Submit or Track your Manuscript LOG-IN

Souvik Ghosh, Nobumichi Kobayashi

British Journal of Virology
...ere viral diarrhea in infants and children. Although studies on the genetic diversity of the antigenically important RVA VP7- and VP4- protein encoding genes are important for vaccine development or judging the efficacy of existing RVA vaccines, they do not always provide conclusive information on the overall and complex genetic makeup of RVAs, as the remaining 9 RVA gene segments are also susceptible to the forces governing RVA genetic diversity. Whole genomi...

Lei Chen, Ling Zhu, Zhi-Wen Xu, Wan-Zhu Guo

 

Molecular Genetics of Aichivirus C (Porcine Kobuvirus) in China
...ins and Aichivirus C variants are circulating in China. Recombination events were also observed in Chinese Aichivirus C strains. More further studies are needed to clarify the evolutionary features and pathogenicity of Aichivirus C.

 

...

Simon Mwangi Kihu1*, George Chege Gitao1, Lily Caroline Bebora1, Njenga Munene John1, Gidraph Gachunga Wairire2, Ndichu Maingi1, Raphael Githaiga Wahome1, Davis Njuguna Karanja1, Julius Otieno Oyugi3, Ernest Lutomia3

...

Peste des petits ruminants (PPR), an economically important morbillivirus infection of sheep and goats, is widely distributed in Middle East, Central and South Asia, China and Africa. Whereas PPR antibodies were first reported in Kenyan small stock as early as 1995, the clinical disease was observed later in 2006 following dramatic and devastating PPR outbreaks in Turkana County. In this context, an outbreak of PPRV was observed in Tukana County in 2011 and...

Muhammad Arif1, Fazal Jalal1, Mohammad Tariq Jan1, Dost Muhammad2

...egumes produced taller plants and high number of grains ear-1. Nitrogen application increased plant height, number of grains ear-1, thousand grains weight, grain and biological yield. It is concluded that integration of biochar and legumes could be a useful strategy for enhancing the overall farm profitability and productivity of cereal-based systems by providing increased yields from this additional ‘summer gap’ crop.

...

Shahid Ali, Munir Khan

...y levels and its determinants. Maximum likelihood estimation (MLE) technique was applied to estimate stochastic frontier Cobb-Douglas production function to ascertain the level of technical efficiency. The econometric computer software STATA was applied for the estimation. The estimated value of technical efficiency ranges from 34 to 88 per cent for the farms in the sample, with an average of 62 per cent. This means that if the average farmer in the sample was...

Michael Shermer

...quiz: What did the assailants shout after murder- ing 17 people in Paris in January, 2015, including edi- tors and cartoonists of the satirical publication Charlie Hebdo?


A. “Moses rocks!”
B. “Jesus saves!”
C. “Vishnu lives!”
D. “Buddha avenged!” E. “Atheists rule!”
F. “Allahu Akbar!”

...

Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4

...

Peste des petits ruminants virus (PPRV) causes a highly contagious disease in both domestic and wild small ruminants, and in camels. Based on sequence analysis of the nucleoprotein (N) gene, the PPRV has been classified into four lineages. Serological investigations in Tanzania indicate that peste des petits ruminants (PPR) was introduced in 2004 in Ngorongoro district bordering Ken- ya...

Muhammad Zahid1*, Muhammad Salman2, Shah Alam Khan2, Alamzeb1, Inamullah Khan1

 

...oved to be the best toxicants, which showed synergistic effect in Bordeaux mixture (Copper oxychloride 75g + Lime 3kg + water 10L) in reducing borer infestation (exit holes/ gum points) in the month of January.

 

...

Suresh V Kuchipudi* and Kin-Chow Chang

 

...ral infections which warrants further in-depth investigations.

 

...

Hu Zenglei1 and Xiufan Liu1, 2*

 

...one of the major determinants for the clinicopathological manifestations in infected hosts. Recent studies showed that the host innate immune responses to infection play important role in the pathologenesis of NDV, and correlate with the severity of the clinical disease. Virulent strains of different genotypes induce distinct pathological manifestations in chicken organs, especially in lymphoid tissues. Genotype VIId of NDV, which is currently endemic in many ...

Hayat Badshah1*, Farman Ullah1, Abid Farid2, Ahmad-U-Rahman Saljoqi1, Sajjad Ahmad3

...ae), on different host plants. Such studies would identify the best host plant for its efficient rearing. The present study investigated some basic life table parameters i.e. female life span, adult female weight, longevity and reproductive potential of P. solenopsis on okra (Abelmoschus esculentus Linn.), brinjal (Solanum melongena Linn.), potato (Solanum tuberosum Linn.), China rose (Hibiscus rosa-sinensis Linn) and tomato (Lycopersicon esculentum Mill.). Th...

Muhammad Nawaz Kandhro*, Habib-Ur-Rehman Memon, Muhammad Ali Ansari, Ahmed Naqi Shah

...tween two rows of crop plants was pulverized with the help of local tool spade. The statistical analysis of data showed that interculturing, Dual Gold, and sorghum and sunflower water extracts caused significant reduction of weeds and increased seedcotton yield as compared to weedy check. The combined application of sorghum @ 15 L ha-1+ Dual Gold @ 1.25 L ha-1 resulted in weeds mortality upto 66.6%, produced seedcotton yield of 3961.4 kg ha...

Luca Vitale

..."text-align: justify;">Plants are often exposed in their habitat to multiple abiotic and biotic stresses that limit growth and productivity; however, plants are able, to some extent, to cope with limiting environmental conditions by means of different mechanisms that contribute to their adaptive success in different habitats.

...

Stephen Kershnar

Email: stephen.kershnar@fredonia.edu

... reading for anyone who wants to think seriously about the topic.

...

Rodolfo Villagra-Blanco1*, Gaby Dolz1, Danilo Montero-Caballero2, Juan Jose Romero-Zuniga2

...V in goats and wild ruminants, and to identify serotypes present in the country.

...

Mohammed A. Rohaim1*, Rania F. El-Naggar2, Abdulrahman M. Gamal3, Elshaimaa Ismael3, Mohamed M. Hamoud4, Sherif T. Moubarak3, Ashraf M. Metwally1, Manal M. Zaki3, Shimaa A.E. Nasr3, Samah Elsaid3, Mohamed M. Ali3, Hussein A. Hussein1 and Osama K. Zahran3

Email: mohammedvet1986@gmail.com; mohammed_abdelmohsen@cu.edu.eg

...ceptible to all disinfectants because they are enveloped viruses. Disinfection against avian influenza viruses at the poultry farms would significantly reduce and/or limit the chance for its transmission and outbreaks. Many disinfectants have been evaluated for their inactivation ability, but there is still a need for their evaluation under different conditions and in different ways. In the present study, repr...

Claudia Kohl*, Andreas Nitsche, Andreas Kurth

Email: kohlc@rki.de

...e all the fish, ducks, plants, fungi, bacteria and everything else that belongs to the lake. If we apply this approach to clinical samples we can identify the community of etiological pathogens, without any knowledge on the targets in advance. However, clinical specimens usually comprise an overwhelming amount of host nucleic acids, which by far exceeds the number of pathogen nucleic acids in the sample. Subsequently, it is necessary to either decrease the amo...

Mudasir Irfan Dar*, Fareed Ahmad Khan and Farha Rehman

E-mail | irfanmudasir@gmail.com

...ted. Forty-day-old pot plants were exposed to different concentrations of the insecticide, ranging from 0 to 40 grams active ingredient per hectare (g.a.i ha-1) through foliar spray. Analyses were done at days 3, 7, and 15 after treatment. Lipid peroxidation rates and contents of proline, ascorbate (ASC), glutathione (GLU), antioxidative enzymes; superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) were assessed...

 Nagina Zeb, Muhammad Sajid, Abdul Mateen Khattak and Imtiaz Hussain

... maleic hydrazide, the plants grown under control treatment took minimum days (112.9) to flowering, maximum plant height (47.06 cm) and number of leaves (57.89) plant-1. Maximum fresh flower weight (47.85 g) and dry flower weight (5.80 g) was observed with 1500 ppm maleic hydrazide. The interaction between “potassium” and “maleic hydrazide” showed significant effects for some of the growth parameters. It can be concluded that potassium ...

Ali Mohammadi, Mohammad Hossein Ebrahimi

...vailable and applied implants, none of them was evaluated by motion analysis system. It has been shown that severity of pain and overall function of knee joint were improved following the use of this implant. Although it has been mentioned that KineSpring knee implant is an effective method to relieve pain and improve function in Knee OA, there are incomplete evidences to support this claim. Therefore, it is recommended to perform high-reso...

Rongfei Lu1, 2, Zhiyang Liu1, Peng Fang1, Guangyi Chen1, Feng Sun1, Yongjian Fan1, Yijun Zhou1, Tong Zhou1*

Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6

...ive strand RNA-virus variants causing neurological and behavioral disorders in a wide range of mammalian animals, possibly including humans. Viral persistence in the brain has been frequently observed, however, the exact mechanisms behind BDV’s ability to establish persistence despite a prominent immune response are not known. Here we have used in situ proximity ligation assay (in situ PLA), a selective tool for studying virus-host protein-protein intera...

Khalid Ali1*, Amanullah Jan2

... DAS) and parts (whole plants incorporation and stubbles incorporation) under varying nitrogen levels (0, 75 and 100 kg ha-1) on physiology, yield and economic returns of Canola (Brassica napus L. cv. Bulbul-98). The experiments were laid out in randomized complete block design with split plot arrangement having three replications. Findings of the experiment revealed that guar as previously green manuring crop considerably increased leaf area index (LAI) 4.4, ...

Ashley C. Banyard1* and Satya Parida2

...Peste des petits ruminants virus causes an economically important disease of small ruminants that causes extensive livestock losses across areas where it is endemic. Further the recent description of the disease in naïve populations of animals have demonstrated an expansion of the distribution of the disease. Having been in the shadow of rinderpest virus for decades little is understood regarding factors that inf...

Vinayagamurthy Balamurugan*, Gurrappa Naidu Govindaraj and Habibur Rahman

...Peste des petits ruminants (PPR) is an acute, highly contagious, notifiable and economically important transboundary viral disease of sheep and goats. PPR is enzootic in India as more number of outbreaks have occurred in the past and now occurring regularly, round the year and most frequently during the lean period throughout the country. In some Indian states viz. Andhra Pradesh, Karnataka, and Chhattisgar h the PPR outbreaks in sheep and goats have de...

Moustafa Kardjadj1, Pam Dachung Luka2

...Peste des petits ruminants virus (PPRV) causes an economically important plague of sheep and goats that serves as a major constraint in the development of the small ruminant’s production within an infected area. The virus is endemic across much of the developing world and has spread into the developed European borders. The small ruminants industry within an infected state or region is often disproportionately af...

Gurrappa Naidu Govindaraj, Vinayagamurthy Balamurugan*, Habibur Rahman

...Peste des petits ruminants (PPR) is a highly contagious viral disease in small ruminants causing huge loss to farmers. In this study, an attempt has been made to estimate the economic losses based on the annual incidence, morbidity, mortality levels etc. derived from literature, discussion with experts, and based upon scientific facts. Different mathematical models were used to assess the losses due to mortality in yo...

Ahmed Zein Mahmoud1, Muaz Abdellatif 2, 3*, Luai Shazali1

...of peste des petits ruminants (PPR) virus antibodies in sheep, goats and camels at Hail, Bagaa, Shenan and Ghazalah, Saudi Arabia. Serum samples (n=400), collected during 2012–2013 from sick and clinically healthy herds, were subjected to antibodies detection using c-ELISA. Out of examined animals, 83 (62.9%) goats and 70 (33.2%) sheep were detected positive against PPRV antibodies, whereas camels appeared to be seronegative. Based upon the seasonal vari...

Amitha Reena Gomes1, Belamaranahally Muniveerappa Veeregowda2, Sonnahallipura Munivenkatappa Byregowda1, Vinayagamurthy Balamurugan3*

...Peste des petits ruminants (PPR), a viral disease of goats and sheep caused by a morbillivirus of the family paramyxoviridae is a major threat to small ruminant farming. Global announcement of PPR eradication by 2030 has opened lot of research gaps for the development of vaccines and diagnostics for differentiating infected and vaccinated animals. With the advent of recombinant DNA technology, recombinant protein based vaccines and/or diag...

Klara Fischer1*, Erika Chenais1,2, Emeli Torsson1, Jonas Johansson Wensman1

...e des Petits ruminants (PPR) is a potentially lethal, highly contagious viral disease of sheep and goats. Domestic sheep and goats are important species for the livelihoods of poor people in many developing countries. Within societies where PPR is now spreading, poverty is widespread and the disease is expected to have significant negative impacts on livelihoods. In resource-constrained marginalised societies, it is often difficult to collect diseas...

Ali Tahmasebi1, Parvin Raji1*, Mostafa Kamali2

...nment. Out of 30 participants in the study, 15 children were with spastic diplegic CP with mean age and body mass index of 7 ± 1.3 years and 14.70 ± 1.73 kg/m2 respectively and 15 normal children with mean age and body mass index of 7.2 ± 1 years and 14.83 ± 1.57 kg/m2. Children were instructed to stand with bare feet for 60 seconds on a 5-cm-thick piece of foam which was placed on a Kistler force plate with their Eyes Open (EO), Ey...

Mohammad Mushfiqur Rahman1, Rokshana Parvin1, Ataur Rahman Bhuiyan1, Mohammad Giasuddin2, Shah Md. Ziqrul Haq Chowdhury3, Mohammad Rafiqul Islam1, Emdadul Haque Chowdhury1*

 

...Peste des petits ruminants (PPR) is an acute and highly contagious viral disease of small ruminants. The disease is endemic in Bangladesh and causes considerable economic losses due to its high morbidity and mortality. The study was undertaken to detect and characterize the PPR virus (PPRV) circulating in Bangladesh. Twelve local isolates of Bangladeshi PPRV were successfully detected from post mortem samples (lymph n...

Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4

...e des Petits ruminants (PPR), possibly caused by the introduction of new animals in the herd, was investigated in an unvaccinated mixed herd of sheep and goats. Goats in the herd showed characteristic signs of PPR including nasal and ocular discharges, high temperature, diarrhea and ulcerative lesions in the oral cavity. A total of eighteen goats from a herd of sixty, were affected and two goats succumbed within two weeks. Interestingly, the disease...

Murad Ali Khan and Mohammad Akmal 

...ws spaced at 70 cm and plants spaced within the rows at 20 cm and (b) 90 x 15.5 cm with rows spaced at 90 cm and plants spaced within rows at 15.5 cm. It is important to mention here that 70 cm is the recommended row spacing used for sunflower crop in the region. Experiments were conducted in randomized complete block design, replicated four times. Results showed no significant changes in yield traits i.e. plant density (m-2...

 Inamullah Khan, Muhammad Subhan Qureshi, Rajwali Khan, Syed Muhammad Sohail, Ijaz Ahmad, Muhammad Shoaib and Asim Ijaz

...ers, 15 veterinary assistants, 15 veterinarian and 40 butchers were also screen out. Overall sero-prevalence in cattle was 15.36% on SPAT, 14.39% by i-ELISA and 14.14% through PCR. Higher prevalence was recorded in abattoir shops (31.01%) followed by private farms (11%) and animal selling points (9.25%). Significant difference was recorded in different breeds i.e. achai, local non-descript and crossbred (non-descript x jersey) cattle. Higher prevalence in fema...

 Mukhtiar Ahmed, Jana Pickova, Taufiq Ahmad, Muhammad Liaquat, Abid Farid, Muhammad Jahangir

...th of consumers. Antioxidants and chelating agents are the most helpful inhibitors of lipid oxidation.

...

 Muhammad Nawaz Kandhro, Qamaruddin Jogi, Mahmooda Buriro, Aijaz Ahmed Soomro, Ghulam Mustafa Laghari and Ali Nawaz Khaskheli

 

...lopathic properties of plants is thought to be an effective and environment-friendly approach for weed management. A pot experiment to evaluate the allelopathic potential of leaves of Eucalyptus camaldulensis (L.) against Convolvulus arvensis (L.) and Cyperus rotundus (L.) was undertaken during summer 2011. The study was conducted at Department of Agronomy, Sindh Agriculture University, Tandojam, Pakistan. The experiment was laid out in three replicated comple...

Amtul Jamil Sami1*, Madeeha Khalid1, Sara Iqbal1, Maira Afzal1 and A.R. Shakoori2

...olymers or mineral coagulants.

...

Sayeda Sarah and Muhammad Ibrar

... soil of control (RP0) plants, which decreases progressively with increasing fertility level. Less number of spores and percent root colonization was found at high RP level (RP100) in all hybrids. Higher P doses declined the sporulation and colonization. There was total seven AMF species that were observed and recorded. The dominant genus was Acaulospora which was followed by Glomus, Sclerocystis and Gigaspora. The average AMF spore density ranged from 56-260 ...

Hina Fatima, Muhammad Azeem Khan, Mahreen Zaid-Ullah, Abdul-Jabbar, Khurram Nawaz Saddozai

...most influential determinants of the technical efficiency in both NonBT and BT- cotton farms. Extension of cotton production required the development of cottonseed that will be suitable for environmental conditions of Pakistan.

...

Hassan Tarik Atmaca

...>| Peste des Petits ruminants (PPR) is a highly contagious and economically devastating viral disease of small ruminants and camels, and thus is negatively affecting the livelihoods of poor people in many developing countries. Efforts are being made to advance our understandings on different aspects of molecular biology of the virus and to consolidate national and international strengths to eradicate the disease from the pla...

Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek

...d giving vigour to the plants. In laboratory experiment, L. muscarium was the most effective against nematode eggs (95.6%) and second stage juveniles (J2) (95.8%) infection. In greenhouse experiment, similar trend was found. L. muscarium proved to be more effective against M. hapla whereas S. rugosoannulata and C. rosea showed better results among other tested fungi in experiments. Moreover, plant growth parameters were also ...

Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek

...ers of eggs per cyst warrants that nematicides were able to penetrate into cysts. Reproduction rate (Pf/Pi) of L. muscarium treated plants was documented minimum as compared to that of control but slightly higher compared to that of treated with nematicides. More interestingly, plant growth parameters including shoot and root were tremendously improved in L. muscarium treated plants than t...

Felwa A. Thagfan1, Mohamed A. Dkhil1,2* and Saleh Al-Quraishy1

...e of the commonly used plants in Islamic countries.The root extracts of S. persica has been tested for its anticoccidial activity against Eimeria paillata induced infection in mice jejunum. Three different doses, 300, 600 and 900 mg/kg were used after infection of mice with sporulated oocysts. A dose of 300 mg/kg reduced the number of oocyst output in mice faeces by about 56.8 % and also improved the body weight. In addition, the root extract dec...

Safdar A. Wahocho, Tanveer F. Miano, Noor U.N. Memon and Niaz A. Wahocho

...CBD design. The zinnia plants were grown under four photoperiodic treatments which included T1=Natural photoperiod (Control), T2=4 hours daylight (8 am -12 noon), T3=6 hours daylight (8 am – 2 pm) and T4=8 hours daylight (8 am – 4 pm). The results revealed significant (P<0.05) photoperiodic effect on all the growth and quality traits of Zinnia. The Zinnia grown under 8 hours daylight (8 am – 4 pm) with 38.29 cm plant height, 6.61 side bra...

Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1

...e aforementioned antioxidants downregulated most of the elevated parameters compared to the APAP-treated group. Treatment with the combination of CUR and THQ was the most effective therapies in the attenuation of liver injury assessed by a decrease in ALT and ALP activities down-regulation of Bax and CD68 expressions. It was concluded that the combination strategy of THQ and/or CUR may be considered as a potential antidote in combating liver injury indu...

Haidar Ali, Malik Muhammad Shafi and Himayatullah Khan

...ds (Owners, Owner-cum-tenants and tenants) was selected using random sampling technique and data were collected through a pre-tested interview schedule. This study is focused on two selected districts of Peshawar and Charsadda. Four villages were studied two each from the sampled districts. Analysis showed that owners (59.31 percent off-farm employment) were performing more off-farm jobs than the ten...

Iqra Mahmood1, Asif Nadeem1*, Masroor Ellahi Babar2, Muhammad Muddassir Ali1, Maryam Javed1, Aisha Siddiqa1, Tanveer Hussain2 and Muhammad Tariq Pervez2

...the genes, and their variants, involved in innate immune responses is essential for the understanding of this inflammatory disease and to identify potential genetic markers for resistance to mastitis. This article presents a systematic integration of complex biological interactions of 226 mammary gland genes to uncover underlying regulatory networks. Data were collected from various databases after having an exhaustive literature study. Network, functional and...

Ai Ming Zhou1,2, Guang Wen Liang2, Ling Zeng2, Yong Yue Lu2 and Yi Juan Xu2*

...raction between invasive ants and honeydew-producing hemipterans has been extensively examined in many studies. Laboratory experiments showed that invasive ant Solenopsis invicta (Hymenoptera: Formicidae) suppress ghost ants Tapinoma melanocephalum (Hymenoptera: Formicidae) through interference competition. However, relatively less testing have been done to evaluate the competition for mutual exploitation between the two ant...

Sadiq Hussain, Muhammad Sharif, Sarmad Khan, Fazli Wahid, Hina Nihar, Wiqar Ahmad, Imran Khan, Nadeem Haider and Tabassum Yaseen

...rmicompost treatments. Plants P uptake of 0.09 g and 0.08 g pot-1 were found in mycorrhizal inoculation along with full and half doses of vermicompost, respectively. Maximum concentration of Zn (0.7 mg kg-1), Cu (0.164 mg kg-1), Fe (1.0 mg kg-1) and Mn (1.63 mg kg-1) were noted in mycorrhiza inoculated treatments with recommended dose of vermicompost and these were statistically at par with treatments receiving mycorrhizal inoculation along with half and full ...

Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

...her in the non-treated plants than those that were treated. The root quality of the fungus-treated plants was significantly improved. All fungi conclusively proved to be effective against H. schachtii and need to be further investigated at the molecular level.

...

Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

...i) was observed in the plants treated with L. muscarium compared to the control. However, all chemical nematicides were also effective in reducing the nematode infestation significantly (P=0.05) in soil compared to the control, but there was no significant difference (P=0.05) among them. Plant growth was significantly (P=0.05) improved in the plants treated with L. muscarium.

...

John Gachohi, Simon Karanja, Salome Wanyoike, Nduhiu Gitahi, Salome Bukachi, Kenneth Ngure

...and transmission determinants for urban Leptospirosis in developing countries. This study aims to source dynamic ecological and epidemiological field parameters to describe a slum household-based pathogenic Leptospira population dynamics simulation model. The model will be analyzed to assess the role of slum-based biotic (human and animal) and abiotic (soil, water and weather) habitats in Leptospira propagation. Influential habitats would serve as key targets ...

Süleyman Kök1*, Sertaç Atalay1, Hasan Semih Eken2 and Mustafa Savaşçi3

...r to sort the allele variants (G/C), PCR products, the ones in CAST with RsaI enzyme, was cut using RFLP method. The allele variants (G/C) of CAPN1 316 and (C/T) of CAPN1 4751 were determined with ARMS-PCR method. This study was conducted to determine three SNPs which were related to meat quality in 130 purebred female and male samples of TGC breed. In TGC samples, C allele frequencies related to UoG-CAST, CAPN1 316 and CAPN...

Jose M. Rojas, Noemi Sevilla and Veronica Martin

...;">Peste des petits ruminants virus (PPRV) is the causal agent of a highly contagious disease that affects domestic and wild small ruminants, Peste des petits ruminants (PPR). Due to the important economical losses caused by this virus in Africa and Asia, the development of more effective, targeted and successful treatments for the disease are necessary. Like other Morbilliviruses, PPRV in...

Dallin D. Oaks and Cynthia L. Hallen

...the vital nature of covenants. As part of the discussion, the metaphor of restoration is identified as the overarching Mormon metaphor to which the others are subordinate.

...

Zafar Waheed, Khalid Usman, Iftikhar Ali

...eat + Rumex dentatus 0 plants m-2 (T1), wheat + Rumex dentatus 05 plants m-2 (T2), wheat + Rumex dentatus 10 plants m-2 (T3), wheat + Rumex dentatus 15 plants m-2 (T4), wheat + Rumex dentatus 20 plants m-2 (T5), wheat + Rumex dentatus 25 plants m-2 (T6), and wheat + Rumex dentatus 30...

Shazia Irfan1*, Asima Rani1, Muhammad Arshad2 and Razia Bashir1

...uced activity of antioxidants enzymes because of polymorphisms in antioxidant genes and variations in levels of metals and minerals creates oxidative stress may play some role in progression and pathogenesis of RA. The objective of this study was to investigate the role of Superoxide dismutase 1 (SOD1) gene polymorphism [rs2070424 (–251A/G)] in RA and to compare the levels of metals and minerals among its various genotypes in RA patients. A total of 400 ...

Iram Liaqat1*, Najma Arshad2, Muhammad Arshad3, Safdar Ali Mirza4, Nazish Mazhar Ali1 and Ammara Shoukat1

Sidra-Tul-Muntaha1, Muhammad Sagheer1*, Mansoor-ul-Hasan1 and Shahbaz Talib Sahi2

...t high concentrations. Plants were effective in order of Azadirachta indica > Melia azadirach > Pegnum hermala > Salsola baryosma> zingiber officinale; whereas effectiveness of pyrethroids was in order of deltamethrin > cypermethrin > bifenthrin. The findings of this research will be helpful in organic storage of pulses by integrating the reduced risk pesticides with plant extracts.

...

Muhammad Saeed* and Iftikhar Hussain Khalil

...from transgressive segregants recovered in latter generations.

...

Aziz-ul-Rahman, Farooq Yousaf, Naveed Anwar and Muhammad Abubakar

...;">Peste des petits ruminants virus (PPRV) causes an economically important disease of small ruminants that causes extensive livestock losses across areas where it is endemic. A serological survey on the prevalence of antibodies to PPRV was carried out in sheep and goats of Jatoi and surrounding areas in Muzaffargarh districts South Punjab of Pakistan. A total of 965 serum samples were collected from sheep and goat’s f...

Ahmed Zein Mahmoud, Muaz Abdellatif and Ahmed Abdalla

...both domestic, wild ruminants and camels. Sera from non-vaccinated sheep (n=683), goats (n=624) and camels (n=155) of all ages and sexes were collected in a cross-sectional study in Hail, Bagaa, Shenan and Ghazalah. Saudi Arabia. The seroprevalece was determined by NP-epitopes based competitive ELISA. The overall prevalence was 59.9%, goats had a significantly higher sero-prevalence of 75.3% compared to 59.4% obtained from sheep, whereas camels were seronegati...

Salma Shaheen, Mumtaz Khan, Muhammad Jamil Khan, Saleem Jilani, Zarina Bibi, Muhammad Munir and Mehwish Kiran

 

... quality. Therefore, warrants further testing under field conditions.

...

Zamarud Shah, Safdar Hussain Shah, Asad Jan and Gul Shad Ali

...ulating heat stress in plants. Tobacco (Nicotiana benthamiana) was transformed with heat shock transcription factor HsfA1d by transfecting leaf discs with Agrobacterium strain GV3101 carrying CaMV35S-YFP::HsfA1d construct. After PCR and confocal-based confirmation, HsfA1d overexpression lines (OX1, OX2 and OX3) were evaluated for their response to heat stress. Overexpression lines on average showed 33.26% less electrolyte leakage after induction of heat stres...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahimand Ghada Kamal El Khalafawy2,*
...two poultry processing plants represented broiler carcasses swabs and worker (hand swabs and nail scrapings). Phenotype-based methods for identifying yeast especially Candida species are often difficult, time-consuming and not enough to identify most yeast species. . Molecular biological techniques provide a useful alternative approach. Concerning with genotypic identification, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was a...
Kiran Afshan1*, Sarwat Jahan1 and Mazhar Qayyum2
...is in sera of small ruminants. The result of current study indicated diagnostic accuracy of test 95.6%, while sensitivity and specificity of this assay for small ruminants was 97.83% (95% CI: 92.35% to 99.67%) and 93.75% (95% CI: 87.54% to 97.44%) respectively. In field this test indicated significant (p<0.05) values for sheep as compared to goat indicating high risk of infection in sheep. The current study showed that co...
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
...i>M. incognita. Eggplants inoculated with nematodes only served as control. Each treatment was replicated tenfold. Data were recorded after one week interval up to five weeks to record different developmental stages of M. incognita. After each harvest, neemex in combination with G. mosseae proved the most effective as the development of nematode was adversely affected. Developing juveniles and adults were less in number in the combined treatm...
Amjad Islam Aqib1, Muhammad Ijaz1,*, Aneela Zameer Durrani1, Aftab Ahmad Anjum2, Riaz Hussain3, Saba Sana2, Shahid Hussain Farooqi1, Kashif Hussain1 and Syed Saleem Ahmad1
...ea. Risk factors determinants were found significantly (P<0.05) associated with mastitis occurrence except frequency of milking per day. Antibiogram of Staph. aureus indicated very strong resistance to oxacillin, ticarcillin, ampicilline, amoxicillin, azlocine, chloramphenicol, mupirocin, vancomycin, cefixinme, cefuroxime, and cefotaxime. In contrast to this sulphaphenazole, gentamicin, amikacin, and ciprofloxacin were highly sensitive. Piperacillin,...
Fazal Said1,Mian Inayatullah2 and Hussain Ali3*
... due to less number of plants with blooms and less availability of pollens and nectar on flowers. Maximum seed production as well as oil contents was obtained from sunflower plots kept under natural conditions, where bee visitors had access to sunflower blossoms. In contrast, sunflower plots covered with insect-proof bags gave minimum seed production and oil contents, which most probably was because of bee visitors denied to forage on flowers of the crop. Resu...
Waqar Islam*1, 2, Madiha Zaynab3, Muhammad Qasim2 and Zujian Wu1,2
...or their reproduction. Plants have undergone continuous evolution and have equipped themselves with counter defense and tolerant strategies against viral infections. In the 21st century, considerable progress has been made in understanding the available natural resistance in plants against viral threats. The review aims to explain the molecular mechanisms involved in triggering the antiviral resistance in pl
Zafar Iqbal1* and Muhammad Khurshid2 
...otiana benthamiana plants inoculated with ToLCNDV. To immunocapture the ToLCNDV, two antisera raised against Tomato yellow leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. However, immunocapture of ToLCNDV could only be achieved by using the TYLCV-CP antisera followed by PCR detection by using specific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae), ...
Akbar Ali1,*, Khalil Mohamed2 and Fawzia Toulah3

 

...us health problems in infants, pregnant women and immune compromised patients. Abortion is one of the most serious outcomes in pregnant women. In this cross-sectional study, a total of 162 women of child bearing age were included from Rafha city of Saudi Arabia. Demographic data was recorded. Specific Toxoplasma gondii IgG and IgM were detected in serum by ELISA method. Toxoplasma gondii DNA was detected using PCR. Most women were in the 20-29 ye...

Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1

...ghter slab (processing plants) in Nigeria. The relatively high prevalence rate documented in this study may be attributed to the generally poor infrastructure, lack of well-equipped poultry slaughter houses, lack or inadequate water supply at these markets which hampers the ability of handlers to maintain good sanitary and hygiene conditions of the carcass, environment and themselves. Data collected could be valuable for instituting effective intervention stra...
Mirza Imran Shahzad1,*, Anna Iqbal2, Farrah Ali1, Nuzhat Sial3, Muhammad Ashfaq4, Abul Hasanat5 and Azra Khanum6
...uged but however supernatants were discarded to get their pellets, which were dissolved in normal saline. Of this one part was taken for thaw and freeze treatment, while the second for ultrasonication treatment, before conducting antimicrobial activities. Zones of inhibition were measured by using disc diffusion method. Supernatant fraction of E. coli was positive against Sal. typhi and supernatant fraction of P. multocida wa...

 Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*

... a result rotten woody plants. The larval beetles characteristically feed in the phloem as well as later in the xylem. The females select living hosts for oviposition and thus destroy the vigour of the trees. However, at the early stage of intestation, detection of Anoplophora glabripennis and exposure will help to eliminate the pest in addition to prevent its establishment. Plantation with different tree species, the cultivation of fast-growing timber ...

Habib Ullah Khan1*, Saleem Ullah1, Hamid Ullah Shah1, Muhammad Arif2

... good or bad effect on plants grown in those soils.

...

Muhammad Waqas1*, Anwar Ali Shad1, Omaira Bashir2 and Mohsin Iqbal3

...ilize it as natural colorants in sunflower oil and spaghetti. Tomato peel contained 720 mg/100g of carotenoids consisting phytoene (3.15%) followed by phytofluene (2.31%), β-carotene (2.11%), cis-lycopene (1.71%), lutein (1.51%), cis-ζ-carotene (0.61%), ζ-carotene (0.56%), and γ-carotene (0.52%). Lycopene was found in highest amount (87.52 %). Antioxidant activity of carotenoids from tomato peel was assessed by measuring Rancimat’s t...
Maoying Zhu, Yuntao Ji, Xiaoyu Wang, Junying Pu and Changqing Qu*
...mbinations of cryoprotectants with and without hydrogen gas (H) (purified H2 was dissolved into normal cryopreservation solution for 2 hrs under 0.6 MPa were tested including the following groups: control (CK), 100µm GSH, 10µm fasudil hydrochloride (FH) and a combination of the two (GSH + FH). A solution of 10% (v/v) Me2SO + 20% FBS was used as the standard cryopreservation solution. After 2 months, MTT assay showed significan...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...am, India and infected plants showed declined symptoms and poor fruit yield. Infested plants displayed stunting and yellowing and thick-root symptoms. The association of the root knot nematode species was identified based on observations on morphology of different life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of ...

Sanaullah Jalil*, Asim Hayat, Abid Majeed, Syed Haider Abbas, Muhammad Noman, Muhammad Imran Kasana and Muhammad Mazhar Hussain

...he utilization of P by plants. This research was conducted during wheat cropping season of year 2010 and 2011 and it consisted of determination of the residual effect of six treatments (T0 = control without rock phosphate & farmyard manure, T1= rock phosphate @150 kg P2O5 per hectare, T2 = FYM @5 tons per hectare, T3 = RP @100 kg P2O5 per hectare+ FYM @5 tons per hectare, E0 = without effective microbes and E1= EM-Biozote @ 50 l ha-1) on yield parametrs of...

Waqas Ahmed Dogar2, Arshad Ali Khan3*, Saeed Ahmed2, Sudheer Tariq2, Mukhtar Ahmad2, Muhammad Imran2, Muhammad Noman2 and Nadeem Khan1 

...griculture Faisalabad. Plants were grown at three planting distances as T1 (11 x 22ft), T2 (11 x 11ft) and T3 (22 x 22ft). T1 (11x22ft) was optimum plantation and showed best results for yield. Maximum fruit yield per plant (3.6373 kg) was observed from the same plants. T2 (11 x 11ft) was close plantation and had more total number of flowers per plant (441.58) and fruit length (58.243 mm), but yield was less due to more frui...

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...ot disease and promote plants growth as the length and weight of root and shoot in pot trials on tomato plants. Keywords: Antagonistic fungi, root knot nematode, wilt fungus, bio-management
 

 

...

K.N. Ahmed and M.R. Hasan

Sudden outbreak of mealy bug and armoured scale causing severe damage to economic crops in Bangladesh
...f different ornamental plants in Rajshahi and Dhaka, Bangladesh. It is a polyphagous pest damaging coffee, sweet potato, jute, groundnut, tomato, citrus, cotton, guava etc. causing enormous damage to them. The female lays about 300-400 eggs which hatch in few hours. The life cycle is completed in about 40 days. The small and big black ants tend F. virgata and they keep other insects including hymenopteran parasites away from...

S. K. Dutta, S. Roy Chowdhuri, D. Pandit and A. K. Bajpai

Rot diseases of muga host, Som (Persea bombycina) in Assam, India
...ifically the pollarded plants) were generally infected with rot disease when it grows older. Phellinus contigus (under Polyporaceae), a white rot fungus, causes heart rot disease and Biscogniauxia mediterranea (= Hypoxylon mediterranea) (under Xylariaceae) causes canker rot disease of Som plant. A survey was conducted to study the infection of rotting pathogens on Som plants at Regional Muga Research Station (RMRS), Boko, As...

Debjani Chowdhury, P. C. Paul and B. Dasgupta

Management of leaf spot of Centella asiatica (Thankuni) caused by Alternaria sp. and target leaf spot of Rauvolfia serpentina (Sarpagandha) caused by Corynespora cassicola
...ight and dry weight of plants.

...

K.N. Ahmed , M.A. Al-Helal, N-E-P. Khanom, S. Bulbul

Control strategies of papaya mealybug, Paracoccus marginatus Williams & Willink infesting vegetable crops in Bangladesh
... cent. Generally young plants die due to heavy infestation and colony formation of the mealybug. P. marginatus is a polyphagous pest attacking several agricultural, horticultural crops, ornamental plants and weeds of economic value. The papaya mealybug feeds on the sap of the plants by inserting its stylets into the epidermis of the leaf as well as into the fruit and stem. In doing so, it ...

M. S. A. Mamun and M. Ahmed

Integrated pest management in tea: prospects and future strategies in Bangladesh
...re associated with tea plants. Among them 25 species of insects, 4 species of mites and 10 species of nematodes are recorded from Bangladesh. Enormous crop loss was incurred due to the attack of these pests and largely responsible for the declining productivity of tea. Extensive use of chemical pesticides began only a few decades ago with tremendous immediate economic gains but its abuses were not foreseen or ignored. As a consequence there arose the developme...

Nilesh Suresh Gole and Bijan Kumar Das

Biology of Dichromia sagitta (Fabricius) (Noctuidae: Lepidoptera), a serious pest of Indian ipecac, Tylophora indica
...dicinal & Aromatic Plants and Betelvine (AICRP on MAPB) at Bidhan Chandra Krishi Viswavidyalaya (BCKV), Kalyani, Nadia, West Bengal during 2010-2011 on seasonality, extent of damage and biologoy of D. sagitta on T. indica. The larvae were active almost throughout the year, fed voraciously on leaves and flowers causing extensive damage to T. indica during June and December. Eggs were laid singly or in batch of 2-3 on younger leaves (mostly on under surface)...

Sitansu Pan and Amrita Das

Control of cowpea (Vigna sinensis) root and collar rot (Rhizoctonia solani) with some organic formulations of Trichoderma harzianum under field condition
...n vigour of the cowpea plants, basal girth, number of branches & pod number, pod vigour of the bio primed seeds over other treatment combinations. Soil application of Trichoderma in vermicompost +20% neem cakes gave better disease control over the others.

...

P.S. Ajith, K.K. Lakshmesha, S. Mahadev Murthy and N. Lakshmidevi

Botanicals for control of anthracnose of bell peppers
... that all the selected plants have potential to inhibit the radial mycelial growth of C. capsici in-vitro. The plant extract from C. aromaticus at 50% concentration showed 42% radial mycelial growth inhibition in poisoned food technique, whereas 15% increased seed germination and 26% reduced disease incidence is recoded when compared to untreated control. In pot experiments, there is an increase in height and weight of the plants

M. A. Al-Helal, K. N. Ahmed, N-E-P. Khanom, and S. Bulbul 

Observations on papaya mealybug, Paracoccus marginatus Williams & Willink (Hemiptera : Pseudococcidae) damag-ing some crops in Bangladesh
...etables and ornamental plants of economic importance in Bangladesh perspectives.
 

 

...

A. Sajeena and T. Marimuthu

Efficacy, stability and persistence of Ganosol, a Ganoderma based fungicide against plant pathogens
...n Ganosol 10EC sprayed plants and were absent in control. The formulation was tested to have good emulsion stability. The antifungal activity of the formulation persisted up to seven days after spraying the formulation on rice plants. The formulation retained its 100% antifungal efficacy up to three months of storage. Surprisingly, spraying cowpea plants with the formulation as simultaneou...

D. C. Khatua, B. Mondal and G. Saha

Bioassay of some agricultural chemicals, human drugs and disinfectants on Phytophthora melonis Katsura causing fruit and vine rot of pointed gourd
..., insecticides, disinfectants and antiprotozoal drugs were tested on Phtophthora melonis Katsura causing fruit and vine rot of pointed gourd in aqueous environment. Antifungal antibiotics viz. validamycin, kasugamycin, griseofulvin, fluconazole and ketoconazole did not have any pronounced effect on mycelial growth, sporangia formation and its germination. None of the eight antibiotics used in this study prevented mycelial growth. No sporangia formation was rec...

S. Patra, V.W. Dhote, SK F. Alam, B.C. Das, M.L. Chatterjee and A. Samanta

Population dynamics of major insect pests and their natural enemies on cabbage under new alluvial zone of West Bengal
...randomly selected five plants /plot. Peak population of diamond back moth (DBM) was recorded on 1st March and 23rd February with13.60 and 14.33 larvae /plant during 2011-12 and 2012-13 respectively. Cabbage aphid reached its peak on 9th February (14.17 aphids/inch2 leaf) and 16th February (11.03 aphids/inch2 leaf) of 2011-12 and 2012-13, respectively. Highest parasitized larvae of diamond back moth by Cotesia plutellae were found on 15th and 8th March with 10....

D.K. Hazra, Megha Pant, S.K. Raza and P. K. Patanjali

 

Formulation technology: key parameters for food safety with respect to agrochemicals use in crop protection
...radable ingredients/adjuvants of the conventional formulations but also increase the bio-efficacy of the products through incorporating latest technologies including size reduction (WP to SC, SL to ME), increased coverage of applied surface area (EC to ME/Nano-formulations), reduced wastage (Dust/WP to Con-trolled Release Formulations) and dose rates of same pesticides applied to improve food quality with minimum pesticide residues. 

...

Anil Sehajpal, Saroj Arora and Parminder Kaur 

 

Evaluation of plant extracts against Rhizoctonia solani causing sheath blight of rice
...sion method. Out of 44 plants tested, 36 plant extracts showed varied degree of antimicrobial effect at different concentrations against the pathogen whereas 8 plant extracts, viz. Abrus precatorious, Acacia auriculiformis, Bougainvillea glabra, Convolvulus arvensis, Hibiscus rosa-sinensis, Morus alba, Thevatia peruviana, and Withania somnifera did not exert any effect. Among all the plant extracts, A. sativum exhibited strong fungitoxicity even at the lowest ...

Dhananjoy Mandal

Eco-friendly management of mealybug and wilt in pineapple
...f percentage of wilted plants and mealy bug population, T3 was the best and T2 ranked second. Percent of wilted plants in T1, T2 and T3 were 11.88, 4.19, 2.62; mean mealy bug population/plant were 9.33, 5.29, 4.20, and yields were 32.5 tha-1, 38.7 tha-1, 41.6 tha-1, respectively. Benefit: Cost ratio was highest in T3 (1.30) followed by T2 (1.24) and T1 (1.09).
 

 

...

S. Pal and I. Sarkar

Pests infesting ornamental plants in hilly region of West Bengal
...g different ornamental plants viz. Myzus persicae on Carnation, gerbera and Anthurium; Macrosiphoniella sanborni on Chrysanthemum; Aphis gossypii on China rose. Other sucking pests infesting ornamentals included Bemisia tabaci on Gerbera, leafhopper on Gladiolus and scale insect (unspecified) on Anthurium. Amongst the thysanopteran pests Taeniothrips simplex was very much serious on Gladiolus and another species of thrips (unspecified) was found infesting Carn...
Sadia Munir1a, Asif Nadeem1a*, Maryam Javed1, Masroor Ellahi Babar2, Tanveer Hussain2, Wasim Shehzad1, Rajput Zahid Iqbal3 and Sidra Manzoor1 
...encies of identified variants were also determined. Chi2 test was performed to evaluate the Hardy-Weinberg Equilibrium of each polymorphic site. Two loci were found to be in HWE. These identified alleles will be useful for animal selection at molecular level i.e. an ideal tool for marker-assisted selection of animals for future breeding programs.
...
P.P. Ghosh*, C. Ghosh, B. Mahato, A. Chakraborty, S.K. Bhattacharya and M.K. Bhattacharjya
...estruction of diseased plants (farmers’ practice). Results indicated all the management approaches under study performed significantly superior to farmers’ practice in terms of reduction in disease severity (32.8-43.6%), yield increase (20.9% - 26.8%) and benefit-cost ratio. Integrated approach was the best approach followed by prophylactic and curative soil disinfestations. Thus, for the present micro-level situation vascular bacterial wilt malady...

Gadeeyya G and Ratna Kumar P.K.

... was conducted on weed plants for the primary investigation of natural enemies which may became promising biocontrol agents. A total of 7 weed plants include Commelina benghalensis, Cyperus rotundus, Crotalaria verrucosa, Digera muricata, Sida cordifolia, Ipomoea pestigridis and Trianthema portulacastrum were selected for in vitro studies. Fungal isolates namely Ascochyta cypericola, Bipolaris sp....

Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1 

...LSDVs from infected ruminants, indicating a potential role of Ixodid ticks for transmission of LSDV. This study showed the role of A. hebraeum ticks for transmission of LSDV. So, tick control is a crucial part, which should be included as a part of LSDV control measures in endemic countries.

...
 

Amir Ismail1, Muhammad Riaz1,2*, Saeed Akhtar1, Amjad Farooq3, Muhammad Arif Shahzad1 and Ahmad Mujtaba4

 

...ough milk showed that infants are most prone towards heavy metal toxicity due to the higher rate of milk consumption.

...
Javeria1, Masroor Ellahi Babar2,*, Tanveer Hussain2, Rashid Saif2, Sadaf Rashid3, Hanan Sarfraz4, Abbas Ali Shah3, Muhammad Wasim1 and Muhammad Abdullah1
... to identify genetic variants in BDNF gene and their association with Obsessive Compulsive Disorder (OCD) among Pakistani Punjabi population. We recruited a total of 100 patients diagnosed with OCD following Diagnostic Statistical Manual-IV (DSM-IV) criteria and controls (n=120) were selected from the same ancestry during August 2011 to January 2014fromSir Ganga Ram Hospital and Panjab Institute of Mental Health, Lahore. The demographic values for age, ...
Azhar Abbas Khan1,*, Arif Muhammad Khan2 and Muhammad Afzal3
...micals released by the plants in response to herbivorous attack influences third trophic level and natural enemies use these substances to locate their prey. Twelve-arm olfactory apparatus was used to evaluate the response of C. septempunctata toward aphids and different host plants of aphids. Different horticultural plants and field crops were used singly or in combination with pre...
Ayesha Ilyas1, Hafiz Azhar Ali Khan2,* and Abdul Qadir1,*
...acts of six indigenous plants viz., amaltas (Cassia fistula), datura (Datura alba), neem (Azadirachta indica), niazboo (Ocimum basilicum), yellow kaner (Thevetia peruviana) and safeda (Eucalyptus camaldulensis) against the peach fruit fly, Bactrocera zonata (Saunders), at 2% concentration in a free choice bioassays. Acetone, chloroform, petroleum ether and ethanol were used for extraction from leaves. Amo...

Muhammad Zafarullah Khan

...y of helping field assistants to plan extension activities. The lowest competencies of AEOs reported were official inquiries conduction, identification of malpractices of inputs supply dealers and evaluate the working of fertilizer dealers. The study recommended that the gap among the competencies of AEOs might be minimized by increasing their educational level and providing training opportunities especially in supervision and administration to deal effectivel...
Adnan Yousaf1,Jia Wu1, Qaiser Shakeel2, Yasir Iftikhar3, Muhammad Irfan Ullah4, Uzma Tahira5,Mustansar Mubeen1 and Wubei Dong1,*
.... Two week old chilies plants were inoculated with M. incognita, S. rolfsii separately and in combination as well. At harvesting, roots of C-302 contained significantly fewer galls (30) and egg-masses (51) compared to the other fourteen cultivars. Seven cultivars including C-33, Gola Peshawari, 11-2010, 18-2010, 15-2010, 27-2010 and C-68 had 10 root galling and egg-masses indices (from a scale of 0-10). Hence, present study shows that none of the availa...

Muhammad Ibrahim and Ahmad Khan*

...e in plastic mulching. Plants took less days to emergence (6 days) in 70% FYM, however, tasseling (45 days), silking (49 days) and physiological maturity (94 days) arrived earlier in no-fertilized plots. Tasseling, silking and maturity delayed with increasing urea N proportion in residue or plastic mulching. The days’ differences for silking across the years were apparent in residue mulching than plastic mulching. Plastic mulching had improved emergence ...
Rahat Naseer1*, Abu Saeed Hashmi1, Zulfiqar-ul-Hassan2, H. Rehman1, Saima Naveed1, F. Masood1 and M. Tayyab1
...xed rations for the ruminants. For this purpose rice husk was subjected to different processing techniques using acid, alkali, water treatment and fermentation to prepare processed moiety on pilot scale. All these processed materials were included in experimental ration at a fixed level (20 %). All iso-caloric and iso-nitrogenous rations were offered to experimental animals (n=36, 22 male 14 female Lohi sheep almost evenly distributed in experimental groups) h...

Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla3

...ste des petits ruminants (PPR) is a viral disease which primarily affects small ruminants, causing significant economic losses for the livestock industry. Clinical investigation was carried out during the suspected outbreaks of PPR/FMD in sheep and goats in Hail. Saudi Arabia. During the outbreaks 271 (20.6%) died out of 648 (49.3%) of affected animals, the overall morbidity in goats (33.3%) was higher as compared to sh...
Talha Nazir1,2,*, Muhammad Dildar Gogi2, Muhammad Zeeshan Majeed1, Waheed ul Hassan2, Abdul Hanan2 and Muhammad Jalal Arif
...ese insect pests such as ants, parasitoid wasps, green lacewings and coccinellid beetles. Experimental design was split-plot randomized complete block with three replications for each treatment. Transgenic (Bt) cotton variety (FH-118) was sown. Insecticide formulations were applied according to their field recommended dose rates upon attainment of ETLs of most of the sucking insect pests. Data regarding insect populations were recorded 3 and 7 day post treatme...
Tiansen Li1, Meiling Huang2, Zhen Wang1,Fei Guo3,Hui Zhang1,* and Chuangfu Chen1,*
...ted with omp10 mutants were noted, inhibition of phagosome-Lysosome fusion was dramaticly impaired, and profound increase of apoptosis rate after exposure of RAW264.7 to omp10 mutants at 12 h, 24 h and 48 h compared to RAW264.7 exposed to 2308. Results indicate that Δomp10 mutant would affect its survival and pathogenicity.
...

Sadia*, Abdur Rab, Sayyed Hamad Ahmad Shah, Irfan Ullah, Farida Bibi and Islam Zeb

...5cm3) were recorded in plants deblossomed in September treated with 50 ppm of GA3. While maximum fruit density (1.13gcm-3) was recorded in the month of July fruits treated with 10 ppm of GA3. While maximum fruit drop (11.69%), titratable acidity (0.59%), with minimum number of new shoots (16.3), number of new flowers (65.3), fruit weight (53.3g), and fruit volume (48.1cm3) were recorded in plants which were not deblossomed a...
Saleem Khan1, Amir Hamza2, Farhadullah Khan3, M. Subhan4, Aziz Khan1, Irfan Ali Shah1, Shakirullah Khan Shakir3*
...sing cotton as a model plants, the present study was designed. For this purpose, dry seeds of four cotton genotypes (Gomal-93, Bt-131, Bt-121 and Bt-CIM-602) were exposed to gamma rays with 10, 15, 20 and 25 Kilo Radium (KR) doses sourced from 60Co. The irradiated seed samples were assumed treated seeds while non-irradiated seeds of each genotype were used as control. Field experiment was conducted in randomized complete block design (RCBD) in three...
Shantanu Jha1, A. Rama Devi1, Ngalaton Kasar1 and Abhishek Mukherjee2
...s attended by 31 participants. The programme was inaugurated by Prof. D. D. Patra, Hon’ble Vice-Chancellor, Bidhan Chandra Krishi Viswavidyalaya (BCKV) and was chaired by Professor C. Sen, President of Association for Advancement in Plant Protection (AAPP). Oher dignitaries attended the meeting were Prof. T. K. Maity, Dean, Faculty of Horticulture, BCKV and Prof. M. R. Ghosh, Taxonomist and Retired Professor of Agriculture Entomology, BCKV.
...

Abdur Rab1*, Muhammad Sajid1, Naveed Ahmad1, Khalid Nawab2, Syed Ghias Ali3

...ted by exposing tomato plants to 0, 75 and 150 mM salinity; and foliar application of 0.0, 0.25, 0.50, 0.75, 1.0, 1.25% calcium solutions. Salinity stress increased leaf Na+ and Na+/ K+, fruit firmness and blossom end rot (BER) incidence but significantly decreased the leaf K+ and Ca content of the fruit and yield. The foliar calcium application decreased the Na+ accumulation, Na+/ K+ ratio and BER incidence as well as increased the leaf K+ and Ca content of t...
Nargis Bano and Khalid Mahmood Qureshi*
...ect several species of plants against environmental stresses by initiating different processes that are involved in the mechanism of stress tolerance. SA is part of an extremely complex signal transduction network’s part and it works differently in different systems. Drought stress is a major restraint for crop production in arid and semi arid states such as Pakistan. In this study experiments were conducted against the responses of strawberry plant to b...

 Zabih Ullah*, H. Rahman and Niaz Muhammad

...desirable as it allows plants to escape various biotic and abiotic stresses. It also makes multiple cropping possible as the land becomes available for next crop. Keeping the importance of early maturity of maize crop in view, the present study was conducted to evaluate different maize hybrids for maturity and related traits in the geographical location of Khyber Pakhtunkhwa. The experiment was conducted at The University of Agriculture, Peshawar during the cr...
Rehmat Ullah1*, Kalim Ullah2, Inam Ullah3, Muhammad Zafarullah Khan1 and Asif Nawaz1 
...rformance of field assistants in Agricultural Extension, the present study was commenced in district Dera Ismail Khan, Khyber Pakhtunkhwa during year 2014. Eight villages were selected randomly. Among all the farmers, 120 farmers were evaluated through valid, reliable and pre-tested interview schedule. Data collected was analyzed through Statistical Package for Social Sciences ver. 20. Descriptive and inferential statistics were used. The study has revealed th...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...e direct damage to the plants by extracting the sap, and indirectly it is a vector to 16 plant viruses. The study presents data referring to the external morphological characteristics, to the biometrical measurements and to the life cycle of Aphis nasturtii. The researches have been carried out for a period of four years on the potato and for a period of two years on the orchards from Romania. At the Aphis nasturtii species the smallest length of...

Arshad Iqbal1*, Iftikhar Hussain Khalil1, Syed Mehar Ali Shah1 and Muhammad Sharif Kakar

...he performance of crop plants by knowing the magnitude of heritability. An experiment was conducted using a set of spring wheat genotypes to estimate heritability for various plant traits during crop season 2014-15 at the University of Agriculture, Peshawar. The randomized complete block design with three replications was used in the experiment. Data were recorded on yield and some other important plant traits like days to heading (days), days to maturity (day...
Ayesha Aihetasham1,*, Muhammad Saeed Akhtar1, Maryam Umer1, Khalid Zamir Rasib2 and Muhammad Imran Din3
.... Extracts of both the plants were found repellent to this termite. LT50 values of O. basilicum and F. vulgare against Heterotermes indicola were 60.91 and 115.9 h, respectively.
...
Mahreen Yahya, Noor Abid Saeed*, Sajid Nadeem, Muhammad Hamed and Sajid Shokat 
...lly with the growth of plants. Three aphid species were recorded i.e., Rhopalosiphum padi (L.), Schizaphis graminum (R.) and Sitobion avenae (F.). Mean seasonal aphid population (no. of aphids/tiller) on wheat plants during the whole season was the highest in NW-1-8183-8 and NW-3-3341-7 and the lowest in Faisalabad-08. However, grain yield was the highest in Galaxy-13 and the lowest was in Lasani-...

Inayatullah Jan*, Sajid Khan, Noor Paio Khan and Muhammad Ashfaq 

... were smallholders or tenants. After procuring and properly utilizing credit, the yield of the major crops such as wheat, maize, and sugarcane and the resultant income of the respondents exhibited significant increase, as confirmed by higher t-values. The study concludes that the socio-economic conditions of the farmers can be improved if credit programme is extended which could benefit all farmers in the area. 

...
Muhammad Qaisar Nawaz
...(132.00 cm), number of plants (91.33 m-2), number of tillers (146.00 m-2), number of leaves tillers-1 (5.66), total dry matter (17.70 t ha-1) and fodder yield (60.90 t ha-1) showed that nitrogen application @ 150 % N of recommended dose with drill sowing proved to be the most cost effective technique for fodder oat production in salt affected soil as compared to other treatments.
...

 Zeenat Bano1,*, Sajid Abdullah1, Waqas Ahmad2, Muhammad Anjum Zia3 and Wardah Hassan1

...e level of selected toxicants in water, their bioaccumulation and effects on antioxidant enzymes i.e. superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD) in vital organs (gills, liver and kidney) of fish, Cirrhina mrigala. The 3 different representative water samples and 60 fish samples (20 fish from each site) were collected from three sites i.e. fish-farm, hatchery and Indus River of Punjab, Pakistan. The results showed diffe...
Tahira Perveen1,*, Shaista Emad1, Saara Ahmad2, Zehra Batool1, Sarwat Yousuf1, Sheeza Sheikh1, Sara Qadeer1 and Saida Haider1
...div>Synthetic antidepressants are effective drugs for the treatment of psychiatric disorders. Along with the effectiveness these drugs are also associated with some side effects. Since ancient times herbs are used as medicinal purposes. One such herb is Fennel (Foeniculum vulgare). Fennel has many efficacious uses. It is a common herb and spice. It is used in many culinary purposes and also it has therapeutic purposes. In the present study antidepressan...

Muhammad Anas1, Abdul Jabbar1, Muhammad Aqeel Sarwar2*, Raza Ullah1, Muhammad Khubaib Abuzar3, Ijaz Ahmad4 and Sohail Latif5 

...ed viz. Four sunflower plants m-2 + 30 mungbean m-2, 6 sunflower plants m-2 + 30 mungbean plants m-2, 8 sunflower plants m-2 + 30 mungbean plants m-2, 4 plants m-2 of sunflower alone, 6 plants m-2 of sunflower alone, 8 plan...

Imtiaz Ahmed, Muhammad Abbas Khan, Noorullah Khan, Naveed Ahmed, Abdul Waheed, Fazal Yazdan Saleem, Sajjad Khan and Sohail Aslam 

... and yield components. Plants with 10 cm spacing had more disease incidence and severity (79 and 55.66% respectively). Plants with 20 cm spacing had more Bulb weight (99.33 g), Bulb diameter (67.33 mm), clove weight (11.65g) and no of cloves per bulb (12.5); whereas taller plants (54 cm) and maximum bulb yield of 12.85 t ha-1 was recorded in those plots planted with 10 cm spacings. While t...

Riaz Alam* and Muhammad Sajid 

...30 and September 14 in plants of olive cultivars Frontoio, Manzanilla, Ottobratica, Pendolino and Picual. Significant variations were recorded among olive cultivars regarding asexual propagation through air-layerage. The daughter saplings of cultivar Manzanilla took less number of days (47.94) to root appearance, produced more rooting percentage (38.89%), number of roots (4.31), root length (4.61 cm) and root weight (1.77g) with more number of re-sprouts (3.18...
Temel Gokturk1, Elif Tozlu2,* and Recep Kotan2
...ses harm in almost all plants that grow along the Eastern Black Sea coast. The chemicals used to control this pest are prohibited in this region due to tea cultivation. For this reason, new strategies are needed to control this pest. With the awareness on the negative effects of the chemicals used in the control against pests and with the increasing awareness on environmental issues, alternative methods were sought in the past; and in this context, studies wer...
Wali Khan1,*, Noor-Un-Nisa2 and Aly Khan3
...fifteen (11.04%) participants were found infected with one or more than one intestinal protozoans. Forty one (35.6%) of the participants were infected with single parasite and seventy four (64.3%) with multiple infections. Entamoeba histolytica 30.5% (n=77/252), Giardia lamblia 15.0% (n=38/252), Ascaris lumbricoides 17% (n=43/252), Trichuris trichura 11.1% (n=28/252), Enterobius vermicularis
Hayat Badshah1, Farman Ullah1, Paul-André Calatayud2, Hidayat Ullah3 and Bashir Ahmad1
...o the locality and the plants on which P. solenopsis is feeding. In this context, this experiment investigated under field and laboratory conditions the influence of the host plant of P. solenopsis on the parasitism success and the female fitness of A. bambawalei, Five plant species, commonly found to be host of P. solenopsis, were tested: hibiscus, potato, okra, eggplant and tomato. Under no choice test conditions, the resul...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...urticae, on tomato plants, was tested under greenhouse and laboratory conditions. A sharp reduction in the population of T. urticae was obtained after one week of applying Huwa-San TR50 at a rate of 4000 ppm. This resulted in mortalities of 82.10 and 78.60% under greenhouse and laboratory conditions, respectively. The side effects of Huwa-San TR50 on predatory mite, Neosiulus cucumeris, were also tested to gain successful implementation of ne...
Faiza Ambreen*1 and Muhammad Javed2
...ng the toxicity of pollutants which may be used as part of environmental monitoring programs.
...

Gamalat Osman1, Mansour Galal1, Abbas Abul-Ezz2, Ahmad Mohammed1, Mohammed Abul-Ela3 and Asmaa Mostafa Hegazy2

... exposure to oil contaminants. L. carinatus was chronically exposed to crude oil at intervals of 24 hours, 15 days and 30 days. The LC50 of crude oil for L. carinatus was 700 ppm. HPLC analysis of 16 polycyclic aromatic hydrocarbons (PAHs) in the flesh demonstrated that PAHs accumulation in the treated snails was fluctuated with time. The accumulation is due to their biotransformation process during metabolism. The histopathological observations of the gills a...

Ayesha Aihetasham1*, Khalid Zamir Rasib2, Syeda Rida Hasan1, Imran Bodlah3

...cts of three medicinal plants viz., Carica papaya (paw paw), Helianthus annus (Sunflower) and Bougainvillea glabra (Paper flower) against Heterotermes indicola. The leaf extract of C. papaya caused highest mortality i.e. 100% of 10%, 5% and 3% concentration. Bougainvillea glabra and H. annus caused 100% mortality at 10% and 5% concentration while 96.4% mortality on 3% concentration after exposure period of 10 hours. B. glabra extracts also caused 100% mortalit...

Muhammad Zahid1*, Muhammad Ather Javed Khan2, Muhammad Idrees3 and Ahmad Kamran Khan4 

...rs adopted thinning of plants, 91.3% knew pest scouting, 87.3% used pesticides after pest scouting while 74% farmers used pesticides both at morning and evening. It was concluded that integrated pest management project enhanced the skills of farmers and resulted in higher yields of quality cotton through reduction of pesticides sprays 

...
Shahid Mehmood1,*, Bushra Nisar Khan1, Hassan Raza1, Rida Ahmad1, Azhar Muhammad3, Zulfiqar Ali2, Farhan Abid1, Fehmeeda Bibi4 and Syed Maviz Ahmed5
...s 50 (70.4%), winter migrants 12 (16.9%), summer breeders eight (8) (11.3%) and passage migrant one (1) (1.4%). More birds were observed in winter season compared to summer season. The most dominant species were house crow, Corvus splendens (n=2518), house sparrow, Passer domesticus (n=772), common myna, Acridotheres tristis (n=327), black-crowned night heron, Nycticorax nycticorax (n=190) and jungle babbler, Turdoides striatus
Muhammad Abubakar,1,2,* Aamer Bin Zahur,1,3 Khalid Naeem1,3, Muhammad Azeem Khan1,3 and Subhan Qureshi
...iv>Peste des Petits Ruminants (PPR) is a highly fatal and economically devastating disease of sheep and goats. Present study was designed to have an insight into the epidemiology of PPR under field conditions in the country using molecular tools. A total of eighty-four (n = 84) PPR outbreaks were investigated during the study (2010 to 2013). The highest number of outbreaks was reported from Punjab province (n = 38) followed by Sindh (n = 21) and Khyber Pakhtun...

Aqsa Waqar1, Sahir Hameed Khattak2, Sania Begum2*, Tayyaba Rehman1, Rabia1, Armghan Shehzad2, Wajya Ajmal2, Syeda Shahdana Zia2, Iqra Siddiqi2 and Ghulam Muhammad Ali2* 

... 100%, due to infected plants and shriveled grain. These problems can be overcome by knowledge about the disease, identifying resistance lines and subsequently develop resistant varieties with an aim to shorten the disease cycle. One of the quickest ways in this direction is the designing molecular markers for non-race-specific resistance genes. Use of molecular markers is efficient tool for screening diversity of rust genes in wheat germplasm and can facilita...
Samra Imran1,* and Afifa Tanweer2
...valuation of the participants. Results indicated that participants aged less than 18 years and those diagnosed within first year of life, had significantly healthier body dimensions. Higher family income, female gender and greater meal satisfaction was found to be associated with better biochemical indices. Most participants reported partial compliance to GFD. Compliant particip
Wali Khan1,*, Noor-Un-Nisa2 and Muhammad Asif Nawaz3
...enty one (21.2%) participants were found infected with one or more than one intestinal tapeworms. Seventy seven (7.39%) of the participants were infected with single parasite and one hundred forty four (13.8%) with multiple infections. Taenia saginata 32.6% (n=146/447), Ascaris lumbricoides 20.3% (n=91/447), Hymenolepis nana 19.7% (n=88/447), Trichuris trichura 14.3% (n=64/447), Enterobius verm...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5

 

...nts from healthy grown plants were used as explants and cultured on standard Murashige and Skoog (MS) medium supplemented with different concentrations and combinations of benzyl amino purine (BAP) or kinetin for shoot induction and Indole acetic acid (IAA) for primary shoot and Indole Butyric acid (IBA) for root proliferation. Best shoot proliferation (4.48 per explant) was observed in MS medium containing 0.2/0.4 mg/L BAP/...
Muhammad Aqeel Sarwar1*, Abid Ali2, Manzoor Hussain2, Saadia3, Muhammad Khubaib Abuzar4, Ijaz Ahmad5 and Sohail Latif6
...M) along with seed inoculants (I1) Azospirillum and (I2) Azotobacter separately for each plot. Data regarding yield, quality and nutrients use efficiency parameters were collected and analyzed. Results depicted that interactive effect of both the factors was non-significant for all the observed parameters. Considering the individual effect of fertilizer combinations, maximum number of productive tillers m-2 (...
Alim-un-Nisa1*, Sajila Hina1, Sania Mazhar1, Imran Kalim1, Ijaz Ahmad1, Naseem Zahra1, Shahid Masood1, Muhammad Khalid Saeed1, Qurat-ul-Ain Syed1 and Maida Asif2
...reservatives and antioxidants like citric acid and determining its usefulness by applying on food products. Natural edible color was extracted from T. erecta gave lemon yellow color shade which when applied on candies increased the attractiveness. The spectrophotometric analysis at 474nm of extracted color both in crude form and in candies was found to be stable at 4oC and showed decay in mean lutein concentration at higher temperatures i.e. ...
Muhammad Naeem1, Bushra Sadia1,2,*, Faisal Saeed Awan1and Muhammad Anjum Zia3
... UV11, UV12 and UV 15 mutants producing halo zones. Percentage blood clot lysis led to screening of mutants UV 2, UV 6, UV 7, UV 9, UV 11, UV 12, UV 15 and EB 3, EB 4, EB 11, EB 13 with hyperactivity as compared to wild bacterial strain. Out of the total 15 isolates of EtBr-treated strains, EB4 gave the maximum enzyme activity (7.3 ± 0.005 U ml-1) with a zone diameter of 6 mm. While UV6 was found to be the ...

Rahila Nizami1, Muhammad Zahid Latif2*, Intzar Hussain3 and Khalid Rashid

...of 36(61.02%) of participants were married and 17(28.81%) were unmarried whereas 6(10.2%) did not disclose their marital statuses. Regardless of the gender, age and character, no dominating leadership-style was identified among the medical professionals participated in this study, highlighting the need for leadership development in health professionals. This present a great challenge for health professionals to understand how their leadership behaviors affect ...

Nukhbat-Ullah Awan1*, Muhammad Sohail2, Zeeshan Sarwar3, Muhammad Mustahsen Bashir4, Muhammad Abbas Khokhar5 and Asad Aizaz Chatha

...sented the study participants. Results demonstrated thatmost common mode of trauma was road traffic accident, and majority (54%) of patients were never vaccinated. Incubation period noted was 7±1 days. Tracheostomy was performed in 16±3 hours of admission and tracheostomy decannulation was performed in 23±3 days. Patients were discharged in 27±3 days.Weconcludethat early control of airway with tracheostomy in grade II tetanus patien...

Ata-ul-Mohsin*, Ehsan-ul-Haq** and Muhammad Naeemullah*

...rasitoid was higher on plants with high phosphorus than those treated with high calcium concentrations.

...

 Z. A. Soomro, M.B. Kumbhar, A.S. Larik*, M. Imran** and S.A. Brohi***

...ping transgressive segregants through hybridization is suggested. However, hybridization system, which exploits both fixable and non-fixable components, simultaneously, could be useful in the genetic improvement of yield and yield components in upland cotton.

...

 Muhammad Asim, Muhammad Asif, Muhammad Munir* and Muhammad Aslam**

...lated and uninoculated plants of soybean [Glycine max (L.) Merr.] from the time of inoculation to root-nodule initiation (192 hours after inoculation). 3H-ABA was applied to the leaves of two soybean cultivars: cv. Williams-82 and its hypernodulating mutant, NODI-3. There was a significant difference in the percent uptake of 3H-ABA between the two varieties both in inoculated and uninoculated plants. A marked difference in t...

 Naheed Akhtar, Muhammad Ashfaque, Waseem Ahmad Gillani*, Ata-ul-Mohsin**, Afzala Tashfeen and Irshad Begum*

...now the effect of host plants on the fecundity of R. padi. Two varieties Wafaq-2007 and Diamond were the least preferred for fecundity and one line V00125 was highly preferred for fecundity.

...

 Badaruddin Khokhar*, Imtiaz Hussain** and Zafar Khokhar*

...ndash;7004, had taller plants in comparison with cultivars NARC–9 and V–7004 however, wheat grain yield was not affected significantly among different cultivars.

...

 Sumia Bint Zaman, Sidra Majeed and Shahid Ahmad*

...ed crops and fuel-wood plants.

...

 Ahmed Aziz Kurd, Amanullah, Saifullah Khan, Basharat Hussain Shah and Munir Ahmed Khetran*

...thout IBA application. Plants were kept in a shade house and humidity was increased manually by hand sprinkling (four times in a day). Highest rooting percentage (60%) was obtained in the cuttings treated with 3000 ppm. The maximum average number of roots per cutting (4.443) and average root length (5.687 cm) were recorded with 4000 ppm IBA treatment. Percentage of rooted cuttings decreased with increased IBA concentration, whereas, number of roots and root le...

Tariq Mahmood, M. Sudheer Tariq, Khalid Mahmood Khokar, Hidayatullah and Syed Ijaz Hussain*

...p with no mortality of plants. Highest mortality of plants due to foliage eating by red pumpkin beetle was observed in control where no permethrin was applied. None of the plant extracts tested in this study as dust alone or mixed with dung ash was effective in controlling red pumpkin beetle attack. Permethrin dust (0.5%) alone and ash + permethrin dust (2000: 1 a.i w/w) gave a significantly higher yield of 18.07 and 18.63 t...

 Oguz Bilgin, Kayihan Z. Korkut, Alpay Balkan, and Ismet Baser*

... out transgressive segregants in late segregations to develop a potential durum wheat variety.

...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...e origin, variety of variants originate through random spontaneous mutation and genetic recombination which could lead to genetic drift. The emergent strain of IBV in this study points out the need to include such variants in killed-vaccine form in the vaccination program of the affected region.
...
Nazish Shaukat1, Muhammad Javed1,Faiza Ambreen2* and Fariha Latif1
... as the most toxic pollutants in aquatic system. These are important inducers of oxidative stress in aquatic animals, promoting the formation of reactive oxygen species (ROS) which ultimately leads to tissue damage and oxidation of biomolecules. Aquatic organisms possess antioxidant system to cope with the oxidative stress. This research was conducted to see the effect of lead on peroxidase activity (antioxidant enzyme) in the gills and liver of Labeo rohit...

 Hidayatullah, T. Mahmood, M. Farooq, M. A. Khokhar and S.I. Hussain*

* Corresponding author: hidayatu2003@yahoo.uk.co.uk

PLANT GROWTH REGULATORS AFFECTING SEX EXPRESSION OF BOTTLE GOURD (LAGENARIA SICERARIA MOLINA) PLANTS
...aria siceraria Molina) plants cv. Faisalabad Round was investigated under field conditions in National Agricultural Research Centre, Islamabad. Plants sprayed with distilled water were considered as control. Among all foliar agents, the response of -l GA3 3 and MH was found better. Exogenous application with 30 µmol l GA maximally increased the pistillate flower production as compared to control. Moreover, the treatmen...

 Shahida N.Khokhar*

CROP INOCULANTS- AN UNDEREXPLORED POTENTIAL IN AGRICULTURE
...en way of life. Bioinoculants are in perfect harmony with the concept of Evergreen Revolution. They have the potential to improve value cost ratio (VCR) of agricultural production. Pakistan faces increase in degraded lands, water shortage, energy crisis, all contributing to poverty. During last two decades, many efforts were made to address the issue through developing and applying the inoculants. Several research institutio...

 Khalid Mahmood Qureshi, Fakhar ul Hassan, Qamar ul Hassan, Usman Shaukat Qureshi, Saman Chughtai and Adnan Saleem*

IMPACT OF CULTIVATION SYSTEMS ON GROWTH AND YIELD OF STRAWBERRY (FRAGARIA ANANASSA) CV. CHANDLER
...Rawalpindi. The runner plants of the strawberry (Fragaria ananassa) cv. Chandler were collected from Swat (Mingora.) Different cultivation systems were adapted i.e., standard growing media in polyethylene bags (T ), soil less media (T ), high tunnel (T ), green house (T ), 1 2 3 4 including open field condition on ridges (T ) by keeping plant to plant 5 distance of 30 cm and row to row distance of 60 cm. The study was conducted to evaluate the effects and suit...

 Habib Iqbal Javed, Ashiq Saleem, Javed Fateh, Mozammil Hussain, Naheed Akhtar and Shamim-ul-Sibtain Shah*

DEVELOPMENT OF RESISTANT MAIZE GERMPLASM
... the basis of survived plants, a total of 250 accessions including 150 exotic out of 350 and 100 indigenous out of 900 were selected. During autumn 1999, out of 250 accessions (progenies) 35 exotic and 10 indigenous could survive under artificial infestation. Under natural infestation, 100 progenies performed little better. The best plants among these progenies were advanced by self pollination. A total of 400 self pollinate...

 Muhammad Tariq*, Raja Muhammad Omer**, Muhammad Ashraf Mian*, Obaid Ur Rehman***, Amjad Tahir Virk and Kazim Abbass**

PROMOTING CERTIFIED SEED AVAILABILITY OF WHEAT (TRITICUM AESTIVUM L) THROUGH PUBLIC-PRIVATE PARTNERSHIP AND ITS IMPACT ON YIELD IN RAINFED AREAS
...tand which enabled the plants to withstand abiotic stress especially drought during the crop season. The seed multiplication of crop varieties of rainfed areas can be done in irrigated areas to ensure the quality of seed and its availability in rainfed areas, which ultimately will increase the income of the farming community of the area.

...

 Arshad Ali, Imdad Ali Mahmood, Muhammad Salim, Muhammad Arshadullah* and Abdul Rasool Naseem**

GROWTH AND YIELD OF DIFFERENT BRASSICA GENOTYPES UNDER SALINE SODIC CONDITIONS
...domly (average of five plants per replication) at the time of crop maturity. Ionic concentration in plant tissues and oil content in seeds were also determined. Comparatively more number of branches and pods per plant were produced by cultivar Dunkled closely followed by BARD-I while maximum seed yield (241.7 and -1 235.1 kg ha ) was obtained from Dunkled and Sultan Raya, respectively which was statistically at par. However, BRS-II and Rainbow showed significa...

 Muhammad Arshadullah, Syed Ishtiaq Hyder, Arshad Ali and Imdad Ali Mahmood*

CUMULATIVE EFFECT OF SULFUR AND CALCIUM ON WHEAT GROWTH AND YIELD UNDER SALINE-SODIC SOILS
...+ receiving CaSO4 help plants to attain more Ca , K and S to avoid Na uptake.

...

 Sajida Taj*, Akhter Ali*, Nadeem Akmal*, Shujaat Yaqoob** and Mubarik Ali***

RAISED BED TECHNOLOGY FOR WHEAT CROP IN IRRIGATED AREAS OF PUNJAB, PAKISTAN
...per analyzes the determinants of adoption of raised bed planting of wheat in irrigated areas of Punjab, Pakistan. Wheat is an important staple food of Pakistan. It contributes 13 % to the value added in agriculture and 2.6 % to the GDP. The agrarian economy of Pakistan is continuously under stress due to the low yield of almost all the crops and constrained with many problem. One of the most important issues of agriculture is water shortage which is increasing...

 Rabeea Tariq*, Khalid Mahmood Qureshi*, Imran Hassan*, Muhammad Rasheed* and Usman Shaukat Qureshi*

EFFECT OF PLANTING DENSITY AND GROWING MEDIA ON GROWTH AND YIELD OF STRAWBERRY
...s. Results showed that plants grown at low planting distance on all growth media showed more pronounced results as compared to high planting distance. Plants grown in peat moss at both planting densities moderately increased the plant height, canopy size, leaf area, number of fruits, fruit size, fruit weight and titratable acidity. A significant increase in fresh and dry weight of leaves, number of leaves, fruit yield in ter...

 Shahida Khalid*and Shahida Nasreen Khokhar*

INTERACTION OF HERBICIDES AND BIO-INOCULANTS WITH AGRICULTURAL CROPS AND WEEDS
...ld.

...

 Asghar Ali*, Muhammad Tahir**, Shahid Riaz Malik* and Muhammad Hanif Munawwar*

EVALUATION OF PRE AND POST-EMERGENCE HERBICIDES FOR WEED MANAGEMENT IN LENTIL (LENS CULINARIS MEDIK.)
...using injury to lentil plants.

...

 Abid Hussain*, Khalid Mahmood Aujla* and Nouman Badar*

YIELD GAP DETERMINANTS FOR WHEAT PRODUCTION IN MAJOR IRRIGATED CROPPING ZONES OF PUNJAB, PAKISTAN
...he yield gap and determinants of wheat production in the Punjab province of Pakistan. It is based on cross sectional data from 210 farmers for the crop year 2009-10. Results suggest that farm level wheat yields are less than the potential yield level by 33.0%, 43.0% and 50.6% in the mixed-cropping, cotton-wheat and rice-wheat zones of the province, respectively. Ordinary least square regression analysis of wheat production by assuming Cobb-Douglas specificatio...

 Sajid Ali*, Quratulain Altaf** and Umar Farooq* 

ACREAGE RESPONSE OF FLUE CURED VIRGINIA TOBACCO IN KHYBER PAKHTUNKHWA
...ifying important determinants of acreage response of FCV tobacco crop in the study area. 

...

 Muhammad Ali*, Ghulam Mustafa Sajid**, M. Faisal Anwar Malik*** and Kalimullah****

ESTABLISHMENT OF IN VITRO CULTURE OF GRAPES
...lture from shoot tip explants (meristemetic tissue) of grapes was investigated through tissue culture technique. These explants were collected from gene bank of Institute of Agricultural Biotechnology and Genetic Resources (IABGR), National Agricultural Research Centre (NARC), Islamabad, Pakistan. Fifteen accessions of grapes were surface sterilized and tested on 75% MS media for germination and initial growth parameters. Ac...

 Aniqa Iram*, Javed Khan**, Nadeem Aslam**, Ehsan-ul-Haq**, Habib Iqbal Javed**, Muhammad Irfan*, Awais Rasool*, Muhammad Ishaque Mastoi** and Sumera Aslam* 

EFFICACY OF PLANT DERIVED OILS AND EXTRACTS AGAINST WHITEFLY, BEMISIA TABACI (GENNADIUS) ON SESAME CROP
... on more than 600 host plants worldwide. Different methods are being used for its control. The present experiment was conducted to determine the effect of some plant extracts of mint (Mentha spp.) and geranium (Pelargonium graveolens) and soybean oil (Glycine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data were recorded 24h before and 24h, 48h, 72h and 168h after application of each sp...

 Hassnain Shah*, Nadeem Akmal*, Waqas Farooq*, Muhammad Azeem Khan* and Shahid Munir**

SHIFT FROM SITE DEVELOPMENT TO SKILL DEVELOPMENT: A CASE STUDY OF WATER HARVESTING THROUGH MICRO CATCHMENTS
...conservation for fruit plants but also cost effective, water, labor and resource saving along with farmer friendly under rainfed condition with scare supplemental water availability. The cost of adoption of technology including labor charges for its preparation and maintenance was recovered from irrigation cost saved from single rainfall at the demonstration site. One of the important implications drawn in this regard was the need of a shift from site developm...

 Nosheen Zahra*, Ghulam Sarwar* and Sher Muhammad**

COMPARISON OF GYPSUM AND POTASSIUM SILICATE FOR RECLAMATION OF SALINE SODIC SOIL
...n all the pots i.e., 3 plants per pot. Necessary N, P and K fertilizers were applied at the recommended rate. After crop harvest, soil samples were taken for analysis of pH, electrical conductivity (EC), sodium adsorption ratio (SAR) and exchangeable sodium percentage (ESP) of soil. All the amendments when used alone or in combination with each other improved the chemical parameters of soil. All levels of gypsum (100%, 75% and 50% G.R) proved effective in lowe...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*

EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
...estibility in small ruminants. Goats fed II , HC II , HC II , HC II and HC had similar 100% 25% 75% 50% 50% 75% 25% 100% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in general more digestible with more than 65% dry matter digestibility. The lowest...

 Ibrar Ali*, Abdul Mateen Khattak*, Muhammad Ali* and Kalim Ullah**

PERFORMANCE OF DIFFERENT TOMATO CULTIVARS UNDER ORGANIC AND INORGANIC REGIMES
... ha ) were recorded in plants provided with organic conditions Roma cultivar performed better than other cultivars under the agro climatic condition of Peshawar followed by cultivar Rio Grande. Therefore, organic tomato production, and these two cultivars are recommended to be grown in Peshawar area. 

...

 Sameera Arshad*, Iftikhar Hussain*, Maqsood Anwar* and Sarwat Naz Mirza*

HABITAT SURVEY FOR RECOGNIZING BIRD ATTRACTANTS AROUND BENAZIR BHUTTO INTERNATIONAL AIRPORT, ISLAMABAD, PAKISTAN
... recognizing bird attractants and hazardous bird species was carried out at 8 selected study sites within 8 km radius of Benazir Bhutto International Airport (BBIA), Islamabad. Each site represented a different habitat and was ranked for the presence of bird attracting sites using Habitat Composite Index (HCI). Habitat representing naturally preserved recreational area (Ayub Park) showed highest rank (9.7) for the presence of bird attracting sites followed by ...

 Quratulain*, Muhammad Aslam**, Muhammad Khalid Rafique*, Mian Atiq Ahmad* and Rashid Mahmood***

POPULATION DYNAMICS OF ROSE APHID MACROSIPHUM ROSAE L. ON DIFFERENT CULTIVARS OF ROSA INDICA L. IN PAKISTAN
...rch field area on rose plants for rose aphid populations during 2008-09. Data were recorded on weekly basis. Nymphs, winged and wingless adults were counted from leaves (upper, middle and lower leaves), buds and flowers by visual observation from tagged plants. Aphid populations start to develop in November and its population decline with decline in temperature in December. While its population started rising again at the en...

 Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**

EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...her in fully irrigated plants as compared to water stress ones. Fertilizer treatments had no considerable effect on phenolic compounds.

...

 Raja Zoq-ul-Arfeen*, Aamir Saleem*, Sarwat Naz Mirza*, Muhammad Akmal**, Hafiz Muhammad Tayyab* and Obaid Afzal***

BIODIVERSITY AND PHYTOSOCIOLOGICAL STUDIES OF UPSTREAM AND DOWNSTREAM RIPARIAN AREAS OF PAKISTAN: SPECIAL REFERENCE TO TAUNSA WILDLIFE SANCTUARY AND KETI SHAH FORESTS
...sanctuary. Total 14259 plants/individuals were recorded, which belong to 54 plant species with 18 different families. In Taunsa pre-monsoon survey, total 30 plant species were found with 4476 plants from 16 different families. In Taunsa post-monsoon survey total 3348 individuals were recorded from 20 plant species and 9 families. Similarly, in Keti Shah forest, total 3975 individual were recorded from 22 species and 11 famil...

 Imran*, Shaheeda Naveed**, Asad Ali Khan* and Inayat Khattak* 

IMPACT OF PHOSPHORUS LEVELS AND SEED RATES ON GROWTH AND YIELD OF LATE SOWN MAIZE ON HIGH ELEVATION IN SWAT, PAKISTAN
...(P) is required by the plants relatively in large quantity and is the second most important crop nutrient that increases productivity of maize (Zea mays L.). An experiment on effect of different P O levels and seed rates on growth and yield of late sown maize cv. 2 5 Baber on high elevation during kharif season, was conducted at Farmer Field School, Swat, Pakistan during summer 2012. The experiment was laid out in randomized complete block design having three ...

 Anwar Hussain* and Muhammad Rahman**

ROLE OF TRAININGS ON FARMERS' PROFITABILITY OF MEDICINAL AND AROMATIC PLANTS IN MOUNTAINOUS AREAS OF DISTRICT SWAT, KHYBER PUKHTUNKHWA
...medicinal and aromatic plants (MAPs) in mountainous areas of district Swat. A convenient sample of 100 respondents, engaged in MAPs in Chail Valley Madyan was taken. Information about revenue from MAPs, marketing, prices and quantities was collected through a structured questionnaire. The respondents were given training under Swiss Development Cooperation Project at the time of collection, harvesting, cleaning, drying, packing and marketing of MAPs. The overal...

 Muhammad Nisar Khan*, Tariq Hassan*, Hassnain Shah*, Saleem Abid*, Irum Raza* and Saqib Shakeel Abbasi*

ASSESSMENT OF THE PROFESSIONAL TRAINING COURSE UNDER WATERSHED PROJECT AT FATEHJANG FIELD STATION, PUNJAB, PAKISTAN
... Majority of the participants were strongly and merely agreed upon the training practicality, technologies adoption probability and its advantages at farmer's field. Overall, most of the training participants were satisfied with the knowledge sharing presentations about the specific technologies discussed during the training.

...

 Azhar Usman Ali*, Ghulam Sarwar*, Muhammad Aftab* and Sher Muhammad**

EFFECT OF SOIL AND FOLIAR APPLIED COPPER ON GROWTH AND YIELD OF WHEAT (TRITICUM AESTIVUM L.)
...-2000) were sown and 3 plants were maintained in each pot after germination. Foliar application of copper was done at booting and tillering stage. At maturity, data regarding different yield components were noted and wheat plants were harvested. Grain yield and total biomass was also recorded. Soil samples were collected from all pots and analyzed for copper concentration by using wet digestion method. Results of the experim...

 Muhammad Mudasar Aslam ⃰, Muhammad Jamil**, Ijaz Malook**, Amana Khatoon*, Ali Rehman*, Abdur Rahim***, Pirzada Khan*, Shakir Ullah Khan Shakir*, Shahid Irfan*, Faizan Ullah****, Khair Ul Bashar**, Mahideen Afridi** and Shafiq Ur Rehman*

PHYTOTOXIC EFFECTS OF CALOTROPIS PROCERA, TAMARIX APHYLLA AND PEGANUM HARMALA ON PLANT GROWTH OF WHEAT AND MUSTARD
...otoxic effects of many plants are known on growth of different useful crops. This research study was designed to find out phytotoxic effects of Calotropis procera, Tamarix aphylla and Peganum harmala on seed germination and seedling length of wheat and mustard. Results showed that seed germination of wheat was significantly decreased by 5%, 10%, 15%, 20% and 25% while mustard seeds were resistant and were affected by higher dilutions (15%, 20% and 25%) of all ...

Sumia Bint Zaman*, Waqas Farooq*, Sidra Majeed*, Hasnain Shah*, and Abdul Majid**

ASSESSMENT OF AGRICULTURE SERVICE PROVIDERS' TRAINING ON WATER CONSERVATION TECHNOLOGIES IN POTHWAR REGION
... opinions of the participants before and after the training. Descriptive analysis alongwith paired 't' test was used to measure the effectiveness of training. Results indicated higher satisfactory level as majority of the participants were strongly agreed (73%) and agreed (23%) that trainings were participatory and skill development oriented and as 96% agreed or strongly agreed that these were helpful in starting the busines...

 Muhammad Farrukh Saleem*, Munir Ahmad*, Shakeel Ahmad Anjum*, Muhammad Aown Sammar Raza** and Abdul Shakoor*

EFFECT OF TOPPING UNDER DIFFERENT NITROGEN LEVELS ON EARLINESS AND YIELD OF COTTON
...showed that 90 cm tall plants -1 produced maximum seed cotton yield when supplied with 150 kg N ha ; 120 cm tall -1 plants gave maximum seed cotton with 200 kg N ha while 150 cm tall cotton plants -1 needed 250 kg N ha for highest seed cotton production. In conclusion, cotton growth can be manipulated successfully for better performance by topping provided N dose is monitored.

...

 Tasawar Sultana*, Farah Deeba* and S.M. Saqlan Naqvi*

HIGH-THROUGHPUT AGROBACTERIUM-MEDIATED TRANSFORMATION OF MEDICAGO TRUNCATULA IN COMPARISON TO TWO EXPRESSION VECTORS
...truncatula transformed plants expressing OsRGLP1 were obtained through GATEWAY technology using pGOsRGLP1 (pH7WG2.0::OsRGLP1). The transformation efficiency of this vector was compared with expression vector from pCAMBIA series over-expressing same gene (pCOsRGLP1). A lower number of explants generated hygromycin resistant plantlet for instance, 18.3 with pGOsRGLP1 vector as compared to 35.5% with pCOsRGLP1 vector. Transform...

Muhammad Zahid Kiani*, Tariq Sultan**, Arshad Ali**, Ghulam Qadir*** Imdad Ali Mahmood**, Tauseef Tabassam**, Muhammad Arshad Ullah** and Nasir Abbas* 

EFFECT OF PGPR STRAINS ON SUNFLOWER GROWTH AND NUTRIENT CONTENTS UNDER SALINITY STRESS
...r six weeks of sowing, plants were harvested and data regarding root length, plant height, root dry weight and shoot dry weight were recorded. The plant growth improved significantly with PGPR strain under salt stress. The root length, plant height, root and shoot weight increased up to 40%, 40%, 167% and 255%, -1 respectively over un-inoculated at 12 dS m salinity level. Whereas an increase of 38%, 54%, 109%, and 117% in root length, plant height, root weight...

 Farid Asif Shaheen*, Sadia Parveen*, Ahmed Zia**, Ghulam Qadir*,
Mureed Husain*** and Rifat Ullah Khan****

PREDATORY APTNESS OF ANTS AGAINST RED FLOUR BEETLE, TRIBOLIUM CASTANEUM HERBST (TENEBRIONIDAE: COLEOPTERA) IN WHEAT FLOUR
...se results indicate that ants could be used as biological control agents against RFB.

...

 Syed Waqar Shah* and Muhammad Ather Rafi*

PIERID (LEPIDOPTERA: PIERIDAE) PESTS AND THEIR NEW CRUCIFERS HOSTS IN POTHWAR REGION OF PAKISTAN
...cultivated cruciferous plants, the known cultivated hosts such as , , ,, var. and were attacked by , and . Among above reported Pieridae species is reported for the first time however, is also a new record from districts Rawalpindi and Chakwal and from Jhelum, Rawalpindi and Chakwal. However, the non-cultivated host plants in the region were , , and . Among noncultivated hosts was the new host for . C. was found common host ...

Mehwish Kiran*, Muhammad Saleem Jilani*, Kashif Waseem*
and Muhammad Sohail**

EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON GROWTH AND YIELD OF RADISH ( L)
...e found in NPK treated plants followed by PM, GM, SS, PrM and FYM, respectively.

...

 Arshia Naeem*, Maria Anjum*, Mariam Rehman*, Zahid Mahmood** and Muhammad Asif Kamran**

AN INTEGRATED INFORMATION SYSTEM TO FACILITATE FARMERS IN WHEAT, SUGARCANE AND OTHER CROP DISEASES IDENTIFICATION
...e yield losses in crop plants. An integrated application to facilitate farmers to communicate their crop related issues directly to agriculture scientists is proposed. This 'AXPERT Platform' consists of web application that provides user centered interface to farmers and a desktop application that facilitates agricultural scientists to identify crop diseases. A case study was developed from Faisalabad region where information about crops, their soil conditions...

 Ghazala Nawaz*, Muhammad Nawaz Malik**, Muhammad Hassan
Mushtaq***, Fraz Munir Ahmad****, Ali Abdullah Shah*****, Farooq
Iqbal******, Shinawar Waseem Ali*******, Zahida Fatima******** and
Amjad Khan*********

SURVEILLANCE OF BRUCELLOSIS IN LIVESTOCK IN RURAL COMMUNITIES OF PUNJAB, PAKISTAN
...rom small and large ruminants of subtropical rural communities in the province of Punjab during January-March, 2015. Total 59665 sera samples from apparently healthy animals were collected and screened by Rose Bengal Plate test and confirmed by Complement fixation test, respectively. After adjustment for test sensitivities and specificities accordingly, and chi square analysis of results, the true prevalence per 1000 animals in buffaloes was (7.86%), significa...

 

Shakir Ullah*, Aish Muhammad*, Iqbal Hussian*, Hafeez-Ur-Rahman**, Muhammad Zeeshan Hyder***, Muhammad Din**** and Nizamud Din

MORPHOLOGICAL VARIATIONS IN APRICOT CULTIVARS GROWN IN GILGIT BALTISTAN PAKISTAN
...on of New Varieties of Plants) and the International Board for
Plant Genetic Resources (IBPGR) characteristics. Three cultivars
(Charmagzi, Shai Pawand and Narie) had fruit weight from 39-41 g. Most of
the cultivars had small fruit with sweet and large size kernel. Habi and
Astore 1 had latest harvest in late June. Nili Pawand, Shai Pawand and
Skardu Local were determined to late blossom as compared t...

 

ROLE OF HONEY BEES FORAGING ACTIVITIES IN INCREASED FRUIT SETTING AND PRODUCTION OF APPLES APIS MELLIFERA MALUS DOMESTICA

...ght gain in pollinated plants compared to non-pollinated plants. Maximum number of fruits per panicle were 5.33±0.51(Mean±SE) whereas the highest fruit weight 170±2.65g (Mean±SE) was recorded in plants provided with augmentation of honey bees along with natural pollination. The lowest fruit weight of 80±3.05g (Mean±SE) and the minimum 0.33±0...

 Asif ullah Khan*, Faizan Ullah*, Sultan Mehmood*, Muhammad Irshad* and Farhat Ullah Khan**

ALLELOPATHIC EFFECTS OF JATROPHA CURCAS L. LEAF AQUEOUS EXTRACT ON EARLY SEEDLING GROWTH OF L. PARTHENIUM HYSTEROPHORUS
... of not only with crop plants but also with weed species before its introduction into agroforestry systems. During present investigation, allelopathic potential of leaf aqueous extract was investigated on seed germination and seedling development of L. Extracts were applied at 25%, 20%, 15%, 10% and 5% as seed soaking for 8 hours prior to sowing. Phenolics compounds were found in aqueous extracts and were higher in 25% extract (52.72 mg gallic acid eq. / gm of...
Muhammad Sharif1*, Shahzada Sohail Ijaz2, Muhammad Ansar3, Ijaz Ahmad4 and Syed Abdul Sadiq5
...ally same under CT (83 plants m-2, 6.02 Mg ha-1, 3.32 Mg ha-1, respectively), MT (83 plants m-2, 5.90Mg ha-1, 3.26 Mg ha-1, respectively) and RT(72 plants m-2, 5.92 Mg ha-1,3.20Mg ha-1, respectively)tillage systemswith retention of crop residues,whilesignificantly lower values were recorded u...

Anza Zahid*, Muhammad Ali Ayub, Mujtaba Saeed, Nasir Pasha, Abdul Jabbar Dar, Huzaifa Javed, Aimen Shakeel, Amna Nasir, Ana Akbar, Zainab Tarrar and Ayesha Humayun 

...aire. Out of 177 participants, 55.36% were females and 51.41% participants were in the range of 52-75 years of age. Among 79 males, majority (45.6%) were employees, whereas 91.8% were housewives among females’ participants,. Out of 177 diabetic patients, 42 patients (23.7%) were non-compliant and 135 patients (62.5%) were found to be compliant. The normal glucose level was observed i...

Samina Ashraf1*, Ghulam Haider2 and Maimoona Ashraf

... selected as the participants of the study. The age of participants was between 25 to 40 years and they had past experience of any type of abuse of violence, and were cognitively normal to respond interview. At first we identified the participants with the help of survey. A series of detailed and in- depth interview of 60 to 90 minutes were conducted from the particip...
Naimat Ullah Khan1,2, Muhammad Hassan Saleem1, Aneela Zameer Durrani1Nisar Ahmad3, Ayesha Hassan1, Muhammad Kashif Prince1, Muhammad Luqman Sohail4,*, Mian Saeed Sarwar2, Hazrat Ali2, Tahir Usman2, Asadullah Khan2, Siffat Ullah Khan3 and Shahid Zaman5
... pathogens in young ruminants and has been associated with diarrhea. The current study was conducted in three selected districts (Bannu, Lakki Marwat and Kohat) of southern Khyber Pakhtunkhwa (KPK) to determine the prevalence and risk factors responsible for the occurrence of Cryptosporidium in lambs and has been known to cause human infection. Three hundred and sixty fecal samples (n=360) were collected through convenient sampling from apparently healt...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
...iv>Peste des petits ruminants (PPR) is as a transboundary disease whose occurrence hampers the trade and consequently causes an enormous economic losses. It is a disease of sheep and goat, particularly in the regions of Africa, Middle East and Asia. Besides clinical signs and symptoms of PPR various diagnostic assays, both serological and molecular, have been developed and are applied for estimating the current status of the disease. This review article focuse...
Muhammad Zameer Kayani1,*, Tariq Mukhtar2 and Muhammad Arshad Hussain3
...he other hand, ages of plants at inoculation had negative correlations with reductions in these parameters at each inoculum density. The production of galls was found to be positively correlated with the inoculum densities and plant ages. However, rate of nematode build up decreased with an increase in inoculum density and appeared to be negatively correlated with inoculum densities and, on the contrary, was found to be positively correlated with plant ages. T...
Muhammad Zeeshan Majeed1,2,*, Abu Bakar Muhammad Raza2, Muhammad Afzal2,Hafiz Salah-ud-Din2, Imtiaz Sarwar2, Muhammad Yahya2 and Khurram Shehzad3

Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1 

...ne yield and its determinants in study area. The results revealed that per acre net return after subtracting total cost from gross revenue was Rs. 33,173.65/-. Results illustrate that labor days, seed quantity, tractor hours, urea and pesticides have positive significant effect on sugarcane yield. Resource use efficiency analysis shows that marginal value product (MVP) to marginal factor cost (MFC) ratios for labor days, irrigation, urea, FYM and pesticides a...

Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1 

...ne yield and its determinants in study area. The results revealed that per acre net return after subtracting total cost from gross revenue was Rs. 33,173.65/-. Results illustrate that labor days, seed quantity, tractor hours, urea and pesticides have positive significant effect on sugarcane yield. Resource use efficiency analysis shows that marginal value product (MVP) to marginal factor cost (MFC) ratios for labor days, irrigation, urea, FYM and pesticides a...
Mubashar Hussain, Muhammad Faheem Malik, Sehreen Siddique, Muhammad Umar, Tamkeen Zainab, Fatima Zafar
...t pests and their host plants.
...
María Magdalena Crosby-Galván1, Bernardino Espinoza-Velasco1 and Mónica Ramirez-Mella2,*
...a standard diet for ruminants elaborated with corn stover, corn grain and soybean meal, and three experimental diets with 10, 20 and 30% dry residue of chihua pumpkin instead of corn stover. Dry matter digestibility and gas production was determined at 24 h of incubation in ruminal fluid obtained from two Holstein cows with a ruminal cannula. Randomized block experimental design was used as and a comparison of means was performed by the Tukey test. The results...

Nadia Mubarik1, Aqib Iqbal1*, Iqbal Munir1 and Muhammad Arif2 

...oliar application, the plants were regularly irrigated upto one week and water stress was imposed by withholding water from half of the pots for 20 days. Data were recorded on the relative water content (RWC), proline, sugar content and transcripts abundance of Lhcb2 gene in the selected leaves. Application of CaCl2 increased the RWC, proline and sugar content as well as the Lhcb2 expression in the leaves under both irrigation conditions; however, the effect w...
Muhammad Umar1, Mubashar Hussain1,*, Ghulam Murtaza1, Farid Asif Shaheen2 , Fatima Zafar1
..., Terns, Ducks and Cormorants), eutrophication (Painted stork and Dalmatian pelican), Agrochemical Contamination (Black-tailed godwit and Fish bird) Heavy Metal Pollution Contamination (Cattle egrets), Unsustainable Fisheries Practices (Ducks), invasive species (Little egret and Night herone) and illegal hunting (Geese, Ducks, Siberian cranes and Bustards) have resulted in the decline of species abundance.. Regular conduct of surveys for important migratory bi...

Zakirullah Jan1, Shamsher Ali1*, Tariq Sultan2, Muhammad Jamal Khan1, Zahir Shah1 and Farmanullah Khan1 

... with large numbers of plants and microbial mats. In this regard, a pot experiment was carried out with the aim to assess the impact of different strains of cyanobacteria on rice crop growth and nutrients uptake under saline soil condition at National Agricultural Research Center (NARC), Islamabad Pakistan during summer 2016. A total of 18 experimental pots were induced with salinity of 7.0 dS m-1 and arranged in Completely Randomized Design (CRD) with three r...
Ghulam Muhae-ud-Din1,4, Anam Moosa1, Umer Farooq Ghummen1, Muhammad Jabran1, Amjad Abbas1, Muhammad Naveed2, Abdul Jabbar1 and Muhammad Amjad Ali1,3,*
... a huge number of crop plants. It also infects the ornamental plants resulting in a serious growth-limiting factor in ornamentals. In this study, the response of ten ornamental plants to M. incognita was assessed in pot experiments. All the ornamental plant species showed varying degree of infection of M. incognita. Rhapis excels and Ophiopogan japonicas were mo...

Muhammad Suhaib1*, Ijaz Ahmad2, Masooma Munir3, Badar-Uz-Zaman1, Bushra Atta4 and Muhammad Khubaib Abuzar5 

...cal parameters of crop plants however lower level of salicylic acid 0.25 mM was found more efficient then the higher level of salicylic acid. Salicylic acid induced improvement is significant regardless of stress environment or normal growth conditions.
 

...

Safdar Ali1*, Obaidullah Shafique1, Tariq Mahmood2, Muhammad Amir Hanif1, Ijaz Ahmed3 and Bashir Ahmad Khan

...by DNA transfer in the plants or nanoparticle-mediated gene. Biofuel production from biomass is estimated to speed up using nanotechnology. Researchers and manufacturers have to demonstrate that the application of nanotechnologies have no harmful effect on the atmosphere against the anomaly based only on small amounts of toxicological research and concerns about the safety of nanomaterials.

...

Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4  

...e the distance between plants to plant was 30 cm. The seed was sown in the first week of August. The following parameters were studied in the experiment i.e. days to flower initiation, days to flower completion, plant height, days to maturity, stem diameter, head diameter, number of leaves, 1000 seed weight and seed yield per hectare. Quality parameters were consisted upon oil content (%), protein content (%), and fatty acid profile. The results showed that si...
Hongqun Li1, Xiaoli Liu2,*, Zhenmin Lian3,RenheWang4, Yongbin Wang4, Yongyao Fu1 andDingyi Wang5
...cess of brown-eared pheasants was negatively related to cover of shrubs, and first-order interaction between cover of trees and cover of shrub at a height of 1.0 m, suggesting bigger cover of shrubs, cover of trees and cover of shrub at height of 1.0 m were the best predictors of nest success from a diverse predator community. In addition, brown-eared pheasants have a preference for rock-cavities. Therefore, based on nest-si...
Huma Naz1,*, Sajid Abdullah2, Sidra Naz3, Sidra Abbas2, Wardah Hassan2, Shakeela Perveen2, Moazama Batool1, Laiba Shafique2
...e toxic effects of pollutants in aquatic systems. 
...

Saima Rani*, Hassnian Shah, Nusrat Habib and Muhammad Azeem Khan 

...in Pakistan. The determinants of willingness to pay of consumers estimated by using the probit model. The model contains the information of socioeconomic characteristics, awareness and preferences of organic vegetables and product attributes. The empirical findings indicate that age, employment status, income, education, number of children, taste, no chemical residual, high nutritional value, freshness and colour of the vegetables have positive effects on co...

Ghufran ul Haq1*, Muhammad Arif2, Asad Ali2 and Mian Inayatullah3 

...lies inoculated tomato plants. Transmission properties of the virus were determined by inoculation of tomato plants of susceptible cultivar, Roma-VF, by whiteflies, determining the minimum time required for acquisition and inoculation of the virus, latency period and the persistence capacity. The highest incidence of 9.47 percent of TYLCV was recorded in Mohmand Agency, followed by Malakand Agency with 8.2 percent, Shabqadar...

Fayaz Ahmad1*, Noorullah Khan1, Farrukh Siyar Hamid1, Qamar uz Zaman1, Shamsul Islam1, Muhammad Abbas Khan1 and Sair Sarwar

...plications. Mature tea plants (26 year old) of Qi-men variety were deeply pruned (30 cm from the ground level by completely defoliating the bushes) on five different dates i.e., November, December, 2012, January, February and March, 2013 having one month interval. Application of potash fertilizer @ 90,120 and 150 kg ha-1 was also compared with control for studying its role in the recovery and growth of deeply pruned tea. The earliest shoot sprouting (April, 20...
Abdul Samad1, Ferhat Abbas1, Zafar Ahmad1, Olena Pokryrshko2 and Tauseef M Asmat1,*
...e of deadly food contaminants like Salmonella spp., Listeria monocytogenes, Campylobacter jejuni and E. coli (O157:H7) in various types of food items consumed locally. Total of 800 most common food samples such as chicken, beef meat, raw milk, vegetables and salad samples were collected from retail market, the overall contamination of food samples with infectious agents was 48.37%. Campylobacter jejuni was recorded much higher (28.9...

Shamsher Ali1*, Sarmad Khan1, Muhammad Jamal Khan2, Naveed ullah4, Muhammad Rashid3 and Wiqar Ahmad1 

...weeks after emergence. Plants growth was observed for three weeks after emergence. Statistical analysis of the data showed that both soils and varieties significantly (p<0.05) affected per cent emergence and growth. Interactions between soils and varieties were significant (p <0.05) regarding emergence and plant heights. From the interactions it is clear that under normal soil conditions, emergence percentage of Pirsabak-2004 variety was maximum (100 %),...
Wael S. El-Tohamy1,*, Russell R. Hopcroft2 and Nagwa E.M. Abdel Aziz3

Abdul Basit1, Muhammad Zeeshan Majeed1,4*, Sohail Ahmed2, Gohar Ali2 and Muhammad Javaid

...tation on bitter gourd plants and compared it with reduced-risk insecticide formulations of spinosad. Refractive sheets of red, orange, yellow, green, blue, black and white were installed in M. charantia beds at three different angles (30º, 60º and 90º). Results revealed that control treatment exhibited significantly higher fruit fly infestation (60%) with minimum marketable fruit yield (374g/bed) than all other treatments. Among treatments, yel...

Muhammad Fiaz1*, Muhammad Afzal1 and Muhammad Zeeshan Majeed1,2 

...insect pests of citrus plants and a putative vector of Huanglongbing worldwide. Treatments were comprised of label-recommended (FD) and its half (HD) dose rates of spirotetramat and I. fumosorosea formulations. Both treatments were applied either alone or in binary combinations. There was a significant reduction in psyllid population for all treatment combinations as compared to control (F8, 107 = 70.36; P-value = 0.001 for 2016 and F8, 107 = 63.58; P-value &l...
Sukirno Sukirno1,2, Muhammad Tufail1,3,*, Khawaja Ghulam Rasool1Said El Salamouny1, 4, Koko Dwi Sutanto1 and Abdulrahman Saad Aldawood1
...sunlight. Many UV protectants were used to improve the efficacy of these viruses under field conditions. The objective of the current study was to evaluate the effectiveness of plant extracts to improve the persistence of Spodoptera littoralis multiple nucleopolyhedrovirus (SpliMNPV) against beet army worm, Spodoptera exigua(Hübner) under harsh sunny field conditions in Saudi Arabia. A preliminary test of SpliMNPV was performed...
Amna Waseem, Sikander Ali* and Syeda Wajiha Khalid
...MMS. Among 13 mutant variants, EM-7 showing maximum lipase activity of 71±3.55 U/g, was selected. Resistance in the hyper producing strain was developed by exposing it with low levels of L-cysteine HCl to protect it from instability. It was observed that under optimum conditions at 30°C temperature, pH 7, and incubation period 64 h, the lipase activity was increased up to 124±2.48 U/g. The crude enzyme was purified by ammonium sulfate precipi...
Naveed Akhtar1, Humaira Zareen2* and Rubina Sarmad3
...mn; 2.1. All the participants were unmarried, 108 (94.7%) liked traditional food, and 84 (73.3%) had a habit of daily breakfast intake. Most of the students (n=73, 64%) were consuming fast/junk food while 81(71.1%) of the students used to take meat and meat products three times a week. A total of 42 respondents (36.8%) were underweight while 41 (36%) were anemic. Positive association was found between eating habits and hemoglobin levels (p = 0.001). Relat...
Faisal Masood*1, Ranjit Kumar Sah2 and Ahmad Humayun Sarfaraz3
...rsquo;s fracture and warrants further randomized control trial study to establish its efficacy in such cases.
...
Mumtaz Akhtar, Iffat Naheed, Khadija Waheed* and Amna Khanum
...ean age of study participants was found to be 29.89±5.89 years while the mean gestational age was 38.86±1.38 weeks. Postpartum haemorrhage was observed in 35.45% cases. Blood loss was recorded in patients with a mean of 374±134.91 mL. Statistically, a highly significant difference was observed between the blood loss and postpartum haemorrhageamong the patients (i.e. p-value=0.000). A low frequency of postpartum hemorrh agein women experien...
Ayesha Noreen1, Dilara A. Bukhari2 and Abdul Rehman1,*
...e of environmental pollutants, smoke, tobacco, xenobiotic, drugs, medical materials, radiations, pesticides, industrial solvents and ozone. The processes running in the cell membranes, peroxisomes, mitochondria and endoplasmic reticulum also generate ROS. ROS can be activated by numerous external factors, and play an important role in cancer growth and metastasis. ROS and tumor cell interaction could activate the signalling pathways, promoting cell proliferati...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
...bers of MM in small ruminants suspected of CCPP in Northern region of Pakistan. A total of 300 samples, (150 sheep and 150 goats) were randomly collected from nasal discharge, pleural fluid and lung tissues, and streaked into Pleuropneumonia like organism (PPLO) medium for isolation and identification of Mycoplasma species. Confirmed mycoplasma isolates were subjected to species specific PCR to identify members of MM cluster. Results revealed that 79/30...

Jahangir khan* and Abbas Ullah Jan 

...entify important determinants of households’ WTP. Results show that 93% of respondents are willing to pay a price premium of PKR. 14. Empirical findings reveal that socio-demographic characteristics like age, education and income have positive significant effects on households’ willingness to pay. Findings of the study also reveal a significant influence of employment status of the household’s head on WTP, whereas household’s size has a...

Abdur Rehman and Zahir Shah 

...nt and root growths of plants. These results suggested that application of both Mo and Fe is necessary for pea crop enhanced nodulation, N2 fixation, yield, nutrient uptake and for improved soil fertility 

...

Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla

...;">Peste des petits ruminants (PPR) is an endemic disease in Hail, Saudi Arabia where outbreaks are regularly reported. This study was carried out to analyze nucleoprotein (N) gene of PPRV from fatal infections in small ruminants. For this purpose, RNA was extracted from suspected animal samples (n=18) and were screened by real time-PCR. Additionally, to assess the phylogenomics, the N gene was amplified and sequenced from s...
Wang-Dui Basang1, Tian-Wu An2, Luo-Bu Danjiu3, Yan-Bin Zhu1, Shi-Cheng He3, Xiao-Lin Luo2, Wei-Wei Ni4, Xiao Wang4, Shu-Zhu Cheng4, Jian Wang4 and Guang-Xin E4,*
...cleotide copy number variants, and 59 haplotypes were detected. The number of haplotypes within the population ranged from 17 (SN and JL) to 28 (DX). The haplotype diversity ranged from 0.9420 (SN) to 0.9770 (NR). The highest nucleotide diversity was found in the JL population (0.01479), whereas the lowest was found in the SN (0.00894) population. Phylogenetic analysis revealed that these four populations separated into two haplogroups; the first included SN, ...
Riaz Aziz Minhas1,*, Muhammad Nasim Khan1, Muhammad Siddique Awan1, Basharat Ahmad1, Syda Shaista Bibi1, Mohsin Hanif1 and Afsar Mian2
...tic differentiation constants among populations (Gst: 0.153±0.025) and within populations (Rst: 0.847±0.025) were calculated. Gene flow (Nm: 3.246±0.448) and genetic similarity (97-98%) between populations was high. UPGMA based dendrogram identified five distinct geographic groups, and Mantel tests (Rxy=-0.008, P>0.05) suggested a non-significant relationship between genetic distance and geographic distance. Phist P...
Qudsia Yousafi1,*, Muhammad Afzal2, Muhammad Aslam3 and Allah Ditta Abid4
...enty randomly selected plants. The percent fruit infestation in all three treatments was lower than control except on June 15 when infestation in control and in plots having light traps was not significantly different. Seasonal means for fruit infestation reduced fruit infestation by 16.1, 9.6 and 19.5 percent in T1, T2 and T3, respectively as compared to control.
...

Irfan Ali Sabir1, Saeed Ahmad1*, Muhammad Nafees2, Ahmad Sattar Khan1, Maryam3 and Ishtiaq Ahmad

..., whereas, total antioxidants (0.68 mM Trolox g-1), total carotenoids (TC) (52.0 µg 100-1) and flavonoids (1.79 µg 100-1) were significantly high in ‘Faisalabad Selection’. Faisalabad Selection and ‘Surkha Burma’ exhibited high score for taste, flavor, texture, aroma and pulp color compared to other indigenous and exotic varieties. It is concluded that ‘Faisalabad Selection’, ‘Surkha Burma’ and &lsquo...
Habib-ur-Rehman1*, Saima Mirza1*, Mansoor-ul-Hasan2, Qurban Ali3, Hafiz Abdullah Shakir4, Muhammad Yasir5
...endly stored food protectants instead of hazardous synthetic pesticides.
...

Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2 

...prayed-glucose treated plants showed increasing trends in grain yield under drought. Physio-chemical attributes were also modulated by exogenously applied carbohydrates. Nitrate reductase activity and total soluble proteins were increased with increase in sugar treatments under drought. Osmotic and water potentials were reduced under drought but foliar glucose sprays of 10 mM and 50 mM applied at reproductive phase significantly reversed the adverse effects of...
Kiran Aqil1, Muti-ur-Rehman Khan2, Asim Aslam2, Aqeel Javeed5, Rizwan Qayyum1, Farooq Yousaf,1 Farkhanda Yasmeen1, Muhammad Luqman Sohail3 and Sajid Umar4,*
...iv>Peste des petits ruminants (PPR) is an important viral disease of sheep, goat and other small ruminants, imparting substantial economic losses. In current study, antiviral activity of six dilutions of Nigella sativa (N. sativa)alcoholic extracts against the PPRV was investigated in vitro. Vero cell lines infected with PPRV were treated with six dilutions alcoholic extracts of N. sativa (200, 100, 50, ...

Ghulam Abbas1, Khalid Pervez Akhtar1, Muhammad Ahsan2, Muhammad Jawad Asghar1, Fiaz Ahmad1 and Muhammad Rizwan3* 

...sh interspecific recombinants. In this study, 72 mung × mash interspecific recombinant genotypes and a susceptible mungbean variety Mung Kabuli were screened against Yellow Mosaic Disease (YMD) using disease severity ratings by visual scoring of symptoms to calculate percent disease index (PDI). Tested recombinants responded differently to the disease. None of the tested genotypes was found to be disease free (field im...

Ali Sher1*, Khalid Naveed1, Gulzar Ahmad2, Ayub Khan1, Muhammad Saeed1 and Shah Masaud1 

...ving N availability to plants improve biomass production and also increase the shoot Fe content and accumulation of Zn in wheat plants. Experiments were conducted at the Cereal Crop Research Institute (CCRI) Pirsabak, Noweshera, Khyber Pakhtunkhwa, Pakistan during 2014-15 and 2015-16 to study the response of wheat to N, Zn and Fe application. Treatments included three levels of N (90, 120 and 150 kg ha-1), three concentratio...

Asinamai Athliamai Bitrus1*, Olabode Mayowa Peter2, Muhammad Adamu Abbas3 and Mohammed Dauda Goni

...on of resistance determinants through horizontal gene transfer. This review focused on the mechanisms of antimicrobial resistance in S. aureus. Understanding the concept of resistance development and transfer will immensely help in curtailing the global rise in antimicrobial resistance in bacteria.  

...

Ashraf Khan1*, Suliman Shah2, Maid Zaman3 and Komal Habib2

...tality was observed in plants treated with combination of Nitenpyram + Chlorfenapyr (99.20 and 99.89 %) followed by Flubendiamide (89.83 and 99.39 %) and Imidacloprid (89.31 and 98.77 %) after spray 1 and 2, respectively. Least effective insecticide was proved to be Melathion with 39.79 and 65.43 percent reduction in citrus psyllidspopulation except untreated plants with 9.27 and 15.94 percent decrease after first and second...

Nusrat Habib1*, Asim Zubair2 and Aisha Siddiqua3 

... find out to the determinants of sunflower area and yield in districts Swabi and Mardan of Khyber Pakhtunkhwa during 2016. The study was conducted in two selected districts through purposive sampling for 100 farms in different locations of selected districts. The objective of the study was to estimate determinants of sunflower area and yield in the study area. To determine the role of different factors that were affecting th...

Muhammad Javed Iqbal and Muhammad Naeem* 

...xternal morphometric variants of Labeo rohita. A total of 75 fish samples @ 5 fish samples per aquaria were analyzed in present study. T1 showed the highest values for mean wet weight 11.32±1.78, Total length 10.54±0.51, Fork length 8.94±0.46, Standard length 8.27±0.44, Body depth 2.64±0.16 and Body girth 5.28±0.33. Pectoral fin length, pelvic fin length, dorsal fin length and caudal fin length also showed highest valu...
Imran Taj1,*, Ferhat Abbas1, Zafar Ahmad1, Mohammad Kamran Taj1, Deedar Ahmad2, Zahoor Ahmed2, Ghulam Mohammad2, Ajaz-ul-Haq1, Farooq Shahzad1 and Sabiha Azam3
...type D in small ruminants. A total of 204 fecal samples were collected from sheep and goats suffering from seasonal diarrhea. C. perfringens type D was identified through different biochemical tests and PCR. Antibiograms and lab animal trials were also carried out on local isolates of C. perfringens type D. Out of 204 analyzed samples, 89.18 % were found positive while 10.82 % were negative for C. perfringens type D. The division wise ...

Muhammad Abu Sufyan Ali, Syed Attaullah Shah*, Ghaffar Ali and Muhammad Fayaz 

...udy examined the determinants of farmland prices in central Khyber Pakhtunkhwa (Pakistan), using land transaction records for 2015-16. Results from Hedonic Pricing analysis show that location, environmental and agricultural characteristics of a farmland determine its price. Residential and commercial encroachment on fertile irrigated farmlands at urban fringe is alarming. More than half of the sampled transacted farmland parcels were used for residential and c...

Abdur Rehman1* and Shad Khan Khalil2 

...e drought tolerance in plants. Field trials were conducted at Agricultural Research Institute Tarnab, Peshawar-Pakistan to study the effects of moisture stress and foliar application of chemicals at different growth stages on canola growth and phenology during 2015-16 and 2016-17. The experiment comprised of four moisture levels (optimum water, 10%, 20% and 30% reduced irrigation water), three chemicals (salicylic acid 0.5mM, potassium nitrate KNO3 1% and meth...

Shamsher Ali1, Zakir Ullah Jan1*, Zahir Shah2, Muhammad Jamal Khan2, Farmanullah Khan2, Inayat ur Rahman3 and Shah Fahad3 

...0000 kg ha-1. The Azam plants were taller than hybrid. The treatment (T5) significantly yielded more grain (6806 kg ha-1) and (5106 Kg ha-1) from hybrid (CS-200) and a local maize Azam cultivar, respectively. Similarly, stover yield of hybrid (10378 Kg ha-1) and Azam (7708 Kg ha-1) were more in T5 than the other treatments. So, it is concluded that the combined application of farmyard manure and balanced inorganic fertilizer (Nitrogen + Phosphorus) gave signif...

Sajad Ali1*, Syed Asghar Ali Shah2, Jaffar Ali3, Muhammad Nadeem Iqbal4, Arshadullah Jadoon5 and Farmanullah

.... Moreover, maximum merchants and Beoparis credited the output of peas from the farmers directly from the local market that is Mansehra and Haripur. It is worthwhile to mention that the public sale arrangement was not totally available in the local markets. Furthermore, the 68 percent in district Mansehra while, in the Haripur 46 percent farmers traded the pea’s output in the local markets. The left over peas output in both the selected districts were of...
Saima Shahzad Mirza1,*, Hafiz Muhammad Qamer2, Hafiz Abdullah Shakir3,*, Rana Shoaib Akram4
...of weaning process in infants above 6 months of age with their mothers’ literacy level, employment, physical and financial health. This study was conducted at Kishwar Fazal Teaching Hospital Lahore in an OPD pediatrics. For this purpose, cross sectional survey data of 34 conservative mothers was analyzed, obtained by means of questionnaire. Initiation of weaning process at proper time is found to be somewhat finance limited factor. Total 17 and 1 out of ...
Asad Ullah1, Umar Sadique Khattak2, Sultan Ayaz1, Muhammad Subhan Qureshi2, Imad Khan1, Ibad Ullah Jan2, Irfan Khattak1, Raheela Taj3, Sahar Nigar4,    Naimat Ullah Khan1,Mumtaz Ali Khan5 and Muhammad Luqman Sohail6,*
...s (bTB) among large ruminants of the five districts (Peshawar, Nowshera, Charsadda, Mardan and Swabi) located in the central zone of Khyber Pakhtunkhwa (KPK), Pakistan. A total of 2400 large ruminants were sampled by convenience sampling approach and tested by comparative cervical intradermal tuberculin test (CCIT) for detection of Mycobacterium bovis infection. Data regarding socio-demographic status, risk factors an...
Qudrat Ullah1,*, Huma Jamil1, Zafar Iqbal Qureshi1, Muhammad Saqib2 and Heinrich Neubauer3
...sk factors in small ruminants kept at nine government livestock farms of Punjab, Pakistan. A total of 1000 blood samples (500 each from goats and sheep) were collected from animals kept at the respective livestock farms. An indirect-Enzyme Linked Immunosorbent Assay (iELISA) was used to detect anti-C. burnetii antibodies in the serum. Serological analysis revealed overall flock-level sero-prevalence of 92.3% which varied from 88.88% in sheep and 100% in...

Zulqarnain and Zafar Iqbal* 

...iments were conducted. Plants given the treatment as Penicillium + Fusarium showed slight yellowing of the leaves after 60th days of cultivation. Present results may help in exploiting the Penicillium sp. extract for isolation and structural characterization of its antifungal compounds. 

...

Shaista Naz1*, Noor Paio Khan1, Naveed Afsar2 and Ashfaq Ahmad Shah3

...possession of small ruminants (goats and sheep), while men were found dominant in large ruminants’ possession (buffalo and cattle). Women’s higher time allocation to livestock management activities depicted their higher level of participation in livestock management was found high as compared to their male counterparts. Women’s participation was found high in the indoor activities of livestock management li...

Asif Nawaz* and Muhammad Zafarullah Khan 

...petencies of Field Assistants of the Agriculture Extension Department, Khyber Pakhtunkhwa. A sample of 234 out of total 543 Field Assistants were selected with the help of Sekaran Sampling Technique and the respondents were distributed in four Agro-ecological zones of the province with the help of proportional allocation sampling method. Data from the respondents were collected through pretested and validated interview sched...

Sher Nawab Khan* and Ghulam Hassan 

..."text-align: justify;">Plants contribute almost 93% of food and among the crops wheat has the largest contribution of about 80% to the total global cereal production. Eight wheat cultivars including a land race were crossed in 8×8 full diallel fashion during 2014-15 wheat growing season. In the succeeding crop season all the 56 F1 hybrids and their parents were evaluated during 2015-16 to study inheritance pattern of yield and yield related traits at Pes...

Aneel Salman1, Muhammad Iftikhar ul Husnain1, Inayatullah Jan2*, Muhammad Ashfaq2, Mudassar Rashid1 and Usman Shakoor1 

...t focus on other determinants like education, role of media, and government policies that can affect farmers’ choices to adopt climate resilient farming practices.  

...

Amjad Ali1, Abbas Ullah Jan1, Lal Almas2, Noor Piao Khan1 and Khurran Nawaz Saddozai

... were considered determinants for cost function. Respondent age, farming experience, education, family size, off-farm income, farm to home distance, tenancy and extension contacts are determinants in allocative inefficiency model. Results of the study revealed that except farmyard manure and pesticides all other explanatory variables are significant influencing factors in total cost of sugarcane production in district Charsa...

Waqas Ali* and Mudasser Habib 

...bility to make escape mutants

...

Sabahat Noor*1, Shaukat Ali1, Hafeez-ur-Rahman1, Farhatullah2 and Ghulam Muhammad Ali1 

...ed and non-transformed plants. It was observed that under drought and salt stresses, proline contents, sugar contents, chlorophyll contents and relative water contents (RWC) were significantly higher in transgenic plants as compared to non-transgenic plants. From obtained results it is concluded that, increase level of RWC, proline, sugar and chlorophyll in transgenic pl

Asma Sohail1*, Aina Rafique2, Kashif Sarfraz Abbasi1 and Maryum Arif3 

...evated amount of antioxidants and have potential antimicrobial activity. Effect of drying methods (sun-, oven- and freeze drying) on antioxidant and antimicrobial activities of date fruit powders from three varieties Zahidi, Aseel and Muzafati were investigated. The DPPH activity was significantly higher in Muzafati sundried date powder, whereas maximum phenolic and flavonoid contents were significantly higher in Muzafati freeze dried date powders. Results sug...

Umair Riaz1*, Muhammad Ali Kharal2, Ghulam Murtaza3, Qamar uz Zaman4, Sana Javaid4, Hina Ahmed Malik3, Humera Aziz3 and Zafar Abbas1 

...ic compounds that help plants to cope with stress conditions by reducing the intensity of stress through enhancing antioxidants activities, detoxifying toxic ions, regulating the uptake of nutrients and by mediating the transport and distribution of different hormones. Caffeic acid is actively involved in plant physiology and mechanisms of stress tolerance primarily utilized by plants for ...
Ghazunfar Rashid1, Muhammad Avais1, Syed Saleem Ahmad1, Muhammad Hassan Mushtaq2, Rais Ahmed3,*, Mahboob Ali1, Muhammad Naveed-ul-Haque4, Mehtab Ahmad5Mumtaz Ali Khan1 and Naimat Ullah Khan6
...nt parts of the fodder plants were estimated qualitatively through the Diphenylamine Filed Test (DFT) and quantitatively by spectrophotometry. The nitrate levels were highest in Jowar, followed by Jai, Shaljam, Makai, Bajra and Sarson. The concentrations were lower in the afternoon in the leaves and in mature crops as compared to stem parts, immature plants, and in samples collected from plants
Sajid Ali Khan1, Mazhar Hussain Ranjha1, Azhar Abbas Khan2,*, Muhammad Sagheer1, Amjad Abbas1 and Zeshan Hassan2
...wo different medicinal plants (Dhatura alba and Calotropis procera) against two different strains of T. granarium. Plant extracts were obtained by Rotary Shaker apparatus by using acetone as solvent. Four different concentrations 5%, 10%, 15% and 20% were prepared by diluting in acetone. The data regarding mortality, growth regulation and repellency of T. granarium was observed. Repellency of plant extracts was tested using area pre...

Syed Atif Hasan Naqvi1*, Ummad-ud-Din Umar1, Ammarah Hasnain2, Ateeq ur Rehman1 and Rashida Perveen1 

...ronomic traits of rice plants. The reduction of disease in all the trials along with healthy crop stand in glass house and field indicated that these decoctions might play an important role in biological management strategies for the control of BLB of rice. The present research may provide an avenue for the formulation of new bactericides for future uses. 

...

 *Muhammad Waseem1, Dost Mohammad Baloch1, Ghulam Khaliq1,
M. Rashid1, Qurban Ali2 and Mustajab A. Khan3

INTENSIFICATION IN BAMBOO (Bambusa bambos L.) TRAITS IN RESPONSE TO ORGANIC AND CHEMICAL NITROGEN ALONG THE COAST OF ARABIAN SEA
...oo (Bambusa bambos L.) plants were grown with four fertilizer sources i.e. S = Control (0) kg N ha-1, S = urea (120 kg N ha-1), S = Farm Yard Manure (FYM 1% N), S = 0 1 2 3 Combination {50% N from urea (the recommended dose) + 50% N from Farm Yard Manure (FYM)}. A recommended dose of nitrogen was used as chemical source and applied at the rate of 120 kg N ha-1. Significant differences were reported for studied traits in response to treatments. The results indi...

 *Irum Javed1, Muhammad Asgher2, Sadia Noreen1, Humara Naz Majeed1 and Tanzila Sahar1

SOLID STATE FERMENTATION OF ASPERGILLUS NIGER FOR CITRIC ACID PRODUCTION USING AGRICULTURE RESIDUE AS SUBSTRATE
... nitrogen source. Surfactants like Tween 80 and sodium dodecyl sulphat (SDS) showed no effect on the citric acid.

...

 Muhammad Akram and Faheem Aftab

THIDIAZURON INDUCES IN VITRO BUD BREAK AND SHOOT DEVELOPMENT FROM NODAL EXPLANTS OF ORTHOTROPIC SHOOTS OF MAIDENHAIR TREE (GINKGO BILOBA L.)
...cut to prepare nodal explants (5-10 mm long), surface sterilized and inoculated on MS (Murashig and Skoog, 1962) medium supplemented with different concentration (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1,2,3,4 or 5uM) of TDZ for 24 days. Highest bud break (100%) was obtained at 0.005 uM TDZ after 14 days of initial culture. The same cultures were further maintained and subsequently obtained with 20.6 mm shoot length and 7.2 average number of leaves for another 10...

 Tahir Abbas*1, Khawaja Raees Ahmad2, Asmatullah3, Khalid Pervaiz Lone4, Muhammad Ali Kanwal2, Sadia Suleman2

Reno-hepatic protective effects of Jambul against chromium induced anomalies in mice
...etals environmental toxicants especially Cr+6 is novel and cheapest; that should be sponsored for ethno-medicinal purpose.

...

Farah Deeba, Hafiz Abdullah Shakir, Muhammad Irfan, Javed Iqbal Qazi*

Chitinase production in organisms: a review
...fe (bacteria to higher plants and animals) as one of the most durable, richest biopolymers distributed widely in nature both in the terrestrial and marine environments. Chitinase are chitin degradable enzyme have control of phytopathogens, physiological functions and degradation of chitinous waste. Interest in chitin wastes utilization is increasing day by day because of its natural resistance against degradation. The review focused on different sources of nat...

 Muhammad Moosa Abro1, Ali Murtaza Dharejo2, Muhammad Munif Khan2, Nadir Ali Birmani2, Saima Naz2*

Description of first record of Petasiger exaeretus Dietz, 1909 (Trematoda: Echinostomatidae) in avian host from Pakistan.
...rasitic species of Cormorants. However, it has not been reported from
Pakistan in Little Cormorant, Phalacrocorax niger prior to the present study.

...

 Anam Javed, Javed Iqbal Qazi*

Skin health implications of Chemical detergents and importance of biodetergents
...utilization of biosurfactants from domestic to industrial level. Biodetergents do not cause health complications, and as they are readily biodegradable so do not persist in environment. Our body’s protecting shield, the skin, has more chances of exposure and biodetergents have potential to eliminate the associated risk. Economical production of biosurface active substances at industrial level through utilization of bio-waste origin feedstocks would also ...

Shaukat Ali1,*, Sundas Nasreen1, Sobia Safeer1, Saiqa Andleeb1, Mubashir Ejaz1, Saira Bano2, Hafiz Abdullah Shakir3

Medicinal plants as therapeutic agents for cancer treatment
...ancer.

...

 Maleeha Manzoor1,2*, Ruijuan Ma2, Hafiz Abdullah Shakir1, Fouzia Tabssum1, Javed Iqbal Qazi1

Microalgal-bacterial consortium: a cost-effective approach of wastewater treatment in Pakistan
... of organic
pollutants, heavy metals and many other contaminants. The biodegradation approach of involving consortium might
attain self-sustaining level and may prove technically cheaper and advance technology. It will finally help in dealing
the dual mission of producing valuable metabolites and pollutants/nutrients removal from wastes/wastewaters.
Agricultural...

 Zubair Ahmed#, Muhammad Farhanullah Khan, Habiballah Rana*

Toxicological effects of Haloxylon recurvum Bunge ex Boiss (Khar Boti) whole plant extract and novel insecticide chlorantraniliprole against maize weevil, Sitophilus zeamais Motschulsky
...ecticides derived from plants have increased popularity in
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
toxicity of crude methanol extract of whole plant of Haloxylon recurvum (Khar boti)
and a novel insecticide chlorantraniliprole. A serial concentration of extract i.e.,
1.2%, 2.4%, 3.6%, 4.8%, 6.0% and insecticide...

 Hafiz Muhammad Tahir1*, Zafar Iqbal Khan2, Saira Batool2, Kafeel Ahmad2, Salma Begum2

Residual effect of lambda-cyhalothrin on abundance of insect pollinators in marigold field patch
...cticide treated
plants for one hour. The mortality rate of honey bees in the control and insecticide
exposed group was compared. Overall, a significant decline in plant pollinators was
observed after application of lambda-cyhalothrin on the patch of marigold plants.
Lambda-cyhalothrin caused significant mortality (15/20=75%) in honey bees in
semi-field experiment. It is concluded that lambd...

 Zafar Iqbal1, Muhammad Farooq Nasir1, Imran Bodlah1*, Rahmatullah Qureshi2, Ayesha Aihetasham3

Notes on three morphs of Bulaea lichatschovii (Hummel) (Coleoptera: Coccinellidae) from Northern Pakistan
...species
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given with illustrations and new ...

 Muhammad Khalil Ahmad Khan1*, Muhammad Zafar2, Munazza Perveen3, Munir Ahmad3, Asia Iqbal4, Asmatullah3

Efficacy of malathion and carbosulfan against crop invadedaphid types Aphis craccivora (Koch) and Aphis gossypii (glover) on bean and brinjal plants
...ed on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii while carbosulfan was found to be least toxic with LC50 as 312.80 μg
cm-2 for A. craccivora and 322.25 μg cm-2 for A. gossyp...
Muhammad Muddassir Ali1,2 and İbrahim Hakkı Ciğerci1,*
...he world. Many endemic plants all over the world have magical therapeutic potential. These could be explored further for medicinal purposes and hence can be preserved for their proper propagation. Thermposis turcica is endemic to Turkey. It’s general anti-oxidant and anti-cancerous activities are explored, but no study has been observed on liver cancerous cell line in term of its genotoxicty. So, genotoxic evaluation was carried out for the alcoho...

Ali Zohaib1*, Saima Yousaf1,2, Shakeel Ahmad Anjum1, Tahira Tabassum1, Tasawer Abbas3, Wardah Muzaffar1 and Wasiq Ikram2 

...4 produced the tallest plants. In conclusion, seed inoculation of soybean improved the growth, allometric traits and dry matter yield of soybean, and could be employed for the betterment of crop productivity. 

...

Neelum Andaleeb1*, Munir Khan1, Syed Attaullah Shah1 and Rahmat Ullah2 

...a to investigate determinants of welfare of livestock farm households with special reference to women’s participation in livestock farming. A multistage sampling technique was used to collect a sample of 274 livestock farm households from six union councils of district Mardan. Data were collected through face to face interviews from female members of the selected livestock farm households in 2015-16. Data were analyzed by ordered logit model to determine...
Mirza Imran Shahzad1, Hina Ashraf2,*, Muhammad Arshad3, Sabeeha Parveen4, Amna Aslam4, Nargis Naz4, Zahid Kamran1, Sumbul Gohar Khalid5, Sajid Hameed1, Muhammad Ashfaq6 and Muhammad Mukhtar7

 

...en selected Cholistani plants against New Castle Disease Virus (NDV)-LaSota strain. All of these plants were reported for their different pharmacological activities but their antiviral potentials were not known before. The methanolic extracts were made and concentrated by rotary evaporator and finally dissolved in distilled water before taking their antiviral trials in 7-11 days old chicken embryonated eggs. The viral loads ...

Muhammad Salman Wazir and Mohammad Akmal 

...n maturity with taller plants at the split N application of NAT2 and NS3 as compared to the NS1. Likewise, better traits of wheat plant and hence the yield including grain wet gluten content were reported for the treatment NS3 as sole wheat crop, followed by the intercropped with fababean. Among the intercropping, IC-I with fababean showed better future scope of wheat crop production under the changing climate to produce higher production per unit area with su...

Amara Amjad Hashmi1,2,*, Maqbool Hussain Sial3, Waqar Akram4 and Maaida Hussain Hashmi5,6

...oach to find out determinants of food insecurity. Results suggest that female headship plays a significant positive role in caloric intake, among the other variable head education, households’ member with basic education and higher education, live stock ownership, consumption of livestock produced at home, farming, consumption of food crop produced at home and foreign and domestic remittances plays a significant positive role in caloric intake of food in...

Muhammad Tahir Amin, Khalid Usman*, Muhammad Waqas Imam Malik and Nishter Ali

...h day) produced taller plants (139 cm) and more sympodial branches (18.3) compared to less frequent irrigations (10-19th day). However, 19th day irrigation interval significantly improved seed cotton yield and fiber quality traits (fiber length, fiber strength, micronaire, and fiber uniformity). Likewise, phosphorus at 150 kg ha-1 significantly improved seed cotton yield (3794 kg ha-1) and ginning out turn (39.1%) compared to other phosphorus levels. In conclu...

Nighat Seema1*, Muhammad Hamayun1, Husan Ara1 and Raham Sheer Khan

...lously with their host plants and may be more capable to solubilize nutrients from soil and provide it to their hosts. In current study, endophytic fungi inoculation significantly affected the soil properties such as soil texture, organic matters, EC and pH with or without 8% PEG induced drought stress. Upon inoculation of different endophytic fungi with or without drought stress, the trend in pH values of soil remain variable (7.61~7.96) compared with the pH ...

Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6 

...t availability to crop plants. A field experiment was carried out to determine the effect of seed inoculation with PGPRs on yield and quality of different genotypes of soybean. Seed inoculation treatments [control (no treatment), nitrogen fixing bacteria (Rhizobium japonicum) and phosphorus solubilizer (Pseudomonas fluorescens)] were applied to three different cultivars of soybean (EBR4V4, Freedom and Swat-84). The results showed that seed inoculation with R. ...

Salman Ali*, Inamullah, Muhammad Arif, Mehran Ali, Muhammad Owais Iqbal, Fazal Munsif and Arsalan Khan 

... maize crop and taller plants with higher number of grains ear-1, 1000-grain weight, biological and grain yield, and harvest index were observed in plots irrigated five times. Likewise, 75 kg K ha-1 application resulted in higher biological (plant height and biological yield) and grain yield (grains ear-1, thousand grains weight, grain yield and harvest index) components of maize. Increase in K levels beyond 75kg ha-1 showed a slight decrease in yield. It is c...
Shamesa Maryam1, Ajaz Ahmad Sandhu1, Imran Bodlah2*, Muhammad Asif Aziz2, Ayesha Aihetasham3

 

...d from twenty two host plants at six different localities of Gujranwala area of Punjab province, Pakistan. Total 12 species namely; Aphis craccivora, Aphis fabae, Aphis gossypii, Aphis nerii, Rhopalosiphum padi, Lipaphis erysimi, Macrosiphum euphorbiae, Myzus persicae, Pentalonia nigronervosa, Sitobion avenae, Greenidea (Trichosiphumpsidii and Cinara (Cupressobium) tuj...

Shumaila Nazeer1, Iqbal Javed1*, Allah Bakhsh2, Mudassar Yasin2, Haroon Javaid3 and Kaniz Fatima1 

...d the margin and determinants of kinnow exports from Pakistan to international markets of UAE and USA by using the primary data. Primary data is collected through pretested questionnaire from 30 kinnow exporters out of total 40 exporters. Personal interviews were conducted by selecting convenient sampling technique. Along with export margin analysis of both markets, an effort is made to quantify impact of the major determinants<...

Khwaja Tariq Ziad1, Umar Hayat1, Muhammad2 and Muhammad Suleman Bacha3* 

... the response of participants an informal and formal supply chains for small-scale dairy farmers in Pakistan. The study aimed at explaining the costs of the chosen supply channels and their transaction costs, the role of the mid-agent opportunistic behaviour in the relative milk supply chain. Using case study and qualitative method approach, eight key informants including five farmers, one local middleman, and representative...

Muhammad Naveed Afzal1, Muhammad Tariq1*, Muhammad Ahmad1, Khuram Mubeen2, Muhammad Ayaz Khan3, Muhamamd Umer Afzal4 and Shakeel Ahmad

...nsities (8.88 and 4.44 plants m-2) were assigned to main plot and four nitrogen rates (0, 50,100 and 150 kg N ha-1) were kept in sub plots with three replications. The PD was maintained by altering the within plant spaces keeping the row spaces (75 cm) constant. The results indicated that significant PD X N interaction was observed for plant biomass components i.e. the high PD (8.88 plants m-2) with 0-N produced 16.80%, 25.0...

 Saira Zaheer1, Abrar Hussain1*, Aqsa Khalil1, Muhammad Mansha1, Muhammad Lateef2

...s parasite of small ruminants, and is a major cause of diseases and significant mortality in various cattle, sheep, deer, buffalo and goat, etc. Various synthetic anthelmintics have been used, on wide scale, to control the helminths infections.But the parasite worms have developed multiple resistances against the synthetic anthelmintics. Hence, various biological controls, vaccines and local medicinal plants are being explor...

Ali Awais, Charassri Nualsri and Watcharin Soonsuwon* 

...anicle length in both mutants were higher than that of control. Several mutants also revealed some notable phenotypic variations in the roots, seeds, panicles and leaf morphology. Phenotypic observations determined that the Dawk Kha 50 has more potential of variability than Dawk Pa-yawm towards EMS. Later selection in the advance generations might be useful to isolate agronomically useful mutants

Ummad-ud-Din Umar1, Syed Burhan-ud-Din2, Muhammad Fahad Khan1, Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Muhammad Asif Zulfiqar3, Azhar Ali Khan3 and Naila Ilyas1

...resistance in mungbean plants by triggering the SA pathway. Induced resistance was assessed by evaluating the appearance of symptoms and detection of virus titter through ELISA. Different concentrations of SA and BTH were exogenously applied to activate the inherent resistance of mungbean by the production of defense associated compounds. All treatments were supportive in suppressing plant infection as compared to infected control, but the most promising outco...

Muhammad Aslam Rajput1,3, Imtiaz Ahmed Khan2, Rehana Naz Syed3 and Abdul Mubeen Lodhi3* 

... development. Diseased plants produced profuse tillers, but of no use as emerging tillers were very weak. Significant positive correlations were found among the disease incidence and other traits as well as between numbers of whips and tillers. 

...

Shakeel Ahmad Anjum1, Muhammad Mohsin Raza2, Sami Ullah1, 3*, Malik Muhammad Yousaf2, Ahmad Mujtaba1, Mumtaz Hussain2, Muhammad Jahangir Shah2, Bashir Ahmad2 and Ijaz Ahmad4 

... plant population (7.2 plants m-2) and stem diameter (1.58 cm), cob length (19.1 cm), biological yield (19.5 t ha-1) and harvest index (37.0%), while lowest grain yield (3.08 t ha-1), number of grains per cob (319), 1000 grain weight (204 g), plant height (174 cm), plant population (6.2 plants m-2), stem diameter (1.28 cm), cob length (14.9 cm), biological yield (12.1 t ha-1) and harvest index (30.5%) were obtained from the ...

Rafiullah1*, Abdur Rahman2, Khalid Khan1, Anwar Ali1, Arifullah Khan2, Abdul Sajid3 and Naimatullah Khan3 

Fariha Latif* and Muhammad Javed
...arkers to assess contaminants impact on fish at earlier level of exposure. Fish from different species has diverse ecological needs and respond differently to the environmental stress conditions. Thus, the sensitivity, bioaccumulation and antioxidant capacities of three major carps Catla catla, Labeo rohita and Cirrhina mrigala towards metals mixture (Cd+Cr+Cu+Pb) were determined during present research work. Sensitivity of the three fish ...

Sabi-Ur-Rehman1, Anwar Khalid2, Qazi Najam Us Saqib3, Farooq Ahmad1, Shaheed-Ur-Rehman4, Neelam Zaman3, Ayeza Mehmood5 and Abdul Samad6*  

...otic drugs resistance, plants provide source for discovery of new antimicrobial drugs. This study was carried out, include in-vitro antibacterial and antifungal screening of aqueous methanolic extracts as well as crude saponins isolated from leaves and roots of Sarcococca saligna, using disc diffusion method. The tested bacterial strains include, B. subtilis, E. coli, S. aureus, P. fluorescens and fungal strains were Aspergillus. niger, A. flavus, and D. turci...
Owen Flanagan, Mona Letourneau and Wenqing Zhao
...ness, happiness of immigrants, and so on. The teams that produce the World Happiness Reports claim that six variables explain most -- as much as 70% -- of the variation in the rankings of happiness among nation states:

...

Ayesha Khan*, Zubair Ahmad Khan, Urooba Pervaiz And Mehmood Iqbal 

...s and 40% of field assistants were interviewed making a sample of 81 extension agents; 10 agricultural officers and 71 field assistants. The study results indicate that 77% field assistants were educated up to Matric with two years diploma while 10% agricultural officers had M.Sc. (Hons) degree with the majority of extension agents having job experience of more than 20 years. The main sour...
Catherine J. Allen
...in by focusing on inhabitants of Sonqo, a rural Quechua-speaking community in the highlands of southern Peru, where I have carried out research since 1975. I explore notions of well-being through vocabulary drawn from Southern Peruvian Quechua, including allin kawsay (well-being), pacha (world), ayllu (community), ayni (reciprocity), uyway (nurturance), hucha (sin) and animu (individuating energy), with par...

 Syed Turab Raza1,*, Zhu Bo1,*, Zulfiqar Ali2 and Tang Jia Liang3

...o recover nutrients of plants such as NPK (nitrogen, phosphorus, calcium). A vermicomposting system using the earthworm species (Eisenia fetida) and treating it with cattle dung, pig manure and biochar with crop (wheat straw and rapeseed) waste was established in upland areas of China. It was monitored for two months. Four treatments (T1 to T4) were prepared using crop residues i.e. wheat straw, rapeseed and cow manure in different concentrations...

Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2 

...6.67%) was recorded in plants inoculated with MPS16 isolate followed by MPS17 (43.33%) and MPS12 (43.0%). Similarly, length of necrotic lesions was also significantly higher in MPS16 (6.67 cm) followed by MPS17 (6.33 cm), MPS12 (6.30 cm), MPS15 (6.17 cm) and MPS 13 (6.07 cm). The predicted isolate (MPS16) was aligned with different species and observed that MPS16 belongs to M. phaseolina isolate. The sequence showed high identity with sequences with Macrophomi...

Salman Anwar1, 2*, Farhan Anwar Khan3 and Atta-ur-Rahman4 

...of Pakistan.. The inhabitants of this area are mostly engaged in the agricultural sector. Before the construction of KKH, their mode of agriculture system was subsistence and crude techniques were applied due to non-availability of modern machines and techniques. This was because of the remoteness and communication gap with the rest of the country. Therefore, this study is an effort to compare and analyze the impacts of KKH on the land use and Agricultural dev...

 Abdul Khaliq1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Akhlaq Ahmad2 and Yasir Iftikhar3

...nsect pests against fumigants is a serious threat to effective commercial use of fumigants in various quarantine treatments. Therefore, resistant strains of Tribolium castaneum (Herbst), Rhizopertha dominica (Fabricius) and Sitophilus oryzae (Linnaeus) were tested against phosphine and bio fumigants to check their fitness and potential following by F1 genera...

Saqib Bashir* and Bashir Ahmad 

...N ha-1 produced taller plants with height of 104.4 and 104.0 cm, heavier grains with 52.0 and 50.8 g weight per thousand grains, higher biological yield 11986 and 11859 kg ha-1 and optimum grain yield 4161 and 4147 kg ha-1. Results indicated that the integration of 90 days older pigeon pea green manuring with 90 kg nitrogen ha-1 can be the best recipe for better and sustainable wheat production. 

...
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
...to infect the small ruminants which may complicate the control measures of brucellosis because most of the control programs rely on serological screening of brucellosis rather than molecular assay which could confirm the particular species circulating in ruminants. In this study 960 and 471 serum samples of goats and sheep were collected, respectively. After screening with Rose Bengal test (RBT), all seropositive samples wer...
Ahmed Ali Samejo* and Riffat Sultana*
...ive pest to the useful plants. Morphology and morphometry of immatures of desert locust in relation to gaining of body length and weight at each consecutive stage was carried out for the purpose of investigating the role of immatures in destruction of plants in Thar Desert, Sindh. Hatchlings of solitarious S.gregaria were light green at the time of emergence, but turned over to black with yellow strips after two hours...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...d in two novel K RAS variants, p.E31K and p.G138V, identified in two CRC patients, which may account for transformative capacity by biochemical and signalling readouts in these patients. Dynamical implications and functional impact of variants were determined by in silico analysis and molecular docking of variants with GTP. MutationTaster was used for functional analysis of genetic vari
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
... microbes, animals and plants. The asparaginase of bacterial origin has been extensively applied in the treatment of childhood lymphomas and leukaemia. However, the glutaminase activity of enzyme can cause serious side-effects triggering a search for highly specific and more stable enzyme. In the present study the gene consisting of 972bp coding for 323 amino acids was PCR amplified from Geobacillus thermodenitrificans DSM-465 was PCR amplified and reco...

Ragia S. Mohamed1, Rania F. El Naggar2, Mamdouh. M. Hamoud1, Mohamed M. Hamoud3, Abdulrhman M. Gamal1, Samah E. Laban1, Shimaa A.E. Nasr1, Manal M. Zaki1, ElShaimaa Ismael1, Osama K. Zahran1* 

...se of effective disinfectants.  

...
Ashfaque Ahmed Nahiyoon1,*, Shahina Fayyaz2 and Nasira Kazi2
...associated with cotton plants in Sindh. During 2017–2018 extensive surveys were conducted at the time of cropping and at harvesting and soil root samples were collected from different fields in the cotton producing regions of five districts of Sindh viz., Sanghar, Mirpurkhas, Umerkot, Mityari and Tando Allahyar. The analysis of samples resulted in the identification of one new species of soil nematode viz., Acrobeloides gossypii n. s...

Fady Samir1, Rania F. El Naggar2, Mohamed M. Hamoud3, Manal M. Zaki1, Abdulrhman M. Gamal1, Samah E. Laban1, Shaimaa A. E. Nasr1, El Shaimaa Ismael1, Osama K. Zahran1* 

...the emergence of new variants and, consequently, the emergence of a different evolutionary pattern of NDV in Egypt. Therefore, it is necessary to test if genotype II-based vaccines apply unique selective pressures on NDV glycoproteins and their role in changing the NDV evolution in Egypt. 

...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...enzymes, widespread in plants, fungi and microorganism, gain commercial importance for improving the yield and nutraceutical properties of juice processing industry, degumming of fibre plants and maximum oil recovery. These enzymes break down complex polysaccharide polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin was purified by salting out with ammoni...
Bushra Siddique1,*, Muhammad Tariq1, Muhammad Naeem1 and Muhammad Ali2
...erent cues released by plants to increase the efficiency of foraging. Aphid endoparasitoid, Diaeretiella rapae (McIntosh) (Hymenoptera: Braconidae) have an ability to locate itshosts by responding to odours from aphid hostplants or by visual searching.The treatments with different combinations of plant extracts and semiochemicals were used for natural enemypreference experiment. The experiment was conducted with seven...

Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4 

Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2 

...l diets and ornamental plants on parasitoid performance. Among artificial diets tested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the field ...
Faraz Akrim1,2, Tariq Mahmood1,*, Muhammad Sajid Nadeem3, Siddiqa Qasim1, Shaista Andleeb1 and Hira Fatima1
... prey contributed 19%, plants 14%, grits 2%, and anthropogenic matter (plastic bags, and threads) 5%. In comparison, 17 dietary items were recorded in the diet of small Indian mongoose, including 10 wild, 1 (one) domestic and 6 plant species. Consumption of wild prey was 60%, domestic prey 17% plant matter 11%, grits 2% and anthropogenic matter ~10%. Dietary niche breadth of Indian grey mongoose was found broad (0.83) during autumn season but narrow (0.36) dur...

Zahin Anjum1*, Farhat Shehzad1, Amina Rahat1, Hamid Ullah Shah2 and Saleem Khan3 

...the levels of these toxicants. Polyaromatic Hydrocarbons and heavy metals refer to a large group of chemicals that may be present in the environment as pollutants and can enter the food chain and might be carcinogenic to humans. The lead content was found high in fish with the mean value of 3.18mg/kg and the lowest values were observed in chicken with mean value of 1.38mg/kg. The chrysene, naphthalene, flourenthene and Diben...
Asma Yousafzai1,*, Muhammad Luqman2, Nisar Ahmed1, Muneeza Arbab1,Muhammad Murad1, Naheed Sajjad3, Sara Naudhani1, Shakeela Daud1, Abdul Hameed Baloch4, Khushnaseeb5, Sana Zahoor6, Zahid Rauf7, Muhammad Mohsin Javed6 and Jamil Ahmad1
...to determine genetic variants in BRCA1 and BRCA2. Nine variants were identified in BRCA1 and four were identified in BRCA2. In case of BRCA1, six missense substitutions (p.Asp343Tyr, p.Gly393Asp, p.Ser561Phe, p.Ser616Phe, p.Pro871Leu and p.Ser1613Gly) two frameshift (p.Ser423fs and p.Gly1770fs) and nonsense mutation (p.Glu1250X) was identified. In case of gene BRCA2, all the four var...
Shamsudin Bojang1, Idris Abd Ghani2, Jugah Kadir1, Adamu Saidu Paiko1, Yasir Iftikhar3 and Muhammad Kamran3,4,*
...e the greens and other plants in other part of the world then the probability for the specie to adapt to other hosts other than the family of poaceae under Malaysian climate should not be discounted. Therefore, screening and restriction of movement of planting materials be observed critically.
...
Lichao Feng1,2, Shaoqing Zhang4, Dianyuan Chen2, Sina Adl3 and Donghui Wu1,4*
... to different types of plants associated with their farmland habitat, as follows: mixed pollen and nectar of flowers (Erigeron annuus, Trifolium repens, Heteropappus hispidus, Potentilla chinensis, Hibiscus trionum), or leaves of grasses (Poa annua, Echinochloa crusgalli), or maize leaves (Songyu 419, a hybrid variety) as food sources to feed the adult of A. fuscicollis. The larvae were reared o...

Mehran Ahmad, Syed Attaullah Shah and Shahid Ali* 

...o identify major determinants that influence tomato yield and estimate allocative efficiency of tomato growers in district Mardan of Khyber Pakhtunkhwa province of Pakistan. The study was based on primary data, collected from a sample of 105 tomato growers selected through multistage random sampling procedure. Data was collected through a well-designed interview schedule during January-July, 2018. Cobb-Douglas type production function was used to estimate effe...
Xiaohui Yu, Shuai He, Liqiang Wang, Mengyang Kang, Yanjiao Zhu, Shuhui Wang and Xiuzhu Sun*
...ect of different antioxidants on the semen cryopreservation in Guangzhong donkey by testing indices of sperm motility, mitochondrial activity, membrane integrity and arosome integrity. The results illustrated that compared with controls, above-mentioned indices of sperm were significantly improved under concentrations of Vitamin C (400 mg/L) and Vitamin E (600 mg/L) (P < 0.05). Moreover, physiological indices of donkey semen were significantly higher...

Muhammad Yasin1, Romana Shahzadi1, Muhammad Riaz2, Mahideen Afridi2, Wajya Ajmal3, Obaid Ur Rehman2, Nazia Rehman3, Ghulam Muhammad Ali1,3, Muhammad Ramzan Khan1,2,3* 

...veloping genome edited plants to prevent yield losses in canola in future. 

...

Hala Mohamed Nabil Tolba1, Naglaa Fathy Saeed Awad1*, Gamelat Kotb Farag Kotb2, Amany Adel3 

...ictive antigenic determinants between these vvIBDV isolates and the classic vaccine strain (Bursin plus). These findings could explain the persistence of vvIBDV circulation in the Egyptian environment in spite of vaccination with classical vaccine strains.  

...

Kamran Aziz1*, Aamir Saleem1 and Arshad Mahmood Malik2 

... role to decompose the plants parts such as roots, shoots, leaves and other parts. The present study was conducted to estimate the decomposition rate, litter fall production and elemental composition of Cedrus deodara and Pinus wallichiana in the study area Dungagali, Taohidabad, Kuzagali and Khanspur situated around the Ayubia National Park. The research was carried from September, 2016 to August, 2017. Litter bag technique was used to estimate the decomposit...
Fatima Tufail1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3
...zardous effects of pollutants. Therefore, this study was done to evaluate the toxicity of endosulfan (END),deltamethrin (DM) mixture on hepatic catalase (CAT) activity of fish, Channa striata exposed to the sub-lethal concentration (1/3rd of LC50) for 14 days. The CAT was partially purified by using ammonium sulphate precipitation technique. Results of partial purification demonstrated that the exposure of insecticides mixture...

Abdul A. Mirani1,2*, Chee H. Teo2, Adel A. Abul-Soad3, Ghulam S. Markhand1, Tahira Jatt1, Ameer A. Mirbahar1,4, Najamuddin Solangi

... (Phoenix dactylifera) plants derived from immature inflorescences. In this study, three to four years old field grown tissue cultured date palm plants of cvs. Kashuwari and Gulistan derived from in vitro subculture 1-10 (block I) and 11-25 (block II) in multiplication stage were screened for type and nature of phenotypic abnormalities. Six phenotypic abnormalities were detected: 1) dwarfism, 2) excessive vegetative growth, ...

Muhammad Affan Khan* and Abdur Rab 

...ar were grown at three plants spacing i.e. 20, 30 and 40 cm and were evaluated for growth and seed production. Variety Arka Anamika had the maximum plant height (136.8 cm), number of branches per plant (1.42), number of pods per plant (26.33), number of seeds per pod (60.67), seed weight per pod (3.87 g) and seed yield (4.54 t ha-1). The plant spacing of 20 cm resulted in the maximum plant height (136.92 cm) but minimum values for all other attributes. 40 cm p...
Tariq Mukhtar1,* and Muhammad Arshad Hussain2 
... is concluded that the plants of moderately resistant cultivar Sanam suffered less damage and suppressed nematode infections at all inoculum levels and therefore, recommended for cultivation in root-knot nematode infested fields to abate yield losses and repress the nematode from further multiplication. 
...

Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2 

... 15 ton ha-1 compost). Plants growth and yield parameters were determined like the total number of leaves per plant, plant height, fruit length, root and shoot dry weight, fresh fruit weight, the total number of fruits per plant, fruit yield and total yield increase. No significant increase was observed in the yield and growth of okra under control and full NPK fertilizer treatment. Application of organic fertilizers like poultry manure and compost as well as ...

Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah

...lated and uninoculated plants were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry weight of plants was increased at 0-50mM NaCl and decreased at 100-300mM NaCI concentration. Inoculation effectively increased the dry weights of plants at salinity levels of 0-50 mM NaCI as compared to uninoculated pl

Ammara Saeed* and Noor-ul-Amin 

...wth and development of plants. A Randomize Complete Block Design experiment was laid with split plot arrangement at Ornamental Horticulture Nursery, Department of Horticulture, The University of Agriculture Peshawar during 2014 and 2015. Cut flower rose cultivars were tested with treatments of 3 levels of phosphorus (30, 60 and 90 kg ha-1) and potassium (20, 40 and 60 kg ha-1) each as well as combined. Results showed that when plants

Ayub Khan* and Ghaffar Ali 

...livelihood of the inhabitants in the area, have been severely hit by this problem. Human activities, such as deforestation, overgrazing and extensive agriculture have made soil resource more vulnerable to rain and flood water. Programs at government and society level are required to control soil erosion. The objectives of this study are to seek the farm household willingness to pay (WTP) for forestation based soil conservation program on communal land in the N...
Asad Abdullah, Muhammad Irfan Ullah*, Abu Bakar Muhammad Raza, Muhammad Arshad and Muhammad Afzal
...e. Suitability of host plants is critical for the efficient management of this economically important insect pest. We studied the effect of various host plants on the growth, development and fecundity of S. litura. The larvae of S. litura were offered leaves of cabbage, alfalfa, sesbania and, maize in comparison to artificial diet under laboratory conditions (32±05 oC; 65±05 RH). Thelar...

Muhammad Usman Ghazanfar, Muhammad Imran Hamid, Mubashar Raza, Waqas Raza*, Misbah Iqbal Qamar 

... promote growth of the plants and commercially used as bio-fungicide against soil borne plant pathogens. The present study was conducted with the aim to determine the efficacy of Trichoderma species using dual culture and pot assays against Phytophthora infestans (late blight) and Fusarium oxysporum (wilt) of tomato on different compost including carbon rich compost, nitrogen rich compost and nutrient enriched compost. The species of Trichoderma includes T. ha...
Hafiz Suboor ul Hassan and Saira Malik*
...ype. Thus, different variants of genotype -13910T/C and -22018G/A of the individuals were found to be associated with the development of lactose intolerance in patients of the studied population. Milk intake status and gastrointestinal disease are among the other factors that may influence the onset of lactose intolerance in patients and controls. 
...
Muhammad Tariq Adnan Khan*, Tariq Mukhtar and Muhammad Saeed
...hs and weights. As the plants of moderately resistant cultivar Brinjal Jamak suffered less damage and suppressed nematode infection considerably and therefore, recommended for cultivation in root-knot nematode infested fields to abate yield losses and repress the nematode from further multiplication. 
...

Muhammad Amin1,2*, Khalid Mahmood2 and Imran Bodlah3 

...d-finding, 11 new host plants and 71 new locality records in Pakistan. Aphis gossypii and Aphis craccivora were found infesting 8 tree species in 8 genera and 6 in 6 genera respectively. Rosaceae with 5 species in 4 genera carrying 9 aphid species in 5 genera was the most aphid-prone family. Systematics, host range, distribution of the related aphids and catalogue of host plant-tree species in the studied area from Pakistan are given herewith. 

...
Joyce Osarogie Odigie*
...y channel for the inhabitants of Agemokpa village in Ovia East Local Government Area of Edo State, as they are fully dependent on it for agricultural and domestic use, bringing its ecological integrity to question. These anthropogenic effects result in the deteriorating quality of the water, which hampers the distribution of benthic macroinvertebrates and may be hazardous to the health of the inhabitant that consumes it on a daily basis. The goal of this study...

Muhammad Arshad1, Muhammad Irfan Ullah1*, Muhammad Afzal1, Mian Anjum Murtaza2, Ejaz Ahraf3, Zahoor Hussain4, Syed Muhammad Ali Zahid1 and Maryam Riaz1 

...pests attacking citrus plants in Pakistan. The study was conducted to quantify the leaf area damage of eight citrus cultivars caused by mining activity of CLM during summer 2016. The total leaf area and mine area per leaf were calculated by the image analysis method using Sigma Scan Pro 5.0 software. The results of the present study showed that CLM generated larger mines; 1.64 cm2 on Grapefruit, 1.44 cm2 on Kinnow and 1.40 cm2 on Succari compared to other five...
Tanzeela Riaz1, Farah Rauf Shakoori2,*, Hareem Mansoor1, Sana Khan1 and Mushtaq A. Saleem1
...wn insecticides and fumigants. The development of resistance can be delayed by using binary combinations of insecticides. Keeping in view the importance of synergism as well as the concerns about environmental hazards and emergence of resistance against these insecticides, the current project was designed to figure out the lethal concentration (LC50) of emamectin, abamectin and spinosad alone and in various conbinations such as abamectin:emamectin (...
Salma Javed1, Muhammad Fiaz Khan1, Irfan Ullah2, Sadia Tabassum1,*
...t included 2,400 participants, amongst which, 1,000 subjects were suffering from type II diabetes, including 432 males (43.2%) and 568 females (56.8%). Whereas 814 (81.4%) of them were over 40 years of age. Battagram district had the highest prevalence (24.2%) because of the lack of awareness about the disease, while Torghar exhibited the lowest prevalence (12.4%). The sociodemographic factors were analyzed one by one to assess their association with th...

Masood Ahmad* and Abdur Rab 

...demand for its quality plants especially cut flowers. Gladiolus is commercially propagated by corms. The quality and health of corm is one of the important factors that affect the production and quality of gladiolus florets and spikes as well as corm production. Keeping in view, the significant role of calcium in plants and its potential effects on vegetative attributes and quality production of gladiolus corms, an experimen...

Muhammad Zeeshan Manzoor1*, Ghulam Sarwar1, Mukkram Ali Tahir1, Noor-Us-Sabah1, Ayesha Zafar1 and Sher Muhammad2 

...he general response of plants to soil and water salinity depends upon climate, soil characteristics, topography and management strategies. Water, even may be saline, is becoming more precious natural resource. Hence, there should be more crops and jobs per drop while conserving the quality of present terrestrial and groundwater. Saline water has been used for production of fodder and forages in many countries. Managing soil and water salinity under prevailing ...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Shahid Nabeel1 and Abu Saeed Hashmi2
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
...tuents, level of antioxidants in plasma, and presence and count of fecal pathogenic bacteria e.g. E. coli and Salmonella spp. Forty lactating Holstein cows, weighing 550±50 kg, with an average of 20 kg daily milk yield, were randomly divided into four groups (ten in each group). Animals were fed rations containing DOP at 0, 25, 50 and 75% substitution of yellow corn grains (R1, R2, R3 and R4, respectively). Digestion trail was condu...
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Naimat Ullah Khan3, Muhammad Asfandyar Khan2, Kashif Prince1,*, Mahboob Ali1, Ghazunfar Rashid1 and Azmat Ulah Khan2
Muhammad Zameer Khan1, Sair Sarwar1*, Ahmad Khan1, Razaullah Khan1, Munazza Yousra1 and Muhammad Ilyas2
...ake by wheat. Two extractants namely, AB-DTPAand NH4OAc were tested for K extraction from soils. The results showed a high positive correlation between AB-DTPA and NH4OAc extractable K, plant growth and yield parameters. The amounts of soil K had positive correlation with shoot K concentration and grain yield of wheat with r = 0.48 and 0.49, respectively for AB DTPA as compared to that of 0.40 and 0.42 for NH4OAc K. On the basi...
Manzoor Hussain*, Marie Maňasová, Miloslav Zouhar and Pavel Ryšánek
...n were observed in the plants treated with Lecanicillium muscarium and both chemicals. Lecanicillium muscarium treatments alone or with nematodes had significant (P = 0.01) positive effects on plant shoot and root growth among all other treatments in the experiment. After L. muscarium and the chemicals (Vydate and Basamid), Stropharia rugosoannulata ranked second in reducing the nematode numbers of galls,...
Qudsia Yousafi1*, Muhammad Aslam2 andShahzad Saleem1
...ves per plant and four plants per plot and averaged per leaf. Numbers of ladybeetles were recorded from the whole plant by sampling three plants per plot. Seasonal mean number of aphids per leaf was at the maximum on the variety Black Beauty and lowest on Nirala, during the 2013-14 growing season. During the 2014-15season the maximum number of aphids per leaf was recorded on the variety Round Black and lowest on Nirala. When...

Faleye Temitope Oluwasegun Cephas1,2*, Adewumi Moses Olubusuyi1, Olayinka Olaitan Titilola3 and Adeniji Johnson Adekunle1,3 

...ine cell culture supernatants (CCS) (collected between 2016 and 2017) from RD and L20b cell-culture-tubes with NR-CPE, were analyzed. The tubes had been previously inoculated with stool suspension from children (<15 years) in Nigeria with acute flaccid paralysis (AFP). All CCS were screened for Enteric Adenoviruses (EAVs) and group A Rotavirus (GARV) using a rapid immunochromatographic test kit. Subsequently, they were passaged in HEp-2 cell line. All isola...

Adewumi Moses Olubusuyi1, Ogunsakin Temitope Rachael1, Ogunrombi Sefiu Babatunde1, Ojeamiren Iduda1, Olawole Alaba Samuel1, Faleye Temitope Oluwasegun Cephas1,2* and Adeniji Johnson Adekunle1,3 

...enteroviruses in supernatants of cytopathic effect (CPE) negative RD and L20B cell culture tubes in which faecal suspension from acute flaccid paralysis (AFP) cases were cultured. Samples analyzed were collected in 2017 as part of the AFP surveillance program in Nigeria and declared negative for enteroviruses because they did not produce CPE in RD and L20B cell lines. In all, 120 cell culture supernatants (60 each on RD and ...
Tahsin Razzaq*, Muhammad Fareed Khan and Shahid Iqbal Awan
... impact of NCLB. Maize plants were artificially inoculated at four to six leaf stages. Thirty genotypes were screened in first field trail in June 2016. Genotypes had significant differences for NCLB severity and reactions and were classified into resistant, susceptible and moderate categories on the basis of 0-5 disease severity scale. The percent disease incidence ranged from 20-60% and area under disease progressive curve (AUDPC) 22-362dsu (Development stag...

Muhammad Khuram Razzaq1,2*, Saeed Rauf1, Mohsin Khurshid3, Shahid Iqbal1,4, Javaid Akhter Bhat2, Ayaz Farzand5, Adeel Riaz1,6, Guangnan Xing2 and Junyi Gai

 

...e substantial stage in plants and fertile pollen are important for proficient plant reproduction. Abiotic stresses reduce the photosynthates production, thus genotypes also reduce the reserve mobilization for tapetum cells which induce the significant reduction in pollen fertility. Therefore, pollen fertility index can be exploited to discriminate resistant and susceptible genotypes under abiotic stresses. High heritability in the segregating generation warr

Muhammad Irfan Ullah1*, Muhammad Arshad1, Muhammad Imran Khan1, Muhammad Afzal1, Azhar Abbas Khan2, Syed Muhammad Ali Zahid1, Muhammad Saqib1, Asad Abdullah1, Saba Kousar1 and Maryam Riaz1 

...odifies the ability of plants to resist against insect feeding is an interesting and important component in an integrated pest management program. In the present study, water stress was applied to field grown cotton with two Bacillus thuringiensis transgenes (CIM-602 and CIM-599) and one non-transgenic genotype (CIM-554) for the performance of H. armigera feeding The difference in leaf injury, relative consumption and growth rate of H. armigera was detected am...

Nosheen1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1 

...th a wide range of pollutants. Heavy metals are important contaminants of aquatic system and can cause oxidative stress in fish. Evaluation of antioxidant in fish can reveal metal toxicity in the water ecosystem. Therefore, this experiment was planned to assess the acute affect of lead (Pb+2) on peroxidase (POD) activity in tissues viz. liver, gills, kidney, muscle, heart and brain of fish Catla catla exposed for 4-day. Afte...

Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4 

...lly, proportion of its plants with vegetative stage declined. This decline of plants with vegetative stage can cause distraction to livestock depending on the species for grazing purposes. It is suggested that two month clipping stage should be applied on Blue panic grass to get sustained grass vigor and optimum herbage yield. 

...

Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2 

...nctions to protect the plants against different forms of stresses. In this study, the feedback-insensitive serine acetyltransferase (SAT); a rate-limiting enzyme for Cys biosynthesis from tobacco i.e. NtSAT4 was successfully cloned into three types of overexpression constructs i.e. pBinAR_NtSAT4 (targeted to cytosol), pBinAR-TKTP_NtSAT4 (targeted to plastids) and pBinAR-SHMT_NtSAT4 (targeted to mitochondria). For stable transformation of B. napus floral-dip an...

Jahangir Khan1*, Abbasullah Jan1, Kar Ho Lim2, Syed Attaullah Shah1*, Aditya R Khanal2 and Ghaffar Ali1 

...were significant determinants of their WTP. In addition, health concern and environment concern of pesticides use also influence the WTP. Findings from this study help in assessing the market potential for pesticides-free fruits in Pakistan 

...

Tanveer Ahmad1*, Muhammad Mujtaba Rafiq1, Waqas Ahmed Dogar2, Abid Mahmood Alvi3, Qumer Iqbal4, Muhammad Azam5 and Arshad Ali Khan6 

...ca L.). Healthy phalsa plants were fertilized with P2O5 @ 50g, 100g and 150g plant-1. Data were recorded on number of fruit bush-1, yield bush-1 (kg), single fruit weight (g), fruit diameter (cm), number of fruiting nodes, length of new shoot (cm), number of sprouted shoots cane-1 and leaf area (cm2). Treatments were applied under Randomized Complete Block Design (RCBD) in triplicates and means were compared by Tukey’s HSD test. Association of the biolog...

Muhammad Abdul Qayyum1*, Farhat Bashir2, Muhammad Mudassar Maqbool3, Anser Ali3, Saqib Bashir1 and Qaiser Abbas4 

...ed a severe threat for plants seed germination because it has highest concentration of soluble salts. This study aims to examine the effect of NaCl salt at 100 mM and 200 mM concentrations on linseed (Linum usitatissimum L.) germination, plant growth, nutrients and soluble salts uptake. The results revealed that tested four linseed genotypes showed an overall germination rate of 86-94% at 100 mM NaCl (T2) and 78-84% at 200 mM NaCl (T3) and seedling survival ra...

Sibgha Noreen*, Sumrina Faiz, Muhammad Salim Akhter, Kausar Hussain Shah 

...gn: justify;">Osmoprotectants are highly soluble, neutral and non-toxic chemical compounds which have low molecular weight. These molecules help the plants to regulate osmotic adjustment and to enhance abiotic stress tolerance in plants. This study was aimed to examine mitigation effects of different osmoprotectants (salicylic acid, ascorbic acid, prolin...

Shahid Ali1*, Farhan1, Murtaza1, Neelum Andaleeb2 and Amjad Ali1 

...nt as compared to the tenants. Farm size was having negative and significant effect on inefficiency while age and farming experience of the sampled respondents were statistically insignificant. It is recommended that extension department should train farmers to improve their farming skills and provide them formal as well as informal education to enhance the technical efficiency of wheat growers. 

...

Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh* 

...and internode (100%) explants was observed in cv. Desiree using Agrobacterium strain GV2260, while the highest gene transfer efficiency rate for leaf and internode explants in S. chacoense M6 were obtained with AGL1. The highest callus formation for both cv. Desiree and S. chacoense M6 was obtained on cv. Desiree leaf explants, transformed via the Agrobacterium strain GV2260. The lowest ca...
Muhammad Furqan Shahid1*, Tahir Yaqub1, Muhammad Yasin Tipu2, Asim Aslam2, Saima Yaqub1, Aziz-ul-Rahman3, Muzaffar Ali1
...fferent AIV (A/H9N2) variants isolated from commercial, backyard poultry and fancy birds (partridge). Commercial broiler birds were infected experimentally at the dose of 106 EID50 by using these three isolates. Results revealed that onset of clinical signs was started at 2nd day post infection (DPI) followed by severity in redness and swelling of eyes, sneezing and lacrimation at 3rd DPI that lasts up to 5th
Hafiz Muhammad Arsalan1, Maria Altaf1, Zeemal Seemab Amin1, Muhammad Khalil Ahmad Khan2, Anum Shahzadi1, Hina Mudasser1, Iqra Maqsood1, Nazia Gulshan1, Saira Naseem3
...elation between Anti-Oxidants and Biochemical status in Rheumatoid Arthritis patients. 60 clinically diagnosed Rheumatoid Arthritis (RA) patients and 50 healthy persons were included in this study. 5 ml Blood was drawn and serum was separated. Anti-Oxidant Biomarkers, Serum micronutrients, serum Electrolyte balance was measured through spectrophotometric procedure. Serum MDA level jump high in patients (14.19) as compared to normal subjects (3.26). Serum Gluta...

Manzoor1*, Ahmad Khan1, Amir Sohail2, Shahzad Ali1, Fawad Ali Shah3, Junaid Iqbal3, Muhammad Owais Khan4 and Sultan Nawaz4 

...rs excluding number of plants at harvest. Full irrigation (10 irrigations) had significantly more plant height (189.25 cm), 1000 grain weight (211.25 g), leaf area (425.95 cm2), number of leaves (16.23), grain yield (3352.75 kg), biological yield (10726.08 kg) and shelling percentage (47.78). Whereas one irrigation missing at six leaves stages produced maximum Harvest index (33.99 %). In case of planting methods, ridge planting had significantly higher plant h...

Hassnain1, Abdul Basit1*, Mehboob Alam1, Imran Ahmad1, Izhar Ullah1, Noor Alam2, Inayat Ullah3, Muhammad Areeb Khalid1, Muhammad Shair4 and Noor ul Ain1 

...) were given to tomato plants from 15 days after transplantation. Results showed that various application of chitosan and water stress interval had a significant (P< 0.01) effect on almost all studied parameter. Tomato plants treated with 6 days water stress interval had maximum average plant height (82.69 cm), average number of leaves (104.02), leaf area (81.47 cm2), chlorophyll content (71.31 SPAD), relative water ...

Noorullah Khan1*, Farrukh Siyar Hamid1, Fayaz Ahmad1, Sabaz Ali Khan2, Imtiaz Ahmed1, Muhammad Abbas Khan1, Shamsul Islam1, Abdul Waheed1, Basharat Hussain Shah1 and Hussain Shah

...5 cm) were recorded in plants treated with 3000 ppm IBA. Contrarily the longest roots of 50.7 cm were observed with IBA concentration of 5000 ppm. Correlation analysis revealed that SSR % and growth of kiwi seedlings are strongly associated with NFARP as we found strong correlation (P<0.001) among NFARP, SSR% and plant height. In addition, the main root length also showed moderate correlation (P<0.05) with plant height but it was not correlated with SSR%...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...s112445441 and other variants involved in NHL pathogenesis. 
...

Asim Munawar1,2*, Farooq Ahmad1, Aqsa Arshad1, Muhammad Ishaque Mastoi3 and Chengjuan Liang4 

...tic pyrethroids and fumigants some major pests of stored grains has develops resistance against them. Resistance mechanisms in R. dominica and T. castaneum against these control agents at different geographical locations was largely unknown. To overcome this gap our research was undertaken to evaluate the resistance mechanism in lab and field collected strains of R. dominica and T. castaneum against deltamethrin and phosphine. Results indicated significant dif...
Umer Iqbal1,* and Tariq Mukhtar2
...nation and survival of plants. Doses also had a significant effect on the germination and plant survival. Maximum germination and survival were recorded where the seeds were treated with a concentration of 150 ppm and minimum was recorded in case of 50 ppm concentration. With a decrease in the concentration, the germination and survival decreased significantly showing a direct relationship between concentrations and plant survival. Benomyl at 150 ppm concentra...

Muhammad Akbar Ali Shah1, Gamze Özel2, Christophe Chesneau3, Muhammad Mohsin4, Farrukh Jamal5* and Muhammad Faheem Bhatti6 

... to discover the determinants of the rice production of Pakistan to improve the production and fulfill the increasing demand. The study conducted in district Lodhran (Punjab province) and 31 villages selected as samples randomly. Time series data collected from Crop Reporting Service (CRS) for the period of last 10 years (2005-2014) containing 516 cases and 14,964 observations. Two different multiple linear regression (MLR) models are applied to study the rela...

Ghulam Murtaza1*, Ghulam Sarwar1, Noor-Us-Sabah1, Mukkram Ali Tahir1, Fakhar Mujeeb2, Sher Muhammad3, Muhammad Zeeshan Manzoor1 and Ayesha Zafar1  

...h as height of sorghum plants, diameter of stem, number of plants/ m2, total biomass of fresh plants were noted. Among all the treatments, T7 (T1 + organic matter @ 10 Mg ha-1) performed the best which produced the highest values of growth parameters. However, the treatment T3 (water of EC 3.0 dS m-1) proved inferior to all others with respect to height of sorghum pl<...

Muhammad Qaisar Nawaz*, Khalil Ahmed, Ghulam Qadir, Muhammad Rizwan, Muhammad Faisal Nawaz and Muhammad Sarfraz 

.../m-2, number of leaves/plants, root length, bulb diameter, forage yield and total bulb yield. Results revealed that all the studied parameters were significantly improved with nitrogen application @ 80 and 100 kg ha-1 in ridge sowing. However, 80 kg N ha-1 in ridge sowing documented maximum economic benefit as compared to other treatments and is suggested as most cost-effective technique for turnip production under moderately salt-affected soils. 

...

Saleha Ashfaq1, Manzoor Hussain1, Nazish Bibi2, Jan Alam1, Muhammad Junaid2 and Sabi-Ur-Rehman3*

... C.C. a narrow endemic plants of northern areas of Pakistan. The antimicrobial potential of H. gilesii extracts in different solvents was assessed using agar well diffusion method against bacterial and fungal strains, while cytotoxic activity was studied in the methanolic extract using brine shrimp’s lethality assay. All the extracts showed significant biological activity against Gram positive, Gram negative bacteria and selected fungal strains. Acetone,...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
...ctive management of ruminants. We attempted to explore the effectiveness of a marketable ELISA test kit for assessment of Pregnancy Associated Glycoproteins (PAGs) in peripheral blood for early pregnancy identification in cattle, buffalo, goats and sheep. A total of 120 blood were taken from jugular vein of different breeds of cattle (Achai, Achai x Jersey, Holstein Friesian and Jersey), buffalo (Nilli Ravi, Aza Kheli and non-descript), goats (Beetal, Teddy an...

Farheen Shafique1, Shaukat Ali2,*, Saiqa Andleeb1, Abdul Rauf1,3, Syed Ayaz Kazmi1,3, Sadia Idrees4, Faisal Farooq1,3, Faiq Nawaz Khan3,4, Muhammad Saad-ul-Hassan1,3, Raja Awais Mumtaz1,3, Saba Khalid1, Zaheem Ashraf1, Hafiz Muhammad Tahir2 and Fazal-ur-Rehman5

...l the understudy participants were interviewed through questionnaire method. After taking written consent from each participant or guardian, 5 ml of blood was collected from each participant and brought to the working laboratory for HBV and HCV screening through ICT kit method. All ICT positive samples were further confirmed through ELISA. Individuals 25(8.2%) were found positive for both hepatitis B surface Antigen (HBsAg) and Anti hepatitis C antibody (Anti-...
Ahsan Anjum1, Asim Aslam1, Raheela Akhtar1, Tahir Yaqub2,  Muti-ur-Rehman Khan1, Rizwana Sultan3, Saba Usman1Aneela Zameer Durrani4 and Muhammad Usman4*
...ssociated economics, warrants the implementation of control measures to mitigate the economic losses associated with the disease.
...
R. Yasmeen1*, S. Shaheen1, B.N. Khan2, S.S. Bokhari1, U. Rafi1 and A.W. Qurashi1
...re exposure to air pollutants noticed for Lahore zoo compared to Bahawalpur zoo.
...

Shahzad Khan1*, Inayatullah Jan1 and Syed Fahad Shah2 

... identify the role of tenants in informal tenancy contracts. Three villages of District Charsadda Khyber Pakhtunkhwa, Pakistan, were purposely selected for the study. A total of 30 respondents were interviewed with the help of a pre-tested questionnaire. The findings of the study reveal that skillful and experienced tenants were given preference by the landlord. But due to non-availability of extension department and its tra...

Asif Yaseen1, Muhammad Israr2*, Allah Bux Khan1, Ahsan Javed3, Nafees Ahmad4 and Zia Ullah

... the significant determinants of farmers’ reliance on high value marketing channels. To this end, policy makers need to give due consideration to certain exogenous factors such as price expectation, delay of payment, trust in buyer, price fluctuation, and provision of farm services. 

...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

...ng levels of NaCI. The plants treated with 50 mM NaCI had maximum amount of protein contents as compared to those at 0mM NaCI level. Varieties CM91 and CM2000 had higher protein contents than CM44 and CM98. At I/50 level of salinity the total protein contents were found more than inoculated control at 0mM NaCI. From this study, it is concluded that PGPRs can play an important role to mitigate the salt stress at different concentrations for better crop yield.&n...
Erum Yawar Iqbal1*, Ashfaque Ahmed Nahiyoon1, Shahnaz Dawar2 and Shahina Fayyaz1
...own that different formulants of EPB produced significant effects on Aphid mortality, change in population density, population reduction and fecundity. Cell-free supernatant of new EPB species Xenorhabdus steinernematis n.sp. strain PAK. CB10 (KU097324) and the other X. indica PAK. S.B.56 (MF521953) resulted in both the highest mortality rate [(94.33±2.05, 100.00±0.00)%] @ 300µl/10ml at 30ºC and the lowest fecundit...

Mohammad Aquil Siddiqui1*, Muhammad Tahir Khan1, Ghulam Shah Nizamani1, Shafquat Yasmeen1, Imtiaz Ahmed Khan1, Abdullah Khatri1 and Nighat Seema Soomro2 

...netic structure of the plants as an indispensable tool for crop improvement. This field study was initiated to evaluate three potential mutant lines of lentil against their parent (M-85) and two check varieties (NIA-Masoor-05 and NIA-Masoor-16). The pooled data of the crop, after two years of evaluation, indicated the earliest maturity in the mutant AEL-40/30 (92.0 days). Plant height was observed to be low in all the studied mutant lines (AEL-40/30, AEL-13/30...
Muhammad Faheem Akbar1,*, Muhammad Abdul Haq2, Imtiaz Ahmad1, Vasileva Viliana3 and Amjad Sultan1
...nd degradation rate constants and half-life were calculated. Conventional pesticides were found to be more persistent in the crop (Average half-life: 2.94, 4.06 and 2.74 days for imidacloprid, endosulfan and profenofos respectively) than bio pesticides (Average half-life: 3.87 and 1.81 days for spinosad and biosal respectively). The crops treated with bio pesticides were found safer for human consumption even after few hours of spray compared with codex and EU...
Muhammad Irfan Ullah1*, Muhammad Arshad1, Sajjad Ali2, Asad Abdullah1, Samina Khalid3, Hafiz Muhammad Aatif4, Syed Muhammad Ali Zahid1, Muhammad Afzal1 and Jaima Molina-Ochoa5
...nt.

...
Abdul Kabir¹, Amjad Hussian Mirani¹, Jam Kashif1, Shumaila Manzoor2, Abdullah Iqbal3*, Ihsan Ullah Khan4 and Muhammad Abubakar2
...ion system of small ruminants and on-going disease outbreaks in the target area.
...

Muhammad Rasheed*, Tayyaba Naseer, Asma Hassan, Fayaz ul Hassan, Rifat Hayat, Ghulam Jilani, Samman Gul Vaseer and Muhammad Bilal Ali 

...on the roots of legume plants. To ensure an optimum rhizobial population in the rhizosphere is necessary that improves the nodulation, N2 fixation and growth of legume crops. The experiment was conducted to access the effect of isolated bacteria from nodules on growth and nodulation of the lentil cultivars. Different cultivars were used in this experiment; Markaz 2009, Masoor 2009 and NIA 2005 treatments were used viz BS0 (control), (Pseudomonas stutzeri), BS2...

Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui

...egetatively propagated plants through in vitro culture. This study was conducted to establish the optimal concentrations of plant growth regulators and sucrose for micropropagation of sugarcane. Sugarcane is cultivated through cane sets and therefore, multiplication of any new genotype through traditional practices requires interminable period of time. Eight sugarcane genotypes viz. NIA-2004, SPF-234, NIA-2012, BL4, AEC92-1208, Thatta-10, Gulabi-95 and NI...
Fatima Hashim Abbas1,2* and Alaa Tareq Shakir Al-Hassnawi1
... balance between antioxidants and oxidants in favor of the later can cause serious problems such as abortion. So the investigation of the oxidants/antioxidants status during early stages of pregnancy is urgently needed to help us solving such health issues. In this current study, One hundred and thirteen aborted women (73 known causes group, 40 unknown g...
Mubashra Salim1, Omeira Ibrahim1, Hugo Vilhena2,3,4, Carla Maia5, André Pereira5, Maria Shahzeen1, Shabana Kalsoom1, Asim K. Mahmood6 and Furhan Iqbal1*
...ats, dogs, domestic ruminants, pigs, rodents and humans. The present study was designed for the molecular detection of Mycoplasma haemofelis and Candidatus Mycoplasma haemominutum in feline blood samples collected from various pet clinics in Pakistan, by Polymerase Chain Reaction (PCR), using 16S rDNA as the target sequence. Clinical and epidemiological data was collected in all animals included in the study. M. haemofelis and C. Mycopl...
Ahsan Numan1,4, Khadija Irfan Khawaja2, Abdul Basit Qureshi3Muhammad Shahbaz Yousaf4, Imtiaz Rabbani4, Hafsa Zaneb5 and Habib Rehman4*
...erum biochemical determinants. Prevalence of DSP was found to be 31.48% when 2,290 diabetes mellitus Type-2 subjects were screened. The patients with DSP were older (p < 0.05), had longer duration of DMT2 (p<0.01), elevated systolic blood pressure (p<0.05), blood sugar (p < 0.05), HbA1c (p<0.001), cholesterol (p<0.01), LDL (p<0.001), triglycerides (p<0.05) and more obese (p<0.01) when compared with the diabetic patients wi...
Ahmet Ozer Sehirli1,2, Serkan Sayiner3*, Ayliz Velioglu-Ogunc4, Nedime Serakinci5, Emel Eksioglu-Demiralp6, Berrak Yegen7, Feriha Ercan8 andGoksel Sener2
...ombination with anti-oxidants.
...
Sumaira Akram1, Sajid Aleem Khan1*, Nazir Javed1 and Saeed Ahmad2
... eggs were observed in plants treated with in aloe vera extract. Protective and curative treatment with plant extracts, biocontrol agents and chemicals suppressed the disease and enhanced plant height and root weight. All treatments evaluated in this study exhibited suppression of MG. Therefore, these treatments can be used in combination against MG infestation on wheat.
...
Jiao Qin,Qian-Qian Su and Quan-Sheng Liu* 
... resistance to anticoagulants with repeated and long-term application of anticoagulant rodenticides in southern China. Fertility control is considered as an alternative strategy for management of this pest. Cabergoline can inhibit prolactin (PRL) secretion and was applied in fertility control for animal, however, the physiological and behavioral mechanisms of cabergoline as a sterilant in practice remain little known. This study determined the effects of diffe...

Reda Mohamed1, 2 

... abdominal aorta in ruminants. In most cases, the celiac artery originated independently, while in few cases it originated by a celiacomesenteric trunk with the cranial mesenteric artery. The branches of the celiac trunk in ruminants varied and originated either directly or indirectly according to the species. The right ruminal artery originated either from the splenic, left gastric or celiac arteries. The epiploic branch de...

Asmaa A. Darwish 

...ements and total antioxidants capacity concentrations significantly (P< 0.05) decreased in the three diseased groups. Both of MMP-2 and MMP-9 yielded a sensitivity and NPV as 100% in the sheep pneumonia, arthritis and enteritis and correlated with some parameters in PG and EG. Ovine inflammatory conditions usually result in different clinicopathological changes. Monitoring of them may be useful in improving our therapeutic intervention and enhancing the ani...
Syed Basit Rasheed*, Ahmad Yar, Farrah Zaidi and Qaisar Jamal
...e: small;">Taxonomically ants are the most neglected group of insects to be studied in Pakistan. The current study was conducted to collect ants from all three tehsils: Charsadda, Tangi and Shabqadar of district Charsadda. Ants were collected randomly from indoor (rooms, kitchen and washrooms) and outdoor (streets, crop fields, barren ground and grave yards) sites by using buccal aspirator...
Mehtap Bayir*
...-known enzymatic antioxidants because of their central role in the antioxidant defense system. In this study, the phylogeny, gene structure, and conserved gene synteny of sod1 and sod2 genes in fugu—a model organism—were determined. Maximum amino acid similarity identity was found between putative fugu Sod1 and Sod2 proteins and their orthologs from teleost fish and tetrapods. Phylogenetic clustering was seen between sod genes ...
Housh Muhammad Solangi1, Javaid Ali Gadahi1*, Mansoor Tariq2, Bachal Bhutto1Zubair Ahmed Laghari1, Jamila Soomro3, Taufeeq Ahhmed Khosa1 and Abdullah G Arijo1
...e parasite of small ruminants producing the economic losses. The present study was conducted to explore the immunogenic properties of H. contortus crude proteins (HcCP). Protein profile of HcCP was checked by SDS PAGE and immunogenic proteins were recognized by the antisera produced by using the HcCP as antigen. Infective stage of the H. contortus (L3) was used for the challenge infection. Protein band pattern ranging from 10 to 170 kDa was obser...

Ihsanullah Kakr1, Sarwar Khan2, Khalid Khan3* and Sajjad Ahmed

...ups viz settled, transhumants and nomads were interviewed in Districts, Musa Khail and Jhal Magsi during the year 2011. The direct as well as indirect economic losses due to camel Trypanosomiasis based on the prevalence of Trypanosomiasis, mortality rate, abortion and perceptions of the respondents were recorded. The camel dies due to Trypanosomiasis in direct visible losses and invisible losses include reduced fertility, meat loss, low quality of hide, loss o...

Muhammad Zamin1*, Abdullah Khan1, Ibadullah Jan1, Fazli Rabbi2, Shahen Shah3, Rashid Ali1, Kaleem Ullah1 and Muhammad Amin4 

...cations. There were 10 plants in each replication. The highest number of florets per spike (11.42) were obtained at treatment combination of nitrogen and potash (100N +200K kg/ha) where other parameters of plant height, number of leaves, leaf length and spike length were at par with their respective maximum results. However, the lengthiest spike (88.10cm) was produced at 100kg/ha nitrogen. Similarly, the application of nitrogen at the rate of 200 kg/ha produce...
Naseeb Ullah1, Assad Ur Rehman1, Aamir Khan1, Rabia Noushin2Shahid Naiz Khan1, Syed Ishtiaq Anjum1, Sajida Afzal1, Asma Naseem1Kenza Javed1, Ujala Rauf1 and Kalim Ullah1*
...ck (large and small ruminants) from December 2017 to April 2018 to examine the prevalence of FMD. The current study indicated that overall FMD in Livestock was 14.31% with 16.37% in small ruminants and 12% in large ruminants. A significant difference in sero-positivity was observed in small, young and adult of both small and large ruminants. The sero-pos...

Pushpa1, Nighat Seema Soomro1, Shahla Karim Baloch2, Mehmooda Buriro1, Aijaz Ahmed Soomro1, Muhammad Tahir Khan3, Qamar Uddin Jogi1*, Muhammad Nawaz Kandhro1 and Farheen Deeba Soomro1 

...ns. The powder of weed plants produced significantly (p<0.05) harmful outcomes on all growth parameters of wheat varieties as compared to the control treatment. The maximum seed germination (82.16a %), shoot length (27.70 cm), root length (14.90 cm), shoot fresh weight (2.19 g), root fresh weight (1.16 g), shoot dry weight (0.54 g), root dry weight (0.27 g), and seed vigor index (3483.5) were recorded in variety Amber under the control (where no allelopathi...

Ahmad Naeem Shahzad1, Muhammad Kamran Qureshi2, Samee Ullah1, Muhammad Latif3, Shakeel Ahmad1 and Syed Asad Hussain Bukhari1* 

...tify;">Use of osmoprotectants is a possible strategy for plants to survive under adverse environmental conditions. The current study emphasizes the ameliorative role of trehalose, in mitigating the detrimental effects of salt stress, in cotton plants. Three concentrations of trehalose (0, 5 and 50 mM) were applied to plant foliage, subjected to varying levels (0, 11 and 17 dSm-1) of salini...
Muhammad Sarmad, Syed Muhammad Zaka* and Syed Muhammad Tahir Abbas Shah
...tems and seeds of host plants. Being a serious pest of many important crops, the present work will study on biology and bionomics of O. laetus on three different hosts Gossypium hirsutum, Abelmoschus esculentus and Helianthus annuus. Shorter nymphal duration was observed on Gossypium hirsutum 20.00±0.14 days as compared to Abelmoschus esculentus 21.00±0.26 days and Helianthus annuus ...

Saira Bano, Muhammad Naeem* and Samrah Masud 

...dy weight. The blood variants were studied like Lymphocytes (LYM), Monocytes (MON), Granulocytes (GRA), Red Blood Cells (R.B.C), Hemoglobin (Hgb), Hematocrit (HCT), Mean Corpuscular volume (MCV), Mean Corpuscular Haemoglobin (MCH), Red Blood Cell Distribution Width when measured with Standard Deviation (RDW-SD), Mean Corpuscular Haemoglobin Concentration (MCHC), Platelets (PLT), Plateletcrit (PCT), Mean Platelets Volume (MPV), Platelets Distribution Width (PDW...

Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad

...combinations on tomato plants. This research study was performed at Agricultural Research Institute, Tarnab, Peshawar-Pakistan. Different biochemical tests were conducted to confirm stem rot pathogen. Boron was applied at the rates of 1.97, 2.96 and 3.95 g seedbed-1. Plant extracts were neem (Azadirachta indica) and ghwaraskay (Dodonaea viscosa). Morphological traits such as plant height, maximum number of fruits plant-1 and yield were observed and severity of...

Muhammad Safdar Hussain1*, Muhammad Farrakh Nawaz2, Muhammad Ayyoub Tanvir2 and Noor-E-Hira

...ion, drought-resistant plants should be sorted out. The objective of this study was to explore the growth behavior of Eucalyptus camaldulensis (recommended for waterlogged areas) and Tamarix aphylla (recommended for arid regions) under water stress. Therefore, a pot experiment was carried out with three treatments: Well-watered, 25% and 50 % drought to achieve said objective. It was found that drought negatively affected plant growth. The mean heights of E. ca...

Umar Hayat1, Khalid Khan2, Saima Liaqat3 and Guo Xiangyu4* 

... study evaluated determinants of rice production in the district Nasirabad, Balochistan by employing Neo-Classical and Cobb-Douglas production functions. The findings of the study show that education, fertilizers, rent, training and total area under the rice crop (wetland), labor, capital, availability of input, and rice prices are the key components that leave a positive and noteworthy impact on rice production in the District. Nevertheless, physical capital,...

Aqsa Ahmad1, Iftikhar Ahmad1* and Malik Fiaz Hussain Ferdosi

... treatment substrates. Plants grown in substrates containing SD + PH + PM (experiment I) indicated that plants grown in these soilless compositions died before flowering, while those grown in silt (control) performed best. While in experiment II, the highest quality plants were grown in 50% CC + 40% RH +10% PM. Quality was defined as plants with shortest...
Aamir Mushtaq1,2, Rukhsana Anwar1 and Mobasher Ahmad1,2,* 
...of extract) and anti-oxidants (IC50 value = 59.60 µg/ml found by DPPH method) in plant extract. Higher inflexion ratio (0.25 ± 0.05), most of time spent in dark area (158.34 ± 4.88 sec), increased no of hole pokings (34.16 ± 2.01), significant (P < 0.001) elevation in superoxide dismutase (17.36 ± 0.49 U/mg), catalase (1.42 ± 0.05 U/mg) glutathione (37.56 ± 1.89

Iqbal Javed1, Abdur Rehman2*, Iftikhar Nabi3, Amar Razzaq4, Raheel Saqib5, Allah Bakhsh6, Muhammad Mohibullah7 and Muhammad Luqman

...ng partner. If Pakistan wants to improve its export value of basmati rice, there must be an effective strategy to control the inflation in Pakistan or at least need to make policy for minimizing the impact of inflation for the rice producers. If it is very difficult to control the inflation there must be subsidies for rice growers for inputs used in the basmati production. The high rates of inflation in trading partners have positive and significant impact on ...
Sajjad Ali1,*, M. Irfan Ullah2, Asif Sajjad1, Muhammad Zeeshan Majeed2, M. Aslam Farooqi1, M. Shahid Rizwan3, Qaiser Shakeel4, Sohail Akhter1,Muhammad Raheel4 and Muhammad Arshad2
...rs with different host plants in terms of their physicomorphic attributes has been the subject of great interest with point of their integrated pest management. Helicoverpa armigera (Noctuidae; Lepidoptera) -being highly polyphagous- is the pest of many crops and exhibits high fecundity and migrating efficiency. The present study aimed to evaluate its physicomorphic responses towards different host plants. The highest...
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...ransition period in ruminants is defined as a phase of 3 weeks preceding and post parturition. It is characterized by metabolic stress, reduced feed intake, intense mobilization of energy reserves, increased nutritional requirements and changes in dams’ metabolism. Yeast Supplementation has been found to increase the production performance and nutrient digestibility in ruminants. However, when compared with large rumin...
Yue Qin Song, Hui Zhong Sun* and Jun Feng Dong
...nd discrimination of odorants. On the basis of female and male antennal transcriptomes of Yemma signatus adults, a total of 66 candidate Y. signatus olfactory receptor genes (YsigORs), including one olfactory co-receptor (Orco), were identified in this study. All the sequences were further validated by cloning and sequencing. Tissue expression profiles of all YsigOR genes in the antennae of females and males were analyzed using real-time quantita...

Anila Latif, Zaheer Abbas, Farhatullah and Ghulam Muhammad Ali* 

...kaloid and produced by plants of family Berberidaceae. Berberine Bridge Enzyme (BBE) gene involved in the synthesis of berberine was isolated from Berberis lyceum and over expressed in Arabidopsis thaliana. The integration of the BBE gene in transgenic lines was confirmed through PCR while the expression was confirmed by Reverse Transcriptase PCR. Whole plant bioassay confirmed 100% mortality in DBM within 72 hours. The present investigation concludes that the...

Muhammad Usman Ghazanfar1, Waqas Raza1*, Waqas Wakil2,3, Imtiaz Hussain4 and Misbah Iqbal Qamar

...ify;">Pre-treatment of plants with chemical elicitors can induce systemic resistance against plant pathogens and insect herbivores. The plan of the study was to study induction of defense responses and protective effects against Phytophthora infestans (Mont.) de Bary and sucking insect pests of potato (Solanum tuberosum L.) with application of salicylic acid (SA) and β-aminobutyric acid (BABA). Concentration of SA and BABA (2, 4 and 5 mM) were applied to ...

Ahmad Kiani1*, Shapour Zarifian1, Hosein Kouhestani1 and Hosein Karimzadeh

...l regions and many immigrants from rural regions to urban regions have been recorded. So, this research tries to prioritize the criteria of establishment and development of agricultural industries in the rural areas in Tehran Province. The result shows the items which refer to market and financial issue have greater weight, So, it is necessary to develop transportation to streamline access to market and also the industries need investors to be flourishing; Acc...
Tehreem Usman1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qaisra Siddique1
...ends on the type of toxicants and exposure duration.
...
Afzal Nimra1, Zulfiqar Ali1*, Safdar Sidra 2, Rida Ahmad1
...y emit trace metal pollutants
 

Abid Khan*, Mukhtar Alam and Yousaf Jamal 

...her LAI (0.99), taller plants (89 cm), higher CGR (8.76 g m-2 day-1), delayed maturity (171 days) and more chlorophyll a and b (1.95 and 0.64 µg ml-1) were achieved while using NS6 as compared to other nitrogen sources. Significantly more leaves and leaf area tiller-1 (5.2 and 34.3 cm2), higher LAI (1.18), taller plants (93.8 cm), higher CGR (10.27 g m-2 day-1) and greater chlorophyll a and b (2.30 and 0.75 µg ml...

Muhammad Medrar Hussain*, Asad Jan* and Sayyar Khan Kazi 

... rice calli transgenic plants were regenerated and established in greenhouse. For the evaluation of OsTZF8 gene role in drought stress tolerance, two weeks old rice seedling were subjected to drought stress. OsTZF8-OX transgenic indica line A and B displayed 69% and 64% survival rates respectively compared to 33% of control. These results confirmed that due to overexpression of OsTZF8 gene, transgenic line A and B displayed considerable level of drought stress...

Gulnaz Parveen1*, Salma Gul2, Muhammad Ather Rafi3, Ashfaq Ali Khattak4 and Hikmatullah Jan

...d the growth of tomato plants. Infection % of all test fungi included Fusarium solani, Fusarium oxysporum, Macrophomina phaseolina and Rhizoctonia solani was significantly controlled by leaf powder (LP) and shoot powder (ShP) when applied alone and with combination. While combinations of 3% LP + 3% ShP, 3% LP + 5% ShP, 5% LP + 1% ShP, 5% LP + 3% ShP, 5% LP + 5% ShP completely controlled the infection of Macrophomina phaseolina. Similarly combination of 5% LP +...

Samman Gul Vaseer1, Muhammad Rasheed1*, Muhammad Ansar1, Yamin Bibi2, Saqlain Shah1, Asma Hassan1, Lubna Ayub Durani1, Muhmmad Asif3 and Zuhair Husnain

... the nodules of legume plants. However, the variable reports for Cobalt (Co) effects on plant growth and crop yields urged to research and verify if the Co is an essential component particularly for leguminous crops. A greenhouse study was

Ayesha Zafar1, Ghulam Sarwar1*, Muhammad Sarfraz2, Muhammad Zeeshan Manzoor1, Sher Muhammad3 and Ghulam Murtaza

...lture in Pakistan. The plants in saline environment are negatively affected due to several issues like low osmotic potential, specific ion effect, and nutritional imbalance. The fertilizer behavior in salt stress conditions is quite different as compared to the normal soils. Linseed is an important oil seed crop. Its 50 % yield reduction occurs at ECe 5.9 dSm-1 and ESP value of 25-30. A field experiment was conducted on saline sodic soils to determine fertiliz...

Iram Fatima1*, Imran Pasha1, Ambreen Saddozai2, Shahid Nadeem3, Amer Mumtaz4 and Saqib Jabbar4 

...r eight different adulterants tested. Sugar samples were free of any adulteration while in beverages two other adulterants were found in 22% of samples. Analysis of variance (ANOVA) under two way factorial indicated significant statistical difference (P<0.05) in mean value of microbial count in different location while between different samples it was non-significant (P>0.05). Thus, the conducted&nb...

Wajiha Anum1*, Liaquat Ali1, Umair Riaz2*, Abid Ali1, Nadia Manzoor3, Laal Hussain Akhter4, Asad Ur Rahman5, Naeem Maan6 and Ijaz Ahmad

... metabolic function in plants. However, it is not readily available to the crop because of its immobile nature. In order to ensure its efficient uptake by crop, an experiment was conducted to appraise the effect of various P placement methods and fertilizer rates on wheat. The fertilizer treatments were F1=150-00-60 NPK kilogram/hectare, F2=150-30-60 NPK kilogram/hectare, F3=150-60-60 NPK kilogram/hectare, F4=150-90-60 NPK kilogram/hectare, F5=150-120-60 NPK k...
Majeeda Rasheed1*, Tanveer Akhtar1, Nadia Mukhtar2, Muhammad Furqan Shahid2, Muhammad Imran3, Saima Yaqub2
...;">Peste des petits ruminants (PPR) caused by PPR virus (PPRV), is a contagious disease of domestic and wild small ruminants. The disease is endemic in developing countries of African and Asian worlds including Pakistan, where several clinical cases in small ruminants (sheep and goat) have been frequently reported. Despite PPRV is endemic in Pakistan, information on disease serosurvei...
Fehmina Ashraf1*, Muhammad Irfan2, Hafiz Abdullah Shakir1, Shaukat Ali3, Muhammad Khan1
...s species of bacteria, plants and in different genera of fungi. Laccases have been purified by various methods. It involves in di-oxygen to water reduction and 1e- oxidation of phenolic and its allied parts. Laccases are mostly used in different industries like food, paper and pulp, pharmaceutical and textile etc. Both laccases and mediators have been used in different process like delignification of pulp. Laccases from bacterial species are used in dye decolo...

Md. Al-Amin Tan1, Mst. Antora Akter1, Md. Sabuj Rahman1, Marzia Rahman2 and Md. Mahmudul Alam1* 

... choice of skin disinfectants and methods of skin preparation is still aberrant in veterinary practice. The study was, thus, conducted to standardize pre-surgical skin preparation with various formulations of Chlorhexidine gluconate, Chlorxylenol, and Povidone-iodine (PI) in goat. Seven surgical fields were prepared for evaluating seven formulations of these antiseptics. The bacterial swabs collected at different stages of skin preparations were transferred in...

Zubair Aslam and Ali Ahmad* 

...ize hybrid P30B74. The plants were harvested 45 days after sowing and the evaluation was done on the basis of various morphological (root length, shoot length, root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaf, leaf length, stem girth) and physiological parameters (relative water contents (RWC), chlorophyll contents and membrane stability index (MSI)). The obtained results indicated that vermi-fertilizers and chemical fer...

Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1* 

...th species of small ruminants showed significant weight gain and different feeding behavior of the consumption of various summer fodders. 

...

Hafiz Abdul Ghafoor1*, Muhammad Afzal1, Muhammad Luqman2, Muhammad Arshad Javed2, Syed Wasim Hasan3 and Muhammad Zeeshan Majeed

...as compared to control plants. Results of 2nd experiment also clearly demonstrated a significant impact of different treatments on the mealybug infestation (F12, 103 = 58.75, P < 0.001; HSD at α = 0.05) as compared to control. At both 3 and 7 days post-treatment, maximum reduction of mealybug infestation was recorded in plots treated with spirotetramat (87.75±3.91%) and lambda-cyhalothrin (85.52±4.42%) in combination with EPF followed by...

Jawad Ali Jan1, Ghulam Nabi1, Maqsood Khan1,2*, Shehzad Ahmad1, Peer Sikandar Shah1, Saddam Hussain1 and Sehrish

...re applied to the crop plants in different farms to improve its production and nutritional value. This experiment was conducted at Agriculture Research Institute (ARI) Tarnab, Peshawar during summer 2016. Two factors i.e. Chilli varieties (Magma and High fly) and humic acid levels (0, 25, 50, 75 and 100 g L-1) were applied in the field during experiment. The results of the experiment showed that High fly variety took minimum days to produce flowering (33 days)...

Khalid Khan1, Marguerite Wotto2, Saima Liaqat3, Gulawar Khan1, Balach Rasheed1, Sara Rafiq4 and Guo Xiangyu5* 

...district and its determinants. A well-structured questionnaire was used to collect data from one hundred tomato growers. Multi-stage random sampling technique was used for selection of the farmers. The Cobb-Douglas production function was used to estimate the technical efficiency and performance of the farmers. The study results disclosed that all explanatory variables have a positive impact on the farmers’ technical efficiency apart from pesticides. Add...

M. Hammouchi1*, G. Sebbar1, N. Touil2, C. Loutfi1, Y.S. Malik3, M. El-Harrak1 and O. Fassi-Fehri4 

...;">Peste des Petits Ruminants virus (PPRV) has caused a serious outbreak of disease in small ruminants recently in 2008 in Morocco. The field data obtained during the outbreak indicated that there were marked differences in breed susceptibilities to PPRV infection. In the field exotic breeds of Alpine goats were observed to be highly susceptible to the disease, with mortality rates approaching 100%, contrary to local breeds ...

 Salman Khan, Irfan Ullah*, Shahid Ali and Murtaza

...d analyzed major determinants of potato yield in district Swat of Khyber Pakhtunkhwa, Pakistan. A three-stage random sampling technique was used to collect data from 100 respondents during 2018. A Cobb-Douglas type production function was used to approximate effect of determinants on potato yield. Major shares of the input cost per acre incurred in the study area were seed (Rs. 18720), followed by land rent (Rs.15890) and la...

Javed Iqbal1, Ali Zohaib1*, Muzzammil Hussain1, Adnan Bashir1, Muhammad Hamza2, Wardah Muzaffer3, Muhammad Tahir Latif1 and Naeem Faisal1 

...mproved the emergence (plants per m2), number of productive tillers per m2 and grain yield (3-7%) of all wheat varieties although productive tillers per plant, number of grains per spike and 1000-grain weight was decreased. Faislabad-08 performed better regarding grain yield and related components among all varieties. Seed rate and varieties did not interact significantly for studied traits. Correlation analysis revealed that grain yield was positively correla...

A. S. M. El-Nuby1† , S. A. Montasser2 and I. A. El-Khadrawy

Control of root-knot nematodes using wild plants colonized Sinai, Egypt
...N). The selected seven plants viz., Artemisia judaica, A. monosperma, Bassia muricata, Cornulaca monacantha, Salsola kali and Zygophyllum album with different dilutions (25%, 50%, 75% &100%). The potent nematicidal efficacy observed in the extract of A. judaica followed by A. monosperma. In vivo trial post inoculation treatments were effective than pre one, the maximum reduction in nematode population was recorded by A. judaica (87.0%) followed by A. monos...

 M. M. A Youssef and W. M. A. El-Nagdi †

Effect of some temperature changes on the population density of some plant parasitic nematode species
...parasitic nematodes on plants viz., date palm and olive in both soil and roots was investigated. These nematodes were negatively correlated with the prevailing average soil temperature during four seasons (autumn= 20°C; spring= 22°C; summer= 27°C and winter= 14°C).

...

 Tajwali Khan1*, Ihtzaz Qamar1, Feroz Shah2, Kareem Akhtar2, Rehman Akhtar3

MODEL FOR FUEL DROPLET EVAPORATION IN COMBUSTION CHAMBER OF LIQUID PROPELLANT ROCKET ENGINES
...burning of liquid propellants droplets is very important to avoid combustion instability and to get higher
specific impulse from liquid rocket engines. Combustion takes place in gaseous phase and reaction is fast. So, the
time consumed by a droplet for complete burning is the time taken by a droplet to get evaporated. An analytical
mono component fuel droplet evaporation model is developed and proposed for droplet evaporation in liquid roc...

Rashid Nawaz*1, Iftikhar Hussain1, Sikandar Bilal Khattak1 

KEY PERFORMANCE INDICATORS IDENTIFICATION AND PRIORITIZATION FOR ENVIRONMENTAL SUSTAINABILITY IN THE CEMENT MANUFACTURING INDUSTRY IN PAKISTAN USING ANALYTICAL HIERARCHY PROCESS
...nting
24 cement plants were analyzed using Analytical Hierarchy Process (AHP). The proposed KPIs are supposed to
assist the decision makers in achieving environmental sustainability. Among the 11 KPIs identified, the KPI “Total
amount of Emissions in Metric tons of CO2 equivalent per year” was identified as having the highest impact on
environmental sustainability.

...

Shafiullah1*, Mohammad Nafees2 

MUNICIPAL WASTEWATER TREATMENT BY COAGULATION/ FLOCCULATION PROCESSES VIA OPTIMIZATION OF INOCULATION DOSE AND SETTLING TIME
...ective removals of pollutants were obtained by using ferric chloride and calcium
hydroxide in ratio of 2:0.5 mL for settling time of 13 minutes. As treatment results, not only removed suspended
solids (86%) but a tremendous decrease was observed in color, chemical oxygen demand (COD) and turbidity by
96%, 66% and 89%, respectively.

...

Razaullah1*, Iftikhar Hussain1 

A TWO-WAREHOUSE SUPPLY CHAIN NETWORK DESIGN AND OPTIMIZATION WITH CROSS-ROUTE COSTS AND BUDGET, MAXIMUM FLOW AND CAPACITY CONSTRAINTS
...uction capacity of the plants, stocking capacity of owned and rented
warehouses and traffic factors on the supply routes in the mathematical model further broadened the problem. A case
study is solved to analyze how the model performs with the changing network characteristics. 

...

Nazish Huma Khan1, Mohammad Nafees1, Adila Bashir1, Farooq Ahmad1 

STUDY OF POLLUTION LAOD IN PAPER MILL EFFLUENTS AND ITS RECYCLING BY SUNDRY PLANTS AT HAYATABAD INDUSTRIAL ESTATE, PESHAWAR
...ia recycling of sundry plants. For this
purpose a detail study was conducted at paper mills and sundry plants at Hayatabad Industrial Estate. The plants
were examined for operation and sampled for waste water. Total 7 waste water samples were collected from selected
points of Paper mills, Industrial drain and Sundry plants. Samples w...

Asif Nawaz1*, Muhammad Zafarullah Khan1, Rehmat Ullah1, Arshad Farooq2 and Abdul Hassan2

Assessment of Weed Management Competency of Field Assistants in Khyber Pakhtunkhwa, Pakistan
...cial for the Field Assistants to be competent in providing extension services to the farming community regarding weeds management. Thus, this study was conducted to assess the weeds management competency level of Field Assistants of Khyber Pakhtunkhwa Agriculture Extension Department. Data from 234 randomly selected Field Assistants were collected through pre-tested and validated interview...
Kemi F. Omotesho*, Adedamola V. Adetayo, Adeniyi F. Akinrinde and Deborah A. Olabode
 
Challenges to the Adoption of Agricultural Innovations: The Case of Yam Minisett Technology in Kwara State, Nigeria
... in its use. The determinants of farmers’ adoption were also investigated. A four-stage sampling procedure was used to select 205 respondents on whom an interview schedule was administered. Descriptive statistics, Probit Regression Analysis and Pearson’s Product Moment Correlation, were used to analyse data. Result reveals that the farmers were mostly males (71.2%), middle-aged (50.7years,) with an average of 28 years of farming experience. Only 58...

Inamullah Khan1*, Amjad Usman2  and Rahamdad Khan2

The Mortality Rate of Pupae and Adult of Fruit Fly Bactrocera cucurbitae Coquillett (Diptera: Tephritidae) Affected by Different Submerging Time and Soil Types under the Laboratory Treatment
...tion of fruit fly host plants standing in clay loam or silt clay loam soil texture may help in controlling the overwintering pupae in the orchards.

...

Sajjad Haydar*, Zunaira Asif*, A. A. Bhatti**, Obaidullah Nadeem***, Ghulam Hussain*, Nadeem Abbas*

EFFICIENCY OF WASTEWATER TREATMENT PLANT IN THE PUNJAB TANNERY SECTOR: A CASE STUDY OF DADA TANNERY
...v>wastewater treatment plants to address the issue. This study aims to evaluate the performance of wastewater
treatment plant (WWTP) of a local tanning industry. Raw wastewater showed high concentration of organic matter
and Chromium. Phosphorous concentration was found deficient for satisfactory biological treatment. WWTP showed
overall removal efficiency of 88.81, 84.54 and 62.31% for total suspended solids (TSS), five day...

Shahida Nasreen Zakir*, Samina Siddiqui**, Nasreen Ghaffar*

MAJOR ELEMENTS CONCENTRATIONS IN CALCAREOUS SOILS
...ence is unavailable to plants. Calcareous soil has more than 15% of CaCO3 at pH ranged from 7.5 to 8.4. Iron was also found to be low in calcareous soils. Such soils are required an improved nutrient management in such a manner that soil contact of P, K and Fe can be minimized.
...
Naeem Ejaz*, Daulat Khan**, Usman Ali Naeem*, Muhammad Ali Shamim*, Muhammad Fiaz Tahir*, Faisal Shabbir*, Jawad Hussain*
DETERIORATION OF ORDINARY PORTLAND CEMENT AND FLY-ASH BASED GEO-POLYMER CONCRETES DUE TO SULFATE ATTACK UNDER THE ACTION OF SULFURIC ACID AND WASTEWATER
...d wastewater treatment plants has been a major problem but this issue has not been resolved satisfactorily yet. Generally, deterioration happens due to sulfuric acid reaction with treatment units and sewer materials. Geo-polymer binders especially fly ash (FA) is an acid resistant and can be used as a substitute binder for sewer construction. This research work highlights the laboratory results of fly ash based geo-polymer concrete and effe...

Asif Nawaz*, Muhammad Zafarullah Khan, Rehmat Ullah, Khalid Nawab and Urooba Pervaiz

Investigation of Professional Competency Level and Training Needs of Field Assistants in Khyber Pakhtunkhwa
...ing needs of Field Assistants of Agriculture Extension Department Khyber Pakhtunkhwa. A sample of 234 respondents was selected and personally interviewed through pre-tested and validated interview schedule. Paired sample t-test and dummy variable regression model were used to achieve study objectives. It was found that Field Assistants were highly competent in conducting farm/home visits followed by conducting meetings and o...

Shahid Ali1, Habib Akbar2, Shamsher Ali3*, Adnan Nasim1, Muhammad Ismail1, Nur Ul Haq1 and Muhammad Usman4

Effect of Planting Sources, Cane Portions and Setts Placement Methods on Sugarcane Yield Attributing Traits
...lso found that tallest plants with maximum biological yield were recorded in canes top portion with triple setts placement methods. Minimum results were observed for all the traits when bottom portion from trenched planting source was planted at single setts. Study suggests that planting fresh cane top portions with double and triple setts placement methods are better than trenched planting for cane yield and yield attributing traits.

...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...bicola infected potato plants were necrotic stem lesions near the collar region. Causal organism was isolated from the infected tissues, purified and identified on the basis of morphological characters, nucleotide sequences of internal transcribed spacer region (ITS) and partial beta tubulin gene. Phylogenetic analysis was also conducted to determine the phylogenetic relationship of this species with other reported species of this genus. Pathogenic potential o...

Saba Iqbal1*, Muhammad Luqman1, Hafiz Muhammad Nasrullah1, Asmat Ullah1 and Hafiz Muhammad Akram2

Response of Cotton to Application of Organic and Inorganic Source of Nutrients in Semi-Arid Climate
...ent resulted in taller plants (121 cm), more number of sympodial branches (19.9), more number of bolls per plant (26), higher boll weight (3.6 g), higher seed cotton yield (1792 kg ha-1) and benefit cost ratio (BCR) (1.8:1) followed by the treatment where 30 kg urea ha-1 was applied in combination with 8 t ha-1 slurry. In conclusion, combined application of urea and FYM @ 30 kg ha-1 and 8 t ha-1, respectively could be the economical approach to attain the high...

 Amir Naveed1, Unsia Habib1, Fouzia Parveen2, Syed Naveed Ul Hasan1, Muddasar Habib1, Irfan Shah1

AN INVESTIGATION OF HEAVY AND TRACE ELEMENTS IN COAL DEPOSITS OF MAKARWAL PAKISTAN AND THEIR POSSIBLE IMPACTS ON SURROUNDING WATER-CASE STUDY
...d with heavy metal pollutants.

...

Zeeshan Ahmad Bhutta1,2*, Muhammad Fakhar-e-Alam Kulyar3*, Muhammad Shoaib4, Wangyuan Yao3, Muhammad Asif5, Shah Nawaz6, Moazam Ali7 and Ayesha Kanwal8

Exploratory Study on the Psychological Impact of COVD-19 on Students
.... Recruitment of participants was done from different universities of Pakistan. The results showed that the students are more concerned about their family members (p=0.00). Under this influence they have increased the frequency of handwashing and use masks when they have to go outside. More than half of the students (53.09%) were afraid of the COVID-19 and similar pattern was noted about depression (54.86%). About 57.5% students were willing to take part in on...

Sikander Hiyat1, Nazim Hussain1, Muhammad Ishaq Asif Rehmani2*, Muhammad Nasir Abbas2, Smana Raza3, Javed Shabbir Dar4 and Tauqeer Ahmad Yasir5 

..., widely spaced cotton plants (RS3, 75 cm) without application of mepiquat chloride produced maximum seed cotton yield as compared to all other spacing levels. Ultra-narrow row spacing (RS1, 25 cm) Combination of narrow row spacing (RS2, 50 cm) and mepiquat chloride application slightly higher seed cotton yield. Ultra-narrow row spacing must carefully use to exploit in the cotton production system was appeared to be a viable alternative approach for successful...

Muhammad Mazhar Iqbal1*, Ijaz Ahmad2, Shahzad Maqsood Ahmed Basra3, Abu Baker Ijaz4, Zahid Hassan Tarar5, Muhammad Ansar6, Umer Iqbal7, Tayyaba Naz4, Bilquees Fatima8, Muhammad Akram9, Allah Wasaya10, Asif Iqbal11, Shakeel Ahmed Anwar12, Khalid Saif Ullah Khan13, Azeem Khalid14, Asif Aziz15 and Rashid Mehmood16 

... index (MSI) and antioxidants activities in heat stress. Moreover, foliar application of chemicals during normal and late planting improved the grain yield by increasing both the grain number and size. Foliar spray of SA, AsA and H2O2 may induce heat tolerance by improving antioxidant activities which stabilized membrane and maintaining relative water, chlorophyll and nutrient content in ear leaves of maize during heat stress. 

...

Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu

...t stress analysis. All plants were grown in pots under greenhouse conditions, and were subjected to 20-day drought stress by withholding irrigation, followed by re-watering for 5 days. The changes in leaf water content (LWC), electrolyte leakage (EL), concentrations of photosynthetic pigments, protein, soluble sugar, hydrogen peroxide (H2O2), malondialdehyde (MDA), ascorbate (AsA) and reduced glutathione (GSH), activities of superoxide dismutase (SOD) and pero...

Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood

...lyphenolics and biostimulants are used across the globe for enhancing productive and qualitative tarits of horticultural plants. A field trial was carried out in 2018-19 aiming at the evaluation of impacts of new commercial products “Quantis” and “Acevit-C” on growth, yield and antioxidative behaviour of bottle gourd cv. Aakash F1. Three level of Quantis (6 ml, 8 ml, 10 ml) and Acevit-C (100 ppm, 150 ...
Muhammad Khan1, Tehmina Ameer Khan1, Aziz Ud Din2, Muhammad Fiaz Khan1, Irfan Ullah3,*, Kalim Ullah4, Sadia Tabassum1,*
Kui Li1, Lijun Li1, Jialun Fu2, Yi He2, Zhaohui Song2, Shuiping Zhou2Luobu Gesang1* and Rui Liu2*
...lthy low-altitude inhabitants residing in Beijing were randomized to two treatment sequences, receiving either 270mg CDDPs or placebo during an 11-day trip in Tibet, China, at an altitude of more than 3000 m. The Lake Louise Scoring System (LLSS) was also utilized to access AMS incidence and severity, twice a day, during the research period. AMS was further diagnosed when headaches and LLSS≥ 3 were present. A total of 54 subjects completed the study and no ...

Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1

Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...e uses of these native plants were recorded such type of study was concluded for the first time in the selected area of Dir (Upper). In view of the fact that these plant species are scarcely distributed, hence struggle should be made to protect them. The key objective of the present study was to file the taxonomic knowledge and the local and medicinal uses of the root juice of Desmodium elegans DC, combined with the bark juice of Bauhinia malabarica for the tr...
Muhammad Rizwan1*, Bilal Atta1, Ana Maria Marino de Remes Lenicov2, Roxana Mariani2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Misbah Rizwan4, Muhammad Sabar1, Ch. Muhammad Rafique1, Muhammad Afzal5
...hoppers and their host plants were studied in the “Kallar” tract of the Punjab, Pakistan (an important growing area of the world for producing Basmati rice). Planthoppers are considered the most important pests of rice. Delphacidae and Cixiidae are families of planthoppers with the most harmful species. Delphacids are primarily vector of the viruses, whereas Cixiids are vectors of phytoplasmas, mycoplasmas and prokaryotes-like associated to th...
Shagufta Parveen1*, Kousar Perveen1, Muhammad Afzal1, Syed Amir Gilani2, Muhammad Musadaq3
...on of malnutrition in infants with the age at which weaning was started. This is an observational, cross-sectional study which was conducted in the Pediatric Medicine Department of DHQ Hospital, Chakwal, Pakistan from January 2020 to February 2020. All infants that presented to the hospital from January 2020 to March 2020 were included in the study after obtaining informed consent from their accompanying parent or guardian. ...

Muhammad Ismail1, Tufail Ahmad2, Shamsher Ali2*, Shahid Ali1, Nur Ul Haq1 and Naveedullah3

Heavy Metals (Pb and Ni) Pollution as Affected by the Brick Kilns Emissions
...al content of soil and plants around the brick kiln chimneys was studied in 2009-2010. The research was carried out on Peshawar Ring Road’s south direction between chimneys of bricks preparation that were named A and B with distance of 300 m. The kilns were positioned such that Southern direction of chimney of A was north for the chimney B. A total of 36 (18+18) soil and wheat leaf samples were collected in four directions. Samples were collected at vary...
Zubair Ahmad1, 2, 4, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Farhat Khan4 and Shujauddin5
...alistic relation between ants and aphids is considered as one of the best examples of inter-specific mutualism between species that produces net benefits for the participants. In this paper, the interaction between aphid M. sacchari and their attending ants on sugarcane (Saccharum officinerum) was studied. The presence of ants, especially, ...

Muhammad Ahsan Naseer1, Mehdi Maqbool1, Saima Rafiq2*, Noosheen Zahid1, Abdul Hamid1 and Syed Zulfiqar Ali Shah1

Comparative Analysis of Physical and Biochemical Attributes of Edible Fig (Ficus carica L.) Collected from Three Districts of Azad Jammu and Kashmir Located at Different Elevations
...ics (5.93 %) and antioxidants (17.33 %) were found in figs harvested from Khoiratta locality of District Kotli. Based on the results obtained during study, it is suggested that District Bagh is more suitable for growing fig as compared to other two locations of Azad Jammu and Kashmir. However, detailed studies are needed to establish its supply chain system and storage conditions for its marketing at national and international level.
...
Safina Naz1, Syed Atif Hasan Naqvi2*, Bushra Siddique3, Muhammad Asif Zulfiqar4 and Abdur Rehman5 
 
Exogenous Application of Selected Antioxidants and Phyto Development Directors Influenced the Development, Output and Biochemical Attributes of Tomato (Lycopersicum esculentum Mill.)
...yacetic acid and antioxidants i.e. Ascorbic acid and 2-hydroxybenzoic acid on development, fruit bearing, output along with biochemical attributes of Lycopersicum esculentum fruits during 2014 and 2015. Foliar spray of GA3(100 ppm) and 2-hydroxybenzoic acid (200 parts/million and 100 parts/million) give rise to significantly taller plants and greater leaf area while, shorter plants and low...
Murtaza, Shahid Ali*, Syed Attaullah Shah, Mehran Ahmad, Irfan Ullah and Jahangir Khan
Adoption of Hybrid Maize Technology in District Mardan of Khyber Pakhtunkhwa, Pakistan
...ion of the major determinants of adoption of hybrid maize technology in district Mardan of Khyber Pakhtunkhwa, Pakistan. A sample of 255 respondents in the study area was randomly chosen using a multistage random sampling technique. The logit model was used to measure the probability of adoption of hybrid maize technology. The estimated results of the model revealed that younger farmers were comparatively more adoptive of the hybrid maize technology. Education...
Arif Alam1*, Faridullah2, Ikram Shah1, Shahzad Khan3, Noor Elahi1 and Ehsan Inamullah1
Estimation of Farm Level Technical Efficiency in Maize Production at the High Mountain North Region of Pakistan
... yields of different peasants were due to inefficiency. The overall average technical efficiency of maize farmers was estimated 73.6%. It was inferred that the productivity can be enhanced by reducing the inefficiency from the ecological factors, peasants’ personal characteristics and farming conditions.

...
Tabassum Yaseen1*, Shehzad Ahmad1, Khushnood Ur Rehman2, Fayaz Asad1, Abdul Waheed1, Rani Gul3, Hussain Gulab4 and Naveed Akhtar2
Arbuscular Mycorrhizal Fungal Spore Density and Root Colonization in Weeds of Carrot field at Charsadda, Pakistan
...otic associations with plants through roots. It forms the multi colonization systems with the roots and provide benefits to the host plants. The present study was conducted to evaluate the occurrence and distributions of Arbuscular mycorrhizal fungi in the rhizospheric soil of major weeds of District Charsadda. In the present study roots and rhizospheric soil of 15 weeds species belonging to 12 families were collected from C...

Muhammad Arsaln1, Sair Sarwar2*, Rizwan Latif1, Junaid Nawaz Chauhdary3, Munazza Yousra2 and Shahbaz Ahmad2

Effect of Vermicompost and Microbial Inoculants on Yield, Soil Fertility and Economics of Wheat under Rainfed Conditions
...ents and microbial inoculants not only maximize the crop production and economic returns but also improve the soil health. A two years field study was conducted in the farm of Barani Agricultural Research Institute, Chakwal (32o55’33”N, 72 o43’30”E) to evaluate the integrated impact of vermicompost (VC) and microbial inoculants on wheat yield and economics. Eight treatments i.e., control; recommended ...

Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi3

GIS Applications in Surveying and Mapping of Rice Weeds in Guilan Province, Iran
...t species with 9 and 8 plants/m2, respectively. Echinochloa crussgalli and C. difformis with a density of 5 plants/m2. Weeds were non-uniformly distributed in various families including Cyperaceae, Poaceae, Lythraceae, Polygonaceae, Asteraceae, and Salviniaceae that accounted for 36 species (54.5 percent). Accurate and specific weed maps are the key to achieving all the benefits of weed management. When in an area the distri...

Joseph Anejo-Okopi1*, Obinna Oragwa Arthur2, Ocheme Julius Okojokwu1, Sarah Joseph1, Geoffrey Chibueze1, Joshua Adetunji1, Joseph Ameh Okwori3, David Ochola Amanyi4, Otobo I. Ujah5 and Onyemocho Audu6

Seroprevalence of Rift Valley Fever Virus Infection among Slaughtered Ruminants in Jos, North-Central, Nigeria
...RVFV in slaughtered ruminants in Jos, North-Central, Nigeria. Blood samples were collected from 100 livestock (cattle and goats) at selected slaughter locations in Jos Metropolis. Questionnaires were administered to obtain information on animal species, sex, and localities of origin. The blood samples were screened for RVFV antibodies using competitive Enzyme Linked-immunosorbent Assays (C-ELISA) to detect anti-RVFV IgG/IgM. Eleven out of 100 samples tested po...

Shahid Nadeem1*, Taj Naseeb Khan1, Mushtaq Ahmad1, Adnan Younis2 and Iram Fatima3

Influence of Plant Growth Regulators by Foliar Application on Vegetative and Floral physiognomies of Gladiolus
...ition among ornamental plants due to its captivating spikes, with plane ruffle and deeply crinkled sepals, and it mainly used as cut flower and greatly demanded in floral markets. In order to achieve the maximum outcomes for the purchaser or community, a comprehensive study was conducted on gladiolus to enhance its vegetative and floral characteristics with the foliar application of growth hormones i.e. gibberellic acid (GA3) and salicylic acid (SA). The resul...

Yasir Arafat1*, Syeda Nabahat2, Hafiz Ullah3, Afaq Ali Muluk4 and Azra5

An Analysis of Energy Supply and Oil Price Shocks on Agricultural Productivity of Pakistan
...ry variables and determinants of agricultural productivity in Pakistan. The study uses Autoregressive Distribution Lag model (ARDL) to measure the correlation between dependent and independent variables. In order to know the stationarity of variables, unit root test is used by employing Augmented Dickey Fuller (ADF) test. It is found that energy supply and foreign direct investment affect agricultural productivity positively and significantly while oil prices ...

Tahseen Ullah* and Noor ul Amin

In Vitro Antibacterial Activity of Medicinal Plant Extracts
...ties of four medicinal plants, Silybum marianum, Berberus lycium, Peganum harmala and Curcuma longa and standard antibiotic tetracycline was carried out in the biosafety level 3 Microbiology Lab, Faculty of Life Sciences, University of Bradford, Bradford, UK. Two different concentrations (low, 5 mg/ml and high extracts, 300 mg/ml) of these plants were evaluate against two different bacterial strains i.e. Bacillus subtilis an...

Shahzad Khan*, Munir Khan, Inayatullah Jan, Mahfooz Khan and Fida Muhammad Khan

Determinants of Sugarcane Yield in District Charsadda, Pakistan
...d to investigate determinants of sugarcane crop in district Charsadda in the year 2018. Three villages viz. Kamran Kalay, Aspandehri, and Sarfaraz Kalay were selected purposively. Primary data were collected with face to face interview method from 41 randomly selected sugarcane growers through structured questionnaire. The selection of farmers was based on proportional allocation technique in the selected villages. For data analysis, profit margin, gross margi...

Shaiza Rasool1, Iftikhar Ahmad1*, Khurram Ziaf1, Irfan Afzal2, Muhammad A.S. Khan1, Muhammad Aashir Sajjad1 and Muhammad Zain Ali1

Seed Conditioning Effects on Germination Performance, Seedling Vigor and Flower Production of Zinnia elegans
...) produced the tallest plants (104 cm) with longer internodes and the largest canopy diameter (42.4 cm). Using MLE along with MTW produced greater plant fresh weight (137 g), more flowers (27.5), and larger flower diameter (9.7 cm) similar to the results of using MTW alone. In summary, seeds primed with MLE in combination with untreated water or MTW resulted in improved plant growth and yield characteristics and may be recommended to commercial growers of zinn...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...es. Tallest (43.08 cm) plants, maximum number of leaves plant-1 (22.17), florets spike-1 (22.79) and number of bulblets produced plant-1 (22.03) were found in soil amended with humic acid. However, the least days (85.22) to flowering were observed in planting medium amended with potting soil and largest bulblets (2.14cm) were found in compost amended sandy soil. As far as the effect of bulb size is concerned, maximum days to flowering (97.44), plant height (43...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...es. Tallest (43.08 cm) plants, maximum number of leaves plant-1 (22.17), florets spike-1 (22.79) and number of bulblets produced plant-1 (22.03) were found in soil amended with humic acid. However, the least days (85.22) to flowering were observed in planting medium amended with potting soil and largest bulblets (2.14cm) were found in compost amended sandy soil. As far as the effect of bulb size is concerned, maximum days to flowering (97.44), plant height (43...

Moazam Ali1, Wajid Ali2, Ayhan Ceyhan2 and Zeeshan Ahmad Bhutta3*

Pigmentation Genome Influence in Animals and Human Interventions in its Course of Action
...ogs, cats, pigs) new variants of coat pigmentation are achieved by generating mutation in MC1R and ASIP allele. A row of scientists is working on genome sequences and mutations for getting a better and healthier pigmentation besides animal welfare. This review article contains a complete elaboration about the worth of pigmentation in animals, natural pigmentation process and new mutation and deviation in animal genome related to their pigmentation for human an...

Nadeem Abbas Shah1*, Ejaz Ashraf1, Hafiz Khurram Shurjeel2, Zaheer ud Din Mirani3, Usman Rafique1 and Raees Abbas Shah4

Assessing Perceptions of the Households-heads Regarding Food Security Status in Drought-hit Areas of District Tharparkar, Sindh, Pakistan: A Case Study for Agricultural Extension
...vements among the inhabitants of Tharparkar to revitalize the status of food security in the study area.

...
Sri Nuryani Hidayah Utami*, Andin Muhammad Abduh, Eko Hanudin and Benito Heru Purwanto
Study on the NPK Uptake and Growth of Rice under Two different Cropping Systems with different Doses of Organic Fertilizer in the Imogiri Subdistrict, Yogyakarta Province, Indonesia
...-align: justify;">Rice plants are commonly cultivated in a grid system with a plant spacing of 25 cm x 25 cm. The modification of spacing to increase nutrient uptake by providing plant free area (PFA) for better air circulation and sunlight distribution needs to be further studied. This study examined the differences in NPK uptake and rice growth in organic farming using the grid system and the cropping system with longitudinal rows given space in between. The...

Khan Sher1*, Muhammad Subhan1, Muhammad Nisar2, Ali Hazrat2, Zahid Fazal1, Gul Rahim2, Imran Ahmad1, Riaz ul Haq1 and Shamia Bibi1

Genetic Diversity in Common Beans (Phaseolus vulgarus L.) Collected from Different Ecological Zones of Malakand Division (A Part of the Sino Japanese Region of Pakistan)
...total of 70% genetic variants. Finally, it was found that a high degree of variance was identified in all germplasm collected from Malakand sections with some additional unique characteristics, such as early cooking, high productivity and protein significance as compared to other parts of the world, which could be utilized for evolving better quality and high yielding cultivars of P. vulgarus.

...

Malik Abdul Rehman1, Shafqat Ali1, Muhammad Babar Shahzad Afzal1, Muhammad Nawaz Khan1 and Mujahid Ali2*

Efficacy of Chemicals and Botanical Extracts to Control Citrus Canker on Kinnow in Sargodha Region
...earing trees of Kinnow plants. There were nine treatments, control (no chemical was applied), Neemsol @ 5 ml, copper oxychloride @ 3 g, streptomycin sulphate @ 1 g, potassium acetyl benzoic acid @ 10 ml, difenoconazole @ 0.5 ml, extracts of Acacia nilotica @ 10 ml, Datura alba @ 10 ml, and Allium cepa @ 10 ml. These treatments were used by mixing in 10-liter water. The foliar spray was applied four times a year, i.e. March-April and August-September. The resul...

Muhammad Imran1,2*, Shahbaz Talib Sahi1, Muhammad Atiq1 and Amer Rasul3

Brown Leaf Spot: An Exacerbated Embryonic Disease of Rice: A Review
... the defense system of plants and reduces the disease. The plants which are scarce nutrients are more prone to disease as compared to nutrient deficient. The pathogen damage is compensating by a specific nutrient that reduces the disease through tolerance. Good management practices are those which include all possible combinations of cultural, biological, chemical, induce resistance, nutrient management, natural byproducts, ...

Joseph Anejo-Okopi1*, Dorcas Yilger Gotom1, Noble Allison Chiehiura1, Julius Ocheme Okojokwu1, David Ochola Amanyi2, John Otumala Egbere1, Joshua Adetunji1, Otobo Innocent Ujah3 and Onyemocho Audu4

The Seroprevalence of Zika Virus Infection among HIV Positive and HIV Negative Pregnant Women in Jos, Nigeria
...the HIV positive participants, p=0.013. No association with educational level, employment, marital and resident, gestational trimester, fever, yellow fever vaccination, rashes and parity was found for anti-ZIKV IgG positivity in the groups. Our results showed high seroprevalence among the pregnant women, an indication that the ZIKV antigen that triggered the antibodies response is in circulation, therefore, suggest the need for ZIKV surveillance and larger stu...
Abida Parveen1, Sajid Aleem Khan1, Nazir Javed1, Anam Moosa1*, Khushboo Javaid1, Hina Safdar1 and Asma Safdar2
...nificantly enhanced in plants treated with MO extracts, SK and their combinations compared to MI treated control plants. The total number of infective juveniles/g root and soil, galls, egg masses, females were highest in MI treated plants while lowest in plants treated with a combination of MI + SK + aqueous MO + ethanolic MO after 60 days of inoculation...

Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4

Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...ment host and non-host plants in cultivated fields of Bagh district, Azad Jammu and Kashmir. Total of 111 vegetable fields from 82 locations of study areas was surveyed during summer 2013, 2014, 2016 and 2017. Okra, Eggplant, tomato, cucumber, chilies, beans and cucurbits were found most frequently cultivated vegetables in the area. RKN was found on 80 fields, with 68 out of 82 surveyed locations with 72% field incidence. Okra was found with highest field infe...
Ammara Gull-E-Fareen1, 3, Imran Bodlah1*, Muhammad Tariq Rasheed1, Yasir Niaz2, Muhammad Adnan Bodlah2, Muhammad Asif4 and Nasir M. Khokhar5
...tic relationship between ants and aphids is a very common and widespread phenomenon. It has been studied in various parts of the world. In this relationship, aphids provide food to the ants, while in return ants provide them protection from natural enemies. Ants also protect aphids from different diseases. Aphids (serious crop pests) can be divided into ...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
...ration of antagonistic plants with the antagonistic fungi may be useful for the better control of plant parasitic nematodes.
...
Hassam Ud Din1*, Huma Rizwana1, Rameez Raja Kaleri2, Kaleem Ullah2 and Muhammad Din2
Evaluation of Production Performance and Marketing of Small Ruminants in District Dukki, Balochistan
... marketing of small ruminants during the year 2018. The information on various aspects was collected from the small ruminants farmers of five union councils i.e. Vialla Dukki, Thal, Nana Sahib, Sadar and Nasar Abad of district Dukki of Balochistan. The sample size was composed by producer (50), wholesalers (50) and retailer (50) for convenient sampling contribution of each selected producer involved in the business area. The...
Amir Aziz1*, Mukkram Ali Tahir1, Noor-us-Sabah1, Ghulam Sarwar1 and Sher Muhammad2
Effect of Rice and Wheat Straw and K-Silicate Application on Maize Growth
...tant for the growth of plants particularly under stress. Silicon is considered as quasiessential element for plant growth. The benefits of silicate fertilization are often correlated with the amount of silicon uptake by plants. In order to evaluate the growth and yield behavior of maize crop in response to different source of Si (straw and potassium silicate), a pot experiment was conducted at College of Agriculture, Univers...
Zulekha Zameer, Samreen Mohsin, Ammarah Hasnain, Asma Maqbool* and Kauser Abdulla Malik
Influence of Explant Sources on in vitro Callogenesis and Regeneration in Maize (Zea mays L.)
...fficiency of various explants sources for maize tissue culture, especially the immature embryos. However, the manipulation of immature embryos as explants is hampered due to its unavailability throughout the year and low regeneration response. The present study is aimed to investigate the effect of various explants sources for callogenesis and regeneration in maize (Pioner 3025). The main ...

Malik Abdul Rehman1*, Hafiz Muhammad Ehsan2, Tehseen Ashraf2, Zulfiqar Ali Gurmani3, Sajjad Khan3 and Mujahid Ali2

Effect of Growing Media on Plant Growth of Rough Lemon (Citrus jambhiri Lush.) and Poncirus (Citrus trifoliata)
...cirus rootstocks. Five plants per treatment were growing in black polythene bags filled with the required media using a Completely Randomized Design with three replications. Data of stem length stem diameter, number of leaves, leaf area, and survival percentage was recorded. Chemical analysis of leaf was done by taking samples from treatments were analyzed for determination of N, P, K. Results indicated that stem length, stem diameter, number of leaves, leaf a...

Muhammad Yaseen1*, Muhammad Luqman1*, Zahoor Hussain2, Usman Saleem3, Asif Nawaz1, Tahir Munir Butt4 and Muhammad Umer Mehmood1

Assessment of Knowledge Level and Information Sources of Vegetable Growers regarding Tunnel Farming in District Sargodha
...y and distance between plants and rows of plants were also answered quite satisfactorily. Farmers do not know how to overcome the increasing attack of insects, pests, and diseases in tunnel farming. Some areas were identified, which require the attention of responsible authorities for the relevant knowledge.

...
Taqiur Rahman1, Tabassum Yaseen1*, Ali Mujtaba Shah2, Samiullah3, Ghulam Jelani3, Gul Nawaz1,Qudratullah Kalwar2
... the leading medicinal plants used by local communities for the treatment of animals and document the threatened herbal knowledge from the elder formers (R1, R2 and R4) this study labels the ethno veterinary practices in different villages of District Shangla, where the documentation process is carried out through semi-structured questionnaires in 2017 (R1) where about seventy plant species belonging to different families of spermatophytes have been collected,...
Jian Yang1, Guangxiang Tong2, Zhipeng Sun2, Xianhu Zheng2, Weihua Lv2, Dingchen Cao2, Xiaowen Sun2 and Youyi Kuang2*
...pe (WT) siblings, the mutants showed no significant differences in the 5 gene expressions. Among different development stages, the expression levels and patterns of the 5 genes in the mutants were similar to that of WT zebrafish in both embryonic and post-embryonic development stages. Furthermore, the results of histological analyses of the muscle fiber showed that there were no significant differences in muscle fiber densit...

Turgay Şişman1,*, Muhammet Çağrı Keskin1, Hatice Dane1, Şeymanur Adil1, Fatime Geyikoğlu1, Suat Çolak2 and Esra Canpolat1

...highest effects of pollutants in frogs were at the agricultural sites in June.
...
Mushtaq Ahamd Khan1, Ziaul Islam2, *, Amin Ullah Jan3, Kamran Khan2 and Abdullah Shah3
...vere abnormalities in infants such as hydrocephalus and mental retardation. The present study was conducted to estimate seroprevalence and potential risk factors in acquiring T. gondii infection by child-bearing age women in Dir Khyber Pakhtunkhawa, Pakistan. A cross sectional study was conducted and data regarding risk factors were recorded through questionnaire. A total of 405 women of child bearing age were serologically tested for T. gondii a...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mudssar Ali and Hasan Riaz
... like branches of host plants. The male and female mean longevity was 6.0 ± 1.171 and 11.4 ± 1.70 days. Pale reddish brown lines were present on the dorsal side of female forewings. Female forewings were broader than male wings with dark reddish brown thorax, head and abdomen. Adult hind wings were grayish with reddish brown outer margins. The biological and morphological information of Trilocha varians described in current paper will lead...
Mehwish Saleem Khan
Evaluation of Changes in Zinc Levels in Patients Suffering from Cancer
... and environmental pollutants. In this study zinc level in serum of cancer patients was observed. For this purpose, the blood of 50 cancer patients was taken from MAYO HOSPITAL Lahore. The patients are suffering from different type of cancers such as, breast cancer, lung cancer, uterus cancer, oral cavity cancer, esophageal cancer, urinary bladder cancer, blood cancer and brain tumor. In addition to serum zinc level of cancer patients many other parameters wer...

Agustine Christela Melviana1, Rizkita Rachmi Esyanti1*, Roy Hendroko Setyobudi2, Maizirwan Mel3, Praptiningsih Gamawati Adinurani4 and Juris Burlakovs5

Gene Expression Related to Steviol Glycoside Synthesis Produced in Stevia rebaudiana (Bert.) Shoot Culture Induced with High Far-Red LED Light in TIS RITA® Bioreactor System
... propagation of Stevia plants using in vivo methods, an alternative technique of propagation using in vitro methods is needed. The micropropagation method with the RITA® (Recipient for Automated Temporary Immersion System) is used in the production of a large amount of stevia biomass in approximately a short period. The forming of flowers is one of the limiting factors interfering with the metabolite production, as the content of steviol glycoside will dec...
Mumtazur Rahman1, Farhan Anwar Khan1,*,Umar Sadique1, Ijaz Ahmad1, Shakoor Ahmad1, Faisal Ahmad1,2, Hayatullah Khan1,3, Muhammad Saeed1, Faiz Ur Rehman1, Ibrar Hussain1, M. Faraz Khan1, M. Izhar ul Haque1 and Hanif-ur-Rehman1,3

...ly disease of small ruminants, especially goats. It is an economically important disease, causing high morbidity and mortality in goats. More recently Mccp Pakistan strain has been identified and isolated by our laboratory. Alarmingly, antimicrobials in animals are inappropriately using and resultantly leading to antimicrobial resistance (AMR) including mycoplasmas, which are causing serious infections in ruminants. Since th...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...e resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transproteins toxic to different plant parasitic nematodes can be expressed into tissues and cells feed upon by nematodes. Transgenic products with...

Zubia Rahim1, Gulnaz Parveen1*, Salma Gul2 and Khushnood-ur-Rehman3

Ameliorating Effects of Salt Stress (KCl, NaCl) on Growth and Germination Parameters of Pearl Millet (Pennisetum americanum)
..."text-align: justify;">Plants facing many abiotic stresses in which salinity is considered as most pronounced factor to effect the plant growth. This research was performed to assess the effects of NaCl, KCl, a mixture of NaCl + KCl in various concentrations on the growth and germination of Pearl millet (Pennisetum americanum), locally named as Bajra. Five seeds sown in petri dishes to observe the radical, plumule length and germination percentage after treatm...
Arifa Khan1*, Arsalan Bashir1, Shazia Erum2, Jabar Zaman Khan Khatak1 and Aish Muhammad3
Effects of 6-Benzylaminopurine and Indole-3-acetic Acid on Growth and Root Development of Banana Explants in Micropropagation
... induction of banana explants micro-propagated in vitro. Explants were obtained from young suckers of 8818-william, Pisang and Brazilian varieties. The explants were cultured in vitro containing MS media and different BAP and IAA combinations. The results showed banana varieties exhibited differences for the shoot and root development and also for the number of shoots and leaves. Wiallium-...

Muhammad Abdullah1, Syed Attaullah Shah1, Khurram Nawaz Saddozai1, Jahangir Khan1*, Mohammad Fayaz1, Irfan Ullah1* and Sabeeh Ullah2

Analysis of Agricultural Land Price Determinants and Policy Implications for Controlling Residential and Commercial Encroachments: Facts from District Swabi (Pakistan)
...entify important determinants of their prices in Swabi district of Khyber Pakhtunkhwa. For this purpose, a sample of 79 land parcels, having transaction record for the year 2015-2017, was selected from 10 randomly chosen villages. Data were collected on their prices and their physical, agricultural and location characteristics. Descriptive statistical tools were used to summarize data on agricultural land characteristics. A linear Hedonic Pricing Model (HPM) w...

Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman

Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
...s in mills, processing plants and storage facilities where these products are stored. The residual efficacy of spinosad was assessed by exposing the Oryzeaphilus surinamensis, Tribolium castaneum and Trogoderma granarium to the treated commodities (wheat, maize, rice and oats) at concentrations of 0.25, 0.50 and 1 mg Kg-1 under laboratory conditions maintained at 28 ± 2oC, 65 ± 5% RH and continuous darkness. Seven bioassays were conducted by rele...
Yonghua Liu*, Xianhua Li, Xiongfei Yan and Gang Li
...e effect of the 4 host plants Armeniaca vulgaris (apricot), Malus pumila (apple), Prunus salicina (plum), and Amygdalus persica (peach) on the growth, development, survival, reproduction, and life table parameters of A. fimbriana were studied. Different host plants had significant effects on the growth, development, and reproduction of A. fimbriana. The overall developmental duration...

Syed Muhammad1*, Badar Naseem Siddiqui2, Farhat Ullah Khan1 and Nawab Khan3

Self-perceived Constraints of Extension Field Staff Affecting their Working Efficiency in Khyber Pakhtunkhwa, Pakistan
...comprised of Field Assistants (FAs) and Agriculture Officers (AOs) served as respondents. Five-point Likert scale (Likert 1967) was used to record the response of respondents. Results showed that a majority of the respondents (85.3 %) were FAs by designation, almost half of them (50.5 %) were of middle age (> 35 to 50 years), majority (48.4 %) had education up to SSC with Diploma in agriculture, majority (81.1 %) were of rural background, and all had receiv...
Adeen Kiran1, Umar Farooq Gohar1*, Ayesha Farooq1, Malik Muhammad Asif2 and Hamid Mukhtar1
Redressal of Antibiotic Resistance using Plant Extracts
...tochemicals present in plants and its ability to kill these pathogens and microbial inability to develop resistance against these pathogens. Therefore, the trend has been shifting from using synthetic or semi-synthetic antibiotics to the use of medicinal plants which are the part and parcel of traditional medicines. Thus, this review article explains the different mechanisms adopted by microbial life to develop resistance ag...

 Shafii Abdullahi Mohamed1, Abdiaziz Idiris Mohamud2*, Yonis Abukar Mohamed3, Pravin Mishra4 and Osman Sheikh Ali Jama5

Assessment of Knowledge, Attitude, and Practices of Population Towards Brucellosis in Benadir Region, Somalia
..., a total of 120 participants share their knowledge, attitude, and practices towards Brucellosis. Their knowledge regarding causative agent was 37.5% (n=45) and the disease was 45% (n=54), while transmission of animal to human was 43.33% (n=52). The majority of participants would take actions to ensure the animal is healthy when they buy 95% (n=114), all participants would like to receive ...

Sajid Ali1, Abdul Basit1,3*, Abdul Mateen Khattak1, Syed Tanveer Shah1, Izhar Ullah2, Noor Alam Khan3, Imran Ahmad1, Kamran Rauf1, Salman Khan1, Irfan Ullah1 and Intizar Ahmad1

Managing the Growth and Flower Production of Zinnia (Zinnia elegans) through Benzyle Amino Purine (BAP) Application and Pinching
...sis showed that zinnia plants treated with 100mg.L-1 and pinched at 6 leaves stage recorded maximum days to flowering, flower persistency, branches, leaves and flowers plant-1 and stem thickness. While in case of untreated and un-pinched plants maximum flower diameter, fresh and dry flower weight, and height of plant were reported. Hence, it is concluded form the research study that BAP application (@100 mg.L-1) reduced heig...
Mardan Aghabey Turghan1, Roller MaMing1*, Li Weidong2, Di Jie1 and Xu Guohua1
...them, 85 species are migrants, 49 species resident, 33 species summer visitors and 5 species winter visitors. Six species of birds viz., Red-rumped Swallow (Cecropis daurica), Eastren Crowned Warbler (Phylloscopus coronatus), Blue-cheeked Bee-eater (Merops persicus), Robin Accentor (Prunella rubeculoides), Tibetan Rosefinch (Carpodacus roborowskii) and Japanese Sparrowhawk (Accipiter gularis) are being reported for the...
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
...d T. ovis) in small ruminants through PCR and microscopy in Musa Pak Shaheed, Multan district, Pakistan amidst 2013. A total of 200 small ruminants (93 sheep and 107 goats) without any apparent signs of theileriosis were examined to diagnose Theileria piroplasms. During sampling, blood was amassed by puncturing the jugular vein in eppendorf comprising EDTA as anticoagulant coated tubes for the detection of Theileria piroplas...

Said Sajjad Ali Shah1*, Muhammad Ilyas Khan1, Aziz Ullah1, Hayat Ullah2 and Faisal Ahmad2

Coprological Examination of Small and Large Ruminants in Central Zone of Khyber Pakhtunkhwa
... in small and large ruminants in central zone of Khyber Pakhtunkhwa. For this purpose, a total of 1700 fecal samples were received from central districts and processed for coprological examination. Out of 1700 samples, 947 samples (55.7%) were positive for intestinal parasites. Specie wise prevalence of GI parasites was recorded as 51.5% in cows, 58.3% in buffalo, 73.9 % in sheep and 68.5% in goats. Trichostrongylus (32.8%) was recorded as highly prevalent in ...

Sanaullah1*, Abdul Basit2 and Inayat Ullah3

Challenges and Prospects of Farm Mechanization in Pakistan: A Case Study of Rural Farmers in District Peshawar Khyber Pakhtunkhwa
...ve effect of key determinants including; income source (0.008), farm size (0.001), farming experience (0.004), extension visits (0.009), access to credit (0.002) and access to agricultural machines (0.006) on farm mechanization adoption. The study emphasized that government may make agricultural mechanization and farming resources available and reachable to the farmers in order to persuade farmers in using them to maximize production, arrange awareness trainin...

Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3 and Waqas Raza1*

Influence of Resistance Inducers on Nitrogen, Phosphorus and Potassium Contents of Susceptible Chickpea Cultivars after Inoculation with Ascochyta rabiei
...the disease. Normally, plants are stressed by different environmental confines may be weakened and susceptible to disease and these include nutrient scarce plants. Tissue contents of potassium, nitrogen, and phosphorus of above parts of the ground of plant in three cultivars of chickpea (‘C-44’, Bittle-98’ and ‘Pb-91’) after treatment with Bion® (acibenzolar-S-methyl), salicylic acid (SA), p...

Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Sher Muhammad3, Usman Saleem4, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz5 and Aamer Sattar2

Impact of NaCl Toxicity on Yield and Yield Components of Rice (Oryza sativa) Grown in Aridisol
...ree can be absorbed by plants. A pot study was performed to assess the poisonous impact of NaCl salinity on rice growth parameters. Selection of soil with customary characteristics was done. Various levels of salinity; < 4, 4, 6, 8, 10, 12 and 14 dS m-1 were established using NaCl salt. Soil was left for appropriate period for accomplishment of salinity. Completely randomized design (CRD) was used for layout of the experiment. Transplantation of seedlings w...
Wentao Wang1,2, Xu Lin3, Jianshu Zhuo3, Dongjie Zhang2, Xiuqin Yang3* and Di Liu1, 2*
...tively. The splicing variants were produced by exon skipping, alternative 5’ and 3’ splice sites alone or in combination. Minigene analysis showed that the splicing of porcine E2F3b is complicated. E2F3b isoforms are expressed in all tissues studied with high level in spleen and muscle. Both of isoforms V1 and 2, containing functional domains of E2Fs, were localized throughout cells. No functional nuclear localization sequence and export signal wer...

Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3

Application of Nanotechnology for Insect Pests Management: A Review
...y” comprising of plants, algae, fungi, yeast, etc. which are consists of wide array of biomolecules. There is various size and shapes of nanoparticles to be synthesized by using the naturally occurring biomolecules. These biomolecules acting as a driving force for the designing of greener, safe and environmentally benign protocols for the synthesis of nanoparticles. Insect pests are main density dependent factors that deteriorate the quality and producti...

Saba Aleem1*, Mehvish Tahir2, Iram Sharif3, Muqadas Aleem4, Muhammad Najeebullah2, Ali Nawaz1, Amina Batool1, Muhammad Imran Khan1 and Waheed Arshad1

Principal Component and Cluster Analyses as Tools in the Assessment of Genetic Diversity for Late Season Cauliflower Genotypes
...btaining diverse recombinants in segregating generations, exploiting heterosis, and broaden the genetic base of the cauliflower germplasm.

...

Muhammad Umair Hassan1, Muhammad Aamer1, Muhammad Nawaz2, Abdul Rehman3, Talha Aslam3, Ubaid Afzal4, Bilal Ahmad Shahzad3, Muhammad Ahsin Ayub5, Faryal Ahmed1, Ma Qiaoying1, Su Qitao1 and Huang Guoqin1*

Agronomic Bio-Fortification of Wheat to Combat Zinc Deficiency in Developing Countries
... irregularties in both plants and humans. The Zn deficiency considerably reduced the plant growth, tillers production, chlorophyll synthesis, and crop yield. Moreover, in the case of humans’ Zn deficiency causes blindness, lower intelligence quotient (IQ) levels, weaker immune system, and impaired physical and mental development. Wheat crop play a chief role in daily food requirement and calories need in developing countries, however, inherently wheat ha...
Faiza Altaf1, Shamim Gul1,2*, Tasawar Ali Chandio3, Gul Bano Rehman1, Attiq-ur-Rehman Kakar4, Sami Ullah4, Naqeebullah Khan4, Umbreen Shaheen5, Muhammad Naeem Shahwani6, Muhammad Ajmal7 and Misbah Manzoor8
 
 
...% - 1166.6%) of tomato plants (as only tomato plants were analyzed for WUE). Furthermore, these amendments reduced concentration of heavy metals in plants of both crops. As compared to contaminated control treatment, amendment of biochar-poultry manure mixtures increased the concentration of soluble mineral phosphorus by 288% - 914% in soil. Our study suggests that amendment of wood-derive...
Nasir Rashid1,2*, Javaid Iqbal1,2, Umar Shahbaz Khan1,2, Mohsin Islam Tiwana1,2 and Amir Hamza1,2
...e accuracy achieved. Variants of support vector machine (SVM) have been used for classification of four movements. Significant improvement in results has been exhibited by quadratic multiclass SVM (Q-mSVM) in terms of classification accuracy. The technique shows average accuracy percentage of 78.48% and maximum accuracy of 88.19% for one of the subjects. The proposed method has shown superior experimental results as compared to the previous studies using the s...
Javeria Afzal, Muhammad Abid, Faisal Hussain* and Alia Abbas
...ctivities of different plants viz., Amaranthus viridis, Chenopodium album, Solanum nigrum, Carica papaya and Euphorbia hirta have been evaluated against root-knot nematodes. Plants were collected from different areas of Karachi. Aqueous extracts (2, 6 and 10%) of these five plant species were made for the experiment. All selected plant species inhibited egg hatching and caused larval mortal...
Muhammad Zubair1, Habib Ahmad2*, Brian E. Hemphill3, Muhammad Tariq4 and Muzafar Shah5
...s and prehistoric inhabitants of the Indus Valley and South-Central Asia. When consideration was limited to the people of Northern Pakistan, the uniqueness of Khalil and Daudzai, was emphasized. A comparison of the people from Peshawar emphasizes the uniqueness with south-central Asia, and shared no affinities to South Asians either living or prehistoric. These results show the influence of the past expansions and migrations have had upon the Pakistani populat...
Wenyou Huang1, Dan Yü1, Song Huang1,2, Jian Xiao2, Ping Qi2, Anhua Song2* and Zhen Huang1*
...on of a collection of mutants with increased virulence. One mutant, designated, MlUV-40b showed 3.3-fold increase in virulence as compared to the wild type parent, with an LC50 = 0.3 ×105 conidia/ml versus 1.1 × 105 conidia/ml, respectively and LT50 = 92 and 123.0 h for the MlU...
Wali Muhammad1*, Humayun Javed1, Munir Ahmad1 and Tariq Mukhtar2
...infestation on brinjal plants sown at different times was at par at both the locations and was found slightly higher at farmer field. The maximum average fruit infestation (52.8 %) was observed at URF Koont on early sown crop (1st of March) while the minimum (46.3 %) was observed on crop sown on 20th of March. At Rawat, the maximum mature infestation (54.5%) was observed on late sown crop (30th of April) while the minimum matur...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
 
...t stress of two weeks, plants were subjected to morphological, biochemical and physiological investigations. Drought stress reduced the biomass and enhanced the root length in all three wheat varieties. However, growth reduction due to drought stress was relatively lower in variety F23. While the shoot length of all three wheat varieties was decreased because of drought stress, whereas the root/shoot ratio was increased. The root length was higher in variety F...
Muhammad Naeem1,2, Nasir Rajput1,2, Sher Ali3, Asmatullah Kaka2, Dildar Hussain Kalhoro2, Mehvish Rajput2 and Tian Wang1,*
... used as forage for ruminants.
...

Saleem Maseeh Bhatti1*, Aslam Khan Gadehi1, Inayatullah Rajpar1, Muhammad Nawaz Kandhro2, Mukesh Kumar Soothar1 and Zohaib Ur Rehman Bughio1

 

 

...sup>-1). Spinach plants were irrigated with defined EC levels at 80% field capacity of a clay loam, non-saline soil. Results indicated that the growth and yield parameters of spinach genotypes were constantly decreased with an increase in EC levels of irrigation water. The plants irrigated with EC 6.0 and 8.0 dS m-1 had less fresh weight of leaves (> 30%) than the plants

Ahmad Ur Rahman Saljoqi, Muhammad Salim* and Iftikhar Ahmad 

 

...e times. A total of 30 plants in each treatment were selected randomly for the data collection at 1, 2, 3, 6, 9 and 12 days intervals. Peak population of thrips (51.27 plant-1) was noticed during the last week of April. Results regarding different treatments showed that Emamectin was effective exhibiting minimum mean number of T. tabaci (nymphs 1.74 plant-1 and adults 1.31 plant-1) as compared to the rest of treatments. ...
Sana Khan1*, Faiza Aman1, Muhammad Ismaeel2, Zafar Ali2, Mehboob Alam1, Sadeed Iqbal1 and Taimur Khan3
 
...s of randomly selected plants in each treatment and replication. Results showed that phosphorus levels significantly affected all growth parameters. Maximum absolute growth rate (3.31cm day-1), leaflets plant-1 (102.61), pods plant-1 (16.43), pod length (9.53 cm), root weight (4.67 g), nodules plant-1 (19.97), 100 seeds weight (40.66 g) and yield ha-1 (5.71 tons) were recorded in pl
Saba Shabeer1, Riffat Tahira2 and Atif Jamal3*
 
...nic species can attack plants at different stages causing considerable damage amounting to millions of rupees. One of the plant pathogenic fungi is Fusarium spp. Fusarium species are very well-known soil-inhabiting fungi that cause many economically important diseases of crops.Many species are included in the Fusarium genus, which are not only pathogenic to plants but also cause different disea...
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
...be grazed for large ruminants and then 21 small ruminants on the same biomass and also maximum forage production recorded 3882 kg/ha and it sequester carbon to up to 3560 kg C/ha in the given interval. Increase in fiber and ash content also justify the increase in biomass yield of the plant after interval of 60 days. The study indicates that Mott grass or Napier grass based on its high biomass yield is an effective approach ...
Kartika Noerwijati1*, Sholihin Sholihin1, Tinuk Sri Wahyuni1, Rohmad Budiono2, Nguyen Van Minh3, Roy Hendroko Setyobudi4, Zane Vincēviča-Gaile5 and Lulu Husna6
 
 
...ause the F1 plants’ ability to form tubers was not optimal, and there were even plants that only produce roots. However, there were F1 plants which had higher tuber yields than the average yield of the check varieties. The harvest index in F1 population ranged from 0.25 to 0.96 with an average of 0.75. The analysis cluster based on fresh tuber yield a...
Muhammad Tariq Chaudhary1, Saleem Ashraf 2, Muhammad Yaseen3 and Muhammad Luqman3
 
 
...appointed as Field Assistants (FAs) in Agriculture Department. Total 237 questioners returned by the respondents were found complete, thus, sample size was reduced to 237. Effective Schools Model presented by Lezotte (2010)” was employed as theoretical framework of this study. Collected data were analyzed through Statistical Package for Social Sciences (SPSS). Results unveiled that average age of respondents was 25.03 years. Maximum respondents (31.96%) ...
Sana* and Abbas Ullah Jan
 
...ly affecting the determinants of child involvement in agriculture.The study recommended forceful control of child labour in agriculture and ensuring their access to free education through an increasing number of government schools in rural areas. Traditional agriculture is labourintensive, provision of interest-free formal credit for the adoption of modern technologies coul...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
...eaflets in numbers per plants with a range of 131.33 to 176.67 cm, 60 to 105, 41.5 to 60.0, 50.66 to 77.167 and 7.607 to 15.33, 30.33 to 82.0, respectively were significantly affected (P<0.05) by the interaction of selenium application in irrigation and foliar spray in relation to season. The effect was also significant (P<0.05) on some minerals like Cu, Mn, Zinc, Mg and Se that ranged from 0.2080 to 0.3150, 0.1260 to 0.2520, 0.2012 to 0.2970 and 18.04 t...

Muhammad Ihtisham1, Noor Amjad2, Muhammad Nauman3, Asghar Ali3, Khawar Riaz3, Muhammad Sajid3, Muhammad Owais Shahid*3 

 

...and winter survival of plants (93.03%). It was concluded from the results that scarification durations of 90 and 135 min and sowing on 4th-14th April were the most effective in improving the germination, growth attributes and winter survival of Sophora.

...
Asima Batool1, Ghulam Abbas2*, Zuhair Hasnain3, Nasira Perveen4 and Muhammad Naeem Akhtar5
...ated maize seedlings / plants were placed in the glass fitted canopies, where canopy temperature was found 7-10°C higher than ambient temperature along with light reflection was enough for optimum photosynthesis. The plants were raised under heat stress environment for 15 days and harvested. Data regarding seedling parameters ...
Javaria Sherani1,2*, Muhammad Saleem Jilani1, Tanveer Ahmad2, Sohail Kamaran3, Abdul Manan2, Tehseen Ali Jilani2 and Mateen Sajid2
 
...at Dehli White grafted plants produced maximum yield kg/plant (60.33, 71.43, 78.00 ) followed by Mehmud Wali, Karela and Suffen scion grafts. Suffen grafted plants produced better quality fruits in terms of total soluble solids (TSS) (14.67, 15.45, 16.56 Brix0), pH and Ascorbate content followed by Karela, Mehmud Wali and Dehli White scion graft. Based on findings of the experiment, it could be recommended that Mahmud Wali a...
Yongyun Zhang1, 2, Xinyang Fan1, Fangting Zhou1, Weizhen Li3, Yina Ouyang1,4 and Yongwang Miao1*
...cordingly, 6 protein variants and 2 synonymous variants of αS1-CN were inferred and named. The variants A, B’, B’’, C, E and F were observed only in river buffalo, whereas variant D was found only in swamp buffalo. The variant B was shared by both types of buffalo with high frequencies. The buffalo variants deter...
Umair Riaz1*, Shazia Iqbal2, Muhammad Irfan Sohail2, Tayyaba Samreen2, Muhammad Ashraf1, Fatima Akmal2, Ayesha Siddiqui3, Ijaz Ahmad4, Muhammad Naveed5, Naveed Iqbal Khan5 and Rao Masood Akhter6
...medicinal and aromatic plants (MAPs) are current hot topic in the industries for their products. MAPs used in various items like pharmaceutical industry, health care items, cosmetics, organic food items etc. MAPs are gaining global admire and most of the pharmaceutical companies filing patents on medicinal plants and their derivatives and about 40% newly approved drugs during last two decades are formulated from natural orig...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
 

... decreased in chickpea plants affected with wilt disease. Leaves of three resistant and susceptible (un-inoculated and inoculated) chickpea lines/varieties were tested to find out their ionic status (N, P, K, Ca, Mg, Na, Zn, Fe and Cu). The un-inoculated and inoculated plants of resistant and susceptible groups exhibited significant variation (
Hafiz Imran Iqbal1*, Zahir Ahmad Zahir2, Obaidur Rehman1, Rizwan Khalid1*, Abdul Waheed1, Raja Abad Raza1, Shahid Saleem1, Muhammad Rashid1, Sarosh Tariq Alvi1 and Asia Munir1
 

...increase the growth of plants. An experiment in pot was conducted to assess the effect of combined use of rhizobia and plant growth promoting rhizobacteria (PGPR) (containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase) on the growth and yield of maize under salt affected conditions. In pots three levels of salinity were developed i.e. 1.2 (original), 6 and 12dSm1 by sodium chloride (NaCl) salt. The inoculants

 Caner Öztürk1*, Mücahid Onay1 and Neşe Hayat Aksoy2

...ve effect of the antioxidants against sonication. Four merino rams (2–3 years old) were used for semen collection, and the ejaculates were pooled and divided into five equal aliquots. The samples were diluted with a solution having different additives at 37 °C. The first two groups contained L-Cystine as an additive (2 and 4 mM), the next two groups had methionine as an additive (2 and 4 mM), and the last group had no additives (control). After dilut...
Ibrar Muhammad Khan1, Dezhi Xu1, Zubing Cao1, Hongyu Liu1, Adnan Khan2,  Sajid Ur Rahman3, Jam Zaheer Ahmed4, Muhammad Akmal Raheem5 and Yunhai Zhang1*
...ance. Hence, the antioxidants agents(L-cysteine and vitamin E) were added into semen diluent and assessed the freeze-thawed semen quality parameters. The ejaculates were collected from two crossbred groups (Sahiwal × Holstein-Friesian), and (Achai × Jersey) and, split into seven aliquots while extended with three different concentration (5, 7.5 and10 mmol) of L-cysteine diluents and followed by other three concentrations (1.2, 2.4 and...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
 

... govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA) before lethal-temperature stress (50 °C) were assessed ...
Praptiningsih Gamawati Adinurani1,*, Sri Rahayu1, Endang Dwi Purbajanti2, Devi Dwi Siskawardani3, Karina Stankeviča4 and Roy Hendroko Setyobudi5
...eight: normal;">Peanut plants use nitrogen sources from the atmosphere with the help of Rhizobium bacteria. Rhizobium was requiring P elements for root nodules formation. This study aims to determine the effects of the application of mycorrhizae at different levels that play an essential role in increasing P elemental uptake and rhizobia inoculants to improve N element fixation and root nodule formation. Rhizobia inoculant a...
Shehzadi Saima1, Maqsoda Perveen2, Muhammad Nawaz1, Khalid M. Ahmad1,* and Haider Sultan1
...elopment and growth of plants. Therefore, the present study was planned to test the effects of potassium on Gladiolus by different treatment methods, and to find out which method is more promising. The corms of Gladiolus hybrid cv. yellow stone was used for plantation. Experiment was carried out in complete randomized design (CRD) with four replications and three fertilizer treatments (control, 2g/pot with side dressing, 2g/pot with foliar spray). Results reve...
Iftikhar Alam1, Atta Ulllah Jan1, Muhammad Ali2 and Muhammad Farooq3*

...ese, as rated by participants, were: undernutrition and its determinants, factors and nutritional determinants of low birth weight (LBW), and factors and nutritional determinants of stunting and wasting. These priorities should direct future research activities in the field and be reflected in research policies of the country. We recommend larger researc...
Uzma Ayaz1,* and Muhammad Fareed Khan2
 

...randomly selecting ten plants per plot data was recorded for various traits i.e. germination percentage, flower initiation days, full flowering days, full development days, total leaves per plant, chlorophyll content (mg/cm-2), height of plant (cm), disk length (cm), thickness of stem (mm), 1000-achene’s weight (g), fresh achene’s weight (g), dry achene’s weight (g) and achene’s yield (kg/ha). This experimental study d...

Memoona Tehseen1, Sajila Hina2*, Alim-un-Nisa2 and Naseem Zahra2

...andard synthetic antioxidants butylated hydroxianisole (BHA), butylated hydroxytoluene (BHT). The stabilization of sunflower oil with spinach extract as natural antioxidant was monitored by evaluating oxidation in terms of peroxide value, free fatty acid value, iodine value, conjugated dienes, conjugated trienes and para-anisidine value. Spinach extract with maximum concentration showed significant effectiveness in oxidative stabilization of the sunflower oil....

Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2

...cal drought stage. The plants were exposed to normal irrigation, application of bio stimulants like 2µM ABA, 10 mM SA, 15% MLE and 10% MBLE were applied at grain filling stage but skipping irrigation. Maximum growth related parameters were observed by applying full irrigation. Comparing the bio stimulants application, the application of ABA significantly increased the pl

Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3, Waqas Raza1* and Mahmood Ahmad Randhawa4

...han induced unstressed plants. The increase was more evident in case of Bion treatment as compared to all other treatments with SA and KOH. Similar trend was shown by plant extracts where in neem extract induced higher amino acid contents. The cultivar C-44 responds efficiently as compared with other two cultivars. The results of the current study showed that amino acids play significant role in resistance and susceptibility of chickpea cultivars against A. ra...
Khaliq Dad1, Muhammad Nawaz2*, Rumsha Hassan2, Kainat Javed2, Asma Shaheen2, Fengliang Zhao3, Muhammad Imran4, Syed Tansir Hussain Shah4, Muhammad Faraz Anwar5 and Muhammad Aurangzaib6
 
...ify;">Heavy metals Pollutants are not only dangerous to human life but also to fauna and flora. The existence of cadmium (Cd) in soil, atmosphere or water may unfavorably affect growth and physiology of plants. The experiment was conducted to study the impacts of biochar on the growth and physiology of tomato grown in Cd contaminated soil and activity of biochar in the contaminated soil. In this study different treatments of...

Saleem Maseeh Bhatti1*, Muhammad Aslam Panhwar1, Zohaib ur Rehman Bughio1, Muhammad Saleem Sarki1, Allah Wadhayo Gandahi1, and Niaz Ahmed Wahocho2

... sprayed to strawberry plants before flower initiation. A continual increase in number of leaves, number and weight of berries, fresh weight of strawberry plants, and Zn concentration in strawberry fruit was observed as a function of foliar application of zinc. Plants sprayed with 66 and 99 mg Zn L-1 had significantly more number of leaves (27.4 ± 1.14 and 29.9 ± 1.36) and be...
Muhammad Naveed1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Fahad Bhutta3 and Ruqayya Bint Khalid1
... Further, 64 genetic variants were also identified in STAT5A gene and these variants were due to cattle and buffalo differences. Phylogenetic analysis and evolutionary divergence were also estimated. The sequence was submitted to GenBank (NCBI) with accession number MN712202. Our results represent a preliminary step towards the identification of polymorphisms in STAT5A gene of Nili Ravi Buffalo. Further studies...
Alamaary Mohaammed Saad1,3, Abd Wahid Haron1*, Mohamed Ali2
Mark Wen Han Hiew1 and Lawan Adamu1
... capacity of the antioxidants could affect the OS level in the frozen semen. This study was to determine the addition of different concentrations of antioxidants to evaluate oxidative stress and fertility of frozen semen in horses. Seven stallion were used for semen collection in this study. A total of twenty ejaculates was collected from three healthy stallions twice a week for the experiments 1 and 2. All ejaculates were d...

Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Naeem Iqbal3, Muhammad Idrees3, Muhammad Nawaz4, Muhammad Yasir Nawaz5, Muhammad Kashif Munir6, Ahmad Kamal1, Ehsan Ullah1, Muhammad Ahsan Jamil1, Yousuf Akram1, Tanveer Abbas1 and Muhammad Mohsin Aziz1

...es about the impact on plants of vermicasts prepared from aquatic weeds and agriculture wastes.

...

Muhammad Junaid*, Musharaf Ahmad and Saifullah

...mum (89.72%) number of plants survived for 1% amendments concentration. Significantly high number (87.22) of plants survived for green manure as compared to FYM with 78.47. C2 amended was found to be best with lowest (1.19) disease ratings. Significantly higher (i.e. 1.75 and 1.89) disease was observed for C1 and C3 amended soils. FYM was better as it produced significantly less (1.14) disease as compared to green manure wit...
Saba Afzal1, Sohail Raza1,*, Masood Rabbani1, Sehrish Firyal2, Imran Altaf1 and Zahra Naeem1
...st Peste des Petits Ruminants Virus (PPRV) in vitro. Firstly, cell cytotoxicity of ivermectin in the Vero cells was determined using MTT assay. The antiviral activity of ivermectin was determined using viral inhibition assays and median tissue culture infectious dose (TCID50). The results showed that 2.5 µM concentration of the ivermectin is non-toxic to the Vero cells. At this concentration, PPRV titre was significantly reduced (p
Celalettin Gözüaçık1, Ecevit Eyduran2 and Mohammad Masood Tariq3*
...e infected 675 alfalfa plants were evaluated with the objective to predict height of eggs laid by the alfalfa weevil at the plant stem from plant height, number of eggs per cluster, number of egg clusters at the plant stem, and location as potential predictors. In the prediction of height of eggs, CHAID (Chi-square Automatic Interaction Detection) and MARS (Multivariate Adaptive Regression Splines) algorithms were implemented for describing egg laying behaviou...

Bushra Baig and Saeeda Yousaf*

...sticide from these two plants could be utilized for their efficacy against various pests of okra and potato. Keeping the environmentally friendly nature of these biopesticide, compared to synthetic pesticides, it is recommended that more research be directed for assessment of more active compounds that could act as potential candidates for biopesticide. The objective of the study was to find the bioactive compounds in plant extracts of Neem and Black pepper an...

Muhammad Yousif Jakhrai1, Ahmed Nawaz Tunio2, Ali Mujtaba Shah1*, Tarique Ahmed Khokhar1, Muhammad Mohsen Rahimoon1

... analgesia in small ruminants like caprine and ovine. The information was obtained from published papers of last twenty years via research gateways such as; PubMed, Scopus and Google Scholar. Small ruminant anesthesia, local anesthesia in ruminants and high epidural analgesia in sheep and goats were key points for this review. However, these research papers were included in this study, were published between from 1999 to 201...

Fayaz Ahmad, Noorullah Khan, Farrukh Siyar Hamid, Abdul Waheed, M. Abbas Khan, Imtiaz Ahmad, Shamsul Islam, Basharat Hussain Shah, Sohail Aslam and Qamar uz Zaman

...ee replication and 100 plants per replication.  Data were recorded on plant height (PH), number of branches per plant (NBP), number of leaves per plant (NLP), stem diameter (SD), main root length (MRL), root diameter (RD), number of lateral roots per plant (NLRP), dry shoot weight (DRW) and dry root weight (DRW). The highest plant height (78.66 cm) was produced by clone BP2-2, followed by Clones BP1-4, BP1-3, BP3-1 and BP2-5 with plant height of 70.46, 67...

Safia Bibi1, Saima Naz1*, Saba Saeed1, Ahmad Manan Mustafa Chatha2

...ts of different contami-nants on fish. Hence, histopathology must be consider to monitor contaminated aquatic systems.
...
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...ne expression of antioxidants including SOD, NADPH-quinone oxidoreductase 1, and hemeoxygenase 1 were significantly increased at the LPS concentrations of 12.5 and 100 ng/mL. Both Fanconi Anemia complementation group D2 protein and Fanconi Anemia complementation group L had significantly higher gene expression at 100 ng/mL LPS level. The protein expression of phosphorylated histone 2AX showed a linear rise in the range of LPS levels from 0 to 12.5 ng/mL, then ...

Muhammad Nawaz1*, Muhammad Dawood1, Kainat Javaid1, Muhammad Imran2, Fengliang Zhao3, Shahzadi Saima4 and Syed Tansir Hussain Shah2

...fy;">Environmental pollutants are considered harmful not only to humans but to flora and fauna. Fluoride present in the soil, water or even in the atmosphere may adversely affect plants and ultimately cause serious negative consequences on the development, growth and maturity of crops. In this regard, this study was conducted to examine the possible health effect of fluoride pollution in the form of sodium fluoride on the gr...

Qaiser Shakeel1*, Rabia Tahir Bajwa1­, Yasir Iftikhar2, Mustansar Mubeen2, Muhammad Luqman3, Waqas Ashraf1 and Ifrah Rashid4

... extracts of different plants and fungicides were performed for determination of antifungal activity against Penicillium digitatum, a plant pathogenic fungi responsible for ginger soft rot. Petri dish were used to conduct bioassay through poisoned food technique with triplicates. The crude extract of all the plants showed a better inhibitory effects on the pathogen’s (P. digitatum) mycelial growth rather than fungicide...

Imtiaz Ahmed*, Naveed Ahmed, Abdul Waheed, Muhammad Abbass Khan, Noorullah Khan and Fayyaz Ahmed

...cations. There were 45 plants in each replication. The treatments comprises of two growing methods i.e. vertical growing method and horizontal method which was assigned to the main-plot and two direction of sowings i.e. east to west and north to south which were allotted to the sub-plot. The results of the experiments revealed significant variation among studied parameters. In case of growing methods, maximum vine length (4.55 m), number of leaves vine-1 (41.2...

Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sher Muhammad3, Muhammad Latif4, Ayesha Zafar1, Imran Shehzad1, Sarfraz Hussain5, Aneela Riaz6 and Abid Niaz2

...ion in shoots of maize plants. The same trend of improvement was noted for maximum nitrogen (3.16%), phosphorus (0.92%) and potassium (2.88%) concentration in roots of maize plants.

...

Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1 

...was experienced by the plants during the curd development stage. Heat tolerance ability of the genotypes was assessed by their ability to curd induction and development at high temperature and also based on different physiological traits. Heat susceptible genotypes showed lengthened curd induction stage. Further, decrease in chlorophyll and osmoprotectants contents was also seen in heat susceptible genotypes. TSX-C40 was ide...

Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sarfraz Hussain3, Ayesha Zafar1, Imran Shehzad1 and Aneela Riaz4

...efore harvesting maize plants. Laboratory analysis for collected soil samples was carried out. Data were statistically analyzed. Results indicated that treatment (T8) produce maximum plant height (115.0 cm), biomass (64.34 g) and root length (27.083 cm) of maize. Organic matter content (1.78 %), phosphorus (16.67 ppm) and potassium (213.0 ppm) concentration in soil was also increased in this treatment.

...

Allah Bakhsh1, Attiq Akhtar1*, Fiaz Hussain1 and Shabbir Ahmed2

...f light and air in the plants, as a result of leaf removal, decreases the occurrence and severity of bunch rot to less than 5%.This method is extremely useful for maintaining grape quality and quantity without the use of chemicals to combat disease. As a result, this strategy is both environmentally and health-friendly. In Pakistan, we consider using leaf removal therapy to treat grape bunch rot disease because it is the least expensive.

...
Suman Bhattarai1*, Subodh Raj Pandey2, Jaya Prakash Dutta3, Meghnath Timalsena4 and Rajendra Bam5
... investigate the determinants and resource use efficiency of honey production at Chitwan, Nepal. The information was primarily collected through 60 Apis mellifera beekeepers registered in bee zone, Chitwan. They were selected for interview by simple random sampling technique. Interview using semi-structured questionnaire schedule was carried out for primary data. Cobb Douglas production function, multiple regression, and paired t-test were used for the analysi...

Muhammad Suhail Ibrahim1*, Asif Ahmad1, Anwaar Ahmed1, Amer Mumtaz2, Muhammad Javaid Asad3, Saqib Jabbar2, Ahmad Mujtaba1 and Muhammad Nadeem4

...ardous agents or contaminants present in food that can cause food-borne illness. These extraneous agents are causing morbidity and mortality. Contamination of food by various agents includes physical, chemical, and microbiological. Food safety ensures that what we eat, chew, or drink is safe for human health. The whole food chain should be monitored right from production to consumption. The public health burden of developing countries is increasing beyond thei...

Mukkram Ali Tahir1, Noor-Us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Abdul Moeez1, Humaira Ramzan1, Mudassar Hafeez1, Muhammad Zeeshan Manzoor1, Aneela Riaz3, Sher Muhammad4 and Muhammad Latif4

...essential nutrient for plants; although it has shown to be beneficial for plant development. Crop production is seriously affected by salinity worldwide. This research was performed in the research zone of Department of Soil and Environmental Sciences during the summer, 2018 in College of Agriculture, University of Sargodha, Sargodha, Pakistan. In the present study growth response of rice under normal and saline soil conditions was checked using Randomized Com...

Qudsia Nazir1, Muhammad Aftab1*, Ghulam Sarwar2, Aneela Riaz3, Sarfraz Hussain1, Ifra Saleem1, Amina Kalsom1, Noor-Us-Sabah2, Mukkram Ali Tahir2, Ateeq-ur-Rehman4 and Muhammad Arif1

... not only for animals, plants but for humans as well. Its importance cannot ignore for the plants to improve overall quality and yield. The overall physiology, quality and biochemical parameters also enhanced with optimum application of Zn. By keeping in mind, the facts, it was hypothesized that the use of ZnO (a cheap source of Zn) impregnated urea for rice may enhance grains (paddy) yield. Three types of urea were prepared...

Muhammad Rafique1, Inam Ul Haq1*, Humara Umar2, Muhammad Jan2 and Muhammad Azhar Iqbal2

... of true to type olive plants for sustainability of olive sector in the country. 

...

Muhammad Ahsan1*, Aneela Ramzan1, Muhammad Nafees1, Adnan Younis2, Muhammad Amin1, Gulzar Akhtar3, Khansa Saleem1 and Azka Sabeeh1

... (T0). There were four plants in each treatment with three replications which were arranged according to completely randomized design (CRD) under room temperature. The results showed that maximum fresh weight (g) was obtained in T4 (acetic acid), flower head diameter (mm) and flower color was ideal under T3 (salicylic acid). Maximum dry weight (g), highest flower freshness on 1st and 3rd day, minimum petal discoloration which leads to productive market accepta...

Khan Tamoor1*, Hafsa1 and Hanif Maryam2

...r indigenous medicinal plants viz., Ferula oopoda, Zataria multiflora, Achillea santolina and Nepeta cateria against Meloidogyne incognita at banana orchards of District Lasbela, Balochistan, Pakistan. Crude extracts, essential oils and fixed oil of these selected plants were tested separately. The crude extracts of Z. multiflora and F. oopoda showed higher mortality as compared to A. santolina and N. cateria. The results sh...

Wajid Habib1, Saira Rasul2* and Hafiza Sadaf Zahra3

...atility of price determinants in Pakistan. The aim of this study is to investigate the causes of agriculture commodities and food products in Pakistan for selected commodities data ranging from June 1983 to June 2018. Data were collected from different sources including IMF (International Monetary Fund), World Bank, IFS (International Financial Statistics) as well as SBP (State Bank of Pakistan). The GARCH (1, 1) models was used to estimate all variables by us...

Kiran Shahjeer1*, Gauhar Rehman1, Khurshaid Khan1 and Toheed Iqbal2

...and collection of worker ants from the area was hired by using pitfall traps, aspirator and hand picking with the help of forceps. The study revealed that three species belonging to genus Lepisiota as a major outcome of this taxonomic study. The species include L. frauenfeldi, L. simplex, L. opaca and its sub-species L. o. pulchella. Among them two species viz., L. simplex, L. opaca and a subspecies of L. opaca i.e. L. o. pulchella are reported as first distri...

Weenghar Ali Chandio1, Tajnees Pirzada1*, Abdul Majid2 and Farzana Rashid3 

...effects of HA on other plants.

...
Maria Qibtia1, Muhammad Wasim1, Farzana Chowdhary1, Muhammad Tayyab1, Sehrish Faryal1, Ahmed Mansouri2, Zeeshan Ahmad2, Muhammad Hamid3 and Ali Raza Awan1,*
...ovide the mutational variants of the LCT-gene in the region of Pakistan. This is a major step in clinical management and accurate genetic counseling of the pre-symptomatic diagnosis of LNP. Among the six novel mutations found, mutation XI was found in all of the LNP subjects and was absent in the lactose persistent group. This study, for the first time, focuses on molecular analysis of LCT-gene from Pakistani patients with LNP.
...
Assefa Tessema Tecklie1*, Abebe Getahun Gubale1, Seyoum Mengistou Yilma1, Tadesse Fetahi Hailu1 and Eshete Dejen Diresilign2
...h were used as key informants. The average age of fishermen was around 36 which were in active force age group (< 65 years). Most (97%) of the fishermen used gillnets imported from Egypt with mesh size of 4-6 cm stretched mesh size < 8 cm which is the national standard. There are three commercially important fish species, common carp (Cyprinus carpio), Nile tilapia (Oreochromis niloticus), and Catfish (Clarias gariepinus). Fishery of...

Md. Mukthar Mia1 and Mahamudul Hasan2

...ons, environmental pollutants, and the host reservoir, like a stray dog, could be feasible. Distressingly, such a pathogen is currently endemic in Asian nations, including India, Bangladesh, Sri Lanka and China. Thus, the literature review encompassed comprehensive knowledge concerning contemporary disease occurrence with causes and transmission imperative for management practice. Besides, the study converged on afresh advanced treatment procedures, vaccine pr...

Ayaz Ahmed* and Muhammad Zulfiqar

...al assets of the participants. In terms of financial asset, odds ratio in favor of ‘NTFPs income’ and ‘employment opportunities’ for JFM sample households were 2.289, 2.501 times respectively more than non-JFM sample households. Trainings imparted by forest department significantly improved the skills, knowledge and leadership abilities of the JFM participants (human asset) as compared to non-particip...

Hussan Ara Begum1, Muhammad Hamayun1, Noor Shad1, Waqar Khan3, Jawad Ahmad1, Muhammad Ezaz Hasan Khan2, David Aaron Jones2 and Kishwar Ali2*

...economically important plants. The current study assesses the effects of UV radiation on germination, growth, chlorophyll content and fresh and dry weight of Brassica rapa L. and Eruca sativa L. Some seeds of Brassica rapa L. and Eruca sativa L. were placed in petri plates, and were exposed to UV light for 30, 60 and 120 mins daily. The source of UV light was a UV box having a UV Tube. The UV exposure on the seeds reduced the germination percentage in both spe...
Ghulam Raza1*, Maqsood Anawar2, Muhammad Akbar1, Muhammad Ali1, Alamdar Hussain1, Azhar Hussain3 and Tanveer Hussain4
...oney to the local inhabitants of the mountainous community. The characteristic habitat analysis and preference was important as the ibex move downwards during winter to cope the fodder shortage after heavy snowfall. This may expose the ibex to potential threats of predation by predators, poaching and competition for food with livestock during winter season. Therefore, the study was conducted to analyze the characteristic habitat feature and preference of Himal...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Muhammad Umair Sial2, Naeem Iqbal2 and Shafqat Saeed2
...) are a large group of plants grown for landscape and medicinal purposes in various regions and also known for absorbing various toxic pollutants from the environment. Several insect pests like thrips, whiteflies, mealy bugs and caterpillars attack on these plants. Among them, leaf eating caterpillar, Trilocha varians (Lepidoptera: Bombycidae) is serious insect pest for these precious plan...

Sami Ul Haq1, Abid Hussain1*, Umair Riaz2, Muhammad Baqir Hussain1, Adnan Fareed1, Nabeel Ahmad Ikram3 and Fahim Nawaz3

...eld (80%) of sunflower plants grown in soil fertilized with 75 kg S kg ha-1 plus Compost (750 kg ha-1). The application of Compost is one of the effective strategies to enhance the availability of nutrients, including S, to obtain high quality and product in sunflower. It can be suggested that the finding of current research can be utilized to as a good strategy for enhancing the productivity of sunflower.

...

Ahmed A. Kheder

...n including strawberry plants. SLRSV was detected and characterized using serological (DAS-ELISA), biological and molecular diagnostic techniques. Virus incidence was performed in different locations in five governorates during 2018-2020. Forty-one samples out of 693(5.94%) reacted positively to SLRSV. Specifically, the percentages of infection were 7.3, 6.7, 5.4, 5.16 and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia governorates ...

Sehrish Khudadad1, Muhammad Ather Rafi2, Ahmed Zia3, Mian Sayed Khan4, Gulnaz Parveen5, Muhammad Kamal Sheikh6*, Falak Naz7, Muhammad Qasim8 and Syed Waqar Shah9

...the taxonomic studies on ants of Pakistan are badly needed. During this study ant specimens were collected from different localities of district Mansehra. Total 28 species were identified under 16 genera of three sub-families, namely Camponotinae, Myrmecinae and Ponerinae. Subfamily Myrmicinae represented 20 species under 10 genera, followed by subfamily Camponotinae with seven species under five genera, while a single species from subfamily Ponerinae has been...

Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*

...iately weighed, and 10 plants were subsampled from each sample for morphological evaluation. Ten plants were weighed and separated into stem and leaves portion, subsequently weighed and analysed for dry matter (DM) content. The remaining samples were air dried, ground and analysed for chemical composition and in vitro digestibility (IVDMD) and in vitro gas production (IVGP). The results revealed large variability (P < 0.0...

Shahzad Khan1*, Munir Khan1, Arif Alam2, Ikram Shah2, Mahfooz Khan1 and Fida Muhammad Khan1

...to elaborate the determinants of wheat crop in district Charsadda, Khyber Pakhtunkhwa, Pakistan in the year 2018. Three villages, namely, Aspandehri, Kamran Kalay and Sarfaraz Kalay, were purposively selected. A sample size of 41 wheat growers from farm households was chosen from these villages for data collection. Thus, selection of the farmers was based on the proportional allocation technique. However, primary data were randomly collected through face to fa...

Ain-ul-Abad Syed1*, Zaheer Ahmed Khan1, Shakeel Hussain Chattha1, Irfan Ahmed Shaikh2, Mian Noor Hussain Asghar Ali1, Zohaib ur Rehman Bughio3, Shahzad Hussain Dahri2 and Ghous Bakhsh Buriro4

...t was used to meet the plants’ light requirements. The stock solution (a combination of water and nutrients) was used to feed the transplanted plants during hydroponic cultivation. On average, relative to water use under geoponic agriculture, the hydroponic model’s productivity was 97.42 percent. The growth efficiency of the hydroponic spinach crop was much higher than that of geoponic cultivation. On average, th...
Mandour, A. M. 1, Abdel Maksoud, H. M. 2, Amal, A. Khalil 3 and Mohga, A. El-Tahlawey 4
...turally infected maize plants at El-Monfia. These samples were checked
for virus presence using Indirect ELISA. A number of cultural practices were
evaluated as control measures against MDMV to minimize the virus
infection in maize crop.
...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef* 
...
BBTV in infected plants and banana aphid (P.nigronervosa) using specific primer
of DNA-1 for BBTV. The results showed that amplified PCR product with the
expected size 476 bp for both infected banana and aphid. PCR was used to detect
component 6 of BBTV-DNA using specific primer at expected size 813 bp.The
isolated component was cloned into PCR™-4-TOPO vector (3.956~kb) and were
transforme...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
... faba
bean plants exhibiting blotchy mottle,vein-clearing and deformation. BBMV was able
to infect limited host range ten out of thirty three tested plant species, and
cultivarsbelonging to six different families. It was transmitted mechanically and not
transmitted by seeds or aphids. The isolated virus was inactivated by 10 min exposure
to 95°C, but not at 97°C, at a dilution of 10ˉ3,and at3...

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

...c hibiscus
plants. Samples of hibiscusleaves were collected from El Giza, Alexandria, Qlubia,El-
Fayom, and El-Mansouragovernoratesand analyzed for phytoplasma infection.The
collected hibiscus plants showed characteristic symptoms for Phytoplasma associated
witches‟-Broom disease, which is characterized by excessive axillary branching,
abnormally small leaves, and...

Enas K. Abo-Elmagd,Kouka S. Abd El-Wahab,Azza H. El- Salakawy

...llected from Egyptian infants and young children with ELISA, and nested reverse transcription polymerase chain reaction (RT-PCR). Furthermore, to study the frequency of RV infection in Egyptian infants and young children during the summer season 2012 and the effect of certain risk factors including age and gender on the extent and impact of RV infection. The study included 73 infants and y...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

...ro-inoculation. Tomato plants were transferred into regeneration medium and genetically transformed with the HSV-2gD-PB21 binary vector through Agrobacterium co cultivation. Agro-inoculated tomato plants were tested for the HSV-2gD insertion and transcription using both PCR and RT-PCR and the results were successful in getting insert-containing tomatoes against HSV-2gD. Specific expression of the introduced antigen construct...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1
...ained from common bean plants were collected from
Qaliobeya governorate, Egypt, and tested for Squash Leaf Curl Virus (SLCV) infection by
PCR using both degenerate and specific oligonucleotide primers. SLCV (bean isolate) was
transmitted from naturally infected common bean onto twenty two species and varieties
belonging to six different families i.e. Moraceae, Solanaeae, Cucurbitaceae,
Leguminoceae, C...

Samah A. Mokbel, Ahmed K. El-Attar

...y
hibiscus plants, the in vitro-infected hibiscus explants were exposed to gamma
radiation at different doses - 5 gray (Gy), 10Gy, 15Gy, 20Gy and 25 Gy- emitted
from cobalt 60 (60Co) for 30 minute. All applied doses resulted in phytoplasma-free
hibiscus plantlets with different survival activity. The presence of phytoplasma 16Sr
DNA was examined using PCR detection ...

Hanaa H. A. Gomaa1; Entsar A. A. Nassar2; K. A. El-Dougdoug3

...t. These are important plants used for treatment of various liver diseases. All the studied genetic parameters showed variations among milk thistle and parent varieties (plant height, main branch, total branches, head flower, fruit yield per plant). Concentration and yield amount of seven detected silymarin compounds using HPLC showed wide variations among varieties. They ranged from 9.2 to 34.78 mg/g fruits or 450.25 to 1250.25 mg/plant. The silymarin product...

Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed

...e OYDV infecting onion plants in
Egypt and to obtain OYDV-free plants from infected onions through tissue culture
techniques. To achieve our aim, the virus has been isolated from naturally infected onion
plants grown in five Egyptian Governorates, Gharbia, Qalyobia, Giza, Fayoum and Beni-
Suef then mechanically transmitted onto healthy onion ...

K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2

...solate-infected pepper plants confirmed by DAS-ELISA and isolated on
Chenopodium amaranticolor L. where gave chlorotic local lesions. Eleven potato cultivars
(Solanum tuberosum) mechanically inoculated with PVY isolate under greenhouse condition
were divided to three categories, resistant (Diamond, Execusa, Hermes and Valor), tolerant
(Sisi, Lady Balfor, Nikola, Ditta and Lady Rosetta), susceptible (Anabel and Sp...

Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2

...the tissues of healthy plants, indicating the effect of the virus of these tissues.
...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
...ommon bean
plants grown in Egypt. Symptomatic leaf samples were collected from bean fields
cultivated in different governorates and tested by PCR using Geminivirus degenerate
primers and Squash Leaf Curl Virus (SLCV) specific primers. All bean varieties grown in
surveyed governorates were found susceptible to Geminivirus infection and the dominant
Geminivirus affecting bean fields was SLCV. Percentage...
M. A. S. El-kady1; A. B. Badr2; Ahmed K. El-Attar1, Hoda M. A. Waziri1 and Kh. E. A. Saker1
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2
... BSV.
...

A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2

...cters of infected bean plants. The thickness of
leaflet blades, palisade and spongy tissues were increased than the healthy plants. In
contrast the thickness of upper and lower epidermis layers were reduced. Also the
thickness of midrib zone was slightly reduced. Moreover, vascular tissues lost their
normal shape and arrangement as xylem arms. The most interesting finding, leng...

Mohamed I. Azzam1, Safaa M. Ezzat1, K. A. El-Dougdoug2, Badawi A. Othman2

...ern that
warrants the need to develop reliable indicators for enteric viruses contamination. This
work assesses the bio-diversity of coliphages to use as bio-indicators for viral water
pollution. The study elucidates the occurrence of enteric viruses at various locations in
Rosetta Branch of the Nile River in addition to five main drains located on its sides which
selected for confirmation the eco-div...

Rehab A. Dawood1; Entsar A. Nassar2; and K.A. El-Dougdoug 3

...d from infected potato plants using osmotic potential (Osmotherapy) applied 50 , 60 and 70 gl -1 sucrose at 210C with 73 , 89 and 92 % respectively . In addition to production of microubers in vitro under osmotic potential 8.8 (50 gl-1); 8.2 (60 gl-1) and 6.2 (70 gl -1) number per 5 plantlets at 170C . All PVY results were confirmed with DAS – ELISA.

...

Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³

...lly infected faba bean plants growing in the experimental fields of Giza Agricultural Research Station showing mottle and distortion of leaves. The identity of the virus was confirmed biologically, serologically and by light and electron microscopy. It was found that BBMV reacted systemically with 12 species belonging to Fabaceae and locally with 2 species belonging to Chenopodiace. It was transmitted mechanically and by Sitona lineate. It was detected serolog...

Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4

...ht and yield of squash plants.

...

Aly M. Abdel-Salam

...Saccharum officinarum) plants in Giza and Assiut
governorates showing leaf symptoms of pronounced flecks or freckles and vein
banding which turn later to chlorotic and necrotic strips. Polymerase chain reaction
(PCR) utilizing degenerate primers for badnaviruses for the reverse trancriptase,
RT/RNase genome regions of ORF III detected the virus in infected sugarcane leaves
and in its vector Saccharico...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...symptomless strawberry plants and identified with a specific antiserum (Loewe Biochemica GmbH) using Double Antibody Sandwich ELISA (DAS-ELISA). Virus survey was carried out during 2013 - 2014 in different locations on commercial strawberry fields. The percentages of infection were 3.7, 4.5, 15.7 and 20% in El-Behera, El-Kalubeia, El-Ismalia and El-Menofia respectively. SLRSV was transmitted either by Xiphinema americanumas nematode vector or mechanically from...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
...sed
tomato plants (Solanum lycopersycum L.), and to identify and classify the phytoplasma
involved. A detection of infected tomato plants, which showed symptoms of big bud,
witches'-broom and phyllody, in all regions of the screened governorates, reacted
positively when assayed by nested polymerase chain reactions (PCR) using universal
phytoplasma-specific primer pa...
M. A. Kararah1, Om-Hashem M. El-Banna1, Salwa N. Zein2 and Abd-Elrehiem, A.F.3 
...ted
cowpea plants, showing mosaic and choloratic ring spot symptoms, which
had been grown in the experimental fields of Giza Agricultural Research
Experimental Station (A.R.E.S) in 2008. Identification studies based on host
range, symptomatology and seed transmission through cowpea and different
hosts belong to Fabaceae.The results indicated that the host range of the
virus was expanded to...

Maryam Yousaf1, Salman Ahmad1*, Romana Anjum2 and Muhammad Zeeshan Majeed3

...hing method. Untreated plants served as control. First disease symptoms appeared after seven days of inoculation and seedlings became wilted within 30 days post inoculation. Stems from wilted as well as control seedlings were cross sectioned to observe the histopathological modifications. Wilted cross sections represented the cell wall disintegration and disruption of the tissues along with the blockage in xylem and phloem vessels due to the tylone production....

Amir M. Walaa1 ; Ausama Yousif1; Walid H. Kilany2; Magdy El-Sayed1; Ahmed A. El-Sanousi1

...ines with different adjuvants except for group 1 & 2. Group 1 was kept as unvaccinated control. At 28 days all groups were challenged with a dose of 105.5 EID50/bird of Variant 2 genotype (1494) IBV through oculo-nasal rout. Blood samples were collected randomly from 10 birds from each group at day 7, 14, 21, 28, 35 and 42 . Organs of 3 birds/each group were collected (trachea, bronchi and kidneys) for PCR at 3, 7 and 10 days post vaccination and post chal...

Megahed, A.A.1; Kh. A.El-Dougdoug2 and B.A. Othman2

...ly infected sugar beet plants showing distincted for one or more viruses were collected from 73 fields in season 2009/2010, while from 76 field, the total of examined plants were 451 through the second season (2010/2011), upon external symptoms. All samples were distributed in 8 symptomatic groups in the forms of: vein clearing, mottling, mosaic, blisters, leaf curling, stunting, yellowing and necrosis. Depending on the exte...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...isolated from cucurbit plants growing in Eastern Province area in Saudi Arabia and characterized using reverse transcription-polymerase chain reaction (RT-PCR). The nucleotide sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the iso...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...aturally infected rose plants collected from different rose farms in Taif, KSA exhibiting a wide range of foliar disease symptoms including necrotic spots, wavy lines, oak leaf pattern, leaf deformation, reduction in number and diameter of flowers , color breaking and necrotic spots on flower petals .The virus was biologically purified from single local lesion formed on Chenopodium quinoa. The isolated virus was identified on the basis of symptomatology, trans...

Badr, A. B. 1, Abou-zeid, A. A2. and Al-Naggar, A. M1.

... tuberosum L.cv. cara) plants during the winter season at 2011 to investigation the abnormalities changes of potato leaflets and tubers infected with Potato virus Y. Anatomical features of terminal leaflets i.e. mean of thickness both, midrib zone, leaflet blade, upper epidermal layer, palisade and spongy tissues, length and width of protoxylem and metaxylem vessels were reduced. However, lower epidermal layer was increased. Stomatal characters i.e. number of ...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

...

Peste des petits ruminants (PPR) is a highly contagious, economically important viral disease of sheep and goats with high morbidity and mortality rates. A live attenuated PPR vaccine has been produced in Veterinary Serum and Vaccines Research Institute (VSVRI), Abbasia. It has and still been utilized to control PPR disease in endemic areas of the Arabian Gulf. In this study, the identity of four batches of PPR vaccines was tested as per the Office Internat...

Eman A. Ahmed1, Osama Y. shalaby2, Emad F. Dwidar2, Samah A. Mokbel1 and Ahmed K. El-Attar1
...at infection of tomato plants with phytoplasma led to an increase in stem diameter by 10.23% as well as greatly increase in measurements of the other stem components while the diameter of pith was decreased by 38.46%. This infection was led to an increase in the diameter of petiole by 109.2% and also the other components of flower petiole. At the same time, tomato leaves were greatly affected as a result of the infection with phytoplasma. The thickness of leaf...

Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3

...urally infected tomato plants collected from Taif governorate, Saudia Arabia for the first time. Observed symptoms circumvented mosaic, curling, bronzing and/or purpling, chlorosis and necrotic spot on the leaves. Disease symptoms of infected fruits produced from inoculated healthy tomato seedling showing discoloration, faint concentric rings, necrotic and chlorotic spot on mature tomato fruits. The virus was biologically purified from a single local lesion fo...

Ramy A. Qabel1; Tarek F. El-Arabi2; Adel A. Shoukry1; Hassan H. Elsebaay1; Abdel-Aziz F. El-Hamahmy1

... symbiosis with legume plants is governed by many factors. The foremost factor that could affect the rhizobia is bacteriophage infection. In this context, this study aimed to investigate the abundance of rhizobiophages in Egypt. Rhizobiophages were isolated from the rhizosphere of different legume plants. While no temperate phages were detected, two groups of phages were determined based on their virulence. Highly virulent p...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...ively in particular in plants treated with algal filtrates by mixed with virus inoculum immediately before inoculation. Spraying plants with the algal filtrates 24 hrs. before inoculation produced a higher inhibitory effect against BYMV than that obtained by spraying 24 hrs. after inoculation. The same trend of inhibition effect that was detected with algal biomass was lower than with filtrates. The indirect ELISA was carrie...

Lala Rukh1, Muhammad Nadeem1, Tusneem Kausar1, Mian Anjum Murtaza1, Muhammad Luqman2*, Muhammad Bilal Shahid1 and Amal Shaukat3

...n digestibility, antioxidants and microbial count. Results showed that date bars are rich source of protein, fiber, carbohydrates and fat with good digestibility properties. Date pit powder and soy protein isolate incorporation enhanced the total antioxidants and DPPH activity in soy date bars however, decreasing trend was observed in total antioxidants and inhibition of DPPH radical activ...

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...commended to use antioxidants in infected animals during treatment.

...

Salama M. El-Saghir1, 2

...s in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence of ...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and Mohammed A. Shalaby2

...of Peste des petits ruminants (PPR) vaccine is a matter of concern to ensure
releasing of safe, effective and potent product.
Objective: To use of some molecular techniques as conventional reverse transcriptase polymerase
chain reaction (RT-PCR) and real time RT-PCR in identity test of PPR vaccine.
Methods: Four batches of PPR vaccines that produced in Egypt by Veterinary Serum and Vaccines
Research I...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...cator (Vollka marina ) plants. The Phytoplasma was
transmitted from naturally infected Lemon (Citrus limon) to healthy periwinkle (Catharanthus roseus)
by dodder (Cuscuta reflexa Roxb) and Lemon (Vollka marina) plants by eye bud grafting.
Cytopathological detection referred to Diene's stain was used to differentiate the phloem tissues of leaf
petiole sections from infected tree...

Maha A. El-Abhar1, Moustafa A. Elkady1, Khaled M. Ghanem2, Hussieny A. Bosila3

...ge among weed and crop plants which produces a variety of symptoms. It can cause problems in potato
in some regions where vectors easily move into potato fields from reservoir host, particularly if a tuber
necrosis-causing strain is involved.
Objective: : The purpose of this study is to characterize biologically and serologically AMV infecting
potato (Solanum tuberosum L.) in Egypt. Moreover, the study described ...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
... frequently occurred variants. A1 is recognized as potential cause of several human diseases. It is important to evaluate the A1/A2 β-casein status in milk. Current study was conducted to molecular characterize the exonic regions of β-casein gene and to explore the status of A1/A2 β-casein type in Cholistani cattle breed of Pakistan. Blood samples of Cholistani Cattle were collected from Government Livestock Farm, Jugait Peer, Bahawalpur. Genomi...

Mohsen M. Elsharkawy1, Salem H. Homayed1, Mohamed M. Elsawy2 and Amr A. Khedr1

...ion of CMV in cucumber plants.
Methods: The fan was operated two times per day (8:00 am and 18:00 pm, each time for 30 min).
Moreover, cucumber plants were treated with cell free filtrate (CF) of GF 19-1 at 1 day before virus
inoculation.
Results: The wind velocity (2.6 m/s) resulted in decreased virus severity and titer compared with the
control. However, the poten...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...omatic infected potato plants during growing seasons for
the cultivated commercial local tuber seeds using Double Antibody Sandwich-Enzyme Linked
Immuno-Sorbent Assay (DAS-ELISA). The PVM was mechanically isolated on potato cv. Diamant.
Host range was carried out by mechanical inoculation of PVM on a set of different plant species.
Electron Microscopy was used to examine the virus morphology. The cytopathic effec...

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

...f aromatic and medical plants. In March 2016, several symptoms of leaf
necrosis, bright yellow mosaic and malformation of leaves suggested viral infection of AMV on
basil plants grown in Beni Suef governorate.
Objectives: The present study aimed to characterize the virus at the molecular level and
described the ultrastructural changes or other histopathological alterations in b...

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

... commercial ornamental plants, leads to serious economic losses all over the world. During
2017-2018, gazania showing phyllody, yellowing, proliferation, virescence and little leaf symptoms
was observed Giza, Egypt.
Objective: The current work aims the detection and molecular identification of phytoplasma infecting
Gazania in Egypt.
Methods: Phytoplasma disease was detected and isolated from naturally...

Ahmed M. Soliman

... largest host range of plants.
Aim: The present study was conducted to identify four Saudi CMV isolates (cucumber, tomato, pepper and watermelon) using biological, serological and molecular assays.
Methods: Survey of some vegetable crops exhibiting mosaic, yellowing, blisters, shoestring leaf, mottling and stunting in different regions of Al-Ahsaa at Eastern Province in Saudi Arabia was conducted during the spring of 2016 and 2017. The ...

Mohsen M. Elsharkawy1, Sara E. Hanbal2, Samir A. Sidaros1, Mohamed M. Elsawy2, Ali H. Hamed2

...n of BYMV in faba bean plants.
Methods: Faba bean plants were treated with PGPF isolates at 2 days prior to BYMV inoculation. Disease severity and virus titer were estimated at 1, 2 and 3 weeks after virus inoculation. The transcription profile related to defense genes was evaluated at 1, 2 and 3 weeks after BYMV inoculation by quantitative real-time PCR analysis.
Results: Treatments with PGPF resulte...

Shimaa A. Khalaf1 , Mohsen M. Elsharkawy2, Samir A. Sidaros2, Shawky A. El Kewey2, Ayman F. Omar2, Ali Hamed1

... evaluated in cucumber plants treated with barley grain (BGI) or culture filtrate (CF) of GU23-3 under greenhouse conditions. Additionally, the expression levels of defense genes were assessed by reverse transcription PCR (RT-PCR) analysis.
Results: Both of virus severity and titer were significantly reduced in treated plants in comparison with the control. All growth characters and yield of cucumber pl

Youssef A. Elgharbawy1, Mervat M. Ali1, Ayman H. El-Deeb2, Mohamed A. Shalaby2

...equal volume of the adjuvants (Montanide ISA 50 and Montanide ISA 206 ) to the total quantity 3ml of the vaccine. The prepared vaccine tested for determination of immunological response against the vaccine with ISA 50 and ISA 206 adjuvants and the results was compared. The results of cellular and humoral immune response and the challenge test showed that using inactivated LSDV vaccine improved by Montanide ISA 206 elevate th...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...pevine and pelargonium plants and detected
using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA). Host range study
was carried out using mechanical inoculation into fourteen different diagnostic host plant species and
cultivars belonging to 6 families. Tomato seeds were treated with four different concentration of
NaN3and EMS (1.0, 2.0, 3.0 and 4.0 mM) and (0.3%, 0.4%, 0.5%and 0.6%) respect...

Tahsin S. Shoala1, Ahmed K. El-Attar2, Ahmed I. Abd El Maksoud3

...thods: Infected potato plants (Solanum tuberosum L. var. slany) were externally sterilized
and cultured in Murashige and Skoog media (MS media). Four weeks later, potato plants were
tested for PLRV using RT-PCR technique, and all of the plants were PLRV positive. MS
media were prepared, autoclaved, and active natural materials (Glycyrrhizic acid ammonium...
Ahmed A. ElWakil1, Ausama A. Yousif2 , Adel A. Fayed3, Ibrahim M. elsabagh2, Mahmoud
El Gamal2, Omnia H. Refaei3
...ansmission is a tick warrants an investigation into
the replication capacity of the virus in ticks. Transstadial occurs when virus remains with vector from
one life stage to the next and transovarian is transmission of virus from parent vector to its egg.
Objective: Investigation of LSDV replication capacity in ticks uses targeted detection of the viral
DNA polymerase mRNA and metagenomics analysis using MinIon t...

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

...to occur in sugar beet plants in Egypt and may
produce severe damage to infected plants. However, studies on the effect of the CMV on the cellular
and internal structures of sugar beet leaves were rare.
Methods: The CMV was isolated from sugar beet samples collected during November 2018 from the
Fayoum governorate, exhibited symptoms of mosaic and leaf malformation. Detection w...

Gulnaz Ismaylova

...ibution, phenology and plants affected by the pest. Both nymphs and adults of O.japonica cause serious damage to plants. When the females lay their eggs, it files the sprouts by the ovipositor and let them dry. Wintering is carried out in the egg phase. Nymphs begin to hatch from overwintered eggs in early May. The eggs of O. japonica were also photographed under a JCM-6000 electron microscope and given dimensions. It turned...

Aliya Munir1, Sajid Abdullah1*, Huma Naz2*, Khalid Abbas1, Tanveer Ahmed3 and Zahid Farooq2

... biomarkers like antioxidants enzymes have been successfully used in ecotoxicology field for evaluating the stress response of organisms exposed to pollutants. Therefore, this work was designed to evaluate the peroxidase (POx) level in kiney, gills and liver of fish Channa striata exposed to LC50 concentration (1.374µgL-1) of deltamethrin+endosulfan (DM+ES) mixture for 4-day. Sampling was performed after a 24-hr period...

Md. Sahidur Rahman1*, Tishita Ape1, Md. Islam1 and Sharmin Chowdhury2

... area. Among the participants, 99% did not follow the withdrawal period of the drugs and claimed their prescribers did not advise them on it. Among participants, 81% were found unaware of the effect of antibiotic resistance on animal health. The univariable significance test showed the educational status of the farmer had a strong (P < 0.01) relationship with the knowledge of antimicrobial resistance. Only 27% of farmers ...

Muhammad Rafique1, Muhammad Azhar Iqbal2, Inam Ul Haq1*, Muhammad Ramzan Anser2, Humara Umar2 and Muhammad Ashraf Sumrah2

.... The demand for local plants is increasing and no scientific study has been previously carried out to standardize propagation technology concerning optimization of light intensity under greenhouse conditions. The current study was conducted at Izhar farms (Pvt.) Ltd. under the collaboration with Barani Agricultural Research Institute (BARI) Chakwal to find out the appropriate light intensity for successful olive propagation under greenhouse conditions. The da...

Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2

...mixture of all 3 herbs/plants at 2ml/L; mixed with distilled water and another with citric acid. The dressing percentage was observed significantly (P < 0.05) higher in compound II supplementary group F and lowest in control group A. Whereas, the fat pad percentage recorded significantly (P < 0.05) lowest in the compound II supplementary group F and highest in control group A. The relative weight of organs; liver, pancreas, spleen, heart, duodenum, jejun...

Haroon Ur Rashid1*, Nazia Tahir2, Muhammad Zamin3, Naveed Shehzad4, Aman Ullah2, Bibi Zainub5 and Farooq Azam6

...d various allelopathic plants [Sorghum {Sorghum bicolor (L.) Conard Moench.}, Sunflower (Helianthus annuus L.) and Parthenium (Parthenium hysterophorus L.)] residues as surface mulches and their water extracts integrated @ 15L each +atrazine @ 0.125 kg a.i ha-1(1/4th of the recommended dose) was assigned to sub plots (Factor B). Data were recorded and analyzed for dry biomass (g) of total weeds 60 DAS, leaf area (cm2), leaf area Index (%) and Stover yield (Kg....

Muhammad Jan1*, Muhammad Ashraf Sumrah1, Shoaib Akhtar1, Inam Ul Haq2, Muhammad Ramzan Anser1 and Iqra Yasmin1 

...nutrients serve as stimulants for cell development and fruit production. In Pakistan, Olive cultivation and production started from a previous one decade. Farmers have a lack of trend for fertilizer application to Olive orchards in a proper dose. Olive intensification for new orchard enhanced fertilizer use especially Nitrogen (N), Phosphorus (P) and Potassium (K) and in micronutrients especially Boron (B) to control alternate bearing of olive. In Pakistan, ol...
Atta Muhammad Memon1, Ubedullah Kaka2*, Muhammad Umer3, Asghar Ali Kamboh4, Atique Ahmed Behan5, Habibullah Janyaro6, Yong Meng Goh7, Amir Bukhsh Kalhoro6Jalila Abu8, Khaleeq ur Rehman Bhutto9 and Arsalan Maqbool10


...h are respiratory depressants to ensure safe or balanced anaesthesia. The timing of administration and the effect on recovery for specific alhpa2 agonist antidotes in birds have not been widely investigated. This study was conducted to assess the reversal effects of atipamezole administered at the first sign of recovery on medetomidine-ketamine anaesthesia in pigeons. Twelve pigeons were administered with 1) medetomidine as a pre-anaesthetic at 120 µg/Kg...
Pengfei Liu*, Xuexue Qin and Fei Shang
...preference for nesting plants between the two species. However, the nest predation rate and breeding success were not different significantly. Our study suggested that the space segregation of nesting site contribute to the extensive stable coexistence of these two species.
...

Fahrauk Faramayuda1,2*, Totik Sri Mariani3, Elfahmi1,4 and Sukrasno1

...that in vitro cultured plants contain the same secondary metabolites as the wild type. This study aims to identify the chemical content of two varieties of O. aristatus resulting from in vitro culture. The five-month-old variety of O. aristatus purple and white purple and wild type was extracted using two solvents with different polarity levels, namely ethanol and ethyl acetate. The concentrated extract was identified for its chemical content using gradient sy...

Muhammad Madni Afzal1*, Shahbaz Talib Sahi1, Amer Habib1, Waqas Ashraf2, Muhammad Ahmad Zeshan3, Muhammad Raheel2 and Qaiser Shakeel2

...eriments. Three desert plants i.e. Gossypium thurberi, Calotropis procera and Suaeda fruticose were used at 50 ppm, 100 ppm and 150 ppm concentrations. Maximum basal rot disease reduction (78.6%) was recorded at 150 ppm concentration of wild cotton (G. thurberi) under in-vitro conditions. Whereas, wild cotton also gave the highest disease reduction under greenhouse (62.93%) and field conditions (52.56%) as compared with other two plant extracts and control. It...

Gulzar Ullah* and Gohar Ayub

...8.87%) was observed in plants treated with 20 hours heat pretreatment duration as compared to other heat pretreatment durations and control. Concerning tomato varieties, number of flower clusters plant-1 (16.99), fruit set percentage (68.25%), number of flowers cluster-1 (7.91), chlorophyll content (48.06 SPAD), leaf relative water content (80.68%), Putrescine concentration (190.25 nmol/g), spermidine concentration (152.57 nmol/g), yield (21.00 t ha-1) and low...

Muzamil Farooque Jamali1, Fayaz Ali Jamali1, Tanveer Fatima Miano1, Zulfiqar Ali Abbasi2, Sohail Ahmed Otho3, Khalid Hussain Talpur4, Niaz Ahmed Wahocho1 and Muhammad Iqbal Jakhro5*

...eties of marigold. The plants irrigated with canal water (control) having EC of 0.7 dSm-1 showed better results for both seed and flowering related traits. The plants treated with canal water showed better seed germination (82.56 %), seed germination index (2.04), plant height (21.31 cm), branches/plant (45.61), leaves/plant (201.67), flowers/plant (8.56), diameter of flower (7.95 cm), fresh root biomass (0.821 g) and dry ro...
Arshad Khan1, Mohammad Ihsan1, Ali Hazrat1*, Mohammad Nisar1, Muhammad Laiq1, Maryam Bibi1, Nasir Ali2, Ulfat Naz1, Muhammad Zakria1, Nausheen Nazir3, Adam Khan4 and Muhammad Asif Nawaz5
... most important annual plants globally. The current study was conducted to evaluate Celtis australis genotypes through morphological and biochemical characterizations. A total of 80 genotypes were collected from different regions of district Dir and Swat, Khyber Pakhtunkhwa Pakistan, and were characterized for 11 phenotypic traits (4 qualitative and 7 quantitative). A significant diversity was found for leaf length with the range of 4 to 15 cm, leaf width 1 to...

Sajid Abdullah1*, Huma Naz2*, Zunera Abbas1, Uzma Nazir1, Mehrunisa Basharat1, Tanveer Ahmed3, Adnan Ahmad Qazi2

...tals and industrial toxicants in water.
...

Muhammad Irfan Ullah1*, Muhammad Arshad1, Abu Bakar Muhammad Raza1, Nimra Altaf1, Muhammad Afzal2

...orded higher on citrus plants after application of this insecticide compared to others. Our findings indicate that imidacloprid can be considered the best insecticide for managing CLM and ACP population in an integrated approach. 
 
Novelty Statement | The present study will be helpful in the selection of effective insecticide for the management of two major insect pests of citrus orchards. 

Kawa A. Ali1*, Sazar S. Noraldeen2 and Arshad A. Yaseen2, 3

... for tomato and pepper plants where higher levels with atLEAF instrument comparing to SPAD chlorophyll meter. Higher chlorophyll levels were recorded in open field plants comparing to lath and plastic houses plants. Chlorophyll a content was related to carotenoid levels in both destruction methods. There was positive correlation between SPAD and atLEAF. Nondestructive methods could be used...

Khaliq Dad1, Muhammad Nawaz2*, Muhamamd Ibrahim3, Fengliang Zhao4, Rumsha Hassan2, Humaira Nawaz5, Muhammad Usman Saleem6, Kinat Javed2, Ayesha Komal2 and Hajra Naz2

...en up from the soil to plants and finally becomes the part of human body which warrants serious health concerns. Cadmium causes mild to severe effects on plants, animals and environmental health. Humans are exposed to cadmium through food, water intake, inhalation (cigarette) and dermal contact which then produces heart disease, kidney failure, lung cancer, orthopedic disease, nervous syst...
Yanhong Hu* and Linkai Cui
...zed glands of animals, plants as well as other organisms via well-characterized biosynthetic pathways. Fatty acyl alcohols are the key components for synthesis of wax. A fatty acyl-CoA reductase (FAR) is often essential in this biosynthetic pathway. The subcellular localization of FARs is crucial for understanding the process of synthesis and transport of wax to the surface of body. In this study, we characterized the subcellular localization of EpFAR from the...

 Yanqiang Zhou1, Lixin Wang1, Chunxiao Hao1, Xiuyun Li2, Shakeel Hussain1, Dongdong Shen1, Zhiwei Peng1, Qi`an Zhai1 and Zhijun Hou1,*

...una among the three ruminants. The data of the study will provide an accumulating knowledge to help preventing and controlling the spread of infectious parasitic diseases in the zoo.
...
Niaz Muhammad1, Samina Yasin1, Zunaira Fatima1, Noor ul Ain1, 
Muhammad Faizan2 and Sadaf Naz1*
...determine the common variants of FGFR3 in one inherited, and eighteen sporadic cases of achondroplasia from Pakistan. Sanger sequencing analysis of FGFR3 exon 9 revealed that more than 90%cases had the c.1138G>A p.(Gly380Arg) variant. Our results suggest that c.1138G>A variant is the most common cause of achondroplasia in Pakistan, a finding which is similar to that reported for achondroplasia patients from other countries.
...

Muhammad Aftab1*, Aneela Riaz2, Ghulam Sarwar3, Muhammad Arif1, Qudsia Nazir1, Ifra Saleem1, Sarfraz Hussain1, Abid Ali4, Abid Niaz1, Fakhar Mujeeb4, Khalid Mahmood5 and Sarfraz Nawaz6

...ed out to evaluate the plants tolerance under combined stress of B and salt. In combined stresses of (B and Salt) causes oxidative stress in plants due to increase in production of the reactive oxygen species (ROS) including hydroxyl radicals (OH-), hydrogen peroxide (H2O2) and superoxide (O2-). However, on their side, efficient antioxidant defense system developed in plants, which having ...

Ayesha Gul1, Mohammad Sayyar Khan1*, Mazhar Ullah1 and Iqbal Munir3

...r of osmotic stress in plants. In the present research, PEG stress was applied to sugarcane calli of CP-77/400 and the physiological and biochemical responses of the stressed and the control calli were measured. The calli were grown on MS media and were then transferred to different PEG concentrations (0%, 2.5%, 5% and 7.5%). Data was taken after 30 and 60 days of treatment. Relative growth of call showed significant decrease after 30 and 60 days. Control had ...

Reena Ambreen1, Sadaf Sarfraz1*, Fouzia Qamar2 and Shomaila Skinadar1 

...-align: justify;">Surfactants are characterized as having amphipathic structures. The solubilization of water insoluble products in water solvent-surfactant mixtures plays a significant role in numerous fields of industries such as polymer industry, enhanced oil recovery, emulsion, drug distribution, textile staining and detergency. Surface active agents molecules tend to aggregate themselves into structures named as micelles. The formation of these micelles i...

Huda Bilal1, Hasnain Raza2*, Kaynat Ahmed2, Iqra Tariq2, Qurat-ul-Ain2, Sana Sarfaraz1, Sanaullah1, Maryam Maqsood3 and Ali Raza3

...hat is affecting land (plants, soil, microbes, animals, and arthropods) and aquatic biodiversity (waterbodies, phytoplankton, coral reefs, and fishes) drastically.

...

Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4

...eful variation in crop plants has been a major thrust of early farmers since the dawn of agriculture. This study aimed to estimate genetic variability, heritability, and genetic advance for quality characters in Brassica carinata L. A total of 22 genotypes comprised of six parental lines and their 16 bulked F2 populations were evaluated in a randomized complete block design with three replications at The University of Agriculture Peshawar during 2013-14. Data ...

Junaid Ahmad1, Shahzeb Javed2*, Mehmood Khan1, Shadman1, Muhammad Farooq3*, Muhammad Saleem4, Rahila Afzal5, Muhammad Aasim6, Naqeeb Ullah7, Muhammad Noman Khan8, Dawood8 and Naila Ilyas9

...cidences of food contaminants emerge, which, if overlooked, can result in a variety of health risks, illness, outbreaks, and even death. The goal of this study was to look at the students’ knowledge, attitudes, and practices on food safety and cleanliness at a different institution in KPK, Pakistan. A cross-sectional study was done among 1000 government and private university students in KPK, Pakistan, using a self-administered, pre-tested questionnaire ...
Nagarathinam Arunkumar*, Jainullabudeen Gulsar Banu, Nagarajan Gopalakrishnan and Arkalgud Hiriyannaiah Prakash

 

...l, detergents and surfactants, and agricultural industries and in waste treatment plants proved their importance. In this study, 23 wax-degrading bacterial strains isolated from four mealybug species infesting cotton were screened for lipase production. On the basis of the 16S rRNA gene sequences, lipase-positive strains were classified into six genera, namely, Pseudoxanthomonas, Acinetobacter, Klebsiella

Mukhtar Iderawumi Abdulraheem1*, Muhammad Ihtisham2*, Abiodun Yusuff Moshood3, Nawab Khan4, Muhammad Owais Shahid5, Shafiq Hussain6, Kumail Abbas6 and Fawad Zaman7

...d that all of the okra plants tested were susceptible to virus infections regardless of treatment. Those who had a treatment combination of three weedings and polythene mulching, on the other hand, had the lowest incidence and severity of viral infection, while those who received no weeding and no mulching had the highest. At the 7th week after planting, the treatment combination of thrice weeding with polythene mulching had the lowest viral incidence of 18.75...

Shahid Ali1*, Murtaza1, Waqas Ahmad1, Muhammad Israr2, Aftab Khan3, Hamdullah1 and Syed Attaullah Shah1

...d to investigate determinants of rice yield in central Khyber Pakhtunkhwa, Pakistan. A random sample of 275 rice growers was selected from district Swabi, using a multi-stage random sampling procedure. Pre-tested interview schedule was used for collection of data from rice growers. Through Cobb-Douglas type production function (CDPF) data was analyzed. Results indicated that 1 percent increase in labor hours and urea increased yield by 0.411% and 0.231%, respe...

Murad Ali* and Said Wahab

...rent Chapli Kabab restaurants based in Batkhela Bazar, District Malakand, Khyber Pakhtunkhwa, Pakistan. Samples of fresh and in-use frying mediums (upto five hours) of each Tallow, Ghee and Oil were collected and the whole frying process was properly monitored throughout. All the samples were analyzed for TPM and Acid value at the time of collection with the help of oil testometer DOM-24. A 100 ml of sample from each of the frying mediums was collected and tra...
Dia Mamadou1,2*, Meissa Beyah1, Sow Amadou Harouna1, Ba Samba Alassane1, Bouzouma Moustapha1, Braham Cheikh Baye1 and Beibou Ely1
... at lobster production plants of this species at the time of their sorting and packaging. A total of 31770 individuals were measured and weighed; their level of maturity and moulting state were noted. This deep-sea species, reproduces all year round with a period of intense reproduction between August and December. The size of the smallest mature female mature female encountered during this period of experimentation (February 2015 to June 2018) is 213.5 mm TL....
Farhat Iqbal1, Abdul Waheed2*, Zil-e-Huma3 and Asim Faraz2
...asurements of small ruminants. The regression tree, random forests, support vector machine and gradient boosting machine methods have been used to predict the live body weight (target variable) of the animal. The predictors (independent variables) included in the current study were sex of the animal, neck length, diagonal body length, head girth above eyes,shank circumference, belly sprung, and rump height measurements of beetal goats (1 – 7 years in age...
Muhammad Zohaib1, Muhammad Sajjad Ansari1*, Bushra Allah Rakha2* and Ali Akhter2
...and other positions of plants were recorded as 17%, 10% and 25%, respectively. The preferred height for nest construction was recorded 1-2m (58%) followed by 2-3m (17%), 0-1m (16%), 3-4m (7%) and 4-5m (1%). The bulbul prefers to make nests on northern white cedar (Thuja occidentalis; 32%) followed by guava (Psidium guajava; 19%), mango (Mangifera indica; 9%), white mulberry (Moris alba; 9%), sweat orange (Citrus X sinensis; 9...
Madiha Nawaz and Shoaib Freed


... of cotton, ornamental plants and many other crops due to its polyphagous nature. A study was conducted to check the efficacy of different local isolates of entomopathogenic fungi on 2nd nymphal instar of P. solenopsis under laboratory conditions by immersion method. Three entomopathogenic fungi; Beauveria bassiana (isolates Bb-01, Bb-08), Metarhizium anisopliae (isolates Ma-11.1, Ma-2.1) and Isaria fumosorosea (isolates ...

Salma Javed1* and Daniyal Siddiq2

...ematode populations in plants in treated containers compared to untreated plants (control) with values increasing as time and concentration increased. During sixty days of treatment, no significant effect was recorded in plant height and shoot weight for extracts and concentration. Extracts of S. cumini may have potential for controlling M. javanica on tomato.

...

Ilker Kepenekci1, F. Dolunay Erdoğuş2 and Adnan Tülek3*

...rious pests of several plants worldwide including straw berry. So far, no record of any plant parasitic nematode (PPN) exists detailing the species found in strawberry growing areas of Kyrgyzstan. This research aimed to provide a faunistic and taxonomic record of PPNs from soil and plant samples collected from strawberry orchards in 10 different locations in Tokmok area of northern Kyrgyzstan during the summer of 2016. PPNs were identified according to morphol...

Mohammed Abdel-Mageed Abdel-Aziz Abdel-Mageed1, Eman Alsayed Hammad2*, Nashaat Abdel-Aziz Mahmoud1 and Anas Farag El-Mesalamy1

...500 ppm applied to the plants as foliar sprays alone, foliar sprays with chelates and soil drenches were tested against root-knot nematode M. javanica infecting tomato plants cv. Strain-B under greenhouse conditions. Almost tested materials have significantly reduced nematode parameters compared to Oxamyl 24% L. and the untreated plants (check). The degree of nematode reduction varied acco...

Mahmoud M.A.Youssef and Wafaa M. A. El-Nagdi

...ta on roots of several plants were reduced gradually by increasing gamma irradiation doses. When tomato plants infected by root-knot nematode, Meloidogyne incognita were exposed to combined elevated atmospheric CO2 concentration (+100 ppm) and higher temperature (+2oC), tomato shoot dry weight and nematode control were increased compared to prevailing conditions.

...

Thomby Paul, Sreekanta Biswas, Sabiha Zarin Tasnim Bristi, Debashish Sarker, Saroj Kumar Yadav and Bhajan Chandra Das*

...firm the position of implants. On 30th day of post-surgical observation, mediolateral radiograph revealed migration of implants but callus formation was observed between the fracture ends of olecranon in order that the implants were removed. On 45th day of clinical observation, the dog showed good weight-bearing in right forelimb and walked normally.

...

Muhammad Junaid Yousaf 1, Farhad Ali2*and Fawad Ali2

...eakage, similar to the plants aerially treated with 2% NaCl while plants treated with 0.2%. 0.6% and 1.2% salt concentrations had high chlorophyll content and low electrolytic leakage, receptively. Seedlings exposed to a 2% salt stress had the highest RWC and low WL, followed by 1.2% and 0.6% while 0.2% and control plants performed similarly. In conclusion, few seedlings survived under sal...
Qazi Muhammad Noman1, Farhan Mahmood Shah1, Khalid Mahmood2 and Muhammad Razaq1*
...pecies using male attractants Attrex® (methyl eugenol 98%, evyol group) and static Spinosad® (spinosad 2% and methyl eugenol 51%, target group) in mango and citrus orchards at different locations in Multan, Southern Punjab, Pakistan. Bactrocera zonata (Saunders) was the most abundant fruit fly species in this study. Our results indicated a positive and significant correlation between the species of fruit flies and mean temp...

Mohamed S. Khalil

...avanica in roots of eggplants. Milbemectin (Milbeknock 1% EC) was applied at 0.1% (1 ml/l) and 0.5% (5 ml/l) in compared with the non-fumigant nematicide fenamiphos (40% EC). Results revealed that all tested doses of milbemectin suppressed galls (ranged from 50.59 to 75.50%, of both experiment) and egg masses (ranged from 66.67 to 87.01%, of both experiment) significantly, while fenamiphos recorded moderate reductions. Also, the measured plant indices were aug...
Manar M. Farouk1*, Amal El-Molla1, Fayez A. Salib1 and Yousef A. Soliman2
...monellosis in small ruminants.
...

Atef El-Sagheer1*, Anas El-Mesalamy1, Abdel-Monem Anany2 and Nashaat Mahmoud1

...anica infecting squash plants under greenhouse conditions. Data indicated that treatment with P. guilliermondii filtrate (1012) caused best percentage of nematode reduction (71.46%). Followed by S. roseus at (1012) (42.95 %), then in third treatment with C. albidus (103) by (40.50 %). On the other hand, all tested treatments decreased the negative effects of nematodes and enhanced growth characters of squash plants. The high...

Oluwatoyin Adenike Fabiyi

... response of sugarcane plants increased significantly (p=0.05) with the highest concentration (75 mg) of furfural. A reduction in nematode population in soil of treated plants was remarked. The results indicated that furfural could be practically applied in the management of nematode pests of sugarcane, while safe guarding the environment from pollution.

...

Nawab Khan1, Ram L. Ray2, Muhammad Ihtisham3*, Badar Naseem Siddiqui4*, Muhammad Khayyam5, Raheel Anjum6 and Simplice A. Asongu7

...he socioeconomic determinants of the awareness and adoption of apple production practices in 2019. This study selected Ziarat district to investigate socioeconomic determinants of the awareness and adoption of apple production because it is located in the center of the high apple-growing districts in northern Balochistan. A sample of 120 respondents was selected through multi-stage-random sampling from two tehsils (Sinjawi a...

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

...romoting the growth of plants and soil fertility traits.
...

Samreen Khan*, Salma Javed, Tabassum Ara Khanum, Nasira Kazi

...tal flowers, medicinal plants and other commercially important trees from different four sites of district Lakki Marwat and subsequently assessed the presence of EPNs using last instar larva of greater wax moth Galleria mellonella L. as baited host. After completion of requisite process, resultantly the corresponding recovery rate of EPNs was found 10.9% which includes only genus Steinernema comprising two isolates of S. balochiense (24%), two isolates of S. s...
Muhammad Rizwan1*, Bilal Atta1, Misbah Rizwan2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Muhammad Sabar1, Muddassar Ali1 and Muhammad Yasir Ali4
...ncreased in Si treated plants by 3rd instar larvae of C. medinalis. Results also showed that enhanced Si level in rice plants reduces food quality and increases plant resistance to the C. medinalis in rice variety. This study concluded that Si fertilizers may play an effective role in C. medinalis management for rice crop protection.
...

Mohammed Naji Ahmed Odhah1,2*, Dhary Alewy Almashhadany6, Abdullah Garallah Otaifah7, Bashiru Garba5, Najeeb Mohammed Salah2, Faez Firdaus Abdullah Jesse4*, Mohd Azam Khan G.K3 

...id cysts among some ruminants (both local and imported breeds of cattle, sheep, and goats) slaughtered in the abattoirs in Dhamar Province-Yemen. The samples were collected from the Central Corporation Slaughterhouse in Dhamar-Yemen from January 2019 to November 2020. During this period, a total of 29,071 and 5,705 samples were collected from local and imported food animals respectively. The results of analysed samples revealed that the distribution of the hyd...
Jarosław Pytlewski1, Ireneusz R. Antkowiak1 and Ewa Czerniawska-Piątkowska2*
... between the genetic variants of the three polymorphic sites of the PIT-1 gene and the following rearing parameters: body weight at birth, body weight at weaning on day 270, daily weight gain from birth to weaning, age at first calving and body weight after first calving. The frequency of alleles of the analysed loci was: T =0.2887 and G =0.7913 (IVS4-39G>T), A =0.1087 and G =0.8913 (IVS5+438G>...
Muhammad Anwarullah1, Aneela Zameer Durrani1, Muhammad Ijaz1Aftab Ahmad Anjum2, Muhammad Usman1*,Muhammad Zahid Iqbal1Muhammad Husnain1,Ahsan Anjum3, Qurratulain Ashraf4 and Ghulam Mustafa3

Sadarman1, Agung Irawan2, Muhammad Ridla3, Anuraga Jayanegara3*, Nahrowi3, Roni Ridwan4, Ahmad Sofyan5, Hendra Herdian5, I Nyoman Guna Darma5, Teguh Wahyono6, Dewi Febrina1, Rakhmad Perkasa Harahap7, Rizki Amalia Nurfitriani8, Danung Nur Adli9 

...tein utilization in ruminants. This study aimed to investigate the effect of tannins extracted from acacia and chestnut on the degradation kinetics of ensiled and non-ensiled soy sauce residue (SSR) in sacco. Two fistulated beef cattle (425±25 kg) fed a diet consisting of 80% Pennisetum purpureum and 20% concentrate was used to incubate the SSR samples (ensiled and non-ensiled) using a 6×11 cm standard nylon bag. Each SSR sample was added with 2% ...
Muhammad Taqi1, Shazia Erum2, Shamaila Rasheed2, Sadar Uddin Siddiqui2 and Shakeel Ahmad Jatoi2*
... Caralluma tuberculata plants resulting in the disappearance of its wild populations in different mountainous regions in Pakistan. A proficient way for large-scale and fast propagation of C. tuberculata through in-vitro organogenesis was carried out at in-vitro lab, Bio-resources Conservation Institute, NARC, Islamabad, Pakistan. Nodal-tips as explants were grown on MS salts enriched with diverse plant growth regulators incl...

Sanjeela Sabahat1*, Juliya Abbasi2, Mushtaq Ahmad1, Saima Mumtaz1, Taj Naseeb Khan1, Sudheer Tariq1 and Muhammad Imran1

...C, manganese and antioxidants. In Pakistan, except for a few low-temperature regions, it is mainly grown as an annual fruit crop where runners are transplanted every year. Owing to its short growing period and high profitability, it is mostly produced by small scale farmers. However, the changing climate from the past few years has affected strawberry production in Pakistan. Heavy rainfall, along with hailstorms causes damage at the fruit initiation stage. Mor...

Vahid Mollasadeghi1,2* and Samaneh Elyasi1,2

... the leaves of tobacco plants compared to PVY on the leaves of Agria. PVY-infected leaves were more curled and paler than healthy leaves of cultivars Agria. The results of analysis of variance of the evaluated traits showed that the effect of PVY virus treatment was significant on chlorophyll a, b, leaf area and stem length at 1% and 5%, respectively. In addition, the effect of Pars Humic seven on chlorophyll a, b, leaf area and stem length was significant at ...

Noha M. El-Shabrawy1, Atef M. Kamel2, Aza S. Goda1, Gehad R. Donia1, Ahmed M. Salah-Eldein2* 

...sing the number of pollutants introduced into the environment. Continuous monitoring of such pollutants required an indicator sensitive to environmental toxins and represents its accumulative effect. The aim of the present study is to determine the preferable tissue and bird that can be used as a bio-indicator for heavy metals pollution in El-Salam Canal which is considered as an important source of water for land irrigation...

Asad Ullah1*, Umar Sadique2, Ibadullah Jan2, Imad Khan1, Raheela Taj3, Mumtaz Ali Khan4, Salah-ud-din4, Naimat Ullah Khan1

...lected as of 800-participants comprised of TB patients (100), livestock(L/S) farm employees(200), abattoir employees(174), butchers(294), veterinarian(10) and veterinary assistants(22). Two out of 100 TB patients (2/100), 3 out of 200 livestock farm workers (3/200) and 3 out of 23 abattoir workers (3/23) were found positive for the presence of M bovis through PCR technique. A significant association (p<0.05) was found bet...

Zahoor Hussain1,2, Yasir Iftikhar3, Mustansar Mubeen3, Muhammad Zia Saleem3, Muhammad Umer Naseer3, Muhammad Luqman4, Raheel Anwar5, Faheem Khadija6 and Aqleem Abbas7

...d on selected diseased plants in combination. Afterward, different vegetative, physiological, and biochemical parameters of citrus greening infected fruit include fruit diameter, fruit weight, flavedo thickness, total soluble solids, ascorbic acids, juice percentages, TSS/TA ratio, total soluble solids, and titratable acidity were statistically analyzed. The application of Zinc sulphate (0.75 g/L) combined with Manganese sulphate (0.75 g/L) had significantly i...
Stefan Pratama Chandra1, Yoanes Maria Vianney1, Theresia Liliani Christie2, Merlyn Wongso2, Melisa Widjaja2, Deok-Chun Yang3, Se Chan Kang4, Manar Fayiz Mousa Atoum5,6 and Johan Sukweenadhi1*
...of the most well-known plants in traditional medicine that contains bioactive compounds called ginsenosides. It is widely used as raw material in many pharmaceutical industries in Indonesia. However, to supply for this purpose, they still rely on imports. PT. Kalbe Farma (through its subsidiary, PT. Bintang Toedjoe), University of Surabaya (Ubaya), and Hanbang-Bio Laboratory (holding company of Kyung Hee University) established the Kalbe Ubaya Hanbang-Bio Labo...

Niamat Ullah Khan1*, Umbreen Shahzad2, Azhar Abbas Khan2, Sami Ullah2, Muhammad Arshad Farooq2, Muhammad Kashan2 and Shitab Khan2

...t (114.8cm), bolls per plants (18.9), bolls weight (2.42g), seed cotton yield (1812 kg ha-1) and lint percentage (36.72%) than conventional tillage. Likewise, frequent irrigation interval of 10 days produced taller plants compared to less frequent irrigations (20-25 days). Irrigation at 20 days interval improved seed cotton yield (48.7%) and lint %age (21.1%). Interaction effects (tillage x irrigation) revealed that reduced ...

Imran Ali Chandio1, Muhammad Nawaz Kandhro1*, Qamaruddin Jogi1, Ghulam Murtaza Jamro2 and Siraj Ahmed Channa3

...trient deficiencies of plants. A field study was conducted in Tandojam for two consecutive years in autumn 2018 and 2019. The experiment was replicated thrice in randomized complete block design. Different doses of nitrogen as broadcasting and fertigation (0, 75, 100, 125 kg N ha-1 in two and three equal splits given at sowing time, 1st, 2nd and 3rd irrigations, respectively) were applied to two sunflower genotypes (HO-1 and Hysun-39). Data analysis revealed n...

Muhammad Iqbal Jakhro1*, Nadeem Sadiq1, Javed Ahmed Abro1, Amanullah1, Fateh Muhammad2, Maqbool Ahmed3, Syed Ishtiaq Ahmed Shah3 and Qasid Hussain4

...es. One-year old Olive plants were applied with organic and inorganic mineral fertilizer application for six months. The results showed that in comparison to control, plants fertilized with T2 (N 50g/plant), T3 (P 25g/plant), T4 (K 25g/plant), T5 (NPK 50:25:25/plant), T6 (Biochar 2:2) and T7 (FYM 2:2) had significant results. The studied parameters which was height of plant, leaves per plant, branches per pl

Ali Zohaib*, Muzzammil Hussain, Iftikhar Ahmad and Adnan Bashir

...ly increased number of plants per tray and per hill after transplanting while decreased the root length and root/shoot ratio of rice. Plant height was not affected significantly by seeding rate. Highest increase in number of productive tillers (8%), 1000-grain weight (8%), total dry biomass (14-17%) and grain yield (10-16%) was caused by 90 g seed per tray, as compared to 110 g seed per tray. Order of grain yield produced by different seeding rates was 90 >...

Asmaa G. Mubarak1*, Mona M. Mustafa2, Mohamed W. Abdel-Azeem3, Dina N. Ali2 

...omly from various restaurants and food shops including, shish-tawook, pane, and shawerma (50 for each), 10% were contaminated with Salmonella with the acquisition of shish-tawook (14%). On the other hand, 100 hand swabs that were assembled from food handlers working in the same places yielded 13 Salmonella isolates, at the time 4 isolates were only obtained from 50 hospitalized patients with diarrhea. From the public health point of view, S. typhimurium, S. en...

Li Wei, Wei-wei Shao and Zhi-hua Lin*

...;">Environmental contaminants derived from pesticides could lead to a decline in wildlife populations and cause disruption of wildlife behavior, life history, and reproduction. Here, we have investigated the toxic effects of four pesticides, namely, chlorantraniliprole, penoxsulam, pymetrozine, and haloxyfop-P-methyl, on the survival and growth of the larvae of two anuran species, Fejervarya limnocharis and Microhyla fissipes. Our results showed that survival ...

Shireen S. Aboelwafa¹, Alsagher O. Ali², Rania Hamada³, Hassan Y.A.H. Mahmoud2* 

... infection in small ruminants may also affect public health risks. So that we estimate the prevalence of T. gondii and N. caninum infections in Egyptian small ruminants, by using enzyme-linked immunosorbent assay (ELISA) to assess the seroprevalence in 92 sheep and 92 goats from four districts in Luxor governorate (Al-Qurnah, Armant, At-Tod, Esna). A total of 92 sheep were sampled, of which 37 (40.2%) were positive for T. go...

Arkan B. Mohammed*, Ammar S. Abdulwahid, Samah M. Raouf 

... biochemical and antioxidants parameters were also determined at the end of the experiment. The results showed that the egg production and feed conversion ration were significantly improved in both thyme treatments (T2 and T3). Also, the PCV (%) and the WBC count. However, there was no significant difference in the egg quality between the thyme-treated and control hens. The hens on thyme-supplemented diets were found to have lower serum cholesterol concentrati...

A.M. Abdul Azeem, Ashraf M. Mounir and Amr N. El-Shahat*

...s.

...

Mirza Gul1*, Muhammad Zahid1, Ikram Ilahi2, Hazrat Ali2*, Fida Hussain3 and Muhammad Anwar Sajad3

...racts of two medicinal plants, Artemisia scoparia and Anisomeles indica against larvae, pupae and adults of Culex quinquefasciatus. The study also evaluated the predatory effects of the diving beetle, Agabus cybister, against various instar larvae of Cx. quinquefasciatus. Bioassay of whole-plant extracts was performed following WHO methods, with slight modifications. LC50 values for A. scoparia and A. indica against early fourth instar larvae were 360.4 and 97...

Sadaf Shahid1, Abdul Razzaq2, Gul-Makai1, Asim Shamim3*, Hafiz Muhammad Rizwan4, Rana Hamid Ali Nisar5, Qaiser Akram6, Mohsin Nawaz3 

...cks, Seasons, Small ruminants, Quetta 

...

Mohamed S. Hussein1*, Hanan A. Fahmy2, Ashraf A. Abd El Tawab3 

...lones resistance determinants in E. coli from apparently healthy broilers in this study could pose a serious public health hazard, which highlights the need for effective monitoring and surveillance programs and cooperation between the sectors related to the epidemiology of these determinants.

Keywords | Antimicrobial resistance, Broiler chickens, Commensals, Escherichia coli, Fluoroquinolones 

...

Hera Gul Mohmmand1, Rozina Gul1, Hamayoon Khan2, Sheraz Ahmed1*, Laila Fayyaz1, Ajmalud Din1 and Imtiaz Ali1

...on mean data, chickpea plants with P application produced more seed number plant-1 (60.9), pods plant-1 (57.3) and seed yield (557.2 kg ha-1). Higher seed yields were produced by genotypes NDC-4-20-1 (1004 kg ha-1) and NKC-5-S-15 (851 kg ha-1). Seed yield had significantly negative phenotypic correlation with plant height. Similarly at genotypic level, it was significantly correlated with seed number pod-1 while negatively with 100-seed weight. Among the teste...
Dyah Roeswitawati1*, Iva Kristova1, Muhidin Muhidin1, Otto Endarto2, Manar Fayiz Mousa Atoum3,4, Irum Iqrar5,6 and Luqman Ali Shah7
 
...rus and Tropical Fruit Plants in Batu City, East Java, Indonesia from July to September 2017. The study was a factorial experiment, the 1st factor is the type of natural pesticides: A1 = soursop leaves, A2 = papaya leaves, A3 = chrysanth leaves. The 2nd factor is the concentration of natural pesticides: B1 = 5 %, B2 = 10 %, B3 = 15 %. Pesticide persistence was observed based on the mortality rate of the red mite phase of the imago. T...

Ahmad-Ur-Rahman Saljoqi1, Sumayya Amin1, Muhammad Salim1*, Taufiq Nawaz2 and Farida Anjum3

...6g) were recorded from plants after 7 and 10 days, respectively. Significantly highest ascorbic acid concentration (9.68 mg/100g) was recorded on day 10 while lowest (9.19 mg/100g) was recorded on 3rd day post treatment. Similarly, highest percent concentration of pesticide residue (0.080%) was recorded on day 1 while lowest (0.0624%) was recorded on 10th day of post treatment. Results showed that Imidacloprid is significantly better against tomato fruit worm ...

Javed Khan1, Abdul Majid1, Mohammad Nisar2*, Ali Hazrat2, Nausheen Nazir3, Muhammad Zahoor3, Mohammad Ihsan2, Azhar Hussain Shah1, Muhamad Ajmal Khan4 and Muhammad Yahya1

...ive and most important plants in District Dir Lower, Khyber Pakhtunkhwa, Pakistan, mostly used for medicinal purposes. In the present study, total 50 genotypes of Alnus nitida were collected from Dir lower and evaluated for morphological traits (leaf, petiole, nut, and catkin size). A significant level of variations was observed in the size of the leaf (10.22%), petiole (24.84%), catkin (9.19%), and nut (3.08%). There is a significant correlation between petio...
Anjum Ara1, Usman Ali1, Muhammad Furqan2*, Zulfiqar Ali2
Muhammad Mudassar Shahzad3, Khawaja Basharat Ahmed4
Riaz Aziz Minhas4, Waqar Ahmed2, Zakir Hussain2 and Mian Aman Ullah2
...erved among local inhabitants regarding importance, ecological role and legal status of freshwater turtles. Awareness and strict law enforcement is recommended to reduce illegal turtle trade and conserve these important species.

...

Zein Ahmad Baihaqi1,2, Irkham Widiyono3*, Bambang Suwignyo4, Amado A. Angeles5 

...the gas produced by ruminants is a big factor in the effects of global warming. Alternative the decrease in methane production from ruminants is by utilizing secondary metabolite compounds in plants. These studies are interesting to be continued and explored in an effort to reduce methane production through in vitro and in vivo, because it is proven that there are many types of biological ...
Muhammad Faisal Riaz1, Abu Bakar Muhammad Raza1*, Muhammad Zeeshan Majeed1 and Talha Nazir2
...tural and agricultural plants. This study determined the prevailing diversity of aphids on different economically important plantations in district Sargodha. From November to April 2018-2019 and 2019-2020, about 51,000 apterous adult aphid specimens were collected from various plantations from all six tehsils of district Sargodha and were identified up to species level. Richness and relative abundance of different aphid species were determined by calculating S...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Sher Shah Souri1, Bibi Amina3, Wajia Noor4, Abidullah1 and Muhammad Adil1

...te 90 kg ha-1 produced plants taller (81 cm), nodules plant-1 (22), protein (22.35 %), carbohydrates (61.11 %) and seed N content (3.60 %). Considering Mo x P, interactive effect was found significant for pods plant-1, protein, carbohydrates and seed N content of mungbean crop. On the basis of experimental consequences, it is clinched that mungbean crop with application of molybdenum and phosphorus at rate of 1.5 and 60 kg ha-1 boosted yield and yield attribut...

Hussain Ali1, Shahid Sattar Khan1, Fazal Maula2, Said Hussain Shah3* and Misbah Uddin1

...incertulas) infest the plants from seedling to maturity, which is one of the key pests that infest the rice crop at regular intervals. It is pivotal to find out management strategies for this pest for higher production of rice. Research experiments were conducted to investigate the impact of different rice varieties and synthetic insecticides on the population density of rice stem borer. Experiments were conducted in randomized complete block design (RCBD) rep...
Abdul Jabbar1, Muhammad Tariq1*, Asim Gulzar1, Tariq Mukhtar2 and Tayyaba Zainab3
...ts of extracts of four plants i.e. Azadirachta indica, Zingiber officinale, Syzygium aromaticum and Datura stramonium and their green synthesized silver nanoparticles (AgNPs) were evaluated against 3rd and 4th instar larvae of C. pipiens. The green synthesized AgNPs of these plants were characterized by UV-Multiskaner. LC20 and LC50 values were calculated through Probit and Logit analysis (POLO) software. All the plant extra...

Muhammad Tahir Jan1, Sarfraz Ali Shad2, Mushtaq Ahmad Saleem3 and Muhammad Binyameen2,*

...tton plant. Out of 240 plants inspected, E. vittella females laid 204 and 194 eggs on 40.9% and 36.9%of the plants in 2011 and 2012, respectively. Spearman Rank Correlation showed that a significant and positive relationship (association) existed between the number of infested plants or plant parts and number of eggs laid. In every week, an average of 6.1±1.2 pl

Bikash Puri1, Anil K. Tiwary2, Bharata Regmi3,4, Dinesh K. Singh1, Doj R. Khanal5 and Manoj K. Shah3*

... apparently healthy ruminants (cattle, buffalo, sheep and goat) and screened for Bluetongue virus (BTV) antibodies in sera using a cELISA kit. Out of 220 sera samples, 92 were positive for BTV, accounting for 41.8% prevalence in ruminants. Seroprevalence rate was the highest in Buffaloes (58.3%) followed by sheep and goats (each 40%), and cattle (37.5%). The BTV seropositivity varied significantly (p<0.001) among rumin

Shumaila Nazir1, Iqbal Javed1, Muhammad Luqman2* and Azra3

...he macroeconomic determinants of Mandarin (Kinnow) export from Pakistan. In this study, the dynamic panel data of 29 importing countries for the period of 2005 to 2018 was estimated by GMM (Generalized Method of Moment) model. The variables of total exports of Kinnow, domestic prices, population of importing countries, domestic exchange rate, exchange rate of importing countries, domestic production, and distance between trading partners were used to estimate ...

Nafisa Shoaib* and Aisha Majid Ali

...etoxification of contaminants. The bivalves were exposed to different concentrations of test pesticides in a static system. The MN frequencies of all the pesticide treated mussel groups increased significantly (p< 0.05) until the end of the exposure period as compare to control. The highest MN frequencies were recorded after cypermethrin exposure on day 12 (7, 8.5 and 11‰ for 0.5 ppm, 1 ppm and 1.5 ppm concentrations respectively) in haemolymph. Howe...
Muhammad Tariq1, Imtiaz Rabbani2, Muhammad Shahbaz Yousaf2, Imdad Ullah Khan1*, Hafsa Zaneb2, Sajid Iqbal3, Alam Zeb Khan1, Shakirullah1, Muhammad Shuaib Khan1, Atta Ur Rehman1 and Mumtaz Ali Khan2
...the inclusion of antioxidants in semen extender at the time of cryopreservation. In the current study, semen from four (n=4) healthy Nili Ravi buffalo bulls was collected through artificial vagina and Gallic acid was added to the semen at 1 µM, 15 µM, 30 µM, 45 µM, 60 µM, and 100 µM. A total of six groups were prepared. One group was kept as control where no Gallic acid was added. After the addition of extender, semen was co...

Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1

...lanum lycopersicum L.) plants and these were liberated to healthy plants for transmission of viruses. It was evident from the results that the whiteflies were incapable to acquire and transmit chickpea chlorotic dwarf virus (CpCDV)-a mastrevirus and mastrebegomo chimeric virus (MCV) from the symptomatic tobacco and tomato plants to healthy plants. Whitef...

Doaa Sh. Mohamed1, Nema S. Shaban2 , Mai M. Labib3, Olfat Shehata4 

...compounds derived from plants have medicinal and antioxidant properties. The purpose of the current investigation was to investigate if almond oil could protect male mice against doxorubicin-induced cardiotoxicity. The experimental mice were divided into three groups; control group: received 0.9 percent saline, doxorubicin group: Mice were intraperitoneal injected with doxorubicin (5 mg/kg) ithree times over a period of two weeks (dose every five days) and alm...
Ghada Mohamed Safwat1*, Mohamed Ahmed Kandiel1, Omayma A.R. Abozaid2, Mahmoud Mohamed Arafa3, Sahar Omar Mohamed4
...le, fatty acids, antioxidants concentrations in serum and/or egg yolk and on gene expression of fatty acid synthase and acetyl CoA carboxylase in laying hens. The experiment was applied on 42 Commercial Mandarah strain laying hens which divided equally into control and olive cake (7%) group.Addition of olive cake (7%) led to a significant increase in serum and egg yolk HDL-C and a significant decrease in TAG, cholesterol, LDL-C and VLDL concentrations. SOD, GS...
Soliman Mohammed Soliman
...thane emission from ruminants during the fermentation of feed represents a loss of energy and contribution of greenhouse gas. Feed additives are one of the various dietary strategies that have been used to mitigate and reduce methane production in dairy cows. This aimed to determine the effects of three varieties of feed additives (green seaweed, probiotics Saccharomyces cerevisiae or Yucca schidigera) on in-vitro total gas and methane pro...
Afsheen Noman Saddar1, Anila Naz Soomro2*, Sadaf Tabasum Qureshi1, Syeda Saleha Hassaney1 and Mukhtiar Ahmed Mahar2
...ty enhancing medicinal plants viz root of sweet flag, seed of radish, root of land-calotrops, leaves of peppermint and flower of red cabbage through brine shrimp toxicity assay. Brine shrimp eggs hatching was optimized by applying three temperature levels (25°C, 27°C and 29°C), three salinities (10 ppt, 30 ppt and 35 ppt), two food demands (0.8 g and 1.6 g) and two levels of shrimp egg (1 g/l and 1.5 g/l). Five concentrations (1200, 2500, 5000, 100...
Alshimaa A. Hassanien1*, Asmaa Osama Tolba2, Asmaa A. A. Hussein3, Walaa M. Elsherif4
...ld in Assiut city restaurants, and among food handlers working in the same food premises. In addition to the sequencing of 23S rRNA gene and phylogenetic relation between S. aureus isolated from meat products and food handlers. Also, detect the antimicrobial profile and effect of two natural agents of cow milk proteins such as casein and α-lactalbumin on S. aureus isolates of chicken and beef meat and human. Bacteriological culture and PCR were used for ...

Hassan Ali1, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1* and Muhammad Imran Hamid2

...uently used grain protectants. This situation necessitates looking for alternate biorational control options such as botanical and microbial insecticides. This in-vitro study assessed the anti-insect potential of four local plant extracts and two promising microbial formulations against 5th instar larvae of T. granarium. Toxicity bioassays revealed that the extracts of Citrus reticulata L. and Solanum nigrum L. were most effective against T. granarium causing ...

Hilarius Yosef Sikone1*, Budi Hartono2, Suyadi2, Bambang Ali Nugroho2 

Palwasha1, Siraj-ud-Din1 and Muhammad Fahim2*

...of the districts were tenants (60-75%). Highest literacy rate was observed in Swat District, (high school/matriculates 55%), while illiteracy rate was highest in district Chitral (72%). We believe that along with lack of proper education, know how about the technology and its use in peach production, growing of decades old cultivars i.e., Elberta (No 6) might be responsible for this production decline. Due to poverty, practice of intercropping is common to max...

Muhammad Rizwan, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad

...s and adults on citrus plants. Results showed that the average population of mealybug nymphs (9.92 individuals per branch) and adults (14.55 individuals per branch) was higher in Bhalwal as compared to Kotmomin and Sargodha. The maximum population of nymphs (31.93 individuals per branch) was observed during April and the adult population was maximum (34.86 individuals per branch) during May. The nymphs and adults were remained lower in January and February. A ...

Sana Shakoor, Tahir Rehman Samiullah, Naila Shahid, Abdul Qayyum Rao*, Aneela Yasmeen, Sana Tahir, Ayesha Latif, Saira Azam, Ahmad Ali Shahid and Tayyab Husnain

...th enhancer (ferund adjuvants) was done and produced antibodies in serum was detected by immunodot blotting assay. The appearance of the dot on spotted position confirmed the specificity of anti-HA antibodies. The titer of antibody produced in immunogenic mice was determined through ELISA. The highest geometric mean titer of HA-specific serum IgG, which was greater as compared to the control.

...

Magdy M. Fahmy1, Nisreen E. Mahmoud 1*, Mohamed R. Mousa2, Manal M. Zaki3, Elshaimaa Ismael3, Mai Abuowarda1 

...isposal of the waste remnants of clearing and dredging processes that were taking place by the government in the lake. Additionally, the bio security strategies should be applied in fish farms, also the dependency of farmers on fish seeds for farm stocking from natural open water instead of the hatcheries should be avoided to prevent the entrance of parasites and other undesirable organisms from open seas to the lake and corresponding fish farms. This stu...

A. Samy1*, H.M.A. Hassan1, Fatma T.F. Abd-El Ghany2, Shama H. Morsy2 

...pm, Improved the antioxidants status by enhanced total antioxidant capacity also, significantly (P<0.05) enhanced hepatic antioxidants enzyme (superoxide dismutase, catalase, and glutathione peroxidase) compared with the control. Slightly (P>0.05) decreased in malondialdehyde of all treatments compared to the control. Also, there is no any negative effect on the thyroid hormones with any treatments compared to the cont...

Zunaira Noreen* and Khawar Sultan

...migrant and 3 winter migrants. The multinomial analyses and principal component analysis (PCA) results showed that out of 29 species using forest as habitat; 13 were “generalists”, 6 species were “rare to classify”, 9 species were “poplar specialist” and only one species was “Eucalyptus opportunist.” Common myna and house crow were the most abundant species. Black kite, house crow, and common myna were found to b...

Hosny Kesba1, Ashraf Suloma2, Samy Sayed3*, Abdullah Abdel-Rahman1 and Shaimaa Diab1

...the production of many plants and is a major problem in organic systems. This study was carried out to examine the influence of irrigation with different effluent water sources, including semi-intensive tilapia pond (STP), intensive tilapia biofloc (ITB) systems, and well water (WW), on the reproduction of Meloidogyne incognita infecting eggplants7 or 45 days after planting in sandy loam or sandy soils. Each irrigation sourc...

Mashakgene Isaac Senoamadi, Thobela Louis, Tyasi Teedzai Chitura* 

...g forty-seven Small ruminants farmers (both males and females) of mixed ages. The average FAMACHA© score for the goats was three while for sheep the average score was 2.62. Ninety-eight goats (60%) had a FAMACHA© score of three and above while fourteen sheep (52.4%) had a FAMACHA© score of three and above. There was a high occurrence of haemonchosis in goats compared to sheep (p<0.05). Differences in occurrence between age groups, sex and phy...

A.J. Shoyombo1, O.O. Alabi, B.M. Falana1*, R.A. Animashahun1, S.O. Olawoye1, F.A. Okenniyi1, M.A. Popoola2, C.I. Ukim2, A.M. Ake, A.E. Jubril3 

...s, cattle and small ruminants. It is a condition which do not often occur but requires a dogged approach in treating affected animals. Atresia ani is a congenital embryological condition that often suffice when the hindgut refuses to connect with the perineum for the proper discharge of muconium. In this study, a three-day-old calf was observed to be suffering from Atresia ani at the Landmark University Teaching and Research farm. This condition was obvious du...

Ahmed Alazzouni1, Ashraf Al-Brakati2,*, Sherif Rabie1, Mohamed Gabry1 and Basmaa Hassan1

...eutic agents and as adjuvants to ameliorate histopathological changes associated with leukemia.

...

Roshana Mukhtar1, Shaheen Shahzad1*, Sajid Rashid2, Maryam Rozi2, Madiha Rasheed3, Imran Afzal4 and Pakeeza Arzoo Shaiq5

... pathogenic sequence variants. CEP patients were identified using successive clinical tests. Blood samples of patients were collected and processed for genomic DNA extraction followed by Sanger sequencing to identify pathogenic mutations in UROS gene. Sequence analysis revealed a pathogenic missense mutation (c.935T>C [p. L237P]) in the exon 10.The sequence was further analysed in-silico to determine the effect of pathogenic mutation on protein structure. I...

Djadouni Fatima* and Meliani Amina

...oats are both small ruminants with wide distributions due to their production of milk, wool, and meat. As such the diseases of these animals are of great economic importance to humans. Poor nutrition, poor breeding, poor hygiene and poor management systems are the most responsible factors of these diseases that cause annually significant livestock losses affecting the economy, animal diversity and ecological balance. These diseases are transmitted among animal...

Ahmed M. Darwish1*, Hassan R. Darwish1, Dalia M. Mabrouk1, Mohamed A. Abdelhafez1, Ahmed M. Abdel-Salam2, Ibrahim E. Mohamed3, Ibrahim M. Farag1 

Sajad Ali1*, Naeem Ur Rehman Khatak1, Shahab E. Saqib2 and Saleem ur Rehman1
...50 landowners and 200 tenants in the study area. A multi-stage sampling technique was employed. Furthermore, to estimate wheat productivity, differences in wheat productivity and socio-economic factors between owner and tenant wheat growers, a log-log regression model and an independent unpaired sample t-test was used in conjunction with face-to-face interview schedule. In addition, a dummy variable was added to the production function to analyze the impact of...

Mona M. Osman1, Kamelia M. Osman2, Manal Abu Elmakarem Mohamed1, Mahmoud E. Hashad2, Jeeser Alves Almeida3, Alaa Saad4, Octavio Luiz Franco5,6, Heba N. Deif 2* 

...ential virulence determinants viz H2S production and catalase activity, for their possible roles in biofilm formation, antibiotic resistance and hemolytic activity of M. ovipneumoniae. The recovered sheep isolates of M. arginini and M. ovipneumoniae were examined bacteriologically and by PCR using Mycoplasma species-specific primers. MIC testing of the axenic isolates showed that 19 of them were 100% susceptible to tulathromycin, streptomycin, oxytetracycline ...

Saima Naz1*, Ahmad Manan Mustafa Chatha2, Sajjad Ali2 and Muhammad Irfan Ullah3

...s of environmental pollutants like heavy metals, pesticides and antibiotics cause changes in insect diversity and continuously have become threat to health of living organisms. Additionally, pollutants coming from traffic smoke also affect the interaction of insects with other insects and plants. Exposure of toxic level of heavy metals can cause DNA damage, learning, sensory disability and...

Bridget Adah1*, Clara Kwanashie2, Haruna Kazeem2 and Samuel Mailafia1

...irosis in porcine inhabitants in different regions in Nigeria.

...

Muhammad Tahir Latif1*, Muzzammil Hussain1, Ayesha Latif2, Majid Hamid Bajwa1, Iftikhar Ahmad1, Ali Zohaib1, Naeem Faisal1 and Muhammad Hamza3

...er fixation of nursery plants in the soil etc. The study results projected mechanically transplanting area (ha) for riding type MT as well as for walk after type MT respectively as 64.78 and 28 annually. Accordingly, there would be 36.15 (000 ha) mechanically transplanted area (5.41%) of province Punjab, Pakistan annually after completion of the Govt. prevailing project on rice.

...

Maria Qibtia1, Sehrish Faryal1, Muhammad Wasim1, Farzana Chowdhary1, Muhammad Tayyab1, Ahmed Mansovuri2, Zeeshan Ahmed2, Muhammad Hamid3 and Ali Raza Awan1,*

...trait and two common variants in intron 13 and 9 (13910-C/T and 22018-G/A) along with the P-value significance level. Therefore in this study, we aimed to access genetic predisposition and clinical manifestations of LNP and LP in 80 subjects (30 subjects with LP and 50 LNP). The presence of T-13910, C-13913, G-13915, G-13907, C-3712, C-13779, A-13937, G-14009, C-14010, T-14011, T-14044, T-14091, A-14107, C-14176, A-14156 and A-22018 polymorphic vari

Dali Wang1,2, Yujing Zhu1,2, Wancai Xia1,2, Mei Zhao1,2,3, Chan Yang1,2 and Dayong Li1,2*

...r shrubs or herbaceous plants. Gnaphalium hypoleucum had the highest importance value of the herbs (27.48%), while Leycesteria formosa had the highest importance value of the shrubs (17.33%). The Shannon-Wiener diversity index was significantly higher in the lower section and the Bray-Curtis distance was significantly lower, suggesting vegetation recovery has progressed faster on the lower end of the debris field. The speed of restoration within the landslide ...

Noora Hassan Hezam Al-Aqmer1*, Zain Aamir2, Muhammad Farooq Hanif3, Soumble Zulfiqar4, Sibgha Zulfiqar1, Mateen Izhar5 and Abdul Rauf Shakoori4*

...t was taken from participants, demographic data was collected, and 5 mL of blood was drawn from each participant and used for DNA extraction, polymerase chain reaction and restriction fragment length polymorphism analysis. After restriction, samples were run on 2% agarose gel followed by visualization under UV light. Data analysis was done using IBM SPSS 24. We found that the distribution of ApaI genotypes was 28 (42.4%), 27 (40.9%), and 11 (16.7%) for the gen...

Shuhuan Li1*, Yongheng Bo2, Youzhi Li3 and Xiuzhen Yang2

...rgic drug from natural plants, and has been widely used in the clinical applications of animals and humans. However, in livestock production, excessive or improper use of atropine will lead to atropine residues in meat. When people eat animal meat from these sources, it will pose a potential threat to human health. Thus, in production practice, atropine residues in meat are usually determined quantitatively. In this study, high performance liquid chromatograph...

Zaniar A. Abas1, Mohammed Omer Baba Sheikh2,5*, Hardi N. Aziz3, Omed I. Abid4 

..., and ten new CPV-2a variants. In the CPV-2 studied, several unique and existing mutations have been discovered, indicating the emergence of CPV-2c variation in Iraq.  Genetic differentiation study based on the genetic variation on the VP2 gene has shown that (CPV-2/Sul) strain belongs to new CPV-2b and CPV-2c, however, the (CPV-2/Erbil & CPV-2/krk) strains belong to new CPV-2a. A Phylogenetic tree constructed basis on the VP2 gene revealed that the f...

Mei Zhao1,2, Xiaoqin Zeng1, Wancai Xia1, Baoping Ren3,4, Hao Feng1, Fan Wang1, Qihai Zhou5,6* and Dayong Li1,7*

...) in 2017. One of the infants was born during diurnal to a multiparous female, while the other one was a nocturnal birth to a primiparous female. Actual parturition lasted only 7 min for diurnal birth. During the parturition process, the mother received what could be described as assistance in delivery from the other females and resident male within one male unit. During each of the two births, the one-male unit’s resident male patrolled the area to keep...

Eman Alsayed Hammad1* and Mahmoud Mohamed Hassanin Hasanin2

...um oxysporum on coleus plants, Coleus forskohlii in vitro and greenhouse conditions. Nanoemulsions of thyme (droplets size was in the range of 25.4–32.9 nm) and spearmint (droplets size was in the range of 5.91–9.77 nm) at concentrations 4000 and 5000ppm separately, recorded the best results in vitro investigations, completely prevented F. oxysporum growth at all concentrations, and increased M. javanica mortality by 100%, in comparison to the non-...

I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2,  I Gede Mahardika1,  I Gusti  Nyoman Gde Bidura1

...-faunating agent in ruminants. In some areas, these plants commonly being used as an alternative feed for ruminant, particularly during the dry season, but the study of its effect was limited. This study aims to determine the effect of additional Hibiscus leaf flour (HLF) in the concentrate on protein balance, blood metabolic profile, and body composition of Etawah crossbreed goats. A total of 20 goats with an average initia...

Aiman Batool1, Muhammad Sohail Sajid1,2*, Hafiz Muhammad Rizwan3**, Asif Iqbal4, Imaad Rashid5, Ibadullah Jan6, Faiza Bano7, Fiaz Ahmad8, Waqas Ahmad1, Muhammad Nisar Khan1 

...Risk factors, Small ruminants 

...
Asmaa Khamis1, Osama Abdalla1, Mohamed Hashem2, Noha Abdelnaeim1*
... major (PM) are herbal plants that are supposed to have hepatoprotective properties. This study aimed to compare the effects of both medicinal plant extracts on rats intoxicated with carbon tetrachloride (CCl4). A total of 60 male albino rats were equally distributed in six groups. The first group received purified water and was kept as a control. The second and third groups were given oral PN and PM (500 mg/kg/day) for 31 days, respectively. The fourth group ...

Muneeza Zafar1,2,3, Fazli Rabbi Awan2,*, Munazza Raza Mirza3,*, Sumaira Nishat2,4, Sajid Ali Rajput5 and Imran Riaz Malik1,*

...vel most deleterious variants of APOB. We also try to predict the structural model of APOB through protein docking. The results indicate the applicability of in silico approach to propose the most deleterious SNPs of APOB that should be prioritize for future genetic association studies in cohort of cardiovascular patients. While their structural impact on APOB may suggest these predicted nsSNPs possibly be a better drug target and contribute to the treatment a...

Iram Liaqat1*, Umaima Bibi2, Muhammad Arshad3 and Najma Arshad2*

...ed medically principal plants; Hyssopus officinalis, Origanum vulgare, Thymus vulgaris, Glycyrrhiza glabra, Cordia latifolia and Zizyphus jujuba. Antioxidant activity was determined by total phenolic content determination, Pyrogallol method, 2,2-diphenyl-1-picrylhydrazyl (DPPH), hydroxyl radical scavenging assay, and free-radical-scavenging assay. Results revealed that O. vulgare and T. vulgaris possess high free radical scavenging capability and significant a...

Nur Prabewi , Supriyanto, Budi Purwo Widiarso* 

...asured including antioxidants, protein, cholesterol, and chemical residues in meat, as well as meat tenderness and color. The study conducted with Completely Randomized Design (CRD) consisting of 3 treatments and 10 replications. Treatments includes: T0= meat marinated for 0 hour (unmarinated), T1= meat marinated for 3 hours, and T2= meat marinated for 6 hours. Our results indicated that herbal marination significantly improved the quality of broiler meat in ...

Abdul Qadoos1, Muhammad Bakhtiar2*, Wajiha Seerat3, Asma Bibi4, Sohail Rahman1, Muhammad Noman Khan5, Ghulam Yaseen6, Mamoona Munir7 and Sadiqullah Khan8

...ller m-2 (304), taller plants (95.40 cm), maximum spike length (10.72 cm), more grain spike-1(49), greater 1000-grains weight (42 g), greater biomass (10719 kg ha-1), maximum grain yield (4148 kg ha-1) and highest economical yield (38%). Regarding Zn levels Plots treated with Zn @ 16 kg ha-1 produce more plants m-2 (295), taller plants (93.5 cm), maximum spike length (10.57cm), more grains...

Iftikhar Alam1*, Muhammad Ali2 and Muhammad Farooq3*

... connect student participants in a photovoice action study design in university settings to identify themes of healthy eating and lifestyle environment. This study used action-research design with photovoice-elicitation technique engaging students of different age categories, both male and female, from a variety of study disciplines at Bacha Khan University, Charsadda, KPK, Pakistan. Data on food and physical activity were collected using a set of food and lif...

Mohamed A. Hussein1, Bahgat A. Abd El-Rehman2, Kareem A. Eldin2, Mohamed Fouad Mansour1* 

...te nanoparticles as adjuvants and evaluate their impact on biochemical, cellular and humoral immune response in sheep, The prepared vaccines were sterile, safe, emulsion is stable and validity within acceptable limit 0.02 EDF50/ml up till 15th month with AlP-NPsV and AlHV except Ch-NPsV that was valid up to 16th month. Lymphocyte count increased from the 1st week post-vaccination till the peak at 5th, 4th and 3th months in groups vaccinated with Ch-NPsV, AlP-N...

Oluwatoyin Adenike Fabiyi

...rground water as contaminants. This necessitated the search for bio-nematicides, accordingly the nematicidal prospect of chromatographic fractions from Mangifera indica as a substitute to synthetic nematicides in the control of Meloidogyne incognita pests of tomato was evaluated. Crude extracts of M. indica bark was fractionated on silica-gel (120-150 mesh) using glass column. The resulting fractions were investigated in screenhouse and field trials. The fract...

Oluwaseun Adetarami1*, Oluwatoyin Olagunju2, Babatunde Adebayo Oyebamiji1, Adegboyega Abel Odeyemi3 and Sina Basil Johnson4

...income are major determinants influencing the utilization of FBS approach. The study concluded that the utilization of FBS approach by smallholder cocoa farmers contributes substantially to the profitability of cocoa business. It is, therefore, recommended that effective general extension services should be extended to the study area to intensify the use of FBS introduced innovative skills by farmers for cocoa production. 

...

Farzana Begum* and Gohar Ayub

...n seeds harvested from plants sown on March 30 as compared to seeds harvested from late sown plants on May 9. Highest hard seed (23.69 %) was recorded in seeds collected from late sown plants on May 9 as compared to other sowing dates. As for as harvesting stages are concerned, maximum seed weight pod-1(3.57 g), 1000 seed weight (61.33 g), seed yield (1.67 t ha-1), germination (81.21 %) an...

Saima Mehar1 and Salma Javed2*

..."text-align: justify;">Plants are the one of the magnificent and captivating source of natural bio-pesticides. The currentstudy was performed for phytochemical analysis and to assess the nematicidal and nematostatic potential of crude extract of Withania coagulans. It is known for its withanolide class of chemical compounds. The biological assessment of two primary fractions of W. coagulans crude extract, chloroform and butanol, is the focus of the current stu...

Mohamed E. El-Speiy1, Tarek A. Sadak1, Mohamed A. Abd-Elaal1, Ayman M. Khalifah2, Amr S. Morsy2*

...ing rabbits, Medicinal plants, Synergistic effect
...
Amreen Zahra1*, Mushtaq A. Saleem2, Hasnain Javed3, Muhammad Azmat Ullah Khan4 and Abdul Rauf Shakoori4
...ance and viral escape mutants of human immunodeficiency virus (HIV-1) worldwide. Therefore, a deep molecular insight unveiling the genetic characteristics of the prevailing strains is the need of the hour for successful disease control interventions in endemic countries like Pakistan. Here we present, a detailed molecular and computational analysis of the major genetic constituents, Gag-Pol region of HIV-1 for the very first time in Punjab-Pakistan including t...
Ch. Muhammad Rafiq1, Muhammad Rizwan1*, Bilal Atta1, Arshed Makhdoom Sabir1, Misbah Rizwan2, Muhammad Arshad3, Muhammad Zeeshan3, Hamza Latif3, Usama Bin Khalid1, Shawaiz Iqbal1
...th a uniform number of plants in each plot had less incidence of N. lugens as compared to narrow spaced (0 and 30 cm) geometries. More number of N. lugens nymphs (80.0-95.0 number/plant) were recorded with less spaced planting geometry as compared to higher spaced planting geometry (27.0-29.5 numbers/plant) during both years. With different planting geometry, no significant difference was recorded in the agronomic parameters except yield and 1000 grain weight....

Atta Ullah*, Nasrullah Khan, Ataur Rahman and Rafi Ullah 

...obtained by local inhabitants from different indigenous angiosperms and their products in Sheikh Buddin National Park. Information from 250 respondents (240 male, 10 females) was gathered randomly about plants’ medicinal and folk uses in the park. One hundred and sixteen plants species belonging to 99 genera and 50 families were recorded and identified with the help of available lite...

Ngoc Tan Nguyen1*, Minh Thanh Tram1, Thi Thu Pham1, Tan Loi Le1, Thi Khanh Ly Nguyen1, Tuan Thanh Hoang2, Cong Thieu Pham3, Nguyen Khang Duong4 

...ation of 49 sequence variants in 599 bp of the control region revealed the nucleotide composition was Adenine (A) = 32.55%, Thymine (T) = 28.33%, Guanine (G) = 14.67%, Cytosine (C) = 24.87% and G+C content was 39.12%. Out of a total of 50 nucleotide polymorphic sites, 48 were transition and 2 were transversion, with 21 haplotypes observed. Nucleotide and haplotype diversity indices (π and Hd) were 0.03005 and 0.889, respectively. The genetic diversity of Sa...
Makhamadi Abramatov1*, Abdurakhim Kuchboev2, Bakhtiyor Ruziev3 and Khumoyun Sobirov2
...matodes in domestic ruminants of Uzbekistan. Nematodes were collected from the gastrointestinal tract of 611 small ruminants and 105 of cattle during the 2018-2020 in the farms of in Uzbekistan. These nematodes represented 28 species, including sheep - 25, goats - 21 and, cattle – 22 of these 27 species belonged to in are geohelminthes, and only 1 species was biohelminthes the main core of nematodes of the gastrointest...

Muhammad Hammad Fayyaz*, S. Murtaza Hassan Andrabi and Muhammad Shafiq Haider

...oses of combined antioxidants (0.5 mM GLU+ 5mM CYS, 0.5mM + 10mM CYS, 1mM GLU + 5mM CYS, 1mM GLU + 10mM CYS and Control). At post-thawing, progressive motility, plasma membrane integrity (PMI), and livability of buck spermatozoa were higher (P< 0.05) with 1mM GLU and 10mM CYS as compared to control. In the second experiment, post-thaw progressive motility, PMI, and livability were higher (P< 0.05) with 1mM GLU + 10mM CYS and 1mM GLU + 5mM CYS compared to...

Khalid Javed Iqbal1, Irfan Baboo2*, Arshad Javid3, Noor Khan4, Hamid Majeed5, Azra Anwer1, Zahid Farooq2, Muhammad Altaf6 and Moazam Jalees7

...bes containing anticoagulants EDTA and transferred immediately to the laboratory for the assessment of their blood profile. There was recorded no mortality after 96h of exposure period. IONPs significantly affected the counts of WBCs, Hb, MCH and MCHC of experimental and control groups. The analysis of blood profile demonstrated that haematological parameters; the number of WBCs and Hb were increased in T1 and decreased in T2 in relation to T0. The counts of R...

Reyad R. Shawish, Reda E. Hamed*, Zakaria H. Elbayoumi 

...ere obtained from restaurants throughout the Menoufiya governorate in Egypt. By using the gas chromatography–mass spectrometry (GC–MS) technology, all collected samples were examined for the presence of certain polycyclic aromatic hydrocarbons (PAHs), and comparison of their contents with the recommended standard limits. Regarding the obtained findings, kabab recorded the highest concentrations of PAHs and PAH4 (the sum of four different polycyclic...

Abdul Ghaffar*, Niaz Hussain, Muhammad Nadeem, Khalid Hussain, Muhammad Aslam, Mudassar Khaliq, Muhammad Irshad, Zubeda Parveen and Muhammad Younas

...nalysis. Analysis of variants revealed good variation among the accessions for the data recorded traits. Principal coefficient analysis differentiates all the traits into six PCs. Two components expressed more than one Eigenvalue which collectively contributed 80.12% towards the genetic variation. High positive loadings were expressed by the secondary branches per plant and pods per plant in all components. Path analysis revealed that secondary branches/pl

Tooba Ather1, Muhammad Rafiq Shahid2*, Muhammad Ahsin Ayub3, Javed Iqbal2, Muhammad Asim Bhutta2, Muhammad Akram2, Naveeda Anjum4, Muhammad Rizwan6, Hafeezur Rehman5 and Umar Farooq5

...d on diversity of host plants. Different concentrations of Pyriproxyfen and Buprofezin are Insect Growth Regulator (IGR) were bio-assayed against 3rd instar of CMBat Integrated Pest Management Laboratory, Department of Entomology, University of Agriculture, Faisalabad, during 2016. The results revealed that mortality of 3rd instar of P. solenopsis increased with increase in concentration of Pyriproxyfen and Buprofezin at three days of post application interval...

Khalid Khan1*, Ahmed Farhan Saeed2, Sanam Wagma Khattak3 and Saima Liaqat4

...derlined the key determinants of adoption of improved poultry practices and technology in the poultry industry of district Lasbela, Balochistan; Pakistan. A multistage random sampling method was adopted to select the samples of 75 farmers from five tehsils of Lasbela namely Hub, Gadani, Uthal, Dureji, and Bela. Around 15 farmers were randomly selected and questioned in each of the tehsil. To achieve the objectives of study nonparametric correlation coefficient...

Dede Kardaya*, Dewi Wahyuni, Elis Dihansih 

...that function as antioxidants, so the use of them in ration is expected to improve the meat quality of spent layer ducks. Sixty spent layer ducks were fed four rations including commercial rations (R1), nonconventional rations + 2% Asam gelugur leaf meal (AGLM) (R2), nonconventional rations + 4% AGLM (R3), and nonconventional rations + 6% AGLM (R4) in a completely randomized design with five replicates containing three...

Muhammad Ajmal Khan1, Muhammad Yahya2*, Ali Hazrat2, Javed Khan3, Saeed Jan4, Tabinda Nowsheen2 and Inam Ullah5

...al constituents, antioxidants, and antibacterial activities of methanolic extracts of T. camphoratum leaves. The methanolic extract was quantitatively evaluated for alkaloids, flavonoids and terpenoids contents. The antibacterial activity of methanolic leaves extract of T. camphoratum was carried out against Gram-positive and Gram-negative bacterial strains through agar well diffusion assay (small wells were made with cork borer and 6μl of plant extract was...

Umair Faheem1*, Qurban Ali2, Mussurat Hussain1, Abrar Ahmad3, Tamsila Nazir2, Ghayour Ahmad3, Idrees Ahmad3, Madiha Mobeen4, Hammad Hussnain3 and Nadia Hussain Ahmad3

...s insect pests. Cotton plants shows genetic resistance or tolerance against these insect pests. In the current experiment six varieties of cotton i.e. CIM-496, CIM-534, NIAB-111, MNH-786 and Bt-121 were sown in the field under sprayed and un-sprayed condition to check the genetic resistance or tolerance against these insect pests and to also check the population of the parasitoids. It was observed that MNH-786 and Bt-121 were the most resistant or tolerant var...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

... well established that plants can communicate with each other under different stressful conditions through (signals, cues, and rhizosphere interactions). Numerous studies have been conducted to find how plants respond to different neighbors at various points of genetic affiliation. Contrasting results and lack of molecular evidence in species recognition studies have made this topic more curious and complex. Some plant speci...

Ochieng Onunga George*, Owuor Ndonga Millicent Florence, Mario Kollenberg  

...consist of several pollutants, including condemned meat parts, aborted fetuses, animal trimmings, horns, undigested ingesta (paunch contents), bones, and hairs. In contrast, liquid parts consist of blood, dissolved solids, urine, gut contents, and wastewater from slaughter operations and floor cleaning. It has been reported that Abattoir wastes can have negative impacts on the areas surrounding them by causing pollution and public health concerns. Therefore, t...

Arsalan Maqbool1,2, Faez Firdaus Abdullah Jesse1,3*, Eric Lim Teik Chung3,5, Abd Wahid Haron3, Mohd Azmi Mohd Lila5, Bura Thlama Paul3,4, Khaliq ur Rehman Bhutto3,6 

 

...ory system of small ruminants from clinical and research perspectives. However, there is still a lack of understanding of this disease’s pathophysiological changes and impact on the reproductive system of affected animals. Therefore, the purpose of this study was to examine at the reproductive hormonal profile of female goats experimentally infected with Mannheimia haemolytica serotype A2 during rainy and hot seasons. Twenty-four healthy female, non-preg...
Eman M. Aboelela1, Mohamed A. Sobieh2, Eman M. Abouelhassan3, Doaa S. Farid4, Essam S. Soliman2*
...nd environmental determinants. A cross-sectional study was designed to last for four successive seasons from September 21st, 2020 to September 20th, 2021. A total of 1393 cats and 1511 dogs were admitted and examined for parasitic infestations. PPinfestations revealed highly significant (P < 0.01) increases during fall and spring and fall in dogs and cats respectively; at < 1-year dogs and cats during all seasons; and during winter in males and spring in...
Ali Basim Abd Al-Hadi*, Tahreer Mohammed Al-Thuwaini, Mohammed Baqur Sahib Al-Shuhaib
... used to confirm the variants in the amplified fragment of the FST gene (exon 4). Results of the genotyping technique identified three genotypes: CC, CG, and GG. Sequencing analysis revealed a novel mutation c. 25760691 C>G in the CG genotype. Association analysis revealed significant differences (P ≤ 0.05) between CC and other genotypes in reproductive hormone levels. Estrogen and progesterone were significantly higher (P≤0.05) and follicle-stimulati...

Zahin Anjum1*, Farhat Shehzad1, Shaista Ali1, Sumbla Yousaf2, Amina Rahat1 and Hamid Ullah Shah3

... spots or general restaurants, and control samples of gas and electric grilled meat samples were also prepared and analyzed. Significant difference sp≤0.05 in PAHs levels were observed in different grilling procedures. Among the mutton samples, the highest concentration of PAHs was recorded in mutton grilled on coals. The chrysene, naphthalene, flourenthene and DBAHA concentrations were assessed high in mutton samples grilled on coals. Furthermore, this res...

Khaliq Dad1, Fenliang Zhao2, Rumsha Hassan3, Kainat Javed3, Humaira Nawaz4, Muhammad Usman Saleem5, Tahreem Fatima6 and Muhamad Nawaz3*

...ich are transported to plants as well as animals through food chain and severely affect the ecosystem by causing acute or chronic disorders in the people of all ages. Similarly these pesticides cause serious threats to the aquatic ecosystem after their release by comprising different toxic substances, heavy metals and contaminants. This review paper has focused on the toxic nature of different pesticides, impacts and their p...

Muhammad Furqan and Zulfiqar Ali

...xt-align: justify;">Pheasants are bioindicators of our ecosystem and their population is declining. We investigated diet composition and threats to kalij pheasant Lophura leucomelanos to prepare conservation and management strategies in Azad Jammu and Kashmir, Pakistan. The diet analysis was done through crop contents of kalij pheasants, threats were assessed through field surveys, communities meeting, and data from 250 ques...

Hairul Islam M. Ibrahim1,2, Abdalla A. Sayed1,3, Abdel Naser A. Ahmed4,5 and Emad A. Ahmed*1,6

...ly regulated the antioxidants and apoptotic markers including Caspase-3, TGF-β, SIRT-1, CCL-2 and MBP. Moreover, PCB modulated the levels of inflammatory mediators and TGF-β in splenic cells. The production of myelin basic protein (MBP) increased in PCB treated EAE mice. Taken together, the current finding revealed that, PCB suppressed EAE pathological checkpoints for demyelination and apoptosis in CNS and act as a therapeutic role for treatment of M...

Muhammad Akram1*, Muhammad Imtiaz Shafiq2, Amber Malik3, Farmanullah Khan4, Munir Ahmad Bhinder5 and Muhammad Sajjad6

..., a total of 504 participants including 261 CVD patients and 243 healthy individuals were enrolled after taking informed consent. The analysis of the three allelic variants GSTM1, GSTT1, and GSTP1 was carried out through PCR-based amplification. Amplification of GSTM1 and GSTT1 was performed using the specific primers designed by Primer-3 software. GSTT1 and GSTMI genotypes were determined by comparing the sizes of amplified...

Hakan Kececi1*, Yasin Ozturk2, M. Bahaeddin Dortbudak3, Seda Yakut4, Gurdal Dagoglu5 and Merve Ozturk1

...bur, potentially toxic plants is found abundantly in meadows and pastures. One of the most significant ingredients that causes toxicity is atractyloside (ATR). In this study, the concentration of ATR in cocklebur seeds was determined as 4 mg/g seed. The study involved 54 rats which were divided into a total of 9 groups including one control group. A single dose of cocklebur seed extract was provided by gavage after being concentrated by 2 ml for each animal (8...

Nguyen Hai Quan, Nguyen Huu Van*, Nguyen Thanh Thuy, Vo Thi Minh Tam, Le Duc Thao, Le Duc Ngoan 

...E and ME values for ruminants were 3,436 and 2,818 kcal/kg DM, respectively. In Exp. 2, eight treatments included: Control (CTL) – without any additives; Salt 0.5% added to CTL (SCTL); Cassava byproduct added to CTL at 5, 10 and 15% (CB5, CB10 and CB15, respectively); Molasses added to CTL at 2.5, 5.0 and 7.5% (M2.5, M5.0 and M7.5, respectively). Samples were collected at day 0, 7, 14 and 21 for pH and ammonia, and day 0 and 21 for chemical analysis. Res...

Saleha Tabassum1, Muneeza Zafar1,2, Munazza Raza Mirza1*, Muhammad Iqbal Choudhary1,3, Ikram ul Haq4, Imran Riaz Malik2, Ambreen Ansari1 and Mehtab Alam5

...tal of 260 study participants, including 122 with tuberculosis disease (TB) and 138 healthy control (HC) were included. Out of these 122 TB disease subjects (67%) were diagnosed with PTB (n = 82) and 33% with EPTB (n = 40). Tri and Tetra- ARMS-PCR techniques were used to genotype rs2276886 of CXCL9 and rs5606198 of CXCL10 for all the samples. The results showed significant association (OR, 2.1 (0.99 to 4.30), p = 0.04) of A allele of rs2276886 with EPTB group ...

Mohamed Saleh*, S.E. Laban, G.Z. Mostafa, S.T. Moubarak 

...litter, the two disinfectants were used for the disinfection of nest bedding (sawdust). Paraformaldehyde powder was mixed manually with nest bedding (5 grams per nest), while potassium peroxy- monosulfate 0.5% based disinfectant was sprayed in each nest. Random samples were collected before and after treatment by 24-, 72- and 120-hours intervals and were tested for total bacterial, coliform, and fungal counts to evaluate the reduction percent achieved. The obt...

Ezz Ibrahim Khalifa, Ahmed Loly Ibrahim Desoky, Adel AbdElaziz Elbadawy, Gamal Ibrahim El-Emam, Tarek Messlam Mahmoud Mahdy* 

...reptomycin), and antioxidants (vitamin E), which served as control extender (E0). However, 2nd, 3rd, 4thand 5th replicates were serviced as trial extenders as E1, E2, E3, and E4, which supplied 0.50, 1.00, 1.50, and 2.00 % of BBE as natural sources of energy, antibiotic and antioxidant, respectively. Results indicated that adding BBE to E1, E2, E3, and E4 extenders has increased (P<0.05) in all sperm characteristics and biochemical activity of extender as c...

Haitham Al Masruri1, Rashid Al Zeidi2, Aiman Al Mufarji3, Abd El-Nasser Ahmed Mohammed3, Ahmed Al-Madani4, Al-Hassan Mohammed5* 

...ve performances, antioxidants, and milk production and composition have been well documented. M. oleifera contains valuable chemical constituents such as proteins, essential fatty acids, vitamins, and beta-carotene. The M. oleifera composition varies depending on nutrient availability for production, species, and lifespan of trees. Extracts of leaves and seeds were used for the production of invaluable compounds. Knowledge of M. oleifera impacts on productive,...

Iqtidar Hussain1*, Shakeel Ahmad Jatoi2, Muhammad Jawad Nazir1, Ehtesham Ul Haq1, Faheem Abbas1 and Muhammad Saqib Raza Shah1

...lopathy from perennial plants (trees) surrounding our crops in the field is our focus in agroforestry. To quantify its severity, the phytotoxic impact of popular (Populus deltoides L.) leaves aqueous extract was determined in cultivated oat (Avena sativa L.), maize (Zea mays L.), rice (Oryza sativa L.), pearl millet (Pennisetum glaucumL.), bread wheat (Triticum aestivum L.) and sorghum [Sorghum bicolor (L) Moench. Response of aqueous leaves extract was assesse...

Muhammad Jan1*, Muhammad Ashraf Sumrah1, Javed Iqbal2, Muhammad Aslam3, Rizwan Latif4, Muhammad Arif5, Muhammad Tahir Akbar6 and Hafiz Husnain Nawaz1

...bitors, use of bio stimulants, and proper use of mineral nutrients at proper nutrient demanding growth stage and use of different vitamins and amino acids. The current review was prepared by highlighting the use of these approaches for alternate bearing control in olive.

...

Ghulam Qadir1, Khalil Ahmed1*, Muhammad Ashfaq Anjum1, Quais Muhammad Affan2, Muhammad Zaighum Mushtaq3, Muhammad Amjad Qureshi4, Amar Iqbal Saqib1, Hafeezullah Rafa1, Abdul Wakeel1, Ghulam Shabir1, Muhammad Rizwan1, Muhammad Qaisar Nawaz1 and Muhammad Faisal Nawaz1

...ing of available local plants which can grow or survive under salt stress and have considerable economic importance to the farming community. Therefore, a three-years pot experiment was executed to explore the salinity tolerance of medicinal plants i.e., Podeena (Mentha spicata), Hina (Lawsonia inermis), Qulfa (portulace oleracea), Methi (Trigonella foenumgraceum), Dill (Anethum graveolens) and Kalwanji (nigella sativa), und...

Ghalib Ayaz Kachelo1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Shahbaz Talib Sahi1, Nasir Ahmad Khan1, Akhtar Hameed2, Noor Muhammad1 and Muhammad Saqib Mushtaq1

...their combination. The plants treated with tilt + moringa was found effective as compared to alone applications. tilt + moringa showed minimum disease incidence (15%) followed by Tilt (18.33%) and moringa (32.33%) as compared to control. While under the field conditions same combination of Tilt + moringa expressed minimum disease incidence (18%) followed by tilt (20.83%) and moringa (34.50%). By these findings it is recommended to farmers that, Alternaria leaf...

Tertia Delia Nova1*, Yulia Yelita2, Rizky Machicula1

...ally friendly. Aquatic plants belong to the duckweed family which can be found in swamps, lakes, and rice fields. This feed is classified as an unconventional feed that can be used as an alternative feed ingredient for fibrous protein sources. In addition, it contains several minerals, xanthophyll pigments and -carotene which are important nutrients for ducks. However, the practical use of this plant has not been fully studied. This experimental study used a R...

Hassan A. Aidaros, Eman M. Hafez, Halla E.K. El Bahgy* 

...d disinfection. Disinfectants play an essential role in controlling pathogens in health care, animal production, and food-related industries. The effectiveness of a disinfectant is mainly dependent on the active compound chosen, its concentration, and the cleanliness of the surfaces to which it is applied. The purpose of this study was to evaluate the effectiveness of some disinfectants (Prophyl 2000®, G7®, Pron-Tech...

Ayesha Khan*, Zubair Ahmad Khan and Urooba Pervaiz

...d 41% of the Field Assistants (randomly selected) of the three districts. Thus, the total number of respondents for the study was 81. The interview schedule was quantitative containing closed-ended questions restricting the respondents to choose from the given options. The majority (90%) of extension agents needed training and the most demanded areas for training were Integrated Pest Management (IPM), computer skills and technology dissemination techniques. A ...

Shou-Dong Zhang1,2,3, Dao-Xin Liu1,2, Dan Mou1, Tong-Zuo Zhang2, Jian-Ping Su2 and Jiu-Xiang Xie1*

... were analyzed and 103 plants were used in the analyses. Kruskal-Wallis tests revealed statistically significant deviations (from the mean) in Ei values among the four taste groups (χ2 = 199.033, df =3, p = 0.000). Pairwise Mann-Whitney U tests showed that, at the p = 0.05 or higher significance level, the Ei values of the four taste groups could be ranked as: sweet > bitter = other-taste > tasteless. Using bootstrapping analyses, we detected ten swe...

Sajjad Ali1*, Atta ur Rahman1 and Sher Ali2

...r capita share of inhabitants in crop production showed a decreasing trend from 1990 to 2020, attributed to the rapid increase in population. The prediction showed that the per capita share of inhabitants in major crop production would decrease further. In 2050, the study area will be unable to feed its inhabitants due to the rapid increase in population and the built-up environment.

...

Oluwatoyin Adenike Fabiyi

...valuation of medicinal plants as probable sources of nematicides. A study was conducted in the screenhouse to evaluate the nematicidal potential of Tridax procumbens and Sida acuta (weeds) on root knot nematodes Meloidogyne incognita infesting lettuce and carrots. T. procubmens and S. acuta was applied as soil amendment (400, 600 & 800g) and organic solvent crude extracts (40, 60, 80g/kg soil) in M. incognita infested lettuce and carrot pl

Muhammad Shafiq1, Tehseen Ashraf2*, Sehrish Mushtaq1, Naveeda Anjum3, Muhammad Asim4, Muhammad Aqeel Feroze3, Malik Abdul Rehman4 and Marja Aziz3

...ocotyl and cotyledon explants was established. The study was conducted to observe the effect of genotypes, culture conditions and growth regulators on plant regeneration of chili pepper genotypes (Seedex Pepper (SP), Loungi, Tatapuri, and Sanam) grown in Pakistan including. For both hypocotyl and cotyledon explants, SP was found to be the most sensitive among the tested genotypes tested. Maximum mean callus induction rate of...

Hurriya Alzahra1, Susmiati Susmiati2*, Sri Melia3 

...>

Keywords | Antioxidants, Fermented milk Lactiplantibacillus pentosus, Oranges, Organoleptic, Total phenols  

...

Hafiz Kashif Ali1, Iftikhar Ahmad1, Mujahid Ali2*, Zahoor Hussain3, Muhammad Ather Nadeem4, Malik Abdul Rehman5, Barkat Ali6, Muhammad Iftikhar7

...acy of various bio-stimulants on yield and quality of stock. Three cultivars of stock, viz. ‘Cheerful White’, ‘Iron Rose’ and ‘Iron White’ foliarly sprayed by bio-stimulants (Isabion and Tecamin Max) with three different concentrations (1 ppm, 3 ppm, and 5 ppm) with the different number of sprays (1, 2, or 3 sprays). The first spray was applied after one month of transplanting, while the o...

Habib Ullah Habib1, Malik Muhammad Akram2, Mujahid Ali1*, Tahir Mehmood3, Muhammad Manzoor4, Maqsood Ahmad3, Hasseb Ahsan1, Muhammad Mazhar Iqbal3, Malik Abdul Rehman5, Muhammad Mohsan1 and Ahsan Mohyo ud Din6 

...ough Crop Watt. Kinnow plants showed significant results regarding plant canopy, plant height, the average weight of fruits, the weight of large size fruits, the weight of medium size, the weight of small size fruits, number of fruits per plant, number of small fruits per plant, number of medium-size fruits per plant, and number of large size fruits per plant. The maximum number of medium-size fruits (15%) was observed at 15% water depletion level with a 50% N...

Dhiya Altememy1, Mohammad Darvishi2*, Samira Shokri3, Saber Abbaszadeh4 

...m on day 21. Medicinal plants Origanum vulgare and Hypericum perforatum, especially their active ingredients hypericin and carvacrol, reduce wound microbial load and inflammation and ultimately repair wounds in diabetic rats due to antimicrobial and anti-inflammatory activities. They can therefore be used as an effective remedy for healing wound infections in diabetics.

Keywords | Nanoparticle, Herbal plants, Diabete...

Kokab Nazim1*, Asghari Bano1 and Ghulam Jellani2

...r transplanting tomato plants were divided into controlled and chilling stressed. Chilling stressed set was placed in open field to apply stress while control treatment was kept in polytunnel. All the genotypes showed significant variability in cold tolerance during two growing seasons. A significant reduction in plant height, setting %age and fruits per plant was observed in sensitive genotypes. Antioxidant enzyme essay showed enhanced production of Superoxid...

Asma Hassan*, Zuhair Hasnain, Muhmmad Asadullah, Syed Saqlain Hussain and Muhammad Abbas Anees

Dong-Min Hou, Hong-bi Peng, Wan-Long Zhu* and Zheng-Kun Wang*

...Although reactions to infants are doubtless affected by the psychological and physiological status of tree shrew mothers as well as the environment, additional work is needed to clarify the relative roles of various factors in shaping maternal behavior post-parturition.

...

Shabana Ehsan1*, Aneela Riaz2, Muhammad Amjad Qureshi1, Abid Ali1, Ifra Saleem3, Muhammad Aftab3, Khalid Mehmood4, Fakhar Mujeeb1, Muhammad Asif Ali1, Hina Javed1, Fraza Ijaz1, Anwar-ul-Haq5, Khaliq-ur-Rehman3 and M. Usman Saleem

...e-limiting conditions, plants and plant growth-promoting rhizobacterial (PGPR) have a siderophore production mechanism. Inoculation with seed soaking of such siderophore-producing bacteria can be a cost-effective biofortification technique. The current study includes the collection of rhizobacterial isolates from wheat, maize, sorghum, millet, and maize rhizosphere soil of Rawalpindi and Sargodha divisions. The screening of bacterial isolates for siderophore p...

Maham Tariq, Aqsa Akhtar and Nauman Khalid*

... rich sources of antioxidants such as lutein, zeaxanthin, and β-carotene. The study aimed at formulating functional candies fortified with fennel seed extract and carrot juice. The candies can be used to improve the nutritive quality of confectionary products that could be healthy options for all age groups, particularly children. Fennel seed extract having the highest flavonoids and antioxidant capacity was selected to blend with carrot juice for hard ca...

Ahmad Nadeem1,2 and Rubina Arshad1,2,*

...LPA6 mutant inoculated plants as compared to control whereas maximum increase in 100 seed weight (43.1%) and plant weight (90%) was attained in consortium treated plants over control. In desi variety, MLPA6 mutant also manifested significant increase in root length (53%), pod number (43.5%), seed number (50%), 100 seed weight (24%) and plant weight (67.9%) than control. These eco-friendly plant probiotics offer great potenti...
Azra Kalhoro1, Abdul Aziz Mirani2, Fozia Khan Siyal1, Tahira Jatt2*, Abdul Razak Mahar1, Sadia Iram3 and Muhammad Abbas Bhutto4
...ted and accumulated in plants and subsequently transferred to human body through the food chain, yet it has become the most commonly used water source for irrigating vegetable crops in peri-urban or urban areas of several countries including in Pakistan. Karachi, the metropolitan city of Pakistan, is the largest industrial and financial hub of the country with an estimated 16 Million population of multilingual, multi-cultural and multi-religious peoples. The c...
Farzana Bashir2, Aysha Saleem1, Khalid Iqbal Khichi2, Rubina Nelofer3* and Rauf Ahmad Khan2
...val of bacterial contaminants from drinking water. The Cu-NP embedded rice husk then characterized by SEM, EMAX and ICP-OES techniques. The antibacterial activity was determined by column studies using response surface methodology (RSM) based on three levels, three factorial Box Behnken Design (BBD). The significance of independent variables (flow rate, bacterial count and column height) and their interactions were tested by means the analysis of variance (ANO...

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

...erved in leaves of fig plants. To evaluate the presence of Fig latent virus (FLV -1) in fig plants. One hundreds fig trees were collected with virus-like symptoms and symptomless fig trees. The virus was detected by DAS-ELISA. Infected fig leaves were mechanically inoculated on Chenopodium amaranticolor L. and reinoculated on Ch. amaranticolar L. and Nicotiana glutinosa for virus propagation. Fresh wood cuttings (4-6 nodes) ...

Rani Winardi Wulan Sari1, Novirman Jamarun2*, Suyitman3, Khasrad4, Elihasridas2, James Hellyward5, Gusri Yanti1 

...anged into dietary tretmeants (Dry Matter (DM) Basic). The experimental design used is a randomized block design consisting of 4 treatments with 5 replications. The treatment was P1=60% Hay Mangrove Leaves (HML)+40% Native Grass (NG), P2=50% HML+50% NG, P3=40% HML+60% NG, and P4=30% HML+ 70% NG. Data were analyzed using General Linear Model and Duncan’s Multiple Range Test to reveal the significant differences between different treatments applied. The re...

Nishim Bhusal1, Bhuwan Raj Bhatt2*, Saroj Shrestha3 and Arjun Chapagain4

...ng cattle and other ruminants, commonly sheep, and caused by Fasciola hepatica and F. gigantica. The disease is cosmopolitan in distribution and can cause extensive economic losses to the farmers. A cross-sectional study was conducted to determine the prevalence of fasciolosis in commercial cattle farms of Tilottama Municipality, Rupandehi district, Nepal. A total of 270 fresh faecal samples were collected purposively from the study area with different ages, s...

Muhammad Tariq Navid1,2*, Mian Muhammad Awais2*, Muhammad Irfan Anwar2 and Masood Akhtar2

...e ELISA kit. The supernatants from oro-pharyngeal and cloacal swabs of the seropositive samples were separated and divided into two segments; one was used directly to detect AI viral genome through RT-PCR while other segment was used for viral inoculation into the embryonated chicken eggs. The direct detection through RT-PCR confirmed H9 gene from cloacal swab samples in 6.9% of the seropositive sample while we could not confirm any of the oro-pharyngeal sampl...

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

...resent in the small ruminants of district Peshawar. The infection was confirmed by PCR and iELISA. The presence of MAP could be a serious threat to livestock and public health in the region.

...

Shahid Amin1*, Jabbar Khan1, Imran Khan2, Dost Muhammad1, Kamran Ullah Khan1, Naqeeb Ullah Khan1, Muhammad Azhar Jameel3 

...ic ability of small-ruminants and it sources enormous economic fatalities in most divisions of the globe as well as Pakistan. This study was designed with the objective to determine the hematological profile and prevalence of haemo-parasitic diseases in small ruminants and to correlate it with its health status. Total of 500 blood samples (Sheep, n=250, Goat, n=250) were collected from different areas of South Waziristan. Sa...

Aslı Çilingir Yeltekin

...ehyde (MDA), and antioxidants (SOD, CAT, GSH-Px) activity in Van fish kidney and muscle tissue after 24., 48., 72., and 96. h of tebuconazole exposure at a concentration of 2.5 mg/L. The obtained results indicated that caspase-3, 8-OHdG, and MDA levels significantly increased compared to the control (p < 0.05). The kidney and muscle tissues indicated a significant decrease in antioxidant enzyme activities (superoxide dismutase (SOD), catalase (CAT), and glu...

Hasnain Raza1*, Tanveer-ul-Haq1, Muhammad Imran1, Nabeel Ahmad Ikram2 and Muhammad Bilal Shoukat1

...concentration of contaminants in wastewater. Samples of wastewater were collected from Wali Muhammad Canal, Multan, and analyzed for heavy metals (HMs) including cadmium (Cd), copper (Cu), nickle (Ni), and zinc (Zn), along with basic physicochemical parameters including biological oxygen demand (BOD), chemical oxygen demand (COD), pH, electrical conductivity (EC), total solids (TS), total suspended solids (TSS), total dissolved solids (TDS), sodium (Na), calci...

Samina Kausar1, Rana Badar Aziz2, Muhammad Waseem3, Muhammad Ahmad3, Hamza Shafiq4, Muhammad Asim5, Usama Zia6, Sobia Afzal7, Wanpeng Xi8*, Mansoor Hameed1* and Muhammad Usman Shoukat9

...thetic organisms e.g., plants, bacteria, and algae, while carotenoids also be synthesized in some non-photosynthetic fungi or bacteria. The color gamut of carotenoids is from colorless to yellow, orange to red color, with variations reflected in many vegetables, fruits and flowers. They are categorized into two types: (1) xanthophylls and (2) carotenes. For instance, lycopene is found in tomatoes and watermelon, beta carotene in sweet carrots and potatoes, lut...

Ishtiaq Ahmad1*, Muhammad Nafees1, Maryam2, Irfan Ashraf3, Ambreen Maqsood4 and Muhammad Saqib5 

...ollected from mulberry plants growing at the experimental area, The Islamia University of Bahawalpur, Pakistan. Analysis of variance showed significant effect of drying methods on fruit quality of mulberry (p ≤ 0.05). There was significant difference (p ≤ 0.05) in fresh and dry fruit weight, fruit width and area, and Cu contents of both the species in spectrophotometer. Reduction in fruit weight, fruit area and moisture percentage were significantly high...

Mahmut Islamoglu

...re many pests of wheat plants, Sunn pest Eurygaster integriceps Put. (Heteroptera; Scutelleridae) is the most important pest in Turkey and West Asian countries. In our country, it causes important economic losses in wheat with the epidemics it has made from time to time. E. integriceps spends most of its life in overwintering sites. It is thought that knowing the wintering characteristics of Sunn pest will provide important advantages in the fight against this...

Humera Manzoor1,2,5 Norbert Brüggemann2,3, Hafiz Muhammad Jafar Hussain1, Tobias Bäumer2, Frauke Hinrichs2, Muhammad Wajid4, Alexander Münchau2, Katja Lohmann2* and Sadaf Naz1*

...rformed for four participants. Variants were filtered based on homozygosity in the three patients and heterozygosity in the obligate carrier (mother), predicted effect of variants on the encoded protein, and their frequencies in public databases. Sanger sequencing was performed to explore the segregation of the variant with the phenotype. All patients had congenital limb contractures. Thes...
Abdullah Iqbal1, Muhammad Abubakar2, Shumaila Manzoor3, Muhammad Kamran Ameen4 and Rani Faryal1*
 

Asma Basharat1, Abdul Wajid2*, Andleeb Batool1, Tayyeba Batool3, Abdul Basit4, Kamran Abbas5, Aziz Ullah1 and Mahmood Shaukat6

...revealed no sequence variants in these locations. The present report is first of its kind in Pakistani population. The findings suggest that TBX22 polymorphisms may responsible for a significant proportion of non-syndromic CP cases in Pakistani population and confirming its importance as a frequent cause of non-syndromic CP across various populations. The robustness of the association between TBX22 and CP is worth further examination in the future across diffe...

K. H. El-Kholy1*, Enayat Hassan Abo El-Azayem2, Safaa Ataya Barakat2, Mona Gamel Mohamed3, Sara H. M. Hassab1 

...rds | Aloe vera, Antioxidants, Blood, Growth, Immunoglobulin, Rabbits. 

...

Muhammad A. Ahmad1, Shabbir Hussain2*, Humera A. Awan3, Muhammad Riaz4 and Muhammad Saeed1

...ustify;">The growth of plants and their productivity can be improved by the use of plant growth regulators (PGRs). The PGRs have pronounced effects on the yield, biochemistry, physiology and plant morphology of wheat crop. Current studies were performed to investigate the effect of PGRs on the yield of wheat crop in Sayban International, Lahore (Pakistan). The field experiments were performed to evaluate the effects of numerous concentrations of three PGRs (so...

Neni Widaningsih1,2*, Budi Hartono2, Hari Dwi Utami2, Eni Siti Rohaeni3 

...reeders, collecting merchants, wholesalers, retailers, and consumers. The number of respondents in this study was 135 persons. Methods of data analysis carried out include; qualitative analysis and quantitative analysis. Qualitative analysis is intended to find out the characteristics of marketing institutions, and the marketing channels of buffalo cattle. While quantitative analysis is intended to find out margins and farmer share and marketing efficiency. Th...

Hams M.A. Mohamed1*, Katreen K.G.2, M.W. Abd Al-Azeem1, Faysal A. Wasel2, Ahmed M. Abd-Eldayem3 

...le and virulence determinants, the purpose of this study is to discuss the presence of Listeria species in raw milk. In total, 150 samples of raw milk from vendors and nearby dairy farms in Sohag, Egypt, were collected. The samples underwent a bacteriological investigation. The results showed that 22 out of 150 samples had Listeria spp. contamination. Polymerase chain reaction (PCR) using the Listeria iap gene identified 13 of the 22 isolates that were reporte...

Abdul Kabir1, Muhammad Rasheed2, Hubdar Ali Kaleri5, Depeesh Kumar Bhuptani3, Mithan Kumar4, Raza Ali Mangi6, Abdul Wahid Solangi4, Sheva Dari1, Saqib Kakar4, Panah Munir4, Ekra Akbar4 and Rameez Raja Kaleri4,5*

...osures, IT parks, restaurants, shopping centers, and multiplexes are relatively easy to close during lockdowns, but agriculture and animal husbandry are more difficult to close; these industries will continue to produce. In order to manage our agriculture and livestock sectors in the best interests of both producers and consumers, we need an effective and quick action plan. The first step is to ensure that farm produce, livestock feed, and veterinary medicatio...

Ibrahim El-Ratel1*, Mostafa El-Moghazy2, Amira El-Gaml2, Ibrahim Abu El-Naser2 

... levels improved antioxidants capacity, while reduced malondialdehyde in blood serum and in seminal plasma. Advanced motility, membrane integrity, livability and sperm viability were improved, but sperm abnormality, apoptosis and necrosis were reduced in cryopreserved semen by all PEE levels. Total antioxidants capacity was increased, while malondialdehyde was decreased in post-thawed semen by all PEE levels. Conception rate...

Rezqita Putri Pitaloka1, Kartiawati Alipin1, Mas Rizky A.A Syamsunarno2, Gemilang Lara Utama3, Ramdan Panigoro2, Ratu Safitri1* 

...n be done with natural plants. Sappan wood (Caesalpinia sappan L.) contains active compounds, such as brazilin and flavonoid with the ability to chelate Fe. This study aims to determine the effect of sappan wood ethanol extract (SWEE) as an adjuvant and substitute for iron chelator. The adjuvant test group was given 60 mg/kg BW iron dextran (ID), 75 mg/kg BW deferiprone (DFP), and 50 to 200 mg/kg BW SWEE, while the substitute group was administered with 60 mg/...

Nosheen Jehajo*, Nasreen Memon, Mansoor Ali Shah and Naheed Shah

...eds of neem and castor plants can be used to manage the stored grain pest up to the tolerable limits in integrated pest management. Moreover, the present study suggests further work on the efficacy of some other local plant extractions as an alternative to chemical pesticides.

...
Humaira Gul1*, Muhammad Junaid Yousaf1*, Fawad Ali1, Mamoona Rauf1, Farhad Ali2 and Iqthedar Ali3
...During the experiment, plants were grown in eleven sets of soil combinations texture wise with varying ratio of sand and clay along their chemical properties. Different growth parameters based on physiological functioning and biochemical aspects were observed for various physical and chemical properties of soil provided to plants for growth optimization.. Barley flourished only well in sandy soil. The number of leaves, branc...

Emtiaz Ibrahim Ghoniem, Gaber Mamdouh Abdelgalil, Amira Farouk Gad* and El-Sayed Hassan Eshra

 
...cultural pest for many plants. Copper sulfate (CuSO4) is extensively used for controlling a number of molluscs in many areas. In this study, CuSO4 toxicity indices against T. pisana after 24, 48 and 72 h using the topical application technique were estimated. Additionally, in vivo evaluation of acetylcholinesterase (AChE), alkaline phosphatase (ALP), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities in T. pisana intoxicated with tw...

Shama Sadaf1*, Komal Hassan1, Ayesha Saeed1 and Zeeshan Ahmad2 

...a and Litchi chinensis plants and applied on 100% cotton. Before and after applying antimicrobial finish mechanical property was checked. The antimicrobial finish was applied by pad dry cure method and finish was fixed by using of poly urethane binder. The presence of microorganisms was checked by ASTEM E2149 shake flask method before and after applying antimicrobial finish and after successive 25 washes. The results were analyzed through MANOVA. The fabric pr...

Hafiz Husnain Nawaz1*, Ayesha Ahsan2, Amir Afzal1, Muhammad Ashraf Sumrah1, Muhammad Jan1, Kashif Ali1, Muhammad Arsalan1 and Rizwan Latif3

...onomic benefits. Antioxidants abound in C. sativa extract, thanks to its high phenolic content. It’s a high-polyunsaturated acid crop that’s strong in antioxidants. Extraction from C. sativa seeds yielded a 33% yield of C. sativa oil, which was then analyzed for TPC and antioxidants in comparison to commercially available C. sativa oil. The Folin-Ciocalteu reagent and the &alph...
Shahrokh Mojarradgandoukmolla* and Hasan Akan
...oldest known medicinal plants in the world which is used in the treatment of many diseases due to its various effective compounds. Trigonella strangulata, Trigonella filipes and Trigonella uncinata are three widely used species and folk medicine that grow well in the northern suburbs of Iraq. Therefore, the present study was designed to evaluate and identify the effective compounds of these species and to investigate their physiological an...

Monis Hussain Shah1*, Rizwan Rafique2,6, Munawar Almas1, Muhammad Usman3, Sadia Yasin4 and Sajida Bibi5

...series stocks of fruit plants should be certified, the small land holders should be supported by the government incentives for specific fruit production. Research according to the modern steps regarding plant protection measures, introduction of exotic varieties and use of Biotechnological tools for crop improvement should be adopted for better yield and production.

...

Mochamad Rizal Umami1, Zainuri*2, Sebastiana Viphindrartin2 and Rafael Purtomo Somaji2

...nterviews with key informants by multistage sampling technique. The data processing includes data reduction, data display using Decision Explorer version 3.3 software. Data were analyzed through descriptive methods and content analysis. The study found that the COVID-19 pandemic formed a new pattern of sugarcane trading system, switching from a contractual trade model to a free market model (redeemer). The model refutes the theory stating that the contractual ...

Sumaria Maqsood1*, Muhammad Ali 2, Amna Shoaib3, Shahbaz Ahmad2 and Noor-ul-Ain2

...eatening pests of many plants including tomatoes. In vitro, mass-rearing of S. litura is essential to attain a large number of insects with good quality for bio-ecological studies and biological control programs. In the current study, a modified diet was formulated and assessed against two diets used for mass rearing of S. litura, and tomato fruits were taken as a natural diet. Results revealed that development attributes based on mass rearing of S. litura on ...

Saba Rehman1, Faisal Salih Hayat1, Sadia Norin2, Abdul Aziz1, Siddiq Ur Rahman1* and Noor ul Haq1*

...d the world. The new variants of covid-19 are classified into two types, VOI (variant of interest) and VOC (variant of concern). The major variants of concern (VOCs) have shared mutations in severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The spike proteins of the novel coronavirus located mostly on the S1 unit result in a higher transmissibility rate and affect the viral virulence and clinical outcome. The spi...

Zaheer Ahmed Lashari1, Muhammad Saleem Sarki1, Saleem Maseeh Bhatti1, Muhammad Sachal Khokhar1 and Zohaib ur Rehman Bughio2*

...rtilizer that enriches plants and soil. The present research was undertaken to prepare composts utilizing organic wastes and to testify their impacts on onion cultivation. Three dissimilar composts with variable recipes viz. banana plants + poultry manure (Compost 1), banana plants + goat manure (Compost 2) and banana plants + cattle manure (Compost 3) i...
Farah Abid1,2, Mohammad Saleem1,3*, Tahir Maqbool4, Tania Ahmed Shakoori5, Faheem Hadi4, Tahir Muhammad4, Saira Aftab4, Yasir Hassan7 and Shabana Akhtar4,6*
...genes. Levels of antioxidants, superoxide dismutase and catalase were determined to be significantly higher (p<0.05) in the group treated with E-AM compared to the arthritic group. In addition, histopathological examination indicated reduction in the index of C-reactive protein, rheumatoid factor and bone and cartilage erosion after treatment with E-AM. Collectively, our findings suggest that E-AM extract might have potential to perform anti-inflammatory an...

Saima Rubab1,3*, Ghazala H Rizwani2, Arjumand Iqbal Durrani3, Iram Liaqat4*, Urooj Zafar5, Mahjabeen6, Farah Batool7, Noor-E- Seher3, Naveera Younas3 and Ayesha Sadiqa8

... traditional medicinal plants have been used for thousands of years in different region of the globe for the treatment of various diseases. In developing countries, traditional medicines are used as source of primary health care. Keeping in view the importance of Camellia sinensis L., present investigation was aimed to evaluate the phytochemical and pharmacological potential of different morphological parts of C. sinensis L. Successive extractions of all plant...

Abdurakhim E. Kuchboev1*, Mehmonjon Kh. Egamberdiyev2 

...ortant lungworms of ruminants, especially Bovids. Its life cycle is participating terrestrial mollusсs as intermediate hosts. In this study, eight species of land mollusсs from Uzbekistan were found to be positive larvae of protostrongylids. Based on the nucleotide sequence data, three species of nematode larvae Protostrongylus rufescens, Muellerius capillaris, and Cystocaulus ocreatus were identified. According to the morphological characteristics of the st...

Muhammad Azam1*, Shaista Naz1*, Malik Muhammad Shafi2, Muhammad Jamil Afridi3 and Ahmad Waheed4

... to evaluate the determinants of food security and coping strategies among the farm households of Khyber Pakhtunkhwa, Pakistan. For this purpose, the data were collected from 180 farm household heads through an interview schedule. In addition, the food consumption data of households were collected on weekly basis. The dietary intake method was used for the assessment of farm households’ food security by using of 2450 kcal/Day/AE. Descriptive statistics, ...

Ibrahim Samir Abd El-Hamid1, Alaa Emara Rabee2, Moustafa Mohamed M. A. Ghandour2, Rasha Salah Mohammed3, Ahmed Mohamed. Sallam4 

...ebracho tannins, Antioxidants, Sperm quality, Damascus goats. 

...

Samiya Rehman*, Eman Mustafa, Ali Ahmad Faiz, Maheen Kanwal, Farkhanda Yasmin and Arooj Fatima

...f microglial pathways. Plants are proved to be promising source of recovering drug addiction side effects. This article also focuses on psychological and emotional regulations, caused by drug addiction involve depression, schizophrenia, family problems and involvement in various criminal activities. Support of local community, use of preventive measures and public policies are required for strong long-term planning to prevent from drug addiction.

...
Huma Abbas1*, Nazir Javed1, Muhammad Kamran2, Sajid Aleem Khan1, Abdul Jabbar1, Akhtar Hameed1, Hira Abbas3, Azhar Iqbal2 and Ehetisham-ul-Haq2
...(Solanum lycopersicum) plants. Tomato seedlings were transplanted in sterilized soil amended with Cartap, Virtako, Cure and Azadirachtin at their recommended doses and inoculated with 500 freshly hatched juveniles (J2s) of M. incognita. Data were recorded after 7, 14, 21 and 28 days to check the invasion and development stages. All the treatments significantly reduced invasion and subsequent development of M. incognita in roots. Different application methods r...

Hongfeng Guo

...reatment of premature infants with apnea. in present study, sixty premature SD mice were randomly divided into blank control group (n = 20), intermittent hypoxia group (n = 20) and drug administration group (n = 20). Establishment of intermittent hypoxia model: the oxygen concentration in the cabin of mice in intermittent hypoxia group was maintained at 40%, then decreased to 10% and maintained for 3 min. After that, it was continuously increased to 40%, and w...

Oluwatoyin Adenike Fabiyi1*, Mariam Temitope Baker2 and Gabriel Ademola Olatunji2

... activities. Medicinal plants are rich source of acid esters, hence Alstonia boonei (Apocynaceae) leaves were extracted cold in ethyl acetate. This yielded crude extract that was subjected to column chromatography (silica gel 100-120 mesh grade), which afforded fractions that were analysed with GCMS and FTIR for constituent identification. The result shows octanoic acid; hexanoic acid methyl ester; ethyl octanoate; 9, 12-octadecadienoic acid methyl ester; dode...

M. M. A. Youssef† and W. M. A. El-Nagdi

...s i.e., when number of plants in the same pot increased (1-4 plants/pot), a higher number of nematode juveniles in plant roots occurred. Thus, plant density, such as 4 plants if produced it promoted the number of the hatched juveniles, galls and egg-masses in roots as compared to the plant densities of 1, 2 and 3/pot. However, number of juveniles in soil decreased with increasing plant den...

A. Ghasemzadeh1, S. Jamali1†, M. Esfahani2 and H. Pedramfar1

... the nematode-stressed plants under both light and dark conditions, amount of minimum and maximum fluorescence (F0 and Fm) and the difference between them (FV), rate of non-photochemical quenching, photochemical quenching and descriptive parameter of non-chemical quenching increased, while the efficiency rate of photosystem II under both conditions trended to a downward with increasing nematode levels. The correlation between nematode levels and various sampli...

S. Miheret1, A. Seid2† and N. Hailu3

...ith other antagonistic plants. Further research is needed to evaluate the effectiveness of the antagonistic plants in the management of root-knot nematodes under farmer’s field conditions.

...

A.H. Choshali1, S. Rezaee2, S. Jamali3, H. Reza3, Zamanizadeh4 and F. Rejali5

...e studied. Mycorrhizal plants which pre-colonized for 7 weeks inoculated with 1500 J2 per 1 kg soil. The quantitative activity of chitinase and ß 1, 3 glucanase enzymes was assessed on 2, 4, 6 and 8th days after M. incognita inoculation based on split- plot in time design. Also the results showed that AMF pre-inoculation caused a significant decrease in RKN pathogenicity factors (number of galls, eggs, egg sacs and J2) in both tolerant and susceptible cu...

Hira Anwar1, Muhammad Jabran1,3, Anam Moosa2, Usman Arshad2, Abdul Haseeb1, Abdul Jabbar1, Muhammad Burhan4, Amjad Abbas1, Muhammad Naveed5 and Muhammad Amjad Ali1*

...e different changes in plants.

...

Urooj Shakoor* and Syed Attaullah Shah

... to identify its determinants. Data set of 3035 rural households, extracted from Pakistan Social and Living Standard Measurement survey (2018-19), was grouped into three geo-climate zones (Northern, Central and Southern zones). Results from data analysis revealed that 46.6 percent of the sampled rural households were multidimensional poor and the derived Multidimensional Poverty Index (MPI), at 0.30 cutoff level, was 0.254 for the overall rural Khyber Pakhtunk...

Muhammad Shahid Nadeem*, Jalaluddin Azam Khan and Firoz Anwar

...sms including animals, plants, fungi and microbes. The enzyme has a clinical applications in the diagnosis of many diseases. In the present study we have produced a recombinant of ALT from Pyrococcus abyssi in BL21 (DE3) strain of E. coli. The recombinant enzyme was purified by anion exchange chromatography, it displayed a 45kDa band on SDS-PAGE, with 58.1% final recovery, 15.3 fold purification and 139 U/mg specific activity. Maximum enzyme activity was found...

Dzulhelmi Muhammad Nasir1,*, Suriyanti Su2, Van Lun Low3, Zulqarnain Mohamed1 and Norma-Rashid Yusoff1

... to identify species variants. However, in this study, a molecular approach was utilized to produce a more precise and accurate result in an effort to identify, delineate and verify the species. Mitochondria-encoded cytochrome oxidase I (COI) and nuclear-encoded 18S rRNA (18S) genes) were adopted to establish DNA bacodes for 17 species of tetragnathid spiders (Araneae, Tetragnathidae) in Malaysia. Generally, the molecular data of tetragnathid spiders was consi...

M. Israr1, F. Shahina2† and K. Nasira2

...nip (Brassica rapa L.) plants collected from Mianwali, Punjab, Pakistan. Aphelenchoides turnipi n. sp. belongs to the Group 2 of Aphelenchoides species sensu Shahina with one or sometimes two mucronate structures in female tail terminus and is characterized by small body size (0.29-0.38 mm); two lateral incisures in the lateral field; small stylet with minute basal swellings (stylet: 7-9 μm); vulva at 67-69 percent of body, tail short with pointed mucro (ta...

I. K.A. Ibrahim1, Z.A. Handoo2† and A. B. A. Basyony1

...ed with different crop plants: Heterodera avenae on wheat, H.
daverti and H. trifolii on Egyptian clover, H. leuceilyma on Bermuda grass, H. lespedezae on lentil, H. goldeni on
qasabagrass, H. schachtii on cabbage and sugar beet, H. zeae on corn and wheat and Globodera rostochiensis on
potato. The cyst nematodes H. leuceilyma and G. rostochiensis are new records of the country and H. lespedezae on
lentil is a new...

M. A. Radwan†, M. M. Abu-Elamayem, S. A. A. Farrag and N. S. Ahmed

...ing tomato
plants was investigated under greenhouse conditions. The results showed that all tested organic acids as well as the
application methods significantly reduced tomato root galls and 2nd stage juvenile numbers in soil compared with
control. Except DNSA and AA, foliar application of tested organic acids was more effective in reducing nematode
galls than soil drench application. Foliar application of ASA c...
K. Nasira, S. Shamim and F. Shahina†
...ater is clear from pollutants in upcountry, but as it flows downstream it becomes more pollutant.
In the present study nematodes were selected as bio-indicators for these pollutants at eight localities of Sindh, which
are Malir, Karachi; Kalri (Keenjhar) Lake, Thatta; Karachi Canal and Al-Manzar at River Indus near Jamshoro;
Goth Detha Hyderabad; Khesana Mori n...

H. Ravindra1, N. Adivappar2, M. Sehgal3 D. M. Soumya4 and H. B. Narasimhamurthy4

... Coriander
plants also exhibited poor growth showing stunting and chlorosis due to severe infestation. This is the first report of
root-knot nematode from Karnataka.
...
M. M. A. Youssef† and W. M. A. El-Nagdi
...ere higher on dry bean plants replacing
cutting sugar beet than those on dry bean plants replacing uprooted sugar beet within the most periods. In contrast,
plant growth parameters were higher for dry bean plants replacing uprooted sugar beet than parameters for plants
replacing cutting sugar beet.
...

I. K. A. Ibrahim1 and Z. A. Handoo2

...sphere of the surveyed plants. Twenty-three genera of phytoparasitic nematodes were detected in the
collected soil and root samples. In soil samples from Alexandria governorate, the sugar beet cyst nematode
(Heterodera schachtii) was very common on sugar beet while the root-knot nematodes Meloidogyne incognita and
M. javanica were very common on guava, olive trees and sugar beet. Helicotylenchus ...

I. K. A. Ibrahim1, M. A. EL-Saedy2, S. F. A. Awd-Allah3 and Z. A. Handoo4,

...goldeni as compared to plants inoculated with M.
incognita concurrently or a week beforehand. When H. daverti or H. zeae were inoculated one week after
inoculation with M. incognita on rice cultivars Giza 178 or Sakha 101, respectively, the final population of these
cyst nematodes increased. Treatments with M. incognita alone or one week before inoculations with the tested
cyst nematodes induced a significant

A. A. Galal1,2, S. F. Abou-Elwafa1,3, F. J. Kopisch-Obuch1 and C. Jung1

...col for testing barley plants against root lesion nematode (RLN) had
been standerdized. The plants were grown in 150 cm³ instead of 20 cm³ tubes and we increased the inoculum size
from 400 to 1000 nematodes/plant in combination with a nutrient solution better adapted to the barley crop. Six
barley accessions were tested with Pratylenchus neglectus and Pratylenchus penetrans. Test...

K. Taimoor1† and F. Shahina2

...medicinal and aromatic plants viz., Perovskia abrotanoides, Valeriana wallichii, Artemisia
vulgaris, Peganum harmala, Saphora alopecuroides, Artemisia absinthium, Carum copticum, Berberis
balochistanica, Matricaria lasiocarpa, Ephedra procera, Centratherum anthelminticum, Zatoria multiflora,
Lallemantia royaleana, Mentha spicata, Withania coagulans, Achillea santolina, Ferula oopoda, Nepeta cateria,
Teucrium stoc...
A.W. Aseffa1, F. F. Addisu2, G. N. Roge3, L. T. Hadis4, T. B. Abera5, M. G. Gero6 and B. H. Meressa1†

I.K.A. Ibrahim1 and Z. A. Handoo2

...tode infection on rice plants.

...

S. Anwar1, K. Wieczorek1 and E. Inselsbacher2

...schachtii infection in plants.

...

A. S. A. Saad1, M. B. Al-Kadi1, A. A. A. Deeabes2 and A. M. El-Kholy2

...ognita) affecting okra plants in vitro as well as in vivo conditions. Five concentrations of all chemicals were prepared. Data of in vitro studies showed a marked nematicidal and nematode hatching inhibitory activity against root-knot nematode (M. incognita). However, the nematicidal activity differed between treatments as compared to control. Fosthiazate was found as the most toxic compound against J2 of M. incognita after 24 and 48 hour exposure time as well...

M. Israr†1, F. Shahina1 and M. Habib2

...d and un-infected host plants. Data indicates that highest reproduction rate and root-knot index was observed in vegetable plants infected with root-knot nematodes after three months as compared to un-infected (control). The physiological parameters as well as biochemical contents showed significant difference in different growth criteria and amount of nutrients between infected host plants

Shaista Naz1*, Muhammad Arif2 and Akhtar Ali3

...ivestock and its determinants in the developing countries. To achieve these objectives, a total of 32 publications after following the inclusion and were reviewed. Content analysis has been used for analysing data and the study found that women have higher participation in livestock management as compared to crop production due to the easy accessibility of livestock and the quick outcome in the shape of milk and milk products for home consumption and sale to e...

Farwa Batool1*, Riaz ur Rehman1, Samia Ikram2 and Maham Zahara3

...rate source in nursery plants production. The present research is focusing on the utilization of agriculture waste with different proportions for better foliage plant growth and development. Different combinations of silt, sand, leaf compost, FYM, peat moss, sawdust and garden soil were used as (SGS) for the growth and quality of three selected foliage plants (A. commutatum, D. deremensis and A. elatiors). The plant response...

C. Azhagumurugan† and M.K. Rajan

...he control and treated plants
were analyzed for various growth characteristics such as, root and shoot length, fresh and dry weight of root and
shoot, leaf area, root gall index and chlorophyll content after 65 days. These growth characteristics found decreased
with increasing inoculum levels of egg-masses and increased with increasing concentrations of leaf extract
treatment and fresh and dry weight of root and ...

A.M. Korayem, M.M.M. Mohamed† and S.M. EL-Ashry1

...ied on common dry bean plants under natural
infestation in the field at two different seasons of planting. In the first season, bean was grown in Autumn, 2012
while, the second season in early Spring, 2013. For the first season, the relation between nematode initial population
density and bean yield was significantly negative (r = -0.6). A significant reduction in bean yield (P = 0.05) was
obtained when nematode ...

R.R. Arain, R.N. Syed, A.Q. Rajput, M.A. Khanzada1, N.A. Rajput and A.M. Lodhi1

... of tomato
plants. The artificial inoculation of M. incognita developed a large number of galls and suppressed the tomato
plant growth significantly. Three different concentrations of neem extract, furadan and Trichoderma harzianum
were evaluated to control the M. incognita. All concentrations proved effective in reducing the disease
development in nematode inoculated tomato plants...
C. Azhagumurugan and M.K. Rajan
...
15, 20 and 25). Plants treated with the leaf extract of M. elengi at different concentrations (5, 10, 15, 20 and 25
ppm). The control and experimental plants were analyzed for various biochemical constituents such as,
carbohydrate, protein, amino acid, lipid, proline and phenol content after 65 days of treatment. Carbohydrate and
protein were found decreased with increasing inoculum...

S.A. Khan†, M. Abid and F. Hussain1

...ck nearly all types of plants. In
this study 32 seaweeds were evaluated to determine nematicidal activity against Meloidogyne javanica (egg
hatching and larval mortality tests) in vitro. Results revealed that seaweed biochemical potential in two different
solvents viz., water and methanol @ ratios 2.5, 5 and 10%. It is observed that Sargasssum tenerrimum, Padina
tetrastromatica and Melanothamnus afaqhusainii show...

W.M.A. El-Nagdi and M.M.A. Youssef†

...wpea, maize and sesame plants
replacing sugar beet for controlling root-knot nematode, Meloidogyne incognita resulted that sugar beet-Hybrid
maize and sugar beet-sesame cropping sequences proved most effective against root-knot nematode as they reduced
nematode parameters as indicated by the number of galls, egg-masses and hatched juveniles on roots. Consequently,
they lowered rates o...

N. Hajra

...oil components treated plants. Higher proline concentrations
reflected in leaves of treated plants as compared with mycorrhizal treated plants. The decrease in shoot length,
number of leaves and leaf area were observed in non mycorrhizal and plant treated with other biotic and
abiotic stresses. Higher amount of proline was produced in non mycorrhizal and...

I. Kepenekci

...und associated with 66 plants from 48 different
localities of the country.
...

M.A.M. El-Saedy, A.A. Mokbel*† and S.E. Hammad**

...gnita infecting tomato plants under laboratory,
greenhouse and field conditions. Treatments with essential oils of arugula, camphor, castor, garlic, nigella, onion
and sesame resulted in 48.0-92.7% reduction in numbers of root galls/root under laboratory conditions. Similarly,
application of these oils resulted in great reductions of 59.2-92.8% and 47.4-89.6% in numbers of root galls and

A.W. Amin† and A.W. Mona*

...indicate that cucumber plants grafted onto Ercola hybrid 6001, C. maxima x C. moshata (Ercola
6001) and Bh had highly significant less root galling, number of females and egg-masses than non-grafted and
infested one. The reduction in number of galls ranged between Rugby 10G (47%) grafted onto Bh (98.3%) and
Rugby 10G (30.2%) grafted onto Ercola 6001 (84.5%), respectively in two seasons followed by grafted onto Ercola
...

A.E. Ismail† and A.M. Kheir*

...est than on the oldest plants.
...

F. Shahina†, K.A. Tabassum and M.A. Habib*

...number of bollworms on plants before and 24 hrs after
EPN spray @ 1000 and 2000 juveniles/ml water were assessed for mortality percentage. All four species of insects,
viz., Helicoverpa armigera, Earias insulana, E. vitella and Pectinophora gossypiella were found susceptible to
infective juveniles of the four EPN species; S. pakistanense was the most virulent EPN species. There is a dire need
to focus further res...

A.A. Mokbel

... rhizosphere of peanut plants.
Meloidogyne arenaria was the most common nematode in all collected soil samples followed by Tylenchorhynchus
spp., Helicotylenchus spp., M. javanica and Pratylenchus penetrans. All tested peanut cultivars were resistant to M.
incognita race 2 and moderately resistant to M. javanica. Whereas, peanut cvs. Balady, Ismailia 1 and Giza 6 were
found highly sus...

A.A. Anter, A.W. Amin†, A.H. Ashoub* and A.S. El-Nuby*

...ne incognita in tomato plants cv.
Castel Rock was investigated under greenhouse conditions. All inducers were applied as soil dren ch to
tomato plants grown in 25 cm-diam. earthen pots. Three days-before nematode inoculation time treatment
maximized the efficacy of tested chemicals in reducing nematode galls, egg-masses and eggs numbers
followed by synchronized addition with in...

A.W. Amin†, A.A. Anter, A.H. Ashoub* and A.S. El-Nuby*

...evated in bacteriazied plants as compared
nematode infected plant as well as total phenol content. Results revealed that crude culture suspension of bacteria
was more effective for reducing nematode population followed by cell-free culture filtrates, bacterial live cells and
bacterial dead cells, sequentially. It was concluded that bacteria has induced tomato resistance or bio-control effects
against M. incognita...

W.M.A. El-Nagdi†, M.M.A. Youssef and M.G. Dawood*

... compared to untreated plants significantly (p ≤ 0.05). Lower concentration of the tested materials caused
higher percentages reduction the mentioned nematode criteria. Vice versa, increase in length of shoots, dry and fresh
weights of shoots and roots occurred by higher concentration of each material followed by those occurred by
moderate and lower ones. The percentages of total soluble carbohydrates, proteins, phenolic ...

O.A. Fabiyi†, G.A. Olatunji* and A.T. Aramide*

...o 39.38% after 24 hrs. Plants received brominated/oxidised oils were taller
with better yields than untreated and nematode infested plots in the field. The GC/MS result indicated that the major
constituents of the orange peel oils were limonene, octanal and citroneloll.
...

Aiman Amur1*, Nasreen Memon1, Khalida Unar2 and Roshan Jamali3

...ies, according to inhabitants they live in tropical and subtropical areas of the world. The fruit flies are the pest of several economical important fruits of world. The Bactrocera dorsalis (handle) complex fruit fly according to morphology, physiology and genetically. It is very serious pest of many fruits in the overall world; such as guava, apricots, Sapodillas etc. this species is voracious for the mango in whole world mostly; means the favorable host of d...

Najam-ul-Sehar Afshan1*, Javeria Majeed1, Abdul Rehman Niazi1, Saima Khanum2, Maria Riaz1, Muhammad Fiaz2 and Shaila Anjum

... in Pakistan. Infected plants were collected from districts Mansehra and Abbottabad of Khyber Pakhtunkhwa, and district Lahore of Punjab, Pakistan, during phytopathogenic surveys in 2015–2020. The causal fungus was observed and identified on the basis of morpho-anatomical and molecular analyses. This is the first report of powdery mildew infection caused by Erysiphe necator var. necator from Punjab and Khyber Pakhtunkhwa provinces of Pakistan.

...

Kalsoom1, Nasir Shah2, Muhammad Ibrahim3*, Tahira Bibi1, Kazim Ali4 and Zahir Shah2

...alt in MS media, while plants of all the tested varieties were dead at concentrations more than 50 mM of NaCl in in vitro condition (75, 100 mM). Variation was observed in the level of tolerance to salinity in these potato varieties. Increasing NaCl (mM) level reduced the overall plant growth, number of shoots, number of nodes and leaves, root and shoot lengths (cm), fresh as well as dry root and shoot weights (g). In contrast, proline, Na+ and K+ (mg g-1 FW) ...

Saima Mumtaz1,3*, M. Imran Kasana1, Riaz Alam1, Noorullah Khan1, Muhammad Noman1, Sanjeela Sabahat1 and Hussain Shah2

...rvival rate of layered plants, more requirement of mother stock and labor intensive method. To address these issues an alternative technique has been employed for quick multiplication of litchi. In the present study we have investigated the influence of various levels of Indole Butyric Acid (IBA) on four Litchi cultivars (Gola, Surahi, China and Bedana) for root induction, its development and success rate of survival in hardwood cuttings. Six treatments of IBA...

Hendro Prasetyo1*, Diah Karmiyati2, Roy Hendroko Setyobudi2, Ahmad Fauzi2, Trias Agung Pakarti1,3, Mardiana Sri Susanti4, Waris Ali Khan5, Leila Neimane6,7 and Maizirwan Mel8,9

...e to grow local rice variants. This study aims to identify, analyze, and describe farmers’ attitude and behavior. A survey was employed for quantitative data gathering and an interview was for the qualitative ones. A total of 52 respondents were of local rice farmers in Sidodadi and Banturejo villages of Ngantang district, Malang Regency, East Java, Indonesia. The result of correlation test showed good cognitive, affective, and conative aspects of the fa...

Majid Ali*, Hafiz Abdul Majid, Farman Ullah, Tahir waseem, Muhammad Rashid Khan 

...moprotozoa of small ruminants in arid zone small ruminant research institute kohat from July 2017 to June 2021. The prevalence was studied in relation to species, seasons and different housing system or herds. Random blood samples were received and collected from the surrounding village of arid zone research institute kohat. A total of 726 blood sample were analyzed from both sheep and goat. Out of the total blood sample (62.39%) total prevalence were recorded...
Makruf Arif1*, Claude Mona Airin1, Dwi Sunu Datrianto2, Dinda Anggun Roro Sejati3
...ates. The use of antioxidants in semen preservation is very important to suppress lipid peroxidation so it can maintain the quality of the sperm. This study aimed to determine additional honey to the quality of KUB rooster sperm during cold storage. The semen with superior quality was diluted into four different treatments, lactate ringer egg yolk without honey as control (LREY0),     LREY with 0.2% honey (LREY2), LREY with 0.4% honey (LREY4), a...

Owolabi Olutunmise Victoria1*, Saka Olusola Stephen2, Olashinde Oluwaseun Ruth1, Alli Smith Yemisi Rufina3

...d to oxidant and antioxidants such as antioxidant enzymes, Reduced glutathione (GSH) activity, Superoxide dismutase (SOD) activity and Malondialdehyde (MDA) activity. When compared control and glibenclamide-treated rats, the antioxidant activity of the extract increases with advancing the dose of treatment. According to the findings, Cola acuminata young leaves have comparable anti-diabetic efficacy to that of a glibenclamide administration. This suggests a pr...

Tariq Mahmood1*, Mamoona Wali Muhammad2, Sami Ullah1, Bilal Ahmad3, Zarmina Aslam4, Naveed Ahmad Khan5, Muhammad Shahzaib Tariq6, Muhammad Ali Raza6, Rana Usama Iqbal7 and Samia Zain8

...vantageous not only to plants and insect colonies but also to humans. Honey bees helps preserve ecosystems as they offer pollination to many wild flowering plants. These pollinators are now under attack from a variety of sources. Pesticides, habitat degradation, genetic diversity loss, inclusion of genetically modified crops, and parasites are among the main threats to these pollinators. As a result of their decrease, there ...
Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed El-Bayoumi1, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila1, Gomaa Abd El-Rhim Abdel Alim2
...e commercial immunostimulants (Lector® and Orego®) in commercial broiler chickens. The pathogenicity studies parameters included the effects on protection, growth performance and clinico-pathological changes. The results indicated that, immunostimulants can keep maternal immunity longer where lector® was the best; the decline in HI titers also indicates that bird groups not contract ND natural infection. The resu...

Muhammad Adeel Qureshi1*, Raza Ahmad2, Bilal Ahmed1, Tanzim Ullah Khan1 and Muhammad Yasin3

.... All the internodal explants placed on CIM1 produced 100% callus while CIM2 produced 70% callus. No callus was observed from leaves on CIM1 and CIM2. After callus induction, four different types of media were used for plant regeneration, having different concentrations of cytokinin (BAP and Zeatin) i.e. RZ1.5, RZ2, RB1 and RB2. The most efficient regeneration media was RZ2, having Zeatin 2mg/lit showed early and maximum shoot formation. On average, 05 shoots ...

Syed Shah Mohioudin Gillani1, Muhammad Naveed Tahir1, Adeel Anwar1*, Syed Ijaz Ul Haq2, Muhammad Awais3, Mujahid Iqbal4, Javed Iqbal5, Hina Ahmed Malik3, Syed Muhammad Zaigham Abbas Naqvi6, Raza Ullah7 and Muhammad Abdullah Khan1

...ophyll pigmentation in plants is a supreme factor to assess the health of plants and ultimately leads to crop yield estimation. The present experiment evaluated the capacity of high-resolution satellite imagery to estimate wheat chlorophyll content coupled with ground-based information for accurately monitoring crop chlorophyll status under rainfed conditions. Images with zero clouds from LANDSAT 8 and ground data collection...

Muhammad Afzal1,3*, Shafqat Saeed1, Hasan Riaz1, Muhammad Ishtiaq1, M. Habib ur Rahman2

...comprised of genetic variants which could be differentiated by mitochondrial cytochrome oxidase I (mtCOI-3ʹ) gene. Most numerous cryptic species is Asia II-1recorded all over in Pakistan whereas North Africa-Middle East (NAFME) previously known to be found in the Sindh province but now also reported in the Punjab province. This study revealed that overall diversity of whitefly cryptic species in Pakistan is higher than previous studies. Some whitefly cryptic ...

B. K. Goswami, C. Bhattacharya, R. Paul and T. A. Khan

...255, 255, 255);"> plants. Among the tested treatments, Trichoderma viride

A.E. Ismail and M. M. Mohamed

...compared to un-amended plants. All rates of Ch M treatment gave best results in protecting sugar beet plants and diminishing the nematode population densities in various stages. But, SM treatment with their rates ranked statistically in the second category. However, the three levels of CM treatment achieved the third category in managing the nematode. All treatments significantly improved infected sugar beet growth including...

B. Archana and R. Saxena

...s extract of medicinal plants viz., Amaranthus spinosus,Chenopodium album, Catharanthus roseus, Solanum nigrum and Ocimum sanctum were investigated for their nematicidal activity against second stage juvenile of Meloidogyne incognita by in vitro technique. Aqueous extract of all plant roots exhibited nematicidal activity. LC50 values calculated as 1024 ppm for C. roseus, 1867 ppm for S. nigrum, 1968 ppm for A. spinosus, 3428 ppm for C. album and 962 ppm for O....

Mohamed S. Abbas1*, Adel E.M. Mahmoud2, Hemat S. Mohamed3, Adam Cieślak4 and Małgorzata Szumacher-Strabel4

...ffect of dietary forge plants (grasses, legumes and forbs) contents and concentration on ruminal fermentation, pH, ammonia (NH3), total gas production (TGP), methane and volatile fatty acids (VFA) concentration. Twenty-six wild palatable forage plants were identified and analyzed for pH, NH3, TGP, methane and VFA. The results indicated that in grasses the highest pH and NH3 concentration was found in Aeluropus lagopoides, TG...

Rehman Shabbir1, Ghulam Sarwar1, Noor us-Sabah1, Mukkaram Ali Tahir1, Muhammad Luqman*2, Muhammad Fahad Ullah3, Muhammad Zeeshan Manzoor1 and Imran Shahzad1

... this trial. The contaminants of the stream water were utilized for this trial to check its impacts on soil properties and growth of tomato plants. The physiochemical parameters of the soil such as pH, EC, organic matter, heavy metals and physiological parameters of the tomato plants were observed. Most of the soil parameters were proved higher with the irrigation of the industrial wastewa...

Ghada A. Ibrahim1*, Mohamed Sayed Helal1, Nahed Abd Elhafeeze Kamoura2, Mohamed Samir3,4, Amira Mohamed Mazid5, Mohamed F.M. Farag6

...etween virulence determinants and MDR. The bacterial examination of 200 nasal swabs and 30 lung tissue samples (taken from 30 emergency slaughtered cattle) indicated that Klebsiella spp. was recovered in 55/230 (24%) of all samples with a high proportion of K. pneumoniae (18.7%). In-vitro antibiogram exhibited a wide MDR phenotype. The virulence genes (fimA, aerobactin, rmpA and magA) were exhibited in 90%, 85%, 90% and 80% of the tested isolates, respectively...

Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*

... the feed derived from plants.

...

Rahmat Ullah Khan1*, Karim Gabol1, Asif Sadam2, Waheed Ali Panhwar3, Hamidullah4 and Abdul Rahim1

... on the branch fork of plants. The nests were mainly constructed using local dry grasses (48%) followed by crop leaves (35%), plastic string (10%), and unidentified materials (7%). The average outer diameter of the nest 12.00±1.1 cm, inner diameter 9.13±2.3 cm and inner cup depth was 4.99±2.1 cm. This bird has one brood per season. Overall breeding cycle lasted for 90 days. The shape of the eggs was oblong and white pinkish, with darker re...
SYED ZULFIQAR ALI ABIDI, HAFIZ ABDULLAH SHAKIR, SYED SHAHID ALI, & JAVED IQBAL QAZI*
..."text-align: justify;">Plants produce different metabolites and some of them are used for antimicrobial, fungicidal, herbicidal, piscicidal and molluscicidal. The present study was aimed to find out metabolites of piscicidal potential. Total thirty plants were collected on the basis of their availability and abundance around the year from different locations of Punjab, Pakistan. The aqueous and alcoholic extract of fresh and...
SAEED AHMED*1, ZIA-UR-RAHMAN1, SALMA KHALID2, TARIQ KHAN1, ARSHAD IQBAL3
& ZAMARUD SHAH4
...king water. Filtration plants, proper chlorination and awareness program should be carried out for safe drinking water.
 
Key Words: Drinking water, Microbial contamination, waste management.
...
 
 MUHAMMAD MUNEEB SOHAIL1, FATIMA AMEER2, GUR CHARN SINGH2, MUHAMMAD ZAID1* 
...pe of study, the participants (n=53) were recruited for the study. Participants were given one-day free health camps and they were anthropometrically measured. Plasma lipid fractions were accordingly determined. Participants suffering from bacterial/viral infection, hemophilia, diabetes mellitus, cardiovascular disease (CVD), cancer, or anemia were excluded from this study. Statistically s...
 
 SADAF SARFRAZ1*, SAFDAR AMEER1, REENA AMBREEN1, SHOMAILA SIKANDAR 2, SHAISTA NAWAZ3 AND YASIR SALEEM
...ly occurring medicinal plants, Cinnamaldehyde, owing to its acid generation, acid tolerance and virulence gene expression has gained a considerable attention. Keeping in view its beneficial aspects, the present study has been conducted to investigate the contents and compare the nutritional and antimicrobial activities of Cinnamon collected from various regions of Asia. In this study, antimicrobial activity of cinnam...

Arief1, Roni Pazla2*, Rizqan1, Novirman Jamarun2 

...>Tithonia diversifolia plants and cassava leaves have the potential to be used as a substitute for field grass. Palm kernel cake is a waste of the palm oil processing industry and can be used as a concentrated alternative. This study aims to determine the impact of giving Tithonia diversifolia plants, cassava leaves, and palm concentrates on the milk production and quality (fat and lactose), intake, and digestibility of Etaw...

AZKA ASIF, HAREEM MOHSIN*, SADIA N CHAUDHRY, & WARDA FATIMA

...he presence of biosurfactants but many of these show variable results under the same conditions and for the same organism. Most commonly applied screening assays including oil spreading technique (OST), tilted glass slide assay (TGS), drop collapse assay, emulsification index E24 and emulsification assay were used to evaluate production of biosurfactants in five biochemically identified strains isolated form oil contaminated...

Muhammad Ramzan1*, Unsar Naeem-Ullah2, Shafia Saba2, Madiha Mobeen Khan3, Umair Faheem4, Asad-ur-Rehman3, Naeem Arshad Maan3 and Waseem Hassan5

...cted from the infested plants grown in lawns of Muhammad Nawaz Shareef University of Agriculture, Multan, Pakistan, and were brought to the lab for rearing and identification. After emergence of moths, specimens were killed and identified using available taxonomic keys under stereomicroscope. After identification, it was revealed that the insect under study was identified as T. varians. After going through the relevant literature, it was found that this specie...

Hemayet Hossain1, Md. Masud Parvej1*, Khadiza Akter Brishty3, Muhammad Ali4, Junayed Ahmed4, Asibul Hasan4, Rubel Miah4, Md. Piplu Mia4, Saad Muhammad Rafe-Ush-Shan4, Md. Nazmul Alam4 and Md. Zahidul Islam Khan2

... disorders (IND) in ruminants throughout the year 2021 in Bangladesh. A total of 755 selected clinical cases were recorded, of which 450 were cattle and 305 were goats, respectively. The selected clinical cases were diagnosed through anamnesis, physical examination, clinical signs, gross pathology or postmortem examination, and clinical examination using common laboratory techniques. A total of 28 infectious and non-infectious diseases and disorders in rumin
Syeda Fakhra Waheed1, Asim Aslam1*, Muti-ur-Rehman Khan1, Kamran Ashraf2 and Beenish Zahid3
... of IBDV segment reassortants having segment A of A3 (very virulent) and segment B of B3 (early Australian-like) genogroups reported in Pakistan backyard poultry. Further study is required to determine the pathogenicity of the IBDV reassortant and development of new policies for IBDV intervention in the country.

...

Ovirup Bhushan Paul1, Shodipta Sharma Urmi2, Md. Ashraf Ali Biswas3* 

...uction. 

...

Riswandi1*, Ali Aim1, Muhakka1, Afnur Imsya1, Agus Wijaya2

...lternative feed for ruminants due to as a source of nutrients and phytochemicals (tannins and saponins), including water mimosa, giant molests, and water chestnuts. The objective of this study was to evaluate the effect of swamp forages combination in the ration on the characteristics of rumen fermentability and methane production. The design used was completely randomized design (CRD) with 4 treatments and 4 replications. The treatments given were A (guinea g...
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
...r, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardou...
Riaz Muhammad1*, Aamer Sharif2 and Muftooh ur Rehman Siddiqi³
...ious micro hydro-power plants because of its low head, cost-effectiveness, environmentally friendly and minimal installation and setup time. In the present study, the performance of single-stage gravitational water vortex turbine assembled in a conical basin with curved blade has been analyzed at different head and flow rate to investigate the performance parameters such as vortex formation, vortex height and rotational speed. In addition to that, the influenc...
Muhammad Arabi Awan1, Hafiz Husnain Nawaz2*, Naeem Akhtar2 and Azmat Ali Awan3
...n on a 10 cm branch in plants treated with CHLORPYRIPHOS 50% EC and THIAMETHOXAM 25 WG was significantly different from that of the control and Detergent, but not from either of the other two treatments. The control group had the highest olive psyllid population, which was measured at 22.08 total individuals. These results suggest that treatment with detergent was the most effective at reducing the population of olive psyllids, while CHLORPYRIPHOS 50% EC and T...

Abubakar Sadiq Muhammad1,2, Latiffah Hassan1, Saleha Abdul Aziz1, Zunita Zakaria1, Hassan Ismail Musa1, 2*, Maswati Mat Amin3 

Ahmad Jupri1*, Yuliana Vofi2, Faturrahman2, Immy Suci Rohyani1, Ernawati1, Bulkaini3, Djoko Kisworo3, Wardatul Jannah4 

...n be polluted by contaminants such as bacteria, viruses and others during storage and distribution. This study aims to analyze the quality and microbiological feasibility of drinking water sourced from Joben Springs, Montong Gading, East Lombok. The research was carried out in May-June 2021. The research method used was purposive sampling with sampling carried out at three points: the spring, the main reservoir, and the residents’ reservoir. The Coliform...

A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1

...N isolated from potato plants cultivated at Monofyia Governorate. RNA was extracted from virus-infected tissues of D. metel leaves by the use of degenerate primers through polymerase chain reaction (PCR). Large-scale amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation...

Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2

...and Physalis peruviana plants. Total nucleic acids were reverse transcribed using Retrotool reverse transcriptase enzyme and the PCR reactions were performed for 30 min in a capillary thermal cycler.  RFLP analysis of the PCR products was performed using Msel restriction enzyme. The results showed a dimorphic restriction digestion profile that "as suitable for identifying the two isolates. The method described here is rapid. reliable and highly recom...

E. K. Allam1; Kh. A. El-Dougdoug1; M. A. Amer2; A. A. Abou-Zaid2; and S. M. Amin2

...was detected in potato plants grown in Egypt using return-polyacrylamide gel electrophoresis (R-PAGE) and molecular techniques. The method involved the extraction of circular nucleic acids followed by electrophoretic analysis of the extracts on 5% polyacrylamide gel. A reverse transcription-polymerase Chain reaction (RT-PCR) assay was used for the isolation and identification of PSTVd cDNA from infected plant materials using a specific primer to PSTVd. A major...

A. S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik2; Nashwa M. A. Abd El Mohsen1; and H. M. Abdelmaksoud1

...;">The infected potato plants showed aucuba symptom characteristic to this virus (brilliant and extensive yellow mottle on lower and middle leaves reaches their tips, brown patches and sunken brown areas were frequently observed on the tubers surface) were used as a virus source. Isolation and identification of the virus was performed through studying biological, serological, and molecular characters. Electron microscopy helped for illustration Of Morphology o...

S.A. El-Kewey1; R.A. Omar1; S.A. Sidaros2 and Samaa Abd El-Khalik3

...ity symptoms on garlic plants of both cultivars. The electron microscope preparations of crude sap extracted from naturally infected garlic plants and negatively stained with 2% PTA showed flexuous rod-shaped particles 657-714 nm long. Biological relationships between the virus and insect vectors were studied.

...

 Salwa N. Zeinl and Hanaa S. Zawam2

...as transmitted to bait plants grown in soil containing Xiphinema spp. nematodes, The virus was identified according to host range, mode of transmission, particle morphology, serological tests, and SDS-Polyacrylamide gels. Purification of ACLSV was performed using bentonite/polyethylene glycol. Electron micrograph of purified virus preparation revealed flexuous filamentous virus particles of 700 nm length and 12 nm wide. The average yield was 1.14-1.7mg/100 g t...

Muhammad Afzal Naeem1*, Muhammad Hassaan Khan2, Tahmina Nazish3, Uzma Bashir4 and Midrarullah5

... of the post-harvest remnants of cotton crop on the germination and growth parameters of successor wheat crop. Experiment was laid down in complete randomized design. The seeds (n=10) of Triticum aestivum L. were placed in each replicate and treated with aqueous extracts from various parts of G. hirsutum (root, stem and leaves) at concentration (0-100% v/v). Among the various test extracts of G. hirsutum, leaf extract were found to impart maximum inhibitory ef...

Bismillah Khan1*, Muhammad Mehran Anjum1,2*, Maaz Ullah1, Izharullah1, Aftab Ahmad3 and Jawad Akbar1

...er weeds density (79.6 plants m-2), (64.0 plants m-2) and (39.6 plants m-2) 30, 60 and 90 DAS, respectively. Similarly, local check PS-15 produced higher weeds fresh weight (219.6 g m-2), (253.7 g m-2) and (303.0 g m-2) 30, 60 and 90 DAS, respectively. Moreover, weeds dry weight was recorded higher (61.3 g m-2), (88.6 g m-2) and (111.6 g m-2) 30, 60 and 90 DAS in local cultivar PS-15, resp...

Galuh Chandra Agustina1*, Erwin Syahfitri1, Viski Fitri Hendrawan1, Siska Aditya1,2 

...k cumin seeds as antioxidants on the expression of caspase-3 and sertoli cells in spermatogenesis. A total of 20 male mouses were divided into five groups, K- (negative control, no treatment), K+ (positive control, 40 mg diazinon/kg BW); P1 (40 mg diazinon/kg BW + 200 mg black cumin/kg BW); P2 (40 mg diazinon/kg BW + 400 mg black cumin/kg BW); P3 (40 mg diazinon/kg BW + 600 mg black cumin/kg BW) throughout trials. The results showed that the black cumin seeds...
Saiwa N. Zein
...dlings and tested host plants. Host range of the virus studied was restricted in Chenopodiceae. Cucurbitaceae. Ebenaceae. Leguminosae and Solanaceae. The identity of the virus to TRV was confirmed by mode of transmission. particle morphology and serological typing. Examination or the purified virus preparation 1» electron microscopy revealed rod-purify the Egyptian isolate of TRV. The yield of the virus was 2.6-5.7 mg/ 100 g tissue of Nicotiona rustica p...

Adel B. Salama and Reham M. Sabry*

...trol). Petal harvested plants produced a significantly much more harvestable total flower yield of 297-350 per plant than control with 48-51 flower/plant. Further, petal harvesting has significant effect on the flowers number and it increased 6-7 folds; hence possibly improve the compensation ability of plants to set new buds. Petal harvesting had positive significant effects on plant fresh and dry weights, seed yield but ad...

Najamuddin Solangi1*, Mushtaque Ahmed Jatoi1, Adel Ahmed Abul-Soad2, Abdul Aziz Mirani1, Muhammad Aslam Solangi3 and Ghulam Sarwar Markhand1

...i and Ajwa. Spikelet explants of spathes (avg. 17, 28, 32 cm) excised at different intervals were used as initial explants. Results revealed that sterilization of spathes with 50% sodium hypochlorite (NaOCl) solution resulted in significantly highest survival, lowest mortality and contamination in spikelet explants. The spikelet explants obtained from im...

Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5

...and protein structure. Plants have adapted several protective mechanisms like production of antioxidants, enzymes and carotenoids to face reactive oxygen species and avoid photoinhibition. This article provides overview of molecular mechanisms involved in photoinhibition and its protective elements.

...

Mehwish Kanwal1, Muhammad Mushtaq1*, Surrya Khanam2, Irfan Ahmed3, Muhammad Sajid Nadeem1, Amjad Rashid Kayani1 and Tariq Mehmood1

...des (acute and anticoagulants) for controlling Indian crested porcupine populations in agro-forestry ecosystems.

...

Rahma Boukarine*, Leila Hamdi and Kamel Khelili

...ve been extracted from plants and fruits, especially antioxidants which aid protect against oxidative stress. This study was conducted on Albino Wistar rats to investigate the antioxidant effect of Eruca sativa on the hepatic and renal profile damaged by xylene. Seventy rats were divided into seven equal groups and treated by gavage for 30 days as follows: Control group (C), group (CO), positive control group (RE) was receiv...

Yue-Xia Ding1, Qun Wu2, Zhao Namula1 and Yi Ma1,*

...plasmid conjugant, conjugants had obtained the resistance phenotype and the related resistance genes from the donor bacteria. The LD50 of conjugants and induced resistance strains compared with parental strain, the virulence was lower than sensitive strains. The present study demonstrated that the virulence of resistant Streptococcus strains obtained by different drug resistance transfer methods was lower than that of their ...
Widya Pintaka Bayu Putra1, Herman W Raadsma2, Indriawati1, Slamet Diah Volkandari1 and Endang Tri Margawati1*
...importance in small ruminants. This study was carried out to investigate litter size (LS) as a selection criterion in Merino rams using Estimated Breeding Value (EBV). Hence, the heritability (h2) value was estimated with paternal halfshib correlation model through analysis of variance (ANOVA) method. A total of 650 records of LS were used in this study, representing in the progeny of fourteen (14) rams collected from year 1999 to 2004 at Cimanglid Research Pa...

Anwar ul Haq1, Maqsooda Parveen2, Shehzadi Saima3* and Khalid Masood Ahmad1*

...ng losses of these pot plants. Optimum concentration of appropriate auxins is used to promote effective rooting. Completely randomized design (CRD) is adopted and it consisted of five treatments including control and different concentration of both auxins viz. 1-Naphthalene acetic acid (50 mg/L,100 mg/L) and Indole-3-acetic acid (100 mg/L, 200 mg/L) on tip cuttings of chrysanthemum. In this experiment, 15 pots of 9-inch diameter were used which were filled wit...

Hassan Raza1, Muhammad Kashif Afzal2, Muhammad Luqman1*, Tahir Munir Butt3, Muhammad Yaseen1 and Muhammad Umer Mehmood1

...t with a minimum of 50 plants was collected from the Department of Agriculture (Extension). A total sample size of 310 farmers was selected through a purposive sampling procedure by using Morgan and Krejcie table as the total population (Olive growers in the targeted research areas) is 1500. Data were collected through a face to face interviews with the help of an interview schedule. The SPSS (Statistical Package for Social Sciences) and MS. Office software we...

Sahar Ezeldien1,2, Foromo Dramou2, Fatma M. Yousseff3*, Alexander A. Nikishov2, Sergy B Seleznev2

...most popular medicinal plants known for its antibacterial, anti-inflammatory, and antioxidant properties. This study was conducted to determine the effect of chamomile aqueous extract on the productivity, egg quality, and serum biochemical parameters of laying Japanese quail. A total of 42 Japanese quail were separated into two groups of 21 birds each, with three replicates per group (7 birds) at random; the control group without any additives and the suppleme...

Syed Muhammad1*, Badar Naseem Siddiqui2, Farhat Ullah Khan1, Muhammad Adnan3, Sami Ullah3 and Nawab Khan4

...field Staff (field assistants (FAs) and Agriculture Officers (AOs) working in the above areas constituted the sample respondents.Data were analyzed using Statistical Package for Social Sciences(SPSS). The results showed that the technical competency of FAs remained in between low and high categories with mean values ranging from 2.45 to 3.80. Similarly, the technical competency of AOs was in between low and very high categories with mean values ranging from 2....

Martin-Luther Oseni Okolo1, Monday Eneojo Akor1, Cornelius Arome Omatola1*, Zainab Penninah Ochada1, Ugbane Eleojo Okolo2, Benjamin Mudi Idache3, Andrew Isiramen4, Julius Akor Omatola5 and Moses Adaji David6

...rs (2.16%) and civil servants (1.79%). Yet among patients who identified as students, no incident of TB was observed. Patients with secondary education had the highest prevalence (3.08%) followed by patients with tertiary education (1.58%). Patients with no formal education and primary education had no co-infection. Between the sociodemographic factors that were assessed and the HIV patients who had TB infection, there was no statistically significant correlat...

Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Summer, Ali Haidar Gormani, Saira Nawaz and Ayesha Muzamil

...rent parts of mulberry plants. Mulberry leaves possess different physiological and biological potentials. Inflammation is the most common factor involved in various chronic diseases. This research study was conducted to evaluate anti-inflammatory and analgesic potentials of hot water extracts of mulberry leaves (mulberry tea) of two species i.e., Morus alba and Morus nigra. Mice were fed orally with mulberry leaves extract (200mg/kg, 100mg/kg and 50mg/kg) mixe...

Imtiaz Khan1*, Bashir Ahmad1, Ahmad ur Rahman Saljoqi1, Shah Alam Khan1, Javed Khan3 and Muhammad Azim Khan2

...ers having 3 rows and 5plants/row in randomized complete block design (RCBD) with three replications. The data was recorded from Mar-Nov from fresh and ratoon crops of the year 2020 and 2021, respectively. The leaves (top, middle, and bottom) of five plants in each subplot was observed randomly for data collection every fortnight in all replications. The total mean population of Pyrilla perpusilla (eggs cluster and nymphs/ad...

Asmaa A. Darwish*, Adel M. El-Kattan, Mona A. Mahmoud, Mohamed T. Ragab, Amani A. Hafez 

...atory cytokine, anti-oxidants, insulin, T3, and T4 levels. The iron profile of infected animals was characterized by a significant (P˂0.05) hypoferremia, hyperferritinemia, and hypotransferrinemia. The estimated pro-inflammatory cytokines and APPs yielded high sensitivity and specificity values in both infected species, but IL-1β, IL-6, and Fb had the highest likelihood ratios in infected sheep and IL-1β and IL-1α had the highest likelihood ra...

Hamdi Mayulu1*, Endang Sawitri2

...ctive Compounds, Antioxidants, Feed Additives, Livestock
...

Indri Juliyarsi1*, Sri Melia1, Rizki Dwi Setiawan1, Deni Novia1, Lailatul Anshor2, Tomi Candra2 

... the addition of antioxidants from Rosella calyx extract (Hibiscus sabdariffa L). The edible film was prepared with the addition of four different levels of rosella extracts (0, 0.2, 0.4, and 0.6%). The addition of rosella calyx extract led to a significant difference (P<0.05) in color (redness), antioxidant activity, and color sensory attributes, but did not affect the moisture content, aroma, and flavor (P>0.05). The greater the amount of rosella extra...

Ikram Ullah1, Zaib Ullah2*, Junaid Khan1, Sajid Mahmood1, Zafar Iqbal3 and Naveed Akhtar2

...9. A total of 100 inhabitants of various occupations were interviewed and questionnaires were filled from 32 villages of both valleys. Agriculture crops destruction was documented as a common conflict issue (92%), followed by livestock predation (90%), and human casualties (85%). Maiz was frequently raided crop (50%) followed by fruits and vegetables (27.1%, 22.6%). Goats were the most (47.61%) predated animals, followed by sheep and cattle (37.14%, 12.38%). H...

Sarwat Yousuf1, Shaista Emad2 , Mohammad Misbah ur Rehman3, Zehra Batool4, Sara Qadeer5, Yousra Sarfaraz1, Sheeza Sheikh1, Sana Sadaf6 and Tahira Perveen1,*

...therapeutic potency of plants has been known for ages and the ability to divulge their biological activity is an area of great interest. Citrus lemon is traditionally used as an antioxidant, antibacterial and anti-inflammatory agent. This study intended to determine the potential role of lemon peel oil in neurobehavioral function and oxidative stress. Rats were treated with lemon peel oil at a dose of 0.7, 1.4, 2.1, 2.7, 3.5 g/kg for 14 days. Results showed th...

Amina Rahat1, Zahin Anjum1*, Sehlina Zehra2, Fatima Umal Baneen3 and Rabia Chishti1

...e present in medicinal plants. These bioactive chemicals serve as a foundation for the creation of antibiotics that are utilized to cure infectious illnesses. Allium sativum is being used traditionally since ages for many purposes. It is extensively used in numerous dishes throughout the world and due to its aromatic nature, as a fragrance and Plantago ovata is traditionally used for many therapeutic purposes; laxative anti-acidic stabliser, stomach soothing, ...

Monis Hussain Shah1*, Riaz Ur Rehman2, Riaz Ali Shah1, Farwa Batool3, Rizwan Rafique4, Muhammad Usman5, Sajida Bibi6, Sadia Yasin7 and Samida Qamar8

...The performance of the plants during 2017-18 were judged by observing the bulb germination percentage, leaf width (cm), leaf length (cm), scape length (cm), flower size (mm), primary color of the flower, secondary color of flower, no. of large, medium and small size of bulbs and number of bulbs harvested. The bulbs were harvested and stored at 5±2oC (In Refrigerator). The morphological attributes of plants were observ...

Salvator Minani1,2*, Eric Nsengiyumva1, Anatole Bigirimana1,2, Arnaud Cubahiro1,2, Dieudonné Ntakirutimana1,2 and Vénuste Bizoza1,2

...ing mainly domestic ruminants and occasionally humans. Due to the lack of epidemiological studies of fascioliasis in Burundi, this study was carried out to assess the prevalence of fascioliasis by liver inspection in slaughtered ruminants at Muyinga slaughterhouse. The liver of each slaughtered domestic ruminant was inspected, palpated and incised to look for flukes in the liver bile ducts. Statistical analysis was done usin...

Siswanto Imam Santoso*, Agus Setiadi, Wahyu Dyah Prastiwi 

Altaf Ur Rahman1, Muhammad Ajmal Khan2*, Ali Hazrat3, Awais Farid4, Muhammad Yahya3* and Inam Ullah5

...rial strains. Numerous plants act as a source of novel compounds that could be used to develop new drugs. Therefore, the current study was aimed to investigate the methanolic extract of Corylus jacquemontii for phytochemical, antibacterial, antioxidant potential. The methanolic fraction of C. jacquemontii was evaluated for quantitative phytochemical constituents. The antibacterial efficacy was investigated via well diffusion method by using a concentration of ...

Shujaullah Khan1, Zahid Hussain1*, Haroon Khan1 and Omer Suha Uslu2

.... However, the tallest plants and the highest number of grains spike-1 were observed in hand weeding. The highest thousand-grain-weight, biological yield and grain yield were recorded in the hand weeding treatments. However, the results of hand weeding treatments were statistically at par with the treatments of artificial intelligence (robotic weeding). The artificial intelligence got the highest CBR followed by the broad-spectrum herbicide and hand weeding. I...
Umer Farooq1,2, Nimra Murtaza2, Abubakar Siddique1, Bilal Saleem1, Obaid Ur Rehman1, Nageen Zahra1, Muhammad Uzair1, Muhammad Naeem Riaz1,3* and Muhammad Ramzan Khan1*
...fied 154 deleterious variants in 134 genes. Gene enrichment highlighted the presence of these genes in different biological processes including developmental, signaling, transport, metabolic and homeostasis. These findings are useful resource for further exploration into the molecular processes associated with these variances.

...

Farheen Shafique1, Shaukat Ali2*, Mahreen ul Hassan3, Saiqa Andleeb1

...nd 1–4 per 1000 infants is diagnosed with the disease making it one of the high-risk countries in the world. This study was aimed to quantify the public’s awareness, attitude, perception and prevention among the population of Azad Jammu and Kashmir. A descriptive cross-sectional was conducted from Mar-Sep 2021. Participants were selected through random sampling and questioned face to face using a predesigned, pre...

Ahmed El-Sayed Ismail 

...ngs than on the oldest plants. Studies on the effect of N, P and/ or K fertilizers applied to Giza 2 corn on the behaviour of H. zeae revealed that the nematode population greatly varied according to the fertilizer type and level. When N, P, or K were used separately, the fertilized plants sustained the lowest nematode final population and rate of build-up as compared with those of the control plants...

Vui Van Nguyen1, Samorn Ponchunchoovong2, Sajeera Kupittayanant3, Pakanit Kupittayanant2* 

...ts of the adding antioxidants to semen extender on canine sperm during 12 days of chilling storage. Twenty ejaculates from five American Bully dogs were used. The sperm quality was determined by system automatic sperm analyser for sperm motility parameters, and by confocal laser scanning microscope for sperm membrane integrity parameters. Sperm lipid peroxidation was also analysed through malondialdehyde production. The study found that there was a gradual dec...

Farooq Jan1*, Abdur Rauf1, Ikramullah Khan1, Muhammad Yasin2, Muhammad Qayash3, Hazrat Wali1, Muhammad Luqman1, Fayaz Asad4 and Muhammad Khalid5

... RotoRod sampler. Many plants pollen are allergenic that cause different types of allergenic diseases globally. Pakistan also faces the problem of pollen allergy caused by various plants pollen. Among these allergenic pollen producing plants are Broussonetia papyrifera, Alternanthera pungens, Cannabis sativa, Eucalyptus globulus and Taraxacum officinales pollen grains are dominant. These p...

Zia Gul1, Muhammad Sajid1, Muhammad Noman Khan1*, Faheem ul Haq1, Zohra Nawaz1, Muhammad Bakhtiar2, Sajid Siddique1, Komal Aslam3 and Muhammad Irshad1

...0.8) was recorded when plants were irrigated at 15 days interval. While regarding organic manures, the maximum number of leaves (11.0) plant-1, plant height (41.6cm), leaf length (39.5 cm), leaf area (247.8cm2) leaf breadth (4.7 cm), leaf thickness (3.5 cm) leaf weight (207.3 g), number of suckers (4.1) plant-1, amount of gel (174.7 g) leaf-1 and survival percentage (71.5) was recorded in plants fertilized with poultry manur...

Akbar Hayat1*, Muhammad Asim1*, Tehseen Ashraf2, Ehsan-Ul-Haque1, Rabia Zulifqar2, Maryam Nasir3, Ahmed Raza1, Fahim Khadija1, Sohaib Afzal1 and Shafqat Ali1

...f healthy and vigorous plants in the nursery. The trial was designed with seven treatment combinations of growing substrates that was five times repeated for each treatment in Completely Randomized Design (CRD). The rough lemon rootstock was tested for growth with all different types of media as T1 = Soil + silt + sand (2:1:1), T2 = Rice husk + sand + soil (2:1:1), T3 = Bagass + sand + soil (2:1:1), T4 = Wheat straw + sand + soil (2:1:1), T5 = Rice husk + sand...

Muhammad Ashfaq ur Rahman1*, Saleem Khan1, Aurang Zeb2, Zia ud Din1 and Zafar Iqbal3

...t bacilli (AFB). Participants underwent TB therapy in accordance with the WHO recommendations. The variables measured included weight, height, BMI, body fat, albumin and sputum test. Subjects with BMI status below normal, normal, and above normal were represented by 23.0%, 58%, and 19%, respectively. Albumin levels were found to be within normal range (3.5 g/dL) in 57% of the individuals. At the two-month follow-up, 75% of patients who had a normal BMI and/or ...

Amirul Faiz Mohd Azmi1,4, Hafandi Ahmad1, Norhariani Mohd Nor1, Goh Yong Meng1, Mohd Zamri Saad2, Md Zuki Abu Bakar1, Norafizah Abdul Rahman5,6, Agung Irawan7,9, Anuraga Jayanegara8,9, Hasliza Abu Hassim1,3,9*

 

... buffalo performance warrants further investigations, especially in an in-vitro study. Even though several studies have reported the potential of supplementation in enhancing the growth of buffaloes, the effect on a different breeds of buffaloes, the potential to reduce methane production, and the changes in microbial populations remained unclear following different ratios of forage: supplementation feeding regime. This study described the effects of supplemen...
Asadullah Memon1, Asghar Ali Kamboh1*, Saeed Ahmed Soomro2, Muhammad Ammar Khan3, Akeel Ahmed Memon4 and Hubdar Ali Kolachi1
...mic losses in small ruminants worldwide. The present study assessed the prevalence of Coxiella burnetii, Chlamydia abortus, and Brucella melitensis in 178 sheep and goat samples obtained from Hyderabad, Tando Allahyar, and Mirpurkhas districts of Sindh Province of Pakistan. The results revealed that the seroprevalence of Q fever was significantly (p<0.05) higher than chlamydiosis and brucellosis (43.82% vs. 37.7% and 17.98%). The districts-wise incidences o...

Afifatul H.A. Adilah1, Junun Sartohadi2* and Suci Handayani1

.... Coconut and Mahogany plants have been cultivated as intercrops in most dry-land agricultural fields by many people for different purposes of income generation. The differences in canopy characteristics between the two plants significantly affect the production of runoff. Field evidence is needed to support it as a suitable plant for soil and water conservation efforts. The study was conducted using a field survey method eq...

Elihasridas, Mardiati Zain*, Roni Pazla, Simel Sowmen, Qurrata Aini 

...ss substitution for ruminants, but the lignin content is relatively high, so it has low digestibility. We evaluated the effectiveness of precursor rumen microbial growth supplementation to increase the digestibility of ammoniated aromatic lemongrass waste. The precursor rumen microbial growth supplement contains cassava leaves as a source of branched-chain amino acids, phosphorus, and zinc minerals, which was administered as follows: T0= ammoniated aromatic le...

Wizna1, Rusfidra2, Robi Amizar3, Romi Andika1, Muhammad Haikal1, Zurmiati1*

...eftover food from restaurants and hotels with Bacillus amyloliquefaciens on total colony count of Bacillus sp. and nutrition content of leftover food.   The research, a 3x3 complete randomized design factorial, consisted of two factors, and each treatment was repeated three times. Factor A is the dose of B. amyloliquefaciens (3, 4, and 5%), and factor B is the fermentation time (3, 4, and 5 days). The total colony count of Bacillus sp., water content...

Rusul Adnan Dawood, Hasan F.K. Alghetaa*

...rol group. Total antioxidants were significantly (P<0.05) higher in the blood of HR group than all others. Moreover, peritoneal exudate showed significant (P<0.05) exacerbation of immunocyte counts in HgCl2-administered groups in comparison with others. However, resveratrol administration to HR group drove the inflammatory cell counts to be significantly (P<0.05) lower than of HD group. Altogether, we can conclude that the resveratrol has the required...

Deny Anjelus Iyai1*, Ambo Ako2, Sitti Nurani Siradjuddin2, Budiman Nohong2 

... find out the types of plants that can be a source of natural food for livestock both inside and outside the oil palm land. The study area was purposively selected from 9 districts (subdistricts) as many as 4 districts (44.44%). Withdrawal of grass clippings is done using a quadrant measuring 1 x 1 m2. Quadrant laying is done diagonally in a land area of ​​100 m2. Dominance Index, Species abundance using Shannon-Weiner Diversity Index, Similarity index, Sp...

Mohammed Naji Odhah1,2, Faez Firdaus Abdullah Jesse1*, Bura Thlama Paul3,4, Bashiru Garba5, Zaid Mahmood1, Eric Lim Teik Chung6, Mohd Azmi Mohd Lila7  

...phadenitis in small ruminants and is of considerable economic importance in many countries worldwide. The control of the disease in animals depends on the control of the disease in infected animals. Nevertheless, few countries where the disease was previously endemic have successfully eradicated the pathogen. This investigation was undertaken to determine the antibody titre (IgM and IgG) in does challenged with C. pseudotuberculosis and its Mycolic acids (MAs)...
Hari Prashad Joshi, Kuaanan Techato, Khamphe Phoungthong* and Keshav Raj Panthee
... on the study of determinants of rice production from a different perspective. This study also has made an effort to investigate the determinants of rice production in Nepal taking annual mean temperature, cultivation area, fertilizer used, and precipitation rate as the independent variable by the use of the Auto Regressive Distributed Lag (ARDL) Model. The data analysis from 1990 to 2019 showed that annual mean annual tempe...

Ishtiaq Ahmed1*, Hamid Ullah2, Zubair Ali2, Muhammad Sohail2, Yasir Amin2 and Afrasyab1

... in large and small ruminants. Substantial parasitic load in these animals is characterized by symptoms like diarrhea, poor weight gain, rough body coat, gastro intestinal disturbance like lack of appetite, reduced milk production, alopecia and bottle jaw. The study on prevalence of gastrointestinal helminths parasite of large and small ruminants was conducted in and around district Haripur. Faecal samples (n=633) were rando...

Asif Sadam1*, Rahmat Ullah Khan2, Karim Gabol2*, Muhammad Awais3,4, Mohammad Ismail1, Sajid Mahmood1, Muhammad Aslam4 and Hamidullah5

...proach including Participants’ observations, interviews and structured questionnaire. Our results showed that the local villagers of the remote area of district Mardan were the active observers of trapping, over hunting and trading of waterhen in the study area. The structured interviews with locals revealed striking facts about ongoing hunting and illegal trade by hunters and traders. The two tribes namely Ottomankhail of district Swabi and Mamund of di...

Zaib Ullah1*, Sajid Mahmood2,3, Zafar Iqbal4, Fakhar-i-Abbas5, Naveed Akhtar1 and Abdul Majid Khan6*

...se 1213 dig marks, 186 plants uprooting and two setting places. An average of 49.95 signs/km2 was recorded; this is a very high encounter rate. According to BBC (British Broadcasting Corporation) Science and Nature, the home range size of Asiatic black bears is 10 to 20 km2, so we concluded that more than 24 black bear were present in both valleys.

...

Bushra Allah Rakha1*, Farah Qayyum1, Muhammad Sajjad Ansari2, Ali Akhter1, Komal Shakeel1, Javeria Batool1, Faryal Akhtar1 and Sehrish Hina1

... other position of the plants 16.25%. Preferable height for nest construction by white-cheeked bulbul was 1-2m (60%) followed by 2-3m (23.7%) and 0-1m (16.25%). Outer diameter of nest was recorded (16.0 ± 4.22cm) while inner diameter was (10.8 ± 2.95cm). The preferred plant species used by white-cheeked bulbul for nest construction was garanda (Carrisa opaca; 58.7%) followed by sanatha (Dodonaea viscosa; 26.25%), panch phuli (Lantana camera; 6.25...

Mehran Ali* and Inamullah

...make it unavailable to plants. Inoculation of arbuscular mycorrhizal (AM) fungi could be helpful in the sustainable management of immobile P in soil. However, their use in releasing P from alternative sources in alkaline calcareous soils have been little investigated. To explore the influence of AM fungi and P management on wheat productivity, two years of field experiments were carried out at Agronomy Research Farm, The University of Agriculture Peshawar duri...

Nasir Ali1,2,6, Muhammad Ilyas2,3, Nazia Akbar1,2*, Gohar Rahman2, Shakirullah Khan4, Mujaddad Ur Rehman6, Abdul Samad5, Habib Ahmad1,2 and Bibi Nazia Murtaza7*

...ncient and modern inhabitants living in Khyber Pakhtunkhwa, Pakistan.

...

Asifa Majeed*, Amir Rashid, Palvasha Waheed, Asma Faryal, Aden Razaq and Ayesha Maryam

...t pathogenic genetic variants in APOA1 and ABCG1 genes associated with dyslipidemia in type 2 diabetic patients. A total of ninety subjects of both genders, aged between 30-70  years were randomly selected and further divided into a diabetic dyslipidemia group, a diabetic group and a healthy group. Genomic DNA was extracted from peripheral blood and subjected to the polymerase chain reaction using primers of the APOA1 gene and ABCG1 gene. The amplicons we...

Tahir Abbas Khan1*, Imran Ashraf1*, Athar Mahmood1, Muhammad Ilyas2, Sardar Alam Cheema1, Muhammad Mahmood Iqbal3 and Muhammad Umair Hassan1

...nutrient necessary for plants growth and development. Similarly, cultivars also differed significantly in terms of growth, yield and P utilization. Therefore, present study was performed to assess P efficient maize genotypes on the basis of growth and yield. The study was comprised different maize genotypes; CS-2Y10, KSC-SB 9663, FH-949, 30Y87, NT-6621 and DK-6789 and of diverse P levels; control (No P), 40 and 80 kg P ha-1. The maximum root length (RL), shoot...

Kyu-Jung Kim and Shin-Jae Rhim*

...or waterbirds were cormorants, large wading birds, dabbling ducks, diving ducks, gulls, and small wading birds. The multiple linear regression analysis revealed close relationships between stream structure variables and major waterbirds. Waterbird community conservation requires wetland-based management programs that are applied to habitat complexes at the landscape scale to support the needs of waterbirds. The results of this study can help with the conservat...

Nida Sadaqat1, Sheheyar Ahmed Khan1, Amna Bibi1, Sadaf Zahra1, Muhammad faisal Salamt1, Noreen Latief2 and Fatima Ali1*

...pplementation of antioxidants has proven beneficial in decreasing free radicals in burns. The aim of the present study was to investigate the effect of N-acetyl cysteine (NAC) on biochemical alterations during the post-burn stage in scalded rats. Twenty-four male Sprague-Dawley rats were anesthetized and dorsum was shaved. Second-degree skin burn was induced by immersing an iron mold (1.0 cm2 in diameter) in boiling (100°C) water for 5 min and placed on th...

Meryem Betmezoğlu1*, Dilek Arsoy2 and Mahmut Çerkez Ergören3

...of Caprine Prnp gene variants should be well understood for goat breeding programs in Northern Cyprus. This current study was designed to determine the putative allele frequencies and genotype distributions of Caprine­ Prnp gene variations in Northern Cyprus Damascus, Cyprus Native Hair and hybrid goats. Four different locations in the Northern Cyprus were selected for targeted gene sequencing. Blood samples were collected from 50 Northern Cyprus goats. Ge...

Rahamdad Khan1, Saad Muhammad2, Muhammad Haroon3, Saad Jan1 and Syed Majid Rasheed1*

...development and allows plants to work properly. Therefore, the aim of this study was to determine the effect of light duration on the growth performance of Parthenium hysterophorus and Cannabis sativa. The results showed that under reduced light duration (2 hours), plant growth performance (i.e., biomass, plant height, leaf area, and number of branches) was all reduced. In addition, with increasing light duration (9 hours), both species grew faster and recorde...

Saad Tahir, Nadeem Ahmed*, Mohsin Ahmad Khan, Muhammad Akram, Rabia Abbas and Kausar Malik

...rain GS115. The transformants showing highest resistance for Zeocin™ was selected for protein expression which produced to >350mg/L HSA-SK fusion protein. Further, affinity chromatography was carried out for the purification of the HSA-SK fusion protein. SDS-PAGE, western blot, and RP-HPLC analysis were also conducted, which confirmed the 98% purity of the product with 40% yeild having a molecular weight of almost 111kDa. The purified fusion protein (...

Abnet Mekonnen1*, Kadir Abderehman1 and Feti Seyaka2

...a in animals. Small ruminants, due to their anatomy and physiology, are not suitable for many of the anesthetic drugs. With strict consideration, some drugs are commonly used in these animals. Anesthetic drugs classified based on their action and efficacy. The commonly used local anesthetic agents include procaine, lidocaine and bupivacaine. Understanding the pharmacology of local anesthetics enables the anesthetists to predict the potency, speed of onset, dur...

Fatimah A. Al-Saeed 

...xposed to chemical pollutants, including heavy metals, which affect humans, animals and plants. Cadmium (Cd) is a heavy metal known as a toxic factor to humans, animals and plants. Saudi Arabia is enriched with medicinal plants whose therapeutic effects are not sufficiently known and not exploited properly. Medicinal plants

Nazia Haider, Asia Bibi* and Nahid Kausar

.... A total of 500 participants, 300 with spontaneous abortion and 200 healthy pregnant controls in first trimester of pregnancy were included in this study. The data was collected through questionnaire at the time of sampling after obtaining informed consent. ABO and Rh blood group was identified by using Antisera (including Anti-A, Anti-B and Anti-D). The analysis of haematological indices was done by using automated haematological analyzer (Sysmex Co. Japan)....
Muhammad Abdul Mannan1,2, Sharmin Chowdhury2, Md Abul Hashem3,4 and Md. Hazzaz Bin Kabir1,5*
...c nematode in small ruminants that causes significant economic losses to sheep and goat breeding operations worldwide. To combat this problem and minimize economic damage, effective preventative measures should be aimed at high-risk populations and a thorough understanding of the epidemiology is crucial. This study aimed to improve the understanding of the molecular epidemiology of Haemonchus contortus in sheep and goat carcasses in the Chattogram Metropolitan...

Asmaa A Darwish* 

...crease in IL-10, antioxidants, total protein, albumin, glucose, total lipids, cholesterol, minerals, electrolytes, and trace elements concentrations. The DG hemogram clarified a significant (P<0.05) microcytic hypochromic anemia accompanied by neutrophilic leukocytosis and lymphocytopenia, and their iron profile characterized by a significant (P<0.05) hypoferremia, hypotransferrinemia, and hyperferritinemia. After the urethral process amputation, ten ra...

Fariha Qahar and Muhammad Sayyar Khan*

...tion of xenobiotics in plants. The genetic manipulation of GSH biosynthesis-related genes is considered a prime strategy to achieve higher in planta GSH contents. In this study, stably transformed Brassica napus lines harboring the feedback-insensitive isoform of Serine acetyltransferase (SAT), a rate-limiting enzyme for cysteine (Cys), and GSH biosynthesis, were subjected to H2O2, metolachlor, and atrazine-induced oxidative stress. The overexpression of the N...

Ahmed Jaafar Mousa*, Nothaila Rasheed Hamid 

...igation, the genetic variants C64T, G236A, C243T, and A363C were found.  

...
Jaffar Hussain*, Zeenat M. Ali and Syed Farman Ali Shah
...cial photosynthesis in plants to produce the raw material for biodiesel production The fourth generation was not available on commercial scale. The biodiesel produced by esterification (one step) and Transesterification process (two step). The catalysts used were homogenous, heterogenous and enzymatic. The homogenous were alkaline and acidic. The alkaline catalyst undergoes saponification reaction when free fatty acid concentration was high. The acidic catalys...

SYED SHAHID IMRAN BUKHARI*, ZULFIQAR ALI & RIDA AHMAD

...remove the load of pollutants present in the air but it is recommended to
conduct detailed studies to monitor indoor air quality to understand the
relationship of environmental conditions and household activities leading
to health problems.
...

SHEHLA AKBAR*, SAIQA ISHTIAQ*, KHALID HUSSAIN, ANS MUNIR & SAIRA REHMAN

...riateness of medicinal plants or their extracts orally taken by the
marginal communities. Primary and secondary metabolites of Misopates
orontium (L.) belongs to Plantaginaceae family were screened out and
tested for therapeutic values through in-vitro biological assays.
Quantitative analysis was done on powder of Misopates orontium by
using standard methods for estimating the primary and secondary
IRAM MUJAHID IQBAL1*, ASAD SHABBIR1, 2, KANZA SHABBIR1, MAHAM NAVEED1, FAREIHA UROOJ1,
AQSA BUTT1, RAEES KHAN3, NIDHAN SINGH4 & FIRDAUS-E-BAREEN1
...e living collection of plants in botanical gardens and academic
institutions play an important role in scientific research, education, and
conservation. The University of the Punjab (PU) is one of the oldest and
largest seat of higher education learning in Pakistan with its two main
academic campuses located in the city of Lahore. Besides several oncampus
plantations, PU has a dedicated botanical gard...

ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2

...n having ten replicate plants for each salt (NaCl) treatment. Initially the plants were raised by irrigating with tap water and then after their establishment, with NaCl (50, 100 and 200 mM) containing water. Various growth and biochemical characteristics were found to be adversely affected by saline treatments i.e., root length, shoot length, fresh weight, dry weight, amount of protein and antioxidant enzymes. The higher le...

Orooba Mohammed Saeed Ibrahim1*, Rawaa Saladdin Jumaa2, Nibras Zeyad Yahya1 

...he market for novel adjuvants. The primary initial source of many medicines used to treat diseases today was plants. This study aims to ascertain the antibacterial activities of fruit Citrus aurantium and Citrus limonum juice on isolated Staphylococcus aureus, Sterptococcus pneumoniae and Klebsiella pneumonia. The antibacterial activity of fruit juice extract on bacterial strain was determined using macro-broth dilution, ag...

Abdul Latif Rind1*, Shahid Hussain Abro1, Rameez Raja Kaleri2,3, Ghulam Mustafa Solangi4, Raza Ali Mangi5, Muhammad Anees Memon6, Depeesh Kumar Bhuptani7, Sana Noor8, Zainab Lanjar9, Zahid Ali Mangrio10 and Abdul Wahid Solangi

Muhammad Ashfaq ur Rahman1*, Saleem Khan1, Aurang Zeb1, Zia ud Din1 and Zafar Iqbal3 

...oup receiving 15 participants on average. Nutritional counseling sessions were provided to patients in the nutrition therapy groups in order to urge them to follow one of nine pre-tailored diets designed to meet the nutrient needs of the group. They were also given food that contained the targeted nutrient(s). Control patients did not participate in these sessions and did not get food rations. Weight fluctuations were among the results of the study. Weight was...

Tariq Jamil1, Muhammad Saqib2*, Abid Rashid3, Muhammad Hammad Hussain4, Khushal Khan Kasi5, Muhammad Haleem Tayyab2, Muhammad Azam Kakar5, Heinrich Neubauer1 and Mudassar Iqbal6*

...tionally exposed participants in Quetta, Pakistan and analyzed by Rose Bengal Plate Test (RBPT). An overall 4/193 (2.1%, CI 0.6-5.2) seropositive were found. A higher seropositive rate was found in participants with >40 years age, livestock contact, poor socioeconomic group and no raw milk consumption. All variables didn’t show statistical significance by Fischer’s exact test. Further epidemiological studies a...

Romedi Çelik

... 14). All the colour variants had a peak crest (upright feathers) costume structure, which was at the back of the head, starting from the end of the neck and extending from ear to ear. Among the gender groups from the measurements obtained in this study; wing length, wingspan, tail length and head width (P < 0.001); shank length and head length (P < 0.01). Differences in beak length and beak width were also significant (P < 0.05). Moreover, the differ...

Salim Saifullah1*, Tasmina Kanwal2 and Khadija Rehman2

...on. The release of pollutants resulting from human activities, including transportation and industrial processes, worsens air quality issues, thereby causing detrimental impacts on both ecosystems and human health. Moreover, there is a strong interconnection between air quality and climate change. Numerous atmospheric pollutants, such as black carbon and methane, exhibit substantial warming characteristics, thereby intensify...

Muhammad Shahid Nisar1*, Ahmad Kamran Khan1, Ghulam Fatima2, Irfan Ahmed4, Khizar Sami Ullah2 and Syeda Amber Hameed2,5

...edients, natural antioxidants, antimicrobial compounds and substantially reduce the amount of waste.

...

Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Farooq Bhatti, Muhammad Summer and Ali Haidar Gormani

...gn: justify;">Mulberry plants belonging to the Morus genus are widely planted across Asia. Almost all parts of these economically and medically important plants including fruits, root bark, stem and leaves are of equal importance in terms of uses but their leaves are the most excessively used part. Traditionally leaves have been used in different folk remedies, dietary supplements and herbal medicine. Commercially these are ...
Nighat Nisar*, Hasina Maham Qadri, Asad Afridi, Muhammad Sami Khan, Muhammad Abdullah Khan
...alf of the study participants reported that the cost of mineral water was high in the cafeteria as compared to the local market. Forty-two percent of the students were not satisfied with the staff attitude and dissatisfied with the availability of food. The study findings reported that cost, availability of food and staff attitude should need improvement to maintain quality of cafeteria services so that majority of the students become satisfied with services a...

Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1

...ses a diverse range of plants, each possessing its own characteristic physical and biological traits that contribute to its individual ability to adapt, grow, and produce. While some generalizations can be made, it is vital to recognize the quality differences between various plant species and even different cultivated varieties. This   study was conducted to evaluate the relationship between nutrient content, digestibility, and gas production of sev...

Rini Widyastuti1*, Rangga Setiawan1, Nurcholidah Solihati1, Siti Darodjah1, Kundrat Hidajat1, Mochamad Ali Mauludin2, Alkaustariyah Lubis3, Mas Rizky Anggun Adipurna Syamsunarno4, Sigit Prastowo5, Takdir Saili6, Arief Boediono7

...sisted of thirty participants and the reproductive performance of 96 goats was investigated. Sociodemographic characteristics and reproductive knowledge of breeding were collected through questionnaires, interviews, and direct observation of the farms. The majority of members of Simpay Tampomas Farmers Group were males aged 41-59 years, who graduated from elementary school and had more than 10 years of experience in dairy goat farming. Furthermore, 75% of them...

Hamdy Abdala El-Nagar1, Abdelaziz Mohamed Elhais2, Ayman Hassan Abd El-Aziz3, Wael Mohamed Wafa1, Mohamed Sobhy Elsayed Farrag2, Moataz Ibrahim Badawy1, Safaa Elsayed Salah Atia2

...yme, or both, as antioxidants, on growth efficiency, liver function, kidney function, total antioxidant capacity, and immune response of Friesian calves from 7 to 105 days of age as an experimental period. Newborn male calves (n=20) weighing 37.92±0.63 kg were divided into 4 groups, five calves/group. The first group (G1, control) included animals without treatment. During the whole suckling period each animal in G2, G3, and G4 daily received milk suppl...
...The infected indicator plants featured severe mosaic on Lentil cv. Giza51, mottling on cv.Giza9, mild mottle on cv. Giza 4, yellow mild mottling on cv.  Giza370. Seed transmission tests of PMoV confirmed of the virus transmission through Lentil seeds. Peanut Mottle Virus was detected in the testas, cotyledons and embryo dissected from seeds of each Lentil cultivates. Electron microscopy of PMoV showed virus particles agg...

Sona Salem El-Nwehy1*, Assem Abbas Mohammed El-Naggar2 and Adel Badr El-Nasharty1

...mpared to the control. Plants fertilized with 2% EM1 in combination with either 75 percent or 100 percent NPK exhibited similar benefits, according to the findings in obtaining the highest percentage of increase, especially in the following traits: leaf area, Days to first floret opening, Fresh weight of florets/spik, new corm diameter, new corm fresh weight, chlorophyll and the content of N, P, K, Fe, Mn, and Zn in leaves. It was concluded that using 2% EM1 i...

Muhammad Raza Salik1, Muhammad Babar Shahzad Afzal1,2*, Ayesha Komal3, Muhammad Nawaz Khan1, Muhammad Ihsan Ullah4, Faheem Altaf5, Akbar Hayat1 and Hira Tariq1

...the second year (2013) plants of T1 yielded fruits of significantly less weight. Significantly less number of seeds/fruit was found in plants grown at a distance of 10` × 10` as compared to others. Plants grown at 22` × 22` distance yielded more fruits as compared to others with less spacing. Chemical characteristics of Citrus reticulata such as juice percentage, TSS, acidity a...

Aishat Adetola Anifowose*, Nkechi Betsy Izuogu and Benoit Katchitche Sossou

...er (P=0.05) in treated plants than in control plants. Galling was most severe in negative control plants with poor yield. Even so, the yellow jersey variety was more susceptible to Meloidogyne incognita infection. However, the combination of EM and compost manure had significantly higher performance than the other treatments, especially on the Boniato variety. The implications of EM combin...

Aeni Nurlatifah1, Anita Hafid1, Pradita Iustia Sitaresmi1, Santoso Santoso1, Rahma Isatirna Anwar1, Mohammad Firdaus Hudaya1, Diana Andrianita Kusumaningrum1, Nurul Azizah1, Dimar Sari Wahyuni1, Herdis Herdis1, Florentina Bety Indah Lupitasari1, Desiana Ade Mahari1, Muhammad Rizal2

...-enzymatic (NEZ) antioxidants on the quality of spermatozoa in chilled, stored liquid semen from Garut rams. The rams were randomly divided into seven treatments in a 2 × 3 factorial design. The two factors were the antioxidant levels of EZ (25, 50, and 75 mg) and NEZ (5, 10, and 20 mg). Motility, viability, and plasma membrane integrity were the metrics used in this analysis. The experiment conducted with the additional NEZ on the 4th day of observation...

Hafiz Nawaz1*, Kashaf Nawaz2, Attiq ur Rehman1, Muhammad Bashir3, Mussera Hira2 and Mariyam Nawaz4

...iral disease. Infected plants have uneven yellow-green spots. Diseased plants develop late and produce few flowers and pods. MYMD causes 85% of economic losses. Begomovirus is a Begomovirus. DNA-A and DNA-B make up its single-stranded genome. The virus’s virulence and symptoms need both components. The sequencing of both components showed considerable variation between old-world and new-world viruses. Cultural practice...

Sajida Batool1, Mubeen Akhtar1, Shafaat Yar Khan1,2*

...nts than healthy participants. WBC count (P<0.01) and neutrophils % age (P<0.05) was significantly higher in PCOS group while eosinophils % age was statistically (P<0.01) decreased in PCOS patient in comparison to control subjects. RBCs and platelets count, lymphocytes and monocytes % age and neutrophils to lymphocytes ratio did not show any significant difference in control and deceased females. The mean LH/FSH ratio was significantly (P<0.05) ele...

Zain Ali1, Amjed Ali1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Asif1, Adnan Ashraf1, Muhammad Ehsan Safdar1, Iram Inayat2, Aneela Nijabat3 and Rameez Hussain3,4

...flower heads and maize plants have better combination for the silage production and the quality parameters like pH, moisture content, protein content, fat content and ash contents. The moisture contents of both the samples and combined silage had not much difference among them, but the protein content, fat content and the pH of the combined silage had remarkable difference among them. The Syngenta-8711 + sunflower and Monsanto-6142 + sunflower varieties were b...

Hafiza Mehwish Iqbal1, Salman Khurshid1*, Saqib Arif1, Qurrat-ul-Ain Akbar1, Saba Iqbal2, Shahid Yousaf3, Kainat Qureshi1, Abdul Karim Khan5, Abdul Ahad6, Aqeel Ahmed Siddique4 and Neelofar Hamid7

...basilicum and S. asoca plants have21 and 22mm MIZD. Methanol 20%has maximum antioxidant activity in O. basilicum whereas, in S. asoca and M. koenigii 20% aqueous showed maximum activity. Total phenolic content (TPC) 80%methanol exhibited high value in O. basilicum and S. asoca and aqueous 0% has a high TPC content in M. koenigii. The study of medicinal plants is an important area of research in modern medical science for bet...

Waheed Ali Panhwar1*, Mehtab Ali Mahar2 and Abdul Manan Shaikh3

...foliator of cultivated plants and plants of barren areas. Survey was conducted to collect beetle fauna from different localities of Sindh Province. 46 specimens were captured and sorted out into Genus Melolontha Fabricius, 1775 of subfamily Melolonthinae with two species i-e: Melolontha indica Hope, 1831 and Melolontha furcicauda Ancey, 1881. In addition to this, M. indica constructed as a new regional record for Pakistan wh...

Muhammad Ayub1*, Syed Arif Husain Rizvi2, Ishtiaq Hussain3, Musa Ali Hashmi4, Iqbal Hussain5, Shahid Hussain1, Zakir Hussain1 and Rehmat Kabir6 

Amna Ali Mohammed Makoof Zabanoot, Al Wafaa Ahmed Suhail Qatan, Amal Salim Mahad Hubais, Khadijah Hamid Musallam Bait Said and Selvaraju Sivamani*

...d better growth with 4 plants, and length of the stem, root, and plant as 14.2, 2.1 and 16.3 cm, respectively. Thus, it is be concluded that rejected lime could be a potential soil conditioner for plant growth.

...

Hassan Anwar1, Talha Anwar2, Khurram Muaz­3, Muhammad Riaz4* and Rabia Anwar5

...le of 1-9 by ten participants. The panellist liked equally mixed wheat and gluten chapatis with an overall acceptability score of 7.6. Barley and gluten equally diverse chapatis are disliked most and the overall acceptability score is 4. We applied statistical analysis and image analysis. Statistical significance results are achieved using MANOVA. The image analysis for texture revealed similar results as those observed for chapatis made from similar flour. Ou...

Rana Mahmood Ahmad*, Orooba M.S. Ibrahim 

...lete Freund’s Adjuvants injected (S.c.) into the hind paw. The confirmation of the synthesis and characterization of ZnONPs was achieved through the utilization of a UV-spectrophotometer and SEM. For this purpose, eighteen adult male rats 200 ± 50 g at six months of age will be randomly divided into three groups, each containing six rats. Groups 2 and 3 were treated daily for 14 days from the day of Freund’s adjuvant injection with SaZnONPs ...

Agha Mushtaque Ahmed1*, Ali Zachi Abdul Qadeer Alhilifi2, Fahad Nazir Khoso1, Muhammad Ibrahim Kubar1, Tehniyat Naz Shah3 and Touseef Ahmed1

...olyphagous nature. The plants on which it feeds possess variable chemical and physical properties which may influence its biology particularly for growth and reproduction. This study evaluated the growth and fecundity of S. frugiperda on artificial diets. The FAW larvae were reared on two distinct composed artificial diets (bean D1 and chickpea flour D2) and one natural diet D3 (fresh and healthy maize leaves). In both artificial diets, only the flours were di...

Jinwen Liu, Hong Li, Jinhua Zhang, Jianping Li and Xiujuan Yan*

...ease of grubs, whereas plants regulated population change through interaction with above- and below-ground herbivores, thus reducing the survival rate of above- and below-ground insect herbivores. In naturally occurring populations, behavior of leaf-feeding were influenced by root-feeders, causing multitude interactions at the same time. In conclusion, it is suggested that there may be a mutual inhibition between different aboveground and below-ground herbivor...

Anas M. S. Al-Haj Afandi*, Ahmed H. F. AL-Bayati 

...rtial degradation of implants in the site of implantation as well as, thinning of white fibrous connective tissue over the sheet. depending on the clinical and macroscopical outcomes, it can be concluded that bovine tunica vaginalis sheets were better than caprine acellular dermal matrixes for repairing of large ventro-lateral abdominal wall hernia in bucks. 

...

Khansa Jamil1, Muhammad Ramzan Khan1, Asad Jan2 and Ghulam Muhammad Ali1

...n: justify;">Medicinal plants have played a vital role in drug production. Herbal medicines have proved to be safe to use. Crude extract of Caralluma tuberculata stem was used to examine its antibacterial activity and phytochemical screening. Antibacterial assay was carried out by well diffusion method. A maximum number of compounds were eluted by methanolic extract by thin-layer chromatography and a total of 70 compounds were identified by GC-MS analysis. The...

Nusirat Aderinsola Sadiku1, Oluwatoyin Adenike Fabiyi2* and Tesleem Taye  Bello

... Two weeks old lettuce plants were inoculated with 1,000 juveniles of Meloidogyne incognita. BPL was applied at three concentrations of 100, 200 and 400 mg/ml. Results revealed that nematode infected lettuce plants treated with BPL recorded significantly higher (P< 0.05) mean number of leaves, plant height and yield compared to the untreated control. In addition, BPL at 400 mg/ml had substantially higher nematicidal effec...

Merita Ayu Indrianti1,2*, Didi Rukmana3, Eymal Bahsar Demmallino3, Muh. Hatta Jamil3

...ture Office as key informants. The results of this study indicate that the Gorontalo regency government currently has a regional regulation (PERDA) No. 2 of 2017 which regulates LP2B protection program, however, there are no clear geographical boundaries regarding the LP2B program in Gorontalo Regency also not implemented yet the regulations related to incentives for farmers whose land is determined in the LP2B program.
 
Keywords ...

Farhana Umer1, Muhammad Sheryar2 and Sangam Khalil3*

...y transfers from power plants generation to substations then to consumers and its own environment is tremendous. Among various hazards, the overhead wires associated with power lines are the most fatal hazard to birds. The power lines and poles have caused fatal risks for birds and have affected their habitats significantly. Dangerous types of power poles in the middle voltage lines which have small distances between the lines and short insulators cause short-...
Qingsen Ran1,2, Manjing Li3, Jiayin Han3, Lifang Wang3, Han Wang3,4, Shaobo Liu5* and Yanping Wang1*
...mpounds from medicinal plants exhibit anti-glycation effects. Therefore, it is of potential significant to find biomarkers based on glycolysis-related genes in predicting the prognosis of colon cancer (CC), a common invasive gastrointestinal tumor. In this study, clinical and gene data were collected to identify glycolytic genes that significantly associated with overall survival (OS) rate of CC patients through gene set enrichment analysis (GSEA) and Cox regr...
Moustafa A. Zaghloul1*, Mohamed F. Azooz1, Saleh E. Ali1*, Heba M. Soliman1, Maha M. Sayed1, Mohamed H. Kafafy2 and Alaa R. Morsy1
...ng viral illness of ruminants that is highly contagious and economically damaging. The goal of this study is to perform sequencing and phylogenetic analysis of GPCR, RPO30, P32 and EEV glycoprotein genes of Lumpy Skin Disease Virus (LSDV) recent isolates in Egypt, as well as to use artificial intelligence to predict the immunogenic landscape of circulating lumpy skin disease in the Egyptian cattle dairy sector, which will lead to universal blueprints for multi...
Hanaa H.A. Gomaa1*, Dalia Y.A. Amin1, Mona A. Ismail1, Basma Hamdy2, Khaled A. El-Dougdoug3
...virus infection in fig plants. The fig (Ficus carica L.) cv. sultani) plants were grafted by infectious blind eye from Fig latent virus (FLV) infected plants. Infected and healthy plants were foliar sprayed with nanochitosan (ChNPs), biomagic (BM) or combination (ChNPs and BM). Microtome and ultrathin sections were carried out on healthy an...

Adnan I Khamis1, Jasim Mohammed Saleh2*, Najwa Ali3 and Anwer T Gaffoori2

... to identify the determinants that hinder work in agricultural projects. The number is (235) respondents distributed among (5) agricultural divisions, the descriptive approach was used as a method to achieve the objectives of the research. A questionnaire was prepared to collect study data if it included two main axes. The first axis included (8) fields of developing and developing the capabilities of rural women by (50) paragraphs. The second axis included th...

Abdul Aleem Memon1*, Inayatullah Rajpar2, Ghulam Murtaza Jamro2, Javaid Ahmed Shah3

...otassium (K) uptake by plants possibly due to K-fixation and variation in cation ratios. Soils in country are thought to be well supplied with K, little or no K fertilizer is applied to majority of the crops, including sunflower. However, recent studies have shown that the sunflower is becoming more responsive and exhibiting superior growth and yield with the addition of K. To determine the impact of K fertilizer sources on the growth and development of sunflo...

M. Azalou1,3*, C. C. Kpomasse1, A. S. Assani3,4, I. T. Alkoiret3,4, Wéré Pitala1,2  

...up 3 included public servants (27.59%) with university-level education. As for the feeding of the geese, Group 3 fed more feed than Groups 1 and 2, where the majority of farmers used cereals, agro-industrial by-products, and food waste (p<0.05). The farming method and the total number of birds varied between rearing groups (p<0.05). The identification of these animals through their size and silhouette was more noticeable in Group 3 (58.62%) than in Group...

Rana Mahmood Ahmad*, Orooba Mohammed Maeed  Ibrahim

...tention to using these plants as anti-inflammatory. This study was designed to highlight and compare the effects of Syzygium aromaticum extracts oil and Piroxicam on inflammation circumstances. Extraction of clove bud with petroleum ether revealed a bright yellow extract with a typical clove oil smell and bud. The gas chromatography-mass spectrophotometer (GC-MS) method revealed the presence of sixteen distinct elements, making up 100% of all known compounds i...
El-Dougdoug. K.A.1, Mervat, M. Fath Alah2, Reham A. Hassen3,Rehab A . Dawoud2
... induced SAR in potato plants using bacterial and fungal contaminants in tissue culture against Potato virus Y. These biotic inducers were Pseudomonas sp., Bacillus sp., Xanthomonas sp. as well as Trichoderma, Aspergillus and Fusarium as contaminants microbial of potato micropropagative in vitro. The occurrence of induced resistance and increased potato plantlets were found by MS medium tr...
Mohga A. El-Tahlawey1, Samah. A. Mokbel1, A.M. Mandour1,and H. A. Mohamed2
... Giza 51. The infected plants feature severe mosaic on lentil cv. Giza51. mottling on cv. Giza9. mild mottle on cv. Giza4, yellow mild mottling on cv. Giza370, Seed transmission tests Of PMoV confirmed of the virus transmission through Lentil seeds. Pean...

Elkalamawyl, I.M.; Elhddadl, S.; Swelim2, M.A.; Hamdy2, S.M. and Fahmy3, Hanan A.•

...: justify;">Two novel mutants of the hepatitis B virus Surface antigen (HBsAg) were characterized. The mutants were isolated from asymptomatic patients who were found to be persistently positive for both I-BsAg and anti-hepatitis B surface antibody (anti-HBs) and a long-lasting anti-HBc (core) IgM. Polymerase chain reaction (PCR) and sequencing were performed to surface antigen region and revealed two genotype D mut

El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.

...gypt. Different potato plants were collected from an experimental station in Giza Governorate, Egypt and were tested using RT-PCR. PVY was amplified using primers represented portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was mo...

El-Bramawyl , M . A. S. A. and El-Beshehy2, E. K. F.'

... susceptible faba bean plants were investigated under artificial infection by BYMV in the green house during two successive seasons (2008/09 and 2009/010). Faba bean population's plants were evaluated for the resistance to BYMV using a four-class scale of increasing susceptibility to the BYMV disease, which took into a account the infected main percentage and disease severity for the faba bean population's pl

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...ally infected cucumber plants Cucumis sativus L. grown in various garden and greenhouses of Ismailia Governorate, Egypt exhibiting systemic mosaic, blistering, fruit malformation and stunted plant growth and identified by biological, serological and molecular analysis. The isolated virus gave positive reaction with CMV antiserum but not with antibodies of WW and SqMV using DAS-ELISA. CMV was able to infect different host plant species including squash, pumpkin...

El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.

... and the culture supernatants obtained were filtered through 0.45 pl filter. These isolates were tested in two experiments for their ability to control a Cucumber mosaic virus (CMV). In the 1st experiment, One half of leaves of Chenopodium amaranticolor were treated with culture filtrate (CF) followed by CMV inoculation on both halves. In the 2nd experiment, The first pair of Cucumis sativus leaves were teated CF with CMV mechanically inoculated onto one leaf,...

Mahdyl , A.M.M.; Hafezl , M.A.; EL-Dougdoug2, Kh. A.; Fawzyl , R.N. and Shahwanl , Eman S.M.•

... non-inoculated tomato plants. Identify of CMV was confirmed by some differential hosts and dot blot immunoassay (DBIA) using polyclonal antibody specific CMV. Water extracts of Mirabilis jalapa, Clerodendrum inerme and Kombucha as antiviral to control the virus infection and detection systemic acquired resistance (SAR) Were Studied. SAR was detected by determination of salicylic acid (SA) resulted induction of protein related to biotic inducers, virus concent...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...ptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antiserum for the isolated virus had a titer 1\1024. 600 bp DNA fragments from the coat protein gene (CP) of TMV—Ch—EG was amplified with Rt-PCR technique. Phylogenetic analysis of the TMV-Ch-EG/CP- gene showed 89% nucleotide sequence homology...

Aboud*, K. A; Gomaa**, Hanaa H. A.; El—Taholowy***, Mohage, A. and El - Sugher**, S.

...ecause infected banana plants produce no fruit. -The tissue culture approach was used to permit the recovery of BBTV-free plantlets, genetic stability followed by chemotherapy and early screening to facilitate the efficient production of virus-free plantlets. Results demonstrated that application of 10,20,30,40 mg/L thiouracil in vitro gave an 85,72,35,20  survival and 60, 83, 91 and 95.5% BBTV-free plantlets ,respectively. Furthermore, the obtained virus...

Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.

...R from infected garlic plants, such fragnent were not obtained from healthylooking plants and/or virus-free seedlings of shoot-tips. The amplified products of OYDV was cloned into pGEM@-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared with corresponding viral nucleotide sequences reported in GenBank. The se...

Eisa*, Nawal A.; Abd El-Ghafar **, N. Y. Abd EL-Mageed*, M.H.; Mohamed* , F.G. and Hasan*, Eman O.

Sofyl *, A.R.; Soliman , A.M.; Mousal, A.A. and El-Dougdoug , Kh.A.

... backgound of CVd-II variants including the noncachexia (CVd-IIa) and the causal agents of severe (CVd-IIb, CVd-IIc), more moderate (Ca903) and mild (Ca909).
...

El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.

...infected Chrysanthemum plants. It is a member of Pospiviroidae. In order to study the structure of CSVd-EG, it was reverse transcribed in total RNA from infected leaves and then amplified by polymerase chain reaction (PCR) using Pospiviroid-CCR specific primers. Purified gel RT-PCR product (⁓199) was cloned into the PCR Il TOPOvector then it was sequenced. Partial sequence 199 bp of CSVdEG is almost identical to that of the prototype 199 bp Canada and USA is...

Nasr-Eldin1 , M. A.; El-Dougdoug2, K. A.; Othman2, B. Ahmedi , Sabah A, and Abdcl-Azizl , S. Il.

...oid-infected grapevine plants than dot-blot hybridization, the number Of HSVd-infected grapevine plants were 10 plants, PSTVd were 10 plants and the CEVd was detected with high incidence level in grapevine, where 12 out of 100 grapevine trees analyzed were infected. The frequency of HSVd, CEVd and PSTVd naturally infected grapevine trees recorded differe...

Abo Elmagd l , Enas K.; Abdel-Wahab l , Kouka S.; Alrasheedy l , Zeinab E. and Khalifa2, Ahmed S.

... in mothers and their infants using serum samples for both mothers and infants plus saliva for infants, in addition to detection of serum HCV- RNA (viremia) by reverse transcription polymerase chain reaction (RT-PCR). Also detection of antiHIV IgG class antibodies in mothers' sera. The study sample included 61 pairs of 20-40 years old Egyptian mothers and their inf...

Abo-Elmagdl , Enas K;El-Mougy2, Hala M. T. and Abd El-Salam 3, Manal

...nchiolitis, affecting infants and young children. An association between primary RSV infection and childhood asthma has been suggested. Rapid and accurate diagnosis of RSV infection is crucial for appropriate patient management and infection control. The aim of our study was to compare the diagnostic performance of Binax NOW RSV (BN) as a rapid test for detection of RSV antigen in nasal wash specimens collected from Egyptian infants

Sharawil , S.S.A. and Abd El-Rahim2, I.H.A.•

...y;">Peste des petit ruminants virus (Abd El-Rahim2) was previously isolated and serologically identified from suspected outbreaks of PPR among sheep and goats in Qalyubia Province, Egypt at 2006. In this study six of this PPRV isolates were confirmed by reverse transcriptase-PCR (RT-PCR) using primer set for fusion protein (F) epitope, then cDNA were send to Institute of Animal Health Pirbright, England to analyze for their  nucleotide sequences of this F...

Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.

...rom infected faba bean plants. The UV absorption spectrum had a maximum at 260 nm and a minimum at 240m. The ratios of Amax /A min and A 260/A 280 were 1.48 and 1.71, respectively. The yield of purified BBTMV preparation was about 1.57 mg/Kg infected leaves. Production of specific antiserum against BBTMV was obtained by rabbit immunization using three different methods of injections. The titer Ofthe prepared antiserum as determined by indirect ELISA with dilut...

El.-Kadyl, M.A.S; Badr2, A.B.; zein3, Saiwa N. and Khalifa4, M.A.A.

...tion in pepper treated plants: Actellic application gave superior results (46.7%) in decreasing the infection percentage followed by either Sumithion or K.Z. oil (55.0%), whereas Potassium Soap spray gave infection percentage of 60.0% followed by Bio-fly (61.7%). Moreover Supper Royal treatment gave the lower effect in the percentage of virus infected plants (63.3%). Although, actellic treatment produced a higher yield as we...

Ahmed, AmalA.; Zein, Salwa N. and Khatab, Eman A. H.

...urally infected celery plants showing mosaic symptoms suspected to be caused by viral infection, also, it was isolated from other hosts. The isolated virus was biologically purified from single local lesions formed on Chenopodium amaranticolor. CeMV was identified by its host range, symptom expression, modes of transmission and particle morphology.  CeMV able to infect only 20 plant species and varieties from 22 tested by mechanical inoculation. The virus...

Zein Salwa N; Abd El-khalik, Samaa; Khatab  , Eman A.A.H and Azzam4,Clara R.

...lly infected sunflower plants growing in Giza Res. Station, showing systemic mosaic and spots. Purified TMV-S migrated as a single zone in density gradient column. Ultraviolet absorbance ofTMV-S was typical of nucleoprotein with minimum and maximum at 247 and 260 nm respectively. The ratios of A260/280 and Amax/min were 1.2 and 1.1 respectively. Electron microscopy of purified virus showed the presence of rod shape particles with a size 300 nm. Titer of the pr...

Ahmed*, Amal A.; Khatab*, Eman A.H. ; Dawood*, Rehab A. and Ismeil*, Amira .M.

...us affecting carnation plants .The two viruses were detected serologically by DAS-ELISA using specific antibodies . Shoots from plants infected with ( CLV & CarVMV ) which maintained in green house were used for tip culture . Murashige and Skoog medium (MS ) supplemented with (0.2 mg/L BA ) and (Img/l BA and 0.5 mg/L kinetin ) were used for proliferation and micropropagation of the infected shoot clumps respectively. The...

*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'

...erosum, L. cv. Spunta) plants, showing bright yellow blotching or mottling «Calico» and aucuba symptoms suspected to be due to virus infection. Leaf samples were collected from different localities in Minufyia Governorate, Egypt. AMV was readily mechanically inoculated by sap extracted from infected potato leaves to host plants (bioassay). The identity of AMV isolate was confirmed by sequence analysis of their co...

Ahmed, Amal A. and Fath-Allah, Mervat M.

...eties out of 24 tested plants by either grafting or mechanical inoculation, and PPV was able to infect only 19 plant species and varieties. CMV and PPV can be transmitted by Aphis gossypii and Myzus persicae from cucumber to cucumber and woody plants. The best time for leaf sampling was to detect the viruses, in diseased apricot tree by sap inoculation or ELISA, in April, followed by May and June. Double infection by PPV and...

El-Sayed • l , Eman H; Mahfouze , Sherin A.; Shaltout ,A. D.; El-Dougdoug3 ,Kh. A. and Sayed1 , R. A.

...tive effects on banana plants. The chemical mutagens such as create mutations in the genome of plants. Selection of plant mutants is based on morphological and ISSR-PCR markers. The DNA based marker is reliable and reproducible for mutant selection for BBTV and BMV resistance banana plants used in the study. Explants f...

Karl Maramorosch

...e detected in diseased plants. The inadequate characterization of viruses delayed the discovery of the pathogens of yellows-type diseases by forty years. In 1967 Japanese plant pathologists and entomologists announced the discovery of mycoplasma-resembling pathogens in diseased plants and insect vectors and the temporary recovery of diseased plants treated with tetracycline antibiotics. Th...
Mazharul A. M. 1, Md. S. Sarwar ,M. Nurullah 2, Keshab K. Adhikary I and M. Rahmatullah 1 
 
... to identify medicinal plants used for the treatment of the above diseases. It was observed that six plants Nyctanthes arbortristis, Swertia chirata, Vitex negundo, Andrographis paniculata, Clerodendrum viscosum and Tinospora cordifolia were used for treatment of viral fevers. Stemona tuberosa was used in case of measles. Moringa oleifera and Azadirachta indica were used to treat chicken pox. Three pl

Ahmed Abd El Samie Hassan Ali

...s a wide variety of ruminants. A random 42 field pooled calf samples were collected and inoculated simultaneously intranasal, oral and intraperitoneal into 6 New Zeeland rabbits. The rabbits were observed for 25 day, slaughtered then tissue harvests from spleen, lung, lymph nodes and intestine were pooled, homogenized; the supernatant was clarified and concentrated for second inoculation. A another 16 BVDV seronegative New Zeeland rabbits, classified into 4 gr...

El-Sabagh, I.M.; Hussein, H.A.; Amer, H.M.; El-Sanousi, A.A.; Reda,I.M. and M.A. Shalaby

...with Baculovirus recombinants expressing VP7 protein revealed high reactivity with hyperimmune antiserum to BRV when tested by immunoflurescence assay. Using solid phase ELISA, the VP7 expressed protein was detected intracellulary and extracellulary at 48 and 96 hours post-inoculation using polyclonal antibodies against BRV, respectively. The VP7 expressed protein was not detected in Coomassie blue stained SDSPAGE but produced a detectable band in Western blot...

Sonia, A.M.; El. Sanousi, A.A.; Saber, M.M.; Daoud, A.M.; Samira, E.K.; and Ismail I.

...sing four different adjuvants which are: Montanide ISA 206, Quil A saponine, Ginseng extract and Montanide IMS 3015. These vaccines were compared with Al (OH) 3 gel vaccine and tested in calves. The obtained results revealed that the duration of immunity elicited by gel FMD vaccine was shorter than oil adjuvanted FMD vaccines. Results also indicated that vaccine emulsified with Montanide IMS 3015 could elicit the best protection capability with long lasting im...

S.A. Sidaros, S.A. El-Kewey , Hala A. Amin;Eman A.H. Khatab ,  A.A. Emeran l , Samaa Abd El-Khalilk and M.A.S. El-Kady

...s isolated from pepper plants grown in Egypt has been characterized. Pepper mild mottle Tobamovirus (PMMoV) was isolated from naturally infected pepper plants grown in Kafr El-sheikh Governorate. RT-PCR using a specific non:åegenerate primer pair for the PMMoV coat protein gene (PMM-F and PMM-R) revealed 470 bp amplified product. Dot blot hybridization was used to establish the authenticity and specificity to the RT-PC...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2 
...LISA), woody indicator plants, differential hosts, peroxidase isozymes and activity, total RNA content and reserves transcriptionpolymerase chain reaction (RT-PCR). The severe isolate (ARC) gave the highest OD. value (2.204) in ELISA, followed by the mild isolate (TB) (1.958) and the last latent isolate (N) (1.669). These isolates differed also in incubation period, intensity of symptoms and response to sensitivity of woody indicator pl

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

...(Solanum tuberosum L.) plants is very important due to their effect on potato yield and degeneration of seed tubers. This study aimed to eliminate potato virus Y (PVY) by tissue culture technique using different therapies, such as thermo-, chemo- and electrotherapies. Potato plants cv. Diamond cultivated at Faculty of Agriculture farm, Sohag University were tested by direct antigen coatingenzyme linked immunosorbent assay (D...

Sahar, A. Youssef t ; M.M.A. Al-Dhaher 2 and A.A. Shalaby 

...wo viruses. Virus free plants were produced within six months using meristem tip culture. Woody plant medium supplied with benzylamino purine (BAP) (1.5 mg/L) for shoot proliferation, and Indol butyric acid (IBA) (0.05 mg/L) for plants rooting. Before acclimatization, the plantlets were submitted to DAS-ELISA and RT-PCR in order to evaluate virus eradication. GFLV- and GLRaV-l-free plants ...

*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,

...rom infected carnation plants and identified by host-range, serological detection and maintained on Carnation (Dianthus caryophyllus L.) and / or Gompherena globosa. Morphological studies of CarVMV were conducted by light and electron microscopy. Light and electron microscopy revealed amorphous cytoplasmic inclusions in infected leaf cells. In some cases, however, inclusions have a characteristic shape, spindle, circular or sledge-like. Pinwheel inclusions cha...

Amina A. II. and M.K. Amin

..., no plaques or transductants were observed at acid Ph values (2, 3). But with Ph7 resulting high titration and subsequently high number of transductants. This study demonstrates that the bacteriophages as a mediated generalized transducing vectors of genetic material play role in natural ecology.

...

* Amal Abou El-Ela, A.

... the causal virus, the plants were tested by enzyme-linked immunosorbent assay using antibodies against different Ilarviruses i.e., Apple mosaic virus (ApMV), Prunus necrotic ring virus (PNRSV), Rose mosaic virus (RNIV) and Tobacco streak virus (TSV) Preliminary results revealed the presence of PNRSV in tested rose shrubs. The isolated virus was biologically purified from single local lesions formed on cucumber cotyledon. Identification of this virus was based...

S. A. Sidaros*, S. A. EL-Kewey*, Eman A. H. khattab**, M. M. ELsharkawy* 

...m faba bean and cowpea plants, respectively using two different methods. The UV absorption spectrum had maxima and minima at 260 and245 nm, respectively for the two viruses. The absorbance ratios of A and A260/280 of the combined lower bands of purified BBSV preparations were 1.19 and 1.62, respectively. Infected faba bean plants yielded up to 0.48 mg/100g tissue. The corresponding data for CABMV were 1.20&1.22 and its y...

S.Y.M. Mahmoud1 and M. Hashem2

... coat protein and bait plants test, respectively. The results confirmed the presence of BNYVV in 46 out of 184 and 24 out of 50 root and soil samples, respectively. The virus was found with percentage of 65% in root samples collected from Kafr EI-Sheikh. The transmission experiments indicated that BNYVV was mechanically transmitted to Chenopodium amaranticolor, C. quinoa, Beta Vulgaris cvs. Pleno. Tripl and Gloria. D. macrocarpa and B. maritema inducing chloro...

Amal Abo El-Ela Ahmed; Eman A.H. Khatab; and M.S. Shafie

... Garden for ornamental plants, Giza Governorate and it was found to be widely spread in rose fields. The virus was transmitted mechanically and by grafting (chipbudding) but not by aphids. It was successfully purified from infected N tabacum L. cv. White Burley leaves. Only one band of purified virus preparation was observed 3.5 cm below the meniscus of the density gradient. Infectivity test of the viral zone was found positive. The absorption spectrum of the ...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

... the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other published sequences of the Same virus shows 79.4% - 84% homology.

...

A-New-Whitefly-Transmitted-Geminivirus

... collected from tomato plants grown at different locations in Egypt. The collected plants were subjected to biological analysis, the viral causal agent vector of the two types of symptoms was found to be Bemisia tabaci (Gennadius). Based on diagnostic host species and back inoculation assay two different types of symptoms were found. The first consists of identical Tomato yellow leaf curl virus (TYLCV) symptoms such as sever...

M.A. Abo-EInasr l, Kh.A. EL-Dougdougl, M.H. El-Kattan2 and L.A. Salem2

...be induced in cucumber plants using different concentrations of seven nutrient chemicals against Zucchini yellow mosaic Potyvirus (ZYMV). These chemicals were. Potassium sulfate, Magnesium sulfate, Ammonium sulfate, Chelated iron, Chelated zinc, Chelated manganese, and salicylic acid. SAR was determined via disease severity. virus concentration and some biochemical changes i.e., the high level of endogenous salicylic acid, proteins related to inducers and acti...

E.F. Mohamed1 and I.M. Sabra2

... is grown ToMV affects plants and yields. Virus was isolated and identified on the base of symptomatology on tomato plants, host range, diagnostic hosts, physical ptoperties, mode of transmission, and ELISA detection. ToMV had a longevity in vitro (LIV) of 90 days at room temperature. dilution end point (DEP) Of 10-6 and thermal inactivation point (TIP) of 90oC. ToMV was easily transmitted by sap. The obtained results reveal...

E.F. Mohamedl and A.A. Owayss2

...lly infected faba bean plants in Fayoum Governorate. The virus was identified as Faba bean mottle Virus (BBMV) according to symptomatology on Faba bean plants, host range, diagnostic hosts, virus stability and ELISA detection. The host range of the isolate was restricted to Fabaceae. BBMV lost infectivity after 10 min at 95 on dilution of 10-3 and after 21 days storage at room temperature. BBMV was easily transmitted by sap....

S.A. Sidaros1; R.A. Omar; S.A. El-Kewey l and Samaa Abd El-Khalik2

...imination and survival plants was 3 mm long whereas 5 mm long produced highest survival plants without virus elimination and I mm long failed to produce survival plants in two of the tested three cultivars. The suitable medium was MS + 0.5 mg/L BA that produced 33.3% survival plantlets whereas MS + 0.1 mg/L NAA + 0.5 mg/L BA and MS + 0.1 mg/L NAA produced 16.6 and 6.6% survival plantlets, ...

M. Osman1, Kh. El-Dougdoug2, E. T. Abd El-Salam3, R.M. Taha4 and R.M. El-Hamidl

...CMV) infected cucumber plants was detected by DAS-ELISA and confinned by inoculation of Chenopodium amaranticolor. CMV-isolate was propagated on squash plants var. Eskandarani. After 15 days. systemic symptoms appeared in the newly formed leaves in the form of vein banding, severe mosaic, yellowing, malformation, and leaves wilting. Histopathological studies of CMV-infected squash leaves showed changes such as compact mesoph...

Hanaa H.A.Gomaa1, A. F. Moustafal, Kh.A.El-Dougdoug2, A.A. Abou-Zeid3 and S. Y.M. Mahmoud4

...e metabolism of potato plants. It was found that detectable decrease or dry matter, total nitrogen, tuber Starch, number of starch granules, and total protein. The nucleic acid content of infected plants increased than healthy ones. The investigated hydrolytic enzymes of amylase and protease were reduced in infected potato plants while the level of polyphenol oxidase and peroxidase was inc...

B. A. Othman; Kh. A. El-Dougdoug; M. H. Abdel Ghaffar and T. F. El-Arabi

...ogen content of clover plants. While Barseem IP2 (mutant) was not affected by phages since the growth characters and nitrogen content of clover plants were increased. 

...

A. A. El-Kholy1, S. Vilcek2 and A. M. Daoud1

...VDVs are low-Kinetic variants of reference BVDV-Ia. particularly the NADL, represented as a distinguished branch within the phylogenetic tree. Accordingly, BVDV-la (NADL-like), is the dominant circulating genotype in Belbees, El-Sharquia, to date, and the local vaccine could likely induce an antigenically appropriate immune response. The present study offers a useful molecular epizootiological tool to group local BVDVs in a herd-specific manner at a geographic...

H.A. SULTANl, H.A. HUSSEIN2, and F.F. EL-KHAYAT3

...etected (89% Of IBDV variants) were related to IBDV Del/E variant strain and one sample (11% of IBDV variants) was related to RS593 strain. The pathogenicity study of representative IBDV field isolates in 49-day-old egg-type chickens revealed that the highest mortalities were 53.30% and 36.6% in birds infected with the two field isolates which typed as classic IBDVs. Whereas. in birds infected with three vari

Anak Agung Ayu Sri Trisnadewi*, I Gusti Lanang Oka Cakra

...source of fiber for ruminants. The research aimed to obtain a ration formulation through the use of elephant grass silage, corn straw silage, and concentrate for etawa crossbreed goats. The experiment used a randomized block design (RBD) with four treatments and each treatment was repeated four times, so there were 16 experimental units. The four treatments were: A = silage with 0% corn straw silage + 60% elephant grass silage + 40% concentrate; B = 20% corn s...

Makmun1, Imam Mujahidin Fahmid2, Muhammad Saleh S. Ali2*, Muhammad Yamin Saud2, Rahmadanih3

...ethod of selecting informants uses purposive sampling of farmers and the Animal Husbandry Department of Blitar Regency. The study’s findings indicated that actors involved in the laying hen farming business were small farmers, medium farmers, large farmers, farmer groups, poultry shops, the Animal Husbandry Department, Ministry of Agriculture-Directorate General of Livestock and Animal Health, feed/medicine companies, egg collectors/middlemen, local trad...

Xiaojun Li

...e pest on Brassicaceae plants family around the world. The present study investigated the feeding selection behavior of diamondback moth larvae with an approach to the acetone extract effects of Salvia Miltiorrhiza Bunge (SMB). It was found that acetone extracts of Salviami ltiorrhiza Bunge (SIB) represented by cryptotanshinone and dihydrotanshinone had lethal effect on diamondback moth larvae, and the correlation coefficient was 0.972. Through further antifee...

Shakir Ullah1* and Lubna Shakir

...mposition of medicinal plants. Euphorbia helioscopia, (sun spurge or madwoman’s milk) (Euphorbiaceae) is a wild medicinal plant that grows nearly in all phytogeographical zones of Bajaur. The plant location, age, and their interactions had a significant influence on the phytochemical composition of E. helioscopia. The plant location had the highest effect on the marginal means of compounds (81.517) while the age influenced a variation by a marginal effec...

Skeikh Mustafizur Rahman1*, Mst. Shirin Sharmin Khan1, Yousef Ahmed Alkhamis2,3, Roshmon Thomas Mathew2, Md. Moshiur Rahman1, Mohammed Monirul Islam4, Md. Asadujjaman5 and Md. Golam Sarower1

...e general coastal inhabitants in Bangladesh.

...

Julieta M Lopez-Martinez and Imran Ahmad*

...tral America. Amaranth plants are well adaptable in different climatic conditions, and easy to grow. Amaranth grains have several beneficial features such as high-quality protein, high content of fiber and micronutrients such as iron and calcium. Furthermore, amaranth seeds are a good source of phytochemical compounds with health-promoting effects such as squalene, phytosterols, and polyphenols. Amaranth seeds have gained popularity in recent years due to thei...
Muhammad Saleem1, Saifullah Khan2* and Mahmood ul Hasan3
 
...rs, stakeholders, consultants and advance the assessment of mega projects in Pakistan as well as international level. 
...

Alveena Izhar1*, Basit Ullah2, Rabia Asghar1, Aqeel Ahmad1 and Hassam Bin Mujahid1

...(32) were noted in the plants supplied with phosphorus at the rate of 100 kg ha-1, while the minimum were observed in the control plots. Steckling size also affected the growth and yield parameters of radish crop. Maximum plant height (68 cm), number of pods plant-1 (183), pod length (7.4 cm), pod diameter (3.54 mm), seed pod-1 (7), 1000 seed weight (21.9 g), seed yield plot-1 (23.2 g), seed yield (153.4 kg ha-1) and seed germination viability (90.0) with less...

Nasir Shah1,4, Muhammad Ibrahim1*, Zarnosh Habib2, Kalsoom3 and Zahir Shah4

...15 days. All the three plants exhibited insect repelling potential but these had no significant difference from each other, while A. indica showing nonsignificant but most promising results. Similarly, there was no significant combine effect of plants extracts and its various concentrations. However, various doses of plant extracts showed significant difference in reducing the number of oviposition, pupae developed, flies se...

Nguyen Binh Truong1,3*, Nguyen Ba Trung1,3, Nguyen Thi Bich Hạnh2,3

...v>
Keywords | Ruminants, Rumen, Digestion, Forage quality, Fiber, Beef cattle
...

Joseph Oyiguh Abraham1, Cornelius Arome Omatola1*, Martin-Luther Oseni Okolo1, Ruth Foluke Aminu1, Emmanuel Edegbo1, Olubunmi Marvelous Emurotu1, Danjuma Muhammed2, Jesse Joseph Chock3, Helen Ojomachenwu Ocean4 and Yahaya Ocholi5

...ire. Of the 1000 participants, HBV, HCV, and HIV were detected in 28 (2.8%), 2 (0.2%) and 3 (0.3%), respectively. However, no participant was simultaneously infected with any two or three viruses. The age group 21-40 years demonstrated greater exposure to HBV (7.57%), HCV (0.37%), and HIV (1.17%) infection than the others. More male than female participants had HBV (3.3% vs. 2.4%). On the contrary, both genders were equally ...
Yongtao Xu1, Dandan Wang1, Xiaolong Hu1, Minling Li1, Ming Tang1, Wuhua Liu2, Jianwen Zhan2 and Weiwei Zhang1*
...icated that the forage plants of sika deer belong to 82 families, and 110 genera. An alpha diversity analysis showed that there was no significant difference (p > 0.05). The NMDS analysis found considerable overlap at the three sampling sites, and the niche breadths of SS (Fir forests), MP (The nursery base), and NJS (Nie Jiashan) were 9.593, 9.426, and 9.419, respectively. High-throughput sequencing and metabarcoding trnL could provide higher taxonomic res...

Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2

...d wilt resistant recombinants in subsequent generations. Resultantly, a uniform and high yielding progeny line PCK-09012, later designated as “Noor-2019” was selected and evaluated for yield, agronomy, and insect pests. This cultivar revealed a potential yield of 2882 kg ha-1 in testing phase and outperformed standard checks by producing 78.2%, 13.1%, and 28.8% higher grain yield in station, adaptation and national uniform yield trials, respectivel...

Muhammad Usman1*, Muhammad Uzair Khalid2, Muhammad Hasnain3*, Muhammad Tauseef4, Ali Raza4, Muhammad Akram4, Muhammad Shahid4, Abrar Ahmad4, Muhammad Shoaib Ismail1, Rabia Afzal2, Atta-Ulla2 and Muhammad Hussnain Babar3

...s metabolic actions in plants. Healthy seedling germination will increase the yield of the crop. Moreover, it was concluded that osmo-priming is best for farmers to reduce the negative effects of zero tillage and by time of bed sowing, and then it will produce maximum results. Further, it will helpful for the farmers to enhance their income.

...

Muhammad Akram1, Anirban Mandal2*, Mehwish Iqbal3, Arindam Mukherjee4, Ritika Bandyopadhyay5, Surendar Rangasamy6, Rida Zainab1, Muhammad Talha Khalil1, Pragnesh Parmar7 and Umme Laila1

..."text-align: justify;">Plants are useful as food and drugs to human beings. People are becoming progressively conscious of complications with the abuse and over prescription of conventional antibiotics. Plant extracts can be good alternative in day-to-day illness instead of antibiotics misuse. Complementary and alternative medicines are good option for treatment of routine ailments. Complexes and constituents with antiviral activity exists in numerous pl

Phoebe Lyndia Tolentino Llantada1,2*, Midori Umekawa2, Shuichi Karita2

...inal tract (GIT) of ruminants is very important for their immunity and productivity. The efficient digestion and utilization of fibrous feed materials are attributed to the foregut, midgut, and hindgut with the aid of the microorganisms that thrive in this region. However, knowledge and studies on bacterial communities across the GIT are very limited. Most researches only focus on the rumen or the hindgut. Therefore, this study was performed to evaluate the ba...

Suhad Mohmmed Alrobyrai1 , Falah Muosa Al-Rekabi2*

...d Tempol are two antioxidants that have been shown to protect against various forms of oxidative stress and inflammation. This study explored the hepatoprotective effects of Alpha Lipoic Acid (ALA) and Tempol against subacutely repeated acetaminophen (APAP) exposure in a murine model. Fifty male Balb-c mice were divided into five groups. Groups received 700 mg/kg.BW of APAP and oral treatments: G1 (distilled water, negative control), G2 (no treatment, positive...

Ida Indrayani*, Andi Andri, Tevina Edwin

 
 
...area to accommodate ruminants based on the total availability of feed in the Pesisir Selatan regency is 220,057 ST, with an IDD value of 3.19, which means it is safe for the development of ruminant livestock. Analysis of sustainability showed that the status of the economic dimension, ecological dimension, and environmental dimension were fairly sustainable, and the institutional dimension was less sustainable. 
 
Keywords | B...

M. Imran Kasana, Rashid Iqbal Khan*, Noor Ullah Khan, M. Noman, Shahid Ali, Saima Mumtaz, Shamaila Rasheed and M. Qamar-Uz-Zaman

...-quality, true to type plants. The current study was planned to evaluate four different grafting techniques (Cleft, Tongue, Patch and T-budding) in ten different cultivars of avocado. The outcomes suggested that Cleft grafting was most suitable one among all other evaluated techniques. The highest survival rate (27.40%) was recorded in cleft grafting. Moreover, vegetative characters, i.e., no. of leaves and leaf area, no. of internodes and internodal length, s...

Munifah Siti Amira Yusuf1, Norsida Man2*, Nur Bahiah Mohamed Haris1, Ismi Arif Ismail3, Siaw Shin Yee1 and Tengku Halimatun Sa’adiah T Abu Bakar1,4 

...ntually help the participants with better living standards and productivity. This study aims to evaluate the effectiveness of urban agriculture programs. Primary data was collected from 230 urban agriculture program participants registered under the DOA Malaysia. The data was analysed using the PLS-SEM analysis method with the help of SMART-PLS software version 3.0. Findings revealed a positive association between all CIPP f...

Aniqa Qaisar, Shabana Naz* and Sajida Arooj

...ntamination and genotoxicants.

...

Hongsen Xu*, Xiaoni Wang, Tie Tian, Changyu Zhao, Denghang Yu and Jun Liu

...olone resistance determinants and tetracycline-resistance) confirmed antibiotics sensitivity of this bacterium. Artificial infection showed that the strain could cause similar symptoms to those of naturally infected crayfish, and the lethal dose 50% was 1.52 × 106 CFU/g crayfish. Serious histopathological changes, such as cell degeneration and necrosis, hemorrhage and inflammatory cell infiltration, were found in diseased crayfish. In conclusion, this st...

Faris Sahib Imran1*, Layth Hamzah Merzah2, Mohammed Mohsin Kareem3

...aqi Awassi sheep and warrants further investigation to determine optimal levels of inclusion.
 
Keywords | Awassi sheep; Body measurement; Ceratophyllum demersum; Growth traits; Protein.
...

Zaryab Murad1*, Sobia Bibi1, Shehr e Yar Ahmad1, Mohsin Ali Khan1, Rimsha Sadaf2, Mauz ul Haq1, Umair Manan1 and Muhammad Younas2

...elected and 10 healthy plants were transplanted into each pot. After successful and possible growth five most perfect and healthy plants were kept for experimental work. All the pots were kept in standing water condition and the pots were irrigated on the visual requirement of the water. From the experimental results, its depicted that rice yield and biological yield was increased from control to 4% BC application (4.9 and 4...

Wafa’a Mohammad Abduwhab1*, Waseem Ali Hasan2, Mohanad Abdulsataar AL-Bayati3

...herbal medicine, antioxidants and biochemical indices.
...

ZOHAIB SAEED1, SHAHID IQBAL*1, UMER YOUNAS1,2, MUHAMMAD PERVAIZ*3, SYED MOHSIN ALI NAQVI3 & RANA RASHAD MAHMOOD KHAN3

...lant. Meanwhile, antioxidants like TPC, Ascorbic acid content and antioxidant potential (DPPH, ABTS, FRAP) were also measured and maximum values were found in 20% to 40% of sewage sludge. Hence, sewage sludge may be exploited for the useful purposes in a controlled manner.

...

ZARYAB KHALID SIAL & FARAH KHAN

...ble life from infected plants of Potatoes. The present study was aimed to confirm the presence and identification of potato spindle tuber viroid (PSTVd) on potato plants in Pakistan. RNA was extracted and purified using optimized Trizol reagent and RNeasy Miniplant Kit. The RNA obtained was converted into cDNA on the same day and amplified. The identification of PSTVd was carried out by Sequencing and BLAST. The advanced opt...
ZAFAR IQBAL KHAN1*, KAFEEL AHMAD1, KHALID NAWAZ2, MUHAMMAD NADEEM3, ASMA ASHFAQ1,
BABAR MUNIR1, HAFSA MEMOONA3, MADIHA SANA3, FARZANA SHAHEEN1, NAUNAIN MEHMOOD4, HIRA MUQADAS4, MAHPARA SHEZADI5, IJAZ RASOOL NOORKA6, HUMAYUN BASHIR1,
MUDASRA MUNIR1, ILKER UGULU7 & YUNUS DOGAN7
...ochemical processes in plants. Any of these metals, at high concentrations in soil, can cause severe damage to physiological and biochemical activities of plants. Scarcity of fresh water in agricultural area enforced farmers to use industrial effluent and domestic wastewater for irrigation purpose. Ramzan sugar mill industry located at Chiniot discharges high amount of effluent which is used by farmers for irrigation purpose...

HIRA MUBEEN1, 2*, AMMARA NASEEM1, AMMARA MASOOD2, SHAHID RAZA3 & NAUREEN NAEEM3

...sion level of genes in plants. The expression of genes is regulated by certain regulatory elements including, Cis-acting regulatory elements (CRE), transcription factors (TFs) and promoters. Cis-acting elements are actually specific class of DNA binding proteins that act at particular site of DNA. Promoters are part of DNA fragment essential for transcriptional regulation of genes with certain transcription factors. These transcription factors could be useful ...

NAILA MALKANI*, IRFAN ISHAQUE, KHALID SHAHBAZ, RIZWAN ULLAH KHAN, ARIFA SHABBIR & ATIF YAQUB

...ncreasing input of pollutants in them adversely affect fish populations and also the pollutants get bio-accumulated in the aquatic food chain. The present study was undertaken to compare selected health parameters of farm-raised and wild-caught Labeo rohita. Twenty fish were taken from each of the two groups to perform kidney and liver enzymes profile and histological analysis. The results showed that the values concerning l...

AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2

...chemical attributes of plants was analyzed by launching a petri dish and pot experiment. The analysis spread out in a totally block design (randomized) with ten replicates for each salt (0 and 120 mM NaCl) and SA (0, 0.1, 0.5 and 1mM) treatment. The commercially available cultivar (cv. Faisal) of maize was planted in earthen pots for 15 days. After fifteen days of growth, seedlings were irrigated with saline water (120 mM NaCl) and SA was applied for 60 days s...

ARIFA ZEREEN & ALMAS JAHAN

... planted as ornamental plants at the green belts. With the passage of time the exotic plant species also called Invasive Alien Species (IAS) is going to be a serious threat to local ecosystems. This research work was planned to determine the harmful and significant effects of exotic plants on local flora. Fourteen species of exotic and invasive plants viz., Eucalyptus camaldulensis Dehnh.,...

Adriana Beatriz Sánchez-Urdaneta1,2*, Gisela del Carmen Rivero-Maldonado2, Cecilia Beatriz Peña-Valdivia3 and Dianelis del Carmen Sánchez-Urdaneta4

 

 

...tter-spacing: -0.1px;">Plants of Opuntia have modified stems, which are called cladodes, and are specialized structures able to photosynthesize. This study was conducted in order to compare the anatomy of the cladodes of the fruit-producing cultivars Floreadora, Moradaza, and Solferino of prickly pear (Opuntia ficus-indica (L.) Mill.). The thickness of cladodes, cuticle, epidermis, collenchyma, parenchyma cell walls, and xylem walls was measured;...

MUBEEN RIAZ1, KIRAN ZAHID1, SUMAIRA ASLAM CHOHAN1, MUHAMMAD ASHFAQ*2, MUHAMMAD ALI2, RIFFAT SIDDIQUE1, NUDRAT ANEES1 & FARAH KHAN1

...lled and NaCl stressed plants, the extracted DNAs were subjected to RAPD markers, using PCR amplification. For this purpose a total of seven primers viz, OPH_01_F, OPH_01_R, OPH_01_RC, OPI_05_R, OPI_05_RC, OPG_10 and OPC_06 were used. PCR amplification was followed by gel electrophoresis (1.2% agarose gel) and visualized by UV light, which revealed the presence of monomorphic and polymorphic bands in the amplified products. During this analysis, two primers (O...

SEHRISH MUSHTAQ1, MUHAMMAD SHAFIQ1, MUHAMMAD ASHFAQ*1 FAIZA KHAN1, SOHAIB AFZAAL1, UMMAD HUSSAIN1, MUBASSHIR HUSSAIN1, RASHID MUKHTAR BALAL2 & MUHAMMAD SALEEM HAIDER1

...s are colonized inside plants and have antagonistic potential for fungal pathogens. These endophytes should be further explored for disease control. Ongoing study in this area will help to the innovate biological control of plant pathogenic fungi.

...

ABRAR HUSSAIN1, AQSA KHALIL1, SAIRA ZAHEER1, MUHAMMAD LATEEF2 & MUHAMMAD MANSHA1

...xt-align: justify;">Ruminants are common victims of helminthic infections which curb the efficient production of livestock. Chemical anthelmintic are used to control parasitic infections but their persistent use develop resistance in parasites. In this connection local plants/ their parts are being used to explore their anthelmintic potential. The aim of the present study was to determine the anthelmintic activity of Tribulu...

ZAFAR IQBAL KHAN1, KAFEEL AHMAD1, HAREEM SAFDAR1, KINZA WAJID1, HUMAYUN BASHIR1, KHALID NAWAZ2, MAHPARA SHEHZADI3, IJAZ RASOOL NOORKA4, MUDASRA MUNIR1, IFRASALEEM MALIK1, ASMA ASHFAQ1, HIRA MUQADDAS5, HAFSA MEMOONA6, MADIHA SANA6, NAUNAIN MEHMOOD7, SAIF UR REHMAN8 & TASAWAR ABBAS8

...various types of contaminants like heavy metals that pollute the soil and crops. In this regard, an experiment was carried out at Department of Botany, University of Sargodha to evaluate the possible health risks of heavy metals in forages. Forages both forsummer and winter were grown with different water treatments (sewage and tap water). The concentration of cadmium in water, root and forage samples was determined. Moreover, bioconcentration factor, pollutio...

AMBASH RIAZ1, SHAHID RAZA2* & HIRA MUBEEN3

... Cry1AB gene and its variants.

...

Uqba Mehmood

.... The analysis of Spo mutants (strains which lack Sporulation (Spo) gene or have its inactive form) revealed that many of these strains did not produce extracellular proteases. Some evidence for the involvement of serine proteases in sporulation has been provided by inhibitor studies. Nevertheless variation in germination response of germination defective strains with different nutrients was recorded in ALA system, but overall responses of germination defectiv...

ALIA NASEEM, *SUMERA IQBAL & KHAJISTA JABEEN

... treated and untreated plants. In comparative analysis compost appeared as more beneficial for okra than farmyard manure. Overall, the application of compost at 5 percent was found to be effective in improving yield characters, chlorophyll and sugar contents of Cr affected okra plants.

...

MARIAM ZAHEER*1, SYED SHAHID IMRAN BUKHARI2, MUDDA

...anticancer and bioflocculants. They are widely used in food industry and bioremediation. This review article describes sources, synthesis, fermentation, extraction and applications of exopolysaccharides.

...

UMER YOUNAS, SHAHID IQBAL* & JAMSHED AKBAR

...on extraction of antioxidants from M. nigra leaves have been studied. Initially, samples were dried using different drying procedures (shade, oven and microwave drying) and extracted using different solvents (ethyl acetate, acetone and methanol) in combination with microwave-assisted extraction technique. Antioxidant potentials of extracts were determined in terms of total phenolics, total flavonoids and ascorbic acid contents. In addition, radicals (DPPH&bull...

HAFIZ MUHAMMAD ARSALAN1,2*, SUMMARA TABASSUM1, MUHAMMAD SHERAZ YASIN3, FAROOQ SALEEM4, ZEEMAL SEEMAB AMIN1, MUNIB ASHFAQ1, UMAR FAROOQ GOHAR5 & RASHIDA BASHIR6

... good source of anti-oxidants.

...

Olaolu Fadeyi1,2, Oluwatoyin Fabiyi3*, Tesleem Bello4 and Gabriel Olatunji5

...s and soil of the Okro plants. This resulted in increased fruit weight and the number of fruits per plant.

...

Karima Akool Al-Salihi1*, Luay Jumaah Jihad2, Abbas Najm Aldin Saleh3

...designed and the participants were invited to answer an online questionnaire on veterinary medical online education. Data of reported diseases were collected from veterinary hospital and ministry of health authorities. This study showed aggressive distribution of external parasites particularly ticks, and other diseases such as Theileria, Anaplasmosis, FMD, three-days sickness, contagious ecthyma, sheep pox, clostridium diseases, brucellosis, mastitis, and res...

Bela Putra1*, Budi Prasetya2

...talling 700 seeds. The plants were grown in acidic soil with a pH of approximately 4.5–5. After two months of growth, the plants were harvested, and various parameters were analyzed. The results of the research indicated that the application of a 15 Gy dosage significantly enhanced the absorption of P (p<0.01), N (p<0.01), and Ca (p<0.01) in the plant. Additionally, gamma irradiation at a 25 Gy dosage demonstr...

Ho Xuan Nghiep1,2, Nguyen Binh Truong1,2*

... Supplement, Rumen, Ruminants, Waste, Energy feed, Crossbred cattle
...

Anisa Mushtaq1, Murtaz ul Hasan1*, Asim Shamim2, Muhammad Ali Abdullah Shah1, Muhmamad Arif Zafar3, Abdul Asim Farooq4, Aayesha Riaz1, Muhammad Kamran1 and Saif ur Rehman

Nurcholis1*, Syetiel M. Salamony1, Abdullah Baharun2

... sperm motility. Antioxidants in the diluent can maintain the motility of bull sperm during the cooling process until after thawing. This research examines the effect of Myrmecodia extract (MYE) supplementation, which has high antioxidants, on semen diluent during the cooling to cryopreservation process. Specifically, five  PO bulls aged four years were collected using an artificial vagina (AV) twice weekly at the Seman...

Shama Sadaf1*, Ayesha Saeed1, Komal Hassan1, Zeeshan Ahmad2 and Maha Naeem Butt1

...s have been used as colorants in food, leather as well as textile since prehistoric times. These dyes are obtained from vegetable and animal matter with no or very little chemical processing. Turmeric spice is used in making natural dye. In this study dye was developed by using three concentration levels from turmeric powder. Then apply a dye on silk fabric after binding it with vinegar. The dye’s colour concentration and color fastness after 15 washes. ...

Habibeh Jabbari

...ltivars and other host plants. High incidence of this nematode revealed by soil and root samples in the vegetable growing farmlands in Tabriz, Iran. Different populations of H. cruciferae were collected from the region and characterized based on morphological, morphometric and molecular features, four out of those populations isolated from the rhizosphere and roots of four different cabbage cultivars were subjected to further studies. All the populations showe...

Mehwish Zafar1, Muhammad Shahzad1*, Muhammad Zubair Akram2, Quratulain3, Mehak Shehzad4 and Samreen Nazeer5*

...alts hampers growth of plants and its yield of biomass by impacting major physiological mechanisms i.e., ionic, oxidative and osmotic stress. One possible and climate resilient strategy is to introduce new crops that can bear high level salinity and allow irrigation with saline water. Quinoa has great potential to grow under saline conditions having outstanding nutritious value. Pot based complete block design was conducted in COMSATS University Abbottabad, Pa...

Tianhoun Denté Fidèle1,2*, Meda Nãg-Tiéro Roland2, Zabré Geneviève3, Koama Benjamin2, Kaboré Adama1, Tamboura H. Hamidou1, Bélem Adrien Marie Gaston4 

...s observed in small ruminants has led to the development of alternative strategies focusing on the use of medicinal plants. Thus, the present study was carried out to assay total phenolics and evaluate the in vitro anthelmintic efficacy of aqueous and hydroacetone extracts of Combretum micranthum leaves on the parasite Haemonchus contortus. Following phytochemical assay, five increasing concentrations (0.6; 1.2; 2.4; 4.8 and...

Kiran Khan1*, Ata ur Rehman2, Jai Dev Maheshwari1, Ghazala Nasim Pasha3, Tayyaba Mumtaz4 and Ruqaya Nangrejo5

...e amount of time participants spent on their smartphones might be associated with increases in musculoskeletal pain of upper extremity. A cross-sectional study observational survey was conducted on all smartphone users between the ages of 18 and 35. A total of 400 samples were randomly selected from various parts of Karachi. The data was collected between February and March utilizing Google forms as a web-based questionnaire. The questions in the study include...

Addisu Jimma1,2*, Aberra Melesse1, Aynalem Haile3, Tesfaye Getachew3  

...on-members. CBBP participants showed higher numbers of lambs below 3 months, male lambs between 3-6 months, intact males between 6-12 months, breeding rams, mature ewes, and the mean flock size of sheep at the household level. The major routes of sheep entry into the flocks were birth (81%), and purchase (17%). The total number of entries and births was higher (p < 0.05) in CBBP members (284 vs. 240) than in non-members (148 vs. 112). The off-take rate, ...

Nadia Kèmi Assana Chabi1, Gildas Codjo Tchemadon1,2*, Olaïgbé Lydie Hounkpatin3, Paul Kouété Jimmy4 and Leonard Antoine Chaffara Afouda1

...g stage of sweetpotato plants. They observe the presence of aphids or whiteflies in their fields at 53.3% (AEZ II); 65.0% (AEZ VI) and 75.6% (AEZ VIII). Moreover, 100% (AEZ II); 92.5% (AEZ VI) and 93.0% (AEZ VIII), of farmers do not apply any management strategy for sweetpotato viral diseases. However, 5.0% (AEZ VI) and 7.0% (AEZ VIII) of them use chemical insecticides and 2.5% (AEZ VI), ash to control these diseases. To limit the impacts of these diseases and...

Muhammad Adnan1*, Muhammad Nauman Khan2,3, Barkat Ullah2, Faisal Zaman2, Alevcan Kaplan4, Hubert O. Dossou-Yovo5, Sajid Ali Khan Bangash6, Sana Wahab7, Mehreen Ghazal8 and Muhammad Hassan Sarfraz9

...irst domesticated crop plants and is the most widely grown crop in the world, both in terms of cultivated area and yield, and wheat is known to be consumed by about two-thirds of the world’s population. The study was carried out to investigate the elemental and proximate composition of wheat against boron induced stress. Greenhouse experiments were conducted in October 2019 under natural light conditions to assess the chemical status of pl

Ali Hassan1, Javaria Ashraf1*, Salman Wahid1, Kamran Alyas1, Samaria Nisar1, Sadia Kanwal2, Nadia Hussain Ahmad2, Amna Bibi2 and Rameen Nawaz3

...rids in different crop plants. In cotton, heterosis of morphological and yield related traits using line × tester design is very important to identify best performing parents in future cotton breeding program. Therefore, in this study five lines (MNH-1020, MNH-1035, FH-152, CIM-632 and BS-20) were crossed with three testers (CEMB-100, RH-662 and NIAB-5) using line × tester crossing design, which resulted 15 F1 hybrids. The analysis of variance foun...

Iqra Munir*, Farrah Iftikhar, Hira Fatima, Sunbal Khalil Chaudhari and Roha Ramash

...n: justify;">Medicinal plants serve as a natural source of herbal medicine employed in treating numerous diseases within local communities across various countries. They also constitute the raw ingredient for the pharmaceutical industry. This study was conducted during year 2020-2021 to gather the native indigenous knowledge about therapeutic uses of medicinal plants in Mandi Bahauddin, District Gujrat, Punjab, Pakistan. Eth...

Jin Jiao1, Jin Song1, Yuanyuan Cui1, Yilin Wang2, Yanling Li1, Jing Li1, Yan Su1, Xiaojing Du3, Yan Wang3, Guiping Sun3 and Minxiang Wei4*

... as the research participants. The Pittsburgh Sleep Quality Index, the Chinese version of the Multidimensional Fatigue Scale and the Hospital Anxiety and Depression Scale were used to analyse the relationship between fatigue and sleep disorders, anxiety and depression, assess the depression status and explore the relationship between myocardial infarction. In this study, 55.3% of patients had sleep disorders, 25.3% had anxiety tendencies with a gender differen...

Shahzad Aslam1*, Amjad Rashid Kayani2, Muhammad Irfan Ashraf3, Muhammad Azhar Jameel2 and Kiran Sahar4

...the study area. Food remnants method was used in combination with fecal analysis and visual observation for food composition. Both macroscopic and microscopic fecal analysis were carried out using 150 fecal pellets, collected from study area. The microhistological fecal analysis showed the presence of 29 dietary plant species as compared to 30 plant species observed in the field. No animal derived food component was noticed in the diet. The results revealed th...

Philip O. Akporhuarho1, Ufuoma Godstime Sorhue1*, Adimabua Mike Moemeka2, Onyinye Stella Onwumere-Idolor3, Jonathan Ujomu1, Emmanuel Abadah1, Jennfer Aaron1

...eat quality, Medicinal plants
...

Bushra AL-Khaqani, Amira Mohammed*  

... is present in several plants, red wine, and grapes, has been researched for its potential anti-inflammatory, and antioxidant qualities, and to induce relaxation of airway smooth muscle. The current study investigated whether Resveratrol (RES) could lessen allergic asthma that ovalbumin (OVA) causes in rats. Current results revealed that RES improved significantly (P<0.05) allergic asthma attenuation by decreasing the number of infiltrated mononuclear cells...

Noor-ul-Ain1, Zulfiqar Ali1*, Saba Naz1, Kiran Saleem1,2, Syeda Rida Hasan1, Sana Arif1, Rida Ahmad1,3, Nida Naeem1, Zarmina Zainab1 and Aliza Batool1,3

...iger) are natural inhabitants of deciduous forests. They live solitary in their natural habitat. Their captive behaviour was studied by taking two Asiatic black bear pairs as study subjects in Lahore Zoo, Pakistan. The study was based on the provision of environmental enrichments to the bear pairs. Each pair’s pre-enrichment activity budget data was collected by scan sampling method of 70 h, documenting the cage area and behavioural ethogram. The observe...
Gilmar Jesús Cañarte-Cañarte1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1 and Fernando David Sánchez-Mora1*
...acing between rows and plants on the growth, development, and production of the cotton variety BRS-336. Twelve plant densities were used: 55 556, 37 037, 27 778, 50 000, 33 333, 25 000, 45 455, 30 303, 22 727, 41 667, 27 778 and 20 833 pl ha-1, with single row planting arrangements. A randomized complete block design, in factorial arrangement (A x B), with four replications was used. The variables recorded were daily height increase (cm/day) in budd...
Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Gilmar Jesús Cañarte-Cañarte1 and Fernando David Sánchez-Mora1* 
...duce the height of the plants, contributing to the good structure of the plant, efficiently using its nutritional resources. When the growth regulator was applied at a single time, that is at 50 DAS, the best average yield of raw cotton was obtained (4,642 kg ha-1). Meanwhile, the most efficient dose was that of 300 mL of MC, with which the highest yield (4,613 kg ha-1) of raw cotton was obtained. 
...
Julio Adolfo Corzo-Bacallao1*, Carlos Alfredo Salas-Macías1, Osvaldo Fonseca-Rodríguez2,3, Felipe R. Garcés-Fiallos1, Erika Isabel Alcívar-Muñoz1 and Henry Fabricio Baque-Loor1 
 
...al Branches) of coffee plants showed higher values in S2 compared to S1 and S3. These results are related to the higher photosynthetic activity associated with the higher intensity of incident solar radiation, although the relationship is not linear. In our results, flowering and fruiting were not affected by the level of shade, nor were their precursors, such as nodes per productive branch and productive nodes per productive branch. On the other hand, coffee ...

Huma Naz1*, Sajid Abdullah2, Tanveer Ahmed3*, Khalid Abbas2, Syed Qaswar Ali Shah1, Muhammad Rizwan1, Fareeha Latif4, Adnan Ahmad Qazi1, Muhammad Adeel Hassan5

...s as well as the fruit plants. However, terrestrial and aquatic biodiversity is directly affected by overuse of insecticides. Present study was conducted to find out the genotoxic effect of insecticides on DNA damage and nuclear anomalies in RBCs of Labeo rohita after exposure to chlorpyrifos+endosulfan (CPF+END) by using Comet and Micronucleus Assay. Twenty fingerlings of L. rohita was kept in LC50 concentration of CPF+END, (1.95±0.02 μgL-1 for 96 h...

Saira Jabeen1, Muhammad Avais1*, Jawaria Ali Khan1, Kamran Ashraf2, Aftab Ahmad Anjum3

...employing different adjuvants. To ensure the quality and safety of these vaccines, quality control assessment was carried out. The efficacy evaluation of the vaccines was performed on 24 locally bred rabbits, divided into 4 groups. Each group received a different type of vaccine, with booster doses at 15-day intervals following the priming. Serum samples were collected biweekly over a 60-day period, and the antibody titers were measured using IHA test. Geometr...

Apurbo Kumar Mondal1, Md. Rabiul Auwul2, Md. Momotaj Hossen3, Md. Sodrul Islam1*, Narayan Paudyal4, Md. Shahidul Islam1 and Kazi Khalid Ibne Khalil1

...;">Peste des petits ruminants (PPR), a prevalent viral disease of sheep and goats that impacts productivity and international animal trade globally. Meta-analysis serves as the most suitable approach for obtaining pooled data from individual studies. This study aimed at using a random-effects model of meta-analysis to compile the estimates of the global prevalence and potential risk factors of PPR among sheep and goats. Based on the selection criteria and qual...
Mona Adel El-Wakeel1*, Salah El-Din Abd El-Ghany Ahmed, Sanaa Abd El Rahman Mohamed
and Nadia Khalil Messiha
...eld of Capsicum annuum plants
and both associated weeds: Phalaris minor (grassy weed) and Malva parviflora (broad-leaf
weed). PLP was mixed with in the soil surface at successive rates (15, 30, 45 and 60 g pot-
1). In the corresponding treatments PLP at the same sequenced rates were mixed with the
soil then sprayed with acetic acid 5% immediately. Moreover, sole spraying of acetic acid
5% treatment wa...

Mona Adel El-Wakeel1 and Ibrahim Mohamed El-Metwally1

...esponse of common bean plants.
Two successive pot experiments were conducted with twelve treatments. The first four
treatments were applied by incorporating of orange peels powder with the soil surface at
successive rates (10, 20, 30 and 40 g/pot) one week pre-sowing of common bean. In
the other corresponding four treatments, the orange peels powder was incorporated with
t...

Felix O. Takim*1, Gideon Z. Nayan2, Oluwafemi O. Osatuyi1and Israel O. Olayiwola1

...ations(maize at 53,333 plants/ha + 33,333 plants/ha of sweet potato, maize at 53,333 plants/ha + 66,666 plants/ha of sweet potato and maize at 53,333 plants/ha +99,999plants/ha of sweet potato), sole maize at 53,333 plants/ha and sole sweet potato ...

Syed Awais Hussain Shah1*and Rizwan Ali2 2

...nformation from the habitants by personal interviews, discussion and also by questionnaires. Plant specimens were also collected from the fields of different selected areas in different seasons of the year. Their medicinal uses and taxonomically confirmed with the help of available literature. The duration of this research work was one year, from December 2019 to January 2020. During the research period, we reported 59 plant species which belongs 54 genera and...

Hussain Shah1, Hamida Bibi2, Ali Hazrat1and Khan Sher3

...ical uses of medicinal plants were documented in tehsil Utman Khel
district Bajaur Khyber Pakhtunkhwa Pakistan. 76 plant species belong to 47 families of
herbs, shrubs, mushrooms, trees and vegetables were recorded for their medicinal use.
These include 74 plants (96%) of angiosperms, 1 (1%) of gymnosperms, 2 (2%) of fungi
and 1 (1%) of Pteridophytes. Asteraceae was a dominant ...
Tabassum yaseen1*, Muzamil shah1, Khushnood Ur Rehman2 Ali Mujtaba Shah3, Gul
Nawaz1,Rani Gul4
...y in
weeds plants of soil selected from the Tehsil Tangi. The spore density was observed in all
weeds plants in the host growth stage. The maximum arbuscular Mycorrhizal Fungi (AMF)
spore density was found in the Chenopodium album (93.00±74.02) and Scandix iberica
(89.00±92.08) at the vegetative stage. The Glomus species is dominant in the rhizospheric
Muhammad Bilal Niaz1, Abdul Ghaffar1, Khuram Mubeen1, Mahmood Alam Khan1
and Wazir Ahmed2
...d the height of cotton plants by
26.51%, crop growth rate in terms of biomass by 28.44%, total dry matter 28.46% and
seed cotton yield by 45% as compared to weed free treatment for whole season. The
increase in yield in horse purslane free crop for whole season (23.45%), horse purslane free
crop for 30 DAS (14.27%), horse purslane free crop for 60 DAS (18.07%), horse purslane
and other weeds free crop...
Luqman1, Zahid Hussain1, Mohammad Ilyas2, Azmat Ali Awan3, Javed Rahman 2,
Mazhar Ali2 and Tamana Bakht4
...esh biomass, number of plants ha-1 and fruit
weight. The results showed significant effect for all the parameters during both years. Weed
biomass was the highest (2971 and 3595 kg ha-1, respectively) in weedy control treatments,
and lowermost in the hand weeded treatments (68 and 83 kg ha-1) in 2012 and 2013,
respectively. Moreover, the effect of the mulching treatments and the herbicidal treatments
w...
Fawad Khan1, Zahir Muhammad1, Khushdil Khan2 , Shabir Ahmad2, Muhammad Jamil Khan3, Tamana Bakht4 And Asif Kamal2
...udy. Among the studied plants, most of the
species belong to the Asteraceae family. For morphological studies of pollen through light
microscope (LM) and scanning electron microscope (SEM), the samples were prepared via
acetalization process. We done the fieldwork for the collection of weed plants and also
performed the experimental work i.e. SEM and LM for the pollen morpholog...

Khalid Ali1, Asif Tanveer1, Naila Farooq2, Tasawer Abbas3*, Ghulam Sarwar2, Muhammad Ather Nadeem4, Ishtiaq Hassan3, Muhammad Mansoor Javaid4, Anees-ul-Hussnain Shah5, Bilal Ahmad Khan4 , Ali Raza6

...under stress than crop plants.

...

Kiran Rani1*, R. Aliya1, Barkat Ali Solangi2, M. Kashif Pervez2, Nasrullah Akhtar3 and Farman Ahmed4*

Shazia Shafique1, Sobiya Shafique1 and Sonia Sahar1

... biocontrol using such plants against the phytopathogens in a vast range. The study can be extended to isolate and purify the compounds and its production on commercial scale to manage these pathogens in field conditions.

...

Amir Ehsan1*, Muhammad Ehsan Safdar1, Amjed Ali1

...d 0, 22, 44, 66 and 88 plants m-2 densities of each of Echinochloa colona and Digera arvensis laid out in randomized complete block design. Augmented densities of E. colona (0, 22, 44, 66 and 88 weed plants m-2) enhanced its plant dry biomass up to 348 and 353%; and relative competitive index maximally to 80 and 77% in years 2015 and 2016, respectively. While the corresponding increases in plant dry weight and relative compe...
Muhammad Ather Nadeem1 , Bilal Ahmad Khan*1, Saima Anwar2, Ahsan Aziz1, Rizwan Maqbool3, Muhammad Kashif Sohail4, Muhammad Ehsan Safdar1, Muhammad Mansoor Javaid1, Muhammad Mohsin Amin1, Muhammad Kashif Iqbal1, Amir Aziz4
...iv>Aqueous extracts of plants are used to control weeds being inexpensive and
environment friendly. Present study was undertaken to investigate the effect of aqueous
extracts of Sonchus oleraceus L. on the red rice (Oryza punctata Kotschy ex Steud.)
emergence and initial seedling growth. Treatments included in the study were aqueous
extract of leaves, stem and fruit of Sonchus oleraceus at varying concentrations ...
Farrukh Avais1, Anser Ali1, Hamza Javed2, Muhammad Saleem3, Tehreem Tahir4,
Muhammad Rafiq5,*
...m selected
plants (Garlic and Peppermint) to explore their tyrosinase inhibition activity. Tyrosinase is
a key enzyme of melanogenesis which determines the mammalian skin, hair and eye
colour. Hyper-pigmentation leads to various skin disorders like melasma, sunspots, age
spots and freckles. Moreover, abnormal skin pigmentation is a serious aesthetic concern
which leads to psychosocial problems. Thus t...
Barkatullah1, Sumayya Noreen1.Khushnood Ur Rehman1, Zahid Ali Butt2, Tabassum
Yaseen3, Kamran Akbar3, and Salma Noreen3
...different parts of the plants, which include bark, fruit, leaves,
mulching, and rainwater. In all applications the growth of plumules and radicles of three
test species was retarded. It was determined that the allelopathic effect of extracts is
directly related to the duration of soaking i.e. 48 h extracts were more effective than 24 h.
among all parts the highest activity was shown by leaves followed by fruit, b...
Naeema Khatoon Khaskheli1 , Muzafar Hussain Sirohi11, 2,*, Ameer Ahmed
Mirbahar1, Abdul Razak Mahar1, Mumtaz Ali Saand1, Mirza Hussain3
...>Weeds are the noxious plants that stunt growth and yield of many crops. This study
recorded the community composition of weeds in maize crops grown at District Khairpur,
Sindh, Pakistan. The weeds were collected from the maize crop at three different localities
using the quadrat method (60 quadrats/site). The species were identified and herbarium
samples were preserved in Herbarium, Shah Abdul Latif University, ...
Haseeb Ahmad1*, Muhammad Shafi1, Waqas Liaqat1, Muhammad Faheem Jan1,
Shahzad Ahmad2 and Muhammad Farooq3
...vator produced tallest plants
(221.22 cm) with maximum grain rows ear-1 (16) and shelling percentage (78.14%).
Among weed control methods, hoeing 15, 30 and 45 days after sowing showed maximum
plant height (226.41 cm), grain rows ear-1 (16), and shelling percentage (79.11%). All weed
control methods showed significant reduction in weeds m-2, weeds fresh
...
Kamran Ahmed Pathan1 , Waheed Ali Panhwar1,*, Abdul Manan Shaikh1, Safdar Ali
Ujan1, Javed Ahmed Ujan1, Khadim Hussain Memon1, Irfan Ahmed Pathan1 and
Shabana Mangi1
...association of various plants with the
species is provided for the first time. This study will be a baseline for the future research
associated with longhorn beetles.
...

*Arshad Javaid1, Syeda Fakehha Naqvi1 and Iqra Haider Khan1

...v>identified. The weed plants were collected from Jehlem, Pakistan. Its roots were dried,
powdered and extracted in methanol. After evaporation of the solvent, the remaining
extract was mixed in water and partitioned with n-hexane, chloroform and finally with ethyl
acetate. The last fraction was analyzed through GC-MS that indicated the presence of 15
compounds. These included the three major compounds namely o-x...

Khushdil Khan1, Mushtaq Ahmad1, Muhammad Zafar1, Khafsa Malik2, Shazia Sultana1, Shabir Ahmad1, Fawad Khan3, Asif kamal1, Kalim Ullah3

...rent weedy bee foraged plants belong to 10 various families from Southern Khyber Pakhtunkhwa were collected, identified, and studied using light microscopy (LM). The plants were Asphodelus tenuifolius, Euphorbia helioscopia, Parthenium hysterophorus, Rhazya stricta, Datura innoxia, Eruca sativa, Convolvulus arvensis, Anagallis arvensis, Galium aparine, and Anethum graveolens. Slides for light microscopic studies were prepare...

Iqtidar Hussain1, Ejaz Ahmed Khan1, Jawad Nazir and Ehtesham-ul-Haq1

...growth of neighbouring plants is called allelopathy. The significance of study was checked allelopathic phytochemical potential of white cedar vern. Bakain (Melia azedarachL.) leaves on wheat.Leaveslitter was used to examine the allelopathic effects of M.azedarach at five concentrations (100, 200, 300, 400 g, control). The studied parameters were germination percentage (%), Speed of germination, plant height (cm), root length (cm), Shoot length (cm), coleoptil...

Muhammad Ather Nadeem1, Bilal Ahmad Khan1* Sadia Afzal2, Rizwan Maqbool3, Hasnain Waheed1, Aneela Nijabat4, Muhammad Ikram5, Amir Aziz6, Muhammad Adnan1, Qaisar Mehmood7, Hasnain Umer3

...y;">Weeds are unwanted plants in crop that can be controlled by different methods among them use of aqueous extracts of crops is an imperative method. In this method allelochemicals present in crop plant help in suppressing or inhibiting weeds. Therefore, this study was planned to investigate the allopathic potential of aqueous extract of winter crop Papaver somniferum (opium) on summer weed Echinochloa cruss-galli (barnyard grass. The experiment comprised of ...

Makruf Arif1, Asmarani Kusumawati2*, Kurniawan Dwi Prihantoko3, Agustina Dwi Wijayanti4, Sri Gustari2 

...oductive issues. Antioxidants are crucial in semen cryopreservation to inhibit lipid peroxidase, thereby preserving sperm quality. This study aimed to investigate the effects of genistein and glutathione supplementation on the quality of cryopreserved sperm. Semen was collected from six KUB roosters and then diluted with the LREY extender using five different treatments: LREY without antioxidant as control (LREY0), LREY supplemented with genistein at 5 µ...

Mushtaq A.Alabodi1*, Imad Majeed Almeeni2 

...iciency of melatonin implants as a single subcutaneous dose to suppress or delay the estrus cycle in queens. Ten domesticated non-pregnant cats of known origin aged between 1-3 years were used. The cats were divided randomly into two groups. The first group (G1, n=5) was left without treatment and served as control group, and the second group (G2, n=5) was administered 18 mg melatonin implants as a single-dose subcutaneously...

Karin Alvåsen1*, Karin Maria Olofsson2, Raymond Kent Fenton3, Ulrika Rockström4, Lena-Mari Tamminen1, Nils Fall1

...ng sessions, the participants performed 15 RDNs. Subsequently, interviews were conducted with 10 participants to capture their experiences and views on using the RDN method. In many of the necropsied animals, the RDN diagnosis matched well with the on-site veterinarian’s observations. The participants expressed a great interest in developing and obtaining more skills in performing on...

Salim Saifullah, Muhammad Ilyas, Bashir Ullah and Sanam Zarif Satti*

... regeneration of antioxidants, hormone biosynthesis, and photosynthesis. This study includes the collection of Rosa brunonii rosehips from various locations in Murree Hills and the quantification of vitamin C in these samples. The average weight of rosehips varied from 4.54 to 7.92 g. Rosehips collected from Lower Topa (LT) showed the highest weight with a mean value of 7.92 g, followed by rosehips collected from Danoi (DA) (7.25 g). The average vitamin C cont...

Zia Ur Rahman1*, Naveed Ahmad1, Adnan Ahmad2, Hammad Ud Din1 and Fazli Amin1

...d in 2022 at Medicinal Plants Farm, located in the Peshawar region of Khyber Pakhtunkhwa, using seven improved varieties of Sesame under irrigation conditions with a conventional watering frequency of once per month. The objective of the study was to identify the best-performing Sesame varieties that would enhance productivity in the target areas. The experiment followed a randomized complete block design (RCBD) with three replications. The tested Sesame varie...

Amir Afzal1*, Sairah Syed1, Hafiz Husnain Nawaz2, Ruqeah Mustafa1, Marjan Aziz1, Madeeha Khan1, Azra Khan3, Uzma Javed1, Attiq Ur Rehman4, Rubab Altaf 5 and Qamar Shakil6

...inst differential host plants, and molecular techniques such as PCR and DNA sequencing are discussed as effective tools for tracking Pst populations, identifying new introductions and monitoring their evolution over time. A combination of traditional and molecular techniques has generated valuable data for understanding populations virulence of Pst.

...
Mohammad Islam, Habib Ahmad, Abdur Rashid, Abdur Razzaq, Naveed Akhtar , Ikarmullah Khan
NAVEED AKHTAR,Maqsood Anwar,WISAL MUHAMMAD KHAN,Amjad Siddique,MUHAMMAD SALEEM KHAN,SAMIN JAN
Muhammad Alam Zeb,Adeela Haroon,SULTAN MEHMOOD,MANZOOR ULLAH,REHMAN ULLAH KHAN,SAAD ULLAH KHAN,ASIM MUHAMMAD,IHSAN ULLAH,Saira Abbas
Siraj Ahmad[1], Asghar Ali , Hanifa Beg , Altaf Ahmad Dasti , Zabta Khan Shinwari
KASHIF ALI,Muhammad Shuaib,SAJJAD ALI,Tanweer Kumar,SHARIFULLAH,IKRAMULLAH KHAN
Muhammad Nabeel,Ali Ahsan Bajwa,Sehrish Sadia,Wahaj Nafees,SHAHIDA KHALID
NAVEED AKHTAR,WAHEED MURAD,IKRAMULLAH KHAN,SAMIN JAN,HABIB UL HASSAN,AKASH TARIQ
Syed Rehmat Ullah Shah, Muhammad Qasim , Ijaz Ahmad Khan , Syed Azmat Ullah Shah
SULTAN MEHMOOD,MANZOOR ULLAH,SAAD ULLAH KHAN,IHSAN ULLAH,ASIM MUHAMMAD,REHMAN ULLAH KHAN
MUHAMMAD SALEEM KHAN,IQBAL MUNIR,SYED ZAHIR SHAH,NAVEED AKHTAR,Haroon Khan,WISAL MUHAMMAD KHAN
Amna Ali,MUHAMMAD SALEEM HAIDER,UZMA BASHIR,NAUREEN AKHTER
Inamullah,SAFDAR SHAH,SHAHIDA BIBI,ABDUL MAJID,SAJJAD ZAHEER,HABIBULLAH,Zahid Hussain,ALAM ZEB
Shad Ali Khan, Lajbar Khan, Iqbal Hussain, Khan Bahadar Marwat , Naveed Akhtar
Arshad Iqba,INAMULLAH KHAN,FAZL E RABBI,SIRAJ UD DIN,SAMIN JAN
Irum Mukhtar , Ibatsam Khokhar , Sobia Mushtaq,Muhammad Azam Khan , Mir Ajab Khan , Mazhar Hussain
Kee-In Lee,In-Taek Hwang,Soo-Jin Cho,Ha-Young Song,No-Joong Park,Hee-Kyung Lim,Dal-Rye Kim
Shahida Naveed , Madeeha , Inayatullah Khattak and Khan Bahadar Marwat

Sheng Zhang, Rui Qiu, Zhiping Lv, Liying Yang and Wei He*

...ally includes 40 participants, and these participants are divided into following two groups: control group (health participants), experimental group (NSCLCP), and then all these participants receive standardized bronchoalveolar lavage. Participants’ general data are collected and analyzed. EphA2 expression and PR...

Hadi Awad Hassooni1, Safaa Sabbar Atiyah2*, Alaa Saleh Jassim1 

... between the genetic variants. The study also found significant differences (P≤0.05) between the genetic polymorphisms 180/170 and 190/181 in the California mastitis test. However, no statistically significant differences noticed in the genetic polymorphisms related to fat, protein, lactose, and solid non-fat in milk elements, with percentages of 3.60% and 3.48% for fat, 2.90% and 3.1% for protein, 4.18% and 4.31% for lactose, and 7.94% and 8.26% for solid ...

Viranga Kumudini Jayasundara¹*, Ali Khatibi², Jacqueline Tham²

...ployed to select participants. The data was collected through in-person interviews adapting a closed-ended, structured questionnaire from 287 participants (dog owners who have local or native dogs). The measure was five point rating likert scale. RDO and SDP management were higher-order constructs, and dog-keeping practice, behaviour, veterinary services, abandonment, and owned stray dogs were first-order constructs of the m...

Migie Handayani1*, Dwidjono Hadi Darwanto2, Jamhari Jamhari2

...k management, Small ruminants, Smallholder livestock farm, Veterinary and animal husbandry
...

Zeinab A. El-Moaty1,2*, Hoda Ahmed1,3, Wafaa Sorour4,5 and Tarfa H. Alsheddi6

... highly significant in plants and insects collected from the cement site. Mg level was the same in plants and insects collected from the two inspected sites. The concentrations of different MHs were higher in beetles than soil and plant. Only, the concentration of Zn in plant (163.59 µg/g) was higher than that recorded in soil (1.67 µg/g) and insect (80.99 µg/g). The concentration of Mg, Cu, Fe, Pb, Cd and ...

Roshan Ara1, Muhammad Ali Khanzada1, Amir Khan Korai1*, Abdul Mubeen Lodhi, Anam Mehwish Khanzada1, Khalid Hussain Qureshi1, Shakal Khan Korai2*

...a) infection on chilli plants and evaluated the efficacy of various chemical nematicides in controlling the infection. Infected plants exhibited symptoms such as pale green to yellow discolouration, stunted growth, and the development of knots on roots containing egg masses and female nematodes. Pathogenicity tests on “Ghotki” chilli plants revealed a direct correlation between...
Manahil Wahab1 and Anwar Ali2
...normal spacing between plants on the boundaries of field is 2-3 feet whereas in case of compact plantations it is 3x3 or 4x4 feet. About 48% of the respondents procured saplings from private nurseries whereas 42% of the farmers produce planting stock in their own nurseries. Majority (82%) of the respondents reported that trees have negative effects on agricultural crops which results in loss of agricultural crop in the range of 20-50%. On the average the loss ...
Basheer Ahmad1, Anwar Ali1, Salman Ahmad1, Nowsherwan Zarif1* and Saif Ullah Khan1
...on, 48% of people are tenants who work on other lands under a share cropping system, and 7% of people have their own land but have also purchased land from owners....
Muhammad Rayyan1, Basheer Ahmad1, Anwar Ali1, Nowsherwan Zarif1*, Saif Ullah1 Khan and Salman Ahmad1
...omic return, while 15% plants for shelterbelt purposes. Whereas, results further revealed that 12.5% farmers planted trees for land stabilization. In addition to that 57.5% of households gets benefits from agroforestry in the form of cash and fuel wood 10% in the form of fuel wood. From the survey it is also revealed that 45% of farmers are directly benefited from fuel wood from farmland, while 32.5% of farmers relied for fire wood on their land as well as fro...
Khush Bakht Arooj1, Muhammad Salman2 and Naveed Ahmed3
...income, pollination of plants to increase crop yield, maintains biodiversity and to protect the environment. The current status of apiculture in district Bannu is evaluated in the study as it is also a famous area for honey production in Khyber Pakhtunkhwa. In this study the primary data was collected through well-designed questionnaire and the study was carried out in different villages of Tehsil and District Bannu. A general survey was also conducted to know...
Maaha Malik1, Muzakir Shah2, Muhammad Naqash2, Mamoona Wali Muhammad2, Safdar Ali Shah2, Bushra Khan1, Sayyed Masoom Shah2, Zahid Mahmood2, Syed Talha Kamil2, Kamal Anwar2 and Faisal Khalid2
...ackground of the participants to their level of awareness regarding climate change and the suggestions for measures to mitigate and adapt the effects of climate change. The study results showed that the only 24% participants know about concept of Climate Change. The term climate change is understood differently by different people and therefore they perceive different reasons for this change. 71% were known to the fact that ...
Sanam Zarif Satti1, Tanvir Ahmad Quereshi2, Mehwish Zarif3 and Iftikhar Ahmad4
...t. ...
Ch. Muhammad Muslim1, Hassan Sher2, Junaid Khan2, Shahid Hussain2, Ashfaq Ali2 and Atif Majeed3
...e herbaceous medicinal Plants of Gadoon area District Sawabi was conducted during summer 2010. Data was collected using a simple and comprehensive questionnaire which was specially designed to meet the requirements of the present study. Interviews were arranged with knowledgeable persons and for validation purpose field visits were arranged. Data about conservation status was obtained through quadrate method. The study reported 40 herbaceous medicinal pl
Muhammad Yousaf Khan and Pervez Manan
...a protest of few participants organized and brought by NGOs based at Peshawar and Islamabad with Play Cards in their hands against Eucalyptus trees planted in Billion Trees Project of the KP Government. The protest organized in front of Malakand Press Club Batkhela on 31st August, 2018 got wide spread publicity in print and electronic Media. In response local members of Nazism, Councilors and Farmers assembled in front of the same Press Club within a week aft...
Ahmed Zamir, Muhammad Waqas Khan and Saeed Anwar Wazir
...o variety of medicinal plants and has been called as the floral emporium of medicinal plants. It has about 6000 species of wild plants, among them almost 4000-6000 are considered to carry or of medicinal importance. During the ethno botanical elaboration of Leepa valley 106 plant species of 55 families were recorded. Among them 93 are considered to carry great medicinal values. Residents o...
Alam Zeb, Fawad Habib, Sajid and Tilawat Khan
... Owners, 19 Owner cum Tenants and 10 Tenants were selected randomly from Gadar, Sawaldher and Gujar Garhi villages. Owner category was found dominant in the above mentioned target villages in the parameters of productivity, formal education, planting experience, knowledge of silviculture of poplar and commercialistic nature of respondents. The Net Incomes (NIs) calculated per Avenue Kilometer of poplar plantation were (Rs.30...
Ashar Farooq1; Farid Shah2; Saifullah Zahri2 and Samiullah Jaffar2
... Leaves of intercepted plants were removed at a distance of 5 meters. The cover and height of the same plants was also measured. Quadrat method was used to measure the number of individuals per unit area of Seriphidium at both sites. For measuring the concentration of Fe+, the plant samples were dried, digested and analyzed on AAS (Atomic Absorption Spectrometer). It has been concluded that there was non-significant i...
Mamoona Wali Muhammad1, Syed Ajmal Rahim2, Junaid Mumtaz3 and Syed Akmal Rahim4
...re landowners with 6% tenants /landless. 54% respondents belonged to middle class (i.e. own pacca house and have less than 10 acres) have sufficient land to plant trees. Forest tree plantations of Eucalyptus species, Poplar and Acacia modesta, etc. were found on 10-12% of land. Majority 68% respondents use farm trees for mix of uses (timber, fuel wood, fodder) with preferred rotation age, expressed by 80% as 6-10 years. Out of total farm tree produce, 3...
Muhammad Imran, Muhammad Anwar Panezai and Ashif Sajjad
...0%) and the local inhabitants of the area are unaware of the facts that deforestation is causing many problems like soil erosion, flooding and also the degradation of forest resources. The data indicated that poverty is a wide spread phenomenon. According to the findings, the people are having very low income. Sherani District is mainly rural area i.e. Poverty is prevalent on larger scale. Although many people have migrated and are working in urban areas like ...
Mian Muhammad Shafiq and Muhammad Saqib
...arried out.

...
Mamoona Wali Muhammad1, Hakim Shah1, Nowshad Khan2 and Mohd Zaki Hamzah3
...eas, nor between participants and non-participants (p=0.128), even though more forest trees were planted under PWSMP. The participants planted more trees than non-participants. The programs succeeded in getting significant involvement (p=0.000) of people in forest protection activities. These two accomplishments serve the forest management and developmen...
Saif-ur-Rehman Saif Abbasi & Saeed Akbar
... in shape of medicinal plants, wood for making their farm implements i.e. wooden plough, spade, blade etc. and domestic goods of daily usage i.e. charpoy, stool, baskets, furniture etc. The use of cheep and easily available forest vegetation, based on indigenous knowledge, has reduced household expenses on one hand but has also put tremendous pressure on forest vegetation on the other hand. There is need to create awareness on sustainable forest resource manag...
Muhammad Tahir Laeeq and Muhammad Asif Aziz
...tilizer and growth stimulants. (iii) use of four mixtures of soil, sand and farmyard manure in the ratios of 3:2:1, 2:2:1, 4:3:2 and 3:2:2. (iv) use of four sizes of polythene bags (17.8 x 10.6 cm, 17.8 x 8.9 cm, 16.5 x 10.6 cm and 20.3 x 10.2 cm).

The result of fertilizer experiment revealed that control seedlings and those treated at intervals of 4,6 and 8 days with urea gave significantly better survival as compared to those seedlings treated at a...

Syed Said Badshah Bukhari, Muhammad Yousaf Khan Syed Zakir Hussain Shah and Khalid Jan
...2010. This situation warrants management of water resources of the country, specially the watershed of river Indus. The territory of almost entire area of Pakistan constitute watershed of river Indus. The flow of Indus is trans-country and runs throughout its length of more than 1700km from northern high peaks to Arabian Sea in the south. This provides maximum opportunity for irrigating the plains situated in Khyber Pakhtunkhwa, Punjab, Balochistan and Sindh w...
Muhammad Shabir Mughal and Abid Hussain
...nd 41.7% grow through tenants. The cost for raising hurrie varied from 7000/acre/rotation (15% respondents), 10,000 (35% respondents) and 15,000 (50% respondents) and income also varied from Rs.150,000 to 160,000 / acre / rotation (41.7% respondents) and more than Rs.170,000 (58.3% respondents). Respondent farmers (66.8%) informed that Hurrie is being raised for fuel wood production, 16.6% reported for forage, fodder and minor timber production and 16.6% respo...
Ch. Muhammad Muslim and Sohail Sikander
...earch on the medicinal plants was started by the researchers in the last century in order to allocate different valuable alternative resources to the increasing demands of population especially to those communities totally dependable on forests and other non-renewable natural resources. Linum usitatisimum is a renowned medicinal herb of the world of herbaceous plants because of its multipurpose uses in different disea...
Mian Muhammad Shafiq and Muhammad Saqib
... carried out.

...
Ch. Muhammad Muslim and Sohail Sikander
...eneration of medicinal plants is adversely affected by a number of climatic and edaphic factors (earthquake). Drug plants occurring at higher elevations acquire perennial nature due to short growing season of 4 to 6 months and hence require a prolong growth periods of 6 to 10 years depending upon plant species concerned. Disturbance in the regeneration pattern is also affected by heavy grazing and intensive felling of trees ...
Muhammad Shabir Mughal and Muhammad Muslim
...augment income of inhabitants as well as conservation of genetic diversity for future prosperity. Jandi-Chontra to Baghsar locality of Tehsil Samani rich in herbal drugs and the main forest crop of this area was Chir (Pinus roxburghii) with other associated species. The information gathered will provide guideline in preparing future forest management plan....
Muhammad Shabir Mughal and Muhammad Muslim
... aromatic and economic plants growing in the area and evaluation of future prospects of endemic tree species including medicinal and economic plants that need in-situ conservation of sustainable utilization having market potential and income generation activities for rural communities. The area falls under scrub forests and subtropical Chir pine forests. Inhabitants are holding small land ...
Rahim Muhammad Akmal Syed1, Hasnain Shahida2, Mamoona Wali Muhammad3 and Jabeen Farkhanda4
...nt suitable species of plants. The results of the soil analysis of various agro ecological zones and the consequent recommendation of the associated suitable species, aids the agrofarmers to pick out the best possible option.

Key words: Soil Analysis, Agro-ecological Zones, Farm Plantations, Soil Texture and Organic Matter, Nitrogen and Phosphorous.

...
Enefiok S. Udo1, Opeyemi Olajide1 and Eyo A. Udoh2
..., Non-Timber Products, Plants, Rainforest, Regeneration, Sustainable Management, Ukpom Community.

...
Ch. Muhammad Muslim1, Yahya Karamat2, Muhammad Shabbir Mughal3 and Imtiaz Hussain4
...earch on the medicinal plants was started by the researchers in the last century in order to allocate different valuable alternative resources to the increasing demands of population especially to those communities totally dependable on forests and other non renewable natural resources. Nigella sativa is a renowned medicinal herb of the world of herbaceous plants because of its multipurpose uses in different disease t...
Muhammad Afzal, Aqeela Mobeen Akhtar and M. Mahboob-ur-Rahman
... Earth's surface where plants developed in relative isolation over long periods of time and are separated from one another by geologic features, such as oceans, broad deserts or high mountain ranges, that formed barriers to plant migration. Forest Ecozones are characterized by the evolutionary history of the plants they contain. These are divisions of the Earth's surface based on plant life form or the adaptation of pl
Muhammad Shabir Mughal, Asif Raza Wazir and Ch. Muhammad Muslim
... of income of the inhabitants. A number of medicinal plants like Berberis lycium, Thymus serpylum, Salvia sp., Solanum suratense were also found in the area. The data reveals that due to ever-increasing human and livestock population, the area is under heavy biotic pressure resulted deforestation and soil degradation. Recommendation for the improvement of vegetation in the area was made of soil, unemployment an...
Ch. Muhammad Muslim, Muhammad Shabbir Mughal and Imtiaz Hussain
...rch, 2003 at Medicinal Plants Farm, Pakistan Forest Institute, Peshawar. Various portions of corms i.e., Daughter, Full and Mother corms (DFM) were planted on ridges 30cm apart with a plant to plant distance of 15cm. The treatments are highly significant at 95% and 99% level of confidence. LSD at 5% shows that all the treatments are highly significant among themselves while the T1 (Daughter) corm is highly significant. Furthermore, it is recommended that the c...
Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...reproductive growth of plants, and depending habitat characteristics. In addition to biologists and ecologists, this study provides guidelines to policy makers for adaptation of mitigation measures.

Key words: Climate change, temperature, rainfall, evaporation, wind

...
Shakeel Haider Zaidi, Ch. Muhammad Muslim, Muhammad Shabbir Mughal and Imtiaz Hussain
Tanvir Hussain
...mbryos with stem) as explants in different culture media i.e. Murashige & Skooge (MS) medium, Gamborgs B5-salt (B5)and Basal nutrient medium (BNM) alone and in combination with Auxins and Cytokinins. It was found that only the axillary buds gave good response to all media. For callus initiation, same ex-plants and media (alone and in combination with callus initiators) were tried but callus formation was not observed. Asepti...
Md Golam Moula
...nsidering the types of plants, survival rate, diameter and height growth, E. agallocha, H. fomes and X. mekongensis are found highly promising for underplanting in the western coastal belt of Bangladesh....
Sarfraz Ahmad, Sarwat N. Mirza and Muhammad Islam
...nd production of range plants in Balochistan. Salsola vermiculata a Mediterranean perennial shrub was evaluated under natural rainfall regimes to assess its potential of germination and establishment under drill and broadcast seeding treatments for range improvement in highland Balochistan. Seeds of S. vermiculata germinated in both treatments with higher germination percentage in drill seeding. Apparently, no differences were observed for seedli...
A. W. Jasra and I. Ahmad
...e one of the largest remnants of their kind on earth. Subsistence oriented pastoral livelihood of around two million people depends on these forests. This paper gives an analysis of the communities inhabiting the juniper zone and their livelihood sources; and suggestions for resource base improvement. These communities consist of settled/sedentary pastoralists, transhumant pastrolists and nomadic pastoralists. The sedentary community has shifted from pastrol l...
Majid Azizi and Mohammad Modarres
...o feed paper producing plants. The decision-making is examined within the framework of benefits, opportunities, costs, and risks (BOCR). A hierarchy is used to prioritize the BOCR themselves are prioritized using the Analytic Hierarchy Process (AHP) ratings approach. A control hierarchy is then created and prioritized using the Analytic Network Process (ANP) to evaluate the control criteria of the system. There are a total of 19 control criteria in the system ...
Asad Ullah, Abdur Rashid and Sher Aman
... knowledge of the inhabitants about the Tree species of the area. Twenty tree species belonging to eleven families and nineteen genera viz. Abies pindrow, Acer caesium, Aesculus indica, Betula utilis, Cedrus deodara, Corylus colurna, Crataegus songarica, Ficus carica, Juglans regia, Malus pumila, Morus alba, Picea smithiana, Pinus wallichiana, Populus alba, Punica granatum, Prunus armeniaca, Prunus domestica, Pyrus communis, Quercus baloot, Salix turanica
Majid Azizi
...hment of Wood industry plants.

Keywords: Wood industry, TOPSIS, Analytical Hierarchy Process, Location, Priority

...
Muhammad Afzal, Aqeela Mobeen Akhter and Masood Amjad
...e to type Shisham tube plants can be produced vegetatively through the application of rooting hormones, which are fit for field planting with in a period of 4 months. NAA with a concentration of 100 mg/l among the other rooting hormones proved to be more economical for production of these true to type tube plants. These tube plants showed promising growth in the field with more than 80% su...
Muhammad Afzal and Aqeela Mobeen Akhter
...ts and 85% survival of plants in soil was recorded....
Sardar M. Rafique and Ghulam Ali Bajwa
..., training of mulberry plants should be carried out before the autumn rearing to get young nutritious leaves.

Key words: Silkworm, Bombyx mori, Rearing, Efficiency, Mulberry leaf.

...
Bashir Ahmed Wani1, Shakeel Haider Zaidi2, Hakim Shah3 and Muhammad Muslim4
...erbal drugs, Medicinal plants.

...
Chaudhry Abdul Rashid1, Raja Muhammad Omer2, Chaudhry Muhammad Faisal2, Waqar Ahmed3, Zahid Ali4
...maldulensis) Eight plants of E camaldulensis were replicated thrice in each treatment with a spacing of 2m x 3m. Plant height (m) and diametre at breast height (DBH) (cm) were measured annually from 1992 to 1998 Soil samples were analysed for pH, organic matter (OM) %, P, K, total soluble salts (TSS) % and soil saturation % Results indicated that the growth of E camaldulensis was highest in combination with Leuceana leucocephala and
Hassan Sher, Midrarullah, A. U. Khan, Z. U. Khan, Farrukh Hussain and Siraj Ahmad
...study of the medicinal plants of Udigram, District Swat was conducted during spring and summer 2003. The study revealed 78 species under 37 genera belonging to 47 families, of which 68 plant were dicotyledons, 6 monocotyledons, 1 gymnosperm, 2 pteriodophytes and 1 fungus. The largest family was Lamiaceae (9 species) followed by Asteraceae, Poaceae (each with 5 species), and Rosaceae (4 species). The family Apiaceae, Asclepidaceae, Brassicaceae, Caryophylaceae,...
Sarfaraz Hussain Bangash
... Functions of boron in plants The exact and specific function of boron in plant vegetative life is not understood as yet. However, investigations have shown that it causes death of the terminal growing point, breakdown of the conducting tissues and results in the brittleness of stem and petiole which finally causes brown coloration and cessation of roots and height-growth (Bangash & Gardiner, 1985). Boron deficiency causes increase in total sugar and starch in...
Md. Aktar Hossain , Mohammad Kamaluddin and M. Serajuddoula
... of etiolation of stockplants on rooting ability to cuttings of Guava (Psidium guajava Linn.). Fifteen months old sun grown containerized stockplants of guava were etiolated in a darkroom. Cuttings from the etiolated and control stockplants were tested for rooting ability. The study revealed that the cuttings of the stockplants etiolated or contro...
Aman Ullah Bhatti, Shamsher Ali and Farmanullah Khan
...K. The total number of plants were 410 in agro-forestry field and were about 5 years old Data collected on soil properties were statistically analyzed. In the field of agro-forestry, the percent co-efficient of variation (% CV) for EC (1:5) and P were 57.4 and 35.2 for surface soil and 49.8 and 72.7% for sub soil, respectively. Based on critical level for soil P. all the soil samples in both the depths were deficient, except one sample which was medium in subs...
Bashir Ahmad Wani, Shakeel Haider Zaidi, Muhammad Shabir Mughal and Hakim Shah
...Medicinal and aromatic plants can be a source of sustained income to the inhabitants of hilly areas, traders, hakims, pharmaceutical and allied industries. The survey brought forth some important facts and figures about floristic composition, status of medicinal and economic plants. At present exploitation of this renewable natural resource is not carried out on scientific lines and thus t...
Muhammad Ibrar Shinwari, Maryum Ibrar Shinwari and Mir Ajab Khan
...terviews of local inhabitants, herbalists, pansaries, park authorities and societies on random bases. Only 26 species have been found as marketable medicinal plants collected by the inhabitants, drug dealers and herbalists for their socioeconomic value. Among the species sold in the local market, 3 species i.e., Asparagus adscendens Roxb., Berberis lyceum Royle. and Viola ...
Raza-ul-Haq and Muhammad Tahir Laeeq
...survival of seedlings. Plants showed better survival under mulching and irrigation thrice a month, while E. camaldulensis gave the best survival (1%) followed by A. altissima (6%) after 4% years of planting....
Muhammad Afzal, Muhammad Mushtaque, Aqeela Mubeen Akhtar, Nighat Chughtai and Shaheena Ramzan
...h multiplication of ex-plants produced from aseptically raised germinates of the species. In the basal media (MS + 5 micro molar BAP), ex-plants started differentiating shoot buds at high frequency. These aseptically developed plantlets were shifted to earthen pots for rooting without applying any root-promoting hormone. These plantlets showed a good growth response in earthen pots and attained one-meter height within a peri...
G.A. Bajwa and H. Gul
... defoliator of nursery plants being environmentally safe for this purpose seed of A. indica, bark of C. fistula and leaves & tender shoots of C. procera were used The reduction in larval body weight in treated larvae was 74 19% to 78.92% over control in case of C. procera and the mixture after 12 and 6 days of treatment, respectively Mean larval period was extended upto 22 days in the mixture treatment while it was 11.5 days in cont...
Muhammad Naqash, Anwar Ali, Ahmad Hussain, Mamoona Wali Muhammad, Ahmad Zamir, Ikram Ul Haq
... the average number of plants regenerated per hectare is estimated to be 136, some of which were coming out of natural regeneration besides plantations. The average survival rate was 92.36% in Mingora and Matta Forest Subdivisions and Kabal and Fatehpur Ranges. In Mingora and Matta Subdivisions the survival rate was 92.08% and 94.65% while in Kabal and Fatehpur the survival rate was 89.20 and 93.50 %. Majority of plants (74...
Siraj-ud-Din and Abdul Waheed Baloch
...survival and growth of plants as compared to conventional planting methods. Within the various water conservation techniques contour trenches and earthen moistures are more economical and are able to keep the period happy and vigorous for a longer period of time. Biological treatment to sand dune stabilization is the only permanent and everlasting solution to this problem.
...
Anwar Ali, Muhmmad Ayaz, Saz Muhammad
...Kaghan. There were 332 plants per ha in the forest area. Reserved forests have significantly higher number of regeneration than Guzara Forests. It was astonishing to know that the highest number of regeneration was recorded for Fir which was 43%, followed by Kail as 27%, deodar 14%, Spruce 12% and Taxus wallichiana as 4%. The study recommends adoption of assisted natural regeneration techniques and opening of canopy for improvement of stand structure....
Sanam Zarif Satti, Tanvir Ahmad Qureshi, Iftikhar Ahmad and Sumara Zarif
...i>....
Sarfaraz Hussain Bangash
...y of these elements to plants. Amongst the micro-nutrient elements, boron is perhaps the most important and plays a very important role in soil-plant relationship. It has a marked effect on crop growth, both from the standpoint of plant nutrition if it is deficient in soil, and of toxicity if it is present in excess. Boron is the 25th element in order to abundance on the earths surface, and 12th in order of abundance in plants<...
Muhammad Rafique and Muhammad Afzal
...sis tubed nursery plants for transplanting in the field. Six different age groups of seedling were planted for this purpose. Results revealed that seedlings of three months old or less are not suitable for out-planting due to their high mortality rate. Seedlings of four and a half to six months are best for transplanting in the field....
Kh. Rizwan Shehzad, Z. H. Malik and Rizwana Aleem Qureshi
...after the 3 leading dominants. The following five communities were recognized: (I) Melia-Lantana-Stellaria, (II) Morus-Dodonaea Melilotus, (III) Dodonaea-Grewia-Melia, (IV) Stellaria-Zizyphus-Dodonaea, (V) Oxalis-Pinus-Olea Communities. Index of diversity and its components decreased from low altitude to high altitude, but in Oxalis-Pinus-Olea community it was high. Soils were generally loamy, sandy loamy to clayey loa...
Jehan Zeb, M. Aslam, Shahid Ahmad, Aamir Kabir and Taj Ali Khan
Muhammad Ibrar Shinwari and Mir Ajab Khan
...ational Park. The inhabitants of the park have always used medicinal plants for various ailments and have for a long time been dependent on surrounding plant resources for their food, shelter, fodder, health care and other cultural purposes. However, encroaching industrialization and the accompanying changes in their life styles are responsible for the decline in the local practice of uses of these pl<...
Mian Muhammad Shafiq
...y and 11% low (5% for plants, 4% for mammals, none for birds, 10% for reptiles for fish) but the blending of elements from different origins has ensured a diverse and interesting flora and fauna....
Muhammad Rafique Sardar
...s the existing forests plants preparation, important characteristics and objectives of forestry projects and evaluation processes. The paper suggests that forestry activities must be integrated with rural development. It further suggests that the importance of Planning, Monitoring and Evaluation (PME) of forestry projects must be recognized and evaluation must be made an integral part of the plans....
Ghulam Akbar, Muhammad Arshad and Taj Naseeb Khan
...vations confirmed that plants emerging from seed were morphologically more vigorous than those arising from root stumps. Thus seeding method if synchronized with suitable soil moisture can prove more effective in terms of DMY in desert areas like Cholistan....
Mohammad Noor and Bashir Hussain Shah
... were compared. Twenty plants of each of the five fodder tree species were planted in each of 6 replications on RCB design. Survival, growth and airdried biomass data were collected in January, 1994 on each tree species, and analyzed statistically. Acacia modesta, Prosopis cineraria and Acaica albida had substantially higher survival percent than Acacia tortilis and Acacia victoriae. Acacia albida and Acacia tortilis ...
A. U. Khan, S. Siddique and F. Naz
...ical forms of the pollutants, effects of exposure dosage on the plants, alongwith plant physiology and the energy and chemical balance in the plant micro-environment created on the road determine to what extent pollution can be absorved or emitted by these trees....
Abdul Khaliq Chaudhry, Sahibzada Muhammad Hafeez and Muhammad Jahangir Ghauri
...sis potted nursery plants and its effect on the out-planting success. Survival percentage and height and diameter growth of seedlings at nursery as well as field phase were found non-significant. Economy in irrigation water and use of labour for irrigation without affecting the growth of plants was also worked out....
Muhammad Hafeez, Liaqat Hussain Jafri and Mohammad Rafiq
...nds by planting tubed plants is preferable....
Hanif Gul
...All the dying and dead plants were found infested by termites while healthy plants were safe from termite infestation. Chemical control trials with chlorinated hydrocarbon insecticides afforded protection for more than 20 years while trials with pyrethroids are in progress and have shown efficacy for the last seven years....
Mohammad Hafeez and Muhammad Rafique
...d make it available to plants in their tender age. An experiment was laid out at Maujghar in Cholistan to study the effectiveness of such a chemical 'alkasorb' for its water retaining capacity and its ultimate effect on the survival and growth of tree species....
Muhammad Rafique
...d in this experiment. Plants were irrigated with aqueous extract o thoroughly chopped fresh leaves, dry leaves, fresh bark, dry bark, fruits and floral buds of Eucalyptus camaldulensis whereas ordinary water was used for control. Fertilizer was also applied to the wheat crop. Effects of different parts of Eucalyptus camaldulensis on germination percentage, number of tillers per plant, hight of crop and yield of wheat crop were studied wh...
Ghulam Ali Bajwa and Hanif Gul
...rcent dry matter. Five plants per treatment were selected at random, then data were converted on per plant basis. Plant height was the only parameter which significantly increased in response to Temik, while others were non-significant. Temik 10g at the dose of 3.2 g/plot increased 32.13 percent plant height over control....
K. M. Siddiqui
...nd graceful group of plants and are of multiple utility. About 14 million hectares of the earth surface is covered by bamboo forests with 80 percent of their total area falling in Asia. They are well represented in all continents except Europe and their distribution extend from 15° North latitude in Japan to 47° South latitude in South Argentina in the areas of Tropic of Cancer and Tropic of Capricon. The altitudinal range is from just abo...
Zakaullah
...t most of the infected plants had already died while the remaining exhibited blisters, swellings and girdling of stem, death of small shoots, needles turnings to reddish brown, resin exudation and eventually leading to the death of entire plant. The dead wood was found attacked by the borers (insects)....
Pazir Gul
...ber from the Medicinal Plants Farm Pakistan Forest Institute, Peshawar. Physico-chemical characteristics of the oil were also determined. October collection the oil were also determined. October collection gave high yield of oil (2.8%) and menthol content (68.0%) as compared to other periods of the year, next high yield of oil and Menthol content was observed in the month of August. ...
Mohammad Arif Chaudhry
...logy of three-year-old plants of 5 Paulownia species namely P. australis, P. elongata, P. fortunei, P.tomentosa and P. forgesii indicated that flower bud production occurred in the month of August in the first four species . P. forgesii did not produced any flower buds. The blooming took place in first week of March before foliation. P. elongata flowered earliest of the species in the first followed by P. fortunei in t...
Sahibazada M. Hafeez
... from CSIRO Australia, plants raised in the nursery and then out planted in the field trial during September, 1990. Three years survival and growth data have been analysed and better performing salt tolerant species have been identified. ...
K. M. Siddiqui and Muhammad Tahir Laeeq
...r which 1309.4 million plants will be raised. On the basis of these targets, 992,710 kg seeds of various tree species would be required during this period....
K. M. Siddiqui
...21-28 May, 1993. Participants from Iran, Kirghizstan, Turkey, Turkish Cyprus. Uzbekistan and Pakistan attended this Conference at the invitation of Government of Pakistan. Representatives of Afghanistan and Turkmenistan were not able to attend the Conference. Although, they had already confirmed their participation....
Mohammad Saleem and C. A. Call
...ere implemented when plants were 32 weeks old; and consisted of: equally clipping (3-cm stubble height) plants in monoculture and mixture zero, one, two or three times at 4-week intervals (32, 36. and 40 weeks after emergence), and clipping (3-cm stubble height) one species in mixture zero, one, two or three times at 4-week intervals (32, 36 and 40 weeks after emergence) without clipping the associated species. The final h...
M. Ismail Chaudhry and Ghulam Ali Bajwa
...nt parts of four drug plants Azadirachata indica, Dhatoora alba, Melia azedarach and Calotropis procera were used to determine their efficacy against Plecoptera reflexa larvae, an important defoliator of shisham plantations. In case of A. indica and M. azedarach seed powder was used for making 10% water extract and for D. alba and C. procera leaves, branches and stem were boiled in water for making 15% a...
Raza-ul-Haq
...-old and 12-month-old plants in polythene tubes gave best survival rate under shade in all three cover condition. Under similar condition the survival rate was comparatively low for the seeding planted directly in forest soil due to root competition. For older plants (24-month-old) both shade and root competition are less important. Height growth of young seedling (3-24 month old) is not significantly affected by shad...
Hanif Gul and M. Ismail Chaudhry
...ficiency at two sites. Plants with 3/4 roots cut showed maximum stress and plant mortality, followed by half root cut and low irrigation frequency. Foliage loss helped in improving vitality of plants by reducing moisture loss through transpiration thereby decreasing plant mortality. Further, almost all dying and dead plants were infested by termites at Kharian while only 30% of dead...
Shakeel Haider Zaidi and Anwar Ahmad Khan
...to 1992) at Medicinal plants farm, Peshawar. The plant has successfully adapted to the climatic condition of Peshawar giving the highest yield when planted at 60*30 cm spacing. It can be easily cultivated under irrigated conditions at Peshawar and has good potential for supplementing the farmer's income even on marginal lands....
Fazal Said Khan
... owners, 41 owner-cum-tenants and 91 tenants) using a questionnaire containing 29 questions of both qualitative and quantitative nature. Charsadda, farmers grow a number of trees on their farmlands. Some of these trees (Populus deltoids, Dalbergia sissoo and Salix spp.) are used in wood based industries and generate US$ 2 million income and contribute to the economic up lift of the area. The study also s...
Hanif Gul and M. Ismail Chaudhry
...lications keeping five plants in each treatment. A total of 243 plants were found dead at D. I. Khan during the period of experiment out of which termite damage was recorded on 27 plants only. At Peshawar mortality of plants was less than that at D. I. Khan. A total of 175 plants died over a period of a year and h...
Mohammad Noor
... number of established plants of the ecotypes from India (269), Australia (426) USA (235) and Pakistan (229) was significantly hider than those of other ecotypes. The ecotype from Pakistan (390) produced minimum air-dried for age and had minimum number of established plants....
Pazir Gul and Muhammad Farooq
...ts physico-chemist constants and the fatty acid composition. It was found to be nondrying comparing oil favorably well with oil from plants grown in colder climate but less unsaturated than Russian oil. It was also observed that the oil was of fair standard and could be used in place of oil from other Ricinus spp....
Anwar Ahmad Khan and Shakeel Haider Zaidi
...ive years at Medicinal Plants farm, Peshawar. Yield data indicated that 3-cuttings proved better as compared to two cuttings/annum.Application of split doses of NPK at the rate of 150:30:30 kg/ha significantly increased the yield of green herb as compared to other doses.The mint oil content are comparable with the main producing countries like Japan, India and China. Pilot-scale cultivation of Japanese mint in the irrigated areas is recommended to the ...
M. Bashir Khan
...f control) was in the plants fed with both ammonium and nitrate. The highest increase (34.7% of control) in the alkaloid concentration was in the plants fed with only ammonium.The increase in the Putrescine level. ODC and ADC activities was higher in the plants fed with only ammonium of both ammonium and nitrate as compared to those plants fed wit...
S. M. Rafique
...ings and whole nursery plants were planted in it at a spacing of 2.7 x 2.7 meters (9 x 9 feet). Irrigation was applied as and when required from an open sewerage drain. All necessary cultural operation were carried out according to the plan of operations. Ten years old tree crop in may, 1992 consisted of only 536 trees because there were numerous gaps in it. Amongst these, 11 trees were defective (top broken per dry and partially rotten from ground upwards). T...
Muhammad Khurshid Swati and Muhammad Afzal Cheema
...ding tree into logs or scants is called outturn volume. On the other hand, standing volume is the total content of wood in the form of timber and smallwood including volume of stumpage. The out turn volume can also be expressed as percentage of the standing volume of the tree. In the process of harvesting and conversion into logs or scants a certain proportion of the standing volume is lost as smallwood, Pharas, kur...
Wali-ur-Rahman and M. I. Chaudhry
...0.01 and 0.02% antimoultants caused 60 to 75% and insecticides 70 to 80% larval mortality in the same periods. The pest was controlled by spraying Malathion 57% E.C. in 0.17% concentration on the resting caterpillars at the natural enemies of the pest....
Editor
...omotion of medicinal plants was held on 6th and 7th March, 1991 at the Pakistan Forest Institute, Peshawar, organized at the initiative of Mr. Amir Gulistan Janjua, Governor, NWFP. The objectives of the Workshop were to bring together research scientists, pharmaceutical industrialists, traders, professional foresters, farmers,'attibas' and personals engaged in the manufacturer of medicines used in the traditional system, to initiate discu...
Mirza Hakim Khan Dr.
...d ample number of food plants, shelter and spring water for the animal. Improvement of this habitat is, therefore, essential for the protection of the animal against biotic interference....
S. H. Iqbal and Firdaus-e-Bareen
...nds of ferns and other plants in the rock crevices start senescing. The fine rhizoids of mosses and liverworts were observed penetrating the decaying aerial portions of Adiantum capillus-veneris L., making them heavily VA mycorrhizal. Vesicular and arbuscular infections were observed in thestem and fronds of Adiantum....
Shakeel Haider Zaidi and Anwar Ahmad Khan
...th performance of the plants were under-taken in its natural habitat. Results are presented in this paper....
Mir Baz Khan
... where mulberry trees plants are found in .abundance. The following sericulture centres have been established over the years in the province....
M. Iqbal Ahmad and I. A. Hafiz
...50% after sprouting of plants in spring and 50% after 20 days of leaf plucking, increased mulberry leaf yield by more then 100%. The PFI-1 early sprouting variety was selected and distributed among all forest departments of provinces and AJ&K for further propagation and raising of plantations. Pollarding at 30 to 70 height cm from ground level was suitable in mulberry plantations on agriculture flat land and 70 cm to 170 cm height in irrigated forest p...
M. Iqbal Ahmad and K. E. Park Dr.
...ine races sex limited mutants were also selected for further research....
M. Khan and M. Kleine
... growth. About a10,000 plants per hectare, which are more than 20 cm tall, and sufficient to constitute future stands of desirable densities, are the result of two years of protection from fire and biotic factors. Strong indications could be found for a substantial reduction of the regeneration period which would lead to an increased productivity of these forests. ...
S.A. Khan and A. R. Beg
...st Institute, (PF1-B), plants collected from three localities in Chitral District were identified as Buxus microphylla Sieb. and Zucc. The plant was referred to Mr. I. C. Hedge of Edinburgh for confirmation who named it B. wallichiana Baill.var. microphylla Hook.f. The taxon represents a new record for Pakistan and is reported....
M. B. Bhatti, M. I. Sultani, M. Aslam and Ehtesham Ali Syed
...iffered significantly, plants being taller under closer spacing, the variations in per-plant fresh weight were found insignificant....
Jehandar Shah and Zakaullah
...cultural and medicinal plants....
Mahmood Iqbal Sheikh
...ntity of water for the plants. Acacia tortilis and A.victoria turned out to be the most outstanding exotic species and P. cineraria and T. undulate which are local to our deserts but never tried before gave very indicative results. These species should be propagated on a large scale for bringing back the desert vegetation for fuel, fodder and food....
Bashir Mohammad Khan and M. Ismail Chaudhry
...Self-pollinated Sarson plants (covered with muslin netting) produced 26.46to 34.34 (mean 28.68) grams of seed per plant while honey bee pollinated and non-apis insect pollinated plants yielded 67.2 to 90.02 (mean 74.37) grams and 41,72 to 56.35 (mean 48.42) grams per plant, respectively. The increase in seed yield due to insect pollination was 159.31% in case of honey bee pollinated plants
Mohammad Bashir Khan, Pazir Gul, Muhammad Farooq and F. W. Khan
...s products of the said plants....
Mahmood Iqbal Sheikh
...onditions affected the plants adversely. Some studies on spacing were laid out in the country in 1969 but the treatments were not properly replicated and distributed. To find a possible answer to these questions this PL-480 study was started in Change Manga irrigated plantation in February, 1976....
Qutabuddin Marwat and Naseer Ahmad Khan
...including 15 medicinal plants and 11 grasses....
Michael R. Dove
...1: Village-level determinants...
F. O. C. Nwonwu
...and 50% fine sand. The plants were watered daily for four weeks and the height gains by plants measured. At the end of 4 week watering was stopped and two plants from mixes A and B were selected and observed for the length of survival without watering. Results showed that height gains due to weeks of watering and soil mix are both significant at the 1% level with LSD (0.01) of 6.9 cm and 5...
Zakaullah, Jehan Ara and Abdul Jabbar
...mber species, orchard plants, condiments, medicinal herbs and weeds. However, earlier workers (Ahmad 1956, 1956, 1978; Spaudling 1961; Sadiq and Shah 1986) have significantly contributed to the records of fungi and their hosts occurring in different regions of the country. The present article describes the fungi comprising 3 Classes: Ascomycetes, Basidiomycetes and Fungi Imperfect with information on habitat, locality and date of collection etc. Five ty...
Qaisar Ali, Mohammad Yousaf Wazir and Mirza Hakim Khan
...ylifera and fodder plants like Diplachne fusca and Juncus maritimus can be tried successfully in the area for land reclamation and range management....
Raja Walayat Hussain and M. I. Sheikh
...nd one year old entire plants were transplanted at the above spacing in RCB design with four replications. First thinning was done in the crop in autumn of 1980 but it was rather on conservative side. The crop gave a congested appearance on visit in September 1984. Therefore second thinning was done giving a release to the left over plants to put up better growth....
Laskar M. Rehman and M. I. Sheikh
...growth of a variety of plants and animals. Due to over exploitation and very little input for their perpetuation this erstwhile resource is fast disappearing. The present paper summarizes the mangroves of Pakistan, the area and distribution, flora and funa, management, utilization, and causes of degradation. Suggestions have also been made to improve the situation....
M.I. Sheikh
...lications. Twenty five plants of each species were planted in a replication in each depth of planting at 2 x 2 metres spacing. The plants were planted at two depths i.e. 30 cm and 18 cm in the pits of 0.5 meter diameter...
M. I. Sheikh
...erbelts. 9-month old plants of Eucalyptus camaldulensis in polythene tubes were planted in 3 rows comprising one belt, 2 m row to row and one m plant to plant distance, staggering plants in adjoining rows. In all 4 such belts spaced at 181 to 196 m and 630 in length were planted. The farmer has been planting wheat, cotton, maize and some other crops in-between the shelterbelts. The farm is canal irrigated. How...
M. I.Sultani, Akhtar Ali, M. S. Khan and M. A. A. Qureshi
...Spring planted popular plants produced and average 30.5g biomass as Compared to 11.5g biomass produced by late summer planted plants. The water use efficiency of spring sown popular plants was 358g and 333g in mulched and unmulched pots respectively while for late summer sown plant it was 381g and 342g respectively in mulched and unmulched pots. This indicated that seasonal differences hav...
Pazir Gul and F. W. Khan
... physico - Chemical constants and chemical composition of oil from the leaves of Mentha arvensis., were determined. The results obtained were compared with those of oil from Mentha piperita L; Mintha piperita var. Vulgaris and Mintha arvensis. It was observed that this oil was of fair standard and could be used for flavouring pharmaceuticals tooth pastes, dental cream, cough drops and alcoholic leqururs like those oils...
Mahmood Iqbal Sheikh
...in February, 1978. 120 plants of each species were planted in 16 subplots at a spacing of 4 x 4 m. In each subplot, 30 plants were planted, 480 plants in all. Planting was done in a randomised complete block design in 4 replications. ...
M.I. Sheikh
... 2-year and 6-year old plants of some of the clones which are represented in the populetum and other experiments, established on the premises of Pakistan Forest Institute, Peshawar. Trees of P. euratnericana cv. 1-214, aged 10 years, were measured from Changa Manga plantation as old trees of this clone were not available in the Peshawar area. ...
Wali-ur-Rehman and M. Ismail Chaudhry
...ge....
M. Kamaluddin and M. K. Bhuiyan
...ition. The survival of plants was 96%. At the age of 5 years the plants attained an average height of 11,54 m with an average diameter (dbh) of 11.64 cm. The yield of fuel wood including bark and branches was 139,1 t/ha 12% moisture content. The results show a good prospect in raising fuel wood plantation of the province in rural waste and marginal land on a rotation of 5 years....
Mohammad Noor
... number of established plants among themselves except Festuca elatior (Kenwell) which had significantly more number of established plants as compared with other ecotypes/species. ...
Anjum Amin
...urvey of ten medicinal plants was conducted in Leepa Valley of Jhelum Valley Forest Division in Azad Kashmir, during the year1978-79 to ascertain the productivity of medicinal plants available in the area. It was found that medicinal plants are available not only in considerable quantities for commercial exploitation but also it is imperative to initiate concerted efforts both by go...
Zakaullah, Mohammad Irfanul Haque and Khial Badshah
...s was parasitizing the plants in the higher range and L. longiflorus in the lower range. They were found attacking 32 timber and fruit plant species some of which had been reported earlier L. longiflorus was more prevalent particularly on old trees of Acacia modesta, while L. pulverulenrus had comparatively low incidence. Only four host species were found commonly attacked by both parasites. For the rest of 28 species they were host...
Salahuddin Ahmad
... multifarious uses of plants, the one rather less appreciated and even neglected aspect is that the plants are the sole source of nectar and pollen for the bees and bee-keeping industry .We talk and dream no stalically about a land overflowing with milk and honey but practically do nothing to realise our ambition. Generally it does not pay to raise plants specially for the bees but we can...
M. I. Shiekh and S. H. Bangash
...height and diameter of plants were recorded from 1978-82. The results did not reveal any significant differences in plant height and diameter. However, the nutrient uptake by the leaves of treated plants during the first vegetative growth period increased significantly....
Yasin J. Nasir
...ed as uncommon or rare plants for the area. The maximum numbers of uncommon or rare plants are to be found in the Poaceae (27), followed by Papilionaceae (10) and Orchidaceae (8). Information including the locality, the vernacular name and flowering period, where ever possible, are given for each taxon....
M.I. Sheikh
...trees and 1 - year old plants of the following 15 clones transported from Pakistan Forest Institute, Peshawar were planted at a spacing of 4.5 x 4.5 m in 0.5 m deep pits. ...
Mohammad Shariq Khan, Altaf Ahmad and Anwar Ahmad Khan
...0). Ephedra plants are a good remedy for curing bronchial asthma, cold, cough, urticaria, renal colic, itching, typhoid, hey fever and body pains. It can also be used as a tanning material for curing goats and lamb skins. This natural resource is exploited on large scale to the tune of 2.2 million kg. per annum for the manufacture of ephedrine which is exported to different countries of the world and is also used in the medicines prepared by the pha...
Mahmood Iqbal Sheikh and Fazle Subhan
...thod. Planting of Chir plants in polythene tubes was started in early seventies and it has now been adopted as the standard practice for artificial regeneration in all Chir pine areas of the country....
M.I. Sheikh, Bashir Hussain Shah and Abdul Aleem
...ct on the survival of plants. However, out of the lour treatments, plastic aprons were significantly effective in improving the growth rate of both the species; stone pitching and grass mulch had rather negative effect on growth. ...
M.I. Sheikh and Sultan Maqsood Khan
...age height of survived plants. The irrigation frequencies had a differential effect on the biomass production of leucaenea and the height of trees but not on their survival percentage. Leucaenea leucocephala, had a much more survival, height and biomass than all other species. Robinia did not do well under low or no irrigation and Tecoma did as good without irrigation as with irrigation. Leucaenea and Tecoma can grow without...
M.I. Sheikh and Abdul Aleem
... growth of 16 year old plants and hence resistance to the disease but none of the three treatments had any effect on the younger plants. ...
M.I. Sheikh and Sultan Maqsood Khan
...onservation, medicinal plants, sericulture, wildlife and outdoor are also described. ...
M.I. Sheikh
...977. One year old tube plants of bamboo were planted at 2 x 2, 3 x 3 and 6x6 m spacing, replicated 3 times using 180, 84 and 24 plants in all the treatments respectively. In the first three years of the study, inter-cropping was done with maize, barseem and wheat. Afterwards it was not possible to do agriculture due to increase in the size of the bamboo clumps except in the 6x6 m spacing where it was continued for one more y...
M.I. Sheikh
...poplars. One year old plants of P. euramericana CV-I-214 were grown for four years with and without agricultural crops. In the control plots no agricultural crop was grown but nevertheless, soil cultivation was done.

2. In another study, weeds were allowed to grow in one set of plots while the second set was regularly ploughed. The average height and diameter after three years Were 5.85 m, 4.3 cm for the control plots, these were 7.71 and 5.6 c...

M.I. R. Khan
...ate sixties to provide plants and seedlings for the plantation and afforestation projects which were started about the same time on the initiative and under the directives of H.H. Sheikh Zayed bin Sultan Al Nahyan, the Ruler of Abu Dhabi. Since then, with the expansion of plantation, agricultural and landscaping projects, the raising of various types of nursuries has made considerable progress both in the public and the private sectors. More recently, indoor...
M.I. Sheikh
... size and shape of the plants of mulberry and the number of branches is controlled and the size and quality of the leaves remains consistent and it is possible to estimate the annual quantity of leaf crop from a given area....
M.I. Sheikh and S. H. Bangash
...dication for the older plants. Higher dose of the fertilizers is recommended for future trials. ...
M. N. Malik and M.I. Sheikh
...ultural crops and tree plants. This menace of land was realized even long before the creation of Pakistan, and full-fledged Department of Land Reclamation was established to counter-check the malady; nevertheless, it attained alarming proportion and threatened the very basis of economy of Pakistan. Of course, vast physical outlays in the form of SCARP have been the outcome of very serious deliberations, even involving the expertise at international level; all ...
M.I. Sheikh, B. H. Shah and A. Aleem
...er and 0.2 meter deep. Plants were raised in 30 cm and 15 cm long polythene tubes. Three tree species viz: Acacia aneura, A. tortilis and Tecoma undulata were planted at two depths i.e., 30 and 18 cm in July 1980. After one and half year it was found that in deep planting 64% plants of all species survived and in shallow planting 54%. In both depths maximum survival was of A. tortilis being 75% fo...
Mahmood Iqbal Sheikh
... old bed. One year old plants of 3 species viz. Acacia victoriae, Acacia aneura (Australia) and A. tortilis (Sudan) were planted in August 1979. One hand watering was given at the time of planting. 16 plants of each species were planted in one plot at 2 x 2 m, in 5 replications; 80 plants each of the three species, 240 plants in all. The st...
Mahmood Iqbal Sheikh and Raza-ul-Haq
...awar on 13-2-1978. 120 plants of each species were planted in 16 sub-plots at a spacing of 4 x 4 m. In each sub-plot a randomised complete block design, replicated 4 times....
Malik Mohammad Khan
... the most fast growing plants. It has 1250 kinds ranging from the small-sized bamboo to the very thick one generally being used for shuttering in the multi-storeyed buildings. Its quick growth, lightness in weight and flexibility are the few prominent characteristics that make the bamboo sticks unique in their nature....
Mahmood Iqbal Sheikh
...t No. 55. One year old plants were planted at 5 x 5 m spacing. Their performance was evaluated in 1981 and the ten clones were found to be the best amongst all clones....
Adil Al-Kinany
...exchange level of transplants was found to be of the same magnitude in different treatments....
Sarfaraz Hussain Bangash and Mahmood Iqbal Sheikh
...b>One year old healthy plants of Pinus roxburghii (Bazkhan Seed source) grown in polythene tubes (7.5 x 18 cm) filled with 50:50 sand-soil mixture, were arranged for this study. Initial height of plants was recorded. The fertilizers were added in a water solution, 50 ml to each tube, on 1-5-1979:...
Mahmood Iqbal Sheikh
...dies one year old tube plants were used. Planting was done just after rain....
Hanif Gul and M. Ismail Chaudhry
...aCl were tried as attractants for snails feeding on juniper seedlings. Among them Temik was the most effective, which attracted and killed 99snails released at a distance of 1-2 meters in 120 hours. Thiodan, Diazinon and Disyston also attracted and killed few snails but NaCl did not act as attractant. ...
Hanif Gul and M. Ismail Chaudhry
... attacking nursery plants. Baylucid gave 75% and 100% mortality in 0.05% and 0.1% concentration respectively, 72 hours after treatments while Barestan gave 70% and 80% mortality in 0.1% and concentrations as against a natural mortality of 23% to 33%. Nogas and Sodium Chloride were less effective....
G. M. Khattak and M. I. Sheikh
... m spacing with entire plants of poplar and Eucalyptus and root-shoot cuttings of shisham and semal.

On 22-10-1979 the area was irrigated to prepare it for wheat sowing. On 5-11-1979 Pavan variety of wheat was sown in drills 45 cm apart between the lines of trees. The drill next to the line of trees was 80 cm away from it. Seed rate was 135 kg/ha. Urea was applied on 4-12-1979 at the rate of 230 kg/ha. Two irrigations of 10 cm depth each were given...

Mahmood Iqbal Sheikh
...ight stemmed healthy plants for getting seed and clonal material for large scale propagation...
G. M. Baloch and M. A. Ghani
...ect a wide variety of plants, some economically important. Loranthus spp. infest about 274 hosts which include citrus, limes, tea. rubber, fruit, forage, park and many other broad-leaved trees (Mushtaque and Baloch, 1979). The dwarf mistletoes, Arceuthobium spp., attack coniferous forest trees (e.g., pines, fir, spruce, junipers, larch) while Viscuni spp. infest deciduous trees in parks, boulevard plantings, natural forests and orchards (e...
Khial Badshah and Zakaullah
...riosis) in basil. The plants in the nursery were found severely attacked by a species of Fusarium causing longitudinal stripes on the stem and chlorotic spots on leaves which wilt and fall prematuiely. The pathogen was found to invade the plants through injured roots. Plant debris, infected young transplanting mateiial and seeds served as source of infection. The pathogen proved specific to Ocimum...
Mahmood Iqbal Sheikh
...ration or seepage, the plants are supplied with a quantity just sufficient for their survival and growth....
Wali-ur-Rehman and M. Ismail Chaudhry
... each height groups of plants. Terracur gave 100%mortality of nymphs in 10-20 days only in the smaller plants. Disyston rated 3rd by giving 96%mortality of nymphs only in highest dose and smaller plants. Disyston other insecticides other insecticides showed no effect against the pest. In check all nymphs survived but 1-6%adults were found dead after a month. ...
Mahmood Iqbal Sheikh
...nutritious fodder. The plants in the first instance were raised in Silvicultural Research Nursery, Lahore and planted in different climatic zones in the country. The sites include Bhurban in Murree hills, Islamabad, Peshawar, Changa Manga etc. The plant seems to have responded well to its new environment with luxuriant growth producing abundant seed and good natural regeneration at favourable site (deep sandy loam, 1000 mm rain or irrigation)....
Pazir Gul and F. W. Khan
...ts physico chemical constants and composition of fatty acids. The analytical data obtained were compared with those of oil from Quercus ilex, Quercus incana and Quercus glauca, (5, 6, 7, 8, 10). It was concluded that this oil, being non-drying in nature and have no toxic compounds, can be used for edible purposes. The seeds, which were analysed for protein, carbohydrate and ash, indicate that they can be utilized as poultry and livestock feed (9)...
Abdul Aleem
...aptive breeding of pheasants in Pakistan was held on May 11, 1977 at the Pakistan Forest Institute, Peshawar. Mr. K.C. Howman, Secretary, Overseas Projects, World Pheasant Association was the Chief Guest....
Munawar Ashfaq and Anwar Ahmad Khan
...ish brown rhizome. The plants occur in the hilly areas of Swat, Dir, Hazara, Kaghan, Murree Hills, Chitral, Kurram Agency and Azad Kashmir....
Mahmood Iqbal Sheikh
...ncreasing demand for plants of chinar, an effort has been made to raise the plants from seed. The fruit which ripens in December is a globose head 2.5 to 7.5 cm in diameter, consisting of numerous one seeded achenes densely covered at the base with long fine hair. Nursery has been raised at two different localities Peshawar and Abbottabad....
K. M. Siddiqui
...ding because most crop plants are raised for their seed and heavy and regular seed production is taken for granted. Most trees however, are not grown for their seed, and many trees that otherwise have desirable characteristics, seed only occasionally or not at all. Then fore, a tree breeder is concerned with seed production. Considerable research is underway in almost all countries on the stimulation of flowering and fruiting of trees (Wright, 1976)....
Mohammad Noor
...rence in the number of plants of species established did not show any significance. ...
Mahmood Iqbal Sheikh and M. Ismail Chaudhry
...by importing grafted plants from France, Italy, Spain and Turkey or by budding or top working on the indigenous wild olive (Olea cuspidata). The history of these attempts carried out in the Punjab, Azad Kashmir and N.W.F.P. has been well documented by Chopra (1), Khan (3) and Chaudhry (2). Khairimurat Plantation: Of all the work done, the most productive effort has so far been the Khairimurat plantation, a 20 hectare piece of land 56 km south west ...
Islam Mahmud Khan, Gulzar Ahmad Khan and Shoukat Islam
...also conducted. ...
Abdul Ghaffar Marwat, Pazir Gul and Fazli Wahid Khan
...ts physico-chemical constants and composition of fatty acids. The oil was found to be a non-drying comparing favorably well with oils from Querous ilex, and Quercus incana (5, 6, 7). It was concluded that this oil can be used for edible purposes. The seeds, which were analyzed for its nutrients, indicate its utilization a as poultry and livestock feed (8). ...
Anwar Ahmad Khan, Munawar Sultana and Shakeel Haider Zaidi
...higher total number of plants. At Dungagali July planting gave significantly higher sprouts on 25th August, 1977 as compared to November planting. Indole acetic acid treatment did not significantly increase sprouting....
Musarrat Nasreen Ali and Anwar Ahmad Khan
...nd violet berries. The plants are distributed throughout the hilly areas of Pakistan, from Baluchistan to Dir, Chitral, Gilgit, Hazara, Murree and Azad Kashmir at an elevation of 900-3,000 metres (4)....
Raja Walayat Hussain
... relationships between plants and their environment and for the simulation of biological and economic situations. In forest management it finds its use in financial control of forest operations, for estimating and controlling forest production, for allocation of resources and for planning and control of new planting programs. In information management it finds its application in maintaining upto- date records of long range experiments and files of employees. ...
Abdul Aleem
...tion and University Grants Commission also co-operated.
The seminar was inaugurated on August 13 by Mr. Justice Abdul Hakim Khan, Acting Governor, NWFP. In his address of welcome, Dr. Mohammad Aslam Khan, Secretary, National MAB programme introduced the programme and its activities in Pakistan. Professor Yogesh Atal, UNESCO Regional Adviser for Social Sciences in Asia and Oceana, highlighted the importance of social sciences and stresse...
Ashiq Ahmad and M. Ismail Chaudhry
... and bark of succulent plants, agricultural crops and perennial grasses. Trees are debarked, young plants and shisham stumps are uprooted. They breed twice a year and usually give birth to tow young ones who live initially in mother's milk switching to tender barks 2-3 months later. ...
Fazli Wahid Khan, Pazir Gul and Abdul Ghaffar Marwat
...its physicochemical constants and composition of fatty acids. The analytical data obtained were compared with those of oils from Q. incana, Q. ruba, and Q. palustris. It is concluded that the oil is non-drying in nature and is fit for edible purposes as it has non-toxic compounds and can be purified cheaply. The seeds have been analysed for protein, arbohydrates and ash and the results indicate their utility as poultry and livestock feed. ...
Islam Mahmud Khan, Shaukat Islam and Qaisar Ali
... from 31% to 0% in the plants growing in the similar environmental conditions. The point of attachment and the T.S. of the gynophores and ovary are given. The probable mode of inheritance is also discussed. ...
Mohammad Shahid and Abdul Qayyum
...r and pollen yielding plants for honey-bees. A detailed list of 122 such plants both wild and cultivated, their scientific names, time of blossom and their distribution in the Province has been prepared. Of the 122 bee-foraging plants, the shisham (Dalbergia sissoo), phulai (Acacia modesta), bhaikar (Adhatoda vasica), apple (Malus sylvestris ), loquat (
Abdul Aleem
...eeding habits and food plants preferred by the animal were observed and the results of the analysis for nutritional contents of food plants have been reported. ...
Islam Mahmood Khan Dr.
...y of the X-ray treated plants a haploid was discovered which was then made diploid by treating it with colchicines. The pollen mother cells in the auto diploid petunia showed a remarkable shape with continuous cytoplasm and without partition walls. The chromosomes were scattered in lots of different sizes. These pollen grains resembled the synocytes described by Levan 1914. ...
Anwar Ahmad Khan and Altaf Ahmad
...mportance of medicinal plants and their use as a remedy of certain diseases was known to human beings from times immemorial. Knowledge of medicinal plants lead to its logical conclusion, that is, gradual evolution of science of Taxonomy. In the present age because of synthetic products some of the medicinal plants have lost their old value but still a considerable number of drugs mention...
Miss Munawar Sultana and Anwar Ahmad Khan
...ith a fetid smell. The plants are commonly distributed in Karachi, Sind, North Waziristan, Khyber and Kurram Agencies, Dir, Chitral, Swat, Lower Hazara, Rawalpindi and Jhelum district upto an elevation of 1200 meters (3).
The plant is much valued for its powerful expectorant and anti-spasmodic properties. Leaves are used in asthma, chronic bronchitis and all kinds of coughs. The powdered leaves are used in malarial fevers, dysentery and diarrhoea. Th...
F. W. Khan and K.K. Niazi
...ts physico-chemical constants and the fatty acid composition. It was found to be a typical semidrying oil comparing favourably with oils from warmer climates but less unsaturated than the English oils. The HCN content of the oil was also investigated. ...
M.I. Sheikh, Abdul Aleem and Mohammad Hafiz
...ignificant survival of plants.
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type of plastic was mere durable....
A. R. Beg
...e are the only known remnants of natural bamboo in the country. This new record thus extends the western geographical limit of this bamboo from Margalla Hills to lower Buner....
Mohammad Hafeez
...ignificant survival of plants.
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type plastic was more durable. ...
Mohammad Shamsul Hasan Khan
...rms cock-chafers, white ants, plant lice and some important insect pests of forest plantations like defoliators and borers has been comprehensively reviewed. Ekalux, Azodrin, Lebaycid and Bidrin against leaf eating insects and Dieldrin, Aldrin and Heptaclhor against white ants and wood borers have been recommended....
Abdul Aziz Khan and M. N. Malik
...Dalbergia sissoo) plants are well acclimatized to the climatic and edaphic conditions generally prevailing in the plains of West Pakistan, where they normally exhibit vigorous growth and, comparatively, do not require much care after germination....
F. W. Khan, Khawas Khan and M.N. Malik
...us physico-chemical constants of these fractions determined. The separation of tallow appears feasible since it does not involve any cumbersome steps in processing....
M. Hafeez and M. I. Sheikh
...ings as well as entire plants exposing them to a number of treatments such as time of planting, different rooting media, frequency of irrigation and position of cutting on the plant etc. and using clones like P. deltoids 63/51, 90/60, 69/55 and 18/62, P. euramericana CV-I-214 being the control. Indications in both the cases were that supported by adequate winter rains or artificial irrigation and an efficient planting schedule, F...
Mohammad Amin Siddiqi
...b-continent. These two plants belong to a very small genus Emex australis with only two species, of the family Polygonaceae. One of the species is Entex australis and the other is Emex spinosus. The first one is native of Cape of Good Hope, South Africa and the second one comes from N. Africa and the Mediterranean coastal regions. It is a strange coincidence that both the species have been found growing not far from each other. E. austr...
Zaka-Ullah
...ytotic form on nursery plants. Absence of large scale and compact plantations of Willows seemed to be a limiting factor in the appearance of few other pathogens in epiphytotic forms. No bacterial or virus disease was observed....

Pavana Jyothi Vanjavaka1, Mouradam Veerasami2, Mohana Subramanian Bhaskaran2*, Vijay A.K.B. Gundi1*

...d by three antigenic variants at different periodic intervals that now circulate globally with random strains. This particular study aimed to determine the genetic changes in the VP2 gene, which are responsible for creating different antigenic variants, and to understand their impact on pathogenicity. In contrast, molecular characterization has become an essential tool in comprehending the evolution of viruses. For studying ...

Syed Shahid Imran Bukhari

...hma, especially and occupants of such houses normally. Curative steps are needed to safeguard the people at risk. 
 
Novelty Statement | This study is unique in reporting the risk of high indoor carbon dioxide concentrations for asthmatic patients of people living the urban areas of Lahore Pakistan.
...

Abdul Aleem Memon1*, Inayatullah Rajpar2, Ghulam Murtaza Jamro2, Javaid Ahmed Shah3 and Saima Kalsoom Babar2

... field-grown sunflower plants. Among interaction of Kfs x Kft, seed and oil yields were obtained to be highest in T3 when NoP>SoP>MoP were sprayed with 0.67% spray each at LDS, IES and FS stage. It can be concluded that under the calcareous conditions of Sindh, foliar application of 2% K (2 or 3 equal splits at LDS, IES and FS) through NoP, SoP, and MoP sources increase the growth, seed and oil content of sunflower.

...

Rafiullah1, Said Sajjad Ali Shah1*, Muhammad Ilyas Khan2, Anwar Ali3, Imtiaz Ali Shah1 and  Sohaib ul Hassan4

...eeding of indigoferous plants by camels.

...

Mohammad Umar* and Gohar Ayub

... of broccoli. Broccoli plants irrigated early in the morning resulted in early curd formation (66.8), maximum plant height (45.21cm), leaves plant-1 (15.84), leaf weight (11.00 g), primary curd weight (340.94 g), secondary curd weight (189.50 g), primary curd diameter (8.60), secondary curd diameter (7.56cm), curds plant-1 (8.73), yield (8.03 t ha-1) and survival (92.67 %) than rest of the treatments. As for as irrigation level is concerned, irrigation at 35 %...

Dunia Tahseen Nema Al-Aridhi 

...e beginning. The participants were monitored for changes in these factors over time. The study consisted of 342 individuals. A reciprocal association was identified between eGFR and levels of uric acid. (p<0.001). The receiver operating characteristic curve (ROC) showed that serum uric acid predicted renal function at 7.5 mg/dl. In a logistic regression model, elevated uric acid levels independently increased renal dysfunction risks.This study provides evid...
Javairia Mehboob1, Syeda Hafsa Ali1*, Fahima Ashraf Kasi1, Syeda Ayesha Ali2, Safa
Farooqi3, Muneeza Arbab4,
... the three
plants have versatile biochemical molecules responsible for wide range of AgNP and its
activity against bacterial and fungal strains. Studies on combined use of AgNPs with other
antimicrobial agents may solve the problem of toxicity and possible risk of drug resistance.
...

Maqsood Anwar, Shah Khalid and Naveed Akhtar1*

...that a variety of weed plants
infest wheat crop in the study area that may cause a loss to crop yield. For acquiring better
yield, it is necessary to take the appropriate chemical, mechanical and biological
measurements for weed control.
...
Muhammad Naeem Korejo1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1 and Niaz
Ahmed Wahocho2
...ination of
plants extracts and herbicides at reduced doses controlled weeds efficiently and optimum
enhancement in seed yield of mungbean was noticed at three irrigations.
...
Rizwan Maqbool1, Bilal Ahmad Khan*2, Sumbal Parvez3, Muhammad Ather Nadeem2,
Muhammad Mughees Ud Din4, Jamshaid Qamar2, Muhammad Waqas1, Muhammad Mohsin
Amin2, Burhan Khalid1
...ol of weeds.
...
Abdul Basit1, Ayesha Zahid1, Syed Tanveer Shah1, Inayat Ullah2, Sana Ullah3*, Muhammad
Kashif Nawaz4, Muhammad Areeb Khalid1, Izhar Ullah5, Fawad Ali1, Shaukat Ali1
...udy revealed that okra plants
sown on the ridges recorded maximum germination percentage (96.9%), fruit weight
(22.41g), pod length (14.44 cm), seed pod-1 (48), 100 seed weight (6.41 g), seed yield
(102.2 kg ha-1) and fresh yield (0.165 tons ha-1). Data regarding number of picking intervals
showed that maximum germination percentage (92.7%), fruit weight (20.97 g), pod length
(12.25 cm), seed yield (1...

Abdul Basit1 and 2Sana Ullah*

...i.e. identification of plants, total area of nurseries, soil type, irrigation system,
weeding, fertilizer application, propagation method, propagation time, transplanting time,
field situation and finally problems of the nurseries were studied. All the agricultural and
horticultural practices were not fully applied and practiced in proper recommended way. Out
of the total studied parameters, irrigation system tha...

Rizwan Maqbool1, Bilal Ahmad Khan2*, Muhammad Ather Nadeem2, Sumbal Parvez3, Muhammad Mohsin Amin2, Jamshahid Qamar2, Azhar Hassan1, Muhammd Alam Elahi1, Jamshed Haider1, Muhammad Irfan4 and Memuna Ghafoor Shahid5

...-align: justify;">Crop plants release biochemicals into surrounding environment that help in obtaining maximum yield of crop by acting as bioherbicide at high concentration and plant growth hormone at low concentration. Therefore, this study was planned at the Department of Agronomy in Weed Science Laboratory, University of Agriculture Faisalabad during Winter season of 2018 to evaluate the hermetic effects of Cinnamomum verum (Dalchini) on vegetable crop radi...

Zara Naeem1, Khajista Jabeen1*, Muhammad Khalid Saeed2, Sumera Iqbal1

... various infections in plants and their post-harvest produce that pose a serious threat to humans and animals. In the current study, the objective was to examine the in vitro efficacy of different concentrations of methanolic leaf extract of Sorghum halepense (L.) Pers. against target pathogenic mycotoxin producing fungal species (Trichoderma viride Pers., Trichoderma harzianum Rifai. and Cladosporium cladosporioides (Fresen.) G.A. de Vries. For this purpose, ...

Md. Nazrul Islam1*, Md. Saiful Islam Siddiqui2, Md. Rafiqul Islam3, Emdadul Haque Chowdhury3’ 

...of cattle and other ruminants. It has originated from adaptation and recycling of the sheep scrapie agent called scrapie associated prion protein (PrPsc). Although Bangladesh did not experience a BSE outbreak so far, Bangladesh has not yet been declared BSE free by OIE due to lack of scientific risk evaluation for BSE. The scientific data were reviewed, hazards were scheduled and surveys were conducted - on import of livestock and its commodities. The analysis...

Siti Fatonah*, Herman and Dewi Yuni Safitri

...ratus are fast-growing plants, easy to find and contain various secondary metabolites. Therefore, these two types of plants can be used as an alternative bioherbicide for weed control. This study aims to determine the effect of aqueous extracts from fresh leaves of C. citratus, M. bracteata and a mixture of both on the germination and growth of Paspalum conjugatum and Borreria alata weeds.Treatments consisted of extracts of ...

Ali D. Nashmi1*, Jawad K. Hasan1, Manal A. Ibrahim2 

...tions, exposure to pollutants or allergens from the air, and lung conditions such as chronic bronchitis or asthma. An inhibitor of phosphodiesterase enzymes 3 and 5, dipyridamole is a conventional antiplatelet drug that increases adenosine. The purpose of this study was to investigate whether dipyridamole plays a role as an anti-inflammatory to improve airway inflammation. A total of 24 healthy rats (albino, male), were weighted (150-300 g), were divided into ...

Hafiz Ishtiaq Ahmad1, Jinlong Zhang1, Fuxun Luo1, Owais Iqbal2 and Yuying Wang1*

...id culture medium. The plants were subjected to various LED spectra for a duration of 14 hours each day and continuous subsequent 100 days. The experiment was completely randomized design with nine treatments and each treatment have ten replications. The SPSS statistics software was used to analyses experimental data. In addition, the result of the current study revealed that the plant height, leaf length, leaf width and root number were significantly increase...

Muti Ul Hannan1, Wazir Ahmed1, Muhammad Naeem Akhtar2*, Muhammad Baqir Hussain1 and Khuram Mubeen1

...ects of heat stress on plants. Based on past studies, the objective of the study was to integrate pre-tested compost, SA, Zn-Fe-B consortia and foliar K with conventional fertilizers for ameliorating detrimental effects of heat stress on morphological and fiber characteristics of cotton. During study, salicylic acid based Fe, Zn, B consortia (S-N consortia), foliar potassium (K) and compost were used in different combinations along with conventionally used fer...

Imania Ghaffar1, Ali Hussain2*, Arshad Javid1 and Shahid Mehmood1

...ce of microplastic pollutants on Hg2+ uptake potential of metal-resistant Aspergillus flavus at laboratory scale under pre-optimized conditions. A. flavus showed a remarkable potential of remediating simulated wastewater, i.e., 100% Hg2+ reduction was achieved at 25 mg/L of the added metal in 15 days of incubation. On higher concentrations like 75 and 100 mg/L, A. flavus showed almost negligible reduction of Hg2+ but this strain was able to tolerate Hg2+ up to...
Nazish Huma Khan1*, Mohammad Nafees2, Tooba Saeed3, Sarzamin Khan1, Hazrat Hussain4, Adila Bashir2 and Nida Naz1
...ture projects of power plants, dams, and highways. For such developmental activities, the role of the crushing unit is tremendous in providing the basic raw material for infrastructure. The literature revealed that the majority of stone-crushing units are operating illegally as 567 units have been declared hazardous to health and safety in the Peshawar region. Due to the lack of safety measures, workers involved in stone crushers were exposed to significant ex...

Saddam Hussain1, Muhammad Asrar2*, Usama Saleem2, Dilbar Hussain3, Muhammad Sohail Qadir3, Muhammad Saleem3, Rashid Ali2, Zeeshan Javed2 and Mubshar Saleem4

... above-ground parts of plants. They bite and chew on tubers, young and old leaves, stems, lower branches of the plants, and peanut seeds. Termite infestation is a considerable problem in the livelihood of the farmers of Pakistan. Termite swarming is a major problem and revenue constraint in the area, destroying crops in the field and store. Forests and orchards are rarely termites free, particularly when conditions are favou...
Cristian Mendoza1*, Adriana Celi-Soto2, Ernesto Cañarte3 and George Cedeño-García2
...rent parts of oil palm plants on controlling root borer (S. valida) in the interspecific oil palm hybrid OxG. The study was conducted at the Palesema plantation, situated in Mataje Parish, San Lorenzo Canton, Esmeraldas Province, Ecuador, located at 1°17’18” N and 78°50’13” E and 100 m above sea level. 10-year plants from the OxG Coari x La Mé hybrid were used in the study. Parts...

Maysaa A. Jumaah*, Ali A. Al-Iedani 

... to current vaccine adjuvants (alum) using inactivated antigens (sonicated and whole-killed bacteria) of E. coli. We also aimed to reveal tthe nature of host innate and adaptive immune responses by measuring the extent of their effects on the level of pro-inflammatory (interferon γ and interleukins (IL)-12) and anti-inflammatory cytokines (IL-4 and IL-10) and innate immune responses (total white blood count, phagocytosis and respiratory burst). Our resul...

Chukwujekwu A. Obianefo1,2*, Ngozi J. Obiekwe1, Nma O. Okoroji3, Zahoor A. Shah4, Uzochukwu V. Uchemba5 and Ebele G. Osegbue5

...dback mechanism. Determinants of ease of use were gender, age, educational background, work experience, household size, work motivation, and organizational support, these were significant at various levels of probability. Constraints on the use of e-extensions were rotated into three factors (commitment, political, and institutional), and in the commitment factor, the extension worker suffered from a lack of support and inadequate training for the e-agricultur...

Shoaib Zawar1, Muhammad Waqas Yonas1,2*, Muhammad Mujahid Akbar1 and Abeer Ahmad1

...due to its ability for plants to maintain optimum density per unit area, reduced intraspecific competition, and enhanced grain formation, leading to higher grain yield (5562.38 kg ha-1 in 2020-21 and 5220.22 kg ha-1 in 2021-22). Adapting an appropriate sowing method is crucial to maximize wheat production which has been proved in the augmented furrow method over a broadcast and/or the usual drill sowing methods. The relatively better performance of augmented m...

Wadood Shah* and Sanam Zarif Satti

...d growth, responses of plants to various levels of drought stress as well as their ability to regulate and alleviate the negative consequences of low water availability. Meeting the world’s population’s continual increase in food consumption is hampered significantly by drought stress. Plants adjust their cellular osmotic potential and water potential in response to stressors, by increasing root length, closing s...

Hawraa F.H. Alowaid1*, Afrah Adil Hassan1, Majdy Faisal Majeed2

...xidative stress, Antioxidants, Biochemical indices, Liver, Kidney, Rat
...

Noorullah Khan1, Shahid Ali1, Azher Zeb2, M. Noman1, M. Imran Kasana1, Rashid Iqbal Khan1*, Saima Mumtaz1, Shumaila Rasheed1, M. Muneer3 and M. Qamar-Uz-Zaman1

...ree replication and 10 plants per replication. Data were recorded on plant survival rate (PSR %), bud sprouting rate (BSR %), shoot length (SL cm), shoot diameter (SD cm) and number of leaves per plant (NLP). The outcomes exhibited that peach scion cvs., “Coronet” and Early Maria Delizia exhibited the maximum plant survival rate (97.67 and 97.33%) and maximum bud sprouting rate (96.0 and 97.0), respectively. On the contrary, the highest shoot lengt...

Muhammad Wasif Gulzar*1, Riffat Maqsood1, Hussain Abbas1, Musharraf Manzoor1, Muhammad Suleman1, Hassaan Ahmad Bajwa2, Ali Hamza2, Shaher Yar1, Muhammad Zain1, Abdul Wadood1 and Noman Aslam3

...erials can be found in plants, soil, water, air, food, and feed. Through the food chain, their residues build in humans and animals after entering plants and animal products.They destroy useful species in the ecosystem and put our lives and health in peril. This review highlights the current standing of the impact of insecticides on viral diseases in man and animals. We observed that in addition to their surroundings, people...

Muhammad Muneeb1, Ali Hussain2*, Qurat-ul-Ain Ahmad3, Arshad Javid1 and Jibran Hussain3

...ed to reduce these pollutants but all have their own limitations including production of secondary pollutants. The current study was designed to show the effect of cellulolytic and sulphate-reducing bacterial species in the form of a co-culture to treat an in-vitro prepared sulphate-rich wastewater while employing various agro-industrial organic waste as economical growth substrates. A combination of sulphate-reducing and ce...

Yugang Meng1*, Xiting Yan2 and Haiying Liang3

...h endometriosis. Participants in the study, 92 patients with endometriosis admitted from June 2016 to May 2017 to our hospital, randomly were divided into control group and study group (46 cases in each group). The control group was given routine treatment such as medroxyprogesterone acetate tablet, and the study group was given injection of goserellin on the basis of the control group. The changes of serum VEGF, EMAb, CA125 and sex hormones (FSH, LH, E2, P) w...

Md. Asaduzzaman Lovelu1, Md. Amir Hossain2*, Md. Uzzal Hossain1, Tanzila Zafrin Tanvi1, Mahfuza Ferdous3, Nazmin Sultana Runa4, Assrafi Siddika3, Md. Sahidul Islam2 

Asad Ali, Anwar Ali, Muhammad Farooq and Basheer Ahmad* 

...re was estimated at 75 plants in pits and trenches at the plantation, with a composition of 70% Prosopis juliflora, 19% Zizyphus nummularia, and 7% Phoenix. The study identified established regeneration, while unestablished regeneration (below 9 inches) was not observed. The data showed an average survival rate of 93% in both subdivisions (Teri and Karak) of the Kohat forest division, with Karak Forest Subdivision recording a 92% survival rate and Teri Forest ...

Ameer Sultan1, Abdur Rauf1*, Farooq Jan1, Muhammad Qayash2, Muhammad Yasin3, Tanweer Kumar4, Wajid Khan4, Muhammad Arif4, Kashmala Jabbar5, Wisal Khan6, Farhan Ullah1, Syed Shabab Hussain1 and Ikramullah Khan1

...diverse wastewater pollutants, often presenting complex and expensive treatment challenges. The attributes of wastewater and concentrations of contaminants vary significantly from one industry to another. Recently, there has been a growing interest in utilizing industrial waste as a soil amendment. The distillery spent wash (DSW) released through the sugarcane processing, is abundant in organic materials and a variety of ess...

Nask Jawher Ahmed and Kawa A. Ali*

...h better adaptation of plants exhibiting drought at flowering and seed development in the plant life cycle.

...

Aysha Fatima1, Safdar Ali1, Saira Azmat2, Luqman Amrao1, Muhammad Usman Ghani3*, Yasir Iftikhar4, Muhammad Ahmad Zeshan4*, Adeel Ahmad5 and Humaira Kalsoom6

...anagement purpose. The plants were treated with zinc sulphate (ZnSO4), copper sulphate (CuSO4), manganese sulphate (MnSO4) and boric acid were used in different combinations i.e., T1 (ZnSO4+CuSO4), T2 (MnSO4+CuSO4), T3 (boric acid+CuSO4) and T4 (ZnSO4+MnSO4+CuSO4+BA). The combination of ZnSO4+MnSO4+CuSO4+BA showed minimum disease severity (5.85%) and disease incidence (23.15%) as compared to control (28.59%). The outcomes of present study would be the way forw...

Efi Rokana1, Iin Rohmatul Fatimah1, Brilian Desca Dianingtyas1, Niswatin Hasanah2, Wulandari3, Zein Ahmad Baihaqi1,3* 

...: elephant grass, corn plants, and rice straw. Employing a completely randomized design (CRD) with three treatments and nine replications, the research examined dry matter intake, body weight gain, feed efficiency, and income over feed cost (IOFC). Results indicated that feeding with different types of forage did not significantly impact dry matter intake (P>0.05) but significantly affected body weight gain, feed conversion, feed efficiency (P<0.05), and...

Bushra Irfan1, Muhammad Shahbaz1*, Asif Mukhtiar1, Muhammad Zubair Akram2, Muhammad Atif Bashir3, Sabina Asghar4, Abdul Ghaffar5 and Samreen Nazeer6*

... balance between antioxidants (superoxide dismutase, catalase, peroxidase) and oxidants (hydrogen peroxide and malondialdehyde), and lessened the uptake of essential minerals (potassium and calcium) irrespective of varietal differences. However, the performance of TH-6 was better than TS-5. In addition, the seed priming of thiourea enhanced the sesame photosynthetic pigments and efficiency, secondary metabolites production, ...
Iswahyudi Iswahyudi1,2, Wahyu Widodo1*, Warkoyo Warkoyo1, Roy Hendroko Setyobudi3, Damat Damat1
Dyah Roeswitawati1, Shazma Anwar4, Thontowi Djauhari Nur Subchi1, Irma Rahmaita Utarid5,  Marchel Putra Garfansa2, Mohammad Shoimus Sholeh2, Ida Ekawati6, Rusli Tonda7,  Wahyu Alvina Mujianti2, Dody Sukma RA8, Sri Utami Lestari8 and Choirul Anam9
...ered as emerging contaminants and attract global attention. On plants, MPs have detrimental effects such as interfering with nutrient absorption, slowing germination and roots development. Of all the stages of growth, seeding has an important role in the crop yields obtained. The examined the impact of three polymer MPs (1 % w w–1) on paddy seeding and control as a comparison with four repetitions by using s...

Salam N. Aritonang1*, Yulia Yellita1, Dwita Saningtias2, Eka Putri2, Rizqan1 

...flour is rich in antioxidants and natural antibiotic compounds that support buffalo health. It is predicted that turmeric flour supplements will enhance erythrocytes, hematocrit, hemoglobin, and leukocytes, as observed in the health of female Murrah buffaloes. Parameters measured in this study included hematology (erythrocytes, hemoglobin, hematocrit, and leukocytes) in Murrah buffaloes. The study involved four lactating Murrah buffaloes aged 3 to 5 years, fol...
Shorouq Mohamed Omara1, Ibrahim Saad El-Shamaa1, Emad Abd-Elaziz Abd-Allah2, Assmaa Abd-Allah Fathy3, Essam-Eldin Tharwat4, Mohammed Hamdy Farouk5* and Ibrahim Mahmoud Abd El-Razek1*
...etermined by genetic variants, but it is also affected by environmental factors. The possible action of L-carnitine (LC) on the maturation of Egyptian buffalo oocytes has not been determined yet. This study aims to estimate the effects of supplementing LC on the in-vitro fertilization (IVF) of Egyptian buffaloes. We evaluated blastocyst and apoptosis rates in order to substantiate the potential development of cumulus oocytes–complexes (COC) and determine...
Langgeng Priyanto1,2*, Herdis2, Santoso2, Pradita Iustitia Sitaresmi2
Tri Puji Priyatno2, Rahma Isartina Anwar2, Desiana Ade Mahari2
Florentina Bety Indah Lupitasari2, Maman Surachman2
I Wayan Angga Darmawan2, Arfan Abrar1 and Arum Setiawan3
...) are two potent antioxidants that operate to prevent oxidation processes. The objective of this study was to analyze the effects of α- tocopherol and ascorbic acid on the motility, viability, abnormality, and plasma membrane quality of post-thawed Tropical Brahman bull sperm. Sperm samples were obtained and pooled from eight sexually mature Tropical Brahman Bull, separated into seven equal proportions, and diluted with TEY extender Semen was supplemente...

Arba Aleem, Norrizah Jaafar Sidik*, Wan Razarinah Wan, Abdul Razak and Norfatimah Mohamed Yunus

...t exudates secreted by plants roots can attract beneficial microbes that help plants by boosting nutrient intake and improving plant growth. Sustainable agriculture and ecosystem management potentially benefit from an understanding of the mechanisms and purposes of root exudates under biotic and abiotic conditions. Harnessing the potential of plant-microbe interactions enables the infrastructure development for more effectiv...

Murad Muhammad1,2,3*, Shahid Ullah1, Nimrah Ameen4, Abdul Wahab3,5, Abdul Basit6, Muqadas Batool7, Muhammad Nazim2,3 and Haroon Khan

...unkhwa. Many medicinal plants grow wild or as weeds worldwide, including in Pakistan. The Dir Upper district boasts a diverse weed flora with significant medicinal value for daily use. Surveys using semi-structured open-ended questionnaires were carried out in distant villages of the Larjam subdivisions, specifically interviewing 120 local respondents (85 males, including herbalists and pansiris, and 35 women) regarding the naturally occurring medicinal weeds ...

Marriyam Batool1*, Ahmed Zia2, Shabir Ahmed1, Imran Bodlah3, Waheed Ali Panhwar4, Muhammad Ashfaque5, Falak Naz6 and Muhammad Muneer5

...ivated as well as wild plants grown at variable altitudes of the valley. A total of 398 individuals were collected from 26 host plants of which, 23 species and 13 genera are reported for the first time for this valley. Within the recorded fauna, Macrosiphum euphorbiae was found to be abundant with 103 individuals followed by Myzus persicae and Aphis craccivora, respectively. Impact of altitudinal variations over the distribu...

Daniel Offiong Etim1*, Etim Johnson Umana1, Idorenyin Asukwo Udo2, Ndarake Eden Ini-Ibehe1

...ol. Two weeks old okra plants were inoculated with 5,000 larvae of M. incognita and one gram of S. rolfsii (3 Sclerotia g-3) in a heat sterilized soil. The obtained results showed highly susceptibility of okra to M. incognita and S. rolfsii infection without neem cake and Trichoderma species infestation. Amendment of soil with neem cake at 4.00t/ha in combination with T. viride significantly (P≤0.05) reduced root galling, nematode population and nematode re...

Marwa M. El-Deriny1,2*, Rania H. Wahdan1, Marwa S. Fouad3 and Dina S.S. Ibrahim1,2*

... various horticultural plants, including eggplants (Solanum melongena, L) and cause destructive loss in crop yield production. The purpose of this study was to evaluate the impact of individual or concomitant treatments with Trichoderma viride and some plant growth promoting rhizobacteria (PGPR) on root knot nematode in eggplant.In greenhouse, a standard microbial fertilizer (NPK) and four microbial isolates involved Pseudom...

Saba Mehnaz1*, Farhan Ahmad Atif2, Rao Zahid Abbas1, Muhammad Kasib Khan1 and Muhammad Saqib3

...ce appeared to be descendants of Indian isolate MH78945.1. In the future, this study will be helpful for large-scale analysis of multiple species by using duplex and multiplex PCR and also for improving the control of associated tick-borne diseases in endemic regions through vaccine development. 

...

Pakistan Journal of Zoology

August

Pakistan J. Zool., Vol. 56, Iss. 4, pp. 1501-2000

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe