimental ponds remained as salinity (15‰ -20‰), dissolved oxygen (5.6 to 7.5ml/l), temperature (25°C to 28°C). pH (7.6-7.8), ammonia (NH4-N) and `nitrites (NO2-N) l...
Yang Wang1, Zhide Cheng2, Mengjie Tang3, Haixia Zhou1, Xiaolu Yuan4,Muhammad Aqeel Ashraf5, Shuting Mao1 and Jing Wang1,*
...al saline. The mRNA and protein expression levels of Ldh-c in plateau pika skeletal muscles were determined by real-time PCR and Western blot. The LDH activities, lactate contents and ATP levels in skeletal muscle were compared between the experimental group and the control group. The results showed that 1) the expression levels of Ldh-c mRNA and protein were 0.804±0.059 and 0.979±0.176, respectiv...
Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*
...ure acclimation-related protein, and it plays an important role in adapting temperature shock. But the research about Wap65 in crucian carp is very limited. In this study, the CDS of Wap65 was firstly cloned and characterized from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids. The calculated molecular weight of crucian carp Wap65 protein (CcWap65) is 5...
K.N. ArulJothi1, M. Abinaya1, B. Suruthi Abirami1, Melvin George2, S. Elangovan3 and A. Devi1*
...receptor class B type I protein (SCARB1) plays an essential role in cholesterol homeostasis. The effect of the polymorphisms in the gene have varying influences on lipid levels and development of cardiovascular disease (CVD) in different populations. In this study, we investigated the association of rs5888 polymorphism with serum lipid levels and CVD risk in an Indian population. A total of 412 samples which included 148 myocardial infarction survivors,...
Zafar Iqbal1* and Muhammad Khurshid2 
...ow leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. However, immunocapture of ToLCNDV could only be achieved by using the TYLCV-CP antisera followed by PCR detection by using specific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae), considered as a close relative of TYLCV, and cause severe losses for many economical imp...

 Eman M. Farghaly1, Ahmed Samy1,2*, Heba Roshdy

...r the deficit in animal protein in developing countries including Egypt. However little is known about the prevalence and antibiotic resistance of major bacterial pathogens such as Escherichia Coli, Staphylococcus aureus Salmonella and Pasteurella spp. in Egyptian quail farms. Such information is important for drug choice and success of treatment as well as spotting the light on emerging antimicrobial resistance that represent major concern for public health. ...

 Abdul Wajid Khalil and Zafar Iqbal

....22±0.05%) while protein (37.46±0.02%) and organic matter (21.25±0.03%) was recorded higher in roots than the aerial parts of B. procumbens. Calcium (309.73±0.06mg/100g), potassium (274.59±0.08mg/100g) and iron (32.58±0.05mg/100g) were found in highest amounts in aerial parts as compared to the roots. The Cadmium metal was not detected while lead was found in permissible limits in both the aerial parts and roots of B. ...

Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1

...idered. Four different serotypes were identified with Salmonella Llandoff having the highest isolation rate in all the matrices sampled (58.8%), followed by, S. Kentucky (17.7%), S. Schwarzengrund and S. Havana had the lowest isolation rate (11.8%). S. Llandoff was isolated in all the matrices and was distributed across the three LBM whereas the other less frequent serovars had a more circumscribed distribution. Resistance to Methicillin, Penicillin, Erythromy...
Abdul Malik1,4, Ghulam Abbas1*, Hameeda Kalhoro2, Illahi Bux Kalhoro3, Syed Sajjad A. Shah4 and Halima Kalhoro3 
...ellets having 35% crude protein at 2% body weight twice a day for 60 days and eggs were collected weekly. Results showed that fertilized eggs were found to be greater in number at low salinity level as compared to higher salinity level. Survival of fry ranged from 1058 to 1100 at salinity level of 0‰ – 20‰ with 5% increment, after which fry number decreased significantly (P<0.05). The fertilized eggs did not differ for the fish at salini...

Mohammad Raoofi and Mohammad Taghi Alebrahim

...s of nutrient elements, proteins and factors such as ADF, Ash, CF, NDF.

...

 Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*

...hes of trees as a result rotten woody plants. The larval beetles characteristically feed in the phloem as well as later in the xylem. The females select living hosts for oviposition and thus destroy the vigour of the trees. However, at the early stage of intestation, detection of Anoplophora glabripennis and exposure will help to eliminate the pest in addition to prevent its establishment. Plantation with different tree species, the cultivation of fast-...
Muhammad Shahid1, Iram Amin1,*, Samia Afzal1, Zareen Fatima1, Sadia Zahid1, Usman Ashraf1 and Muhammad Idrees2
...pictus having five serotypes 1-5 and infecting about 100 million people each year. To address dengue outbreak 2013 in Pakistan we aimed to conduct a comprehensive study at molecular level to determine the main causative serotype of 2013 DENV outbreak in Pakistan. Overall 703 serologically positive suspected patients from different major health centers of Pakistan were registered in present study of which 214 were females...

Erum Bughio1, Ahmed Sultan Jatoi*1, Muzamil Memon2, Reema Bughio3, Pervez Ahmed Khoso4, Zafar Ali Khoso1 and Ali Asghar Baloch5

...with live vaccines were protective against the IBDV. Based on the findings of present study, it can be concluded that all vaccinated group displayed similar antibody response irrespective of the types of vaccines administration to the chicks.

...
Uzma Farid Durrani1,*,Sagar Mal Goyal2, Asim Khalid Mahmood1,Cathleen Hanlon3, Susan Moore3, Muhammad Waqas1 and Raheela Akhtar4
...titer less than minimum protective level (0.2-0.4 IU/mL). RFFIT did not reveal mRVNA in 23 puppies that were declared lacking maternal rabies immunity. One basis of findings of this study it was concluded that puppies population lacking maternal rabies immunity is one of the responsible factors for increasing incidence of rabies in humans and dogs living in Lahore, Pakistan.
...

Muhammad Waqas1*, Anwar Ali Shad1, Omaira Bashir2 and Mohsin Iqbal3

...">In the present study carotenoids from tomato peel was elucidated by HPLC to utilize it as natural colorants in sunflower oil and spaghetti. Tomato peel contained 720 mg/100g of carotenoids consisting phytoene (3.15%) followed by phytofluene (2.31%), β-carotene (2.11%), cis-lycopene (1.71%), lutein (1.51%), cis-ζ-carotene (0.61%), ζ-ca

John G. Bruno

...tails on the surface of Protein A-conjugated magnetic beads. While no clear similarities in the partial or complete primary DNA sequences or secondary stem-loop structures of these aptamers were observed, 3-dimensional computer models of these top ten anti-idiotypic aptamer candidates showed some topological similarities which suggest common binding motifs. Unfortunately, without knowledge of the hypervariable region amino acid sequences of the target antibodi...

Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

...(HEK) cell line. The HA protein was analyzed using SDS-PAGE followed by Western blot and immunofluorescence assays. The pCAGG-optiH9 vaccine efficacy was evaluated by intramuscular immunization of SPF chickens with different concentrations of plasmid DNA and the sera were collected weekly post vaccination for antibody detection by HI test. All immunized chickens shown high HI antibody titers (9Log2) two weeks post-booster dose. The chickens were then challenge...

Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*

...ng brain heart infusion broth supplemented with horse serum. The blood was used for serum plate agglutination assay. Thereafter, the samples were subjected to genomic DNA extraction to detect Mycoplasma spp. using multiplex-PCR. Isolation and identification data showed that a total of 58/96 samples (60.41%) were positive for Mycoplasma infections whereas a total of 61/96 blood samples were also found positive using serum plate agglutination. However, the multi...
Jun Gao1,2, Liang-Liang Yue3, Xianhuan Jiang1, Liju Ni4, Muhammad Aqeel Ashraf5, Yuxun Zhou,1 Kai Li1,* and Junhua Xiao1,*
...c relationships of Microtus fortis in China, we investigated 84 individuals collected from five populations. The mitochondrial cytochrome b gene (cyt b) and control region (CR) were sequenced and 49 haplotypes were observed. No shared haplotype was found among different geographic populations. High Fst values among the populations suggested that fragmentation of habitat has resulted in genetically distinct populations. The trees...
Maoying Zhu, Yuntao Ji, Xiaoyu Wang, Junying Pu and Changqing Qu*
...ent combinations of cryoprotectants with and without hydrogen gas (H) (purified H2 was dissolved into normal cryopreservation solution for 2 hrs under 0.6 MPa were tested including the following groups: control (CK), 100µm GSH, 10µm fasudil hydrochloride (FH) and a combination of the two (GSH + FH). A solution of 10% (v/v) Me2SO + 20% FBS was used as the standard cryopreservation solution. After 2 months, MTT assay showed sign...
Adel Eid Mohamed Mahmoud*
...n coefficients of crude protein and digestible crude protein. Ruminal pH values and ammonia nitrogen concentrations did not show any significant differences among groups.No significant differences were observed in meat chemical analysis of slaughtered animals among different groups. Animals fed BBP recorded insignificant increase in growth rate by 9 g daily with improvement in feeding cost by 10%.Bakery waste can replace cor...
Muhammad Tahirand Memoona Shehzadi*
...ield, harvest index and protein content were recorded where seed inoculation with PGPR-1 + PGPR-2 and full dose of recommended chemical was applied during both the growing seasons. Overall the performance of sunflower was better in spring as compared to autumn season. However, it was also noted that the combination of PGPR-1 + PGPR-2 and half recommended doses of chemical fertilizer gave results as full recommended dose of chemical fertilizer alone. Therefore,...
Abdus-Subhan1, Qudratullah Khan1, Muhammad Mansoor2, Muhammad Jamil Khan1, Ammanullah2, Matiullah Khan3
.../sub> followed by single rotavator in main plots while sowing methods i.e. Raised Bed Sowing S1and Flat Bed Sowing S2 in the subplots. The results showed higher WUE in the plots receivingP2and S1 in both years of experiments. Statistics revealed that P had significant effect on tillers plant-1, weight of grain spike-1, grain yield and harvest index % (H.I. %). While (S) had significant effect on...
Mustafa Cengiz1*, Jama Hussein Ali2, H. Mehtap Kutlu2, Djanan Vejselova2 and Adnan Ayhanci3
...ate the therapeutic and protective effects of ellagic acid (EA) on the toxicity of the liver induced by D-Galactosamine (D-GaIN) in rats. With this in mind, the rats were categorized into five groups. The study groups were given saline, 0.2 % dimethyl sulfoxide, D-GaIN, EA plus D-GaIN and D-GaIN plus EA, respectively. In the group given D-GaIN, the following transmission electron microscopic and light microscopic results were found: degenerative changes in the...
Neenish Rana, Nosheen Ehsan, Awais Ihsan and Farrukh Jamil*
...ved that their putative protein products will be thermodynamically stable. The sequence-based predictions suggested that the pseudogenes-derived proteins may involve in different biological functions like translation, energy metabolism, amino acid metabolism and transport and binding.
...

M. B. Meah

Biopesticides for crop growth and crop protection
...educed damping-off, seed rot, seedling blight and tip over of vegetables (egg-plant, tomato, chilli) in the nursery and leaf blight, anthracnose, fruit rot, root knot and leaf curl/mosaic of tomato and carrot in the field. Aqueous solution of garlic and allamanda tablet sprayed at 1:1, 1:2, 1:3, 1:3, 1:4, 1:5 conc. increased seed germination by 45-60%, completely eliminated damping-off, se...

Honnur Basha, Vinaya Hemannavar, B.Ramanujam, R. Rangeshwaran and S.Sriram 

Screening of chilli microflora and other biocontrol agents for their antagonistic effects on Colletotrichum spp. infecting chillies
...um, Monodictys, Mucor, Myrothecium, Penicillium, Periconia and Pithomyces. One-hundred and thirteen isolates of chilli microflora and 49 isolates of Trichoderma, 19 isolates of Bacillus sp., 34 isolates of Pseudomonas fluorescens and 29 isolates of yeasts from NBAII germplasm collection of biocontrol agents were tested for their antagonistic effect on Colletotrichum gloeosporioides and C. capsici by dual culture test. Among the isolates of chilli microflora te...

Neerja Agrawal, Mukesh Srivastava, Akhilesh Tripathi and Amrendra Singh

Survey and monitoring of pests, parasites and predators of pulse crops in central and eastern Uttar Pradesh
...rmes spp, and cut worm Agrotis ipsilon in chickpea whereas Campoletis chlorlidae was recorded as natural enemy feeding on H. armigera larvae. In pigeonpea crop, mainly H. armigera, leaf webber Grapholita (Cydia) critica, Myllocerus spp, spotted pod borer Maruca testulalis, plume moth Exelastis atomosa, tur pod bug Clavigralla gibbosa, jassid Amrsca bigutulta, termite Odontotermes spp, green bug Nezara viridula, tur podfly Melanogromyza obtusa, blue butterfly L...

A. K.Bhattacherjee and B. K. Pandey

Dissipation of carbendazim in mango after pre- and post-harvest treatments
...sporioides) and stem end rot (Lasiodiplodia theobromae). Carbendazim dissipated to 1.01 and 2.14 mg kg in mature whole fruit after harvest (12 days after second spray) at 0.05 and 0.1 per cent concentrations, respectively, following first order rate kinetics. The corresponding values in fruit pulp after 12 days were 0.57 and 1.26 mg kg . In another experiment, cold water dip treatment in carbendazim solution @0.05 and 0.1 percent was given for 10 min to a sepa...

1Parvin Noor and 2Md. Nashir Uddin

Morphological changes of different castes of the subterranean termites (Odontotermes proformosanus) in fungus combs of termitophiles
...kers of the subfamily Macrotermitinae have the extra-ordinary phenomena of making fungus combs inside the termitophiles. Considering the consistency of fungus-bed in the termitophiles, an attempt has been made to observe the morphological changes of nymphs while they stayed within the fungus comb. Biological attributes indicated that Odontotermes proformosanus are polymorphic in nature and have exopterygote post-metamorphic development. During the period of st...

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
... and cultured in liquid protein supplemented broth medium and culture filtrates (CF) were prepared. In in-vitro test single eggmasses of uniform size were kept in 5ml CF in 5cm diameter Petri plates. Antifungal activity was tested by dual culture of wilt fungus with antagonist fungus and bacteria isolates in PDA media plates. In in-vivo test soil was amended with antagonist and wilt fungal and bacterial isolates 2 x 106 CFU/...

Sitansu Pan and N. K. Mishra

Epidemiological studies on some diseases of guava (Psidium guajava L.)
...tem canker and dry fruit rot (Botryodiplodia theobromae) and Phytophtora fruit rot (Phytophthora nicotianae var parasitica) of guava were analysed for predictive purpose from regression equations. The simple correlation coefficient matrix showed significantly positive correlation of canker severity with maximum relative humidity at 1% level whereas, anthracnose correlated well with minimum relative humidity, temperature and ...

S. K. Dutta, S. Roy Chowdhuri, D. Pandit and A. K. Bajpai

Rot diseases of muga host, Som (Persea bombycina) in Assam, India
... generally infected with rot disease when it grows older. Phellinus contigus (under Polyporaceae), a white rot fungus, causes heart rot disease and Biscogniauxia mediterranea (= Hypoxylon mediterranea) (under Xylariaceae) causes canker rot disease of Som plant. A survey was conducted to study the infection of rotting p...

Basudeb Dasgupta, Partha Dutta and Srikanta Das

Biological control of foot rot of betelvine (Piper betle L.) caused by Phytophthora parasitica Dastur
...act of incidence of foot rot of betelvine caused by Phytophthora parasitica and growth, yield, and keeping quality by applying two bioagents, viz., P. fluorescens and Trichoderma harzianum. P. fluorescens inoculated in 500 kg oil cake ha-1 was applied once at pre-monsoon, twice during pre- and post- monsoon and four times at quarterly intervals. T. harzianum inoculated in 500 kg oil cake ha-1was applied at quarterly intervals. Bordeaux mixture (BM) was used to...

Sitansu Pan and Amrita Das

Control of cowpea (Vigna sinensis) root and collar rot (Rhizoctonia solani) with some organic formulations of Trichoderma harzianum under field condition
...seases. Among those root rot and collar rot are important and R. solani has been an important factor behind these two main diseases. A field trial was conducted during pre-kharif season of 2011 to control root and collar rot of cowpea caused by Rhizoctonia solani with two organic formulations of Trichoderma harzianum along with other treatment combinations. It was observed that seed primin...

Amitava Konar, Kiran A. More and Pradip Mondal

Efficacy of some insecticides against cutworm and molecricket of potato in West Bengal
...il pests i.e. cutworm (Agrotis ipsilon Hufner; Noctuidae: Lepidoptera) and molecricket (Gryllotalpa africana P. de Beau; Gryllotalpidae: Orthoptera) infesting potato at Adisaptagram Block Seed Farm, Mogra, Hooghly, West Bengal (India) during 2007-08 and 2008-09. The field trial was conducted in Randomized Block Design with six treatments and five replications. Among the various treatments for managing soil pests of potato (cv. Kufri Bahar) i.e. cutworm and mol...

Goutam Samui and Shantanu Jha

Branch gall of mango (Oligotrophus mangiferae Keiffer) its bioecology and management
...loprid @ 0.006% and monocrotophos @ 0.005% gave effective control of the pest.


...

Biswajit Pramanick, Sruti Karmakar, Koushik Brahmachari, Rupayan Deb 

An integration of weed management practices in potato un-der New Alluvial soil
...ld of potato was Cyperus rotundas, Chenopodium album, Anagallis arvensis and Fumaria purviflora. The results revealed that the maximum tuber yield and return per rupee invested vis-à-vis the maximum N, P, K uptake by potato and the minimum uptake of N, P and K by weeds emerged in the potato field were recorded under the treatment T3 (hand weeding at 20 DAP along with mulching) which was closely followed by the treatment T9 (Pendimethalin @1kg a.i. ha-1 ...

D. C. Khatua, B. Mondal and G. Saha

Bioassay of some agricultural chemicals, human drugs and disinfectants on Phytophthora melonis Katsura causing fruit and vine rot of pointed gourd
..., disinfectants and antiprotozoal drugs were tested on Phtophthora melonis Katsura causing fruit and vine rot of pointed gourd in aqueous environment. Antifungal antibiotics viz. validamycin, kasugamycin, griseofulvin, fluconazole and ketoconazole did not have any pronounced effect on mycelial growth, sporangia formation and its germination. None of the eight antibiotics used in this study prevented mycelial growth. No spora...

Abhijit Ghosal and M. L. Chatterjee

Bioefficacy of imidacloprid 17.8 SL against whitefly, Bemisia tabaci (Gennadius) in brinjal
...vided similar levels of protection as that of imidacloprid. The conventional insecticide, methyl demeton (125 g a.i./ha) was less effective.

...

Anjan Bhattacharyya, Suhrid Ranjan Barik & Pritam Ganguly

New pesticide molecules, formulation technology and uses: Present status and future challenges
...a history of using crop protection products from non-selective, naturally occurring compounds to highly specific synthetic and biological materials for assured food production and protection of environment since long time. There is a sequential rise in the production and consumption of pesticides in India during the last three decades. Researches are going on to develop safer molecules which could undergo photo-degradation, ...

Goutam Samui and S. Jha

Biology, seasonal incidence and management of Apsylla cistellata Bucton. on mango in West Bengal
...anches treated with monocrotophos (0.35 galls/shoot) followed by quinalphos (0.73 galls/shoot) and imidacloprid (1.03 galls/shoot). However, the performance of all the three insecticides were statistically at par.
 

 

...

Amitava Konar and N. Johnson Singh

Occurrence of aphids on various potato germplasms in eastern gangetic plains of West Bengal
... during late January to protect the crop against the aphids while other varieties will require insecticide spraying during early January onwards to manage the crop from the infestation of aphids..
 

 

...

Someshwar Bhagat and Sitansu Pan

Comparative ecological behaviour of some pre- and post-tsunami isolates of Trichoderma harzianum and T. viride from Andaman & Nicobar Islands
...tage colonization of sclerotia of boh R. solani and S. rolfsii, followed by mycelial and conidial inoculum. The isolate ThrAN-5 (T. harzianum) was most efficient in parasitizing the sclerotia of S. rolfsii and R. solani, followed by TvAN-3, TvAN-5 and ThrAN-7 (Pre-Tsunami isolates), whereas there was significant reduction in their parasitizing ability of post-Tsunami isolates. Similar results were also noted in their rhizosp...

Dhananjoy Mandal

Eco-friendly management of mealybug and wilt in pineapple
...1 during planting + monocrotophos 36% EC @ 0.03% at 100 DAP + endosulfan 35% EC @ 0.02% during 150-180 DAP]; T2 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G @ 15 kg ha-1at 100 DAP + Neem oil 1500 ppm spray @ 2.5 m/L-1 at 150 DAP]; T3 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G @ 15 kgha-1 at ...

Dhananjoy Mandal 2K. Baral 3M. K. Dasgupta

Developing site-specific appropriate precision agriculture
... marketing, production, protection and processing, and other essential information provided through a decision support system (DSS), in an agriinformatics networking such that is not ordinarily available to Indian farmers in general. Due to Precision Farming (PF), production increased by 40 to 60 percent farmers’ margins of the produce and reduction of the commission charged by the middlemen to 7-10 percent. Further, bargaining power, capacity building, ...

Partha Pratim Ghosh and 2N. C. Mandal 

Some disease management practices for bacterial wilt of potato
...) @ 10 gL-1, along with protective banding with well decomposed cowdung + oilcake + Single Super Phosphate + Muriate of Potash mixture at 20:5:3:1 in each bacterial wilt affected plant + mancozeb spray @ 2.5 gL-1 at 50, 57 and 60 DAP) were the best treatment in terms of their responses to yield, disease management and higher return per rupee investment. The highest tuber yield and low disease intensity was obtained from T1 (TPS whole tuber planting) followed b...

T. P. Ghosh, D. Mandal, S. Laha and M. K. Dasgupta 

Dynamics and severity model in managing fungal diseases
... a useful tool in plant protection, especially supervisory management and appropriate IPM.
 

 

...

S. Pal and I. Sarkar

Pests infesting ornamental plants in hilly region of West Bengal
...nd Anthurium. Cutworm (Agrotis segetum) damaged the seedlings of Gladiolus. Among the Coleopteran pests, the Blister beetle (Mylabris p) was the most important feeding on the flowers of Gladiolus and China rose. The steel blue beetle, Altica p. and white spotted flea beetle (Monolepta signata) was found infesting Gladiolus and Chrysanthemum respectively. The serpentine leaf miner (Liriomyza trifolii) was recorded on gerbera. Among non-insect pests the red spid...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
.... The Albumin and total protein values were significantly low (P<0.05) in infected groups A and B as compared to control groups C and D on 5th and 7th day. The alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly (P<0.05) high in infected groups A and B. On 3rd, 5th and 9th day five birds from each group were slaughtered and histopathological lesions observed in burs...
Muhammad Mansoor, Zaigham Abbas and Nageen Husssain*
... individuals. Gluten, a protein fraction commonly found in wheat grains, associated with food related disorders and a number of autoimmune diseases. We hypothesized that gluten containing diet would further exacerbate an already undergoing arbitrary immune reaction in SLE patients. Pristane was injected in female BALB/c mice to induce the disease. After five months, mice in various groups were treated with prednisone and fed with gluten containing and standard...
Bushra Niaz1,*, Tahir Zahoor1, Muhammad Atif Randhawa1 and Amer Jamil2
... a multifunctional glycoprotein, occurring as awhey constitute in milk secretions of animals and humandisplays a variety of antimicrobial, antioxidant and immunomodulatory as well as a number of other biological functions. Its potential can be exploited in several food applications. Keeping in view the increased demand of natural antimicrobial agents to control prevalence of food borne pathogens in final packaged food products as well as for food preservation/...
Freeha John, Noor Abid Saeed*, Sajid Nadeem and Muhammad Hamed 
...cost benefit ratio when protected against aphids.
...
Yasemin Bircan Yildirim* and Hediye Tugce Vurmay
... aerogenes, E. cloacae, Proteus vulgaris, K. pneumoniae and Pseudomonas fluorescens were isolated from the fish intestine samples. E. aerogenes (68.4%), Serratia spp. (53.3%), E. cloacae (50%) and K. pneumoniae (44.4%) showed high level of resistance against ampicillin. K. pneumoniae also showed high resistance against Cefepime (52.9%) and Ciprofloxacin (47.1%). Pseudomonas species exhibited high leve...
Burhan Azam1, Muhammad Naeem Tahir2,*, Faisal Shahzad2, Abdul Ghaffar3, Ghulam Abbas4, Madiha Gohar5 and Saima1
...pped. The yield of milk protein, fat, solids not fat and lactose were not affected (P>0.05). Milk fat, solids not fat and lactose concentrations differed (P<0.001) among the treatments but did not show (P>0.05) any linear or quadratic trends with increasing level of enzyme in the diet. Milk protein concentration linearly (P<0.001) increased with increasing level of enzyme in the diets. It is concluded that fibrol...
Ayesha Zahid,Ammara Muazzam, Sidra Mustafa, Saba Irshad*,Malik Siddique Mahmood and Rehman Shahzad

 

...nal analysis of mutated protein was anticipated by bioinformatics tools, which manifest mild changes in overall charge but altered post translational modifications in a way which might have a deleterious effect on ion channels anatomy and on the whole, pave ways to the genesis of cataract.
...
Rauf Ahmad1, Karam Ahad2 and Aziz Ullah Shah3
...tes obtained for onward protocol was 43%, 24% and 0% respectively. The overwhelming of hybrid candidates with good quality indicates that they have common source, origin and or different brands of the same company.
...
P.P. Ghosh*, C. Ghosh, B. Mahato, A. Chakraborty, S.K. Bhattacharya and M.K. Bhattacharjya
...ant formulation and well rotten cow-dung manure (1:40 w/w) or need based curative application of bleaching powder at 20 kg per ha through every irrigation.
...

Gadeeyya G and Ratna Kumar P.K.

...na benghalensis, Cyperus rotundus, Crotalaria verrucosa, Digera muricata, Sida cordifolia, Ipomoea pestigridis and Trianthema portulacastrum were selected for in vitro studies. Fungal isolates namely Ascochyta cypericola, Bipolaris sp., Chaetomium globosum, Colletotrichum capsici, Colletotrichum sp., Curvularia lunata, Curvularia tuberculata, Fusarium oxysporum, Helminthosporium sp. and...
Fariha Imtiaz1, Muhammad Islam1, Hamid Saeed2,*, Bushra Saleem1, Maryam Asghar1 and Zikria Saleem2
...ities of carbohydrates, proteins and secondary metabolites in methanol compared to other extracting solvents. Moreover, only ethanol (5 and 10%) and petroleum ether (5%) demonstrated significant hair growth promoting effects (p < 0.05) compared to standard, i.e., 5% minoxidil and extracts in other solvents. Likewise, ethanol (5% and 10 %) and petroleum ether (5%) extract had significant impact (p < 0.05) on hair length in comparison to minoxidil, ...

Mahmoud Said1*, Abd El Satar Arafa1, Mohammed A. Rohaim2* and Hussein A. Hussein2

...timized vaccine-induced protections.

...

Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1 

...tudy, we analysed the G-protein-coupled chemokine receptor (GPCR) genes of two LSDV isolates from Ixodid (hard) ticks (Amblyomma hebraeum) in Egypt. Multiple alignments of the nucleotide sequences revealed that both isolates had nine nucleotide mutations in comparison with the local reference strain, LSDV-Egypt/89 Ismalia. Compared with the GPCR sequences of SPV and GPV strains, 21 nucleotide insertion and 12 nucleotides deletions were identified in the GPCR g...
Rafi Ullah1, Sarzamin Khan1,*, Abdul Hafeez1, Asad Sultan1, Nazir Ahmad Khan2, Naila Chand1 and Naseer Ahmad1 
...y be used as a low-cost protein constituent in the broiler finisher ration.
...
Viram Kumar1,*, Moolchand Malhi1, Saeed Ahmed Soomro1, Toufique Ahmed Qureshi2, Muhammad Nawaz Sanjrani3 and Khushal Das Malhi1
...05) and the serum total protein and Mg concentrations were significantly lower (P < 0.05) in male compared to female peafowl. In conclusion, the present study provides base-line values for hematology and serum biochemistry of apparently healthy Indian adult blue peafowl of Thar and can be used as reference values to evaluate the health or diseased conditions in the same species.
...
Muzammil Sattar
...ng amounts of different proteins in the diet of adult Chrysoperla carnea (Stephens). Results show that proteins play a vital role in the fecundity, fertility and all the biological parameters of F1 for mass rearing. The tested proteins were: Casein, Protein hydrolysate, Torula yeast and Nu lure. Al these prot
Muhammad Ayaz1,*, Muhammad Athar Abbas2, Pervez3, Noorulain3, Yasir Amin1, Zubair Ali3, Naila Siddique2 and Khalid Naeem2
...gs. Identification of H protein was undertaken through hem agglutination Inhibition (HI) test while N typing was done using reverse transcriptase polymerase chain reaction (RT-PCR) procedure. Out of 600 examined locations twenty two (22) H9N2 subtypes isolates were recorded. The total prevalence recorded was 3.66%and out of 498 broiler operations yielded 17 (3.4%) positive isolates and 44 golden type native chicken farms yielded 05 (11.36...
Yun Wang1,*, Lei Guan1, Jiding Chen1, Yaping Kong1, Lang Si2 and Asif Shah3
...and QTR. To improve the protection mechanism for the four large ungulates viz., Tibetan antelope Pantholops hodgsonii, Tibetan gazelle Procapra picticaudata, Kiang Equus kiang) and Wild Yak Bos grunniens; we suggest that the distance between the proposed route for the expressway and the present highway and railway should at least be 1500m, and ideally, it should be 2500m.
...
Muhammad Ashfaq,1 Shamim Akhtar,2 Saleem Akhtar2,* and Mariyam Masood2
...xt-align: justify;">PCR protocol was developed to detect hyperparasitism in cotton mealybug. Cotton mealybug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae) is an invasive and major pest on cotton. Aenasius bambawalei (Hymenoptera: Encyrtidae) is an effective parasitoid of mealybug and has been the backbone of the biological control program of cotton mealybug in Pakistan, but its multiplication for inundative releases has been impacted by a h...
Mutassim M. Abdelrahman1*,Ibrahim Alhidary1, Abdullah H. Alyemni2, Rifat U. Khan3, Abdel Raouf S. Bello4, Mohamed Y. Al-Saiady2 and Ramzi A. Amran1
...the effect of different protocols of alfalfa hay supplementary on ruminal characteristics and performance of growing Naemi lambs fed TMR. Four groups, each of 3 months old growing Naemi male lambs (28.85±1.09 kg), were fed on TMR (NDF=41. 95%) (T1). TMR plus 100 g alfalfa hay (NDF= 43.3%) daily (T2), TMR plus 200 g alfalfa hay (NDF= 43.3%) every two days (T3) and TMR plus 300 g alfalfa hay (NDF= 43.3%) every three days (T4). Rumen fluid samples were ana...

Shahid Iqbal Khattak1*, Mohammad Safdar Baloch1, Khalid Naveed2 and Ejaz Ahmad Khan1

... However, maximum grain protein content was recorded in soil applied method in comparison to foliar N application. In conclusion, higher results for all the quantitative parameters were observed at 120 kg N ha-1.

...

Khurram Shahzad and Mohammad Akmal*

...stem i.e. maize-wheat in rotation. The results concluded that wheat crop fertilized with 140 kg ha-1 preferably in three splits for sustainable farming system for Peshawar climate and surroundings.

...
Muhammad Mansoor1, Amanullah1, Zafar Islam2*,Sher Muhammad3, Muhammad Umair4, Mehmood Ayaz5, Asghar Ali Khan6, Muhammad Asif2 and Ya Sakina3
...h resistance to charcoal rot, cercospora leaf spot and Yellow mosaic virus.
...
Madiha Hashmi1, Abid Hussain1, Shafiq ur Rehman1, Farida Ahmed2, Shahbaz Aslam3,Nadeem Afzal4 and Zaigham Abbas1,*
...ergens and could have a protective role for allergy while HLA-DRB1*12 did not show any association with aeroallergen sensitization.
...
Aneela Qureshi1, Ammara Ainee1*, Muhammad Nadeem1, Masooma Munir1,2*, Tahir Mahmood Qureshi1, Saqib Jabbar2
..., color, moisture, fat, protein, ash, NFE and fiber content changed significantly (p<0.05). Gross energy level in cake which is desirable by consumers was reduced but high fiber cake was dark colored, low in volume and with increased hardness. Treatment (T3) containing 5.6g grapefruit albedo powder shows significantly (p<0.05) higher sensory scores in term of color (8.02±0.50), flavor (8.04±0.29), taste (8.18±0.37), mouth ...
A. Hamid1,*, M. Ilyas2 and S. Kalsoom3
...), very low density lipoprotein (VLDL), low density lipoprotein (LDL), high density lipoprotein (HDL) and triglyceride level. Group I comprised control group of induced hypercholesterolemic rats fed on purified diet AIN-93 G. Group II comprised induced hypercholesterolemic rats fed on WBF. Group III comprised induced hypercholesterolemic rats fed on MBF, Group IV comprised hypercholesterol...
Adnan Yousaf1,Jia Wu1, Qaiser Shakeel2, Yasir Iftikhar3, Muhammad Irfan Ullah4, Uzma Tahira5,Mustansar Mubeen1 and Wubei Dong1,*
...incognita and Sclerotium rolfsii and their integrated management by using derosol, cadusafos and Trichoderma harzianum in the green house at 25 ± 4ºC. Primarily, 15 chilies cultivars viz., 28-2010, C-72, Sanam, C-73, Gola Peshawari, 27-2010, Tata Puri, C-302, C-33, C-19, 5-2010, C-68, 11-2010, 18-2010 and 15-2010 were evaluated against M. incognita and S. rolfsii. Two week old chilies plants were inocul...

Wesam Hasan Mohamed Mady1*, Bing Liu2, Dong Huang2, Abdel Satar Arafa1, Mohamed Khalifa Hassan1, Mona Mehrez Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

... The confirmation of H5 protein expression was performed using SDS-PAGE followed by Western blotting and immunofluorescence assays. The humoral immune response was evaluated by intramuscular immunization of specific pathogen free (SPF) chickens with two different concentrations of Egy-H5 plasmid DNA 15µg and 60 µg. Results demonstrate that chickens developed detectable HI antibody titers up to 6log2 within two weeks post-booster vaccination. The ch...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and  Kui Chen2,*
...tween speculated fusion proteins. Under bioinformatics analysis, the T2R1 gene without introns was consistent with the structural domains characteristics of this family genes. The translation protein of T2R1 gene displayed with corresponding signal loci and functional domains of this gene family, and the result showed that the taste receptor translated by T2R1 gene belongs to G p...
Syed Makhdoom Hussain1,*, Tasneem Hameed1, Muhammad Afzal2, Arshad Javid3, Nosheen Aslam4, Syed Zakir Hussain Shah6, Majid Hussain5, Muhammad Zubair ul Hassan Arsalan1 and Muhammad Mudassar Shahzad1
...0% and 12.70% for crude protein, crude fat and apparent gross energy as compared to the reference diet, respectively at 1000 FTU kg-1 level. It was concluded that the phytase supplementation to sunflower meal based diet at 1000 FTU kg-1 level is optimum to release adequate chelated nutrients for maximum growth performance of C. mrigala fingerlings. Our results also suggested that phytase supplementation to sunflower meal based diet...
Rahat Naseer1*, Abu Saeed Hashmi1, Zulfiqar-ul-Hassan2, H. Rehman1, Saima Naveed1, F. Masood1 and M. Tayyab1
...n was recorded in HT (hydrothermal treatment) 1096.69±26.8 (mean± SE) while lowest in NC (untreated husk) 974.91±18.8 followed by 1069±28 in FT (Fermented), 1045.81±27.7 in BT 1042.47±33 in AT and 1032.17±32 in PC group. A significant difference (p=0.039) in the weekly body weight gain (BWG) was recorded among the experimental groups. The highest weight gain was found in PC (0.977±0.75) followed by FT (0....

Muhammad Abid1*, Tahir Yaqub2, Arslan Mehboob3 and Muhammad Zubair Shabbir4

...rious regions of the NA protein were determined with unknown functions and consequences. These findings warrant future studies for analysis of whole genome sequencing of prevailing H9N2 viruses in Pakistan which may further contribute towards the better understanding of the genetic nature and evolutionary behavior of these viruses in the country.

...
Netti Aryani1, Azrita2, Ainul Mardiah3 and Hafrijal Syandri2*
...g, made up of 30% crude protein, 7% crude lipid, 6% crude fiber, 12% ash, and 12% moisture as a percentage of fish body weight, with three replicates per treatment. Fish were fed three times per day at 09:00, 14:00, and 18:00. The experiment was carried out for 120 days. Each month, 30 fish were removed from each of the floating net cages to be measured and weighed. The biomass of fish was calculated, and the amount of feed was adjusted. The feeding rate signi...
Mehran Kausar1,2, Naveed Ashraf3, Farzana Hayat4, Asraf Hussain Hashmi1, Saima Siddiqi1,* and Mariam Anees2
...members, three affected brothers, one unaffected sister and the unaffected mother. We identified a known missense mutation c.136 C>T in the third exon of CTSK changing arginine to tryptophan (p.Arg46Trp) which segregated with the disorder. The clinical findingsimplicated CTSK and the use of direct sequencing provided a precise molecular diagnosis. Theidentification of the same variant in CTSK as identified in other families from Pakista...
Tiansen Li1, Meiling Huang2, Zhen Wang1,Fei Guo3,Hui Zhang1,* and Chuangfu Chen1,*
...s of the outer membrane protein 10 (Omp10) on bacterial survival, virulence, phagosome-lysosome fusion, and apoptosis induction, as assessed in appropriate in vitro (cell culture) and animal models. Results showed the omp10 mutant was dramatically attenuated for survival in macrophages and mice than the parent strain 2308. With decrease in the spleen/body weight ratios of mice infected with omp10 mutants were noted, inhibition of phagosome...
Muhammad Arslan Khan1,*, Sajid Aleem Khan1, Imran-ul-haq1 and Rashad Waseem Khan2
...xt-align: justify;">Root rot is very drastic disease prevalent in major cotton producing areas of Pakistan. Complex nature of disease due to root rot fungi and root-knot nematode cause huge losses to cotton. Experiments were conducted to assess the role of fungi and root knot nematodes in root rot disease complex of cotton and to optimize their control. For this purpose fifteen cotton grow...

Kamran A. Awan1, Jawad Ali2 and Mohammad Akmal3

... in the season. Grains protein was observed high for sowing made on November 15-25 for wheat varieties Dharabi, Shahkar-2013, Pakhtunkhuwa-2015 and Ghanemat-2015 as un-irrigated crop for the area. The study suggests that none of the existing wheat variety has potential to sustain grain yield of wheat if planted on December 5 or thereafter. However, Ghanemat-2015 is relatively better option over the other varieties for Peshawar.

...
Muhammad Abdullah1,*, Rashid A. khan2, Muhammad Rafay3, Tanveer Hussain3, Tahira Ruby4,Fariha Rehman5, Sangam Khalil3 and Sohail Akhtar6
...ystem is recommended to protect and promote their habitats from anthropogenic activities.
...
Tanveer Ahmad1, Hafiz Sultan Mahmood1*, Zulfiqar Ali1, Muhammad Azeem Khan2 and Shahid Zia3
...re from sisal leaves. A prototype of sisal decorticator was designed and fabricated at Agricultural and Biological Engineering Institute, National Agricultural Research Centre, Islamabad. The prototype machine was tested for fibre extraction. Results indicated that sisal fibre production capacity of this machine was 15.94 kg h-1 (dry fibre). Average yield of dry sisal fibre was 3.2% of green leaf weight and averag...
Muhammad Tariq Saeed1*, Muhammad Ashfaq Wahid1, Muhammad Farrukh Saleem1, Mumtaz Akhtar Cheema2, Muhammad Shahid1, Abdul-Shakoor1, Abdul-Sattar3
...es rich in high quality protein and oil. Its cultivation in Pakistan is restricted to few areas due to poor germination and low seed viability. The optimum yield and quality of this oil seed crop is noticeably affected by its lower germination rate. To address the problem of poor germination and low seed viability, a field study was conducted at Agronomic Research Area, University of Agriculture Faisalabad, during spring 2011. The experiment was composed of tw...

Jawad Anwar* and Zafar Iqbal 

...aureus) using 96 well microtitre plate method. The Ethyl acetate fraction showed maximum zone of inhibition (24.25±1.06 mm) against X. campestris and (23.15±2.12 mm) against C. michiganensis on growth nutrient broth (GNB) medium as compared to other culture media (Potato dextrose broth and yeast extract broth). Similarly maximum zone of inh...

Muhammad Zafarullah Khan*, Shah Saud Ahmad and Asif Nawaz 

...C i.e. cultivator (51%), rotavator (56%), mold bold plough (56%), disk plough (48%), single furrow (47%), drill (61%) and ridge maker (53%). Market was the source of seed for majority of the respondents regarding cauliflower (43%), bitter gourd (32%), bottle gourd (13%), potato (34%) and squash (29%). Similarly, majority of the respondents obtained urea (73%), SSP (54%), DAP (60%) and Nitro-Phos (55%) from the FSC whereas 91%, 99% and 96% respondents obtained ...
Shantanu Jha1, A. Rama Devi1, Ngalaton Kasar1 and Abhishek Mukherjee2
...or Advancement in Plant Protection (AAPP). Oher dignitaries attended the meeting were Prof. T. K. Maity, Dean, Faculty of Horticulture, BCKV and Prof. M. R. Ghosh, Taxonomist and Retired Professor of Agriculture Entomology, BCKV.
...
Mushtaq Ahmad1,*, Mehboob Ahmed1,2 and Nasim Ahmad1
...he steps of AO staining protocol for buffalo sperm which has not been explored yet. Semen was collected from two mature buffalo bulls, diluted in tris citrate egg yolk based extender and cryopreserved using standard protocol. The semen straws were thawed at 37oC and stained using different protocols as followed: Protocol 1 (washing effect); wa...

Abdur Rab1*, Muhammad Sajid1, Naveed Ahmad1, Khalid Nawab2, Syed Ghias Ali3

...firmness and blossom end rot (BER) incidence but significantly decreased the leaf K+ and Ca content of the fruit and yield. The foliar calcium application decreased the Na+ accumulation, Na+/ K+ ratio and BER incidence as well as increased the leaf K+ and Ca content of tomato fruit, yield and fruit firmness. The interaction of salinity and calcium significantly affected the yield and BER incidence of tomato fruit. Whereas, the yield of tomato decreased with in...
Furqan Sabir1, Muhammad Tayyab1,*, Bushra Muneer2, Abu Saeed Hashmi1, Ali Raza Awan1, Naeem Rashid3, Muhammad Wasim1 and Sehrish Firyal1
...the size of recombinant protein as 70 kDa. The optimization studies demonstrated the maximal production of recombinant phytase, when the recombinant cells were induced with 1.4 mM IPTG with the post induction time of 6 hours. PHYTN showed maximal activity at 80°C in 50 mM sodium acetate buffer pH 6. Presence of Fe3+ or Cu2+ showed an enhancing effect on the PHYTN activity. Thermostability studies demonstrated tha...
Muhammad Usman Qamar1, 2, Sidrah Saleem1, Usman Arshad1, Muhammad Farhan Rasheed3, Hasan Ejaz4, Naveed Shahzad5 and Shah Jahan6,*
...iffusion assay and microbroth dilution assay respectively. All isolates (n=5) were carbapenamase and MBL producers andNDM-1 gene carrier. These isolates displayed significant resistance against commonly used antibiotics including carbapenem and colistin proved to be most effective drug. Manuka honey manifested significant antibacterial activity against all test isolates with almost similar zone of inhibition (7.4mm) except E. cloacae. Highest MIC and MB...

Carolina Torres Alejo1,2, Laila Andreia Rodrigues Beserra1,2, Paulo Eduardo Brandão1,2, Luis Ramiro Luna Espinoza1,2 and Fabio Gregori1,2* 

...ions for the presence of rotavirus (RVA, RVD, and RVF), avian coronavirus (ACoV), and avian astrovirus (AAstV), using PCR reactions followed by nucleotide sequencing and analysis. Twenty-nine pools (29/59; 49%) appeared positive for AAstV, 6 pools (6/59; 10%) were positive for RVD, forty-three pools (43/59; 72.8%) were positive for ACoV, and twenty-four pools (24/59; 40.67%) presented concomitant viral infections of two or three investigated agents. The relati...

Muhammad Sohail1, Muhammad Nauman-ul-Islam1, Hayazuddin2*, Imtiaz Ali Shah1, Abdur Raziq1, Subhan Ullah3 and Arsalan Ali Shah1

...t (p>0.05) effect on protein, SNF and Lactose contents of the milk. These results concluded that milk yield and milk fat were increased by supplementation of MSC in the dairy cattle ration. The proportion of MSC up to 12% in the ration has shown the best efficiency of production as compare to other rations. 

...
Rana Muhammad Aadil1,2*, Xin-An Zeng1, Saqib Jabbar3, Akmal Nazir2, Abid Aslam Mann2, Muhammad Kashif Iqbal Khan2, Abdullah2, Amna Ramzan2
... in cloud value, total carotenoids, total anthocyanins, DPPH activity, total antioxidant capacity (TAC), total flavonoids (TF) and total flavonols as equated to thermal and control, while ºBrix, pH and acidity remain unchanged in all HPP treatments with control and thermal. After this, we suggested that HPP treatment (250 MPa/60 °C/3 min) has a potential against thermal to progress the value of grapefruit juice and could be applicable at industrial sc...
Aqsa Qayyum1*, Masooma Munir1, Saeeda Raza1, Mussarat Gillani1, Saima Kanwal1, Nouman Rashid1, Amer Mumtaz1, Naeem Safdar1, Zarmina Gillani2
... while ash, fat, fiber, protein, iron, zinc, magnesium and manganese contents increased significantly (p < 0.01). There was a non-significant (p > 0.05) effect on the color, flavor, taste and texture of biscuits. So, it is concluded that replacement of wheat flour with pea flour up to a level of 20% improved the nutritional potential of biscuits without affecting the consumer acceptability score.
...
Masooma Munir1,2*, Aqsa Qayyum1, Saeeda Raza1, Nouman Rashid Siddiqui1, Amer Mumtaz1, Naeem Safdar1, Sahar Shible1, Sohaib Afzal3, Saiqa Bashir4
...ood source of fiber and protein but they provide appreciable amount of minerals and phenolic compounds. Swollen basil seeds were used to prepare beverage at three supplementation levels i.e. 0.2, 0.3 and 0.4%. Sensory evaluation of basil seed drink revealed that 0.3% basil seeds supplemented drink was liked most in term of taste, texture and over all acceptability whereas 0.4% basil seeds supplemented drink were least liked as compared to other treatments. It ...
Nargis Bano and Khalid Mahmood Qureshi*
... SA levels are found to protect several species of plants against environmental stresses by initiating different processes that are involved in the mechanism of stress tolerance. SA is part of an extremely complex signal transduction network’s part and it works differently in different systems. Drought stress is a major restraint for crop production in arid and semi arid states such as Pakistan. In this study experiments were conducted against the respon...

Rabia Tahir1*, Khushi Muhammad1, Masood Rabbani1, Muti-u-Rehman Khan2, Farah Khan1, Hassan Bin Aslam1 and Arslan Mehboob

...rn of avian adenovirus serotype 4 (AAV-4) causing hydropericardium syndrome (HPS) by transovarian route. For this purpose, liver and spleen samples (n=90) were collected from day-old-chicks derived from breeders at 14, 21 and 30 days of post-infection with AAV-4. The presence of AAV-4 DNA was detected through PCR. Chicks from virus-challenged breeders failed to show a clear and expected PCR positivity. The connotations derived from these findings are that vert...
Aqsa Mehboob1, Noor Khan1,*, Usman Atiq1, Khalid Javed Iqbal2, Rafia Tayyab1, Syeda Suhaira Batool1, Hafiza Saleha Batool1, Sana Amjad1 and Mehwish Tanveer1 
...s and control for crude protein while rest of the parameters remained same. Apparent digestibility of crude protein and fat was found non-significantly different among treatments. It is concluded that addition of fenugreek in fish feed can improve growth performance and also protein content of the fish meat as well.
...

Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali

... genetic transformation protocol developed in this study will possibly improve the efficiency to produce new transgenic maize lines expressing desirable agronomic characteristics. 

...

Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3* 

...al growth factor (VEGF) protein and its family of ligands and receptors (VEGFRs). Survival, proliferation, migration and invasion of endothelial cells which give rise to the vascular network, is mediated through VEGF/VEGFR activation of the signal transduction pathways. Thus blocking VEGF is an efficient strategy for blocking tumor angiogenesis. Several anti-VEGF drugs have been developed over the last two decades and some are still at different development st...
Naheed Bano* and Muhammad Afzal
...ent in body dry matter, protein, fat, energy and ash contents of L. rohita. Acidification and phytase supplementation showed significant (P < 0.05) interaction on body composition and mineral utilization in rohu. Citric acid and phytase supplementation improves the diet by increasing the availability of minerals and quality of fish by positively affecting the body composition of fish. 3% citric acid and 1000FTU phytase proves to be interacted positiv...
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
...n methods were used and broth dilution method found simpler and most efficient for positive PCR. Primers were selected for 16s rRNA and it could detect up to 100 cfu and 250 cfu from MS and MG respectively in a samples. We have tested pure DNA of other mycoplasmas (5 species from avian origin and 3 other mycoplasmas species) but it produced only the genus specific band. The optimized ratio of tPCR primers were 1: 1: 10: 1. For Outer F, Inner R, and Inner F and...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...i>Aphis nasturtii a protocol for the prevention and control can be established.
...
Talat Bilal Yasoob and Nasir Ali Tauqir* 
..., 0.336%, respectively. Protein and energy values in all broiler starter rations were kept at 20% and 2800 kcal/kg, respectively. In second phase, six finisher rations (5-6 weeks) were formulated viz., control ration and five other rations having 0.10-0.74% levels of NaHCO3. The resulting dietary treatments were having DEB and sodium levels of 222, 240, 256, 273, 290, and 307 meq/kg and sodium levels of 0.203, 0.243, 0.283, 0.323 and 0.363%, respect...
Jiandong Wu, Miao Ye and Zaigui Wang*
...G), and low-density lipoprotein-cholesterol (LDL-C) and increasing the concentration of high-density lipoprotein-cholesterol (HDL-C).
...
Xue-yang Wang1, Shang-zhi Zhang1, Ming-hui Liu2, Dong Yu1, Yan Ma1, Dong-qiong Fei1, Hai-zhong Yu1 and Jia-ping Xu1,*
...>Armadillo (ARM)-repeat protein is involved in many biological processes, including cell–cell adhesion and the Wnt signaling pathway. However, the function of ARM-repeat protein in Bombyx mori has not been completely clarified. In this study, a gene encoding ARM-repeat protein was identified, which has an open reading fragment of 1923 bp, encoding a predicted 641 amino ...
Ayesha Aihetasham1,*, Muhammad Saeed Akhtar1, Maryam Umer1, Khalid Zamir Rasib2 and Muhammad Imran Din3
...ely.
...
Mahreen Yahya, Noor Abid Saeed*, Sajid Nadeem, Muhammad Hamed and Sajid Shokat 
...he grain yield when not protected by insecticide. Insecticide protected crops give maximum net returns. Integration of varietal resistance and insecticides showed an effective reduction of aphids and gave a significant increase in grain yield.
...
Carolina A. Bonin1,2, Eric A. Lewallen2,3, Andre J. van Wijnen3, Marta Jussara Cremer4 and Paulo C. Simões-Lopes5*
...ployed the group follow protocol, which resulted in 260 h of direct observation. Our results revealed feeding as the most frequent activity in the estuary, totaling nearly two thirds of all records. We also identified two sites of Guiana dolphin habitat preference in our study area, where sightings remarkably totalled > 62% of observation records. These sites (especially Guaraqueçaba Bay) were not only important for feeding, but also for S. guiane...
Liushuai Hua1,3, Shiping Gong1,*, Xiangjing Zhong2, Jun Tao2, Yu Chen2 and Jieming Deng2 
...reeding is an effective protection against extinction, but safe overwintering is still technically difficult to captive big-headed turtles. Determining optimal hibernation conditions is important in resolving this problem. In this study, the effects of two important environmental conditions (water depth and availability of sand beds) on changes in body weight and health status in captive big-headed turtles before and after hibernation were evaluated. Results s...
Zhenyu Chang1, Hui Zhang1, Khalid Mehmood1,2, Mujeeb Ur Rehman1, Xiaodan Yuan1, Zhaoyang Li1, Fazul Nabi1, Xiaoxing Wu1, Xinxin Tian1, Xueting Liu1, Jingen Xu3 and Donghai Zhou1,*
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
...3) as a ~24 kDa soluble protein and showed to be catalyticly active towards the model substrate 1-chloro-2,4-dinitrobenzene. The results of the present study provide new information into camelid evolution and give further insights into the diversity and complex enzymatic functions of GST superfamily.
...
Jianping Li1, Qian Jiang2, Wei Chen2, Yumei Li3, Huaizhi Jiang4, Jinlong Huo5 and Qiaoling Zhang2*
...KIT gene and its protein ingoats of different fur colors. The effect of KIT mutations on KIT protein expression was examined in white cashmere and black cashmere goats. A single A→G missense mutation in exon 13 differentiated cashmere goats with different colors. Only a histidine (H)→arginine (R) amino acid (AA) change was detected at KIT exon 13 in both the white cashmere goat and the b...
Amtul Jamil Sami1,*, Madeeha Khalid1, Rehman Shehzad1, Sana Mughal1 and A.R. Shakoori2 
...action of extracellular proteins at pH 9.5 using Tris-Glycine buffer. Placental lactogen was purified by gel filtration chromatography using Sephadex-G100 and ion exchange chromatography on DEAE- Sepharose, employing a linear salt gradient. SDS-PAGE was used to monitor the purification steps, and protein band was located by immunoblotting technique. Bubaline placental lactogen was purified to homogeneity and showed a molecul...
Jing Xin Mao1,2, Guo Wei Wang2, Yuan She Huang3, Rui Wang2, Guo Ze Wang4, Bing Zeng1 and Fu Yuan Zuo1,*
...iv>BPI is a pluripotent protein located in neutrophils and tissue that likely plays a vital role in host defense against GNB (gram-negative bacteria) and their endotoxin by means of its antibiotic and endotoxin neutralizing and disposing functions. BPI has several biological functions in mammals such as human, bovine, pig and rabbit, it also has major influence in the natural defense of the animal body. In this paper, by comparative study on BPI gene expressio...
Pei-feng Yin1,2,Xiu-xiu Li1,Qi-wei Zeng3, Cheng-chen Shen1, Le Gao1 andJian-zhang Ton2,*
... differential expressed proteins. Almost 78 patho-stress responsive proteins which expression level more than 1.5-fold were identified, where 50 proteins were up-regulated and 28 proteins were down-regulated; The identified proteins were categorized into 16 classes, which are mainly including energy metabolism, gene ex...

Muhammad Aqeel Sarwar1,2*, Muhammad Tahir2, Abid Ali3, Manzoor Hussain3, Muhammad Waheed Anwar4, Muhammad Khubaib Abuzar5 and Ijaz Ahmad

...dex (34.22 %) and grain protein content (8.56%) was obtained with (moringa green manuring).While Among fertilizer levels (100% of RDF) produced maximum plant height (189.02 cm) cob length (18.21 cm), number of grains per cob (438.7), 1000-grain weight (216.57 g), biological yield (17.79 t ha-1) grain yield (6.99 t ha-1) harvest index (39.37%) and grain protein content (8.78%). It can be concluded from above results that alon...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

.../i>) and outer membrane protein (ompA). Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isolates through subcutaneous-infection. Out of 81 E.coli isolates, the most prevalent gene detected was ompA (90.12%), followed by ETT2 (69.14%), irp2 (54.32%), EAST1 (46.91%), CS31A (41.98%), es...
Falah Baiee1,3, Wahid Haron1,*, Rosnina Yusoff1, Ariff Omar,2 Nurhusien Yimer1, Salman Hammadi1, Tarig Ahmedeltayeb1, Asmatullah Kaka4
...l as the time of penile protrusion (p = 0.003) and semen emission (p = 0.084) were improved using Method II than Method I. However, the total time taken for semen collection was the same in both methods. Also, there were no significant differences in semen parameters such as sperm volume, motility, morphology, viability, and concentration. In conclusion, gradation of electrical stimulation into three stages (our modified Method II) could help to ease the colle...
Qunhua Han1,2, Meiwen Zhang1,*, Cong Guo2, Xunjun Zhou1, Bo Li1 and Yong Wang1
...ent of Yangtze voleMicrotus fortis calamorum from birth through approximately 3 months of age with respect to growth. Vole pups were randomized into litters of 1-2 (LD, low density), 3-5 (MD, medium density), and 6-9 (HD, high density) individuals, and the body weight, body length, tail length, and hind foot length were measured and curve-fitted by using Von Bertalanffy and Logistic equations. Instantaneous growth rates and growth acceleration of...
Anan Kenthaoand Pornpimol Jearranaiprepame*
...e as source of low-cost protein in Lower Mekong Region. The present study applied multivariate morphometric technique to identify fishery management units of C. apogon from six populations of three different river drainages: Pong, Chi, and Mun Rivers. Thirty-two truss measures and standard length were obtained using digital calliper from 291 fish individuals, and raw measured data were then subjected to allometric equation to remove size-dependent varia...
Aqsa Imtiaz and Abdul Rehman*
... copper ions. A 130-kDa protein was detected from feather-treated bacterial cells, suggesting its role in degrading feather. B. subtilis BML5 can be used to overcome the poultry wastes based environmental pollution and keratinase could be used to improve feather meal digestibility in animal feed as an additive.
...
Muhammad Saqlain1, Humaira Kalsoom1, Muhammad Fiaz1,2, Abid Mahmood1, Rizwan Aziz Qazi4 ,Waseem Safdar5, Pakeeza Arzoo Shaiq1,Bernard M.Y. Cheung3 and Ghazala Kaukab Raja1,*
...inal fatty acid binding protein in the pathogenesis of MetS.
...
Muhammad Siraj-ud-Din1,2, Riaz Aziz Minhas1, Usman Ali3,*, Mayoor Khan2, Muhammad Siddique Awan1, Nuzhat Shafi1 and Basharat Ahmad1
...al could be achieved by protecting its potential habitat and preferred food plant species.
...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
...ease in live weight and protein efficiency rates when were directly compared with mock-treated fish control. However, there was no statistically supported level of significance was observed for growth rates and feed conversion rates among groups. Improved live weight and protein efficiency rates reflected positively on the survival rate in MOS-fed fish. Interestingly, the whole body and fillet fatty acid composition shown no...
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
...ddition, genes mRNA and protein levels were detected after bull testicular Sertoli cells were transfected with miR-122 and miR-449a. Meanwhile, DUSP4, PDK4 and FKBP1B overexpression experiments were conducted. Eventually, MTT assay was performed to observe the cells proliferation. The results showed that miR-122 and miR-449a were highly-expressed in testis tissues (p<0.01). The expression levels of miR-122 and miR-449a in the 24-month-o...
Bian Xunguang1,2, Li Jiancheng1, Xu Chu1 and Yang Li2,3,4,*
...bution of intracellular proteins in the oviduct of the hen, which provides an important basis for the regulation of the physiological activities of poultry oviduct and the molecular mechanism of sperm storage.
...
Tanzeela Riaz1, Farah Rauf Shakoori2,* and Syed Shahid Ali3
...ydroxylase) and soluble protein contents of a wheat grain pest, Trogoderma granarium collected from godowns of Punjab, Pakistan. Six populations of khpara beetle with different levels of susceptibility to phosphine were used in this study. Based on LC50, five populations (previously exposed to phosphine for 15 years)viz., Mandi Bahauddin-I (MBDIN-I), Mandi Bahauddin-II (MBDIN-II), Gujrat, Gujranwala and Sargodha were labeled as phosphi...
Wanrong Wei and Weiguo Zhang* 
...ernation, food storage, protection from predators and extreme environment, and the function of burrows varies with the degree of burrow complexity. We studied the burrow architecture (length, internal dimensions, fractal dimension of tunnel systems, number of nesting chambers and surface holes) by excavating the tunnels of 24 burrow systems of the plateau pika (Ochotona curzoniae). Pikas have two types of burrow systems, namely temporary and permanent b...
Tariq Mahmood*1, Syed Wasif Ahmed Shah1, Muhammad Rais1, Hira Fatima1, Faraz Akrim1 and Muhammad Sajid Nadeem2
...Columba livia, parrot Psittacula sp.and kingfisher Halcyon sp.did not show any evidence of nesting or breeding. 
...

Irfan1* , Arshad Javid2 , Muhammad Altaf3 , Muhammad Shahbaz3 , and Khalid Javed Iqbal4 

...plusmn;0.58 g/dL, total protein 5.35±0.55 g/L, urea 26.95±0.65 mg/dL, creatinine 0.83±0.01 µmol/L, alanine aminotransferase (ALT) 35.56±1.16iu/L and aspartate aminotransferase (AST) 44.16±1.83 iu/L were recorded for adult birds while alkaline phosphatase (ALP) values were significantly (P<0.05) higher 104.86±16.39 iu/L in grower birds. Similarly, the rearing systems also influenced biochemical parameters of M....

Ayesha Aihetasham1*, Khalid Zamir Rasib2, Syeda Rida Hasan1, Imran Bodlah3

...aper flower) against Heterotermes indicola. The leaf extract of C. papaya caused highest mortality i.e. 100% of 10%, 5% and 3% concentration. Bougainvillea glabra and H. annus caused 100% mortality at 10% and 5% concentration while 96.4% mortality on 3% concentration after exposure period of 10 hours. B. glabra extracts also caused 100% mortality on 10% and 5% concentration while 96.4% mortality on 3% concentration. C. papaya showed the minimum LT50 of 3.03, 3...

Naeem Iftikhar1, Qamar Zaman Qamar2, Usman Ali3, Muhammad Siddique Awan4, Syeda Shaista Bibi4, Riaz Aziz Minhas4*

...s potential habitats as protected area to ensure the further survival of this important species.

...

 Asma Akhtar, Abdul Rehman

...al pattern of bacterial proteins in tellurite stress was obtained by SDS-PAGE. Both bacterial strains can be utilized to convert toxic tellurite into its elemental form from the contaminated sites.

...

Hafiz Muhammad Tahir1, Khanum Zahra2, Arooj Zaheer2, Khizar Samiullah3

... categorized as fibrous protein. Spiders produce several types of silk. Spider silk is important because of its maximum mechanical strength, biocompatibility and biodegradability, pore filling ability and very low immunogenicity. In this review structure and types of silk producing gland, spinning process, chemistry of spider silk fiber, mechanical properties and applications of silk in health, military industry and many other fields is discussed. Its antifung...
Ayesha Aihetasham1,*, Humaira Aziz1 and Khalid Zamir Rasib2
...d in soil against Heterotermes indicola. Treatment with Pronil and Mirage during 8 h caused less than 97% mortality in 8 h. LC50 values for Pronil and Mirage were 39.81 ppm and 177.32 ppm, respectively. Pronil was found more toxic than Mirage with low LC50 value however both insecticides revealed to be non-repellent against H. indicola.
...

Soraya Khosravian Dehordi*, Abdolnaser Mohebbi and Kahin Shahanipour

...(gavage) given to rates.Protein carbonyls (PC) andthiobarbituric acid reactive substances (TBARS),superoxide dismutase (SOD) glutathione peroxidase (GPx) and catalase (CAT) values in spleen were measured. An increase in TBARS and PC levels was obtained in rats' spleen of the Cd-group than controls and nano-Se decreased this effect close to the control. The CAT values of all groups did not differ significantly. The values of SOD and GPx were reduced in splenic ...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4 and Lorenzo Gallus
...al floating pellet (35% protein) at 3% body weight per day for 40 days. Results showed that fish growth was significantly (P<0.05) higher in term of weight gain, WG % of initial weight, mean daily WG, SGR, feed conversion and survival rate from 15‰ to 30‰ salinity than those reared in 35‰ and 40‰ salinity. Condition factor was found to be significantly higher on 40‰ salinity than 15‰ to 35‰ salinity. Feed con...
RuiHua Zhang, YongFang Jia, TingTing Liang, QianWen Yang, QiYan Du and ZhongJie Chang*
... 784 and 602 amino acid protein, respectively. Chromosome synteny analyses revealed that CcSox5 and CcSox13 weretightly linked with the etnk gene, which was conserved in all species; however, there were no conserved regions flanking CcSox6. Numerous essential transcription factor binding sites (TFs) were predicted within the 2000 bp upstream of the 5’ end of these genes. These TFs include BSX, BRN4 and NGN–NEUROD, which have be...
Yunjun Yan, Zhenming Lü, Tianming Wang, Yongjiu Chen, Jingwen Yang, Baoying Guo, Lihua Jiang, Changwen Wu and Liqin Liu*
...de pairs and encodes 13 proteins, 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a major long noncoding region (LNCR) of the mitochondrion’s own protein synthesizing system. Seven of thirteen proteins, eight tRNAs are encoded by the plus strand, while the other proteins and tRNAs, as well as two rRNAs are encoded by the minus strand. Two (N...
Qamar-un-Nisa1, Muhammad Younus2,*, Muti-ur-Rehman1, Azhar Maqbool3 and Sajid Umar4

 

...r vNDV, E. coli serotype O78 or both agents simultaneously or 3 days apart. The birds were clinically observed and swabbed daily. They were killed at 4 and 14 days after single or dual inoculations and were inspected for gross lesions. Samples of the respiratory organs (trachea, lungs, and air sacs) were taken for histological analyses. All the infected subjects showed clinical signs of varying severity. Co-infected groups showed the most obvious clinic...
Tahira Kamal1*, Saeed-Ul-Hassan Khan2, Amir Bin Zahoor3, Khalid Naeem3, Muhammad Naeem Riaz1, Siddra Tayyab Akhtar4, Ghulam Muhammad Ali1*
...aviridae. It has seven serotypes with no cross protection among these. FMD is responsible for heavy economic losses in cattle and buffalo. So rapid and accurate diagnosis of FMD is uttermost need of this time. Several lab.techniques are developed for rapid detection of FMD but these are expensive and time consuming. Elisa, cell culture, Reverse Transcriptase (RT-PCR) and real time PCR need specific high quality equipments in...

Ayesha Bibi*, Musharaf Ahmad and Shaukat Hussain 

...ally available kit i.e. protinase-K (sigma). 27 out of 34 isolates were confirmed as Cmm having 614bp band. Black nightshade (Solanum nigrum L) was the only weed from which pathogen was consistently isolated. From Northern KP, a total of nine weeds including; Solanum nigrum L., Solanum americanum Mill., Solanum Sarrachoides Sedntner, Amaranthus blitoides S. Wats, Amaranthus albus L., Lactuca serriola L., Amaranthus retroflexus L., Malva parviflora L. and Sisym...
Shahid Mehmood1,*, Bushra Nisar Khan1, Hassan Raza1, Rida Ahmad1, Azhar Muhammad3, Zulfiqar Ali2, Farhan Abid1, Fehmeeda Bibi4 and Syed Maviz Ahmed5
...urgent need to save and protect bird diversity by maintaining the suitable habitat of the area.
...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4, Lorenzo Gallus4 and Syed Sajjad A. Shah2,3
... constituting 35% crude protein with 2% body weight twice a day. Eggs were collected on weekly basis by cultch removal method. Results showed that the highest fecundity, fertility, hatchability and survival of fry were obtained on salinity of 0%-15% and significantly decreased on 20‰ and 25‰. The eggs per gram body weight were also recorded in all treatments and highest eggs were obtained i.e. 4.0-4.3 per female on 0‰-15‰. Wa...
Jo Ik-Hwan1, Choi Kwang-Won1 and Muhammad Fiaz2,*
...eased (P<0.05) crude protein (CP) yield and carrying capacity for Hanwoo heifers than that of rye monoculture. DM and TDN yield under 100 kg manure was higher (P<0.05) than control and 50 kg N/ha levels but not different (P>0.05) with that of 150 kg N/ha. Manure levels did not affect (P>0.05) protein yield. The carrying capacity for Hanwoo heifers was not different among zero, 50 and 100 kg manure levels, whereas...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Ghulam Dastagir4, Sara Ferrando5, Lorenzo Gallus5, Asad Ali Muhammad1,6, Abdul Jabbar2 and Khalil-ur-Rehman2 
...al floating pellet (35% protein) with 3% of total biomass day-1 for 50 days. Results showed that the growth increment reared on 10‰ - 20‰ salinity were significantly highest in term of weight gain, WG % of initial weight, daily weight gain, specific growth rate, condition factor and survival rate than those reared on 25‰ and 30‰. Feed conversion ratio was found similar in all levels which is not significantly different (<...

Arooj Fatima1* and Ashfaq Ahmed

...raining in patients with rotator cuff (RC) tendinopathy. This single blinded randomized clinical trial was conducted at University Physical therapy and Rehabilitation clinic, Raiwind road, Lahore. The study included sample size of 50 subjects diagnosed with rotator cuff tendinopathy. Patients included in study were allocated randomly into; Group-A: This group was treated with routine physiotherapy treatment. Group-B: In this...

Bashir Ahmad1*, Ahmad-Ur-Rahman Saljoqi1, Hayad Zada2, Shahid Sattar1, Toheed Iqbal3, Saddam Hussain1 and Muhammad Saeed4 

...lign: justify;">Under unprotected condition study was carried out during the months from July to November in the year 2012 and 2013 to investigate population dynamics and observe the impact of temperature, relative humidity and rainfall on population of Plutella xylostella (L.) in Cauliflower, Brassica oleracea crop at District Haripur of Khyber Pakhtunkhwa. Field studies results showed that the population of P. xylostella gradually increased from mid of July ...
Muhammad Hafeez-ur-Rehman1,Farzana Abbas2,Ghulam Abbas3,*, Arshad Javid4, Ali Hussain4, Syedah Andleeb5,Khalid Javed Iqbal6 and Muhammad Akmal1

 

...ct of different dietary protein levels on the growth and chemical conformation of broodfish and its eggs. There were three treatments (T1, T2 and T3) and a control with three replicates in each group. Control group was exclusively fed on natural food composed of tilapia fry while fish in T1 was fed on 30%, T2 on 35% and T3 on 40% protein diet, respectively. A ...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5

 

...ize an in-vitro culture protocol for propagation of an endangered medicinal plant Neurada procumbens L. from Cholistan desert in Pakistan. Nodal segments from healthy grown plants were used as explants and cultured on standard Murashige and Skoog (MS) medium supplemented with different concentrations and combinations of benzyl amino purine (BAP) or kinetin for shoot induction and Indole acetic acid (IAA) for primary shoot and Indole Butyric acid (IBA) f...
Muhammad Aqeel Sarwar1*, Abid Ali2, Manzoor Hussain2, Saadia3, Muhammad Khubaib Abuzar4, Ijaz Ahmad5 and Sohail Latif6
...5.40 t ha-1) protein contents (12.52%), nitrogen (28.22kg kg-1), phosphorus (34.85 kg kg-1) and potassium (47.40 kg kg-1) use efficiency were obtained with the treatment F2 (100% recommended dose of NPK).While in seed inoculants, maximum values of yield and yield contributing parameters were obtained in I1 (Inoculation with Azospirillum). However despite the better performance of F2<...
Yanjie Guo1, Weini Wu1, Hongmei Wang2, Xiao Guo2 and Yongping Xu2,*
... IL-18Rα mRNA and proteins are expressed in the IMG, which provides molecular evidence for the study of immune and neuro-modulation in the female reproductive system.
...

Muhammad Naeem Safdar, Khalid Naseem, Muhammad Amjad, Amer Mumtaz and Saeeda Raza*

... grains, moisture, ash, protein (N x 5.7), wet and dry gluten, falling number, and minerals (copper, manganese, iron, zinc). It was observed that wheat samples varied considerably within each region and also between regions. Attock region samples had highest test weight (80.50 kg hl -1), protein (11.80 %) and lowest nonedible foreign matter (0.45%) and broken/shrunken grains (0.88 %). Highest wet and dry gluten (27.44 % and ...

Raania Ahsan* and Zafar Altaf**

...t cotton production and protection in the country. Bt cotton can play a significant role to enhance agricultural productivity as the productivity of cotton in Pakistan 0.5 t ha-1, as compared productivity of Bt cotton in China 9 t ha_1, which implies a huge cotton productivity gap. This gap can be narrowed down by the adoption of Bt cotton in Pakistan which will have major impact on food security efforts in the country. The findings of literature review reveal...

 Nasreen Sultana* and A.Ghaffar**

...omae , the cause of seed rot, seedling and root infection on bottle gourd was studied in vitro and in vivo. Carbendazim and Topsin-M completely inhibited the growth of L. theobromae in vitro at 50 ppm whereas Aliette, Benlate, Mancozeb, Ridomil and Vitavax showed complete inhibition of colony growth at 100 ppm. Invariably all fungicides at three different concentration viz., 1, 2, 3 g (a.i.) kg-1 seeds reduced the recovery of the seed borne fungi. The most eff...

 Abdullah Adil Ansari* and Kumar Sukhraj**

... percentage of fats and protein content in VW+VC when compared with those grown with chemical fertilizers by 23.86% and 19.86%, respectively. The combination treatment [VW+VC] also have a significant influence on the biochemical characteristics of the soil with marked improvement in soil micronutrients. The combination treatment [VW+VC] was found better suggesting qualitative improvement in the physical and chemical properties of the soil, which is substantiat...

 S. Shahid Shaukat*, Mian Sayed**, Aly Khan, M. Azhar Khan* and Babar Qazi***

 Oguz Bilgin, Kayihan Z. Korkut, Alpay Balkan, and Ismet Baser*

...valuate magnitude of heterotic effects in F1 hybrids of seven durum wheat cultivars, and to investigate the performance and relationship of F1 hybrids and parents for the spike characters and to select suitable parents and population for designing an effective wheat breeding programme. Highly significant genetic variability was present in parents and their genetic combinations for the characters. The degree and direction of heterosis varied for different chara...

 Shazia Erum, Rashid Anwar and Shahid Masood*

... analysis of total seed proteins of Kasuri methi (GI of Kasur, Pakistan) was evaluated with other Trigonella genotypes by SDS-PAGE. Results showed that at protein level Kasuri methi acquired a unique status as a G.I of Kasur. Cluster analysis (UPGMA) of 28 genotypes including both methi and methray from various agro ecological zones of Pakistan were interlinked to some extent however Kasuri methi make their identity by stand...

 Sarfraz Ahmad, Shaista Koukab, Nayyar Razzaq, Muhammad Islam, Aneel Rose*, and Muhammad Aslam**

...found naturally in many protected rangelands areas. However, its population is declining due to over-exploitation and un-controlled grazing. Traditionally these species are used for the treatment of fever and pain. Annual or German chamomile (Matricaria recutita L.), and perennial chamomile (Chamaemelum nobile) are the most important species all over the world due to multipurpose uses. Field experiments were conducted at Arid Zone Research Centre, Quetta to ev...

 Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*

...the basis of total seed protein and phenotypic characters, except Siam Queen and Lime basil stand alone, respectively. Euclidian distance for morphological traits ranged from 3.60 to 7.26. Conversely on the basis of total seed proteins genetic distances ranged from 0.11 to 1.00. Due to greater genetic diversity in Ocimum germplasm and its suitability for commercial cultivation even in the area under small holdings, the inves...

Muhammad Athar Khan1, Muhammad Zahid Latif2*, Syed Amir Gilani3 and Ifrah Bukhari4 

...rice cultivators should protect their body parts with gloves or boots as prevention is the most appropriate way to control any disease. 

...

Iracema Nunes de Barros1,2, Luciane Dubina Pinto3, Rosely Bianca dos Santos Kuroda1, Sheila Oliveira de Souza Silva1, Leonardo José Richtzenhain1,2, Cláudio Wageck Canal3 and Paulo Eduardo Brandão1,2* 

... (N) and non-structural protein 3b genes. Out of the samples collected, 40.17% were positive for CCoV; 57.45% of CCoV-infected animals showed enteritis and most of these (76%) were younger than 3 months and unvaccinated. Distance genealogy using CCoV sequences from GenBank for M gene showed that eight strains were CCoV-II twenty-six were CCoV-I. These findings show some genetic features of CCoV in Brazil and may require future studies to elucidate full genome ...
Maryyum Khalil1, Hamda Azmat1,*, Noor Khan1, Arshad Javid2, Ali Hussain1, Syed Makhdoom Hussain3, Asim Ullah1 and Sumaira Abbas1
...;0.36 g). The 40% crude protein diet was prepared by adding feed ingredients along with 0.75, 0.50, 0.25, 0.00 g kg-1 of α-amylase as T1, T2, T3 and T4 (control). At the end of feeding trial, 100% survival rate was recorded. Growth rate was significantly increased in fish fed with enzyme supplemented diets in comparison with control group. The maximum increase in growth rate was recorded in treatment # 2. Highest prot<...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...o 974 base pairs. The S protein sequence was submitted to the GenBank with accession number KU145467. Phylogenetic grouping and maximum nucleotide sequence identity values were used to identify the isolate that looked to be derived from recombination. It showed maximum nucleotide homology 99.5% with ck/CH/LHB/121010 (KP036503), India/IBV572 (KF809797) and Japan/JP/Wakayama-2/2004 (AB363951.2) and 99.3% with 4/91 vaccine (KF377577), Iran/491/08 (HQ842715) and 9...
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2

 

...T. castaneum enzyme protein. Computational studies inidicate that A. mellifera enzyme had a little binding affinity for saponin as compared to T. castaneum AChE. The amino acid residues of T. castaneum AChE identified at positions 259(SER), 176(SER), 173(GLY), and 502 (HIS) are involved in binding with saponin molecule to form four hydrogen bonds. Whereas in A. mellifera hydrogen bonds are formed at two positions by SER 171 and ...
Haixia Liu, Yuwei Ye, Yang Li, Xiaolin Liu, Dongmei Xiong* and Lixin Wang
...y will be vital for the protection and restoration of this endangered species.
...
Qin Liu1,2, Feiwei Liu1, Xiuyue Zhang1, Nan Yang1 and Jianghong Ran1,*
...ndemic species which is protected in first-grade state in China. Here, 22 polymorphic tetranucleotide microsatellite markers were isolated from T. szechenyii using a next-generation sequencing technology. The allele number of these loci ranged from two to six in genotyped 35 individuals. Polymorphism information content ranged from 0.2735 to 0.7717 with an average of 0.5149. Observed and expected heterozygosities at each locus ranged from 0 to 0.879 and...

Imtiaz Hussain*, Hassnain Shah, M. Azeem Khan, Waqar Akhtar**, Abdul Majid*** and M. Yaqub Mujahid*

Corresponding author:izhussain@yahoo.com

PRODUCTIVITY IN RICE-WHEAT CROP ROTATION OF PUNJAB: AN APPLICATION OF TYPICAL FARM METHODOLOGY
...ly crop that breaks this rotation. Farmers are aware of the beneficial effects of this crop rotation and believed that this riceberseem rotation control weeds in the next wheat crop along with yield -1 -1 improvement of both rice (upto 5.4 md acre ) and wheat (4.4 md acre ). However there is need to assess the economic impact and evaluation of berseem in rice-wheat cropping system and eval...

Akhlaq Ahmad, M. Anwar Arain*, Rahila Nazli**, Syed Anser Rizvi***,
Mubarik Ahmed* and Farzana Ibrahim****

Corresponding author: dr.akhlaqahmad@yahoo.com

COST EFFECTIVENESS OF UNDER-SHEET AND WHOLE GODOWN FUMIGATION OF BAGGED WHEAT
...and feasible method for protection of stored cereals, and need to be implemented at the provincial and national levels.

 

...

 A. N. Naqvi and K. Fatima*

INCIDENCE OF LIVESTOCK DISEASES IN NOMAL AND NALTAR VALLEYS GILGIT, PAKISTAN
...lue tongue, cow pox, enterotoxaemia, tetanus, paralysis and arthritis. In precise, endoparasites were found in 25.3% animals followed by respiratory diseases (24.74%). Most of the cattle (2053) and sheep (926) were found affected with endoparasites, whereas most of the goats (3960) were suffering from respiratory disorders. The seasonal data indicated that the incidence of diseases prevailed was high (33.94%) in winter while it was as low as 14.18% in summer.&...

 Gulzar S. Sanghera and Wassem Hussain*

HETEROSIS IN RELATION TO COMBINING ABILITY PER SE PERFORMANCE IN TEMPERATE RICE (ORYZA SATIVA L.)
...ted to find out best heterotic combinations in terms of yield and yield components of rice (Oryza sativa L.). Analysis of variance revealed significant differences among genotypes, crosses, lines, testers and line x tester interactions for all the traits studied. The specific combining ability (SCA) effects along with per se performance revealed that some of the crosses have shown desirable SCA effects, having superior per se performance for most of the traits...

 Saima Rani and Irum Raza*

COMPARISON OF TREND ANALYSIS AND DOUBLE EXPONENTIAL SMOOTHING METHODS FOR PRICE ESTIMATION OF MAJOR PULSES IN PAKISTAN
...pensive livestock-based protein-rich food will be badly affected.

...

 Munir Ahmad* and Asif Ali Mirani**

HEATED AIR DRYING OF GROUNDNUT
...oundnut contains 25-32% protein and 42-52% oil, therefore, it has the potential to become a significant contributor to edible oil production in Pakistan. It is harvested in October-November in Pakistan, when the weather is cold, and it is not possible to dry it down to a safe moisture level by sun drying. Therefore, the chance for developing aflatoxins in it is high. To solve this problem of the groundnut growers, a low cost mobile flat-bed dryer designed and ...

 A.A. Mengal* , M. U. Mallah, Z. A. Mirani* and B. N. Siddiqui**

AN ANALYSIS OF PUBLIC AND PRIVATE AGRICULTURAL EXTENSION SERVICES IN BALOCHISTAN, PAKISTAN
...ce for the use of plant protection measures. Significant differences were observed between public and private extension field staff on various statements regarding competency level and agronomic practices.

...

 Amir Khatam*, Sher Muhammad and Ijaz Ashraf** 

ROLE OF FARMER FIELD SCHOOLS IN ENHANCING SKILLS OF FARMING COMMUNITY IN KHYBER PAKHTUNKHWA, PAKISTAN
...ll improvement in plant protection especially in the area of insect pests identification was ranked st 1 with mean value 3.22 closely followed by insect pests control by local nd rd recipes and their mass killing which were ranked 2 and 3 with mean values 3.03 and 2.84, respectively. Likewise, chemical and manual weed st nd control measures were ranked 1 and 2 with mean values 2.99 and 2.97, respectively. Correspondingly, farmers' skills in furrow irrigation w...

 Sara Khalid*, Khalid Mahmood Qureshi*, Ishfaq Ahmad Hafiz*, Khalid Saifullah Khan* and Usman Shaukat Qureshi*

EFFECT OF ORGANIC AMENDMENTS ON VEGETATIVE GROWTH, FRUIT AND YIELD QUALITY OF STRAWBERRY
...re utilized globally to protect our environment and prevent health issues resulting from pesticides and hazardous chemicals. In this regard, studies were conducted using six different organic amendments on strawberry (Fragaria ananassa Duch.) cv. Chandler which included T = planting 1 media -1 (soil + silt + farm yard manure); T = planting media + 400 mgl humic 2 -1 acid; T = planting media + 200 g kg leaf manure; T = planting media + 200 3 4 -1 -1 g kg vermic...

 Naheed Zahra*, Muhammad Zubair Anwar*, Sonila Hassan** and Irfan Mehmood**

INSTITUTIONAL CREDIT ARRANGEMENT AND THEIR IMPLICATION ON AGRICULTURAL INCOME IN THE SELECTED VILLAGES OF RAWALPINDI DISTRICT
...ce the credit policy to protect the interest of small and medium farmers by providing them loans on easy terms and to facilitate them against any natural hazards and disaster.

...

 Nasia Batool*, Imtiaz Ahmad Qamar**, Imdad Hussain Mirza** and Muhammad Fateh Ullah Khan**

MIXING LESS PALATABLE GRASSES WITH UREA, MOLASSES AND EFFECTIVE MICROORGANISMS AND ITS EFFECT ON CHEMICAL COMPOSITION AND DIGESTIBILITY IN GOATS
... was carried out. Crude protein content of mixtures improved as compared with sole grasses. Digestibility of HC supplemented with urea, molasses and EM in various combinations was also studied in growing goats. The highest digestibility of DM in goats was recorded in HC + 4% urea + 4% molasses treatment (85.51%) followed by HC + 4% urea (78.57%) and HC + 4% urea + 4% molasses + 1:100 EM (78.00%).

...

 Khalid Naseem*, Naseem Bibi**, Saeeda Raza*, Amer Mumtaz*, Nouman Rashid Siddiqui*, Amina Bibi*** and Muhammad Ahsan Khan****

DEVELOPMENT, CHARACTERIZATION AND EVALUATION OF HIGH ENERGY BISCUITS FOR COMBATING MALNOURISHMENT AMONG CHILDREN IN PAKISTAN
... the highest values for protein, zinc and iron. Results of all treatments were in acceptable range regarding sensory evaluation. These results indicate that biscuits can be successfully supplemented with chickpea and oat. According to sensory evaluation, biscuits containing 20% chickpea and 15% oat were found to be the best among all treatments and could be a potential composition for preparing high energy biscuits for malnourished areas of Pakistan.

...

Ayesha Tahir* and Sonila Hassan**

ECONOMIC FEASIBILITY OF SMALL SCALE BUTTON MUSHROOM PRODUCTION IN PAKISTAN
... widely cultivated as a proteineous vegetable in many countries of the world including Pakistan. Its cultivation requires less space, care, equipment and cost compared to many other crops and livestock. The present study was conducted in 2010 to estimate the profitability of small scale button mushroom production at National Agricultural Research Centre (NARC) Islamabad, Pakistan. The cost of production methodology was used for this study. The yield and gross ...

 Adnan Umair*, Safdar Ali**, Muhammad Sarwar***, Kashif Bashir**, Muhammad Javed Tareen**** and Muhammad Asghar Malik*****

ASSESSMENT OF SOME PRIMING TECHNIQUES IN MUNGBEAN (VIGNA RADIATA) : A GREEN HOUSE STUDY
...iming also improved the protein concentration at the early stage of seedlings. Phosphorous application through priming significantly improved germination up to 95%, seedling -1 vigour index up to 23.05 and protein content up to 2.17 (g FW).

...

 Javed Khan*, Ehsan-ul-Haq*, Habib Iqbal Javed*, Tariq Mahmood*,
Awais Rasool*, Naheed Akhtar and Saleem Abid**

BIOLOGICAL PARAMETERS AND PREDATORY POTENTIAL OF CHRYSOPERLA CARNEA (NEUROPTERA: CHRYSOPIDAE) FEEDING ON WHEAT APHID SCHIZAPHIS GRAMINUM (HEMIPTERA: APHIDIDAE) UNDER LABORATORY CONDITIONS
...Plant and Environmental Protection, National Agricultural Research Centre, Islamabad, Pakistan. The results indicate that incubation period was 3.8±0.08 days with 87.0% hatchability. The developmental duration of first, second and third instar larvae were 3.2 ± 0.13, 4.0±0.21 and 4.8±0.25 days, respectively. The total larval developmental duration was 12.0 ±0.67 days with 85.05% survival rate of larvae. The larval predatory p...

 Imtiaz Ahmad Qamar*, Maqsood Ahmad*, Gulshan Riaz* and Sartaj Khan*

PERFORMANCE OF SUMMER FORAGE LEGUMES AND THEIR RESIDUAL EFFECT ON SUBSEQUENT OAT CROP IN SUBTROPICAL SUBHUMID POTHWAR, PAKISTAN
...n had the highest crude protein content (23.2 %) followed by cowpea (22.6 %), lablab bean (21.6 %), rice bean (20.1 %) and sesbania (19.1 %). Millet had the lowest crude protein content of 6.2%. Dry matter yield of oats owing to the previous crops was least after millet (7.5 -1 -1 tha ) and ranged from 8.5 to 8.9 tha after sesbania, cluster bean and cowpeas. Differences in crude protein co...

 Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*

 
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
...lage number (64), crude protein (CP) content (8.64%), in vitro organic matter (OM) digestibility (47.36%) On the other hand, B. mulato had highest tillage number (117) and DM yield (0.79 kg -2 DMm ). Legume herb species affected significantly (P<0.05) plant height, yield, in vitro digestibility. At 8 weeks of age Dolichos lablab showed the -2 highest plant height (189 cm), DM yield (0.45 kg DM m ) and in vitro OM digestibility (71.12%). The nutrient content...

 Asghar Ali*, Muhammad Tahir**, Shahid Riaz Malik* and Muhammad Hanif Munawwar*

EVALUATION OF PRE AND POST-EMERGENCE HERBICIDES FOR WEED MANAGEMENT IN LENTIL (LENS CULINARIS MEDIK.)
...herbicide treatments Isoproturon as pre-emergence @ 2 kg -1 ha produced statistically at par grain yield to that of manual weeding -1 followed by Isoproturon after one month of planting @ 2 kg ha . Both the treatments showed 193.9% and 109.2% yield increase, respectively, over -1 the check. It indicates that Isoproturon @ 2 kg ha can be used pre or postemergence in lentil fields to control...

 Nazir Ahmad*, Sultan Ayaz*, Sumaira Shams**, Karimullah*** and Riaz Ahmad****

PREVALENCE AND MORPHOLOGY OF HELMINTH PARASITES OF FISH FROM RIVER SWAT, KHYBER PAKHTUNKHWA
...potaenia, Cucullanidae, Proteocephalus, Rhabdochona charsaddiensis, Rhabdochona schizothoracis and Neoechynorhynchus devdevi. They were identified by morphological characteristics through microscopic techniques. Overall prevalence of the fish parasites was 58% (145/250). Among these Schizothorax plageostomus fish 93.04% (107/115), Schizothorax labiatus 61.11% (33/54), Salmo trutta fario 17.85% (05/28), Gara gotyla 0% (0/09), Rita rita 0% (0/25) and Oncorhynchu...

 Saima Rani*, Hassnain Shah*, Umar Farooq** and Bushra Rehman**

SUPPLY, DEMAND, AND POLICY ENVIRONMENT FOR PULSES IN PAKISTAN
...ation in fulfilling the protein demand. Hence there is need to increase production through improving management practices and dissemination of improved technologies.

...

 Syeda Nasreen*, Mehwish Ishaque**, Muhammad Ayub Khan*, Saleem-ud-din* and Syeda Musarrat Gilani*

COMBINING ABILITY ANALYSIS FOR SEED PROTEINS, OIL CONTENT AND FATTY ACIDS COMPOSITION IN SUNFLOWER (HELIANTHUS ANNUUS L.)
...lues for seed 1 1 total proteins, oil content and fatty acids composition. Among parental lines, CMS-64, CMS-53, CMS-H55-2-2-1 and CMS-53 were the best general combiners for seed total proteins, oil content, oleic and linoleic acid, respectively. Among males, C-206-R, SF-187R, RHA-295 and RHA-854 were the potential parents exhibiting desirable GCA for seed total proteins, oil content, olei...

 Muhammad Ali*, Ghulam Mustafa Sajid**, M. Faisal Anwar Malik*** and Kalimullah****

ESTABLISHMENT OF IN VITRO CULTURE OF GRAPES
...on. In conclusion, this protocol proved to be useful in optimizing the dose and duration of the treatment of grape explants with the surface disinfectant.

...

 Aniqa Iram*, Javed Khan**, Nadeem Aslam**, Ehsan-ul-Haq**, Habib Iqbal Javed**, Muhammad Irfan*, Awais Rasool*, Muhammad Ishaque Mastoi** and Sumera Aslam* 

EFFICACY OF PLANT DERIVED OILS AND EXTRACTS AGAINST WHITEFLY, BEMISIA TABACI (GENNADIUS) ON SESAME CROP
...ial to be used in plant protection strategies but still more research has to be incorporated in the pest management programmes.

...

 ZafarUllah*, Muhammad Azim Malik*, Muhammad Ansar*, Shahzada Sohail Ijaz* and Muhammad Rasheed*

WINTER FORAGE QUALITY OF OATS (AVENA SATIVA), BARLEY (HORDEUM VULGARE) AND VETCH (VICIA SATIVA) IN PURE STAND AND CEREAL LEGUME MIXTURE
... higher values of crude protein (CP) and lower values of neutral detergent fiber (NDF) and acid detergent fiber (ADF) reflected quality forage. CP for oats in oats-vetch -1 -1 mixture and barley in barley-vetch mixture was 175 g kg and 170 g kg , -1 respectively. NDF and ADF for oats in oats-vetch mixture were 494 g kg -1 and 341 g kg , respectively; while these values for barley in barley-vetch -1 -1 mixture were 340 g kg and 176 g kg , respectively.

...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Abdul Razzaq*

EFFECT OF MIXING LOW PALATABLE GRASSES AND IPIL IPIL LEAVES ON FORAGE QUALITY
...imate parameters (crude protein (CP), crude fiber (CF), total ash and ether extract (EE)). The results revealed that there were significant differences in dry matter (DM) among different grasses. DM content of low palatable grasses was generally high (70-75%) as compared to Ipil ipil leaves (45-55%). DM content among mixtures was also variable. For the treatment grass 75% + Ipil ipil 25%, DM range was 65-70%, for grass 50% + Ipil ipil 50%, it was 60-65% and fo...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*

EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
... dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in general more digestible with more than 65% dry matter digestibility. The lowest digestibility of dry matter (41.66%) was observed in HC 100%. A similar trend was noted for CP digestibility. However, ...

 Muhammad Ayub*, Rizwan Maqbool*, Muhammad Tahir*, Zoaib Aslam*, Muhammad Ather Nadeem* and Muhammad Ibrahim**

IMPROVED GROWTH, SEED YIELD AND QUALITY OF FENNEL (FOENICULUM VULGARE MILL.) THROUGH SOIL APPLIED NITROGEN AND PHOSPHORUS
...rvest index by 162% and protein content by 6%. However, fertilizer NP -1 (90:45 kg ha ) decreased oil content by 26%. Therefore, addition of NP fertilizer had the potential to increase fennel seed yield, but reduce oil content, under Faisalabad conditions.

...

 Mazher Abbas*, Irfan Mehmood*, Arshed Bashir*, Muhammad Ather Mehmood* and Sonila Hassan* 

WOMEN COTTON PICKERS PERCEPTIONS ABOUT HEALTH HAZARDS DUE TO PESTICIDE USE IN IRRIGATED PUNJAB
...and only 10% women wear protective clothes during cotton picking. Majority of the respondents (76%) wash their clothes after cotton picking whereas almost all the respondents wash their hand after cotton picking. The women cotton pickers faced health problem, tiredness (54.5%), mental disturbance (9.90%) and fatigue (8.00%). More than 58% women reported their involvement in household decision making regarding food and groceries while 30.6% women involved in de...

 Muhammad Akhter*, Muhammad Azhar Ali**, Zulqarnain Haider* and Shahzad Muzammil***

PHYSICO-CHEMICAL CHANGES IN GRAINS OF SOME ADVANCE LINES/ VARIETIES OF RICE (ORYZA SATIVA L.) AFTER PARBOILING
...atter, crude fat, crude protein, crude fiber, vitamin B6; milling quality parameters such as total milling recovery, head rice recovery, ratio of broken grains and cooking quality parameters such as curling, bursting and cooked grain length. The study showed significant variation in efficacy of parboiling to different varieties/lines. The results clearly showed average increase in mineral contents in terms of ash% increase, dry matter, longer cooked grain leng...

 Riaz Hussain*, Muhammad Riaz**, Mushtaq A. Saleem*** and Muhammad Ishaque Mastoi**

BIOCHEMICAL ABNORMALITIES INDUCED BY ABAMECTIN IN SIXTH INSTAR LARVAE OF THE RED FLOUR BEETLE, TRIBOLIUM CASTANEUM (HERBST)
...hosphatase (AcP), total protein, soluble protein and free amino acids (FAA). The sixth instar larvae of T. castaneum were released and exposed for 48h without food on abamectin treated glass petri dishes. The surviving ones were then homogenized in saline and centrifuged prior to biochemical analyses. Results showed differences in the activities of enzymes and quantities of total protein, ...

 Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed**** 

IMPROVING FODDER QUALITY OF PANICUM GRASS THROUGH INTERCROPPING OF LEGUMES AND THEIR INOCULATION
...eatments.

...

 Said Salman*, Shah Jehan Khan* and Javed Khan**

HETEROSIS AND HETROBELTIOSIS PERFORMANCE OF MORPHOLOGICAL TRAITS IN BREAD WHEAT CROSSES UNDER DROUGHT STRESS CONDITIONS
...igned to observe the heterotic and heterobeltiotic effects in F s of four different crosses having four drought 1 tolerant cultivars and four susceptible lines as parents. The experiment was conducted at the Faculty of Agriculture, Gomal University, Dera Ismail Khan, Pakistan during 2012-13. The performance of crosses and their parents were evaluated with three replications. These crosses were -1 evaluated for plant height, number of tillers plant , days to 50...

 Muhammad Mohsin Raza*, Muhammad Aslam Khan*, Irfan Ahmad**, Ali Ahsan Bajwa***, Hafiz Muhammad Usman Aslam*, Badar Ahsan Ullah****, and Kashif Riaz*

FOREST PATHOGENS AND DISEASES UNDER CHANGING CLIMATE -A REVIEW
...ated migration, genetic protection and breeding for disease resistance and relating results to forest policy, planning as well as decision making, the suspicions innate to climate change effects can be minimized.

...

 Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**

EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...ative analysis of total protein and phenolic compounds, respectively. Proteins were greatly affected by fertilizer treatment and water stress, but phenolic compounds remained unchanged upon fertilizer treatment. However, they were greatly affected by irrigation and water -1 stress. Crop treated with 100 kg ha P O under water stress maintained high 2 5 protein content as compared to unferti...

 Saima Kanwal*, Saeeda Raza*, Khalid Naseem*, Muhammad Amjad*, Naseem Bibi* and Musarrat Gillani*

DEVELOPMENT, PHYSICO-CHEMICAL AND SENSORY PROPERTIES OF BISCUITS SUPPLEMENTED WITH PUMPKIN SEEDS TO COMBAT CHILDHOOD MALNUTRITION IN PAKISTAN
...ur (20%) 5 with maximum protein (12.30%), fat (28.29%), ash (4.13%), iron (2.28%) and zinc (3.11%). Sensory results also revealed increasing trend in all sensory parameters. Results showed acceptability at all levels but treatment T with 15 % pumpkin 4 seed flour scored highest (8.0) for maximum overall acceptability. It was concluded that pumpkin seed flour can be supplemented successfully to partially replace wheat flour to prepare highly nutritious biscuits...

 Doulat Baig*, Fida Mohammad Abbasi*, Habib Ahmed*, Maqsood Qamar** and Muhammad Ayub Khan**

RESPONSE OF SUNFLOWER HYBRIDS TO DIFFERENT NITROGEN LEVELS FOR PHYSIOLOGICAL AND AGRONOMICAL TRAITS UNDER FIELD CONDITIONS
...sunflower productivity. Protein is the basic requirement of the metabolic processes for the vegetative, reproductive growth and yield of the crop. The protein is wholly dependent upon the amount of nitrogen fertilization available in soil for the plant use. A two year study was conducted in 2012 and 2013 at National Agricultural Research Centre (NARC), Islamabad, Pakistan. The experiment was aimed to –1 –1 evalua...

  Sohaib Arshad*, Sarwat Naz Mirza*, Imtiaz Ahmad Qamar** and Maqbool Shahbaz**

DETERMINATION OF FORAGE QUALITY OF INDIGENOUS AND EXOTIC RHODES GRASS ACCESSIONS UNDER RAINFED CONDITIONS
... energy, carbohydrates, proteins and other important minerals. As global warming is increasing, overall water scarcity is resulting in deterioration of natural resources, and it is need of the hour to find fodder crop resources which are more accustomed to change climatic conditions. Hence, different exotic and indigenous varieties of Rhodes grass were tested for quality and yield parameters. Three varieties were imported from Australia and Zimbabwe namely Sab...

 S. Talat Gilani*, Shahid Hameed* and Hussain Shah* 

OCCURANCE AND DISTRIBUTION OF POTY VIRUSES INFECTING GARLIC IN PAKISTAN
... stripes, mosaic and chlorotic spot symptoms of the disease resemble the viral infection in garlic reported to occur worldwide. Altogether 690 samples were collected from 29 locations of Punjab and 40 locations of Khyber Pukhtunkhwa to determine the prevalence of Onion Yellow Dwarf Virus (OYDV) and Leek Yellow Stripe Virus (LYSV). Serological testing DAS-ELISA technique was used to test the samples collected from the farmer fields. Based on the DAS-ELISA poty ...

 Tasawar Sultana*, Farah Deeba* and S.M. Saqlan Naqvi*

HIGH-THROUGHPUT AGROBACTERIUM-MEDIATED TRANSFORMATION OF MEDICAGO TRUNCATULA IN COMPARISON TO TWO EXPRESSION VECTORS
...mediated transformation protocols. In current study, M. truncatula transformed plants expressing OsRGLP1 were obtained through GATEWAY technology using pGOsRGLP1 (pH7WG2.0::OsRGLP1). The transformation efficiency of this vector was compared with expression vector from pCAMBIA series over-expressing same gene (pCOsRGLP1). A lower number of explants generated hygromycin resistant plantlet for instance, 18.3 with pGOsRGLP1 vector as compared to 35.5% with pCOsRGL...

 Muhammad Tahir* and Nawal Zafar* 

FORAGE YIELD AND QUALITY PERFORMANCE OF RABI CEREALS SOWN ALONE AND IN BLENDED POPULATION AT VARIABLE SEED RATIOS
...0% seed ratio and crude protein percentage was highest when oat was blended together with barley at 75% + 25% seed ratios.

...

 Waqar Akhtar*, Muhammad Sharif**, Abdul Hayee Qureshi*, Khalid Mahmood Aujla*** and Muhammad Azeem Khan*

COMPETITIVENESS OF TOMATO PRODUCTION IN PUNJAB, PAKISTAN
...ity. Results of Nominal Protection Coefficient (NPC) and Effective Protection Coefficient (EPC) indicated that combine effects of policies on output and tradable input market did not pass any protection to tomato farmers in the study area. Net effect of policy or market failure is reducing the profitability of tomato producers at farm level which indicates lack of motivation from policies ...

Basharat Hussain Shah*, F. S. Hamid*, Shams ul Islam*, Fayaz Ahmad*, Sohail Aslam*, and Noorullah Khan*

EVALUATION OF DIFFERENT PEA (PISUM SATIVUM L.) GENOTYPES FOR YIELD AND OTHER ATTRIBUTES AT SHINKIARI, MANSEHRA
...mic traits studied. Root rot attack was observed during the growth period. Pea variety 'Meteor' was found susceptible against this disease followed by 'Sarsabz 9800-1' as moderately susceptible and 9375 as resistant. The other varieties/lines Pea-09, Climax, Local and PF-400 were found tolerant against this disease. Green pod yield per hectare data revealed that pea variety 'Climax' produced the highest yield (11.6 t ha-1) followed by advance lines PF-400 (11....

 Muhammad Tahir* and Neelam Yasin*

EFFECT OF MICRONUTRIENTS FOLIAR APPLICATION ON YIELD AND QUALITY OF MAIZE
...d, harvest index, grain protein and grain oil contents. However, micronutrients application at stem elongation stage showed non-significant effect on plant papulation and number of cobs plant . Therefore, for attaining maximum yield of maize, it is suggested that 250 ml ha at stem elongation stage of maize should be used.

...

 

Shakir Ullah*, Aish Muhammad*, Iqbal Hussian*, Hafeez-Ur-Rahman**, Muhammad Zeeshan Hyder***, Muhammad Din**** and Nizamud Din

MORPHOLOGICAL VARIATIONS IN APRICOT CULTIVARS GROWN IN GILGIT BALTISTAN PAKISTAN
...ion
for the Protection of New Varieties of Plants) and the International Board for
Plant Genetic Resources (IBPGR) characteristics. Three cultivars
(Charmagzi, Shai Pawand and Narie) had fruit weight from 39-41 g. Most of
the cultivars had small fruit with sweet and large size kernel. Habi and
Astore 1 had latest harvest in late June. Nili Pawand, Shai Pawand and
Skardu Local were determin...

 Tassadduq Rasool*, Ali Zohaib*, Ehsanullah*, Riaz Ahmad*, Tasawer Abbas*, Tahira Tabassum*, Muhammad Ather Nadeem*, Mahmood-ul-Hassan*

FORAGE YIELD AND QUALITY IN PEARL MILLET-SESBANIA INTERCROPPING SYSTEM UNDER VARIOUS GEOMETRICAL PATTERNS
...to sole-cropping. Crude protein (84%) was improved most by cross planting over sole pearl millet, while, crude fiber (36%) and ash contents (20%) were improved by blended seed sowing, as compared to sole cropping of sesbania. Potential benefits of forage pearl millet can be acquired by intercropping with sesbania and following the planting geometry of sesbania intercropped in 45 cm apart two-row strips of pearl millet.

...
Yanling Xia1,2, Heping Li2, Yuntao Liang2, Jichen Zhao2, Binshan Lu2 and Di Liu1,*
...ransport of the recycle proteins from the endosome to Golgi, and Vps26A protein is an important component of the retromer complex. In the present study cDNA sequence of the full coding region of the Vps26A gene was successfully cloned from antler tip of the Sika deer (Cervus nippon hortulorum). The Vps26A cDNA contains an open reading frame of 984bp encoding a polypeptide with 327 amino acids. The deduced molec...
Rabia Faiz and Dilara A. Bukhari*
...sion bodies Cry and Cyt proteins. The present study focuses on determining the insecticidal activity of cyt positive B.t. strains against 3rd instar larvae of mosquito. Larval mortality was noted after 24 h and GCU B.t. 4 (400± 1.15) was found to be the most toxic against 3rd instar larvae of mosquitoes. Spores LC50 values of other isolates were 451± 0.90 (GCU B.t. 1), 511± 0.85 ...

Samina Ashraf1*, Ghulam Haider2 and Maimoona Ashraf

...iption, the researchers wrote a composite description that to present the essence of the phenomena. 

...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Arshad1, Rashid Mahmood2,* and Ziyad Abdul Qadir2
... The apiary had 24 Langstroth standard colonies of Apis mellifera naturally infested with Varroa destructor. Ectoparasitic mite, V. destructor is considered the most important parasite of A. mellifera L. that badly affects the development and performance of bees. Main objective of our study was to assess the effectiveness of five synthetic acaricides (Bayvarol®, Apivar®, Apistan®<...
Xiaopeng Tang1,3, Rong Xiang1, Sijia Chen1,3, Shufen Yang1,3, Hu Liu1,3, Rejun Fang1,3,* and Aike Li2,
...ottonseed meal on crude protein (CP), water-soluble protein (WSP), amino acid (AA) and peptide fractions, and the AA digestibility and metabolic energy of fermented cottonseed meal (FCSM) and enzymatic hydrolyzed cotton seed meal (EHCSM) in white leghorn roosters. Firstly, CSM were fermented with Aspergillus niger, or hydrolyzed with alcalase and flavourzyme. Secondly, a total of 32 white leghorn roosters with similar...
Zhiping Hu, Hussain Ahmad, Jingfei Zhang, Lili Zhang and Tian Wang*
...content (21d) and total protein content (42d) were lower in T2 group than that of CON group. Serum total antioxidant capacity was higher and malondialdehyde content was lower in T1 group than that of CON group at 21d. Serum glutathione peroxidase enzyme activity was significantly increased in T1 group compared to CON group at 42d. Malondialdehyde content of liver in T1 group was lower than that of CON group. These results suggested that dietary supplementation...
Basit Zeshan1,2,*, Mushtaq A. Saleem2,Javed Iqbal Wattoo2, Mohd Mokhtar Arshad1 and Maizan Mohamed1
...cid residues of S1 glycoprotein) were amplified by overlap PCR, cloned into prokaryotic expression vector resulting pET-Sf200 and confirmed the construct by sequencing. The recombinant plasmid was identified by restriction enzyme and sequencing analysis. The in vitro expression of the truncated protein was analyzed in E. coli with a molecular weight of 38kDa determined through SDS-PAGE and confirmed ...
Saba Parveen Samo1, Moolchand Malhi1,*, Javed Gadahi2, Yan Lei3, Allah Bux Kaciwal1 and Saeed Ahmed Soomro1
... dry matter (DM), crude protein (CP) and crude fiber (CF) increased (P < 0.05) by 13.71, 12.02 and 4.78% at week 3 and by 11.11, 11.8 and 3.46 % at week 6 in B compared to A. Among carcass characteristics the carcass dressing % (52.99 ± 0.77 vs 49.41 ± 0.6 ) and leg weight (kg) (1.28 ± 0.06 vs 1.05 ± 0.04) increased (P < 0.05) in B compared to A. The physico-chemical properties of meat were not significantly different between ...
Aqsa Gulzar1, Tariq Mahmud1,*, Rubina Munir2 and Asma Anjum3
...t by MTT - colorimetric protocol on HeLa cells (cervical disease) and Luminol-improved chemiluminescence assay, respectively. The novel Schiff bases 4a and 4b have been synthesized by the reaction of 2-[(1,3-benzothiazol-2-yl)sulfanyl]-N-[4-(hydrazinecarbonyl)phenyl]acetamide with 3-nitro and 4-nitrobenzaldehyde. Characterization of the synthesized compounds was done by using various spectroscopic techniques namely FTIR, prot
Wei Dang1, Ning Xu1, Wen Zhang1, Jing Gao2, Handong Fan1 and Hongliang Lu 1,*
...adaptations. Heat shock proteins and other molecular chaperones play specific physiological roles in such thermal adaptation. Here, we analyzed heat shock protein 70 (Hsp70) expression in six lizard species to investigate the variation in Hsp70 response contributing to thermal adaptation. At first, we collected three lizard species of the genus Takydromus from different geographical locations. We found that either the...
Muhammad Umair Sattar1, Aysha Sameen1,*, Nuzhat Huma1 and Muhammad Shahid2
...pearance (L* value) and proteolysis by RP-HPLC. Use of guar gum as fat mimetic and cheese milk homogenization significantly (p<0.01) affected the composition, functionality, texture and appearance of LFMCs. LFMCs functionality and texture also improved during ripening but appearance was negatively affected. Reverse phase HPLC results indicated that level of intact casein in LFMCs decreased with increase in ripening period. Use of guar gum at 0.15% le...
Sabah Mansoor1, Muhammad Tayyab1,*, Amna Jawad1, Bushra Munir2, Sehrish Firyal1, Ali Raza Awan1, Naeem Rashid3 and Muhammad Wasim1
...enaturing the insoluble protein using 8M urea followed by refolding through gradual dialysis. The refolded enzyme exhibited optimum activity at 55 °C between pH 8-9. The effect of metal ions on the activity of AMYSBS showed that Co2+ remarkably enhanced the enzyme activity and 500µM was recorded as optimal Co2+ concentration for the maximal activity of AMYSBS. Presence of ionic (SDS) and nonionic (Tween-20,...
Kaori Sasaoka1, Takahiro Kataoka1, Norie Kanzaki1, Yusuke Kobashi1, Akihiro Sakoda2, Yuu Ishimori2 and Kiyonori Yamaoka1,*
... however, it induces nephrotoxicity caused by oxidative stress. Here, we investigated whether radon inhalation has different effects against CDDP-induced renal injury in two mouse strains differing in radiosensitivity, and determined the appropriate dose of CDDP combined with radon inhalation for highly radiosensitive mice. CDDP was administered at 20 mg/kg weight to C57BL/6J and BALB/c mice after radon inhalation at 1000 Bq/m3 and 2000 Bq/m3
Humaira Jabeen and Nazia Jamil*
... when grown in nutrient broth was very low. The Fourier-transform infrared spectroscopy (FTIR) analysis of the extracted bio-plastic indicated the presence of the C=O functional group specific for the presence of polyhydroxyalkanoates, the absorbance peaks were specifically at 1600 cm-1. Ribo-typing of all the six strains were carried out, strains identified as Exiguobacterium indicum, Bacillus acidiceler, Acinetobacter seohaensis, Serratia p

Ikramullah Khan1,2*, Muhammad Subhan Qureshi2, Sohail Akhtar2, Ijaz Ali3 and Ghufran Ullah4 

...cortisol and Heat shock protein-70 (HSP-70). Thermal stress increased all physiological parameterssignificantly (P < 0.001). Holstein Frisian manifested maximumincrease in RT, RR and PR (3.33, 209.50 and 59.41%) than crossbred (0.59, 40.22 and 22.0%), Sahiwal (0.78, 42.54 and 34.31%) and Achai (0.78, 39.22 and 33.85%) respectively (P < 0.001).Thermal stress increased biochemical changes significantly (P < 0.001). The increase in serum glucose, cortiso...
Ambreen Asghar, Tasleem Akhtar, Nadeem Sheikh*
...the variations in serum protein level induced by fat rich diet. For this purpose, two groups of Wister rats were fed with diets carrying difference in percentage of fats. Protein profiling of treated groups indicated a marked increase in serum protein (related to iron metabolism and immune response) level compared to low fat-fed rats. Additionally, a decreased level of serum p
Shagufta Andleeb*1, Shabana Shaukat1, Chaman Ara2
...of cadmium chloride and protective role of garlic (Allium sativum), to minimize the intensity of these toxicities. For this purpose, fertilized eggs of Gallus domesticus were randomly divided into four groups of forty eggs each. Control group was intact and untreated. Eggs of one group were injected with a sub-lethal dose of cadmium chloride (1.5 µg/egg) in albumin on 7th day of incubation. In another group, eggs were treated wit...
Naimat Ullah1,3,*, Aneela Zameer Durrani1, Muhammad Avais1, Nisar Ahmad2, Sana Ullah3, Muhammad Shuaib Khan3, Khalid Mehmood5, Mumtaz Ali Khan1 and Ikramul Haq1
...iosis is a common blood protozoan disease of sheep in tropical and subtropical areas. The current study was designed to inspect the prevalence and its correlation with various risk factors and host biomarkers concerned with the occurrence of theileriosis in sheep. Total 600 blood samples were taken each 200 from districts Bannu, Tank and Dera Ismail Khan of southern Khyber Pakhtunkhwa Pakistan and screened through blood microscopy. The current study revealed a...
Syeda Madiha, Zehra Batool, Saiqa Tabassum, Laraib Liaquat, Sadia Sadir, Tahira Perveen and Saida Haider*

 

...ent study evaluated the protective role of curcumin against rotenone-induced motor deficits, biochemical and neurochemical alterations. Rotenone was injected subcutaneously at the dose of 1.5 mg/kg for 8 days. Supplementation of curcumin (100 mg/kg/day, p.o.) was started before 15 days of rotenone injection. The effects of curcumin pre-treatment were eva...

Hamza Khan1, Safdar Ali1, Ijaz Ahmad*2, Ihsanullah Khan3, Shujaat Hussain1, Bashir Ahmad Khan4 and Muhammad Suhaib5  

...d upon oil content (%), protein content (%) and Fatty acid profile. Results showed that SMH-1001 and SMH-1215 hybrids performed best for yield and quality parameters, whereas, SMH-1006 and SMH-0909 were considered best for early maturing traits.  

...
Ligia Neves Scuarcialupi, Laila Andreia Rodrigues Beserra, Julia Rosas Hochheim, Rodrigo Martins Soares, Fabio Gregori*
... better understanding of rotavirus distribution in Brazil.
...
Lotta Wahldén1, 3, Ulf Emanuelson1, Torsten Møller2 and Jonas Johansson Wensman1*
...en suggested to provide protective immunity in the African wild dog; however, their use has been hampered by the fear of vaccine-induced disease. Kolmården Wildlife Park in Sweden has used a live attenuated vaccine without any apparent cases of vaccine-induced disease, but no studies to evaluate immune response after vaccination have been performed. The objective of this study was to gain more knowledge about immune response following vaccination of...
Muhammad Umar1, Mubashar Hussain1,*, Ghulam Murtaza1, Farid Asif Shaheen2 , Fatima Zafar1
...rent approaches for the protection of their habitats, and to prevent the illegal hunting and poaching, mitigating agricultural and industrial pollution, preventing water reservoirs from heavy metal poisoning are important considerations. Ceasing anthropogenic activities along with the mass awareness programs on electronic and print media could be effective conservation strategies during the period of their stay in Pakistan.
...

Azhar Mehmood1,2,*, Muhammad Farrukh Saleem2, Muhammad Tahir2, Muhammad Aqeel Sarwar3, Tasawer Abbas4, Ali Zohaib2, Hafiz Tassawar Abbas

...ower plant. The oil and protein contents of sunflower were significantly affected by varying levels of both nitrogen and boron and maximum oil contents were observed when boron was applied @ 2 kg ha-1 with 0 kg ha-1 of nitrogen whereas maximum protein contents were recorded when 2 kg ha-1 boron was applied in combination with 150 kg ha-1 of nitrogen of both hybrids (H1=Hysun-33 and H2=DK-4040). The combined application of ni...
Nanjing Zeng1, Guanhua Liu1, Sibiao Wen1 and Feiyun Tu2,*
...in grade I national key protected animals, and 56 species are designated in grade II national key protected animals. Four species (Bambusicola thoracicus, Turdus mupinensis, Garrulax poecilorhynchus and Parus venustulus) are endemic to China. Breeding birds account for 201 species (52.8%) of the nature reserve bird species; 53 belong to Palearctic, 78 to Oriental Realms and the rest 70 cosmopolita...
Huma Ayub1,Iftikhar Ahmad2, Syed Lal Shah3,*, Muhammad Zafarullah Bhatti4, Nuzhat Shafi5 and Mazhar Qayyum1
...a viz.; copepoda, rotifera and cladocera. The diversity of the zooplankton species in the lake was determined by richness and evenness indices, which were found as follows; Margalef Index 1.30 to 3.87, Shannon’s Index 2.54 to 3.68, Simpson Index 0.92 to 0.97, Simpson’s Reciprocal Index 12.25 to 37.69 and Pielou’s Evenness Index 0.94 to 1.0. The zooplankton community was found abundant in summer as compared to winter. The copepods were ...
Hamayun Khan1,*, Abdul Wahab1, Navaid Kazi2, Younas Muhammad1,Summaya Kazi3, Salman Kazi4, Azmatullah Khan1, Ikramullah Khan5 and Shakoor Ahmad1
...includes glucose, total protein, albumin, creatinine, triglycerides, blood urea nitrogen (BUN), alanine transaminase (ALT) and aspartate transaminase (AST). The current study demonstrated the ascertained value in amniotic fluid for glucose, total protein and albumin at day 18, 25 and 28 was 42.9±0.80, 37.4±0.90, 36.5±0.88mg/dl; 17.9±0.30, 16.1±0.22, 13.9±0.34g/l; 13.9±1.6,11.5...
Felicia NkechiEkeh*, Ifeanyi Oscar Ndimkaoha Aguzie, Joy Ihuoma Nzei, Chinenye Maria-Goretti Ohanu, Godwin Ikechukwu Ngwu and ChukwudiebubeUgolo
...moderately effective in protection of dried catfish, C. gariepinus against D. maculatus infestation.
...
Kashifa Naghma Waheed1,2,*, Zaid Mehmood2 and Sikender Hayat1
...ud by ICP-OES following protocols of AOAC from five randomly selected sugar mills situated in South Punjab, Pakistan. It was observed that the samples contained potential amounts of essential elements, while the toxic elements were present in low quantities. The results were statistically analyzed and compared for their significance and showed significantly higher quantities of Ca, Na, K, Fe, Mg followed by relatively lower quantities of Al, Mn and low quantit...
Leila A. Kaimbayeva1,*, Elena S. Malysheva2, Rashit Kazikhanov3 and Saule R. Kazikhanova4
... revealed the nature of protein substances, altered рН value of the meat and the intensity of glycolysis. All these parameters were indicative of autolysis process in the meat. The levels of water-binding capacity and structural-mechanical properties of red deer meat that occurred during the course of autolysis were further confirmed by the histological changes in the meat. Specifically, it was observed that post-mortem changes were characterized b...
Hafiz Azhar Ali Khan1,*, Waseem Akram2, Sumi Lee3, Shakir Manzoor1, Syed Rajab Ayub1, Khalil Ur Rehman1, Shinawar Waseem Ali1, Muhammad Bilal Chattha1 and Sumaira Maqsood1
...y being used as a grain protectant in different countries. Geographical variation in susceptibility to spinosad in stored grain insect pests has been reported worldwide; however, there is a lack of information in Pakistan. In the present study, one laboratory reference strain and five field strains each of, Rhyzopertha dominica, Sitophilus oryzae and Tribolium castaneum, were collected from Punjab, and assessed for their susceptibility to ...
Muhammad Akbar Khan
...red to the genus Hexaprotodon and the species Hex. sivalensis. Due to rarity of this taxon, its morphological characters are incompletely known. Hippopotamid material recently excavated in the middle Pleistocene locality of Bhimber (Azad Kashmir, Pakistan) includes an almost complete mandible that provides a better knowledge of the taxon morphology. Hexaprotodon sivalensis is reported for the first time ...
Habib-ur-Rehman1, Masood Ahmed Siddiqui1,*, Abdul Qayyum1, Arifa Bano1 and Naeem Rashid2
...el of expression or the proteolytic machinery of the host. Herein we report expression in Escherichia coli and purification of metal ion independent type II pullulanase from Pyrobaculum calidifontis. Thermophilic origin and metal ion independency of the enzyme reported in this study make it a potential candidate for starch hydrolyzing industry.
...

Mehran Ali, Inamullah*, Sajjad Ahmad and Arsalan Khan 

...nts (mould board plough, rotavator, disk harrow and cultivator) were applied in main plots while nitrogen sources (control, cattle manure, poultry manure, sheep manure, mushroom spent, mungbean residue and urea) in subplots. The results exhibited that, higher plant height (200.4 cm), grains ear-1(351), seed index (228.8 g), grain yield (3522 kg ha-1), and biological yield (10799 kg ha-1) were observed with nitrogen sources incorporated with mould board plough....

Safdar Ali1*, Obaidullah Shafique1, Tariq Mahmood2, Muhammad Amir Hanif1, Ijaz Ahmed3 and Bashir Ahmad Khan

... sustainability and the protection of agricultural products, including crops for human and livestock. Nanotechnology helps in the manufacturing of innovative agrochemicals and novel delivery mechanisms to enhance crop production and decrease in pesticide use. Nanotechnology also contributes in increasing the crop yield in agriculture. One of the major contribution of nanotechnology in the field of agriculture is the formulation of nano based pesticides and fer...

Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4  

...d upon oil content (%), protein content (%), and fatty acid profile. The results showed that significantly highest seed yield (2187.3) kg ha-1 was produced by SF 16003 followed by SF16010 and SF 16002 having (2016.2) kg ha-1 and (1888.2) kg ha-1 seed yield respectively. The Cluster analysis also determined SF 16003 as best hybrid which was at a very close distance from the group of SF16010 and SF 16002. 

...
Muhammad Shahbaz Aslam1, Iram Gull1, Zaigham Abbas2,* and Muhammad Amin Athar1
...nant expression of some proteins in E. coli produces inclusion bodies which are misfolded proteins. The objective of this study was soluble expression of IFNα2-Tα1fusion protein in E. coli using pET-SUMO vector and determination of its biological activity. SUMO-IFNα2-Tα1 was successfully expressed in soluble form with IPTG induction to final concentrat...
Farah Rauf Shakoori1,*, Anum Feroz1, Ayesha Gondal1,Sahar Akram2 and Tanzeela Riaz3
...amino acids and soluble proteins while contents of total proteins, lipids, glycogen and trehalose were significantly reduced with reference to their control (untreated group). Among carbohydrate metabolizing enzymes, the activities of amylase and invertase were significantly reduced while activity of trehalase were significantly increased after treatment with sub lethal dose of λ-cyhalothrin as compared to control. Th...
Asad Sultan1,*, Shahroom Khan1, Sarzamin Khan1, Naila Chand1, Muhammad Shuaib Khan2 and Hamza Maris3
...5) in OA-2, while crude protein, crude fibre, ether extract and metabolizable energy increased significantly (P<0.05) in OA-1.5 and OA-2. In conclusion, addition of OA in drinking water at the rate of 2 ml/L improved weight gain, feed efficiency, nutrient digestibility, and tibial mineralization of Ca and P in broiler.
...
Baoying Guo*1, Yu Chen1, Chuan Zhang2, Zhenming Lv1, Kaida Xu3, Hongling Ping4 and Huilai Shi4
...228 bp and contained 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 2 long-noncoding regions [both in the control regions (CR)]. The composition and order of genes in S. lycidas were similar to those of most other invertebrates. The overall base composition of S. lycidas is 35.8% T, 14.8% C, 41.3% A, and 8.1% G, with extremely high A+T content (77.1%). Both control regions contain termination-associated sequences and c...

Nashwa Mohamed Eid1, Al-Hussien Mohamed Dahshan1, El-Shayma El-Nahass2, Basma Shalaby3 and Ahmed Ali1* 

...s (CP) type A induced necrotic enteritis (NE) in broiler chickens. The influence of varying concentrations of both EOs was determined in vitro using the agar dilution test. Concentration as low as 0.25% and 0.125% of thyme and clove oils, respectively, were able to completely inhibit the growth of CP. An in vivo study was conducted in commercial broiler chickens, where, 2 groups of 10 day-old broilers were fed a balanced ration with addition of thyme (0.25%) o...
Ye Gong, Nehafta Bibi and Haitao Wang*
...rtificial nest boxes to protect Mandarin duck Aix galericulata in a secondary forest in Northeast China, we found mixed clutches that contained eggs of Mandarin duck and other species over 11 breeding seasons (2004 - 2014). We monitored the frequency of occurrence and the fate of eggs in those nests and recorded fourteen cases of mixed clutches that contained Mandarin duck eggs. Nine cases were classified as successful nest usurpation: in six cases nest...
Yijiang Liu1, Kun Li2, Hui Zhang2, Khalid Mehmood2,3, Muhammad Shahzad3, Houqiang Luo1,*, Muhammad Asif Yaseen4 and Xiong Jiang2,5,*
...9 bp) is composed of 13 protein coding genes, 22 tRNA genes and 2 rRNA genes. The ratio of the bases of the mt genome of R. pruinosus from Wenzhou are A (32.31%), T (31.04%), C (24.77%), G (11.88%), A+T (63.35%), respectively. The multivariable sites in rRNA were 1.98% and 5.53% in 12S rRNA and 16S rRNA, respectively. The multivariable sites in protein coding gene were ranged from 0 to 4.83%, while the multivar...
Muhammad Nazar Aftab1, Ahmed Ali1, Muhammad Asad1, Sadia Fatima2 and Furhan Iqbal2,*
...es (P = 0.0075 ), total proteins (P = 0.042) and creatinine (P = 0.0038)were significantly higher in treated male mice when compared with their untreated control group indicating the hazardous effects of AlCl3 on blood chemistry of adult male albino mice.
...

Wiqar Ahmad1* and Farmanullah Khan

...s (CP); i. cereal-cereal rotation ii. cereal-legume rotation and iii. cereal-cereal+legume intercrop rotation in main plots and b) soil amendments (SA); i. The control (C), ii. Farmers practice (FP; 60:45:0 N: P2O5: K2O), iii. Recommended NPK dose (RD; 120:90:60 N: P2O5: K2O ) and iv. 60:90:60 N: P2O5: K2O integrated with FYM 20 t ha-1 (N1/2PKF) in sub plots. Maize (Zea mays L.) CV Azam (y...
Farrukh Jamil*, Samra Raheel and Haroon Rasheed
...e other heme containing proteins and it may be a phosphate sensor.
...
Nausheen Irshad1,*, Imran Yousaf1, Tariq Mahmood2 and Muhammad Saeed Awan1
... measures are needed to protect the species. The other aspects of leopard ecology like habitat requirement, food and major threats are yet to be identified and addressed.
...
Jun Chen1, Shuai Shang2, Xiaoyang Wu1, Jiakuo Yan1, Huaming Zhong1, Huanxin Zhang2, Weilai Sha1, Wanchao Zhu1 and Honghai Zhang1,*
...oidetes (21.26-27.82%), Proteobacteria (3.05%-7.14%), represented by Ruminococcaceae, Lachnospiraceae, Prevotellaceae, Porphyromonadaceae, Succinivibrionacea and Rikenellaceae families. The present work offers an initial phylogenetic baseline for further research on the intestinal ecosystem of these African animals. This work is of great significance for disease monitoring and protection of these animals.
...

Fatma Abdallah1*, Ola Hassnain2, Elsayed Attar3, Haytham Ali3,5, Mohamed Megahed1 and Venugopal Nair

...o acid sequences of Meq proteins possess several amino acid mutations associated with the MDV virulence and a unique distortion in the Proline repeats (Proline-to-Alanine) at position 176 in the Egyptian MDV strains. The Phylogenetic analysis grouped the eight analysed sequences with the previously investigated Meq from Egypt (2011-2013) together with the very virulent European and Chinese MDV isolates. The latter confirmed the geographical structuring of the ...
Danyu Zhang1, Ying Liu1, Qinxin Shi1, Zhiwei Peng1, Yan Hua1 and Zhijun Hou1,2,*
...e popular bacteria were Proteobacteria (33.54%), following by Firmicutes (18.58), Acidobacteria (12.82%), Actinobacteria (9.27%), Bacteridetes (5.44%), Crenarchaeota (4.58%), Fusobacteria (2.66%), Verrucomicrobia (2.29%), Gemmatimonadetes (2.18%) and Planctomycetes (1.39%), and they were more than 92.75%. The gut bacteria of the sable have more diversity than Siberian tiger, panda, horse, and human, and it may originate from the more divertible diet of the sab...
Souheila Slimani1,*, Sonia Hamouda1, Chahrazed Souadi1, Sara Silini2, Cherif Abdennour2 and Leila Delimi3
...abolic, carcinogenic, neurotoxic and fertility disorders. The objective of this work is to study the toxic effect of the dithiocarbamate “thiram 80% purity” on seasonal reproduction of male domestic pigeons Columba livia domestica, subjected to a long photoperiod (19L: 05D). The fungicide was orally administered at 5 and 10 mg/Kg body weight/day for 10 consecutive weeks.Testicular volume and weights were measured weekly, whereas semen qualit...
Musrrat Fatima, Muhammad Saad Khan, Hamid Rashid, Asim Mehmood, Sumaira Kanwal, Muhammad Asif Rasheed and Farrukh Jamil*
...inhibitors against ZIKV protease NS2B-NS3, which has a well-known role in the viral replication. By using three dimensional structure of the NS2B-NS3, an allosteric site has been identified in the protein. Moreover, the identified site is used for structure-based virtual screening. After screening 100,000 compounds, 14 compounds are selected, which fulfilled different already established drug likeliness parameters such as ru...
Tayfun Karataş
...rease in glucose, total protein, triglyceride, cholesterol, high-density lipoprotein and low-density lipoprotein levels as well as protein and lipid reserves in liver and muscle tissue of fish (p<0.05). The fasting period had no significant effect on the hepatic thiobarbituric acid reactive substances (TBARS), but, it caused a significant decrease in ...
Zihong Chen1, Ling Xu2, Xiaona Yang2, Yaguan Zhang3* and Yuming Yang4
... relevant in biological protection. A new species of the genus, collected from Taibao mountain, Baoshan City, Yunnan Province, southwestern China, was described here as Metarhizium baoshanense. It was proposed and determined based on morphological characters combined with a multigene phylogenetics analysis involving 5.8S–ITS, nrSSU, nrLSU, EF–1α, RPB1 and RPB2. In multilocus phylogeny, M. baoshanense was grouped as a sister clad...
Changqing Zhao*, Zhuochi Chen and Yubin Li
...rmented jerky; the true protein content of the fermented jerky was lower than that of the non-fermented jerky; the free amino acids content of the fermented jerky was higher than the non-fermented jerky; the acid protease activity was slightly higher than the neutral protease activity in the fermented jerky; four and fifteen volatile compounds were detected for the non-fermented and fermen...
Jia Chen*, Yuanxi Deng and Hui Xu
...rgen in mutton, soluble protein from mutton was extracted, and separated by SDS-PAGE. With the positive and negative sera of rats, the special allergen was identified with the Western Blot, showing that the 12kDa was the specific allergen. The protein of 12kDa was then analyzed by ion exchange and gel filtration chromatography, and the MALDI-TOF/TOF-MS search on the Internet. The results indicate that the p
Bin Wang1, 2, Qianji Ning1,*, Qian Wang2, Wei Peng2, Tong Hao2,*and Jinsheng Sun2,*
...dent analysis of single protein, rather than a protein-protein interaction. In this work, with the systematic point of view, the subcellular location of 830 unidentified proteins were annotated based on the previously reconstructed protein-protein interaction network (PIN) of E. s...
Wael S. El-Tohamy1,*, Russell R. Hopcroft2 and Nagwa E.M. Abdel Aziz3
...mportant group (12.6%). Protozoa contributed 10.6% of the total community. According to the Canonical Correspondence Analysis (CCA), the variations in the species data were significantly (P< 0.05) related to salinity, temperature, phosphate concentration and phytoplankton biomass. The main spatial gradients along the estuary were associated with salinity. The high salinity zone in the estuary downstream was dominated by the calanoid paracalanidae and the ha...
Syed Makhdoom Hussain1,*, Muhammad Zubair ul Hassan Arsalan1Arshad Javid2, Abdullah Ijaz Hussain3, Nosheen Aslam4, Qasim Ali5, Majid Hussain6Muhammad Masoom ul Hassan Rehan7, Muhammad Mudassar Shahzad1,8Anam Khalid1 and Danish Riaz1
...2% for crude fat, crude protein and supposed gross energy when compared to control diet, respectively. The next higher growth performance and nutrient digestibility values were observed at 20% replacement level based diet. It was concluded that the 10% replacement level of fish meal with MOLM is optimum which release adequate amount of chelated nutrients for maximum growth performance of L. rohita fingerlings.
...
Syed Makhdoom Hussain1,*, Nosheen Aslam2, Arshad Javid3, Shehzadi Liaquat1,Muhammad Mudassar Shahzad1, 4, Muhammad Zubair-ul-Hassan Arsalan1 and Muhammad Adnan Khalid1
...d levels of probiotics (Protexin) such as 0, 1, 2, 3, 4 and 5 gKg-1 level in the canola meal based diet. Triplicate tanks were used for each treatment and 15 fingerlings were stocked in each replicate. Fingerlings were fed at the rate of 5 % of live wet weight. Plant meal based diets in the absence of probiotics played negative effect on fish growth performance. Chromic oxide (1%) was added in the diets as inert marker. It was noted that probiotics ...
Selçuk Kaplan
...ing. Leptin is a 16 kDa protein which is highly expressed in adipose tissue. Leptin is one of the most significant candidate gene marker for MAS studies. Therefore, bubaline leptin gene exon 2, part of the intron 1 and intron 2 region were amplified and sequenced to identify nucleotide variations in Anatolian water buffaloes. Sequence analysis were revealed seven polymorphic site (G1072A, T1081C, T1131G, T1143C, T1145G, T1151G and C1221T) and one monomorphic s...
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Shehla Gul Bokhari1, Ikramul Haq1,*, Imdad Ullah Khan3, Naimat Ullah4, Naimat Ullah Khan4, Kashif Hussain1 and Azmat Ullah Khan2
...> were isolated from enterotoxaemia suspected sheep and goats from the endemic areas of Khyber Pakhtunkhwa Province, Pakistan during 2016. The isolates were initially identified through colony characters, Gram staining and biochemical tests. The identified isolates were quantified on blood agar and confirmed through PCR. Toxins were extracted, quantified, formalized and adjuvanted with aluminium hydroxide gel. Safety, sterility and stability of the toxoid were...
Abdul Wajid1,*, Asma Basharat2, Muhammad Akbar Shahid3, Sidra Tul Muntaha1, Abdul Basit4, Tanveer Hussain5, Muhammad Farooq Tahir6, Muhammad Azhar7, Masroor Ellahi Babar1 and Shafqat Fatima Rehmani2
...fowl adenovirus (FAdV) serotype is of most importance in epidemiological studies of disease outbreak and the adaptation of vaccine strategies. In spite of appropriate administration of vaccination, FAdV outbreaks have been reported and caused significant losses in poultry flocks throughout Pakistan in recent years. To identify the serotype and gain a better understanding of the genetic properties of the FAdV strains responsi...

Muhammad Rehan Aslam1, Muhammad Maqsood1, Zahoor Ahmad2*, Sajjad Akhtar3, Muhammad Rizwan4 and Muhammad Usama Hameed

...t index (38.43%), grain protein contents (8.09%) and grain oil contents (4.76%) were obtained when two foliar sprays of 0.5% MgSO4 (T2) were applied. Similarly, highest cob weight without sheath (258 g), number of grains per cob (475.1), 1000-grains weight (272.5 g), biological yield (13.4 t ha-1), grain yield (5.15 t ha-1), harvest index (38.20%), grain protein contents (9.01%) and grain oil contents (4.76%) were recorded w...

Muhammad Fiaz1*, Muhammad Afzal1 and Muhammad Zeeshan Majeed1,2 

...dy, field efficacy of spirotetramat and Isaria fumosorosea formulations was assessed in spring 2016 and 2017 against Asian citrus psyllid Diaphorina citri, one of the economic insect pests of citrus plants and a putative vector of Huanglongbing worldwide. Treatments were comprised of label-recommended (FD) and its half (HD) dose rates of spirotetramat and I. fumosorosea formulations. Both treatments were applied either alone...
Sukirno Sukirno1,2, Muhammad Tufail1,3,*, Khawaja Ghulam Rasool1Said El Salamouny1, 4, Koko Dwi Sutanto1 and Abdulrahman Saad Aldawood1
...o the sunlight. Many UV protectants were used to improve the efficacy of these viruses under field conditions. The objective of the current study was to evaluate the effectiveness of plant extracts to improve the persistence of Spodoptera littoralis multiple nucleopolyhedrovirus (SpliMNPV) against beet army worm, Spodoptera exigua(Hübner) under harsh sunny field conditions in Saudi Arabia. A preliminary test of SpliMNPV was per...
Doğan Türkyılmaz1,*, Selçuk Özyürek2,Nurinisa Esenbuğa1 and Mustafa Yaprak1
...solid non-fat, density, protein, lactose and ash. Density of the milk is expressed in kg/m3 and the other components are in percent. Fat, solid non-fat, density, protein, lactose and ash percentages of the milk in this study were respectively 7.19%, 9.67%, 1030.78 kg/m3, 3.18%, 5.55%, 0.93% in Morkaraman; 7.20%, 9.95%, 1031.78 kg/m3, 3.29%, 5.70%, 0.96% in Tuj; 6.79%, 9.60%, 1030.77 kg/m...
Amna Waseem, Sikander Ali* and Syeda Wajiha Khalid
...ls of L-cysteine HCl to protect it from instability. It was observed that under optimum conditions at 30°C temperature, pH 7, and incubation period 64 h, the lipase activity was increased up to 124±2.48 U/g. The crude enzyme was purified by ammonium sulfate precipitation method at 40 %. The molecular weight of the enzyme was found to be 33 kDa. The results showed that the enzyme produced from mutant strain gave significantly higher (p≤0.05) lipas...
Maaz Ahmad1*, Mussab Ahmad2 and Tehreem Munir3
...cantly effective gastro-protective as compared with placebo.
...
Farhat Ijaz1, Rana Khurram Aftab2*, Samia Jawed3
...kers such as C-reactive protein (CRP), interleukins 6 (1L-6) and tumor necrosis factor alpha (TNF-α). Relation of TNF-α with obesity induced IR and T2DM is unclear as results obtained from different studies are very controversial.
Objective: This study was designed to compare TNF-α levels and insulin resistance in obese and non-obese type 2 diabetics.
Methodology: A cross sectional comparative study was c...
Sahar Naz1, Farhan Rasheed2, Muhammad Saeed3*, Shagufta Iram4 and Ambereen Anwar Imran5
...pecies 37.0% (n=10), Proteus 66.6% (n=2) and 0% Citrobacter sppwere MβL positive. 32.5% MβL positive isolates were from ICU, 21.2% were from OPD, 12.5%were from Surgical Units, 12.5% were from Medical Unit, 17.5% were from Orthopedic Unit, and 3.7% were from Pulmonology ward. Almost 100% resistant was observed in MβL positive isolates for Imipenem,Piperacillin+Tazobactum, Ceftriaxone, Co-amoxyclav, Cefoperazone+Sulbactam, Ciproflox...
Bo Wu1, Hui Zhang2, Kun Li2, Khalid Mehmood2,7, Yan Zhao1, Bin Jiang1, Chengjun Xue3, Muhammad Tariq Javed6, Fazul Nabi2, Zhaoqing Han5,* and Houqiang Luo4,*
...rogram optimization of serotype O of FMD through ELISA and IHA in pigs in Zhejiang. A total of 368 serum samples were collected from June to July in 2016. Out of these samples, 23 (6.79%, 95% CI 4.4-9.9) pigs were found positive for FMD antibodies with the further distribution of 9.09% (95% CI 4.6–15.7), 6.90% (95% CI 2.6–14.4), 5.49%, (95% CI 1.8-12.4) and 4.35% (95% CI 0.9-12.2) from Wenzhou, Lishui, Jinhua and Ningbo counties, respectively. For ...
Maryam Javed*, Farwa Saghir, Naveera Aziz, Maham Saeed, Asif Nadeem and Wasim Shehzad
...elated to the territory protection, competition for resources like water, food, offspring and mating probabilities. It is an antisocial behavior having strong genetic relation. Current study focused mainly on the screening of genetic marker V158M located in COMT gene for its relation to physical aggression in the four domestic bovine species of Pakistan, which are normally less aggressive. Selected animal species were cattle (Bos indicus), buffalo (B...
Irshad Ali1, Mohammad Masood Tariq2,*, Abdul Waheed2, Ferhet Abbas Yousafzai1, Farhat Abbas Bokhari1, Majed Rafeeq1, Muhammad Ali1, Muhammad Adnan Attique1, Shahid Amin3 and Tahir Hameed1
...dinary long limbs which protect them from very heated ground. The odor of BN animal sweat is so pungent that helps it in tick resistance. The white color of the skin is natural reflector in an extreme weather, whereas, the inner coat of this animal has black lining (the natural insulator), provides an excellent insulation capability against heat. Furthermore, very large pendulous dewlap and naval flap provides larger skin surface area to the animal to p
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
...trogenous compounds and protein fractionations of casein and whey proteins of milk from different dairy animals like buffalo, cow, sheep, goat and camel. The buffalo and sheep milks have comparatively higher fat, solid-not-fat and total solid contents than other milks. Maximum whey proteins were found in the sheep milk (0.78%) whereas cow milk had lowest contents (0.54%). Non-casein-nitrog...
Sana Rafique1, Hina Saqib1, Khushi Muhammad2, Nazia Akbar2, Abdul Rauf3, Muzafar Shah4,*
...ue virus non-structural protein using Rapid Diagnostic kit for Dengue virus (DENV) i.e. SD BIOLINE Dengue IgG/IgM. Data was obtained from patient’s record, filled forms and through questionnaire. Total 1332 blood samples were collected from 3 tehsils of District Mansehra. Out of which, 725 were found positive for dengue fever infection. Out of 725 positive cases, 410 (56.5%) were males and 315 (43%) were female’s patients. The high rate of D...
Rafa Almeer1,*, A. Alqarni1,2, S. Alqattan3, S. Abdi4,*, S. Alarifi1, Z.Hassan5 and A. Semlali6
...ue inhibitors of metalloproteinase (TIMPs) and two matrix metalloproteinase (MMPs) were measured by real-time PCR. All subgroups exhibited altered morphology with accelerated detachment compared to untreated cells. The MTT assay after 48 h revealed that treatment with H1 and H2, reduced cell viability by 48% and 91% respectively, compared to that of untreated cells. These results suggest that anticancer effect of Sidr and Wi...

Kashif Akbar* and Muhammad Ayub 

...3%), fat 24.23-23.94%), protein (8.20-7.68%), fiber (6.47-6.38%) while NFE increased slowly (57.86-58.60%). The color of the cookies ranged from F0-F6 (6.88-6.93), taste ranged F0-F6 (6.82-6.04) and texture ranged F0-F6 (6.91-6.15). Maximum overall acceptability was recorded in F2 (7.32) proceeded by F0 (6.99) whereas minimum mean score was recorded in F6 (6.37) proceeded by F5 (6.47). 

...

Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla

...ed out to analyze nucleoprotein (N) gene of PPRV from fatal infections in small ruminants. For this purpose, RNA was extracted from suspected animal samples (n=18) and were screened by real time-PCR. Additionally, to assess the phylogenomics, the N gene was amplified and sequenced from sheep and goats (n=12). Nucleotide identity among Hail strains was identified to be 96.2-100%, while identity with previously sequenced Saudi Arabian strains and with reference ...
Tanveer Hussain1,*, Masroor Ellahi Babar1, Marcos De Donato2, Abdul Wajid1, Asif Nadeem3, Zahoor Ahmad3, Waqas Ahmad Khan4, Sunday O. Peters5 and Ikhide G. Imumorin6
...ino acid changes in the protein sequence. The UPGMA tree showed a clear differentiation between taurine and indicine cattle, except mitochondrial taurine sequences in Lohani and Nari Master breeds. The within-breed estimates of divergence were very low in all breeds except for Nari Master (mixed-bred). The estimates of divergence among breeds were also low for most breed pairs, except for Nari Master and Dhanni. While the overall genetic divergence within the ...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

 

...arzianum, T. viride, Pleurotus ostreatus, and Monacrosporium ellipsosporum demonstrated a prominent attraction intensity. The attraction intensity of all these fungi increased with time, while that of two fungi, Dactylaria gracilis and A. dactyloides, remained neutral throughout the experiment. Only the fungus species A. arthrobotryoides repelled the nematodes.
...
Jingen Xu1, Yang Liu2, Erhui Jin1, Youfang Gu1, Qin Zhang3 and Shenghe Li1,*
...cesses, including the G-protein coupled receptor protein signaling pathway, intrinsic to membrane, cell junction and ion transport. KEGG pathway analysis showed that the neuroactive ligand-receptor interaction was significantly enriched. The results offer a foundation for exploration of immune functions and genetic control of peripheral blood T lymphocyte subsets. Also, several differentially expressed immune-related genes m...
Ayesha Aihetasham, Saira Shariq and Javed Iqbal Qazi*
...erranean termite, Heterotermes indicola. Virulence of Rhizopus stolonifer isolate and resultant variations in food consumption of H. indicola workers were evaluated over a period of one month by employing surface culture method. Following different time exposures, R. stolonifer significantly produced epozootics on the tested insects, with resultant decrease in food consumption. Behavioral changes included lethargic workers which wer...

Muhammad Khalid1,2 and Muhammad Naeem2* 

...omposition of moisture, protein, lipids and carbohydrates. The purpose of this study was to affirm the proximate composition and nutritious status of Ctenopharyngodon idella. Standardized methods were used to determine the proximate composition of 72 samples. On wet weight basis, mean percentage for water was 80.76 %, ash 3.40 %, 4.31 % for fat and 11.53 % for protein in C. idella. Percent water contents showed inverse relat...
Wei Meng1,3, Tianyan Yang2,*, Yunguo Liu1, Mahmut Halik1 and Tianxiang Gao2
...nated H-strand-encoding protein genes were conducted by Neighbor-Joining method to reveal the evolutionary relationships within subfamily Schizothoracinae. Three different grades of schizothoracine fishes were well recognized from each other in branching diagram. The primitive group and the specialized group + the highly specialized group constituted a sister relationship with strong supports.
...
Ai Guo1,2,3, Jiaguang Xiao4, Binbin Shan4, Tianxiang Gao5 and Yongdong Zhou3,*
...ribosomal RNA genes, 13 protein-coding genes and non-coding regions. The mitogenomes of C. mystus N and C. mystus S shared the identical structural organization and gene arrangement with those of other Coilia fishes. Both lineages of C. mystus showeda similar features in not only the strand-specific asymmetry of nucleotide composition, but also the codon usage of genes. Whereas a significant variation among Coilia species was...

Irfan Ali Sabir1, Saeed Ahmad1*, Muhammad Nafees2, Ahmad Sattar Khan1, Maryam3 and Ishtiaq Ahmad

... mM Trolox g-1), total carotenoids (TC) (52.0 µg 100-1) and flavonoids (1.79 µg 100-1) were significantly high in ‘Faisalabad Selection’. Faisalabad Selection and ‘Surkha Burma’ exhibited high score for taste, flavor, texture, aroma and pulp color compared to other indigenous and exotic varieties. It is concluded that ‘Faisalabad Selection’, ‘Surkha Burma’ and ‘Kensington Pride’ among indi...

Muhammad Amir Maqbool1*, Muhammad Aslam1, Waseem Akbar2, Muhammad Waheed Anwar3 and Ehtisham Shakeel Khokhar

...stify;">Major intrinsic proteins (MIPs) of chickpea (Cicer arietinum L.), barrel medic (Medicago truncatula L.) and maize (Zea mays L.) were targeted in current studies. Amino acid sequences of major intrinsic proteins of chickpea, barrel medic and maize were retrieved from NCBI database followed by BLASTP. Pairwise and multiple alignment of sequences was done by using ClustalX software, and phylogenetic trees were construct...
Hülya Şereflişan and Beyza Ersoy Altun*
...e Gölbaşı. Crude protein and lipid contents were higher in U. tigridis (10.75%, 0.96%) than in A. pseudodopsis (8.63%, 0.77%, respectively), whereas the situation was vise versa for fatty acid compositions. The proportions of Omega-3 (n3) were higher than those of Omega-6 (n6) in both of the mussels. n6/n3 ratio, which was 0.90 for A. pseudodopsis and 0.99 for U. tigridis, is an index for comparing...
Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3,*
... concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii, O. rebecca and Odontamblyopus sp. were all circular double-strand molecules, 17245 bp, 17009 bp and 17004 bp long, respectively. Compared with other bony fishes, the three species shared the similar features in gene arrangements, base composition and tRNA structure. The control region spanned 1571 bp, 13...
Habib-ur-Rehman1*, Saima Mirza1*, Mansoor-ul-Hasan2, Qurban Ali3, Hafiz Abdullah Shakir4, Muhammad Yasir5
...e plant was extracted on rotary shaker using four solvents viz.; methanol, chloroform, petroleum ether and n-hexane separately. Periodic analysis for the repellent effects was carried by impregnating each filter paper (half-disc of filter papers) with micropipette at three concentrations (5, 10 and15%) of each of the plant extract. The repellence was recorded after 24, 48 and 72 h of the treatments application. The findings of experimental trials presen...
Farah Rauf Shakoori1,*, Tanzeela Riaz2, Uzma Ramzan1, Anum Feroz1 and Abdul Rauf Shakoori2,3,*
... amino acid while total protein and total lipid contents, were significantly increased with reference to their control (untreated group). Among carbohydrate metabolizing enzymes, the activities of trehalase, amylase and invertase were significantly reduced after treatment with sub lethal dose of esfenvalerate as compared to control. The metabolic derangements induced by sub-lethal dose of esfenvalerate suggest that infestation caused by T. granarium in ...
Muhammad Mobashar1, Muhammad Tahir1, Shahbaz Javaid2,*, Muhammad I. Anjum2, Insha Gul3, Nazir Ahmad1 andAbdul Sami1
...larly, intakes of crude protein (CP) and crude fat (CF) were significantly higher (P<0.05) on ration II compared to rations I and III. Neutral Detergent Fibre intake (Kg/day) in rations I, II and III was 5.4, 6.8 and 6.19, respectively. Intake of Acid Detergent Fibre (Kg/day) was higher in ration II while lower in ration I. Acid Detergent Lignin intake (Kg/day) in three rations ranged from 2.26 to 2.61. In vitro DM digestibility (%) signif...

Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2 

...ivity and total soluble proteins were increased with increase in sugar treatments under drought. Osmotic and water potentials were reduced under drought but foliar glucose sprays of 10 mM and 50 mM applied at reproductive phase significantly reversed the adverse effects of drought. Gas exchange characteristics including CO2 concentration, transpiration and photosynthesis rates were raised by glucose treatments under irrigated and non-irrigated conditions. Henc...
Nevran Eylem Akman Gündüz1,* and Özgür Özcan2
... the synthetic diet and protein, lipid, carbohydrate and glycogen levels in the hemolymph were evaluated for the GA3 concentrations. The hemolymph protein level of the larvae increased significantly at 5, 10, 50 and 200 mg/L with respect to the control group. The lipid level of hemolymph fluctuated among the tested GA3 concentrations. It was significantly reduced at 5 and 10 mg/L, but increased at 50 an...
Xiaqing Chen, Yü Huang and Zhen Huang*
...amatum fermentation broth and its ethyl acetate extracts caused high mycelial growth inhibition and germination inhibition of S. shiraiana, with the inhibition value up to 80% and 90%, respectively. An apparent increase in mycelial growth inhibition in a dose-dependent manner was observed when ethyl acetate extract and carbendazim were applied individually. The EC50 of T. hamatum ethylacetate extract or carbendazim in mycelial grow...
Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
..., Staphylococcus protein A (spa) was identified most frequently (81%) and proportions of capsular polysaccharides (CPs8), clumping factor A (clf A) andintracellular adhesion A (ica A) were 78%, 68.5% and 40%, respectively. ica D and CPs5 could not be amplified from any isolate. Toxin genes were present in 43.5% isolates. Among toxin genes, enterotoxins (SEs) were...
Binbin Shan, Yan Liu, Changping Yang, Shengnan Liu and Dianrong Sun*
... clusters of eukaryotic proteins. In addition, a total of 17,671 unigenes were classified into 311 KEGG pathways. Finally, we predicted the coding sequences of 13,072 unigenes and obtained 9,222 SSRs in the present study. The whole transcriptome is an important foundation for future genomic research on the P. penicillatus and can provide comprehensively understanding and further characterizations of transcriptomes of non-model organisms.
...
Majid Hussain1, Syed Makhdoom Hussain1,*, Razia Iqbal2, Arshad Javid3, Muhammad Mudassar Shahzad1,4 and Muhammad Zubair-ul-Hassan Arsalan1
... digestibility of crude protein (68.57%) was observed at 4% CA level, whereas highest digestibility of crude fat (72.23%) and gross energy (66.63%) was observed at 3% CA level. Fingerlings also showed maximum weight gain (WG), weight gain% (WG%), specific growth rate (SGR) and lower FCR value at 3% CA level. Hematological indices of fingerlings fed CA supplemented MOLM based diets were significantly (p< 0.05) improved as compared to control diet. Maximum nu...

Iqbal Javed1*, Amar Razzaq2, Mudassar Yasin3, Muhammad Ali Imran4, Haroon Javaid5, Iftikhar Nabi6, Anum Sardar1 and Shahbaz Ahmad

...abad, Pakistan. Nominal protection coefficient (NPC), revealed comparative advantage (RCA) and Revealed Symmetric Comparative Advantage (RSCA) were estimated for the export of mutton to all existing international markets. According to the finding of the current study under hand internal markets are categorized into three categories of with high potential markets, low potential markets and markets with no potential. First Category of markets with no potential i...

Saif Ullah and Mohammad Akmal*

...ower for better oil and protein. The study suggests that N, P and S at the rate of 80, 90 and 30 kg ha-1 is the best combination for soils remained with cereal crops in cultivation to plant with sunflower good quality of oil and protein.  

...

Safina Naz1, Muhammad Akbar Anjum1, Saeed Akhtar2, Syed Atif Hasan Naqvi3* and Muhammad Asif Zulfiqar

...kra, tomato, spinach, carrot and cauliflower, grown with canal, tubewell and sewage irrigation water, were assessed for their proximate (moisture, ash, protein and fiber) and heavy metal (Pb, Ni, Cu, Cd, Fe and Cr) contents. Significant differences were found for proximate composition of canal, tubewell and sewage water irrigated vegetables. The vegetables grown with tubewell water had higher moisture, ash and fiber contents...

Muhammad Javed Iqbal and Muhammad Naeem* 

...rohita fed with various protein: Energy ratios; fish meal (T0), 25%CP (Crude proteins) (T1), 30%CP (T2), 35%CP (T3) and 40%CP (T4). Experiment was designed to replace enriched fish meal diets with cheaper plant origin crude protein diets in fish culture. A total of 15 aquaria having 20 samples each were arranged in triplicate for 90 days to study the effect of five feeding groups on Length...

Safina Naz1, Khushbo Hussain1, Muhammad Asif Zulfiqar2* and Syed Atif Hasan Naqvi3
 

...3 (mg g-1), while total protein content were 25.33(mg g-1), SOD 214.30 (IU min-1 mg protein-1), 895.52 POD (mmol min-1 mg protein-1) and catalase value was 2159.90. Similarly, SA application promoted total phenolic content up to 157.84 (mg g-1), while total protein content were 26.66(mg g-1), SOD 199.33(IU min-1 mg prot
Zain ul Abidin1, Aisha Khatoon2, Abdul Whab Manzoor1,*, Nida Arooj1, Sajjad Ali1 and Muhammad Numan1
...amily, is a potential neurotropic disorder affecting all mammals and humans. This infection spreads through biting of infected and/or carrier animals to healthy ones including humans. Incubation period of this infection is quite variable ranging from a few days which can last up to one year in few cases. This case report presents the diagnosis and screening of suspected rabies samples of cow and mule. Clear behavioral changes along with paralysis of tail and h...
Imran Taj1,*, Ferhat Abbas1, Zafar Ahmad1, Mohammad Kamran Taj1, Deedar Ahmad2, Zahoor Ahmed2, Ghulam Mohammad2, Ajaz-ul-Haq1, Farooq Shahzad1 and Sabiha Azam3
Wajid Ali1,*, Asma Karim1, Muhammad Irfan2, Hafiz Abdullah Shakir3*, Ghulam Mustafa4, Zeeshan Shafique1, Ijaz Anwar1
..., cholesterol and total protein) and gills for histology were taken after 96 hrs. After acute exposure to pesticide, significant changes were observed in serum biochemistry and histology. Serum glucose and cholesterol were increased while total protein was decreased. Histopathological result reveled that gills of experimental fish was damage severely resulting Necrosis, Damaged nuclei , rupturing of epithelial cells, Mucous ...
Faxiang Wang, Yan Chen, Sai Chen, Xianghong Li, Jian Yu, Jianhui Wang and Yongle Liu*
...roperties of grass carp protein. The results show that muscle proteins of grass carp were degraded and underwent conformational changes when stored at 4 °C, and significant changes of the proteins content, as shown by the SDS-PAGE fingerprint, was observed after 6 days of storage. Protein’s surface hydrophobicity and total SH content increased ...

Sana Rana1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1 

...tial purification total protein contents and percentage recovery decreased from crude extract to desalted sample while fold purification was increased. The maximum activity of purified CAT was recorded at 6.0 pH and 30°C temperature for gills of C. striata. As the temperature was raised further the catalase activity decreased. 

...

Safina Naz1, Muhammad Akbar Anjum1, Syed Atif Hasan Naqvi2*, Bushra Siddique3 and Muhammad Asif Zulfiqar4

...con esculentum (93.7%), protein in Spinacia oleracea (2.23g/100g), fats and fiber in Abelmoschus esculentus (0.44g/100g and 3.27g/100g, respectively), ascorbic acid in Spinacia oleracea (84.5mg/100g) and carbohydrate and energy values in Daucus carota (11.25g/100g and 55.80 cal, respectively). While, higher mineral contents were recorded for phosphorous (P) in Spinacia oleracea (85.5mg/100g), sodium (Na) and iron (Fe) in Lyc...
Yang Liu1,2,3, Baimei Liu1,2,3, Chenchen Li1,2,3 and Meiwen An1,2,3,*
...The mRNA expression and protein secretion of supernatant were tested using Q-PCR and ELISA method, respectively. Co-culture KM&FM under 3.4 kPa pressure enhanced typeIcollagen and type III collagen mRNA expression and protein secretion from KM. It however reduced typeIcollagen and type III collagen mRNA expression and protein secretion from FM; it promoted mRNA expression and p
Xiaojie Ding, Xiling Sun, Zuien Wang, Qiusheng Zheng, Xiaofei Yu, Wenjin Hao, Kejun Wang, Wenjuan Xu and Zhengping Dong*
...RNA, to decrease TLR4/9 protein synthesis and expression. So we concluded that Wumei Pill probably reduce the release of pro-inflammatory cytokines and the bacterial endotoxins by blocking the transmission of TLR4/9-NF-kB signaling pathway so that Wumei Pill has a significant therapeutic effect on IBS-D.
...
Peng Xu1, Bin Liu1,2, Yongqiang Zhao3, Shicheng Lv3 and Changhu Lu1,*
...ficance for the species protection and management. Here, based on the annual maximum population size of red-crowned crane wintering in Yancheng Nature Reserve (YNR) from 1981 to 2016, we tested the correlation between population size and the climate variables. The results showed that mean air temperature in wintering period showed a linear upward trend. Annual maximum wintering crane population was 623±33. Fitting the population size and the climate var...
Soumble Zulfiqar1, Khuram Shehzad1, Sana Tahir1, Khalid A. Al-Ghanim2 and Abdul Rauf Shakoori1,2,3,*
...KW strain. The CueO protein was purified to homogeneity by nickel affinity chromatography. Enzyme assays of CueO protein with phenolic substrates revealed its laccase activity. The kinetic studies showed Km value of 0.2µM, kKcat 0.68 S-1 and Kcat/km 1.2S-1 µM-1 for 2,6-Dimethoxyphenol (DMP) and Km value of 0.25mM, Kcat 300 S-1 and Kcat/Km=1200S-1mM-1...
Nimra Naseer, Adeela Fatima and Imran Sajid*
...domonas spp. and Proteus spp. In this study, a collection of nineteen actinomycetes strains isolated from Cholistan Desert, Pakistan, were screened biologically and biochemically for their potential bioactive secondary metabolites against MDR bacterial pathogens. The identification of strains was done by morphological, physiological and biochemical characterization and by 16SrRNA gene sequencing. For biological screening different methods inc...
Merica Slišković1, Meta Povž2, Marina Piria3,*, Goran Jakšić4, Ana Gracanin5 andGorana Jelić Mrčelić1
...r research and targeted protection of the sichel in the middle Danube River tributaries are urgently required.
...

Saeed Ahmad Shah Chishti1, Mudassar Iqbal1*, Nusrat Parveen1, Kashif Nadeem1, Muhammad Iqbal1, Umbreen Shahzad2, Rana Husnain Shabbir1 and Muhammad Najeebullah1 

...to tolerate against root rot and powdery mildew diseases of pea crop. The newly approved variety has potential to moderately resist to collar rot disease as compared with all other existing varieties. Studies on organoleptic characteristics showed that Sarsabz is less sweet in taste than Pea-2009, suitable for all types of dishes. This variety was approved by Punjab Seed Council and its seed is available for dissemination.&n...

Ali Muhammad*, Yasser Durrani, Majid Suhail Hashmi, Ihsan Mabood Qazi, Muhammad Ayub and Saifullah 

...t-align: justify;">Whey proteins have many nutritional and beneficial therapeutic properties, which are indispensable for the functional and nutritional properties of foods. The aim of the study was to neutralize whey by addition of NaOH (0.1 and 0.01N) and NaHCO3 (0.1 and 0.01N) for fortification and enrichment of foods. However, addition of these solutions results in an increase in total solids and ash content of the whey sample The samples were normal whey ...

Ambrin Rajput* 

... yield (31050 kg ha-1), protein (15.77%), shoot N, P and K (2.1, 0.3 and 1.3 %) concencentration and N, P and K uptake (95.3, 16.4 and 49.9 kg ha-1) were recorded by combined application of N, P and K fertilizer application. However, the minimum values were obtained from control treatment. The combined application significantly increased chickpea yield compared the one without K application. There was positive significant relationship between all yield paramet...

Waqas Ali* and Mudasser Habib 

... study, 336 strains of serotype O (n = 178), A (n = 82) and Asia 1 (n = 76) were downloaded from NCBI database that mainly belonging to Pakistan, along with three vaccinal strains. Phylogenetic analysis (maximum likelihood) showed that lineages Pan Asia II, An Iran-05, and Group VII within serotype O, A and Asia 1 are causing majority of the outbreaks in the Pakistan during recent years. Moreover, only one residue of VP1 reg...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
... blood cholesterol, lipoproteins like low density lipoproteins, very low-density lipoprotein and decreased high density lipoprotein levels are the major risk factors involved in the development of cardio vascular diseases. Lovastatin is formed as secondary metabolic intermediate initiated by anion moiety (acetate) through polyketide chain reactions. The ...
Muhammad Babar Khawar1, Muddasir Hassan Abbasi2*, Zillay Mariam1, Nadeem Sheikh1,2*
.../sup> (P=0.0001), total proteins (P<0.0001) and albumin (P<0.0001) when compared against control. Similarly, hematological analysis revealed a significant decrease in WBCs (P<0.0001), RBCs (P=0.0001), Hemoglobin (P<0.0001), Platelets (P<0.0001) and MCHC (P<0.0001) while MCV (P<0.0001) showed a remarkable positive change when compared with control. Hematocrit (P<0.0001) was found to be enhanced significantly in Group 1 but decreased in G...
Ashraf M. Mounir, A.N. El shahat* and A.M. Abdul Azeem
...vide significant cardio-protective effects evidenced by an obvious reduction in the level of cardiac marker enzymes, inflammatory factors and lipid contents with marked improvement in the cardiac antioxidant status and reduction of lipid peroxidation relative to untreated infarcted group. The study concluded gamma irradiation could be used as an efficient method for sterilization and increasing the active contents of frankincense. Also, gamma-irradiated franki...
Asima Bano1, Hafiz Muhammad Tahir2, Hira Sherawat3, Muhammad Mutlib4, Muhammad Arshad5, Muhammad Akram Qazi6, Sajida Naseem5, Rabia Ishaq1, Iram Liaqat2 
...ne the overall level of protein was also found to be decline. It is concluded from the study that these enzymes can be used as biomarker in the diagnosis of breast cancer. 
...

Asma Sohail1*, Kashif Sarfraz Abbasi1, Maryum Arif2 and Fatima Najam1 

...ysaccharides, vitamins, proteins, essential amino acids, carotenoids, fatty acids like linoleic acid and linolenic acid, lignans, minerals and various phytochemicals. Due to the presence of two unsaturated fatty acids, these oils can reduce their biological activity on heating, volatilization, and other parameters like oxidation and UV rays. This limits the commercial application of these oils. To overcome such problems enca...

Shoaib Nawaz1, Muhammad Razaq1, Zahid Mahmood Sarwar1*, Muhammad Sajjad1*, Syeda Aneeza Ubaid1, Muhammad Asif Zulfiqar2 and Usman Haider

...e to its nutrients like protein vitamin calcium potassium, value play an important role in Ghanaians diet. Sucking pest jassid become major problem on okra in tropical and subtropical regions and cause heavy losses. Neonicotinoid insecticide, like nitenpyram was used on calendar basis and ETL basis. Data was recorded on weekly basis. In first week jassid population in control and ETL treatments was equal with non-significant difference between them while in ca...
Sajid Ali Khan1, Mazhar Hussain Ranjha1, Azhar Abbas Khan2,*, Muhammad Sagheer1, Amjad Abbas1 and Zeshan Hassan2
Zafar Iqbal*, Farah Ansar, Zil-e-Huma
... these fish were: seven protozoans species (Chilodonella sp, Trichodina sp; Ichthyobodo sp. Epistylis sp. Tetrahymena sp. Ichthyophthirius multifiliis; Piscinoodinium pillulare;); three monogeneans species including (Dactylogyrus extensus, D. vastator; Gyrodactylus turnbulli,); one digenean (Cryptocotyle sp.), two nematode (Capillaria sp., Camallanus sp.); two crustacean...

Hareem Mohsin, Azka Asif*, Warda Fatima, Sarooj Nadeem, Anjum Nasim Sabri

Assessment of biocalcification by the water absorption test using microorganism from oil contaminated site
...es the precipitation of protective layer of calcium carbonate on the cement based structures or buildings. In the present study, the biocalcification capacity of Bacillus pasteurii was studied on the cement samples. The cement samples were treated with urea and calcium salt (calcium carbonate) that act as a source of calcium along with the microorganism under optimum culture conditions. Alkaline conditions produced by the activity of the enzyme urease allowed ...

 Sumera Siddique1,†, Hafiz Abdullah Shakir1, Javed Iqbal Qazi1*, Amtul Bari Tabinda2, Muhammad Irfan1

Screening of some agri-wastes for economical cultivation of Candida tropicalis SS1
...SS1 for the single cell protein (SCP) production employing different fruit’s peels. The C. tropicalis SS1 was cultivated in media containing 2% pulverized peels of apples, mangoes, water melon and bagasse singly as well as in eleven different combinations. The media were inoculated with 1% (w/v) suspension of 24 h old yeast cultured in nutrient broth. The strain grew best in water melon (WM) at pH 7.0 and 37 °C und...

Muhammad Babar Khawar, Nadeem Sheikh*

Effect of paper industry leachate on various serological indices and serum proteins of wistar rats
...1) and High density lipoproteins (HDL) (P<0.0001) while a significant negative change in triglycerides (P=0.0002) and creatinine (P=0.0370) level in both experimental groups. Alanine aminotransferases (ALT) level showed a significant increment in Group 1 and a decrement in Group 2 compared to control group (P<0.0001). SDS page analysis revealed an overall decreased expression of various proteins in both experimental gr...

 Tahir Abbas*1, Khawaja Raees Ahmad2, Asmatullah3, Khalid Pervaiz Lone4, Muhammad Ali Kanwal2, Sadia Suleman2

Reno-hepatic protective effects of Jambul against chromium induced anomalies in mice
...nducted to evaluate the protective effects of Jambul (Syzygium cumini) against Cr induced reno-hepatic anomalies. Male albino mice (Mus musculus) were equally divided (n=10) as C; control, Cr-treatedandCr-JgroupsreceivingCr+6 in the form of potassium dichromate (K2Cr2O7) 50ppm for 10days ad-libitum while Cr-J group additionally given 0.25ml/12h Jambul Fruit Extract (JFE) for next 5days by oral gavage. On the 16th day blood, liver and kidney were collected for ...

Tasleem Akhtar, Nadeem Sheikh*

Induction of acute phase in response to tacrolimus induced hepatotoxicity
...he level of acute phase proteins due to the toxic effect of an immunosuppressive drug (tacrolimus). Aqueous suspension of tacrolimus powder (3 mg/ml) was orally given to four experimental groups of wistar rats. Control group was provided with normal drinking water and dissections were done after 6, 12, 24 and 48 h of tacrolimus dose. Densitometric analysis revealed considerable elevated level of some positive acute phase prot

Riffat Mehboob1*, Sami Ullah Mumtaz2, Zoya Manzoor3, Sajid Abaidullah2, Fridoon Jawad Ahmad1

Deranged biochemical and hematological profile of septicemia patients in Mayo hospital, Lahore
...of patients while total protein was in normal range in 97.02% patients and the trend of albumin was towards low (44.55%).In Renal function tests, urea was elevated in 71.29% and creatinine in 51.48% patients and in electrolytes Na+ was low in 41.58% patients K+ were normal in majority of patients. Hematological parameters such as WBCs were high in 84.16%, hemoglobin was low in 78.12% and platelets were normal. The most common causes were urinary tract infectio...

 Shagufta Andleeb*

Teratogenic potential of pyrethroids: a review
...uctive toxicology and neurotoxicology is available except teratogenicity. This review concludes the teratogenic potential of sublethal doses of different types of pyrethroids in various groups of animals in systematic way. On line available data interpretation through Pubmed Central NCBI, Google Scholar and Google was done to achieve the target and 122 references were found the most relevant in this perspective.

...

Nasir Raza Zaidi1, Mian Waheed Ahmad1, Mahesh Gautam1, Riffat Mehboob2*

Risk factors for multiple sclerosis in Pakistani population- A crosssectional study
...he myelin sheath
protecting the neurons. Many environmental and genetic factors have been associated with MS. The aim of this study
is to identify the possible risk factors that are linked to MS in Pakistani population. This study was conducted in
Department of Radiology, Mayo Hospital Lahore from 2013 to 2014. The first hundred patients who came for
reporting MRI of the brain and had positive findings of MS were retrospectively eva...

Muddasir Hassan Abbasi1, 2, Noor Fatima1, Syed Shahid Imran Bukhari1, Asma Rashid khan3, Nadeem Sheikh2*

Variations in proteins and transaminases following experimental induction of Bisphenol A in mice
...the estimation of total protein and albumin and aminotransaminases activity. The sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) was also run to analyze protein bands. Statistically significant
increase in total protein contents, albumin and aminotransaminases were noted in sample in comparison with control.
Comparative analysis between experiment...

 Abir Ishtiaq, Muhammad Naeem*

Length-weight relationships and condition factor for farmed Catla catla (Hamilton, 1822) from southern Punjab, Pakistan
... 15%, 20% and 25% crude protein (CP). The regression
estimates for LWRs were highly significant (P <0.001) with coefficient of determination, r2-values being >0.930 in the
three studied groups and for overall data. The value of the regression coefficient (b) indicated negative allometric
growth (b= 2.87), isometric growth (b= 2.95) and positive allometric growth (b= 3.22) for fish fed 15 %, 20 % and 25
% crude p

 Jhan Zeb, Muhammad Javed

Forecasting percentage contribution of plankton biomass towards increase in fish yield under composite culture conditions
...entary diets at varying protein level viz., 22, 24, 26, 28, 30 and 32% digestible protein (DP), respectively @
2% of their wet body weight daily. However, control fish (T7) although had an access to plankton; but were devoid of
the availability of any supplementary diet. Data on dry weights of plankton biomass and increase in fish yield were
collected on monthly basis and subjected to regression analysis...

 Zafar Iqbal*, Hafiza Madhia Imtiaz

Parasites of double tail goldfish, Carassius auratus L. imported to Pakistan
...d fishes in Pakistan to protect the local biodiversity of
Pakistan.

...

Dilara Abbas Bukhari1, Abdul Rehman2*

Isolation of bioactive compounds from exudate of edible fungus, Pleurotus ostreatus
...exudate of a fungus, Pleurotus ostreatus. Exudate as liquid droplets on the mycelium was checked for antimicrobial activity against bacterial strain, Bacillus subtilus. Biochemical techniques, thin layer chromatography, high performance liquid chromatography and gas chromatography/mass spectrometry, were employed to study fungal exudate. A total of fifteen different metabolites were detected in the sample by GC/MS. The detected metabolites could be classified ...

Sadaf Niaz1, Masroor Ellahi Babar2, Tanveer Hussain2, Asif Nadeem1, Misbah Hussain1, Riffat Mehboob3*, Fridoon Jawad Ahmad3

Mutation analysis of RING1 domain of Parkin in early onset of Parkinson’s disease in Pakistani patients-a pilot study
...domain of Parkin
protein was performed in a sample set of 30 patients (selected from different areas of Punjab, Pakistan) to find out
any Single Nucleotide Polymorphism (SNP).No SNP was detected in RING1 domain that could be related to the
disease. The data suggests that no genetic predisposition in RING1 domain may be responsible for the occurrence of
disease in local population. It may be due to genetic changes in any other part o...

 Bushra Siyal1, Sanjota Nirmal Das1, Rafia Rehana Ghazi2, Aly Khan3

Heterotestophyes gibsoni sp.n. (Trematoda: Heterophyidae) from the bird little tern (Sternula albifrons) in Sindh, Pakistan
...s of trematode genus Heterotestophyes gibsoni
sp. n. was recorded from the intestine of little tern (Sternula albifrons) collected from Jamshoro, Sindh, Pakistan. The
new species is characterized by having small body, maximum width attained at the level of mid body region and
twisted at the level of pharynx. Oral sucker terminal, rounded and broader than long. Esophagus long, intestinal
bifurcation is above the acetabulum. Ventral s...

 Muhammad Babar Khawar1, Muddasir Hassan Abbasi1, 2, Sana Fatima3, Khawaja Abdul Mujeeb2, Nadeem Sheikh1

Alterations in proteins and transaminases activity induced by thioacetamide in albino rats
... tissue and serum total proteins and
albumin along with urea, uric acid and serum transaminases activity after 12 and 24h of TAA administration in albino
rats. Rats were randomly divided into three groups (n=3) namely control group, 12h group and 24h group. Each
experimental group (12h and 24h) was administered 300 mg/ kg TAA intraperitoneally (i.p) while control received
same volume of normal saline solution. Rats of 12h and 24h gr...

 Anam Javed, Javed Iqbal Qazi*

Skin health implications of Chemical detergents and importance of biodetergents
...nment. Our body’s protecting shield, the skin, has more chances of exposure and biodetergents have potential to eliminate the associated risk. Economical production of biosurface active substances at industrial level through utilization of bio-waste origin feedstocks would also enhance recycling and energy conservation in the environment. Through the application of biosustainable developments in the field of biotechnology, we would be able to get rid of ...

 Zubair Ahmed#, Muhammad Farhanullah Khan, Habiballah Rana*

Toxicological effects of Haloxylon recurvum Bunge ex Boiss (Khar Boti) whole plant extract and novel insecticide chlorantraniliprole against maize weevil, Sitophilus zeamais Motschulsky
...
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
toxicity of crude methanol extract of whole plant of Haloxylon recurvum (Khar boti)
and a novel insecticide chlorantraniliprole. A serial concentration of extract i.e.,
1.2%, 2.4%, 3.6%, 4.8%, 6.0% and insecticide 0.00224%, 0.00448%, 0.00896%,
0.01792%, 0.02688%, ...

 Hafiz Muhammad Tahir1*, Zafar Iqbal Khan2, Saira Batool2, Kafeel Ahmad2, Salma Begum2

Residual effect of lambda-cyhalothrin on abundance of insect pollinators in marigold field patch
... should be minimized to protect the population
of insect pollinators.

...

Nabila Roohi, Mehjabeen, Samina Ashraf*

Effects of cigarette smoking on serum proteins profile in male active and passive smokers
...analysis of serum total proteins and fractions
(albumin, total globulins, gamma globulins and non-gamma globulins) of active and
passive smokers. Blood samples of 180 cigarette smokers were collected from
different locations of Lahore and 60 healthy non-smokers from University of the
Punjab, Quaid-e-Azam campus Lahore, in terms of comparable age, height, weight
and socioeconomic set up. Serum prot

 Siddra Tayyab Akhtar, Anjum Nasim Sabri

Twitching, swimming, swarming in biofilm forming strains in response to chemical and physical factors
...otilites whereas
proteinase K enzyme showed weak antimotility effect against all tested bacterial
strains. From this study we proposed that instead of biofilm detachment by
expensive commercial detergents, we could change the physical environment of
sewage systems as well as flooding some specific chemicals, which disrupt
bacterial motilities and biofilm formation.

...

 Raazia Kiran1, Alya Riaz1, Muhammad Irfan1*, Hafiz Abdullah Shakir2

An overview of pre-treatment methods used for bioconversion of lignocellulosic biomasses into valuable products
...l methods involving whiterot/
brown-rot fungi and bacteria, and quite a few combinations thereof to
breakdown the lignocellulose into its components. Pre-treatment process changes
cellulose morphological, chemical and physical features, making it prone to
enzymatic attack for saccharification. In this review, we have discussed different
pre-treatment methods and their effect on recalcitrant...

Muhammad Shahzad Akbar, Muhammad Zeeshan Majeed* and Muhammad Afzal 

...ely. On the contrary, spirotetramat, pymetrozine and spinosad were least effective against O. obesus termites. Conclusively, based on the results of this study, chlorantraniliprole, chlorfenapyr, pyriproxyfen, triflumuron and indoxacarb are recommended to be incorporated in future integrated pest management programs against subterranean termites. 

...

Akshay Sharma*, Mohit Mahajan, Madhumeet Singh and Pravesh Kumar 

...ubercle, median raphe, scrotal and penis impression. With the aid of ultrasonography and color Doppler technique, it is possible to determine the twins’ zygosity and viability. 

...

Farkhanda Asad1*, Samina Qamer1, Tayyaba Ali1, Ammara Behzad1 and Tahira Yasmin2 

... mg/Kg while, for crude protein higher value of nutrient digestibility was recorded in test diet T3(G/0.2, CrCl3.6H2O mg/Kg).It was concluded that chromium supplementation with gelatinized corn in fish (Cirrhinusmrigala) diet can improve the nutrients digestibility more efficiently as compared to non gelatinized and Cr-free diet. 

...
Qingling Hu1,2,3,* and Jinian Feng3
..., a new species Megalurothrips longus sp.n. from Hainan Island of China is described and illustrated. This new species is unique in this genus by the combinations of having 5 pairs of long setae on pronotum, the ultrashort chapped craspedum on posterior margin of abdominal tergites, and the shape and relative locations of setae on tergite IX.
...
Muhammad Kashif Maan1, Ghulam Mustafa1, Munibullah2 and Sajid Umar2,*
... were large and usually protruded through the palpebral fissure and infiltrate the entire eye ball. Diagnosis was made based upon the clinical and histopathological examination of the tumor sample. In all cases, tumor resection was performed followed by cauterization of the remaining surface with silver nitrate. No postoperative complications or local recurrence were reported by owner of each case.
...
Chao Zhao1,2, Juan Feng1, Haidong Xu1, Lihua Qiu1,2,*, Qibin Yang1, Zhenhua Ma1 and Jian G. Qin3
...P < 0.05). Heterotrophic bacteria and vibro counts in the formalin treatment were significantly lower than UV treatment and untreated group (P < 0.05). Based on the results obtained in the present study, we suggest that formalin treatment could be a better away to control bacteria in P. monodon larvae culture.
...
Mirza Imran Shahzad1, Hina Ashraf2,*, Muhammad Arshad3, Sabeeha Parveen4, Amna Aslam4, Nargis Naz4, Zahid Kamran1, Sumbul Gohar Khalid5, Sajid Hameed1, Muhammad Ashfaq6 and Muhammad Mukhtar7

 

...made and concentrated by rotary evaporator and finally dissolved in distilled water before taking their antiviral trials in 7-11 days old chicken embryonated eggs. The viral loads were determined through heamagglutination (HA) test. The methanolic extract of each plant was found effective against NDV but in varying order. The active extracts were further used in different concentrations and IC50 of each extract was calculated. The extract of Achy...
Fatih Korkmaz1, Veysel Parlak2, Özgür Kaynar3, Arzu Ucar2, Gonca Alak1,* and Muhammed Atamanalp2
... evaluated based on the protein profile, bacterial content (total aerobic mesophilic, psychotropic and lactic acid bacteria, Pseudomonas and Enterobacteriaceae), lipid peroxidation (TBARS), total volatile basic nitrogen (TVB-N) and pH values on quality during 12 days. The decrease in bacterial growth activity, physicochemical values (TVB-N, TBARS and pH) and prolonged shelf life in a natural preservative dependence were observed in the fillets. Generall...
Abderraouf Chouaib Rebbah1, Mohcen Menaa2,*, Salah Telailia3,Menouar Saheb1 and Mohamed Cherif Maazi2
... woodlands. We noted 20 protected species, only one endangered species, and five endemic species to the Maghreb and/or to North Africa. The presence of these species with patrimonial value reinforces the importance of the conservation of Sidi Reghis avifauna. Bird abundance, species richness and species diversity were significantly higher in pure pine woodlands than in mixed oak-pine and oak forests. According to PERMANOVA and ANOSIM tests, and the NMDS plot,...
Xiao-Ying Ren1, Di Zhang2 and Wan-Long Zhu1,*
... special status in Microtus, Arvicolinae. In order to investigate the geometric morphometrics of the craniums and mandible in nine species of Eothenomys (E. fidelis, E. melanogaster, E. chinensis, E. proditor, E. custos, E. cachinus, E. eleusis, E. miletus and E.olitor), ANOVA analyses, principal components analysis, thin plate spline, UPGMA and Multidimensional Scaling were used. The...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...ng Frame that encoded a protein of 388 amino acids. The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length ortholog PTGES2b was 1,457 bp and contained a 729-bp ORF that encoded a protein of 242 amino acids. The 5′ and 3′ untranslated regions were 402 bp and 326 bp, respectively. One polyadenylation signal (AATAAA) was present 14 nucleotides upstream of the poly...

Muhammad Tahir Amin, Khalid Usman*, Muhammad Waqas Imam Malik and Nishter Ali

...e tiller followed by one rotavator at 7–10 cm depth). Five irrigation intervals (7th, 10th, 13th, 16th and 19th day) and phosphorus levels (0, 50, 100, 150 and 200 kg P2O5 ha-1) were kept in main- and subplots, respectively in RCBD with split plots arrangement with three replications. Results revealed that irrigation intervals significantly affected all the parameters such as plant height, sympodial branches, seed cotton yield, and quality-related traits...

Nadejda Lukanova1*, Radka Vlaeva2 and Boriana Ivanova

...dy includes 34 purebred trotter mares and 292 gestations. Some of the mares are born in Bulgaria, and some are imported, as they represent four different trotter breeds – Standardbred, Orlov trotter, Russian and Italian trotter. The study refers to a period of 19 years, from 1997 to 2016. The aim of the recent study is to examine some reproductive ...

Sahar Shibli1,2*, Farzana Siddique1, Saeeda Raza2, Zaheer Ahsan3 and Irum Raza4 

... to 26.43±1.15 % proteins, 13.23±2.20 to 19.42±3.83 % carbohydrates and 4.95±0.06 to 8.53± % fiber. Mineral analysis of peanut cultivars showed 12.60±0.38 to 16.61±1.51 mg/100g Fe , 2.34±0.075 to 3.37±0.040 mg/100g Zn, 38.64±3.50 to 48.24±32.58 mg/100g Ca, 67.81±7.86 to 82.72±9.09 mg/100g Mg, 199.19±33.18 to 342.00±19.03 mg/100g Na and 1220.6±9.045 t...
A.H. Shahzad1, A. Sattar1,*, A. Husnain1, I. Ahmad2, N. Ahmad1, D. Nak3 and Y. Nak3
...R-Ovsynch based resynch protocol in lactating Holstein cows at two different geographical locations. On location A, 160 postpartum cows were enrolled in standard CIDR-EB protocol. Cows were subjected to timed AI and randomly assigned into two groups: 1) control (n=70), subjected to AI on detected estrus (AIDE) from d18-d30 post TAI. Pregnancy rate was diagnosed on d30, d60 and d90 post TAI, 2) resynch (n=90) received ...

Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6 

... yield, oil content and protein content of soybean, as compared to un-inoculated control. Seed inoculation with P. fluorescens was more effective than R. japonicum in improving grain yield and quality. The genotypes did not differ significantly in grain yield, biological yield and oil content; however, differed in protein content. Swat-84 was superior among all genotypes pertaining to yield formation and p
Tamoor Azeem1,*, M. Yasin Tipu1, Asim Aslam1, Sajjad Ahmed2, Salman Ahmed Abid1, Abdullah Iqbal3, Naeem Akhtar4, Muhammad Saleem4, Aamerzish Mushtaq4 and Sajid Umar4
...while decrease in total protein and albumin (p>0.05).
...
Muhammad Huzaifa Mehmood1, Muhammad Ahmad Iqbal2, Muhammad Daood1, Muhammad Rizwan Tariq3*, Khubaib Ali3
...d. The pH texture, fat, protein, blood lipid profile and PUFA concentration was significantly affected by the incorporation of oat in rabbit feed. It was concluded that the supplementation of 2% oat in rabbit feed increase n-3 PUFA in meat while improvement in serum lipid profile was observed by 4% supplementation of oat seeds. It was also observed that fat percentage in meat was also reduced by oat seed supplementation.
...

Mehran Ali1*, Inamullah1, Muhammad Bilal2, Salman Ali1, Farooq Nawaz1 and Muhammad Owais Iqbal1 

...nts (mould board plough, rotavator, disk harrow and cultivator) were used as main plot factor and N sources (control, cattle manure, poultry manure, sheep manure, mushroom spent, mungbean residue and urea) as subplot. The results exhibited that, improved bulk density, grain yield, harvest index and soil total N (STN) were observed when N incorporated with MB plough. In case of N sources poultry manure, sheep manure and mushroom spent gave at par yield with ure...
Pingping Cang1, Mingming Zhang1, Guo Qiao1,Qirui Sun1, Dehai Xu3, Qiang Li1, Xinghua Yuan4 and Wenbin Liu2,
...al differences in crude protein (CP), crude lipid (CL) and ash contents of gibel carp muscle between BFT and control group at the end of experiment (P >0.05). The essential amino acids, non-essential amino acids and total amino acids contents of gibel carp muscle in BFT group were higher than those in control group. Bioflocs were composed with 29.8% CP, 3.2% CL and 19.1% ash at day 60. CP content was appropriate, and LP was lower for gibel carp. Econ...
Bei Liu1, Yanli Hong1, Huifang Zhou1,*, Zhenzhen Cao1, Shuang Zhang1, Jing Jin1, Miao Jiang1, Cunsi Shen2 and Jianjian Ji2
...ach group. The mRNA and protein levels of GnRHR, the hub genes and key transcription factors in the downstream cAMP-PKA signaling pathways in RPC cells were also detected. The secretion and transcription levels of FSH and LH in Cetrorelix group were significantly decreased, while the expression of GnRHR was significantly increased compared to the blank group (p<0.05). Use of CSF with BSZYD alone showed no significant effect on the secretion of RPC, a...

Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Nosheen Fatima1, Raheel Babar3 and Ikramul Haq4  

...e issues are related to protection of natural environment and biodiversity which is one of the critical problems encounter by farmers of Pakistan. It is vitally important to take proactive measures to enact timely solutions to this issue, and avoid further losses in biodiversity. The present study was aimed to determine the awareness level of the respondents regarding biodiversity conservation. The results showed that farmers were relatively aware of regarding...
Tafail Akbar Mughal1, Muhammad Zubair Saleem2, Shaukat Ali3,*, Khawaja Khurshid Anwar1, Muhammad Majid Bashir1, Muhammad Babar4 and Muhammad Adeeb Khan1
...also to investigate the protective effect of Vitamin E pre-treatment on the carbon tetrachloride-induced hepatotoxicity. Study included the estimation of the activities of the enzymes such as ALAT (alanine aminotransferase), ASAT (aspartate aminotransferase) and LDH (lactate dehydrogenase) and biochemical components like glucose, urea, lipids, cholesterol and protein contents both in the liver and blood while DNA and RNA con...

Omer Baris Ince* 

...the disease is endemic, protective vaccinations are performed with inactive vaccines of suitable serotype and measures are taken in order to reduce the prevalence of the disease. In this study, blood samples were collected from clinically healthy sheep and bovine in the surrounding region of the southeast of Konya province that were classified as non-vaccinated, single-vaccinated, multiple vaccinated, aged 0-1 and 1-3 and ma...

Ummad-ud-Din Umar1, Syed Burhan-ud-Din2, Muhammad Fahad Khan1, Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Muhammad Asif Zulfiqar3, Azhar Ali Khan3 and Naila Ilyas1

...nt of MYMV by improving protection level by the induction of systemic acquired resistance. 

...

Muhammad Aslam Rajput1,3, Imtiaz Ahmed Khan2, Rehana Naz Syed3 and Abdul Mubeen Lodhi3* 

...zed germplasm screening protocols as well as optimized inoculation techniques are required. The pathogen inoculation method should be less cumbersome, simple, and rapid. Here, we compared the effectiveness of six different inoculation methods, i.e., dipping, paste, wound+paste, soil infestation, spraying and injection methods for the establishment of smut disease. It appears that disease expression was significantly influenced by pathogen inoculation method. T...

Rehmat Ullah* and Khalid Nawab 

...y measures and Personal Protection Equipment on self-reported acute poising cases. Binary logistic regression analysis depicted highly significant negative association between adverse effects of pesticides like headache, dizziness, feeling weak, difficulty in seeing, chest pain, burning sensation, and fever with precautionary measures/Personal Protection Equipment’s recommending that these precautionary measures and PP...
Khalid Khan1, Saima Liaqat2*, Somaiya Rasheed1 and Ihsanullah Kakar3
...chistan. Livestock is a protagonist in stimulating the economy and improving people’s living conditions. The study used primary data which were composed via well-regulated questionnaires from one hundred livestock farmers of diverse Tehsil/Union Council of District Lasbela. The findings of the study exhibited that trivial farm holders widely used livestock for income generation. Furthermore, livestock have a predominant role to accomplish the rudimentary...
Ali Raza Jahejo1,2, Nasir Rajput2, Wen-xia Tian1,*, Muhammad Naeem2, Dildar Hussain Kalhoro2, Asmatullah Kaka2, Sheng Niu1 and Fa-jie Jia1
...the absorption of crude protein (CP), crude fibre (CF), and metabolized energy (ME). However, the values of red blood cells and packed cell volume were non-significant whereas white blood cells, haemoglobin, and new castle disease antibody titer were significantly higher in basil supplementary group. The weight gain and feed conversion ratio significantly improved in basil treated group, while ascorbic acid and basil significantly decreased the water intake. B...
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
...ponsive element-binding protein) plays a crucial role as a central regulator of lipid synthesis and glycolysis in animal liver. In this study, the relative quantitative real-time PCR analysis indicated that the duck ChREBP mRNA is widely expressed in all examined tissues. ChREBP mRNA level was the highest in abdominal fat and the lowest in gizzard. The g.247075G>A silent mutation in exon 10 was first identified by direct sequencing approach, and resulted in...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
...typical structure of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and one noncoding control region. Genomic composition, organization and gene order were similar to that obtained in most vertebrates. By comparative analysis of the two genomes, 941 variable sites (5.69%) were found. Sequence divergences of 13 protein-coding genes, 2 rRNA genes and one control region which are commonly used as molecul...
Sakhra Mahmood1, M. Younus1, A. Aslam1, A.A. Anjum2, S. Umar3, Aamerzish Mushtaq3 and M.L. Sohail4,*
...the quails, an emerging protein source in developing countries.
...
Aisha Khalid1, Muhammad Tayyab1,*, Abdual Rauf Shakoori2, Abu Saeed Hashmi1, Tahir Yaqub3, Ali Raza Awan1, Muhammad Wasim1, Sehrish Firyal1, Zaheer Hussain4 and Munir Ahmad5
...inant enzyme as soluble protein. The recombinant protein was purified by affinity column chromatography. The characterization studies of purified protein demonstrated the optimal enzyme activity at 90°C and pH 4.8. The presence of cobalt enhanced the cellulase activity and 2.5 mM cobalt was recorded the optimal concentration for the maximal cellulase activity. SDS-PAGE anal...
Doğukan Ölmez1 and Gonca Alak2,*
...rich wastes in terms of protein. These wastes can be converted into different economic value products under controlled conditions. Under controlled conditions, byproducts have the potential to be converted into nutrients suitable for human consumption, as well as different products that have economic value. For this purpose, hydrolysates were prepared by enzymatic methods at different time periods using different trout byproducts. In this study, two different ...
Yang Liu1, Jing-xin Mao2, Xiao-dong Wei2, Man Yi2, Xiao-long Zhang2, Ke Zheng3, Xian-xin Chen4, Guo-Ze Wang5 and Bing-bo Chen1,*
...he control group, total protein, albumin, and albumin/globulin ratio were increased in lactobacillus BFA group. The total bilirubin decreased significantly (P<0.05) both in lactobacillus BFA and Bacillus BFA group. Total weight gain and daily gain were increased in mixed fermentation BFA group significantly than the control group (P<0.05). For feed conversion rates in each group, the mixed fermentation BFA group had the highest feed efficiency, increased...
Tahira Moeen Khan* and Amat ul Mateen
...e (Escherichia coli, Proteus mirabilis, Salmonella) and one gram positive (Clostridium tetani). The minimum concentration of leaf extracts needed against these bacterial strains were also calculated. The present study indicated that Melia azedarach and Morus nigra leaf extracts can be used successfully for nanoparticles synthesis and CuO as significantly active antibacterial material. Antibacterial activity of these nanoparticles wa...
Naveed Ahmad1,*, P.J.A. Siddiqui1, Amjad Ali1, Khan Mir Khan2, Rafaqat Masroor3, Noor ul Akbar4, Muhammad Amin5 and Mohammad Attaullah6
...ptimum level of dietary protein on growth performance, feed utilization, survival and carcass composition of yellowfin seabream, Acanthopagrus arabicus. Five semi-purified experimental diets were formulated containing 350 (P30), 400 (P35), 450 (P40), 500 (P45) and 550 (P50) grams of protein kg-1 of dry matter. Thirty healthy fish (20.94±0.81g initial weight) were stocked in each floating net cage (1....

Aqsa Khan1, Sabyan Faris Honey2*, Babar Bajwa2, Nelofer Jamil1 and Muhammad Sohail Mazhar2

...ir composition as major protein source and one diet without wheat germ were used. Addition of wheat germ in the diet composition for larvae resulted in significantly high percent survival (maximum value) (60± 4.56 and 56± 2.56) and significantly increased larval body weight of codling moth (0.58± 0.04 and 0.42± 0.03 gm). While diet without wheat germ resulted in low percent survival (40 + 5.46) and reduced larval body weight (0.15 +...

 Adile Tatliyer1,*, Sinan Bas1 and Serdar Yagci2

 

...lying the Varimax rotation in explanatory factor analysis. In the first period of average 11 days after birth, 2 factor scores (FS) were used as new latent predictors in order to predict live body weight in multiple linear regression model. The 2FS at the first period, 3 FS at the second period, 4 FS at the third period accounted for 80, 45 and 57 % of the total variability in live weight, respectively. The achieved results revealed that using of b...

Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2 

...seolina causing charcoal rot of sunflower is major fungal pathogen which can survive for months to years in soil and also over season in the seed. Therefore, population density and their aggressiveness to cause the disease is playing critical role for management of this pathogen. For such purpose colony forming units (cfu) per gram of soil and seed were determined and capability of previously characterized M. phaseolina isolates to cause the disease was tested...
Shehzad Ghayyur1,3, Sadia Tabassum1, Munawar Saleem Ahmad2Naveed Akhtar1 and Muhammad Fiaz Khan1,*
...ent, while total plasma proteins and triglyceride level were significantly decreased (p < 0.05).

...

 Jawaria Shaheen1, Samiah Shahid1, Sabahat Shahzadi2, M. Waheed Akhtar1,3 and Saima Sadaf1,*

...as isolated by standard protocol of centrifugation and then isolation of total RNA including miRNA was done. About 100ng of isolated miRNA was converted to cDNA after addition of poly (A) tailing and then expression profiling was done by using real time-qPCR technique in which miR-specific DNA primers were used to increase sensitivity of reaction. Expression of miRNA panel was normalized with mir-16 and expression fold change was calculated by 2-Δ&D...

 Sohaib Afzaal1, Usman Hameed2, Nasir Ahmad3,*, Naeem Rashid3 and Muhammad Saleem Haider1

...8 h growth in skim milk broth, while the least (12.131 mg/mL) was produced by pediococci. These LAB strains are being studied for their probiotic properties and good quality indigenous starter cultures from them are anticipated to be employed in food industry.

...

 Şaban Çelebi

... laying hen diets could protect these animals from detrimental effect of free radicals by increasing activity of antioxidant enzymes.

...
Jie Yang
...ptidoglycan recognition proteins (PGRPs) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs (PGLYRP1, PGLYRP2, PGLYRP3 and GLYRP4). They are secreted proteins expressed in different tissues. It is significant to make a study of human PGLYRP1 because neut...

 Asad Sultan1, Rabia Ali1, Rifat Ullah Khan2,*, Sarzamin Khan1, Naila Chand1 and Ambrina Tariq3

...n period). Standard lab protocols were adapted to measure proximate analysis, minerals and phytate content in grain and fecal samples. Sorghum cultivars were different in nutrient profile with red higher in protein content (11.41%). It was observed that phytase inclusion in grain increased the availability of all nutrients except crude lipids. Total tract nitrogen retention was increased by 3% in red sorghum compared to whit...

 Tazeen Jamil, Saba Ijaz, Rabia Arif*, Faiza Akram and Muhammad Saleem

...nsposons.

...

Ihsan Ullah Khan*, Muhammad Arshad, Muhammad Ayub Khan, Muhammad Ashraf, Ashiq Saleem, Sundas Awan, Samra Azam and Shamim Ul Sibtain Shah 

...arents. Overall, the heterotic effects were more prominent on the PHT, ST, HD, 100-GW and SY (kg ha-1) as compared to other traits both relative to mid- and better-parent values. The hybrid vigor (%) in the hybrids over the standard check regarding seed yield ranged from 4.84 % in the cross CMS-77 x R-18 to 20.09 % in the cross CMS-77 x R-83(1). The discovery of Cytoplasmic Male Sterility (CMS) and fertility restoration genes gave a new direction to heterosis ...

 Mahroze Fatima1*, Muhammad Afzal2 and Syed Zakir Hussain Shah3

...d for dry matter, crude protein, crude fat and ash content in fish body. Lipid peroxidation was determined in terms of thiobarbituric acid reactive substances (TBARS) and antioxidant enzyme activities. The minimum value of TBARS was recorded in VE150 group, which was increased again with supplementation of high vitamin E levels. Similarly, adequate supplementation levels (VE1000, VE1500) reduced the superoxide dismutase (SOD), ...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...>ein.
...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
...oli as heterologous protein under 0.3mM IPTG. The recombinant enzyme was purified by DEAE-Sephadex colum based anion-exchange chromatography. On SDS-PAGE, the enzyme exhibited a molecular weight of about 36 KDa. Its specific activity was 1650 U per mg of protein with about 5% glutaminase activity and no activity against D-asparagine. Optimal enzyme activity was found at 75°C and pH 9. The KM value of 5.9mM...
Faiza Jabeen1,*, Bushra Muneer2 and Javed Iqbal Qazi3
...g the wastes nutrients. Protein production was determined using 1% (w/v) of various agro-dairy wastes in production medium both with and without nutrients at pH 7.0 for 48 h at their respective suitable temperatures. They yielded enough thermostable protein suggesting their potential in production of various enzymes and proteins in unconventional and economical substrates suitable for vari...

Ragia S. Mohamed1, Rania F. El Naggar2, Mamdouh. M. Hamoud1, Mohamed M. Hamoud3, Abdulrhman M. Gamal1, Samah E. Laban1, Shimaa A.E. Nasr1, Manal M. Zaki1, ElShaimaa Ismael1, Osama K. Zahran1* 

...ovide various levels of protection against challenge with different NDV genotypes, raising the importance of the relationship between vaccines and field strains. The aim of the current work is to evaluate the effect of moisture percentage and pH on the persistence of velogenic NDV genotype VII in the poultry manure which considers a major threat to the Egyptian poultry industry since 2011 onwards. In the present study, manure of specific pathogen free (SPF) ch...
SiRui Wang1,2, Fekede Regasa Joka1,2, XiaoLong Wang1,2,* and SuYing Bai2,*
...xovirus-resistance (Mx) protein in the evolution of different wild birds, 10 wild bird species, including Anas formosa, Anas crecca, Anas strepera, Mergus squamatus, Accipiter nisus, Buteo hemilasius, Buteo lagopus, Passer montanus, Psittacula roseata and Emberiza elegans, were selected.The sequences of the GTPase effector domain (GED) of the Mx gene were determined by PCR sequencing....
Tianlong Cai1, Falk Huettmann2, Kisup Lee3 and Yumin Guo1,*
...nd is not well known or protected even. Here, we present the spatial distribution of the stopover habitats for hooded cranes in the East Asia. A machine learning modeling algorithm of maximum entropy (MaxEnt) weas applied and evaluated with Stochastic Gradient Boosting and Random Forests based on 115 every year used occurrence points (1990-2013) and 14 environmental layers as predictors. Results show that the Songnen Plain and Korea Peninsula are the most impo...

Saud Khan and Inamullah* 

...) plough, cultivator and rotavator were allotted to main plots and P levels (control, 30, 60, 90 and 120 kg ha-1) to subplots. MB plough applied one time was followed by cultivator; while cultivator and rotavator were applied once in separate experimental units. The results revealed that higher number of achenes (grains) capitulum-1 (974) and thousand achenes weights (51.4 g) were produced with MB plough which were statistic...
Fukuan Du1,2, Yongkai Tang1, Juhua Yu1, Shengyan Su1, Fan Yu1, Jianlin Li1, Hongxia Li1, Meiyao Wang1 and Pao Xu1,2,*
...h on C. nasus to protect the wild population. In this study, we sequenced the brain transcriptome of C. nasus using Illumina Hiseq 4000 platform. We obtained 123,764 unigenes with an average length of 1092 bp and a total of 115,169 putative Simple Sequence Repeats (SSRs). Among them, 37 SSRs were selected for the validation experiments. All of the loci were found to be polymorphic and showed bi-allelic in 60 individuals of C. nasus. These ...

Fady Samir1, Rania F. El Naggar2, Mohamed M. Hamoud3, Manal M. Zaki1, Abdulrhman M. Gamal1, Samah E. Laban1, Shaimaa A. E. Nasr1, El Shaimaa Ismael1, Osama K. Zahran1* 

...e pressures on NDV glycoproteins and their role in changing the NDV evolution in Egypt. 

...
Fan Yi1,2, Xiaobin Yang1, Shigen Ye1, Hua Li1 and Ruijun Li1,*
...eding had higher immune protection against Edwarsiella tarda infection; and the relative protection ratios were 60% and 50%, respectively. It was also obtained that interval feeding experiments also significantly boost non-specific immunological function of P. olivaceus compared with continues feeding experiments, HCT application in P. olivaceus farming potentially enhances P. olivaceus resistance...
Aisha Khalid1, Muhammad Tayyab1,*, Abu Saeed Hashmi1, Tahir Yaqub2, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Sehrish Firyal1 and Abdul Rauf Shakoori3
...oduction of recombinant protein. Higher level enzyme activity was recorded at 25°C, pH 7.0 when the cells were induced with 0.5 mM IPTG with 22h post induction incubation. Supplementation of LB medium with 1% glucose and yeast extract enhanced the production of recombinant thermostable cellulase. Enzyme showed strong potential for its use in paper and poultry feed industry. Under the optimal conditions we could able to produce 48 U/mL of recombinant...

Abdul Kabir1, Laiba Uroog2*, Naushad Ahmad3, Fawad Ahmad3, Muhammad Saqib3, Noor Badshah4 and Taj Ali Khan3 

...), Streptococcus (10%), Proteus (7%) and Salmonella (3%). The study reported high percentage of E. coli in cases of subclinical mastitis. It may be due to transfer of pathogen from cow to buffaloes and from the environment in herds of mixed farming. The study results may be helpful in developing the strategic policies against the control of disease. 

...

Gulnaz Saleem1, Aijaz Hussain Soomro1*, Nouman Rashid2 and Mehar un Nisa Narejo3 

...Masoor-93 was higher in protein content (25.16%) than all other varieties. The supplementation resulted in a significant increase in protein, fat, crude fiber and ash contents of the biscuits. The thickness and spread factor of biscuits differ significantly while non-significant effect was observed in the width of the biscuits. Sensory analysis revealed that there were no significant differences (p>0.05) amongst all treat...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...ase was recognised as a protein with 47kDa molecular weight by SDS-PAGE. The optimum pH of purified polygalacturonase activity was found to be 4.5 and stable within pH range 3.5-5.5. Temperature dependent studies revealed temperature optimum of enzyme to be 40°C and stable up to 60°C. Among substrates, polygalacturonic acid was established as the best substrate for polygalacturonase showing its specificity in the hydrolysis of polysaccharide galacturon...
...ct of Different Dietary Protein Levels on Growth and Proximate Composition of the Eggs and Broodstock of Giant Murrel, Channa marulius (Forsskal). Pakistan J. Zool., vol. 50(2), pp 595-602
...

Fraza Ijaz1*, Umair Riaz2, Shazia Iqbal3, Qamar uz Zaman4, Muhammad Furqan Ijaz5, Hina Javed1, Muhammad Amjad Qureshi1, Zuhra Mazhar3, Ahmad Hassan Khan6, Hassan Mehmood7 and Ijaz Ahmad8 

...itious Parameters crude protein (30.23%), neutral detergent fiber (33.45%) and acid detergent fiber (26.56%) gave significant results as compared to control (T1). Results indicated that the combined application of Rhizobium species and Tryptamine performed better by improving growth and yield and quality parameters. It is concluded that precursor-inoculum combination is an effective approach and should be tested in different ecologies. 

...

Muhammad Sohail1*, Asad Sultan2, Said Sajjad Ali Shah3, Muhammad Sajid1 and Adnan Khan4

...% and 17.04 MJ/kg). The protein levels in wheat varieties were 12.15 and 11.89% which were more than that of both of corn (8.21 and 8.05% respectively) and sorghum varieties (10.41% and 9.89% respectively). The bioavailability of crude protein was higher in maize followed by wheat and sorghum. The phytic acid contents were found highest in both varieties of sorghum (0.85% and 0.87% respectively) as compared to the wheat vari...

Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4 

...lceration on udder and scrotum. Increase in WBC, lymphocytes, monocytes count while decrease in RBC, platelets count and Hb concentration in diseased animals representing hematological investigation.  

...
Ailing Huang, Lingyu Meng, Wei Zhang, Junyan Liu, Guangyao Li, Huihua Tan, Wen Lu and Xialin Zheng*
...ides on detoxifying and protective enzymes in P. flammans larvae were also measured. Results showed that the LC50 value of beta-cypermethrin, abamectin, chlorpyrifos, thiamethoxam and bisultap against P. flammans larvae were related to the instar and pesticide. Control efficacy of beta-cypermethrin was the best among of these pesticides, and the LC50 value of which against 1st instar larvae in P. flammans r...
Shengjie Zhou1,2, Pengfei Wang1,2, Chao Zhao1,2, Mingjun Fu3, Jian G. Qin4, Lihua Qiu1, Zhenhua Ma1, 4,* and Maoshang Lin1
...type fatty acid binding proteins (L-FABP) gene in golden pompano Trachinotus ovatus larvae was cloned in the present study. The full length of L-FABP cDNA from golden pompano was 604 bp, including a 5’-untranslated region (UTR) of 154 bp, a 3’-UTR of 69 bp and an open reading frame (ORF) of 281 bp. L-FABP encoding a polypeptide of 126 amino acids with a predicted molecular weight of 14.06 kDa and a theoretical isoelectric point of 8.7...

Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2 

...sted were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the field for conservation of the C. flavipes. The results showed that during 2013 and 2014, the C. flavipes fed on Hollyhock pr...
Sheng Niu1, Ali-Raza Jahejo1, Fa-jie Jia1, Xin Li1, Guan-bao Ning1, Ding Zhang1, Hai-li Ma1, Wei-fang Hao2, Wen-wei Gao1, Yu-jun Zhao1, Shi-min Gao1, Jian-hui Li1, Gui-lan Li1, Fang Yan1, Rong-kun Gao1, Huan-chun Chen1,3 and Wen-xia Tian1,*
...transferase A3 (rGSTA3) proteins. We explored the responses of HDPs in erythrocytes to thiram-induced TD and rGSTA3 protein by quantitative real time PCR (qRT-PCR). The results showed many HDPs expressions were suppressed by thiram-induced TD, and the expressions of HDPs were upregulated by rGSTA3 protein. These findings demonstrated that mRNA expressions of HDPs are highly related to thir...
Muhammad Ahmad, Zohaib Noor*, Karim Johar Khan, Waqar Younas and Ajmal Hussain
...es of (P<0.05) crude protein, fats, carbohydrates, Mg (%) and K (%) was recorded in the H. molitrix than C. catla. The results of the study showed that H. molitrix probably consumed all the phytoplankton density by filtering the water continuously resulting in the reduction of growth in other fish species in the polyculture system.
...
Nursinatrio and Rudy Agung Nugroho*
..., feed efficiency (FE), protein efficiency ratio (PER), survival rate (SR) and carcass proximate of red tilapia were measured. The results showed that HCFM up to 12% could be used as supplementation and showed positive effects on all growth parameters. Supplementation of HCFM above 6% in the red tilapia diet increased the protein and fat content of red tilapia’s carcass. The highest survival was found on red tilapia fe...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
...significant lower total protein (TP), cholesterol (TC), triglyceride (TG) and glucose (Glu) content in serum compared with those reared at low density on day 90 and 120 (P<0.05). In conclusion, the present results indicated that the largemouth bass (36-308 g) could be reared at high stocking density without depressed growth and chronic stress in commercial-scale in-pond raceway systems under this experimental conditions.
...
Wang Zaigui1,*, Guo Panpan1, Ye Miao1, Sun Linghong1, Zhang Hongfu2 and Liu Chaoliang1,*
...P<0.01). (5) The proteinase activity in middle intestine was higher than that of the blank group (P<0.05). Collectively, the results indicated that adding B.subtilis to the feed of silkworm had positive effects on growth performances of the Bombyx mori L. apparently.
...
Iram Gull*, Muhammad Shahbaz Aslam, Imran Tipu, Roohi Mushtaq and Muhammad Amin Athar
...uman latency associated protein with insertion of HCV NS3 protease cleavage site at splicing junction is reported.
...
Wali Khan1,*, Mudassar Iqbal2 and Israr Khan2
...e appropriate treatment protocol. All the infected children were randomly divided into 2 groups (A and B). Children in group A were treated with albendazole (bendazol) 400mg/kg while children in group B were treated with albendazole (zentel) 200mg/kg orally once a time. Eggs per gram of faeces were counted in each group before and after treatment. The % efficacy of albendazole (bendazol) and albendazole (zentel) against ancylostomiasis, ascariasis, taeniasis a...
Shamsudin Bojang1, Idris Abd Ghani2, Jugah Kadir1, Adamu Saidu Paiko1, Yasir Iftikhar3 and Muhammad Kamran3,4,*
... sparsely growth and chlorotic appearance of the greens. A total of 36 soils and roots sample were collected. Scanning electron microscopy (SEM) was used to identify the parasitic nematode. Both the field symptoms and SEM micrographs confirmed that the nematode isolate was M. graminis. Since this nematode has been known to damage the greens and other plants in other part of the world then the probability for the specie to adapt to other hosts other than...
Abid Hussain Shahzad1, Abdul Sattar1,*, Nasim Ahmad1, Ijaz Ahmad2, Deniz Nak3 and Yavuz Nak3
...ency of standard Ovsych protocol (OVP0) and its modified forms (OVP5 and OVP7) as postpartum reproductive management tools in cyclic dairy cows. In total, 167 Holstein cows were randomly divided into three treatment groups. The OVP0 group was comprised of 58 cows. Other two groups, OVP5 (n=55) and OVP7 (n=54), were similar to OVP0 except the intravaginal insertion of controlled internal drug release (CIDR) inserts for 5 or 7 days, respectively. Pregnancy was d...
Muhammad Shoaib Saleem* and Muhammad Faheem Akbar
...cs insecticides in crop protection has also led to development of resistant strains of pests and have adverse effects on non-target organisms including natural enemies and pollinators. Amongst bio-rational insecticides, neonicotinoids and insect growth regulators (IGRs) may be exploited as eco-friendly approach in crop pest management. We therefore, evaluated the effectiveness of nitenpyram, Clothianidin, Momentum (Mixture of Nitenpyram and Chlorfenapyr) and B...
Pin Lyu1, Xiangxian Chen2* andQinlong Liu3*
...tructure and C-reactive protein levels, followed by the other three groups. C-reactive protein decrease in exercise and massage, massage only or exercise only groups was significantly different comparing to control group (p<0.05).Combined treatment of exercise and massage therapy showed the best effect in inflammation suppression, skeletal muscle regeneration, control of skeletal muscle fibrosis and muscular tissue...
Xiaona Cao1,3-5, Yuanyuan Ren2-5, Xiaoteng Cui2-5, Baoxin Qian2-5, Chunyan Zhao 2-5, Jie Yang2-5, Chao Su2-5,* and Xingjie Gao2-5,*
...bution of three nuclear proteins, including heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), Hu Antigen R (HuR) and T cell intracellular antigen 1 (TIA1), in the SG aggregation and nucleus/cytoplasm localization under stress condition. We found that hnRNP A1, HuR and TIA1-containing SGs were aggregated in the cytoplasm of HeLa cells, and accompanies the alteration of nucleus/cytoplasm localization during arsenite induc...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and  Cheng-Kai Zhai1, *
...ase in high density lipoprotein cholesterol. However, CWD can improve blood lipid and blood sugar levels, and at the same time improve obesity and fat accumulation in rats. CWD significantly augmented the relative level of peroxisome proliferators-activated receptor γ (PPARγ) and suppressed the sterol regulatory element-binding protein 1c (SREBP-1c) protein expres...
Bo Zhang1, Changbo Zhu1, Zihao Meng1,4, Baosuo Liu1, Lian Zhong3, Guiju Huang1, Jiaqi Su1, Sigang Fan1 and Dahui Yu1,2,*
...omically important and carotenoid-containing bivalve shellfish that is cultured for pearls and acts as a source of seafood. To investigate the distribution of carotenoids in P. fucata and establish a more efficient method to assess carotenoid contents, we measured the carotenoid levels in selectively bred P. fucata individuals of different ...
Jun Yan Bai*, Shuai Yang, You Zhi Pang, Xiao Hong Wu and Guang Lu Li
... quail (P<0.05), the protein height of Beijing white quail is greatly higher than those of ret two species (P<0.05). Based on comprehensive evaluation, the egg quality of Korea quail is better than those of other two species, egg production and laying rate of China yellow quail are significantly higher than those of Korea quail and Beijing white quail (P<0.05). The average egg weight of Korea quail is significantly higher than those of China yellow qu...

Waqar Akhtar1*, Munir Ahmad2, Nadeem Akmal1, Hassnain Shah1 and Asif Ali Mirani2 

...(0.72). The measures of protection showed that there was more dis-protection for fresh dates as compared to dried dates. Despite more resource use efficiency in the fresh dates only 16 percent produce was processed as fresh dates remaining 84 percent produce was converted into dried dates. This finding implicates that the overall dates production system secure low domestic resource use efficiency in the production of dates i...
Hashim Ullah1, Abdur Rahman1, Rifat Ullah Khan2, Shakoor Ahmad2 and Ambrina Tariq3, Shabana Naz4,*
...cholesterol, fat, crude protein, ash, moisture and dressing percentage of WaziriandMazaisheep. A total of 36 mature sheep of Waziri and Mazai were selected and processed for dressing percentage and meat quality through proximate analysis. Wazirisheephad lower cholesterol as compared to Mazai. With the increasing BCS, the cholesterol content was significantly increased in both the breeds. The dressing percentage and crude prot
Zhengfei Wang*, Dan Tang, Xuejia Shi, Huayun Guo, Xiuping Chen, Daizheng Zhang and Boping Tang*
...s.
...
Hong Ma*, Bo Fu, Liang Wang, Zhong-qiu Li and Di Liu*

 

...ll 117 (HSPC117) protein has been identified as being involved in placental formation, and can be modified by epigenetics. However, whether HSPC117 affects development of cloned embryos mRNA expression is unknown. To investigate the influences of HSPC117 on embryonic development, we generated transgenic porcine embryos by handmade cloning. We then assessed the embryonic developmental rate at cleavage and blastocyst stages. Our results show...
Muhammad Afzal1, Nighat Sultana1, Ali Hassan1, Syed Zakir Hussain Shah2,*, Mahroze Fatima3, Syed Makhdoom Hussain4, Muhammad Bilal5 and Majid Hussain2
...es of dry matter, crude protein and crude fat in Labeo rohita juveniles when fed CA supplemented diet. Similar observations were also recorded for the group fed on PHY supplemented diet. Citric acid addition in the diet also resulted in improved (p<0.05) digestibilities of Ca, Mg, P, Na, K, Cu, Zn, Fe and Mn. Similarly, PHY pretreatment had also resulted in enhanced mineral digestibility as compare to control group. However, both the supplemen...
Junli Sun1,2,3, Lin Bai1 2, Xiaogan Yang1,2, Yangqing Lu1,2, Shengsheng Lu1,2,* and Kehuan Lu1,2,*
...mbrane lipids, membrane proteins and nucleic acids. The PCA analysis also exhibited that these three groups were well distributed in different areas. In conclusion, the microoperation of ICSI caused some changes in the metabolism of embryos. Raman spectroscopy is a valuable technology for assessing embryonic metabolism.
...

Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Luqman and Muhammad Zeeshan Majeed 

...ugs were sulfoxaflor, spirotetramat, thiamethoxam and pyriproxyfen with mean mortality and LT50 values of 64.00±3.50% and 31.67 h, 62.67±2.64% and 34.42 h, 53.01±4.10% and 45.84 h, and 51.00±3.97% and 48.10 h, respectively. Based on these results, the above mentioned novel chemistry insecticides are recommended to be incorporated in future pest management programs against D. mangiferae mealybugs. 

...
Rabia Khalid1, Saleema Bashir Shams1, Bibi Nazia Murtaza1,*, Gaitee Joshua1, Saira Mushtaq1, Hassan Al-Talhi2 and Abdulaziz Al-Amri2
... (TG), high density lipoproteins (HDL), low density lipoproteins (LDL) and fasting blood glucose (FBG) were used to demonstrate the incidence of metabolic syndrome. Overall, 39.025% of bank employees and 22.53% of randomly selected control individuals have metabolic syndrome. Among the bank employees, prevalence of obesity was 67.53% and in general population it was 57.1%. The mean values of body mass index (BMI) for bank em...
Xiaohui Yu, Shuai He, Liqiang Wang, Mengyang Kang, Yanjiao Zhu, Shuhui Wang and Xiuzhu Sun*
... an effective method to protect Guanzhong donkey, a precious species. The objective of this study was to reveal the effect of different antioxidants on the semen cryopreservation in Guangzhong donkey by testing indices of sperm motility, mitochondrial activity, membrane integrity and arosome integrity. The results illustrated that compared with controls, above-mentioned indices of sperm were significantly improved under concentrations of Vitamin C (400 mg/L) a...
Iram Liaqat1,*, Nazish Mazhar Ali2, Najma Arshad3, Riffat Iqbal1 and Zain-ul-Abideen1
...cylidene acylhydrazide, proteinase k, trypsin and chymotrypsin target bacterial virulence in Desulfovibrio spp. that causes bacteremia, periodontitis and abdominal infections. Ten soil samples were collected and screened by morphological and biochemical study. Only one strain DUV1 was confirmed by 16S rRNA gene sequencing as D. vulgaris (accession number: KY698020). It showed significantly reduced biofilm formation (52%; p<0.05) by test tube m...
Zhimin Yuan1, Yan Yu2, Yanmei Wang1, Yanzhen Bu1,* and Hongxing Niu1,*
...ive phyla, dominated by Proteobacteria (27.8% in stomach and 39.7% in intestine) and Firmicutes (59.5% in stomach and 12.7% in intestine). Enterococcus and Bacillus were the two dominant bacterial genera in the stomach, accounting for 46.1% and 7.4% of total bacteria, respectively. Sphingomonas and Mycobacterium were the two dominant genera in the intestine, accounting for 10.5% and 7.3% of total bacteria, respectively. Furthermore,...

Anam Sardar1, Iqbal Javed1, Abdur Rehaman2*, Mudassar Yasin3, Raheel Saqib4, Allah Bakhsh3, Haroon Javaid5 and Muhammad Luqman

...2002-2016. NPC (Nominal Protection Coefficient), RCA (Revealed Comparative Advantage) and RSCA (Revealed Symmetric Comparative Advantage) were estimated to find the possible international markets for beef. According to the findings internal markets are categorized into four categories of existing potential markets, future potential markets, low potential markets and markets with no potential. First category of beef markets with no potential includes Afghanista...
Rana Waqas Arshad1, Asim Aslam1, Muhammad Saeed Imran1, Kamran Ashraf2 and Raheela Akhtar1,*
...ine group and a partial protection was observed in birds vaccinated with immune complex or intermediate plus vaccines. Consistently, histopathological lesions of IBD were less evident in live vector vaccine group in comparison to other groups. In addition live vector vaccine improved the feed conversion ratio (FCR) by keeping the bird healthy and by decreasing the immunosuppression. These results indicated that live vector vaccine has overall positive impact i...

Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan 

... for the partial fusion protein. Phylogenetic analysis revealed that 20 samples are genotyped as very virulent NDVclass II of genotype VIIb, 4 samples were of high identity (94%-100%) with NDV class II of genotype II (vaccine strain) and 1 sample was phylogenetically related to NDV class II of genotype I with 98% identity. Furthermore, the intracerebral pathogenicity index (ICPI) for selected 5 virulent viruses reveals velogenic features with high pathogenicit...
Jie Zhang1,2,*, Baradi Waryani3,4 and Qihai Zhou2,*
...re also evaluated on Protosalanx chinensis, Neosalanx anderssoni, Neosalanx argentea and Neosalanx oligodontis, and 6-7 loci were amplified in these species. The outcome of the present investigation would be useful in understanding genetic diversity, gene flow and the population structure of this species in the future.
...
Jingchen Chen, Zhaochao Deng and Zhiqiang Han*
...TAA, T or TA) in the 13 protein-coding genes are found. Except for tRNA-Ser(AGN), the second-structure of other tRNAs is the typical clover structure. The lengths of 12S rRNA and 16S rRNA are 945 and 1,698 bp (AP1, AP2) and 1,696 (AP3). A control region containing key sequence tags have three different domains, namely, terminating sequences (TAS1, TAS2), central conservatives (CSB-F, CSB-E and CSB-D) and conservative sequences (CSB1, CSB2 and CSB3)....

Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2 

...5 g 3.2 g and 1.48 g of protein, fat, carbohydrates, fiber and sugar, respectively. As well as one gram of okra contain 31.3 mg and 299mg of vitamin K and potassium, respectively. Therefore, to examine the effect of different forms of fertilizers (organic and inorganic) on the yield and physiochemical attributes of okra Abelmoschus esculentus a field trial was conducted. For this purpose, organic form of fertilizers like kitchen waste, poultry manure and compo...

Sadaf Rahim and Mudassar Iqbal* 

...g Glucose Peptone Yeast Broth (GPYB) and Potato Dextrose Broth (PDB) and the effect of organic extract was investigated against selected insects’ pest. From this study it was found that the mycelial extract of T. harzianum fermented on PDB showed enhanced insecticidal mortality (73% and 76%) against Diuraphis noxia and Tribolium castaneum respectively while the extract obtained from GPYB media showed merely 46% and 56%...

Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah

...roduction, nitrogen and proteins percentage of four mung bean varieties under different NaCI levels in sand culture after 5,7 and 9 weeks of sowing. Both inoculated and uninoculated plants were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry weight of plants was increased at 0-50mM NaCl and decreased at 100-300mM NaCI concentration. Inoculation effectively increased the dry weights of plants...

Yasir Ali1,2*, Bashir Ahmad1, Naqeebullah Jogezai3 and Adil Hussain

...te cold active alkaline protease and alkaline active lipase producing psychrotrophic bacteria from water and soil samples collected from different glaciers of Karakorum Range of mountains, Pakistan. Serial dilution and plating approaches were exploited for bacterial isolation and the isolates were qualitatively screened for proteolytic and lipolytic activity with skim milk and Tributyrin a...

Shaikh Abdul Lateef, Zhou Lin, Wu Jian, Junjie Qian, Jonathan Hartanto Tan and Zheng Shusen*
 

... not providing adequate protection against HBV. It is mandatory to characterize and devise novel antiviral therapies to control the spread of hepatitis  

...

Samina Qamer1, Farkhanda Asad1*, Amna Faiz1, Robina Arshad1, Zunaira Shaheen1 and Tahira Yasmin2 

...n for dry matter, crude protein and gross energy. While comparing organic and inorganic Cr efficiency in fish feed, it was concluded that organic chromium (picolinate) inclusion increased the nutrients digestibility and enhanced the nutrients deposition in body muscles of fish. 

...
Tian-Yi Zhao1, Zi-Qing Liu2, Bo Yang1, Qiao Gao1, Hong-Yu Zhang1, Pei-Yu He1, Ming-Hua Duan1* and Yu-Li Yan1*
...5, Bcl-2, and Cyclin D1 protein expression in peripheral blood.The red blood cell count and hemoglobin levels decreased in 5-Fu group compared with the control group (P < 0.05). 5-Fu+APs group showed a marked increase in the number of erythrocytes and a significant increase in hemoglobin content (P < 0.05). Compared with the control group, 5-Fu group showed a significant decreased in the number of CD71/Ter119-labeled erythrocytes (P <...
Syed Makhdoom Hussain1*, Nisar Ahmad1, Azhar Rasul1, Muhammad Mudassar Shahzad2, Muhammad Latif3, Muhammad Zubair Ul Hassan Arsalan1, Muhammad Umair1  and Hafiza Hina Shafqat1
...nt digestibility (crude protein 71% and gross energy 69%) and hematological parameters (WBCs 7.87×103mm-3, RBCs 3.04 ×106mm-3 and Platelets 67) were observed in the fingerlings fed with test diet supplemented with 2 mg kg-1 nano Cr while crude fat digestibility (79%) was found maximum at test diet supplemented with 1.5 mg kg-1 of nano Cr which were significantly different from fish fed with control and ot...
Wen-Feng Li1, Rong-Yue Zhang1, Chun-Hua Pu2, Jiong Yin1, Zhi-Ming Luo1, Xiao-Yan Wang1, Xiao-Yan Cang1, Hong-Li Shan1 and Ying-Kun Huang1,*
...umeralis Chevrolat. Protecting these natural enemies will encourage natural control of pest species while protecting the environment and maintaining ecological balance. Moreover, through enhanced comprehensive pest control, sustainable development of the sugar industry will be promoted.

 

...
Muhammad Shahid1, Iram Amin1, Samia Afzal1,*, Zareen Fatima1 and Muhammad Idrees2
...han RNA positive ones. Serotype-2 remained the main causative serotype of the outbreak of dengue viral infection, started in the commencement of year 2013 and continues to infect Pakistani population till now.
...
Hui Wang1, Lin Wang1, Xuanlu Li1, Shanshan Li1, Yongqiang Zhao2, Shicheng Lv2, Xinrong Xu1, Guang Yang1 and Bingyao Chen1,*
...r zone. As a result, 34 protected species among the 4975 individuals were sighted, including 127 red-crowned cranes (Grus japonensis) and 868 common cranes (Grus grus). The overall density of protected species, winter migratory species, and resident birds was 1244.60 individuals/km2, 396.88 individuals/km2 and 758.94 individuals/km2 respectively. The woodland, aquaculture, and f...
Zil-e-Huma1, 2, Abdul Malik Tareen3, Kaleem Ullah3, Tauseef M Asmat4,Abdul Samad4Asim Iqbal2, Mohammad Zahid Mustafa3*,Irshad Ahmad5 and Sadeeq ur Rahman6
...>E. coli (EAEC), enterotoxigenic E. coli (ETEC), enteroinvasive E. coli (EIEC), and enterohemorrhagic E. coli (EHEC). Results show that the virulent EAEC strain of E. coli was found to be the most prevalent (35%), while EPEC was identified in 15%, followed by EHEC (8%). Notably, none of the samples was found positive for EIEC. Moreover, ETEC was identified in 11% cases of co-infection. Results showed that children with less than...
Unal Kilic1*, Abdiwali Mohamoud Abdi1 and Deniz Ekinci2
...ocks. In terms of crude protein content, the highest CP was obtained from the urea+molasses treatment for wheat, sorghum and soybean straws, while control groups were found to have the lowest CP content. The lowest NDF, ADF and lignin contents were found in sorghum straws (P<0.001). The highest gas production value was obtained from sorghum straws for 24-hours incubation process (P<0.001). Treatments did not cause any effects on 24-hours gas production f...

Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Gul Bahar Khaskheli2, Allah Jurio Khaskheli3, Arshad Ali Khaskheli4, Abdul Samad Magsi5, Ghulam Shabir Barham2, Arab Khan Lund5 and Maqbool Ahmed Jamali4 

... concentration of crude protein. Further the Prosopis juliflora against Zea mays, in Acacia nilotica versus Alhagi maurorum, in Tamarix orientalis versus Trifolium alexandrinum, Tamarix gallica versus Cordia sinensis (Linn.) crude protein content existed statistically non-significant, but each of above set varied significantly to one another. Trifolium alexandrinum and Zea mays though had statistically similar concentration ...
Riyadh S. Aljumaah1, Mutassim M. Abdelrahman1,*, Moez Ayadi1 and Abdullah H. Alyemni2
...nt levels of energy and protein viz. higher protein than recommended by National Research Council (1985; TMR1), and higher energy than National Research Council (1985; TMR2) compared with the traditional feeding system of barley and alfalfa hay; Control). A total of 96 Najdi ewes, about nine months old, were divided randomly into three dietary treatments two months before parturition (Late gestation). Lambing percentage, lam...
Nida Zia1, *, Ayesha Maqbool2, Muhammad Safdar3, Umm-I-Habiba1, Altaf Mehmood4, Muhammad Usman5, Zahid Iqbal6, Javed Iqbal6, Shahid Mehmood6, Amanullah Khan7 and Sajid Umar8
...he FAdV- C species and serotyped as FAdV-4 and showed close proximity at the nucleotide level. The other cluster containing three strains belonged to the FAdV-D species and serotyped as FAdV-11. Furthermore, the sequencing analysis of detected field strains revealed the high similarity and close clustering with FAdV-4 and FAdV-11 strains isolated from neighboring countries, suggesting geographic and temporal relationships am...

Azeem Haider1, Muhammad Mohsin Alam2*, Azhar Ali Khan3 and Muhammad Asif Zulfiqar3

...fficacy of different Pleurotus ostreatus (L.) isolates to treat pulp and paper industrial effluent on a shake flask were studied. In the shake flask studies, Pleurotus ostreatus (L.) decolorized the effluent 69.68 %, on 7th day of incubation. Various cultural conditions including different glucose concentrations, nitrogen sources, pH, temperature and incubation period influence on biomass and different enzymes viz; xylanase,...
Xiaopeng Tang1, Wen-qin Su1 and Re-jun Fang1,2,*
...treatment. The NaPi-IIb protein expression was determined by Western Blot, and the NaPi-IIb mRNA expression was determined by RT-PCR. The results showed that, compared with the control group, different levels of CT had no effect on cell proliferation, but it inhibited (P < 0.05) the absorption of phosphorus at CT concentration of 1×10-11, 1×10-10 mol/L and 1×10-9 mol/L. There was no effect of ...
Constance Obiageli Ejilibe1, Helen O. Nwamba2, Ifeanyi Chinedu Atama3,*, Chiamaka Lynda Ani2, Ifeanyi Oscar Aguzie3, Josephine C. Madu3 and Christopher Didigwu Nwani3
...phatase (ALP) and total protein (TP) concentrations in homogenized muscle samples was determined by standard procedures. ALT, AST and ALP increased significantly in response to concentrations of Butaforce® (7.00, 9.00 and 11.00 µgL-1) and Termex® (15.00, 20.00 and 25.00 µgL-1) used. The TP decreased in response to the same concentrations of pesticides. The response of these biochemical parameters ...

Zubaria Malik, Zahir Shah* and Muhammad Tariq 

...eat and maize crops in a rotation experiment involving cereals {wheat (Triticum aestivum), maize (Zea mays L.)} and legumes {chickpea (Cicer arientinum), mungbean (Vigna radiata)} in a calcareous alkaline soil of Peshawar valley during 2015/16 and 2016/17. This study was conducted in an already established experiment which was in a randomized complete block design with split plot settings. Keeping cropping systems in main plots and biochar levels in subplots. ...
Abd El-Nasser Ahmed Mohammed1,2,*
...obin, glucose and total protein), oocyte quality after ovarian transplantation (cumlus enclosed, brilliant cresyl blue stain and diameter) and reproductive performances (litter size and weight) were determined and recorded. In addition, values of body temperature and blood glucose were determined after general anesthesia. The results indicated that N. sativa oil supplementation resulted in significant (P < 0.05) increase of RBCs, hematocrit, WBCs and...
Kun Wang1,2, Yinglin Cui2, Xu Zhao2 and Changjiang Hu1*
...to investigate the neuroprotective effect of XN on ICH model rats and to explore the underlying mechanisms of this therapy. In this study, experimental ICH was induced by the administration of stereotaxic collagenase type VII into the caudate nucleus. XN (at a high dose and a low dose of 3.60g·kg-1 and 1.80g·kg-1, respectively) was administered via enema. The detection of neuronal apoptosis was measured by TUNEL assay. Using...
Muhammad Saeed1,2,*, Tariq Mukhtar1 and Malik Abdul Rehman3
...he first root flush, to protect the new roots from nematode infection.
...
Nouf Alharbi*, Mai Elobeid and Promy Virk
...iod was four weeks. The protective efficacy of quercetin was evaluated in terms of cadmium (Cd) accumulation in liver and hair, blood profile, catalase (CAT) and superoxide dismutase (SOD) activity in liver, malondialdehyde (MDA) levels in liver and serum, and histopathological evaluation of liver and kidney. Results showed that low dose of quercetin was significantly (p≤0.05) more effective than the high dose. Low dose was more efficacious in reducing Cd a...
Tanzeela Riaz1, Farah Rauf Shakoori2,*, Hareem Mansoor1, Sana Khan1 and Mushtaq A. Saleem1
...re on soluble and total proteins, total lipids, glucose, glycogen, free amino acid and trehalose contents was also recorded. The results indicated that contents of glycogen, trehalose, total lipids, free amino acids, soluble proteins and total proteins were significantly deceased in both larval instars except the free amino acids that increased in 4th larval instar of both popul...
Gul Afshan1,2,*, Soumble Zulfiqar2, Sumaira Mehboob2, Muhammad Tahir Javed Khan1 and Abdul Rauf Shakoori2,*
...ing HCV3a envelope glycoprotein E2. HCV3a E2 gene was amplified and cloned first in cloning vector pTG19 and subcloned in expression vector pET21a. E2 protein, expressed in insoluble form, was purified by repeated sonications, followed by denaturation and refolding through fractional dialysis with urea. Multiple alignment with other sequences showed nucleotide variations of HCV3a E2 compared with already reported sequ...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

...omain (ORF1) and capsid protein (ORF2) revealed clustering of Pakistani aHEV (Pak aHEV) strains with members of Orthohepevirus B species. However, Pak aHEV strains were highly divergent from other known members within Orthohepevirus B suggesting as novel aHEV strains circulating in the population of layer chickens in the country. Detection of HEV in layer chickens may pose public health risk in context of zoonosis and food borne transmissi...

Abir Ishtiaq and Muhammad Naeem* 

... the effects of dietary protein levels on growth and to elucidate the optimal dietary crude protein requirement for Catla catla (Thaila) in a polyculture system was conducted. Four experimental diets containing graded levels of protein (15, 20, 25 and 30%) were tested. Triplicate groups of C. catla stocked in outdoors earthen ponds at 2000 fish/acre were fed at 4% of body weight, 2 times a...

Wajid Khan* and Raziuddin 

...arent and commercial heterotic effects were observed in 17 and 13 hybrids for maturity, respectively. Desired significant positive best parent and commercial heterotic effects were observed in 18 and 21 hybrids for primary branches plant-1, 19 and 10 hybrids for pods main raceme-1, 11 and 05 hybrids for 1000-seed weight and 18 and 01 hybrid for seed yield plant-1, respectively. Top ranking F1 hybrids were, AUP-05 × AUP...
Maliha Ayub1, Muhammad Javed1, Fariha Latif 1*, Faiza Ambreen2, Komal Sabir1
...nzymes are effective in protecting the bio-molecules against the reactive oxygen species (ROS) and their harmful effects. This study was aimed to evaluate the effects of sub-lethal concentrations of manganese on antioxidant activity in the fish, Labeo rohita. Fish were acclimatized for two weeks in the cemented tanks prior to the start of experiment. Four groups (n=10) of one year old fingerlings of Labeo rohita were exposed to 96-hr LC50
Zijuan Li1,2, Rong Ma2, Muhammad Khan3*, Chenchen Liu2, Xiaolin Cui2 and Yongming Li1,2*
...e expression of various proteins. The data demonstrated that piceatannol inhibited growth and induced G2/M phase arrest and apoptosis. Further studies showed that piceatannol induces mitochondrial apoptosis as shown by Bcl-2 family proteins modulation. Finally, piceatannol significantly enhanced apoptotic efficacy of CDDP in U2OS cells. On the basis of our findings, piceatannol is a promising anticancer agent which could be ...
Abdul Waheed1,2, Sidrah Saleem1, Naveed Shahzad3, Junaid Akhtar4, Muhammad Saeed5, Iqra Jameel1, Farhan Rasheed6 and Shah Jahan7,*
...erogenes (n=02), Proteus mirabilis (n=05), Proteus vulgaris (n=02) and Citrobacter freundii (n=02). Extended spectrum beta lactamases (ESBL) production was screened by double disc synergy test (DDST) and combination disc method as per Clinical Laboratory Standard Institute (CLSI) guidelines 2015. Presence of “blaSHV” and “blaOX...
Fiza Asif1,*, Muhammad Siddique Awan1, Nasra Ashraf1, Nuzhat Shafi1, Abdul Rauf1, Khizra Bano1, Muhammad Razzaq2 and Naeem Iftikhar Dar2
...onal Park would require protection of core habitat of the langur in MNP. Wildlife managers should focus on conservation and increasing the number of preferred forage species of Kashmir grey langur i.e. Asculus indica, Cedrus deodara, Vibernum foetens, Pyrus pashia and Eleagnus orientalis in MNP.
...
Huaisheng Zhang1, Pengfei Li2, Huajun Wen2, Guangming Tian1, Hui Chen1, Lu Zhang1 and Jianqiang Zhu1,*
...ow become a first-class protected animal in the country. Moreover, research on the Milu has begun. After 30 years of breeding and development, the Milu population has formed stable captive or wild populations in Beijing, Dafeng, Shishou and Dongting Lake. It has become a typical example of the successful reintroduction of a species. Because of the precision of the information on the Milu in biology and population history, the research on Milu has developed rap...
Huma Sattar1, Sehrish Firyal1,*, Ali Raza Awan1, Habib-Ur -Rehman2, Muhammad Sajid Hasni3 and Amjad Islam Aqib4*
...ge in the folding of 3D protein structure of clinical sample, while in subclinical samples, showing the same variation in overall 3D protein structure analysis of TNF-α gene. The association between polymorphism identified within the TNF-α gene with mastitis reported in this study revealed that SNPs has potential to serve as a molecular marker for screening of mastitis resistant and susceptible Sahi...
Mumtaz Ali Khan1,*, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Ikramul Haq4, Kashif Prince1, Asad Ullah5, Muhammad Shoaib2, Shahid Zaman6, Amjad Islam Aqib7, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4,Imad Khan5, Naimat Ullah4 and Muhammad Shahid8
...were vaccinated with enterotoxaemia vaccine. Group C was kept as negative control in both rabbits and goats. The immune titer against C. perfringens type D was evaluated on 0, 7, 14, 28th and 60th day of vaccination with indirect haemagglutination test (IHA). The results showed significantly higher (P< 0.05) immune titer in vitamin E supplemented animals groups against C. perfringens type D epsilon toxin.
...
Laiba Shafique1,*, Muhammad Afzal2, Syed Zakir Hussain Shah3, Mahroze Fatima4, Huma Naz5, Saif ur Rehman1, Youchuan Wei1 and Qingyou Liu1,*
...ub> increased the crude protein, ash and decreased the fat contents in muscles while same result was observed by supplementation of formic acid. In conclusion, dietary formic acid and vitamin D3 improves the growth performance and muscle proximate analysis for the C. idella fingerlings.
...
Muhammad Suleman1,*, Abu ul Hassan Faiz2, Muhammad Shahbaz2 and Ayesha Riaz3
... KDa by SDS-PAGE. Total protein present in crude enzyme was calculated as 188 mg/ml. Crude xylanase showed specific activity of 41.22 IU/mg protein. Partially purified xylanase showed protein content of 80.6 mg/ml. The novelty of this study is basic sources used are indigenous and cheap for production of xylanase.
...
Irfan Irshad1, Asim Aslam1,*, Muhammad Yasin Tipu1, Kamran Ashraf2, Beenish Zahid3 and Abdul Wajid4
...no acid sequence at the proteolytic cleavage-site of the HA gene with PAKSSR/G. Our findings highlight the potential risk of ND and AI in poultry and continued active surveillance is needed to monitor the transmission of these viruses. 
...
Lin Qi, Lu Li, Danyang Chen, Mingxiao Liu, Yan Wu and Wei Hu*
...man degradation using a protein/peptide sequencer. The antibacterial activity of the protein monomer in antlerplate was studied by disc diffusion method, and the antibacterial ring diameter of each antibacterial agent was measured to determine its antibacterial ability. The molecular mass and purity of this polypeptide was 18.970kDa and 90%. Amino acid sequence analyses indicated that the N-terminal amino-acid sequence of th...
Jinfeng Liu1,2, Yanhong Cao3, Tong Feng1, Laiba Shafique1, Chan Luo1, Peng Zhu1,4,* and Qingyou Liu1,*
... exhibited BMP15 protein was located in germ cells of testis, in primordial granulosa cells, primary, secondary, and antral follicles of ovary, and none in theca cells. The more conspicuous reaction for BMP15 was observed in germ cells than cumulus cells and granulosa cells, particularly in primordial germ cells of genital ridge or in foetus ovary of buffalo. The expression pattern of BMP15 suggested that it may play a key role in the form...
Muhammad Waseem1, Ahmed Raza1, Hamera Aisha1, Muhammad Naeem Awan1, Tariq Ahmad2, Rabia Nazir2 and Tariq Mahmood2,*
...ghlighting the need for protecting the species against illegal trade. In the current study, we investigated the scale of its poaching and illegal trade in the country. Results revealed that poachers use spotlight and tracking techniques (42% respondents). Summer is the best season for poaching the pangolins (44% respondents). Forest is best preferred habitat of pangolin (54% respondents) and pangolins selling and buying points are located outside the villages ...
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
...N) and digestible crude protein, showed that there were insignificant (P>0.05) differences between cows fed R2, R3 and R4 compared with those fed R1 (control), except digestibility of nitrogen free extract which was significantly (P≤0.05) decreased by feeding experimental rations by increasing replacement level of DOP to more than 25% (R2). Blood constituents of experimental cows on all rations were within normal range for platelets, red blood cells (RBC...
Abdulkareem Mohamed Matar1, Moez Ayadi1,2, Hassen Mohamed Sbihi3*, Imeddine Arbi Nehdi3, Mutassim Mohammad Abdelrahman1 and Riyadh Saleh Aljumaah1
... (6.40%); however, milk protein percentage was higher in the milk of ewes fed CF1 (4.29%) and CF3 (4.64%) compared to TF (3.78%) and CF2 (3.57%). Total (C12:0 + C14:0 + C16:0) saturated fatty acids were significantly lower in milk fat from ewes fed TF (45.67%) and CF1 (42.13%) compared to CF3 (53.65%) and CF2 (49.67%). Linoleic acid (C18:2∆9c,12c; n-6) was significantly higher in milk fat from...
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Naimat Ullah Khan3, Muhammad Asfandyar Khan2, Kashif Prince1,*, Mahboob Ali1, Ghazunfar Rashid1 and Azmat Ulah Khan2
...ds with the signs of enterotoxaemia. The isolates were initially identified by colony characteristics, Gram staining, biochemical tests and CFU/g. Clostridium perfringens was isolated from 43.45% of lambs and 50.59% of the kids. Obtained isolates were further analyzed for toxinotyping with conventional PCR. Sequence analysis of 73 strains from diseased lambs showed 13.10% type A, 9.52% type B and highest 20.83% proportion of Clostridium perfringens
Mohammed Al Bratty1,*, Hassan A. Alhazmi1,2, Desam Nagarjuna Reddy3, Abdul Jabbar Al-Rajab3, Sadique A. Javed1 and Zia ur Rehman1,4
...y honeybees and used to protect their hives from outside attackers including microorganisms. In present study, propolis sample was collected from adjacent to Jazan city, Saudi Arabia and the chemical constituents of the ethanolic extract was evaluated by GC-MS. The ethanolic extract was tested against selected strains of microorganisms for its antibacterial and antifungal activities. The major classes of compounds indentified in the extract were fatty acid est...

 Li-na Li1, Sheng Li2, Ping Gui3, Jing-hui Li1, Fen Ai4,* and Li-li Cai1,*

...expression of the pro-fibrotic TGF-β1 and increased the expression of anti-fibrotic IFN-γ at both mRNA and protein levels. Furthermore, we found that MSCCM inhibited the activation of NF-κB signaling pathway induced by irradiation as well. Our data suggest that MSCCM could reduce irradiation-induced TGF-β1 production and ameliorate collagen deposition by inhibiting NF...
Muhammad Aslam Farooqi*, Bakhtawar Irsa, Sajjad Ali, Asif Sajjad, Muhammad Waqar Hassan and Sohail Akhtar

 

...iuron, profenofos and spirotetramat against adult workers of Apis mellifera L. These insecticides were frequently being used to control different insect pests of major crops in Punjab-Pakistan. The experimentation was performed under laboratory conditions (28±2°C and 65±5% R.H). Four different concentrations (i.e. 50 ppm, 100, 200 and 400 ppm) of each insecticide were evaluated against A. mellifera as derived from their r...
Manzoor Hussain*, Marie Maňasová, Miloslav Zouhar and Pavel Ryšánek
...harzianum and Pleurotus ostreatus,along with two chemicals,Vydate and Basamid (G),were evaluated against northern root-knot nematodes, Meloidogyne hapla, on carrots in a greenhouse. All fungi and chemicals proved to be efficient in reducing the infestation level of Meloidogyne hapla and providing better growth of carrots compared to their controls. Ma...
Muhammad Usman Akhtar1,2, Abdul Qayum3, Anshan Shan1,*, Shuli Chou1, Hyeonsoo Jo4, Syed Waqas Ali Shah4 and Ishfaq Muhammad5
... and 70% RDP of dietary protein represented as 30RDP, 40RDP, 50RDP, 60RDP and 70RDP, respectively. Feed intake was recorded, nutrient digestibilities (DM, CP, ADF and NDF) were determined and blood samples were taken at 3, 6, 9 and 12 h post feeding, and examined for BUN. In addition, milk produced by each goat was recorded. The results showed that increasing RDP level in the diet has a linear effect (dose-dependently) on nutrient digestibilites, nutrient inta...
Muhammad Mansoor1, Khalid Usman2*, Shahid Hameed Khan Khalil3, Abdul Mateen Khattak4, Muhammad Ehsan Elahi1, Muhammad Waqas Imam Malik2 and Amir Hamza2
...e required results. The protocols of using solar tunnels needed fine-tuning of temperature and relative air humidity, which affect fruit quality. During dates’ drying process high temperature and low humidity is required. This research was conducted at Arid Zone Research Center, D.I. Khan, Pakistan for quick and safe ripening of date fruits under controlled conditions. For ripening of date fruits, 35 ± 5°C temperature and 80 ± 5% relati...

Faleye Temitope Oluwasegun Cephas1,2*, Adewumi Moses Olubusuyi1, Olayinka Olaitan Titilola3 and Adeniji Johnson Adekunle1,3 

Ping Jiang1 , Zhihui Zhao1, 2, Xiaohui Li2, Mengyan Wang2, Lixin Xia2, Yang Cao3, Runjun Yang2 and Xibi Fang2*
...1 (ABCA1) is a membrane protein. As a member of the superfamily of ABC transporters, ABCA1 can transport lipids and cholesterol across cell membranes. To further verify the relationship between the ABCA1 gene and milk fat metabolism of Chinese Holstein dairy cows, we exploited transient transfection mediated-RNA interference technology to specifically knockdown expression levels of the endogenous gene ABCA1 in bovine mammary epithelial cells (BMECs) to analyse...

Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Rashid Mahmood2, Ziyad Abdul Qadir2, Muhammad Arshad1 and Mubasshir Sohail3 

... The apiary had 20 Langstroth standard colonies of Apis mellifera naturally infested with Varroa destructor. Varroa destructor (Anderson and Trueman) is the most destructive pest of honeybees and a major threat to beekeepers in different areas of the world. Many control measures including application of chemicals, are adopted to control the infestation of mites in honey bee colonies. Chemical are still the most effective option; however, they pose different th...
Qi Ren, Shufeng Sun, Chen Niu, Yuhong Li, Yingzhi Chong, Biao Li, Guoying Zheng and Fumin Feng*

 

...hen the CYP1A1 mRNA and protein expression decreased with cell damage, thus suggesting that elevated methylation of the promoter region of the CYP1A1 gene may affect its expression and could be associated with cell damage. After treatment of the cells with AZA, increases in methylation rate and DNMTs expression were reduced, CYP1A1 mRNA and protein levels increased, and cell damage was ameliorated; these results indicate tha...
Yating Cheng1, Wenlong Shi1, Xue Xiao2, Qirong Zhang2, Qihao Zhang1, Zhijian Su1, Qi Xiang1,2* and Yadong Huang1,2
...ne of the most abundant proteins in humans and plays an essential role in cell maintenance and organization. Collagen has a unique triple-helix structure composed of three polypeptides, and hydroxylation of proline residues is vital for the stability of this triple-helix. Prolyl-4-hydroxylase (P4H) is an enzyme with an α2β2 tetramer arrangement that functions to post-translationally hydroxylate proline residues in the collagen chain. The α sub...
Wiqar Ahmad1*, Farmanullah Khan2, Muhammad Sharif2 and Muhammad Jamal Khan2
...istically similar crude protein content. Compared to the control, INM significantly (p<0.05) improved the wheat and lentil yield by 128 and 87%, respectively, and the crude protein by 17%. Yield improved by 13% for wheat in intercrop over the wheat after maize and by 46% for lentil after maize over the lentil in intercrop. The INM treatment showed 94% higher OM, 10% reduced bulk density (ρb) and 12, 20 and ...
Shou-Hong Zhang1*, Ying Zhang1, Kun-Ming Wen2, Wei Wu3 and Wen-Yan Li3
...ts a valid liver anti-fibrotic molecule. PWI might be an effective method for quantifying the severity of liver fibrosis.
...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Abu Saeed Hashmi1, Ghulam Yasein2 and Ghulam Abbas1 
...gulation. IGF-1 control protein metabolism and is extremely conserved region amongst species. IGF-1 have not been studied before in camel. The DNA samples of Marecha camel were collected from the Camel Breeding and Research Station at Rakhmani Bhakkar, Pakistan. Four polymorphic sites were detected in the IGF-1 gene. A significant finding was the occurrence of a T→C polymorphism in exon 5 that causes a substitution of an amino acid from Cysteine to...
Memis Ozdemir
... the expression of milk protein genes. It has been seen many studies about Prl/RsaI polymorphism found in the exon 3 or exon 4 region of bovine prolactin gene in the literature. The aim of this study was to determine whether the DNA sequence of the Prl gene exon 3 or exon 4 in cattle breeds has the RsaI polymorphic digestion site. As a result of the study, it has been seen that the Prl/RsaI specificpolymorphic site is on exon...

Aamir Saleem1, Arshad Mahmood Malik2*, Najam Ul Hassan1 and Imtiaz A. Qamar

...nd dry weight and crude protein) and meteorological data regarding rain fall, temperature, pan evaporation, sunshine and wind speed for interpreting results along with their statistical analysis as fixing legume with grass has improved the forage quality. Overall, these results has suggested that grass-legume mixtures can improve livestock and pasture productivity, sustainability and as well as to fix atmospheric nitrogen and this may improve soil N status als...

Muneer Abbas1*, Muhammad Ramzan1, Niaz Hussain1, Abdul Ghaffar1, Khalid Hussain1, Sohail Abbas2 and Ali Raza3 

...ra, Spodoptera litura, Agrotis Sp., Bemesia tabaci and Microtermes Spp. were major pests of gram and mungbean attracted in light traps. May, June and July were hottest months of the year with highest population captures of 2892, 2789 and 2475, respectively. Temperature had significant impact of 80.7 % on per unit population attraction (r=0.807). However, humidity had no significant impact (2.9 %) on per unit population attra...

Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2 

...(GSH). GSH functions to protect the plants against different forms of stresses. In this study, the feedback-insensitive serine acetyltransferase (SAT); a rate-limiting enzyme for Cys biosynthesis from tobacco i.e. NtSAT4 was successfully cloned into three types of overexpression constructs i.e. pBinAR_NtSAT4 (targeted to cytosol), pBinAR-TKTP_NtSAT4 (targeted to plastids) and pBinAR-SHMT_NtSAT4 (targeted to mitochondria). For stable transformation of B. napus ...

Muhammad Naeem Khan* and Asad Jan 

...smn;0.83 %) followed by protein (30.26±0.72 %) while crude fibers were found least in amount (1.43±0.53 %). Among different minerals, reasonable amount of calcium (3268±0.53 μg/g), potassium (2873±0.71 μg/g), sodium (591±0.23 μg/g) and iron (223 ± 0.46 μg/g) were found while no cadmium and chromium was detected. MCE and EAF displayed considerable antibacterial activity against Xanthomonas campestris and Pse...

Sibgha Noreen*, Sumrina Faiz, Muhammad Salim Akhter, Kausar Hussain Shah 

...xt-align: justify;">Osmoprotectants are highly soluble, neutral and non-toxic chemical compounds which have low molecular weight. These molecules help the plants to regulate osmotic adjustment and to enhance abiotic stress tolerance in plants. This study was aimed to examine mitigation effects of different osmoprotectants (salicylic acid, ascorbic acid, proline and their admixture) @ 200 mgL-1 on sunflower (Helianthus annuus...

Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh* 

...We aimed to develop the protocol for transformation of Solanum chacoense diploid M6 potato using tetraploid S. tuberorsum cv. Desiree as a control using five different Agrobacterium strains harboring pBIN19 binary vector that further contains gusA gene, interrupted by an intronic sequence, under the control of 35S CaMV promoter. After transformation, we analyzed the transformation efficiencies of each of the Agrobacterium strains using the histochemical GUS an...
Hanif Ullah1, Muhammad Inayat Ullah Khan2, Suleman3, Sawar Khan1,Salma Javed4, Abdul Qadeer1, Mohsin Nawaz1, Sardar Azhar Mehmood4
...tious disease caused by protozoan parasite of the genus Plasmodium. In Pakistan, P. vivax and P. falciparum are common species. The current study was designed to investigate the prevalence of malaria infection in District Lower Dir Pakistan. A total of 1750 blood samples were collected from seven tehsils of District Lower Dir (January to December 2013). The data were analysed tehsils wise, month wise, gender wise, age wise and species wise...
Fizza Anwar1, Muddassar Zafar1*, Zahid Anwar1, Raja Tahir Mehmood2
...erichia coli and Proteus mirabilis. The fungus Aspergillus niger was found best among all tested strains as it produced maximum amount of antimicrobial agent Tautomycetin. The antimicrobial activities were determined through disk diffusion assays and Tautomycetin was observed as best antimicrobial agent having inhibitory effect on serine/threonine phosphatases leading to hindrance in bacterial growth. In addition, phylogenetic tree was also c...
Ali Mujtaba Shah1,2,3, Ali Raza Shah3, Muhammad Farooque Hassan2, Muhammad Yousif2, Zhisheng Wang1*
...also confers additional protection by binding to intestinal receptors which could otherwise be bound by bacteria. Moreover, the adequate colostrum reduces neonatal mortality, strengthen immunity and increase animal lifespan. Delaying intake of colostrum in dairy calves causes decreased transport of both immunoglobulins as well as fat-soluble vitamins. In this review, an attempt has been made to study the composition of colostrum, i.e. fat, p
Hafiz Muhammad Tahir*, Palwasha Jabeen, Chand Raza, Shaukat Ali
... other. Spidroin is the protein found in spider silk while silkworm silk is made up of an inner core of fibroin and outer layer of sericin protein. After the removal of sericin, silk is non-immunogenic and non-allergic. It is a renowned biomaterial due to its biocompatible nature. Silk proteins have been found to possess antibacterial properties and application in culturing tissues includi...
Mehwish Faheem1*, Maleeha Rafeeq1, Aisha Majeed1 and Saba Khaliq2
...p1a1 and heat shock proteins mRNA level was evaluated using real time qPCR. Results revealed that exposure to bisphenol A caused decrease expression of cyp1a1 in a concentration dependent manner. Exposure to graded concentrations of bisphenol-A resulted in significant increase in mRNA expression of heat shock proteins (hsp70 and hsp90). In the light of present results, expression of cyp1a1 or ...
Chaman Ara1*, Asmatullah1, Sehrish Kanwa1, Asma Chaudhary2, Ayesha Siddiqua1
...uced hepatotoxicity, nephrotoxicity and its likely noxious effects on spermatogenesis in mammals. Forty mice, randomly categorized into four groups (N=10) were administered orally with different concentrations of levofloxacin (0.00, 9.37, 18.75 and 37.50µg/g BW of mice) for 30 days consecutively. Mice were sacrificed on 31st day (24 hours after last dose administered) under deep chloroform anaesthesia. Blood was extracted through cardiac punct...
Chaman Ara1*, Asmatullah1, Zainab Riaz1, Memoona1, Asma Chaudhary2, Shagufta Andleeb2
...possible hepatic and nephrotoxic effects of Butyl paraben in mice and to explore the possible curative and protective impacts of turmeric. Fifty mice randomly divided in five groups, i.e. Control, dose group (BP), dose and antidote group (BP+AD), vehicle control group (VC) and antidote group (AD). A sub lethal concentration containing 15ug/g B.W of BP was given with and without turmeric orally, dissolved in corn oil, used as...
Peng Chen1,2, Zuhao Huang3,Chaoying Zhu1, Yuqing Han1, Zhifeng Xu1
Guanglong Sun1, Zhen Zhang1, Dongqin Zhao4, Gang Ge1 and Luzhang Ruan1*
...GC. The start codons in protein-coding genes (PCGs) included ATG, GTG, ATT, ATC and ATA, while its stop codons included TAA, TAG, AGG, AGA and the incomplete cipher T. In PCGs, the highest frequency of codon was CTA (Leu). The highest frequency of amino acids was Leu, whereas the lowest was Cys. In phylogenetic analyses, Gruiformes included Grui and Ralli, and Charadriformes included Charadrii, Lari and Scolopaci. The genus Porzana was closest to Por...

Turab Ali Kaurajo1*, Huma Rizwana1, Gulbahar Khaskheli2, Muhammad Haroon Baloch1, Muhammad Naeem Rajput1, Asad Ali Khaskheli3 and Mohsin Solangi

... 25 years. Incidence of protozoa were more common at study area. The age of puberty and breeding life were 3-5 and 12-22 years respectively in females. Duration of estrus cycle in camel varied from 16-22 days. Average hair production of 1.63, 1.62, 1.47 and 1.36 kg was noted for Kharai, Dhatti, Larri and Sakrai breeds respectively. Average daily milk production of Dhatti, Sakrai, Kharai and Larri camels were recorded as 6.40, 5.23, 4.90 and 5.20 liters respect...

Imran1*, Amanullah1, Muhammad Arif1, Zahir Shah2 and Abdul Bari3 

...ion of Trichoderma (soft-rot fungi) along with seed inoculation of phosphate solubilizing bacteria (PSB) (Pseudomonas) and phosphorus (P) on weeds frequency, and biomass at various growth stages of soybean and its yield contributing parameters. The consecutive field experiments for years 2016 and 2017 using randomized complete block design (RCBD) were conducted on soybean (cv. Malakand-96) crop. Experimental treatments included three organic sources, three pho...
 

Aftab Shaukat1,2,*, Tauseef ur Rehman3, Rizwan Shukat4, Shahid Ali Rajput5, 

Shadab Shaukat6, Muhammad Ahsan Naeem2,5,8, Mubashar Hassan2,5, Tabassam Fatima2,5
Fayyaz Ahmad1, Muhammad Usman Saleem7, Fatima Arooj1, Ashar Mehfooz2 and Anas Sarwar Qureshi2
... g and 500 g with crude protein 17.5 % and metabolizable energy 2.9 Mcal/kg was offered to does for one month prior and post breeding season (15 September-30 October). Does were weighed at the start of breeding season T2 (BW=29.18±0.21kg) and T1 (BW=28.93±0.53kg), respectively. All the does were sent for grazing of jantar fodder for four hours daily and were sheltered during the rest time in different pens with separate feed...
Jam Nazeer Ahmad1,2*,Mujahid Manzoor1, Zubair Aslamand  Samina Jam Nazeer Ahmad1, 2
.../div>...
Sumaira Abbas1, Muhammad Sultan Haider2,*, Fatima Kafayet1, Sana Ashraf2, Atifa Masood3 and Moazma Batool4
...ndeavor to use natural carotenoid sources to enhance skin color of gold fish Carassius auratus. Citrus peels were collected from local market dried and grinded. Organic solvent extraction was carried out by hexane and acetone mixture (1:1 v/v). Carotenoid concentration was determined by thin layer chromatography (TLC) and found satisfactory. By mixing fish meal, sunflower meal and rice polish four treatment diets, T
Saman Muhsin Abdulkareem* and Nadir Mustafa Nanakali
...
In this study, the protective effects of antioxidant quercetin(QCT) were studied on indices of oxidative stress, liver enzymes activity and the expression of cytochrome P450 1A1 (CYP1A1) against hepatotoxicity induced by 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin (TCDD) in male rat. Thirty adult male Wistar rats randomly divided into five equal groups. TCDD and QCT were orally administered at the dose of 10µg/kg /day and 20 mg/kg/day, respectivel...
Hüseyin Erdem* and Ibrahim Cihangir Okuyucu
...at dry matter (NDM) and protein percentages were measured for colostrum produced at 2, 24, 48 and 72 h after birth. The specific gravity of colostrum (colostrum quality) was determined using a colostrometer. The effects of DPL, ADMY, parity and calving season on the specific gravity of colostrum (colostrum quality) were found to be significant at the 2nd h after birth. Colostrum quality of cows with ADMY low (Group 1) and high (Group 2) were found t...
Nazir Ahmad Khan1,*, Mudassir Alam1, Rafiullah khan1, Kamran Khan2 and Sadeeq ur Rahman3
...lity.
...
Asima Rani1,*, Syed Kashif Nawaz2 and Muhammad Arshad3
...main-containing-adaptor-protein gene in malaria susceptibility and clinical outcomes upon P. falciparum and P. vivax exposure. Blood samples of 228 malaria patients and 226 healthy controls were selected from the local population. Malarial samples were divided in to complicated malaria (N=89) and mild malaria (N=139) groups according to WHO criteria. Malarial groups were further divided into P. vivax and P. falciparum groups based o...

Awais Ahmed Khan1*, Zafar Iqbal1 and Muhammad Atiq2 

...D activity (8.4 U/min g protein), SOD (6.96 U/ min g protein) and TPC (3.21 mg GAE/ 100g of sample) as compared to control where POD (1.13 U/min g protein), SOD (1.46 U/ min g protein), and TPC (1.14 mg GAE/ 100g of sample). Amount of hydrogen peroxide (H2O2), the signaling molecule was also significantly increased (30.33 mmol/ mg FW) and catalase (CAT) ...

Shazia Akhtar1, Abdul Samad1*, Afshan Gohar1, Muhammad Munir Shahid2, Muhammad Ishtiaq1, Arslan Sarwer1, Adnan Khan1 and Karam Ahad1 

...esticides effects their protective measures are very poor. The low level of awareness in the study area and the public health and environmental consequences resulting from the misuse of pesticides is alarming. Proper training is required to handle the pesticides for farmers in peach orchards of Swat, Malakand Division. There should also be monitoring of the health status of farm workers.  

...
Huanxin Zhang1,2, Hongshuo Tang3, Jun Chen1, Yu Zang1,2, Xuexi Tang1,2,* and Ying Wang1,2,*
... evolutionary conserved protein and have contributed to the understanding of the host defense processes against infection. Researches have been performed on the evolution in many species, but the evolutionary characteristics of African hunting dog TLR genes are scared. The available genome sequence of African hunting dog offers us the way to examine the innate immunity of this endangered carnivore. 10 TLR genes (TLR1-10) were initially identified from the Afri...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...ascade activation. PTEN protein is involved in the negative regulation of PI3K pathway. Mutations in upstream kinases, growth factor receptors or intrinsic members of cascades can lead to induce or promote cancers. Number of somatic mutations in several genes, majority of which are involved in chromatin modification and transcriptional regulation, have been reported in NHL. G468R and G468A mutations in BRAF gene have been reported in NHL, BRAF is a memb...
Kadry A. El-Bakry1, Lamiaa E.M. Deef1*, Lotfy Z. Habbak1 and Samia S. El-Naeli2
...nvestigate the possible protective effect of ginger on patulin (PAT)-induced hepato-renal toxicity in male rats. Rats were intraperitoneally (i.p) injected with PAT in a single dose (3.75mg/kg body weight). Rats were treated with ginger in a dose (100 mg/kg-1 body weight) for 4 weeks and 8 weeks. Blood samples for biochemical analysis and liver tissues were collected and fixed in 10% formalin for histopathological studies. The present study showed that, PAT ca...
Muhammad Muneeb1, Muhammad Ayub1, Sher Bahadar Khan2,*, Amjad Sohail1, Farkhanda Jabeen1, Mumtaz Ali Khan3, Amjad Khan4, Kashif Prince3, Asghar Khan5 and Irshad Ahmad6
...ar (17.92%) and maximum protein content was found in samples taken from Warsak Road (25.40%) followed by Hashnagri (24.24%). In sensory analysis the maximum mean score of judges for color, Flavor, Texture and overall acceptability were observed in Board Bazaar (7.97) followed by University Town (7.89) and the minimum values were given to the samples taken from Hashtnagri (7.57). Hence it was concluded that the samples taken from Hashtnagri and Chowk Yadgaar we...
Erum Iqbal*, Nasir Mehmood, Nasira Kazi and Shahina Fayyaz
...cro;m long; vulval lips protruding with vulval flap; lip region rounded or truncated without submedian lobes, tail ventrally curved with pointed or acute terminus. P. sindhicus n. sp.,is characterized by stylet 20-21µm long; vulval lips not protruding with advulval flap; female head with small submedian lobes; tail ventrally curved with finely to broadly rounded terminus. Detailed taxonomical studies of new spec...
Romaan Hayat Khattak1,3, Hussain Ali1, Ejaz Ur Rehman1 and 
Muhammad Ali Nawaz1, 2*
...munities, which in turn protects the entire population and associated ecosystem from illegal massive hunting. The present study successfully tested CMR method, and produced reliable and accurate estimate of the population, which could help in determining sustainable trophy quota.
...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4

 

...ed containing 29% crude protein and gross energy of 3,340.50 kkal/kg of feed and cultured for 90 days. The physicochemical parameters of water were always at satisfactory levels for fish culture throughout the experiments except for NH3-N (0.05 mg/L) and NO2-N (0.02 mg/L): water temperatures ranged from 27.5 to 30.5 °C, DO 4.3 to 5.6 mg/L, pH 6.56 to 6.96, alkalinity 50.65 to 52.25 mg/L, and hardness 6.65 to 66.85 mg/L. Survival was ...
Sajida Rasool1, Saba Irshad1*, Neelam Saba1, Mehak Fiaz1Muhammad Sajid Hussain2, MuhammadWajid Hussain3 and Peter Nürnberg2

 

...on. BICD2 is an adaptor protein which regulates the cellular trafficking of cargo molecules crucial for motor neuron growth and maturation. In present study, a Pakistani family of HSP penetrating in autosomal recessive pattern was ascertained. Patients presented spasticity and stiffness of upper and lower limbs, severe microcephaly, dysphagia, no speech, hearing loss and seizures. Genome wide linkage analysis and whole exome sequencing revealed a novel homozyg...
Sameh S. Tawfik, Ahmed A. Elkady* and Ehab T. Mohamed
...γ-rays-induced nephrotoxicity in irradiated rats was investigated. Forty albino-rats were divided into four groups: Control, rats were orally administered the vehicle for 6weeks, TSE-treated (each rat received 230mg TSE; once daily, for 6weeks), irradiated (animals subjected to whole body γ-rays (8Gy), and TSE-treated and irradiated (each rat received 230mg TSE; once daily for 6week, then one-hour later after last-treatment, rats were exposed to wh...

Naglaa M. Hagag1*, Mervat E. Hamdy1, Mary A. Sargious1, Sara M. Elnomrosy1, Nahed A. Ahmed1, Ayman A. Hamed1, Ahmed R. Habashi1, Essam I. Ibrahiem1, Mahmoud A. Abdel-Hakim2 and Momtaz A. Shahein

...ization indicates that serotype SAT2 is widespread (in 96 cases), while only four cases of Serotype O were detected. Phylogenetic analysis of the study sequences indicates that the circulating FMDV serotype SAT2 viruses were homogeneous and related to Topotype VII. Importantly, the newly emerged viruses were closely related to strains isolated from Libya in 2012 (Topotype VII, lineage 3), ...

Muhammad Rehan3, Asim Aslam3, Javeria Umber4, Muti-ur-Rehman Khan3, Waqar Azeem3, Hassan Aftab5, Ahsan Anjum3, Muhammad Abid6, Abdul Hameed Khan3, Hafiz Hasnain Ayoub5, Altaf Hussain2 and Muhammad Farooq Khalid1* 

...h which vitamin D exert protective role against different viral, bacterial, parasitic infections and non-infectious disorders.  

...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
...egnancy Associated Glycoproteins (PAGs) in peripheral blood for early pregnancy identification in cattle, buffalo, goats and sheep. A total of 120 blood were taken from jugular vein of different breeds of cattle (Achai, Achai x Jersey, Holstein Friesian and Jersey), buffalo (Nilli Ravi, Aza Kheli and non-descript), goats (Beetal, Teddy and non-descript) and sheep (Bulkhi, Karri and non-descript). In cattle, the average sensitivity, specificity, false pregnancy...
Anam Tariq, Alina Gul, Majida Atta Muhammad, Samia Falak and Naeem Rashid*
...oduction of recombinant protein in the cytoplasm which secreted gradually to the extracellular culture medium. Determination of the N-terminal amino acid sequence of the recombinant protein, in the extracellular medium, revealed that the 19 amino acid signal peptide was cleaved between Ala19 and Gly20. It seems probable that the signal peptide of TK0522 can be used for secretion of other recombinant p
Imdad Ullah Khan1, Shehla Gull Bokhari2, Mumtaz Ali Khan3, Ikramul Haq3*and Naimat Ullah Khan4
...udal ventral midline laparotomy, incised to evacuate themeconium, and replaced in the pelvic canal. The rectum and anal orifice were then reconstructed using the cruciate flap incision technique at the anal site.Finally, the urachal duct was identified at the apex of the urinary bladder, and excised after ligating itclose to the bladder wall. The calf recovered uneventfully after a post-operative antibiotic and antipyretic cover for 7 days.
...
Haroon1,2, Yu-Feng Meng1, Zahid Khan1, Farzana Perveen2, Muhammad Ather Rafi3, Sayed Waqar Shah4, Xiao-Hong Su1 and Lianxi Xing1,*
...important waterways and protect their flora and fauna of the study area.
...
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
... species. The goat MC1R protein has a molecular mass of 34.65 ku, an isoelectric point of 8.70, which is weakly alkaline, and contains seven transmembrane domains typical of cell membrane receptor proteins. Sequencing analysis of the black, brown and white different color MC1R genes of Nubian goats revealed that there are three SNPs in the gene sequence, which are 219, 712 and 1160, respectively. The C/T mutation did not cau...

Anand Kushwaha, Amit Kumar, Aparna Madhavan, Durga Goswami, Golmei Poulinlu and Gnanavel Venkatesan* 

... available, recombinant protein based diagnostic assays namely ELISA is safer and robust to handle large sample size and also to minimize labor/time. However, the genus Capripoxvirus encodes putative 147 proteins in their genome, among which some of them are reported as potential immunogenic candidate genes. Selection and use of such candidate immunogenic proteins from an array of genes lo...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

...having high quantity of proteins. In the present study, four varieties (CM44, CM91, CM98 and CM2000) were grown in the presence and absence of PGPR inoculated media and nitrogen in different salinity levels (20, 50, 100, 200 and 300mM NaCl). The biomass production of the varieties CM91 and CM98 increased at 20-100mM NaCl concentrations but drastically decreased at higher levels. While in varieties CM44 and CM2000 a gradual decrease of biomass with increasing s...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool4, Laraib Liaquat3, Fatima Ahmed5, Asra Khan1, Tahira Perveen3, Mirza Jawad ul Hasnain6, Saima Khaliq7 and Saad Bilal Ahmed8
...-α) and alpha-fetoprotein (AFP) were estimated before and after the administration of different meals. After the experiment, the liver samples were weighed and histopathologically evaluated using a knodell score to assess portal hypertension and liver damage. Animals fed with commercial chicken meat and feed for six weeks showed development of inflammation, necrosis, apoptosis and cirrhosis on histopathological examination of the liver, and had raised pl...
Muhammad Afzal1, Mahroze Fatima2, Aasma Qamar1, Muhammad Farhan1 and Syed Zakir Hussain Shah3,*
...;0.05) dry mater, crude protein, crude fat, and crude ash contents in the muscles and whole body of juveniles in response to CA and PHY supplementations were observed. Again, dietary acidification with CA also improved (p<0.05) the whole-body mineralization. Moreover, PHY pretreatment also resulted in higher (p<0.05) mineral deposition in the body as compared to control group. Both supplements interacted positively (p<0.05) to enh...
Elmas Ulutaş1,*, Abdullah Eryavuz2, Aziz Bülbül2, Abdur Rahman3,*, İsmail Küçükkurt4 and Cangir Uyarlar5
...l ammonia and number of protozoa were decreased (p<0.05) with 700 ppm and 1000 ppm zinc supplementation. Rumen Zn concentration increased (p<0.05) in the goats fed with 1000 ppm zinc, whereas there was no difference in rumen Fe and Cu concentration among the treatments, except for 1000 ppm zinc supplementation. High zinc supplementation to diet increased (p<0.05) the liver Zn and Fe concentrations and mohair Fe levels but decreased the kidney Cu conce...
Peng Peng1,3, Xiaopeng Tang2*, Dun Deng3, and Rejun Fang1*
...of GM as an alternative protein resource in meat duck diets. Firstly, the chemical composition, dry matter (DM) digestibility, metabolic energy (ME) were determined. Secondly, a total of four hundred eighty 15-day-old Shuanggui-tou meat ducks were divided into 4 treatments, 1) Control group (0% GM in the diet), 2) 3% GM group (3% GM in the diet), 3) 6% GM group (6% GM in the diet), and 4) 9% GM group (9% GM in the diet). All groups had 8 replicates and 15...

Iqbal Javed1, Abdur Rehman2*, Farhana Khaliq1, Amar Razzaq3, Mudassar Yasin4, Ghulam Mustafa5, Allah Bakhsh6 and Raheel Saqib7 

...of a commodity. Nominal protection coefficient (NPC) is projected for the time period of 2003 to 2016 for using as a dependent variable in the current study. To estimate the impact of different macroeconomic variables on basmati export competitiveness panel data set is used following Park’s Feasible Generalized Least Square (FGLS). According to the results of the study about the impact of macroeconomic variable on basmati competitiveness, inflation has n...
Nihat Yeşilayer*
...tionship between total carotenoid concentration (TCC) and flesh colour, determined by visual and colorimetric methods, of three fish species. Linear relationships were observed between CIELAB colour measurements (lightness-L*, redness-a*, yellowness-b*, hue-H°ab and chroma-Cab), DSM SalmoFan card scores and TCCs. The redness (a*) was mostly correlated with TCC of the fish fillets. The FRT group had the highest TCC (9,75 mg kg-1) compared ...
Tian-Yi Zhao1, Zi-Qing Liu2, Shu-Fei Ma3, Bo-Yang1, Fan-Fan Guo1 and Ming-Hua Duan1*

 

...olide in preventing and protecting Alzheimer’s disease (AD) remained elusive. This study was conducted to observe the effect of biatractylolide on the pathological changes of amyloid beta protein (Aβ)-induced AD. In vitro assays (MTT and flow cytometry) were applied to detect the effect of biatractylolide on PC12 cell proliferation, growth inhibition rate and apoptosis. In order to assess the spatial learning and ...
Mingsan Miao*, Hui Zhao, Jiaojiao Jia, Xiaoyan Fang and Yanyan Miao
...model and to assess the protection mechanism of cerebral ischemia-reperfusion injury. The repeated cerebral ischemia-reperfusion mice model was used where bilateral common carotid artery was targeted to block blood flow, reperfusion and then re-blocking the arteries. Brain tissues were examined 24 hours post-drug administration to determine the level of biochemical indicators such as serum NSE in the brain tissue. To investi...
Derya Kocamaz* and Elif Oruc
..., glutathione (GSH) and protein carbonil (PCO) increased in comparison to the control. After the recovery period, EROD, GST, malondialdehyde, estradiol/testosterone levels were found to be lower than the control. In the pesticide mixture group, the activity of antioxidant enzymes was highest and the level of hormones was lowered. The group of the mixture pesticide showed the highest lipid peroxidation and protein carbonylati...

Stanley Uchenna Onwudike* and Vivian Chizoba Edoziem 

...t practices such as crop rotation, mixed cropping and shifting cultivation is recommended for sustainable phosphorus management in the studied soil. 

...
Kanwal Nisa1, Sadaf Ashraf1, Masood Ahmed Siddiqui1*,Naila Taj1Habib-Ur-Rehman1, Arifa Bano1 and Naeem Rashid2
...a and was a dimer of heterotetramers (αβɣδ)2 with molecular masses of 44, 36, 20 and 12 kDa, respectively. Both of the activities were oxygen sensitive. The apparent Km values for POR reaction towards pyruvate and CoASH were 0.49 µM and 115 µM, respectively, while for PDC reaction values these values were µM 0.34 and 42 µM. To the best of our knowledge this is the first report on purificati...

Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui

...mature micropropagation protocols for new elite sugarcane cultivars can help in rapid multiplication of disease-free potential material to occupy large area in short time span, giving the phenomenon paramount economic importance. 

...
Amna Shoaib*, Zoia Arshad Awan and Naureen Akhtar
...r Aspergillus minisclerotigenes and Aspergillus flavus are morphologically similar species that belong to the Aspergillus section Flavi. A. minisclerotigenes and A. flavus were isolated from soybean and okra seeds, respectively. The isolated species were first identified morphologically. ITS1–5.8S–ITS4 primers sequence and amplification of ISSR nucleotide sequences using ...
Asim Faraz1,*, Abdul Waheed1, Riaz Hussain Mirza1, Muhammad Shahid Nabeel2 and Hafiz Muhammad Ishaq1
...gross composition (fat, protein, lactose, SNF and total solids percentages being 4.26, 3.62, 4.84, 9.02 and 13.28, respectively), Barela milk appears particularly rich compared to literature data. A long term monitoring, notably throughout the lactation, could be a good opportunity to assess the potential of this breed at national level.
...
Saeed Murtaza1, Abdul Sattar1*, Nasim Ahmad1, Muhammad Ijaz2Maqsood Akhtar3 and Muhammad Shahzad4
...esults showed that fat, protein, lactose, freezing point, SNF and solids were significantly higher (P<0.05) in group-2 and group-3 as compared to group-1 except density and pH which remained non-significant (P>0.05) in all groups. On the basis of result, it may be concluded that oxytocin had no effect on uterine involution and progesterone; however, it had some role to affect the normal composition of milk in postpartum involution interval.
...
Ahmet Ozer Sehirli1,2, Serkan Sayiner3*, Ayliz Velioglu-Ogunc4, Nedime Serakinci5, Emel Eksioglu-Demiralp6, Berrak Yegen7, Feriha Ercan8 andGoksel Sener2
..."font-size: small;">The protective effects of ACE inhibitor, Captopril, and angiotensin receptor blocker, Valsartan, were evaluated in the treatment of chronic renal failure (CRF) with and without the presence of N-acetylcysteine (NAC). The renal mass of Wistar albino rats was reduced at a rate of 5/6. Captopril, Valsartan and NAC were applied intra-peritoneal alone or in combination. Blood pressure and heart rate were monitored at weekly intervals over a peri...
Sumaira Akram1, Sajid Aleem Khan1*, Nazir Javed1 and Saeed Ahmad2
...rtality after 48 h. The protective and curative effect of chemicals, biocontrol agents and plant extracts on the development of MG was recorded on the basis of number of eggs on the most susceptible wheat variety cv. ‘Aus -7-58-0850’. In protective effect the highest number of eggs were recorded in rugby treatment. Chemicals were found to be more effective than plant extracts and biocontrol agents. Among biocontr...

Asmaa A. Darwish 

...Although it starts as a protective mechanism, it ends with serious cliniopathological alterations, which disappoint our therapeutic programs and frustrate our expectation for curing. This work aimed to assess the most important clinicopathological alterations related to sheep pneumonia, arthritis and enteritis and spot the light on MMP-2 and MMP-9 diagnostic and prognostic accuracy in these conditions. 80 barki lambs were divided into four groups control group...

Kenneth Nnamdi Anueyiagu*, James Jingmang Kopmut, Chrysantus Achi Lagi and Kelly Nkem Okoh 

...riched in peptone water broth, incubated at 37oC for 24 hours, and sub-cultured onto Mannitol Salt Agar and thereafter standard bacterial procedure continued. A total of 83 (51.9%) S aureus isolates were identified, 54 (33.8%) MRSA, and 15 (9.4%) Methicillin Susceptible Staphylococcus aureus (MSSA). The study showed a statistical association between the prevalence of MRSA in livestock and students. This could lead to cross infection of MRSA from livestock to m...

Shazia Mansoor1, Muhammad Sohail2*, Saima Aslam3 and Muhammad Nauman ul Islam4 

...luded that higher Crude Protein (CP) and Total Digestible Nutrients (TDN) supplementation to pregnant ewes improves the birth weight, growth rate of lambs and body condition scoring of ewes. 

...
Daniel Cocan1, Vioara Mireşan1, Florentina Popescu1, Radu Constantinescu1, Aurelia Coroian1, Călin Laţiu1, Romulus Valeriu Flaviu Turcu3, Alexandru Ştefan Fărcăşanu3 and Cristian Martonos2,*
...bo RARE High Resolution protocols were used, based on the echo-type RF pulse sequence. In transversal sections, organs, blood vessels, and bone formations appear unchanged in shape, size, appearance and location. For the studied species, the venomous glands, together with the first radius of the pectoral and dorsal fins, as well as the muscular fascicles attached to the radius, are forming the venomous apparatus. Triangular positioning of pectoral and dorsal s...
Zhi Yi Jin and Shao Ming Qin*
...ce human activities and protect woodland and aquatic environments because Scaly-sided Merganser have high requirements for safety and water conditions under both landscape and micro-habitat scales.
...
Mehtap Bayir*
...tive fugu Sod1 and Sod2 proteins and their orthologs from teleost fish and tetrapods. Phylogenetic clustering was seen between sod genes in fugu and their orthologs. Finally, highly conserved gene synteny was determined between fugu sod genes and their orthologs from teleost fish and human.
...
Boxin Dou, Ying Liu*, Yumeng Liu, Lili Fan, Yongqiang Ma, and Yanguo Shi
...ained by using alkaline protease to enzymatic hydrolysis of RB crude protein purified by ultrafiltration, size exclusion chromatography and RP-HPLC. Using consecutive chromatographic techniques successively, the acidic hydrolysates of RB proteins were fractionated and the new ACE inhibitory triplet was isolated and identified. The amino acid sequence of the ACEI was identified as Ile-Thr-L...
Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Muhammad Ibrahim Khaskheli2, Gul Bahar Khaskheli3, Allah Jurio Khaskheli2 and Arshad Ali Khaskheli1
...), ether extract, crude protein, crude fiber, nitrogen free extract and total carbohydrate contents) were included. Comprehensive survey indicated year round availability of 19 different vegetations at study areas whereby dry matter contents in Calligonum polygonoides (93.63%) recorded significantly high, and in Trifolium alexandrinum it was low, while moisture content appeared vice versa to dry matter. Organic matter contents in Senegalia sen...
Meriem Msaad Guerfali1,*, Heitham Hamden1, Salma Fadhl1, Wafa Djobbi1, Lotfi Sillini1, Wafa Marzouki1 and Mohammed Ammar2
...enomenon is suspected, a rotation of insecticides with different modes of action is desirable in insect resistance management programs.

...
Housh Muhammad Solangi1, Javaid Ali Gadahi1*, Mansoor Tariq2, Bachal Bhutto1Zubair Ahmed Laghari1, Jamila Soomro3, Taufeeq Ahhmed Khosa1 and Abdullah G Arijo1
...>H. contortus crude proteins (HcCP). Protein profile of HcCP was checked by SDS PAGE and immunogenic proteins were recognized by the antisera produced by using the HcCP as antigen. Infective stage of the H. contortus (L3) was used for the challenge infection. Protein band pattern ranging from 10 to 170 kDa was observed and p
Yunfang Tian, Zeqin Fu, Jiantong Feng, Yahong Guo, Yingying Ye*, Jiji Li and Baoying Guo
... M. meretrix and protect the natural resource. 
...

Amit Sharma1* and Pankaj Sood2 

...omposition, type of cryoprotectant used, cooling rate, equilibration time, freezing and thawing rate. All these factors should be given due credit for achieving better post-thaw post thaw quality of semen to be utilized in different advanced reproductive techniques. 

...
Seval Dernekbasi* and Emin Karatas
....05). The highest crude protein, lipid and ash contents were determined in the FO/SFO group (p>0.05). Experimental diets containing vegetable oil (CO and SFO) and vegetable oil blend (CSFO) had significantly higher concentrations of n-6 fatty acids, predominantly in the form of linoleic (LA, 18:2n-6c) and oleic acid (OA, 18:1n-9c), while n-3 fatty acids were present in significantly higher concentrations in the FO group. The fatty acid composition of rainbo...

Hamza Rehman*, Nida Ahmad Khan, Asad Ali, Warda Batool and Kanwal Razzaq 

...oth are used as cereals protectant against stored grain pests world widely. The recent study was planned to evaluate the efficacy of thiamethoxam and imidacloprid for the control of Trogoderma granarium under laboratory conditions. The insecticides were tested at four different concentrations (0.25, 0.5, 1 and 2ppm). Mortality of insects was documented after 24, 48 and 72 hours. Abbot’s formula was used to determine the corrected mortality. At 2ppm conce...
Savas Atasever*, Ali Vaiz Garipoglu and Huseyin Erdem
...k composition (fat (F), protein (P), lactose (L)), density (D), freezing point (FP), somatic cell count (SCC) and daily milk yield (DMY) according to the different feeding applications (grazing (G), silage usage (S), compound feed usage (C), number of milking cow (NMC), calf suckling period (CSP)). Average F (3.144±1.931%), P (3.022±0.448%), L (4.475±0.669%) and logSCC (5.386±0.529) values were within acceptable ranges. The present ...
Peimin Yang*, Zongyun Hu, Yixin Liu, Guanghai Jin and Lei Wang
...g populations should be protected and managed separately, and Panjin and Tieling populations should be considered as a genetic management unit.
...
Larysa Kladnytska1, Anatoliy Mazurkevych1, Natalia Bezdieniezhnykh2Oleg Melnyc1, Sergiy Velychko3, Mykola Malyuk1, Vasyl Danilov1Yuriy Kharkevych1 and Magdalena Gryzinska4*
...ytoplasmic and membrane proteins on dog stem cells from fat tissue at the IVth and Xth passages was examined by immunohistochemical method using monoclonal antibodies. Determination the index of proliferationdogs adipose-derived stem cells (DADSCs) on IVth and Xth passages. Established that DADSCs contains multipotent stem cells, that are characterized by an almost homogenous fibroblast-like cells оn the IVth
Jing Zhang1,2, Xin Wang2, Yun Zhao2, Yongcheng Jin2, Yongfeng Zhou2, Junmei Wang2, Yurong Fu2, Rui Wang2, Ruihua Li2, Hengtong Fang2 and Hao Yu2,*
...enerating islet-derived protein 3 gamma (Reg3γ), and tumor necrosis factor (TNF) were significantly downregulated. The mRNA expression levels of mucosal β-defensin, regenerating islet-derived protein 3 alpha (Reg3a), regenerating islet-derived protein 3 beta (Reg3β) and secretory immunoglobulin A (sIgA) levels were significantly increased. The interleukin-1beta (IL-1β)...
Yan-Guo Han, Jia-Yuan Wu, Ri-Su Na, Wei-Jiang Si, Yu-Qin Han, Yan Zeng, Yong-Ju Zhao and Yong-Fu Huang*
...d immunosorbent assay. Scrotal circumference was detected from week 0 to week 14 after primary immunisation, and the testes were weighed at week 14 after primary immunisation after slaughter. The concentrations of 4-methyloctanoic acid and 4-methylnonanoic acid in waist subcutaneous adipose tissue were detected using gas chromatography. Immunisation of oral and plasmid-injected KISS1 DNA vaccines induced strong antibody response, significantly suppresse...
Qaisra Siddique1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3

 

...(GST) activityand total protein contents (TPCs) in tissues viz. brain, gills, kidney, heart, muscle and liver of Labeo rohita kept under sub-lethal dose (4.13 µgL-1) of chlorpyrifos. Fish was kept under chlorpyrifos stress for two months and samples were collected on weekly basis. It was noted that GST level varied significantly with duration. The GST level was raised in first 28 days after that it was dropped off up to 56-day. The tren...
Waqas Ahmad Shams1*, Gauhar Rehman1, Khurshaid Khan1, Ibrar Ahmad1, Saima Bibi1, Saif Ul Islam2, Dawood Safi1, Saba Gul Ayaz1
...h water is a source for proteins having immense importance and its use as a food is not hidden from anyone. Its use by the traditional healers and animal therapists as a healthy calcium supplement and in healing of other injuries is also proven. In the present study, the diversity and abundance of crabs from Buner district of Khyber Pakhtunkhwa Pakistan were looked over, over a period of three years extending from June 2013 till June 2016, collected at differe...

Ahmad Naeem Shahzad1, Muhammad Kamran Qureshi2, Samee Ullah1, Muhammad Latif3, Shakeel Ahmad1 and Syed Asad Hussain Bukhari1* 

...n: justify;">Use of osmoprotectants is a possible strategy for plants to survive under adverse environmental conditions. The current study emphasizes the ameliorative role of trehalose, in mitigating the detrimental effects of salt stress, in cotton plants. Three concentrations of trehalose (0, 5 and 50 mM) were applied to plant foliage, subjected to varying levels (0, 11 and 17 dSm-1) of salinity. Salt stress disturbed the sodium and potassium concentrations ...
Maria Khalid1, Tanveer Hussain1*, Zahid Farooq2, Kamran Abbas1 and Masroor Ellahi Babar1  
...servation strategies to protect this unique genetic resource of Pakistan.
...
Masroor Ellahi Babar*
... the expression of milk protein. It stabilizes the milk micelle and gene 5’ flanking region which works valuably in transcription regulation. Current study illustrates that Kappa-casein gene 5︠ flanking region in Dromedary camel of Pakistan is highly polymorphic and it is phylogeneticaly linked with other mammals. The analyses of the sequence of 5︠ flanking region in various breeds reveals the presence of different polymorphic regions includes cystei...
Wen Qin1,2, YanGan Huang1, Lei Wang1, Gonghua Lin1, Jundong Yang1,2, Pengfei Song1,2, Hongmei Gao1,2, Jingjie Zhang1,2 and Tongzuo Zhang1,3,*
...is a good basis for the protection of the goitered gazelle. Here, we present our findings on the diversity of the gut microbiota in fecal samples from wild goitered gazelle from Qiadam Basin, Qinghai-Tibet Plateau, which are the first such data to be reported. A total of 25 phyla were found, of which the dominant phyla are Firmicutes and Bacteroidetes in both summer and winter, representing more than 90% of the overall relative abundance. Diet is a key factor ...

Jie Yang

...tern blot, the mRNA and protein expression were detected, respectively. Cellular apoptosis were examined by flow cytometry and Western blots was applied to assess the cleaved caspase-3, -8, -9, and cleaved poly-ADP-ribose polymerase. Protein expression of extracellular-regulated kinase were detected. Finally, data analysed statistically to determine significantly differences among groups. Results showed that breakpoint clust...

Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan

...m already PPD (purified protein derivatives) tested lactating animals aseptically. The data obtained were finally analyzed statistically using chi squared test. The Mycobacterium was identified through ZN staining, culture and PCR. Out of 1608 milk samples, 60 (3.73%) were found positive for acid fast bacteria through ZN staining whereas the prevalence of Mycobacterium bovis was confirmed in 65 (4.04%) and 85 (5.29%) isolates through culture and PCR respective...
Asim Faraz1*, Abdul Waheed1, Annamaria Passantino2, Ayman Balla Mustafa3, Nasir Ali Tauqir4, Naeem Ullah Khan5, Muhammad Shahid Nabeel6
...ic diets with different protein levels as 18% (G1) and 22% (G2). Regarding roughage proportion lucerne and gram crop residues were fed. Daily feeding allowance was offered as 3% body weight. Water was provided twice a day. In blood-biochemical analyses, level of Hb (hemoglobin) concentration (P<0.05) was found to be significantly different as 16.4±0.14 and 16.8±0.09 (g/dL) with G1 and G2, respectively. The concentration levels of cholesterol, ...
Asim Faraz1*, Abdul Waheed1, Muhammad Mudasser Nazir2, Aneela Hameed3, Nasir Ali Tauqir4, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal5
... composition especially protein, fat, lactose and mineral concentration are influenced by exogenous OT administration. It affects the cell maintenance and mammary metabolism along with its proven physiological role in the milk ejection reflex. OT effects are not manifested through effects on cell remodeling. Observed effects of OT administration on reproductive anomalies are anestrous, the development of corpus-luteum cysts, follicular ovarian cysts, delayed a...

Saira Bano, Muhammad Naeem* and Samrah Masud 

... fed at different crude protein (CP) levels ratios i.e., 15%, 20% and 25% CP. Fish were first collected, acclimatized, kept in triplicate aquaria under controlled conditions in three groups (T1, T2 and T3) and then 5 fish were selected from each treatment at the end of 12 weeks of feeding trial from January to April, 2018, during which fish were fed at the rate of 4% of their body weight. The blood variants were studied like Lymphocytes (LYM), Monocytes (MON),...

Anila Kousar, Muhammad Naeem* and Samrah Masud 

...ence of three different protein diets (T1=15%, T2 = 20% and T3 = 25% crude protein) on the proximate composition of Genetically Improved Farmed Tilapia (GIFT). It is a developed strain of Nile tilapia (Oreochromis niloticus). In the whole wet body weight of GIFT, the mean percentages for water, fat, ash, protein and organic content were observed as 79.13, 3.74, 2.75, 14.43 and 18.12 (T1,15...
Ahmad Osman Mal1 and Mohamed Hosny Gabr1,2,*
...t stock status of two Parrotfish, Hipposcarus harid and Scarus ferrugineus in Jeddah was assessed. Scales were used for age determination and back calculations of length-at-ages. The growth parameters were estimated to be: the asymptotic length L = 54.044 cm, the growth coefficient K = 0.168 year-1, and age at zero length to = -0.707 year for H. harid and L = 51.238 cm, K = 0.170 ye...
Salahud Din1,*, Saima Masood1, Hafsa Zaneb1, Habib ur Rehman2, Saima Ashraf1, Imad Khan3, Muqader Shah4 and Syed Abdul Hadi1
... sphenorbital fissure, carotid canal, foramen magnum, stylomastoid foramen, foramen rotundum, foramen ovale and jugular foramen, and the rostral and the caudal foramina that formed the pterygoid canal. The measured craniometric parameters did not show statistically significant differences (p>0.05) between male and female adult Chinkara except palatine bone, OI, DO, IOCDE, OCT, ICW, IPCW, and PCPL were significantly higher...

Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad

... pathogen of tomato stem rot and to evaluate the effect of different doses of boron, plant extracts and a bactericide in different combinations on tomato plants. This research study was performed at Agricultural Research Institute, Tarnab, Peshawar-Pakistan. Different biochemical tests were conducted to confirm stem rot pathogen. Boron was applied at the rates of 1.97, 2.96 and 3.95 g seedbed-1. Plant extracts were neem (Aza...

Rabia Iqbal, Muhammad Naeem*, Samrah Masud and Abir Ishtiaq 

...ng them at three graded protein feeds (15%CP, 20%CP, 25%CP). Eighteen days old fry of hybrid (L. rohita ♀ and C. catla ♂) of 0.12±0.08 average weight(g) and length(cm) 1.63±0.21 were acclimatized and shifted in hapas (8x6x3 ft.), fed at the rate of 5% of their wet body weight. Ten samples from each hapa were randomly selected at the end of three months (90 days trial) for body composition analysis. Mean percent water, ash, fat and p
Daniel Masood1, Noor Khan1*, Khalid Javed Iqbal2, Sadaf Dogar1, Abdul Hanan1, Sadia Nazir1, Sheeza Bano1, Azra Anwar2, Sameul A.M. Martin3  and Chris J. Secombes3
...eaper alternative plant protein moringa meal (Moringa oleifera) on growth and body composition of Labeo rohita fingerlings. L. rohita (average weight 190.25±00g) were stocked randomly in glass aquaria for a 90 day feeding trial. Fish were fed twice daily with four different iso-nitrogenous diets at a feeding level of 3% of total biomass. The diets contained 26% crude protein in which moringa meal ...
Yan Xu1, Jia Zhou1, Guangfu Lv2, Yuexin Liu1, Xintong Zhao1, Xin Li1, Doudan Ye2, Xiaobo Qu1,* and Xiaowei Huang1*
...d Bcl-2 expression. The protein levels of TGF-β/ Smad / ERK signaling pathway were detected by Western blot. We found that PAP significantly increased cell viability after DOX-induced injury, reduced LDH, CK-MB levels, up-regulated Bcl-2 expression and down-regulated Bax expression levels. In addition, PAP can delay cell G2/M phase arrest, reduce apoptosis, significantly reduce TGF-β1 protein levels and ...
Ke Zhang1, Shuai Liu2, Qiu Chen1, Yu Wang1, Li Liu1, Bingjie Li1, Kai Ma1, Xiaoya Wei1, Aijun Li3 and Junyan Li2*
...ere selected to prepare protein samples. Some of them were used for 2-DE, and the others were used to immunize mice to collect tick antiserum for WB. Then, 2-DE followed by WB and MALDI-TOF was carried out to screen and identify tick antigens. We identified 19 protein spots representing 12 ORFs: 4 from ticks and 8 from cattle. Among the the 4 ORFs, Tropomyosin, Elongation factor 1-alpha (EF-1α) and P
Ambrin1*, Ghulam Dastagir1, Jehan Bakht2 and Muhammad Adil1
... acids, reducing sugar, proteins, triterpenoids, gums and mucilages, fats, steroids, phenols and phytosterol.
...
Imran Khan1, Muhammad Nawaz1,*, Aftab Ahmad Anjum1, Mansur-ud-Din Ahmad2, Adnan Mehmood1, Masood Rabbani1, Amina Mustafa1 and Muhammad Asad Ali1
...ng commercial probiotic Protexin (1g/litre) at day 01 to 35 and challenge bacteria at daye 07. Group 10 started receiving antibiotic at day 01 to 10 and challenge bacteria at day 07. Birds were challenged with a single dose of 106 cfu of Salmonella enteritidis by oral gavage. D-xylose absorption capacity and gut morphometric parameters (villus height, crypt depth and villus height to crypt depth ratio) were studied at day 35. Broiler administ...
Hui-Ying Chen1,2*, Ping-Chuan Yin1,2, Ya-Nan Lu1,2, Hai-Yun Li1,2*and Yang Shan3
...alysis. Additionally, a protein-protein interaction network (PPI) was constructed and block analysis was performed using STRING and Cytoscape databases. A total of 248 genes were identified, of which 84 were downregulated and 164 were upregulated. Functional and pathway enrichment analyses indicated that upregulated genes were significantly involved in pyrimidine metabolism, glyoxylic acid metabolism and dicarboxylic acid me...
Lei Wang1, Lu Yang2, Lei Luo1, Yaqi Gao1*, Jian Gao1 and Ping Liu1
...es using NCBI-NR, Swiss-Prot, KOG, Pfam, eggNOG, KEGG, COG, and GO for functional annotation and classification. Some differences in the regularity of distribution and the time of eclosion of the pupa were detected between the southern and the northern populations. We obtained 142.65 Gb of data from transcriptome sequencing and recovered 70,397 unigenes through a de novo assembly. In total, 2089, 2420, and 6286 differentially expressed genes were gained...
Yuhong Li1, Dongxue Wu1, Xue Wang1, Mi Zhang1, Hanyu Zhu1, Zhe Shi1 and Fumin Feng1,2*
...ine group, the mRNA and protein levels of NF-κB and TNF-α in the H group showed an increasing trend, and p-NF-κB and p-IκB also showed an increasing trend. However, these indicators increased first and then slightly decreased in the R, Z and HRZ groups. Among them, the significant changes in the indicators of the HRZ group were earlier than those of other drug groups and the changes were most obvious. The mRNA and p
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...riod. Serum urea, total proteins, albumin, globulin, albumin to globulin ratio, triiodothyronine, aspartate aminotransferase and alanine aminotransferase remained unchanged amongst the groups during the transition period. In conclusion, dietary yeast supplementation has resulted in better DMI and has a potential to improve the ability of Beetal goats to counteract the metabolic stress imposed by the transition period.
...
Muhammad Saeed Imran1, Asim Aslam1*, Muhammad Yasin2, Tahir Yaqoob2 and Beenish Zahid3
...ns. After screening the protective titers in birds at 19 days post inoculation three week-old broilers were challenged with 10-5.76 and 10-6.03 EID50 dose of NDV and IBV, respectively. The hosts were divided into six groups of 35 birds each. These were groups A (NDV-challenged), B (IBV- challenged), C (NDV+IBV-challenged), D (IBV+NDV challenged), E (NDV and IBV- challenged) and F (negative control). Mild to moderate clinical pr...
Fermín López-Uriostegui1, Jesus T. Ponce-Palafox2*, Fabiola Lango-Reynoso1, María R. Castañeda-Chávez1, Itzel Galaviz-Villa1, Sergio Castillo-Vargasmachuca2 and Arturo Ruiz Luna3
...al shrimp feed with 35% protein, 12% lipid) daily at a ratio of 10% body weight, twice a day (10:00 and 18:00 h). The optimal growth intervals were from 26 to 29°C and from 3 to 11‰ of salinity, and survival was at 23 to 29°C and 0 to 5‰. The greatest effect of the temperature-salinity interaction was on the upper extremes of response. The analysis of response surfaces showed that the final weight and weight gain increased as temperature ...
Arifa Savanur1,*, Tallat Naz1,2, Tayyaba Hamid1,3, Syed Abid Ali4, Mian Jahangir1,3 and Muhammad Abdul Azeem4
... on the non-contractile proteins of Uromastix smooth muscle.
...

Anila Latif, Zaheer Abbas, Farhatullah and Ghulam Muhammad Ali* 

...n effective strategy to protect plants from herbivorous insects and this pathway should further be evaluated for possible application in agriculture. 

...

Muhammad Usman Ghazanfar1, Waqas Raza1*, Waqas Wakil2,3, Imtiaz Hussain4 and Misbah Iqbal Qamar

...f defense responses and protective effects against Phytophthora infestans (Mont.) de Bary and sucking insect pests of potato (Solanum tuberosum L.) with application of salicylic acid (SA) and β-aminobutyric acid (BABA). Concentration of SA and BABA (2, 4 and 5 mM) were applied to foliage. Application of both resistance inducers suppressed disease development by 54.1% and 67.4%, for SA and BABA, respectively, 5 days after pathogen inoculation. Numbers and ...
Xiuqing Hao1, Zhe Hong2, Huili Gao1, Fumin Tian1, Hongke Zhang3, Yu Zhou3, Yuming Guo3, Guang Yang1,* and Bingyao Chen1,*
...nd a new perspective in protecting and monitoring seabirds.
...

Tingting Li, Shuangshuang Geng, Long Xie, Huiyan Xu, Aolin Luo, Pengwei Zhao, Huan Yang, XingWei Liang, YangQing Lu, XiaoGan Yang* and KeHuan Lu*

...ial cell line-derived neurotrophic factor (GDNF) is a neurotrophic factor cloned from mouse brain tissue by Lin et al. (1993) and can also be secreted by Sertoli cells. GDNF has a variety of physiological functions and plays important roles in the nervous system and in the reproduction of spermatogonial stem cells (SSCs). To date, commercialized murine and human GDNF have typically been used for the in vitro cu...
Shaheen Rahman1, Kafeel Ahmad1*, Niaz Ali2, Muhammad Idrees3 and Waqar Ali4
...confirmed by in vitro carrot and potato discs inoculation assays. A total of seven strains of A. tumefaciens were isolated on yeast extract mannitol agar (YEMA) medium. The isolated strains were confirmed as A. tumefaciens on the basis of morphological, biochemical and pathogenicity tests. The bacterial cells were rod shaped having rounded ends. The strains were Gram positive. Results confirmed the pathogenicity of the isolated strains as shown b...
Tehreem Usman1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qaisra Siddique1
...CAT) activity and total protein contents (TPC) in Ctenopharyngodon idella under binary mixtures of insecticides viz. endosulfan(ES)+chlorpyrifos(CPF) and endosulfan(ES)+bifenthrin (BIF). The fish behaviour was observed from both treated and control groups. Fish under exposure of insecticides mixtures exhibit abnormal behaviour and tried to jump out from water, come to surface and gulp air, showed increased opercular movement and erratic movements, hyper...

Muhammad Salim1*, Ayhan Gökçe1, Muhammad Nadir Naqqash1 and Orkun Ersoy

...n to the insects’ protective cuticular wax layer. In order to develop environmentally sound control programs for in sito management of granary weevils, it will be necessary to expand the present study based on life table to get a comprehensive understanding and to determine the effect DE has on granary weevils and other grain pests when it is combined with plant extracts. 

...

Gulnaz Parveen1*, Salma Gul2, Muhammad Ather Rafi3, Ashfaq Ali Khattak4 and Hikmatullah Jan

...ghly susceptible to root rotting fungi causing huge losses each year in Pakistan. Acacia nilotica used as a biofertilizer and Significant (p< 0.05) enhanced the growth of tomato plants. Infection % of all test fungi included Fusarium solani, Fusarium oxysporum, Macrophomina phaseolina and Rhizoctonia solani was significantly controlled by leaf powder (LP) and shoot powder (ShP) when applied alone and with combination. While combinations of 3% LP + 3% ShP, 3...

Shah Nawaz Khuhro1*, Irshad Ali Junejo1, Muhammad Haroon Hullio1, Mohammad Farooque Hassan2, Sultan Ahmed Maitlo3 and Mukhtiar Ahmed Shaikh

...oper storage, handling, protective devices and most of them did not used any other alternate practices as bio pesticides, bio-control enhancement practices to control pest problems. Research result provides the course of action to researchers, scientists, health practitioners in Sindh province regarding exercise of pesticides in Pakistan because the farmers were not aware of pesticide hazards. In our country the farming community not has information on safe ha...

Md. Zubael Islam, Rukhsana Amin Runa and Md. Mahmudul Alam* 

... Laminitis (17.39%), Footrot (15.22%), Sole ulcer (13.04%), Interdigital dermatitis (10.87%), Upward patellar fixation (10.87%) and Digital dermatitis (8.69%). The highest prevalence of foot diseases was recorded in female animals (56.52%). The indigenous cattle were comparatively resistant to foot diseases than crossbred animals. One to two years old cattle were mostly affected in our investigation. In the rainy season, FMD, laminitis, and sole ulcer were mor...

Md. Al-Amin Tan1, Mst. Antora Akter1, Md. Sabuj Rahman1, Marzia Rahman2 and Md. Mahmudul Alam1* 

...transferred in nutrient broth and cultured in Plate Count Agar for counting of Colony Forming Unit (CFU). Results revealed that Chlorxylenol was less efficacious than PI and Chlorhexidine gluconate when mean CFU was counted at different stages of surgical field preparation. Soap water scrubbing and ethanol spray followed by aqueous Chlorhexidine gluconate painting eliminated 100% bacterial load and kept the site aseptic for 60 min. On the other hand, alcoholic...

Anurag Sharma*, Naresh Kumar, Geetanjali Singh and Anika Sharma 

...c, antidiabetic, hepato-protective, anti-carcinogenic, anti-inflammatory, antibacterial, antifungal and galactagogue activity. The commercially available drugs pose health threats and prove detrimental to both human and animal health. The traditional use of herbal preparations suggests that they are safe and effective, however, scientific validation is still required for many of them especially for animal use. The phyto-pharmacological research on these two na...

Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5* 

...nalysis of unusual human rotavirus VP4 genotype detected in Moroccan children fully vaccinated with Rotarix™. After RNA virus extraction, the rotavirus VP7 and VP4 genes were amplified. The DNA was purified, sequenced and genotypes were determined using the RotaC online classification tool. A phylogenetic tree was constructed using the Maximum Like...

Zia-Ur-Rehman1, Faisal Sohail Fateh2*, Humayun Saleem1 and Muhammad Abu Bakar Siddique1 

...ng these diseases, brown rot disease is very important that reduces yields primarily by decaying the fruits on the tree and after harvest. A preliminary study was designed to see the prevalence, incidence and severity of peach rot disease in the markets of Federal Territories of Islamabad to estimate the intensity of the disease by calculating the disease index. The prevalence of disease was 100% in all markets of Khanna Pul...

Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1* 

...ter intake (DMI), crude protein (CP) natural detergent fiber (NDF) and nutrient detergent fiber (NDF) were recorded significantly similar (P<0.05) in both species. Furthermore, digestibility of DM was observed similarly among two species while, digestibility of CP was recorded higher on millet fodder compare to other fodders. The digestibility of various nutrients such as CP, NDF and ADF were significantly higher (P<0.05) in sheep compared to goat. Daily...

Joseph Anejo-Okopi1*, Ocheme Julius Okojokwu1 and Onyemocho Audu2 

...emodialysis patients, unprotected sexual intercourse, blood transfusion and vertical transmission. Therefore, there is a need for government commitment for HCV elimination program through making the DAAs available and its affordability to general population to curb the catastrophic cost of managing the epidemic. However, the diagnosis of HCV infection is faced with several challenges, therefore there is a demand for development of easy to use and inexpensive m...

Hafiz Abdul Ghafoor1*, Muhammad Afzal1, Muhammad Luqman2, Muhammad Arshad Javed2, Syed Wasim Hasan3 and Muhammad Zeeshan Majeed

...in plots treated with spirotetramat (87.75±3.91%) and lambda-cyhalothrin (85.52±4.42%) in combination with EPF followed by these two insecticides and sulfoxaflor alone. Based on overall study results, the insecticidal formulations of spirotetramat, lambda-cyhalothrin and sulfoxaflor in combination with EPF and under-canopy hoeing are recommended to the local citrus growers for an effective control of D. mangife...

Muhammad Raheel Faiz1, Ijaz Ashraf1, Haq Nawaz2, Muhammad Zubair3*, Muhammad Sajid Mahmood4, Sajid Hussain5 and Abdul Qadeer2 

...ount due to production, protection and marketing problems which are faced by the vegetable growers. Therefore, the present study was designed to identify and prioritize the production, protection and marketing problems faced by the vegetable growers for suggesting possible solutions. Faisalabad Sadar Tehsil was selected as a study area where the vegetables are intensively grown by the farmers. There were total 58 rural union...

Hafiz Muhammad Imran Javed* and Mushtaq Ahmed 

...on of three-dimensional protein structures. The N gene ORF was 1578 nucleotide long with a single open reading frame encoding 526 amino acids. Similarly, the ORF of F gene was 1641 nucleotide long which encoded 547 amino acids. Upon phylogenetic analysis of the country isolates with the vaccine strains, it was revealed that isolates were clustered within lineage IV (Asian Lineage) closer to Indian isolates. On the other hand, a number of substitutions were obs...

M. Hammouchi1*, G. Sebbar1, N. Touil2, C. Loutfi1, Y.S. Malik3, M. El-Harrak1 and O. Fassi-Fehri4 

...ally infected using the protocol previously validated for Alpine goats. The infected animals showed mild or no clinical signs of disease, with low levels of viral RNA detectable in swabs and fecal samples taken at the peak of infection. The transmission of the disease to animals (Timahdid breeds) brought into contact without manifestation of clinical signs, may indicate that local breeds of sheep might play an important role in the prevention of dissemination ...

Ehsan-Ul-Haque1, Akbar Hayat1*, Muhammad Asim1, Sajjad Hussain2, Muhammad Shakeel Hanif3, Muhammad Zubair1, Muhammad Abdullah Jamil1 and Faheem Khadija1 

...(10.75 and 9.83), crude protein, crude fat and in DPPH activity respectively. The study depict that incorporation of salts to wax in substitution to the fungicide is an effective application to control postharvest citrus fruit decay with perks of safety and convenience. 

...

I. Erum, K. Nasira, H. Sagir, S. Raza and Firoza, K.

Description of Discolaimus miniodontii n.sp. and Laevides hunderansis n. sp. with notes on Discolaimoides spatilabium (Nematoda: Dorylaimida) from District Ghizer, Gilgit-Baltistan, Pakistan
...14mm; a= 38.5-45.8); sclerotized odontostyle, its aperture occupying 50-55% of its length; oesophagus with conspicuous muscular sheath in the expended part of oesophagus; basal part of oesophagus expended gradually 51-54% of the total neck length. Laevides hunderansis n. sp., collected from district Ghizer village, Hunder of Gilgit-Baltistan is characterized by the smallest body (0.7-0.8mm), small moral tooth (7-8 µm), short spicule, gubernaculum and tai...

U. A. Al-Karim, A. A. Alshimaysawe, A. E. Mohammed† , W. A. R. Aljaafri and F. A. Al-Fadhal

Evaluation of biological seed treatments for management of Rotylenchulus reniformis on cotton

Younis Jamal1, Asad Naeem Shah1, Wasif Amin Butt1, Ahmad Naveed1*, Muhammad Usman1 

EXPERIMENTAL INVESTIGATION OF THE EFFECTS OF FUEL INJECTION PARAMETERS ON DIESEL ENGINE PERFORMANCE AND EMISSIONS
...es and tip penetration (protrusion) lengths (designated as 135° × 3.5 mm, 140° × 3.5 mm, 145° × 3.5 mm,
150° × 3.5 mm, 150° × 2.5 mm, and 150° × 1.5 mm) were used at three different injection timings comprising 16°
before top dead center (BTDC), 13°BTDC and 10°BTDC. Experimental results reveal that VCO nozzles in toroidal
combustion chamber (CC) are better than sac noz...

Daulat Khan1*, Khizar Azam2, Noor Muhammad Khan1, Muhammad Israr1, Naeem Ejaz3 

ASSESSMENT OF WASTEWATER FOR DISPOSAL IN ACCORDANCE WITH NEQS CRITERIA AND ITS REUSE FOR IRRIGATION WITH DILUTION
... Pakistan Environmental Protection Act (PEPA) 1997, “No person shall discharge or
emit or allow the discharge of any effluent or waste in an amount, concentration or level which is more than the
National Environmental Quality Standards(NEQS)”. Even in the presence of this act there are many housing societies
and Industrial zones, which are continuously disposing off their untreated wastewater to the natural water bodies. In

Nabeel Maqsood1,2*, Afzal Khan1, Muhammad Khalid Alamgir2, Shaukat Ali Shah1, Muhammad Fahad3 

PTFE THIN FILM COATING ON 316L STAINLESS STEEL FOR CORROSION PROTECTION IN ACIDIC ENVIRONMENT
...g is often required for protection of 316L SS from wear and corrosion. In this research
paper polytetrafluoroethylene (PTFE) was coated on 316L SS by spin coating technique to modify their corrosion
resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion property of the 316L SS and PTFE
coating was studied in 40% HCL by electrochemical corrosion test and potentiodynamic polarization curves at room
temperatur...

Waqas, A. Imtiaz1, Yousaf Khan1, Syed Waqar Shah2 

COST VERSUS RELIABILITY ANALYSIS OF NEW TREE-BASED HYBRID PROTECTION ARCHITECTURE FOR OPTICAL CODE DIVISION MULTIPLE ACCESS SYSTEM
...plications in providing protection to network components. This increases the overall downtime of PON, and
reduce its feasibility for deployment at the access domain. Therefore, it is imperative to design an economical system
that should be able to provide fault detection and restoration at both feeder and the distribution level. This paper
focuses on design and analysis of a novel tree-based hybrid prote...

Farid Ullah Khan*, Adeel Ahmed*, Uzair Khan Jadoon*, Fahim Haider* 

MODELING, SIMULATION AND FABRICATION OF AN UNDERSHOT FLOATING WATERWHEEL
...of 1.5 m/s. Moreover, a prototype of an undershot floating waterwheel is also fabricated from low weight materials,
such as, fiber glass and mild steel square tubes. For electrical power generation a DC generator is coupled with
the output shaft of the waterwheel. The developed prototype wheel successfully produced a maximum power of 0.6
kW from a water stream flowing at 1.2 m/s in an irrigation channel....

Mujahid Badshah, Saeed Badshah, Sakhi Jan 

HYDRODYNAMIC DESIGN OF TIDAL CURRENT TURBINE AND THE EFFECT OF SOLIDITY ON PERFORMANCE
...d turbine has a 3 bladed rotor of 4 meters diameter and rated mechanical power of 20 kW. Performance metrics of the rotor for steady and uniform flow was simulated at flow speeds from 0.5-3.5 m/s. The turbine achieved its rated power at a tip speed ratio (TSR) 5.7 with a peak CP value of 0.47 and peak thrust of 16.7 kN-m. Additionally, a series of simulations were performed at TSR from 1-10 to obtain performance curve for t...

Parsa Riaz and Muhammad Naeem*

Digestive Enzymes Activity with Gut Morphometric Parameter of Carnivorous Fish Wallago attu (Siluridae, Siluriformes)
...zymes, such as lipases, proteases and amylases in the digestive tract of a wild, freshwater, carnivorous Wallago attu. Wallago attu is a fast growing catfish that belongs to family siluridae under the order siluriformes. It has good market demand as a food fish having high nutritional value, and high protein content in its flesh, Carnivorous in nature. Descriptive data of the studied traits included total body weight, total ...

 Mujahid Badshah*1, Saeed Badshah1, Sakhi Jan1

HYDRODYNAMIC DESIGN OF TIDAL CURRENT TURBINE AND THE EFFECT OF SOLIDITY ON PERFORMANCE
...d turbine has a 3 bladed rotor of 4 meters diameter and rated mechanical power of 20
kW. Performance metrics of the rotor for steady and uniform flow was simulated at flow speeds from 0.5-3.5 m/s.
The turbine achieved its rated power at a tip speed ratio (TSR) 5.7 with a peak CP value of 0.47 and peak thrust
of 16.7 kN-m. Additionally, a series of simulations were performed at TSR from 1-1...

 Muhammad Amir*1, Syed Waqar Shah1, Michael J. Pont2

FAULT-MANAGEMENT ON SYSTEM’S LEVEL IN CONTROLLER AREA NETWORK BASED “SHARED-CLOCK” ENVIRONMENTS
...ller Area Network (CAN) protocol have been inherently

plagued by flexibility and fault-management issues since they were introduced. The easiest way out of such issues
is to adopt the more flexible/fault-manageable but expensive protocols such as the Time-Triggered Protocol (TTP)
and FlexRay. Looking at the cost-effective nature of CAN and its widespread u...

Farid Ullah Khan*, Sheraz Ali Khan*

A SMART STARTUP AND SHUTDOWN SYSTEM FOR DOMESTIC ELECTRIC POWER GENERATORS
...aluates the results ofa prototype smart system, developed to control the startup and shutdown operations ofa typical household electrical generator. An ATMEL 89C51 microcontroller, relays, voltage regulators, current amplifier, automatic switching relay and step down transformers are used in the prototype circuit to control the functions required for startup, shutdown and switching onto and off the electric grid supply. Simu...

Nisar Mohammad٭, Mohammad Mansoor Khan٭, Noor Mohammad٭

EXTRACTION OF HIGH QUALITY TALC FROM TALC-CARBONATE ROCK OF MINGORA EMERALD MINES BY FLOTATION AND LEACHING
... the research. Two step froth flotation process with AF65 (Poly propylene Glycol, Cyanamid) as frother, Sodium hexa metaphosphate as depressant for carbonates, equal mixture of oleic acid and kerosene oil as collector gave encouraging results. It was found that talc can be separated as float at pH 6 - 7±0.2 in rougher flotation and 10 - 11±0.2 in cleaning flotation, depressant dosage 0.10kg/ton, and collec...

M. Nafees*, Bushra Khan*, Robina Naz*

STUDY OF OCCUPATIONAL HEALTH SAFETY IN STEEL RE-ROLLING MILL WITH REFERENCE TO HIGH NOISE LEVEL AND TEMPERATURE
... Pakistan Environmental Protection Agency (PEPA) should strictly implement and follow-up on the occupational safety laws, adopt shift rotation and ensure reduction in the length of exposure of each worker i.e. 1.5 to 2 hours instead of 6 hours work in these working conditions.
...

Gulzar Ahmad*, Sahibzada Faheem*, Amjad Ullah*, Waqar Shah*, S.M. Majid Ashraf*

COMPARATIVE STUDY OF RELAY PROTOCOLS USING SIMULATION
...in cooperative relaying protocols. The performance is evaluated in terms of average symbol error under various ranges of signal-to-noise ratio (SNR) probabilities. A three node system i.e. source, relay and destination, placed on the edges of equilateral triangle, has been proposed using Maximal ratio Combiner (MRC) method by combining signals from source and relay at destination point. The transmission path is modeled as a frequency non-se...

Inayat Ullah*, Shah Khusro**, Saeed Mahfooz**, Azhar Rauf**

IMPACT OF NETWORK SCALABILITY ON THE PERFORMANCE OF RIP AND IGRP FOR EMAIL SERVICES
...works, in which routing protocols are used to automate the process of routing. Routing protocols dynamically determine best path(s) to every network. Routing protocols are classified as distance vector and link-state routing protocols. Routing Information Protocol (RIP) and Interior Gateway Routing P

Zeeshan Sabir*, M. Inayatullah Babar*, Saeed Ur Rehman**, Amjad Ullah Khattak * Syed Riaz Ul Hassnain*

EVALUATING PERFORMANCE OF DIFFERENT ROUTING PROTOCOLS IN MANET ENVIRONMENT BASED ON TCP WINDOW SIZE EVALUATION
...marily depends upon the protocol running at the backend for routing the packets between the mobile nodes of the network. Each of these protocols has its own pros and cons in different scenarios. In this paper we have simulated an environment of MANETs consisting of a few Mobile nodes that tend to form a network amongst eachother during their random mobile behaviour. The environment has been simulated usin...

Tanveer Sultan1, Anwaar Ahmed1, Aqsa Qayyum2*, Amer Mumtaz2 and Naeem Khalid

... 3.80±0.04). The protein (8.93±0.03) and fat contents (3.01±0.06) were significantly higher in supplemented pasta having 50% buckwheat. However, it negatively influenced the cooking quality parameters (cooking time, loss of solids). The sensory scores emphasized that pasta with 30 % buckwheat supplementation was more appealing for taste, color and texture. The study postulated that buckwheat could be used as a potential source of gluten-fr...
Sumaira, Ali Mujtaba Shah*, Ghulam Asghar Solangi, Ifra Anwar, Qudratullah Kalwar 
...carbohydrates, lactose, protein, minerals, nutrients and catalysts. A total of 20 % milk is obtained from different species including sheep, ass, horse, yak, goat, bison and camel while the 80 % milk is produced by cows. Milk of camel plays an essential part in the diet of human. Additionally, camel milk comprises numerous fatty acids and enzymes. Hence camel milk has many beneficial effects, such as antiviral, antibacterial, anti-diabetic, anti-carcinogenic a...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...s, fungal stem and tuber rot are the most common diseases that cause significant loss in potato production in Punjab province, Pakistan. Neocosmospora rubicola was found as a new pathogen causing stem rot of potato in the potato growing area of district Kasur. Symptoms of the N. rubicola infected potato plants were necrotic stem lesions near the collar region. Causal organism was isolated ...

Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Saima Sadaf1, Adnan Ahmad1, Usman Rafique1 and Muhammad Arshad Javed1

An Assessment of Farmers’ Awareness Level Regarding Integrated Farming System in District Sargodha, Punjab, Pakistan
...ation and environmental protection are considered as basic human needs of a society. The developing world is struggling with lack of or inadequate supply of these resources while combating with climate change at the same time. It is a fact that sustainable development comes only by judicious utilization of the resources and environment protection that help in addressing socio-economic challenges. An integrated farming system...

Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Saima Sadaf1, Adnan Ahmad1, Usman Rafique1 and Muhammad Arshad Javed1

An Assessment of Farmers’ Awareness Level Regarding Integrated Farming System in District Sargodha, Punjab, Pakistan
...ation and environmental protection are considered as basic human needs of a society. The developing world is struggling with lack of or inadequate supply of these resources while combating with climate change at the same time. It is a fact that sustainable development comes only by judicious utilization of the resources and environment protection that help in addressing socio-economic challenges. An integrated farming system...

Usman Ghani*, Naeem Ijaz* and Daulat Khan**

NUMERICAL SIMULATION OF MEANDERING OPEN CHANNEL FLOWS
... and for devising flood protection strategies. This study is based on three dimensional numerical simulation of overbank flows in meandering channels. Four different flow cases were considered. The cases vary from each other in the sense of bed slope and overbank flow depth. There were two overbank flow depths for each bed slope. In this study a rectangular main channel flanked by floodplains on both sides has been considered. The simulatio...

 Majid Ashraf, Mohammad Haseeb Zafar, Tariqullah Jan

EFFICIENT ROUTING SCHEME FOR UNIDIRECTIONAL LINKS IN MULTI-HOP NETWORKS
... AODV-Blacklist routing protocols in Multi-hop networks. The performance analysis when compared with the three routing protocols to manage unidirectional links shows that our proposed ARR scheme is superior to the AODV and AODV-Blacklist.

...

 Muhammad Shahzad1, Arif Iqbal Umar1, Syed Hamad Shirazi1, Muhammad Tariq Pervez2*, Zakir Khan1, Waqas Yousaf1

HCDP: HEPATITIS C DATA BANK OF PAKISTAN
...uitination sites in the protein sequences, motif/signature sub-sequences pattern, visual appearance of protein/nucleotide sequences for analysis of different sites, visual representation of multiple sequence alignments using colour code along with motif finding/conserved region in the sequence and analysing of graphical structure of phylogenetic tree. With the help of Format converter/Fasta generator tool user...

 Nisar Mohammad1, Mohammad Mansoor Khan1

RECOVERY OF TALC FROM TALC- CARBONATE SCHIST OF SWAT EMERALD MINES, NWFP, PAKISTAN
...with 80% recovery using frother as a process aid whereas, upgradation using gravity separation was 82%. The flotation concentrate on leaching further improved and the level of impurities reduced from15 to 8 %.
...

 S.W. Shah*, M.I. Babar*, L. Khan**, M.N. Arbab*, H. Ullah*** and R.A. Syed***

RELIABLE MULTICAST IMPLEMENTATION IN JAVA
... based on User Datagram Protocol (UDP) that provides a “best effort” delivery service. Best effort implies that IP packets are treated with essentially equal weight, and while IP makes an effort to deliver all packets to their destination, packets may occasionally be delayed, lost, duplicated, or delivered out of order. One of multicast’s weaknesses is its lack of reliability due to its use of UDP for data transmission. Re...
Kadir Karakuş1, Turgut Aygün2, Şenol Çelik3, Mohammad Masood Tariq4*, Muhammad Ali4, Majed Rafeeq4 and Farhat Abbas Bukhari4
...th weight (BW), around scrotum (SCC), scrotum length (SCL) and birth type (BT). TDIA > 8.5 and DAGE will provide 21.06 unit to live weight (LW). BW > 4.2 will provide 18.43 kg to LW. TESLENG > 8.5, SCC < 2.4 and SCL will provide 8.227 to LW. TDIA < 4.5 and TESLENG > 9 will provide 4.095 to LW. Analytic results shown that MARS outperformed CHAID, Exhaustive CHAID, and CART approaches in terms of R2

Parakriti Gupta1, Kapil Goyal2 and Mini Pritam Singh3*

Hepatitis E Virus and Zoonosis
...the virus has only one serotype, 8 genotypes have been documented. Out of these, HEV 1 and 2 have been reported from developing countries and are transmitted mainly through faeco-oral route while HEV 3 and 4 are reported from developed countries and the infection is acquired by humans due to the eating of undercooked pigs, deer and wild boar meat. Recently HEV genotypes 5 and 6 have been reported in Japanese wild boars while HEV genotypes 7 and 8 have been rep...
Dibyendu Biswas1*, Shib Shankar Saha2, Shankar Biswas3 and Md. Abu Sayeed4
Outbreak of Lumpy Skin Disease of Cattle in South-West Part of Bangladesh and its Clinical Management
...ive different treatment protocols were applied for recovery of the affected cows; where no significant differences were estimated among the treatment protocol in contrast to recovery from LSD. However, dexamethasone, chlorpheniramine maleate, combination of oxytetracycline and meloxicam showed apparently good results. Interestingly, most of the household in this study area never used mosquito curtains at their cattle house a...

Markus I. Francis1*, Paul I. Ankeli2, Clara N. Kwanashie1, Jibril Adamu1, Lushaikyaa Allam1, Mashood A. Raji3, Godwin O. Egwu4, Flavio Sacchini5 and Massimo Scacchia5

Detection of Mycoplasma bovis from Cattle Presented for Slaughter in Adamawa and Taraba States, Northeastern Nigeria
... on standard laboratory protocols. An overall Mycoplasma bovis isolation rate of 0.83% (4/480) was obtained. Based on the states studied, 1 (0.35%) and 3 (1.53%) M. bovis were isolated from Adamawa and Taraba States, respectively with an insignificant association between M. bovis infection and the states sampled (P>0.05). Based on organs/site sampled, 2 (5.40%) isolates of M. bovis were from lung tissues and 1 (2.70%) were from both pleural fluid and ear sw...

Uzma Arif1, Sadar Uddin Siddiqui2, Muhammad Fareed Khan1, Muhammad Arshad3 and Shakeel Ahmad Jatoi

...ior during storage of carrot seeds was assessed by subjecting them to controlled-ageing for different temperatures and incubation time during 2016 at Seed Preservation Laboratory, Bio-resources Conservation Institute, NARC, Islamabad. Forced seed ageing was carried out at 25, 30, 35 and 40°C for Day-one (D1) through day-six (D6) of incubation period. Observations were recorded for percent germination, shoot length (cm), root length (cm), fresh seedling bio...

Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh 

...110-120 cm), high crude protein (36.23% over check variety S-2000), thick stem (14.86% more than check variety S-2000) and higher leaf area per plant (21.55% over check variety S-2000). The variety is drought tolerant may be grown in semiarid and arid areas having minimum rainfall up to 300 mm, highly lodging-resistant, late-maturing i.e. stay green till mid May, having up to 12 % crude protein and having green fodder potent...

Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu

...hotosynthetic pigments, protein, soluble sugar, hydrogen peroxide (H2O2), malondialdehyde (MDA), ascorbate (AsA) and reduced glutathione (GSH), activities of superoxide dismutase (SOD) and peroxidase (POD) in leaves of ‘Hull Thornless’ were investigated. In the treatment group, water stress significantly increased EL, and the accumulation of photosynthetic pigments, protein, soluble sugar, H2O2 and MDA. After re-...
Magbolah Salem Helal Alzahrani
...d decrease in serum lipoprotein HDL, LDL, VLDL fraction levels, indicating liver damage. Rats given CCl4 and fed on 5% M. chamomilla showed the most significant increase in organ weight as compared to all levels of treatment suggesting that M. chamomilla can reduce liver damage. Rats given CCl4 then fed on a combination of all levels of M. chamomilla showed a decrease of AST, ALT and ALP enzyme levels in the serum, su...
Mumtaz Ali Khan1, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Kashif Prince1*, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4Asad Ullah5, Naimat Ullah4, Muhammad Shoaib2 and Said Sajjad Ali Shah2
... suspected of having enterotoxemia and 107 sheep were identified to be infected with Clostridium perfringens. Genotypic Analysis of all isolates from infected sheep was performed. Results showed, 53.27% isolates showed infection of CP type A, 10.28% of type B and 36.44% of type D. Animal infected with different serotypes (A, B, and C) were categorized into two groups healthy and diseased to compare the hematolo...
Cheng Zhao1,2, Jianghong Ran2*, Bin Wang2,3, Qin Shi4 and Marwan M.A. Rashed1
...o human disturbance. To protect this species, we investigated the relationship between giant panda habitat use intensity and human disturbance density in the Daxiangling Mountains. The results indicated that, among multiple kinds of disturbances, roads affected the giant panda habitat use significantly. In addition, roads caused the giant panda habitat use intensity to decline sharply. The giant panda nearly stopped using the habitat when road density was more...

Olga Mikhailovna Blinnikova1*, Vadim Anatolyevich Babushkin1, Lyudmila Gennadievna Eliseeva2 and Galina Severyanovna Usova3

Modeling a Formulation and Assessment of the Consumer Properties of the Special Purpose Starch Drink
...body to produce its own protein. Drinking kissel is a perspective product type for enrichment the CCR (Central Chernosem Region’s) fruit and berry’s by collagen and natural physiologically active agents. At the same time the new types of drinking kissel useful to health, in assortment are which confirms the feasibility of updating the range due to enriched drinking kissels. Drinking of one glass of kissel covers the body daily need for ascorbic aci...

Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood

... activity (64.42 U mg-1 protein), peroxidase activity (1.90 µmol min-1 g-1 protein), catalase activity (37.81 nmol-1 g-1 protein) and protein (6.28 mg g-1 fresh weight) contents. These commercial plant products based on amino acids enriched macro and micronutrients as well as acetyl-salicylic acid combined with ascorbic acid can be used carefully f...
Mahak Fatima1, Memoona Syed1, Rabia Zeeshan2, Farah Rauf Shakoori3, Naveed Shahzad4, Moazzam Ali1 and Zeeshan Mutahir1*
...iRNA transfection, MTH1 protein was knockdown to approximately 77% in the transfected sample and resulted in a 1.75-fold increase in sensitivity of MCF7-R cells to gemcitabine. Moreover, higher expression of p21 protein was also observed in transfected MCF7-R cells that may indicate induced cell death. This study highlights the effect of MTH1 gene silencing in drug-resistant cancer cells as a mean to improve combined ...
Maryam Yousaf1, Naveed Shahzad2, Zeeshan Mutahir1 and Moazzam Ali1*
...ssion of MRP-1 mRNA and protein in comparison with PC-3/Wt cells. MRP-1 was found distributed between intracellular and cell surface pools in PC-3/Res cells and was capable of drug efflux as shown by doxorubicin and epirubicin efflux assays. Moreover, qRT-PCR and Western blot analysis showed that PC-3/Res cells also had significantly up-regulated expression of Rab21. To study the effect of Rab21 on MRP-1 mediated multidrug resistance, siRNA mediated knockdown ...
Ayesha Noreen1, Amina Elahi1, Dilara Abbas Bukhari2 and Abdul Rehman1*

 

... as cofactor. The protein profile of B. cereus 3.1S, showed two bands of approximately 14 and 70 kDa, which had their possible role in arsenite oxidation. This was confirmed by transforming E. coli DH5α with plasmid DNA of B. cereus 3.1S. This arsenite resistant bacterial strain oxidized 76 and 86.5% As3+ from the original industrial wastewater after 3 and 6 days of incubation, respectively. This bacterially treated ...
Muhammad Khan1, Tehmina Ameer Khan1, Aziz Ud Din2, Muhammad Fiaz Khan1, Irfan Ullah3,*, Kalim Ullah4, Sadia Tabassum1,*
...ing Phenol: Chloroform: protocol. The target genes were amplified via polymerase chain reaction (PCR). The amplified gene products were sequenced and compared with the revised Cambridge Reference Sequence (rCRS) Accession-No. N_012920.1. Four mutations in 16S-rRNA gene have been identified viz mt-2552T>A, mt-1811A>G, mt-1888A>G and mt-2467A>T and two are novel, mt- 2552T>A and mt-2467A>T while others have been previously reporte...

Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1

Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...uggle should be made to protect them. The key objective of the present study was to file the taxonomic knowledge and the local and medicinal uses of the root juice of Desmodium elegans DC, combined with the bark juice of Bauhinia malabarica for the treatment of cholera, branches of the Indigofera heterantha Wal. ex Brands vari; gerardiana used in basket making, twig bridges making, soil cover for preventing erosion. Similarly, Astragalus genus used as a fodder...
Zhi Yijin, Shao Mingqin* and Li Quanjiang
...s II Chinese nationally protected bird species were identified. Of six habitats, 64% (15,435 individuals) of the total number of wading birds counted occurred in water-covered areas. The common crane Grus grus has the widest habitat niche (0.727), utilizing grasslands and farmland after crops were harvested, where it ate vegetation (roots) or seeds. Shorebirds have narrow habitat niches, and are limited largely to shallow water areas. Of species pairs, ...
Gregory Ejikeme Odo1,*, Juliana Ekenma Agwu1, Nkechi Nweze2, Clara Ikegbunam2,Felicia Ekeh N1, Vincent Ejere1, Ngozi Ezenwaji1, Reginald Njokuocha2, Godwin Ngwu1 and Fabian Okafor1
...erecta offered some protections against diseases related to the muscles. The significant reduction of AST level has further eliminated any leakage of the enzyme in the liver due to hepatic injury in the treated rats. Previous biochemical studies have also confirmed the non toxicity of the plant extract of D. erecta to the kidney.
...
Feng-Mei Yang1, Rui Li2, Xiu-Xue Hu3, Yong Liang4, Bo Gao3* and Wei Chen3*
...n and senescence marker protein-30 (SMP30) after normal human skin fibroblasts (NHSFs) irradiated by different UVB doses as well as durations, thus unveiling mechanisms underlying HSF senescence induced by Ultraviolet B (UVB). NHSFs treated under different doses (100, 200, 300 mJ/cm2) of UVB with different durations (1, 2, 3 days) were case group, while those without UVB irradiation were control group. Expressions of gene/pr...
Zengwen Huang1,2, WuReliHazi Hazihan2*, Baheti Bodai2, Kadyken Rizabek3, Nuralieva Ulzhan3, Omarova Karlygash4, Juan Zhang1 and Yaling Gu1*
...to approximately 40 KDa protein. Q-PCR analysis showed that the plasmid pGenesil 10-3p-siRNA could interfere with the expression of INHα in granulosa cells to an efficiency of 83%, which was also confirmed through western Blot assay.This study successfully constructed the eukaryotic expression plasmid pGenesil 10-3p-siRNA, and confirmed that the plasmid interfered significantly with the expression of INHα gene in YM sheep. Our current findings can ...
Yan Zhou1,2, Hai Xia Han1,2, Qiu Xia Lei1,2, Jin Bo Gao1,2, Wei Liu1,2, Fu Wei Li1,2, Jie Liu1,2 and Ding Guo Cao1,2*
...;">Very low density lipoprotein receptor (VLDLR) is of vital importance for egg production in mediating the synthesis of yolk protein precursors. To better understand the effects of VLDLR on reproduction in chickens, the haplotypes and diplotypes based on three genetic mutations (NC_006127.2:g.8467G>A, NC_006127.2:g.12321G>A and NC_006127.2:g.13876A>G) were constructed, and the associations of diplotypes with reprod...
Ishrat Perveen1, Yasar Saleem2 and Javed Iqbal Qazi3* 
...c amines (HCAs) in high proteinaceous food specifically in cooked meats is a point of great concern for the health risk factor of Pakistani community. Ready-to-eat (RTE) chicken kabab samples of four commercially available brands (K, S, D and B) were analysed for the simultaneous determination of HCAs i.e. 2-amino-3-methyl-imidazo[4,5-f] quinoline (IQ), 2-amino-3,8-dimethylimidazo [4,5-f] quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenylim...

Khalil Ahmed1*, Amar Iqbal Saqib1, Abdul Rasul Naseem1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Muhammad Khalid2, Imtiaz Ahmad Warraich3 and Muhammad Arif4

Use of Hyacinth Compost in Salt-Affected Soils
... crops were grown in the rotation. Data analysis showed that gypsum and hyacinth compost remarkably improved the soil SAR, pHs, ECe, BD, HC, growth and yield characteristics of rice and wheat crops, however at the same time use of gypsum and hyacinth compost in combination proved more superior to their sole application. Hyacinth compost @ 10 and 15 t ha-1 with gypsum @ 50 % of GR performed equally in all studied parameters of rice and wheat crops and soil prop...

Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3

Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
...e that serve as dietary protein source for poor farmers in the developing countries. Yield and production severely challenged by biotic stresses. Wilt complex is the major biotic factor that contribute significantly in yield loss. Wilt complex is caused by various pathogens, including diverse type of Fusarium species. Molecular approach is a useful technique for the identification of wilt complex pathogens. The study conducted to identify the polygenetic assoc...
Safina Naz1, Syed Atif Hasan Naqvi2*, Bushra Siddique3, Muhammad Asif Zulfiqar4 and Abdur Rehman5 
 
Exogenous Application of Selected Antioxidants and Phyto Development Directors Influenced the Development, Output and Biochemical Attributes of Tomato (Lycopersicum esculentum Mill.)
...itamin C, lycopene and carotenoids while, lower values for these parameters were recorded in control. Total acidity was significantly greater in fruits when GA3(100 ppm) was applied. Total acidity was significantly lower in fruits of plants from control.

...
Chao Zhao1,2, Sigang Fana2 and Lihua Qiua2,3,*
...rate concentration), heterotrophic bacteria, and vibrios during different P. monodon stages(nauplii, zoea, mysis stage, postlarvae). In ponds 1, 2, 3 and 4, the survival rates were significantly lower but the nitrite concentration and vibrio numbers (before mysis stage) were considerably higher than those in other ponds (P < 0.05), indicating that nitrite and vibrios influenced P. monodon survival during larva culture. Nitrite and ...
Muhammad R. Khan1, Bushra A. Rakha1,* and Muhammad S. Ansari2
...N 2017 and needs urgent protection and proactive conservation efforts to save from becoming extinct in most of its range. The most abundant species of river swat was Schizothorax plagiostomus while the least abundant species was Schizothoraicthys macropthalmus. However, all of the species of genera Schizothorax and Schizothoraicthys facing drastic decline in their distribution range and within River Swat due to introduction of exoti...
Tabassum Yaseen1*, Shehzad Ahmad1, Khushnood Ur Rehman2, Fayaz Asad1, Abdul Waheed1, Rani Gul3, Hussain Gulab4 and Naveed Akhtar2
Arbuscular Mycorrhizal Fungal Spore Density and Root Colonization in Weeds of Carrot field at Charsadda, Pakistan
...s were collected from Carrot field of District Charsadda and was investigated for the sporulation and root infections types. From the recorded results the highest spore density was found in Melilotus indica having spore number 276 which is followed by Malva neglecta and Sonchus asper having spore number 244, 214 respectively. The lowest spore density was recorded in Pao annua having spore number 35. The maximum Glomus density was found in Melilotus indica havi...

Rabab Rafaqat1, Habib Ahmed Rathore1, Tariq Masud2, Imran Hayat1* and Imtiaz Hussain1

Determination of Different Chemical Constituents of Fruit, Leaves and Oil of Olea cuspidata (Wild Olive) Grown at Rawalakot, Azad Jammu and Kashmir
...ent, crude fibre, crude protein, total oil, ash content and nitrogen free extract of fruit and leaves were studied. Extracts of wild olive fruit and leaves were made in four different solvents (ethanol, methanol, acetone and water). Total phenolic content (TPC) and total flavonoid content (TFC) of fruit and leaves extracts in these solvents were determined. Oil was extracted from wild olive fruit by the process of solvent extraction and was studied for physico...
Huma Abbas1, Muhammad Azhar Iqbal2, Muhammad Kamran3, Muhammad Umar Shahbaz3*, Haseeb Ullah Kamber1, Nazir Javed1, Muhammad Junaid1, Hira Abbas4 and Muhammad Ehetisham ul Haq3
Evaluation of Advanced Mung Bean Germplasm against Cercospora Leaf Spot and its In-vitro Management by Different Fungicides
...iod legume and poor man protein source along with carbohydrates and vitamins. Cercospora Leaf Spot is a devastating threat to the crop caused by Cercospora canescens, affects the whole crop and 95% yield losses may be attributed in severe conditions. To manage the diseases through tolerant germplasm and with environmentally safe fungicides is a cost-effective approach. The present study was aimed to find the resistant germplasm against the disease and to evalu...

Moazam Ali1, Wajid Ali2, Ayhan Ceyhan2 and Zeeshan Ahmad Bhutta3*

Pigmentation Genome Influence in Animals and Human Interventions in its Course of Action
... tick resistance, photo-protection, camouflage appearance in wild, and identification. Pigmentation is a complex and multi-factorial regulated process to produce the melanin from melanocytes. Melanin amount, size, shape, and distribution control the color pigmentation of fiber, coat, and hairs in animals. Melanin production in an intricate course is under the control of Melanocortin 1 Receptor, alpha Melanocyte stimulating hormone and Agouti signaling gene. In...

Khan Sher1*, Muhammad Subhan1, Muhammad Nisar2, Ali Hazrat2, Zahid Fazal1, Gul Rahim2, Imran Ahmad1, Riaz ul Haq1 and Shamia Bibi1

Genetic Diversity in Common Beans (Phaseolus vulgarus L.) Collected from Different Ecological Zones of Malakand Division (A Part of the Sino Japanese Region of Pakistan)
..., high productivity and protein significance as compared to other parts of the world, which could be utilized for evolving better quality and high yielding cultivars of P. vulgarus.

...
Asmat Ullah1,2, Shahid Iqbal1,2 and Furhan Iqbal2*
...emale albino mice during rota rod test (P = 0.002), had more rotations (P = 0.02) and clockwise rotations (P = 0.01) during plus maze test and had more stretch attend reflex (P = 0.005) than control group. During the second trial of novel object test, Bauhinia variegata’s leaf extract treated male albino mice approached old object A (P = 0.04) and spend more time with object A...
Asim Faraz*
...l, triglycerides, total protein, albumin, calcium and phosphorus were found to be significantly different higher in IMS compared to SIMS and EMS. The levels of urea, creatinine and glucose were found to be varied (P>0.05) among groups. Regarding hair mineral status Ca, Mg, Cu, Zn, Fe and Mn concentrations were found to be significantly different (P<0.05) among calf groups in IMS, SIMS and EMS.
...

Dalal H. Sary and Rama T. Rashad*

A Comparative Study on the Impact of Compost, Humate, and Silicate on the Nutritional Characteristics of Calcareous Soil Cultivated by Soybean
...significant increase of protein and total N (~77.07%) followed by K-Si (~60.67%) then K-H (~ 17.69%). However, compost and K-Si have almost decreased the concentration (mg kg-1) of Cu, Fe, Mn, Zn, and Si in soybean seeds significantly by increasing the application rate from 50 to 100 %. Potassium silicate was the most effective Si-source in this study due to its content of readily soluble Si in soil solution. Silicon uptake can partially control the availabili...
Oluwatoyin Adenike Fabiyi1*, Olubumi Atolani2 and Gabriel Ademola Olatunji3
Toxicity Effect of Eucalyptus globulus on Pratylenchus spp. of Zea mays
...s Spectrometry (GC-MS), proton and carbon-13 Nuclear Magnetic Resonance (1H-NMR and 13C NMR) Spectroscopy analysis. Effect of application of plant phytochemicals on the planted maize was also examined in terms of growth rate and survival of Pratylenchus spp. The essential oil (ECSG/EO) exhibited significant (p<0.05) toxicity, reduced nematode population and increased grain yield (6.79 kg) compared to the standard, carbofuran (CBFN) (7.18 kg) The Eucalyptus ...

Muhammad Nauman, Unsar Naeem-Ullah*, Mehreen Hanif, Hafsah Ghaffar, Muhammad Shahid and Syed Haroon Masood Bokhari

Management of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) by using Microwave Oven
...ns have rich sources of proteins, fibers and minerals. This cereal crop has maximum proportion in daily basic diet of human in Pakistan. Disinfestation of wheat grains by using microwaves can be safe option than chemical control. Therefore, in this study a digital microwave oven of 50 Hz is used to determine the mortality of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) adults. Grain samples of 20 g in each petri dish were infested with bot...

Ashraf Ismail Afia1 and Ahmed Soliman Mohmed El-Nuby2*

Soybean Genotypes Response to Root-Gall Nematode
...for the planning of crop rotation systems as well as the identification of resistance sources for breeding purposes.

...
Ammara Gull-E-Fareen1, 3, Imran Bodlah1*, Muhammad Tariq Rasheed1, Yasir Niaz2, Muhammad Adnan Bodlah2, Muhammad Asif4 and Nasir M. Khokhar5
...eturn ants provide them protection from natural enemies. Ants also protect aphids from different diseases. Aphids (serious crop pests) can be divided into myrmecophilous and non- myrmecophilous. The main objective of this study was to determine trophic associations of ants associated with aphids on various host plants in Pothwar. For this purpose, seven ant species were selected, identified as Camponotus compressus (F...
MA Liman1, QI Yongxiao1, Wang Wenji2* and Zhong Qianyi3*
...esulted in reduced Vegf protein expression. Our study suggested that G-Rh2 may exert anti-angiogenic activity by downregulation of Vegf in zebrafish embryos, thus indicating its role as a potential therapeutic agent against cancer.
...

Syeda Farzana Bibi* and Siraj ud Din

Unraveling the Bioherbicidal Potential, Elemental Analysis and Nutritional Evaluation of Crataeva adansonii Dc Leaf and Bark
...tages of carbohydrates, proteins, fats, fiber, ash, and moisture. The bioherbicidal potential of the proposed plant was evaluated through the Lemna minor model of phytotoxicity. C. adansonii is a source of several essential macro and micronutrients. A nutritional value analysis of this plant offers its use as a food source. Bioherbicidal/phytotoxic activity revealed significant results in the form of dose-dependent inhibition of frond growth. Ethanolic extract...

Taqi Raza1*, Sergio de Los Santos Villalobos2, Muhammad Shehzad3, Shakeel Imran4 and Derly José Henriques da Silva5

PGP Characterization of Rhizobacteria Associated with Apple Gourd (Praecitrullus fistulosus L.)
...trient availability and protecting plant against stresses. The current study was carried out to characterization of rhizobacteria associated with Apple Guard (Praecitrullus fistulous L.). Morphological, qualitative and quantitative tests were performed to characterize the PGPR abilities of isolated rhizobacteria. Lab study indicated that isolated bacterial strains have morphologically different colonies, shapes, and colors. The isolated strain mostly belonging...
Atef  Mohamed El-Sagheer
Status of Phytonematodes in a Main Commercial Banana Production of Upper Egypt

 Majid Shahi Bajestani1, Esmat Mahdikhani Moghadam2*, Reza Aghnoum3 and Hamid Rohani2

Study of Plant Parasitic Nematodes and Description of New Record (Rotylenchus alius) Associated with Barley (Hordium vulgare L.) in Khorasan Razavi Province, Northeast Iran
Kui Zhang1,2, Ping Geng1, Sher Khan Panhwar3, Khadim Hussain Memon4 and Zuozhi Chen1,2,*
...the provision of animal protein, employment solutions, and foreign-exchange earnings through exports. However, stock assessments are available for few of the commercial marine fish species in Pakistani waters. Most commercial fish species lack assessments of maximum sustainable yield (MSY) and allowable catch, a situation that hinders effective fisheries management. A Catch–MSY model based on statistical catch data and prior information on population par...

Kecheng Zhu1,2,3, Peiying He1, Baosuo Liu1,2,3, Huayang Guo1,2,3, Nan Zhang1,2,3, Liang Guo1,2,3, Shigui Jiang1,2,3 and Dianchang Zhang1,2,3,* 

...uscle-specific membrane protein that is essential for myoblast fusion. Myomaker is regulated by myoblast determination protein (MyoD), a muscle-specific basic helix-loop-helix (bHLH) transcription factor in higher vertebrates. However, the transcriptional regulatory mechanism of the myomaker gene has not been explored in marine fishes. In the present study, molecular cloning, bioinformatic analysis and transcriptional...

Fan Sigang1, Guo Yihui1* and Xu Youhou2

...EGG pathways related to protein glycosylation, fatty acid biosynthetic processes, hydrolase activity, and AMPK were enriched in the ovary, whereas those related to male organ formation and spermiogenesis were enriched in the testis. The glycosphingolipid biosynthesis pathway was identified for the first time in a mollusc testis.The present study provides the first transcriptomic analysis of C. nobilis, which will help clarify the molecular mechanisms of...

Asim Faraz1*, Abdul Waheed1, Ayman Balla Mustafa2, Nasir Ali Tauqir3, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal4 and Muhammad Shahid Nabeel5

... respectively. The fat, protein, lactose, SNF and total solids percentage was found to be 4.44, 4.40; 3.42, 3.38; 4.82, 4.76; 8.96, 8.93 and 13.38; 13.33, respectively under EMS and SIMS. The results could be used for future intensive camel production in Pakistan.
...
Yujun Zhao and Jianping Fan*
...d factors Bcl-2 and Bax protein and the activities of Caspase-3 and Caspase-8 in colon cancer SW480 cells were studied. Compared with the control group without medication, the proliferation inhibition rate of cells processed with Kanglaite injection (10, 20 and 40 μL/mL) significantly increased (p <0.05), the apoptosis rate increased (p <0.05), the expression of Bcl-2 protein decreased (p <0....
Yahui Wang1, Ling Ren1, Yishen Xing1, Xin Hu1, 2, Qian Li1, Lingyang Xu1, Junya Li1* and Lupei Zhang1*
...cts of bone morphogenic protein 4 (BMP4) and rosiglitazone during differentiation were studied. Comparing with control group, progenitor cells treated with BMP4 or rosiglitazone accumulated more intracellular lipid. Furthermore, the mRNA expression level of adipocyte-specific genes also increased significantly in BMP4 or rosiglitazone treated cells. The result indicated that BMP4 and rosiglitazone could promote adipogenesis and be applied in adipogenic differe...
Mumtazur Rahman1, Farhan Anwar Khan1,*,Umar Sadique1, Ijaz Ahmad1, Shakoor Ahmad1, Faisal Ahmad1,2, Hayatullah Khan1,3, Muhammad Saeed1, Faiz Ur Rehman1, Ibrar Hussain1, M. Faraz Khan1, M. Izhar ul Haque1 and Hanif-ur-Rehman1,3

...inolones in Pakistan by broth microdilution method. Quinolones including moxifloxacin, levofloxacin, ciprofloxacin, and enrofloxacin were selected for in vitro susceptibility of Mccp Pakistan strain. The concentration for each drug was measured distantly depending on high concentration available in the market and was then used in various concentrations ranges from higher to lower i.e. moxifloxacin 80-0.156 µg/ml, levofloxacin 250-0.488 µg/ml...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...ndustrial production of proteins and peptides to manage root-knot nematode. Mi gene resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transp<...

Muhammad Abdullah1, Syed Attaullah Shah1, Khurram Nawaz Saddozai1, Jahangir Khan1*, Mohammad Fayaz1, Irfan Ullah1* and Sabeeh Ullah2

Analysis of Agricultural Land Price Determinants and Policy Implications for Controlling Residential and Commercial Encroachments: Facts from District Swabi (Pakistan)
...ricultural land must be protected through laws from residential and commercial encroachments. Investment in development of agricultural infrastructure and provision of subsidized on important inputs could raise farmers’ returns from agriculture and could change their perception to favor using land for agriculture.

...

Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman

Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
...ement of conventional neurotoxic insecticides for managing the insect pests of stored commodities.

...

Masoud Hassani1* and Omid Madadgar2,3

Serological Evidence of Bluetongue in Iran: A Meta-Analysis Study
...T epidemiology and BTV serotypes, vector control, animal movement restrictions and vaccination program to reduce.

...
Abdul Majid Khan1,*, Muhammad Tahir Waseem1, Rana Manzoor Ahmad2, Ayesha Iqbal1, Hafiza Imrana Naz1, Amtur Rafeh1 and Muhammad Ameen1
...etaconal area has caused rotation of the metastyle in relation to the antero-posterior tooth axis and thus situated more lingually. The protocone in second upper premolar is well developed and situated posteriorly and also has an anterior lingual constriction. The metaconule in the third upper molar is smaller than the protocone. The dentition in Eotragus noyei is smaller in ...
Inga Kowalewska-Łuczak1 and Ewa Czerniawska-Piątkowska2,*
... the highest content of protein and the lowest content of fat in milk. On the other hand, for the SAA2 c.114G>A polymorphism, it was shown that cows with GA genotype were characterized by the lowest calving interval (P≤0.05). In summary, the information contained in thi...
Syed Zakir Hussain Shah1*, Muhammad Afzal2, Mahroze Fatima3Syed Makhdoom Hussain4 and Tanveer Ahmed5
...e contained 37.6% crude protein and 4.72 kcal/g gross energy. Results showed improved (p<0.05) dry matter, crude protein, crude fat and gross energy digestibility by fingerlings when fed PHY sprayed diet. Similarly, CA addition in the diet resulted in increased (p<0.05) digestibility of these nutrients. Also, the minerals digestibility was significantly (p<0.05) affected by top spraying of phyta...
Xuya Zhou1, Ying Liu1, Deqin Xu1, Jie Bao1, Yaru Cao2 and Yong Jin3*
...ern blot to explore the protein expression levels of COX-2 and cytochrome P450 (CYP) 4A1. The expression of CYP4A1 was detected by immunohistochemistry. Enzyme-linked immunosorbent assay (Elisa) was used to detect the prostaglandin E2 (PGE-2), 20-Hydroxyeicosatetraenoic acid (20-HETE), endothelin 1 (ET-1) and B-type natriuretic peptide (BNP) in blood serum of diabetes complicating arthritis rats. Blood pressure was measured by a noninvasive caudal artery blood...

Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Shehzadi Saima4, Muhammad Suhaib2, Muzammil Husain3, Haris Khurshid1 and Shahid Ali Khan1

Effect of Temporal Application of Gypsum on Mineral Uptake and Economically Important Morphometric Traits in Groundnut (Arachis hypogea L) under Rain-fed Conditions
...nut is a good source of protein, edible oil, and vitamins. A gradual decline in groundnut yield has been reportedly subjected to various agro-climatic conditions and soil fertility problems. In this study, various regimes of gypsum application and its effect on groundnut yield, morphometric parameters, and minerals (Ca, K, P) concentration in root and shoot have been examined. A newly released Pothowar groundnut variety (Variety name) was grown in 3 replicatio...

Muhammad Iqbal1, Muhammad Ehetisham ul Haq1*, Muhammad Kamran1, Muhammad Idrees1, Shahid Nazir2, Ihsan Ullah3, Sumera Naz1, Shaukat Ali1 and Muhammad Zafar Iqbal2

Morpho-Molecular Characterization of Xanthomonas Axonopodis Pv. Citri Associated with Kinnow (Mandarin) and its Management
...rial culture using CTAB protocol with modifications. Amplification of 581bp fragment from isolated DNA from bacterial isolates confirmed the presence of pathogen i.e. X. axonopodis pv. citri. The amplified PCR product was purified and further confirmed by sequencing which showed 100% similarity with 40 nucleotide sequences of X. axonopodis pv. citri submitted in NCBI. Relative efficacy of six antibiotics (Streptomycin sulphate, Oxytetracycline, Cefalexin, Kasu...

Luqman* and Zahid Hussain

Impact of Tillage Tools and Weeding Regimes on Nutritive Values of Maize Grains
... grains including crude protein content, fat content, ash content and dry matter content of the maize grains. The results showed 13% protein content, 5.8 % fat content, 0.93 % ash content and 89.6 % dry matter content in the maize grains, which were the higher values achieved in plots treated with mouldboard plough, while in the weeding regimes the crude protein content, fat content, ash c...

Sidra Shehzadi, Sher Bahadar Khan*, Umar Sadique and Saqib Nawaz

Isolation and Molecular Identification of Clostridium perfringens Type D in Goats in District Peshawar
...ext-align: justify;">Enterotoxaemia, caused by Clostridium perfringens Type D, is a disease of domestic animals particularly sheep and goat widespread in Pakistan due to endemic outbreak in every spring season; therefore the current study was conducted for isolation  and molecular identification of new strains of C. perfringens Type D for effective diagnosis, treatment and vaccination. A total of 100 fecal samples  were collected aseptically from fou...

Muhammad Luqman1*, Roshan Hussain1, Muhammad Yaseen1, Muhammad Umer Mehmood1, Ijaz Asghar2 and Usman Saleem1

Comparative Analysis of Dietary Intake Patterns of Rural and Urban Communities of Southern Punjab, Pakistan
... the communities prefer proteins with fats and sugar commodities. In lunch rural community is much attracted towards carbohydrates and dairy products, while urban community prefers wheat bread with fruits and vegetables. Fruits, dry fruits and legumes are a best source of attaining maximum micro and macro nutrients. In comparison to this rural community of the study area perceived that vegetables and fruits are rich in macro and micro nutrients. Keeping in vie...

Muhammad Amir1*, Syed Waqar Shah1, Salman Ilahi1 and Michael J. Pont2

Integrating TTC-SC5 and TTC-SC6 “Shared-Clock” Protocols
...ve developed two new SC protocols based on star topology. In both bus and star-based designs, the Controller Area Network (CAN) protocol was used for network communications. Previously we have demonstrated that both new protocols in their individual capacities have the potential for addressing issues relating to Time-Triggered Cooperative (TTC) scheduling, Time Triggered bus-based CAN netw...
Muhammad Faisal Ayoob1,2, Zaheer Ahmed Nizamani1, Asghar Ali Kamboh3, Mansoor Ayoob4, Waseem Ali Vistro3 and Abdul Sattar Baloch3*
...erimental velogenic viscerotropic newcastle disease (VVND) in Japanese quails and mynas. Both birds were divided into Q1, Q2, Q3, M1, M2 and M3 group each of four bird. The birds of group Q1, M1 and Q2, M2 were administered with 0.3ml of VVND virus (1.8×109 EID 50)via intramuscular and oral routes, respectively, whereas, birds of group Q3 and M3were kept in contact exposure with VVND virus infected chickens. Clinical signs were obse...
Q. Sun1, Q. Liu1, R. Di1, Y. Wang1, S. Gan2, S. Liu2, X. Wang1, W. Hu1, X. Cao1, Zh. Pan1, X. Guo1, Y. Yang3, H.E. Rushdi4* and M. Chu1*
...THRSP) is a crucial protein for cellular de novo lipogenesis. THRSP gene encodes a nuclear protein which regulates fatty acid synthesis in lipogenic tissues. Identification of single nucleotide polymorphisms (SNPs) of sheep THRSP gene and their association with fat deposition were investigated using Altay and White Suffolk sheep. In addition, the messenger RNA expression profiling of THRSP in fat-tai...
Saima Yaqub1, Tahir Yaqub1*, Muhammad Zubair Shabbir2, Asif Nadeem3Aziz-Ul-Rahman1, Muhammad Furqan Shahid1, Zarfishan Tahir4 and Nadia Mukhtar4
...V) PIs mutations in the protease region while four NRTI (D67T, K70R/Q, M184V and T215F) and four NNRTI (V108T, E138A, V179I and Y181C) mutations in the reverse transcriptase region were observed. The present study concludes circulation of multiple subtypes of HIV-1 among IDUs and a continuous disease surveillance coupled with delineation of disease risk factors may provide a crucial insight into HIV prevention and treatment which could substantially curtail HI...
Muhammad Shafiq1,2,*,Rajwali Khan1, Ilyas Ali3, Sadeeq Ur Rahman4, Saif Ullah3Shah Jan Mohammad2, Mohammad Jan2 and Jinhu Huang2
...rum IgG and serum total protein concentration (b) colostrum immunoglobulin level and (c) their respective calves’ serum immunoglobulin and serum total protein concentration. Three breeds of cattle were observed: Jersey, Holstein Friesian (HF) and local Pakistani cow breed Achai. To assess serum IgG, sodium sulphite precipitation technique was used while IgG in colostrum were determined using digital Brix refract...

Ambreen Akhtar Saddozai1, Amer Mumtaz2, Naseem Rauf1, Saeeda Raza2, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Sahar Shibli2, Muhammad Suhail Ibrahim3*, Muhammad Akhtar4 and Muhammad Saad Rehan5

Preparation and Quality Evaluation of Soymilk Carrot Blend
...stify;">Shelf life of carrot supplemented soya milk was studied at two different temperatures to improve its pro vitamin A profile. Soymilk being potential source of protein was used as a carrier of pro- vitamin A. Carrot powder was blended in soya milk at three different concentrations levels 2%, 4% and 6% and packed in sterilized bottles. The product was kept at two different temperature...
Ahmad Sadiq1, Muzafar Shah2*, Habib Ullah1, Irfan Ali1, Amir Alam3
Navid Jalil1 and Muhammad Khan3
...ts with low density lipoprotein (LDL), high density lipoprotein (HDL) and body mass index (BMI) were found to be significantly lower (p > 0.05) than normal or control. Gender-based analysis has shown that HbA1c, RBS, DBP and SBP in male patients have significantly higher (p<0.05) than female. But in female patients the TC, TG and BMI are insignificantly higher (p<0.05) compared to male. High density lipop
Minghao Gong1*, Shiliang Pang2, Zhongyan Gao2, Wanyu Wen1, Ling Zhang3, Gang Liu1, Huixin Li1, Fawen Qian4 and Wenfeng Wang2
... improvements needed to protect appropriate areas that ensure the RCC’s long-term survival. Based on monitored data of nesting locations and climate variables gathered from 2014 to 2017 around Zhalong Reserve on the Songnen Plain in northeast China, we used four General Circulation Models in Maxent modeling to project changes, including suitability and fragmentation, in RCC breeding habitat up to the year 2050. Based on climate change, we predicted a dec...
Shikang Deng1,2, Yan Jin2, Jing Xu2, Xiufang Zhu2, Pinghai Hu2, Jiao Li2, Li Zhang2 and Jianzhong Tang2,*
...a;1, cyclinD1, and CDK4 protein in each group of cells; and real-time polymerase chain reaction was used to detect the expression levels of TGF-β1, cyclinD1, and CDK4 mRNA in each group of cells. The results showed that after 5-FU intervention, the proliferation of bile duct scar fibroblasts was inhibited, and the expressions of TGF-β1, cyclinD1, CDK4 mRNA and protein in the cells were down-regulated (P<0.05), s...
Pengfei Liu1*, Hongxia Liu2 and Jiajia Xiao1
...y significantly higher carotenoid chroma than female in grayish-white tail end, however, there was no difference in orange wing patch and yellowish-brown hip plumage between sexes. Both male PL and EL had higher reflectance than female in wavelength ranges 300-700 nm. We argued that the patterns of sexual plumage dimorphism in these two babblers might be selective advantage in reducing nest depredation risk and brood parasitism, and it could be viewed as an in...
Maria Syafiqah Ghazali1, Azlan Che’ Amat2 and Nor Azlina Abdul Aziz1*
...rometra sp.), and a protozoan (Isospora sp.). Half (n=5/10) of the large felines had mixed infections with Toxocara cati and Ancylostoma spp.
...
Aamer Sharif1,*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2
...bsorbed by measuring the rotational speed (rpm), torque, output power and efficiency of the vortex turbine. The result showed that efficiency (52.54%) is maximum at median rotational speed and median torque applied on shaft. Also water vortex height and output power decreased as torque increased on turbine shaft.
...

Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3

Application of Nanotechnology for Insect Pests Management: A Review
... environmentally benign protocols for the synthesis of nanoparticles. Insect pests are main density dependent factors that deteriorate the quality and production of various crops i.e. vegetables, fruits, ornamental and field crops. In past decade, these insect pests had been controlled by the application of synthetic insecticides but due to the injurious application of these insecticides causes the development of resistance, environmental pollution, pest resur...
Eslam Moradi-Asl1*, Behnam Mohammadi Ghalehbin2, Kamran Akbarzadeh3, Jafar Mohammad-Shahi4, Hajar Afshin4
...d Physical inability to protect the wound were the most important factors in wound myiasis in this report. 
 
Vijay Lal and Muhammad Naeem*
...sh 6.72%, fat 3.45% and protein 16.62% in the whole wet weight of body of T. jarbua. % water represented correlation with highly significant value (P<0.001) with protein, ash, fat and organic constituents in wet weight. Fish body weight represented highly significant (P<0.001) positive relation to all the studied body constituents in log transformed data. Total length also represented highly-significant positive...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Fazal Yazdan Saleem Marwat3, Hamida Bibi4, Farhan Ahmad1, Wajia Noor5 and Bibi Sadia5

Yield and Nutritional Status of Mungbean as Influenced by Molybdenum and Phosphorus
...1 molybdenum while more protein content (21.91 %), carbohydrates (60.36 %), nitrogen content in grain (3.76 %) and straw (1.10 %), phosphorus uptake in grain (0.380 %) and straw (0.186 %) was achieved with molybdenum applied at rate of 2.5 kg ha‑1. Whereas in case of phosphorus use maximum  seed yield (810.88 kg ha‑1) and harvest index (26.92 %) was observed with 60 kg ha‑1 P application while highest protein cont...
Xiaopeng Tang1,*, Lei Chen1, Kangning Xiong1, Dun Deng2 and Peng Peng2,*
...presents an alternative protein resource to meet ever-increasing demands of feed ingredients in poultry production sectors.  
...
Abdul Hafeez1*, Akhtar Nawaz Khan2 and Zahid Ullah3
...molecules including DNA/proteins and diseased human cells can be detected by a variety of micro and nanoscale devices and systems. Unfortunately, these biomedical applications suffer from huge amount of data. That is, the data generated by such systems is so large that a typical computer workstation cannot handle it in real-time. Traditional approaches rely on unloading raw data to off line storage and suffer from the trade-off of an insufficiently rigorous sa...
Abdul Nabi Jatt1,2*
...rum-quenching (QQ) AiiA protein. The present study, for the first time provides evidence that the QS system via AHL molecules involved in regulating the production of two different forms of an extracellular cellulase enzyme, i.e., exoglucanase and endoglucanase in marine snow associated bacterium C. freundii
Humza Sami1, Mahnoor Sagheer1, Muhammad Amir Altaf1, Javaid Iqbal2 and Muhammad Zubair1,*
 
...e the small tumors. The prototype hardware setup uses two Vivaldi antennas, one as transmitter and other as receiver for scanning. The distance between phantom and antennas is kept almost 20 cm. The scattered signals from the high contrast objects emulating the tumor characteristics have been processed through an open-source imaging algorithm, known as MERIT, to construct the image. To get the best results, images are constructed by comparing different algorit...
Faheem Ahmed Khan1*, Sarzamin Khan2, Qurat-ul-Ain3, Saqib Ishaq1Muhammad Salman1, Abdul Rehman1, Ikram Ullah4, Kalsoom5 and Johar Jamil5
...ion of non-conventional proteins utilizing the available cheap sources. The indigenous Saccharomyces cerevisiae were isolated from different fruit samples, identified by conventional polymerase chain reaction (PCR) and were characterized for production of single cell microbial protein (SCMP). Out of 60 different fruit samples, a total number of confirmed S. cerevisiae isolates were 1, 2 and 1 from orange (Ci...
Mashal Malik and Mudassar Nawaz Khan*
 
...tionally rich source of proteins and fats. It is grown in many countries of world including US, China, Brazil and India. Pakistan grows soybean on a very limited land owing to lack of farmers interest and government attention. Soybean lines; B24G14, B23G5, B20G16, B21G2, B21G9, B6G23, B23G16 and B29G11 were grown for one month and analyzed for morphological and molecular variations. In order to analyze genetic variat...
Naveed Akhtar1*, Muhammad Fiaz Khan1*, Sadia Tabassum1
Munawar Saleem Ahmad2 and Khan Dil Badshah3
..., cholesterol, urea and protein level decreased, whereas in the glucose level increased in all treated groups. In histopathology, dose dependent lesion and alterations in gills, liver, brain, kidney, intestine and muscles related with oxidative stress damage was observed. Genotoxicity increased with increase in time and concentration of cypermethrin. Cypermethrin is therefore extremly harmful to aquatic life.
...
Ye Ge1, Chunmiao Zhao1, Weitian Xie2, Ying Liu2,* and Chunhou Xu1,*
...nzymes, we produced the protoplast as the parent strain of B. subtilis and Rhamnose lactobacillus and analyzed the production rate of spores, the ability to resist high temperature and hereditary stability. The results showed that RH-3 was a perfect protoplast from which 48 strains were obtained through regeneration, with a sporogenic rate of 69.1% and a colony number of 2.7×105 CFU/mL after an...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
 
...ions. The total soluble proteins, proline, glycinebetaine and phenolic contents were improved in all three wheat varieties under drought stress. The variety Pu19 was exhibited a higher level of proline, glycine betaine and phenolic contents were. Similarly, hydrogen peroxide (H2O2) and malondialdehyde (MDA) were improved in all three wheat varieties but this increase was relatively lower in variety F23. The superoxide dismutase (SOD), per...
Muneer Abbas1*, Dilbar Hussain2, Muhammad Saleem2, Abdul Ghaffar2Sohail Abbas3, Niaz Hussain1 and Abdul Ghaffar1
...A=sanitation, B=MAT, C= protein based baits, D= plant extracts and E= A+B+C+D were used during 2015-16. Data of % infested fallen fruits, total flies/trap, total flies captured/year, % fruit punctures, pupal population, % fruit infestation and market value of fruits was collected at regular intervals. Results indicated that when all the components were applied in a combined way they gave significant reduction of fruit losses. As a result of continuous sanitati...
Kamal Al-Samawi1, Mohamed Al-Hassan2, Hussein Migdadi3,4*, Megahed Ammar5 and Salem Alghamdi3
...nized using the ovsynch protocol level in combination with natural mating (NM). Blood samples were collected at 1, 7, 15, 23, 35, and 60 days post NM. Levels of ISG15 and ISG17 mRNAs were assayed using real-time PCR, and serum progesterone (P4) concentrations were assayed using an ELISA kit. Pregnancy detection was performed by US on 23, 35, and 60 days post NM. Serum P4 concentration was significantly higher in pregnant than non-pr...
Ying Liu1, Shankun Liu1, Hui Wang2 and Weihua Su2,*
...y was to scrutinize the protective effect of caffeic acid against the streptozotocin induced GDM in rats and explores the possible mechanism of action. A total 36 female rats were caged into the male rats for the pregnancy, and 33 female pregnant rats were collected and weight. The female rats were group into following groups and each group contains 6 rats. Once the pregnancy was verified, the streptozotocin (STZ) single intraperitoneal injection was used for ...
Muhammad Naeem1,2, Nasir Rajput1,2, Sher Ali3, Asmatullah Kaka2, Dildar Hussain Kalhoro2, Mehvish Rajput2 and Tian Wang1,*
...TRS-II, while the crude protein (CP) were higher and acid detergent lignin (ADL) were lower (P<0.05) in AH than other groups. The concentration of acetate, butyrate and iso-butyrate were almost similar in TRS-II, AH and CWR; valeric and iso-valericwere lower (P<0.05) in CWR and TRS-I than AH and TRS-II, while the propionate and total VFA were higher in AH but similar in CWR and treated rice straw. The in vitro degradibility of DM, OM...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6 
...biofilm effect of three proteolytic enzymes including trypsin, chymotrypsin and proteinase k against S. Gallinarum. We observed that S. Gallinarum has strong biofilm forming ability as observed by dark black colonies on congo red medium. Quantification assays such as test tubes revealed significantly (p<0.001) strong biofilm after 5 days with significantly increased planktonic cells (after 3 days) and increa...

Natalija Grittner1, Radomir Mandić2,* and Milivoje Urošević3

...strains), which are not protected by the Decree of the Ministry of Agriculture of Serbia on animal genetic resources, be included in the Decree in the future, in order to preserve and improve their numbers. An urgent establishment of the animal gene bank of Serbia has been also proposed. It is given a proposal of measures for further activities on the preservation and improvement of the state of animal genetic resources in Serbia.
...
Qiang Tang1 and Qianli Tang2*
...vels of Ang-1 and Tie-2 proteins in skin tissue decreased (both p<0.001). Compared with model group, thickness of epidermis, dermis and collagen fibers, and expression levels of Ang-1 and Tie-2 proteins in skin tissue in isoliquiritin group increased (all p<0.001), and inflammatory factors TNF-α, IL-6 and IL-1β contents and expression level of Ang-2 protein i...
Junyan Bai*, Zhihao Dong, Youbing Yang, Ziheng Li, Xiaoning Lu and Huirong Gong
...i>P<0.05). Crude protein contents in forelegs, hind leg and back were remarkably higher than that in waist (P<0.05). The crude fat content of the waist was significantly higher than that of other parts (P<0.05). To sum up, due to low shearing force, meat quality of hind leg was tender just with slightly low crude fat content; crude fat content of waist was high, so flavor of waist was good. The correlation coefficients of flesh color...
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
...mate analysis including protein content, crude fiber, ether extract, and total digestible nutrients. Significant results were obtained by applying ANOVA test on the data retrieved. All three factors (BP, CC and CS) showed maximum results after 60 days of growth. The result indicated that after the 60 days interval the animal unit per month gave the maximum fodder (7.0667 AU/M/Ha) that proposed to be grazed for large ruminants and then 21 small ruminants on the...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
...ash, crude fiber, crude protein, crude fat ranged from 92.082 to 92.317, 3.097 to 3.85, 4.9133 to 5.2717, 5.0133 to 5.2867, 1.08 to 1.24, 0.0236 to 1.9567 g/100g and that of fruits with lesser values were also affected significantly (P<0.05). From the present study it was concluded that Se applied in the form of sodium selenite in irrigation and foliar spray considerably affected the physical parameter of tomato hybrid Salar F1, followed by proximate compos...
Yuanyuan Zhang1*, Liping Song1, Hui Guo2, Jun Wu1, Xiaoli Wang1 and Fangbin Yao1
...rformance and the hepatoprotective and antioxidant effects of curcumin against carbon tetrachloride (CCl4)-induced liver injury in common carp Cyprinus carpio. A 10-week feeding trial was carried out. A basal feed was supplemented with 0 (control), 30, 60, 120 and 240 mg/kg curcumin to formulate five experimental feeds. At the end of the feeding trial, the growth performance was determined. Subsequently, CCl4 was used for the model...
Jiawei Hong1,2, Mingqiang Chen 1,2, Zhenghua Deng1,2, Youning Li1,2 and Yu Wang1,2*
...e relative abundance of Proteobacteria increased (from 34.96% to 77.31%) with the increasing of enrofloxacin exposure dosage. The dominant position of Tenericutes was replaced by Proteobacteria, and in parallel the proportion of Tenericutes slumped to 3.85%. At the genus level, the relative abundance of Mycoplasma, dropped down from 58.38% to 3.85%, and Vibrio increased (from 15.23% to 40.8%) to become the domi...
Sadaf Javaria1, Anum Marwat1, Muhammad Nadeem2, Mehwish Zerlasht1, Aiman Kareem3, Iqra Rubab1 and Masooma Munir4*
...olids (TSS), vitamin C, protein, iron and magnesium were investigated. Results of sensory evaluation showed that all the samples were in an acceptable range. However, Mix fruit leather with 50 % apple puree and 50% peach puree was liked the most by the panelists.
...
Salman Ali1*, Ayaz Ali2, Riaz Ali Rind2, Majid Ali3, Zulfiqar Ali Mastoi2, Shagufta Naz3, Muhammad Shakir3, Rashid Ahmed Qaim Khani1
...y 1.78%, pH value 6.26, protein 24.07%, fat 3.76%. Whereas, the fried fish resulted moisture 62.16%, titratable acidity 1.39%, pH value 5.96, protein 21.11%, fat 5.93%. The fish grilled resulted in moisture 60.19%, titratable acidity 1.32%, pH value 5.89, protein 20.28%, and fat 4.13%. According to the sensory evaluation the result of microwave method were found significantly high than oth...
Ahmad Abrar Khan* and Muhammad Idrees
...rop. Besides scab, brown rot and shot hole were reported by more than 60%, apricot growers.Regarding dormant practices, 65.2% apricot growers pruned their trees, 67.4% applied winter oil and 69.7% Bordeaux mixture while unfortunately,60.6% of the respondents were not doing hoeing practice. The Regression analysis results reported application of chemical fertilizers, FYM, irrigation in drought periods, pruning, winter oil and Bordeaux mixture application were p...
Yongyun Zhang1, 2, Xinyang Fan1, Fangting Zhou1, Weizhen Li3, Yina Ouyang1,4 and Yongwang Miao1*
...udy, and accordingly, 6 protein variants and 2 synonymous variants of αS1-CN were inferred and named. The variants A, B’, B’’, C, E and F were observed only in river buffalo, whereas variant D was found only in swamp buffalo. The variant B was shared by both types of buffalo with high frequencies. The buffalo variants determined here did not exist in Bos genus. In addition, 9 amino acid differential sites of ...

 Muhammad Ajmal1, Saima Mustafa1, Fizza Ibrahim Bajwa1, Cheng Zhou2, Guangdong Wen2, Soe Lwin Myint2, Syed Irfan Raza3, Ihtasham Bukhari4, Mubashir Hassan5, Muhammad Faisal6 and Furhan Iqbal1*

...ature termiation of the protein after 23 amino acid residues (p.P144LfsX23), resulting in a truncated HR protein with 166 amino acid residues. The mutation followed Mendalian pattern of inheritance as all the patients are homozygous for the mutation while parents were heterozygous and unaffected siblings from both families were either heterozygous for the reported mutations or they lacked this mutation.
...
Chen Tongde1, Fakher Abbas1, Jiao Juying1, Shahzada Sohail Ijaz2*, An Shoshan1, Muhammad Ansar3, Qaiser Hussain2, Mah-Noor Azad2 andAyaz Ahmad2
...ould be strengthened to protect farmland and ensure food security. It is recommended that collection of basic data on soil erosion, and study of the mechanism and process of soil erosion at different scales should be strengthened in order to protect the land resources in Pakistan.
...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
... for the partial fusion protein, The eight NDVs isolates of velogenic genotype VII and contain the unique cleavage site motif 112RRQKRF117 with high relation to very virulent NDV Chinese strain Chicken /China/SDWF07/2011 strain with nucleotide identity percentage (99.3% -100%). The main causative agent of recent ND outbreaks in vaccinated broiler flocks in Menofia governorate, Egypt was found to belong to very virulent genotype VII. This strain was genetically...
Ryan Septa Kurnia1* and Radiana Dhewayani Antarianto2
 

...lial which functions as protective and adaptive barrier against continuously inhaled substances including pathogens and allergens. Current research about mechanism of disease and drug development is conducted in 2D cell culture or in animal models. The 2D cell culture models poorly imitate the condition in vivo and provide limited utility due to mimic tissue physiology in multicellular organisms. Although animal models can be used as pre-clinical tools ...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
 

... a rich source of plant protein. A number of diseases attack chickpea crop but wilt disease is the principle one. In mineral contents i.e. nitrogen, phosphorus, potassium, calcium, magnesium, sodium, zinc, iron and copper were decreased in chickpea plants affected with wilt disease. Leaves of three resistant and susceptible (un-inoculated and inoculated) chickpea lines/varieties were tested to find out their ionic status ...
Sohail Akbar1*, Muhammad Shafiq2, Muhammad Yaqoob2, Muhammad Farooq Iqbal2, Kashif Ishaq2, Muhammad Kamran2, Shazia Shamas3, Arbab Sikander4 and Muhammad Hashim5
 
 
...s along with the bypass protein. So there is need of nutrition based management of animals in proper way.
...

 Caner Öztürk1*, Mücahid Onay1 and Neşe Hayat Aksoy2

...ation procedure and the protective effect of the antioxidants against sonication. Four merino rams (2–3 years old) were used for semen collection, and the ejaculates were pooled and divided into five equal aliquots. The samples were diluted with a solution having different additives at 37 °C. The first two groups contained L-Cystine as an additive (2 and 4 mM), the next two groups had methionine as an additive (2 and 4 mM), and the last group had no ...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
....50% fat and 4.80-5.10% protein. The lactose content did not differ significantly between milk samples from the two locations (3.90-4.20%). Total unsaturated fatty acid levels were significantly higher than total saturated fatty acid contents, irrespective of the lactation period (p<0.05). Milk from Hatay was high in saturated fatty acids, aromatic hydrocarbons and benzaldehydes, i.e. 4.50 g 100 g-1, 6.80-4.65 mg 100g-1 and 0.28-0.70 m...
BamideleAkinsanya1, Isaac O Ayanda2,*, Benson Onwusa1 and Joseph K Saliu1
... (100) samples of Heterotis niloticus were investigated for parasitic infection for a duration of six months, while the parasites encountered were used as sentinel organisms to check for the presence of PAH and BTEX. GC-MS was used to analyse for the presence of these chemicals, while parasite identification was done using conventional method. Only one parasite species, Teneuisentis niloticus, an acanthocephalan was recovered. There was 72% infec...

 Amjad Ali1*, Pirzada Jamal Ahmad Siddiqui1, Naveed Ahmad2,Shabir Ali Amir3, Rafaqat Masroor3,Seema Shafique1 and Zaib-un-Nisa Burhan1

...ent of effective marine protected areas, involvement of different stakeholder (well reputed research institutes, universities, dive centers, tour operators, local community), making tourism laws and their implementation, rehabilitation of microhabitats for fish communities through the involvement of local community and creating awareness in general public on the significance (ecological, commercial) of these natural resources via print and electronic media for...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
 

...mal;">The specific proteins induced by sublethal-temperature are molecular chaperons that positively regulate plant growth and development that govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA
Suwati Suwati1, ErniRomansyah1,*, Syarifudin Syarifudin1, Yahya Jani2, Agus Heri Purnomo3
Damat Damat4 and Erkata Yandri5,6
...nsists of carbohydrate, protein, fat, fiber and ash, vitamin, and beta-carotene. Right drying methods are needed to preserve the quality of dried seaweed. This study aims to compare the trend of weight reduction in seaweed during drying by natural and cabinet methods. The methods were used experimentally in the field and laboratory. And the data were analyzed using simple linear regression to formulate a trend of reduction i...

Saad A. Moussa1, Ahmed F. Afify1*, Suzan Salah2 and Ayman Hamed3

...argeted to nucleocapsid protein gene (N-gene) was carried out followed by phylogenetic analysis. Positive samples were isolated on Vero cell culture and identified by TEM and immune-peroxidase technique. Betacoronavirus 1 was detected by ELISA in 6 out of 20 fecal samples (30%), PCR detected 4 out of 6 ELISA positive samples at specific M.W. band of 236 bp by electrophoresis, and one sample was sequenced and submitted on Genbank with acc.no. MW173144, further ...
Haris Setiawan1, Aris Winaya1,*, Herwintono Herwintono1, Mulyoto Pangestu2 and Yayuk Kholifah3
 

...line-through;">s protects the membrane of spermatozoa. This study aimed to observe the effects of Snakehead Fish (Channa striata [Bloch 1793]) Extract (SFE) supplementation in tris Egg-yolk extender on mortality and motility of spermatozoa of Limousin bull (Bos primigenius f. taurus [Linnaeus, 1758]) collected from Singosari Artificial Insemination Center, Indonesia and commercial SFE. Semen from the same bull were collected and processed ...

Masood Sadiq Butt1, Sadia Aslam1,2, Rizwan Shukat1,*, Syed Qamar Abbas1, Muhammad Issa Khan1, Shadab Shaukat3 and Muhammad Shahid4

...n appreciable amount of proteins, enzymes and fats. It was considered as garbage of no financial value and disposed of without any attempt of recovery. The aim of this study was to optimize the hydrolysis conditions for production of protein hydrolysate with enhanced functionality. Minced rohu (Labeo rohita) waste mainly comprising of head, tail, fins and skin was considered as raw material to prepare p
Muhammad Farhan Qadir1, Xin-Yu Han1, Meng-li Qiao1, Ying Wang1, Ding Zhang1, Yu-hai Bi1,2, Ali Raza Jahejo1,Qian-qian Cheng1 and Wen-xia Tian1,*
... blot analysis of COX-2 protein expression further supported the mRNA results. Moreover, this was first study indicating the expression levels of PG-related genes in the H9N2 infected chicken’s erythrocytes. This study may provide a new biomarker to detect H9N2 in chickens. Future studies are in process to know the morphological features, and to evaluate the mechanism exhibited by erythrocytes in response to H9N2 with new experimental evidence in chicken...
Aysha Riaz* and Said Wahab
...ich in nutrients namely proteins, fibers and minerals. Keeping in view the nutritional importance of moringa leaves powder, the present study was carried out to investigate the effect of moringa leaves enrichment on the overall quality of whole wheat flour biscuits. Composite flours were made by incorporating moringa leaves powder in different ratios (2, 4, 6, 8 and 10%) in whole wheat flour. Biscuits were prepared from the composite flours and were analyzed f...
Muhammad Farooq1*, Allah Rakha2,Jawad Ul Hassan2, Iftikhar Ahmed Solangi1, A. Shakoor3, Muhammad Bakhtiar4, Muhammad Noman Khan5,Shoaib Khan5, Ibrar Ahmad6, Shabir Ahmed7 andWang Yunyang1*
 

...wder on moisture, crude protein crude fat and nitrogen free extract of muffin were non-significant and effect on ash and crude fiber were significant when 0%, 10%, 20%, 30% and 40% mushroom powder based muffin were prepared. The effect of mushroom powder supplementations on loaf weight of muffin was significant and resulted in gradual decrease. However, the effect on loaf volume of muffins was non-significant. The effects of mushroom powder on texture and colo...
Saira Batool1, Safdar Ali Shirazi1 and Syed Amer Mahmood2*
 
 
...n and natural resources protection. It is inevitable to make suitable water harvesting structures and control rainwater to stop soil removal and water provision for the lean season in this rain-fed region. The results obtained can help realize that conservation practices and soil management can decreas soil erosion. The hypsometric and spatial autocorrelation investigations are in agreement with the results obtained from RUSLE technique. Tree plantation, check...
Arshad Bhat1*, Masudul H. Wani1, Shabir A. Wani2, Abid Qadir3, Iqra Qureshi4 and Abid Sultan2
 

...urred on the health and protective items purchased for reducing the impact of excessive pesticide use on health and ecosystem. Furthermore, Contingent Valuation Method was employed for knowing the willingness of the apple growers to use pesticides in biodegradable packages for reducing the environmental damage caused due to dumping of polyethene and other non-degradable bottle in the canals, streams orchards and other open spaces. The results reveal that numbe...
Tanay Dineshkumar Shah
 

...ey are a rich source of protein and fiber and have very low calories and low cholesterol. Days are not far when mushrooms will be a regular alternative to vegetables for many vegetarians. India is having a favorable environmental condition to grow mushrooms. Hence various varieties of mushrooms are grown in different regions of India. However, the per capita consumption of mushroom in India is very less as compared to other countries though mushroom has many h...

Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2

...t yield index (92.21%), protein contents (17.37 mg g-1), leaf water contents (72.65 %), soil moisture contents (14.40 %). Comparing the genotypic performance Aas-2011 performed well as compared to Faisalabd-2008 and TD-1 wheat genotype.

...

M. Javed Iqbal1, Rizwan Shukat1, Muhammad Farooq2*, Iftikhar Ahmed Solangi2, Naila Ilyas3, Rahman Ullah4, A. Shakoor5, Muhammad Bakhtiar6 and Faraz Ahmed7 

...nt concentration of soy protein (0%, 4%, 8% and 12%) as foaming agent and Carboxyl methylcellulose (0.5%) as foam stabilizer and these were dried in hot air tray drier at different temperatures (55°C, 65°C and 75°C) with 3mm sheet thickness of onion foams. Effect of different concentration of foaming agent and drying temperature was studied on moisture loss drying rate of onion paste. Increase in concentration of foaming agent significantly increas...

Ali Zaman1, Nabila Roohi1 and Muhammad Irfan2*

...LPS) and outer membrane protein (OMP) on Nili Ravi buffaloes. Prepubertal Nili Ravi female buffaloes (N=18) of 10-12 months age in good health condition were divided into five treatment groups (n=3 each) and a control group (n=3). Treatment groups’ animals were exposed to P. multocida bacterial culture and its immunogens, i.e., LPS (oral and intravenous) and OMP (oral and subcutaneous). Animals were analyzed for the development of clinical signs, hematol...

Aamer Sattar1, Sadia Sultana1*, Abid Niaz1, Muhammad Aftab1, Ghulam Sarwar2, Irfan Rasheed3, Muhammad Shoaib4, Raheela Naz1, Amina Kalsom1, Nisa Mukhtar1, Farah Rasheed1, Arfan ul Haq1, Munazza Rafique5, Muhammad Arif1, Sarfraz Hussain1 and Jafar Salim6

...ncorporation practice by rotavating the crop biomass into the soil. The selected field was sufficient in exchangeable K and available P but was deficient in organic matter contents. The results showed that in first year the wheat yield was maximum in T4 (5.04 t ha-1) in complete removal plot followed by residues incorporated (4.43 t ha-1) and burnt plots (3.72 t ha-1) respectively. It was observed that yield in residues incorporated plots was declined in next ...

Arshad Mehmood Khattak1, Saleem Ullah1*, Farida Anjum2, Hamid U. Shah1 and Sahib Alam1

...r (6.60) in KK-2, Crude protein in Chattan (7.87) while Crude fat (2.22) was high in KK-1. Among the edible parts, Moisture (85.54) and Ash (3.54) were high in Green grains while Crude fiber (6.38), Crude protein (8.29) and Crude fat (1.99) were maximum in Tender leaves. Mineral (mgKg-1) content of the cultivars showed that Na (38.3), Pb (0.30) and Cu (0.09) were high in Sheenghar, Cr (0.36), Ni (0.92) in KK-2, Fe (0.29) in ...
Tai-hua Jin1, An-gang Lou2,Jiu-xiu Ji1, Cheng-dou Cui2, Long-zheng Yu2 andLi-zeng Guan1*
... the GH mRNA and protein level in pituitary cells of Yanbian yellow cattle could be significantly decreased by adding miR-1468 mimics (P<0.01), while these were significantly increased by adding miR-1468 inhibitor (P<0.05). The results of bioinformatics analysis and double luciferase reporter gene system validation showed that miR-1468 targeted 3’UTR of cAMP responsive element binding protein...

Manzoor Hussain Memon1, Khalid Khan2, Anjum Parvez3, Sarfaraz Ahmed Shaikh4, Khan Mir Khan2, Guo Xiangyu5*, Mohammad Nasrullah6 and Saima Liaqat7

...r sources that fulfills protein and vitamin need of human body. Because of increased urbanization and change in human eating habits the global demand of meat has been increasing. At present, in Pakistan, poultry consumption is the key source of the general masses to get the mandatory protein and nutrients. The foremost impact of the poultry industry is to boost up nutrients value and provide an inexpensive and economical sou...
Asim Faraz1*, Abdul Waheed1, Hafiz Muhammad Ishaq1 and  Muhammad Shahid Nabeel2 
...ic diets with different protein levels viz: one group with 18% CP and other group with 22% CP. Daily feeding allowance (@ 3% body weight) was calculated and adjusted according to fortnightly live weights. Water was provided twice a day. Daily weight gain was 953±50 and 996±40 g/d with 18% and 22% levels of protein ration, respectively while average DMI of concentrate, fodder and crop residues was 2.93±0....
Li Shengqing1,2,3, Zhang Xiyun2,3, Liu Shengcai2,3, Hu Guoyuan2, Fan Yuxia2,Liu Huaixin2, Wang Tingting2 and Zhang Yanming1*
...lateau zokors, and Microtus fuscus are calculated through Horn’s method and the improved Karber method. The ability of the toxin to prevent and control rodent damage is assessed through plot experiments. The safety of type D botulinum toxin toward nontarget animals, such as yaks, Tibetan sheep, dogs, vultures, and birds, is also tested. Results show that the toxin is encoded by a type D botulinum neurotoxin gene...
Alamaary Mohaammed Saad1,3, Abd Wahid Haron1*, Mohamed Ali2
Mark Wen Han Hiew1 and Lawan Adamu1
... revealed a much better protection of oxidative stress. The supplementation of cysteine and ascorbic acid showed an adverse effect on sperm motility, membrane integrity, and viability. Nonetheless, those with cysteine and ascorbic acid recorded better sperm morphology and acrosome integrity than those from the control group. Furthermore, the fertility of frozen semen was better with the cysteine groups than with the ascorbic acid groups. The addition of antiox...
Hesham Saeed1*, Manal Abdel-Fattah1, Ahmad Eldoksh1, Farid S. Ataya2 and Manal Shalaby3
...wed a 564-bp encoding a protein of 187 amino acids with a predicted molecular weight of 21 kDa. Basic local alignment search tool (BLAST) sequence analysis revealed that C. dromedarius IFNα gene shares high sequence identity with IFNα genes of other species, including C. ferus, Vicugna pacos, and Homo sapiens. Expression of C. dromedarius IFNα cDNA in Escherichia coli revealed a fusion p
Xiujun Yao1, Haofeng Wang 2, Ligong Zhang3, Jingzhang Wu4 and Lijun Wang1*
...ntervention, 24-h urine protein quantity, serum levels of IL-6, IFN-γ, and TNF-α ,kidney ROS and MDA levels, relative content of TGF-β1 and CTGF in TGP group were lower than that in model group (P <0.05); serum levels of IL-2 and CTLA-4,SOD levels in TGP group were higher than that in model group (P <0.05).These results indicated that TGP could reduce urinary protein quantity, inhibit inflammatory resp...
Chaman Ara1*, Asmatullah1, Saima Hanif1, Shagufta Andleeb2, Beenish Zahid3 and Madeeha Arshad4
...as onion extract showed protective effects as well as regenerative potential against Al provoked toxicity in male mice.
...
Naimat Ullah Khan1*, Muhammad Hassan Saleem2, Aneela Zameer Durrani2, Nisar Ahmad2, Muhammad Shafee3, Ayesha Hassan2, Mumtaz Ali Khan2 and Nadeem Rashid3
...ryptosporidium is a protozoan parasite causing diarrhea in human and animals. This study has been aimed to find out its prevalence and chemotherapy of cryptosporidiosis in goats in three selected districts of southern Khyber Pakhtunkhwa (KPK), Pakistan. A total of 1440 fecal samples were collected from goats, 120 samples per month from each of 3 districts for twelve months. Identification of oocysts was done through conventional acid fast ZN staining. Prev...

Syed Muhammad Aun Naqvi1, Sara Tahir1, Tanveer Ahmed2*, Huma Naz3, Amara Gilani4, Atif Liaqat5

... higher levels of crude protein and lipid percentage compared with W1 and W2. Highest ash (percentage) was measured in the gills of the weight group W3 as compared to W1 and W2. Generally, total carbohydrates are determined by the difference of the entire proximate body composition indices, and in this study, it was found that the liver contains maximum carbohydrates (percentage) relative to other sections of the body examined. Weight group W3 was found to hav...

Muhammad Yousif Jakhrai1, Ahmed Nawaz Tunio2, Ali Mujtaba Shah1*, Tarique Ahmed Khokhar1, Muhammad Mohsen Rahimoon1

... sedative effect for laparotomy (peritoneal) surgical interventions in ovine and caprine species as compared to lidocaine. 
 
Novelty Statement | This comprehensive review will be very helpful to reduce anesthetic risk by using high epidural analgesia in small ruminants for hindquarter surgical procedures like hysterotomy, celiotomy, rumenotomy, repair of prolaps...

Jabeen Farheen1,2*, Simeen Mansoor1 and Maria Abid1

...tation in humans’ proto-oncogenes which leads to carcinogenicity. The current findings aimed to evaluate the genotoxic impact of widely used azo FCAs on the cell cycle by using onion as a model plant. The study was designed in a complete randomized design where the grown onion roots were exposed to 0%, 0.001%, 0.01%, 0.1%, and 1% concentration of FCA for 120 hours for macroscopic and 36 h for microscopic evaluation. The onion root tips morpho-physiology ...

Attaullah Jan1*, Saleem Khan2, Iftikhar Alam1, Farzeen Khan3 and Muhammad Farooq4*

...elation between age and protein and energy intake, and weight and energy and protein, showed that protein energy intake increased with increasing age and weight. Overall, both stunting and underweight were more common in girls than boys. Girls in general, had poor nutrient intake compared to boys, girls were therefore more likely to suffer from under-nutrition compared to boys.

...

Shujaa Arshad1, Muhammad Umair1*, Rana Shahzad Noor1, Chaudhry Arslan2, Arslan Afzal1 and Zafar Islam3

...The results showed that prototype help to keep the room temperature up to 4 °C to 5 °C lower than the ambient temperature while using the only solar energy through PV panel. The use of solar energy with new technologies in Pakistan is not yet adopted on large scale. This research will promote the researcher and user to adopt such technologies as Pakistan has great potential to harvest solar energy. 

...
Imran Tarique1*, Muhammad Ghiasuddin Shah1, Illahi Bux Kalhoro1
Zaheer Ahmed Nizamani2, Mansoor Tariq 2, Jamil Ahmed Gandahi1
Saqib Ali Fazlani3 and Benazir Sahito3
...ions (dewlap, abdomen, scrotum / udder and thigh) of young and adult of either sex of red Sindhi cattle (Bos indicus). Skin of red Sindhi cattle showed epidermis thickness rang of 41.1-50.13 µm and dermis thickness rang of 443.97-597.05 µm in all body regions and significant (0.05) in age and sex group. The epidermis possessed stratified squamous epithelium, and main cells was keratinocytes.
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...omplementation group D2 protein and Fanconi Anemia complementation group L had significantly higher gene expression at 100 ng/mL LPS level. The protein expression of phosphorylated histone 2AX showed a linear rise in the range of LPS levels from 0 to 12.5 ng/mL, then significantly declined at 100 ng/mL LPS level. Oxidative stress and oxidative damage to protein and DNA were induced by LPS ...

Qaiser Shakeel1*, Rabia Tahir Bajwa1­, Yasir Iftikhar2, Mustansar Mubeen2, Muhammad Luqman3, Waqas Ashraf1 and Ifrah Rashid4

...ponsible for ginger soft rot. Petri dish were used to conduct bioassay through poisoned food technique with triplicates. The crude extract of all the plants showed a better inhibitory effects on the pathogen’s (P. digitatum) mycelial growth rather than fungicides. Among all the plant extracts, the best result was showed by garlic extract with 87% of mycelial growth inhibition followed by moringa with 82%, the best concentration is 100mg/mL. Besides, Rido...

Imtiaz Ahmed*, Naveed Ahmed, Abdul Waheed, Muhammad Abbass Khan, Noorullah Khan and Fayyaz Ahmed

... (3.68), number of fruit rot vine-1 (1.44), fruit weight (1.92 kg), fruit length (43.46 cm), fruit width (9.80 cm), fruit cavity (7.23 cm), number of seeds fruit-1 (534.83), seed weight fruit-1 (73.50 g) and seed yield (245.67 kg ha-1) was obtained from plants which were planted in north-south direction. The findings of the present trial indicates that vertical growing method in combination with east to west direction of sowing suited best for seed production ...

Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1 

... in chlorophyll and osmoprotectants contents was also seen in heat susceptible genotypes. TSX-C40 was identified as most susceptible genotype to heat stress due to low accumulation of glycine betaine and proline, and greater relative cell injury percentage, along with lengthened curd induction stage. Curd induction in TSX-C40 was seen when the maximum temperature was between 21.5-26.0 ˚C. While CF-Early was identified as heat tolerant genotype as curd inducti...
Yahong Guo1,3, Zeqin Fu1,3, Jiantong Feng1,3, Chengrui Yan1,3, Yingying Ye1,3*, Kaida Xu2 and Baoying Guo1,3
...ed to establish genetic protection units for M. unguiculatus, limit the selection of breeding parents, and maintain a high-quality germplasm bank for M. unguiculatus.
...

Muhamamd Rizwan1*, Muhammad Arshad2, Muhammad Kashif3, Aneela Zameer Durrani4, Asghar Abbas5, Tanveer Ahmad6, Muhammad Nadeem7 , Kinza Khan8

...ne system that provides protection against viral infection. When bacteria recognize viral DNA inside it, bacteria incorporate small fragment of viral DNA into its genome at specific site termed as CRISPR locus. Insertion of viral DNA at CRISPR locus allows to remember, diagnose and clear the viral infection by the mechanism of sequence specific Adaptive Immunity. CRISPR Cas system is sustainable to combate with the mutation developed in viral genome that help ...

Allah Bakhsh1, Attiq Akhtar1*, Fiaz Hussain1 and Shabbir Ahmed2

...t-align: justify;">Bunch rot is a fungal disease and causes significant yield loses to grapes yield every year. Fruit Zone Leaf Removal (FZLR) is a canopy management technique that provides a cost-effective and high-quality grape yield. In order to boost grape quality and minimize disease incidence in the King’s Ruby variety, FZLR was used for two seasons in a row. Total leaf removal was used before bloom, during full bloom, and four weeks after bloom, a...

Habiba ur Rehman, Muhammad Usman Ghazanfar and Waqas Raza

...des against the charcoal rot of sunflower caused by Macrophomin phaseolina under greenhouse conditions. The treatments viz. Success, Nativo and Control with the concentrations of 2, 4 and 6mM were used with three replications under completely randomized design in greenhouse conditions. Nativo had given the most significant results in all studied traits as compared to all other treatments at the concentration of 6mM. The results showed that Nativo exhibited the...
Sadaf Aslam1*, Abdul Majid Khan1 and Muhammad Akhtar2
... to Pliocene rocks of Tatrot/Hasnot area of Pakistan. The molar resemblance with equids indicates their grazing feeding habits. This species migrated to Potwar land when grasslands became established. It has typical suine characters with hypsodont dentition and complex infolding of enamel surfaces. The described material consists of isolated molars. This discovery will provide a new insight to understand the diversity and geographic distribution of Siwalik Sui...
Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2, Muhammad Azmat Ullah Khan3, Muhammad Naveed1 and Abdul Rauf Shakoori4
... of SNPs in the Gag-Pol proteins by molecular modeling approaches. Mutational analysis in our study revealed S61A, S61M, S61Y, S61G, S61Q and M90L as the most hypervirulent mutations. This induces a selection pressure and a rate of increased virulency on Gag-Pol cleavage sites. These results significantly highlight the fact that the identified SNPs possibly contribute towards a positive selection pressure contributing to the identification of novel mutations l...

Rabia Iqbal and Muhammad Naeem *

...g levels of plant based protein diets (15%, 20%, and 25% crude protein) prepared from cheaper plant proteins, to keep minimum use of fish meal, on growth performance, survival and production of hybrid fry (Labeo rohita♀ x Catla catla ♂). The hybrid fry of mean 1.05±0.08 g body weight and 4.36±0.40 cm mean length were acclimatized and transferred to 8 X 6 X 3 ft. hapas. Fr...

Muhammad Ibrahim Kubar1, Fahad Nazir Khoso1*, Imran Khatri1, Niaz Hussain Khuhro2 and Arfan Ahmed Gilal1

...cer), T3= Cue-lure, T4= Protein hydrolysate, T5 = Trybliographa daci. Furthermore, combinations of these treatments were designed to find out the most effective combination. The results revealed that among the solo treatments, the plots sprayed with chemical (T2 = Tracer) had least number of infested fruits (29.75±2.69) while in combine treatments, the most effective treatment was T16 (Tracer + Protein hydrolysate + c...

Barış Bayraklı

...eeds densely, the crude protein (%13.52) rate was found to be the lowest compared to other months. In September, the crude fat rate (1.07%) was found to be the lowest, and in August, moisture was the highest. Among the essential amino acids (EAA) determined during the study, lysine reached the highest value each month followed by leucine and isoleucine, respectively. On the other hand, among the non-essential amino acids (NEAA), aspartic acid and glutamic acid...
Shuang Yang1,2, Huiting Zhao3, Xuewen Zhang2, Kai Xu1, Lina Guo1, Yali Du1 and Yusuo Jiang1,*
...ding 37 odorant-binding proteins, 35 chemosensory proteins, 33 olfactory receptors, 14 ionotropic receptors and 2 sensory neuron membrane proteins. The expression patterns of these genes were determined using the estimated fragments per kilobase of transcript per million fragments mapped. Among the 114 DEGs, 66 were expressed exclusively in the female antennae, whereas the remaining were e...

Md. Mukthar Mia1 and Mahamudul Hasan2

...t pertains to the genus Protoparvoviorus with a high genomic replacement unlike other DNA virus; the organism is primarily segmented into three forms acknowledged as (CPV-2a, CPV-2b, and CPV-2c), which resembles to be liable for the infection’s statewide spread. For transmission, the fecal-oral pathway is deemed the most obvious route than other permissible routes. Moreover, spreading through contact interactions, environmental pollutants, and the host r...

Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1 

...s of total seed storage protein resulted in a total of 18 polymorphic bands. Total genetic diversity on the basis of total seed storage protein analysis was 17.5%. In Band, the 14 total genetic diversity was (0.60%) followed by Band 16 (0.58%) and Band 17 (0.55%). Similarly, Band 3 showed diversity, while Band 8, 4 and 5 indicated 0.45, 0.38 and 0.35%, respectively. A cluster dendrogram tree was constructed which was divided...

Gulnaz Parveen1*, Naila Mukhtar2, Shumaila Irum3 and Nain Bukhari4

...les including potato, carrot, okra, eggplant, turnip, cucumber, round gourd, cauliflower, and chilli. These losses result in about a 30% reduction in the yield of these vegetables. By reducing the post-harvest losses, it could be possible to overcome the need of food as the world population is in dare need of research relating to crop sustainability.

...

Abdul Hameed1*, Ihtsham Ul Haq Padda1 and Abdul Salam2

...holds were deficient in protein, with 58% in urban and 44% in rural areas. Micronutrient deficiency analysis shows that 22% of the survey households in Punjab, 30% in Sindh, 11% in KP, and 37% in Balochistan are suffering from iron deficiency. Besides, 57% of households in Balochistan, 56% in Sindh, 35% in Punjab, and 26% in KP experience deficiency of zinc. The vulnerability analysis of the survey data found 12% of the households at the national level to be e...

Saddar Faheem1,2, Hameeda Kalhoro1, Naeem Tariq Narejo1*, Muhammad Hanif Chandio3, Memon Samina4, Shahnaz Rashid5 and Ghulam Abbas5*

...serum constituents like protein, cholesterol and glucose were also assessed and it was reported that serum glucose was found more in male than female fish, while in male protein and cholesterol were high in female in summer. In winter season, female fish showed low level of cholesterol, though protein and glucose remained high. Based on the serum biochemical constituent data, it was conclu...
Sana Ilyas1, Muhammad Hidayat Rasool1,*, Muhammad Javed Arshed2, Muhammad Usman Qamar1 and Bilal Aslam1
...s was determined by the broth dilution method. Phenotypically confirmed ESBL producing strains were further subjected to molecular characterization for the presence of ESBL and carbapenemase-producing genes using PCR. Of 392 samples, 219 ESBL positive E. coli were recovered and among these 156/213 (73.2%), 42/63 (66.6%) and 21/27 (77.7%) were from poultry, environmental water, and urine samples, respectively. The PCR results revealed that71.2% of bla...
Rahma Mohamed, Sara Nader, Dalia Hamza and Maha A. Sabry*
...differences. Molecular serotyping of 6 identified Cryptococcus spp. evidenced C. gattii in the nasal passages of 4 healthy donkeys (7.7%); while the other 2 C. neoformans serotype A (3.8%) isolates identified in healthy and diseased donkeys. Four C. gattii and C. neoformans isolates demonstrated higher laccase (LAC1) genes among the identified virulence factors. While capsular associ...

Sami Ul Haq1, Abid Hussain1*, Umair Riaz2, Muhammad Baqir Hussain1, Adnan Fareed1, Nabeel Ahmad Ikram3 and Fahim Nawaz3

...ur for oil contents and protein synthesis. A field trial was conducted to evaluate the effects of S application, alone or in combination with Compost containing sulfur-oxidizing bacteria (SOB), on the yield and growth of sunflower. Sulfur was applied as individual treatments (25, 50, 75 kg ha-1) and in combination with Compost (750 kg ha-1). The results showed a considerable increase in plant height (67.60%), chlorophyll b content (92.10%), stomatal conductanc...

Ahmed A. Kheder

...amplify ~497bp for coat protein gene in RNA 2, the amplified product was confirmed with direct sequences. Phylogenetic analysis results indicated that SLRSV-Eg isolate under study (acc. no. MT648777.1), showed 65.9 – 99.5% nucleotide similarity with available homologous sequences from other crops. Reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of the most promising molecular diagnostic techniques was applied. Th...

Iftikhar Jan* and Sahib Alam

...ced color change and sclerotia production) and immunological methods i.e., enzyme linked immunosorbent assay (ELISA). All the four cultural methods successfully differentiated aflatoxigenic and nonaflatoxigenic isolates, however ammonium hydroxide vapor induced test was found to be the most efficient (80.29%) for segregation of the isolates. Among all isolates, thirty were screened for their total aflatoxin production in corn meal agar medium by using ELISA te...

Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*

...om 6.01 to 7.90%, crude protein (CP) from 8.71 to 12.40% and crude fat (CFat) from 1.02 to 3.26%. The neutral detergent fibre (NDF) from 43.2 to 44.7%. The IVDMD varied from 48.4 to 58.9% and IVGP varied from 110 to 172 mL/g organic matter. Among the five wheat cultivars Bakhtawar-92 had maximum DM yield (2747 kg/ha), proportion of leaves (45%), CP (12.4%), IVDMD (58.9%) and IVGP (172 mL/g organic matter), and minimum portion of stem (55%) and NDF (43.2%), and...
Ying Yang 1,2,3, Tietao Zhang 1,2,3, Min Rong 1,2,3, JiaPing Xu 1,2,3 and Xiumei Xing 1,2,3*
...lated with 32% of crude protein and increasing bean oil contents were fed to eight groups of mink. It were fed containing approximately 3, 6, 9, 12, 15, 18, 21 or 24% bean oil in the complete dry power respectively. Mink were voluntary feed intake was found to be dependent upon dietary energy content. Body weights were regulated by energy intake tended to increase at first and then decreased as the energy level was increased. The growth rate and voluntary feed...

Ahmed F. Afify1, Mohamed A. Shalaby2, Ahmed A. El-Sanousi2 and Amal S. Gaber1

...esent study to design a protocol for isolation
trials and characterization of equine arteritis virus from field specimens. A total of
548 samples were collected from governmental and private studs of Arabian horses
and also foreign horse breeds, including 540 serum samples, among these, 4 EDTAblood
and 4 semen samples. Serologically, indirect ELISA was performed on 540
serum samples. 130 samples were ...

Walaa ,S. Shabanaa;Bakr, A. Abdallaa; Eman, M. ELShalamia; I.M. Redab; M. A. Shalabyb

...ters continued with the protective level till the 32 to 36th week post vaccination,
In single vaccination either FMD or RFV alone while till to 40th WPV in combined FMD/RVF
vaccine.In the final we can conclude that the use of Montanide ISA 50 as an oil adjuvant in prepared
vaccines improve the immune response against FMD and RVF, giving high titer of antibodies
against both diseases, and long duration of immunity...
Ala’audin Hakami,1AusamaA Yousif,2* Mohamed Zaki,3 Mahmoud Ismail,4,5 Ahmed Al-Ali,5 Abdu-Rahman Al-Ankari5 
... A replicase-associated protein (Rep) gene-specific PCR was used to
amplify a 603 bp region of the viral genome. PBFDV was detected in
31.6% of clinical cases (3.5% of samples). Two positive samples were
collected during 2008, three during 2009, and one during 2010. Positive
samples were from clinical cases. Negative samples tested positive for bird
rDNA. In positive cases, feathers not blood, consist...

D. N. Abd-elshafy1, 2 and M. M. Bahgat2, 3

...hibiting HepG2 cellular proteases on replication rate of the virus. Plaque infectivity count assay was carried out using safe concentrations of the cocktail protease inhibitor MixG and its five components: ABESF, aprotinin, E-64, leupeptin and EDTA. Also quantification of the activities of both intracellular and secreted HepG2 proteases was carried out u...
Nader M. Sobhy,1 Sunil K. Mor,2 Mohammed E.M. Mohammed,1
Iman M. Bastawecy,3 Hiam M. Fakhry,4 and Sagar M. Goyal2
... also copying specific serotypes O, A and SAT2 nucleotide sequence. In this work FMDV serotype O, A and SAT2 were isolated from cattle clinical samples (foot lesions). RNA extracted from clinical samples was subjected to reverse transcriptase polymerase chain reaction( Rt. PCR) nucleotide of FMDV ID and 3D genes were determined using standard automated sequencing technique. Phylogenetic analysis of FMD / SAT-2 /3D/Egypt/Shar...

Hiam M. Fakhry and Assem A.A.

...isease virus, to induce protection against foot and mouth disease. This study was conducted in three sheep groups ; the first group was vaccinated intramuscularly (I/M) with trivalent foot and mouth disease zeolite (1 μg/dose) vaccine, The second group was vaccinated with foot and mouth disease oil vaccine and Third group was vaccinated with foot and mouth disease ( oil + zeolite ) vaccine. The cellular immune responses were monitored in different tested gr...
RehamM. El-Bakrey1, Shimaa M.G. Mansour2, Mohammed A. El Sisi1 AndAmal A.M. Eid1
...luated by percentage of protection from mortality, morbidity and reduction in virus shedding from respiratory and/orintestinal tracts. Despite the H5 antibody responses in vaccinated chickens with program I (rFP-AI-H5" vaccine then Re-5) being significantly lower prior to challenge, it provided good protection (73.3%) against the lethal A/chicken/Egypt/SHAH-1403/2011 (H5N1) AIV challenge, with no evidence of virus shedd...

Yasser F. Elnaker 1, Mohamed El-Tholoth 2, Sahar Saber 3, Amira A- Elsaid4, Mohamed A. Saad 3, Emad E. Younis 5

...nal antibodies could be protected from infection. In conclusion, this study revealed that the maternal immunity may disappear before six months and make the calves vulnerable for infection. So further study should be directed toward identifying the optimal age at which LSD vaccination should be started and also on the role of passively transferred cell mediated immunity in protection of calves against infection with LSDV.

Walaa Abd El-Fatah S. Metwally1, Ismail M. Reda2, Ahmed A. El-Sanousi2, Mohamed Abd El-Khalek Ali2

...s post vaccination with protective antibody titer and protection against challenge followed by the ratio of 30% Chicken strain to 70 %Duck strains of AI containing 256 HA unit/dose which gave high antibody titer after 4 weeks post vaccination and remained high till 26 weeks post vaccination followed by the ratio of 30% Chicken strain to70 %Duck strain of AI containing 100 HA unit/dose which gave high antibody titer 5 weeks p...

Ebtisam, A. Abouel yazeed1; Yanni, M.I.1 and Hanan A. Fahmy2

...ed to investigate bovine rotavirus antigen in fecal samples of forty diarrheic new borne calves of cattle (32) and buffaloes (8) below three months in some farms in Egypt. The detection was done by ELISA and indirect fluorescent antibody technique (FAT) as well as molecular method as real-time quantitative reverse transcriptase PCR (RT-qPCR) from samples collected during neonatal diarrhea. Six out of forty tested samples were found positive for

Fawzy Rania1, AboElkhair M.1, Bazid A.M.1, Sultan H.2, Hussien A.H.3

...h called quasispecies. Serotypic and or genotypic classification of IBV is mainly based on the S1 subunit of Spike (S) gene. In the present study, thirty tracheal samples of broiler flocks suspected to be infected with IBV were collected from different Egyptian governorates during 2012. Isolation and genetic characterizations were carried out for only ten samples which were positive for IBVs. Multiple nucleotide and amino acids alignments revealed prominent nu...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...e for FMD non structure proteins( NSP) antibodies which indicated the natural infection. ELISA kit used for FMDV antigen detection for the epithelial suspension from 42 field samples collected from various geographic locations 10 governorates are ( El-Sharkia,Giza, Port Said, Assuit, Suize, Kafre El-Shake, Qina, Al-Gahrbia, Domiatte and Alexandria) Serotyping and molecular characterization by polymerase chain reaction PCR fo...

Nashwa M. Helmy1 and Ahmed S. A.2

...imals. There are seven serotypes of FMD virus (FMDV), namely O, A, C, SAT 1, SAT
2, SAT 3 and Asia 1. Tests for antibodies of FMDV nonstructural proteins (NSPs) are
useful in providing evidence of previous or current viral replication in the host,
irrespective of vaccination status. NSPs, unlike structural proteins are highly conserved
and th...

Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc

...t coated with AIV nucleoprotein and hemagglutination inhibition (HI) test against H5 and H9 antigens. The overall results using both ELISA and HI tests revealed that the prevalence of AIV antibodies was 12.6% (18/143). The seropositive samples represented 5/143 and 15/108 for ELISA and HI, respectively. The detection of both H5 and H9 antibodies in (4) samples indicated that co-infection may occur, while (10) samples were only containing H9 antibodies and (1) ...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

...2 was isolated and Glycoprotein D (HSV-2gD) subunit was amplified using specific PCR primers.PCR product was molecularly cloned in t E.coli cells using PCR2.1/TOPO/ TA cloning vector. HSV-2gD fragment was liberated from 1 μg recombinant plasmid by using the restriction endonuclease EcoRI. HSV-2gD was successfully sub-cloned into binary plant expression vector PBI-121. HSV-2gD subunit-containing binary vector PBI 121 were transformed into Agrobacterium tumif...

Allam A. Megahed1; Hoda M.A. Waziri2; Khaled A. El-Dougdoug3; Badawi A. Othman3; Sirag M. Lashin1; Mohamed D. Hassanin1 and Mahmoud A. Ibrahim4

...s preparation of Beet necrotic yellow vein virus (BNYVV) were 2.196 mg/ml, and the min, max nm, Amax./Amin., A260/A280 and A280/A260 were 248, 264, 1.606, 1.237, and 0.785, respectively. The polyclonal antibodies raised against BtMV and BNYVV by 5 injection doses each, using different injection types obtained from rabbit bleedings 10 days after the last injection had the titer of 1:2048 and 1:1024, respectively by indirect-enzyem linked immunosorbent assay (I-...

K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2

...icolor L. where gave chlorotic local lesions. Eleven potato cultivars
(Solanum tuberosum) mechanically inoculated with PVY isolate under greenhouse condition
were divided to three categories, resistant (Diamond, Execusa, Hermes and Valor), tolerant
(Sisi, Lady Balfor, Nikola, Ditta and Lady Rosetta), susceptible (Anabel and Spunta) based on
different external symptoms, the severity infection and virus concentrati...

Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2

...rom tomato exhibiting necrotic rings and sinuous lines symptoms. The virus was checked in the suspected samples by ELISA using the specific antiserum. Anatomical and ultrastructure changes in leaf tissues of both Tomato and Grapevine artificially infected with Tomato ringspot virus were studied by light and electron microscopy. By light microscopy viral infection resulted in the presence of amorphous inclusion bodies in the cytoplasm of infected leaves.Phloem ...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
...n-significant. The coat protein gene of
SLCV was PCR amplified from infected common bean plants. SLCV-CP was cloned in
pJET cloning vector and directly sequenced. The sequence alignment and phylogenetic
analysis showed a relatively high diversity among the three different isolates that the
identity ranged from 89 to 94%.
...

A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2

...s
of both , protoxylem and metaxylem were reduced while their widths were increased.
Ultrathin sections of symptomatic leaf tissue showed several cytological changes
characteristic of Potyviruses. The thlakoidal structure of the chloroplastes becomes
disorganized, abnormally distributed and dilated . The number of plastoglobulis
increased and clumped together, their starch content was decreased. Clump...

Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4

...n the nuclear inclusion protein b (NIb) coding region of the virus genome. The cytopathological effects of ZYMV on the infected cells were completely chloroplasts destruction, and deformation of vascular bundles. The effect of late ZYMV infection decreased fresh weight and yield of squash plants.

...

Aly M. Abdel-Salam

... which turn later to chlorotic and necrotic strips. Polymerase chain reaction
(PCR) utilizing degenerate primers for badnaviruses for the reverse trancriptase,
RT/RNase genome regions of ORF III detected the virus in infected sugarcane leaves
and in its vector Saccharicoccus sacchari and in another unidentified
Pseudococcidae- mealybug. Amplicons for the RT/RNaseH motifs of the...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...ific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis.

...

AdlyAbd-Alla1,2, MahaNada3, Francois Cousserans1, and Max Bergoin1

...apsids showed two major proteins of 31 and 32 kDa
and a minor 78 kDa protein. Infection of third instar nymphs by feeding on contaminated food
induced similar disease symptoms and bioassay experiment confirmed virus concentration
response mortality. Injection of a purified virus suspension to third instar larvae of Galleria
melonella and Spodopteralittoralis failed to induce an...

Aly M. Abdel-Salam1 and Samah A. Mokbel2

...v>A severe isolate of Necrotic ringspot virus (NRSV) was isolated from apple orchards
in the vicinity of Nubaria city, Beheira governorate, Egypt. Infected-apple trees
showed chlorotic, necrotic ringspots, and shoot holes on leaves. Severely infectedtrees
withered, became useless, and were removed causing severe economic losses.
Reverse trans...

Arshad Abdulkhalq Yaseen1,2* and Mária Takácsné Hájos1

...ealth and environmental protection. This research was aimed to assess the possible role of moringa (Moringa oleifera) leaf extract (MLE) in improving some quality parameters of lettuce (Lactuca sativa L.) grown under plastic tunnel conditions. In this regard, three different lettuce varieties (May King, Kobak and Great Lakes) were grown in spring 2019 and 2020. The concentration of 6% MLE was sprayed as a biostimulant every two weeks from transplanting with th...

Magdy, Mariam1 ; Abou ElHassan D.G. 2 ; and Salem, S.A.H 3

...v>
onwards. FMDV serotype (O) was the most prevalent until serotype (A) appeared in 2006 then
during April and May 2012, six outbreaks of FMD serotype (SAT 2) were reported in Egyptian
governorates. This study based on evaluation of vaccinated animals by detection of antibodies
against serotypes of FMDV (A),(O) a...
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...es on The envelope glycoprotein D of EHV-1 (EHV-1gD) due to its essential role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins .A wave of Abortions has been recorded in El Zahraa stud for Arabian Horses ,collected samples were either aborted fetal tissues either Lung and livers as well a...

Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1

...raa/2014 using the glycoprotein D of EVH-1 due to its role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins based on sequence analysis and multiple alignment revealed single nucleotide substitution at the base pair number 121 from the start codon which give lead to single Amino Acid Subst...

Amir M. Walaa1 ; Ausama Yousif1; Walid H. Kilany2; Magdy El-Sayed1; Ahmed A. El-Sanousi1

...estigate its ability to protect experimental broiler chickens against challenge with wild ND and IB viruses. Two hundred and eighty commercial one-day-old broiler saso chicks were divided into 8 groups (35 birds each). Groups 2, 3, 4&5 were vaccinated at one-day-old with live hitchner + IB Primer. Then all groups at 7 days old were boosted with inactivated combined NDV+IBV vaccines with different adjuvants except for group 1 & 2. Group 1 was kept as un...

Megahed, A.A.1; Kh. A.El-Dougdoug2 and B.A. Othman2

...otyvirus (BtMV), Beet necrotic yellow vein benyvirus (BNYVV), Beet curly top geminivirus (BCTV) and Beet yellows closterovirus (BYV) symptomatology and serologically by double antibody sandwaich Enzyme linked immunosorbent assay (DAS-ELISA). The survey of sugar beet viruses achieved in 15 field locations belonging to 5 different Governorates, which performed by examination 915 plant samples from 149 fields in two seasons (2009/2010 and 2010/2011) symptomatolog...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...e sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the isolates from Sudan, Iran and the other isolate from Saudi Arabia. The analysis showed that the highest nucleotide identities were 100% with other isolates that isolated from Sa...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...>An isolate of Prunus necrotic ringspot virus (PNRSV) was obtained from naturally infected rose plants collected from different rose farms in Taif, KSA exhibiting a wide range of foliar disease symptoms including necrotic spots, wavy lines, oak leaf pattern, leaf deformation, reduction in number and diameter of flowers , color breaking and necrotic spots on flower petals .The virus was bio...

Badr, A. B. 1, Abou-zeid, A. A2. and Al-Naggar, A. M1.

...es, length and width of protoxylem and metaxylem vessels were reduced. However, lower epidermal layer was increased. Stomatal characters i.e. number of stomata and length of stoma pore were increased, while, width of stoma pore, length and width of guard cells were reduced. Anatomical characters of tubers i.e. thickness cork layers was slightly increased, however, its number was sharp reduced compared with healthy tubers. Biochemical changes of potato tubers i...

Hanan M. El-Zahed, Hanaa A. Mostafa, Nermeen M. El Sayed and Lamiaa M. Omar

...re high, homogenous and protective (titer range from 27.8 to 211) Also, these titers lay within the range of that titer of the vaccinated chicken with AI vaccine alone (AI control group) as it ranged between 28.3 and 2 10. Moreover, protective percentage of chickens in CAV subgroups post challenge with virulent H5N1 strain at 4th WPV with AI vaccine were satisfactory and equal to or above that of AI control group (80-85%). I...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

...ation of fragments of N-protein. All batches are also subjected to sterility tests for detection of bovine viral diarrhea virus as possible extraneous virus contaminant using RT-PCR and detection of mycoplasma as possible bacterial contaminant using PCR technique. All of the four batches were positive when tested using specific primers and they were free from BVDV or mycoplasma contamination. Results in this study showed that molecular techniques could be used...

Amany Adel1, Abdelsatar Arafa1, Hussein A. Hussein2 and Ahmed El-Sanousi 2

...ons 80 to 84 in the NS1 protein along all Egyptian isolates under study. Ala149, which is a pathogeneicity marker for interferon antagonism was found in the studied indicating capability of these viruses to transmit between different avian species. PL motif ESEV was found in 6 isolates from chicken and ducks circulating in such population whereas 17 viruses have ESKV similar to those reported in human in 2006. Based on NS1 sequence analysis of the H5N1 Egyptia...

Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3

...rpling, chlorosis and necrotic spot on the leaves. Disease symptoms of infected fruits produced from inoculated healthy tomato seedling showing discoloration, faint concentric rings, necrotic and chlorotic spot on mature tomato fruits. The virus was biologically purified from a single local lesion formed on Chenopodium amaranticolor Caste & Reyn. The isolated virus was identified on th...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...h and dry weight. Algal proteins were identified by the protein profile pattern using SDS-PAGE method. The contents of alkaloids, phenols and terpenoids in both algal filtrates and biomass were determined.

...

Lala Rukh1, Muhammad Nadeem1, Tusneem Kausar1, Mian Anjum Murtaza1, Muhammad Luqman2*, Muhammad Bilal Shahid1 and Amal Shaukat3

...er (by product) and soy protein isolate in date paste. Date bars were formulated after ingredients optimization and were analyzed for physico-chemical, in-vitro starch and protein digestibility, antioxidants and microbial count. Results showed that date bars are rich source of protein, fiber, carbohydrates and fat with good digestibility properties. Date pit powder and soy p

Shahida Sabir1, Anwar Ali Shad1, Tariq Masood1*, Zafar Ali Shah1, Nasiruddin2, Yaseen Ahmad1 and Syed Sartaj Alam3 

...nd % bio-efficacy of Pleurotus eryngii. It was found that maximum 20 and 34 days were taken by 50% and 100% colonization, respectively on 25% supplemented B. lycium substrate compared to control treatment (17 days). The yield and bio-efficacy of mushroom was observed around 596.7 g per bag and 99% respectively at 25% supplemented B. lycium substrate. The P. eryngii mass was extracted with different solvents and showed promising results for the number of phytoc...

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...0 of tested cattle give protective antibody titer, while 23/200 gave non protective titer and 87/200 have no antibody againest LSDV. The results of clinco-pathological revealed highly significant increase in ALT, AST, ALP, GGT, urea and uric acid, while the level of total protein, albumin and calcium showed significant decrease and non-significant reaction in creatinine and non-organic pho...

Lamya A. F. Ateya1 , Said. A .Ahmed2, Khamees K.S. Ashraf3, Heba A. Abdel-Hady4

...culation with vaccines.Serotyping of FMD antibodies were adopted on examined sera for imported and local vaccines using solid phase competitive ELISA 2,4,8,and 10 weeks post vaccination(wpv). Results were 45(24.2%), 65(34.9%)2 WPVand 55(29.5%) ,68(36.5%) 4WPV- 58(31.2%),71 (38.2%) 8WPV and 58(31.2%), 69(37.1%) 10 WPV for serotype A.For serotype (O):55(29.5%) ,58(31.2%)2WPVand 60(32.3%), 62...

Ola Youssef 1; EL-Deeb A.H.2 Nassif S.A.1 and Ahmed A. El-Sanousi 2.

...ational quality control protocol for evaluation of recombinant H5
vaccines had been established yet so, these vaccines are evaluated by applying the conventional QC
tests such as identity, safety, purity, potency and efficacy that were not satisfactory in vaccine
evaluation.
Objective: The present study was conducted to standardize a protocol for quality control and

Aly M. Abdel-Salam

...as used to amplify coat protein genes for the two viruses using specific primers. DAS-ELISA and immuno-blotting were used for evaluating the induced antisera. Results: Antisera for CYSDV and CVYV were produced efficiently and used for virus diagnosis through DAS-ELISA, DBIA, and TBIA. RT-PCR confirmed the nature of the two viruses. However mixed infection was noticed for CVYV and CVYV upon using duplex RT-PCR. Conclusion: Mixed infection with WTV is common and...

Ehab M. El-Nahas1, Hemat S. El-Sayed2, Sawsan S. El-Basuni3, Gabr F. El-Bagoury1

...at of the Massachusetts prototypes. Comparisons nucleotide and amino acid sequence of partial S1 gene showed that the recent isolate had 98.2% and 95.2% nucleotide similarities and 96.8% and 91.4% amino acid similarities with the commonly used IBV vaccine Massachusetts strains H120 and M41 respectively. Egypt/Qal/014p had a unique amino acid substitution at residues 39 (Serine), 40 (Tyrosine), 41 (Lysine), 64 (Glutamate) and 69 (Valine) of the S1 p

Salama M. El-Saghir1, 2

... virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence of PVS in Egypt for the second time; yielding 187
bp of the virus coat p

Salama M. El-Saghir1, 2

...iv>Background: Prunus necrotic ringspot virus (PNRSV), family Bromoviridae, genus Ilarvirus is known
to infect stone fruit trees and causes extensive economic losses in Egypt. Distinctive symptoms with
PNRSV are necrotic ring spots on leaves, bud failure and poor quantity and quality of fruits. Upon
continuous observation of peach trees previously known to be infected with PNRSV, additiona...

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

...inhibition (HI) test. F protein encoding gene of NDV was amplified using Reverse Transcription-Polymerase Chain Reaction (RT-PCR) then subjected for nucleotide and amino acid sequence detection. Results: NDV Giza 2014 isolate and NDV Qualubiya 2014 were characterized as velogenic and lentogenic strains, respectively using Mean Death Time (MDT), Intracerebral Pathogenicity Index (ICPI) and studying amino acid motif of the F prot<...
Muhammad G. Khodary1, Ayman H. El-Deeb2, Mohamed M. Emara2, Othman E. Othman1, Hussein A. Hussein2
...iv>samples belonged to serotype O of FMDV. Sequencing and phylogenetic analysis of 6 representative
samples clustered the detected viruses with O topotype East Africa-3 (EA-3) viruses.
Conclusion: The newly identified 2016 viruses clustered in distinct clade in the phylogenetic tree
other than the serotype O viruses isolated in previous outbreaks in Egypt, indicating the likelihood of

Dina A. Abdulrahman1, Ayman H. EL-Deeb2, Momtaz A. Shaheen1 & Hussein A. Hussein2

... all seven
serotypes of FMDV. The positive-resulted samples were then tested using conventional PCR and pan
FMD primers. The same samples were tested again using serotype-specific primers to amplify the VP1
coding region and the products were sequenced for phylogenetic analysis.
Results: FMDV RNA was detected in eight out of the 12 samples tested using real time RT-PCR.
...
Maha M. Khedr1, Reem A. Suliman1, Marwa F. Mohamed1, Mounir D. El Safty1, Hussein A.
Hussein2
...% and 0, 14 and 86 % of protection in groups 1,2,3 and groups 4, 5, and 6; respectively. RT-PCR and
virus isolation revealed that all chicken groups vaccinated at 1 and 5 days of age demonstrated 100%
shedding at 3, 5, 7 and 10 days post challenge. However, groups 3 and 6 which were vaccinated at 10
days of age revealed difference in shedding pattern where group 3 (vaccinated with local prepared
vaccine) showed 1...

Shimaa M. Mansour, Reham M. ElBakrey, Ahmed Orabi, Haytham Ali, Amal A. Eid

...nce within ARV- sigma C protein revealed 7/18 positive samples. All positive samples (7/18)
were successfully isolated on specific pathogen free embryonated chicken eggs (SPF-ECE). Additional
RT-PCR testing and re-isolation of ARV from ECEs of a breeder flock of a history of uneven growth
and/or arthritis revealed ARV infection in six (6/60) examined ECEs.
Conclusion: These results indicated the incrimination of ...
Hussein A. Hussein, Maha Khedr, Reem A. Suliman, Marwa F. Mohamed, Mounir D. El
Safty
...ines is urgent to reach protective antibody titers and reduce virus shedding.
Methods: Groups of one-day old commercial broiler chicks were divided in to 8 groups 1, 2 and 3 were
vaccinated with a prepared vaccine contain 500HAU of H5N1 reassortant antigen; while group 4, 5 and 6
were vaccinated with an imported reassortant vaccine with 500HAU antigen content of H5N1 at 1, 5 and 10
days of age; respectively. A gr...

Nermeen A. Marden1, Lamiaa M. Gaafar1, Hussein A. Hussein2

...>
to estimate the protection percent of each vaccine against both classical and variant HPAI viruses.
While, the invitro method was done by the direct detection of the viral content and viral identity using
the rRT-PCR technique from final product of these inactivated vaccines.
Results: The data of this study showed that sufficient HA antigen content and similar HA sequences
with the field HPAI challenge vi...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
...is second most abundant protein of cow’s milk. β-caseingene is highly polymorphic. A1 and A2 are the frequently occurred variants. A1 is recognized as potential cause of several human diseases. It is important to evaluate the A1/A2 β-casein status in milk. Current study was conducted to molecular characterize the exonic regions of β-casein gene and to explore the status of A1/A2 β-casein type in Cholistani cattle breed of Pakistan. Bl...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
...vely. Two major surface protein genes (MSP1a and MSP4) sequence were compared with cattle isolates from different origins. Phylogenetic analysis of local isolates showed a close homology with the isolates from Australia, Brazil, Turkey and Japan. It was found that aged, exotic and crossbreed cattle were more susceptible to A. marginale infection in summer season compared to the younger and indigenous cattle breeds, respectively (...

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

...goat pox. In Egypt, the protection from lumpy skin disease (LSD)
among cattle population was carried out using sheep poxvirus vaccine. Last year (2016-2017) revealed
many cases of LSD in sheep pox vaccinated cattle in Egypt.
Objective: In this study LSDV was isolated from sheep pox vaccinated cattle showing LSD signs to
confirm LSD viral infection even in sheep pox vaccinated cattle.
Methods: 130 Nodu...
Nagwa K. Meselhy1, Mohamed A. Abo El-khair1, Basem M. Ahmed2, Sherif A. El-Soally3,
Abdelhamid M. Fares1, Mohamed A. Nayel1 and Hussein A. Hussein2
...ent of
glycoprotein B gene (ORF 33), followed by sequencing and phylogenetic analysis.
Results: The study revealed that 19% of our samples were positive to EHV-1 and phylogenetic
analysis showed that the Egyptian EHV-1 isolates were more than 99% similarity to European
abortogenic isolates (EHV-1 strains: Army 183 and Suffolk/48/2013). Indeed, the analysis reports that
these viruses are circulating in...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...
using coat protein gene specific primers with an expected amplicon of 520 bp. Electron Microscopy
examination revealed that, the viral particles were slightly flexuous rod shape with about 680 x 13 nm
in size. Ultrastructure analysis showed different degrees of chloroplast degradation in PVM-infected
potato leaf tissues.
Conclusion: Occurrence of PVM was detected and confirmed in commercial potato se...

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

...formed for the AMV coat protein (CP) gene. An amplicon of the
predicted size (∼666 bp) derived from O. basilicum isolate was purified and cloned in E.Coli
into pCR®4-TOPO vector before proceeding to DNA sequencing and the alignment of
sequences.
Results: Electron microscope examination of negatively stained preparations from
symptomatic basil leaves revealed viral particles have a bacilliform ...
Riham H. Bassam, Hussein A. Hussein, Mohamed M. Amer, Basem M. Ahmed and Ahmed A. El-Sanousi
... with VAR2
serotype present in Egypt.
Conclusion: VAR2-IBV is circulating among chickens demonstrating mortalities which affect poultry
industry in Lebanon.
...
Hanan Sayed1, Mohamed S. Madkour1, Hussein A. Hussein2, Mounir Mohamed Elsaft 3,
Marwa F. El saied3, Ahmed A El-Sanousi2
...round: Prolonged immune protection for H9N2 and Newcastle in layer chicken rearing is an
important issue.
Objective: To evaluate the protection duration for H9N2 and NDV post vaccination by inactivated
trivalent (H9N2, LaSota, M41 and Var2 IB) vaccine based mainly on repetition of challenge.
Methods: We prepared formalin inactivated combined vaccine for Avian Influenza (H9N2N),...

Hanan Sayed 1, Mohamed S. Madkour 1, Hussein A. Hussein 2, Ahmed A El-Sanousi 2

...round: Prolonged immune protection for classic and variant IBV in layer chicken rearing is an
important issue.
Objective: Evaluation of the protection duration for IBV (M41 and Var2) post vaccination by
inactivated combined (H9N2, LaSota, M41 and Var2 IB) vaccine based on laboratory tests and
repetition of challenge test.
Methods: We prepared formalin inactivated co...

Ahmed M. Soliman

...y isolated by single chlorotic local lesion on Chenopodium amaranticolor and propagated in healthy Nicotiana benthamiana. Enzyme linked immunosorbent assay (ELISA) and reverse transcription-polymerase chain reaction (RT-PCR) with specific primers designed for the coat protein gene of CMV were used to detect the virus. RT-PCR products (657 bp) of coat protein gene of CMV were cloned and the...

Mohsen M. Elsharkawy1, Sara E. Hanbal2, Samir A. Sidaros1, Mohamed M. Elsawy2, Ali H. Hamed2

Youssef A. Elgharbawy1, Mervat M. Ali1, Ayman H. El-Deeb2, Mohamed A. Shalaby2

...etermination of minimal protective dose (MPD) of prepared inactivated LSDV. The MPD was 1.5 ml of the inactivated virus and the vaccine was prepared by adding equal volume of the adjuvants (Montanide ISA 50 and Montanide ISA 206 ) to the total quantity 3ml of the vaccine. The prepared vaccine tested for determination of immunological response against the vaccine with ISA 50 and ISA 206 adjuvants and the results was compared. The results of cellular and humoral...
Hadeer M. Mossa, Ausama A. Yousif, Emad A. Aboelsoud, Mahmoud El Gamal, Ahmed El-
Sanousi
... results and incomplete protection in vaccinated cattle, since that it was a
must to produce a homologues vaccine for LSDV.
Methods: A local isolate of LSDV strain was propagated on MDBK cell line and CPE was appeared
after 72 hours as cell rounding, cell aggregation and cell degeneration with titer of 105.5TCID50/ml,
DNA extraction and PCR for the candidate strain was performed using universal and specific prime...
Soad, E. Elsayed 1, Mohammed A. Shalaby2, Ausama A. Yousef2, Abu bakr A. Agor1,
Sherouk E. Aly1
...enge test revealed high protection
levels that reached 90% of the Guinea pig vaccinated by nano emulsion.
Conclusion: Our findings suggest that we aimed to enhance immunity through nano emulsion of
Montanide ISA 206 is well achieved.
...
Shourok E. Aly 1, Karim Zaki1, Soad E. Elsayed2, M. Elgamal2, Ausama A. Yousef1, Mohamed A. Shalaby1
...formula were completely protected against RVF challenge virus and
produced higher RVFV neutralizing antibody titers.
Conclusion: The vaccine developed based on small particle vaccine formulation is an economic
solution that can be added inline to existing production platforms to enhance immunogenicity.
...
Karim M. Selim1, Abdullah A. Selim1, abdelsattar Arafa1, Hussein A. Hussein2, Ahmed A. El-Sanousi2
... that both programs can protect birds from mortalities (up to 100 %). The
parameters used in this evaluation are the antibody immune response using hemagglutination
inhibition (HI) assay, protection post challenge, virus shedding and transmission in contact
non vaccinated chickens using qRT-PCR test.The genotype VII (GVII) vaccine group
induced higher HI titer by using GVII mon...

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

.... Detection of the coat protein gene of
CMV in infected leaves has been done by reverse transcriptase-polymerase chain reaction (RT-PCR),
and the appearance of 678 bp bands confirmed the expected size of such gene. Light and transmission
electron microscopy were used to study the cytological and histological changes that occurred in the
leaves of the sugar beet plant by the pathogen, as well as, to determine some...

Muhammad Ehsan Safdar1*, Samra Ammara1, Muhammad Sikander Hayyat1, Shahbaz Hussain2, Muhammad Mansoor Javaid1, Abdul Rehman1 and Amjed Ali1

Md. Abdullah Al Mamun1,2*, Shamima Nasren1,3, Sanjay Singh Rathore1 and Kavalagiriyanahalli Srinivasiah Ramesh1

...sed eye opacity and tail rot indicated the devastating effects of A. japonicus. Infestation by this parasite resulted in histopathological changes in the skin and muscle, gill, liver, kidney, heart and different parts of gut tissues. According to the results obtained in the present study, it can be suggested that acute infestation of A. japonicus elicited direct effects such as eye opacity, fin rots, scale loss and severe hi...

Anila Kousar, Muhammad Naeem*, Samrah Masud, Abir Ishtiaq, Zara Naeem and Rabia Iqbal

...effect of three dietary protein feeds (15% CP, 20%CP, 25%CP) composed of plant protein ingredients, on elemental concentration in Genetically Improved Farmed Tilapia (GIFT) fingerlings, a developed strain of Nile tilapia (Oreochromis niloticus). Feed preparation criteria was based on cost effectiveness and local availability of cheaper plant protein feed ingredients. Ten specimens were ran...

Bakhtiar Gul*, Saleetha Rabial and Haroon Khan

...pared to bromaxonil, isoproturon and paraquat. Therefore, glyphosate and MCPA proved suitable, economical and less laborious for the management of duckweed for large scale infestation.

...
Ramazan Erdogan1*, Mikail Tel2, Vedat Cinar2 and Ragip Pala2
...AS), zinc-α2-glycoprotein (ZAG), adipose triglyceride lipase (ATGL), glucose transporter-4 (GLUT-4) and insulin receptor substrate-1 (IRS-1) in adipose tissue of rats fed on zinc picolinate supplement diet. A total of 42 male 8-week-old Wistar albino rats were randomly divided into 6 groups, each of seven; Control (C), Zinc picolinate (ZP), Chronic exercise (CE), Chronic exercise+Zin picolinate (CE+ZP), Acute exercise (AE), Acute exercise+Zinc picolinate...

Ibadullah Jan1*, Iqbal Munir2, Inamullah Khan3, Syed Muhammad Suhail4 and Aqib Iqbal2

...against multiple target proteins. It must also be screened for long-term toxicological and side effects to further investigate its safety profile.

...
Jehan Dastagir, Muhammad Amir*, Bilal Ur Rehman, Shahid Hameed and Majad Ashraf
...one of the existing TCP protocols. Firstly, the proposed approach looks into various queue limits e.g. Drop Tail and RED. Evidently, a comparison of these two queue limits vividly demonstrates that RED demonstrates a better performance when it comes to attainment of optimized TCP congestion control. This investigation is naturally followed by simulating different TCP versions such as TCP Tahoe, TCP Sack, TCP NewReno, TCP Reno and TCP Westwood for checking and ...
Song Jiang1,2,3, Xianbin Mo1,2, Falin Zhou2,3, Jianhua Huang2,3, Qibin Yang2,3, Lishi Yang2,3 and Shigui Jiang2,3*
...ary levels of fish meal protein on body weight and survival of Penaeus monodon families. In this study, 5400 P. monodon from 36 families were mixed cultureed with two kinds of different dietary levels of fish meal protein (Diet A and Diet B) for 56 days to analyze the genetic parameters of body weight and survival traits, as well as the interaction effect of genotype and environment. The results showed that the...

 Yongmin Li1,2, Huabin Zhang1, Xiaoyou Wu1, Dongwei Li 2, Peng Yan1 and Xiaobing Wu1*

...ed twelve mitochondrial protein-coding genes of the newly sequenced and other reported species to assess phylogenetic relationships of Ranoidea. Phylogenetic analyses using maximum likelihood (ML) and Bayesian inference (BI) methods supported the sister-group relationship between ((Rhacophoridae + Mantellidae) + Ranidae) and Dicroglossidae. Within Rhacophoridae, two species of the genus Rhacophorus (R. schlegelii and R. dennysi) were clust...
Bingjie Zhou1, Hitesh Bhagavanbhai Mangukiya1, Siva Bharath Merugu1, Fakhar-un-Nisa Yunus1, Yuchen Fan1, Zhenghua Wu1,* and Dawei Li1,2,*
...d gene belonging to the protein disulfide isomerase (PDI) gene family. AGR2 exists in both intracellular and secreted form, it is overexpressed in many types of cancer cells and also detected in extracellular space of solid tumor interstitial fluids. The intracellular AGR2 is critical in protein folding while secreted AGR2 function as a paracrine signal promoting tumor microenvironment formation. Beside cancer progression an...

Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2

...the percentage of crude protein and fat contents as compared to control and other groups. Histomorphological examination of liver of broiler chicken supplemented with Compound-I and Compound-II in the coccidiosis challenged broiler chickens showed few pathological changes as compared to control (coccidiosis induced and without supplementation) group. In conclusion, supplementation of herbs mixture (Group E and F) at the dose 2ml/L to the coccidiosis challenged...
Aamer Abbas1, Jabbar Khan1*, Mir Abid Hassan2, Asif Qayyum3 and Hamed Shafiq4
...was done using standard protocols. Healthy women were used as negative controls. This study revealed significant concentrations of Zn, Cd, Cr, Pb, Cu. Except Zn and Pb, the other 3 metals were found below the permissible limit set by WHO. Interestingly, the infertile males having maximum age limit of above 47 years and highest marriage ages during the present study showed comparatively higher concentrations of all the heavy metals. Zinc was found with highest ...
Guan-bao Ning1, Sheng Niu1, Yue-jian Li1,2, Xiao-xiao Lu1,3, Shi-xiong Yang1,  Ali-Raza Jahejo1, Ding Zhang1, Wei-fang Hao4, Wen-wei Gao1, Yu-jun Zhao1, Jian-hui Li1, Fang Yan1, Rong-kun Gao1, Yu-hai Bi1,5, Wen-xia Tian1* and Ling-xia Han6*
...hway, mitogen-activated protein kinases (MAPK) signaling pathway, Janus kinase/signal transducers and activators of transcription (JAK-STAT) signaling pathway were involved in the response to MDV infection. The expression levels of all most differentially expressed genes (DEGs) in these four pathways were upregulated significantly at 14 and 22 dpi, indicating that the immune responses of erythrocytes were induced by MDV. This study may help to elucidate the mo...
Asma Chaudhary1, Qurat-ul-Ain Ahmad1, Afia Muhammad Akram1, Mehwish Iqtedar2 and Javed Iqbal Qazi3,*
... isolate enhanced total proteins, total lipids, DNA contents in G2, G3, average weight, weight gain in G1, G3 than both control groups and specific growth rate in G2. On the contrary carbohydrate contents were found to be decreased significantly in all experimental groups. Henceforth, it has been concluded that on the basis of survival data and body profile, Sphingomonas sp. AsCh--P3 could be used successfully as probiotic bacterium against the fish pat...

Jie Gao1, Guannan Wang1, Chuang Zhou1, Megan Price2, Jinnan Ma1, Xiaohong Sun1, Benping Chen3, Xiuyue Zhang2 and Bisong Yue1*

...A+T content (52.7%), 13 protein-coding genes (PCGs), 22 tRNAs genes, 2 rRNA genes, a control region (CR) and a non-coding region (NC). We found strong support for F. cinereiceps being placed within Sylviidae (superfamily Sylvioidea)and for babblers being separated into two families, Sylviidae and Timaliidae, with four subfamilies within Timaliidae. This is one of many taxonomic arrangements for babblers and there is likely to be continuous debate until ...
Wenjuan Yan1, Qunlan Zhou2, Bo Liu2,3*, Cunxin Sun2, Huimin Zhang3 and Changyou Song2
...trogenous (40.54% crude protein) and isolipid (6.16% crude lipid) diets with different I. cicadae levels (0, 100, 200, 400, and 800 mg Kg-1). Results revealed that I. cicadae significantly increased specific growth ratio (SGR) and protein efficiency ratio (PER), while decreased feed intake (FI) and feed conversion ratio (FCR). Meanwhile, I. cicadae significantly increased plasma ALT activity, ...
Nianhong Huang, Yan Wu, Yuanyuan Li* and Jinhong Zhao*
...atozoon, increasing protection and prevention of parasitic diseases of snakes.
...
Nabila Kousar1, Tanzeela Riaz2, Anum Feroz1, Abdul Rauf Shakoori3 and Farah Rauf Shakoori1*
...cogen, trehalose, total proteins, soluble proteins, free amino acids and total lipids contents of 4th instars larva of most resistant GUW and least resistant LAB-S populations at exposure to LC20. Among the biochemical parameters glucose, soluble proteins and FAA contents were found to be elevated significantly whereas the concentration of total p
Muhammad Mobashar1, Qazi Aqeel1, Muhammad Tahir Khan1, Assar Ali Shah2*, Ahmed A.A. Abdel-Wareth3, Salman Khan4, Nazir Ahmad1, Sami Ullah1 and  Haq Amanullah5
...ry matter intake, crude protein intake and organic matter intake (g/day) were significantly (P<0.05) affected in treatment groups. In-vivo nutrient digestibility, dry matter, organic matter, crude protein, crude fat, nitrogen-free extract (NFE), ash were significantly higher (P<0.05) in treatment groups, while in in-sacco degradability the DM and OM degradability at different time intervals (2h, 4h, 8h, 1...

Muhammad Madni Afzal1*, Shahbaz Talib Sahi1, Amer Habib1, Waqas Ashraf2, Muhammad Ahmad Zeshan3, Muhammad Raheel2 and Qaiser Shakeel2

...fungus that causes basal rot onion and it has the ability to survive in the soil for many years without having a host. Many fungicides are available in the market to control the basal rot of onion which contain hazardous material that continuously destroys the environment and human health. The objective of the present study was to evaluate the fungicidal efficacy of desert plant extracts against basal <...

Moheem Khan1, Arif Ali1*, Shafique Ahmed Memon1, Taimoor Khan Qambrani2, Ghulam Khaliq3, Jahanzaib Khan1, Saghir Ahmed1, Azmat Hussain Abro4 and Sohail Azeem Baloch1

...t may be useful for the protection of stored grain products from T. castaneum infestation. 
...
Arshad Khan1, Mohammad Ihsan1, Ali Hazrat1*, Mohammad Nisar1, Muhammad Laiq1, Maryam Bibi1, Nasir Ali2, Ulfat Naz1, Muhammad Zakria1, Nausheen Nazir3, Adam Khan4 and Muhammad Asif Nawaz5
..., in total seed storage proteins, a total of 13 polypeptides bond were found with the total genetic diversity of (0.68%) found  in band 1, while in band 2, the variation was 0.63%. A cluster dendogram was constructed for total seed storage proteins and divided 7 sub clusters, where CA1 and CA69 were found the most diverse genotypes. The main aim of this study was to explore morphological variation in order to generate d...

Izaz Hussain, Ahmad Khan* and Habib Akbar 

... (soil incorporated with rotavator) one month before sowing. Maize growth contributing parameters (leaves plant-1, leaf area and index, ear length, and plant height) were improved in treated plots than control plots. The application of 50 L BM ha-1 improved maize growth contributing parameters over 25 L BM ha-1. Increasing the application rate of HA from 3 to 9 kg ha-1 had increased leaves plant-1, leaf area, leaf area index, plant height and ear length of mai...
Arbab Zubair Ahmad1, Farman Ullah1, Hayat Badshah2, Muhammad Shehzad Khan1* and Bashir Ahmad1
...ult moth emergence with protein and strong negative between development time and moisture content and carbohydrate was observed. Wheat proved to be suitable as host with high bio-chemical contents for mass rearing of S. cerealella that provide maximum moths in short duration and their eggs yield more of T. chilonis, thus recommended for production system of T. chilonis.

...

Muhammad Irfan Ullah1*, Muhammad Arshad1, Abu Bakar Muhammad Raza1, Nimra Altaf1, Muhammad Afzal2

...affected chemical was spirotetramat, as the population of both pests was recorded higher on citrus plants after application of this insecticide compared to others. Our findings indicate that imidacloprid can be considered the best insecticide for managing CLM and ACP population in an integrated approach. 
 
Novelty Statement | The present study will be helpful in the selection of effective insectic...
Kai Jin1,2,3, Chen Chen 1,2,3, Xinyu Sun1,2,3, Caiye Zhu1,2,3, Mahmoud F. Ahmed1,2,3,4, Qisheng Zuo1,2,3, Jiuzhou Song4 and Bichun Li1,2,3*
...en the target genes and protein expression level in F2 transgenic mice, as well as fat content in F1 and F2 transgenic mice muscle were examined. Successful transgenic goats generation was identified by testicular injection. The results showed a developmental time specific SCD1 expression in the goat mammary gland tissue and muscular tissue. The rate of positive expression of exogenic gene and exogenic p
Tanzeela Riaz1, Farah Rauf Shakoori2*, Syed Shahid Ali2 and Mushtaq Ahmad Saleem1
...ues. In case of soluble proteins, an elevation was observed which was followed by a decline after 72 h. Similarly, free amino acid contents showed increasing trend in both larval instars of tested populations throughout the exposure period with the exception of the 4th larval instars of susceptible population which decreased after 72 h. The concentration of glucose showed significant increase in 6th larval instars of both populations at e...
Zhengyi Fu1,2,3,4, Rui Yang2,3,4, Zhenhua Ma2,3,4*, Mingyang Han2,3,4 and Yifu Wang2,3,4
...f different dietary non-protein energy sources on growth performance, somatic parameters, histology and digestive enzymatic activity of barramundi (Lates calcarifer). Fish were fed ioso engery diets (18 kJ/g) with two types of non-protein energy sources in the experimental groups and a regular diet was used as the control. The feeding trial lasted for 56 days. Results from the present study indicate that, except ...
Ewa Czerniawska-Piątkowska1, Iwona Szatkowska1, Daniel Zaborski2*, Wilhelm Grzesiak2, Sara Tabor-Osińska1, Małgorzata Wasielewska1Witold S. Proskura1, Wojciech Kruszyński3 and Edward Pawlina3
... in milk yield, fat and protein percentage were found in the second lactation. In HO, significant differences in milk fat content and yield were observed in the third lactation. No significant differences were found for RW. The bioinformatic analysis allowed us to infer that transcription factors other than the ZFP217 protein bind to the sites located outside the C>T substitution. Further studies are required to elucidate...
Wanqiu Zhao1,2, Taoyan Yuan1, Li Chen2, Xue Du2, Weihu Chen4, Yan Fu1, Dong Niu3,* and Lizhi Lu2,*
...es, Actinobacteria, and Proteobacteria were the three most abundant phyla in the duodenum of the laying geese. Cyanobacteria predominated in broody geese, followed by Firmicutes, Proteobacteria, and Spirochaetes. The microbial communities of the recovery geese were dominated by Spirochaetes, Firmicutes, Cyanobacteria, and Proteobacteria. Additionally, the microbial diversity and richness w...
Iram Liaqat1,*, Safdar Ali Mirza2, Sumera Sajjad3, Shaukat Ali1,*, Muhammad Faiz Qamar4 and Ikram Ul Haq5
...ated motility. Type III protein secretion systems of several gram-negative bacterial pathogens use flagella to invade foreign surfaces, host tissues and substrates. Flagellar biosynthesis and function in Salmonella typhimurium isregulated by >50 genes. Bioinformatics analysis of flagellar assembly in S. typhimurium identified several conserved structural elements. In this study, FliI a flagellar protein requ...

Kawa A. Ali1*, Sazar S. Noraldeen2 and Arshad A. Yaseen2, 3

...content was related to carotenoid levels in both destruction methods. There was positive correlation between SPAD and atLEAF. Nondestructive methods could be used as an alternative method for destructive methods. 

...

Asim Faraz1*, Abdul Waheed1, Nasir Ali Tauqir2 and Muhammad Shahid Nabeel3 

...n rut-camels. The total protein, urea and creatinine concentrations varied non-significantly among animals. While the calcium and phosphorus concentration (P<0.05) was found to be 9.88±1.16, 4.77±0.8 and 9.06±1.18, 4.06±0.9 mg/dl respectively in August and February, lower in rut-camels. Such biochemical investigations are evident of the importance of serum bio-gram which has pronounced effect on sexual behavior and may be used fo...

Jo Ik-Hwan1, Choi Kwang-Won1, Muhammad Yaqoob2 and Muhammad Fiaz3*

...ll manure levels. Crude protein (CP) yield of triticale hairy vetch and pea mixtures was not different (P>0.05) across all manure levels. Yield of total digestible nutrients (TDN) was highest at 150 kg N/ha in triticale sole monocrop, followed by 100, 50 and 0 kg N/ha levels. The overall TDN yield in triticale vetch mixture with 100 kg N/ha was higher (P<0.05) than control and not different (P>0.05) from 50 and 150 kg N/ha levels. However, TDN yield o...
Yanhong Hu* and Linkai Cui
...oplasmic reticulum (ER) proteins. Comparative analysis of the prediction results showed EpFAR was localized to the ER membrane. These results, combined with the localization of other FARs, suggested the importance of ER as a related subcellular site of white wax biosynthesis.
...
Mengke Wang1, Shucheng Huang2, Cai Zhang1*, Haizhou Gong1
Shunan Cuan1, Shuaishuai Wang1, Qi Shao1, Wenhao Xu1, Sudan Meng1
Pengfei Li1, Yuqin Wang1 and Zijun Yang1
...), the content of total protein (TP), albumin (ALB) and globulin (GLB) (p<0.05). Furthermore, supplementation of MAG increased the activity of total superoxide dismutase (T-SOD) (p<0.05), slightly increased the activities of total antioxidant capacity (T-AOC) (p>0.05) and catalase (CAT) (p>0.05). And the concentrations of malondialdehyde (MDA) were reduced in MAG groups, yet the differences were not significant (p>0.05). Notably, Liver weight, l...
Zhengyi Fu1,2,3,4, Rui Yang1,2,3, Shengjie Zhou1,2,3, Zhenhua Ma1,2,3* and Gang Yu1,2,3*
... in L grade. Heat shock protein has no obvious rule in body length grade. L grade pro-inflammatory cytokines were up-regulated, but anti-inflammatory cytokines were down-regulated and inflammatory markers were up-regulated, indicating an obvious inflammatory response. The expression levels of S and M grade anti-inflammatory and proinflammatory cytokines was more balanced. This study provides the basis for finding the relationship between size heterogeneity and...
Li Ma1 *, Xu Han1, Bo Yang2 and Chunhua Zhou3
...order to understand the protective impact of kaempferol, MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) assay was applied in hydrogen peroxide-treated human umbilical vein endothelial cells (HUVECs). The hydrogen peroxide-induced apoptosis was gauged using flow cytometry whereas western blotting was applied to detect the expression of key cellular markers in oxidation pathways. The data indicate that a total of 50 µmol/l concentration...
Ayman Balla Mustafa1, Abdalla Elgenaidi1, Aldukali Alkeskas1, Asim Faraz2,*, Ahmed Eisa Elhag3, Mohanad Bashari4 and Bernard Faye5
...tpartum. The total fat, protein, lactose, solid non-fat (SNF) and density percentages were determined by automatic milk analyzer device (lactoscan Model-90, Europe). Results elucidated that there was no significant difference of lactose and fat content between two groups throughout experiment period. Where the significant difference (P˂0.05) of protein, SNF and density contents of milk were detected during lactation stages ...
Zhi-Ming Luo*, Xiao-Yan Wang, Jiong Yin, Ying-Kun Huang, Wen-Feng Li, Rong-Yue Zhang, Hong-Li Shan, Xiao-Yan Cang and Jie Li
...key to sustainable crop protection and integrate pest management. Here, were assessed resistance to damage caused by two species of borer in seedlings of 12 new sugarcane varieties. The results showed that there were differences in resistance among the varieties, where varieties YT60, GT31, GT29, LC05-136, and YT55 were classified as showing moderate resistance, YZ06-407, YZ05-51, ROC22, YZ05-49, YZ03-194, and FN38 were found to be susceptible, and FN39 and DZ...
Aqsa Shahid1, Saima Muzammil1, Farhan Rasheed2,Bilal Aslam1, Muhammad Akhtar Ali3, Syed Zohaib Haider4, Masroor Ellahi Babar4, Muhammad Saeed1, Umair Waqas1 and Mohsin Khurshid1,*
...es was evaluated by the broth microdilution method. Moreover, the armA genes were studied by PCR followed by Sanger sequencing. The isolates showed a high rate of resistance to cephalosporins, carbapenems, aminoglycosides, and fluoroquinolones whereas colistin and tigecycline were the most active antimicrobial agents against A. baumannii as none of the isolates was found resistant to these two drugs. Moreover, the armA was found in 25% (n=...

Nasir Mahmood Cheema1*, Ghulam Shabbir2 and Nazakat Nawaz3

...acid, palmitic acid and protein but indicated no difference significantly (p>0.05) in oleic acid and ricin oleic acid. Among cultivars, DS-30 showed maximum oil content (49.356 %) and ricin oleic acid (87.978%). The most important component of castor oil the ricin oleic acid% was found highest by sowing date 15th July in all the varieties while highest oil content was also obtained with sowing date 15 July. The present research is the first report on oil co...
Yuli Andriani1*, Rintan Octaviana Julia1, Lintang Permata Sari Yuliadi1, Iskandar Iskandar1 and 
Yaya Rukayadi2
...dy aims to examine the carotenoid content in Butterfly pea (Clitoria ternatea L.) leaves meal (BPLM) as a source of natural pigment and its effect on the tail color quality of Swordtail fish (Xiphophorus helleri, Heckel. 1848). Completely Randomized Designed (CRD) was applied consisting of four treatments with three replications. The treatments were added 0 % (A), 1 %, (B), 6 % (C) and 12 % (D) of BPLM. The parameters observed included biochemica...

Hidayatullah1*, Sammia Mahroof1, Saleem Abid2, Naveeda Anjum3, Noor Habib4, Akhter Saeed5 and Muhammad Arshad Farooq1

...ith Vitamin C and beta-carotene, traditionally are the integral part of daily food in Pakistan. Like any other agricultural produce, chillies too have been greatly affected by erratic environmental conditions. So, it is important to assess yield stability in diverse environments. Therefore, stability analysis of six chilli advance breeding lines; NARC Chilli-1, NARC Chilli-2, NARC Chilli-3, NARC Chilli-4, NARC Chilli-5, NARC Chilli-6 was carried out. F1 hybrid...
Diana Rachmawati1*, Johannes Hutabarat1, Olga Anne2, Roy Hendroko Setyobudi3 and Tita Elfitasari1
...entation in the diet on protein digestibility, the efficiency of diet utilization, growth, and activities of digesting enzymes of E. fuscoguttatus. The sampled fish has an average weight of 4.24 g ± 0.023 g per fish. Diet used in the study contained 45 % protein with the supplementation of various amounts of B. subtilis varying in (0, 2.5, 5, 7.5, 10, and 12.5) % per kg of diet as A, B, C, D, E, and F tr...
Muhammad Bilal Tayyab1, Muhammad Zeeshan Majeed1*, Muhammad Asam Riaz1, Muhammad Anjum Aqueel2, Sylvain Nafiba Ouedraogo3, Muhammad Luqman4, Kanwer Shahzad Ahmed1 and Mujahid Tanvir1
...rnate biorational plant protection measures such as botanical pesticides. This study evaluated the potential toxicity of acetone extracts of 40 indigenous plant species of Soon valley and surrounding salt range (Punjab, Pakistan) against D. citri and A. gossypii using standard twig-dip and leaf-dip bioassay methods, respectively. Results of initial screening bioassay showed the highest mortality of D. citri by 10% extracts of Mentha longifolia (L.) Huds. (93%)...
Ayu Suci Wulandari1, Siwi Indarti1,2*, Muhannad Illayan Massadeh3 and Nguyen Van Minh4
Ahmad Wahyudi1*, Sujono Sujono2, Listiari Hendraningsih2, Ari Prima2, Zane Vincēviča-Gaile3 and 
Ivar Zekker4
...shown to increase crude protein content and improve feed efficiency. However, its addition in Total Mix Ration (TMR) and also TMR silage on calves’ growth performance is yet to be elaborated. Therefore, the effect urea addition on TMR and its silage on performance of Friesian Holstein (FH) male calves were evaluated. The calves (n = 27; 5 mo to 7 mo, mo = month old) were divided into three groups, each group consisted of nine calves, based on age: 5 mo (...
Bushra Shaikh, Sadia Muniza Faraz*, Syed Riaz un Nabi Jafri, Syed Usman Ali
...98 % for a mobile robot prototype in an indoor environment. The proposed algorithm is simple, low cost, independent of lighting conditions and requires less computational steps to identify the exact location on the map. 
...

Muhammad Dawood1,2, Naeem Sarwar2, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha3*, Faiz Hussain4, Muhammad Mahmood Iqbal5, Muhammad Akram4, Hammad Husnain5, Muhammad Shahid5, Mussarrat Hussain6 and Muhammad Umair Hassan1

...ld (5.40 t ha-1), grain protein contents (12.54 %) and grain fiber contents (4.15 %) followed by Ujala-2015 and Punjab-2011 and Fsd-2008, however, cultivar, SH-2002 and Auqab-2000 performed poorly in terms of yield and quality. These results suggested that wheat cultivars i.e. Galaxy-2013, Ujala-2015, Punjab-2011 can grow successfully under Faisalabad conditions for getting good yield and quality. Moreover, these cultivars can also be used in future breeding p...

Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4

...ecorded on oil content, protein content, oleic acid, glucosinolates, erucic acid, and linolenic acid. Significant genetic differences were observed for all the traits studied. Among parental lines, C-88 performed better for protein content (20.48%) and erucic acid content (50.31%), C-89 for oleic acid (36.15%), and linolenic acid content (10.18%). Among F2 populations, C-95 × C-93, C-88 × C-95, C-97 × C-95,...
Aneela Hameed1, Faqir Muhammad Anjum2, Zia ur Rehman3, Saeed Akhtar1, Asim Faraz4*, Majid Hussain1 and Amir Ismail1
...tages. Decrease in fat, protein, lactose, solids not fat and total solids contents and increase in ash contents were noted in oxytocin administreted milk. Minerals’ analysis of the milk samples were conducted and it was found that lactation stages have significant effect on minerals composition i.e. macro minerals (Na, Cl, K, Ca, Mg and P) and micro minerals (Zn and Cu) in milk. Oxytocin administration showed significant effect on milk minerals during va...
Dong-Min Hou1, Ting Jia2, Chun-yan Liu1, Zheng-Kun Wang1 and Wan-Long Zhu1*
...pressions of uncoupling protein 1 (UCP1) and Cd137, and the relative expressions of PR domain containing 16 (PRDM16), bone morphogenetic proteins 7 (BMP7), peroxisome proliferator-activated receptor α (PPARα), cyclooxygenase 2 (COX-2) and peroxisome proliferator-activated receptor coactivator 1α (PGC-1α) of WAT were measured. The results showed that body mass, food intake and RMR were decreased in ...
Jun-Dong Tian1,2, Wei-Jie Guo1,2, Han Yan1, Jie Zhang1, Shu-Liao Tian3 and Ji-Qi Lu1,2,*
...micutes, Bacteroidetes, Proteobacteria and Spirochaetace accounting for over 86 % of the richness of whole microbiota, ii) Ruminococcaceae, Prevotellaceae, Lactobacillaceae and Spirochaetaceae were together taken over 60% at family level, iii) Prevotella was the dominant genus, iv) the community richness at OTU and family levels and both community evenness and community diversity at OTU level of the AM group were significantly higher than that of the PM...
Anwar Khan1, Fareeha Nosheen2,4, Bushra Tabassum2*, Olawale Samuel Adeyinka2, Khurram Shehzad3, Naila Shahid2, Arif Muhammad Khan4 and Idrees Ahmad Nasir2
...font-size: small;">Coat protein gene of potato virus X is a structural protein that plays a vital role in viral transmission and pathogenesis. RNA interference or post transcriptional gene silencing is a regulatory conserved mechanism that uses small interfering RNAs to control the expression of desired gene by inhibiting mRNA transcription. The present study aims to investigate the potential role of different siRNAs in down...
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
...ine transaminase, total protein, total albumin, globulin, triglycerides and cholesterol values. Histopathological examination demonstrated degenerative changes, necrosis haemorrhages, and sloughing off epithelial cells of broad folds of caeca, mild lymphoplasmacytic infiltration in the periportal area of the liver and mild depletion of lymphocyte in the bursa of Fabricius. The seven clades of avian Eimeria species strongly support that E. neca...
Muhammad Javed Iqbal1,*, Muhammad Afzal1, Khalid Abbas1 and Muhammad Shahid2
... the effects of dietary protein to energy (P/E) ratios on the nutrients and minerals digestibility of Labeo rohita fingerlings. Twelve experiment diets containing four protein levels (24, 26, 28, and 30 %) at three dietary energy levels (2400, 2700, and 3000 kcal/kg) with P/E ratios from 80.00 to 125.00 mg / kcal were evaluated. Eac...
Nagarathinam Arunkumar*, Jainullabudeen Gulsar Banu, Nagarajan Gopalakrishnan and Arkalgud Hiriyannaiah Prakash

 

...agement of waxy cuticle-protected insect pests.
...
Liyun Chang1, Yingbin Chen1, Qian Kang1, JianhuaQin1,* and Zhiyong Liu2,*
...vum) is a parasitic protozoan that causes cryptosporidiosis in mammalian intestinal tract. In this study, C. parvum infection model was established in Balb/c mice, followed by extraction of total RNA from small intestine of infected mice at 1, 3, 7 and 14 dpi, respectively. The relative expression of IFN-γ, TNF-α, IL-2, IL-4 and IL-6 in the small intestine of Balb/cmice infected with C. parvum, were then detected using Ct value co...

 Song Jiang1,2, Xianbin Mo1,2, Falin Zhou2,3, Jianhua Huang2,3, Qibin Yang2,3, Lishi Yang2,3 and Shigui Jiang2,3*

...ffects of two fish meal protein level diets (Diet A and Diet B) on the growth and survival rates of 36 families of Penaeus monodon. The results showed that significant differences were observed in the weight gain of different P. monodon families fed with the same diet(P<0.05). The AGR (absolute weight gain rate) of the fastest weight gain families was 97.16% and 95.46% higher than that of the slowest weight gain families fed with Diet A and Diet B, respecti...
Zheng Yan1,2,*, Shuang Liu2, Ai-Qing Liu2 and Hai-Yan Wang2
...ars. To investigate the protective effects of the oral administration of elastin peptide on photoaged skin, BALB/C Nude mice were exposed to UVA+UVB for 16 weeks to establish the photoaging model. The concentrations of elastin peptide given to the low, medium, and high dose groups were 1.5, 5.0 and 10 mg/animal per day, respectively. Then, skin elasticity was measured using a cutimeter dual MPA 580. The concentraions of three type of collagens, hyaluronic acid...
Ou-Mei Hao1*, Xue-Feng Wang1, Zhi-Jun Yue1, Chun-Hong Nan1,Yan Yu1,Tong Zhang2,Yu-Feng Liu3 and Xue Zhao1
...xpression of surfactant protein A (SP-A), B7 homolog 3 protein (B7-H3), interleukin (IL)-12 and IL-13. The expression levels of B7-H3 and IL-13 were upregulated after MPP infection in the mouse model (P<0.05), while the expressions of SP-A and IL-12 were significantly decreased (P<0.05). After five days of therapy, the protein and mRNA expression levels of B7-H3 and IL-13 decreased, ...
Muhammad Arslan Akbar1, Khalid Javed2, Asim Faraz3* and Abdul Waheed3
...testes width (TsW) and scrotal circumference (ScD). Male and female animals were placed in two separate groups. The correlation coefficients among most of the morphometric traits were high and significant (P≤ 0.01) particularly among withers height, body length, heart girth and live body weight in both male and female animals. Principal component analyses of morphometric traits were done and two principal components were extracted in females with 66.02% var...

Sheikh Muhammad Azam1,2 and Muhammad Naeem1*

...position of water, ash, protein and lipids. Basic purpose of the present work was to avow nutritious status of Scomberoides commersonnianus. Therefore, current study analysis was performed to analyze body composition of the studied fish. A total of 73 specimens of S. commersonnianus having different size, ranged 94.5 to 1183g of body weight and 20.5 to 56.9 cm in total length were randomly chosen from Arabian Sea Karachi, Sindh, Pakistan for analysis of proxim...
Amin Arif1, Khizar Samiullah1*, Riffat Yasin2, Bilal Rasool1, Shakila Naz1, Xijun Ni3 and Saleem Akhtar1
... of Giraffidae with Procerotidae have been discussed comprehensively. Palaeoenvironment, biostratigraphy and geology of the locality have also been discussed. The coexistence of Giraffokeryx punjabiens with its mammalian paleo-community reveals the persistence of mosaics of diverse habitats ranging from tropical evergreen forest to subtropical ones, closed seasonal woodlands to wooded savannas during the deposition of the Dhok Bun Ameer Khatoon, Chinji ...
Zhiyuan Sun1, 3, Xuhui Zhang2,*, Xian Li3, Yanping Huang3, Shiyan Sui3, Weifeng Liu3, Guochao Ni3, Xiaozhou Xu1, Jianbo Yang1, Xue Lian1 and Hui Jia1
...nd T-NOS, iNOS and cNOS proteins (P =0.002, P =0.028 and P =0.003, respectively) and increased serum tumor necrosis factor alpha (TNF-α) concentration (P <0.01), but ACTH treatment has no significant effect on them. Neither ACTH nor LPS treatment had any significant effect on levels of pulmonary SOD, CAT and MDA secretion, as well as expression of IL-6, TNF-α, IL-10, COX-2 and TLR4 mRNAs (P >0.05). Pulmonary...

Mst. Deloara Begum1, Md. Muniruzzaman1, Md. Salauddin2* and Md. Mostafizer Rahman1

...y rich source of animal proteins. The soft tissues of fish and aquatic environment are extremely susceptible to microbial contamination. In this research a total of 79 samples were collected from different local market. In which 54 samples were from dried fish and 25 from cooked fish samples. In this research there were 18 different types of dried fish and 6 types of cooked fish were used as a sample. Laboratory work was done by different bacteriological labor...
Manar M. Farouk1*, Amal El-Molla1, Fayez A. Salib1 and Yousef A. Soliman2
...gate the presence of enterotoxin(stn) gene in the recovered Salmonella spp. strains, and 3) Build a phylogenetic tree for the partial codon sequence of stn gene of some recovered strains in order to provide a scientific basis for the implementation of practical preventive measures. A total number of 518 diarrheic sheep and goats belonging to 7 mixed flocks of sheep and goats were enrolled and from which rectal swabs were collected and subj...
Vishal Ambidi 1,3, Sanjeev Bantewad2, Suraj Prasad Mishra1, Anupama Hingane1 and Jagdish Jaba1*
...the biochemical factors protein, sugar content in pigeonpea seeds exhibited significant positive correlation with correlation coffecient (r) being (0.710**, 0.843**), respectively with percent pod damage by pod borer complex. Whereas, total phenols, tannins, total flavonoids present in seeds showed significant negative correlation with correlation coffecient (r) being (-0.729**, - 0.650**, -0.783**), respectively with percent pod damage by pod borer complex. T...
Muhammad Hamza Tariq1, Mahjabeen Akram2 and Yasir Sharif3*
...nding receptor of Spike Protein (S-protein). The present study aimed to investigate the phytochemicals as potential inhibitors of the binding domain of S protein so that the binding of COVID-19 with ACE2 receptors could be restrained. For this purpose, the library of 2113 phytochemicals was docked against the binding domain of the S-protein. Top ten comp...
Nida Sadaqat1, Abdul Wajid2, Quratul Ain2, Muhammad Zia Akbar2Farkhanda Manzoor4, Muhammad Sarwar Khan1, Nasir Ali3,  Masroor Ellahi Babar3 and Tanveer Hussain3*
...-encoded cellular-prion protein (PrPc) in the central nervous system (CNS) and in some peripheral tissues in sheep and goats. Scrapie resistant/susceptibility have been associated with the presence of PRNP gene polymorphisms. We analyzed the polymorphisms in PRNP gene sequences in 49 wild Punjab urial (Ovis vignei punjabiensis). Four novel amino acids polymorphisms (p.Q149E, p.Q155E, p.Y228L and p.L253F) were detected in ...

Ruqia Bibi1, Najam-un-Nisa1, Sania Komal1, Hafiza Nimra Ghani Qureshi1, Maryam Safdar1, Hafiza Hina Jameel1, Saman Gul1, Sania Saeed1 and Inam Ullah1,2*

...there is a dire need to protect avifauna diversity for the proper functioning and stability of an ecosystem.

...

Muhammad Shahbaz1,2, Sajid Abdullah1*, Huma Naz3*, Khalid Abbas1, Tanveer Ahmed4, Sana Mehmood1, Muhammad Adeel Hussan5

...as proven beneficial in protecting cellular membranes against oxidation and increases the resistance to stress. 
 
...
Monif AlRashidi1*, Sami Saeed M. Hassan2 and Mohammed Shobrak3
...behavioral mechanism to protect the egg from direct sunlight.
...
Nasir Ali Tauqir1, Asim Faraz2*, Muhammad Arif1, Abdul Rehman1Imtiaz Hussain1, Abdul Waheed2, Gabriele Marino3 and Michela Pugliese3

 

...centrations (% of crude protein) were formulated and represented as high essential amino acids (HEAA), medium essential amino acids (MEAA) and low essential amino acids (LEAA) concentrations, respectively. The study lasted for 100 days; first ten days were given for the adaptation to new diets while every six days after every month of the remaining period served as collection periods. The intake (% body weight) of dry matter (DM), crude p...

Mazhar Ullah and Mohammad Sayyar Khan*

...ustify;">Tissue culture protocols with enhanced efficacy are prerequisite for the effective micro-propagation of sugarcane. Various factors affecting tissue culture must be evaluated and optimized to produce maximum callus and regenerated plantlets. In this research, different auxins [Dichlorophenoxy Acetic acid (2,4-D), Nephthalene Acetic Acid (NAA)], cytokinin [Benzyl Amino Purine (BAP)] either alone or in combination with each other and carbon sources [sucr...
Ho-Seong Cho1 and Yeonsu Oh2,*
...oembryonic antigen, fetoprotein and hepatocyte paraffin-1. Taken together, the tumor was diagnosed as cholangiocarcinoma. This is the first case report of a cholangiocarcinoma in the puma.
...
Nasir Ali Tauqir1, Asim Faraz2*, Annamaria Passantino3, Muhammad Asif Shahzad1, Rana Muhammad Bilal4, Adeel Tahir1, Hafiz Muhammad Ishaq2 and Abdul Waheed2
...nsable source of animal protein and it is speculated that the demand of animal protein will be increased by 60-70% in 2050 for human consumption and much of this share will come from developing nations. This research was executed to find out the nutritional influence of corn steep liquor and enzose mixture as a non-conventional protein ingredient in day old broiler chicks. For this purpose...
Zahid Beg Mirza1,*, Naveed Ali Soomro2 and Farwah Shariff1
...ce of wild ungulates in protected areas such as the Khirthar National Park.  

...
Junli Liu1, Tongfang Yang2 and Lisheng Wu3*
...ine-containing aspartic protease 3 (Caspase-3) protein expression in U2OS cells were detected by western blot, thiazole blue (MTT) and plate cloning experiments to determine cell survival and colony formation, flow cytometry to measure apoptosis, and quantitative real-time polymerase chain reaction (qRT-PCR) to assay LINC00857 and miR-340 expression. Bioinformatics and dual luciferase reports analyzed the targeting relations...

Rasool Bux Kalhoro1, Ghulam Mustafa Laghari2*, Ghulam Hyder Jamro2 and Muhammad Ibrahim Keerio2

...portant oilseed andrich protein crop throughout the world.A two- years (2007-2008) fieldtrail was carried out to improve the soybean production under integrated agronomic practices.A three replicated experimental design was conducted, which consisted of three different seed rates (60, 75 and 90 kg ha-1) and row spacings (30cm, 45cm, and 60cm). The results exhibited higher plant 55.24cm and 55.14cm at 45 cm row spacing under the interaction of seed rate 60 and ...

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

... content as compared to Protein contents. It was found that the microbes associated with earthworm (L. terrestris) have significant potential of adherence and can be exploited as a bioinoculant formulation for improving soil fertility. 
 
Novelty Statement | The study is novel in its design as it is planned to see the aggregation potential of microbial communities which are associated with earthwor...
Iqra Mobeen1*, Rabia Arif1*,Maimoona Ilyas1, Siu Fai Lee2 and Muhammad Saleem1
...al differences in their protein products.
...
Khanitta Ruangwittayanusorn1, Doungnapa Promket1*, Kamonnate Pimrueng1, Jennarong Kammongkun2
...ickens (HPHC). PCR-RFLP protocols were used to identify polymorphisms of both genes. The frequencies of TT, TC and CC genotypes of DRD2 were 0.05, 0.40, and 0.55, respectively. The frequencies of T and C alleles of DRD2 were 0.25 and 0.75, respectively. Regarding VIP, the frequencies of II, ID and DD genotypes were 0.59, 0.28, and 0.13, respectively. The frequencies of I and D alleles of VIP were 0.73 and 0.27, respectively. The ass...
Muhammad Rizwan1*, Bilal Atta1, Misbah Rizwan2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Muhammad Sabar1, Muddassar Ali1 and Muhammad Yasir Ali4
...anagement for rice crop protection.
...

Najeeb Ullah1*, Muhammad Nadeem2, Malik Mujaddad-ur-Rehman1, Rubina Nelofer2 and Yasir Arfat3

...n: justify;">Abstract | Protease is one among other many enzymes which possess the qualities of the vitally important hydrolytic enzymes. The present experimental work of the protease production was conducted by using skin waste from leather industry as a substrate. Different sources of nitrogen and carbon were screened in order to enhance the production of protease by a locally isolated B...

Ayesha Muzamil, Hafiz Muhammad Tahir, Shaukat Ali, Iram Liaqat, Aamir Ali, Muhammad Summer

...nes are diverse form of proteins that act pro- and anti-inflammatory cytokines. The main component of immunity is IL-1. IL-6 cytokine play its role in regulation of metabolic reactions. The activity of various leukocytes is suppressed by IL-4 and IL-10 (anti-inflammatory cytokines) that triggers the production of pro-inflammatory cytokines. This review paper provides an overview of inflammation, its associated factors, causes and treatment and role of cytokine...

Khlood G. Abdelkhalek*, Aly B. A. Badawy, Mohamed Fathi, Elshymaa A. Abdelnaby 

...esticular morphometry, scrotal circumference, Doppler examinations, image analysis, and blood sampling were performed on a weekly basis. Results showed that FSH level was elevated (P<0.05) firstly from 5-months to 6.5-months-old, and then a second elevation was reported at 9.5-months-old, both E2 and NOMs levels were increased significantly (P<0.05) from 8-months to 10-months-old. Testosterone level showed a significant (P<0.05) increase from 8.5-mont...

Eman H. Mahrous1, Mohamed. W. Abd Al -Azeem2, Faisal A. Wasel1, Waleed Younis2* 

...ates belong to somatic serotypes 1, 3, and 12 with a percentage of 20%, 10%, and 10% respectively, while other isolates were untypable. All the recovered isolates were further subjected to multiplex PCR screening of some common virulence genes and revealed the presence of pfhA, hgbB, tbpA, toxA, sodA, ptfA, sodC, nanB, and oma87 with percentages of 30%, 60%, 10%, 100%, 70%, 90%, 90%, 90%, and 100% respectively. Antibiotic susceptibility tests of the recovered...
Longjun Guo*, Jiaqi Teng, Juan Wang and Yukun Chen
...pinal fluid τ (Tau) protein expression in leukoaraiosis patients. Inpatients who attended the Department of Neurology of our hospital from January 2018 to December 2018 were selected as study subjects, with 58 patients with leukoarais as the experimental group, and 60 patients without leukoarais in the same period as the control group. ELISA was used to detect τ (Tau) protein expression level in the cerebrospinal flu...
Amr N. El-Shahat1, Refaat G. Hamza1,*, Ashraf M. Mounir1 and Madeha N. Al-Seeni2
... determine the possible protective effects of graviola fruit juice (GFJ) against radiation induced oxidative stress and biochemical alterations in the liver and kidney of male albino rats.In the present study, gamma- irradiation (2 Gy every 3 days up to 8 Gy total doses) induced biochemical and oxidative damage in rats when compared to control group. In GFJ (10ml/Kg B Wt. /day) treated irradiated group, there were noticeable decreases recorded in lipid content...
Jhan Zeb1*, Saiqa Tufail1, Nausheen Saboohi1, Zafar Samuel2, Asher Azeem3, Yaseen Amir4 and Sehrish Akram5
...uation of optimum lipid/protein level in pelleted diets for Labeo rohita (Initial weight; 2.87±0.01g). Four pelleted diets varying in their lipid/protein levels i.e. 7.5/25, 9.5/25, 7.5/30 and 9.5/30% were formulated and hand fed for 90 days to four groups of 10 fish each. Results of the present study showed that L. rohita attained significantly higher a...
Abdullah Abdo Albegali1, Tayyaba Aftab1, Atiq-ur-Rehman1*, Amir Rashid1 and Mayada Mohammad1,2
...rides, high density lipoprotein, low density lipoprotein, very low density lipoprotein, asparate aminotransferase and alkaline aminotransferase. The plant maintains the level of HDL to a normal range. It is concluded from the study that the plant may be supportive treatment in combating hyperlipidaemias.
...

Vladimir Safonov 

...>Keywords | Antioxidant protection, Biochemical composition, Cows, Pathology, Peroxidation, Selenium 

...

Sadarman1, Agung Irawan2, Muhammad Ridla3, Anuraga Jayanegara3*, Nahrowi3, Roni Ridwan4, Ahmad Sofyan5, Hendra Herdian5, I Nyoman Guna Darma5, Teguh Wahyono6, Dewi Febrina1, Rakhmad Perkasa Harahap7, Rizki Amalia Nurfitriani8, Danung Nur Adli9 

...fe additives to improve protein utilization in ruminants. This study aimed to investigate the effect of tannins extracted from acacia and chestnut on the degradation kinetics of ensiled and non-ensiled soy sauce residue (SSR) in sacco. Two fistulated beef cattle (425±25 kg) fed a diet consisting of 80% Pennisetum purpureum and 20% concentrate was used to incubate the SSR samples (ensiled and non-ensiled) using a 6×11 cm standard nylon bag. Each SS...
Weihao Chen1, 2, Zhilong Tian1, Lin Ma1, Shangquan Gan3, Wei Sun2, 4* and Mingxing Chu1*
...ed that the CRY and PER proteins may function in the circadian rhythm either as a complex or as individual, Therefore, we concluded that circadian rhythmicity may regulate the estrous mode of rams via clock genes within transcription/translation feedback/feedforward loops. This is the first study to systematically analyze the expression patterns of clock genes in rams.
...

Muhammad Zeeshan Majeed1*, Muhammad Irfan Ullah1, Dilbar Hussain2, Muhammad Luqman3, Muhammad Qasim1, Gulfam Yousaf1, Hamza Latif1 and Muhammad Zeeshan1

...rid, clothianidin and spirotetramat (causing 78–85% cumulative mortality), spirotetramat, acetamiprid and thiamethoxam (causing 68–90% cumulative mortality), and chlorantraniliprole, pyriproxyfen and chlorfenapyr (causing 80–85% cumulative mortality), respectively. Overall study findings suggest these above mentioned non-conventional insecticides to be incorporated in the biorational management of these ins...

Aftab Ahmad Sheikh1, Khalil Ahmed1*, Belqees Akhter1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Hafeezullah Rafa1, Abdul Wakeel1, Abdul Manan Saeed2

...(NFE), crude fat, crude protein, crude fiber, phosphorus, and calcium contents were envaulted at the physiological maturity of crop, four months after the sowing of crop. Results revealed that water salinity adversely affected the quantitative and qualitative attributes of sorghum crop and negative effects were more pronounced with higher level of salinity ECiw (10 dS m-1). Irrigation with higher level of salinity ECiw (10 dS m-1) decresed the plant height (9%...

Daniel Stewart Robertson

... Also shown is that for protection against the common cold an individual has ideally to be vaccinated with attenuated versions of the virus particles produced by his or her own cells. Observations supporting the proposals are presented.

...
Stefan Pratama Chandra1, Yoanes Maria Vianney1, Theresia Liliani Christie2, Merlyn Wongso2, Melisa Widjaja2, Deok-Chun Yang3, Se Chan Kang4, Manar Fayiz Mousa Atoum5,6 and Johan Sukweenadhi1*
...he plant tissue culture protocol for the mass production of P. ginseng root cultures. This paper is the first report of in vitro P. ginseng culture in Indonesia. The initial stage of the mass production focused on optimizing the culture conditions: inoculum weight (100 g, 150 g, 200 g), medium volume (12 L, 13 L, 14 L), medium formulation (“A”, “B”), and incubation temperature (15 °C to 20 °C and 21°C to...
Ardi Prasetio1*, Christina Maria Sri Lestari2, Sutaryo Sutaryo2, Manar Fayiz Mousa Atoum3,4Muhammad Zahoor5, Asma Nisar6 and Muhannad Illayan Massadeh7
...l (SBM), as the primary protein source in rabbit ration, has some disadvantages. Protein value in Black Soldier Fly Larvae -BSFL (Hermetia illucens Linnaeus, 1758) is equal to SBM and better in the amino acid profile. However, the chitin contained in BSLF may cause subclinical inflammation by blood parameter detection. Thus, this study investigated the BSLF substitution effect on rabbit blood traits. This study was pe...

Niamat Ullah Khan1*, Umbreen Shahzad2, Azhar Abbas Khan2, Sami Ullah2, Muhammad Arshad Farooq2, Muhammad Kashan2 and Shitab Khan2

..., one tiller followed by rotavator) and conventional (20 cm depth, including disc plough, cultivator, rotavator, and levelling operations)] and five irrigation intervals (10, 15, 20, 25 and 30 days) on cotton yield and lint percentage. Total irrigation water used in irrigation treatments, 10, 15, 20, 25 and 30 days intervals were 1125, 750, 560, 450 and 360 mm, respectively. Results indicated that reduced tillage had higher ...

Faryal Malik, Mudassar Nawaz Khan* and Israr-ud-Din

... stress to 2.32 unit/mg protein at the end recovery period. SOD activity was increased from 2.27 to 3.15 unit/mg protein and POD from 1.71 to 2.39 unit/mg protein. The enzyme activities in Siran revealed the same trend as observed in Atta Habib. Recovery capacity was least in Ghanemat-e-IBGE. The results suggest that the tested three wheat varieties suffered oxidative stress due to floodin...

Dewi Ratih Ayu Daning1,2, L.M. Yusiati1, C. Hanim1, B.P. Widyobroto1*

... µL. In contrast, protozoa significantly decrease (P<0.05) across all treatments. Furthermore, 30 and 60 µL of galangal EO and cineole does not affect (P>0.05) microbial protein but 120 µL dose of galangal EO significantly decrease the microbial protein. At the genus level, galangal EO increases the abundance of Succinivibrio when added cineole showed a hi...

Sudip Debnath1, Dipta Sundar Sarker1, Pankaj Kundu1, Md. Shahin Parvez1, Shaikh Tareq Arafat1, Roshmon Thomas Mathew2, Yousef A Alkhamis2,3, Md Moshiur Rahman1, Sheikh Mustafizur Rahman1* 

...vival, growth, and body protein content of swordtail in triplicates. Swordtail juveniles (initial weight: 0.46±0.03 g and length: 3.28±0.30 cm) were randomly stocked in glass aquaria feeding ad libitum two times a day. After four weeks of feeding trial, survival of swordtail juveniles was high (≥ 90%) in all treatments and remained unaffected by the dietary treatments (P > 0.05). Differences in growth performance were realized in terms of f...
Yang Yang1,2, Ji Shao1,2, Mingxu Zhou3,4, Qiangde Duan1,2, Xinyi Zhang1,2 and Guoqiang Zhu1,2*

...g industry, while F4 enterotoxigenic Escherichia coli (ETEC) is an important pathogen causing diarrhea of newborn or weaned piglets, which seriously harms animal husbandry and causes huge economic losses. The pathogenicity of E. coli is closely related to its virulence factors, which are strictly regulated in vivo, and the quorum sensing system is involved in this process. To study the effect of quorum sensing signal molecule acyl homoseri...

Ahmed M. Elbaz*, Engy F. Zaki, Morsy A. S. 

... a source of energy and protein on performance, blood metabolite, and meat quality in broiler chickens. A total of four hundred and eighty 1-day-old Ross 308 chicks were randomly divided into four experimental groups: Control (CON), 5% of quinoa seeds (QS5), 10% of quinoa seeds (QS10), and 15% of quinoa seeds (QS15) groups. Results indicated that increasing inclusion levels of QS improved body weight gain, feed conversion ratio, and crude p
Tabinda Urooj1,*, Bushra Wasim1, Shamim Mushtaq2, Syed Nudrat Nawaid Shah1, Lubna Faisal3, Moazzam Ali2, Nabeela Rasheed1 and Syed Faizan Ali Rizvi4
...dbirth were observed as protective factors for this cancer. Also, majority of our study subjects were diagnosed at late stages of cancer (stage III and stage IV). Therefore, early detection will not only cure the breast cancer patients but also prevent them undergoing painful circumstances.
...
Romaan Hayat Khattak1, Zhensheng Liu1*, Liwei Teng1* and Ejaz ur Rehman2
...gered. Four species are protected under the Khyber Pakhtunkhwa Wildlife and Biodiversity (Protection, Preservation, Conservation and Management) Act, 2015. Threats being faced by the reported mammalian fauna from human activities are emphasized.

 

...

Rehman Shahzad1, Saba Irshad1* and Faisal Amin2

...Influenza viral surface protein neuraminidase enhances both virus replication and its release from host cells. In this study we isolated nineteen H9N2 viruses from infected birds of various farms from Punjab, Pakistan. Neuraminidase gene of these viruses was amplified using RT-PCR and sequenced to perform mutational analysis. Phylogenetic analysis revealed that B2 sub-lineage is endemic in the country as all isolated H9N2 strains belongs to this clade of G-1 l...

Asmaa G. Mubarak1*, Mona M. Mustafa2, Mohamed W. Abdel-Azeem3, Dina N. Ali2 

...f different Salmonella serotypes to hospitalized patients in Assiut Governorate, Egypt, as well as, to assess their pathogenic potential and antimicrobial resistance. Out of 150 chicken meals collected randomly from various restaurants and food shops including, shish-tawook, pane, and shawerma (50 for each), 10% were contaminated with Salmonella with the acquisition of shish-tawook (14%). On the other hand, 100 hand swabs that were assembled from food han...

Ho Shi Hui1, Eng-Keng Seow2, Nurul Huda1* 

...fects on duck egg white protein that influenced the physicochemical properties of egg white. Hence, ultrasound treatment for 40 minutes was suggested to produce duck egg white with better physicochemical properties.

Keywords | Duck egg, Egg white, Physicochemical properties, Ultrasound, Foaming  

...

K.M. Injarul Haque, Sharmeen Islam*, Md. Rokibul Islam Khan, Md. Ruhul Amin 

...iling period. The crude protein (CP), metabolizable energy (ME), and organic matter digestibility (OMD) were improved (p<0.05) but dry matter (DM), crude fiber (CF), ether extract (EE), and ash were declined (p<0.05) in all the treatments (T1, T2, and T3) compared to control T0. In the consideration of results among all the treatments, T2 and T3 up to 28 days were desirable for the preparation of silage. To sum up, rumen content can be utilized in rice s...

Rehman Shahzad1, Saba Irshad1*, Malik Saddique Mehmood1 and Faisal Amin2

... terminal region of NEP protein is conserved while C terminal region of effector domain (ED) of NSI protein exhibit mutations. These mutations are enhancing the total hydrophobicity of the molecules. Hydrophobicity was calculated by using Kyte and Doolittle method. High hydrophobicity of NS1 protein is also posing a potential for H9N2 virus to adapt in host, which might be contributing to ...

Yan Jiang1,2, Xia Tao3,4 and Hongxia Chen5,6*

...n indices such as urine protein quantification (Upro), blood creatinine (Scr), urea nitrogen (BUN)), serum albumin (ALB), nephrin, and BAFF levels before treatment, 3 months after treatment, and 6 months after treatment were compared between the 2 groups. Results showed that after treatment, the total effective rate of the study group was 93.48% higher than that of the control group 76.09% (P<0.05). The clinical symptom scores of the two groups were lower t...
Amjad Ali1, Muhammad Amir2*, Bilal Ur Rehman2, Zafar Khan3 and Abid Munir1
 
...>owadays,biometric data protection is one of the main security parameters to be looked after. In fingerprint processing, initially, appropriate proven methods are used for processing fingerprints in a sequential manner followed by the application of various encryption algorithms for ensuring protection of such biometric data. In fingerprinting, image processing techniques include: low-quality-fingerprint enhancement, normali...

Fang Zhao, Gen Wang, Xiaobin Li, Guodong Zhao, Hui Chen, Chen Ma and Kailun Yang*

...supplemented with rumen-protected 5-hydroxytryptophan (RPT 5-HTP) on the concentration of 5-hydroxytryptophan (5-HTP) and melatonin (MLT) in the plasma of sheep. Eighteen sheep were assigned randomly to three diet groups (n = 6). The treatment groups included control (CT, corn-soybean meal basal diet), CT + 111 (CT + 111 mg/kg BW RPT 5-HTP), and CT + 222 (CT + 222 mg/kg BW RPT 5-HTP) groups. The experiment lasted for 16 d. On the 16th day of the experiment, bl...

Shireen S. Aboelwafa¹, Alsagher O. Ali², Rania Hamada³, Hassan Y.A.H. Mahmoud2* 

...ninum are intracellular protozoan parasites that are distributed worldwide and of major economic importance in the livestock industry especially sheep and goats. Sheep and goats are thought to be biological indicators of environmental contamination with T. gondii and N. caninum oocysts. In addition, in developing countries such as Egypt, where sheep and goat meat is commonly consumed, T. gondii and N. caninum infection in small ruminants may also affect public...

Tintin Rostini1*, Irwan Zakir1, Danang Biyatmoko2 

..., organic matter, crude protein, NDF, ADF, daily body weight gain, feed conversion, and blood metabolism. Furthermore, the data obtained were analyzed using analysis of variance while differences between treatments were further analyzed with Duncan’s test. The results showed that yeast + curcuma (TR3) supplementation had a significant performance by increasing consumption, dry matter digestibility, organic matter, crude prot
Lin Ye, Jie-Lan Jiang*, Jia Xu, Rui-Ting Liu, Yin-Qiu Tian, Qing-Qing Zang, Jia-Yi Cao and Ming-Guang Mao*
...ed that TrCLCN5-deduced protein was a type III transmembrane protein and lacked a typical signal peptide. Conserved Domain analysis revealed that there was a Voltage_CLC domain and two CBS domains located in the TrCLCN5 deduced protein. qPCR analysis showed that TrCLCN5 was highly expressed in the intestine, kidney and liver, and up-regulated in gills under low-salinity stress in 3h to 6h,...

Chunjie Song1, Shangquan Gan2 and Xiaoyun Shen1,3*

...of potassium (K), total protein (TP), albumin (ALB), globulin (GLB), and total antioxidant capacity (T-AOC) in the 3 drug delivery groups were extremely significantly higher (P<0.01) than that of control group, but there were no remarkable differences between the 3 drug delivery groups. The serum catalase (CAT) activity in the high-dose group was extremely significantly higher (P<0.01) than that in the low-dose group, gentamicin sulfate group, and contro...

Keqiang Wei1*, Yue Wei2 and Changxia Song1

...trong staining of these proteins in hepatopancreatic cells was observed. The synchronous expression of p38 and its phosphorylated form (p-p38) was mainly present in B- and R- cells, and their MOD values were 0.0055±0.0038 and 0.0046±0.0027, respectively. As its downstream transcription factors, both RelA (p65) and Nrf2 were widely distributed in the cytoplasm of B- and R- cells, but RelA (p65) showed a relatively higher MOD level compared to Nrf2...

Mohammad Hussain Haidary1, Rozanaliza Radzi1*, Muhammad Waseem Aslam1, Seng Fong Lau1, Farina Mustaffa Kamal2, Ahmad Rasul Radzali1 

...indings. Elevated total proteins (96.5%) and hyperglobulinaemia (96.5%) were remarkable findings in biochemistry results. Thrombocytopenia was prominent and found in 70.9% of cats. Treatment options were varied; 39% (22/57) of the cats showed no signs of FCGS with various medical combination treatments based on owner observation, while 33% (19/57) succumbed to death. Partial and full mouth dental extraction was applied in 16/57 (28%) cats and result exhibited...

Zheng Tan*, Li Li, Yuxin Song, Meirong Tian and Fan Jia

...gh sensitive c-reactive protein in patients with CHD were observed and analyzed. The levels of serum endothelin, brain natriuretic peptide and high-sensitivity c-reactive protein were significantly higher in AMI group compared to UAP group, SAP group and the control group, p<0.05. The level of indicators in the UAP group was higher than that in the SAP group and the control group, p<0.05. Compared with the control grou...

Sameh Abdel-Moez Ahmed Amer1*, Mohamed Abdel-Aziz Kutkat1, Mohamed Mahmoud Abdel-Baki1, Asmaa Mahmoud Maatouq1, Omnia Mohamed Kutkat2, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1 

...ger provide an adequate protection for birds against ND outbreaks, where expected to be due to genotype mis-matched vaccines to the rapidly evoluted NDV field strains. Herein, the present study investigated the prevalence and the phylography of currently epidemic genotypes of NDV. Out of 550 samples were collected during an active surveillance in 2020 and 2021 from different poultry farms in five Egyptian governorates, 100 pooled samples were tested for NDV id...
Johar Hussian1, Faiz Muhammad2, Shafqat Fatimah Rehmani3, Aqeel Ahmad4, Nazir Ahmad Lone4, Moomal Bughio5, Syed Khurram Freed1 and Shakeel Ahmed Khan4*
...ol due to its multiple serotypes. The disease could be prevented by rapid diagnosis either molecular or serological test. However, the later test is inexpensive such as heamagglutination inhibition test (HI), but IBV fail to give Heamagglutination (HA) reaction without pretreatment. Therefore, we designed this study for preparation of IBV antigen by treating with different enzymes for HA reaction. IBV local isolates were characterized by SDS-PAGE and RT-PCR. T...

Tran Thi Bich Ngoc1,2, Ninh Thi Huyen1,2, Nguyen Cong Oanh2, Pham Kim Dang2* 

... tract digestibility of protein, organic matter, neutral detergent fiber, and phosphorus than those fed CONT diet. A significant decrease in ammonia (NH3) and hydrogen sulfide (H2S) concentrations were observed in diets with PROB or ORAC or PROR, with lower values for PROR diet. In conclusion, in grower-finisher pigs, dietary supplementation of either PROB or ORAC as a single product or their combination had improvements in performance parameters, nutrient dig...

Esraa Yosry Abdel Halim1, Hamdy El-Essawy1, Abeer Abdel Nasser Awad1, Mona S. El-Kutry2, Lamiaa Ibrahim Ahmed1* 

...and mold. Additionally, proteolytic and lipolytic organisms were present nearly in most of the examined samples, which resulted in lowering the flavor and texture scores of the tested products. Finally, public awareness targeting the imported companies and good hygienic practices should be fullfilled during handling, packaging, storage and distribution.

Keywords | Milk powder, Labneh, Cheddar cheese, Microbial examination, Sensory characteristics, E. c...

Jarmuji Jarmuji1,3, Lili Warly2*, Mardiati Zain2, Khasrad Khasrad2

...rm flour as a source of protein as a substitute for rice bran. The treatments were arranged as follow: P0= OPF + concentrate + 10% commercial sakura block, P1 = OPF + concentrate + 6% sakura block plus, P2 = OPF + concentrate + 8% sakura block plus, P3 = OPF+ concentrate + 10 % sakura block plus, P4 = OPF + concentrate + 12% sakura block plus, P5 = OPF+ concentrate + 14% sakura block plus. Supplementation of sakura block plus in OPF was able to increase rumen ...
Zane Vincevica-Gaile1, Karina Stankevica1, Maris Klavins1, Roy Hendroko Setyobudi2, Damat Damat3*, Praptiningsih Gawawati Adinurani4, Lili Zalizar5, Muhammad Zul Mazwan6, Juris Burlakovs7
Didiek Hadjar Goenadi8,9, Rista Anggriani3 and Aamir Sohail10
 
 
...eat-free product made by rotary drum granulation from biomass fly ashes (energy production waste) and local freshwater sediments in a mass ratio mixture of 67:100, optimally applicable for soil improvement at a rate of 50 g L–1. Besides, regional opportunities in Indonesia and Latvia are referred. It was concluded that peat-free soil amendment elaboration can be better implemented on a regional scale after assessing agricultural need...
Indah Prihartini1*, Miftachi Ari2, Manar Fayiz Mousa Atoum3,4, Akhis Soleh Ismail1 and  Listiari Hendraningsih1
...efficiency of microbial protein synthesis using in vitro residual gas production and the optimal lignolitic probiotic in rice straw. The materials used were rice straw IR 64 cultivar and lignolitic TPG probiotic. The method used was Randomized Complete Block Design (RCBD) with four levels of treatments and three groups. In addition, a further test was conducted using Duncan’s multiple range due to a significant difference. The treatments were rice straw ...

Shang Zhenda1,2*, Kong Qinghui1,4*, Li Jiakui1,4, Liu Suozhu1,2, Tan Zhankun1,2, Shang Peng1,3 and Wang Honghui1,2

...k than in domestic yak. Proteobacteria, Epulopiscium, Amycolatopsis, Brucellaceae, Sediminibacterium and Rhodococcus were significantly higher in domestic yak than in wild yak. The present study reported the microbial diversity of bacteria between wild yak and domestic yak. The findings can help improve the production performance and disease resistance of domestic yak.

...

Lin Huang1, Ling Mai2, Keyan Zhong1 and Xinjun Chen3*

...paei fatty acid-binding protein (SeFABP) and obtain its recombinant protein, the basic physio-biochemistry characteristics, signal peptides, antigen epitopes, transmembrane domains, secondary and tertiary structures, multi sequence alignment and molecular evolutionary tree of SeFABP were predicted and analyzed. On this basis, SeFABP was whole-genome synthesized and cloned into prokaryotic expression vector. The recombinant p...

Yao Zou, Shien Ren, Miao Xu, Nannan Liang, Xuxin Zhang, Chongxuan Han and Xiaoning Nan

...ospalax cansus, Eospalax rothschildi, Eospalax baileyi, and Myospalax aspalax. We also used principal component analysis and dichotomy to explore key measurements which could reflect skull differences to the maximum. In addition, we tested the correlations between environmental factors and skull measurements for each species. The results of variance analysis indicated that three zokors showed male-biased sexual size dimorphism except for E. baileyi. We also fo...

Lanjie Li1, Jingjing Zhang2, Ruiyan Zhang2, Ning Zhang2, Zixiang Wei2, Guiqin Liu1,*, Riaz Hussain Pasha3, Muhammad Akram Khan4 and Saif-Ur-Rehman5

... of hydrolysis (DH) and protein recovery (PR) were evaluated, and the chemical composition, antioxidant activity, and molecular weight distribution of oligopeptides in hydrolysates were studied. The optimum enzymatic hydrolysis conditions were identified at 5.96 pH, 0.7% enzyme-substrate ratio, 55ºC temperature and 3 h time. Under these optimum conditions, DH of 25.4%, PR of 95% was obtained. Moreover, hydrolysates were rich in oligopeptides, especially d...
Syed Makhdoom Hussain1,*, Hina Gohar1, Muhammad Asrar1, Muhammad Mudassar Shahzad2, Azhar Rasul1, Majid Hussain3, Muhammad Zubair ul Hassan Arsalan1, Nisar Ahmad4 and Aqsa Sharif1
...mate composition (crude protein, crude fat, ash, moisture and carbohydrates) were noted in fish group fed on 400mg/kg of polyphenols in diet. Hence supplementation of polyphenols at 400mg/kg was found to be optimum for better hematology, minerals absorption and carcass composition of common carp.

...

Fujun Miao1, Chunlan Shan2, Wei Yang3, Hao Wang3, Shuxiang Geng1 and Delu Ning1*

...nts. In this study, the protective effects of walnut oil isolated from Juglans sigllata on livers of alcoholic liver disease (ALD) mice were studied. The results showed that serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the ethanol + walnut oil (ETH + WO) and ETH + silymarin positive group (PC) groups significantly decreased, and the lesions of ethanol-induced liver injury were relieved compared with the ethanol (ETH) group. Waln...
Damat Damat1*, Roy Hendroko Setyobudi2, Juris Burlakovs3, Zane Vincēviča-Gaile4
Devi Dwi Siskawardani1, Rista Anggriani1 and Anas Tain5
...ent, ash, carbohydrate, protein, fat, antioxidant activity, fiber content, water absorption index, color intensity, and sensory evaluation. The data were analyzed by ANOVA and continued according to Duncan’s multiple range test. The results showed that all formulas of analog rice produced from arrowroot starch, with the addition of seaweed pulp and spices, fulfill the chemical and physical properties of paddy rice requirements according to Indonesian Nat...

Noura El-Shahat Attia1*, Abd El-Khalek Ramadan El-Sheikh1, Mohamed Omia Siam2 

...volume (PCV), total erythrothetic count (TEC), white blood cells (WBCs), serum glucose, total proteins and serum Zn were significantly decreased. Moreover, while copper (Cu) and iron (Fe) were significantly increased (p<0.05). All diseased dogs were treated with Zn sulphate @10mg/kg orally and daily for 14 days, and the treated dogs revealed a marked improvement in clinical signs and other different hematological and bioc...

Saima Parveen1, Altaf Mahmood2*, Ayesha Azad3, Sajid Umar4, Nosheen Shoukat6, Mirza Muhammad Arsalan Azam5, Qurat-Ul-Ain5 and Nausheen Akhtar Malik1

...tory disease (7.67%), necrotic enteritis (6.48%), coccidiosis (6.09%), mycotoxicosis 5.43%), fowl cholera (4.74%), infectious coryza (4.41%), fowl typhoid (4.22%), omphalitis (3.71%) and hydropericardium syndrome (0.05%). Maximum share in crude morbidity was contributed by bacterial diseases with highest proportional morbidity of 48.68% followed by viral (40.32%), parasitic (5.80%) and fungal (5.20%) diseases. This epidemiological data represents true picture ...

Jing Fu

...fic AT sequence binding protein 2 (SATB2 Group) and Cytokeratin 20 (CK20 Group) in mucinous ovarian tumors and their correlation with tumor pathological classification and prognostic outcome. One hundred and sixty cases of ovarian mucinous tumors diagnosed from January 2018 and January 2020 were selected. They were divided into four groups: mucinous cystadenocarcinoma group (age 62.78±7.92, n=53), borderline mucinous cystadenocarcinoma group (age 63.82&...

Zhang Dong-jie1, He Xin-miao1,2, Wang Wen-tao1,2 and Liu Di1,2*

...es encoding zinc finger proteins. Additional genes associated with myokinesis and lipid metabolism were also identified as under selection. Only SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) interactions in the vesicular transport pathway were identified as under selection (P=0.0029). This study describes the genomic framework of the Min pig and identifies signatures of selection. These resul...

Maid Zaman1*, Imtiaz Ali Khan1, Amjad Usman1 and Ahmad-Ur-Rahman Saljoqi2

...cies from the genera Heterotermes (02), Odontotermes (04) and Angulitermes (01). Genus Odontoteremes is more strengthened (57%) in number of species followed by genus Heterotermes (29%) and genus Angulitermes (14%). In district Buner, wood and Pinus were mostly attacked by the various species. Similarly, in district Haripur, wood was most attacked followed by grasses and acacia while in district Swabi most attacks were noted...

Wafaa M.A. Ghoneem, Reham R. El-Tanany and Adel E.M. Mahmoud*

...sed as digestible crude protein. And there were insignificant (P<0.05) differences between G1 and G2 in the digestibility (%) of OM, CP, ADF, and TDN values. While the highest nutrients digestibility and nutritive value were recorded in G3 (2% zeolite addition) Rumen parameters were in the normal range and with insignificant (P<0.05) differences among groups. The pH values tended to increase but concentrations of ruminal NH3-N and TVFA tended to decrease...

Mukhlisi Mukhlisi1,*, Tri Sayektiningsih2 and Ishak Yassir1

...itat for threatened and protected bird species.

...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Sher Shah Souri1, Bibi Amina3, Wajia Noor4, Abidullah1 and Muhammad Adil1

... an important source of protein for a vast majority of the country and an important place in order to mitigate the protein requirements of increasing population. Mungbean has more protein contents and better digestibility than any other pulse crop. A field study was carried out at Agronomy Research Farm, The University of Agriculture, Peshawar in summer season 2018 with objectives to find ...

Amir Z. Allam, Hayam A. Mansour, Nermeen M.L. Malak, Heba H.S. Abdel-Naeem* 

... plate count (APC), psychrotrophic, Enterobacteriaceae, and lactic acid bacterial (LAB) counts. The results revealed that the sole effect of T, CL, and O oleoresins caused non-significant reductions in all investigated bacterial counts. Among the treated groups (T, CL, or O alone), it was found that O oleoresin achieved the highest reduction rate, followed by CL while the least reduction rate was recorded in samples treated with T. Therefore, addition of O int...

Bikash Puri1, Anil K. Tiwary2, Bharata Regmi3,4, Dinesh K. Singh1, Doj R. Khanal5 and Manoj K. Shah3*

...e species level and to serotype the BTV prevalent in the study areas.

...

Hams M.A. Mohamed1, Mona A. El-Zamkan2* 

... to produce biofilm and protease enzyme. All the isolates displayed resistance to penicillin and oxacillin, while, two isolates were resistant to vancomycin and erythromycin, and three isolates were resistant to linezolid. None of the isolates were resistant to tetracycline, chloramphenicol or clindamycin. B-lactams drug resistance encoded by pbp1A gene could be detected in all the isolates, while one isolate harbored vanA and optrA gene, and no isolate harbor...

Hong Yin*, Dan Yang, Ji-Jie Liu, Jing-Wei Ding and Dan-Dan Cui

...udies showed the tissue protective role of β-CM-7 in aged mice. The treatment of β-CM-7 in aged mice significantly increased the triglyceride (TG) level with decreasing high density lipoprotein (HDL) level in serum. The superoxide dismutase (SOD), glutathione peroxidase (GPx) activities and malondialdehyde (MDA) level were significantly increased in liver tissues with β-CM-7 treated. β-CM-7 decreased the ...
Muhammad Tariq1, Imtiaz Rabbani2, Muhammad Shahbaz Yousaf2, Imdad Ullah Khan1*, Hafsa Zaneb2, Sajid Iqbal3, Alam Zeb Khan1, Shakirullah1, Muhammad Shuaib Khan1, Atta Ur Rehman1 and Mumtaz Ali Khan2
...icance, while it has no protective effects on other parameters like Acrosomal integrity, DNA status and oxidative stress. However further studies are needed to assess the role of Gallic acid in different concentrations and in other animals. 

...
 Mian Abdul Hafeez1*, Adeel Sattar2, Faiza Aslam3, Muhammad Imran3, Kamran Ashraf1, Rashid Zia2 and M. Muntazir Mehdi1
...C. This study suggested protective, therapeutic as well as a synergistic effect of Ibuprofen with clopidol in chicken coccidiosis.

...

A.H. Alqhtani1, A.S. Alharthi1, N.J. Siddiqi2, S. Zargar2 and A.M. Abudabos1*

...s. However, total serum protein, gamma glutamyl transferase (GGT) and alkaline phosphatase (ALP) showed no significant differences between the groups. Thus, it can be concluded that probiotic, prebiotic and symbiotic in feed may cause some degree of liver damage as indicated by the release of AST and ALT in the serum.

...

Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1

...ify;">Gemini virus coat protein (CP) is an important element of vector specificity and mandatory for insect transmission as well regardless of the type of gemini virus. This study was planned to conduct virus acquisition and transmission experiments using screen cages in an insectary for the period of one month. For this purpose non-viruliferous whiteflies (B cryptic species) were reared and used to acquire the viruses for 48-72 h from the agroinfiltered sympt...

Doaa Sh. Mohamed1, Nema S. Shaban2 , Mai M. Labib3, Olfat Shehata4 

...ate if almond oil could protect male mice against doxorubicin-induced cardiotoxicity. The experimental mice were divided into three groups; control group: received 0.9 percent saline, doxorubicin group: Mice were intraperitoneal injected with doxorubicin (5 mg/kg) ithree times over a period of two weeks (dose every five days) and almond oil group: Mice were administered almond oil orally (2.26 g/kg) using oral gavage daily over a period of three weeks, one wee...

Kanakuntla Sandhyarani*, Dhoppalapudi Madhuri, Yadala Ravikumar 

...um (>2%), high crude protein (> 30%), Hypovitaminosis A, Hypervitaminosis D3, dehydration, high sodium carbonate, Copper sulfate, mycotoxins in feed causes renal failure leads to gout. The managemental practices involves high brooding temperature thereby reducing the water intake and hence increasing chances of development of gout. In addition, products used on a routine basis and result into toxicity includes antibiotics, anticoccidials, manufactured ch...
Heba Mohamed Shaheen1, Ali Meawad Ahmed1*, Hosny Abdelltief Abdelrahman1, Rania Helmy Abohatab Abdou2, Aya Salama Mohamed Kamel1
... tetracycline (TTC), chlorotetracycline (CTC), and doxycycline (DOC) in broiler samples were 160.26, 89.19, 98.75, and 175.64µg/Kg respectively. Based on the local and international regulations, the results revealed that out of 260 positive samples for tetracycline levels, 170 (65.4%) were unfit the maximum residual limit and 90 (34.6%) broiler samples were agreed with the MRL. After the samples were simmered, the average concentration values of OTC, TTC...

Muhammad Amin1*, Masarrat Yousuf1 and Naveed Ahmad2

...and 48 h and then total protein was estimated in the brain, gills and muscle tissues. Significant (p< 0.005- 0.00) decreased in total protein was noted in response to all the pesticides as compared to control group and a slight increase was also noted during 48 h as compared to 24 h. The level of total protein was decreased for pesticides in order of chlorpyrifos>malathion> lambda...

Shakila Mumtaz1, Khalid Javed1, Muhammad Dawood1*, Muhammad Imran2, Asad Ali1 and Nazia Ramzan1

...d ration fed. Different proteins can be found in milk. Beta-caseins are thought to be more important because some serious health-related issues in humans have been reported with the consumption of A1 milk (mutated casein variant). This study was planned to investigate the polymorphism in the beta-casein gene (CSN2) in Sahiwal (40), American Holstein Friesian (40) and the crossbred (Sahiwal × HF) (50). PCR-RFLP and conformational sequencing were performed...

Jie He* and Ren Yang

...ed (P < 0.05), Bcl-2 protein expression was increased (P < 0.05), Bax protein and caspase-3 protein expression was decreased (P < 0.05). In conclusion, propofol and vitexin could up-regulate expression of Bcl-2 protein, down-regulate expression of Bax and caspase-3 protein, inhibit cell apoptosis, reduce liver...

Qaisra Siddique1*, Sajid Abdullah1, Huma Naz2, Khalid Abbas1, Laiba Shafique1 and Qingyou Liu3

...GST) activity and total protein contents in various tissues (gills, hepatic, renal, brain, muscle and cardiac) of Labeo rohita was determined. Fish was exposed for 60-day and sampling was done after 7-day. Results showed that the GST activity was considerably increased in L. rohita as compared to control. The GST activity was enhanced in various tissues (hepatic, brain, cardiac, gills, renal and muscle) of CPF treated fish as compared to control group. Compari...
Soliman Mohammed Soliman
...monia concentration and protozoal population. Furthermore, the addition of probiotics or green seaweed to the diet has significantly improved milk yield and composition compared with yucca supplementation, as well as decreased the somatic cells count (SCC) as a result of feed additives. Experimental feed additives contributed to enhancing beneficial processes and the reduction of methane production.

Nuzhat Naseem, Sajid Abdullah and Sana Aziz*

...ncreased the crude ash, protein and fat significantly in proximate composition of whole-body of the fish and hence, improved the meat quality of Labeo rohita fingerlings.

...

Fatma Desouki Mohammed Abdallah

...rces for human feeding (protein source) then, statistical analysis of animal characteristics is of great importance. The objective of this paper was to explain and apply an important statistical method called principle component analysis to extract new carcass trait components of Japanese quail from old variables. The idea of this method is that it forms a new variable (linear combinations of them) by reduction the dimension of the data for a large number of o...
Alshimaa A. Hassanien1*, Asmaa Osama Tolba2, Asmaa A. A. Hussein3, Walaa M. Elsherif4
...ural agents of cow milk proteins such as casein and α-lactalbumin on S. aureus isolates of chicken and beef meat and human. Bacteriological culture and PCR were used for S. aureus detection in 150 meat products (50 grilled chickens, 50 grilled beef kofta, and 50 cooked beef meat) as well as 92 food handlers. 23S rRNA gene sequencing was done. Disk diffusion method was used for antimicrobial resistance detection, while the impact of casein and α-lac...

Hassan Ali1, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1* and Muhammad Imran Hamid2

...r frequently used grain protectants. This situation necessitates looking for alternate biorational control options such as botanical and microbial insecticides. This in-vitro study assessed the anti-insect potential of four local plant extracts and two promising microbial formulations against 5th instar larvae of T. granarium. Toxicity bioassays revealed that the extracts of Citrus reticulata L. and Solanum nigrum L. were most effective against T. granarium ca...

Houria Bouazzara1,2,*, Rachid Chaibi 1,2, Farouk Benaceur 1,2,3, Amira Nouioua4 and Laura Bruno 5

Asmaa Sh. Fayed1*, Safaa M. Abo El-Soud2 

...total bacteria, and psychrotrophic bacteria, as well as pH, thiobarbituric acid (TBA), and total volatile base nitrogen (TVB-N), especially for 4% GA/ zein wax film. The coatings resulted in the prolongation of the shelf life of meat chunks. The shelf lives of the control, the 2%, and the 4% GA-coated meats were 7, 9, and 11days, respectively. Coated meats had higher overall sensory acceptability scores compared to uncoated ones. The antioxidant capacity, the ...

Mohamed Saeed M. Hassan¹, Hitham Abdel-Saeed1*, Kawkab Abd El Aziz Ahmed2, Ossama Mohamed Abdou1 

...nd 3 (P≤0.01). Total protein decreased significantly in sub-groups 1and 3(P≤0.001), sub-group 4 (P≤0.01) and sub-group 2 (P≤0.05). All results were in comparison with apparently healthy group records. Etiopathological identification of canine anemia in the light of hematobiochemical status is helpful for further investigations and therapeutic protocol decisions.

Keywords | Anemia, Dogs, Etiopathologies, H...

Heba El-Zahar*, Zeinab Abd El-Rahman, Abbas El-Naggar 

...valuation of C-reactive proteins (CRP), haptoglobin and fecal calprotectin concentration as prognostic markers in dogs with IBD. After a detailed clinical, laboratory and ultrasonographic examination 21 IBD dogs with symptoms of chronic gastrointestinal diseases were chosen for the study. In addition to 11 healthy dogs served as control group. In comparison to controls, hematological analysis revealed significant variations ...

Palwasha1, Siraj-ud-Din1 and Muhammad Fahim2*

...hangla Districts). Peach rot and fruitflies, are prevalent in all peach growing areas. Thirteen diverse insecticides and 22 fungicides alone or in combination are used to manage this twin menace. The indiscriminate use of agrochemicals i.e., 24-30 sprays per season with no effective results; led us to believe that either the pest or pathogen or both might have developed pesticide-resistances. We conclude that i. lack of knowledge about pests and diseases, ii m...

Naila Shahzadi1, Hafiz Muhammad Tahir1*, Shaukat Ali1, Muhammad Farooq Bhatti2, Azizullah1, Shafaat Yar Khan3, Abdul Khaliq4

...us nutrients like Amway protein, honey, bovine milk, sericin, probiotics (Bacillus cereus, B. subtilis, B. amyloliquefaciens, B. licheniformis, Lactobacillus casei, Saccharomyces cerevisiae and Spirulina), vitamins (C and E), royal jelly, ascorbic acid, cowpea seed powder, AgNPs, secondary metabolites (phenols flavonoids, phenolic amino acids and proline) and white hen’s egg at different larval instars. Economic parameters (pupal weight, shell ratio (%),...

Muhammad Hanif Khan1, Syed Muhammad Suhail2, Hayaz uddin1, Aitbar Khan3, Rashid Ahmed Magsi3, Rajwali Khan2*, Iftikhar Ahmed2, Asim Ijaz2 and Khalid Khan2

...on produced higher milk protein (3.43±0.04%). Higher (P<0.05) total milk solid not fat (SNF) content was recorded for animals fed with 20g yeast culture ration. Daily feed intake was significantly (P<0.001) different among groups, highest mean daily feed intake of 38.74±3.36 kg/day was found in group C. Economically ration having 40g YC produce 145.04 liter more milk, worth (145.04 X 70 = Rs.10152.8/-) than control group, while extra cost o...
Hanan A. Abo-State*, Mosaad M. El-Monairy, Yasser A. Hamouda, Hussein M.A. Hassan
... contained 30.36% crude protein and 3879 kcal kg-1 gross energy with different levels of PSO (0.0 (control), 25%, 50% and 75% from the source of vegetable oil that was added to the basal diet). Fish (300 male) were distributed randomly into four groups (4 groups x 3 replicate x 25 fish of each). All groups were fed diets twice a day during the trial period (56 day) at 5% of body weight for the first two weeks thereafter at 4% for the last period. The results s...

Sana Shakoor, Tahir Rehman Samiullah, Naila Shahid, Abdul Qayyum Rao*, Aneela Yasmeen, Sana Tahir, Ayesha Latif, Saira Azam, Ahmad Ali Shahid and Tayyab Husnain

.... The specificity of HA protein produced from E. coli was confirmed through an antibody-antigen reaction on the nitrocellulose membrane. The appearance of 67 KDa protein on the nitrocellulose membrane confirmed its specificity. The intraperitoneal immunization of mice with HA protein along with enhancer (ferund adjuvants) was done and produced antibodies in serum was detected by immunodot ...

Fan Da1,3, Zheng-Yong Wen1,2*, Xiao-Dong Wang4 and Yu Luo5

...n: justify;">Uncoupling protein-2 (UCP2), an important member of the inner mitochondrial membrane protein families, plays pivotal roles in energy expenditure, fatty acid metabolism and ROS emission in mammals. In contrast to mammals, the roles of this protein are still rarely known in fish. Here, we first identified the ucp2 gene in yellow catfish (Pelteobagrus vachelli) and investigated i...

Safaa M. Barghash1*, Amani A. Hafez2

... is the most ubiquitous protozoan parasite with a wide geographical distribution. The current study aimed to investigate if Trypanosoma evansi induces immunosuppression that may interfere with the development of immunity after vaccination in rats against Pasteurella multocida. T. evansi-infected and non-infected Wester Albino rats immunized against pasteurellosis with two vaccines; one is commercial, and the other is a formalin-killed vaccine (prepared from a ...

Amal Hamad1, Ashraf M. Abu-Seida2*, Faisal A. Torad2, Nahed S. Thabet3, Shabaan M. Gadallah1

..., serum levels of total protein (TP), albumin, urea, creatinine, creatinine clearance and serum enzymatic activities of alanine transaminase (ALT) and aspartate transaminase (AST) along the whole experiment. Meloxicam induced no sedation, no behavioral changes, insignificant increase in heart rate, significant increase in systolic, diastolic and mean blood pressure and significant increase in respiratory rate after 15 and 30 minutes. In conclusion, meloxicam i...

Ly Thi Thu Lan1, Nguyen Thi Anh Thu1, Lam Thai Hung2, Nguyen Thi Hong Nhan3, Le Thanh Phuong4, Nguyen Trong Ngu3* 

Muhammad F Tajol Ariffin1, Chai M Hian1, Muhammad Z Sukiman1, Mohd F Ghazali1, Siti M Zainal Ariffin2* 

...o determine acute phase protein (APP) and its association with somatic cell count (SCC) during experimentally induced subclinical mastitis in goats. Thirty lactating goats were divided into two groups (n=15 per group) challenged either by intramammary infusion of 1 x 103 cfu/mL Staphylococcus aureus (S. aureus) or phosphate-buffered saline (control). The haptoglobin (Hp), serum amyloid A (SAA) and α1-acid glycoprotein ...

Magdy M. Fahmy1, Nisreen E. Mahmoud 1*, Mohamed R. Mousa2, Manal M. Zaki3, Elshaimaa Ismael3, Mai Abuowarda1 

...eans, 4Monogeneans and2 Protozoans) of which the crustaceans recorded the highest prevalence (63.67%). In the present study, Manzala Lake and its corresponding fish farms considered new localities for the detected crustacean and monogenean species. Significant positive correlations between the prevalence of parasitic infestation and water quality parameters were reported. Pathological finding of the affected fish tissues revealed deleterious responses especial...

Nazakat Nawaz1, Nasir Mahmood Cheema2*, Malik Muhammad Yousaf3, Muhammad Jahanzaib1, Mubashir Ahmad Khan1 and Muhammad Munir4

...cm, oil content 53% and protein content 28%. It was also evaluated under natural field condition to check its potential and tolerance against fungal disease and insects. The subject line is rated as moderately resistant to fungal attack. At the same time, it is 10 to 15 days earlier than check varieties i.e. BARD-479 and Golden. PG-1090 has been approved by concerned authorities as a new variety with the name NARC-2019 for cultivation in rain-fed as well as ir...

Mudssar Ali1*, Muhammad Awais Ahmad1, Asif Sajjad2 and Shafqat Saeed1

...text-align: justify;">Carrot is one of the most consumed vegetable in Pakistan and ranked among top ten vegetables grown across the world. The present study was designed to evaluate the diversity and effectiveness of native insect pollinators in carrot seed production. An experiment was performed at the research farm of MNS University of Agriculture, Multan during vegetative season (October-April) in 2019-20. Seven syrphid f...

Aymen Mabrouk*

...xt-align: justify;">The protective role of thymoquinone (TQ), the major active ingredient of volatile oil of Nigella sativa seeds, against the deterioration of blood indices by lead (Pb) has never been studied. Therefore, the present study was carried out to evaluate the possible beneficial effect of TQ against Pb-induced hematological changes. Adult male Wistar rats were treated with Pb (2000 ppm of Pb acetate in drinking water) and/or TQ (5 mg/kg/day, per os...

Yaruq Jabeen1, Nida Ansari1, Haroon Rasheed1, Muhammad Asif Rasheed1,*, Muhammad Awais2, Muhammad Ibrahim1, Sumaira Kanwal1, Aqsa Khalid3, Manzoor Ahmad Zahid4 and Farrukh Jamil1,*

...king of a ligand into a protein by seven steps. For docking analysis of several ligands, AutoDock Vina is a time-consuming tool. In order to make AutoDock Vina more efficient and smart way, a platform has been developed in this study. It is designated “Let’s Dock”. By using this platform, we can perform a docking analysis of several ligands into a protein with AutoDock Vina by just submitting ligands and p<...

Ji Xu, Zhonghua Liu, Zhenhai Cui and Wenhai Zhao*

...f Bax, cleaved-caspase3 protein were significantly increased (P <0.05), the protein level of Bcl-2 was significantly reduced (P <0.05), and the expression level of miR-99a was significantly reduced (P <0.05). After GSTT treatment, the levels of inflammatory factors IL-6, TNF-α, and IFN-γ were significantly reduced (P <0.05), the apoptosis rate was significantly reduced (P <0.05), and the p

Sheng Dong1*, Ning Li2, Jiawei Zhang2 and Ting Wang2

..., GRP94, and Caspase 12 protein expressions. We found that DS enhanced the proliferation of high glucose-induced podocytes (P<0.05), increased the number of clones formed (P<0.05), reduced the apoptosis rate and GRP78, GRP94, Caspase 12 protein levels (P<0.05), and increased Nephrin protein level (P<0.05). High glucose-induced podocytes had increased KCNQ1OT1 expression level (...

Hamdy Abdala Elnagar*, Wael Mohamed Wafa, Moataz Ibrahim Badwy, Abdelaziz Mustafa Sakr 

...tween blood plasma (BP) proteins and seminal plasma (SP) proteins in low and high fertile buffalo-bulls. Also, the relationship between protein profile in BP of adult bulls and bull calves were studied. Blood samples were taken from 3 calves (128.33±7.58 kg and ageing 6 mo.) and 10 bulls (400±37.5 kg and 24-25 months of age) and semen samples from bulls. Semen was collected o...

Taiwo Oladoye Akande*, Dayo Johnson Ogunyemi, Priscilla Funmilola Okunlola, Emmanuel Owolabi, Odetayo Olakanmi 

...rom Tumeric to moringa. Protein digestibility increased by 5% and 3% in birds fed garlic and the blend respectively while about 4% increase in fat digestibility was observed in birds with PFAs. The PFAs exhibited varied positive influence (P<0.05) on carcass yield, but no difference (P>0.05) was observed in the organ weights of the chickens. The fat deposition was substantially reduced (P<0.05) in birds with PFAs. The blood triglycerides, cholesterol,...

Ejaz Ali and Nageen Hussain*

... encodes a gap junction protein involved in the homeostasis of the inner ear by recycling potassium ion. This research aimed to find out mutations in the GJB2 gene and its protein structure. Both control and patient samples were collected from Gilgit-Baltistan for DNA isolation and PCR was done by using a specific primer while sequencing was done by Sanger sequencing. Mutations were detected by Mutation Surveyor and BLAST. P...

A. Samy1*, H.M.A. Hassan1, Fatma T.F. Abd-El Ghany2, Shama H. Morsy2 

...ignificantly meat crude protein (P<0.05) while, decreasing moisture and fat levels. Digestibility coefficients of CP, CF, and EE, as well as the nutritive values of TDN, DCP, and DE, were considerably improved (P<0.05), although DM, OM, and NFE digestibility was unaffected in all treatments. Considerably, Addition of curcumin or garlic extract boosted final weight, weight gain, and feed efficiency compared to the control group. Dietary treatments were si...

Honnakerappa S. Ballari1 and Shashikant S. Udikeri2*

...s recorded against monochrotophos with LC50 160.94 ppm and 18.23 resistance ratio in Rachur population itself. The same population exhibited 9.24 resistance ratio towards thiodicarb a carbamate insecticide. Kalaburagi population indicated resistance close to Raichur population against all insecticides both being high selection pressures areas. On the contrary resistance to each insecticide tested was low in Vijayapur population, a low rainfall area. The cross ...

Rabia Bibi1, R. Muhammad Tariq2, Samir A.M. Abdelgaleil3 and Munawwer Rasheed1, 4*

...4 mg/cm2) after 48 h. Neurotoxic effects were also determined after 12 and 24 h. L. karachiana was the second in toxicity against C. maculatus and S. oryzae population. In addition, all treatments of A. taxiformis and L. karachiana significantly reduced the eggs laying by C. maculatus counted after 96 h of treatment. More than 70% mortality was also obtained after 96 h exposure at a dose of 2.2 mg/cm2 with most of the seaweed extracts against S. oryzae and C. ...

Mohamed Mohamady Ghanem1*, Yassine Mahmoud Abdelraoof1, Abdelghany Hefnawy Abdelghany2, Eman Abdelhamid El-Ebissy3, Ahmed Ragab Askar4,5, Attia Ahmed Eissa6  

...lbumin, globulin, total protein, A/G ratio, Na, Cl, Ca, P and Mg. Examination of ruminal fluid showed a significant increase (P < 0.05) in SAT, MBRT, and a significant decrease (P < 0.05) in ruminal pH, protozoal count and activity. Ultrasonographically, there was significant increase (P < 0.05) in ruminal wall thickness, reticular wall thickness, and small intestine diameter. The content of abomasum and small intes...

Nuraini Nuraini*, Mirzah Mirzah, Yuliaty Shafan Nur, Harnentis Harnentis 

...oliferates and has high protein but contains high fiber. Therefore, fermentation with lignocellulolytic fungi was carried out to improve the nutritional quality of Azolla microphylla. This research has 2 phases. Phase 1, determination of the best types of lignocellulolytic fungi on the nutrient quality of fermented Azolla microphylla. This study used an experimental method with a Completely Randomized Design (CRD). The treatments were the types of fungi, namel...

Hosny Kesba1, Ashraf Suloma2, Samy Sayed3*, Abdullah Abdel-Rahman1 and Shaimaa Diab1

...ent regarding the total protein, total amino acids, and total carbohydrates in both tested soil types. These results suggest that aquaculture effluents from tilapia production could be utilized to manage M. incognita in different soil types.

...

Muhammad Tahir Jan1,2, Mushtaq Ahmad Saleem3,*, Muhammad Binyameen1,* and Sarfraz Ali Shad1

...s not controlled. Plant protection measures should therefore be taken before the critical tolerance period.

...
Muhammad Tariq Khan1, Muhammad Ather Rafi2, Riffat Sultana3*, Anjum Munir1 and Sajjad Ahmad4
...na, one is part of the Afrotropical and Palearctic Region and three belong to Oriental, Afrotropical and Palearctic Regions. This reconfirms the transitional bio-geographical position of the Pakistani fauna. However, more species of Subfamily Eumeninae are expected to be present in Sindh if more frequent survey would be carried out.

...

Majid Hussain1, Syed Makhdoom Hussain2, Razia Iqbal3, M. Mudassar Shahzad4,*, Syed Zakir Hussain Shah3, Afia Muhammad Akram4, Nisar Ahmad5 and Muhammad Zubair ul Hassan Arsalan2

...5%). Maximum body crude protein and crude fat contents were observed in C. mrigala fed 2 % and 3% CA supplemented diets, respectively. Moreover, fingerlings fed CA acidified diets showed significant improvement (p< 0.05) in hematological parameters compared to control diet. Comparison of treatments showed maximum values of RBCs (2.83×106mm-3), WBCs (7.76×103mm-3), PLT (65.96), Hb (8.47 g/100ml), PCV (24.51 %), and MCV (187.11 fl) in fingerlings ...

Min Li1, Shiwu Deng2*, Yiqian Peng3 and Hong Li2

...NK, Caspase-12 and CHOP protein in MIRI + DEX group decreased significantly (P<0.05), while the expression of GRP78 increased (P<0.05). It is concluded DEX can alleviate mitochondrial damage induced by ischemia reperfusion, inhibit excessive endoplasmic reticulum and improve myocardial function.

...

Ahmed Alazzouni1, Ashraf Al-Brakati2,*, Sherif Rabie1, Mohamed Gabry1 and Basmaa Hassan1

...his study evaluated the protective effect of Moringa oleifera, curcumin, and green tea extracts against benzene chromasolv-induced leukaemia in rats and their ability to alleviate the histopathological alterations in the mesenteric lymph nodes (MLNs) and spleen. In this study 70 rats were divided into seven groups as follow: control, benzene (0.2 ml twice/week), Moringa oleifera (100 mg/kg), curcumin (300 mg/kg), green tea (350 mg/kg), combined green tea and c...

Muhammad Idrees1, Bashir Ahmad2, Muhammad Waqas1, Syed Muhammad Mukarram Shah3 and Saad Ahmad Khan4

...ecule inhibitors of the proteins encoded by the drug resistant genes, i.e., katG, gyrA, pncA and rpoB of Mycobacterium tuberculosis (M. tuberculosis), were identified using computational methods. In the ligand base pharmacophore, an already reported four ligands for the four proteins encoded by the resistant genes of M. tuberculosis were selected for the generation of pharmacophores. The validated pharmacophores model of all...

Roshana Mukhtar1, Shaheen Shahzad1*, Sajid Rashid2, Maryam Rozi2, Madiha Rasheed3, Imran Afzal4 and Pakeeza Arzoo Shaiq5

... pathogenic mutation on protein structure. In-silico analysis and comparison between UROSL237P and UROSWT 3-dimensional structures revealed remarkable changes in the binding site of Urogen (3-[7, 12, 18-tris (2-carboxyethyl)-3, 8, 13, 17-tetrakis (carboxymethyl) 5, 10, 15, 20, 21, 22, 23, 24-octahydroporphyrin-2-yl] propanoic acid) due to narrowing of domain-I and domain-II (18.46-12.17Å) of UROSL237P as compared to UROSWT. This suggests that UROS L237P ...

Muhammad Altaf1* Arshad Mahmood Abbasi2, Muhammad Shoaib Amjad3, Sadia Naseer1 and Muhammad Umair4

...l RNA viruses and has 4 proteins i.e. envelope, spike, nucleocapsid and membrane. Coronaviruses are classified into 4 genera: Alphacoronavirus, Betacoronavirus, Gammacoronavirus and Deltacoronavirus. Betacoronavirus most probably originated from bats and the virus may have jumped to avian species and evolved as Deltacoronavirus group. The avian coronaviruses jumped among other avian species, giving rise to Gammacoronavirus from Deltacoronavirus, while Betacoro...

Laiba Ajmal1, Sidra Ajmal2, Maleeha Ajmal3, Gul Nawaz3, Rabail Hassan Toor4, Hooria Younas1, Tassaduq Hussain Sheikh5 and Raazia Tasadduq1*

...mune activity towards a protective function, leading to acceptance of the fetus. Further studies encompassing the functioning of HLA system at maternal fetal interface would prove to be beneficial for the affected couples.

...

Riffat Sultana1*, Samiullah Soomro1 and Chuan Ma2

...align: justify;">Genus Chrotogonus has been reported to cause massive damage to agricultural crops where it exists. In past many of its sibling species were misidentified on morphological examination. However, DNA-based species assignments has now made it possible to overcome this barrier. In this study we present CO1 gene data set on the 6 species of Chrotogonus i.e. Chrotogonus (Ch

Haipeng Liu1, Xubin Jiao1, Xiangqing Li1 and Xinru Xu2*

...ks after surgery, osteoporotic rat models were copied and randomly divided into a calcitriol group and a model group, with 10 rats in each group. The ovaries of another 10 rats were detached but not removed as a sham-operated group. After 12 weeks of continuous administration in each group of rats, the results showed that calcitriol increased the BMD values, reduced the levels of bone formation indicators ALP, BALP, UcOC and PINP, increased the levels of bone ...

Jun Zhang1*, Xiaocao Xu2 and Min Cao2

...e of the most important protective factors in this group of the population. Therefore, administration of a reminder dose based on antibody titer is recommended in these individuals.

...

Chuanfeng Fan1,2,*, Wenguo Feng1,3, Jingchang Yang1,2, Qingchao Chen1,2 and Yu Wang1,4

... was to investigate the protective effect of the excitatory amino acid receptor antagonist, α-melanocyte stimulating hormone, on the retina. Twenty-four Sprague Dawley (SD) rats were randomly divided into normal control group, glutamate induced injury group and α-melanocyte stimulating hormone pretreatment group each with 8 rats, 16 eyes in each group. The content of neurotransmitter amino acids and the survival ...

Jabbar Khan1, Mehwish Jehan1, Zeeshan Mutahir2, Muhammad Rafi1, Muhammad Ismail1, Aamer Abbas1 and Jabbar Tanveer3

...concentrations of total protein, cholesterol, albumin and glucose were found significantly higher in Damani breed than control group, indicating that Damani breed had comparatively better adaptive capabilities in preparing the internal physiology and metabolic processes in response to heat-stress environmental conditions. Hence, vitamin E, in combination with Se improved the physiological and biochemical profile of blood in Damani goat.

...

Xiaopeng Tang1*, Kangning Xiong1 and Rejun Fang2*

... of glutamine transport protein Na+-dependent neutral amino acid transporter (ASCT2) and protein expression of ASCT2 were measured. The results showed that LPS significantly (P<0.05) decreased the gene and protein expression of ASCT2 in IPEC-J2 cells. EGF significantly (P<0.05) promoted the gene and protein expression of ASCT2. EGF plus LPS group h...

Ahmed M. Darwish1*, Hassan R. Darwish1, Dalia M. Mabrouk1, Mohamed A. Abdelhafez1, Ahmed M. Abdel-Salam2, Ibrahim E. Mohamed3, Ibrahim M. Farag1 

... of hydrogen (pH), fat, protein, lactose, and solid not fat (SNF) were determined by biochemical methods in all milk samples. Different genotypes of β-LG and LEP genes were detected by single-strand conformation polymorphism (SSCP-PCR), and then validated by sequence analysis. The results of SSCP-PCR showed a monomorphic pattern for the β-LG gene and a polymorphic pattern for the LEP gene. The sequence analysis showed that the β-LG gene has one ...

Laiba Shafique1*, Mahroze Fatima2, Syed Zakir Hussain Shah3, Muhammad Afzal4, Huma Naz5, Saif ur Rehman1 and Qingyou Liu1*

... C. idella. Amylase and protease activity was maximum in fish intestine fed with formic acid followed by fornic acid × vitamin D3, vitamin D3 = control diet. Activity of lipase enzyme was reduced by formic acid supplementation as well as vitamin D3. The observed formic acid and vitamin D3 (interactions) were synergistically bone mineralization of phosphorus, sodium, copper and also showed positive result for the activity of amylase, p

Xian Zhang1, Erjiang Lin1, Shizhe Hong1 and Zhengjie Zhu2*

...eta; and β-catenin proteins; and flow cytometry was used to detect cell apoptosis rate and mortality rate. SSAT was successfully transferred into prostate cancer LNCaP cells. Compared to the blank cell group and the blank vector group, the expression of Akt, GSK-3β and β-catenin proteins in the SSAT transfection group was significantly down-regulated (P <0.05), the cell proliferation was significantly inhib...

Arab Khan Lund1*, Atta Hussain Shah2, Gul Bahar Khaskheli2, Mool Chand Malhi3, Ahmed Sultan Jatoi4, Abdul Samad Mangsi5 and Asad Ali Khaskheli6

... non-casein (NCN), whey protein nitrogen (WPN) and whey protein denaturation (WPD) were significantly (p<0.05) varied at different heat treatments in contrast to control (T0). The variation was also observed in conductivity, refractive index, moisture, fat, protein and lactose content, however, it was non-significant (p>0.05). Results are concluded that the nitrogen fractions markedl...

Aml M. Ragab1*, Maha R. Basyoni1, Enas A.I. Khoris2, Nadia A. Abd Elghany3 

...), (cytK), and (ces) enterotoxigenic genes. B. cereus isolates were analyzed for antibiotic susceptibility. A lab trial was conducted for two weeks using 60 Tilapia fish were divided into three equal groups, (1): kept as control negative, (2): infected intraperitoneally with (0.1ml) 8×107 (CFU/ ml/ fish) B. cereus on 1st day, (3) infected I/P intraperitoneally with (0.1ml) 8×107 (CFU/ml/fish) B. cereus on the first day and treated with erythromycin...

Alaa Jaheen*, Noha Salem, Mohamed El-sherif 

...ntioxidant changes, and protein and lipid profiles in horses suffering from equine eczema. Thirty (30) horses were included in this study (20 males, 10 females), classified into the healthy control group (n = 10) and the equine eczema group (n = 20). All horses were subjected to a complete physical examination. Blood samples were collected for hematological profile and estimation of serum concentration of total antioxidant capacity (TAC), malondialdehyde (MDA)...

Ibrahim Samir Abd El-Hamid1*, Wafaa Adel Abd Fouda1, Hesham Attia Shedeed1, Safaa Ali Mostafa1, Ahmed Mohamed Elbaz2, Salah Abo Bakr2, Baliegh Hamdy Mosa1, Ali Saber Morsy1, Amal Mohamed Hasan1, Khamis Refaay Emam3 

...sults showed that total protein (TP) and globulin (GLO) concentrations increased (P<0.05) in treatment groups compared with control. Levels of albumin (ALB) and aspartate aminotransferase (AST) decreased (P<0.05) in Tr2 compared with Tr3 or Tr1. While alanine aminotransferases (ALT) and creatinine (CRA) concentrations decreased in treated groups compared with control. Value of total antioxidant capacity (TAC) increased (P<0.05) in treaded groups comp...

Muhammad Ali Raza1*, Aneela Zameer Durrani1, Muhammad Hassan Saleem1, Kamran Ashraf2, Muhammad Muddassir Ali3, Kumayl Hassan Akhtar4 and Nazia Rubab5

...he legislative. For the protection of public health, the research has been conducted for the first time in Lahore.
...

El-Kholy KH1*, Tag El-Din H1, Seham NE Seleem1, Eman Hussein2 AM El-Shhat2 

...trations of serum total protein and their fractions (albumin and globulin) and all lipid profile were insignificant affects by in-ovo different SV solutions, times of eggs dipping and their interaction. The best values of body weight gain, feed conversion ratio and performance index were recorded in that group dipping eggs at 0.05% SV followed by groups dipping at 0.15 or 0.10 % SV throughout the experimental period. According to the results, it can be conclud...

Ouedraogo Oumar1,2, Tianhoun Denté Fidèle2,4*, Séré Modou3, Kaboré Adama2, Tamboura H. Hamidou2 and Belem Adrien Marie Gaston4

...erable losses in animal protein, the financial losses linked to the seizure of organs affected by tuberculosis were evaluated at 206,949.968 CFA francs for butchers without any compensation during the same period. The study shows that tuberculosis exists in the cattle population of the urban commune of Koudougou, and that these animals must therefore be properly inspected to protect human health.

...

Rasha Ali Taha Hamza1, Atef Saad Osheba1, Hassan Mohamed Sobhy2, Sahar Hussein Abdalla Hekal2* 

... an excellent source of protein but unfortunately it vulnerable to lipid oxidation and many pathogens, which carry the risk for human health. The aim of this work is to determine the antioxidant and antimicrobial activities as well as total phenolic and flavonoids contents in both water and ethanolic extracts of galangal and sumac extracts. Also, the effect of previous extracts on quality attributes of beef burger was evaluated. The ethanolic extracts of both ...
Roy Hendroko Setyobudi1, Erkata Yandri2, Yogo Adi Nugroho3, Mardiana Sri Susanti4
Satriyo Krido Wahono5, Wahyu Widodo1, Lili Zalizar1, Elfi Anis Saati1, Maftuchah Maftuchah1
Manar Fayiz Mousa Atoum6, Muhannad Illayan Massadeh6, Dwi Yono3, Rangga Kala Mahaswa7
Herry Susanto2, Damat Damat1*, Dyah Roeswitawati1, Praptiningsih Gamawati Adinurani8 and 
Susi Mindarti1
...etric titration), beta carotene (UV-Vis spectrophotometer), amino acid (amino acid analyzer), and reducing sugars (colorimetric method). Utilizing descriptive statistics, the research is presented in box-plot, with a t-test. It was recorded that Fe content in Mengani’s CCF [9.269 mg 100 g–1, ranged (4.717 to 15.686) mg 100 g–1] was lower than La Boite’s, although statistically insignificant (&g...

Muhammad Asif1*, Ahmad Ali Shahid1,2 and Nasir Ahmad3

...biting potential. Crude protein extract was also prepared to observe the inhibitory effect of G. lucidum against A. solani. The results for interaction of mycelia of G. lucidum with pathogen A. solani reveal that G. lucidum is an efficient biocontrol agent to reduce the disease incidence. Crude protein extract was also found beneficial to control the pathogen. The results for minimum inhibitory concentration (MIC) of crude p...

Eman Alsayed Hammad and Atef Mohamed El-Sagheer

...lied three times. Under protected conditions the pest reduction percentages of M. incognita and increase percentages in shoot dry weight were associated with the use of Marjoram emulsion oil (82.5, 208%), Chitosan (75.3, 105.8%), and Vermicompost (72.1, 93.4%) after chemical nematicide (93.0, 424.3%). Whereas, under field conditions, the application of Chitosan achieved the greatest reduction percentage (82.2%), followed by Marjoram emulsion oil (71.2%), compa...

Mirtneh Akalu1,2*, Takele Abayneh2, Esayas Gelaye2, Behailu Tefera2, Teferi Degefa2, Vemulapati Bhadra Murthy1 

...tial of M. haemolytica serotype A:1 OMVs (MH-OMVs). Fifteen calves were divided randomly into three groups of five calves and immunized with single-dose and booster-dose of 0.15 mg/ml vesicle preparation. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) assay of the partially purified MH-OMVs revealed approximately ten protein bands ranging from 25 to 104 kDa. Hemagglutination inhibition (HI) assay confir...

Dali Wang1,2, Yujing Zhu1,2, Wancai Xia1,2, Mei Zhao1,2,3, Chan Yang1,2 and Dayong Li1,2*

...ea is important for the protection of Yunnan snub-nosed monkeys living at Gehuaqing. A reasonable plan for vegetation restoration according to the composition of the surrounding community could mitigate population reductions in the monkeys and other local wildlife.

...
Mubasshir Sohail*, Qadeer Ahmed Soomro, Raza Muhammad, Muhammad Usman Asif and Imran Rauf
...was detected from crude proteins using substrate-agar plate assay and laterally confirmed by endoglucanase assay. Enzyme activity measured using the glucose standard curve was 725 U/ml after acetone precipitation. Thermal stability and optimum temperature were found to be 60°C for maximum activity. Likewise, enzyme was found more stable at 6.0 pH. Various mono and divalent cations were studied against the cellulolytic activity exhibited significant enhanci...

Aiman Al Mufarji, Abd El-Nasser Ahmed Mohammed* 

...include plasma glucose, proteins, liver and kidney functions and minerals values. The results indicated that organic M. oleifera leaves contain protein (28.28%), carbohydrate (47.82%), fat (7.57) and fiber (28.35%). In addition, fatty acid profiles were saturated fatty acids (3.76%), unsaturated fatty acids (3.79), monounsaturated fatty acids (2.39%), polyunsaturated fatty acids (0.76%) and trans fatty acids (0.64%). Upon su...

Qiong Xiang1, Jing-Jing Li1, Qian Zhang1,3, Rong-Bo Tian1 and Xian-Hui Li1,2*

...the expression of SSTR2 protein in DRGs after injecting Carrageenan, the inflammation-induced reagent into the mouse left-hind paw(Ipsilateral-side). Compared with the SSTR2 in normal right -hind paw(contralateral-side) DRGs. The variation of SSTR2 protein expression is fast, because about 15 min after injection the significant up-regulated expression of the SSTR2 proteins are found in inf...

Haroon1, Chen-Xu Ye1, Yu-Xin Li1, Hong-Xin Zhang1, Qing Liu1, Xiao-Hong Su1,2,3 and Lian-Xi Xing1,2,3,*

...y of the effectiveness, protection from pathogens and parasites.

...

Wei Cui1, Yanwei Du1, Lijuan Jiang1, Yan Wei1, Yuguo Li1, Wenfeng Zhang1* and Ling Zhang2*

...als. To investigate the protective effect and mechanism of BHD on hippocampal neurons in diabetes, a high glucose (HG) induced PC12 cell injury model was established, cell proliferation and apoptosis were detected. The protein expression levels were detected by western blot. Rats with type 2 diabetes mellitus were fed high-fat-sugar diet and low dose of streptozotocin for 4 weeks to observe the body weight, fasting blood glu...
Yuechen Li1, Yumo Li1, Xuefeng Zhuang1, Guangfu Lv2, Xiaowei Huang1, Zhe Lin1, Yuchen Wang1* and He Lin1*
...nificantly improved the protein expressions of Nrf2, HO-1 and NOQ1 in the brain tissues of aging mice, which was detected by western blotting. In conclusion, OR treatment improved behavioral disorders and brain damage in the aging mice, suggesting that OR has the potential to be a new anti-aging drug candidate.

...

Momotaz Khanom*, Sheikh Mustafizur Rahman, Muhammad Yousuf Ali, Md. Shahin Parvez, Al-Hasan Antu, Md. Nazmul Ahsan 

...ad significantly higher protein content than the other treatments (p<0.05). Water quality parameters remained optimum throughout the experimental period. The feeds used in treatments did not show any deleterious effect on survival. Physiologically, FF led to significantly higher amylase activity in comparison to other feeds, while protease activity was comparable among the feeds except for DT. The results suggest that for...

Zhongqing Wang1, Qiuyue Wu1, Ruiling Ye1, Fazul Nabi1,4, Yangfei Shang1, Sarfaraz Ali4 and Juan Liu1,2,3*

... out to investigate the protective effects of Atractylodes macrocephala polysaccharide (AMP) on the quantity of intestinal intraepithelial lymphocytes (iIELs), and the IL-6, TNF-α mRNA transcription level in duodenum of diarrheal mice. A total 72 mice were randomly divided into 6 groups: control (CG), infection (IG), positive drug (PG), AMP low/middle/high dose (LG/ MG/ HG) groups respectively, (n=12). The mice were induced by diarrhea with E. coli (5&ti...

Shorouk Aladdin Helmy1, Hossam Mahrous Ebeid2*, Mohamed Ahmed Hanafy1, Adel Eid Mohamed Mahmoud1, Reham Roshdy Ali El-tanany1 

...%) with three different protein sources, (soybeans, sunflowers, or cottonseed meals) on a dry matter basis. All rations were incubated in a rumen culture medium collected from sheep in a 3 (sources of clay), 4 (levels of clay), and 3 (protein sources) factorial design. All rations were prepared to be iso-nitrogenous. The results illustrated that humic acid addition had made a significant difference on the amount of degradabl...

Zhongxi Zhang1, Ping Zou2*, Jingfang Zhang1, Yujuan Zeng1 and Yujie Tang1

...od-brain barrier marker protein expression in rats with acute basilar artery occlusion. Sprague Dawley rats (n=180) were randomly divided into 6 groups, 30 in each group, which were sham operation group, model group, and intravenous thrombolysis for 0, 2, 4, and 6h groups. The rats were scored by Zea-Longa method. The effects of intravenous thrombolysis on brain injury and blood-brain barrier were detected by TTC staining. The expressions of ICAM-1 and MMP9 mR...

Sania Subhan Qureshi*,1, Baitullah Khan1, Shahid Khan1, Hanif Ur Rahman1 and Muhammad Subhan Qureshi2

... caused by 7 different serotypes of FMD virus having different virulence. To compare the virulence of various FMD serotypes the study was designed to propagate the virus on BHK-21 cell line. The results revealed that serotype ‘A’ virus virulence is more as compared to serotype ‘O’ and ‘Asia-1’. Although less virulence ...

Ikele*, Chika Bright, Ujunwa Aghaji, Mgbenka, Benard Obialo 

...1 to 324 mg/L. Total heterotrophic bacteria present in the biofloc media were higher in CA 20:1 with a significantly peak value of 390X104 cfu/ml compared to other groups. The C:N at 10 and 20 utilizing cassava and wheat supported growth of C. gariepinus with a mean weight gain of 214.91±26.84g, specific growth rate 3.78±0.26 but did not enhance the condition factor >1 of C. gariepinus juveniles within 28-days. In conclusion, inclusion of C:N...

Gamal Shawki1, Tawfek Mohamed Barakat1, Attia Mohamed Samy2, Ahmed Alhamed AL-Mejren2, Ayman Mesalam1* 

... as the width of total scrotum were higher (P < 0.05) during August, July and September. Moreover, the number of mounts per ejaculation, reaction time, time to erection, ejaculation times and time to ejaculation were significantly lower during summer and spring seasons (P < 0.05). A positive correlation (P < 0.05) between sperm parameters and testicular parameters and negative correlation between the sperm parameters and sexual behaviors were recorded...

Feng Xu, Weijing Fan and Guobin Liu*

...cluded that rutin had a protective effect on ox-LDL-induced vascular endothelial apoptosis and oxidative injury, and its mechanism may be related to the up-regulation ofNEXN-AS1/miR-410-3p pathway.
...

Tao Ren1, Guiqiu Cao2, Xiao Han3, Feng Tan1, Qiaoli Chen4, Shicheng Yang5 and Haiyan Zhang6*

...o scrutinize the cardio-protective effect of naringenin against the I/R induced myocardial injury and elucidate the possible mechanism of action. In vitro studies, the H9c2 cardiomyocytes cells were treated with naringenin or without naringenin and then subjected to I/R, respectively. At end of the experimental study, the rats were anesthetized and blood samples were collected to scrutinize the various parameters such as creatine kinase myocardial band (CK-MB)...

Amjed Ali1, Muhammad Tayyab1*, Abu Saeed Hashmi2, Asif Nadeem3, Shumaila Hanif4, Sehrish Firyal1, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1

...pression of recombinant protein was examined in BL21 CodonPlus (DE3) cells. SDS-PAGE confirmed the size of recombinant protein as 34 kDa. Recombinant β-lactamase was produced optimally when the BL21 CodonPlus (DE3) cells were induced with 0.6 mM IPTG with a post induction time of 5h at 37 °C. The characterization studies demonstrated the maximal enzyme activity at 37 °C in 50 mM sodium phosphate buffer pH 7. The...

Weam Mohamed Baher*, Gamilat A. El said 

...ource of animal-derived protein, essential amino acids, vitamins, and minerals. This study was taken to investigate the hygienic status of chicken meat including breast and thigh collected from rural and urban localities in Egypt. Evaluation of the hygienic status of chicken meat was done via estimation of total bacterial count (TBC), most probable number (MPN) of coliforms, total staphylococcus count (TSC), and total mold count (TMC). An experimental trial fo...

I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2,  I Gede Mahardika1,  I Gusti  Nyoman Gde Bidura1

...) in the concentrate on protein balance, blood metabolic profile, and body composition of Etawah crossbreed goats. A total of 20 goats with an average initial body weight of 18.22 ± 3.09 kg were used in the study with a randomized block design consisting of 4 treatments and 5 replications. The four treatments tested were as follows: A: elephant grass + concentrate A (without HLF); B: treatment A + concentrate B (with 5% HLF); C: treatment A + concentrat...
Tri Eko Susilorini1*, Ahmad Furqon2, Wike Andre Septian1, Desinta Wulandari3, Suyadi Suyadi3
...s one of the major milk proteins approximately 80-83% of total protein. The CSN3 gene has been broadly studied due to its important influence on the milk properties. Senduro goat is local breeds in Indonesia that provide milk. This study was aimed to analyse CSN3 gene polymorphism and its association with milk production and composition on Senduro goat. A total of 42 lactating Senduro goat were used in study from parity 1 to...
Paulus Klau Tahuk*, Oktovianus R. Nahak T.B., Gerson F. Bira, Adrianus Manek, Donatus Manek, Tobias Y. Purnama, Emanuel Bubun, Bergias Subay
...ontained standard crude protein and high energy (11% CP and 72% TDN), T2 ration which contained medium protein and high energy (13% CP and 72% TDN); and T3 ration which contained high protein and high energy (15% CP and 72% TDN). The level of Gliricidia sepium leaves in each treatment ration was also different, where T1 contained 10% of, T2 contained 20% of Gliricidia sepium leaves, and T3...

Soliman Mohammed Soliman1*, Mohsen Mahmoud Shoukry2, Ahmed Mohammed El-Okazy1, Ahmed Mahmoud El-Morsy1, Mahmoud Mohammed Soliman1

...l is the most important protein source used to fodder mixtures. However, more than 60% of the protein is degradable in the rumen. Several attempts have been made to reduce protein degradation. This experiment was carried out to investigate the effects of different supplementation levels of pomegranate peel (PP) on the in situ degradation of soybean meal (SBM) by using three ruminally cannu...

Barirah Rehman Talpur1, Zaheer Ahmed Nizamani1*, Imdad Hussain Leghari2, Mansoor Tariq1, Aisha Rehman3, Shahnawaz Kumbhar1 

Hye-myoung, Jang 1,3, Ju-Hyeun, Kim3, Garam Park1, Yoon Dong Choi4, Sun-Eui Kim1,5, Gwang Joo Jeon1,2* 

...yloid (Aβ) and tau-protein (τ-protein) formed in the brain tissues. Under the hypothesis of obesity inducing potential dementia, mice were fed with high-fat energy diet to gain excessive weight. The experimental groups in this study are 1) high-fat diet fed only (control) and 2) high-fat diet fed with AE added (AE group). After the experiment was terminated, they were slaughtered and brains were obtained. Throughout...
Manatsanun Nopparatmaitree1*, Pornpan Saenphoom1, Sittichai Bunlue1, Silchai Washiraomornlert1, Warangkana Kitpipit2,3,4, Soranot Chotnipat1
... crude fiber, and crude protein (p<0.05). The supplementation of TABP combined with probiotics increased the lactic acid bacteria, Enterococcus sp., and volatile fatty acids (p < 0.05) and decreased Salmonella spp. and Escherichia coli in the cecum of different treatment to control groups (p < 0.05). In addition, TABP combined with probiotics supplementation increased the villus height, villus surface area, and the depth of the crypt of Lieberküh...
Mohammad Belal Shaker1, Waleed Rizk El-Ghareeb2,3*, Marwa Magdy Seliem4, Wageh Sobhy Darwish3, Bassam Abdulla Alhawas2, Ahmed E. Tharwat3
..., high biological value protein, minerals, and vitamins. However, crustaceans are regarded as potential sources for the transmission of foodborne pathogens. Aeromonas spp. is one of the opportunistic microorganisms, that normally inhabits aquatic environments such as fresh, and marine water bodies. Aeromonas spp. might cause food-borne gastroenteritis that might be complicated to cause septicemia, meningitis, endocarditis, and osteomyelitis with high mortaliti...
Ade Djulardi1*, Robi Amizar2, Tigor Sanjaya1
...ementation at different protein levels on the performance of laying quail. This study used 240 heads of laying Japanese quail (Coturnix coturnix japonica) aged 42 days with 10% egg production in the layer phase aged 6-9 weeks. This study used an experimental method with a completely randomized design (CRD) in a 3x2 factorial with four replications. Each replication consisted of 10 laying quails. The first factor is expired milk powder supplementation with thre...
Chinar Mustafa Mohammed1*, Thamer M. Bashir1, Omar A.M. Al-Habib2, Farhad Ramadhan1, Mohammed Bassam1
...estigated the potential protective effects of taurine, on behavior and cardiovascular function in the male rat following arrhythmia induced by the social stressor. Here, we studied levels of heart electrical activity following experimental conditions: Cage control, social isolation in standard rat housing for 14 days, and pharmacokinetics effect of intravenous administration of different doses of taurine on arrhythmia induced by social isolation in vivo after....

Hany M.R. Elsherif1, Ahmed Orabi2, Hussein M.A. Hassan3, Ahmed Samy3*

...to broiler diets, total protein, globulin, albumin/globulin, T3, T4, and total antioxidant capacity levels were dramatically increased, while alanine aminotransferase (ALT), aspartate aminotransferase (AST), and urea levels remained not affected. Adding SF, SA, or SP to broiler diets significantly improved immunological state (P<0.05) via enhancing avian influenza (H5) and Newcastle disease (ND) titers. Accordingly, OAS’s as natural feed additives cou...

Abd El-Moniem Ali S. Mahgoub, Ahmed Mohamed Abd El-Hafeez, Mahmoud Yassin Mohamed*, Al-Moataz Bellah Mahfouz Shaarawy, Mohamed Ibrahim Nassar

...lue of digestible crude protein (P < 0.0001), ruminal pH, and NH3-N values. Total dry matter intake tended insignificantly decrease with increasing levels from sesban hay. Final body weight, average daily gain, growth rate, and body weight gain did not affect by sesban supplementation. Supplementation of sesban hay improved feed conversion to digestible crude protein (P < 0.002). The replacement of clover hay 10, 20, a...
Asmaa Khamis1, Osama Abdalla1, Mohamed Hashem2, Noha Abdelnaeim1*
... supposed to have hepatoprotective properties. This study aimed to compare the effects of both medicinal plant extracts on rats intoxicated with carbon tetrachloride (CCl4). A total of 60 male albino rats were equally distributed in six groups. The first group received purified water and was kept as a control. The second and third groups were given oral PN and PM (500 mg/kg/day) for 31 days, respectively. The fourth group was intraperitoneally injected with CC...
Ahmed Mohamed Elmahdy1*, Naglaa Mohammed Alkalamawy2
...ed at the hepatic-renal protection of Origanum majorana “O.M” leaves extract in male rabbits against the negative effects of ivermectin. Twenty male rabbits were used and divided into four groups each group contain 5 rabbits as a following: Group one: rabbits which served as negative control were orally administered distilled water for 60 consecutive days. Group two: The rabbits in this group were given an aqueous extract of O.M. orally (200 millig...

Avijite Sarker, Sharmeen Islam, S.M. Ariful Islam, Md. Rokibul Islam Khan*, Md Mukhlesur Rahman 

...e reduced and the crude protein (CP), ether extract (EE), ash, ME, OMD were elevated significantly with MFW and ensiling time (P<0.05). Comparing the parameters, T2 and T3 were preferable to prepare silages as cattle feed. Finally, it can be summed up that market fish waste is a valuable resource for the preservation of rice straw which provides farmers with cheap and environmentally friendly cattle feed.

Keywords | Environmental pollution, Silage, ...

Luu Huynh Anh1, Huynh Tan Loc2, Nguyen Hong Xuan3, Le Minh Thanh1, Trinh Thi Hong Mo4, Ly Thi Thu Lan5, Nguyen Trong Ngu1*
...ainst Escherichia coli serotype O6 infected in chickens. A total of 420 broilers were randomly assigned to seven treatment groups. The negative control (NC) birds received no E. coli or phages, whereas the positive control (PC) birds were infected with E. coli only. The NC+MHH6 and NC+PR2 treatments received 109 pfu/ml of phages MHH6 or PR2, respectively; whereas the PC+MHH6, PC+PR2, and PC+MHH6PR2 groups were infected with 107.1 cfu/ml of E. coli strain O6 an...
Rubaijaniza Abigaba1,4*, Pharaoh C. Sianangama1, Progress H. Nyanga2, Edwell S. Mwaanga3, Wilson N.M. Mwenya1
...ed to reduce the animal protein deficit. This study aimed to assess the socio-demographic characteristics, awareness levels and attitudes of male and female traditional pig farmers toward reproductive biotechnology application. A cross-sectional descriptive survey was employed to obtain sex-disaggregated data from 622 respondents using a semi-structured questionnaire. Descriptive statistics including frequencies, mean, and standard error of the mean as well as...

Muneeza Zafar1,2,3, Fazli Rabbi Awan2,*, Munazza Raza Mirza3,*, Sumaira Nishat2,4, Sajid Ali Rajput5 and Imran Riaz Malik1,*

...align: justify;">Apolipoprotein B (APOB) is the major part of low density lipoprotein (LDL), with two major isoforms: APOB100 and APOB48 found in the human body. Both isoforms are involved in the formation and transport of chylomicron and LDL-cholesterol. Point mutations in APOB may lead to change in protein stereochemistry, which may result in premature coronary artery disease, familial h...

Ghulam Abbas1*, Muhammad Arshad1, Muhammad Saeed2*; Safdar Imran3, Ashgar Ali Kamboh4, Duraid KA Al-Taey5, Muhammad Asad Aslam1, Muhammad Saeed Imran6, Muhammad Ashraf3, Muhammad Asif7, Abdul Jabbar Tanveer8, Razia Abdul Majid Qureshi9, Maria Arshad1, Hussain Ahmed Khan Niazi1, Muhammad Tariq10, Sikandar Abbas1 

... the uptake of digested proteins and important minerals. The advantages of using OA as feed additives greatly outweigh their disadvantages like decreased palatability. Organic acids can increase egg productivity and enhance the egg quality in layers. In broiler, use of OA is associated with improved weight of birds and feed conversion ratio. Dietary OA showed 1.85-8.48% increase in the FCR of chicken. Lactic acid fed 0.3 g/kg diet reduced Escherichia coli and ...

Junaid Ali1, Muhammad Nawaz2, Muhammad Ilyas3, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha4*, Muhammad Arshad5, Muhammad Akram6, Mina Kharal7, Ehsan Ullah1, Muhammad Talha Aslam1, Fareeha Athar1, Ayesha Mustafa1 and Muhammad Umair Hassan1

...quantity of mineral and protein. Sowing methods and irrigation application are an important agronomic consideration to get maximum production of lentil crop. Therefore, this study was conducted in RCBD with a two-factor split plot to determine the impact of various levels of irrigation and sowing methods on the growth and yield of lentil. Crop was sown by three sowing methods; flat, bed and ridge and with four different irrigations levels; I1: one irrigation, ...

Abdul Majid1*, Farah Naz1, Nasrullah Laghari1, Sanaullah Abbasi1, Sham Lal2 and Safdar Ujjan3

...ice of solvents for the proteins functionality is remained a challenge for biochemical applications, hence there is always a need to understand the effects of solvents on secondary structural conformation. Biophysical investigations about the changes in secondary structure conformation of lysozymes were performed with CDS using them in water and buffer. Membrane bilayer mimics were prepared from dimyristoylphosphatidylcholine (DMPC) through rehydration method....

Nur Prabewi , Supriyanto, Budi Purwo Widiarso* 

...ss value, and protein instability upon heating, thus it needs special treatment. Marination is a flavored liquid that serves as the ingredients of the meat marinated, and is usually used to improve the yield and shelf-life of meat. The research aims to study the effect of herbal marination on the quality characteristics of broiler meat. The variables measured including antioxidants, prot

Muhammad Zeeshan Nadeem1, Muhammad Farrukh Saleem1*, Muhammad Ashfaq Wahid1 and Muhammad Anwar ul Haq2

... Likewise, fodder crude proteins, crude fiber contents, ash contents and ether extractable fat were increased prominently by CaCl2 over the other priming agents. Among the cultivars, Sargodha Bajra 2011 performed better than other cultivars it showed better adaptability for more pearl millet fodder yield and quality. Therefore, seed priming with CaCl2 can be used to increase pearl millet fodder yield and quality to overcome the fodder scarcity under semi-arid ...

Iqtidar Hussain1, Haroon Shahzad2*, Sami Ullah2*, Muhammad Jawad Nazir1 and Muhammad Rizwan3

...weed densities of Cyprus rotundus L., Eleusine indica L., Cynon dactylon L., Trianthene portulacastrum L., convolvulus, and other miscellaneous weeds were registered before and after weed management. Results indicated that chemical control significantly best over control (No Treatment) after hand weeding. Agronomic parameters i.e., germination percentage (%), 50% tasselling, 50% silking, ear height (cm), stem diameter (cm), leaf area (m2), Biological yield (t ...

Adimabua Mike Moemeka1, Ufuoma Godstime Sorhue1*, Sylvanus Ikenna Omeje2, Lawrence Bratte2, Raphael Onainor1, Okpara Oghenesuvwe2 

...t (NFE) and lower crude protein content in boiled red sweet potato meal than in the maize. Nutrient digestibility was significantly different (P<0.05) among treatments. The average total weight gain ranged from 13.22kg in T2 to 17.18kg in T1 followed closely by 16.44kg in T3. There were significant differences (P<0.05) among the treatments for all the performance characteristics studied, except average daily weight gain and feed conversion rate. Average ...

Mehwish Saleem Khan* and Sumama Farooq

...number of mechanisms to protect themselves against the action of antibiotics. Antibiotics are chemical substances which bacteria and fungi produce either to inhibit or kill the other microbes. Antibiotics are classified on the basis of their structure and mode of action. Bacteria resist antibiotics by inactivating the drugs, altering the target site, chemically modifying the antibiotics and by ribosomal splitting. Antibiotic resistance can be intrinsic or extr...

Muhammad Bakhtiar1*, Fayaz Ali Niaz2, Asim Muhammad2, Mamoona Munir3, Wajiha Seerat4, Sadiqullah Khan5, Ghulam Yaseen6, Muhammad Noman Khan7 and Asma Bibi8

... treated plots, maximum protein content, glucosinolate content, and erucic acid (percent) as well as grain yield was recorded, except oil contents which was higher at 20 kg N ha-1 plots, while on other hand S application, whereas Sulfur applied @ 40 kg ha-1 produced maximum Grain yield, oil content, protein content, Glucosinolate contents and erucic acid. It was determined that applying N @ 120 to 160 kg ha-1 in association ...

Marwa Ragab Saeed Abdallah, Hussein Mohamed Hussein Mohamed, Mohamed Mohamed Talaat Emara, Mai Atef Mohamed

...y was to apply the whey protein isolate/beeswax (WPI/BW) as an edible coating to improve the quality and extend the shelf life of sliced pastirma stored under either aerobic or vacuum packaging. Pastirma was produced, sliced, and then allocated to four groups; the first group was aerobically packed and used as control, the second group was vacuum packed, while the third and fourth groups were coated with WPI/BW then packed in either polyethylene or vacuum bags...

Syeda Rubab Zaidi* and Safdar Ali Mirza

...ds were used along with protein estimation. The purified fraction was then subjected to enzymatic characterization to find its thermal stability, effect of pH and selected chemical compounds. Other significant experimental findings were; optimum incubation period was 7 days, inoculum size was 3 discs of 0.5 cm, CuSO4 as inducer improved production, laccase activity of crude extract i.e. 10.89U/ml increased to 15.07U/ml with purification of the enzyme, the puri...

Nishant Shah1*, Rakesh Kumar Yadav1, Anil Gautam1*, Shambhu Shah1 and Mohan Kumar Gupta2

...i of strain χ7122 (serotype 078: K80:H9) at pathogenicity amount (9.4 x 105 cfu E. coli per bird) was done and morbidity and mortality rate was also recorded. The significantly minimum ammonia (ppm) was recorded in CRH (30.53±0.77); however, the maximum ammonia (ppm) was recorded in RH (49.78±0.42) with that compared to SD (33.42±0.25) and RS (43.22±0.56). Similarly, the mortality rate due to colisepticemia was recorded minimum ...

Yahia A. Amin1*, Alaa Eldin Z. Mahmoud2, Mohamed Sabry Aref3, Abd El-Latif Shaker Seddek4, Waleed Younis5 

...he end of the treatment protocol, the herd reproduction management was applied to all treated cows. Results showed that different bacterial species were isolated (Staphylococcus, Streptococcus, Escherichia coli, and Klebsiella). The infection is either a single infection (Staphylococcus only), or a mixed infection, while the control group has no bacterial growth. Staphylococcus was the only microorganism responsible for the single infection. Infection with Sta...

Nkana Kontchiachou J. Gwladys1, Kouamo Justin2, Vemo Bertin Narcisse3*, Mweugang Ngouopo Nathalie4, Wang-Baa Temoa Christophe1, Awantu Christian Funwi1, Semi Yam Alphonsius1, Kenne Noubissie Christèle5, Tendonkeng Fernand5

...concentrations of total proteins, globulins and HDL increased at 0.50% green anise supplementation, referring to the control diet, nevertheless, the difference was significant (p<0.05) just for globulins concentration. Meanwhile, the concentrations of albumin, total cholesterol, triglycerides, glucose, creatinine, urea, ALAT and ASAT were comparable (p>0.05) among rations. The histological sections of the liver and kidney showed that their structures wer...

Teguh Wahyono1,2*, Wahidin Teguh Sasongko3, Wijaya Murti Indriatama4, Setiawan Martono5, Slamet Widodo3, Widhi Kurniawan6, Muhamad Nasir Rofiq7

...ng did not affect crude protein (CP), ether extract (EE), neutral detergent fibre (NDF), acid detergent fibre (ADF), hemicellulose, cellulose, or non-fibre carbohydrate (NFC) content. Samurai 1 sorghum silage had the lowest NDF and ADF, both in non-wilted and wilted materials (P < 0.05). The interaction of wilting and different variety had a significant impact on NDF (P < 0.05), ADF, OM, and CP (P < 0.01). Wilting treatment had no significant impact o...

Amal Ramadan Fawy1, Hussein Yousef Ahmed2, El-Sayed S.E. Shabana3, Mohamed Abdelfattah Maky4*

...ef burger had a greater protein than other groups as well as being the best in terms of quality. Furthermore, six beef burger formulations with different amounts of beef fat and vegetable oils were prepared and stored at 4 ± 1°C for 21 days. Analysis of samples showed that fat content was significantly lowered in F1 and F2 (beef fat partially replaced by olive and rice bran oils, respectively) than in control (100% beef fat). In addition to, aerobic...

Xing Lu1, Mahmoud A.O. Dawood2, Fan Wu1, Hua Wen1, Wei Liu1, Juan Tian1, Ming Jiang1, Li-Juan Yu1, Xiang Li3, Ning Xu3 and Hong-Wei Liang1*

... at 400 mg kg-1. Muscle protein content was significantly increased when turtles were fed diets with 200 or 400 mg kg-1 L-carnitine (P < 0.05). The serum biochemical indices analysis revealed that dietary L-carnitine at 400 mg kg-1 had markedly reduced triglyceride (TG) concentration (P < 0.05). The elevated expression of hepatic igf1 gene at the transcriptional level was positively correlated with dietary L-carnitine levels on the growth performance of ...

Yasmin M. M. Mahmoud* 

...concentrations of total protein, albumin and globulin as well as activity of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were significantly (P<0.05) increased while, glucose, total cholesterol, uric acid and creatinine were significantly decreased (P<0.05) in G1 as compared to unsupplemented group. Kids in G1 group recorded the highest (P<0.05) concentrations of hemoglobin, mean corpuscular volume and mean corpuscular hemoglobi...
Dalia M. Aboelhassan1*, Inas S. Ghaly1, Noha E. Ibrahim2, Nermeen M. Shaffie3, Mariam G. Eshak1, Aboelfetoh M. Abdallah4, Ibrahim M. Farag1
...utilization either as a protective or therapeutic agent. Using FCE as a therapeutic agent, particularly in the treatment with the highest dose (5.0 g/Kg), produces the best results, where some genotoxic and histopathological parameters are restored to the normal level or natural status. The present investigation confirms the important role of Fagonia cretica in overcoming the harmful BPA-induced effects on animal cells, since the extraction of this medicinal h...

Aiman Al-Mufarji3, Abd El-Nasser Ahmed Mohammed3*, Rashid Al-Zeidi1, Haitham Al-Masruri2, Al-Hassan Mohammed4

...etabolic profile (total protein and blood urea nitrogen) were measured and evaluated. The ovarian follicular wave dynamics and corpora lutea (CL) development were followed. The results indicated that body weights significantly (P < 0.05) improved in ewes and lambs treated with M. oleifera. M. oleifera supplementation increased significantly (P < 0.05) fat (%) and milk energy (MJ/kg) whereas it lowered solid not-fat and lactose (%). Red blood cells (RBCs)...
Aiman Al-Mufarji1, Abd El-Nasser Ahmed Mohammed1*, Haitham Al-Masruri2, Rashid Al-Zeidi3
...croalgae include “proteins, polysaccharides, lipids, PUFAs, vitamins, pigments and other bioactive compounds”. The microalgae composition varies depending on species and nutrient availability for production. Genetic engineering might be used for production invaluable microalgae compounds. Microalgae consider a promising source of omega-3 fatty acids (n-3 FAs), which have beneficial effects for humans and animals. Knowledge for microalgae effects on...
Basel A. Abokhadra, Samah M. Mosad, Sahar Abd El Rahman*
...on (PCR) targeting glycoprotein B (gB) gene. Six PCR positive samples were isolated on chorioallantoic membranes (CAMs) of 11 days old Embryonated Chicken Eggs (ECEs) for three blind passages. The CAMs showed thickening and congestion at 1st passage and typical pock lesions appeared at 3rd passage. Indirect immunofluorescent technique (IFT) was used for confirmation of BoHV-1 presence in CAM; the CAM with clear pock lesions showed yellowish-green fluorescence ...

Imtiaz Ahmed*, Imran Khan and Zia Ud Din

...uo;. The ash, fiber and protein content increased significantly while the carbohydrate content had significantly lower values (p, for all trends < 0.05) as the ratio of incorporation increased when compared with the control sample (data not shown here). The CWB also showed significantly (P<0.05) higher phenolic and total flavonoids content. Furthermore,CWB showed significantly (P<0.05) higher antioxidant activity, low starch digestibility and low hydr...

A. El-Shemy1*, Hoda M. Mekky2, M. A. Bosila2, A. M. Allam1, Kh. M. Elbayoumi2, M. M. Amer3 

...ip using the partial 3D protein revealed that the isolated Egyptian strains in this study were distant from the vaccine strain used in Egypt. In conclusion, three isolates of DHAV-1 were characterized from the examined duck flocks. Phylogenetic analysis of these isolates revealed the occurrence of differentiation between our field DHAV-1 isolates and the vaccine strain. Therefore, applying an appropriate vaccination program for breeder duck flocks is significa...

Hui Xu1,*, Ronghua Luo1, Yaping Duan1, Mingjia Chen1, Jiaxu Zhou1 and Xiaoli Shao2

...3), and lung surfactant protein A (SP-A) before and after treatment were evaluated between the two groups. The total effective rate of treatment in the experimental group was higher than that in the control group (P<0.05); the cough relief time and hospitalization time of the experimental group were shorter than those of the control group (P<0.05); after treatment, FEV1%, V-T, FEV1, and FVC in the experimental group were higher than those in the control ...
Baila Ahmad1, Muhammad Ammar Khan1*, Zulfiqar Ahmad1, Rana Muhammad Bilal2 and Asghar Ali Kamboh3
...ash, moisture and crude proteins indicated retention of nutritional and market value of the broiler breast. The raw meat samples were not PSE (L* was 52.43±1.6). Thermal processing increased lightness and chroma but decreased redness and hue angle. Furthermore, the 80°C treatment significantly increased product doneness and sensory scores. Finally, the correlation analysis showed that industrial, as well as consumer acceptability were influenced by ...

Limei Yuan1, Kong Yang1* and Dechun Jiang2*

...mpered the taxonomy and protection of these species. In this study, we investigated the molecular phylogenetic status of R. laoshan and Z. yinggelingensis using mitochondrial DNA (12S rRNA, tRNAVal, 16S rRNA and Cyt b) fragments and nuclear DNA (RAG-1, RHOD, TYR) fragments. Our results revealed that Rhacophorus laoshan is closely related to R. verrucopus, R. orlovi and R. calcaneus, and Zhangixalus yinggelingensis should indeed be placed under Zhangixalus. Thi...

Sameena Gul1, Sayyeda Hira Hassan1, Amara Maryam1, Hafiz Abdullah Shakir1, Muhammad Khan*1, Muhammad Irfan2, Farah Rauf Shakoori1 and Javed Iqbal Qazi1

...d cell cycle regulatory proteins. Clinical studies demonstrated that EGCG treatment of different type of cancers has synergistic effect in combination treatment with other common clinical drugs (cisplatin, taxol, doxorubicin and vinblastine) by modulating chemotherapy response to cancer cells as compared to clinical drugs alone. This review enlightens the possible mechanisms by which EGCG overcome chemo-resistance and recover efficacy of many clinical drugs in...

Abdullah Channo1*, Asmatullah Kaka1, Qudratullah Kalwar2, Imdadullah Jamali3, Ghulam Jelani2, Muhammad Bakhsh4, Ghulam Nabi Dahri5 and Jai Parkash Goil6

...ing different treatment protocols such as hormonal, medicinal and homeopathic medicines.

...

Xiaowei Huang1, Jinji Wang1, Zhun Yu2, Minghua Duan1* and Zhe Lin1*

...aims to investigate its protective effect on kidney injury and its influence on BMP-7/Smads/TGF-β1 signal pathway in irradiated rats. Total 60 Sprague Dawley (SD) rats were randomly divided into 5 groups: the normal (normal saline), model (normal saline), and low, medium, high dose of ASP groups (9.0, 18.0 and 36.0 mg/mL, 2.0 mL/kg·d, intragastric gavage once a day for 14 days). On the 15th day, all other groups received 60Co γ-ray irradiatio...

Xiaojing Liu and Zhongxin Li*

...VEGF) and matrix metalloproteinase (MMP-) 9 protein expression in kidney tissues, in order to reveal the mechanism of TSG. After 12 weeks of administration, compared with those in the DN modeling group, 24 h urine protein, serum creatinine (Scr), blood urea nitrogen (BUN), blood uric acid (UA), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) significantly reduced in rat...
Muhammad Zaeem Abbas1, Khurram Ashfaq1, Amjad Islam Aqib2, Mughees Aizaz Alvi1*, Muhammad Haleem Tayyab1, Muzafar Ghafoor1, Muhammad Usman Naseer3, Ali Abbas4 and Ali Hassan1

Harpreet Kaur* and S.S. Hundal

...dacloprid, indicating neurotoxicity. There was an initial increase in the GST activity followed by its decrease with the duration of exposure to imidacloprid. Imidacloprid is highly toxic to earthworm inducing physiological which may cause catabolism of enzymes. Earthworm M. posthuma was observed to be more susceptible as compared to E. eugeniae. The current study signifies that the irrational use of such insecticides could pose high threat to non-target organ...

Khalid Khan1*, Ahmed Farhan Saeed2, Sanam Wagma Khattak3 and Saima Liaqat4

... the foremost source of protein and nutrients for the general masses. The prime impact of the poultry industry is to provide an inexpensive and economical source of meat with high nutrients value to the masses. Keeping in view, the significance and need of dietary protein and it is easy availability, the study has underlined the key determinants of adoption of improved poultry practices and technology in the poultry industry...

Dede Kardaya*, Dewi Wahyuni, Elis Dihansih 

...lity (moisture content, protein, fat, ash, and phosphorus) parameters. Data were subjected to an analysis of variance and a Duncan’s multiple range test. Results revealed that meat cooking loss and fat content were significantly lowered (P<0.05) in ducks treated with treatment rations. No significant differences were found in other physical and chemical quality parameters. It was concluded that supplementation of 2, 4, and 6% AGLM reduced cooking loss...

Mostafa El-Sebelgy1*, Hanafy Madbouly2, Sabry Tamam2, Nagwa Ata1, Kawther Zaher1

 

... before. Therefore, the proteomic approach was utilized. The virus was isolated on SPF-ECE and concentrated using PEG-6000. The concentrate was analyzed using liquid chromatography with tandem mass spectrometry (LC-MS/MS) using a technique called untargeted (label-free) shotgun proteomic analysis. The resultant peptides were used along with RefSeq proteins and primers for multiple sequence...

Muhammad Ajmal Khan1, Muhammad Yahya2*, Ali Hazrat2, Javed Khan3, Saeed Jan4, Tabinda Nowsheen2 and Inam Ullah5

...ough a well established protocol 2,2-diphenyl-picrylhydrazyl hydrate (DPPH) at various concentrations (50, 100, 150, 200, and 250 µL). The phytochemical analysis of methanolic leaves extract of T. camphoratum showed 2.80% alkaloids, 4.90% flavonoids and 1.80% terpenoids content. The antibacterial activity of the methanolic extract showed high effectiveness against Gram-positive bacteria (MRSA) with 23 mm zone of inhibition (ZOI), whereas against Gram- ne...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...n via volatile signals, protein interaction and cues. 

...

Arsalan Maqbool1,2, Faez Firdaus Abdullah Jesse1,3*, Eric Lim Teik Chung3,5, Abd Wahid Haron3, Mohd Azmi Mohd Lila5, Bura Thlama Paul3,4, Khaliq ur Rehman Bhutto3,6 

 

...Mannheimia haemolytica serotype A2 during rainy and hot seasons. Twenty-four healthy female, non-pregnant does were used, and divided into two equal groups, 12 does were further allocated into 3 groups (n=4), control, non-vaccinated and vaccinated in each season. After acclimatization and synchronization procedure, the vaccinated group was administered with 2 mL of alum-precipitated pasteurellosis vaccine while non-vaccinated and control groups were administer...

Taufiq Bachtiar1, Muftia Hanani2, Anisiyah2, Winda Puspitasari2, Wahidin Teguh Sasongko3, Teguh Wahyono4*

.... Organic matter, crude protein, ether extract, and non-fiber carbohydrate content in soil with pH 5.4 ranged between 91.94–94.67, 27.78–38.20, 13.99–22.78, and 16.31–33.82% DM, respectively. Meanwhile, in soil pH of 4.0, ranges were 92.24–94.80, 23.07–39.99, 14.88–22.82, and 12.69–38.20% DM, respectively. The Deja 2 genotype had the highest (p < 0.01) IVDMD value (84.07 %) in pH 5.4 soil. However, in pH 4.0 s...
Gamilat A. Elsaid1, Weam Mohamed Baher1*, Eman Shukry1, Abeer E. Abd El. Ghafar2, Marwa Shalaby1
...t of the human needs of protein, vitamins, and minerals. This study aimed at estimation of most probable number (MPN) of coliforms and E. coli and investigation of the prevalence of shiga toxin producing E. coli in kareish cheese collected from grocery stores and street vendors at Mansoura city, Egypt. In addition, molecular confirmation, and detection of shiga toxin coding genes (stx1, and stx2) in the recovered E. coli isolates was done using PCR. Moreover, ...

Lyudmila Yakovlevna Rodionova*, Irina Valeryevna Sobol, Lyudmila Vladimirovna Donchenko, Artem Vasilevich Stepovoy  and Andrey Georgievich Koshchaev

...anic acids, vitamin C, carotene, pectin substances) of pumpkin varieties grown in the south of Russia. In the course of the study, standardized and modern methods of physical and chemical analysis of plant materials were used. The biochemical parameters of pumpkins were studied: the content of dry substances, sugars, titratable acidity, the content of ascorbic acid and carotene. Data on the content and fractional composition...

Zohair S. Mulla1*, Mostafa M. Abdelhafeez2 

...er identified into six serotypes, namely E. coli O2:H6, O26:H11, O55:H7, O78:H-, O86:H11, and O119:H4. Detection of shiga toxin producing genes (stx1 and stx2) in the recovered serotypes was followed using multiplex PCR. A significant decrease in the microbial loads was recorded after dipping of the formulated ground beef as meat balls in the acid solutions, particularly at the acid cocktail 2%. To the best of our knowledge,...

Xiaoguang Su1,*, Yanjun Gao2, Yanling Wang1 and Yaohui Ma2

...s of Ki-67, PCNA, Bcl-2 protein were significantly reduced (P <0.05), and the level of Bax protein was significantly increased (P <0.05), the expression level of miR-128-3p was increased significantly (P <0.05), the expression levels of EPHB2 mRNA and protein levels were decreased significantly (P <0.05). After overexpression of miR-128-3p or inhibition of EPHB2, the cell viabi...

Rahmat Ullah Khan1*, Asif Sadam2, Karim Gabol1, Waheed Ali Panhwar3, Sajid Mahmood4, Mustafa Kamal5, Hamid Ullah6, Syed Abidullah7, Muhammad Tufail8, Bashir Ahmad4, Gul Bacha Khan4 and Habib Ul Hassan1

...ps. Awareness about the protection strategy of skylark from egg laying till fledging is required among locals and farmers.

...

Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*

...o express a recombinant protein (SAG2), identified using SDS-PAGE and Western blot analysis. The purified protein was then used as a coating antigen to establish an indirect ELISA method for detecting the T. gondii antibody in pet cats, whose reaction conditions were optimized. The SAG2 gene was successfully cloned into a pET-21a (+) prokaryotic expression vector, and the recombinant plasmid pET-21a-SAG2 was obtained. The si...

Muhammad Furqan and Zulfiqar Ali

...es. Development of more protected areas for conservation, awareness education, implementation of wildlife laws, patrolling of officials in the breeding season, and long-term monitoring plan can help in the conservation of kalij pheasant.

...
Muhammad Kashif Iqbal1*, Khalid Mehmood2,4, Shakeel Ahmed3, Fazul Nabi4, Muhammad Arif Rizwan1, Muhammad Kaleem1, Mushtaq Ahmed1, Abdul Waheed1 and Jiakui Li5
...erum biomarkers and the protective effects of the medicine was assessed through these values. Results showed that VEGF mRNA levels were significantly (P<0.05) up-regulated; however, the Flk-1 receptor levels were down-regulated in TD-affected birds significantly (P< 0.05) as compared with the control group. Furthermore, thiram induction also increased the levels of AST, ALT and MDA contents in liver, whereas decreased the antioxidant enzymes (SOD; GSH-Px...

Mohammed A. Almujtaba1, Turky Omar Asar2, Salma Naqvi3, Vikas Kumar4, Fahad A. Al-Abbasi1, Abdulbasit I. Al-Sieni1 and Firoz Anwar1*

...28 days of experimental protocol. Group-1 served as normal control (NC), group 2 as doxorubicin control (DC), group 3 as doxorubicin+ Zamzam treatment (DZ) and group 4 as Zamzam control (ZZ). Doxorubicin (1mg/ kg bw) was injected i.p. in DC and DZ groups on first day of study. NC and DC groups were at normal bottled water p.o., while DZ and ZZ groups received Zamzam water p.o. for 28 days. At the end of protocol, the animals...

Ehab A. Fouad1*, Khaled A. Abd El-Razik2 , Eman H. Abdel-Rahman3

...ed by purification with Protein A Sepharose gel. The separated IgG was dialyzed for 3 days against a 0.1 M NaHCO3 buffer pH 8.3 with 0.5 M sodium chloride and 0.02 percent NaN3 before being linked to CNBr-Sepharose 4B swollen beads. Bound fraction was eluted with mixture of glycine (0.1 M) and sodium chloride (0.5 M) at pH (2.3). Purified antigens and unbound were inspected of protein concentration. In the crude antigen, the...

Amira Adel Taha AL-Hosary1, Walaa Mostafa2* 

...ost effective treatment protocol with a synergistic effect (100% recovery rate), followed by Frontline® (95%), BARS® ampules (75%), and finally, BARS® ear drops (66.67%).

Keywords | Cat, Otoacariasis, BARS®, Frontline®, Age, Season 

...

Zhaojun Wang1, Yang Zhou2 and Xinghua Song3*

...ower, and matrix metalloproteinases content was also significantly reduced (P<0.05). IL-1β, IL-6 and TNF-α in the observation group were respectively 8.07±3.13 ng/mL, 9.31±6.83 ng/mL and 7.72±1.86 pg/mL, with MMP-3 and MMP-9 contents at 29.42±6.74 and 20.23±5.24, showing significantly superior improvement compared with the control group and indicating statistically significant difference (P<0.05). The inciden...

Hairul Islam M. Ibrahim1,2, Abdalla A. Sayed1,3, Abdel Naser A. Ahmed4,5 and Emad A. Ahmed*1,6

...gh antioxidant and neuroprotective effect. The present study was designed to evaluate the immunomodulatory properties of pinocembrin (PCB) and the anti-apoptosis effects using in vitro and in vivo mice splenocytes and experimental autoimmune encephalomyelitis (EAE) in C57BL/6j female mice, respectively. The reduction of clinical symptoms and disease index were evaluated by histochemical analysis. T-cell population and cytokines levels in myelin oligodendrocyte...

Omnia Mohamed Khattab1*, Hala Kamel Abdelmegeed2, Mohamed Mahmoud Mashaly1, Mervat Hamdy1*, Naglaa Hagag1, Ayman Hamed3, Hanan Aly Fahmy3, Essam Ibrahim4, Momtaz Abdelhady Shahein2, Elsayyad Mohamed Ahmed2

...ositive. The virus glycoprotein B (gB) fragment (580pb) was amplified in selected isolates using the nested PCR (n-PCR), sanger sequencing of gB from three isolates with phylogenetic analysis reveals the full identity between the Egyptian isolates from the outbreaks and other EHV-4 strains available in databases proving wide distance with other EHV-8 and EHV-1. The study recommends rt-PCR as a screening test for the tentative diagnosis of EHV-4 in epidemiologi...

Hakan Kececi1*, Yasin Ozturk2, M. Bahaeddin Dortbudak3, Seda Yakut4, Gurdal Dagoglu5 and Merve Ozturk1

...pendent hepatotoxic, nephrotoxic, hematological and biochemical effects were analyzed. No histopathological change was detected in the liver and kidney tissues of the rats in the experimental groups. Both hematological and serum biochemical values (Ca, P, TBIL, ALT, AST, ALP, Urea, and Creatinine) were within the physiological limits in all groups. Consequently, in light of the obtained data, it was observed that the rats were not exposed to any toxic effect e...

Eman A. Al-Shahari1,2, Eman R. ElBealy3, Abdelhalim A. Alkhazendar4 and Abeer A. Alm-Eldeen4*

...ession of pro-apoptotic proteins p53 and bax and increase the antioxidant defense of hepatocytes in aged male rats.

...

Jie Zhang, Na Li, Tingting Guo, Dandan Hu, Xiaofeng XU and Lili Zhang*

...hereas the abundance of Proteobacteria in the rumen of the house-raised group was significantly higher than that in the grazing group (P < 0.01). At the generic level, the abundance of Fibrobacter, Ruminococcus, Lachnospiraceae_XPB1014_group, and Lachnospiraceae_NA, which are associated with hemicellulose degradation, and Desulfovibrio, which is associated with lactic acid oxidation, was significantly higher in the grazing than in the house-raised group (P ...

Junling Liu, Chen Sun, Qiao Yu, Yanzhi Liang, Shanshan Lin and Meng Tian*

Afifa Yaqub1, Mehroze Amin1, Qindeel Fatima1, Rabail Hassan Toor1,3, Saira Aftab1 and Abdul Rauf Shakoori1,2*
...ubunit of AMP-activated protein kinase (AMPKα2), RNA polymerase II transcription elongation factor (ELL2), and pro-apoptotic Bcl-2 homology 3-only protein (BIM) in MCF-7 breast cancer and normal human embryonic kidney HEK-293 cell lines were studied in response to treatment with different concentrations of UNC0642. Inhibition of G9a expression was observed in a dose-dependent manner in both cell lines with increasing U...

Gawhara Ahmed-Abdelmonem1*, Zeinab Aboezz2, Ahmed Habashi1, Saad Sharawi2 

...for cattle production. Serotype A is one of FMDV that is already existing and incriminated lastly in serval problems in cattle population. So, this study aimed at molecular characterization of serotype A FMDV that has been involved in the latest FMD outbreaks in Egypt. Thirty-six samples (26 blood and 10 oral epithelial tissue samples) were obtained from suspected cattle in three Egyptian governorates during 2019-2020. The s...

Xiangli Dong1,2, Shilin Mikhail Borisovich2, Jiji Li1,*, Jianyu He1, Zeqin Fu1, Yingying Ye1, Julia N. Lukina3, Olga V. Apalikova4 and Jianshe Zhang1

..., we performed membrane protein analysis and epitope analysis to select MRC1 and MRC2 protein fragments suitable for antibody production. We then PCR amplified L.c-MRC1 and L.c-MRC2 and cloned them into prokaryotic protein expression vectors (MRC1 (1044bp)-pET32A and MRC2 (993bp)-pET32A). We performed SDS-PAGE analysis of the expressed L.c-MRC1 and L.c-MRC2 prot
Zahra Naz1,2, Fouzia Ismat1, Muhammad Saleem2, Mazhar Iqbal1, Aamir Shehzad1 and Moazur Rahman1,2*
...ustify;">The matrix (M) protein is the most abundant structural protein in Newcastle disease virus (NDV), the causative agent of Newcastle disease (ND) in chickens. Owing to its highly conserved nature among NDV strains and also due to its pivotal role in the viral life cycle, the M protein can be employed as a promising diagnostic antigen for reliable detection of NDV infection in chicken...

Umar Farooq Gohar, Attia Majeed, Bushra Muneer* and Hamid Mukhtar

...h yeast extract sucrose broth medium with 15% and 5% supplementation of glucose and peptone as carbon and nitrogen source, respectively at pH 5.5 and temperature 25ºC. The endophytic fungi emerging as an alternative source of such medically important secondary metabolites.

...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...crobiome and ultimately protecting the chicken from pH-sensitive pathogens. The purpose of this study was to define the bactericidal action of organic acids on Campylobacter jejuni, individually and in combination. Total 120 broiler chickens were randomly distributed in ten groups. The groups included negative and positive control, pure organic acid group and commercial organic acid formulation group. Excluding negative control group, all other groups were ora...

Malik Fiaz Hussain1, Atif Akbar2, Muhammad Asif1, Laraib Nisar3, Muhammad Naeem Ashiq3 and Furhan Iqbal1*

...reated male mice, during rota rod test, spent significantly less time on rotating rod than controls. Male mice treated with both doses of NiO NPs performed more stretch attend reflex than control. Female mice injected with high dose of NiO NPs had significantly reduced mobile and immobile episodes during open field test than mice exposed to low dose and control group. High dose of NiO NPs treated females had reduced line cro...

Qi Zhuo, Yuanchun Yao, Meisongzhu Yang*, Jinhua Chen and Miao Tian

...f miR-216b-5p and HDAC8 protein expression in tissue samples; reverse transcription quantitative PCR (RT-qPCR) real-time analysis of miR-216b-5p, HDAC8 mRNA expression in cell lines; MTT detection of cell proliferation; wound healing test and transwell assay were used to evaluate the ability of breast cancer cells to metastasize and invade; colony formation test was conducted to detect the effect of HDAC8 on the cells. We found that the expression of miR-216b-...

Alexander Tsybulsky1*, Eduard Kostetsky1, Anton Degtyarenko2, Michail Shchelkanov1,2,3 

...lar censor systems that protect the health of the cellular genome. Evaluation of the expression levels of this spectrum of genes, especially the gadd45g and ifnλ1 genes, may be useful as an additional criterion for the differential diagnosis of benign and malignant breast diseases in cats.

Keywords | Breast cancer, Mastopathy, Interferon genes, Tumour-suppressor genes, Expression 

...

Abdulkhaliq A. Al-Janabi1*, Mohammad S. Alsalami1, Arkan B. Mohammed1, Abdulkhaliq A.R. Al-Douri2 

...erides, low-density lipoproteins and the aspartate aminotransferase (AST) and alanine transaminase (ALT), were significantly decreased in both Omega-3 treated groups compared to the control. In conclusion, the supplement with Omega-3 (150 and 300 µl) induced the growth rate, and liver enzymes, and reduced their lipid profiles, suggesting it would be a beneficial dietary supplement for rabbits.

Keywords | Omega-3, Polyunsaturated fatty acids, Diet...

Sarzamin Khan1, Abdul Jabbar Tanweer2, Rafiullah1, Ibrahimullah1, Ghulam Abbas3*, Jabbar Khan4, Muhammad Saeed Imran5, Asghar Ali Kamboh6 

...eased demand for animal protein and high cost as well as shortage of conventional feed ingredients has driven the dire need to search for alternative protein and energy sources to be incorporated in poultry feed. Insects may be one of the alternative feed source which can be used as a good quality, low-cost and sustainable ingredients of poultry feed. Therefore, the present experiment was designed to explore the effect of di...

Desy Cahya Widianingrum1*, Himmatul Khasanah1, Melinda Erdya Krismaputri1, Susan Barbara Patricia Sembiring Meliala2 

...with supplementation of protected Virgin Coconut Oil (VCO) made by the non-heating method. The ration of the wafer consisted of 30% rice straw, 30% concentrate, 30% indigofera, 5% molasses, and 5% VCO. The group of treatments were wafer supplemented with VCO (P0); wafer supplemented with VCO saponification (P1); wafer supplemented with VCO protected by formaldehyde (P2); wafer without VCO (P3); and wafer supplemented with VC...

Haitham Al Masruri1, Rashid Al Zeidi2, Aiman Al Mufarji3, Abd El-Nasser Ahmed Mohammed3, Ahmed Al-Madani4, Al-Hassan Mohammed5* 

...al constituents such as proteins, essential fatty acids, vitamins, and beta-carotene. The M. oleifera composition varies depending on nutrient availability for production, species, and lifespan of trees. Extracts of leaves and seeds were used for the production of invaluable compounds. Knowledge of M. oleifera impacts on productive, reproductive, and therapeutic performances is more fragmentary and the present review is comp...

Muhammad Mansoor1, Shahid Hameed Khan Khalil2*, Zafar Islam2, Muhammad Asif2, Ghani Akbar2, Muhammad Ashraf Khan3 and Ibadullah Jan4

...ts collected from trees protected from rain-fall. The results show that BCR for fresh dates was 2.85, while, it was 1.06 for dry dates. It is depicted that fresh dates give double economic return as compared to dry dates. It was observed that 1Kg Khalal fruits yields ½ Kg dry dates whereas the same quantity of Rutab fruits on ripening and drying yields ¾ Kg of fresh dates. General evaluation of bunches bagging treatments on fruiting traits was co...

Eman H. Abotalp, Sahar R. Mohamed, Jakeen K. El Jakee

...ed with unsafe E. coli serotypes and the antibiotic resistance in these E. coli isolates. A total of 129 rectal swabs were gathered from apparent healthy and diarrheic canines and felines. By using Vitek2 compact system, 42 E. coli isolates (32.6%) were resulted from canines (24%) and felines (44.4%) rectal swabs. E. coli were serotyped to: O8, O25, O26, O28, O36, O55, O78, O86, O111, O114, O125, O127, O128 and O157. Th...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari

...native source of animal protein. This research aims to study the effect of the Tenebrio molitor caterpillar in concentrate and tofu dregs growth media on nutrient content and determine the Tmc effect in the diet on the production of laying quail. The study was divided into two stages of research. Phase 1 of the laboratory experiment determined the composition of the concentrate and tofu dregs media on the nutrient content of Tenebrio molitor. This study method...

Tertia Delia Nova1*, Yulia Yelita2, Rizky Machicula1

... ingredient for fibrous protein sources. In addition, it contains several minerals, xanthophyll pigments and -carotene which are important nutrients for ducks. However, the practical use of this plant has not been fully studied. This experimental study used a Randomized Block Design with a Split Plot pattern. The ducks were divided into three groups. Each group is further classified into three weight classes. The variables o...
Abdulaziz A. Alaqil1*, Mohammed I. Buhaya2
... nutritive value animal protein foods sources consumed all over the world. Recently, with the increasing of health-conscious there is a growing interest in producing and consuming functional foods especially for individuals suffering from chronic diseases. The current study aimed to investigate the effect of dietary linseed oil (LO) inclusion, as enriched-source of omega-3 polyunsaturated fatty acids, on egg production performance and egg yolk cholesterol cont...

Razaq Adekunle Animashahun1*, Gbenga Emmanuel Onibi2, Samuel Olanrewaju Aro2, Oghenerobor Benjamin Akpor3, Funmilayo Abimbola Okeniyi1, Olayinka Olubunmi Alabi1, Michael Babatunde Falana1, Ayoola John Shoyombo1, Samuel Oyewale Olawoye1 

...riod. The highest crude protein (CP), ether extract (EE), ash, and lowest crude fiber (CF) in fermented cassava stumps were obtained at 192 hours of fermentation with the following values CP 7.45%, EE 9.81% and ash 7.01%. A similar trend was also observed for mineral enhancement and anti-nutrient degradation. Conclusively, this study showed that solid-state fermentation using Aspergillus niger (ATCC 16404) strain can effectively enhance the nutritive value of ...

Asim Faraz1*, Nasir Ali Tauqir2, Abdul Waheed1, Hafiz Muhammad Ishaq1, Syeda Maryam Hussain3, Riaz Hussain Mirza1, Rana Muhammad Bilal2, Muhammad Arslan Akbar4 and  Muhammad Shahid Nabeel5 

...l, triglycerides, total protein, urea and creatinine concentrations were analyzed on haematology and biochemistry analyzer. The mean Hb concentration (P<0.05) was found to be 14.77±0.76 and 14.16±0.97 g/dl in non-breeding and breeding males, respectively. The hematological values of RBC, WBC and PCV were found to be varied (P<0.05) as higher in non-breeding animals, while the biochemical indices including cholesterol, triglycerides and tota...

Waqas Raza1*, Muhammad Usman Ghazanfar1, Muhammad Asif2, Ikram-ul-Haq3, Muhammad Zakria4 and Laith Khalil Tawfeeq Al-Ani5,6

...rowth was observed on carrot agar media across most isolates. Therefore, the determination of morphological characteristics for plant-pathogen may add knowledge of the taxonomic behavior of pathogen. The usage of various growth media is providing a useful pattern of the growth that can be utilized in determining the best possible control of late blight disease.

...

Hassan A. Aidaros, Eman M. Hafez, Halla E.K. El Bahgy* 

...against field isolated serotypes of E. coli, Pasteurella multocida, Campylobacter jejuni, and Staphylococcus aureus from chicken and duck farms production at a titer of 3×106 CFU (Colony Forming Unit) /cm2 in the absence and presence of organic matter (O.M). The results showed that the efficiency of disinfectants was significantly increase with high concentration and long contact time. The Prophyl 2000® was the most powerful disinfectant against fiel...

Entesar Z. Eliraqy1*, Basant M. Shafik2, Yasser S. Hussein1, Abdelwahab A. Alsenosy3, Emad A. Abd allah1, Mohamed F. Saad1 

...Egypt. The experimental protocol was designed as four groups (Control, G1, G2 and G3). Buffalo-bulls’ semen were exposed to different concentrations of garlic extract (0, 3, 6 and 9%, respectively) to evaluate the semen quality parameters after cooling and freezing process. Data obtained showed that, progressive motility, live spermatozoa and acrosome integrity % were higher (P < 0.05) in G1, G2 and G3 with reduced mortality percentage than control gr...

Gudeta Nepir Gurmu, Tade Bitima Mulisa, Alemu Lenco Gemechu, Kegna Gadisa Amena and Gemechu Nedi Terfa*

...s crops that is rich in protein and essential amino acids. A field experiment was conducted during the 2019 cropping season consisting of eight (Bursa, Burkitu, Adi, Herena, Hortu, Letu, T/shaman, and Weyib) improved field pea varietiesand one local variety at west Showa zone Oromia region to identify high yielding varieties. The experiment was carried out using a randomized complete block design with two replications at Babich, Goda Hora, Chelia Rafiso Alenga...

Madumetja Cyril Mathapo and Thobela Louis Tyasi*

...esticular length (TL), scrotal circumference (SC), body weight (BW), body length (BL), heart girth (HG), rump height (RH), withers height (WH) and sternum height (SH) were measured. Pearson’s correlation and simple linear regression were used for data analysis. Phenotypic correlation outcomes indicated that SC had a positive statistically significant (P<0.05) correlation with BW (r = 0.425) and non-significant correlation with BL (r = 0.108), HG (r = ...

Tariq Ali1,2*, Kamran1, Abdur Raziq1, Inam Ullah Wazir1, Anwar Ali1, Muhammad Ijaz Ali1, Muhammad Shuaib Khan2, Shakeeb Ullah2 and Sher Hayat Khan3

...andida spp. (4.1%), and Proteus spp. (1.5%). The isolated bacteria were mostly resistant to ampicillin (96.5%), sulphamethoxazole (96.5%), streptomycin (95.1%), oxytetracycline (85%), and amoxicillin (78.1%). However, the isolates were highly susceptible to enrofloxacin (86.2%), gentamicin (83.5%), and florfenicol (82.6%). This study might be helpful to the clinicians and researchers associated with the dairy industry for designing prophylactic as well as ther...

Anara Ryskeldina, Indira Iskakova, Nurgul Sarina , Alexander Shevtsov , Laura Syzdykova, Alexander Shustov, Yerlan Ramankulov, Marat Kuibagarov* 

...egnancy-associated glycoprotein 1 (boPAG1) antigen. The aim of this work was to produce a recombinant boPAG1 antigen and obtain monoclonal antibodies (mAbs) against boPAG1. We have obtained the boPAG1 cDNA and are reporting its nucleotide sequence. Bacterial expression of a portion of the natural gene encoding a mature form of boPAG1 failed. But a fusion protein made up of E. coli thioredoxin and boPAG1 was efficiently expre...

Maher Mohammed Yousef Alobaysi,1,4 Turki Albacker2, Waleed Alharbi2, Osama Almogbel2, Sadik Mohammed3, Fahad Al-Abbasi4, Vikas Kumar5 and Firoz Anwar4

...thyronine, thyroxine, thyrotropin and Vit D in paired sample correlation. WBC counts measured before and after intervention were 5.81±1.12 and 5.19±0.98 respectively, which showed a significant fall in the WBC count and increase in cortisol after intervention. These alternations suggest to review and redesign the curricular or assigning duties to medicos under training.

...

Fatin Khalil*, Harinath Yapati, Zainab Al Blallam, Ronia Jose 

..., dry ewes’ total protein and hemoglobin levels are significantly greater (P<0.05) than other types of sheep, according to a biochemical investigation. The results showed that the physiological, biochemical, hematology analysis and production performance of Naeemi sheep were affected by the seasons and stage of production and growth.

Keywords | Naeemi sheep, Seasonal effect, Intensive management, Reproductive performance, Baseline data. <...

Iram Amin1,2*, Shazia Rafique1, Nadeem Ahmed1, Muhammad Shahid1, Samia Afzal1, Tahir Rehman Samiullah1, Mohsin Ahmed Khan1 and Muhammad Idrees1,3

...HDAg, which is the only protein of HDV of the local isolate is the primary objective of the study. This antigenic recombinant HDAg protein can be useful for both vaccine development and as a diagnostic marker of HDV. After determination of HDAg antigenic region of HDV and its amplification, the fragment was cloned in bacterial expression vector. The expression of recombinant protein was ch...
Ghulam Nabi Dahiri1, Akeel Ahmed Memon2, Qudratullah Kalwar3*, Asmatullah Kaka2, Waseem Ali Vistro4, Yar Muhammad Jalbani3, Kiran Nazish3 and Jai Parkash Kolhi5
... estrus synchronization protocols with or without biostimulation in Thari cattle. A total of forty Thari cattle maintained at semi intensive management conditions at Thari Cattle Farm Nabisir Road, Distt: Umerkot were used in the study. The selected animals were divided into four groups to observe estrus signs and artificial insemination. Animals of group B and D were treated with OvSynch (GnRH at day 0 followed by PGF2α day 7 and 2nd GnRH at day 9) for ...

Amoon Danial1, Shahan Azeem1*, Sohail Raza1 and Muhammad Hassan Mushtaq2

...ect antibodies for glycoprotein E of BoHV-1. Of 126 sampled goats 13 (10.3%) were seropositive for BoHV-1. The odds ratio analyses indicated that both the history of abortion and respiratory disease as well as being a male goat and accompanying cattle were significant risk factors for BoHV-1 infection in goats, however, age (> 2 years), was not a significant risk factor. To our knowledge this is first study in Pakistan investigating the role of goats in the...

Olufemi Bolarin, Sijuade Adebukola Adebayo and Sola Emmanuel Komolafe*

...lching (Mean=3.46), crop rotation (Mean=3.27), organic fertilizer (Mean=3.07) and cover crops (Mean=3.05). The result of regression analysis showed that coefficient value of farm size (p=0.017) and membership of cooperatives (p=0.013) positively enhanced resilience building used to mitigate the effects of climate change. The study further averred that inadequate finance, traditional belief, and inadequate access to new technologies were serious constraints enc...

Oluwatoyin Adenike Fabiyi

...infesting lettuce and carrots. T. procubmens and S. acuta was applied as soil amendment (400, 600 & 800g) and organic solvent crude extracts (40, 60, 80g/kg soil) in M. incognita infested lettuce and carrot plants as treatments. Results showed that lettuce and carrot plants grown in pots amended with the highest quantity of plant materials (800g) had commendatory vegetative growth all ...

Muhammad Shafiq1, Tehseen Ashraf2*, Sehrish Mushtaq1, Naveeda Anjum3, Muhammad Asim4, Muhammad Aqeel Feroze3, Malik Abdul Rehman4 and Marja Aziz3

...ubtropical countries. A Protocol for chili plant regeneration with hypocotyl and cotyledon explants was established. The study was conducted to observe the effect of genotypes, culture conditions and growth regulators on plant regeneration of chili pepper genotypes (Seedex Pepper (SP), Loungi, Tatapuri, and Sanam) grown in Pakistan including. For both hypocotyl and cotyledon explants, SP was found to be the most sensitive among the tested genotypes tested. Max...

Zayed M.A1, M.F. Shehata1, I.M. Ismail1, Mona Mohammady1, M.A. Radwan2*  

... G1 and G2 groups. Meat protein % was higher (p <0.05) in G3 than G1 group. Meat of the G3 group was less (p <0.05) tender than other two groups. The ultrasound Longissimus dorsi muscle area (ULDMA) and ultrasound fat thickness have a positive significant (p <0.05) correlation with carcass back fat and carcass Longissimus dorsi muscle area. The hot carcass weight could be predicted using the ULDMA and slaughter body weight, where the model R2 reached ...

Al-Hassan M. Mostafa1*, Gehan Mohammed Sayed2 

... malondialdehyde (MDA), protein carbonyl (PC), Catalase, reduced glutathione (GSH) and superoxide dismutase (SOD). Garlic and coriander treated goats showed significant reduction of FEC as compared with control positive ones. Treated goats exhibit no changes in total peroxides while there were non significant changes of PC, MDA, Catalase and SOD, in contrast there was an obvious increase of GSH. Histopathologically, Abomasum tissue restored completely normal h...

Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed Elbayoumi1 , Sameh Abdel- Moez Ahmed Amer1, Asmaa Mahmoud Matoaq1 , Mohamed Abdel Aziz Kutkat1, Gomaa Abd El-Rhim Abdel-Alim2  

... but there is no marked protection against NDV genotype VII. So, the need of improved vaccines and vaccination protocols to reduce clinical disease and mortality is necessary. The current study evaluated the efficacy of different NDV vaccines used in poultry flocks in Egypt: live attenuated NDV vaccines (genotype II) and live recombinant herpes virus of turkey (rHVT-ND-IBD) alone or in combination with inactivated NDV vaccin...

Rijumoni Daimari, Silistina Narzari, Jatin Sarmah* 

...-9.85%, ash 0.16-0.92%, protein 6.85-22.36%, carbohydrate 10.18-24.65% and calorie 124.31-198.16 k/cal/100g. Among the samples the maximum protein, carbohydrate and calorie were found in liver. Most numbers of the essential amino acids was found in spleen with lysine contributing the largest amount. Fat content was maximum in large intestine, similarly the saturated fatty acid content too was found highest in large intestin...

H. A. Aidaros1*, S. S. Khalafallah1, M. S. Diab2, Nehal K. Alm Eldin2, Halla E.K. El Bahgy1 

...% & 60% of E. coli serotypes, respectively.  The application of good biosecurity programs including strict measures in poultry farms is the preferable method to reduce the risk of pathogenic bacteria and reduce the use of antibiotics.

Keywords | Poultry farms, Hygiene, Enterobacteriaceae, Antimicrobial Resistance, Resistance gens. 

...

Paulus Klau Tahuk*, Oktovianus Rafael Nahak, Gerson Frans Bira 

...ntaining fish meal as a protein source on the performance of fattened male Bali cattle. Cattle used were 15 heads, in the age range of 2 – 2.5 years with an initial body weight range of 158.333±31.565 - 195.333±22.189 kg. Cattle were divided into three ration treatment, where each treatment group consisted of 5 cattle. Ration formulations of T1, T2 and T3 contained fish meal levels of 4%, 8% and 12%, respectively. The observed research vari...

Mian Sabahatullah* and Maqsood Shah

...Indiopius fischeri, Phaedrotoma biharensis, Phaedrotoma angiclypeata and Xynobius maculipennis. New distributional data for already reported species Diachasmimorpha longicaudata are also provided. The study raises the number of species of the subfamily to 9 from Khyber Pakhtunkhwa province of Pakistan.
...

Nurdan Urvaylioglu1*, Ogunc Meral1, Serkan Sayiner2, Ulvi Reha Fidanci1 and Arif Altintas1

...t efficacy. Acute-phase proteins have not yet been adequately studied and clinically used in dairy animals, routinely diagnostic and prognostic, but they are used in human medicine for these purposes.

...
Ahmed H. Massoud1, Mohamed S. Ahmed2, Moustafa Saad-Allah1, Aly S. Derbalah1, Ashraf Albrakati3* and Ehab Kotb Elmahallawy4*
..., hepatotoxicity and nephrotoxicity were obvious in rats treated with cymoxanil, meanwhile, neuronal and pulmonary changes were nearly the same in all doses of the used pesticides. Taken together, our study recommends examining pesticides for their possible adverse effects on animals and humans in case of repeated use, even in small doses, before their application to agricultural fields.

...

Muhammad Ikram Ullah

...for the DNA sequencing. Protein homology was analyzed by the pymol tool to predict the effect on the mutant protein. A novel missense mutation c. 2710A>T; p.904Tyr>Ser was detected, and co-segregation analysis was established in the complex neurological family. The pymol analysis detected the loss of hydrogen bonding between Thr at 904 with Arg at 916 in mutant MAN2B1. It is concluded that a novel mutation is identifie...

Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Ehsan Ullah1, Ali Raza1 and Muhammad Asif3

...sts over time, but also protect environment and human health. Vermicomposting is the process of breaking down and stabilizing solid organic waste to produce fine organic rich manure that can be readily stored, processed, and put into agricultural areas with no negative repercussions. In the vermicomposting process, earth worms and mesophilic microbes collaborate to digest solid agricultural waste under controlled circumstances, resulting in a stable form of or...

Shakeel Ahmad1*, Humaira Wasila2, Juweria Abid3, Nazir Muhammad4 and Hazrat Usman5 

...carbohydrates, fats and protein contents of milk products. Atomic absorption spectroscopy and flame photometry were used for mineral analysis. Total phenolic compounds were evaluated by the Folin-Ciocalteu method. The aluminum chloride colorimetric method was used for evaluating total flavonoids contents. Antioxidant activity was assessed by the DPPH method. The results showed that moisture was high in Buttermilk (92.15±0.13 g/100g), ash and p

Hasan Çelikyürek

...er, testicular length, scrotal length, and scrotal circumference were determined to be 2.98±0.10, 5.56±0.14, 9.76±0.16, and 14.08±0.20 cm in male Norduz lambs, respectively. Body length, chest width, chest depth, withers height, rump height, and chest girth were 50.25±0.55, 14.65±0.15, 23.64±0.25, 58.49±0.55, 59.14±0.55, and 71.39±0.73 cm, respectively. Ac...

Abhishek Pandit1, Suman Poudel2, Manish Gautam3* and Shambhu Shah4

...ively. The selection of protocol depends on the assessment of resources, including facilities, labor, experience, and budget. PGF2α induces luteal regression followed by estrus and ovulation in cows when administered during the luteal period. Progestin suppresses the activity of the ovary and inhibits the dominant follicle maturation due to the suppression of both FSH and LH. Gonadotropin-releasing hormone or an analog is administered with PGF2α to...

Wael Mohamed Wafa1*, Mohammed Mahmoud Hegazy1, Mohamed Mohamed El-said Ibrahim1, Hamdy Abdala El-Nagar1, Rehab Fawzy Ismail2 

... evaluate the impact of protected fat (PF) or glycerol (GL), oral administration on puberty, some metabolic parameters, and pregnancy rate of Friesian heifers. Eighteen Friesian female calves (14.55±1.15 months of age and 205.0±16.09 kg LBW) were divided into three groups (6 in each) according to age and body weight. All groups were fed same diet; control group was untreated (CG), while those in the 2nd and 3rd groups were orally treated with 300...

Hossam Mahrous Ebeid1, Ahmed Abdelkader Aboamer1*, Amgad Ahmed Abu Elella2, Ibrahim Mohamed Khattab3, Osama Hefny Matloup1, Fatma Ibrahim Hadhoud1  

...>Moringa seed cake is a protein-rich source that can be utilized as a feed supplement or a cheaper protein feed ingredient. This study aimed to: (1) assess the ruminal degradation features of machine-dehulled moringa seed cake (DMSC); and (2) examine the effect of supplementing lactating Damascus goats’ diets with DMSC on milk production. Three cannulated rams (50.60± 3.05 kg, body weight) were used to assess th...

Maham Tariq, Aqsa Akhtar and Nauman Khalid*

...text-align: justify;">Carrot and fennel seeds are considered rich sources of antioxidants such as lutein, zeaxanthin, and β-carotene. The study aimed at formulating functional candies fortified with fennel seed extract and carrot juice. The candies can be used to improve the nutritive quality of confectionary products that could be healthy options for all age groups, particularly chil...

Jiangbo Shao1, Donglai Zhu2, Shengqiang Zou1, Guohong Ge1 and Ju Huang1*

...n heat stress response, protein folding as well as metabolism and biosynthesis of amino acid. SOX9 correlated with HSPA1B were negative to the progression in hepatocellular carcinoma patients. These results suggest that SOX9 participated in hepatocellular carcinoma progression through targeted regulation of HSPA1B that might provide novel insights in hepatocellular carcinoma therapy.

...

Zahin Anjum1*, Mubashra Tarana1, Shaista Ali1, Faryal Yousaf1, Amina Rahat1 and Sumbla Yousaf2

... Mg), moisture content, protein, lipids and ash were carried out. The samples were obtained from five different sites of the University Campus, Peshawar- Pakistan. The Atomic Absorption Spectrometry was employed for determination of Cu, Zn, Pb, Ni, Ca and Mg. Furthermore, a spectrophotometer was also used for the purpose of phosphorus (P). However, the analysis of sodium (Na) and potassium (K) content was done through a flame photometer. It was observed that g...
Azra Kalhoro1, Abdul Aziz Mirani2, Fozia Khan Siyal1, Tahira Jatt2*, Abdul Razak Mahar1, Sadia Iram3 and Muhammad Abbas Bhutto4
...nip, cauliflower, and carrot crops, irrigated with sewage water (SW) of peri-urban area of the Karachi. Four treatments were designed, the fresh water (FW) was used as the control (T0), whereas T1, T2 T3 and T4 contained 25, 50, 75 and 100% of SW respectively. The samples analyzed through atomic absorption spectrophotometer using flame atomic absorption techniques revealed that among the five treatments, accumulation of the six metals was found higher with 100...

Ashira Manzoor1, Imran Ahmad Khan1,2*, Muqadas Sadiq3, Muhammad Omer Iqbal4 and Shaukat Hussain Munawar5

...">To evaluate the cardioprotective potential of hydroalcoholic leaf extract of Citrullus colocynthis against doxorubicin-induced myocardial ischemia in rats. Animals were divided into 5-groups each group consisting eight rats. Group-1 was given saline for 2 weeks and on 11th day DOX 18mg/kg was given intraperitoneally. Group-2, Group-3, Group-4 rats pre-treated orally with the leaf extract of C. colocynthis 250mg/kg, 500mg/kg, 750mg/kg respectively for 14 succ...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari 

...rnative feed option for protein sources. This research includes 2 phases. Phase 1. Effect of different medium compositions on the production and nutritional content of Tenebrio molitor larvae. Phase 2. Effect of Tenebrio molitor larvae in the diet on broiler performance. Phase 1 used a completely randomized experimental design (CRD) with six treatments and three replications. The treatment variations were treatments A (100% Concentrate), B (100% Chicken Manure...

Zheng-Yong Wen1, 2*, Chuan-Jie Qin1,2, Bin Li1,2, Rui Li1,2 and Xiao-Tao Shi3*

...t predicted to encode a protein of 172 amino acids. Multiple Leptins alignment showed that four a-helix domains and two cysteine residues were conserved in vertebrates. Three-dimensional (3D) structure modeling revealed that pvLeptin was highly conserved with that of other tetrapods. Genetic synteny analysis revealed that lepB had specifically lost in siluriformes teleosts. Phylogenetic analysis showed that fish lineage contained two clades of leptinA and lept...

Ekechukwu Esther1, Ohanu Chinenye1, Ossai Nelson1*, Elijah Okwuonu1, Hinmikaiye Funmilayo1, Ngene Innocent1, Andong Felix1, Ikegbunam Clara2, Echude Daniel1, Ekeh Felicia1 and Odo Gregory1

...up. The diets contained protein, fibre, ash, fat and sugar /energy. Feed efficiency increased in the rats fed on 30% and 50% C. cajan. Crude protein digestibility decreased (P< 0.05) with increased levels of C. cajan. The values of plasma total protein, albumin, Albumin/Globulin ratio, glucose, total cholesterol and urea nitrogen revealed non- significant changes among the groups that r...

Hayrettin Çayiroglu1*, Füsun Coskun1, Hüseyin Çayan1, Ayse Gül Filik2 and Ahmet Sahin1

..., total cholesterol and protein levels were not affected while serum triglyceride level and prolactin hormone level increased by fenugreek seed supplementation (P<0.05). Fenugreek seed supplementation did not affect milk organoleptic properties such as smell, taste and appearance. To conclude, fenugreek seed in lactating goats can be used as natural supplement to increase milk yield since fenugreek seed had no effect on sensory properties of milk.

...

Jiahua Peng1,2, Shiyao Hua3* and Qian Wu4

...Kβ and NF-κB protein expression. The results of fasting blood glucose and serum insulin test showed that DHEA could significantly reduce fasting blood glucose and insulin levels and improve insulin sensitivity index, and the effect was more obvious in the high-dose group. The above results indicated that DHEA could regulate the intestinal microbial level of rats, and further regulate the sugar metabolism process of rats by increasing the serum estro...

Muhammad Said1, Amjad Hussain Mirani1, Abdul Kabir*1,2, Muhammad Haris Raza Farhan3, Abdul Latif Bhutto1, Ghulam Shabbir Barham1, Khaleeq Ur Rahman Bhutto4, Muhammad Uzair1, Maaz Khan1 

...have evolved, including proteomic approaches, particular immunoassays, and infrared thermography, all of which provide quick findings. This article efforts primarily on the complex methods of mastitis detection, as identification of the etiological agents are vital to preventing mastitis in dairy cows.

Keywords | Mastitis, Diagnosis, Bovine Mastitis, Immunoassays, Diagnostic Techniques, Chronic Mastitis 

...

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

...external symptoms of chlorotic to yellowish mottling, mosaic spots and deformation were observed in leaves of fig plants. To evaluate the presence of Fig latent virus (FLV -1) in fig plants. One hundreds fig trees were collected with virus-like symptoms and symptomless fig trees. The virus was detected by DAS-ELISA. Infected fig leaves were mechanically inoculated on Chenopodium amaranticolor L. and reinoculated on Ch. amaranticolar L. and Nicotiana glutinosa ...

Reza Aghnoum*, Hamid-Reza Sharifi, Masoud Ghodsi and Ahmad Zare Fizabadi

...ematodes under four crop rotation patterns. The experiment was arranged as a split plot in randomized complete block design with three tillage systems (conventional tillage, minimum tillage and no-tillage) as the main plots and three level of crop residue retention (no-residue, 30%, and 60% of residue retention) as the sub-plots that replicated three times during five consecutive cropping seasons. The results showed that fungivorous and free living nematodes e...

S. M. Ashraful Karim1, Md. Shohel Al Faruk2* 

...sphorus, Glucose, Total protein, BUN, and Serum creatinine. The Urine sample was taken also for determination of Urine pH, Specific gravity, Proteinuria, and Glucose. Ultrasonography was performed to check the condition of the kidney. Increased levels of BUN, Serum creatinine, Proteinuria, and thickened cortex of the kidney confirmed that the cat was suffering from CKD. The diagnosis and m...

Shahid Iqbal, Muhammad Aslam Khan, Muhammad Atiq*, Nasir Ahmed Rajput, Muhammad Usman, Ahmad Nawaz, Ghalib Ayaz Kachelo, Azeem Akram and Hadeed Ahmad

...anthracnose and stem end rot. Previous investigations revealed that the disease incidence may reach up to 100% on fruits under humid conditions. Many management strategies such as chemical control, biocontrol, use of Phyto-extracts and nanotechnological approaches have been introduced to combat this disease. The synthetic fungicides are used to curb the disease incidence. Pathogen have developed resistance against various chemicals that are generally utilized ...

Rani Winardi Wulan Sari1, Novirman Jamarun2*, Suyitman3, Khasrad4, Elihasridas2, James Hellyward5, Gusri Yanti1 

..., organic matter, crude protein, acid detergent fiber (ADF), neutral detergent fiber (NDF), cellulose, and hemicellulose of 62.82%;65.69%;66.17%;50.67%; 57.22%; 55.84%; 63.27%. VFA and NH3 is 156.20%;9.84%. The methane gas production in P3 was lowest 20.57 ml/gr DM. This research concludes that P3 (40% hay mangrove leaves + 60% native grass) had the best resulted effect on nutrient and fiber in vitro digestibility, rumen fluid characteristic, and gas productio...

Saydat Saad Abd El-Megeed1, Walaa Yehia El-Sayed1*, Tarek Khamis2 

...1, hedgehog-interacting protein (Hhip-1), smoothened (SMO), glioma-associated oncogene homolog 1 (GLI1), and extracellular signal-regulated kinases 1 (ERK1). On the other hand, there was a significant upregulation in the mRNA expression of peroxisome proliferator-activated receptor (PPAR) –γ, insulin-like growth factor 1 (IGF1), PPAR-α, glucagon-like peptide 1 (GLP-1) in pancreatic homogenate, and peroxisome proliferator-activated receptor ga...

Jie Li, Gaofu Wang, Xiaoyan Sun, Lin Fu, Peng Zhou* and Hangxing Ren*

...es of the gene-encoding protein, and analyzed the different expression level in goat tissue. The result showed that the coding region of goat KITL gene was 825-bp long and encoded 274 amino acids. The goat KITL amino acid sequence had high homology with this molecule in other mammalian species. And the KITL gene was extensively expressed at 0-, 12-, and 24-month-old goat tissue. Moreover, the mRNA and protein of KITL were in...

Tlou Grace Manyelo1,2, Nthabiseng Amenda Sebola1, Jones Wilfred Ng’ambi2, Monnye Mabelebele1* 

...erformance  

...

Man Wang1 and Fengmei Yang2*

...sions of TOP2A gene and protein in tumor tissues were higher than those in normal tissues, and the differences were statistically significant (P<0.05); TOP2A gene expression was positively correlated with immune cells infiltration (P<0.05); the overall survival, disease-free survival and survival probability of patients with high expression of TOP2A gene were lower than those with low expression of TOP2A gene (P<0.05). In clinical specimens, the expre...

Hira Jabbin1, Muhammad Arshad1*, Naunain Mehmood1, Wardah Hassan1, Syed Zakir Hussain Shah2 and Farzana Siddique3

...city, water extractable proteins, salt extractable proteins, thiobarbituric acid reactive substances (TBARS) and sensory quality of mori fillets. The results indicated that chitosan coatings were effective in controlling pH, water loss, TBARS production, retention of water extractable proteins and salt extractable proteins in fish fillets. The sensory at...

Samina Kausar1, Rana Badar Aziz2, Muhammad Waseem3, Muhammad Ahmad3, Hamza Shafiq4, Muhammad Asim5, Usama Zia6, Sobia Afzal7, Wanpeng Xi8*, Mansoor Hameed1* and Muhammad Usman Shoukat9

..."text-align: justify;">Carotenoids are natural pigments, synthesized in photosynthetic organisms e.g., plants, bacteria, and algae, while carotenoids also be synthesized in some non-photosynthetic fungi or bacteria. The color gamut of carotenoids is from colorless to yellow, orange to red color, with variations reflected in many vegetables, fruits and flowers. They are categorized into two...

Sherif Abdelghany1, Hossam Mahrous Ebeid2*, Ahmed Abdelkader Aboamer2, Mohamed Ali Radwan1, Rania Agamy1 

...o develop an assessment protocol to evaluate feeding practices at small dairy farms. The study was based on 56 smallholder farms that raised crossbred cows and local buffaloes in mid-lactation, with an average of 4.4 parties and an average herd size of 1.28 and 1.19 head/farm for Nile Valley and Newly Reclaimed districts, respectively. A structured questionnaire survey was designed, and field interviews were conducted to collect data and to characterize the cu...

Humera Manzoor1,2,5 Norbert Brüggemann2,3, Hafiz Muhammad Jafar Hussain1, Tobias Bäumer2, Frauke Hinrichs2, Muhammad Wajid4, Alexander Münchau2, Katja Lohmann2* and Sadaf Naz1*

...variants on the encoded protein, and their frequencies in public databases. Sanger sequencing was performed to explore the segregation of the variant with the phenotype. All patients had congenital limb contractures. These included camptodactyly of hands and feet, ptosis, adducted thumb and clubfoot morphology. A novel homozygous missense variant in ECEL1 c.2051A>G, p.(Tyr684Cys) was identified in all three patients. The variant was absent from the DNA of 5...

Muhammad Shuaib1*, Abdul Hafeez1, Naila Chand1 and Muhammad Tahir2

... dry matter (DM), crude protein (CP), crude fiber (CF), and fat were recorded higher in the control group during all the three phases. It is concluded that the different levels of soybean hull in the basal diet resulted in lower production performance and nutrient digestibility than the control group.

...

Hemat A. Abdel Magied*, Heba H. Habib, Amany H. Waly, Ahmed Fadl, Sayed M. Shalash 

...nted pectinase (PE) and protease (CIBENZA® DP100) (P) individually or mixture (PEP) and either on low crude protein (CP) and low metabolizable energy (ME) were studied on growth performance, carcass characteristics and meat quality of Arbor Acres broiler chickens. Two experiments were conducted in current study; experiments 1 (EXP1) evaluated the effects of PE and/or P supplementation to standard corn-soybean broiler die...

Noha M. Abd El-Azeem*, Hemat A. Abdel Magied, Mervat N. Ghazal, Nehad A. Ramadan, Enayat H. Abo El-Azayem, Y. S. Hussein, Heba H. Habib 

...icant increase in total protein, globulin, total antioxidant capacity (TAO), glutathione peroxidase (GPx) and superoxide dismutase (SOD), with significant improve in A/G ratio and decrease malondialdehyde (MDA) in the treated groups in compared to the control group. In conclusion, turmeric, MOS and Biostrong supplements had a beneficial effect as natural antioxidant additives, especially the mixture among them, by protecting...

Irshad Ahmad1,2*

... are reasonably rich in proteins, lipids, carbohydrates, vitamins, minerals, pigments, etc., which are essential for not only sustaining fish health but also its unique array of bioactive compounds can improve coloration and quality of fillet. The aim of this review is to provide an update of the current knowledge of microalgae as a supplement or feed additive to substitute FM and FO in aquafeeds. This review will provide a platform to highlight the potential ...
Abdullah Iqbal1, Muhammad Abubakar2, Shumaila Manzoor3, Muhammad Kamran Ameen4 and Rani Faryal1*
 
...ucks, developed humoral protection against PPR within the 1st week. Only, 50 percent bucks of group 1 developed humoral protection against PPR after one week of vaccination. The mean percent inhibition value of competition-ELISA of group 2 was half the mean percent inhibition values of group 3 and group 4 after one week of vaccination. There was no antigen shedding through nasal or fecal route after vaccination in any animal...
Thobela Louis Tyasi*, Innocent Mokhwee Mohlabeng and Lebelo Joyceline Selala
...ular diameter (TD) and scrotum circumference (SC). A total of 40 Dorper rams aged between 1 to 5 years were used for data collection. Pearson’s correlation was used to determine the relationship between BW, TL, TD and SC, and Spearman’ rho correlation was used to determine the relationship between BCS, BW, TL, TD and SC. Pearson’s correlation results indicated that BW had a positively high statistical significant correlation with TL (r = 0.64...
Jie Wu1,2, Xiang-long Lu1,2, Wen-dan Wang1,2, Tian-you Wu1,2, Xing-yi Zhang1,2 and Yan-jing Su1,2*
...udy was to compare milk protein, amino acid and free fatty acid content among two kinds of milk with different foaming properties, used in coffee. For the milk protein, a significant difference between milk types was found in β-lactoglobulin (β-LG) and α-lactalbumin (α-LA), but not in casein content. The content of β-LG and α-LA in milk with the high foaming property of 70-96% (milk C) was si...

K. H. El-Kholy1*, Enayat Hassan Abo El-Azayem2, Safaa Ataya Barakat2, Mona Gamel Mohamed3, Sara H. M. Hassab1 

... animal productivity by protecting against oxidative stress which in turn increasing the production yield. This study hypothesized that using Aloe vera (AV) leaves powder may provide protection against stress and enhance animal physiological responses. Thus, this study aimed to investigate the effect of dietary AV addition on growth traits, caecal ecosystem and some physiological and biochemical responses in growing rabbits....

Chattida Panprom1, Nakrob Pattanapon1, Wannisa Meepoo1, Soontaree Petchdee2* 

... appropriate anesthetic protocols and managing dogs with moderate to severe valvular degeneration during general soft tissue surgery. Three client-owned dogs with valve degeneration stages C or D who underwent general anesthesia for surgical treatment were included in this study. All dogs in this study were assigned to receive diazepam 0.3 mg/kg body weight, alfaxalone 2.5 mg/kg body weight, and a perioperative fluid rate of 5 ml/kg/hr. An appropriate assessme...

Maria Al Mazed1*, Md. Ashikur Rahman1 and Sk. Istiaque Ahmed2

...with toxic metals are neurotoxic and carcinogenic to blood, lungs, kidneys, bones, liver and other vital organs of human. The present review outlines the contamination of aquatic environment with heavy metals and their contagious effects on aquatic animals and their public health concerns.

...

Inam Ul Haq1*, Humara Umar1, Farah Umar2, Naeem Akhtar3 and Muhammad Jan4

...re need to optimize the protocols for nursery production. In order to attain success in this sector, investigation was carried out to improve the rooting ability of a widely grown olive cv. “Arbequina”. This research aimed to enhance the rooting ability of semi-hardwood cuttings through application of different separate and combined concentrations of indole butyric acid (IBA), urea phosphate (UP) and paclobutrazol (PB). These chemicals were evaluat...

Sugiharto Sugiharto*, Ikania Agusetyaningsih, Endang Widiastuti, Hanny Indrat Wahyuni, Turrini Yudiarti, Tri Agus Sartono 

...hile alleviating muscle protein catabolism in high-density pens from days 15 to 28.

Keywords | Broiler, Chitosan, Germinated seed, High stocking density, Stress 

...

Istna Mangisah1*, Heni Rizqiati2, Nyoman Suthama1 

...inal bacterial balance, protein digestibility, and growth performance of broilers, but it did not affect the relative weight of digestive tract segment and immune organs of broilers.

Keywords | Broiler growth, Digestive tract, Feed additive, Intestinal bacteria, Lymphoid organ  

...

Reda Hassan*, Bahaa Abou-shehema, Sherif Zayed, Micheal Gorgy, Shama Morsy, El-Sayed Abu El-Hassan, Mahmoud El-Gbaly, Hanaa Basuony, Ebtehal Hassan 

...ood cells (SRBC), total protein, albumin values in broilers serum compared with ngative control. Aflatoxins supplementation significantly (P<0.05) increased malondialdehyde values in liver and significantly (P<0.05) diminished the reduced glutathione (GSH), glutathione S- transferase (GST). In addition to, dissemination of aflatoxin residue in broilers liver was detected. Nevertheless, dietary addition of HSCAS and SC, in separate and combined forms, all...

Antonius1,3, Anuraga Jayanegara2*, Komang Gede Wiryawan2, Simon Petrus Ginting3, Anjas Asmara Samsudin4, Elizabeth Wina5 

..., organic matter, crude protein, crude fiber and crude fat. The T1 and T2 treatments resulted higher (P<0.05) average daily gain of 52.87% and 48.05% than that of control, respectively. The mutton tenderness level of T1 increased from tough scale in the control treatment to quite tender. In conclusion, gambir leaf extract addition did not negatively affect palatability and nutrient intake, increased average daily gain for Boerka goats, increased tenderness,...

Nosheen Jehajo*, Nasreen Memon, Mansoor Ali Shah and Naheed Shah

...ct toxicity and surface protectant effect. Results showed that as percentage of concentrations increased mortality of adult beetles also increased with increased exposure time. In addition, among the dissimilar concentrations of oils, it was found that 0.50% of both oils were lethal concentrations (LC50) which killed almost (50%) population of beetles after 48 hrs of exposure. Furthermore, both oils were effective by reducing (100%) oviposition, population eme...
Humaira Gul1*, Muhammad Junaid Yousaf1*, Fawad Ali1, Mamoona Rauf1, Farhad Ali2 and Iqthedar Ali3
..., fruits, plant height, proteins, and chlorophylls were significantly (P<0.05) increased in sandy soil proportion whereas in soil analysis moisture, hygroscopic water, pH, cation exchange capacity (CEC), chlorides, organic matter were significantly (P<0.05) increased for the soily soil in same proportion that is of sandy soil. This reveals that Barley should be grown in sandy soil for its better growth and productivity. The least growth parameters were n...

Lopamudra Samantaray*, Yashaswi Nayak 

...balanced sole source of protein in terms of nutrition. Concerns over the extensive use of Antibiotic Growth Promoters (AGPs), which may have driven consumer demand for antibiotic-free animal yield, have necessitated research towards a safer natural alternative, such as the use of phytobiotic essential oils (EOs). The purpose of this study was to determine the effect of phytobiotic EOs on laying hen performance, physical characteristics, and egg cholesterol con...

Pham Tan Nha*, Le Thu Thuy  

...feed addition and crude protein level on the performance of local chickens in the south of Vietnam. It was (3*2*3 factorial) with 2 factors. Factor fermentation: Yeast-fermented maize (YM), Yeast-fermented broken rice (YR), Probiotic fermented maize (PM). Factor protein level: 20% (CP20) and 16% (CP16). One hundred and eighty Noi chickens at 6 weeks of age (334±9.5 g/bird), and 10 birds per unit (balanced sex) were in...

Abdullah Al Musabbir1, Md Abedur Rahman2*, Naveed Anjum2, 3 and Mustajab Ali4,5

...ied the effectiveness of rotary blades and roller cutters on residue management in the planter. A new rotary blade (Blade B) along with roller cutter was designed and their effect on the residue management was investigated. However, to justify the effectiveness of newly designed rotary blade, the traditional blade (Blade A) was also considered in addition to Blade B. Experimental results s...

Sara Magdy Hashim1, Elshaimaa Ismael2, Mohamed Tarek3, Faten Fathy Mohammed1*, Fatma Amer Abdel Reheem3, Rawhia Esawy Doghaim1 

...d acute inflammatory, necrotic and vascular reactions that involve different tissues. The immunohistochemical characterization of viral antigen revealed direct relation between viral residence in tissue and developed pathology. The present study confirmed that H5N8 HPAI clade 2.3.4.4b, became a predominant strain during the period 2018-2020, causing severe outbreaks in duck farms in Egypt.

Keywords | Avian influenza, HPAI, H5N8, Ducks, Pathology, Egyp...

Shama Sadaf1*, Komal Hassan1, Ayesha Saeed1 and Zeeshan Ahmad2 

... is suitable to provide protection cover for medical industry, paramedical staff, sports wears, home furnishing as well as common people.

...

Muhammad Nadeem1, Muhammad Rizwan2,3*, Tanveer Ahmad4, Muhammad Kashif5, Aneela Zameer Durrani2, Muhammad Ali6, Asghar Abbas7, Safder Imran8, Sidra Saher9, Syeda Fakhra Waheed10

... syndrome, mastitis, enterotoxaemia, tick and mite infestations and pox disease. There was no proof of rinderpest occurrence since long in area of examination. Participatory disease surveillance presented to be a worth full technique to obtain trustworthy data that may be helpful in making most effective policies for control and eradication of livestock diseases in and Pakistan. 
 
Novelty Statement | Participatory surveillanc...

Hafiz Husnain Nawaz1*, Ayesha Ahsan2, Amir Afzal1, Muhammad Ashraf Sumrah1, Muhammad Jan1, Kashif Ali1, Muhammad Arsalan1 and Rizwan Latif3

...copherol, chlorophyll, carotenoids, phenolics, flavonoids, and other scavenging components, make them more potent. Thus, the 50µg/ml concentration plant extract solution has the lowest radical scavenging percentage, whereas the 1000µg/ml concentration plant extract solution has the highest DPPH percentage 80%. The results of the test reveal that the extract concentration had an influence on the assay’s absorbance, or, to put it another way, a...

Ahmed M. El-Waziry1,2*, Saeid M. Basmaeil1, Ibrahim A. Alhidary1, Gamaleldin M. Suliman1,3, Mutassim M. Abdelrahman1, Maged A. Al-Garadi1 

...ng the degradability of protein in the rumen, which increases its by-pass to the small intestine and decreasing the ammonia concentration in the rumen. Moreover, ionophores increase propionic acid in the rumen, which is used as an energy source; hence, ionophores increase muscle growth by enhancing the daily weight gain due to the improved feed conversion rate. Studies indicate the effect of ionophores on the characteristics and quality of the carcass hav...

Monis Hussain Shah1*, Rizwan Rafique2,6, Munawar Almas1, Muhammad Usman3, Sadia Yasin4 and Sajida Bibi5

...n steps regarding plant protection measures, introduction of exotic varieties and use of Biotechnological tools for crop improvement should be adopted for better yield and production.

...

Ergi Bahrioglu1, Mustafa Hac Isa2, Sibel Cengiz2 and Ertan Ercan2*

... to given ratios of the protein, carbohydrate and lipid sources provided from the feed materials. The plant-based diet yielded the highest worm density of the study (2220 worms/unit) while the garden soil was used as substrate. In comparison, the fish feed-based diet fed white worms reached a significantly lower density (627 worms/unit) although the optimal nutritional value for the fish diet was ensured. These results showed that the carbohydrate content of t...

Rahman Ullah1*, Muhammad Junaid2, Nabila Gulzar2, Rahat Ullah Khan3, Baseer Ahmad4, Ambrina Tariq5, Aamir Iqbal6, Mushtaq Ahmed7 and Mirwaise Khan8*

...dentification) ETEC (Enterotoxigenic Escherichia coli) strains in both raw and pasteurized milk available in the market of District Kasur, Punjab (31.0896° N, 74.1240° E). A total of 65 samples of milk including 5 pasteurized milk samples from various sources were analyzed through scientific polymerase chain reaction (PCR) method including other microbiological laboratory techniques (Total plate count, Gram staining, Hydrogen sulphide, Citrate, Urease ...

Cristina Stanca Moise1*, Cornelia Chimisliu2, Mihaela Arinton3, Tom Brereton4 and George Moise1

...he distribution of this protected species in Romania, our paper forms a new baseline for future surveys and studies on Lucanus cervus.

...

Saba Rehman1, Faisal Salih Hayat1, Sadia Norin2, Abdul Aziz1, Siddiq Ur Rahman1* and Noor ul Haq1*

...(SARS-CoV-2). The spike proteins of the novel coronavirus located mostly on the S1 unit result in a higher transmissibility rate and affect the viral virulence and clinical outcome. The spike protein and other non-structural protein mutations in VOCs may lead to escape the approved vaccinations. Here the VOC mutations i.e., OMICRON VARIANT have been discussed in detail, and the therapeutic...
Farah Abid1,2, Mohammad Saleem1,3*, Tahir Maqbool4, Tania Ahmed Shakoori5, Faheem Hadi4, Tahir Muhammad4, Saira Aftab4, Yasir Hassan7 and Shabana Akhtar4,6*
...the index of C-reactive protein, rheumatoid factor and bone and cartilage erosion after treatment with E-AM. Collectively, our findings suggest that E-AM extract might have potential to perform anti-inflammatory and anti-arthritic activity which could have beneficial impact for the patients associated with arthritis.

...

Lei Zeng1,2,3,4, Pimao Chen1,2,3,4, Zhenzhao Tang1,3,4, Jie Yu1,2,3,4 and Guobao Chen1,2,3,4*

...are significant for the protection and restoration of crustaceans resourcs along coastal water, given the rapid establish of AR around the world.

...

Abdurakhim E. Kuchboev1*, Mehmonjon Kh. Egamberdiyev2 

... Prevalence 

...

Ghazala Nasreen1, Ali Hussain2, Komal Tayyab1, Muhammad Rashid3 and Sumaira Aslam1*

...levels of total soluble proteins and hepatic enzymes being marker of hepatic injury for all the treatment and control groups. The highest levels of acid phosphatase (ACP, 11.75 ± 0.23 IU L−1), alkaline phosphatase (ALP, 81.50 ± 1.49 IU L−1), aspartate aminotransferase (AST, 30.25 ± 1.62 IU L−1) and superoxide dismutase (SOD, 19.75 ± 1.78 IU L−1) were recorded in the liver samples of the fingerlings of the tre...
Chunlan Shan1, Chaoying Liu1, Qin Lu1, Guowen Fu2, Syed Aftab Hussain Shah3, Rana Waseem Akhtar4, Ru Zhao2, Libo Gao2, Chang Liu2, Shushu Miao2, Hongdan Wang2 and Hong Gao2*

 

...ch 44 E. coli superior serotype strains were isolated and identified from Yunnan Saba pigs. The genomic DNA of all isolated superior serotypes of E. coli was obtained. Five major high pathogenicity island (HPI) structural genes (irp1, irp2, irp3, irp4 and irp5) were cloned, sequenced and referenced with GenBank database. The sequence identities of irp1, irp2, irp3, irp4 and irp5 with GenBank were 98 %, 99 %, 99 %, 98 %, and ...

Amal G. Abdelrahman1, Nabil A. Yassien1, Hussein M.H. Mohamed1, Khaled S. Tolba2, Heba H.S. Abdel-Naeem1* 

...od affordable source of protein but will also provide economic benefits to the poultry meat industry. Therefore, this study aims to appropriate utilization of this meat to produce less expensive and highly nutritious value-added chicken meat patties. In this context, five groups of spent hen meat patties were formulated as follows: The first and 2nd groups were treated with 5 % and 7 % of kiwi extract, the 3rd and 4th groups were treated with 5 % and 7 % of pi...

Doaa H. Assar1, Rasha A. Al Wakeel2, Mahmoud M. El-Maghraby3, Mohammed M. El-Badawy3, Adel A. El-Badawy3, Wael M. Nagy3, Mustafa S. Atta2, Abdel-Khalek E. Abdel Khalek4* 

...eased (P<0.05) total proteins and globulin, while decreased (P<0.05) creatinine, urea, total cholesterol, and triglycerides. Allicin supplementation reduced MDA and increased GSH, SOD, Gxp, catalase, and GPx. Allicin treatment of ewes (0.8 and 1.2 g/kg) increased (P<0.05) LBW and weight gain (total and daily) from birth to weaning, IgG, GSH, SOD, catalase, and GPx, while decreased MDA in blood serum of their lambs. Allicin dietary supplementation (1.2...

Amir Abdullah Khan and Muhammad Irfan*

...t-align: justify;">Fruit rotting is major problem in the world and the fungus mostly causes it. Citrus is susceptible to postharvest decay caused by fungus. The use of synthetic fungicides, which have negative effects on human health and the environment, reduces the widespread economic losses in citriculture caused by these pathogens. In the current study, 68 bacterial strains were isolated from citrus field soil and tested for antifungal activity using the st...

Manzoor Ali Magsi1*, Naimatullah Laghari1, Ahmed Ali Tagar1, and Habibullah Magsi2

...cific not only for wheat rotation but for other crops. Further experiments should be conducted to analyze the impact of deep tillage treatments on the tillage practices and organic fertilizers on soil properties, growth, and yield of the wheat crop.

...
Huma Abbas1*, Nazir Javed1, Muhammad Kamran2, Sajid Aleem Khan1, Abdul Jabbar1, Akhtar Hameed1, Hira Abbas3, Azhar Iqbal2 and Ehetisham-ul-Haq2
...ation methods regarding protective and curative were used to test the efficacy of Cartap, Virtako, Cure and Azadirachtin. Results revealed that Protective application of bio and synthetic chemicals was more effective at nematode suppression rather than being curative. Then the impact of bio and synthetic chemicals were tested in combination with NPK on nematode reproduction. Following treatments i.e. Virtako + NPK, Cartap + ...

Müge Aliye Hekimoglu and Sırma Sönmez

...e basal diet (55% crude protein+14% oil), the four experimental diets were designed with supplementation of L-carnitine (0, 500, 1000, 2000 mg/kg). They were fed 10% of their weight every day. Sampling was done at the beginning and the final day of the experiment for digestive enzymes (protease, lipase, amylase), weight and length, body colour and survival rate. The image analysis method was used to determine skin colour. Th...

Jin-Ming Zhao1,2, Yun Fang2 and Yue-Hua Sun2*

...zed as class I national protected animal species in China. Lower breeding performance has been suggested as a main factor influencing the population viability of Chinese grouse. Nest predation, which might be time-varied, is a main contributor to the nest failures of Chinese grouse. Therefore, it is urgent to estimate nest age of Chinese grouse accurately before taking appropriate conservation actions. In this study, we estimated the nest age of Chinese grouse...

Nauman Zaheer Ghumman, Muhammad Ijaz*, Arslan Ahmed, Muhammad Umar Javed, Iqra Muzammil and Ahmed Raza

...the presence of a 78KDa protein band specific for PBP2a protein in MRSA. The comparative risk factor analysis showed significant variation among risk factors associated with S. aureus and MRSA-induced mastitis. The phylogenetic analysis of MRSA mecA gene showed a high resemblance of the study isolates with MRSA isolates of the USA, Turkey, India, Africa, and Brazil. This is the first study regarding molecular characterizatio...
Shakeel Ahmed Wagan1, Akeel Ahmed Memon1, Qudratullah Kalwar2*, Asmatullah kaka1, Mohammad Farooque Hassan2, Hidayatulah Soomro2, Safia Kadhro3, Abdullah Sethar4 and Muhammad Jehangeer5
... estrus synchronization protocols following ovsynch and ovsynch + CIDR in Thari cows during different breeding seasons. Total (n=80) Thari cows 1st to 4th parity were selected for this study. The experiment was conducted twice in a year i.e. in October to January, n=40 (Peak breeding season) and March to May, n=40 (Low breeding season). Animals were divided into three groups (A, B and C). In group A, 02ml I/M injection of GnRH (25µg lecirelin acetate) we...

Hongfeng Guo

... kit; the expressions ofprotein kinase B (Akt), Bax and Bcl-2 were detected by Western blot. According to our findings after drug treatment, the body weight and respiratory ventilation of mice returned to normal level compared with the intermittent hypoxia group. Compared with the blank control group, after intermittent hypoxia, the contents of MDA, SOD and PGE in the lower respiratory tract of SD mice were significantly lower than those in the normal air grou...

Mian Shamas Murtaza1,*, Aysha Sameen2, Saima Rafique3, Muhammad Shahbaz1,*, Nabeela Gulzar4, Mian Anjum Murtaza5, Umar Farooq1 and Iram Hafiz6

...hemical (moisture, fat, protein, ash,) characters. Melt-ability and flow-ability showed inverse relationship with levels of inulin. Melt-ability and flow-ability decreased by increasing level and increasing hardness. Yield calculation showed non-significant effect within levels but significant effect as compared with control. The fat substituting property is based on its ability to stabilize the structure of aqueous phase which creates an improved creaminess. ...

Mustafa Erkan Özgür1*, Selim Erdogan2, Songül Aydemir3 and Hatice Yumusakbas2

...ality and fertilization protocols.

...

Monu Karki, Amit Kumar and Gnanavel Venkatesan*

...world. The virus is the prototype member of the Parapoxvirus genus of the Poxviridae family and is known to cause zoonotic affection sporadically. The main attraction to this virus has always been its wide range of virulence factors, known to be responsible for deceiving the host’s defense strategies and causing re-infection within a year of infection. From viroceptors like chemokine binding protein to GM-CSF and IL-2 ...

Barbosa Carla1*, Gregori Fabio2, Thomazelli Luciano1, Oliveira Amanda1, Araújo Jansen1, Ometto Tatiana1, Marcatti Roberta3, Nardi Marcelo3, Paludo Danielle4, Utecht Nathalia1 and Edison Durigon1

...cted to a RT-Nested-PCR protocol, with primers targeting RdRp region. Positive samples were confirmed using Sanger followed by Ion Torrent S5 sequencing platforms and results were submitted to phylogenetic analysis. From total of 8 confirmed samples, 3 clustered to Deltacoronavirus genus and 5 to Gammacoronavirus. Two of those samples showed partial sequences of other regions of CoVs confirming their genotyping to Gammacoronavirus genus and proximity to import...

Oluwatoyin Adenike Fabiyi1*, Mariam Temitope Baker2 and Gabriel Ademola Olatunji2

... the environment. Plant protection is primarily saddled with replacing the synthetics. A promising technique is the application of bio-pesticides. Organic fatty acid esters (FAE) are reassuring materials with nematicidal activities. Medicinal plants are rich source of acid esters, hence Alstonia boonei (Apocynaceae) leaves were extracted cold in ethyl acetate. This yielded crude extract that was subjected to column chromatography (silica gel 100-120 mesh grade...
W. M. A. El-Nagdi1†, M. M. A.Youssef1, H. Abd-El-Khair1, M. M. M. Abd Elgawadand M. G. Dawood2
...ng phenolic and soluble proteins, respectively. The effects of combined treatments of Pf+Bs and Pf +Bp were recorded for highest contents of photosynthetic pigments than the other treatments either as single or combined treatments.

...

S. Ahmed†, Q. Liu and H. Jian

...condary metabolite with protease and chitinase
activity was used as seed bacterization in green house experiments. In green house significant reduction in white
female development was observed for avermectin (84.53%) followed by B. cereus strain B48 (78.10%) as compared
to results of the untreated control treatment (P≤0.05).
...

N. Hajra

...n profile comprising of proteins, amino acids protease and proline. Results showed that carbon profile in plant treated with AM fungi have high to low and varied amount of carbohydrates, sucrose, glucose and total soluble sugars in different parts of the plant; amino acids and proline in nitrogen profile found in higher amount in AM treated plants.

...

Y. Danso†, J. Adomako, K. Osei and B. Abugri

...o well planned crop-land rotational and maize breeding systems to minimize M. incognita populations’ build-up and damage to susceptible crops such as okra which follow maize in a crop rotation system.

...

M. Israr1, F. Shahina2† and K. Nasira2

...m around the roots of carrot (Daucus carota L.), from Hasan Abdal, Punjab, Pakistan. Morphometric data of a known species A. bicaudatus (Imamura, 1931) Filipjev & Schuurmans Stekhoven, 1941 is also given.

...

Mutala’liah, S. Indarti † and N. S. Putra

...langsari, Getas and Candiroto feilds. Samples of soil and roots were collected and various parameters of soil
abiotic factors (pH, soil moisture, soil temperature, soil texture and organic matter) were obtained from each of the
three fields. Vertical distribution was assessed using two soil sample depths (30 cm and 50 cm). This research
showed that the highest population abundance of Pratylenchus sp. both from soil and roots...

Öznur Özil*, Öznur Diler, Mevlüt Nazıroğlu, Aşkın Atabay 

...mplanatum were caused necrotic and fibrotic muscle tissues lesions in Garra rufa.

Keywords | Clinostomum complanatum, Garra rufa, Histopathology, Prevalance, Intensity  

...

Nadia A Eltablawy1, Ibrahim El Tantawy El Sayed2, Hamed Mohamed Abdel Barry2, Marwa A. Ibrahim3*, Maha Nageib Ahmed Serag ElDein2 

...rk aims to evaluate the protective and attenuating effect of Terminalia Muelleri ethanol extract (TME) against doxorubicin-induced cardiac toxicity. Methods: Total phenolic content (TPC), total flavonoid content (TFC), DPPH. radical scavenging, FRAP and FRAC were determined in the TME extract. Forty-eight adult male Wistar rats were divided equally into six groups: control non-treated, Doxorubicin (DOX) challenge (rats were injected with 2.5 mg/kg of DOX in si...

H. Ravindra1, N. Adivappar2, M. Sehgal3 D. M. Soumya4 and H. B. Narasimhamurthy4

...antations from open and protected cultivations at Karnataka for the
prevalence of nematode. Heavy infestation of root-knot nematode was observed on coriander with small to big sized
galls or knots on the roots. Soil and root samples were collected for analysis of nematode infestation. Coriander
plants also exhibited poor growth showing stunting and chlorosis due to severe infestation. This is the first report of
...

R. Singh1† and R. Z. Sayyed2

...revealed an increase in protein, nucleic acids (RNA and DNA) and
amylodextrin (hydrolyzed starch) concentration in the infected regions as compared with normal healthy sections.
Protein localization found more pronounced at the sites of infection of M. incognita viz., cortical cells, giant cells,
abnormal xylem, medullary region and nematode body. Active RNA synthesis in infected cortical,...

A. M. Korayem1†, M. M. M. Mohamed1 and S. M. El-Ashry2

...ld. Seed contents viz., proteins, carbohydrates, zinc and copper
decreased at severe infestation in the second season, while in the first season quality of seeds was not affected.
...

M. M. A. Youssef1†, Wafaa M. A. El-Nagdi1, and Mona G. Dawood2

.../div>
and soluble proteins in seeds increased at the different treatments compared to those of the untreated check and the
effect, in general, was higher by using the highest rate compared to the lowest one. On the other hand, the contents
of chlorophyll a, chlorophyll b and carotenoids in leaf increased at untreated check compared to those at different
treatments.
...

A. A. Galal1,2, S. F. Abou-Elwafa1,3, F. J. Kopisch-Obuch1 and C. Jung1

...conditions, an improved protocol for testing barley plants against root lesion nematode (RLN) had
been standerdized. The plants were grown in 150 cm³ instead of 20 cm³ tubes and we increased the inoculum size
from 400 to 1000 nematodes/plant in combination with a nutrient solution better adapted to the barley crop. Six
barley accessions were tested with Pratylenchus neglectus and Pratylenchus penetrans. Tests were ...

K. Taimoor1† and F. Shahina2

...plants viz., Perovskia abrotanoides, Valeriana wallichii, Artemisia
vulgaris, Peganum harmala, Saphora alopecuroides, Artemisia absinthium, Carum copticum, Berberis
balochistanica, Matricaria lasiocarpa, Ephedra procera, Centratherum anthelminticum, Zatoria multiflora,
Lallemantia royaleana, Mentha spicata, Withania coagulans, Achillea santolina, Ferula oopoda, Nepeta cateria,
Teucrium stocksianum and Fagonia cre...

I.K.A. Ibrahim1 and Z. A. Handoo2

... of oyster mushroom (Pleurotus ostreatus), the biocontrol agent Bacillus thuringiensis, the bionematicide abamectin, and the nematicide fenamiphos on Mi 1 on rice cv. Sakha 101. All the applied control treatments were effective in reducing nematode infection on rice plants.

...

A. S. A. Saad1, M. B. Al-Kadi1, A. A. A. Deeabes2 and A. M. El-Kholy2

...st suppression in total proteins (10.41 mg/g), total sugars (7.86 mg/g) and reduced sugars (3.09 mg/g) as compared with untreated check. Moreover, citric acid was the most effective treatment which exhibited the highest values of total phenols (0.69 mg/g), total protein (18.08 mg/g), total sugar (17.89 mg/g) and reduced sugar (10.05 mg/g), whereas cattle manure gave the least values of total phenols (0.47 mg/g), total p

M. Israr†1, F. Shahina1 and M. Habib2

...l soluble sugars, total protein, total phenols and amino acids. Chlorophyll a, chlorophyll b and carotenoids also decreased in nematode infected plants as compared to control. This study gave the fair report towards nutritional quality because no significant work has been done so far on this aspect in Pakistan.

...

S. Feroza 1, A. G. Arijo1†, F. M. Bilqees2* and M. S. Phulan1

...all, inflammation and necrotic patches with consolidation of intestinal contents were generally observed. Infected liver showed dark red coloration. Severe congestion, chronic pneumonia, exuded in one lobe of the lung were seen, whereas, necrosis and atrophy in infected heart were notable observations.

...

Muhammad Nadeem1*, Aneeta Rehman1, Masooma Munir1*, Hira Fatima2, Faiqa Malik1, Aqsa Iqbal1 and Alaiha Asif3

...hat the moisture, crude protein, fat, fiber, ash and NFE contents for treatments ranges from 5.45-7.27%, 4.02-5.25%, 1.77-2.81%, 1.48-2.97%, 1.28-1.93% and 82.69-83.09%, respectively. The microbial analysis of fruit bars showed that mean values of TPC changed gradually from 1.64 to 2.31 log10 CFU / g during 90 days of storage. The mean values for sensory assessment indicated that T1 was preferred over the other treatments in terms of overall acceptability, col...

F. Shahina† and G. Mehreen

...ungus growing termite Microtermes 
mycophagus  (D.). The study were also influenced by mortality; days to death, infection cycle length and
reproductive potential. Highest mortality 100% was obtained on PAK.S.S.16 @ 75 IJs/cm2. The strains PAK.S.S.16
and PAK.P.S.9 showed shortest 1.21 and 1.2 days to death in termites, while the isolate PAK.P.S.9 showed the
shortest infection cycle length (4.65). Moreov...

A.A. Tanimola† and B. Fawole1

...F), Aloe
succrotina (AST), Aloe vera (AVR), Aloe chinensis (ACS), Aloe arborescens (AAR), Aloe keayi (AKY), Aloe
macrocarpa (AMC) and Aloe schweinfurthii x Aloe vera (ASV) that showed nematicidal activity in in vitro on
Meloidogyne incognita. The phytochemical analyses revealed that the Aloe species had similar phytochemicals:
tannins, saponins, flavonoids, cardenolides, phenols, alkaloids and anthraquinones. How...
A.A. Tanimola and B. Fawole1
...v>
(ASF), Aloe succrotina (AST), Aloe vera (AVR), Aloe chinensis (ACS), Aloe arborescens (AAR), Aloe keayi
(AKY), Aloe macrocarpa (AMC) and Aloe schweinfurthii x Aloe vera (ASV) on egg-hatching and mortality of
second-stage juveniles (J2) of Meloidogyne incognita was investigated in vitro. Extracts were tested at
concentrations of 50,000 mg/kg and 25,000 mg/kg in an experiment laid out in completely randomized design i...

A.M. Korayem, M.M.M. Mohamed† and S.M. EL-Ashry1

...22 J2/200 g soil. Total protein and nitrogen element decreased in seeds of infected plants compared with those of
healthy ones.
...
C. Azhagumurugan and M.K. Rajan
...iv>
carbohydrate, protein, amino acid, lipid, proline and phenol content after 65 days of treatment. Carbohydrate and
protein were found decreased with increasing inoculum levels of egg-masses and increased with increasing
concentrations of leaf extract treatment and lipid, amino acid, proline and phenol content found increased with
increasing inoculum levels of egg-masses and decrea...

A. Khan†, Saifullah, M. Iqbal* and S. Hussain

...maticidal ability of Pleurotus ostreatus, P. florida and P. citronopileatus against phytonematodes of
vegetables was determined in this study. Crude extract from Pleurotus spp., were tested against Pratylenchus,
Xiphinema, Tylenchorhynchus, Tylenchus, Helicotylenchus, Ditylenchus, Psilenchus, Aphelenchus, Hoplolaimus,
Longidorus, Aphelenchoides and Paralongidorus spp. Extracts from the fru...

A.W. Amin†, A.A. Anter, A.H. Ashoub* and A.S. El-Nuby*

...ongata, Obesumbacterium proteus and Pseudomonas aeruginosa recovered
from tomato rhizosphere and tested for their ability to induce systemic resistance or bio-control agent against
Meloidogyne incognita in tomato under greenhouse condition. Results showed that all tested bacterial strains
showed significant reduction in nematode development and reproduction. The most effective strains were M.
methanica, B. cereus...

W.M.A. El-Nagdi†, M.M.A. Youssef and M.G. Dawood*

... soluble carbohydrates, proteins, phenolic and carotenoid contents
increased at all tested concentrations as compared to untreated plants, but no any relation among them.
...

Jax Vincent Gamulo, Maye Pearl Bolina, Jessica Serena Brion, Via Crishiela Nicole Dela Rosa, Roxanne Francesca Maglaya, Carl Lexter Tan, Aimee Caye Chang* 

...teria for inclusion and protocol was defined for systematic publication database searching. Final reference database consisted of eight (8) published journal articles with a total of 106 Fasciola flukes, published between years 2001 to 2021. The mortality time between tropical plant extracts and commercially available drugs posed a significant difference (P < 0.05), while ten (10) among the plant species differed in fasciolocidal activity (P < 0.05). Alb...

Lulu Ding, Ke Wang, Ruxue Huang, Wenjing Yu, Bingzhao Yan, Mengli Jiang and Jicang Wang*

...dant, Nar has a certain protective effect on oxidative stress and kidney injury induced by Cd.

...

Muhammad Iqbal Anjum*, Shahbaz Javaid, Agha Waqar Yunus, Faisal Ashfaq and Javed Iqbal

... dry matter (DM), crude protein (CP), neutral detergent fibre (NDF) and acid detergent fibre (ADF), among all the groups was similar, however, except ADF, digestibility of DM, CP and NDF was significantly (P<0.05) higher in calves fed TMR with 25% MC and lower in those fed 35% WS based TMR. Cost of feed per kg gain was lowest (Rs 128) in calves fed TMR with 35% MC and it was highest (Rs. 167) in both TMRs with 25% WS and 35% WS, respectively. In conclusion,...

Mengxue Sun1, Yanjiao Li1,2, Zhen Gao1, Qinghua Qiu1,2*, Xianghui Zhao1,2, Lanjiao Xu1,2, Huan Liang1,2, Ke Pan, Mingren Qu and Kehui Ouyang1,2*

... that, 1) Pre-treatment protection of niacin: pre-treatment with 20 or 40 mM niacin increased the cell viability under pH 5.8, while 80-320 mM niacin decreased the cell viability compared with the control group (P < 0.01). Under pH 5.5, results were similar to those under pH 5.8, except for pre-treatment with 40 mM niacin with no significant effect on the cell viability. Under pH 5.2 or 5.0, pre-treatment with niacin reduced the cell viability compared with...
Ghulam Jelani1, Qudratullah Kalwar1*, Asmatullah Kaka2, Abdullah Channo2, Ayyaz Ahmed1, Majid Hussain Soomro1, Hidayatullah Soomro1, Deepesh Kumar Bhuptani1 and Yar Muhammad Jalbani1
...tial benefits. Hormonal protocol and synchronization improvements increase the embryo production rates via superovulation. This review details the embryo production technique, transfer of embryo from donor to recipient and the factor that are necessary for transfer of embryo from donor to recipient for production of offspring. Previously limited information existing regarding embryo transfer and its significance in farm animals therefore, in future this review...

Mohsin Shad1, Muhammad Usman2 and Qurratulann Afza Gardner1*

..., b, Rieske iron-sulfur protein, and subunit IV. Electrons transferred through these complexes are responsible for the pumping of protons across the membrane to produce ATP through ATP synthase. The present review provides the structural comparison of mitochondrial cyt b in ten model organisms targeting archaea, prokaryotes, and eukaryotes, highlighting phylogenetic and mutational analysis. Polymorphism in the mitochondrial ...

Ronny A.V. Tuturoong1*, Sony A. E. Moningkey1 and Nova L.I.M. Ogi2

...efficiency of microbial protein synthesis were analyzed. The highest dry matter digestibility (DMD), organic matter digestibility (OMD), neutral detergent fiber digestibility (NDFD), NH3 concentration and efficiency of microbial protein synthesis (ESPM) were found in T2 group (64.04%, 65.05%, 60.63%, 189.36 mg.L-1, and 24.10 gr N.kg-1. BOTR-1, respectively). While the highest ADF was found in the T3 group (56.37%). The study...

Sri Setyaningrum*, Dini Julia Sari Siregar, Tengku Gilang Pradana  

...arcass percentage, meat protein content and lactic acid bacteria. The treatment decreased (p<0.05) of feed conversion ratio (FCR), meat fat content, meat cholesterol and total coliform in the ileum and caecum. The treatments of CGLp were not affected (p> 0.05) of feed intake, immune organs, hematological and pH in the ileum and caecum. In conclusion, the CGLp treatments improve the performance, carcass, and gut microflora of broiler chickens.

Key...

Zubair Aslam1, Ali Ahmad1*, Korkmaz Bellitürk2, Hira Kanwal1, Muhammad Asif1 and Ehsan Ullah1

...ntent of leaves, total carotenoids, chlorophyll a, chlorophyll b, total chlorophyll (a+b) contents, SPAD value of chlorophyll and photosynthetic rate). The obtained results indicated that treatment T5 had significantly (p<0.05) higher fruit yield (1.50 kg/plant, 15.5 kg/plot and 13657 kg/ha) while treatment T0 had significantly lower fruit yield (0.87 kg/plant, 8.33 kg/plot, and 7900 kg/ha) as compared to all other treatments.

...

Majid Ali*, Hafiz Abdul Majid, Farman Ullah, Tahir waseem, Muhammad Rashid Khan 

...Kohat. 

...
Ulvi Fitri Handayani1, Wizna2, Irfan Suliansyah3, Yose Rizal2, Maria Endo Mahata2*
...ted in the blood by lipoproteins. Therefore, that is important to know the effect of giving processed tomatoes wastes (PTW) on laying hens to lipid profile of blood serum consist of cholesterol total, triglycerides, LDL (Low Density Lipoprotein), and HDL (High Density Lipoprotein). Two hundred laying hens of the Lohman Brown were healthy, had no physical defects, weighed 1600-1800 g, and p...
Abdelwahab Mohammed Abdelwahab1,2*, Ahmed Almadani1, Ibrahim Almehsen1
... a comparable effect in protein and energy productive values compared to the control diet versus lower values (p<0.05) of 66.0% and 100.0%% biofloc diets. Furthermore, the biofloc diets (66.0 and 100.0%) almost decreased in all the recorded parameters compared to biofloc (33.0%) and control diets except body fat content and flesh color. Therefore, it might be concluded that feeding biofloc up to 33.0% could be promising in feed utilization, growth performan...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel4, Abdelwahab M. Abdelwahab1,5
... inexpensive sources of protein and energy in poultry nutrition. The current study was conducted to explore the possible impact of soybean-corn replacement with various levels of black soldier fly larvae Hermetia illucens (BSFL) meal on egg production, egg quality, physiological aspects and economic efficiency of laying hens. The study employed 270 commercial layers, 40-wk-old, that belonged to the W-36 Hy-Line chickens. The layers were randomly designated int...

Bashir Ahmad1*, Ali Muhammad Yousafzai2, Waqar Ali1, Ikram Ilahi1, Farman Ullah3, Saeed Ahmad1, Ayaz Ali Khan1, Umair Ahmad2 and Hafsa Maria2

...ose of the common hepatoprotective medication silymarine (50 mg/kg body weight). When contrasted to toxic control rabbits, the highest dose of garlic aqueous extract i.e. 300 mg/kg b.w excellently decreased the high serum rates of alkaline phosphatase (ALP), alanine transaminase (ALT), and aspartate transaminase (AST). The outcomes of the extract-treated rabbits were comparable to those of the group of rabbits given silymarine. RBC, platelets, haemoglobin, MCH...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Mohammad A. Al-Mahaish4, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel5
...broilers, such as total protein, albumin, globulin, triiodothyronine hormone, triglycerides, and cholesterol profile concentrations in the serum were significantly (p < 0.05) improved by increasing the level of MWM into broiler diets up to 6%. In contrast, some traits of carcass composition and meat quality as well as physiological parameters deteriorated when adding higher levels of the MWM (8-10%) to the diets, compared to the control. Economically, there...
Magda A. Eldomiaty1,2, Manal E. Elsawaf2, Soad S. Ali3, Heba El-Sayed Mostafa4,5*
...up. The forced swimming protocol was used to induce depression, while the rat voluntary wheel was used for voluntary exercise. After scarification, estimation of corticosterone level was conducted, and samples of adrenal gland were examined for structural changes by light and Electron microscope, and for immunohistochemical expression. Rats from group III showed statistically increased corticosterone level and increased cortical thickness compared to other gro...
Shaker Al-Suwaiegh
...determination of plasma proteins, glucose, liver enzymes and minerals parameters. The results indicated that Azolla pinnata contain protein (32.83%), crude fiber (13.6%), ether extract (1.17%) and ash (3.89%). Upon feeding, replacement diet with 20.0% Azolla pinnata caused significant increase in feed efficiency and body weight gain. In addition, the plasma metabolites (total protein, glob...
Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed El-Bayoumi1, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila1, Gomaa Abd El-Rhim Abdel Alim2
...included the effects on protection, growth performance and clinico-pathological changes. The results indicated that, immunostimulants can keep maternal immunity longer where lector® was the best; the decline in HI titers also indicates that bird groups not contract ND natural infection. The results of performance parameters after immunostimulants administration and challenged with IBDV at 14-days of age and NDV GenotypeVII.1.1 at 21- days of age in broiler...

Aiman Al-Mufarji, Shaker Al-Suwaiegh, Abd El-Nasser Mohammed*

...lasma parameters (total protein, albumin, globulin, glucose, urea, and minerals) of ewes and lambs. It could be concluded that M. oleifera leaves supplementation to pregnant ewes from eight weeks prepartum to eight weeks postpartum might be ameliorative for both productive and reproductive performances of ewes through modulating thermo-tolerance responses, blood and plasma parameters in subtropics.
 
Keywords | Moringa oleifera, Gr...

Roni Pazla1, Novirman Jamarun1*, Elihasridas1, Arief1, Gusri Yanti2, Zaitul Ikhlas2

...versifolia) as a forage protein source in Kacang goat rations. Avocado waste to optimize rumen bioprocessing. This research aimed to obtain good performance from Kacang goats through appropriate ration formulation based on fermented forage (sugarcane shoots and tithonia) with avocado waste. This formulation is expected to minimize the use of concentrate in the ration. This study used 16 male Kacang goats aged one year, which consisted of four groups based on b...
Seyedmohammad Karimi1, Mohammad Darvishi2*, Mohammad Barati3, Ramin Hamidi Frahani4, Mohammad Hassan Kazemi5
...reviously been shown to protect the liver with their antioxidant properties, may reduce the hepatic toxicity induced by Remdesivir. Given that few studies have been performed on the role of oral melatonin and N-acetylcysteine on reducing the hepatic adverse effects of Remdesivir, we decided to conduct this clinical trial study. In this double-blind, randomized clinical trial study, 70 patients with Covid-19 in Besat Hospital, Tehran, Iran, during 2022, were en...

Aqleem Abbas1, Mustansar Mubeen2, Yasir Iftikhar2, Qaiser Shakeel3*, Hafiz M. Imran Arshad4, Maria del Carmen Zuñiga Romano5 and Sarfaraz Hussain6

...l agent of RSB is the necrotrophic fungus Rhizoctonia solani. Finding appropriate management strategies to combat the disease to minimize rice yield losses and reduce global food security threats is challenging. However, scientists are still figuring out the best way to safeguard rice crops from RSB. Recently various pathogenesis-related (PR) viz. PR-3, PR-5, PR-9, PR-10, PR-12, and PR-13 and WRKY genes have been discovered in rice crops which are engaged in p...

Muhammad Adeel Qureshi1*, Raza Ahmad2, Bilal Ahmed1, Tanzim Ullah Khan1 and Muhammad Yasin3

...tudy was to find a best protocol for callus induction and plant regeneration of potato (Solanum tuberosum L.). The experiment was carried out in complete randomized design (CRD). Leaves and internodes of potato cv. Desiree were used as explant for callus induction and plant regeneration. Two types of callus induction media (CIM) were used, i.e. CIM1 and CIM2 with concentrations of 2, 4-D 2mg/lit and 3 mg/lit respectively. Among the two different callus inducti...

Ghulam Sarwar Shah1,2, Maqsood Anwar Rustamani1, Rab Dino Khuhro1, Rehana Naz Syed1 and Abdul Mubeen Lodhi1

...bles by causing seedling rots, root rot, pre- and post-emergence damping-off, cottony-leak, cottony blight, and stalk rot diseases. An advantageous combination of various factors makes the control of Pythium aphanidermatum difficult. However, synthetic fungicides provide quick and effective control. Therefore, we checked the sensitivity of different isolates of P. aphanidermatum to 17-old ...

Kainat Bibi1*, Sajjad Khan1, Zulfiqar Ali Gurmani1, Fahad Karim Awan1 and Sajid Ali2 

...more 13.67 % more crude protein and 2.41 % more crude fiber fat were recorded in organically grown wheat. Therefore, for high quality and environment safe production of wheat, organic fertilizer may be applied at recommended rates (compost 12 t ha-1, poultry manure 6 t ha-1 and farmyard manure (12.5 t ha-1).

...

Yuli Retnani1*, Heri Ahmad Sukria1, Indah Wijayanti1, Didid Diapari1, Muhammad Dimas Erlangga1, M Fatahillah Ibsyah1, Taryati1, Nisa Nurmilati Barkah1,3, Novia Qomariyah2,3

...n the dry matter, crude protein, and crude fat intake and was able to increase final body weights and feed efficiency compared to sheep fed with conventional feed. Processing of agricultural waste into silage and wafers can improve the performance of local sheep so that agricultural waste has great potential to be used as animal feed. 

...

Faustin Dokui1*, Frédéric M. Houndonougbo1, Service G. Djidda1, Venant P. Houndonougbo1, Edith Gangbedji1, Gwladys Menon Agbo2, Sedjro Ludolphe Dedome2, Séverin Babatoundé1, Soumanou Seibou Toleba1, Christophe A.A.M. Chrysostome1 

...fed stone rich in crude protein and molasses, was higher compared to the other groups during the dry season and higher than the intake of the treatment group fed with salt-poor stone during the experiment period. Cows in the LS2 treatment group produced much more milk during the dry season than the other treatment groups. Cows in the LS3 treatment group fed with stone low in salt produced much more milk from the fifth week to the end of the trial than the othe...

Mutia Rizkia Shaffira, Nurhayati, Dwi Desmiyeni Putri* 

...he using red ginger and brotowali extract both single or in combined application in drinking water on the productivity and carcass quality in broiler. One hundred unsexed broilers were reared for 28 days. This study used a completely randomized design (CRD) with 4 treatments and 5 replications, each replication consist of 5 broilers placed randomly in each treatment. The treatment were P0 = giving drinking water without adding red ginger and b

Hussein Jabar Jasim1*, Amer Murhum Al-Amery2

...ses appearing as pale necrotic areas, as well as thickness and calcification with fibrinous exudates of bile ducts, were the most frequent gross lesions. Meanwhile, the histopathological examination showed hyperplasia, fibrous proliferation in the portal area and coagulative necrosis of hepatocytes with large numbers of inflammatory cell infiltration such as eosinophil, Kupffer cell and scattered lymphocytes in the area previously migrated by young flukes as w...

J. Salma and F. Shahina

... large scale to provide protection to crops against insects.

...

A.E. Ismail and M. M. Mohamed

...nt gave best results in protecting sugar beet plants and diminishing the nematode population densities in various stages. But, SM treatment with their rates ranked statistically in the second category. However, the three levels of CM treatment achieved the third category in managing the nematode. All treatments significantly improved infected sugar beet growth including yield and TSS %. There were positive correlations between the evaluated concentrations and ...

W. Khan, N. U. Nisa, A. Khan and S. M. H. M. Naqvi

...sites than cestodes and protozoans. The prevalence rate was: Ascaris lumbricoides 39.8, 

A. Khan, B. Nawab, S. S. Shaukat, M. A. Samad and J. K. Tareen

D. S. Srivastava, M. Sehgal†, A. Kumar, S. Verma, B. K. Dwivedi and S. P. Singh

Saima Akter1, Md. Rasel Prank1, Shariful Islam1, Sharmin Akter1, Injamamul Hasnine1, Murshed Uddin Ahmed2, Md. Shohel Al Faruk3* 

...ematode was 57.86%, and protozoa was 9.1%. The infestation rate of the Strongylys group (45.4%) was dominant followed by Fasciola gigantica (24.79%), Paramphistomum spp. (24.79%), Neoascaris spp. (12.4%) and Eimeria (9.09 %). The parasitic infestation in cows was higher than in heifer, bull, and calf based on animal categories, and the animals within 2 years of age were more susceptible to parasitic infestation. As there are no previous studies on the parasiti...

Jie Chen, Qinghua Qiu, Yanjiao Li, Xianghui Zhao, Lanjiao Xu, Xiaowen Xiong, Qingqi Wen, Mingren Qu and Kehui Ouyang*

...gy marker genes i.e., microtubule-associated protein 1A/1B-light chain 3 (LC-3) and lipolysis protein i.e., hormone-sensitive lipase (HSL) expression in visceral pre-adipocytes were higher than that in subcutaneous pre-adipocytes, but adipogenesis transcriptional factors such as sterol regulatory element-binding protein 1c (SREBP-1c) and peroxisome proli...
Aadil Sultan, Mohsin Ahmad Khan*, Nadeem Ahmed, Muhammad Hassan, Rashid Bhatti, Hafsa Naeem, Muhammad Islam Khan, Saad Tahir,  Samia Afzal* and Ahmad Ali Shahid
...="text-align: justify;">Protein production in any expression system can be enhanced either by optimizing the culturing parameters or targeting the genetic factors that enhance protein production. One of those genetic factors is gene dosage, which can be increased by increasing the vector copy number. However, increased number of expression vector poses some metabolic burdens on bacterial cells. The current study provides gen...

Shah Murad Khan1, Hamayun Khan1, Younas Muhammad1, Haq Aman Ullah1*, Muhammad Tariq Tunio2, Ali Gohar2 and Fazli Rabbani

... estrus synchronization protocols in Achai breed of cattle. Twelve lactating Achai cows were divided into two equal groups and subjected to Presynch Ovsynch (POP) or Modified 7-day Select Synch (MSS) protocol. In POP protocol animals were administered with PGF2-α injections on day -38, -24 and -3. GnRH-1 was given on day -10 and 0, along with timed artificial insemination after 16 hr...

Ghada A. Ibrahim1*, Mohamed Sayed Helal1, Nahed Abd Elhafeeze Kamoura2, Mohamed Samir3,4, Amira Mohamed Mazid5, Mohamed F.M. Farag6

...leucogram picture total proteins, globulins, urea, creatinine levels were significantly increased in klebsiella-infected animals. An alarming increase in MDR and ESBL klebsiella bovine infections necessitates a controlled use of antibiotics in cattle farms and warrants sustainable monitoring of antibiotic emergence events and further studies for their genetic phenotypic interrelation. Moreover, the haemato-biochemical alterations in the klebsiella infected cat...

Asmaa A. Darwish*, Mona A. Mahmoud, Adel M. El-Kattan 

...increased matrix metalloproteinases activity, T/HDL/LDL-hypocholesterolemia, and decreased minerals, electrolytes, and trace elements concentrations and these changes were more prominent in goat than in sheep. While, the diseased ewes suffered from higher degrees of leukocytosis, total hyperproteinemia, hypoglycemia, increased kidney function tests, and oxidative stress than the diseased does. Total antioxidant capacity (TAC...

Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*

... higher values of crude protein. No negative change was observed in the histological parameters of the liver and intestinal tissues for the fishes fed with plant based feeds added with probiotics. Conclusively, fish production can be enhanced with the addition of probiotics in the feed derived from plants.

...

Bilgenur Yasa1* and Ali Uzun2

...eriformes, 1 (0.8%); Bucerotiformes, 1 (0.8%); Galliformes, 1 (0.8%); Cuculiformes, 1 (0.8%); Caprimulgiformes, 1 (0.8%); Coraciiformes, 2 (1.6%); Gruiformes, 2 (1.6%); Podicipediformes, 2 (1.6%); Suliformes, 2 (1.6%); Pelecaniformes, 3 (2.5%); Strigiformes, 3 (2.5%); Columbiformes, 4 (3.3%); Accipitriformes, 6 (5.04%); Piciformes, 6 (5.04%); Anseriformes, 9 (7.5%); Ciconiiformes, 9 (7.5%); Charadriiformes, 19 (15.9%); and Passeriformes, 46 (38.6%). The migrat...

Zongliang Li1, Rongxin Ma2,*, Yan Wei1 and Jianghua Zuo3

... group (P<0.05). The protein expression of bFGF and IL-6 in the combined treatment group was lower than that in the conventional treatment group (P<0.05). The conventional treatment group 30 (75.00%) had a lower tumor growth rate (P<0.05) than the combination treatment group (92.50%), and the combined treatment group 32 (80.00%) had a significantly reduced tumor depth compared with the conventional treatment group 21 (52.50%). There was no difference ...

Lihang Wang, Qiling Chen, Tingsheng Lu, Shudan Yao, Xingwei Pu and Chunshan Luo*

...e P38AMPK/Smad2 pathway proteins (phosphorylated p -P38MAPK and Samd2) were notably higher in the model versus the control and the sham, while MH and MH+MPS could patently down-regulate p-P38MAPK and Samd2 protein levels. To conclude, MH+MPS is available to refrain the activation of P38AMPK/Smad2 signal, hence repressing cell apoptosis after SCI, reducing secondary SCI, and benefiting the recovery of nerve function.

...

Athhar Manabi Diansyah1, Muhammad Yusuf2*, Abdul Latief Toleng2, Muhammad Ihsan Andi Dagong2, Tulus Maulana3, Hasrin4, Abdullah Baharun5 

...ost-thawing quality and proteomic plasma semen as fertility performance in Bali-polled bull. The utilization of Bali-horned bulls as a point of reference was necessary to achieve this aim. The semen samples from Bali-horned and Bali-polled bulls were obtained twice weekly using an artificial vagina. The semen samples were immediately sent to the laboratory for processing. Parameters measured were sperm motility, abnormality, viability, acrosome integrity, and ...

Ambrin Rajput1* and Mehrunisa Memon2

...of straw (509 kg ha-1), protein (22%), leaves P (0.46 %) content, P uptake (11.49 kg ha-1) and P utilization efficiency (10.3 %) were noted by P application with N and K applied treatment. However, the lowest values were recorded where no P was applied. The highest yield had 100% increase in mungbean yield with combined nutrient application of N:P: K (15:75:15 kg ha-1) compared the control plot through this study. Increasing the P application levels from 100 t...

Ali I. Al-Ameedi1, Zahraa M. Ayad2*, Wed Abbas Mohammed3, Salim K. Hajwal4

...y aimed to evaluate the protective effect of Ginkgo Biloba against Genotoxicity Induced by Hyroxyurea in Mice. Forty male albino mice were randomly divided into 4 groups of ten animals. The first group received hydroxyurea (80mg/kg B. W) orally daily for 30 days, while second and third group received Ginkgo Biloba (100 mg/ kg.BW) and omega3 (150 mg/kg.BW) orally daily for two weeks of HU administration as protective and 4th ...

JAVERIA NEHAL1, ARIF MUHAMMAD KHAN1, AZHAR ABBAS KHAN*2, MUHAMMAD MUBIN3, HAFIZ MUHAMMAD TAHIR4 & JAVED IQBAL5

...-specific and expensive protocols. ELISA, Nested PCR has been used for many years in different countries. Citrus orchards in Sargodha region were surveyed and leaf samples showing typical symptoms of citrus canker were collected. Infected section of leaf was taken for isolation of bacteria. Lesions were cut into parts and streak bacteria by the help of inoculation loop grown in nutrient medium. Pure bacterial culture of Xanthomonas axonopodis were used for det...
ASMA ABDUL LATIF*1, SAMREEN MUSHTAQ1, SABIHA FAZAL1, MUHAMMAD MANSHA2, & ATIF YAQUB3
...asma gondii a neglected protozoan parasite commonly infects humans worldwide. One third of human population has become victim of T. gondii and its infection in pregnant women has serious consequences on women as well as on fetus health. Present study was conducted to assess the seroprevalence of Toxoplasma gondii among pregnant women of Lahore, Pakistan.
239 blood samples of pregnant women were collected from Lady Walingdon hospital, Lahore along w...

MUHAMMAD EJAZ*1, MUHAMMAD JAMIL YOUSAF5, ASMA MAQBOOL3, ALTAF HUSSAIN4 & ABDUL QAYYUM KHAN SULEHRIA2

...assemblage of planktonic rotifers were determined with respect to seasonal variations in a pond of Pipnakha village, Gujranwala. Sampling was executed on monthly basis at three sites of the pond from October, 2011 to September, 2012. Altogether, 74 rotifers belonging to 24 genera and 13 families were identified. Highest (128.7±40 ind/ml) ppopulation density of rotifers was observed ...

Chun Ik Lim, Hyeon Kwon Kim, Kang Nyeong Heo, Are Sun You, Hyo Jun Choo* 

...) increased serum total protein (TP) level. Aspartate amino transferase (AST), cholesterol (CHOL), and triglyceride (TG) concentrations were significantly (P < 0.05) decreased in the FGP2.0 group than in the CON group. Serum IL-2 level was significantly (P < 0.05) higher in the FGP2.0 group than in the CON group, although IL-6 level showed no significant difference. These findings suggest that dietary supplementation of FGP as a feed additive might impro...
 
 MUHAMMAD MUNEEB SOHAIL1, FATIMA AMEER2, GUR CHARN SINGH2, MUHAMMAD ZAID1* 
...ons of high-density lipoprotein cholesterol (HDL) but high concentrations of other plasma lipids. This study reanalyzes the relation between plasma lipids and various anthropometric parameters. In this cross-sectional type of study, the participants (n=53) were recruited for the study. Participants were given one-day free health camps and they were anthropometrically measured. Plasma lipid fractions were accordingly determined. Participants suffering from bact...
 
 MUHAMMAD MUDASSAR SHAHZAD1*, FATIMA KHALID1, MEHWISH FAHEEM2, SYED ZAKIR HUSSAIN SHAH3, SANA BASHIR1 & SYED MUHAMMAD KHAN
...ude fat (66%) and crude proteins (73%) was observed in fish at 4 g/kg level of Tau in LSM based diet. Likewise, better absorption of the majority minerals occurred on said level. Our results showed that Tau could be used as a feed additive in linseed meal based diet to confer improved health status and higher growth in common carp at a 4 g/kg level in a plant-based diet. 
...
 
 SYED ALI RAZA1, MUHAMMAD WASEEM MUMTAZ2*, AYOUB RASHID CH1, ABDUL WAHEED1, JAMES WILLIAM3 & MUHAMMAD ARSHAD
... ASE/g DE). The β-carotene bleaching inhibition of 87.44 ± 1.20% was computed for 60% ethanolic leaf extract being statistically non-significant from BHA (89.41 ± 2.45%). The in-vitro anti-obesity attribute of extracts was assessed by measuring the inhibition of enzymatic activity of pancreatic lipase. The 60% ethanolic leaf extract exhibited maximum pancreatic lipase inhibition of 54.55 ± 0.72% but lower than standard drug orlistat (...

Zubair Ali, Muhammad Sohail*, Yasir Ameen, Hamidullah, Ishtiaq Ahmed and Mehwish Malik

...arch on the efficacy of protocols that integrate ultrasonography with timed AI protocols for re-synchronzation of ovulation, differential management strategies for cows carrying twin fetuses conducted.

...

Caiping Duan

...tern blotting (WB). The protein contents of B-cell lymphoma factor 2 (Bcl-2), apoptosis-related genes Bax and caspase-3 were detected by WB. The contents of lactic dehydrogenase (LDH), creatine kinase (CK), superoxide dismutase (SOD) and malondialdehyde (MDA) were detected by enzyme-linked immunosorbent assay. Results showed that compared with the control group, the low-dose propofol group had increased NO, decreased ET-1 and cTnT contents (P<0.05), and hig...

Ubaida Hussain1,2*, Amtul Jamil Sami1*, Shazia Rafique3*, Muhammad Idrees khan3 and Ahmad Ali Shahid3

... and NS5A nonstructural proteins of HCV 3a genotype. Owing to the fact that HCV patients can develop HCC, plant extract has also been tested for cytotoxic activity. Colorimetric analysis was done to determine the vitality of HepG 2 cells for 24 h after treatment with methanolic seed extract and minimum inhibitory concentration was calculated. HepG2 cell were transfected stably to express nonstructural proteins NS3 and NS5A o...
Ayesha Ahsan1, Rabia Arif2*, Samina Nazir1, Muhammad Saleem2 and Memunna G. Shahid1
...="text-align: justify;">Protein Kinase C (PKC) and tubulin homologs are present in all eukaryotes and play significant role in growth, development and cell differentiation through phosphorylation and de-phosphorylation of other proteins. In this study, we have amplified PKC and beta tubulin homolog bml gene from six strains and F3 and F4 generations of Sordaria fimicola collected from the Evolution Canyon-1. Sequenced produc...

Irene S. Gamil1* and Dalia Fouad1,2

...enia tessellata sp. n. (Proteocephalidea: Proteocephalinae) is described from the intestine of the dice water snake Natrix tessellata (Laurenti, 1768) (Serpentes: Colubridae) collected from El Faiyoum Governorate, Egypt. Standard methods of collection of the snakes and examination of the cestode tapeworms for taxonomic studies were used. Ophiotaenia tessellata sp. n. was identified and being separable from Ophiotaenia specie...

Ovirup Bhushan Paul1, Shodipta Sharma Urmi2, Md. Ashraf Ali Biswas3* 

... population to meet the protein demand is one of the driving factors of increasing global greenhouse gases. The current study aimed to assess the effects of total mixed ration (TMR) and fermented TMR (FTMR) feed on digestibility, total gas production and pH of ruminants. Novel feeding techniques were implemented that combined fermentation to improve digestibility with locally accessible feed supplies using a completely randomized design. TMR feed was produced ...

Yuhua Chen1 and Song Lu2*

... by flow cytometry. The protein expression of PD-1 and CD39 of the mice was analyzed by Western blot. The metabolic rate of CD8 + T was analyzed by fluorescent nutrient stain. Results showed that the mRNA of IL-10, IL-6 and 1L-1β in the electric stimulation group decreased compared with that in the control group (P<0.05). On the 15th and 25th day, the tumor volume of the mice in the electric stimulation group decreased compared with that in the control...

Lei Jiang, Yi Huang, Runfeng Yang, Xiaohui Jiang* and Hao Yan

...xpressions of apoptotic proteins Bax, Bcl-2, cleaved caspase and PAX2 in SKOV3/DDP cells, and the targeted relationship between circ_0009910, miR-455-5p and PAX2 was verified by double luciferase. Our results showed that circ_0009910 and PAX2 genes were significantly up-regulated in SKOV3/DDP cells, and miR-455-5p was significantly down-regulated in SKOV3/DDP cells. circ_0009910 could enhance cisplatin sensitivity of SKOV3/DDP cells. circ_0009910 targeted miR-...

Zhe Lin1, Yumo Li1, Yuchen Wang1, Yuechen Li1, Ke Pei1, Guangfu Lv2, He Lin1* and Zhun Yu3*

...R were screened, and an protein-protein interaction (PPI) network between the target of OR and anti-stress target was constructed using STRING database. Kyoto Encyclopedia of Genes and Genomes (KEGG) was used for analyzing the pathways of target gene. To further verify this, total 96 ICR mice were used, forced swim test and anoxic tolerance test were performed. The effect of OR on levels of monoamine neu

Doaa H. Assar1, Rasha A. Al-Wakeel2, Zizy I. Elbialy3, Mahmoud M. El-Maghraby4, Helmy K. Zaghlool5, Adel A. El-Badawy4, Abdel-Khalek E. Abdel-Khalek6*

...volume, and serum total protein, high-density lipoproteins, testosterone, and thyroid hormones (T3 and T4), and significantly decreased activity of aspartate and alanine transaminases (AST and ALT), triglycerides, cholesterol, low-density lipoproteins (LDL), very-LDL, and urea. Semen variables including semen volume, and percentages of sperm motility, livability, and abnormality as well as...

Riko Noviadi, Dwi Desmiyeni Putri, Gusma Gama Maradon*, Agung Adi Candra, Nani Irwani, Gadis Apriani, Made Guntur Candra Adinata, I Made Krisnanda

...="text-align: justify;">Protein is the most expensive component of feed, resulting in economically burdensome production costs. The Maggot Black Soldier Fly (Hermetia illucens) can be utilized as protein source feed ingredients. We aimed to analyze the implications of maggot black soldier fly (Hermetia illucens) flour with various processing techniques in broiler rations. This study used a completely randomized design (CRD) ...

Theresia Nur Indah Koni*, Tri Anggarini Yuniwati Foenay, Stormy Vertygo

...p and nitrogen from Non-Protein Nitrogen such as urea. This experiment aimed to evaluate the fermentation characteristics and nutrient content of rice bran fermented anaerobically for six days. This experiment used a Completely Randomized Design with four treatments and four replications. The treatments included rice bran without palmyra sap and urea (T0), rice bran with 2% urea (T1), rice bran with 10% palmyra sap (T2), and rice bran with 2% urea and 10% palm...

Fathin Faahimaah Abdul Hamid1, Mohd Farhan Hanif Reduan1*, Jasni Sabri1 , Faez Firdaus Jesse Abdullah2,Mohammed Naji Odhah1, Nur Athirah Binti Abdul Manaf1, Mohd Jefri Norsidin2 , Siti Nor Che Yahya1, Intan Noor Aina Kamaruzaman1, Nur Zul Izzati Mohd Rajdi1 

...emistry shows the total protein, albumin and globulin are within the range with mild increment in creatine kinase, blood urea nitrogen, and gamma glutaryl transferase however there were increased lactate dehydrogenase levels post-infection with Mannheimia haemolytica (p<0.05). In conclusion, oxytetracycline and flunixin meglumine treatments does not have a great influence on the parameters evaluated in goats experimentally induced with Mannheimia haemolytic...

Safaa Rhaimi1, Sara Brikat2, Mouloud Lamtai2*, Mohammed Ouhssine1

...ential oil produce neuroprotective activity in female rats.
 
Keywords | Herbal medicine, Acute toxicity, Salvia officinalis, Anxiety, Depression, Memory, Rats, Phytotherapy
...

Siti Fairus Mohamed Yusoff1, Annie Christianus1*, Yuzine Esa1, Muhammad Fadhil Syukri Ismail1, Bashiru Garba2, Nik Siti Zaimah Safiin3, Nur Hamid Hidayahanum4

...ophthalmus. Also, crude protein and docosahexaenoic acid (22:6n-3, DHA) were higher in the hybrid PH×PN and P. nasutus. However, there were no significant differences recorded between the hybrid and its parents for omega-3 (n-3PUFA), total polyunsaturated fatty acids (PUFAs), and eicosapentaenoic acid (C20:5n-3, EPA) and (C22:5n-3, EPA). Likewise, the total essential amino acids (EAAs) was significantly higher in hybrid PH×PN and P. nasutus. In sum...

Riswandi1*, Ali Aim1, Muhakka1, Afnur Imsya1, Agus Wijaya2

...on, total bacteria, and protozoa were the variables observed. The results showed that the combination of swamp forage could increase (p<0.05) DMD, OMD, TVFA, partial VFA, and total bacteria, while N-NH3, methane production, and protozoa decreased. It was concluded that the combination of water mimosa in the ration was the best composition in increasing DMD, OMD, total bacteria, and rumen fermentability and reducing methan...
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
...commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on t...
Riaz Muhammad1*, Aamer Sharif2 and Muftooh ur Rehman Siddiqi³
...ation, vortex height and rotational speed. In addition to that, the influence of vortex formation, vortex height and vortex shape on rotational speed is also investigated. A two input factors, i.e. water head and flow rate, and each having five-level has been selected in a present study. The results showed that at median head 0.70 m and flow rate 0.004 m³/s, the maximum rotational spe...

Anhar Ibrahim Elhanafy*, Amr Mohamed Mousa, Amaal Mohamed Kamal 

...ount, WBCs, serum total protein, albumin and globulin concentrations, as compared to control. Upon treatment, a significant decline in aspartate aminotransferase, alanine aminotransferase, serum total bilirubin, direct bilirubin and in direct bilirubin, serum creatinine, urea content, serum total cholesterol, triglycerides, and low-density lipoprotein, and vice versa regarding the high-density lipop

Khitam J. Yahya*, Mohammed T. S. Al-Zubaidi

...oridium is a ubiquitous protozoan parasite causing gastrointestinal disorders in various hosts worldwide. The current study was undertaken to study the biology of Cryptosporidium meleagridis and examine the anti-Cryptosporidial efficacy of curcumin in experimentally infected quails compared with that of paromomycin. This study carries out from September 2022 to January 2023 in Baghdad city, Iraq. Oocysts were isolated from naturally infected quails identified ...

Oussama Zghari*, Mouloud Lamtai, Sofia Azirar, Mohamed Yassine El-Brouzi, Hajar Benmhammed, Aboubaker El-Hessni, Ali Ouichou, Abdelhalem Mesfioui

...is a well-established neurotoxicant, affecting various regions of the brain and causing many neuropathological and neurobehavioral abnormalities as well as oxidative stress (OS). Conversely, melatonin (MEL) has been considered as an antidepressant, anxiolytic substance and protects neurons from OS. The present study was designed to evaluate the neuroprotection effect of MEL against Al neu<...

Shaimaa M. Ahmed1, Gehan M.A. Kassem1*, Fernando Pérez-Rodríguez2, Heba H.S. Abdel-Naeem1 

...aureus in Tryptone Soya Broth (TSB) using turbidity and plate count methods as well as monitoring and modelling its potential growth in chicken breast and thigh meats at room temperature (25 °C) and refrigeration temperature (4 °C). The calibration curve showed a linear relationship between the turbidity measurement and bacterial cell count in TSB. Moreover, the coefficient of determination index (R2) was 0.8789 which indicates that the linear function...

Abubakar Sadiq Muhammad1,2, Latiffah Hassan1, Saleha Abdul Aziz1, Zunita Zakaria1, Hassan Ismail Musa1, 2*, Maswati Mat Amin3 

...atistically significant protective association was recorded between water pH and ST84 (OR=0.401, 95% CI 0.195-0.828; p = 0.013) when compared to ST51. This showed that for a unit increase in water pH, there was a 2.5 times increase in the odds of recovering ST51 compared with the odds of recovering ST84. These findings suggested that variation in the occurrence of various B. pseudomallei STs is associated with variations in the environmental (soil and water) p...

A. A- E. Abo-Elkhier1, K. S. E. Abdel-Wahab2, M. A. Ali3, M. A-H. El-Sayed4, N.A-K. Saleh5 and A. A. Atef6

... (P 0.05) (Except total protein and alkaline phosphatase). It was found that 3 anti-HEV IgM. anti-HEV IgG. HEV RNA and HEV Ag positive pregnant women transmitted the virus to their all fetus (100%). While 14 anti-HEV IgG, HEV RNA and HEV Ag positive pregnant women transmitted the virus to 12 (85.7 %) of their fetus and the fetus died and terminated to abortion. However, the 7 anti-HEV IgG positive aborted women did not transmit the infection to their fetus. Al...
M. A. Abou El- Nasr1, Kh. A. Dougdoug1, Hayam S. Abdelkader2, and Rehab A.
Dawoud2
...l portion of the capsid protein of PPV. The amplified products were cloned into pGEM-T-Easy vector and hybridized to PPV DNA specific probe labeled with Dig-I 1dUTP. DNA sequencing using fluorescent dideoxy nucleotides showed that the capsid protein region of PPV-EA strain had about 65% sequence homology with other strains of PPV and 45% similarity to the CP or PPV-D strain. A PCR fragment coding for the 43 C-terminal amino ...

M. A. Amer1; M. H. El-Hammady2; H. M. Mazyad1; A. A. Shalabyl and F. M. Abo-El-abbas

... into the Pinpoint Xa-l protein expression vector. The accury of each PCR amplified PVY CP gene was tested by PCR, restriction analysis, and translation. Analysis by in vitro translation using western blotting assay on nitrocellulose membrane using monoclonal antibodies verified that the PVY-CP gene correctly encoded and expressed a protein reacting with PVY antibodies. The CP gene, approximately 32 KDa reacted successfully ...

Om-Hashem M. EI-Banna1, M. A. S El-Kady2, E. A Salama1 and Salwa N. Zein2

... (UTR) between the coat protein and ꞵb gene. It was clear that five bases, and 18 out of 1 16 amino acids were found different. three amino acids insertion, and one amino acid deletion. Little differences were also observed regarding the 5' UTR of RNA γa as six nucleotides were changed. 12 out of 162 amino acids were differed and one amino acid deletion. Gl19 strain cross reacted specifically with the monoclonal antiserum raised against the coat p

A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1

...t of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation of plasmid DNA. then used restriction enzymes Bam HI and Bgl II to identify clones containing inserts. To confirm the fragment inserted of CP gene sequence. PCR was performed using specific primers for PVYN CP gene. (3) T...

Hala A. Amin1; A. Barakat2; A.A. Abou Zeid1

...nology, a 38-KDa fusion protein containing a complete coat protein (CP) gene or Citrus tristeza virus (CTV) encoded by the expression vector plasmid (Pinpoint™ Xa3, Promega) with a fragment of biotin binding protein (BBP-rCTV-CP) was highly expressed and purified from E. coli cell culture. Antiserum obtained from rabbits after injection with the BBP-rCTV-CP fusion p

E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2

...nt (321 bp) of the coat protein gene of GFLV was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two primers specific for the coat protein gene or GFLV. Nucleotide sequences of the RT-PCR products confirmed that these sequences were amplified from the GFLV coat protein gene. A specific GFLV Dig labeled DNA probe was prepared by PCR and detected the GFLV virus in...

Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2

...th the structural viral proteins nucleoprotein (N) and the envelope glycoproteins GI and G2 and the nonstructural viral proteins NSs and NSm were accumulated to amounts sufficient for detection and cytopathological analysis. Electron micrograph of the virus showed that it is quasi-spherical and its diameter ranges from 80 to 100 nm. The virus caused thic...

Om-Hashem M. El Banaa l, A.A. Abou Zeid2, Fawzia I. Moursy3 and Azza, G. Farag

...alin which is the major protein of Spiroplasma citri (S. citri Saglio et al), the causal organism of citrus stubborn disease. RecA gene protein is the enzyme primarily responsible for the homologous recombination of chromosomal DNA in bacteria. The Immunocapture- Polymerase Chain Reaction (IC-PCR) technique was applied for detection of S. citri Saglio et al in which the Spiroplasma was captured with the specific polyclonal a...

 Salwa N. Zeinl and Hanaa S. Zawam2

...ign: justify;">Apple chlorotic leaf spot virus (ACLSV) isolated from apple trees was successfully transmitted by dagger nematodes (Xiphinema spp) It was transmitted to bait plants grown in soil containing Xiphinema spp. nematodes, The virus was identified according to host range, mode of transmission, particle morphology, serological tests, and SDS-Polyacrylamide gels. Purification of ACLSV was performed using bentonite/polyethylene glycol. Electron micrograph...

Asim Faraz1*, Nasir Ali Tauqir2, Hafiz Muhammad Ishaq1, Muhammad Arslan Akbar3, Muhammad Abubakar Sufyan1, Abdul Waheed1, Muhammad Usman Saleem4, Muhammad Shahid Nabeel5, Morteza Bitaraf Sani6, Amal AlKharusi7, Samira Jebahi8 and Ayman Balla Mustafa9

...re determined including protein, total solids, fat, density, lactose, and solids not fat (SNF). The difference between composition of milk, and yield was found to be significantly (P<0.05) high. Solids not fat (SNF), protein, and total solids in milk were found to be highly significant (P<0.05) in early lactating and non-pregnant females while milk density and lactose were studied to be highly significant in mid-end la...

Muhammad Ismail1, Abu Bakar Muhammad Raza1,2, Zarina Qasim3, Muhammad Zeeshan Majeed1*

...and kill strategy (T2), protein-based bait method (T3), combination of all three methods (T4) and control (T5) were evaluated against B. dorsalis infestation in citrus during 2015 and 2016. Data of percent infested fallen fruits, percent pupae recovered from these fallen fruits, percent adult deformity, percent sex ratio and cost-benefit ratio were recorded. Results showed that when all of the components were used together (T4), fruit damage was significantly ...

Muhammad Afzal Naeem1*, Muhammad Hassaan Khan2, Tahmina Nazish3, Uzma Bashir4 and Midrarullah5

...b province annually. The rotational cultivation of cotton and wheat crops constitutes the major cropping pattern in Pakistan. Current study was undertaken to investigate the allelopathic effect of the post-harvest remnants of cotton crop on the germination and growth parameters of successor wheat crop. Experiment was laid down in complete randomized design. The seeds (n=10) of Triticum aestivum L. were placed in each replicate and treated with aqueous extracts...

Yun Zhang*

... was done to detect the protein expression. Transmission electron microscope analysis revealed that exosomes could be significantly observed in the PE group. The expression of surface markers that included CD63 and CD81 were dramatically upregulated in PE group. The protein level of ET-1 and Ang-II were significantly increased in PE group, and the upregulated ET-1 and Ang-II expression were highly correlated with PE progress...

Xiaoying Liang1,2, Xiaofang Jiang3, Honglin Jia1, Ru Zhang1, Li Gao4* and Qing Yang5*

... by flow cytometry, the protein expression was detected by enzyme-linked immunosorbent assay, and the gene expression was detected by real-time polymerase chain reaction. In addition, in vitro experiments with Jurkat cells were used to verify the effect of methylase inhibitor 5-Aza-2’-deoxycytidine on the expression of cytokines and genes in the T cells. The expression of Th2 cells, cytokine proteins and genes after al...

Pengliang Xie1, Lufang Zheng2*, Mingxia Dong3, Huaiqiang Zhang1 and Fang Chen1

...seased group had higher protein expression of IL-6, IL-8, IL-12 and IL-13 than the control group (P<0.05). In detection of protein expression levels of sVEGFR-1 and sVEGFR-2 in patients with different severity levels, diffuse macular edema group had higher protein expression levels of sVEGFR-1 and sVEGFR-2 than the localized macular edema group (P<0.05), and cystoid macular edema gro...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...bull;E strain. a single protein band "ith a size of about 35-37 KDa was obtained after SDS-PAGE analysis of the purified virus preparation. The SCMV-E-RNA was isolated from virus-infected sugarcane tissues and then used as a template for reverse used transcription-polymerase to amplify the coat protein chain reaction (CP) gene (RT-PCR) Of SCMV-E to amplify strain. the ThecDNA t...

Rafik Soliman1*, Rafik H. Sayed2, Hanan Mahmoud3, Heidy Abo El-Yazeed1, Marsell Saad1, Shaimaa Abdelall Elsaady2, Khalid Sh3 

... the recovered E. coli serotypes, the serotype O111:K58 (B4) was the most prevalent (38.2%). An inactivated polyvalent autogenous mastitis vaccine was prepared from the most encountered bacterial pathogens, namely, E. coli, S. aureus, Str. agalactiae and Str. dysgalactiae. The selected strains for vaccine preparation were inactivated with a predetermined minimal lethal dose of gamma radiation (4krad kGy/min) and the bacteri...

Muhammad Arshad Iqbal*, Aamir Ghafoor, Irfan Ahmad, Muhammad Ijaz 

... C. perfringens cause necrotic enteritis (NE) which instigated extreme economic losses and usually occur in broiler chicken. Use of AGP in Poultry feed has several negative implications involving public health concerns and trade restrictions. Bacillus amyloliquefaciens has been investigated as potential probiotic. The study involves the evaluation of competitive exclusion ability of B. amyloliquefaciens against S. Enteritidis and Cl. perfringens. A total of 18...

Wuritunashun*, Burenbatu, Narenqiqige, Jiuguniang, Eerdunduleng, Shuanglian Wang, Cuiqin Gong, Hashengaowa, Huizhi Jin, Baiwurihan and Chunhaizi

...ee quantification (LFQ) proteomics approach to investigate the effect of the Zhenbao pill on the differential serum protein expression of HSP patients. Out of 14 significantly differentially expressed proteins, four proteins immunoglobulin lambda variable 3-27, immunoglobulin kappa variable 3-11, neural cell adhesion molecule L1-like p

Tarique Ahmed Khokhar1*, Atta Hussain Shah1, Muneer Ahmed Jamali1 and Asghar Ali Kamboh2

...position such moisture, protein, fat, ash and glycogen decreased with increasing storage period of chilled, frozen and thawed buffen, chevon and chicken meat samples. Nutritive values of chilled, frozen and thawed buffen sample also decreased with increasing storage period.

...
Mansoor Ayoob1, Atta Hussain Shah1, Zaheer Ahmed Nizamani2, Muhammad Faisal Ayoob2,3*, Deepesh Kumar Bhuptani1,5 and Abdul Sattar Baloch4
...yzed for moisture, fat, protein, glycogen, peroxide, thiobarbituric acid, total viable count and total coliform count after marination with 0, 10, 20, 30 and 100% concentrations of honey and after 1, 4, 8 and 12 days of storage (4 ̊C). The moisture, fat and protein contents were moderately decreased on the 4, 8 and 12th days of storage in all the groups. The glycogen content showed a significant (P < 0.05) increase among...

Shaimaa A.Tawfik2,3, EL S.T. Awad1*, Hoda O.Abu Bakr1, Amira M.Gamal-Eldeen4, Esmat Ashour2, Ismail M.Ahmed1  

...YP3A4, MRP-1, and c-MYC proteins and expression of miRNAs were assayed. Results: Findings indicated that CSO treatment led to a suppression in hepatotoxicity, nephrotoxicity and cardiotoxicity induced by DOX in male albino rats evidenced by a significant enhancement in the activity of ALT, GGT, LDH, AST, also creatinine and uric acid. CSO induced antioxidant activity GSH, CAT and inhibited MDA. Histopathological examina...

Muhammad Mohsin Abbas1*, Sajjad Ur Rahman1, Muhammad Abubakar2, Muhammad Imran Arshad1 and Khurram Ashfaq3

...of the prevalent virus serotypes in the area. The current cross-sectional study was conducted in the Bahawalpur district of Punjab, Pakistan, with the purpose to determine the prevalence of FMD virus serotypes Asia 1, O and A in bovines. A total of 838 bovine sera samples were tested through Solid phase competitive enzyme-linked immunosorbent assay (SPC-ELISA), based on structural proteins...

Najamuddin Solangi1*, Mushtaque Ahmed Jatoi1, Adel Ahmed Abul-Soad2, Abdul Aziz Mirani1, Muhammad Aslam Solangi3 and Ghulam Sarwar Markhand1

...ains effective in vitro protocols for somatic embryogenesis and plantlet regeneration in commercially important date palm cvs. Begum Jungi and Ajwa. Spikelet explants of spathes (avg. 17, 28, 32 cm) excised at different intervals were used as initial explants. Results revealed that sterilization of spathes with 50% sodium hypochlorite (NaOCl) solution resulted in significantly highest survival, lowest mortality and contamination in spikelet explants. The spike...

Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5

...r system components and protein structure. Plants have adapted several protective mechanisms like production of antioxidants, enzymes and carotenoids to face reactive oxygen species and avoid photoinhibition. This article provides overview of molecular mechanisms involved in photoinhibition and its protective elements.

...

Rahma Boukarine*, Leila Hamdi and Kamel Khelili

... antioxidants which aid protect against oxidative stress. This study was conducted on Albino Wistar rats to investigate the antioxidant effect of Eruca sativa on the hepatic and renal profile damaged by xylene. Seventy rats were divided into seven equal groups and treated by gavage for 30 days as follows: Control group (C), group (CO), positive control group (RE) was received 350 mg / Kg bw of Eruca sativa aqueous extract (ESAE), 2 toxic groups X1 and X2 were ...

Meng Wang, Dongliang Zhou, Huixia Li, Chunqin Wu,Yan Zhao and Houqiang Luo*

...mechanisms to transport proteins synthesized in the cytoplasm to the outer membrane or extracellular environment of the bacterial cell, or directly to other cells. The bacterial secretion system plays an irreplaceable role in this process. Up to now, at least 11 kinds of secretion systems are involved in the pathogenesis role of bacteria, especially the formation of bacterial resistance. Therefore, the study of the bacterial secretion system is of great signif...

Atena Azarniush1, Majid Moghbeli2*, Farshid Kafilzadeh1, Mohammad Kargar1 and Hooshang Jamali1

...ding to the recombinant protein was observed in positive sample. This research demonstrated the efficacy of using B. subtilis as an expression system for the production of IL-11 and it can be used as a candidate for the proteins without post-translational modification.

...

Xiaowei Huang1, Chao Ma1, He Lin1, Yuchen Wang1, Yan Xu1, Guangfu Lv2* and Zhe Lin1*

...phological changes. The protein levels of glucocorticoid receptor (GR), mineralocorticoid receptor (MR), brain-derived neurotrophic factor (BDNF), trosine kinase B (TrkB) and cyclic adenosine monophosphatec response element binding protein (CREB) in hippocampus were detected by western blotting. The results showed that, OR could significantly reduce the contents of CRH, ACTH and CORT in se...

Anwar ul Haq1, Maqsooda Parveen2, Shehzadi Saima3* and Khalid Masood Ahmad1*

...ilt, leaf mould and well rotten farmyard manure (1:1:1). Three cuttings in each pot and a total of 45 cuttings were planted. Cuttings of each treatment were dipped for 3 minutes in respective solution before planting. Uprooting was done after 60 days of plantation the cuttings. NAA with 100 mg/L proved best treatments that produced maximum root length, number of roots, dry and fresh weights of roots, number of sprouted buds, number of leaves, leaves fresh weig...

Nitya Salsabila, Djalal Rosyidi, Agus Susilo* 

...t effect (P>0.05) on protein, ash, and organoleptic quality, could have a very significant effect (<0.01) on water, fat, and carbohydrates, and had a significant effect (P<0.05) on Aw . The best value was obtained by sonication liquid smoke for 20 minutes with Aw content of 0.65, water 40.04%, fat 9.09%, protein 29.14%, ash 0.37%, carbohydrates 21.37%, color 4, 35, texture 4.15, aroma 4.10, and taste 4.20. It can be...

Sahar Ezeldien1,2, Foromo Dramou2, Fatma M. Yousseff3*, Alexander A. Nikishov2, Sergy B Seleznev2

...d serum levels of total protein and albumin while decreasing glucose level compared to the control group. Eggs of Japanese quail supplemented with chamomile extract showed a higher egg weight, egg length, albumen weight, albumen length, and yolk index. It could be concluded that the chamomile aqueous extract can positively affect the egg quality and productivity of laying Japanese quail. 
 
Keywords | Chamomile, Japanese quail...

Munasik*, Titin Widiyastuti, Caribu Hadi Prayitno

...sture, crude fat, crude protein, crude fiber, NFE, calcium and phosphor, and anti-nutritional phytic acid. The results showed that the fermentation process using red oncom mushrooms enriched with Na-glutamate improved the nutritional level of the cassava-tofu dreg mixture. Although the NFE content decreased, the crude fiber content increased, and the amounts of calcium, phosphorus, and protein significantly increased (P <...

Imran Ahmad

...etables (beetroot and carrot) at three different levels (3%, 5%, 7% w/w). A Texture Analyzer determined hardness, adhesiveness, cohesiveness, gumminess, and chewiness. The difference among the treatments was analyzed using standard deviation and ANOVA (p ≤ 0.05). To evaluate the various samples, a focus group of twelve panelists on the same day of preparation using a 9-point hedonic scale for seven attributes: viscosity, airiness, graininess, consistency, s...

Sar Zamin Khan1*, Muhammad Waqas1 and Sagar M. Goyal2

...tive systems. Multiple serotypes of IBV have emerged due to the high rate of mutation and genetic recombination, which has made it difficult to control the disease. Certain serotypes have disappeared because of the availability and use of vaccines but new serotypes have emerged. A regular watch on the disease including virus variation, prevalence, pathogenesis and development of diagnostic...

Nawfal Hammadi Jasim1, Yasmeen Jassim Mohammed2 , Jala Amir Salman Alahmed1, Majdy Faisal Majeed3* 

...hepatocytes vacuoles, necrotic foci, inflammation cells aggregation, sever dilated and congestion of sinusoids and nucleus pyknotic. Conclusion: These findings demonstrated that the MPH overdose induced free radical-mediated oxidative stress, through an increase of antioxidant enzymes and histological alterations in the liver.  

...

Sumbal Nazir1*, Farkhanda Manzoor2, Ishrat Perveen3, Anum Rana2, Irum Naureen1, Abad Ali Nadeem3 and Hafiza Najma Naeem2 

... Some viral, bacterial, protozoan, and fungal pathogens are attached on the honeybees worldwide. These pathogens affect the honeybee population by creating disease in it, which also effect the economy of country. It destroys the honey production and causes a subsequent reduction in the crop yield. In this present work, we isolated and screened various honeybee pathogens i.e., Nosema apis, Nosema cerus, Acute bee paralysis virus (ABPV), Black queen cell virus (...

Muhammad Mukhtar1*, Lely Ummi Wakhidah2,Mohammad Zubair Hippy3 

... and various sources of protein. Thus it is necessary to add a strategy to the previous strategy (strategy) in the development of beef cattle in Gorontalo. Based on the results of the AHP and SWOT above, it can be seen that the implementation of all process models for the beef cattle development policy strategy is the WO strategy. The level of the role of the actor element on the focus element found that the actor who has the biggest role in the development of...

Pawinee Kingkan1, Thanathip Supcharoenkul1, Chaowit Rakangthong1, Chaiyapoom Bunchasak1, Komwit Surachat2,3, Wiriya Loongyai1* 

...d relative abundance of Proteobacteria in the Amox-Phage group. Concurrently, the Amox-Phage group showed an increase in the relative abundance of Lactobacillaceae in the caecum. The results of this study indicate that the bacteriophage cocktail has the potential to alter the abundance of intestinal microbiota without increasing the incidence of diarrhea or negatively affecting growth. Hence, a bacteriophage cocktail could be added to the feed of nursery pigs....

Ahmad Shahzaib1*, Tabish Raza2 and Aisha Areej2

...reatment and management protocols. 

...

Jawad Ali1,*, Samiya Rehman1, Aqsa Aslam1, Fouzia Tanvir2, Rida Liaqat1, Muhammad Ahmad1, Aamir Riaz1, Muhammad Shafique3, Hassan Ali1 and Amjad Ali1

...compounds polyphenols, carotenoids, vitamins, and trace elements as secondary metabolites imparts antidiabetic, hepatoprotective, hypolipidemic, antidepressant, immunosuppressive, anti-microbial properties to the W. coagulans Dunal. Plant samples from Mianwalli, Kohat, and Sargodha city were gathered for antioxidant potential determination. Free radical scavenging activity and total antioxidant activity experiments were perf...

Muhammad Usman Shafi1, Hafiz Azhar Ali Khan1*, Tiyyabah Khan2, Waheed Anwar2, Adnan Akhter2 and Muhammad Zubair3

...l, storage and Personal Protection Equipment (PPE) during operation leads to health problems of human, increase resistance against pests with negative effects on the environment. The purpose of this survey was to check the knowledge about pesticide uses, risks and storage among farmers in Lahore division of Punjab, Pakistan. And, to get knowledge from farmers regarding local knowledge system (LKS) and Integrated Pest Management (IPM). Most of respondents 97% (...

Asmaa A. Darwish*, Adel M. El-Kattan, Mona A. Mahmoud, Mohamed T. Ragab, Amani A. Hafez 

... cytokines, acute phase proteins (APPs), free radicals, cortisol, growth hormone, and TSH concentrations and a significant (P˂0.05) decline in the anti-inflammatory cytokine, anti-oxidants, insulin, T3, and T4 levels. The iron profile of infected animals was characterized by a significant (P˂0.05) hypoferremia, hyperferritinemia, and hypotransferrinemia. The estimated pro-inflammatory cytokines and APPs yielded high sensitivity and specificity values in both...

Thekra Fadel Saleh, Omar Younis Altaey*

...showed that acidic glycoprotein was dominant in the villi and crypts, with higher density in the middle portion compared to the proximal and distal portions. The density of glycosaminoglycans was also higher in goblet cells at the basal crypts compared to longitudinal crypts. Immunohistochemical analysis revealed higher levels of lymph follicles and B lymphocytes in the proximal portion compared to the middle and distal portions. The complex architecture sugge...

Peng Xu1, Yankuo Li2*, Shusong Zhang1 and Bin Liu3

...eat significance in the protection and construction of biodiversity in the forest ecosystem of Wuyi Mountain area.

...
Nasir Ali Tauqir1*, Asim Faraz2, Abdul Waheed2, Ayman Balla Mustafa3, Irfan Shahzad Sheikh4, Michela Pugliese5 and Shahid Nazir6
...ine the effect of rumen protected methionine supplementation on milk production and its composition in lactating Nili-Ravi buffaloes. Sixteen early lactating nili-ravi buffaloes were divided into four groups according to Randomized Complete Block Design for this study. Four experimental diets were formulated supplementing 0, 15, 25 and 35g of methionine/ animal/ day. The experimental period was of 56 days out of which 10 days were as adaptation period. Daily f...

Meltem Kızıl1*, Ali Rişvanlı2, Murat Abay3, Tarık Şafak4, Mehmet Akif Kılınç5, Öznur Yılmaz6, Burak Fatih Yüksel1 and İbrahim Şeker1

...tigation of peptide and protein-structured hormones in biological fluids has become one of the most striking issues. The aim of this study was to determine irisin, asprosin, leptin, adiponectin, and IGF-1 levels in cows and calves after calving according to the mode of delivery. The study was carried out with 20 Holstein cows and 20 calves born from these cows. Blood samples were taken from cows and calves in all groups during birth, after drinking colostrum f...
Umara Amir ud Din1, Waqas Ahmed Khan1*, Khurrum Shahzad1,2, Basharat Ali3, Misbah Hussain1,4 and Fazli Rabbi Awan4
...atinine, albumin, total protein cholesterol, and liver enzymes (ALP, ALT, and AST) were measured for all subjects. Genotyping for ACE (I/D) polymorphism was done by PCR assay. Statistical analysis showed that subjects with DN had higher (67%) frequency of ID genotypes and the ID genotype carriers also exhibited higher levels of creatinine (6.2±3.9 mg/dL) and urea (99±41 mg/dL). Moreover, logistic regression analysis also indicated that ACE ID gen...

Khalil1*, Dwi Ananta1, Andri Bachtiar2, Hermon3

...but increased the crude protein and reduced the crude fiber content. Feeding the stored rice straw gave no significant effects on cattle performances. The results suggested that wrapping was the most appropriate method to maintain the moisture, and nutrient content of supplemented rice straw during storage.
 
Keywords | Calcined mineral, Physical appearance, Rice straw storage, Supplemented rice straw, Pesisir cattle
...

Aqleem Abbas1, Mustansar Mubeen2, Waqar Younus1, Qaiser Shakeel3, Yasir Iftikhar2*, Sonum Bashir2, Muhammad Ahmad Zeshan2 and Azhar Hussain1

...roy whole fields. Plant protection units are needed to tackle these challenges to prevent future outbreaks. Herein, we describe significant diseases and pests that are catastrophic to GB’s crops in the future. In addition, this review shows how diseases and pests impact the yields of GB’s crops.

...

Mati Ullah1*, Muhammad Rizwan2, Ali Raza3, Xianlin Zhao4, Yanling Sun4, Sarah Gul5, Muhammad Ihtesham Waheed6, Muhammad Nadeem Khan7, Alvina Gul8, Sami Ullah Jan9* and Chao Huang4*

....03 to 46.52% while the protein-coding sequences (CDS) were in the range of 2544 to 2888. The pan-genome analysis of the three strains identified a total of 5449 genes with 377 as core genes. The functional characterization by subsystem category distribution analysis revealed “Carbohydrates” is the largest subsystem followed by “protein metabolism” while the biological pathway analysis by the Kyoto en...

Ibrahim Elmaghraby*, Abdel-Baset I. El-Mashad, Shawky A. Moustafa, Aziza A. Amin 

... (0.55 %), thecoma or fibrothecoma (1.10 %), steroid cell tumor-NOS (0.55 %), and granulosa-theca cell tumor (5.55 %). Specifically, all cases had distinctive histomorphological appearance characteristics for benign tumors, except adult granulosa cell tumor, which had sarcomatous changes and other features reliable for malignancy. Importantly, granulosa-theca cell tumor exhibited a wide spectrum of histologic patterns as micro/macrofollicular, trabecular, diff...

Amr N. El-Shahat1*, A.M. Abdul Azeem1 and Mohamed H.M. Abd el Megid2

...y leaf extract (BLE) in protection against high cholesterol diet (HCD) induced hypercholesterolemia. About thirteen compounds of essential oils were identified by GC/MS analysis including 1.8-cineole, Linalool and sabinene which represent the main volatile oils of bay leaf. Supplementation of BLE with HCD for 10 weeks resulted in reduction in the levels of some lipid contents (total cholesterol, triglycerides, Low-density lipoprot

Yufang Liu1,2, Guiling Cao3, Yujing Xie3 and Mingxing Chu1*

...slational modification, protein turnover, chaperones, energy production and conversion, and transcription process. Pathway analysis in KEGG pathway database of the known genes revealed that the five pathways that most differentially expressed genes involving: GnRH signaling pathway, oxytocin signaling pathway, melanogenesis, thyroid hormone synthesis, and insulin secretion. Online tool was used to predict the function of DEGs, the results showed that the CYP11...

Fadzlin Afiqah A. Samad2, Amirul Faiz Mohd Azmi1, Muhamad Affan Ab Azid1, Hafizin Mu’izz Zalazilah1, Syakirah Zulkifli1, Izreen Edriana Mohd Jasmi1, Muhammad Baqir Irfani Rahimin Affandi1, Mohd Zamri Saad1, Md Zuki Abu Bakar1, Agung Irawan3,7, Adib Norma Respati4, Anuraga Jayanegara5,7, Sadarman Sadarman6,7, Hasliza Abu Hassim1,2,7*. 

...lso noticed on the milk protein content of Murrah buffalo in association with increasing FC ratio (P<0.05; R2 = 0.76). In addition, increasing NFC content in the diets also contributed to decrease milk protein content across the breed of buffaloes but without a strong correlation (P<0.05; R2 = 0.149). For milk lactose content, CP intake was the only factor explaining the decreased trend when the level increased (P<0...

You-Ming Teng, Wen-Zhou Liu and Li Yang*

...thological changes. The protein and mRNA expression of PPAR-α, CPT-1 as well as PDK-4 were measured by western blot and qRT-PCR. The results showed that pioglitazone could reduced SBP, DBP, MCD, SA, HMI, LVMI as well as myocardial fibrosis and FFA and Ang II levels in serum. Moreover, pioglitazone inhibited the expression of HIF-1α protein and simultaneously enhanced the expressions of PPAR-α, CPT-1 as well...

Yanping Li, Fei Xu, Yongming Wang*, Yunyun Lv, Jinrong Shi, Biwen Xie, Wenyao Cai and Dian Liu

...propagation programs to protect their populations. Here, we firstly carried out artificial breeding of S. superciliaris and S. reevesae, and hybrid combinations were designed as S. superciliaris ♀ × S. reevesae ♂, and S. superciliaris ♂ × S. reevesae ♀. Secondly, 19 microsatellite loci were used to evaluate genetic diversity between hybrid offspring and their parents. The mean polymorphic information content (PIC) among groups ranged from 0...

Luigi Liotta1, Vincenzo Lopreiato1, Fariborz Asroosh2 and Alireza Seidavi2*

...15 °C), pH, fat and protein were determined according to the standard methods. Macro and micro elements of milk were analyzed using inductively coupled plasma mass spectrometry. Data were subjected to the two-way ANOVA analysis to determine the significant differences between species/breeds. The acidity, density and fat in Talesh sheep’s milk was higher than milk from other species/breeds (P<0.01). Also, the amount of prot...

Ayesha Anwar, Sadia Aslam and Nauman Khalid*

... showed highest fat and protein content. There was a significant difference between the pH values of cooked and uncooked patties from different treatments. Increased lipid oxidation content was observed in cooked and uncooked patties containing different concentrations of emulsions, together with non-significant difference in values of water holding capacity and cooking yield among different treatments. A slightly higher scores were obtained for sensory parame...

Dalia M. Amin1*, Noha Mohammed Halloull1, Walaa E. Omar2, Basma A. Ibrahim2, Nahla M. Ibrahim1 

...ught on by their anti-fibrotic, antioxidant, and antiapoptotic pathway capabilities.
 

...

Aneela Ahmed Tagar1*, Mahvish J. Channa2, Kanwal Ahmed Tagar3 and Kaka Kainat4

...n, D-dimer, C- reactive protein, LDH, CBC and troponin). The study reveals the following findings as majority of patients were in age group 37-47 years, male and were married. Moreover, the majority belonged to the medical field. The greater number of the patients were physically active. Only 18.5 % of patients reported co-morbidities such as diabetes in 12.3% with one exceptional case in which Diabetes developed after the occurrence of COVID-19 .The majority ...

Abdulaziz A. Alaqil*

... assess heat shock protein 70 (HSP70) density and glutathione peroxidase (GHS-px) activity, respectively. The general linear model procedure with one-way analysis of variance (GLM-ANOVA) was used to analyze the data. The results showed a significant (P<0.05) increase in the BT, H/L ratio, MDA, and CORT, and over-expression of HSP70 in the hens of LPS group. Also, significant (P<0.05) impairments were perceived in the feed consumption and conversion,...

Samin Ullah1, Huma Rizwana1, Abdul Kabir1,2*, Atique Ahmed Behan1, Muhammad Naeem1, Ghulam Shabbir Barham1, Abdul Hafeez Bukero1, Anees ur Rahman1, Naseeb Ullah1 and Shafiq ur Rahman Shah1

...eed intake, total serum protein, and serum antibody IgG levels of group C were also higher than those of groups B and A. The study also found that two calves in group A, one calf in group B, and one calf in group C had health issues such as diarrhea and pneumonia. The findings suggest that providing 4 liters of colostrum to crossbred Holstein Friesian calves within 30 minutes of birth can improve their immunity and health. This study provides evidence for farm...

Roy Malindo1, Hosea Abdiel Duto Wicaksono2, Maskur2, Anuraga Jayanegara3, Osfar Sjofjan4, Siti Chuzaemi4* 

...y 100% of the needs for protein and energy, and 96.5% for dry matter by 2029.  

...

Abdullah*, Imtiaz Khan, Muhammad Ishfaq Khan, Muhammad Ibrahim and Muhammad Fawad

...ulus arvensis L., Cyprus rotundus, Vicia sativa L. Ehrh., Cynodon dactylon L. Pers. and Fumaria indica Hausskn were all found in five locations around the district. The main species in the district emerged as A. tenuifolius Cav. The highest relative weed density (64.2%) and relative weed frequency (45.2%), respectively was noted for A. tenuifolius Cav. While, the lowest value of relative weed density (3.5%) and relative weed frequency (1.2%), respectively was ...

Nguyen Thi Anh Thu1*, Ly Thi Thu Lan1, Nguyen Thuy Linh1, Chau Cong Dang1, Nguyen Hoang Phuc1, Tran Dinh Tuan1, Nguyen Trong Ngu2 

...at 108,2 CFU/mL. In the protective experiment, 1-day-old chicks were arranged in CD) control diet; BC+S) CD + 1 mL BC (gavaged at days 1, 2, 3, 4, 5) + 1 mL SE (gavaged at day 3); S) CD + 1 mL SE (gavaged at day 3); S+A) CD + 1 mL SE (gavaged at day 3) + gentamicin at 1 g/4 L water (gavaged at days 1, 2, 3, 4, 5). In therapeutic experiment, 2-days-old chicks were arranged in CD; BC+S) CD + 1 mL BC (gavaged at days 2, 3, 6, 8, 10, 13, 15) + 1 mL SE (gavaged at ...
Umer Farooq1,2, Nimra Murtaza2, Abubakar Siddique1, Bilal Saleem1, Obaid Ur Rehman1, Nageen Zahra1, Muhammad Uzair1, Muhammad Naeem Riaz1,3* and Muhammad Ramzan Khan1*
... which possibly disrupt protein’s structure and function, as well as lead to genetic disease. We performed genome wide reference-based sequence alignment and functional annotation to identify deleterious non-synonymous SNPs (nsSNPs) in cattle breeds of Pakistan. For this purpose, genomic data of four different purpose cattle breeds including Bhagnari, Cholistani, Sahiwal and Red Sindhi was analyzed. Comparison with taurine reference genome ARS-UCD.1.2.99...

Zaki Al-Hasawi1* and Reda Hassanine2

...an level of serum total protein was significantly lower. Only, significant correlations were found between mean levels of blood biochemical parameters and mean concentrations of Zn, Cd and Pb in the liver of contaminated fishes from the polluted site. Liver of fish from the unpolluted site appeared normal, while that of fish from polluted site appeared abnormal due to sever histopathological alterations.

...

Zaki Al-Hasawi1* and Reda Hassanine2

...an level of serum total protein was significantly lower. Only, significant correlations were found between mean levels of blood biochemical parameters and mean concentrations of Zn, Cd and Pb in the liver of contaminated fishes from the polluted site. Liver of fish from the unpolluted site appeared normal, while that of fish from polluted site appeared abnormal due to sever histopathological alterations.

...

Qi Zhuo, Yuanchun Yao, Meisongzhu Yang* and Jinhua Chen and Miao Tian

...nowcked out) group. The protein expression and the gene expression were measured using Western blotting and RT-QPCR, respectively. We found that cell proliferation rates in CON, TGT and DGT groups showed that cells were transfected with trangelin gene, the cell proliferation rate died down, significantly lower than that in CON and DGT groups (p<0.05). Cells migration and invasion results in all groups showed that after cells were transfected with trangelin ...

Fuji Astuty Auza1*, Sri Purwanti2, Jasmal A. Syamsu2, Asmuddin Natsir2, Rusli Badaruddin1, Deki Zulkarnain1, La Ode Muh. Munadi1 

... 

...

Dede Kardaya*, Deden Sudrajat, Dewi Wahyuni 

...ng is the high price of protein source feed in tropical regions. Therefore, in this study, we substituted protein sources of the feed with urea which was processed with slow-release technology to avoid urea poisoning. Slow-release urea-impregnated zeolite (UZ) and Indonesia’s natural zeolite (Z) were examined using 24 heads of seven-eight months old of local male lambs (20.12 ± 2.1 kg BW) allotted to four treatm...

Rizki Palupi*, Arfan Abrar, Fitri Nova Liya Lubis, Yuni Kurniati, Bianca Ikriza Octa Nadia Putri 

...lity (dry matter, crude protein and crude fiber), hematological status and blood malondialdehyde levels in blood of broiler chickens. Data were analyzed by ANOVA and further tested by Duncan Multiple Range Test (DMRT). The results of this study indicated that the CCI had a significant (P<0.05) effect on nutrient digestibility, hematological status and malondialdehyde levels in blood of broiler chicken. The CCI at a level of 10% in the ration increased hemog...

Atef M. El-Sagheer1*, Aline F. Barros2, El-Sayed M. Abd El-Aal3, Mohamed M. Gad4, Doaa S. Mahmoud4 and Amr M. El-Marzoky3

...e showed R. similis was protruding out or was inside the feeding site of M. incognita. In addition, R. similis was deepened within the root more than usual, with a lower number of phenolic and lignified cells. The obtained results can form the basis for understanding of the nature of nematode parasitism and be used as a basis for the establishment of field experiments that allow the creation of sustainable management strategies to suppress nematodes in infeste...

Farooq Jan1*, Abdur Rauf1, Ikramullah Khan1, Muhammad Yasin2, Muhammad Qayash3, Hazrat Wali1, Muhammad Luqman1, Fayaz Asad4 and Muhammad Khalid5

Muhammad Adeel Farooq1, Shaukat Ali1*, Ali Hassan1, Rida Sulayman1, Muhammad Ahsan Kaleem2, Hafsa Shahzad1, Muhammad Summer1, Arooj Latif1, Tahreem Tanveer1

...8 h on wheat bran-based broth. BSAA-25 demonstrated maximum biosynthesis of α-amylase as compared to BLAA-25. Optimum α-amylase activity was measured at 40±0.5°C, pH 7.0±0.2 and 1% starch solution by BSAA-25 (338.6±11.0 U/mL) and BLAA-25 (326.8±6.4 U/mL). A considerable increase was seen in the biosynthesis of α-amylase from mutant strains of B. subtilis and B. licheniformis using agro-waste as substrate. ...

Farha Deba1, Rubina Nelofer2 and Muhammad Irfan1*

...ent | The study reports proteolytic/keratinolytic bacteria for the first time from abattoir  region. 
...

Walaa I. Mohameden1, Haidy G. Abdel-Rahman2, Ibrahim M. Hegab3* 

...05) increases in plasma proteins, zinc, and copper were recorded, while malondialdehyde, TNF-α, and MMP-9 significantly (P < 0.05) decreased. Furthermore, buffalo calves showed significant ( P < 0.05) increases in both ingestive and locomotor activities, while grooming and lateral recumbency significantly (P < 0.05) declined. Mineral supplementation had a favorable effect on animal skin, health conditions, and antioxidant activity, as well as i...

Lianci He1, Dingxi Bai2, Chenxi Wu2, Yizhu Zhong2, Shi Chen2, Xinru Bao2, Jing Gao2*, Chaoming Hou2*

... mobility, and mRNA and protein levels of interleukin-1 beta (IL-1β), tumour necrosis factor alpha (TNF-α), transforming growth factor β-activated kinase 1 (TAK1), TAB, IκB kinase (IKKα), IκBα, NF-κBp65 and cyclooxygenase-2 in the serum were measured. Compared with the CON group, the CFS group had decreased weight and decreased activity and mobility (P < 0.05). Compared with the CFS group, the three SXC groups a...

Yakun Ge

...levels of pro-apoptotic proteins Bax, caspase-3 and caspase-9, inhibit the expression level of anti-apoptotic protein Bcl-2 and the epithelial-mesenchymal transition of cancer stem cells, reduce the proliferation ability of cancer stem cells, and increase the apoptosis of cancer stem cells.

...

Amirul Faiz Mohd Azmi1,4,Wan Nur Hanani Wan Roslan1, Athirah Zawani Zulkifli Amin Rashid1, Siti Aisyah Mohd Hafiz Ngoo1, Mohd Hezmee Mohd Noor1, Muhammad Azrolharith Rashid1, Mohd Zamri Saad2, Danung Nur Adli5, Hasliza Abu Hassim1,3* 

...aste. The carcass crude protein and fat were also significantly (p<0.05) better. In conclusion, adding soybean waste into quail diet for up to 30% could be a potential protein source that enhances the growth and improves meat quality of quails.
 

...

Amirul Faiz Mohd Azmi1,4, Hafandi Ahmad1, Norhariani Mohd Nor1, Goh Yong Meng1, Mohd Zamri Saad2, Md Zuki Abu Bakar1, Norafizah Abdul Rahman5,6, Agung Irawan7,9, Anuraga Jayanegara8,9, Hasliza Abu Hassim1,3,9*

 

... optimum value of crude proteins but low in crude fiber compared to diets B and A. Total volatile fatty acids (TVFA) and their molars proportion, gas production, total fatty acids, total bacteria count, and total protozoa count increased in parallel with the concentrate levels in Diets B and C (P < 0.05) in both breeds. The result also revealed that Murrah cross and Swamp buffaloes showed comparable rumen fermentation pat...
Maria Azam1, Tahir Mahmood Qureshi1, Saddam Hussain2, Amjad Islam Aqib3*, Shanza Rauf Khan4, Kashif Akram1, Misbah Ijaz5, Maheen Murtaza6, Afshan Muneer6 and Sammina Mahmood7
...h by well diffusion and broth microdilution method. To analyze the data, both probability and non-probability statistical tools were applied using SPSS version 22 of statistical software at 5% probability. The current study showed 24.56% of S. aureus positive from commercial dairy while the resistance of these isolates against gentamicin, enrofloxacin, levofloxacin, and vancomycin was found to be 50, 40, 30, 30%, respectively. On the other hand, a disc diffusi...

Yao Xixi1, Zhou Rui2* and Ma Yinshan3

... rumen pH, forage crude protein, crude fat, nitrogen free extract, tannic acid and total fatty acid with CLA content in grazing yaks (P<0.05). A significant negative correlation (P<0.05) of crude fiber and crude ash with CLA content in milk of grazing yak was recorded, while no significant correlation (P>0.05) of PUFAs and tvfa with CLA content was observed. This study is helpful to improve the grazing management of alpine grassland and the production...

Jing Hu1,2,3 and Zhenhua Ma1,2,3*

...s cell boundaries and necrotic cells deepened over time within 96h and also deepened from C group to T3 group. In all groups, triglyceride increased with time. In the treatment groups, the cholesterol was higher than that in C group at 6 h. The high-density lipoprotein cholesterol of C group remained stable at a higher level than the treatment groups. The low-density lipoprotein cholestero...

Rashid Saraz1, Saiqa Amur1, Zia-ul-Hassan1*, Naheed Akhter Talpur1, Inayatullah Rajpar1, Muhammad Sohail Memon2, Muhammad Nawaz Kandhro3, Khalid Hussain Talpur1 and Nizamuddin Depar4

...termined using standard protocols, with no further alterations. Soil variability mapping was done using ArcGIS ver. 10.7. through IDW interpolation. The results reveled that majority (40%) of soils were clayey in texture, followed by clay loam and silty clay loam (16% each). Slightly to moderately medium-textured soils were dominant, followed by heavy clays. Majority of soils had high to excessively high salinity (56%) followed by the soils having medium salin...
Tehreem Fatima1, Jabbar Khan1,*, Hamid Shafiq2, Dost Muhammad3, Muhammad Rafi1 and Shoaib ur Rehman1
...diated by intracellular proteins, called heat shock proteins (HSPs). Among various known stressors, heat is a major factor that induces the production of HSP70. Keeping in view the very hot conditions of Dera Ismail Khan (D.I. Khan) division where the temperature remains at 45-50°C during the months of June to September, it was hypothesized that heat stress conditions do induce the overexpression of HSPs, especially Hsp7...

Umana Niazi, Muhammad Mushtaq*, Mehwish Kanwal and Momina Raheem

...ant source of vegetable protein. In Pakistan, it was grown on area of about 86974 ha with a total production of 100790 tons during 2018-19; almost 89% groundnut area lies in the Punjab province. Average per hectare yield of groundnut, in Pakistan, is near 1200 kg, which is quite low as compared to its potential, which is some 3000 kg. The low productivity of groundnut is attributed to a number of factors, like, rainfall uncertainties, low yielding varieties, d...

Amthal Ahmed Fouad1, Basem Mohamed Ahmed2, Momtaz Abdelhady Shahein1, Hussein Aly Hussein2* 

...uding the standard RABV protein genes in the correct order. Twenty-nine synonymous and five non-synonymous mutations were evident in the protein genes. Deletions and insertions were observed in the intergenic spaces. It was highly similar to Egyptian RABV genomes and clustered within the Africa-4 (AF4) lineage of the cosmopolitan clade. It was submitted to NCBI GenBank under the access number OL314495. Conclusion: The study ...

Elihasridas, Mardiati Zain*, Roni Pazla, Simel Sowmen, Qurrata Aini 

..., organic matter, crude protein, neutral detergent fiber, acid detergent fiber, cellulose, and hemicelluloses in the ammoniated aromatic lemongrass waste samples was evaluated by incubating them on in-vitro media at 39ºC/48 h. The analysis of variance following a 5 x 4 randomized block design was used. The results revealed a significant (P<0.05) increase in the digestibility of ammoniated aromatic lemongrass waste in the rumen. The degradation of ammo...

Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein

...e secretion of aspartyl proteinase 1 (SAP1) gene were used to detect C. albicans virulence with 100% and 80% accuracy, respectively, while Hyphal Wall Protein 1 (HWP1) gene was not detected. It is expected that these C. albicans isolates contained a significant proportion of virulence factors that were linked to pathogenicity and the severity of infection. There findings suggest that poor sanitation and a reduction in goat h...

Novirman Jamarun1, Roni Pazla1*, Arief2, Elihasridas1, Gusri Yanti3, Rani Winardi Wulan Sari4, Zaitul Ikhlas4

...a as a source of forage protein. This study aims to determine the intake, body weight gain, and digestibility of nutrients of goats fed mangrove leaves and T. diversifolia with different levels. The research employed 16 one-year-old goats and divided them into groups according to their body weight. The concentrate utilized in the study comprised tofu dregs, corn, rice bran, palm kernel cake, minerals, and salt. A randomized block design with four treatments an...

Wizna1, Rusfidra2, Robi Amizar3, Romi Andika1, Muhammad Haikal1, Zurmiati1*

...tent, dry matter, crude protein, crude fiber, crude fat, calcium, and phosphorus were measured. The dose of B. amyloliquefaciens and fermentation time significantly effect (p<0.05) the total colony count of Bacillus sp. in the fermented product, but there was no interaction. The dose of B. amyloliquefaciens had a significant effect (p<0.05) on the water content, dry matter, crude protein, crude fat, and calcium. In add...

Khalid M. Al-Syaad1,2

...ic effect of CC and the protective effect of Propolis aqueous extract on CC-induced toxicity in male rats. A total of 24 Wistar albino rats were included in this study, divided into four groups; each group containing 6 rats and administered the treatment doses orally by gavage for 28 days. Control, treated with a physiological solution (5.0 ml/rat). CC-treated group, treated with CC 15 mg/kg/bw. CC+propolis, treated with CC 15 mg/kg/bw + 30 mg/kg/bw propolis. ...

Rusul Adnan Dawood, Hasan F.K. Alghetaa*

...justify;">Keywords | Nephrotoxicity, Mercuric chloride toxicity, Peritoneal exudate, Resveratrol, Oxidative stress, Herbal medicine, Antioxidants and biochemical indices
...

Muhammad Nasir Bhaya1,2* and Hikmet Keles2

...nt malignant tumors. Nephrotoxicity is one of the major side effects of it. Ellagic acid (EA) is a polyphenol, known for its antioxidant properties. In this study, the protective effect of EA on CP-induced renal damage was evaluated. For this purpose, 24 rats were divided into four groups, control, CP, CP+EA50, and CP+EA75. Histopathological examination of kidneys revealed hyperemia, epithelial degeneration, swelling, cystic...

Lichun Jiang1,2*, Lan Zhu1, Meiqi Li1, Xinyue Bao1, Zhenkun Zhao2, Haifen Qin2 and Wei Chen3*

...he least, containing 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and a non-coding control region (CR, D-loop). The overall base composition included 33.37 % A, 29.33 % T, 23.94 % C, and 13.36 % G. According to 13 protein-coding genes and phylogenetic analysis, Elaphodus may have a sister relationship with another deer group Muntiacus and they belong to the monophyletic genus. This study depicted ...
Hung Phuc Nguyen1*, Doan Van Thuoc2*, Nguyen Thi Trung Thu1, Huong Tran Thi Mai3, Nguyen Tran Khanh Hoa1, Nguyen Thi Tuyet Nhi1, Nguyen Phuong Thao1, Tran Thi Loan2 and Nguyen Thi Huyen My2
... main source of dietary protein. A total of 300 fingerling red tilapia with an initial body weight (BW) of 13.7 g were randomly distributed into 15 tanks (20 fish/tank, 3 tanks/dietary treatment) and fed the experimental diets twice daily, for 8 weeks. Results showed that fish fed SR35D and SR50D had significantly lower final BW, weight gain (WG) and specific growth rate (SGR), but higher feed conversion ratio (FCR), than fish fed FMD (P < 0.05). Meanwhile,...

Hafiz Muhammad Arsalan1, Amina Arif1 and Muhammad Khalil Ahmad Khan2*

...NO), advanced oxidation protein product (AOPP), advanced glycation end products (AGE’s) and micronutrients (retinol, ascorbic acid, alpha tocopherol), complete blood count, liver profile, renal profile, lipid profile, serum electrolytes were evaluated in CML and control groups. Our study reported that no significant difference in biochemical profile among treated with Nilotinib or Imatinib tretated groups while in comparision to control group, a marked d...
Muhammad Shoaib1, Muhammad Mahboob Ali Hamid1, Shafaq Amir2, Shaukat Ali Bhatti1*, Hafiz Hassan Iqbal1, Najam-us-Sahar1 and Mubsher Hussain1,3
...gain, feed intake (FI), protien efficiency ratio (PER), energy efficiency ratio (EER), mortality percentage and food conversion ratio (FCR) were similar (P > 0.05) by addition of lipase and bile acids in energy diluted diets during starter phase in broiler chicks. However, birds of NC1L group had higher European production efficiency factor (EPEF) than other treatments. Weight gain, PER, EER and EPEF were higher (P < 0.05) in birds of NC1LB group and low...

Mohammad Bani Ismail

...xidative stress-related proteins NRF2, HO-1, and NQO-1. SPN protects against oxidative stress and inflammation-induced cardiomyopathies, according to our study.

...

Chen Zhao, Lulu Ding, Ying Ye, Congying Kou, Haoran Xiao, Jing Zhu and Jicang Wang*

... natural flavonoid that protects many tissues of the body from the toxic effects of heavy metals. Studies have explored the adverse effects of Cd on rats and other animals, but the mechanism of Cd-induced autophagy in the kidney and the antagonistic effect of Nar on Cd are still unclear. In this study, SD rats were treated with Cd and/or Nar to investigate the protective effect of Nar on Cd-induced toxicity. The rats were tr...

Sherein H. Mohamed1, Soad El Naggar2*, Ayman A. Hassan3, Mohamed A.M. Mousa3, Mohamed M. Basyony3, Mohamed F. Sadek3, Mohamed A. A. Ahmed4, Saadia M. Hashem5 

...ty coefficient of crude protein, crude fiber, neutral detergent fiber and acid detergent fiber, nitrogen balance, acetic acid and propionic acid, the aerobic and facultative anaerobic bacteria (Lactobacillus spp.) in all treatment groups.  Concurrently, they showed increase (P<0.05) in total protein, albumin, and globulin, total antioxidant capacity, superoxide dismutase, catalase, glutathione peroxidase, immunoglobu...

Ishtiaq Ahmed1*, Hamid Ullah2, Zubair Ali2, Muhammad Sohail2, Yasir Amin2 and Afrasyab1

... strategic anthelmintic protocols as per regular faecal examination and awareness of farmers regarding husbandry practices may be implemented in the study area to boost the economy of the farmers.

...

Sajid Ali1, Ghulam Abbas1, Shahnaz Rashid1, Asma Fatima1*, Abdul Malik1, Dilawer Ali1, Muneer Hussain Bijoro1, Ushra Batool Hashmi1, Rumaisa Abdul Rahim1, Shahid Hussain2, Kashif Ali3, Jabbar Memon4 and Javeria Khourshid1

...775) by using different protein-containing diet i.e., soybean meal and fishmeal. The dietary efficacy was monitored in seawater earthen ponds designated into four nylon meshed hapa (3.7×9.5×9.5 feet) for 60 days. Juveniles (35.75±3.2g) were collected with the help of cast net from Sakro creek and transferred into the earthen fish ponds located at Garho, Thatta, Sindh. Juveniles were acclimatized for more than two weeks (15 days) to the exper...

Imbang Dwi Rahayu1, Ali Mahmud1*, Wahyu Widodo1, Adi Sutanto1, Apriliana Devi Anggraini1, Devi Dwi Siskawardani2, Wisnu Nurcahyo3, Tri Untari3

...;0.05) the total plasma protein (TPP), globulin, cholesterol, high-density lipoprotein (HDL), aspartate aminotransferase (AST), and all parameters of the blood profile. However, the herbs’ addition significantly (p<0.05) affected albumin, triglycerides (TG), low-density lipoprotein (LDL), alanine aminotransferase (ALT), and malondialdehyde (MDA). Adding herbs through drinking wate...

Mudawamah Mudawamah1*, Sumartono Sumartono1, G. Ciptadi2, E. Susanto3, Y. Hartoyo4, L. Affandhy5,6

...sian sheep that must be protected and preserved include the Sapudi sheep and their crosses, which produce meat with highly adaptive and sigmoid fat tails. This study aims to determine the differences in the relationship between physiological status, morphology, and total protein of the single and twin ewe sheep and their crosses. The research method was a field study with quantitative and laboratory analysis, with statistica...

Nosheen Jehajo* and Naheed Shah

...le, it is imperative to protect them from the infestation of cowpea weevil which causes considerable economic damage. Using no choice tests, this laboratory study investigated the effect of different temperature (20, 30 and 40°C) and humidity (50, 55 and 60%) regimes on the damage extent and weight loss caused by C. maculatus to some stored pulses i.e. green gram (Vigna radiata (L.) Wilczik), mash gram (Vigna mungo (L.) Hepper), cowpea (Vigna unguiculata (...

Sameh Abdel-Moez Ahmed Amer1*, Aly Mohammed Ghetas1, Asmaa Mahmoud Maatouq1, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1, Mohamed Abd El-Rahman Bosila1, Ahmed Ali El-Shemy2

... viruses can definitely protect against repeated NDV outbreaks. Therefore, the aim of the this work is to prepare a secure, sterile and potent an oil inactivated vaccine from a recent local isolate genotype VII 1.1 “NDV-CH-EGY-GIZA-VVTNRC-2021” and evaluates its efficacy against commercially available NDV genotype II vaccines in broiler chickens. Eighty chickens were housed in four groups (A, B, C and D) of 20 birds per group. Group A has been rece...
Sri Rahayu*, Muhaimin Rifa’i and Widodo 
...I-TASSER and human GDF9 protein sequences obtained from UniProt. We also analyzed GDF9 gene expression levels using GENEVESTIGATOR. Furthermore, we identified the proteins that interact with GDF9 using the Biological General Repository for Interaction Datasets and investigated their network formation using the STRING database. Finally, we performed a pathway analysis for GDF9 using the Kyo...

Tahir Rasool Qamar1, Sanaullah Iqbal1*, Muhammad Nasir1 and Habib-ur- Rehman2

...chicory root powder has protective impact against CRC biomarkers particularly if it is taken as preventive measure.

 
*      Corresponding author: sanaullah.iqbal@uvas.edu.pk
...

A.M. Abdul Azeem1, A.N. El shahat1* and Mohamed H.M. Abd el Megid2

...me activities), tumor necrotic factor-α (TNF-α) and apoptotic marker Caspase-3 compared to the control group. Rats received BPA along with SeNPs-CP showed significantly less severe damage and remarkable improvement in all the measured parameters when compared to BPA-rats. In this study it was concluded that the synthesis of selenium nanoparticles using a natural source such as grapefruit was effective in combining the antioxidant and anti-inflammat...

A.M. Abdul Azeem1, A.N. El shahat1* and Mohamed H.M. Abd el Megid2

...me activities), tumor necrotic factor-α (TNF-α) and apoptotic marker Caspase-3 compared to the control group. Rats received BPA along with SeNPs-CP showed significantly less severe damage and remarkable improvement in all the measured parameters when compared to BPA-rats. In this study it was concluded that the synthesis of selenium nanoparticles using a natural source such as grapefruit was effective in combining the antioxidant and anti-inflammat...
Mohamed A. Abu El-Hamd1*, Abdelslam M. Metwally2, Zahya R.  Ghallab2, Wael A. El-Hamady and Mohamed A. El-karamany1
...group) for two hormonal protocols. Cows in the first and second groups high or low-fertility (G1 and G2, respectively) were treated with PGF2α-GnRH protocol. Cows in the third and forth groups high or low-fertility (G3 and G4, respectively) were treated with OvSynch protocol. Results showed effective increasing oestrus responses 90, 70, 100 and 80% in G1, G2, G3 and G4, respectively....

Xiaowei Huang, Yajie Wang, Jia Zhou, Junxiu Liu, Zhe Lin and Ruili Li*

...ficantly decreased. The protein expression levels of TLR4 and Nuclear factor-κB (NF-κB) p65 in kidney were significantly decreased. HandE staining on renal showed that SBG groups had a certain protective effect on renal injury, especially the high-dose group. In conclusion, SBG may improve hematopoietic function and improve vascular endothelial injury in AA model rats by regulating TLR4/NF-κB signaling path...

Azza M. El-Kattawy1, Tarek Abou Zed1, Randa Megahed1 and Mohammed El-Magd2*

...ession of matrix metalloproteinase-3 (MMP3), transforming growth factor beta (TGFβ), and oxidized-LDL receptor (OLR1), 4) upregulated the expression of the anti-inflammatory gene IL10, 5) reduced the levels of the oxidative markers [lipid peroxide marker malondialdehyde (MDA) and nitric oxide (NO)], 6) increased the levels of antioxidant markers [reduced glutathione (GSH) and superoxide dismutase (SOD)]. These findings conclude that administration of Sim ...

Wei Wang1, Meifeng Zhou2, Yuebo Liang1, Fan Zhang1, Zhong Wu3, Shaowei Mo4* and Yi Qing Wang1*

...yzed by flow cytometry. Protein and mRNA expression was measured using western blotting and RT-qPCR, respectively. The mRNA and protein level of YAP was significantly increased in the tumor tissues of HER2-positive breast cancer patients. Consistently, the expression of YAP and TAZ were both dramatically upregulated in SK-BR-3-TR cells. The cell viability was increased, while cell apoptosis was inhibited in SK-BR-3-TS cells ...
Md. Abdullah Al-Mamun1,2, Al-Mamun2,3, Sanjay Kumar Mohanta2,3, Md. Farhan Tazim2,3, Mohammed Rashed Parvej 2,3, Md. Sharif Uddin2,3, Suman Barua1,2 and Liu Qun1*
...esh size regulation for protecting this species less than 145 mm and seasonal closures in the Bay of Bengal (BoB), Bangladesh would be very effective.

...

Abdullah Naser1*, Nirwana1, Sri Wulan1, Zaenal1, Mustafa1, Effendy2 

...y can be used as animal protein feed to replace soybean meal (SBM) in animal feed. This study aimed to study the effect of substituting soybean meal with fermented kapok seeds on the growth performance and digestibility of sheep reared in stalls with either palm leaf roofs or galvanized iron roofs. This study used a 2 x 5 split plot pattern randomized block design and was replicated three times. Livestock was grouped based on body weight. The main plots are tw...

Kandiah Pakeerathan*, Konesalingam Jeyavithuyan, Aruchchunan Nirosha and Gunasingham Mikunthan

...and lower Fusarium basal rot incidents were recorded in T. viride and P. fluorescens fortified paddy straw and kitchen waste-based vermicompost. Actual yield of the “Poovallarai” onion is higher than the theoretical yield of 15-20 Mt/ha in paddy straw and kitchen waste-based vermicompost too. C/N ratio and growth parameters were strongly co-related (R2 >0.5). These findings could be new eco-friendly low-cost approaches to manage soil-borne disea...

Yasir Ali1, Muhammad Shahbaz2, Hafiz Muhammad Aatif1-2, Salman Ahmad3*, Muhammad Zeeshan Majeed4, Saqib Saeed2, Mohsin Iqbal1, Mozam Ejaz1 and Saima Naseer5

... fungicides such as Cholorothalonyl+metalyxl @ 2000 ml/ha; Pyraclostrobin @ 375 ml/ha; Sulphur @ 2500 g/ha; Diphenoconazole @ 375 ml/ha; Tubiconazole+trifloxystrobin @ 303 g/ha, Polyram DF @ 625 g/ha and Propiconazole @ 625 g/ha for the management of leaf rust of wheat in Research Area of Plant Pathology, Hafiz Abad Research Station, B.Z.U. Bahadar Sub-Campus, Layyah, during crop seasons 2018-2019 and 2019-2020 in Randomized Complete Block Design (RCBD) with t...

Fahad A. Al-Abbasi1*, Abdullah Samer Habib1, Vikas Kumar2 and Firoz Anwar1

...ted level of C-reactive protein was observed in two of human samples, which reflected some internal inflammation without any clinical symptoms. This is fore thought to evaluate the conditions in which these livestock are grown and processed for import and the need to reset the standards for workers with periodic health checkups.

...

Mohammed A. El-Sayed1*, Mahmoud H Hatab2, Heba AEM Assi3, Nashaat S Ibrahim2, Hisham M Saleh2, Waheed AA Sayed2, Birgit A Rumpold4 

...sustainable alternative protein source for feed. The effect of black soldier fly (Hermetia illucens) meal on growth performance, heat stress-responses (HS) and heat shock protein (HSP70) gene transcription in gendered Japanese quail was assessed. The quails were fed on three different diets containing 100% soybean meal (diet A), 50% soybean and 50% H. illucens meal (diet B) and 100% H. illucens meal (diet C). ...
Burarah Arooj1, Zeeshan Mutahir1, Moazzam Ali1, Mohsina Akhter2, Malik Siddique Mahmood1, Arslan Hamid3 and Mahjabeen Saleem1*
... the recombinant 52 kDa protein. Purified chitinase showed optimum activity at 60°C and pH 5.5 with colloidal chitin breakdown. Enzyme showed stable residual activity within pH range of 4.5–6.5 and >70% thermal stability upto 60°C for 2.5 h. The activity of chitinase increased in the presence of Mn+2, SDS, and methanol. Chitinase has Km and Vmax values of 2.287 mg/ml and 6.784 µM/min, respectively, towards colloidal chitin. The p

Bdour Muhammed Al-Shweily1*, Jawad Bulbul Al-Zaidawi2, Muhammed Jubair Hanawi1 

...ch benefit from partial protection due to their cocoon enclosure, mitigating the impact of external influences. 

...

Omar Berkani1*, Souheila Slimani2, Nora Sakhraoui3 and Cherif Abdennour1

...xtract could serve as a protective agent against the toxic impacts of two doses of cypermethrin (CYP) on the seasonal reproduction of domestic males pigeons (Columba livia domestica) subjected to a long photoperiod (19L: 05D). Therefore, thirty pigeons were divided equally into six groups; group C used as a control, group PO used as a positive control that treated by PO (300 mg/k b.w/day), CYP1 and CYP2 groups were respectively treated by 10 and 20 mg/Kg b.w/d...

Mahmoud Abdelhady Metwally1*, Mona Abdelftah Ali1, Farouk Abdelmohdy1, Mohamed Kassab1, Tarek Kamal Abouzed2 and Khalil Fathy Abou-Easa1

...d p53 and lowered Bcl-2 protein levels. In addition, ELISA findings showed decreased toll-like receptor 4 (TLR4) concentration. Taken together, our findings highlight the potent therapeutic function of BMMSCs-CM in suppressing HepG2 cancerous cells across multiple platforms, including proliferation, apoptosis, cell cycle, and oncogene expression. Furthermore, our findings suggest that the Notch and TLR4/NF-kB signaling pathways may be targets of BMMSCs-CM for ...

Muhammad Nadeem1, Jamshaid Iqbal2, Tariq Mustafa3, Gul Rehman2, Muhammad Faisal Shahzad2, Muhammad Younas4,5*, Aftab Ahmad Khan6, Ameer Hamza2, Abdul Ghaffar1 and Muneer Abbas1

... mung bean thrips, Megalurothrips distalis Karny (Thysanoptera: Thripidae). Evaluations were based on thrips population, percentage reduction in number of thrips per flower, and percentage damage of the mung bean pods. On an accumulative basis, B. bassiana at 7.5 % concentration resulted in the reduction of thrips population per flower (59.42 %) and it was observed more superior than other tested EPFs. Application of B. bassiana resulted highest number of flow...

Momina Raheem1, Muhammad Fiaz2*, Muhammad Mushtaq1, Umana Niazi1, Evelyn Saba3 and Mansoor Abdullah3

..., lactose, minerals and protein were increased (P<0.05) with increasing rate of dietary supplementation of CRS except fat percentage. In case of blood parameters, effect of dietary supplementation of CRS was found variable. It is concluded that 25 g/d CRS is an optimum dietary supplementation level a month before and two months after lambing for adequate weight gain and milk quality in terms of all constituents except fat percent in Salt Range ewes as rapes...

Haiyan Nan, Ran Feng, Guiling Zhang and Jingqin Liu*

...n and the formation of carotid atherosclerosis in patients with type 2 diabetes mellitus (T2DM). In this study recorded patients who were admitted to the No.1 hospital of Baoding from August 2017 to January 2020. We continuously observed the comprehensive diabetes complications screening or blood glucose of 517 hospitalized patients with T2DM. 67 subjects were excluded due to incomplete physical examination and clinical parameters, lack of ca

Sehrish Ishtiaq1, Mahroze Fatima1*, Syed Zakir Hussain Shah2, Noor Khan3, Muhammad Bilal4, Maryam2 and Sobia Nisa1

...lementation. Whole body protein content increased (p < 0.05) slightly with Ca and P supplementation. However, moisture, fat and ash contents remained unaffected (p > 0.05). Dietary Ca and P supplementation improved (p < 0.05) the protein and fat digestibility in silver carp. Ca and P contents showed significant increase (p < 0.05) with increasing Ca and P levels in the whole body, bones and scales, achieving the ...

Saad Tahir, Nadeem Ahmed*, Mohsin Ahmad Khan, Muhammad Akram, Rabia Abbas and Kausar Malik

...olytic and fibrinolytic protein (47kDa), naturally produced by beta-hemolytic streptococci. Purified SK is used for many blood circulatory complications, i.e., myocardial infarction, ischemic stroke and pulmonary embolism. In this study, human albumin fusion technology has been developed to increase the half-life in-vivo and also invoke less immune response. We designed codon-optimized HSA-SK fusion gene, integrated into -pPICZaB vector, cloned and transferred...

Ayoola J. Shoyombo1, Ake A. Moses1, Comfort I. Ukim2, Mustapha A. Popoola2, Olayinka O. Alabi1, Noah C. Edozie1, Faith Ogbor1, Jacob Kuusu1, Ekemini M. Okon3* 

...e increasing demand for protein in developing regions. The effect of seasonal variation on reproductive endocrinology was examined in a group of West African Dwarf (WAD) does and bucks. Throughout the study, the animals were kept in the same environment. The results showed that most hormones in the does were nominally superior during the wet season compared to the dry season, while progesterone and luteinizing hormones were significantly (p<0.05) higher dur...
Akram Ali Baloch1*, Adeel Ahmad2, Kaleem U. Kakar3, Sara Naudhani1, Samiullah Khan1, Agha Muhammad Raza3, Imrana Niaz Sultan1, Humaira Zahid4, Saadullah3 and Shakeela Daud1*
... encodes 395 amino acid protein called Malin comprising a zinc finger of the Ring-type in the N-terminal half and 6 NHL-repeat domains in C-terminal. In this study, four families were enrolled from Balochistan including two or more epileptic individuals aged between 10-24 years. Blood samples were collected and DNA extraction was performed by inorganic method. DNA was amplified by polymerase chain reaction and subsequently sequenced to confirm any genetic vari...

Fatimah A. Al-Saeed 

...er, the levels of total protein, albumin and CAT were statistically declined. The O. oleaster leaves’ extract could nearly normalize those blood parameters for protection against Cd toxicity. It might be concluded from this study that the protective effect of O. oleaster leaves extract against Cd toxicity may be attributed to its antioxidant activities.
 

...
Rabail Hassan Toor1,3, Raazia Tasadduq2, Jane B. Lian3, Janet L. Stein3, Gary S. Stein3 and Abdul Rauf Shakoori1*
...tment options for osteoporotic patients, along with their long-term use safety concerns, our research group focused on investigating efficacious, inexpensive and safe alternative therapies for osteoporosis. Investigating the osteogenic potential of CQ, our research group previously reported osteogenic stimulatory effects of CQ (hexane fraction). The present study explores anti-resorptive effects of CQ-H on bones. We utilized RAW264.7 murine macrophage cell lin...

Yunilas1*, Muheri Indra Aja Nasution2, Edhy Mirwandhono1, Adi Fathul Qohar3 

...nal content, especially protein, used as a source of animal feed. However, in the prepupal phase (BSFP) there is chitin which is a limiting factor in livestock rations because the bodies of poultry and monogastric livestock cannot digest it. Chitin is found in the BSF exoskeleton which is bound to proteins, minerals, and pigments, so it is necessary to do processing to reduce the chitin content first by fermentation using or...

Razia Sultana1, Shinawar Waseem Ali1*, Ghulam Murtaza2 and Shahid Mahmood2

...f phyla was 3, of which proteobacteria showed the highest abundance (89.9%). Four classes of bacterial microbiota were detected in which the proportion of class Gamma proteobacteria was the highest (84.8%). The numbers of orders, families, and genera to which bacteria belonged were 9, 10, and 15, respectively. Genus Stenotrophomonas had the highest relative abundance (48.8%), which was followed by Citrobacter with a relative...

H.A. El-Nagar1, A.M. El-Hais2, M.S. Mandouh2, W.M. Wafa1*, A.H. ABD El-Aziz, K.A. Attia4 

...G, IgM, and IgA), total protein, albumin, globulin, glucose, total lipids, total cholesterol, and total antioxidant capacity in blood serum, and RBCs, WBCs, Hb, and PCV increased (P<0.05) in treated than in the control calves, being the highest with the combination treatment. Urea-N and creatinine concentrations, and AST and ALT activities decreased (P<0.05) in treated compared with the control calves, with the lowest values for the combination treatment...

Di Zhou1, Qingmeng Long1*, Rong Yang1, Xiaoshan Tan1, Jun Li1, Mingyan Tang1, Zhonghai Zhao3, Ye Ao2, Zhinan Zhou1 and Changxue Chen1

...e genes were related to protein binding, catalytic activity and cell proliferation. Moreover, these DEGs were enriched in the categories of signal transduction, reproductive system, endocrine system and cancer-related pathways and linked the cGMP-PKG, cAMP, TGFβ and mTOR signaling pathways to reproductive performance. We verified these results using qRT-PCR for 9 up-regulated (AMH, CYP19A1, FOXL2, FSHR, GATA4, INHBA, LHB, LHX9 and ZP3) and 9 down-regulate...

Wafaa AL. Bnyean1,2 ,Zainab A.H. AL-Mousawi1* 

...GA (100 mg /kg) orally. Protective group(G4): Rats were treated for seven days with hydrocortisone Sodium I.P. (50 mg /kg) with GA for 14 days(100mg/kg) orally. glycyrrhizic acid Group (G 5): rats for 21 days, were given 100 mg/kg of GA orally. At the end of the experiment, Serum cortisol, ACTH, CRH hormone, 11 β -Hydroxysteroid Dehydrogenase enzyme (11β-HSD), and malondialdehyde were measured. The results revealed treatment with glycyrrhizic acid im...

Wei Fang1,2,3, Jiawei Hong1,2,3,4, Zhengyi Fu1,2,3, Jing Hu1,2,3, Gang Yu1,2,3, Zhenhua Ma1,2,3* and Humin Zong5*

...NT, GO, COG, KEGG, Swissprot and Interpro), a total of 23,417 unigenes were annotated (accounting for 61.14%); A total of 253 differentially expressed genes (DEGs) were screened, with 199 up-regulated genes and 54 down-regulated genes; GO analysis showed that DEGs was mainly enriched in cellular processes, biological regulation, cell parts, membrane parts, binding and catalytic activity; COG analysis showed that DEGs was mainly related to posttranslational mod...

Zhipeng Song1,2, Jialiang Xin1,3, Xiaoli Wei1,2, Abula Zulipiya1,3, Kadier Kedireya1,2 and Xinmin Mao1,3*

...e expression of retinal proteins was detected by tissue immunofluorescence and immunohistochemical staining. The mRNA level of VEGF was detected by RT-qPCR. In the in vitro experiments, cell viability was detected by CCK-8 reagent. The expression of related proteins was detected by western blot. We found that marein can effectively reduce triglycerides (TG), total cholesterol (TC), low-density lipopr...

Bilal Ahmed Shah1, Muhammad Avais1*, Jawaria Ali Khan1, Masood Rabbani2, Aftab Ahmad Anjum2, Muhammad Asad Ali2, Muhammad Awais1, Sohail Ahmad3 and Shahan Azeem2*

...side effects, challenge protection assay, sterility and humoral response in laboratory animals. Safety test showed no general adverse reactions to the vaccines when injected either into mice or rabbits or cow calves. Challenge protection studies revealed a significantly higher survival rate in vaccinated mice and rabbits compared to placebo groups. None of the vaccines when streaked onto culture media showed any growth indic...

Liyun Chang*, Yazi Li, Yumei Cai and Chenghui Li

...hea virus (BVDV), bovine rotavirus (BRV), and bovine coronavirus (BCV) have increased calves morbidity and mortality in Hebei Province. To detect these three pathogens simultaneously, we designed specific primers based on the conserved gene sequences of the three pathogens available in GenBank. After optimization of the reaction conditions and system, we successfully established a novel multiplex PCR method for detection of the aforementioned three pathogens. ...

Swagata Das Gupta1, Majharul Islam1, Towhida Kamal2,Md. Rayhan Faruque3,Md. Shohel Al Faruk4* 

...ichomonas gallinae is a protozoan parasite that causes the avian trichomonias is disease known as “canker,” which primarily affects the esophagus and upper digestive tract in pigeons.A common case of pigeon cankers was diagnosed in two pigeons 40 days of age who came to S.A. Quaderi Teaching Veterinary Hospital, Chattogram Veterinary and Animal Sciences University (CVASU).Clinical history indicated that the birds were taking both food and...

Asmaa A Darwish* 

... cytokines, acute phase proteins, free radicals, globulin, triglycerides, kidney function tests, and liver enzymes concentrations and a significant (P<0.05) decrease in IL-10, antioxidants, total protein, albumin, glucose, total lipids, cholesterol, minerals, electrolytes, and trace elements concentrations. The DG hemogram clarified a significant (P<0.05) microcytic hypochromic anemia accompanied by neutrophilic leuko...

Fariha Qahar and Muhammad Sayyar Khan*

... the leaf area turned necrotic in the single overexpression lines compared to 95% damage in the wild-type plants. Whereas, the least amount of damage (10-20%) was observed in the double overexpression lines. When subjected to 24 µM metolachlor, the wild-type leaf discs were fully necrotic, whereas the single overexpression lines exhibited 20-60%, and the double overexpression lines showed only 15-20% necrosis. The data...

Ahmed Jaafar Mousa*, Nothaila Rasheed Hamid 

...Trichomonas gallinae, a protozoan widely found in pigeons and other wild birds, causes the parasitic disease known as “avian trichomoniasis”. The complications of this illness include lesions in the upper gastrointestinal tract. The present study’s goal would be to study the prevalence and genetic characteristics of T. gallinae in racing pigeons in Thi-Qar province, Iraq, utilizing the ITS1-5.8s rRNA-ITS2 gene. 100 samples were collected from...

Mustafa M. Khalaf*, Rana A. Salih 

...udy was to evaluate the protective effect of quercetin against cyclophosphamide. An explanation of quercetin’s hepatoprotective effects against cyclophosphamide-induced hepatotoxicity. Twenty-eight male Westar rats (that weighed 200–250 g) were chosen at random and divided into four equal groups for this investigation. During the initial periods of acute exposure, the animals had treatment with quercetin (50 mg/k...

Wen Xiong1*, Shengao Chen2, Dong Xie3, Qiang Wang4, Yanxia Li5, Lei Pan6, Xiaolei Ren7*, Wei Tang8*, Kang Chen9 and Ross N. Cuthbert10

...nd identify habitats to protect. The Qiantang River is the largest river in the Zhejiang Province, located in the southeast of China, with extensive fishery and aquaculture sectors. However, synthetic information on freshwater fish biodiversity and invasions in this region is lacking, impeding conservation efforts. We compile published information and empirical surveys to comprehensively discern the fish community of the Qiantang River. There are 184 (167 nati...

Syed Shakeel Shah1, Ayesha Jameel1, Sabila Afzal1*, Muhammad Zubair2, Iram Fatima Bokhari1

... (Capsicum annum) and carrot (Davcus carota), were examined in our study. One hundred forty-five samples of different vegetables were collected and processed. 200 grams of each vegetable sample was centrifuged, followed by sedimentation and floatation to recover parasites eggs, cysts and larvae. A high prevalence of about 47.58% was described in this study. Coriander was the highest contaminated vegetable (51.42%), followed ...
ZAMARA MASOOD1, FAROOQ SALEEM1, SARFRAZ AHMAD2, TALHA JAMSHAID3, IMRAN WAHEED4,
MUHAMMAD AZEEM1, UMAR FAROOQ GOHAR5 & HAFIZ MUHAMMAD ARSALAN6, 7*
...>31.8%. The established protocols were carried out with slight
modifications for phytochemical and pharmacological activities.
Phytochemical screening revealed the presence of carbohydrates,
glycosides, cardiac glycosides, saponins, flavonoids, cumarins, steroids,
proteins, and amino acids, fixed fats and oils in all fractions. Floral
ex...

MALIK ASIF HUSSAIN

...rs of biofilm provide a protective cover around bacteria and
hinder penetration of these agents deep. Furthermore, this tolerance also
helps them to survive against immune system, as immune system cells
and other components cannot penetrate through layers of biofilm. This
review paper discusses important aspects of biofilm formation, clinical
importance and the concept of resistance versus tolerance.<...

SHEHLA AKBAR*, SAIQA ISHTIAQ*, KHALID HUSSAIN, ANS MUNIR & SAIRA REHMAN

... (14.69μg/ml), total protein (14.34μg/ml), total amino
acids(28.43μg/ml), total lipids (3.67 μg/ml), total glycosaponins (14.95%),
total alkaloids (24.67%), total polyphenolics (28.40%) and total flavonoids
(5.67%) were found in given plant samples. were found in the samples.
Haemolytic and DNA protection studies of Misopates orontium were also
performed...
FARZANA SIDDIQUE*1, NAZIMA FIRDOSE2, MUHAMMAD ARSHAD2, WARDAH HASSAN2
& SHAFAAT YAR KHAN2
...s all required building proteins, bone
forming minerals and fats. Milk is contaminated with pesticides and
consumption of contaminated milk, meat and dairy products is the cause
of high level of pesticides in the human body. Milk is a good source of
dissolving pesticide residues which are fat soluble. Present study was
designed keeping in view the nutritional importance of milk and its
con...

SHEZA AYAZ KHILJI1* ZAHOOR AHMAD SAJID2 & SONIA GHULAM BARI1

...ects of heavy metals on proteins, chlorophyll content and growth of Eichhornia crassipes L. in different concentrations of industrial effluents of district Shiekhupura. Eichhornia crassipes was grown for 15, 30 and 45 days in different concentrations of the industrial effluents (5, 10, 15, 20 and 100%) prepared with tap water. All physico-chemical parameters in the different concentrations of the industrial effluents were recorded. The values of these paramete...

ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2

..., dry weight, amount of protein and antioxidant enzymes. The higher levels of NaCl (100-200 mM) in this investigation drastically suppressed the growth of plants of Suaeda fruticosa L. in the form of stunted growth. The overall increase in antioxidant enzyme activities during this study seems to be their scavenging role by neutralizing the reactive oxygen species produced during salt stress episode. It is therefore, suggested from the results of this research ...

SHEIKH AJAZ RASOOL1*, MUNAZZA DANISH AJAZ2, MUHAMMAD SALMAN RASOOL3, AHSAN SATTAR SHEIKH4 & FIRDAUS KOUSAR BUKHARI5

...lt with antibiotics and proton-pump inhibitors. However, an ever increasing problem of antibiotic resistance evolution has been there and that is alarming. Thus, urgency exists for finding out non-classical therapies as reduction factors against Campylobacter nuisance in humans and poultry. In addition, a few probiotics have been instrumental to cut down the adverse effects rendered due to the classical antibiotic therapies with particular reference (wpr) to G...

Muhammad Syarif Djaya1, Osfar Sjofjan2, Hartutik Hartutik2, Irfan Hadji Djunaidi2 

...fects in the different carotenoid on external and egg yolk quality of Alabio laying ducks (Anas plathyrhyncos borneo). To begin with, the carotenoid was identification using High Performance Liquid Chromatography (HPLC) for lutein content. Second, 200 day-old-Alabio laying ducks by age 4-5 months was used in this study. The basal diet was used in this study T0: basal diet, T1: basal diet + 10% lutein, T2: basal diet + 20% l...

Orooba Mohammed Saeed Ibrahim1*, Rawaa Saladdin Jumaa2, Nibras Zeyad Yahya1 

... determined using macro-broth dilution, agar well diffusion methods and time kill curve. Results revealed that the used juice extracts were variously bacteriostatic and bactericidal against the examined bacteria depending on concentration. Phytochemicals analysis indicated the presence of alkaloids, phenol, saponins, flavonoids, tannins, and glycosides. The test organism was more sensitive to C. limonum compared to C. aurantium. The MICs ranged from 1.56 to 12...

Nusrat Habiullah1*, Shah Nawaz Kumbar1, Fahmida Parveen Samo1, Shamusuddin Bughio2, Asghar Ali Kamboh3, Burirah Rehman Talpur1 

...th selenium) showed the protective effect by decreasing (p <0.05) GGT, creatinine, bilirubin and uric acid concentration as compare to C and D groups. Gross pathology observed in liver of C, D and F groups revealed inflammation, and discoloration, whereas kidneys were found swollen and congested with distended ureters. Major histopathological changes observed in kidneys of group C, D and F like shrinkage of glomeruli with widened bowman’s spaces, necr...

Hazrat Usman1, Shakeel Ahmad2*, Salah Uddin3, Humaira Wasila3 and Yasser Durrani4

...ed States Environmental Protection Agency (US-EPA, 2018), and the Pakistan Environmental Protection Agency (Pak-EPA, 2008). By aligning the recorded values with these standards, the researchers aimed to assess compliance with recommended thresholds and evaluate potential health implications. Unfortunately, based on the guidelines set by the World Health Organization (WHO, 2011), the majority of the well water samples collect...

Muhammad Ashfaq ur Rahman1*, Saleem Khan1, Aurang Zeb1, Zia ud Din1 and Zafar Iqbal3 

...s in the ‘caloric protein’ group represented the highest mean weight increase, at 2.9 Kg, increasing from 53.46 to 54.71 Kg in 3-months PI and from 54.71 to 56.33 Kg in 6-months PI, respectively. Weight gains in the nutrition therapy group were statistically significant at both 3 and 6 months PI. Patients in the control group either maintained or lost weight, with an average loss of 3.29 kilograms (7.1 pounds). In conclusion, pTB patients benefited...

Hui Fang*, Kai Xue and Teng Yang

...candidate target mRNAs (Protein Kinase C Epsilon, PRKCE; Transmembrane P24 Trafficking Protein 5, TMED5; RUNX1 Partner Transcriptional Co-Repressor 1, RUNX1T1; and Fibroblast growth factor 2, FGF2) were identified. In conclusion, ADPKD may be better understood by examining the novel miRNA-mRNA network we constructed.

...
Fariha Javaid1*, Zahoor Qadir Samra1, Madeeha Shahzad Lodhi1,2, Aroosha Hussain1 and Gulnaz Pervaiz1
...iol-containing cysteine protease isolated from the stem, peel, and leaf parts of Ananas comosus. Protease accounts for 60% of the total enzyme market. Being a plant-based cysteine protease, it has various pharmaceutical and biotechnological applications. The isolation and purification cost of the enzyme is highest, so there is a need to develop cost-effective purification methods. This res...

Jyotsana Shakkarpude1*, Aditya Mishra2, Deepika D. Caesar2, R.K. Sharma3, Anand Kumar Jain2, Sanju Mandal2, Rajesh Kumar Vandre4, Danveer S. Yadav5, Bhavna Ahirwar6 and C.P. Solanki6

...s it repairs heat shock proteins. The present study was aimed to investigate the effect of dietary betaine on heat and metabolic stress during lactation in Murrah buffaloes (Bubalus bubalis). For this purpose, a total of 18 postpartum Murrah buffaloes were randomly divided into control, low betaine and high betaine groups supplemented with betaine @ 50 g/animal/day and 100 g/animal/day respectively from day 5 postpartum and was continued up to 4 months postpar...
Saad Ibrahim Al-Sultan1, Mariam H.E. Khedr2, Ahmed S. Abdelaziz3, Mostafa M. Abdelhafeez4, Tamer Mohamed Gad5, Sabry Mohamed El-Bahr6,7*, Sherief Abdel-Raheem1,8 and Hesham A. Khalifa3
... rich in animal-derived protein in particular countries such as Egypt and Saudi Arabia. Camel meat and offal supplies humans with part of their needs from essential amino acids, minerals, vitamins, and polyunsaturated fatty acids. Toxic metals such as lead (Pb), cadmium (Cd), arsenic (As), and mercury (Hg) are of no-known physiological importance. The objectives of the present study were to quantitatively estimate the residual levels of Pb, Cd, As, and Hg in c...

Shafi Muhammad1, Bibi Nazia Murtaza2, Aftab Ahmad1, Muhammad Shafiq3, Nurul Kabir4 and Hamid Ali1*

...nd age in chronic and fibrotic HCVpatients by ELISA and evaluated different markers that are invloved in the progression of CLDs towards HCC by performing histopathology and immunohistochemistry (IHC) techniques in liver tissues in HCV patients from the southern districts of Khyber Pakhtunkhwa, Pakistan. In addition, the network of IL-17A and its KEGG pathway related gene IDs were constructed using GeneMANIA and STRING online web tools. IL-17A serum levels wer...

Lu Liu1, Xiang Zhao2, Yue Qin2, Tianxiang Gao3 and Tianyan Yang3*

...us litulon contained 13 protein-coding genes (PCGs), two ribosomal RNA (rRNA) genes, and 22 transfer RNA (tRNA) genes. The total length of the mitochondrial genome of L. litulon was 16,430 bp, and the overall base composition of the mitochondrial genome was 26.96% A, 30.13% C, 17.58% G and 25.33% T. Our sequence is consistent with the mitogenome (NCBI accession number AP004413) named Lophiomus setigerus, indicating that the latter might be a misidentifi...

Wafa Akram1, Shahan Azeem2, Shafqat Shabir1, Haroon Akbar1*, Warda Gill3 and Muhammad Imran Rashid1*

...is a neglected zoonotic protozoal disease caused by Leishmania infantum and Leishmania donovani that is transmitted by sandflies (Phlebotamine flies). In November 2020, a case of leishmaniasis was diagnosed in a captive tiger through microscopy and L. infantum was confirmed by PCR and sequencing analysis. DNA sequencing of the amplicon revealed close homology with Leishmania sequences available in GenBank. Alignments and phylogenetic analyses of the Leishmania...

Al Salihi karima Akool1* , Almas. M. Al-Bayati2, Iman Mousa Khaleel3  

...ays important source of protein, vitamins and other nanocomponents. The camel’s daily milk production shows a variation in milking frequency, which is affected by environments, feeding, stage of lactation, breed, species and diseases of the udder . Moreover, she-camels also shows fluctuating in the lactation length from 9 to 18 months. This study intends to investigate the macro and microscopical features of local Arabian she-camel’s productive a...

Muhammad Mudassar Shahzad1*, Tehreem Shabbir1, Syed Makhdoom Hussain2, Fatima Yasin1, Humayoun Huma Maqbool1, Aasia Karim3

...Thus, the production of protein-rich aquatic food is high on the agenda. Feed accounts for 60% of total expenditure in aquaculture. This study was designed to examine the optimal inclusion level of barley meal (BM), competitive plant proteins, as a fishmeal replacer in the formulation of diets, to evaluate its effects on the carcass composition, immunity, and mineral absorption in common carp. Six experimental diets using BM...

Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1

...n this study were crude protein (CP), neutral detergent fiber (NDF), acid detergent fiber (ADF), lignin, fat, minerals, dry matter digestibility with pepsine (DMdPeps), organic matter digestibility with pepsine (OMdPeps), nitrogen digestibility with pepsin (NdPepsin), gas production.   The results showed that CP, NDF, and ADF   had the highest variability among the nutrients. A total of 27 significant (p<0.05) among nutrient content, dig...

Maria Endo Mahata*, Yose Rizal, Zurmiati, Sepri Reski

...anic matter (OM), crude protein (CP), ash, salt, and alginate contents. The results revealed a significant (p<0.05) impact on OM, CP, ash, salt, and alginate contents but did not significantly affect DM. Immersing P. australis in flowing water for 4 h is the optimal duration for decreasing salt content up to 97.62% while increasing CP and alginate levels proportionally. Immersion treatment in flowing water maintained the DM, OM, and ash contents.

Mervat M. Fath- Allah, Amal A. Ahmed, Hala A. Amin

...used to amplify the polyprotein region of members of Potyviridae. The RTPCR
revealed 335 bp amplified products with only infected plant samples corresponding to viruses
BYMV, CVMV, PVY, WMV and ZYMV, and according to virus symptoms and ELISA results. The
nucleotide sequence analysis of the polyprotein gene of PVY-ME2 (the present Egyptian isolate)
showed 98% homology with the PVY-isolate strain N ...

Nguyen Thi Thu Hien1, Dong Huu Rin2, Nguyen Xuan Hoa1, Le Viet Tuan Khanh2, Phung Thang Long1*, Dinh Thi Bich Lan1

...ng M. hyopneumoniae P36 protein, express this protein in E. coli BL21(DE3), and evaluate its antigenicity as a base for further studies to against M. hyopneumoniae. The gene encoding M. hyopneumoniae P36 protein isolated from DNA of fresh lung tissue samples from PEP infected pigs was cloned into pGEM®-T Easy vector for sequencing, and then was inserted into pET28a vector to express th...

Hamdy Abdala El-Nagar1, Abdelaziz Mohamed Elhais2, Ayman Hassan Abd El-Aziz3, Wael Mohamed Wafa1, Mohamed Sobhy Elsayed Farrag2, Moataz Ibrahim Badawy1, Safaa Elsayed Salah Atia2

...ells, hemoglobin, total proteins and their fractions, total lipids, total cholesterol, and glucose, and the lowest urea and creatinine levels (P<0.05). Plasma immunoglobulins (IgG, IgA, and IgM) and total antioxidant capacity increased to the maximal values, while AST and ALT activities decreased to the minimum values in G4. Feeding Friesian calves on milk supplied with propolis (5 g) plus thyme oil (2 ml) per calf during the suckling period can improve gro...

Nur Saptahidhayat1, Claude Mona Airin1, Yanuartono1, Dyah Ayu Widiasih1, Soedarmanto Indarjulianto1*, Sri Handayani Irianingsih2, Meta Iqomah3

...ation of basal feed and Protelis® concentrate. The study had 55 days of treatment. The evaluation of milk production and quality was conducted before and after treatment. The research showed that all cows were diagnosed as healthy after suffering from FMD based on clinical symptoms, antibodies to FMD, and the FMD virus examined by Polymerase Chain Reaction (PCR). This result presents a significant difference (p<0.05) in milk production, which is a combi...

Al-Moataz Bellah Mahfouz Shaarawy1, Wael Mohamed Wafa1*, Ashraf Ali Mehany1, Reda Abdel Samee Ahmed Rezk2, Shereen Kamal Genena1, Mohamed Hamada El-Sawy1 

...hile TSH, T3, T4, total protein, glucose, cholesterol, Ca, P, Na, and K, ALP activity, and milk yield significantly decreased (P<0.05, 0.01 and 0.001) in summer than in spring in Friesian and crossbred cows. In summer season, Friesian cows showed significant increase (P<0.05, 0.01 and 0.001) in RR, PR, creatinine, K, ALT and AST, while T3, T4, glucose and milk yield showed significant reduction (P<0.05, 0.01 and 0.001) as compared to crossbred cows. I...

Moazzam Baig*, Sohaib Ahmed and Arz Muhammad Umrani

...ny clear guidelines for protecting the forest in the Sherani district. The people are using the forest resource to meet their energy needs due to lack of facilities. People keep a large number of livestock that are grazed year-round on forest and range terrain. These animals harm the local regeneration as well as the local land cover. The proposed Hypothesis shows that the significant relationship between Dependent and Independent variables i.e. Forest Degrada...

I Nyoman Sumerta Miwada1*, I Nyoman Sutarpa Sutama1, Agus Susilo2

... significantly affected protein and ash content (p<0.05). In the color aspect, the L* and a* values ​​significantly decreased (p<0.05), but the b* values ​​significantly increased. Texture profile analysis showed a significant increase in hardness, guminess, cohesiveness, springiness, and chewiness (p<0.05). The antioxidant capacity of cheese (mg/L Gallic Acid Equivalent Antioxidant Capacity (GAEAC)) significantly increased, namely 33.60 &plus...

Ahmed Al-Hasnawi*, Wafaa Kadhim Jasim

...oe vera extract had any protective effects against the hematological and histopathological alterations brought on by azathioprine. animals are evenly divided into four categories: (G1) group: were received distilled water. (G2) group: were administrating azathioprine (50mg/kg. b. w). (G3) group: were administrating Aloevera gel extract (500mg/kg b.w). (G4) group: were administrating azathioprine (50mg/kg. b. w) and aloe vera gel extract (500mg/kg b.w). after f...

Hermawan Setyo Widodo1,2*, Tridjoko Wisnu Murti1, Ali Agus1, Ambar Pertiwiningrum1

...hen quantified the milk proteins from 34 PE, 57 SA, and 15 SP does. The study found the A allele was predominate followed by F and N on PE and SA. However, the SP goat only has A and F alleles in equal frequency, and the E allele was only found on SA. The AF genotype predominated on all breeds in almost half of its population, thus, the most diverse was SA. The Hardy-Weinberg disequilibrium of PE and SA indicated the influence of the breeding program. The geno...

Raed Hussein Salih Rabee1, Yahya Sabah Abdulameer1, Walla Farhan Obed1, Noor R Abady1, Adnan Mansour Jasim1*, Firas Hussein Albawi1, Mohammed Jasim Jawad2, Ahmed Samir Abukhomra3

...3A4 (CYP3A4) and P-glycoprotein (P-gp) an enzyme responsible for the metabolism of antibiotics. Additionally, berberine demonstrated antibacterial effects against E. coli, as well as anti-inflammatory and antioxidant properties. Furthermore, histopathological examination of the intestinal broiler received BBR showed improvements and restore tissue near to normal.
 
Keywords | Enerofloxacin, Berberine, E. coli, Antibiotic residues, ...

Irfan Safdar Durrani*, Noreen Asim and Ammar Sohail

...Germins and Germin-like proteins (GLPs) are the ubiquitous family of plant proteins that belong to the cupin superfamily and have been reported to play a major role in plant defense against pathogens attacks and different abiotic stresses. Current research deals with the study of cis-regulatory elements located in the promoter region of OsGLP12-3 gene of Nipponbare and newly sequenced Oryza sativa L. cultivar Dilrosh-97 usin...

Naeem Tariq Narejo1*, Muhammad Hanif Chandio2, Faheem Saddar3, Majida Parveen Narejo4, Bushra Ainy Dars5, Hafeez ur Rehman Narejo6, Athar Mustafa Laghari2, Shafiq ur Rehman Shaikh3, Shahnaz Rashid7 and Ghulam Abbas7

...e the impact of dietary protein concentration on survival and growth efficiency of monosex tilapia, Oreochromis niloticus which were maintained in aquarium during the period of April-June 2020. Three diets were prepared by using locally available ingredients (wheat and rice bran, powder of mustard oil cakes, whole wheat flour etc.) to have varying levels of crude protein, specifically 35%, 40%, and 45%. The aeration provided...

Abir Ishtiaq1*, Abdul Ghaffar2, Maria Younas1, Tasveer Ishtiaq1, Zara Naeem3 and Muhammad Naeem4*

...n percentage for water, protein, fat and ash was found 74.70±0.76%, 16.92±0.66%, 4.60±0.16% and 3.78±0.12%, respectively, in H. nobilis. Highly significant (P<0.001) positive correlation was observed between fish size (weight and total length) and various body constituents of the fish. Positive allometry for all the studied constituents was found except for log total water content which represented negative allometric pattern wit...

Saman Rizwan and Sohaib Aslam* 

... organic matter levels, protect soils against erosion and improve water retention. This research was conducted in laboratory-controlled conditions using maize residues and a loamy soil from a sugarcane field to determine carbon mineralization patterns. Two different residue management practices were chosen for this study; mulched (soil covered by residues) versus incorporated (residue incorporated in surface soil layer). Carbon mineralization patterns under tw...

Hafiz Nawaz1*, Kashaf Nawaz2, Attiq ur Rehman1, Muhammad Bashir3, Mussera Hira2 and Mariyam Nawaz4

...sion must be studied to protect mungbean farming. This will help produce resistant cultivars and effective management measures. To combat MYMD and preserve mungbean production in Pakistan, research institutes, agricultural extension agencies, and farmers must work together.

...

Haneen Imad Al-Sultani1*, Ahmed Obaid Hussain1, Hazar Shakir Saleh2 

...in high doses causes nephrotoxicity.   

...
Zahir Muhammad1, Muhammad Zubair Anjum1*, Shamim Akhter1, Muhammad Irfan1, Saira Amin1, Yousaf Jamal1, Sharjeel khalid2 and Shakira Ghazanfar2
...l diets each (30% crude protein supplemented with either T1-L. plantarum1×108 cfu), T2-(P. pentosaceus 1×108 cfu), T3-(L. plantarum and P. pentosaceus1×108 cfu) or (T0-(No probiotics) for 60 days in a triplicate manner (n=10/replicate/aquarium of 1 ft3). Growth performance was assessed by final weight (FW) weight gain (WG), average daily weight gain (AWG), specific growth rate (SGR, %), percent % weight gain (% WG), and feed conversion ratio ...
Waheed Ahmad1, Muhammad Tayyab1*, Bushra Muneer2*, Abu Saeed Hashmi1, Mansurud Din Ahmad3, Shagufta Saeed1, Muhammad Nauman Aftab2, Sehrish Firyal1, Muhammad Wasim1, Muhammad Azam4, Muhammad Talha5 and Ali Raza Awan1
...y of novel thermostable protease in poultry production. The protease was produced from Geobacillus sp. SBS-4S using Luria Bertani medium and it was used as supplement in poultry feed trial. The data were statistically analyzed by Multivariate Analysis of Variance. For feeding, 150 day-old broiler chicks were divided randomly into 5 groups having 30 chicks each. Group A served as negative control, group B, C and D as experime...

Wenxiao Jia1*, Yilinuer Yilihamu1, Yunling Wang1, Shuang Ding1, Dilinuerkezi Aihemaiti1, Hanjiaerbieke Kukun1 and Yanhui Ning2

...ng an unstable atherosclerotic plaque model in the abdominal aorta of New Zealand rabbits. The experimental New Zealand rabbits were fed adaptively for one week before being punctured through the abdominal aorta with a balloon to injure the intima. Vitamin D (1.5 mL/kg) was administered one week after the surgical model was completed. Following injection, the animals were fed a high-fat diet for 16 weeks. High-resolution magnetic resonance imaging (HR-MRI) and...

Kristina Morkūnienė*, Rūta Insodaitė, Laimutis Kučinskas, Renata Bižienė 

...d sequence of the Mblk1 protein leading to higher brain functions in bees. In this study, we aimed to test the contribution of three Mblk-1 gene polymorphisms to the resistance to V. destructor mites. This case–control study involved 117 DNA samples that were genotyped for three single nucleotide polymorphisms (SNP) using the real-time polymerase chain reaction method. Statistical analysis was performed with SPSS Statistics 20 and PLINK software. SNP at ...

Ghani Khan1, Saeed Ahmed Soomro1, Abdul Kabir2, Abdullah Iqbal3*,Naik Muhammad Marri 4, Syed Ahmad khan5, Muhammad Roidar Khan6 , Anees ur Rehman1, Muhammad Zakir Khan7 

... specific gravity, ash, protein, total solids, fats, lactose, and moisture content. The results showed that oxytocin treatment significantly decreased pH levels in milk from the first lactation, while specific gravity did not differ significantly between the control and oxytocin-treated groups. Total solids, ash, and protein concentration were significantly higher in the oxytocin group, while lactose concentration significan...

Zain Ali1, Amjed Ali1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Asif1, Adnan Ashraf1, Muhammad Ehsan Safdar1, Iram Inayat2, Aneela Nijabat3 and Rameez Hussain3,4

...e pH, moisture content, protein content, fat content and ash contents. The moisture contents of both the samples and combined silage had not much difference among them, but the protein content, fat content and the pH of the combined silage had remarkable difference among them. The Syngenta-8711 + sunflower and Monsanto-6142 + sunflower varieties were best and had maximum mean values for most of quality parameters, (Fat conte...

Abdul Hayee Gabol1, Arfan Ahmed Gilal1*, Lubna Bashir Rajput1, Jamal-U-Ddin Hajano2, Muhammad Ishaque Mastoi3, Ghulam Qader Mangrio1 and Jam Ghulam Mustafa Sahito4

Muhammad Nauman Arif1, Muhammad Mansha1* and Tanveer Hussain2

...hting the importance to protect Pakistan’s unique genetic resource.

...

Jasir Hakim Hidayah1,2, Yos Adi Prakoso2, Sitarina Widyarini3* 

...ic stroke using common carotid artery ligation for 4 hours. After 24 hours, the rats were treated twice daily using various doses of calabash for seven days. On day 8, the brains were collected and processed against histopathology. The data was analyzed using SPSS version 26. The result indicated that the most efficacious dose of calabash was 2.96 mg/kg BW from the P5 group. It is supported by the minimization of infarct area in the P5 group compared to the ot...

Yanmei Wang1,2, Haoyun Li1, Lijuan Han1 and Wenkui Wang1*

...actor (MIF) and related protein and gene expressions in its downstream signal pathways need to be studied to explore the mechanism of MIF participating in PH. In this study, 4-5 weeks broilers with clinical PH were collected as experimental (PH) group, while the healthy broilers were taken as control group. The related mRNA expression levels were determined by qRT-PCR. The protein expressions and distributions were detected ...

Romaan Hayat Khattak1, Shakeel Ahmed2, Liwei Teng1,3* and Zhensheng Liu1,3*

...ble areas comprised the protected areas (PAs) and their buffer zones; however, the moderately suitable areas mainly occurred in the peri-urban zones and were avoided by red fox. Results revealed that global land cover (glc2009) and poultry (ch_2010da) were the most influential factors defining red fox suitable habitats. Based on the results obtained in the current study, we strongly recommend focusing preservation of highly and moderately suitable areas for re...

Faiza Naeem1, Muhammad Farooq Sabar1, Muhammad Usman Ghani2,*, Qurat Ul Ain1 and Qurat-ul-Ain Zafar1

...nking of genes based on protein interactions and centrality-lethality hypothesis representing that knockdown of influential node and edge leads toward the development of the disease. This ranking allows identification of the influential protein for the targeted drug discovery and therapies. An extensive study of published articles was conducted to enlist asthma-associated genes reported significant (P-value < 0.05) in the...

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

...(TAG), high-density lipoprotein (HDL)-c, low-density lipoprotein (LDL)-c, very low-density lipoprotein (VLDL)-c concentrations, tumor necrosis factor-alpha (TNF-), and interleukin 10 (IL-10) concentrations. The results revealed the development of signs of incitement such as increased TC and reduced IL-10, decreased HDL-C, and increased TC, TAG, VLDL-C, and LDL-C, along with an increase in ...

Muhammad Luqman1*, Muhammad Talha Shoaib1, Muhammad Yaseen1, Umair Safdar2 and Hassan Raza2

...izers and pesticides to protect their crops from diseases and insect pest attacks. In this perspective, current study was designed to explore negative consequences of pesticides applications on human health and environment in district Sargodha. A cross sectional survey method using convenient sampling was adopted for this research and data was collected from 300 respondents with the help of structured interview schedule. The results revealed that all the respo...

Sara H. Zughayyar*, Amer H. Gyad 

...des, while steroids and proteins were absent. The extract displayed antidiarrheal activity comparable to loperamide, showing a significant reduction in intestinal content volume and weight (P≤0.05). In conclusion, the ethanolic extract of Prosopis farcta L. fruits demonstrated promising antidiarrheal activity, potentially due to the phytochemical constituents identified, warranting further research for clinical applications. 

...

Agha Mushtaque Ahmed1*, Ali Zachi Abdul Qadeer Alhilifi2, Fahad Nazir Khoso1, Muhammad Ibrahim Kubar1, Tehniyat Naz Shah3 and Touseef Ahmed1

Sidra Hafeez1, Tayyaba Sanaullah2, Hafsa Naeem3, Mah Noor Hassan4, Muttalib5, Farhana Kausar6, Muhammad Salman Hameed7*, Muhammad Anayat Ullah8, Abdul Samad9, Memoona Bashir10 and Sadaf Shabbir11

... active compounds like carotenoids, alkaloids and flavonoids and necessary for food security against disease causing agents like bacteria, fungi etc. Black rot is a serious disease in pumpkin caused by fungus (Didymella bryoniae) and damaged fruit with the symptoms of dark brown lesions but causal organism identification through DNA is still unknown. We collected infected leaf from C. pepp from the vicinity of The University...

Hafsa Saeed, Soumble Zulfiqar, Abeedha Tu-Allah Khan and Abdul Rauf Shakoori*

...essed and purified ZntR protein showed binding with zntA promoter. Increased transcripts of zntR in the presence of metal ions revealed its metal inducible nature. The molecular dynamics simulation and protein-metal ion docking studies of the K. pneumoniae ZntR protein are being reported for the first time.

...

Ying Chen1, Chao-Zheng Li2, Zhun Yu3, Jia Zhou4, Yan Xu4, Zhe Lin4, He Lin4* and Xiao-Wei Huang4*

...shed to investigate the protective mechanism of VAP on MIRI in rats. Total 90 male Sprague Dawley (SD) rats were divided into the control, model (MIRI), positive (Diltiazem, DLZ, 20 mg/kg), VAP high, medium, low dose (VAP 300, 200, and 100 mg/kg) groups. After 21 days of intragastric administration, the electrocardiogram (ECG) changes in each group were detected. The activities of lactate dehydrogenase (LDH) and creatine kinase-MB (CK-MB) isoenzymes in serum, ...

Khansa Jamil1, Muhammad Ramzan Khan1, Asad Jan2 and Ghulam Muhammad Ali1

... kcal/mol with targeted protein. Hence the study revealed that bioactive compounds derived from the Caralluma tuberculata plant pose highly antibacterial activity and might be used to synthesize the antibacterial drug.

...

Muhammad Ali Raza1*, Aneela Zameer Durrani2, Muhammad Muddassir Ali3, Tariq Usman4, Bilques Bano5, Nazia Rubab6, Syed Tasadak Mehdi7, Muhammad Wasim Iqbal8, Kumayl Hassan Akhtar9, Hira Hameed10

...with a proper treatment protocol and comparison with levamisole, oxyclozanide and the combination of both drugs.
...

Shu-Zhi Qin, Wen-Pei Ling, Mei-Fang Yin, Chun-Yu Luo and Cheng-Guo Zhao*

...ify;">Mitogen-activated protein kinases (MAPK) is an important signal pathway involved in cardiomyocyte injury. To investigate the protective effect of paeoniflorin (PF) on hypoxia reoxygenation (H/R) injury and its effect on MAPK signal pathway to reveal the mechanism of PF against myocardial ischemia-reperfusion injury, in this study, the H/R model of H9C2 cells was established by hypoxia for 3 h and reoxygenation for 3 h....
Xiao-Wei Huang1,2, Mei-Li Liu1, Jin-Ji Wang1, Yue-Xin Liu3, Zhe Lin1, Chun-Shu Rong4* and Ji-Xiang Ren4*
... (MDA), brain-derived neurotrophic factor (BDNF), and nerve growth factor (NGF) in serum were detected using ELISA. The protein expression levels of phosphoinositide 3-kinase (PI3K), protein kinase B (Akt) and mammalian target of rapamycin (mTOR) in the hippocampus were detected through western blotting. In the results, VAP contained 17 kinds of AA, including 7 essential AA, with a content...

Nafissa Sahel1*, Fadela Chougrani2, Abderrahim Cheriguene3 and Zineb Hamani1

...otal aerobic flora, psychrotrophic flora, total and thermos-tolerant coliforms, faecal streptococci, total yeasts and moulds. Whereas camel milk from El Bayadh was the least contaminated with total aerobic flora, psychrotrophic flora, total yeasts and moulds. All samples tested for pathogenicity were negative for pathogenic germs.

...

Nguyen Huu Van1*, Nguyen Thi Mui1, Dinh Van Dung1, Van Ngoc Phong1, Tran Ngoc Long1, Le Tran Hoan1, Le Duc Thao1, Vo Thi Minh Tam1, Ngo Mau Dung1, Bui Van Loi1, Nguyen Xuan Ba1, Ton Nu Minh Thi2, Nishino Naoki2

...the animals where crude protein (CP) digestibility increased as concentrate level increased, whereas digestibility of neutral detergent fiber (NDF) decreased. There were no significant differences in pH values, ammonia and VFA concentrations in rumen fluid between treatments before and 4h after feeding. The pH values remained in critical rumen pH range of 6.0-7.0 for optimum microbial growth and nutrient utilization. Hence, this study demonstrated that increas...

Merita Ayu Indrianti1,2*, Didi Rukmana3, Eymal Bahsar Demmallino3, Muh. Hatta Jamil3

...needs to implement food protection policies in every region. This underlies the issuance of several related regulations, including Law No. 41 of 2009 about sustainable food agricultural land (LP2B), Government Regulation (PP) No. 12 of 2012 about incentives for protecting LP2B. The success of implementing these regulations is certainly different in each region. This can be measured from the extent to which the implementation...

Abida Mushtaque1, Ali Ahmad Sheikh1, Aamir Ghafoor1*, Wasim Shehzad2 and Nadeem Ahmad3

...types of outer membrane proteins (OMP’s) which assist in interaction with host cells. The outer membrane protein H (OmpH) of Pasteurella multocida B:2 is a major transmembrane porin that can be used as a subunit vaccine and development of diagnostic kit against hemorrhagic septicemia (HS) because of its immunogenic nature. Pasteurella multocida has economic importance because of endemic and epizootic diseases in domest...

Dan Song1,2, Ming-Juan Ge3, Jie Li1,2, Yi Jiang1, Xiu-Mei Kong1, Jiao-Jiao Xu1, Xu Ji1,2, Rui-Xin Shi1 and Qin Zhao1,2*

...rite poisoning test, isoproterenol poisoning test, and acute cerebral ischemic hypoxia test. Subsequently, the content of superoxide dismutase (SOD), malondialdehyde (MDA), and activity of total antioxidant capacity (T-AOC), catalase (CAT) in mice liver were measured; while SOD and MDA contents and activity of T-AOC, CAT, Na+-K+-ATPase, Ca2+-Mg2+-ATPase, pyruvate kinase (PK) and phosphofructokinase (PFK) in mice brain were evaluated. In the results, G. stramin...
Qingsen Ran1,2, Manjing Li3, Jiayin Han3, Lifang Wang3, Han Wang3,4, Shaobo Liu5* and Yanping Wang1*
...can-1 (GPC1), Nucleolar Protein 3 (NOL3) and Stanniocalcin 2 (STC2). A prognostic risk score model was established, and the OS rate of high-risk patients was found significantly reduced (p <0.001) compared to low-risk patients. The 5-year OS ROC area under curve (AUC) of the model was 0.75. qPCR results confirmed that glycolysis-related genes ENO3, GPC1, NOL3 and STC2 were significantly upregulated in HCT116 cells compared to FHC cells. In conclusion, our s...
Iko-Ojo Charity Ikwe Agada, James Agbo Ameh, Olatunde H. Olabode and Martha Echioda-Ogbole*
... caused by carnivore Protoparvovirus 1 (CPV). The CPV is a small, non-enveloped, single-stranded DNA virus of the family Parvoviridae. CPE is a highly contagious enteric disease of dogs transmitted mainly via the fecal- oral route. This ten (10) years retrospective study was carried out to describe the pattern, prevalence and seasonality of canine parvoviral infection in Abuja based on records of laboratory confirmed CPE cases from 2011- 2021 pre...
Mahmoud M. Bayoumi
...ncodes the target viral protein, with no infection hazard or even nucleic acid integration. Furthermore, mRNA vaccines can stimulate both specific cellular and humoral immunity in a short time scale to combat a life-threatening or emerging viral disease. This review will comprehensively cover the recent advances in mRNA vaccine production, the delivery methods, and the essential compositions added to the mRNA vaccines to enhance efficacy and stability. This in...
Moustafa A. Zaghloul1*, Mohamed F. Azooz1, Saleh E. Ali1*, Heba M. Soliman1, Maha M. Sayed1, Mohamed H. Kafafy2 and Alaa R. Morsy1
...RPO30, P32 and EEV glycoprotein genes of Lumpy Skin Disease Virus (LSDV) recent isolates in Egypt, as well as to use artificial intelligence to predict the immunogenic landscape of circulating lumpy skin disease in the Egyptian cattle dairy sector, which will lead to universal blueprints for multiepitope lumpy skin disease vaccine designs. A total of 40 skin nodule samples were collected from clinically affected cattle to detect LSDV using PCR targeting GPCR, ...
Hanaa H.A. Gomaa1*, Dalia Y.A. Amin1, Mona A. Ismail1, Basma Hamdy2, Khaled A. El-Dougdoug3
...ation (ChNPs and BM). Microtome and ultrathin sections were carried out on healthy and infected treated fig leaves. The shoot length, leaf area, fresh and dry weight were determined. Biochemical markers as indicators for systemic acquired resistance; total proteins, salicylic acid, phenol, proline, oxidative enzyme activities (polyphenol oxidase and superoxide dismutase) and virological assessments were assayed. Reduction in...

Amal Hammad*, Shaaban Gadallah, Tarik Misk, Ahmed Mourad 

...e each of four sedation protocols at one-week interval. Hence, 4 groups were evaluated: XH (xylazine high: 1mg/kg of xylazine intravenously); XL (xylazine low: 0.25mg/kg of xylazine intravenously); XLL (xylazine low combined with laser acupuncture: 0.25mg/kg of xylazine intravenously with laser stimulation at GV20 and Yintang) and XLV (xylazine low combined with vibrational acupuncture: 0.25mg/kg of xylazine intravenously with vibrational stimulation at GV20 a...

Milena Vlahovic*, Dragana Matic, Marija Mrdakovic, Larisa Ilijin, Anja Grcic, Aleksandra Filipovic, Jelica Lazarevic and Vesna Peric-Mataruga

...nt correlations between proteases and PMM were detected at lower metal concentrations (Acute10 and Chronic10 and 30 μg Cd/g dry food). In contrast to chronic treatment, egg masses respond more uniformly by reducing PMM during the short-term effect of cadmium. Finally, we can conclude that, as an addition to biochemical and molecular research, PMM can be used for studying the cadmium effects to gain a better insight into the state of the organism under stres...

Oghenebrorhie M. Oghenochuko1,4*, Olubukola T. Adenubi3, Olusola L. Ajayi3, Fakilahyel M. Mshelbwala3, Johnny O. Olukunle3, Samson A. Rahman3 and Godfrey N.O. Ezeri2

...f carbohydrate (7.82%), protein (4.48%), crude fiber (1.68%), iron (0.5mg/l), magnesium (210mg/l), flavonoids (0.46%), saponins (0.28%), tannins (0.95%). PCV, Hb, RBC and WBC were increased in all treatments but values were higher in bath treatment for RBC (3.0×1012/L), PCV (32.7%), Hb (10.7%). MCV, MCH and MCHC showed similar trend. Similar trends as in RBC and WBC were observed in total proteins. Liver and kidney fun...

Usama Mahalel1, Barakat M. Alrashdi1, Ibrahim Abdel-Farid1, Sabry El-Naggar2, Mohamed Hassan3, Hassan Elgebaly1 and Diaa Massoud1,4*

Aleena Kokab1, Ali Ahmad Sheikh1*, Masood Rabbani1, Wasim Shehzad2, Muhammad Ilyas Riaz1, Sohail Raza1 and Rida Haroon Durrani1

...against non-Salmonella serotypes tested. Latent time period of 15, 15, and 20 min was documented for SEPL01, SEPL13, and SEPL20, respectively, with an average burst size of 110, 32, and 63 PFU CFU-1, respectively. All the three bacteriophages were tolerant of temperature range 4°C-70°C and pH between 3-12, thus providing a broader window of their application throughout the food chain. On chicken breast cuts, phage mix efficiently supported sustained (3...

Taidong Wang1, Xiaowei Huang1, Jian Huang2, Guangfu Lv3 and Zhe Lin1*

...3, COX2 and TNF-α protein expression levels in hypothalamus (P<0.01 or P<0.05), and low-dose group significantly increased BCL2 protein expression levels (P<0.01). It was found that SR can significantly inhibit lipopolysaccharide-induced fever in rats with elevated body temperature, reduce serum TNF-α, IL-1β and IL-6 levels, reduce the hypothalamus COX2, caspase3 and Bax pro...

Rasema Majeed, Alaa Kamil Mahmood* 

...s study to evaluate the protective effects of ginger ethanolic extract, chitosan nanoparticles, and ginger ethanolic extract loaded with chitosan nanoparticles (GEE-CNPs) against DNA damage and pancreatic histological changes in dogs with alloxan-nicotinamide-induced diabetes. histological analysis was assessed. The results showed that first group (Control negative) administered distilled water showed no abnormal lesion, while second group (Control positive) i...

Franciscus Rudi Prasetyo Hantoro1,2,*, Dwi Sunarti1, Turrini Yudiarti1, Sri Sumarsih1, Rini Nurhayati2 

...cking density and crude protein levels on blood parameters, bacterial populations, immune organs, antioxidant status, and growth performance in Sentul Selection (SenSi) 1 Agrinak chickens. Treatments consisted of three stocking densities (10, 14, and 18 birds/m2) and three levels of crude protein (14, 16, and 18%) factorially (3×3) which were arranged in nine treatments and four replications. Treatment and data collect...

Lijiao Wang1, Haibin Chen2*, Hongyan Yu1, Zexian Fu3 and Jianjun Zhao2*

... endothelial PAS domain protein 1 (EPAS-1) gene in renal cell carcinoma (RCC), adjacent tissue and metastatic lymph node tissue. For this study, 110 cases of RCC tissue and corresponding adjacent tissue and 40 cases of metastatic lymph node tissue were selected. Western blot and immunohistochemical methods were used to detect the expression of EPAS-1 in the three groups. The expression of EPAS-1 and the clinicopathology of RCC were further analysed. To examine...
Rabiea Pervaiz, Shaista Bano*, Sarfraz Ali Tunio, Abdul Nabi Jatt and Aisha Amber Soomro
...diverse environment and Proteus mirabilis from clinical environment were strongly inhibited.

...
Kanwal Nisa1, Sadia Roshan1, Shazia Shamas1,2*, Raheela Atta Mustafa3, Shamaila Irum1, Kalsoom Sughra4 and Memoona Iqbal1 
... analyzed through ELISA protocol to check the testosterone and Prostate-specific antigen (PSA). Testosterone significantly affects the prostate-specific antigen (PSA) with (P<0.05). In the cases, the mean testosterone, age, PSA was 38.45±36.66, 66.28±6.386 and 9.655±6.656, respectively while in the control group mean testosterone, age and PSA were 194.1±84.08, 59.35±6.794 and 1.295±0.809 respectively. The present st...

Wang Teng1,2,3,4, Li Chunhou1,2,3,4, Liu Yong1,2,3,4* and Zhu Ren5*

...nagement. For better to protect fish biodiversity and fisheries resources, more international cooperation on protected areas, fishing ban, and scientific research should be implemented for effectively protecting fish biodiversity and fisheries resource sustainability.

...

Rizki Dwi Setiawan1, Zurmiati2, Wizna2, Ridho Kurniawan Rusli2, Ade Trisna3, Surya Aulia4 

...he moisture, ash, crude protein, and crude fat content of the meat. Administration of probiotics (Bacillus subtilis FNCC 0059) up to 53 × 1012 CFU/mL affected the lightness and water-holding capacity of bayang duck meat.  

...

Roheela Yasmeen1,3* , Faheem Hafeez1 , Umme Ammara1 , Rubab Younas1 , Sibtain Ahmad2 , Zulfiqar Ali3, Zaheer Ahmad Nasir4 

...due to cheap sources of proteins and it is also considered as the center of various organic and inorganic emissions. The current study was designed to see the release of different metals from the poultry farms. Air samples both from indoor and outdoor along with the litter and feed samples of ten poultry houses were collected from the outskirts of Lahore, Punjab, Pakistan. Poultry farms were varied in feed and grouped into three categories: Group A (using Feed...

Turrini Yudiarti*, Sugiharto Sugiharto, Endang Widiastuti, Hanny Indrat Wahyuni, Tri Agus Sartono, Maulana Hamonangan Nasution

...holesterol value, total protein, MCHC, Coliform population in ileum and weight of heart also bursa of fabricius, whereas could reduce MCV, coliform population in caecum, and weight of pancreatic also caecum and no effect on broiler performance. The conclusion is supplementation of fermented product of the fungus Monascus purpureus as a feed additive that applied on boiler can improve the physiological parameters, intestinal microbial population and internal or...

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

...xidant capacity(TAO-C), protein carbonyl(PC), reactive oxygen species (ROS), and gamma-glutamyl transferase concentration(GGT). The results indicated that 200 mg/kg of SiO2 - NPs orally for 4 weeks contributed to a substantial drop in serum TAC-O, an increase in MDA, GGT, PC, and ROS concentration, and attenuation of silica’s oxidative stress status, CP NPs (T3) or SiO2 NPs (T2) administered orally to female rats for four weeks constitutes a case of oxid...
Omaima Khamiss
...eously: In addition to' protein profiles by SDS-PAGE, TEM electron microscopy ultrathin sections and hybridization dot blots, gel transfer to follow the probable mechanism especially with the high percentage of genome homology that was over 66% with one of five tested restriction enzymes. These observations suggest an important possible role for recombination in the early evolution and biological characteristics of these two viruses.
...
El-Dougdoug. K.A.1, Mervat, M. Fath Alah2, Reham A. Hassen3,Rehab A . Dawoud2
...ogenous salicylic acid, protein content, chlorophyll contents and peroxidase and polyphenol oxidase activities as well as increasing in growth parameters).
...
Mohga A. El-Tahlawey l, L.R. Rizkallal , S.A. El-Arnaouty 2 and Amal A.Khalil 3
...nfection by Faba Bean Necrotic Yellows Virus (FBNYV) in faba bean crop. The results of seed dressing by Gaucho were obtained in the growing season 2007/08 and 2008/09 growing seasons. In 2007/08 growing season showed that seed dressing with Gaucho was effective in reducing FBNYV from 44.50% in plant without treatment to 8% only when used the concentration 2 g / kg seeds. The results in 2008/09 growing season showed that seed dressing with Gaucho was effective ...

Khalid Alhudaib

...uits annually. Prunus necrotic ringspot virus (PNRSV), Prune dwarf virus (PDV) and Plum Pox virus (PPV) are the most important and common viruses infecting stone fruit trees in nearby countries, Jordan, Lebanon, Syria, and Egypt. In spring 2009, field surveys were carried out in an area of stone fruit production (Al Juof- North of Saudi Arabia) to record virus incidence of stone fruit trees. Apricots and peaches were observed showing chlo...

 Shawki, Khaled K.; Carter, M.J.; Alnashar, Nariman M., El-Farrashl, Mohamed A. and Taher, Sahar

...bly of the virus capsid protein. In this study we employed a new approach for engineering stable particles of Hawaii virus capsid protein by deleting those immunodominant regions (P2subdomains) that evoke type-specific responses and bridging the resulting gap with a synthetic poly-glycine chain. This construct was expressed using the baculovirus system and the obtained purified protein was...

Hemeida, A. A., Osman, M., El-Shahat, Mohamed, Hashem, Medhat H., Mahmoud, Amal and Dahi, Hosni

... (AST), Serum alpha fetoprotein (AFP) , serum Albumin , serum creatinine , Serum TSH, Hemoglobin (Hb),White blood cells count (WBCs) and Platelets count . Hematological disorders and ALT elevation were common side effects of treatment. The side effects were increased within group B than that of group A. Three random hepatitis C virus (HCV) samples from group B were studied for the diversity and sequence variations. Sequencing of 223 nucleotide of 5'-untranslat...

Yousifl ,3 , Ausama A. and Al-Naeem , Abdelmohsen A.

...of the A-type inclusion protein (ATIP) gene. The orthopoxvirus (OPV) ortholog genes LIR, A27L, A33R and B5R of the Saudi enzootic CMLV were also investigated using a modified PCR assay. Our data explains some of the variation obtained with restriction analysis and underlines the need for a review of some of the vaccines used to control CMLV.

...
Hassanein, Suzan A.; Abd El-Wahab, Wafaa; Eweis, Moustafa and Mahmoud, Mervat M.
... to 3ABC non-structural proteins using commercial ELISA kit (Priocheck). The overall percentage of positive was 38.9 %. The higher percentage of positive detected in Behaira (48%), then Mounofya (45.3%) while Kafer El-sheikh was the lowest (23.7%). The positive results of detection of antibodies against non structured proteins of FMDV indicate that these samples come from natural infected animals.

...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...ctivity. Non-structural protein (NSP) 3ABC antibody is considered to be the most reliable indicator of present or past infection with foot-and-mouth disease virus (FMDV) in vaccinated animals. An indirect ELISA was established, for detection of the antibody response to FMDV NSP 3ABC using commercial ELISA kit (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330) from Kafr ElSheikh Governorates during 2009 from cattle and buffaloes. Th...

Madbouly*, H.M.; Saif**, M.A. and Hussein* , A.S.

...vvNDV for detecting the protection percent. From this study it could be concluded that MDV vaccine has an immunosuppressive effect on chicks and this could be antagonized by immunostimulant as curcuma longa The surprising immuno-stimulatory effect of curcuma is in the induction of protection level 80% in treated but not NDV vaccinated group which equivalent to that group vaccinated with NDV vaccine only and not treated. From...

Zaghloull , A.H.; Mahmoud2, Amal; Hassanl , H.Y.; Hemeida2, A.A.; Nayell , M. A. and Zaghawal , A.A.

...fragments from the glycoprotein G gene allowed specific amplification of BEFV-cell culture isolates from Egypt (Menoufia and Alexandria Governorates) and Japan. The PCR product was sequenced and analyzed. PCR product of Alexandria isolate was cloned and labeled with digoxigenin and used as diagnostic probe for BEF virus infection using dot-blot hybridization. Thirty six samples were collected from Menoufia Governorate (Berket El-Sabaa, Tokh Tambesha and Salamo...

Madboulyl , H. M.; Tamami , S.M.; Abd Elmoneml , A.S.; Husseinl , A.S. and Arafa2, A.M.

... sera. This denotes the protection against APV independent on the presence of high levels of maternal antibodies.

...

Abd El-Razakl, A.G. and AboElkhair2, M.

...ccines provide complete protection against mortality but not protection against bursal atrophy or histopathological changes after challenge. As well as RT-PCR-based viral IBD detection in bursa of Fabricius at day post challenge.

...

El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.

...ted portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was more closely related to PVY strains. Ten nucleotide substitutions resulted in 3 conserved amino acid substitutions (VI*I, G7*E, M or V and S8*G) and were able to differentia...

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...aic, deformations and necrotic and chlorotic ring spots, that resemble those induced by CMV. SDS-PAGE test showed various distinguishable sole novel protein bands in four cucumber cultivars infected with CMV but not in healthy one. RT-PCR, with the primer CMV 1 and CMV2 for CMV-CP. gene, yielded 422 base pair DNA fragments. The following sequences were used in the comparison: Brazil (AF418...

El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.

... in glycerol asparagine broth medium and the culture supernatants obtained were filtered through 0.45 pl filter. These isolates were tested in two experiments for their ability to control a Cucumber mosaic virus (CMV). In the 1st experiment, One half of leaves of Chenopodium amaranticolor were treated with culture filtrate (CF) followed by CMV inoculation on both halves. In the 2nd experiment, The first pair of Cucumis sativus leaves were teated CF with CMV me...

Mahdyl , A.M.M.; Hafezl , M.A.; EL-Dougdoug2, Kh. A.; Fawzyl , R.N. and Shahwanl , Eman S.M.•

...) resulted induction of protein related to biotic inducers, virus concentration and disease severity (DS). The obtained results from quantification of total SA in induced tomato plants (after 7 days of spraying inducers) showed high level of SA with kombucha &eatment followed by C. inerme and M. jalapa, while mixed (M. jalapa+C. inerme) gave the lowest level of SA compared with healthy and infected controls. On the other hand, after virus inoculation tomat...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...ce analysis of the coat protein gene demonstrated that the virus represents an isolate of the Tobamoviridae Family. The isolated virus was nominated as TMV Chrysanthemum Egyptian isolate (TMV-Ch-EG). This virus isolate caused severe disease symptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antiserum f...

Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.

...cloves subjected to electrotherapy, thermotherapy, chemotherapy or meristematic dissection followed by in vitro culture. A combination treatment with electro- and chemotherapy (15 mA/10 min + 20 mg 1-1 virazol) was found to more effective on viral elimination and survival of explants. ELISA tests showed that 85% of the plantlets that survived severe OYDV-negative.

...

El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.

...dentical to that of the prototype 199 bp Canada and USA isolates of CSVd with 96% homology. The sequence of CSVd-EG can be arranged into viroid specific rod like structure. CSVd-EG differ from the prototype isolates Canada and USA at sites occur in regions corresponding to the conserved, variable and right terminal domains which are believed to control viroid pathogenicity. Finally, this constitutes the first isolation and i...

Rabia Anjum

...brillary tangles of tau proteins. Currently different hypothesis was proposed in the progression of disease which are amyloid cascade, tau and cholinergic hypothesis. Other than that age, family history, injury, high blood pressure and genetic may play an important role in the disease development. Current AD treatment are acetylcholinesterase inhibitors are easily accessible in the market to relief the AD primary symptoms but did not cure it. AD treatment need...

Sharawil , S.S.A. and Abd El-Rahim2, I.H.A.•

...g primer set for fusion protein (F) epitope, then cDNA were send to Institute of Animal Health Pirbright, England to analyze for their  nucleotide sequences of this F protein gene and phylogenic analysis properties, by matching with other reference world recorded isolates. The gene sequenced a 322 nucleotide cDNA fragment of the fusion protein gene was obtained. The isolates showed un...

Ebied, Eman M.; Salem, Zeinab T. and Al-Imam, Hemmat S.

...ination and remain with protective level up to 6 months, while their foals had moderate (HI) antibodies within  48 hours post colostral suckling, the HI antibodies rise to a level similar to their dams within one to two weeks then persisted with considerable level up to 6 months of their age.

...

Zein Salwa N; Abd El-khalik, Samaa; Khatab  , Eman A.A.H and Azzam4,Clara R.

...-S was typical of nucleoprotein with minimum and maximum at 247 and 260 nm respectively. The ratios of A260/280 and Amax/min were 1.2 and 1.1 respectively. Electron microscopy of purified virus showed the presence of rod shape particles with a size 300 nm. Titer of the prepared antisera as determined using ELISA was 1/2000. Electron microscopic examination of infected leaves of N. clevelandii founed various cytological abnormalities. Due to the non-availabilit...

Alhudaib, Khalid

...he main symptoms are chlorotic mottling, blotching and various types of leaf deformation. Samples were collected, with consideration of the economically importance and distribution of the cultivars, from different areas of Hofuf Saudi Arabia. Each sample was consisted of 10-15 leaves. Samples were labelled and stored in plastic bags at 40C; then transferred to the laboratory, for total nucleic acids (TNAs) extraction. One hundred mg of leaf veins and or cortic...

*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'

... analysis of their coat protein (CP) gene. The sequence of the coat protein gene (CP) of AMV was determined from cDNA clones. The CP gene was cloned into pGEM-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared with corresponding viral nucleotide sequences reported in GenBank. The analysis showed that nucleoti...

El-Tabakh, SAA l ; Abdel Wahab, KSE; Badr, AF   and Helal, IG  

...tion (RT PCR) and viral proteins by polyacrylamide gel electrophoresis (PAGE). HCV infected and control HepG2 cells supernatant fluids (SF) were sampled before complete change with fresh MM at weekly intervals for periods extended to one month after infection. Three SF samples taken 5 days apart after HCV infection showed that detection of HCV-RNA in SF was intermittent but' detection of new native protein as well as gl...

Fadia M. Attia and Hanaa H. A. Gomaa

..., complete blood count, prothrombin time and liver function tests were performed. The results showed that leucopenia and thrombocytopenia are more frequent in HCV patients with moderate degree of viremia than patients with mild viremia than those with no viremia (p<0.05). Moderate neutropenia (< 1000 /ul) and moderate lymphopenia (< 1000/ul) are observed in all patients with different levels of viremia in comparison with those patients with no viremia...

Hussein, HA; sultan, HA. Al Deeb AH and AA. El-Sanousi

...propose such titer as a protective titer against H5Nl virus. In group 2 (samples collected between April and July, 2007), titers in 36.4% of the tested samples were protective. In group 3 (samples collected between August to November, 2007).

...

Madbouly, H.M; Orkhan, M.H**; Nagwa El-khoty

...ps (sells broilers or parrots The number of dead and culled birds in this outbreak was 34.4 millions with economical losses 2-3 billion dollars.

...

Abd Elwanis, N.D.; Abou El Khair, M.A.; Afaf H. Amin; Azab, A. and A.O. Abd El Rahman

...l vaccine candidate for protection of chickens against the highly pathogenic avian influenza (HPAI) virus has been discussed.

...

Eman, Abo Hatab*; Hussein, HA.; El-Sabagh IM. and Saber, MS.

...haracterization of GIO serotype of group A rotaviruses from fecal samples collected from camel farms suffering from diarrhea in Alexandria and Esmalia governorates. After preparation of fecal samples and inoculation on MA 104 cell line for five passages, eight isolates were successfully isolated with a clear and reproducible CPE on the inoculated cells. The isolates were identified antigenically using VP6 monoclonal antibodi...

El-Sabagh, I.M.; Hussein, H.A.; Amer, H.M.; El-Sanousi, A.A.; Reda,I.M. and M.A. Shalaby

...gment 9 (coding for VP7 protein) of NCDV was inserted into a baculovirus transfer vector under the control of the polyhedrin promotor. A recombinant baculovirus carrying the VP7 gene was constucted through homologous recombination between the baculovirus transfer vector carrying the VP7 gene and Autographa californica Nuclear Polyhedrosis Virus (AcNPV). Infection of Spodoptera frugiperda (SD) cells with Baculovirus recombinants expressing VP7 p

Amer, H.M.; Hussein, H. A.; El-Sabagh, I. M.; El-Sanousi, A. A. Saber,M.S. and Shalaby, M. A.

...irus (BCV) nucleocapsid protein was carried out in a baculovirus expression system. The specific RT-PCR product of N gene was cut and extracted from gel using DNA gel extraction kit (Millipore). Eluted DNA was successfully cloned in pBlueBac4.5N5-His TOPO TA baculovirus transfer vector and transformed in chemically competent E. coli. A modified colony PCR assay was utilized to identify the positive bacterial colonies that harbor the recombinant plasmids carryi...
Hala M. El-Makaky*•, Sherif, N.A.;Fekria El-Bordiny* and Taha, M.M.*
...ed vaccine induced good protection and has good potentiality for use in chicken in the Egyptian poultry industry.

...

Manva F.M. Abdel Monem; Gihan K. Mohammed;** Sami A.M.; and Saber M.S.*

...p; month and still in a protective level only 10th  month post vaccination.

...

Sonia, A.M.; El. Sanousi, A.A.; Saber, M.M.; Daoud, A.M.; Samira, E.K.; and Ismail I.

...5 could elicit the best protection capability with long lasting immune response (up to 42 week) in calves, if compared with other FMD vaccine batches emulsified with: Montanide ISA 206 mixed with Ginseng extract (duration up to 38 week), with Montanide ISA 206 mixed with Quil A saponine (36 week) and with Montanide ISA206 alone (34 week).

...
Ashraf M. Metwally*, Ausama A. Yousif*k , Iman B. Walaa A.   Attia M. Samy * , and Ismail M. Reda *
 
...s bursal disease (IBD) serotype 1 viruses continue to cause major economic losses in the Egyptian poultry industry despite the implementation of intensive vaccination programs. A recent increase in IBD related mortality in vaccinated farms prompted this investigation into the genetic character of the circulating IBD virus (IBDV). Bursa and proventriculus samples were RT-PCR tested using novel primers flanking VP2 region coding the two major and two minor hydro...
Eman, M. M. Soliman*; Taha, M. M.*;El-Sanousi A,;Shalaby M. S. Wasscl , Youscf Adel*
...es (OIE) RVF evaluation protocol. The tested batches proved to be sterile and safe when inoculated subcutaneously (S/C) and intraperitoneally(I/P) into mice (3-5 days old) and lambs without showing adverse post vaccinal reactions. Duration of immunity to RVF virus in vaccinated sheep has been determined by using both serum neutralization test (SNT) and enzyme-linked immunosorbent assay (ELISA) on sera collected weekly up to 7 weeks post vaccination, where the ...

Abdel Razek,B.Omar*and Magda M.Sayed**

...with fluorescent. Total protein concentration of the prepared LSDV antisera was 0.8g/dl. Separation of anti-LSDV immunoglobulins 1gG were done using ammonium sulphate followed by conjugation with fluorescein isothiocyanate at pH 9.6. The anti-LSDV IgG conjugated fluorescein sterile and was used to detect LSDV in the MDBK cells and gave good results to dilution 1/20 while the reference conjugate to 1/30.

...

M.A. Farag*, Abeer, E. Mansour* and s.M. 

...ypt/2006 accompanied by protection percentage of 33% against challenged virus 01/3/93 with low values of AOD were recorded in sheep previously infected with BVDV one week before vaccination. Challenging the immunity of sheep both simultaneously infected with BVDV and vaccinated or infected one week post vaccination against 01/3/93 revealed protection percentages of 66%. Sheep fed on commercial ration treated with 40gykgm rat...

Sahar A. Youssef I and A. A. Shalaby 

...ruses namely ,4pple cholorotic leaf spot virus (ACLSV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Plum pox virus (PPV) and Tomato ringspot virus
(ToRSV) which considered the most economically damaging viruses of stone fruit trees in Egypt and worldwide. Five compatible primer sets for one•step RT-PCR amplification  used in a single closed tube to detec...

S.A. Sidaros, S.A. El-Kewey , Hala A. Amin;Eman A.H. Khatab ,  A.A. Emeran l , Samaa Abd El-Khalilk and M.A.S. El-Kady

...pair for the PMMoV coat protein gene (PMM-F and PMM-R) revealed 470 bp amplified product. Dot blot hybridization was used to establish the authenticity and specificity to the RT-PCR amplified Products of PMMoV. The coat protein gene of an Egyptian isolate of PMMoV was cloned and sequenced, The sequence contained a full-length ORF coding for the viral CP. It comprises 473 nt and a polypeptide chain of 157 amino acids with a M...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2 
...ere base number of coat protein gene ARC isolate 571 bp; TB isolate 529 bp and TN isolate 546 bp.

...

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

...thermo-, chemo- and electrotherapies. Potato plants cv. Diamond cultivated at Faculty of Agriculture farm, Sohag University were tested by direct antigen coatingenzyme linked immunosorbent assay (DAC-ELISA) using antisera against PVY, Potato virus X (PVX) and Potato leaf roll virus (PLRV). The results indicated the occurrence of single and mixed infections of three viruses in potato plants. Survey results indicated highly distribution of PVY infected plants, w...

* Amal Abou El-Ela, A.

...ign: justify;">Prunus necrotic ring spot Ilarvirus (PNRSV), was isolated from rose shrubs during the survey of rose plantations in Orman Garden, showing Ilarvirus-like symptoms. To identify the causal virus, the plants were tested by enzyme-linked immunosorbent assay using antibodies against different Ilarviruses i.e., Apple mosaic virus (ApMV), Prunus necrotic ring virus (PNRSV), Rose mosaic virus (RNIV) and Tobacco streak ...

Manal A. El-Shazly1, A. s. 2 Abdel Wahab and Salwa N. Zein3

...ellowing for TSWV and necrotic eyelike spots and yellow spots on leaves, and flower stem for IYSV. Both TSWV and IYSV were mechanically and seed transmitted. TSWV was transmitted by two different thrips species, Thrips tabaci L (33.3%) and Frankliniella occidentallis Pergamde (60.9%) whereas the transmission of IYSV was obtained by Thrips tabaci L. only (45%).  Adults of T. tabaci and F. occidentallis Pergamde as vectors of TSWV and IYSV were discussed. F...

Mayada A. Abd Elgalell; B.A Othman2; Th. Radwan, 1 and Amal S.M. Abo-Sinna3

...5 nm) and neck (27 nm). Protein patterns of the isolated Ps. putida phages were analysed by SDS-PAGE and the data revealed that phage PPI had 16 structural proteins, 6 are known and the other are extrapolated, but phage PP2 had 13 structural proteins 5 are known and the others are extrapolated. Both viruses have one molecule of the nucleic acid DNA with molecular weight of 2223 bp and 2559...

Mohga M. El-Tahlawey, A. Mandour and AE Aboulata

...ced by both Faba bean necrotic virus (FBNYV) and mosaic causing viruses were inspected during Oct. 2003 to Apr. 2004 on Faba bean fields grown in Qalyubia governorate. Population density of seven different aphid species on faba bean was arranged descendingly as follow: Aphis craccivora (270.9). Myzus persicae. (89.0). A fabae (52.5). Acyrthosiphon pisum (24.3), A. gossypii (4.7). A sesbaniea (1.8). and A. nerii (0.7). Population fluctuation of previous aphid s...

S.Y.M. Mahmoud1 and M. Hashem2

...align: justify;">Beet necrotic yellow vein Benyvirus (BNYVV) is the important soilborne virus disease in the production areas of sugar beet. In this study. field survey was carried out in sugar beet growing areas belonging to Kafr-ElSheikh, El-Beheira, El-Dakahlia, El-Gharbia. and Minia Governorates. The results of this survey revealed the presence of characteristic symptoms of rhizomania syndrome. i.e., stunted, and constricted roots which developed prolifera...

A. E. Aboul-Ata, Mohga, M. El-Tahlawey, M. A. Amer and A.M. Mandour

...: justify;">Faba bean necrotic yellows virus (FBNYV) has been isolated and identified as an isolate of FBNYV from Egypt. FBNYV characterization was proved according to the following Criteria: Symptomatology, insect transmission (Aphis craccivora), serological tests (DAS-ELISA), PCR product for amplified replicase gene Of FBNYV (920 bp). Virus-vector relationship was recognized as follows: AAP is 2 hr. IAP is 0.5 hr. Latent period in the aphid is 18 hr. and ret...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

...fected trees develop chlorotic spots, rosetting, mosaic, chlorotic mottling, leaf deformation and shortening or the internodes (rosette appearance). The virus causes chlorotic local lesions on Chenopodium quinoa Wild. Ch. amaranticolor Cost&Reyn and N. tabacum L. cv. White Burley. It also causes local infection followed by systemic chlorotic leaf spo...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...ign: justify;">Apple Chlorotic Leaf Spot virus (ACLSV) was isolated from symptomless peach trees and then identified with a specific antiserum (Sanofi comp) using Double Antibody Sandwich ELISA (DAS-ELISA) and Dot Immunobinding Assay (DIBA). Survey was carried out during 2001 to 2003 in different locations on commercial peach orchards. Percentages of infection were 6.3, 6.7, 12.3 and 10.9 in Menofia (Khatatba) . EL-Behira (EL-Nobaria North Sinai (Rafah) and Da...

A-New-Whitefly-Transmitted-Geminivirus

...es showed that the coat protein and the replicase genes of putative TYMV-QaIubia are not identical to TYLCV resembled genes, at least at the flanking regions of each gene. According to the results obtained from the PCR products and indicator host plants, it can be concluded that they are two different Geminiviruses. Based on host range and symptomatology, the TYMV-QaIubia appeared to cause infections only to some species of the family Solanaceae, in contrast t...

M.A. Abo-EInasr l, Kh.A. EL-Dougdougl, M.H. El-Kattan2 and L.A. Salem2

...ogenous salicylic acid, proteins related to inducers and activity of peroxidase and chitinase enzymes. Salicylic acid (0.5%) and potassium sulfate (3%) gave the highest effect in inducing SAR. where the treatment with them had forbid disease symptoms, and virus concentration was (0), 25 days post inoculation. In addition, the biochemical changes reached to the maximum values. whereas other chemicals gave a medium ability to induce SAR and gave varied values.

Hanaa H.A.Gomaa1, A. F. Moustafal, Kh.A.El-Dougdoug2, A.A. Abou-Zeid3 and S. Y.M. Mahmoud4

...rch granules, and total protein. The nucleic acid content of infected plants increased than healthy ones. The investigated hydrolytic enzymes of amylase and protease were reduced in infected potato plants while the level of polyphenol oxidase and peroxidase was increased. PVX and PVY infected potato plants contained less auxins and gibberellins, and the pattern of growth promotors and growth inhibitors was altered. Cytokinin...

B. A. Othman; Kh. A. El-Dougdoug; M. H. Abdel Ghaffar and T. F. El-Arabi

... contained 6 structural proteins of 62.4, 60. 53.4, 50, 28, and 20 kDa; RM2 had 5 structural proteins of 60.4. 53.4, 50, 21.5 and 20 kDa: RM3 had 4 structural proteins of 60.4, 53.4, 50, and 21 KDa while RM4 had 3 structural proteins or 60.6, 53.4, and 50 kDa. The thermal inactivation points for the four phages were 68, 76, 80, and 64oC for the four phag...

Seham A. El-Zeedy1, Dalia A. Abd El-Moaty1, H. A. Hussein2 and M. A. Shalaby2

...es with different IBDV serotype I strains showed that isolate shared three unique a.a residues at positions 222A, 256I, and 294Ile that were found only in vvIBDV as well as the conserved serine rich heptapeptide region. Giza/2000 showed two additional unique a.a residues at positions 220Phe and 321Thr that resulted from two unique nucleotide substitution at positions 609 (A to T) and 911 (G to A). Surprisingly Giza/2000 shared the unique a.a residue at positio...

H.A. SULTANl, H.A. HUSSEIN2, and F.F. EL-KHAYAT3

...genic sites with other serotype-1 IBDV strains. as they cross-reacted in AC-ELISA and AGPT. Although, the epidemiological investigation and antigenic typing by AC-CLISA test as well as pathogenicity study suggested that IBD field isolates are in the majority of highly virulent pathotype producing acute disease with severe clinical picture. The current study presents evidence of two variant isolates existing in commercial broiler and native Baladi farms with hi...

M.S. Wassel1; Elham A. El-Ebiary1; Soliman, Y.A.l and El-Sayed, M.M.2

...er in animals using its protein analysis and Western blotting.

...

Arwa H. El -Naggar, Nirmeen G. Shafiek, and M. S. Wassel.

...fied by IFA to be Bovine rota. Separation of anti B. Rota immunoglobulins IgG "were done using activated Sepharose 4B followed by conjugation with fluorescein isothiocyanate at PH 9.6. The conjugated IgG was tested against reference B. Rota antigen using direct and indirect fluorescein assay (FA. IFA). Both assay gave good result as the working dilution of the fluorescein isothiocyana...

Maria Kikelomo Adegun1*, Femi Godwin Ekundayo1, David Daisi Ajayi2 

...est substances in total protein, globulin, total cholesterol, triglycerides, aspartate aminotransferase, and alkaline phosphatase. In all these except alkaline phosphatase, the animals fed 30% GSF and 70% UTCP (T4) fared better than the animals on other treatments. Therefore, when the grasses in tropical regions dry up during the prolonged dry season, sheep can survive on urea-treated cassava peels and Gliricidia sepium fodder. 

...

Anak Agung Ayu Sri Trisnadewi*, I Gusti Lanang Oka Cakra

...C. Dry matter and crude protein digestibility of treatment A was the lowest but the highest on nitrogen-free extract (NFE) compared to treatments B, C, and D. The crude fiber digestibility was highest in treatment C and significantly different compared to treatment A, B, and D. The nutrient consumption, digestibility of organic matter, crude fat, and total digestible nutrient (TDN) showed no significant differences in all treatments and tended to be the highes...

Sulake Fadhil Al-Zubaidi1*, Ghusoon A.A. Alneamah2, Ali Saleh Mahdi1, Abdulraheem Abduljalil Wali3

... PGF2α, Different protocols
...

Nurlan Akhmetsadykov1*, Tanatar Kydyrov2, Moldir Akhmetzhanova1, Gulnazi Akhmetova3, Maxat Berdikulov4 

...ns was carried out. The protein sequence was reverse translated to the nucleotide sequence, after which the gene was synthesized using solid-phase method. The gene fragment, encoding the GM6 protein, was inserted or cloned into the pET28 expression vector after synthesis. The obtained sequences were checked by sequencing for correspondence to the matrix molecule. For transformation E. coli BL21 (DE3) strain was used. To asse...

Zhengfei Wang1*, Chenchen Shen1,2, Yiping Zhang1, Dan Tang1,3, Yaqi Luo1, Yaotong Zhai1, Yayun Guan1, Yue Wang1 and Xinyu Wang1

...um/calmodulin-dependent protein kinase II and Na+/Ca2+ exchanger. As a whole, our study laid a solid foundation for further functional elucidations of olfactory molecular mechanism in Procambarus clarkii, and provided further insight for a better understanding of olfaction molecular mechanism in crustaceans.

...

M. Tariq Mushtaq1, Faisal Manzoor1, M. Ishtiaq1*, Mirza Abdul Qayyum1, Muqarrab Ali2, M. Akram3, M. Rafiq Shahid3 and Saleem Riaz1

...ides could be applied in rotation with each other to reduce insecticides resistance and combined attack of whitefly and jassid. However, it is recommended that integrated pest management approach using different control tactics for conservation of natural enemies, use of yellow sticky traps, botanicals, use of selective insecticides when needed could be the best strategy to overcome insecticides resistance problems.

...

Estabraq Hayder Khayoon, Ammar Ahmed Abdulwahid*  

...ide )ACR( displayed a neurotoxicity and alteration in behaviors. Curcumin (CUR) is useful in reducing behavioral flaws and restoring a normal body systems’ function. The goal of the current study is to evaluate the how the brain effected oxidatively by Acrylamide exposure and the ability of Curcumin to ameliorate the neurotoxicity. For this investigation, thirty mature male albino rats be used, (10/group), the control ...

Xiaojun Li

...ryptotanshinone and dihydrotanshinone had lethal effect on diamondback moth larvae, and the correlation coefficient was 0.972. Through further antifeedant test, it was found that diamondback moth larvae had obvious antifeedant behavior to acetone extracts of SIB represented by cryptotanshinone and dihydrotanshinone, and the correlation coefficient was -0.915. By further observing the influence of acetone extract of SIB on th...
Zeynep Karapinar1* and Mehmet Özkan Timurkan2
... the genus of Carnivore protoparvovirus 1. Feline panleukopenia virus (FPLV) and Canine Parvovirus (CPV-2), which causes the disease, are genetically closely related and show a high genomic similarity. Groups are formed according to the genomic differences of parvoviruses, especially in the VP2 gene. There are 3 groups as G1, G2, G3 in FPV and 3 groups as 2a, 2b and 2c in CPV-2. The present study aimed to determine the presence of infection, to perform molecul...

Farid S. Nassar1,2, Osama A. El-Sayed3, Saidi Ouassaf4, Ahmed O. Abbas1,2* 

...0.05). The plasma total protein and triiodothyronine hormone levels were remarkably (p < 0.05) enhanced by adding FS to broiler meals. At the same time, the concentrations of alanine transferase, aspartate transferase, and uric acid were significantly (p < 0.05) lowered. Additionally, the triglycerides were dramatically (p < 0.05) decreased while the high-density lipoprotein composed a higher proportion than the low...

Ahmed M. Manthoor, Ali H. Saliem* 

...ns, free amino acid and protein. While the gram staining, cultural characteristics, biochemical tests, Vitek 2 system and PCR tests referred to that bacteria was E. Coli. Bacteria was susceptible to the alcoholic extract of P. oleracea and gave an inhibitory zone 14-30 mm, while 15- 37 mm for ciprofloxacin. The MIC was 32 mg/ml for the extract and 25 µg/ml for the antibiotic. The MBC was 64 mg/ml for the extract and 50 µg/ml for ciprofloxacin. Fe-S...

Tabinda Nowsheen1, Sayed Wadood Ali Shah2, Ali Hazrat1*, Muhammad Yahya1, Gul Rahim1, Muhammad Mukhtiar4 and Muhammad Ajmal Khan3

...drates but deficient of proteins. In minimum inhibitory concentration assay, the crude methanolic extracts showed significant inhibition against all tested bacterial strains at25, 50 and 100 µg/ml. The methanolic crude extract of A. maritime various parts showed MIC of 37.5µg/ml for S. aureus which is gram-positive bacteria followed by 75µg/ml for P. aeruginosa, (gram negative), and B. subtilis (gram positive) that is nearly similar to the ac...
Rehan Ahmed Siddiqui1,2*, Shabana Usman Simjee2,3, Nurul Kabir4, Muhammad Ateeq3,5, Kevin Joseph Jerome Borges6, Muhammad Raza Shah3 and Rahman M. Hafizur2
...intact, decreased COX-2 protein expression, down-regulated the expressions of NFkB p50 and iNOS, and up-regulated Kim-1 and HO-1. The tested compounds (CA and CA-AuNPs) prevented the kidney from injury in the rhabdomyolysis-induced AKI animal models. However, almost complete protection is observed in CA-AuNPs treated animals at a relatively lower dose.

...

Skeikh Mustafizur Rahman1*, Mst. Shirin Sharmin Khan1, Yousef Ahmed Alkhamis2,3, Roshmon Thomas Mathew2, Md. Moshiur Rahman1, Mohammed Monirul Islam4, Md. Asadujjaman5 and Md. Golam Sarower1

...rce of heath-benefiting protein and other indispensable nutrients. This study aimed to investigate the proximate components (e.g. protein, lipid, moisture and ash) of eleven non-commercial marine fish species namely Johnius argentatus, Harpodon nehereus, Cynoglossus lingua, Johnius elongatus, Sillaginopsis panijus, Pomadasys hasta, Setipinna phasa, Megalaspis cordyla, Rita rita, Gonialosa manmina and Scatophagus argus obtain...

Julieta M Lopez-Martinez and Imran Ahmad*

...es such as high-quality protein, high content of fiber and micronutrients such as iron and calcium. Furthermore, amaranth seeds are a good source of phytochemical compounds with health-promoting effects such as squalene, phytosterols, and polyphenols. Amaranth seeds have gained popularity in recent years due to their perceived health benefits and dubbed as superfood. The food industry is formulating new products adding amaranth to cereal-based food and gluten-...

Wisnu Jaka Dewa1,2, Ekowati Handharyani3*, Sri Purwaningsih4, Silmi Mariya5 

.... Bax and Bcl-2 are two proteins that are involved in controlling the apoptosis process. This research aimed to quantify the expression of bax and bcl-2 gene in colon cancer cell WiDr treated with red snail ethanol extract 125, 62.5 and 31.25 ppm concentration. mesenggerRNA (mRNA) was isolated from WiDr cells using a commercial kit. The mRNA concentration was then measured with a UV-Vis microvolume spectrophotometer at 260/28 nm. Relative expression of bax and...

Ram Prasad Ghimire

....625±2.67% crude protein contents), voluntary fodder dry matter intake (74.40±10.12 g day-1 per kg metabolic weight of goat), apparent dry matter digestibilities of dry matter (54.96±4.77%), crude protein (57.73±5.97%), neutral detergent fiber (52.48±6.0%) and acid detergent fiber (39.29±4.18%) and for the body weight gain of goats (5.35±0.51 kg goat-1 in 120 days) among the i...

Theresia Nur Indah Koni*, Yeria Banoet, Welhelmina Wahon, Cytske Sabuna, Melkianus Dedimus Same Randu, Yanse Yane Rumlaklak, Tri Anggarini Yuniwati Foenay

...ays increased the crude protein content, and decreased the crude fiber and tannins of banana peels. The level of fermented banana peels had a significant effect (P<0.05) on body weight gain, feed intake but had no significant effect (P>0.05) on feed conversion. Body weight gain and feed intake of crossbred native chickens up to eight weeks of age, fed banana peels up to 20% were not significantly different (P<0.05) with control diet.
 ...

Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*

...oup, while serum plasma prothrombin time (PT) and activated partial thromboplastin time (APTT) were much shorter than those in the hypoglycemia group (all P < 0.05). Thrombus precursor protein (TpP), P-selectin (Ps), maximum platelet aggregation rate (MAR) and mean platelet volume (MPV) of patients in the hypoglycemia and hyperglycemia group were all higher than their counterparts in the control group, while those in the ...

Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*

...oup, while serum plasma prothrombin time (PT) and activated partial thromboplastin time (APTT) were much shorter than those in the hypoglycemia group (all P < 0.05). Thrombus precursor protein (TpP), P-selectin (Ps), maximum platelet aggregation rate (MAR) and mean platelet volume (MPV) of patients in the hypoglycemia and hyperglycemia group were all higher than their counterparts in the control group, while those in the ...

Xiangmei Chen, Burie Bao* and Mo Degema

... (GLUC3) as well as the protein expression and mRNA levels of sodium-glucose co-transporter 2 (SGLT2) and glucose transporter 2 (GLUT2) were used to study the mechanism of the hypoglycaemic effect of CPP on diabetic rats. We found that camel placenta produced no meaningful changes in the weight of hyperglycaemic rats or the weight of the liver, kidney, or pancreas. After STZ modelling, the blood glucose levels of rats noticeably increased. However, the blood g...

Faramin Javandel Soum Sarai1, Mir Daryoush Shakouri2* and Alireza Seidavi3*

...icant increase in total protein and a decrease in glucose, total cholesterol, and LDL cholesterol concentrations (P<0.05). All supplements significantly decrease mean corpuscular volume (MCV), percentage of heterophils and the ratio of heterophil to lymphocyte (H/L), and increased mean corpuscular hemoglobin concentration (MCHC) and white blood cells (WBC) (P<0.05). Addition of formic acid lowered the effect of chromium picolinate on performance paramete...

Siqiang Li1,2, Tiantian Wang1, Peng Sun1, Airong Gao1, Xin Gong1, Yuanhong Xu2, Baogen Wang2, Jun Wu1* and Bo Liu1*

...tation tank. The target protein was purified in three-step purification and identified by peptide mass of fingerprint. The enzymatic activity and optimal reaction conditions of MDS I were detected using DNA sequencer-assisted fluorophore-assisted carbohydrate electrophoresis. We obtained MDS I with a purity exceeding 90% in gram scales, which was capable of digesting α-1,2 linked mannose residues in high selectivity. The highest enzymatic activity of MDS...
Pratap A. Divekar1,2*, Sampat K Patel2, Guru Pirasanna Pandi G3, Manimurugan C2,4, Vikas Singh2 and Jagdish Singh1
... to manage DBM and CB on rotational basis in the cabbage ecosystem.

...

Afrasyab Khan1,3, Ali Raza Jahejo1,3, Meng-li Qiao1,3, Xin-yu Han1,3, Raza Ali Mangi1,3, Ding Zhang1,3, Yu-hai Bi2, George F Gao1,3* and Wen-xia Tian1,3*

...ferentiation-associated protein 5) IKBKE (inhibitor of nuclear factor kappa-B kinase subunit epsilon), NFKBIA (NF-kappa-B inhibitor alpha), NFKBIE (NF-kappa-B inhibitor epsilon), Interferon Alpha (IFN-α), cMGF (chicken myelomonocytic growth factor), and TRAF6 (Tumor necrosis factor receptor-associated factor 6) in chicken erythrocytes infected with M. synoviae using quantitative real-time PCR (qRT-PCR) at four different time intervals (0, 2, 6 and 10 h) ...
Yongtao Xu1, Dandan Wang1, Xiaolong Hu1, Minling Li1, Ming Tang1, Wuhua Liu2, Jianwen Zhan2 and Weiwei Zhang1*
... a Class I National Key protected wild animal and is an endemic species in the East Asian monsoon region. Although the species as a whole is thriving, it is endangered and locally extinct in many areas of China, and the South China sika deer (Cervus nippon kopschi) is one of three subspecies left in China. Diet analysis is one of the core contents in studying animal habitat requirements, and a study of their diet could provide valuable reference for species co...

Rehana Shahida1, Shagufta Naz1*, Tasnim Farasat1, Saima Sharif1, Shah Jahan2 and Farkhanda Manzoor1

...higher risk of atherosclerotic cardiovascular disease. The development and outcome of atherosclerosis are both influenced by vascular inflammation. The main purpose of this study is to find the impact of Interleukin-6 (IL-6) and thrombomodulin on vascular damage in the patients having impaired glucose tolerance (IGT) and to identify the relationship of IL-6 with insulin resistance. The patients visiting Amin Hayat Memorial Diabetic Center, Lahore from (January...

Riaz Alam1*, Muhammad Sajid2, Imtiaz Hussain3, Gulzar Ullah1, Hussain Shah3, Muhammad Arshad Farooq3 and Rashid Muhammad4

...) (0.43%) and a higher carotene content (2.70 mg L-1). These quality values fell within the established standards for extra virgin olive oil category by International Olive Council (IOC, 2003) except for the FFA levels in Ottobratica fruit ripe stage oil that met the criteria for virgin olive oil category. The semi-ripe stage fruits oil recorded maximum total phenols (530 mg kg-1) along with lower FFA percentage (0.25%) as well as POV (3.04 meq kg-1). In contr...

Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2

...tial, dietary elements (proteins, fat, ash), and more importantly, resistance against fusarium wilt and ascochyta blight compared to the existing varieties. The evolution of this strain commenced in 2002-03 cropping season by crossing K-90399 as a female parent with K-52582 as a male parent. The female parent had high yield potential, whereas the male parent had wilt resistance and was developed through introgression breeding using ILWC-126, an accession of Ci...

Eman Said El-Hadad*, Hesham Ahmed Madian, Mahmoud A.E. Hassan, Mohamed Fahmy Saad, Abdelghany M. El-Shhat, Entesar Zakaria Eliraqy

...arginine on hematology, protein and lipid profiles, renal, hepatic, and intestinal functions, antioxidant status, and immunity of heat stressed Egyptian geese. A total of 30 sexually mature ganders (local Egyptian male geese strain) with 10 months of age and 3.20±0.25 kg body weight was divided into three groups (10 birds/group). Ganders were kept under normal hot climate in summer of Egypt and fed ad libitum on a commercial mash diet (15.2% CP and ME o...

Pramudya Andiana*, Moch. Geerhan Miraja Syahdan, Khothibul Umam Al Awwaly, Abdul Manab

...ydrolyzing chicken head protein in terms of the physicochemical characteristics and bioactivity of the hydrolysate. A laboratory experimental method using a completely randomized design (CRD) was used in this research. In this study, chicken head protein was hydrolyzed using different combinations of bromelain (b) and papain (p), namely CHP (without hydrolysis); CHP1 (0.25% b and 0.75% p); CHP2 (0.5% b and 0.5% p); and CHP3 ...

Muhammad Akram1, Anirban Mandal2*, Mehwish Iqbal3, Arindam Mukherjee4, Ritika Bandyopadhyay5, Surendar Rangasamy6, Rida Zainab1, Muhammad Talha Khalil1, Pragnesh Parmar7 and Umme Laila1

...s. Ascorbic acid, beta carotene and lots of phenolics play active parts in decreasing inflammation, postponing aging, and averting certain kinds of carcinomas. There are some phenolic compounds such as tannins, flavonoids, vitamins and lignins derived from plants acts as antioxidants. In this review article, we discussed upon history of use of plants as medicine, role of plants in viral infections, and anti-viral effects of various plants.

...

Noor A. Namaa*, Hayder A.N. Al-Zamely

...s on the level of total protein in testicular tissues utilizing the two assays of Western blotting and Bicinchonic Acid. A total of 60 Wister rats were chosen, prepared, and divided equally into three groups: T1, T2, and negative control, which received only distilled water daily and no other treatment. T1 was given a daily dose of (500 mg/kg) of Ginseng extract, while T2 received a daily dose of 250 mg/kg of Ginseng NPs. After a 60-day experimental period, al...

Elly Roza*, Salam N. Aritonang, Yulia Yellita, Hilda Susanty, Rizqan

...h;8% fat and 4–8% protein compared to 3–4% fat and protein content in cow’s milk. Generally, the maintenance of dairy buffalo is still traditional, so the productivity of Murrah buffalo is still not optimal. This study aims to improve the health of Murrah buffalo by providing feed based on local forages to increase milk production. This research is an experimental study with the Latin Square Design (LSD), u...

Mahmoud Hamouda1*, Ahmed Al-Jazzar1, Fahad Al-Hizab1, Ahmed Azab2, Mohamed Al-Hammadi3

...was Klebsiella oxytoca, Proteus vulgaris, Proteus vulgaris and Enterobacter aerogenes. The conclusion is that uterine disorders play a crucial role in female buffaloes’ infertility. It is highly recommended to use specific clinical parameters and biopsy techniques for early diagnosis in order to proceed with the appropriate treatment.
 
Keywords | Buffaloes, Uterus, Infertility
...

Hossam F. Abou-Shaara

... one contained yeast as protein source (yeast), the second one contained corn flour (corn flour), and the third one contained corn flour plus turmeric (turmeric). These pollen substitutes were presented to bee colonies beside sugar candy without any protein source as a control group. Some parameters were subsequently measured under apiary and laboratory conditions. All feeding types were attractive to bee colonies but bees c...
Raza Ali Mangi1,2, Ali Raza Jahejo1,2, Afrasyab Khan1,2, Meng-li Qiao1,2, Muhammad Farhan Qadir1,2, Mazhar Hussain Mangi3,  Shi-xiong Yang1,2, Xin-yu Han1,2, Sheng Niu1,2, Ding Zhang1,2, Ying Wang1,2 and Wen-xia Tian1,2*
...transferase A3 (rGSTA3) protein on HDR and PRRs in the thiram-induced TD chicken. One hundred twenty arbor acres (AA+) broiler chickens of seven-day-old were equally divided into six groups. Group A, B, and C were treated with 0, 20, 50 μg.kg-1 of rGSTA3 protein, respectively. Group D, E and F were treated with 0, 20, 50 μg.kg-1 of rGSTA3 protein + thiram 100 μg.kg-1. The results ...

Peixia Yu1*, Lijun Bo2 and Xueyin Song1

...phoma 2 (Bcl-2) and Bax protein and mRNA expression were detected in the myocardial ischemia (MI) region. The HR and the MAP of the Fen group exceeded that of the I/R group, while the LVDP and ±dp/dtmax were approximate to the basic values. The MDA concentrations and CK-MB values of the Fen group went down and the SOD activity went up when was compared with the I/R group. Whereas, cTnI concentrations of Fen1 and Fen2 groups sharply decreased (all P<0...

Suhad Mohmmed Alrobyrai1 , Falah Muosa Al-Rekabi2*

...that have been shown to protect against various forms of oxidative stress and inflammation. This study explored the hepatoprotective effects of Alpha Lipoic Acid (ALA) and Tempol against subacutely repeated acetaminophen (APAP) exposure in a murine model. Fifty male Balb-c mice were divided into five groups. Groups received 700 mg/kg.BW of APAP and oral treatments: G1 (distilled water, negative control), G2 (no treatment, po...

Roni Pazla1, Mardiati Zain1*, Fauzia Agustin1, Yetti Marlida1, Zaituni Udin2, Jaswandi2, Masrizal2, Hendri2, Windu Negara3, Totti Tjiptosumirat3, Ezi Masdia Putri3, Multiviza Muslim4

...xt-align: justify;">The protein-energy ratio in Pesisir cattle diets plays a role in determining their productivity. We aimed to establish the most effective combination of crude protein (CP) and total digestible nutrients (TDN) in a ration to enhance the productivity of Pesisir heifers. We evaluated consumption, nutrient digestibility, production performance, and the percentage of first estrous in sixteen heifers at 12-15 m...

Roni Pazla1, Mardiati Zain1*, Fauzia Agustin1, Yetti Marlida1, Zaituni Udin2, Jaswandi2, Masrizal2, Hendri2, Windu Negara3, Totti Tjiptosumirat3, Ezi Masdia Putri3, Multiviza Muslim4

...xt-align: justify;">The protein-energy ratio in Pesisir cattle diets plays a role in determining their productivity. We aimed to establish the most effective combination of crude protein (CP) and total digestible nutrients (TDN) in a ration to enhance the productivity of Pesisir heifers. We evaluated consumption, nutrient digestibility, production performance, and the percentage of first estrous in sixteen heifers at 12-15 m...

Babi Kyi Soe1*, Toe Win Naing2, Su Lai Yee Mon1, Nay Chi Nway3, Hiroshi Sato4

...analysis, whereas total protein and albumin were low. To our best, this study is the first molecular evidence for the presence of Anaplasma marginale infection in cattle in Myanmar, with a sequence similarity range between 98.8 and 100%. By understanding one of the major tick-borne pathogens (TBPs) in Myanmar, possible control measures might be implemented not only to minimize the transmission but also to increase the farm productivity.
 

Junita Mayasari, Vira Oktavia, Indri Juliyarsi, Ade Sukma, Sri Melia*

 

...content, water content, protein content, viscosity, total lactic acid bacteria, and organoleptic tests. The results showed that adding porang flour to fermented goat milk significantly (P<0.05) decreased the total lactic acid bacteria total titrated acid increased the pH value, dietary fiber content, water content, viscosity, texture value, and color value. Still, it had no significant effect (P>0.05) on protein conten...

Irfan Ullah1, Asad Ullah2*, Tahira Tayyeb1, Rafiq Ullah1, Muhammad Hanif1, Faiza Khan3, Imad Khan2, Raheela Taj4, Fatima Syed4, Shumaila Gul5, Muhammad Sadeeq6, Muneeb Islam7, Arsalan Khan8 and Khudija Ghani9

...vel and low-density lipoprotein (LDL) in group B (positive control) was significantly higher (P≤0.00) than the group A (negative control) and Se supplemented group C, D and E. 

...

Moazama Batool1*, Saima Naz2*, Ghulam Abbas3, Ahmad Manan Mustafa Chatha4, Mamoona Mahmood1, Asma Aziz1 and Fatima Yasmin2

...meters, including total proteins, albumin and globulin, decreased significantly (p < 0.05). At the same time, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), glucose and cholesterol were significantly (p < 0.05) increased in the treated groups compared to the control group. In conclusion, the study indicates that exposure to cadmium chloride, even in a low concentration, can cause adverse hematological and bi...

Wahid Hussein El-Dabae*, Eman Shafeek Ibrahim, Eslam Gaber Sadek, Mai Mohamed Kandil

...e 20 SPF chicks and its protective efficacy was checked. Intracerebral pathogenicity index (ICPI) of the attenuated strain was 0.2, the mean death time (MDT) was 120 hours and infectvity titer was 7 log10 EID50/ml compared to 1.97 ICPI, 36 hours MDT, and 9.5 log10 EID50/ml of the original strain. The attenuated AOAV-1 was protective in vaccinated chicks by means of HI antibody response and prot

Diding Latipudin*, Chitra Kumalasari, Lovita Adriani

...d. Dried probiotics can protect kidney cells from stress and free radicals in late-phase laying hens, which can be demonstrated by normal levels of creatinine, uric acid, and urea, thereby increasing productivity. The treatment consists T0: basal rations, T1: basal rations + 100% CM dried probiotic, T2: basal rations + 75% CM + 25% fermented MBM dried probiotic, T3: basal rations + 75% CM + 25% SM dried probiotic, and T4: basal ration + 50% CM + 25% MBM + 25% ...

Zahid I. Mohammed

...increase in total serum protein, albumin, and globulin. Also, Spirulina caused a reduction in blood urea, cholesterol, triglyceride, LDL, ALT, AST and ALP enzymes concentration while there was increase in HDL.
 
Keywords | Albumin, Cholesterol, Goat, kids, Liver enzymes, Spirulina
...

Shirina Akter Toma1, Shah Ahmed Belal2, Md Abdul Baset3, Md Nazim Uddin3*

...ent hens contained more protein than broiler meat. The spent hen’s breasts had a pH that was noticeably higher yet the broiler’s cooking loss was greater. Overall collagen content was highest in the thigh and breast muscles of the spent hen but the concentration of soluble collagen in broiler meat was greater. The spent hen was distinguished from broilers by having more moisture and ash contents (except wing meat of broiler), better pressing loss a...

Yaseen1, Asad Ullah2*, Imad Khan2, Maryam Begum3, Sumbal Bibi3, Umber3, Namra3, Abbas Khan4, Shumaila Gul5 and Raheela Taj6

...ariety of pesticides to protect its crops. The use of pesticides has substantially increased in Pakistan over the last decades, which when reach the water bodies, adversely affect the rich biodiversity found in aquatic systems of Pakistan. This review discusses research over past decades regarding toxic effects of pesticides induced in edible freshwater fishes of Pakistan and future considerations.

...

Shahid Iqbal1, Arshad Khan, Ali Hazrat1*, Gul Rahim, Mohammad Ihsan1, Umar Zad Gul1, Maryam Bibi1, Khadija Bibi1 and Muhammad Mukhtiar2

...For total seed, storage proteins all the genotypes were subjected to SDS-PAGE analysis using 12.5% acrylamide gel, where a total of 14 polymorphic bands were observed. In Band 1 the highest degree of variation (0.83%), followed by Band 2 and Band 3 with a value of 0.75% variation, whereas the lowest (0.17%) was found in Band 12, followed by Band 14 with a value of 0.25% respectively. Based on two-way cluster analysis all the genotypes were divided into 2 main ...

Zhenglei Qiao*, Jie Xing and Fang Li

...ase pairs, including 13 protein-coding genes, 22 transport RNA genes, two ribosomal RNA genes, and one control region. The A+T content (59.7%) of the whole mitochondrial genome was greater than the G+C content (40.3%), indicating an obvious A+T preference. The mitochondrial genome of P. stoliczkana is similar to that of most teleost fish, and no gene rearrangements were detected. The phylogenetic relationship tree of Smiliogastrinae fish was constructed based ...

Tayfun Karatas1*, Betul Apaydın Yıldırım2 and Serkan Yıldırım3

... aimed to determine the protective effects of tea leaf extract (TLE) (Camellia sinensis) against cypermethrin (CMN)-induced toxicity in gill and liver of rainbow trout (Oncorhynchus mykiss). CMN exposure led to increase in aspartate aminotransferase (AST), serum alanine aminotransferase (ALT) and malondialdehyde (MDA) levels, and reduction in superoxide dismutase (SOD), catalase (CAT) activities, glutathione (GSH), total immunoglobulin (T. Ig), and white blood...
Sijie Jian1,2,3,4, Wei Sun1,3, Jia Chao1,2, Na Rong1,4, Xiang Liu1,2,3,4* and Chen Chen1,2,3,4*
... The outer membrane lipoprotein Slp of A. hydrophila has potential applications in fish vaccines. Slp bioinformatics analysis showed that anti-Slp serum might provide cross-protection to resist bacterial infection in fish. Slp was obtained by molecular cloning, expression and purification, and the expression conditions were optimized. In mice immunized with Slp, the immune-related factors of LZM and AKP were enhanced (p <...

Kenyum Lollen1, Judith Betsy C1*, Cheryl Antony2 and Stephen Sampath Kumar J3

... ratio using 3 freezing protocols with two step cooling profile in programmable freezer. The spermatological properties of milt obtained from non-induced fishes were superior which was further used for short term preservation. When experimented with dilution ratio, the highest motility duration of 74.3±2.16 s was obtained at 1:10 dilution ratio. The best results on motility duration (62.28 ± 2.12 s), fertilizing ability (77.3±1.63 %) and h...
Fen Wang1,2, Lin Zuo1,2, Xiang Zhou1,2, Zhu Chen1,2, Xiao Na Xu1,2, Suo Fei Ji1,2, Guan Jun Hou1,2, Cheng Jun Zhu2, Ye Zhang3, You Feng Su4, Gendong Jin5, Jia Jia Wang1,2, Yuan Gao6, Guang Tong Song1,2* and Ye Lin Jiang1,2*
...atic products with high protein and low fat contents. The amino acid contents in the muscle of type A were significantly higher than those of type B (P < 0.05), but no significant differences were observed in the calipash. Additionally, the amino acid score (AAS) in the muscle of type A was >1, which was significantly higher than that of type B (P<0.05). The contents of all fatty acids and EPA+DHA were significantly higher in Type A than in type B (P&...
Aatif Masood Ahmad Khan1, Masood Rabbani1*, Arfan Ahmad1, Muhammad Wasim2 and Sohail Raza1
...CR tests and classical serotyping were performed. Two types of swab samples were used, one for direct PCR detection and other for the conventional diagnosis procedure. All isolates were identified as Avibacterium paragallinarum and required nicotinamide adenine dinucleotide phosphate (NAD) for their growth. The isolates were typical for Av. paragallinarum as they were not able to ferment neither galactose nor trehalose. Performing PCR of direct swab samples pr...

Rondius Solfaine1, Faisal Fikri2, Salipudin Tasil Maslamama3, Muhammad Thohawi Elziyad Purnama4, Iwan Sahrial Hamid5*

... study investigates the protective effects of Lactobacillus acidophilus against the expressions of tumor necrosis factor-alpha (TNF-α) and interleukin-1 beta (IL-1β) in the pulmonary section of mice induced with canine coronavirus (CCoV) vaccine. The research utilized male mice (Mus musculus) aged two to three months, divided into three groups: a control group administered with normal saline (D0), a CCoV-induced group (D1), and a group induced with ...

Faris Sahib Imran1*, Layth Hamzah Merzah2, Mohammed Mohsin Kareem3

... in the sheep diet as a protein source at certain levels. The study was conducted in Karbala province, using the Al-Husseiniya River as the source of C. demersum. A total of 40 Awassi sheep were divided into two groups. The experimental group received a diet containing C.demersum as the primary protein source, while the control group had natural grass grazing as the basal diet. The results revealed that weight gain, final we...

Kalsoom Abdulrazaq1*, Bisma Arif1, Rimsha Mehboob2, Asma Mehboob3 

...cteria, fungi, viruses, protozoa, and other parasites. These pathogens have the ability to infect both domesticated and wild animals. Zoonoses involve interactions among a minimum of three species: an infectious agent and two host organisms, which can either be humans or animals. They can spread directly through contact with diseased animals, such as rabies, and through bites, or indirectly through exposure to contaminated surroundings and contaminated food. V...

Sandriana J Nendissa1,2, Meta Mahendradatta3, Zainal3, Februadi Bastian3

...n the water content and protein of tuna fish meatballs However, there is no significant difference on the sensory and total bacteria (p > 0.05) of tuna fish meat balls.  The best treatment, determined to be the addition of 2% Tomi-tomi fruit tannin extract concentration (C3), resulted in round and well-formed meatballs with a resilient texture and a distinct taste favored by the panelists. The water content measured at 52.63%, p

Feri Eko Hermanto1, Yuli Frita Nuningtyas1, Filoza Marwi1, Fajar Shodiq Permata2, Agus Susilo1, Muhammad Halim Natsir1*

... how these herbs confer protective effects remains challenging, given the intricate nature of mucosal immunity and its role in maintaining gut health. This study adopts a network biological approach to decode the complex web of protein interactions within mucosal immunity and explore the immunomodulatory potential of bioactive compounds found in these herbs. Biological networks were constructed for gut health and mucosal imm...

Shanti Fitriani*, Usman Pato, Yusmarini Yusuf, Emma Riftyan, Evy Rossi

...cted moisture, ash, and protein contents but did not significantly influence the descriptive test.   The best treatment in this study was B5 (the addition of bacteriocin 0.6%), which can maintain the quality of fishballs for up to 12 days at cold temperatures with a moisture content of 73.10%, ash 1.29%, protein 8.35%, and a descriptive test had a surface less smooth, slightly hollow and less bright, odour and tast...

Ediset1*, Jaswandi2, Fuad Madarisa1, Amrizal Anas1, Rizqan2

... availability of animal protein from buffalo can only be maintained by relying on an innovation-based maintenance system. This study aims to determine the level of adoption of Artificial Insemination (A.I.) innovations and the success rate of A.I. innovations in the buffalo farming business. This study uses a survey method and a secondary data analysis approach. The population is 100 buffalo breeders who have adopted the AI. innovation. In comparison, the numb...

ISHRAT FATIMA1, MOAZZAM JAMIL1, AZHAR HUSSAIN1*, MUHAMMAD ZAHID MUMTAZ2, MUHAMMAD LUQMAN1, SAJID HUSSAIN3, SAIF UR REHMAN KASHIF4 & MAQSHOOF AHMAD1

...o 65%, K up to 20%, and protein contents up to 20% as compared to uninoculated control. It is concluded that inoculation of ZSB strains like Bacillus sp. ZM20 and Bacillus aryabhattai ZM31 is an effective approach to improve the productivity of okra (Abelmoschus esculentus L.).

...

TAHIR IQBAL1, 2, UMER RASHID1* & MUHAMMAD IDREES3, 4

...omology of ORF3 encoded protein (ORF3P) of Pakistani novel aHEV (Pak naHEV) strain with a kinase 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophos-phokinase (HPPK) which participates in folate biosynthesis in bacteria. This finding is in agreement with the role of ORF3P as multifunctional protein modulating host cell signaling and gene expression to promote viral replication during infection.

...

ZOHAIB SAEED1, SHAHID IQBAL*1, UMER YOUNAS1,2, MUHAMMAD PERVAIZ*3, SYED MOHSIN ALI NAQVI3 & RANA RASHAD MAHMOOD KHAN3

...e chlorophyll content, carotenoid content, and protein content along with total biomass of the plant showed that the soil mixed with 20% sewage sludge showed maximum growth of the plant. Meanwhile, antioxidants like TPC, Ascorbic acid content and antioxidant potential (DPPH, ABTS, FRAP) were also measured and maximum values were found in 20% to 40% of sewage sludge. Hence, sewage sludge may be exploited for the useful purpos...

ZARYAB KHALID SIAL & FARAH KHAN

...m fields, therefore the protocol for PSTVd RNA isolation was optimized and improved for obtaining Pure and high quality RNA having an increased and nondegradable life from infected plants of Potatoes. The present study was aimed to confirm the presence and identification of potato spindle tuber viroid (PSTVd) on potato plants in Pakistan. RNA was extracted and purified using optimized Trizol reagent and RNeasy Miniplant Kit. The RNA obtained was converted into...

HIRA MUBEEN1, 2*, AMMARA NASEEM1, AMMARA MASOOD2, SHAHID RAZA3 & NAUREEN NAEEM3

...ic class of DNA binding proteins that act at particular site of DNA. Promoters are part of DNA fragment essential for transcriptional regulation of genes with certain transcription factors. These transcription factors could be useful in developmental regulation, interpretation and validation of candidate genes. This review highlights the importance of Cis-acting regulatory elements and transcription factors for regulation of gene expression. Furthermore, the u...

AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2

...biochemical attributes (protein contents, antioxidants enzyme activates). A decrease in seed germination percentage from 95.22 (at control) to 25.34% (at 120 mM salt stress) and shoot length from 86.12 (at control) to 42.36 cm (at 120 mM salt stress) was observed. Similar decreasing pattern of growth was observed in case of pot grown plants after 60 days. The results suggested that salt stress drastically reduced length of shoot and root, fresh / dry weight an...

Adriana Beatriz Sánchez-Urdaneta1,2*, Gisela del Carmen Rivero-Maldonado2, Cecilia Beatriz Peña-Valdivia3 and Dianelis del Carmen Sánchez-Urdaneta4

 

 

...while providing greater protection of the inner tissues. All of the above has applicability for the selection and cultivation of promising genotypes.
...
Jaime Vera Chang1, Arianna Torres Coronel2, Luis Vásquez Cortez2,3, Kerly Alvarado Vásquez2,3 and Frank Intriago Flor4*
 
...ix, pH, potassium, fat, protein, fiber and energy), sensory variables (flavor, color, taste, smell and texture). In the analysis of variance (ANDEVA) it is concluded that in the bromatological analyzes T2 contains the greatest amount of energy with a value of 403.57kcal/100g, in T1 a value of 0.46% protein was determined and in T4 8.51% mg/ potassium. 100 g were obtained; These variables are important indicators for an energ...

ASMA WAHEED QURESHI1* & SHUMAILA ALAM2

...uce (Lactuca sativa), carrot (Daucus carota), mint (Mentha spicata), chili (Capsicum frutescens), cucumber (Cucumis sativus) and corriander (Coriandrum sativum) were assessed using standard methods. Overall parasitic contamination of 30.7% was observed. Highest contamination was detected in Mardan (36%) followed by Katlang (30%) while the lowest contamination was observed in Takhat bhai (26%). Hookworm (32.6%) was the most c...

ASIFA BASHIR1, AAMIR MUSHTAQ2* & TOOBA MEHBOOB3

...osides, amino acids and proteins in crude extract with phenolic and flavonoid contents observed as 9.9 mg/g equivalent of gallic acid and 100 mg/g equivalent of rutin, respectively. Free radical scavenging activity by plant extract was observed as 68±0.33 % as compared to rutin (58±1.15 %) at concentration 2.56 mg/ml. Similarly, in vivo studies indicated that Phyllanthus emblica 80 mg/kg significantly reduced the glucose level in diabetic rats up...

*SHAJAHAN BAIG1, MUSHTAQ AHMAD SALEEM1, MUHAMMAD AZMAT ULLAH KHAN1 ZEESHAN NADEEM2, SUFIAN AHMED2, MEMUNA GHAFOOR SHAHID3 & TANZEEM AKBAR CHEEMA3

...rrays, metabolomics and protein profiling methods. These profiling methods are very useful but still studies on sensitivity, specificity and substantiation are needed. Furthermore, bioinformatics studies may be quite useful for the successful application of these profiling methods to analyze the safety of genetically modified (GM) foods. These bioinformatic methods employ the comparison of different linked databases which may cover all the information signific...

SIDRA MOQADDES*¹, RABIA ZULFIQAR1, MAWRA GOHAR1 & HINA QAISER1

..., Klebsiella spp. (9%), Proteus spp.(4%) and others (2%). Out of 85 samples (march-june 2015), 48(56%) were from females and 37(44%) from males. Samples were categorized into five age categories age and majority of the collected samples (42%) were found in age group of young adults (15-25 years) following elder adults (29%) and elderly (20%) respectively. Socioeconomic analysis of data revealed that maximum number of patients visiting hospital for UTI belongs ...

SAIMA SHARIF, SHAGUFTA NAZ, FARKHANDA MANZOOR, AYESHA NOOR & ZAHRA JAMIL

...d according to standard protocol after taking written consents. On the basis of body mass Index (BMI) subjects were divided into three groups normal weight (n=80), overweight (n=29) and obese (n=71). Respiratory function was measured by peak expiratory flow rate (PEFR) with the help of wright’s peak flow meter. Demographic data was presented as mean ± S.E.M. The level of significance was p ≤ 0.05. The average age of normal weight, overweight an...

ASMA ZAFAR*, MONIBA KHAWAR, MAHNOOR CHAUDHRY, SAYYEDA SANA BATOOL, AMJAD HUSSAIN** & MUSHTAQ AHMAD SALEEM

...products, and bacterial proteins are used to treat cancer. One of the amazing bacterial protein azurin can work as an anti-cancerous agent which only target cancerous cells and do not cause any harm to healthy cells and thus minimize the risk of adverse side effects. The interaction of azurin with P53 (tumor suppressor protein), Eph/ephrin receptor and Cadherin enhances the activity of azu...

AMBASH RIAZ1, SHAHID RAZA2* & HIRA MUBEEN3

...e production of Crystal protein. The present study is focused on the cloning and characterization of Cry1AB gene which expresses to produce crystal protein. Cry1AB gene was amplified using specific primers which gave successful PCR results of 3.5 kb long gene amplification. The amplified gene was further verified by inserting it into the expression vector. Furthermore, a computational approach was used to understand evolutio...
SHAHZADA NADEEM ABBAS1, KIRAN JAMSHED1, SARAH BUSHRA NASIR2,
SAMAN SHAHID3 & NASIR MAHMOOD4
...g). Specific laboratory protocols of antibacterial and antifungal assays were adopted. Absorbance of the broth bacterial culture was measured after 72 hours by using photo spectrometer at the wavelength of 600 nm (A600). For antifungal assays, the volume and concentrations of extracts used were 2 μl (250μg), 4μl (500μg), 8 μl (1000 μg) and 10 μl (1250 μg). The methanolic extract of Nigella sativa (1&m...

UROOJ SAEED1, SAJID RASHID AHMAD2, HAMMAD GILANI3*, RAB NAWAZ4, NAEEM SHAHZAD5, IRFAN ASHRAF6 & WAQAS AHMED QAZI3

...pport in plantation and protection of mangroves saplings. On the brighter side, in recent years Pakistan has taken enormous steps towards tree plantation under national (Green Pakistan Programme) and provincial (Billion Tree Tsunami in Khyber Pakhtunkhwa) initiatives. Through this study, we have proposed a cost-effective and convenient tree plantation-monitoring mechanism, which can be replicated over any plantation sites at diverse landscapes.

...

Uqba Mehmood

...="text-align: justify;">Proteolytic enzymes are characteristically produced by Bacillus species during sporulation and germination. The hydrolysis of spore proteins to free amino acids, is accomplished by proteases, in first 20 minutes of spore germination. The analysis of Spo mutants (strains which lack Sporulation (Spo) gene or have its inactive form) revealed that many of these strains ...

MARIAM AHMED, YESRA ARSHAD & HAMID MUKHTAR*

...11) is an extracellular protease having efficient ability to degrade keratin found in feathers and hair. It has various applications including leather, textile, pharmaceutical, detergent and animal feed industries. In current study, keratinolytic bacteria were isolated from the soil of poultry farm and different cultural conditions were optimized to obtain maximum enzyme yield. The isolates were initially screened by formation of zone of clearance on the skimm...

ZAHID FAROOQ1, IRFAN BABOO2, MUHAMMAD WAJID3, HAFIZA SADIA4, MUHAM

...rase, Creatinine, Total Protein and Albumin were determined. The overall biochemical blood values of Urea 282.06±37.18mg/dL, ALT 13.61±2.597 μL, AST 48.23±28.157 μL, Creatinine 61.04±12.658 mg/dL, Total protein 9.29±1.228 mg/dL and Albumin 2.44±0.108 mg/dL and were recorded. All these parameters between male and female were non-significant (p>0.05). As a pioneer work, these ...

SHEIKH AJAZ RASOOL1, MUHAMMAD SALMAN RASOOL2 & MUNAZZA AJAZ3

... is being tried against proteinaceous infectious particles (causing many transmissible neuro-diseases). These epigenetical agents have been a source of concern for our planet regarding food safety issues (e.g. infected meat). No doubt, man has made significant achievements in effective and neo-antimicrobials research, one wonders why not a single infectious agent has been completely knocked out. Our group has been focusing on ascertaining the basis of antibiot...

ASUMAN ARSLAN DURU1*

...basal diet (166 g crude protein and 2821 kcal ME kg-1). Feed was offered limited (110 g/hen) and water was available ad-libitum. The trial was continued for 8 weeks. At the end of the study, egg yield, egg mass, feed intake and feed conversion ratio of laying hens were not affected by treatments with the addition of GBL (P>0.05). Whereas GBL20 treatment reduced the yolk cholesterol level (P<0.05). GBL10 and GBL20 decreased egg shell thickness compared to...

MUHAMMAD AMJAD ALI1*, MUMTAZ AHMAD KHAN2, WAQAS AHMAD3, FAIZ-UL HASSAN4, SYED MUHAMMAD RAIHAN DILSHAD5, MIAN MUHAMMAD AWAIS1, MUHAMMAD IRFAN ANWAR1, MUHAMMAD RAZA HAMEED1 , MUHAMMAD ASHRAF SULTAN6 & HASEEB ANWAR7

...moglobin (Hb) and total proteins were also studied. Blood parameters such as RBC, Hb and total proteins were significantly different among dogs of both treatment groups. The changes in TLC values were insignificant amongst both treatment groups. Hypertonic colloid fluid can effectively be used as resuscitation fluid in medical emergencies.

...

*AMNA SHOAIB, AROOJ SHEZAD, ARSHAD JAVAID, SUNDUS AKHTAR & ZOIA ARSHAD AWAN

...ungal effect against Sclerotium rolfsii, the causal agent of collar rot disease in chickpea. In vitro, methanolic leaves extract of R. sativus significantly decreased pathogen biomass by 6-96% and three Trichoderma species also caused significant inhibition in pathogen growth variably between 30-100%. In potted soil, application of separate or combined application of myco- and phyto-fungicides proved highly efficient in mana...

Sri Wahjuningsih1*, Ani Atul Arif1, Khaerudin2, Herlina Pratiwi3, Ardyah Ramadhina Irsanti Putri1

...addition of 7% DMSO cryoprotectant. Then the semen was equilibrated at different times and then frozen. The frozen semen was then stored in a liquid nitrogen container at a temperature of -196°C.After 24 hours, the semen was thawing at a different temperature. The evaluation of semen quality included motility, viability, plasma membrane integrity, and acrosome integrity. All data obtained were analyzed with two way-analysis of variance. The result showed t...

María Julia Traversa1*, Mónica Saracco2, María Alejandra Colombatti Olivieri3, Fernando Paolicchi4, Edgardo Rodriguez5, Silvia Estein5, María Cristina Jorge5, William C. Davis6

... to the bovine purified protein derivatives (PPDb) caudal fold skin test and were transiting the early peripartum period (EPPp). Flow cytometry, interferon gamma (IFNγ) production, and metabolic activity assessed peripheral blood mononuclear cells (PBMC) stimulation. The study enrolled 19 Argentinian Holstein cows older than two years classified into four groups, one of PPDb reactors that transited the EPP period (PPDbEPPp) (n=5), another of PPDb reactor...

Deni Novia*, Indri Juliyarsi, Rizki Dwi Setiawan, Clara Mustika, Cindi Melani

...energy value, moisture, protein, fat, ash content, solubility, color (L*, a*, b*), and sensory evaluation of hedonic preferences and qualities. The results revealed that different drying times showed significant differences (P<0.05) in antioxidant activity, energy value, protein, fat, ash, moisture content, color (L*, a*, b*), and sensory properties, except for color attributes in the hedonic preference test. The longer t...

Jacob Situmeang1, Lovita Adriani1*, Deny Saefulhadjar1, Safri Ishmayana2

...a probiotic, yogurt has protease and lipase enzyme activity, which can increase digestive tract enzymes in laying hens. In this study, it is hoped that probiotics can increase protein levels and reduce lipid and cholesterol levels in chicken egg yolks. This study aims to determine the activity of the protease and lipase enzymes from yogurt and the effect and level of use of probiotic powde...

Putri Okta Shafura1, Mardiati Zain2*, Elihasridas2, Bima Bagaskara1, Ummi Amanah1, Laras Sukma Sucitra1, Bella Veliana Utami1, Roni Pazla2, Erpomen2, Ezi Masdia Putri3, Rusmana Wijaya Setia Ningrat2, Riris Delima Purba3, Ruslan Abdul Gopar3, Putut Suryo Negoro3

...nutrient digestibility, protozoan population, microbial protein synthesis, and methane gas production. The results revealed a significant impact (P < 0.05) of these treatments on nutrient digestibility and rumen fermentation characteristics. The combination of 0.5% S. cerevisiae and 0.3% sulfur tended to increase nutrient digestibility, total VFA production, and microbial protein synthe...

Anisa Mushtaq1, Murtaz ul Hasan1*, Asim Shamim2, Muhammad Ali Abdullah Shah1, Muhmamad Arif Zafar3, Abdul Asim Farooq4, Aayesha Riaz1, Muhammad Kamran1 and Saif ur Rehman

...acteria, rickettsia and protozoa and cause mortality in humans and animals. This study was focused on morphological and molecular identification of ixodid ticks, using morphological keys and an internal transcribed spacer (ITS-2) Deoxyribonucleic acid (DNA). Moreover, the presence of Babesia and Theileria species was also investigated in ticks using 18S rRNA gene. Identification of ticks collected from 384 cattle and 384 buffaloes screened revealed three tick ...

Pham Tan Nha*, Le Thu Thuy

...60% and 80% of fishmeal protein with larval protein (LP) in the control diet with four replications, each replication with 10 ducks (5 males and 5 females). The results showed that the weight gain of the LP20, LP40, and LP60 treatments was as high as the CTL treatment. The FCR of ducks at CTL treatment (3.40) and LP20 treatment (3.44) was significantly (P<0.05) lower than LP60 treatment (3.52) and LP80 treatment (3.59). I...

Laila Ibouzine-Dine1*, Inssaf Berkiks1,2, Mouloud Lamtai1*, Hasnaa Mallouk1, Ayoub Rezqaoui1, Abdeljabbar Nassiri1, Abdelhalem Mesfioui1, Aboubaker El Hessni1

..., Signaling pathways, Neurotransmitter and free radicals, Sex-dimorphic, Rat, Age, Brain
...

Muhammad Yusuf1*, Abd Latief Toleng1, Sahiruddin1, Masturi1, Hasrin1, Musdalifa Mansur2, Hendrikus Fatem3, Johan Koibur4

...asynch and Select Synch protocols. The study was conducted in Maiwa Breeding Centre (MBC) Farm of Hasanuddin University. A total of 18 dairy Holstein Friesian heifers were used in the present study. The heifers were then divided into two groups based on different treatments of estrous synchronization. All heifers were examined for ovarian activities prior to synchronize the estrus then subjected to either Heasynch or Select Synch prot<...

Wasan Ali Hasan1*, Manal Abdulkhaliq Ibrahim2 

...usion, famotidine has a protective effect against airway inflammation by the reduction of inflammatory cells and improvement in the histopathological picture. 

...

Srisukmawati Zainudin1,3, Hartutik2, Edhy Sudjarwo2, Osfar Sjofjan2*

...recommended as a source protein for local chickens.
 
Keywords | Fatty acid, Local chicken, Nutrient digestibility, Skipjack tuna, Omega
...

Nurcholis1*, Syetiel M. Salamony1, Abdullah Baharun2

... diluent affected sperm protection during the equilibration and cryopreservation processes, following Indonesian National Standard 4869-1:2021 frozen bovine semen. 
 
Keywords | Cryopreservation, Myrmecodia extract, Tris egg yolk, PO bull, Tannin, Protection
...

Nawab Ali1, Akeel Ahmed Memon1, Asmatullah kaka1, Amjad Hussain Mirani2, Muhammad Ibrahim Panhwar3*, Nisar Ahmed Solangi1, Kashif Ali Malik1, Fazul U Rahman1, Moin Akhtar Vistro1 

...nized using the Ovsynch protocol. Group A goats were inseminated with semen extended in a TEY extender without selenium supplementation (control) and group B goats were inseminated with 02 mM selenium supplementation. After 45 days of insemination, pregnancy was confirmed utilizing a transabdominal probe and real-time B mode ultrasonography. The results showed that group B had a significantly (P<0.05) higher conception rate (50%) than group A (30%). In conc...

Erika P. Grijalba-Bernal*, Fernando Rodríguez-Villamizar, Martha L. Chaparro-Rodríguez, Juan C. Ovalle, Martha I. Gómez 

...n emulsion that offered protection over time to its four constituent anaerobic probiotic bacteria (Butyrivibrio fibrisolvens B9, Streptococcus bovis C2, Fibrobacter succinogenes Fs, and Ruminococcus flavefaciens Rf). When it was stored over 6 months at 4ºC, a significant reduction (P ≤ 0.05) of viable cell counts, from 1.95 x 109 CFU/mL at time zero to 3.02 × 108 CFU/mL at 6 months, was noted; despite this, viable cell counts were never less than...

Waseem Abbas, Imtiaz Ahmed* and Imran Khan 

...qual to that of CB. The protein content increased “significantly in a dose-dependent manner with the increasing incorporation of these two herbs” when compared with the CB. When the carbohydrate content of both breads was compared, the functional bread had significantly lower values (p, for all trends < 0.05), respectively, as the ratio of incorporation increased. Total starch (TS) and DS reduced non-significantly at 1 and 2 % and significantly ...

Mehwish Zafar1, Muhammad Shahzad1*, Muhammad Zubair Akram2, Quratulain3, Mehak Shehzad4 and Samreen Nazeer5*

...lorophyll contents, and protein contents were noted in all condition in line L30 and L24 as compared other lines. High levels of potassium, calcium and magnesium and lowest sodium were noted in quinoa lines L30 and L24 aided in resisting salt stress and may be the cause of increased growth in both saline and non-saline soil. The present trial recognised the maximum salt-tolerant lines under severe salt stress, it might be applied to improve quinoa’s tole...

Safdar Hassan1, Shaukat Ali Bhatti1, Fawwad Ahmad1, Asad Ullah Hyder1, Muhammad Arslan2, Ashar Mehfooz3, Ijaz Saleem3, Muhammad Umar Yaqoob4,5, Mushrraf Nazir1, Muhammad Sharif1* 

...-soy diet (Zn-40, crude protein (CP): 20%; metabolizable energy (ME) : 3000 Kcal/Kg) was formulated to contain 40 mg/kg Zn. The basal diet was supplemented with three super doses viz; 25, 50, or 75% of NRC recommended (1994) level and then these diets (Zn-50; Zn-60; Zn-70) contained 50, 60, and 70 mg/kg Zn, respectively. Two hundreds day-old broiler chicks were used for this study. Each diet was fed to a group of 50 broilers (Hubbard, BW 40±3 g, mixed ...
Muhammad Atif Raza1, Muhammad Tariq Javed2, Muhammad Fiaz1*, Muhammad Shakeel3, Muhammad Shahbaz Ul Haq2, Amna Kanwal2, Syeda Maryam Hussain1 and Muhammad Zubair Siddiqi4
...in terms of total serum protein and lipid profile; total glycerides, very low-density lipids, high density lipids and total cholesterol. It was concluded on the basis of findings of current study that nanoparticles zinc oxide and copper oxide mixture (37.5 + 15 mg/Kg/d) was found optimum alternate to Florfenicol antibiotic against Salmonella gallinarum infection in broiler birds. Hence, Zinc oxide and copper oxide nanoparticles could be an adequate alternative...

Mercy Cuenca-Condoy1*, Lourdes Reinoso-García2, Juan González-Rojas2, Dionel García-Bracho3  

Muhammad Shuaib1*, Abdul Hafeez1, Woo Kyun Kim2, Aamir Khan3 and Abubakar Sufyan4

...nificantly higher crude protein during phases 1 and 2, while crude fiber during phase1 and 3 for the SH treatment groups. The crude fat had a significantly higher value for the control group than all SH treatment groups during all (three) phases. The ash amount was significantly higher in the 3 and 6% SH groups during phase 1 while 6% and 9% SH groups during phase 3 than in all other groups. The control group had (P<0.05) lower gut contents viscosity during...

Abeer Alahmari1,2*

... by toxins. Because the protective impact of myrrh resin on renal damage induced by alcohol intake has not been previously evaluated, this study was designed to investigate the in vivo antioxidant activity of aqueous myrrh extract (AME) on oxidative stress-dependent nephrotoxicity caused by ethanol in rats. Male Sprague‒Dawley rats orally received 40% ethanol (3 g kg-1) and were then orally treated with (500 mg kg-1) AME...
Fahad Shahzad1, Muhammad Tahir1, Abdul Hafeez2, Muhammad Shuaib2*, Muhammad Shahkar Uzair2, Abdul Jabbar3, Abubakar Sufyan4, Muhammad Aamir Khan5, Muhammad Ayaz5, Hameed Ullah5 and Hammad Ullah5
...inimum level of dietary protein and subtilisin protease enzyme on the performance and nutrient utilization in broiler chicks. Different levels of proteins with and without subtilisin protease enzyme were evaluated on the overall performance, carcass yield, and nutrient utilization. For this purpose, 3 proteins and 2 p<...

Javairia Shafi*, Kashifa Naghma Waheed, Zahid Sharif Mirza and Shaista Razaq

...g treatments. Feed ADC (protein) with duckweed at 30% inclusion level was significantly lower (P<0.05) compared to the other treatments. There was no significant difference in muscle composition of fish reared under the four treatments. Results of the present study showed that duckweed can be used to replace up to 20% of fish meal in feed of catla without any negative effect on fish growth or feed digestibility.

...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

... the role of C-reactive protein as a prognostic agent in Borrelia-positive dogs. For this purpose, twenty-four dogs of different breeds were used in the study. These dogs were found Borrelia positive on PCR and equally divided into four groups (n=6). Group A was treated with doxycycline @ 10mg/Kg, B with azithromycin @ 20mg/Kg and C with clindamycin @ 11mg/Kg, and D with amoxicillin @2mg/Kg. All drugs were administered orally in different forms, i.e., tablet, ...

Tanveer Jilani1*, Irfan Khan2, Asmat Salim2, Fareena Bilwani1, Bushra Moiz3 and Mohammad Perwaiz Iqbal1,4

... differentiated by this protocol can then be used to study normal and abnormal erythropoiesis.

...
Mouhamed Zakiou Kolawole Adissa Raimi1, Ghulam Hussain2, Nousheen Zafeer3, Faheem Ahmad1, Muhammad Irfan4, Anwar Ullah1, Imdad Kaleem1 and Asghar Shabbir1*
... possessing potent neuroprotective, antioxidant, and anti-inflammatory properties with no reported side effects can be a prospective candidate for an alternate remedial treatment of MS in animal model as well as in humans. In this study we established a new animal model (quail), to assess the synergistic efficacy of honey and black seed against demyelination within brain. A total of 35 male quails were used, among 10 were non treated and 25 were treated with 2...

Syed Makhdoom Hussain*, Hafiza Hina Shafqat, Muhammad Faisal, Mahnoor Saleem, Zeeshan Yousaf and Muhammad Amjad

...at (CF) (81.25%), crude protein (CP) (69.39%), and gross energy (GE) (71.74) were seen in VI-level diet and these results were statistically (p<0.05) different from all other test diets. However, the test diet-IV had the least digestibility value of nutrients, including CF (73.55%), CP (49.17%) and GE (65.96%). It was concluded that C. catla fingerlings showed improvement in growth performance, nutrient digestibility and body composition when fed plant mixt...

Zhenkun Zhao1,2, Ziniu Alimo2, Xinyue Zhao2, Haifen Qin1, Buddhi Dayananda3, Lichun Jiang1,2* and Wei Chen4*

... 37 genes, including 13 protein-coding genes, 22 tRNAs, 2 rRNA gene fragments, a control region (D-loop region) and gene arrangement was identical to that of other Passeriformes mitogenomes. The overall base composition included A, 29.34%; C, 32.50%; G, 14.82% and T, 23.34%. The motifs obtained by sequence comparison, “ATGAACCTAA” between ATP8 and ATP6, and “ATGCTAA” between ND4L and ND4, and “CAAGAAAGG” between COXI and tRN...

Gokarna Gautam1*, Hari Adhikari1, Bhuminand Devkota1, Subir Singh2

...rug Release) in Ovsynch protocol for the treatment of anestrus in buffaloes during low breeding season (April to June). Buffaloes in Group T1 (Ovsynch, n=25) received GnRH on a random day (d0),  PGF2α on d7, GnRH on d9, followed by fixed timed artificial insemination (FTAI) at 16-20 hours after second GnRH. Buffaloes in Group T2 (CIDR-synch, n=30) were treated as in group T1 except that a CIDR containing 1.9 gm progesterone was inserted into the vag...

Umair Ahmad1*, Asad Sultan1, Sarzamin Khan1 and Muhammad Tahir2

...of ginger-derived phyto-protease on production performance, gut health, immunity, and nutrient digestibility of broilers fed a high level of poultry by-product meal-based (PBM) diet. A total of 320-day-old broiler birds were assigned to four dietary treatments CON, N-CON, GPP1, and GPP2. CON a commercial corn-soybean meal-based diet as per ROSS-308 nutritional specifications. N-CON was a 6.5% PBM-based diet and to this group, a ginger-derived phyto-p

Marah Salim Hameed1, Ali Ibrahim Ali Al-Ezzy2*

...n of antioxidant, nephroprotective and immunomodulatory activity of vitamins C and E -sodium selenite in mice intoxicated with sodium nitrate. Thirty healthy adult male mice of 25-30gm body weight divided randomly into six groups (5 mice/each) administered the following daily for 2 weeks, respectively: Vitamin E -sodium selenite 0.5 ml/LDW(T1); vitamin C (0.5 gm/L (T2); NaNO3 0.5gm/L (T3); NaNO3 (70 mg/kg) and vitamin E -sodium selenite 0.5 ml/L (T4); NaNO3 [7...

Dio Fico Felsidan Diatmono1, Seraphina Kumala1, Pradita Iustitia Sitaresmi2, Stefani Winda Paramita1, Megawati Andi1, Yustina Yuni Suranindyah3, Diah Tri Widayati1*

...s immediately for total protein, cholesterol, glucose, and blood urea nitrogen (BUN) levels assay. The spectrophotometry method used for biochemical data using specifics enzymatic were used. Feed samples were analysed using proximate method to determine dry matter (DM), crude protein (CP), and total digestible nutrient (TDN) intake. The data results were analysed using Independent Sample T-Test and the correlation between bl...

Hayder S. Rwayyih*, Tahani S.S. Al-Azawi

...s designed to study the protective role of ALA on some biological cardiac markers include creatinine phosphokinase, C- reactive protein and troponin and histology of heart and aorta in intact and ovariectomized rabbits. Twenty rabbits, aged seven to eight weeks, were employed in this investigation. The animals were split up evenly into the following four groups: The intact rabbits in Group One (G1) were given distilled water...

Abdelghafour El-Hamzaoui*, Mouloud Lamtai, Laila Ibouzine‑Dine, Sofia Azirar, Mohamed Yassine El-Brouzi, Ayoub Rezqaoui, Aboubaker El-Hessni, Abdelhalem Mesfioui

... underpinnings of the neurotoxic effects observed following exposure to GBH.

...

Ahmed Kareem Kadhim Al-Wasmee1, Waddah Salam Hassone2, Hawraa Talib Al-Janabi3, Hamed AH Al-Jabory1

...ulata, a tick-borne hemoprotozoan parasite that result in a tropical theileriosis in bovine herds and causes significant economic losses in the cattle sector. We estimated and interpreted the frequency of theileriosis in the calf herds in Babylon Province. We carried out the study from July until the end of December 2022 in several regions of Babylon Province. Ninety jugular vein blood samples were collected. The calves ranged from <1 M to ≥4 M and both ...

Noura K. Al-Suwailem1, Nancy N. Kamel2, Ahmed O. Abbas1,3*, Farid S. Nassar1,3 , Dalia A.A. Elsayed4, Gouda F. Gouda1,5, Hosam M. Safaa6

...Meanwhile, plasma total protein, cholesterol, triglycerides, creatinine, urea levels, and liver enzymes activity were significantly (P<0.05) increased. The carcass yield and meat quality showed significant (P<0.05) deterioration in response to heat exposure. MLM administration to the basal diet significantly enhanced blood metabolite levels, hematological parameters, antioxidant activities, carcass yield, and meat quality in broiler chickens exposed to H...

Aspen Abutalip*, Batyrbek Aitzhanov, Assiya Mussayeva, Vladislava Suchshikh, Natalya Yegorova

..., antibodies to surface proteins associated with the flagellar antigen Clostridium chauvoei were used, which sensitised latex microparticles with a size of 0.8-1.1 microns from Thermo Fisher Scientific Corporation. In the process of testing the prepared diagnostic system with vaccine strains of the causative agent of emphysematous carbuncle used for active immunisation of animals in Kazakhstan and field experiments with biological material from sick and deceas...
Yanis Cruz-Quintana1*, Ana María Santana-Piñeros1, Byron Manuel Reyes-Mero1, Leonela Griselda Muñoz-Chumo1 and Lenin Cáceres-Farías1,2 
... normal;">Ectoparasitic protozoa of the genus Trichodina are considered one of the main pathogens affecting cultured fishes, mainly in small organisms or early ages. However, its incidence and effects on Amazon traditional aquaculture species such as Piaractus brachypomus has been little studied. The objective of the present investigation was to establish the presence of Trichodina heterodentata, its parameters of infection, and associated...

Evy Rossi1*, Fajar Restuhadi1, Raswen Efendi1, Yusmarini1, Rahmayuni1, Emma Riftyan1, Bisma Panca Winata2, Yolanda Ashara2, Usman Pato1

... of 84.18–86.12%, protein content of 3.52–3.78%, a fat content of 3.34–3.38%, pH 4.72–5.05, titratable acid (TTA) 0.74-1.24%, total lactic acid bacteria (LAB) 7.69–12.07 log CFU/mL, viscosity 285.15–2417.9cP, and Syneresis 0.00-0, 14%. Yoghurt made using fresh cow’s milk (FCM) had the following characteristics: water content 84.02–86.18%, protein content 3.43–3.74%, fat c...

Muhammad Ali Raza1*, Aneela Zameer Durrani2, Bilques Bano3, Muhammad Muddassir Ali4, Nazia Rubab5, Syed Tasadak Mehdi6, Muhammad Wasim Iqbal7, Kumay Hassan Akhtar8, Aqeel Raza9, Ujala Fatima Shan10, Muhammad Aftab11

...utritional food rich in proteins and other essential minerals. Poor quality milk having Antibiotic Resistance resides threat to one health. Antibiotic Resistance is the main issue that affects the livestock, humans and environment. Antibiotic Resistance occurs due to the use of excessive amount of antibiotics for the growth and development of livestock. 90 samples of each weigh about 50 grams have been collected from Lahore and brought to University of Veterin...

Bilal Atta1*, Arshed Makhdoom Sabir1, Muhammad Dildar Gogi2, Muhammad Asif Farooq3, Muhammad Ijaz1, Tahir Hussain Awan1, Muhammad Ahsin Ayub4, Muhammad Usman Saleem1, Amara Nasiba1

...e observations can help protect rice crops from significant damage. 
 
Novelty Statement | The novelty of this study lies in its investigation of the effectiveness of light traps for early detection and management of rice insect pests. By analyzing population data spanning multiple years, the study provides novel insights into the temporal dynamics of six specific insect species, highlighting their...

Muhammad Adnan Khalid1, Syed Makhdoom Hussain1*, Shafaqat Ali2,3*, Abdullah Ijaz Hussain4, Muhammad Asrar1, Nisar Ahamd5, Majid Hussain6 and Muhammad Zubair-ul-Hassan Arsalan7

...ustry to produce animal protein but its growth is impeded by the cost of fishmeal, an optimal protein source for fish health. In this study, we examined the feasibility of various biochar supplements with Moringa oleifera seed meal (MOSM). Six iso-nitrogenous and iso-energetic diets were prepared: Control (without biochar) and diet II (parthenium biochar), diet III (farmyard manure biochar), diet IV (poultry waste biochar), ...

Saira Jabeen1, Muhammad Avais1*, Jawaria Ali Khan1, Kamran Ashraf2, Aftab Ahmad Anjum3

...nted vaccine. Challenge protection assay revealed that Montanide and aluminum adjuvanted vaccines had 100% survival rate among rabbits compared to 16.7% of placebo group. It was concluded that newly developed E. coli (aggR) mastitis vaccines have promising results to combat E. coli mastitis in dairy cows. 
 
Novelty Statement | This research presents a novel approach to combating E. coli mastitis i...

Jinzhao Li1, Yawen Zhang2, Binghan Jia1, Yuqiong Zhao1, Huijuan Luo1, Xiaojie Ren1, Yuan Li3, Xiaoyan Bai1, Jing Ye3 and Junping Li1*

...r396-tau, P-Ser404-tau, protein kinase C (PKC), p38 MAPK (p38), p-p38 MAPK (p-p38) and µ-opioid receptors (MORs) in the colonic samples. The gene sequencing approach was used to detect alternatively spliced tau isoforms in the distal colonic muscle layer. Sequencing analysis revealed that 3 isoforms of tau, namely 2N4R, 1N4R and 0N4R were expressed in the distal colonic myocardium tissue. OIC rats had small, dry and hard feces, and intestinal propulsion ...

Yan Wang1,2*, Lin Liu3, Na Li4, Yijun Zong1, Wei Liu1, Wenhua Xu1, Qi Wang1, Peijuan Zhang1 and Huiling Feng2,5*

... was used to detect the protein expression of proteins. RT-PCR was used to detect the mRNA expression level of genes. Cell proliferation was discovered using the CCK8 test and plate cloning. The impact on the cell cycle was examined by using flow cytometry. The production of glycolytic enzymes and the significance of LY6K in the development of lung cancer in naked mice were both noted. The effects of LY6K knockdown on glucos...
Sanaullah Sattar1, Ali Hussain1,2*, Javed Iqbal Qazi2, Arshad Javid1 and Shahid Mehmood1
... for devising corrosion-protecting strategies.

...
Danish Riaz1,2, Syed Makhdoom Hussain2*, Majid Hussain3, Muhammad Zubair-ul-Hassan Arsalan4 and Eman Naeem2
...y explored and serves a protective function against gut pathogenic microorganisms. The purpose of this study was to examine the effects of supplementing Catla catla fingerlings fed a diet including sunflower meal (SFM) with probiotics (Protexin®) on growth performance, nutritional digestibility, and hematological indicators. Six test diets and one control diet (0 g/kg) were formulated before the beginning of the experime...

Md. Khayrul Basher1, Sumon Sarkar2,3, Md. Samiul Haque1, Sourav Sarker4, Md. Rashedul Islam1*

...emale mice assessed the protective effects of Na-selenite against arsenic-mediated hematological, biochemical, and organ development toxicities. In this study, adult female mice (Swiss Albino) were categorized into four groups namely control, NaAsO2, NaAsO2+Na2SeO3, and Na2SeO3 (10 µm NaAsO2 and 10 µm Na2SeO3, respectively) were orally administrated via drinking water up to 60 days of the treatment period. Then the hematological, biochemical parame...

Hanita Fadhilla1, Shafia Khairani1,2*, Ahmad Fitrah3, Wendi Prameswari4, Nur Purba Priambada4, Indri Saptorini4, Imam Arifin4

...al trade. Despite their protected status, slow lorises are often hunted using air rifles. This study aims to evaluate the effects of air rifle wounds in slow lorises, identify hot spot areas for improved habitat protection, and develop standard operating procedures for veterinarians in rehabilitation centers. From 2015 to 2022, 16 individual cases of air rifle shot to slow lorises were documented by Yayasan Inisiasi Alam Reh...

Asmahan M.S. Lashein1, Al-Kazafy H. Sabry2 and Mahmoud M.A. Youssef1*

... 25,12.5 and 6.25ppm, spirotetramat at 50,25 and 12.5 ppm and methoxyfenozide at 120,60, and 30 ppm in biocontrolling root- knot nematode, Meloidogyne incognita infecting eggplant (Solanum melongena L.) cv. Baladi i.e. at the recommended and other two lower concentrations. The tested materials at the highest concentrations were more effective in reducing nematode criteria than the other concentrations compared to untreated control. The moderate and highest con...

Muhammad Rafiq,1 Amna Shoaib,1 Arshad Javaid1

...number of persistent sclerotia on tubers, while the
current conventional practices against diseases are limited and are associated with toxicity
and resistance. Botanical fungicides have shown enormous antifungal potential against
many sclerotial forming phytopathogens. In the present study, methanolic root extract of
Sonchus asper was assessed for its antifungal activity again...

Arshad Javaid, Amna Ali, Iqra Haider Khan and Amna Shoaib

...and yield.
...

Khalid Ali1, Asif Tanveer1, Naila Farooq2, Tasawer Abbas3*, Ghulam Sarwar2, Muhammad Ather Nadeem4, Ishtiaq Hassan3, Muhammad Mansoor Javaid4, Anees-ul-Hussnain Shah5, Bilal Ahmad Khan4 , Ali Raza6

Haroon Khan1*, M. Mubassir Khan1, Bakhitar Gul1, M. Fawad1 and Imtiaz Khan1

...uinalis (14.87), Cyperus rotundus (12.96) and Euphorbia prostrata (5.12). Parthenium hysterophorus L. an invasive alien weed was recorded in almost all the sites with a density of (2.6 m-2) in the non-field areas particularly, followed by (0.85 m-2) in field crop and (0.8 m-2) in orchards and with a mean density of (1.42 m-2) and a relative density of (1.52%) across all locations. Similarly, another invasive weed Broussonetia papyrifera was recorded in the non...

Shazia Shafique1, Sobiya Shafique1 and Sonia Sahar1

...thogens. In pot trials, protective assays proved more pronounced in controlling the disease. The work concludes that organic extract of T. serpyllum has stable compounds which have the ability to inhibit the damaging properties of pathogens. This fact guides towards biocontrol using such plants against the phytopathogens in a vast range. The study can be extended to isolate and purify the compounds and its production on commercial scale to manage these pathoge...
Haseeb Ahmad1*, Muhammad Shafi1, Waqas Liaqat1, Muhammad Faheem Jan1,
Shahzad Ahmad2 and Muhammad Farooq3
...ces i.e. chisel plough + rotavator, mouldboard plough + rotavator,
cultivator + rotavator and rotavator were assigned to main plots. Weeds management
practices include control, hoeing 15 days after sowing, hoeing 15 and 30 days after sowing,
hoeing 15, 30 and 45 days after sowing, and herbicide (Nicosulfuron) were kept...
Kamran Ahmed Pathan1 , Waheed Ali Panhwar1,*, Abdul Manan Shaikh1, Safdar Ali
Ujan1, Javed Ahmed Ujan1, Khadim Hussain Memon1, Irfan Ahmed Pathan1 and
Shabana Mangi1
...1878) and
Macrotoma crenata (Fabricius, 1801), were recorded as new record from Sindh Province.
While Archopalus exoticus (Sharp, 1905), Dorysthenes hugelii (Redtenbacher, 1848) were
reported first time from Pakistan. Additionally, the association of various plants with the
species is provided for the first time. This study will be a baseline for the future research
associated with longhorn beetles.

Iqra Haider Khan1, *Arshad Javaid1 and Nadeem Shad1

...anol was evaporated on a rotary evaporator.
Thereafter, water was added to the residues and the aqueous mixture was successively
partitioned with n-hexane, chloroform, ethyl acetate and n-butanol. Different concentrations
of each fraction were prepared which ranged from 1.562 to 200 mg mL-1. Antifungal activity
was carried out in malt extract broth medium. In general, all the c...

Shabnam Javed1, Amna Shoaib2 and Zaid Mehmood1

...like carbohydrate, ash, protein, moisture
content and fat, along with carbon, hydrogen, nitrogen and sulphur were analyzed in whole
plant of S. tomentosa. The results revealed the occurrence of considerable proportion of
carbohydrates (52%) and protein (23.80%). Moisture, fat and ash contents were found in
small amount i.e. 6.25%, 2.02% and 0.20%, respectively. Elemental analys...

Afrah Adil Hassan1*, Hawraa F. H. Alowaid1, Majdy Faisal Majeed2 

...nvestigate the combined protective effects of Chrysin (Chy) and Ginkgo biloba (Gnk) against the bioaccumulative toxicity of Pb+2 on histological liver profiles and antioxidant enzyme activities in male adult rats. Adult male Wistar rats (250±10 g) were divided into four groups: group I (n = 6) served as the control and received 2.5 mg NaCl/kg/day as a sodium chloride solution, group II (n = 6) received 2.5 mg/kg/day as lead chloride solution orally, gro...

Journal of Animal Health and Production

October

Vol. 11, Iss. 3, Pages 234-329

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe