Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1
Life Sciences International Journal Issue 7 Volume 1
Xingdong Yang and Lijuan Yuan
...uman-gut-microbiota transplanted gnotobiotic pig models. Given the advantages of gnotobiotic pig models, it is expected that they will be used more widely in biomedical research for studies of human viruses and other human diseases....
Muhammad Arif1, Fazal Jalal1, Mohammad Tariq Jan1, Dost Muhammad2
...r significantly enhanced plant height and grain yield. The plots previously sown with legumes produced taller plants and high number of grains ear-1. Nitrogen application increased plant height, number of grains ear-1, thousand grains weight, grain and biological yield. It is concluded that integration of biochar and legumes could be a useful strategy for enhancing the overall farm profita...
Zaheer Ahmed Deho1, Shamsuddin Tunio2, Qammaruddin Chachar2, Fateh Chand Oad2
...ny response to different planting times. The variety Sadori exhibited higher values for most of the traits like sympodial branches plant-1 (14.28), seed cotton yield plant-1 (51.04g), seed cotton yield (2223kgha-1), ginning out turn (36.8%), seed index (7.4 g), and seed germination (58.5 %) as compared to other varieties. The normal (1st May sown crop) sowing showed significantly highest v...
Salma Shaheen, Muhammad Jamil Khan, Saleem Jilani
...g higher average spinach plant height (35 cm), number of leaves (16.4), fresh foliage yields (330 g pot-1), dry foliage yields (32 g pot-1), leaf length (40.5 cm) and leaf area (238.4 mm2) relative to poultry manure, compost or FYM treatments. Similar trend was observed during 2010-11. Over all, press mud with EM was more effective in improving soil quality and enhancing spinach growth and quality followed by FYM and poultry manure. These results suggested tha...
Muhammad Irshad1, Abdur Rab1, Javed Rahman2, Muhammad Sajid1, Ilyas Khan2, Sajad Ali1, Muhammad Razaq1, Sallahuddin1
...e influence of different planting dates and media on the growth of kiwi (cv. Hayward) cuttings at Agriculture Research Institute (ARI) Mingora Swat, during 2011. The experiment was laid out in Randomized Complete Block Design (RCBD) with split plot arrangement in three replications. Planting Dates (20th Jan, 30th Jan, 10th Feb, 20th Feb and 2nd March) were allocated to main plots, whereas soil media (Silt+ Garden soil+ FYM) ...
Arshad Ali Khan1, Muhammad Sajid1, Abdur Rab1, Sahib Alam2, Abdul Bari3
...highest number of leaves plant-1 (75.25) and yield (49.25 t ha-1) were gained by Falcon in 50-50 treatment during, 2010. However, the plant height (134 cm) and fruit size (147.1 cm3) were higher at 25-75 and 75-25 treatment, respec- tively. Whereas, the less number of leaves plant-1 (15), plant height (28.25 cm), fruit size (92.3 cm3) and tomato yield (7...
Mohammed Ali Hussain, Zakiya Ahmed Hassan
...d produced highest yield plant-1 at both location with average values of 146.94, 125.84 and 136.00 g, respectively. The value for genotypic variation ranged from 4.51 (rows ear-1) to 3161.30 (leaf area) while the phe- notypic variance ranged from 5.27 to 3473.97 for the same trait. High estimates for the broad sense heritability were found in various plant traits under study. The yield exhibited positive and significant rela...
Malik Ikram Ullah1, Abdul Aziz Khakwani1*, Muhammad Sadiq1, Inayatullah Awan1, Muhammad Munir2, Ghazanfarullah1
...aits and quality such as plant height, stem diameter, leaf area plant-1, leaf area index, chlorophyll content, green fodder yield, dry matter yield, crude protein, crude fiber and ash percentage were significantly increased with increase nitrogen levels (200, 240, and 280 kg N ha-1). However, highest benefit-cost ratio was estimated when 240 kg N ha-1 was applied which was found best compromise between forage yield and quali...
Muhammad Mudassar Maqbool1, Anser Ali1, 2 *, Tanveer ul Haq1, Muhammad Nasir Majeed1, Dong Jin Lee2
...but also on the stage of plant growth at which it develops. A pot study was conducted during 2011-12 at College of Agriculture, Dera Ghazi Khan, to assess the effect of induced water stress on performance of different wheat varieties at critical growth stages. Three wheat varieties viz. Faisalabad-2008, Lasani-2008 and Kohistan-97 were manually sown in polythene lined pots. Five water stress treatments were created by withholding the irrigation for specified t...
Aqeel Ahmad, Zammurad Iqbal Ahmed, Irfan Aziz*
...ng 2007-2009. Lentil was planted in winter and during summer sorghum (sorghum bicolor) and mung bean (vigna radiata) followed lentil. Five different fertilizer treatments i.e. farmyard manure (FYM) 30 tons ha-1, NPK 35-40-20 kg ha-1, poultry manure 20 tons ha-1, compost (press mud) 12.5 tons ha-1 and inoculation by phosphorus mobilizing microorganisms 2.5 packets ha-1, in addition to control were evaluated...
Hayat Badshah1*, Farman Ullah1, Abid Farid2, Ahmad-U-Rahman Saljoqi1, Sajjad Ahmad3
...idae), on different host plants. Such studies would identify the best host plant for its efficient rearing. The present study investigated some basic life table parameters i.e. female life span, adult female weight, longevity and reproductive potential of P. solenopsis on okra (Abelmoschus esculentus Linn.), brinjal (Solanum melongena Linn.), potato (Solanum tuberosum Linn.), China rose (Hibiscus rosa-sinensis Linn) and toma...
Khalid Usman1*, Niamatullah Khan2, Fazal Yazdan3
... owing to more bolls per plant (37.2), boll weight (3.4 g) plus higher ginning out turn (39.9%) compared to the standard varieties of cotton in Pakistan. The quality characteristics such as fibre length (29.2 mm), strength (28.5 g tex-1), micronaire (4.3µg inch–1) and uniformity (80.2%) were also higher for DNH-105 than other varieties. Ginning out turn ranged from 37.2 (CIM-612) to 39.9% (DNH-105). Fibre length ranged from a low of 28.3 (CIM-612) ...
Muhammad Shah Zaman1, Ghulam Muhammad Ali2, Aish Muhammad1, Khalid Farooq2, Iqbal Hussain1*
...variety with the highest plant height (6.5 cm), number of nodes (8.8), fresh shoot weight plant-1 (0.166 g), number of roots (4.6) and root length (2.5 cm) at 60 mM NaCl followed by Sh-5. Desiree and Cardinal were moderately tolerant varieties to NaCl stress. The most sensitive variety Asterix produced minimum plant height (2.7 cm), number of nodes (2.4), number of roots (2.6), root lengt...
Imdad Sohu1, Allah Wadhayo Gandahi2*, Ghulam Raza Bhutto2, Muhammad Salim Sarki2, Rabail Gandahi3
...analysis of the soil and plant samples were recorded. The application of organic sources of farmyard manure and poultry manure in combination with inorganic NPK fertilizers had shown positive effect on chickpea plant height, number of branches plant-1, number of pods plant-1 and seed index. The growth and yield of chickpea significantly increased with t...
Shahid Iqbal Awan1*, Syed Dilnawaz Ahmad2, Muhammad Amjad Ali3, Muhammad Shahzad Ahmed1, Aurangzeb Rao1
...ment and grain yield per plant were major contributors towards variability. Grain yield per plant was closely linked to relative water content, cell membrane stability and specific flag leaf area. Eight clusters were formed through cluster analysis, and greater genetic distance was detected among the members of cluster 6 and cluster 8 and cluster 7 and 8. Members of these two clusters can be utilised in transgressive breedin...
Muhammad Nawaz Kandhro*, Habib-Ur-Rehman Memon, Muhammad Ali Ansari, Ahmed Naqi Shah
...between two rows of crop plants was pulverized with the help of local tool spade. The statistical analysis of data showed that interculturing, Dual Gold, and sorghum and sunflower water extracts caused significant reduction of weeds and increased seedcotton yield as compared to weedy check. The combined application of sorghum @ 15 L ha-1+ Dual Gold @ 1.25 L ha-1 resulted in weeds mortality upto 66.6%, produced seedcotton yield of 3961.4 kg ...
Luca Vitale
...d productivity; however, plants are able, to some extent, to cope with limiting environmental conditions by means of different mechanisms that contribute to their adaptive success in different habitats....
Claudia Kohl*, Andreas Nitsche, Andreas Kurth
Email: [email protected]
...ude all the fish, ducks, plants, fungi, bacteria and everything else that belongs to the lake. If we apply this approach to clinical samples we can identify the community of etiological pathogens, without any knowledge on the targets in advance. However, clinical specimens usually comprise an overwhelming amount of host nucleic acids, which by far exceeds the number of pathogen nucleic acids in the sample. Subsequently, it is necessary to either decrease the a...
Mudasir Irfan Dar*, Fareed Ahmad Khan and Farha Rehman
E-mail | [email protected]
...gated. Forty-day-old pot plants were exposed to different concentrations of the insecticide, ranging from 0 to 40 grams active ingredient per hectare (g.a.i ha-1) through foliar spray. Analyses were done at days 3, 7, and 15 after treatment. Lipid peroxidation rates and contents of proline, ascorbate (ASC), glutathione (GLU), antioxidative enzymes; superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) were assess...
Ummara Waheed Khan, Raza Ahmed, Irum Shahzadi and Mohmmad Maroof Shah
Email | [email protected]
... techniques, traditional plant breeding has been on leading edge. The discovery of molecular genetics and biotechnological techniques, such as genome mapping, tissue culture, genetic transformation and in vitro regeneration offered new dimensions of research to improve important crop species including wheat. The tissue culture by itself has increased the crop improvement potential to develop new cultivars with desirable traits through ...
Nagina Zeb, Muhammad Sajid, Abdul Mateen Khattak and Imtiaz Hussain
...s of chrysanthemums were planted during the first week of January and transplanted in 20 cm clay pots in July. The experiment was laid out in Randomized Complete Block Design with two factors replicated three times. Different levels of potassium (0, 100, 200 and 300 mg pot-1) and maleic hydrazide (0, 500, 1000 and 1500 ppm) were used. The results revealed that potassium levels significantly influenced all the parameters exce...
Mushtaq Ahmad1*, Habib Akbar1, Mohammad Tariq Jan1, Muhammad Jamal Khan Khattak2 and Abdul Bari3
...ugar sucrose. Sugar beet planted at 2 cm depth showed highest germination process and gave better yield production. Mean maximum leaf area plant-1 (170.49 cm2), leaf area index (6.77), root length (35.50 cm) and root weight plant-1 (0.98 kg-1) were recorded in sugar beet planted at 2 cm depth. Nitrogen band placement method significantly affected growth ...
Shahid Ali1, Habib Akbar2, Mohammad Tariq Jan2, Mohammad Jamal Khan3 and Abdul Bari4
...ustify;">The response of planting sources i.e. standing (fresh canes-frost exposed) trenched (stored canes-frost protected), cane portions and setts placement methods on the attributes of sugarcane were assessed at Sugar Crops Research Institute, Mardan-Pakistan. The experiment was conducted in RCB Design with split plot arrangement, over years (2012-13 and 2013-14). Planting sources i.e. standing (fresh canes frost exposed)...
Ali Mohammadi, Mohammad Hossein Ebrahimi
.... KineSpring knee implant system was designed for young subjects with knee OA to reduce knee pain, improve stability and knee function. The aim of this review article is to screen for the available information on knee implant system and to propose a suitable remedy for effective management of such ailments. Out of the available and applied implants, none of them was eva...
Fatemeh Kheiri
... between both sides. The plantar exion moment in prosthesis and sound sides varied from 0.92-0.98 N/BW and 1.19-1.39 N/BW, respectively (p value of di er- ence <0.05). The energy consumption of amputees was high due to reduced walking speed. However walking with Nabtesco knee joint improved the symmetry of walking and kinematic of the joints in prosthesis side compared to the sound side....
Rongfei Lu1, 2, Zhiyang Liu1, Peng Fang1, Guangyi Chen1, Feng Sun1, Yongjian Fan1, Yijun Zhou1, Tong Zhou1*
Muhammad Amjad Nadim1*, Mohammad Safdar Baloch1, Ejaz Ahmad Khan1, Abdul Aziz Khakwani1, Kashif Waseem2
...ignificant variations in plant growth and yield attributes with recommended doses of NPK fertilizers. This treatment (NPK at recommended levels) resulted in higher leaf area index (0.33 and 0.27 [49 days after sowing-DAS] and 2.03 and 2.77 [98-DAS]), crop growth rate (40.42 and 40.96 g m-2 day-1), relative growth rate (88.94 and 84.14 mg g-1 day-1), net assimilation rate (3.58 and 3.89 mg m-2 day-1) and grain yield (4.40 and 5.29 t ha-1) during the years of ex...
Khalid Ali1*, Amanullah Jan2
...g, DAS) and parts (whole plants incorporation and stubbles incorporation) under varying nitrogen levels (0, 75 and 100 kg ha-1) on physiology, yield and economic returns of Canola (Brassica napus L. cv. Bulbul-98). The experiments were laid out in randomized complete block design with split plot arrangement having three replications. Findings of the experiment revealed that guar as previously green manuring crop considerably increased leaf area index (LAI) 4.4...
Ilham Ulla, G. Arjumand, Nawab Ali and Mohammad Akmal*
...eason crop. However, its planting in summer is at risk of the moon-soon outbreak duration in the season. Present study was aimed to quantify delay-sowing response with increasing N-rate on crop productivity at Agronomy Research Farm, University of Agriculture Peshawar Pakistan. Sunflower (cv. Hysun-33) was planted on different dates i.e. Jul. 1, 11 and 21 treated with different N-rates starting from 40 kg ha-1 wit...
Mukhtarullah1, Jawad Ali2 and Mohammad Akmal1*
...orld. In Pakistan, it is planted on a significant cropped area (Ca. 38%) every year. In Khyber Pakhtunkhwa (KP), wheat is also a popular crop in the cropping system, however, average yield differs by 100% from the national average yield due to rainfed planting (67%). Sowing of wheat in the area starts in October subject to onset of winter rains which delays its planting in the season. This...
Tahir Khan, Raziuddin, Fakharuddin* and Muazam Jamal Razi
...ering, days to maturity, plant height, primary branches plant-1 and main raceme length. Among parents, CA2, DH8, DH4, CA4 and DH6 performed better for different traits. Whereas among F4 populations, cross combinations CA5 × DH8, CA2 × DH7, CA2 × DH8, CA5 × DH7, CA4 × DH7 and CA4 × DH8 performed better. Plant height and main raceme l...
Imtiaz Hussain, M. Sajid, Noor ul Amin, Abdul Mateen Khattak, Abrar Hussain Shah, S. Mussarat Hussain, Sayed Hussain and Nagina Zeb
...f growing conditions and planting dates on vegetative growth of Silvery was studied at Ornamental Horticulture Nursery, Department of Horticulture, The University of Agriculture, Peshawar Khyber Pakhtunkhwa, Pakistan, during January to September, 2011. Randomized Complete Block Design (RCBD) with split plots arrangement was used for the experiment. The experiment was replicated four times. The Silvery softwood cuttings were
Qaizar Ahmed1, Fida Mohammad2, Hidayat-ur-Rahman2, Sheraz Ahmed2* and Fakharuddin2
...ir parent cultivars were planted in randomized complete block (RCB) design with four replicates at Tobacco Research Station Mardan (plain) and Tobacco Research Substation Mansehra (hilly). Data for all traits were analysed in pooled analysis and individual environments. Heterosis over better parent was determined for all traits across environments. Heterobeltiosis estimates reflected both positive and negative values, suggesting additive as well as non-additiv...
Nadeem Khan1*, Arshad Ali Khan1, Mukhtar Ahmad2, Muhammad Nouman2 and Badshah Islam1
... cm). Similarly, maximum plant spread and leaf area were recorded in Mexican Lemon 124.07 cm and 11.35 cm2, respectively. However, Hamlin showed the highest stem girth (9.90 cm) and number of branches (66.53). The internode length was the greatest in Kinnow cultivar (2.66 cm). In case of disease incidence maximum lesion on leaves were found in Kinnow (14.2) while in Cara Cara, Salustiana and Arnold Blood, lesser lesions were found. On the basis of r...
Keyvan Sharifmoradi1*, Nader Farahpour2
...formance of ankle joints plantar flexor which decreased in this group of subjects....
Muhammad Jurial Baloch1*, Ghulam Murtaza Channa2, Wajid Ali Jatoi2, Abdul Wahid Baloch1, Imdad Hussain Rind1, Muhammad Ahmed Arain1 and Ayaz Ali Keerio1
...to 75% maturity, tillers plant-1, spike length, spike density, grains spike-1, grain yield plant-1, seed index and harvest index. Significance of GCA and SCA variances suggested that both additive and non-additive genes were controlling these characters. The magnitude of SCA variances were higher than GCA indicating pre-dominance of non-additive gene effects for spike length, spike density, s...
Murad Ali Khan and Mohammad Akmal
...o evaluate the effect of plant arrangements i.e. planting geometry on yield and yield contributing traits of sunflower (Helianthus annuus L.) hybrid Hysun-33 at the Agronomy Research Farm, The University of Agriculture Peshawar, Pakistan during spring 2011 and repeated in spring 2012. The planting geometries were (a) 70 x 20 cm with rows spaced at 70 cm and plant
Muhammad Ishaq and Raziuddin
...eritance of maturity and plant architecture traits. Analyzed data revealed highly significant differences among the genotypes for days to flowering, maturity, plant height, primary branches plant-1 and main raceme length. Analysis of combining ability revealed highly significant GCA (general combining ability), SCA (specific combining ability) and RCA (reciprocal combining ability) effects...
Farmanullah Khan, Samad Khan, Wiqar Ahmad and Imran Khan
... organic matter content, plant available N, P and K significantly (p<0.05) both at 0-15 and 15-30 cm depths. Effect of fertilizer sources either alone or in integrated form was non-significant on Cu, Zn, Fe and Mn concentration. Economic analysis showed that NPK75FYM20 rewarded the maximum net income of Rs. 43108 ha-1, indicating its superiority for profitable wheat yield under rain-fed conditions. It can be concluded from these results that the application...
Umed Ali Laghari, Ahmed Naqi Shah, Muhammad Nawaz Kandhro, Zia-ul-Hassan, Ghulam Murtaza Jamro and Khalid Hussain Talpur
...ced maximum branches per plant (5.2), pods per plant (32.3), seeds per pod (4.7), seed index (82.7 g) and seed yield (2589 kg ha-1) when compared with 0.0 and 10 kg K2O ha-1. Interestingly, Sel-449 was the most responsive genotype to K nutrition which resulted in higher branches per plant (5.3), pods per plant (29.7), seeds per pod (4.5), seed index (87....
Abdul Qahar and Bashir Ahmad
...wever, sulfur content in plant tissue did not vary with increasing N from 250 to 350 kg ha-1, but was considerably improved with respect to control. It is concluded that R-2210 produced maximum yield, BCR value and N content in tissue with 350 kg N ha-1, however S content in soil and in tissue was more with 40 kg S ha-1. Hence, it is recommended that 350 kg N ha-1, and R-2210 should be used for optimum grain yield and economic benefits....
Muhammad Nawaz Kandhro, Qamaruddin Jogi, Mahmooda Buriro, Aijaz Ahmed Soomro, Ghulam Mustafa Laghari and Ali Nawaz Khaskheli
...lelopathic properties of plants is thought to be an effective and environment-friendly approach for weed management. A pot experiment to evaluate the allelopathic potential of leaves of Eucalyptus camaldulensis (L.) against Convolvulus arvensis (L.) and Cyperus rotundus (L.) was undertaken during summer 2011. The study was conducted at Department of Agronomy, Sindh Agriculture University, Tandojam, Pakistan. The experiment was laid out in three replicated comp...
Sayeda Sarah and Muhammad Ibrar
...he soil of control (RP0) plants, which decreases progressively with increasing fertility level. Less number of spores and percent root colonization was found at high RP level (RP100) in all hybrids. Higher P doses declined the sporulation and colonization. There was total seven AMF species that were observed and recorded. The dominant genus was Acaulospora which was followed by Glomus, Sclerocystis and Gigaspora. The average AMF spore density ranged from 56-26...
Allah Wadhayo Gandahi, Khalilluah Panhwar, Rabail Gandahi, Muhammad Saleem Sarki and Mahmooda Buriro
...kg ha-1 resulted maximum plant height, number of green leaves plant-1, number of opened bolls plant-1, seed index, and seed cotton yield ha-1. Red leaves reduced when soil was fertilized with N, P and K @ 120-70-40 kg ha-1; and plots without application of K (120-70-0 kg ha-1) and PK (120-0-0 kg N ha-1) increased number of red leaves. In case of micronutrients, Zn @ 4 kg and B @ 1.5 kg ha-...
Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek
...and giving vigour to the plants. In laboratory experiment, L. muscarium was the most effective against nematode eggs (95.6%) and second stage juveniles (J2) (95.8%) infection. In greenhouse experiment, similar trend was found. L. muscarium proved to be more effective against M. hapla whereas S. rugosoannulata and C. rosea showed better results among other tested fungi in experiments. Moreover, plant
Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek
... of L. muscarium treated plants was documented minimum as compared to that of control but slightly higher compared to that of treated with nematicides. More interestingly, plant growth parameters including shoot and root were tremendously improved in L. muscarium treated plants than that of other treatments....
Felwa A. Thagfan1, Mohamed A. Dkhil1,2* and Saleh Al-Quraishy1
...one of the commonly used plants in Islamic countries.The root extracts of S. persica has been tested for its anticoccidial activity against Eimeria paillata induced infection in mice jejunum. Three different doses, 300, 600 and 900 mg/kg were used after infection of mice with sporulated oocysts. A dose of 300 mg/kg reduced the number of oocyst output in mice faeces by about 56.8 % and also improved the body weight. In addition, the root extract d...
Safdar A. Wahocho, Tanveer F. Miano, Noor U.N. Memon and Niaz A. Wahocho
... RCBD design. The zinnia plants were grown under four photoperiodic treatments which included T1=Natural photoperiod (Control), T2=4 hours daylight (8 am -12 noon), T3=6 hours daylight (8 am – 2 pm) and T4=8 hours daylight (8 am – 4 pm). The results revealed significant (P<0.05) photoperiodic effect on all the growth and quality traits of Zinnia. The Zinnia grown under 8 hours daylight (8 am – 4 pm) with 38.29 cm ...
Ai Ming Zhou1,2, Guang Wen Liang2, Ling Zeng2, Yong Yue Lu2 and Yi Juan Xu2*
...oraging activity both on plants and the ground. Ant diversity in fire ant-infested plots was significantly reduced compared with in fire ant-free plots. Compared with in the no-ant plots, the colony growth rate of mealybug significantly increased, and the parasitism of mealybug was obviously decreased, both in fire ant-infested plots and in fire ant-free plots. Colony growth rate of mealybug in fire ant-infested plots was greater than fire ant-free plots. Thes...
Sadiq Hussain, Muhammad Sharif, Sarmad Khan, Fazli Wahid, Hina Nihar, Wiqar Ahmad, Imran Khan, Nadeem Haider and Tabassum Yaseen
...nd 21.2 g pot-1, maximum plant N uptake of 0.71 g and 0.68 g pot-1 were obtained by mycorrhiza inoculated with half and full doses of vermicompost treatments. Plants P uptake of 0.09 g and 0.08 g pot-1 were found in mycorrhizal inoculation along with full and half doses of vermicompost, respectively. Maximum concentration of Zn (0.7 mg kg-1), Cu (0.164 mg kg-1), Fe (1.0 mg kg-1) and Mn (1.63 mg kg-1) were noted in mycorrhiza...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
...ng nematode that affects plant growth and yield. We report on studies aimed to evaluate the effects of five nematophagous fungi on the population dynamics of this pest in sugar beets in laboratory and greenhouse trials. The fungi chosen were Arthrobotrys oligospora, Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata, and Lecanicillium muscarium. In the laboratory experiment, S. rugosoannulata proved to be the most efficient biocontrol agen...
Syeda Farzana Bibi*, Lal Badshah and Siraj-ud-Din
...e for future studies and plantation of this area. It is suggested that plantation of invasive species should be discouraged which might become problematic in future for the indigenous flora....
Muhammad Basit1, Shafqat Saeed2, Mushtaq Ahmad Saleem3, Rana Zulfiqar4
... 3.9 and 3.5 individuals/plant, respectively. Further, correlation study indicated that syrphids and chrysoperla had a significant positive correlation with A. gossypii and T. orichalcea, respectively. Likewise, spiders and lady beetles had significant positive relationship with B. tabaci, N. inconspicuous and Empoasca spp. Furthermore, temperature had a significant positive correlation with B. tabaci, N. inconspicuous and Empoasca spp, suggested increas...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
.../Pi) was observed in the plants treated with L. muscarium compared to the control. However, all chemical nematicides were also effective in reducing the nematode infestation significantly (P=0.05) in soil compared to the control, but there was no significant difference (P=0.05) among them. Plant growth was significantly (P=0.05) improved in the plants treated with L. muscarium....
Zafar Waheed, Khalid Usman, Iftikhar Ali
...wheat + Rumex dentatus 0 plants m-2 (T1), wheat + Rumex dentatus 05 plants m-2 (T2), wheat + Rumex dentatus 10 plants m-2 (T3), wheat + Rumex dentatus 15 plants m-2 (T4), wheat + Rumex dentatus 20 plants m-2 (T5), wheat + Rumex dentatus 25 plants m-2 (T6), and wheat + Rumex dentatus ...
Muhammad Shafiq and Tahir Maqsood
...e vegetative growth i.e. plant height, tillering and total biomass were affected non-significantly in response to B application. Regarding chemical analysis concentration of boron in both wheat straw and grains increased with B application but there was no effect of fertilizer B on NPK concentration of straw and grains. These results are very heartening; signifying that for any soil, B adsorption isotherm need to be worked out for location precise fertilizer B...
Iram Liaqat1*, Najma Arshad2, Muhammad Arshad3, Safdar Ali Mirza4, Nazish Mazhar Ali1 and Ammara Shoukat1
...f aqueous and methanolic plant extracts of Camellia sinensis (Green tea), Syzygium aromaticum (Clove) and Mentha piperita (Peppermint) was evaluated against identified isolates. Agar well diffusion assay was used to monitor the antimicrobial activity of these strains both in mono culture and mixed culture. Streptomycin sulphate (10 μgml-1) and Amphotericin B (5 mgml-1) were used as positive controls. Minimum inhibitory concentration (MIC) and minimum bacter...
Sidra-Tul-Muntaha1, Muhammad Sagheer1*, Mansoor-ul-Hasan1 and Shahbaz Talib Sahi2
...itory efficiency of five plant extracts (Azadirachta indica, Melia azadirach, Pegnum hermala, baryosma and Zingiber officinale) and three synthetic pyrethroids (bifenthrin, cypermethrin and deltamethrin) on three geographical populations of Callosobruchus chinensis collected during 2013 from Faisalabad, Multan and Nankana districts of Punjab, Pakistan. Three concentrations of each plant extract (5, 10, 15 and 20%) and synth...
Muhammad Saeed* and Iftikhar Hussain Khalil
...ts including grain yield plant-1 which can be subsequently utilized in future wheat breeding to develop high yielding new wheat cultivars from transgressive segregants recovered in latter generations....
Salma Shaheen, Mumtaz Khan, Muhammad Jamil Khan, Saleem Jilani, Zarina Bibi, Muhammad Munir and Mehwish Kiran
...ate nutrient cycling and plant growth. However, information regarding its co-application with organic wastes and chemical fertilizers on enhancing spinach yield is scarce. A pot experiment was conducted at Gomal University D.I. Khan, Pakistan, during 2009-10 to study the changes in soil fertility and spinach growth after the application of EM with organic wastes and chemical fertilizers. The six treatments were; control (T0), 10 tons (t) ha-1 farm yard manure ...
Fida Mohammad, O.S. Abdalla, Sheraz Ahmed, Fakharuddin and S. Rajaram
...ight check cultivars was planted in alpha lattice design with three replications. Genotypes exhibited significant (p≤0.01) variations for all the studied traits excluding biomass. Genotype by environment interactions (GEI) were significant for all the characters except for thousand kernel weight. The influences of yield components on grain yield were explained by the cluster analysis of environments. Clustering of five test environments based on Shifted Mul...
Muhammad Shahzad Ahmed and Dilnawaz Ahmed Gardezi
...ealed maximum values for plant height and number of nodes. Analysis of variance revealed highly significant differences for plant height, number of tillers, leaf area, brix percentage, reducing and non-reducing sugar. A total of 79.75% cumulative variance was estimated in genotypes with PCA analysis at eigenvalue >1 and grouped 20 genotypes into five clusters at Euclidean distance (ED) 7. Cluster analysis revealed that th...
Sheraz Ahmad Khan and Ghulam Hassan
...ty (0.93) was noticed in plant height followed by flag leaf area (0.89). The values of genetic advance were recorded low to moderate for all parameters. Grain yield was observed to have positive significant association with most of the important yield related traits such as fertile tillers, spike length, 1000-grain weight and grains per spike. These results suggest that all the traits showing significant correlation with grain yield needs better attention in f...
Zamarud Shah, Safdar Hussain Shah, Asad Jan and Gul Shad Ali
...st devastating impact on plant growth. Heat shock transcription factors are known to play an important role in regulating heat stress in plants. Tobacco (Nicotiana benthamiana) was transformed with heat shock transcription factor HsfA1d by transfecting leaf discs with Agrobacterium strain GV3101 carrying CaMV35S-YFP::HsfA1d construct. After PCR and confocal-based confirmation, HsfA1d overexpression lines (OX1, OX2 and OX3) ...
Ibni Amin Khalil* and Raziuddin
...ted trial for seed yield plant-1 performance. Differences among the parental lines, testers, F1 hybrids and line × tester interaction for found significant (P<0.01) for the studied parameter. Promising genotypes for seed yield i.e. L-4, L-5, L-7 and T-4 were identified as best parents as they outclassed all other genotypes by producing maximum seed yield per plant of 28 g. Since, the line × tester source was s...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahim2 and Ghada Kamal El Khalafawy2,*
...m two poultry processing plants represented broiler carcasses swabs and worker (hand swabs and nail scrapings). Phenotype-based methods for identifying yeast especially Candida species are often difficult, time-consuming and not enough to identify most yeast species. . Molecular biological techniques provide a useful alternative approach. Concerning with genotypic identification, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was...
S. Bushra1,*, M. Tariq1, M. Naeem1, M. Ashfaq1, I. Bodlah1 and M. Ali2
...s are the major pests of plant crops in temperate areas of the world. They are monophagous as well as polyphagous and damage wheat, oilseeds, vegetables and fruit crops. This study was carried out to observe the effect of plant extracts and semiochemicals on physiology and performance of endoparasitoid of aphids, Diaeretiella rapae. Seven different treatments of semiochemicals and plant...
Sumra Ashraf1, Zain ul Abdin1,*, Saqi Kosar Abbas2,Rao Sohail Ahmad Khan3, Muhammad Tahir1, Sehrish Rasool1, Maryam Anwar1 and Fiaz Hussain1
...rom animal secretions or plant exudates which include honeydew, fruit juices and both floral and extra-floral nectar. A direct behavioral assay was conducted to investigate the dietary preference and effects of different diets on the fecundity, sex ratio and longevity of B. hebetor. Three different diets [Honey syrup, sugar syrup, date syrup and a control (water)] were used with different solution percentage (25, 50, 75 and 90%). It was observed that ho...
Glomus mosseae (Gerd and Trappe) and Neemex Reduce Invasion and Development of Meloidogyne incognita
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
...t-align: justify;">Among plant parasitic nematodes, root knot nematodes are the major problem for vegetables including eggplant. Chemical control of nematodes is hazardous to health and causes environmental pollution by contaminating underground water. The bio-protectant potential of mycorrhizal fungus (Glomus mosseae) and neemex® (Azadirachtin) against invasion and development of Meloidogyne incognita was ...
Fazal Said1,Mian Inayatullah2 and Hussain Ali3*
...ng due to less number of plants with blooms and less availability of pollens and nectar on flowers. Maximum seed production as well as oil contents was obtained from sunflower plots kept under natural conditions, where bee visitors had access to sunflower blossoms. In contrast, sunflower plots covered with insect-proof bags gave minimum seed production and oil contents, which most probably was because of bee visitors denied to forage on flowers of the crop. Re...
Waqar Islam*1, 2, Madiha Zaynab3, Muhammad Qasim2 and Zujian Wu1,2
... Crops are threatened by plant viruses worldwide as they hack the host machinery for their reproduction. Plants have undergone continuous evolution and have equipped themselves with counter defense and tolerant strategies against viral infections. In the 21st century, considerable progress has been made in understanding the available natural resistance in plants against viral th...
Zafar Iqbal1* and Muhammad Khurshid2
...xpedite the detection of plant viruses from plant species containing various forms of PCR amplification inhibitors. In current study, IC-PCR was used for the detection of Tomato leaf curl New Delhi virus (ToLCNDV) from plant extracts of Nicotiana benthamiana plants inoculated with ToLCNDV. To immunocapture the ToLCNDV, two antisera raised a...
Sheraz Ahmed and Fida Mohammad
...xperimental material was planted at two locations i.e. Mardan (E-1, E-3 and E-5) and Mansehra (E-2, E-4 and E-6) using alpha lattice design with three replicates during 2012/13, 2013/14 and 2014/15. Heritability in broad sense was generally low for all traits except nicotine and reducing sugar. Days to flowering was the most environment responsive trait and its heritability fluctuated between 0.22 and 0.91. Plant height was ...
Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1
...aughter slab (processing plants) in Nigeria. The relatively high prevalence rate documented in this study may be attributed to the generally poor infrastructure, lack of well-equipped poultry slaughter houses, lack or inadequate water supply at these markets which hampers the ability of handlers to maintain good sanitary and hygiene conditions of the carcass, environment and themselves. Data collected could be valuable for instituting effective intervention st...
Mohammad Raoofi and Mohammad Taghi Alebrahim
...nd non-hand weeding) and plant density in four levels (20, 40, 60 and 80 stems per square meter). The results obtained in two cuttings in the third year of established alfalfa showed that the weeds caused quantitative and qualitative reduction in alfalfa. Alfalfa in the second cutting had better growth compared to the first cutting, so that the plant produced the highest fresh and dry yield in the second cutting. However, we...
Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*
...as a result rotten woody plants. The larval beetles characteristically feed in the phloem as well as later in the xylem. The females select living hosts for oviposition and thus destroy the vigour of the trees. However, at the early stage of intestation, detection of Anoplophora glabripennis and exposure will help to eliminate the pest in addition to prevent its establishment. Plantation with different tree species, t...
Habib Ullah Khan1*, Saleem Ullah1, Hamid Ullah Shah1, Muhammad Arif2
...ve good or bad effect on plants grown in those soils....
M. Abdus Salam1, M. Moynul Haque2, Md. Obaidul Islam3, M. Nasir Uddin4 and Md. Nazmul Haque3*
...ghest sympodial branches plant-1 (19.11), days to 50% flowering and boll splitting (72.00 and 156.33, respectively), number of bolls plant-1 (20.33), boll weight (4.60 g), seed cotton and lint yield (2305.30 and 832.49 kg ha-1, respectively), ginning out turn (36.04%) and lint index (6.28 g) were recorded for genotype BC-0125 grown from seed stored in polythene bag. Regarding fiber quality, the genotype SR-08 grown from seed...
Waqar Islam
...’s knowledge about plant virus diseases. Therefore, here we reviewed about this issue by highlighting that what farmers know about plant viruses, what is their perception about yield losses by virus diseases and what management strategies they choose to apply against viruses. We further added our suggestions that how plant viruses can be managed effectively through simple and credibl...
Syed Ishfaq Ali Shah1,*, Tassawar Hussain Malik2, Imran Rafi Khan1 and Zahid Hussain3
...increased with day after planting (DAP) and high infestation level of whiteflies as it was positive and non-significantly correlated with DAP and whitefly on both USDA accessions and local varieties. Maximum and minimum temperatures, rainfall and wind velocity were negative and non-significantly correlated while, % relative humidity (%R.H) was found non-significantly and positively correlated both with USDA accessions and local varieties. On overall basis, dur...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...oram, India and infected plants showed declined symptoms and poor fruit yield. Infested plants displayed stunting and yellowing and thick-root symptoms. The association of the root knot nematode species was identified based on observations on morphology of different life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of <...
Hamayun Khan1,*, Momen Khan2, Muhammad Subhan Qureshi3, Shakoor Ahmad1, Ali Gohar4, Hameed Ullah5, FarmanUllah6, Arab Hussain7, Pershotam Khatri8, Said Sajjad Ali Shah1, Hamid Rehman1 and Azmatullah Khan1
...y;">Green tea extract is plant–dervied natural antioxidant. The objective of this study was to explore the antioxidative effect of green tea extract on the cryopreserved bull semen. Experiments were carried out on Achai breeding bulls of similar age at the Semen Production Unit, Harichand, District Charsadda, Khyber Pakhtunkhwa. Collection of semen was done using artificial vagina (42°C) for three weeks. Semen was extended in egg yolk extender at var...
Muhammad Noor, Hidayat ur Rahman and Muhammad Iqbal
...a trait of interest help plant breeders to plan their long term breeding programs more accurately. This study was conducted to estimate the magnitude of heritability for flowering and maturity attributes along with plant and ear height parameters in four popcorn populations. Broad sense heritability estimates varied from 0.69 to 0.76, while narrow sense ranged from 0.38 to 0.69. Maximum broad sense heritability estimate of 0...
Sanaullah Jalil*, Asim Hayat, Abid Majeed, Syed Haider Abbas, Muhammad Noman, Muhammad Imran Kasana and Muhammad Mazhar Hussain
... the utilization of P by plants. This research was conducted during wheat cropping season of year 2010 and 2011 and it consisted of determination of the residual effect of six treatments (T0 = control without rock phosphate & farmyard manure, T1= rock phosphate @150 kg P2O5 per hectare, T2 = FYM @5 tons per hectare, T3 = RP @100 kg P2O5 per hectare+ FYM @5 tons per hectare, E0 = without effective microbes and E1= EM-Biozote @ 50 l ha-1) on yield parametrs ...
Response of Spring and Autumn Sunflower to Chemical and Bio-Fertilizers for Yield and Quality Traits
Muhammad Tahirand Memoona Shehzadi*
Abdus-Subhan1, Qudratullah Khan1, Muhammad Mansoor2, Muhammad Jamil Khan1, Ammanullah2, Matiullah Khan3
...ficant effect on tillers plant-1, weight of grain spike-1, grain yield and harvest index % (H.I. %). While (S) had significant effect on yield of grain, straw, biomass and H.I. Maximum grain yield and BCR was recorded in treatment combination of P2 × S1.It is concluded that use of 2-tillers on raise bed sowing method gave significant result of WUE, economics and grain yield which may be recommended for the arid...
Waqas Ahmed Dogar2, Arshad Ali Khan3*, Saeed Ahmed2, Sudheer Tariq2, Mukhtar Ahmad2, Muhammad Imran2, Muhammad Noman2 and Nadeem Khan1
... effects of high density plantation on growth and yield of citrus (Kinnow and Musambi) grown under drip irrigation at Postgraduate Agriculture Research Station (PARS) Institute of Horticultural Sciences, University of Agriculture Faisalabad. Plants were grown at three planting distances as T1 (11 x 22ft), T2 (11 x 11ft) and T3 (22 x 22ft). T1 (11x22ft) was optimum ...
Ahmad Khan1, Raza Ullah Khan1*, Muhammad Zameer Khan1, Fayyaz Hussain1,Muhammad Ehsan Akhtar2, Jalal-Ud-Din3
...riety Red Swat) transplanted earlier to field (plot size=1.2×0.8 m2). Results showed that maximum bulb yield of 25.1 and 24.5 t/ha were obtained with application of plant derived HSs; SFDHSs and MDHSs respectively, while 24.7 t/ha bulb were obtained with CDHA applied at the rate of 20 kg/ha. Almost same trend was observed with respect to the number of bulbs per plot. The highest number of 28.3 bulbs/plot...
Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty
Recent advances in geminivirus detection and future perspectives
...ent of the discipline of plant virology over a century ago.Agreat variety of methods have been developed that permit differentiation of viral pathogens.These methods, initially based solely on identifying the distinct biological characteristics of different viruses, were soon supplemented with methods based on light or electron microscopy and serology and subsequently by Enzyme Linked Immunosorbant Assay (ELISA) and finally the use of molecular (nucleic acid-b...
M. B. Meah
Biopesticides for crop growth and crop protection
... over of vegetables (egg-plant, tomato, chilli) in the nursery and leaf blight, anthracnose, fruit rot, root knot and leaf curl/mosaic of tomato and carrot in the field. Aqueous solution of garlic and allamanda tablet sprayed at 1:1, 1:2, 1:3, 1:3, 1:4, 1:5 conc. increased seed germination by 45-60%, completely eliminated damping-off, seedling blight and tip over and increased seedling vigour by 22-50%. The tablets retained the similar range of action over agi...
Honnur Basha, Vinaya Hemannavar, B.Ramanujam, R. Rangeshwaran and S.Sriram
Screening of chilli microflora and other biocontrol agents for their antagonistic effects on Colletotrichum spp. infecting chillies
...gal isolates belonged to plant pathogenic genera like,Alternaria, Cercospora, Colletotrichum, Curvularia, Glomerella, Mycosphaerella, Phoma and Stemphylium and the other 24 isolates of fungi belonged to Aspergillus, Acremonium, Chaetomella,Cunninghamella, Geotrichum, Gliocladium, Monodictys, Mucor, Myrothecium, Penicillium, Periconia and Pithomyces. One-hundred and thirteen isolates of chilli microflora and 49 isolates of Trichoderma, 19 isolates of Bacillus s...
Neerja Agrawal, Mukesh Srivastava, Akhilesh Tripathi and Amrendra Singh
Survey and monitoring of pests, parasites and predators of pulse crops in central and eastern Uttar Pradesh
...lar, Spilarctia obliqua, plant hopper of Pentatomorpha group, termite Odontotermes spp, and cut worm Agrotis ipsilon in chickpea whereas Campoletis chlorlidae was recorded as natural enemy feeding on H. armigera larvae. In pigeonpea crop, mainly H. armigera, leaf webber Grapholita (Cydia) critica, Myllocerus spp, spotted pod borer Maruca testulalis, plume moth Exelastis atomosa, tur pod bug Clavigralla gibbosa, jassid Amrsca bigutulta, termite Odontotermes spp...
K.N. Ahmed, S.H.A. Pramanik, M. Khatun A. Nargis M. R. Hasan
Efficacy of plant extracts in the suppression of insect pests and their effect on the yield of sunflower crop under different climatic conditions
...fficacy of five kinds of plant extracts or botanicals viz., Neem (Azadirachta indica) seed oil, castor ( Ricinus communis) oil, a mixture of Neem seed oil and sesame oil, leaf extracts of custard apple (Annona squamosa ) and Bara Bishkatali ( Polygonum orienta) were tested against the pest infestation. The treatment of custard apple leaf extract produced the most favourable result in respect of pest control and crop yield. The other treatments also exhibited b...
Palash Mondal1 , Amitava Konar2 and N. Johnson Singh3
Evaluation of insecticidal schedules for the management of insect pests of potato
...ith chlorpyriphos before planting and foliar spray of acephate, imadichloprid and chlorpyriphos + cypermethrin at 40, 55 and 70 DAP(T ).Yield of damaged tuber caused by soil pests was found maximum in control plot and it was recorded lowest in T treatment which received soil application of phorate 10G at 40 DAPand foliar spray with imadichloprid and chlorpyriphos + cypermethrin at 55 and 70 DAP, respectively. But soil application of phorate at
M.K. Pandit,P. K. Pal and B. K. Das
Effect of date of sowing on flowering and incidence and damage of melon fruit fly in snap melon Cucumis melo var.momordica genotypes
...tal number of fruits per plant and moderately lower fruit fly incidence,BCSM-4 andBCSM- 8 may possibly perform better than the other genotypes in the lower Gangetic plain if sown during end of January.
...
B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran
Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
...rge number of soil-borne plant pathogenic fungi, suppressive effects on some root nematodes without adversely affecting beneficial microbes like Rhizobium and capable of promoting growth of certain crops. There are two major methods of inoculum production of Trichoderma spp. viz., solid state fermentation and liquid state fermentation. In solid fermentation, the fungus is grown on various cereal grains, agricultural wastes and byproducts. The solid state produ...
1S. A. Khan and 2S. Jha
Effect of dates of sowing, moisture regimes, varieties and weather factors on incidences of aphid, Lipaphis erysimi (Kalt.) in rape and mustard
...g greater than 30 aphids plant-1) prevailed between 19 December and 21 January. Number of aphids plant-1 was consistently greater in crops grown under irrigated condition than those under rainfed condition. Aphid population was highest during siliqua formation phase due to prevalent conducive weather conditions, followed by reproductive and vegetative phases over all varieties. Weather conditions associated with critical per...
A. K. Chaubey and Satyandra Kumar
Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...mato seedlings were transplanted after dip treatment in antagonist fungal and bacterial CF in earthen pots filled with amended soil. Seven days after transplanting, the seedlings were inoculated with second stage juveniles of M. incognita @ 2J2/g soil. The exposure of M. incognita eggs and juveniles to the culture filtrates showed high inhibition in egg hatching and caused high mortality of juveniles than the control (P< ...
K.N. Ahmed and M.R. Hasan
Sudden outbreak of mealy bug and armoured scale causing severe damage to economic crops in Bangladesh
...vegetable crops viz., eggplant, lady's finger, papaya, basil etc. by citrus mealybug, Planococcus citri (Risso) (Homoptera: Pseudococcidae) has been noticed in Bangladesh. It is mainly a pest of citrus and coffee crops but now it has become polyphagous in nature. Based on laboratory studies on immature and mature fruits of lady's finger; the total period of all four nymphal stages lasted for 32.6 ± 4.17 days at an average room temperature of 28 ±...
Bijan Kumar Das
Incidence of Aleurocanthus spp. (Aleyrodidae: Hemiptera) on betelvine (Piper betle L.) and their interaction with host plants
...ted by the nature of the plantation. A good number of hemipteran insect pests occur in betelvine ecosystem which dwindle betelvine yield potentiality. Among these, the polyphagous betelvine blackfly, Aleurocanthus rugosa Singh (Aleyrodidae: Hemiptera) is a major pest causing severe damage to the foliage in the conservatories (borojas) of West Bengal. The seasonal incidence of A. rugosa in boroja was recorded during 2003-2004. A. rugosa adults were active in th...
S. Subharani, S. S. Thorat, N. Abem, L. Amit Kumar and T. K. Singh
A database on parasitoid of insect pests of crops in Manipur, India
...itoid, host insect, host plant, morphological characters, geographical distribution, period of activity, parasitoid behavior and its biology etc. Image of the parasitoid species are also provided for helping in easy identification of the species. Keywords: Database, insect-pest, parasitoids, Manipur
...
...
S. K. Dutta, S. Roy Chowdhuri, D. Pandit and A. K. Bajpai
Rot diseases of muga host, Som (Persea bombycina) in Assam, India
...Kost.), the primary food plant of muga silkworm, (Antheraea assamensis Helfer) growing mainly in North Eastern region and Uttaranchal State in India. India is unique in producing the golden muga silk and has monopoly in global silk market grows up to 20-25 meters and survives for 18-20 years. Pollarding of Som plant at 6 ft height is a common practice in North Eastern region of India for controlled rearing (outdoor) of muga ...
Sitansu Pan and Someshwar Bhagat
Biological control of plant diseases
...ct Biological control of plant diseases seems to be the best alternative for plant disease control. It is ecofriendly, reliable, cost effective and is an integral component of integrated plant disease management framework for sustainable crop production. A considerable number of biocontrol agents have been established successfully for their bioconrol potential including strains belonging t...
Debjani Chowdhury, P. C. Paul and B. Dasgupta
Management of leaf spot of Centella asiatica (Thankuni) caused by Alternaria sp. and target leaf spot of Rauvolfia serpentina (Sarpagandha) caused by Corynespora cassicola
...ht and dry weight of the plant per sq.M) and increased the fresh weight and dry weight of plants....
Amitava Konar, Palash Mondal and N. Johnson Singh
Occurrence of potato pests in different dates of planting in Gangetic plains of West Bengal, India
...ato under five different planting dates (P1 to P5) was carried out for two consecutive years, 2006-07 and 2007-08 at Adisaptagram Block Seed Farm, Hooghly, West Bengal, India. Kufri Chandramukhi was planted in five dates of planting starting from 3rd week of November with one week interval upto 3rd week of December with a spacing of 60×20 cm. The trial was laid in Randomized Block De...
K.N. Ahmed , M.A. Al-Helal, N-E-P. Khanom, S. Bulbul
Control strategies of papaya mealybug, Paracoccus marginatus Williams & Willink infesting vegetable crops in Bangladesh
...er cent. Generally young plants die due to heavy infestation and colony formation of the mealybug. P. marginatus is a polyphagous pest attacking several agricultural, horticultural crops, ornamental plants and weeds of economic value. The papaya mealybug feeds on the sap of the plants by inserting its stylets into the epidermis of the leaf as well as into the fruit and stem. In doing so, i...
M. S. A. Mamun and M. Ahmed
Integrated pest management in tea: prospects and future strategies in Bangladesh
...ge contiguous areas. Tea plant is subjected to the attack of several notorious pests such as insects, mites, nematodes, diseases and weeds. Globally 1034 species of arthropods and 82 species of nematodes are associated with tea plants. Among them 25 species of insects, 4 species of mites and 10 species of nematodes are recorded from Bangladesh. Enormous crop loss was incurred due to the attack of these pests and largely resp...
Nilesh Suresh Gole and Bijan Kumar Das
Biology of Dichromia sagitta (Fabricius) (Noctuidae: Lepidoptera), a serious pest of Indian ipecac, Tylophora indica
...s an important medicinal plant in the family Asclepiadaceae, indigenous to India. In West Bengal, we observed the herb to be heavily infested by a defoliator pest, Dichromia sagitta (Fabricius) (Noctuidae: Lepidoptera). A study was conducted in the field and laboratory of All India Coordinated Research Project on Medicinal & Aromatic Plants and Betelvine (AICRP on MAPB) at Bidhan Chandra Krishi Viswavidyalaya (BCKV), Kal...
Sitansu Pan and Amrita Das
Control of cowpea (Vigna sinensis) root and collar rot (Rhizoctonia solani) with some organic formulations of Trichoderma harzianum under field condition
...ion vigour of the cowpea plants, basal girth, number of branches & pod number, pod vigour of the bio primed seeds over other treatment combinations. Soil application of Trichoderma in vermicompost +20% neem cakes gave better disease control over the others....
Sunita J. Magar and D.D. Nirmal
Effect of plant spacings and cultivars on spread of Yellow Vein Mosaic Virus (YVMV) disease
...MV) disease in different plant spacing 30 x 30 cm, 50 x 30 cm, 60 x 30 cm, 60 x 60 cm and 60 x 40 cm and using two cultivars, i.e., cv. Parbhani Kranti and Local indicated that the first appearance of symptom was earlier in cv. Local and late in cv. Parbhani Kranti. The rate of infection was higher at 45 to 60 days after sowing in both kharif and summer while in cv. Local it was higher at 30 to 45 days after sowing. Less infection rate was observed at 30 to 45...
SK Fashi Alam, Atanu Seni and Ajoy K Sahoo
Biology of the mealybug, Phenacoccus solenopsis Tinsley (Pseudococcidae: Hemiptera) on sprouted potato and brinjal plant
...y was studied on brinjal plant and sprouted potato tubers in the laboratory. The female nymphs moulted three times for becoming adults while the male took four moultings. The female and male nymphs completed development in 14.45± 0.96 days and 19.53±1 days, respectively on brinjal plant at 20-36.2° C temperature and 15.1±1 days and 18±0.82 days respectively on sprouted potato. The ratio of the...
Amitava Konar, Kiran A. More and Pradip Mondal
Efficacy of some insecticides against cutworm and molecricket of potato in West Bengal
...rate 10 G @ 15kg ha-1 at planting plus drenching the ridges with chlorpyriphos 20 EC @ 2.5ml/L of water on appearance of pest (T5) was found most effective in decreasing the incidence of cutworm and molecricket followed by soil treatment at planting with phorate 10 G @15kg ha-1 with addition drenching the ridges with imidacloprid 17.8 SL @ 0.004% (2ml/10L of water) on the occurrence of the pest (T6 ) than other treatments as...
Amitava Konar, S. Paul and Kiran A. More
Efficacy of different insecticidal treatment schedules against aphid and whitefly on brinjal
...ation of phorate at transplanting, followed by foliar spray with acephate, thiodicarb and Bacillus thuringiensis var. kurstaki at 50, 70 and 90 days after transplanting, respectively) and seedling treatment with imidacloprid before transplanting, succeeded by foliar spray with imidacloprid, novaluron, B. thuringiensis var. kurstaki and novaluron at 30, 50, 70 and 90 days after trans
A. Regupathy and R. Ayyasamy
Initiatives of papain industry by private-public-farmer link-ages in classical biocontrol program for papaya mealybug in Tamil Nadu
...p spraying. The infested plant parts from infested fields were availed regularly by TNAU to facilitate mass production of parasitoid. This is a successful model of partnership of private sector-public institutions in biocontrol of the PMB biocontrol which has practically impacted through rise in quality and quantity of latex supply and area increase in papaya cultivation.
P.S. Ajith, K.K. Lakshmesha, S. Mahadev Murthy and N. Lakshmidevi
Botanicals for control of anthracnose of bell peppers
... justify;">Botanicals or plant extracts from Cathranthus roseus, Coleus aromaticus , Manilkara zapota and Azadirachta indica was studied by poisoned food technique, seed germination and under green house experiments for control of Colletotrichum capsici, fungal pathogen responsible for anthracnose disease in bell peppers (Capsicum frutescence L.). The results showed that all the selected plants have potential to inhibit the ...
Goutam Mondal
Plant growth promoting activity of some indigenous Tricho-derma isolates and their field performance against sheath blight of rice in old alluvial zone of North Bengal
...ctive against soil-borne plant pathogens, namely, Fusarium oxysporum f. sp. ciceri (Padw.) Matuo. and Rhizoctonia solani Kühn. Efficacy in plant growth promoting activity of all the isolates was also tested on cauliflower (Brassica oleracea var botrytis L.), chilli (Capsicum frutescens L.) and tomato (Lycopersicon esculentum Mill.) with culture filtrate of biocontrol agents and found both positive and negative effect on...
A.A. Oyerinde, P.Z. Chuwang, P.Z. and G.T. Oyerinde
Evaluation of the effects of climate change on increased in-cidence of cowpea pests in Nigeria
...wth stages of the cowpea plant in the two seasons. Therefore the advent of increased fauna on cowpea established in this study portrayed a need to find possible ways to reduce the emission of Greenhouse gases in the region in order to ameliorate the effects of induced global warming on cowpea production in the country and also provide effective control of the identified pest in order to maintain or stall resurgence. ...
A. Sajeena and T. Marimuthu
Efficacy, stability and persistence of Ganosol, a Ganoderma based fungicide against plant pathogens
... in Ganosol 10EC sprayed plants and were absent in control. The formulation was tested to have good emulsion stability. The antifungal activity of the formulation persisted up to seven days after spraying the formulation on rice plants. The formulation retained its 100% antifungal efficacy up to three months of storage. Surprisingly, spraying cowpea plants with the formulation as simultane...
S. Patra, V.W. Dhote, SK F. Alam, B.C. Das, M.L. Chatterjee and A. Samanta
Population dynamics of major insect pests and their natural enemies on cabbage under new alluvial zone of West Bengal
...all) seedlings were transplanted in the plot of 9 m2 area with 45cm x 45cm spacing. Observation was recorded at weekly interval from randomly selected five plants /plot. Peak population of diamond back moth (DBM) was recorded on 1st March and 23rd February with13.60 and 14.33 larvae /plant during 2011-12 and 2012-13 respectively. Cabbage aphid reached its peak on 9th February (14.17 aphids...
Abhijit Ghosal and M. L. Chatterjee
Bioefficacy of imidacloprid 17.8 SL against whitefly, Bemisia tabaci (Gennadius) in brinjal
...hitefly population (1.55/plant) and offered maximum reduction of whiteflies (83.15%) as well as highest marketable fruit yield (146.50 q/ha). However, imidacloprid at lower doses showed nearly similar results. The other neonicotinoid, thiamethoxam also provided similar levels of protection as that of imidacloprid. The conventional insecticide, methyl demeton (125 g a.i./ha) was less effective....
Dharmishthabahen R. Shah and Abhishek Shukla
Reaction of gerbera cultivars to spider mite, Tetranychus urti-cae Koch (Tetranychidae: Acari) under polyhouse conditions
...e popu-lation (1.62mites/plant) whereas Venezia and Fana were tolerant to spider mite with 7.72 and 9.67 mites per plant, respectively. The gerbera cultivar C. F. Gold (13.31 mites/plant) and Stanza (15.56 mites/plant) were medium tol-erant under polyhouse conditions. On the basis of biomorphological characters cultivar stanza has maximum mite population...
Shams Ur Rehman, Muhammad Arif and Abdul Mateen
Soil-borne viruses in major potato growing areas of Pakistan
...produced by them on host plant. The interaction and association of vi-ruses (PMTV and TRV) and their vectors was calculated by using Jaccard index of similarity. The association of PMTV to its vector Spongosporsa subteranea in Hazara division was found 27.0% while their association in Malakand division was found 24.4%. The TRV associated to its vectors Trichodorus in Hazara division was found 8.94% while in Malakand division was 20.70%. It was concluded that m...
A. K. Ganguly and Uma Rao
Decades of researches in biochemical and molecular nematology at IARI
...and molecular biology of plant parasitic nematodes during the early seventies of last century. The main research areas were biochemical mechanism of resistance against phytonematodes and diagnostics of economically important plant parasitic nematodes. Specific isozymes have been identified for differentiating the important root knot nematodes species of India belonging to the genus Meloiodogyne. Further, molecular markers li...
Amitava Konar and N. Johnson Singh
Occurrence of aphids on various potato germplasms in eastern gangetic plains of West Bengal
...s. Potato seed tuber was planted by end of November following all standard agronomic practices except insecticide application. The aphid species viz. Myzus persicae (Sulzur) and Aphis gossypi Glover were recorded first during third week of December and crossed the threshold limit (20 aphids/100 compound leaves) during first to second week of January in Kufri Chandramukhi whereas in Kufri Jyoti and Kufri Joawhar, the pest was observed first by fourth week of De...
Anil Sehajpal, Saroj Arora and Parminder Kaur
Evaluation of plant extracts against Rhizoctonia solani causing sheath blight of rice
... antifungal effect of 44 plant extracts and 8 plant oils against the pathogen Rhizoctonia solani was evaluated by disc diffusion method. Out of 44 plants tested, 36 plant extracts showed varied degree of antimicrobial effect at different concentrations against the pathogen whereas 8 plant extracts, viz. Abrus precatori...
S. Pal, H. Banerjee and N. N. Mandal
Efficacy of low dose of herbicides against weeds in transplanted kharif rice (Oryza sativa L.)
...SC against weeds in transplanted kharif rice was studied at Regional Research Sub-Station (New Alluvial Zone), Bidhan Chandra Krishi Viswavidyalaya, Chakdaha, Nadia, West Bengal. The experiment was laid out in a randomized block design with 7 treatments and 3 replications. The results revealed that the major weed flora associated with the transplanted rice during kharif season was mainly comprised of Echinochloa colona (30 %...
Dhananjoy Mandal
Eco-friendly management of mealybug and wilt in pineapple
... 10 G @ 20 kgha-1 during planting + monocrotophos 36% EC @ 0.03% at 100 DAP + endosulfan 35% EC @ 0.02% during 150-180 DAP]; T2 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G @ 15 kg ha-1at 100 DAP + Neem oil 1500 ppm spray @ 2.5 m/L-1 at 150 DAP]; T3 [Treating planting materials (basal portion) with monocrotophos 36% EC @ 0.02% + phorate 10 G...
Partha Pratim Ghosh and 2N. C. Mandal
Some disease management practices for bacterial wilt of potato
...that T1 (TPS whole tuber planting) and T4 (supervised management - cowdung @ 40 ha-1 at land preparation + seed piece tuber treatment with carbendazim 2.5 gL-1 and Streptocycline @ 1 gL-1 + stable bleaching powder drenching with out removal of affected plant at 40 Days After Planting (DAP) @ 10 gL-1, along with protective banding with well decomposed cowdung + oilcake + Single Super Phosph...
K. K. Hegde and B. S. Nandihalli
Bioefficacy of some indigenous products in the management of okra fruit borers
...umber of eggs (1.40 eggs/plant) followed by NSKE (5%) alternated with cow dung 10 per cent (1.71 eggs/plant). Repeated sprays of cow dung and cow urine used individually were not effective against the borers and recorded higher fruit damage of 55.70 and 52.10 per cent, respectively. GCKE was significantly superior in reducing the fruit borer damage to the tune of 64.83 per cent with higher fruit yield of 35.87 q.ha-1. The hi...
Shrinivas Mudigoudra and Shekharappa
Evaluation of plant products aganist sorghum shoot fly, Atherigona soccata Rondani
...he efficacy of different plant products against sorghum shoot fly during Kharif 2005 at University of Agricultural Sciences, Dharwad. The different plant products used in the study were, Vitex negundo, NSKE, Adathoda vesica, Pongamia glabra, Vinca rosea, Butea monosperma, Aloevera @ 5% concentration and were compared with carbofuran 3 G @ 30 kg. ha-1 to know its efficacy on shoot fly in sorghum ecosystem. The results clearly...
Sujoy Mondal and S. S. Ghatak
Bioefficacy of some indigenous plant extracts against epilachna beetle (Henosepilachna vigintioctopunctata Fabr.) infesting cucumber
...o find out the impact of plant derived pesticides viz; Neem Azal, Rhizome extracts of Acorus calamus with petroleum ether as solvent and seed extracts of Annona squamosa with methanol as solvent in controlling epilachna beetle, Henosepilachna vigintioctopunctata, Fabr; Both Neem Azal and seed extracts of Annona squamosa were used at 4ml, 5ml and 6ml (per Lt. of water) while this was 1ml, 2ml and 3ml (per Lt. of water) in case of petroleum ether extract of rhiz...
V. S. Desai, S. D. Desai, A. J. Mayekar and V.G. More
Infestation of coconut eriophyid mite, Aceria guerreronis Keifer in Konkan region of Maharashtra
... cause damage in coconut plantations in Konkan region of Maharashtra from January 2002. Three orchards from this area were surveyed to record infestation level of this pest in April and October of 2004 and March 2005. The survey indicated that the infestation was higher in Thane district followed by Sindhudurg district.
...
Manidipa Chowdhury
Incidence of saw fly, Athalia lugens proxima Klug. as influenced by level of irrigation and fertilizers on mustard
... population (0.26 larvae/plant) was recorded on the crop grown without irrigation and medium level of fertilizers (60:30:30 Kg NPK ha-1) while lowest population level (0.10 larvae/plant) was observed at highest level of irrigation (three) coupled with medium level of fertilizers (60:30:30 kg NPK ha-1) and two irrigations coupled with lowest level of fertilizers (40:20:20 Kg NPK ha-1).
...
Shyam Singh and L.P. Awasthi
Plant products for the management of yellow mosaic disease of mungbean and urdbean
...n, respectively. Maximum plant height (70.90 and 56.20 cm), primary branches (6.36 and 6.38 per plant), secondary branches (13.56 and 10.68 per plant), nodules (27.48 and 37.69 per plant), pods (17.25 and 22.85 per plant), seed yield (4.43 and 3.89 g per plant) were recorded in eight...
S. Pal and I. Sarkar
Pests infesting ornamental plants in hilly region of West Bengal
...ing different ornamental plants viz. Myzus persicae on Carnation, gerbera and Anthurium; Macrosiphoniella sanborni on Chrysanthemum; Aphis gossypii on China rose. Other sucking pests infesting ornamentals included Bemisia tabaci on Gerbera, leafhopper on Gladiolus and scale insect (unspecified) on Anthurium. Amongst the thysanopteran pests Taeniothrips simplex was very much serious on Gladiolus and another species of thrips (unspecified) was found infesting Ca...
Freeha John, Noor Abid Saeed*, Sajid Nadeem and Muhammad Hamed
... evaluate the use of the planting time and the insecticide sprays for managing aphids to avoid losses to grain yield. During the crop season in year 2015-16, wheat variety (Millat 2011) was sown on three planting dates: mid Nov (crop 1), end Nov (crop 2), and mid Dec (crop 3). Trial was laid out in split plot design having three replications. Planting dates were kept in main plots while, i...
P.P. Ghosh*, C. Ghosh, B. Mahato, A. Chakraborty, S.K. Bhattacharya and M.K. Bhattacharjya
... destruction of diseased plants (farmers’ practice). Results indicated all the management approaches under study performed significantly superior to farmers’ practice in terms of reduction in disease severity (32.8-43.6%), yield increase (20.9% - 26.8%) and benefit-cost ratio. Integrated approach was the best approach followed by prophylactic and curative soil disinfestations. Thus, for the present micro-level situation vascular bacterial wilt mala...
1Sitesh Chatterjee, 1Chirasree Gangopadhyay and 2Santosh Kumar Roy
...less expensive than transplanted main-field because of smaller area of nursery that can be managed better way as compared to transplanted field. In the present study, chlorantraniliprole granule was applied both in seedbed and transplanted field along with spraying of some new generation insecticides like indoxacarb, flubendiamide, spinosad and chlorantraniliprole to test their efficacy ag...
Gadeeyya G and Ratna Kumar P.K.
...dy was conducted on weed plants for the primary investigation of natural enemies which may became promising biocontrol agents. A total of 7 weed plants include Commelina benghalensis, Cyperus rotundus, Crotalaria verrucosa, Digera muricata, Sida cordifolia, Ipomoea pestigridis and Trianthema portulacastrum were selected for in vitro studies. Fungal isolates namely Ascochyta cypericola, Bipolaris s...
Azhar Abbas Khan1,*, Arif Muhammad Khan2 and Muhammad Afzal3
...hemicals released by the plants in response to herbivorous attack influences third trophic level and natural enemies use these substances to locate their prey. Twelve-arm olfactory apparatus was used to evaluate the response of C. septempunctata toward aphids and different host plants of aphids. Different horticultural plants and field crops were used singly or in combination with p...
Shahid Iqbal Khattak1*, Mohammad Safdar Baloch1, Khalid Naveed2 and Ejaz Ahmad Khan1
...tly (P≤0.05) affected plant height (89 cm), tillers m-2 (313), grains spike-1 (48), 1000-grain weight (43.0 g) and economic yield (3760 kg ha-1). Foliar applied nitrogen also produced higher nitrogen use efficiency, net return, value cost ratio and relative increase in income as compared to soil applied method. However, maximum grain protein content was recorded in soil applied method in comparison to foliar N application. In conclusion, higher results for ...
Khurram Shahzad and Mohammad Akmal*
...s recommended for wheat, planting was made with basic seeds (cv. Pakhtunkhwa) using seed drill in rows spaced 0.25 m equal distances. Recommended rates of phosphorus and potassium were applied yielding 90 and 60 kg ha-1respectively while the N-application rates (i.e. NAR 0, 100, 120, 140 and 160 kg ha-1) were added with different N application timings (i.e. NAT1100% at seedbed, NAT2 50% at sowing and 50% 70 days after sowing (DAS), NAT3 25% at sowing, 50% + 70...
Oaj Khurshid1*, Naureen Aurangzeb1, Ayaz Khan1, Alia Naz1, Abdullah khan1, Sobia Nisa2 and Sehrish Sajawal3
...has adequate quantity of plant nutrients C34%, N (0.06%), K (0.32%), P (0.004), Na (4.6%). The quality of compost could further be enhanced with the addition of yard waste or cow and poultry manure etc. For land reclamation or plant productions the use of compost may be supportive not only increase moisture holding capacity but also help to sustain soil conditioning. Composting through MSW could be introduced country wise as...
Ayesha Ilyas1, Hafiz Azhar Ali Khan2,* and Abdul Qadir1,*
...tracts of six indigenous plants viz., amaltas (Cassia fistula), datura (Datura alba), neem (Azadirachta indica), niazboo (Ocimum basilicum), yellow kaner (Thevetia peruviana) and safeda (Eucalyptus camaldulensis) against the peach fruit fly, Bactrocera zonata (Saunders), at 2% concentration in a free choice bioassays. Acetone, chloroform, petroleum ether and ethanol were used for extraction from leaves. A...
Muhammad Imran Shabbir
...pproach is the basis for plant and animal breeding to get desired varieties as well as performing genetic analysis including prediction of patterns of inheritance in family lines and to calculate the recurrence risk for relatives etc. Punnett square is used to describe the possible combinations of paternal and maternal alleles for a particular cross. Described here is a line-dot method using ternary genotype codes to determine genotype probabilities in a very ...
Aftab Wajid1, Ashfaq Ahmad1, Muhammad Awais2, Muhammad Habib-ur-Rahman3*, M. Aown Sammar Raza2, Usman Bashir2, Muhammad Naveed Arshad1, Sana Ullah4, Muhammad Irfan5 and Umair Gull1
...more number of bolls per plant (31.00), average weight per boll (3.48 g) and ultimately lead to higher seed cotton yield (2.42 t ha-1) as compared to other N rates (50, 100, 150 kg ha-1). Significant differences were also observed in cultivars, CIM-496 produced higher seed cotton yield than other under arid climate of Multan in Cotton-Wheat Cropping system. Empirical model was developed on the basis of field observations to compute the seed cotton yield beyond...
Niamatullah Khan1*, Najeeb Ullah2, Inam Ullah2 and Asif Imran Shah1
... cotton yield while late planting induced flowering and boll formation when temperature was much cold that adversely affected cotton yield. The results further illustrated that, genotype DNH-105 ranked first for plant population, sympodia per plant, bolls per plant, weight per boll and seed cotton yield when sown on April 01. CIM-616 was the 2nd suitable...
Saba Irshad1,*, Ayesha Ashfaq1, Ammara Muazzam1 and Abida Yasmeen2
Adnan Yousaf1,Jia Wu1, Qaiser Shakeel2, Yasir Iftikhar3, Muhammad Irfan Ullah4, Uzma Tahira5,Mustansar Mubeen1 and Wubei Dong1,*
...i>. Two week old chilies plants were inoculated with M. incognita, S. rolfsii separately and in combination as well. At harvesting, roots of C-302 contained significantly fewer galls (30) and egg-masses (51) compared to the other fourteen cultivars. Seven cultivars including C-33, Gola Peshawari, 11-2010, 18-2010, 15-2010, 27-2010 and C-68 had 10 root galling and egg-masses indices (from a scale of 0-10). Hence, present study shows that none of the avai...
Muhammad Ibrahim and Ahmad Khan*
...of 50% FYM had increased plant at harvest (2%) over control (no-fertilized) plots. In conclusion, the plastic mulching had increased emergence. Thus a more optimum source of 50% N from farmyard and 50% from urea would be more suitable for appropriate phenological stages and improved crop stand....
Attaullah Khan1, Muhammad Shafi1*, Jehan Bakht2 and Shazma Anwar1
...40% and 73.89%), tillers plant-1(2.83 and 3.49), leaves plant-1(11.44 and 12.79), leaf area (21.47cm2 and 25.20cm2) and more days to emergence (9.92 and 8.98), was recorded from salinity levels of 135mM and 90mM, respectively compared with maximum germination (94.80%), tillers plant-1 (4.42), leaves plant-1 (17.45), leaf area (32.10cm2) less number of da...
Sania Shaheen1*, Hina Fatima2 and Muhammad Azeem Khan3
...ainly using for the transplanting of rice paddle (Conventional method) and Direct seeded method (Dry method) in rice growing areas of Punjab. In last some years, the direct seeded rice system is introduced in some of the rice cropping districts of Pakistan. The current research estimate the technical efficiency of conventional and dry rice farmers and also determine the factors which significantly contribute to increase the rice output. Moreover, this study es...
Kulsoom Akhter1, Tahseen Ghous1,2,Saiqa Andleeb3,*, Faiz-ul-Hassan Nasim4, Samina Ejaz5, Zain-ul-Abdin1, Bilal Ahmed Khan1 and Muhammed Naeem Ahmed1
..., Ni(II) and Cd(II). The plant was selected due to its natural abundance in the climate of Kashmir and also in the area of study. On the basis of morphological, biochemical, 16S rRNA gene sequencing, the isolates were identified as B. cereus BDBC01, B. cereus AVP12 and B. cereus NC7401. At maximum studied concentration of metal ions (250 mgl-1), in above sequence, the strains accumulated 118.2, 121.87 and 90 mg/g Cr (VI), 135, 1...
Kamran A. Awan1, Jawad Ali2 and Mohammad Akmal3
... Pakistan. Wheat crop is planted on more than 52% area as rainfed crop in the providence Khyber Pakhtunkhuwa (KP). The study, therefore, aims to plant wheat in season from early to late i.e. November 15 to December 25 with about 10 days intervals. Field experiment was conducted at Agronomy Research Farm, the University of Agriculture Peshawar in winter season 2015-16. Experiment was in a randomized complete block design, in ...
Muhammad Tariq Saeed1*, Muhammad Ashfaq Wahid1, Muhammad Farrukh Saleem1, Mumtaz Akhtar Cheema2, Muhammad Shahid1, Abdul-Shakoor1, Abdul-Sattar3
...ays to maturity (96.42), plant height (25.84 cm), plant population at harvest (25.22), 1000-seed weight (94.97 g), seed yield (1.71 t ha-1) and biological yield (4.37 t ha-1) of both soybean varieties was significantly improved by hydration inoculation and hydro priming techniques. It was concluded that hydration inoculation and hydro priming were best techniques for better stand establishment of soybea...
Muhammad Amin1*, Khalid Mahmood2, Imran Bodlah3, Muhammad Rahim Khan2
...was recorded on new host plant, Rosa species, in Pakistan. Distinguishing characters, morphometric data, biology and distribution of the studied species are provided herewith. ...
Sadia*, Abdur Rab, Sayyed Hamad Ahmad Shah, Irfan Ullah, Farida Bibi and Islam Zeb
...5.5cm3) were recorded in plants deblossomed in September treated with 50 ppm of GA3. While maximum fruit density (1.13gcm-3) was recorded in the month of July fruits treated with 10 ppm of GA3. While maximum fruit drop (11.69%), titratable acidity (0.59%), with minimum number of new shoots (16.3), number of new flowers (65.3), fruit weight (53.3g), and fruit volume (48.1cm3) were recorded in plants which were not deblossomed...
Mohammad Umar Farooq1*, Sarfaraz Ahmad2, Ghulam Nabi1, Ijaz Ali1 and Imtiaz Ahmad1
...otosynthesis process via plant biomass is the extent of this atmospheric gas. An experiment the data for above and below phytomass for grazed and un- grazed range land was collected and carbon pool was estimated by Wet Combustion and Dry Combustion method.Four transect lines were drawn in each experimental plot. Twenty four samples of each experimental plot were collected with the help of ADC one m 2 quadrate methods, weighed and then oven dried at ...
Saleem Khan1, Amir Hamza2, Farhadullah Khan3, M. Subhan4, Aziz Khan1, Irfan Ali Shah1, Shakirullah Khan Shakir3*
... using cotton as a model plants, the present study was designed. For this purpose, dry seeds of four cotton genotypes (Gomal-93, Bt-131, Bt-121 and Bt-CIM-602) were exposed to gamma rays with 10, 15, 20 and 25 Kilo Radium (KR) doses sourced from 60Co. The irradiated seed samples were assumed treated seeds while non-irradiated seeds of each genotype were used as control. Field experiment was conducted in randomized complete block design (RCBD) in thr...
Shantanu Jha1, A. Rama Devi1, Ngalaton Kasar1 and Abhishek Mukherjee2
Abdur Rab1*, Muhammad Sajid1, Naveed Ahmad1, Khalid Nawab2, Syed Ghias Ali3
...gated by exposing tomato plants to 0, 75 and 150 mM salinity; and foliar application of 0.0, 0.25, 0.50, 0.75, 1.0, 1.25% calcium solutions. Salinity stress increased leaf Na+ and Na+/ K+, fruit firmness and blossom end rot (BER) incidence but significantly decreased the leaf K+ and Ca content of the fruit and yield. The foliar calcium application decreased the Na+ accumulation, Na+/ K+ ratio and BER incidence as well as increased the leaf K+ and Ca content of...
Qudsia Khalid, Safdar Hussain Shah*, Faiza Zaeem and Saad Hussain Shah
...n adapted line. Complete plantlets were obtained in about ten days while normally plantlets were obtained after 28 days. ...
Mian Ahmad Raza*, Ghulam Hassan and Naqib Ullah Khan
...esultant F1 hybrids were planted following a randomized complete block design using three replications in the subsequent wheat growing season of 2012-13. For days to maturity, F1 cross combination PS × FS among the F1 hybrids showed earliness (160.7) whereas F1 cross combination BST × SRN and JNB × BST ranked first among the crosses for spike length (15.9 cm). Among the F1 hybrids, FS × SRN and TTR × BST displayed maximum spikelet...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Irfan Ullah1,*, Muhammad Arshad1, Mubasshir Sohail1,2 and Jaime Molina-Ochoa3,4
Masooma Munir1,2*, Aqsa Qayyum1, Saeeda Raza1, Nouman Rashid Siddiqui1, Amer Mumtaz1, Naeem Safdar1, Sahar Shible1, Sohaib Afzal3, Saiqa Bashir4
...t only as pharmaceutical plant but also for culinary purpose. The current study has been undertaken to develop a nutritious, healthy and value added drink. Proximate, mineral analysis, total polyphenol content and mineral analysis of basil seeds was conducted. Result revealed that basil seeds are not only good source of fiber and protein but they provide appreciable amount of minerals and phenolic compounds. Swollen basil seeds were used to prepare beverage at...
Asim Gulzar1,*, Ather Maqsood1, Munir Ahmed1, Muhammad Tariq1, Muhammad Ali2 and Rahmatullah Qureshi3
... like biocontrol agents, plant extracts etc. In the present study the extract of Citrullus colocynthis in different solvents were evaluated on second instar larvae of H. armigera under laboratory studies for toxicity, sublethal and antifeedant effect. The result showed that ethanol based extract was the most effective to control the H. armigera followed by the ethyl acetate. The sublethal concentration of ethanol based extract of
Nargis Bano and Khalid Mahmood Qureshi*
...otect several species of plants against environmental stresses by initiating different processes that are involved in the mechanism of stress tolerance. SA is part of an extremely complex signal transduction network’s part and it works differently in different systems. Drought stress is a major restraint for crop production in arid and semi arid states such as Pakistan. In this study experiments were conducted against the responses of strawberry
Zakirullah Jan1, Shamsher Ali1*, Tariq Sultan2, Wasiullah1 and Wiqar Ahmad1
...mprovement of some major plant nutrients and soil organic matter content (SOM) under saline soil and yield of rice crop at National Agricultural Research Center (NARC) Islamabad during summer 2016. Pots were induced with salinity of 7.0 dS m-1 and arranged in Completely Randomized Design (CRD) with three replications. Six treatments consisted of a control (no strains) and 5 different strains of cyanobacteria i.e Oscillatory-MMF-1 (Oscillatoria princeps), Lepto...
Abdus Subhan1, Qudrat Ullah Khan1, Muhammad Mansoor2 and M. Jamil Khan1
...(p≤0.05) variation in plant growth, yield parameters of wheat and water use efficiency. The inorganic fertilizer gave significantly higher total dry matter, grain and straw yield and also due to the greater grain yield the water use efficiency calculated was greater in the NPK treatment. Bulk density, porosity and organic matter were significantly improved by the cattle manure and compost treatments. The moisture content and water holding capacity revealed ...
Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali*
... that deliver T-DNA into plant cell from which whole plant can be regenerated. The results indicated that optimal embryo physiological age is 15 and 18 days after pollination and transient transformation efficiency decreased at 22 days after pollination. Enhanced transient beta glucuronidase (GUS) expression with average frequency of 40.56% was noticed with three days of co-cultivation period while two days of co-cultivation...
Zaheer Abbas*, Shaukat Ali, Jalal-Ud-Din and Ghulam M. Ali*
...to regenerate into whole plant under specific chemical and environmental conditions....
Zabih Ullah*, H. Rahman and Niaz Muhammad
...y desirable as it allows plants to escape various biotic and abiotic stresses. It also makes multiple cropping possible as the land becomes available for next crop. Keeping the importance of early maturity of maize crop in view, the present study was conducted to evaluate different maize hybrids for maturity and related traits in the geographical location of Khyber Pakhtunkhwa. The experiment was conducted at The University of Agriculture, Peshawar during the ...
Shakeel Ahmad Anjum, Muhammad Farrukh Saleem, Muhammad Shahid, Abdul Shakoor*, Muhammad Safeer, Imran Khan, Ayesha Farooq, Iftkhar Ali and Usman Nazir
...f Zn and B produced more plant height, cob length, girth, stem girth, shelling percentage, number of grains per cob, 1000-grain weight, harvest index, grain and biological yield. Maximum marginal rate of return was obtained with foliar application of both Zn and B and using foliar Zn alone. Integrated B and Zn application produced more marginal rate of returns both in soil and foliar applications. Use of foliar Zn application also depicted promising results wh...
Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3*
...me reduction in xenotransplanted SCID mice and by histopathological and immunohistochemical analyses. Our results demonstrated that fusion protein VEGFR1(D1-D3)-Fc efficiently inhibited
the lung cancer growth in vivo. Although the aptamer RNV66 was not found to be as efficient in this study, the results were also not surprising as the aptamer was administered naked and at low dose. As these are only our preliminary studies, a detailed investigation is p...
the lung cancer growth in vivo. Although the aptamer RNV66 was not found to be as efficient in this study, the results were also not surprising as the aptamer was administered naked and at low dose. As these are only our preliminary studies, a detailed investigation is p...
Mahmood-Ul-Hassan*, Naeem Fiaz, Muhammad Akhlaq Mudassir and Muhammad Yasin
...r harvesting schedule of plant crop is essential since low temperature severely effects the sprouting of subsequent ratoon in cane growing areas. A field study was conducted on loamy soil during 2011-2013 at Sugarcane Research Institute (SRI), Faisalabad to explore the ratooning ability of five sugarcane varieties/clones under varying harvesting dates of plant crop using randomized complete block design (RCBD) with split plo...
Attaullah Ansari* and Nasreen Memon
...lation of number of host plant species with the profusion of hoverflies whereas; temperature had a strong negative and significant correlation with the abundance of hoverflies. Moreover relative humidity, rainfall and cloudiness were also negatively correlated with hoverfly population but their correlation was not significant. Habitat wise variation in average population size, species richness, evenness and diversity index were also calculated. The highest and...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...use direct damage to the plants by extracting the sap, and indirectly it is a vector to 16 plant viruses. The study presents data referring to the external morphological characteristics, to the biometrical measurements and to the life cycle of Aphis nasturtii. The researches have been carried out for a period of four years on the potato and for a period of two years on the orchards from Romania. At the Aphis nastur...
Amjad Ali1*, Sher Aslam Khan2, Abid Farid2, Ayub khan2, Shah Masaud Khan2 and Naushad Ali2
...es were conducted in two plant crops to calculate broad sense heritability (repeatability), genetic gain and correlations among the parameters, and establish selection criteria.Highly significant (p ≤ 0.01) differences were found among the genotypes for number of tillers, plant height, cane length,number of nodes, internodes length,number of millablecane and cane yield while non-significant differences were recorded for c...
Estimation of Heritability, Genetic Advance and Correlation for Marphological Traits in Spring Wheat
Arshad Iqbal1*, Iftikhar Hussain Khalil1, Syed Mehar Ali Shah1 and Muhammad Sharif Kakar2
... the performance of crop plants by knowing the magnitude of heritability. An experiment was conducted using a set of spring wheat genotypes to estimate heritability for various plant traits during crop season 2014-15 at the University of Agriculture, Peshawar. The randomized complete block design with three replications was used in the experiment. Data were recorded on yield and some other important ...
Ayesha Aihetasham1,*, Muhammad Saeed Akhtar1, Maryam Umer1, Khalid Zamir Rasib2 and Muhammad Imran Din3
... Chemical composition of plant extracts by chromatography-mass spectrometry (GC-MS) revealed five different compounds in F. vulgare: Piperidine, 3-isopropyl, Bicyclo[2.2.1]heptan-2-one, 1,3,3-trimethyl, Benzaldehyde, 4-methoxy, Estragole, 11-Octadecenoic acid, methyl ester and 9-Octadecenoic acid ethyl ester. Whereas nine different compounds were identified in extracts of O. basilicum. These were: 1-Isopropyl-2, 2-dimethylpropylideneamine, Campho...
Mahreen Yahya, Noor Abid Saeed*, Sajid Nadeem, Muhammad Hamed and Sajid Shokat
...id attack, which affects plant vitality and grain production. Planting resistant/tolerant varieties against pests is the main way to overcome these field losses. Present study is an effort to screen different wheat varieties/lines against aphids under field conditions. Wheat varieties, Galaxy-13, Millat-11, Lasani-08, Faisalabad-08, and two wheat lines NW-1-8183-8 and NW-3-3341-7 were sown at Nuclear Institute for Agricultur...
Tahira*, Muhammad Arshad, Muhammad Ayub Khan and Mubashar Ahmad Khan
...re branches and pods per plant.CRH-35 in cluster-VI was high yielding and has more seeds per pod. Similarly in second year, these thirty-six Brassica hybrids were grouped into ten clusters. Cluster-I consist of seven hybrids. Analysis for mean and standard deviation showed that hybrids in Cluster-VII (Hyola-401) was short durational and produced more number of seeds per pod. Genotypes CRH-84 and CRH-235 grouped in cluster IV produced maximum number of branches...
Muhammad Qaisar Nawaz
...imental N rates. Data on plant height (132.00 cm), number of plants (91.33 m-2), number of tillers (146.00 m-2), number of leaves tillers-1 (5.66), total dry matter (17.70 t ha-1) and fodder yield (60.90 t ha-1) showed that nitrogen application @ 150 % N of recommended dose with drill sowing proved to be the most cost effective technique for fodder oat production in salt...
Muhammad Imran Mahmood* and Muhammad Zubair
...ls exhibited the highest plant height in Sufeda under flooding which were 135 and 125cm after and before the experiment. However, Neem showed maximum plant height after experiment (103 cm) under drought condition. But, the minimum plant height (57 cm) before experiment was observed in Sufeda under droughtexhibiting 50% decline than Sufeda under flooding. Contrary to that Neem exhibited the...
Ehab Bo Trabi1,2, Xianjun Yuan1, Junfeng Li1, Zhihao Dong1, Assar Ali Shah2 and Tao Shao1,2,*
Muhammad Anas1, Abdul Jabbar1, Muhammad Aqeel Sarwar2*, Raza Ullah1, Muhammad Khubaib Abuzar3, Ijaz Ahmad4 and Sohail Latif5
...uded viz. Four sunflower plants m-2 + 30 mungbean m-2, 6 sunflower plants m-2 + 30 mungbean plants m-2, 8 sunflower plants m-2 + 30 mungbean plants m-2, 4 plants m-2 of sunflower alone, 6 plants m-2 of sunflower alone, 8 pl...
Muhammad Asad1, Safdar Ali1, Muhammad Ramzan Ansar2, Ijaz Ahmad3*, Muhammad Suhaib4 and Muhammad Khubaib Abuzar5
...t growth parameters like plant height, number of tillers per m2, spike length and number of spikelets per spike remained statistically at par among various treatments. Significantly higher number of fertile tillers (172), Plant height (93.83 cm), spike length (7.4 cm) were noted with Wheat Star @ 370.5 g ha−1. Although treatments did not differ significantly with respect to wheat grain and biological yields, yet the hi...
Muhammad Aqeel Sarwar1,2*, Muhammad Tahir2, Abid Ali3, Manzoor Hussain3, Muhammad Waheed Anwar4, Muhammad Khubaib Abuzar5 and Ijaz Ahmad6
... and moringa are rich in plant nutrients and becoming popular in farming community as a green manure. An experiment was conducted for evaluating green maunuring of moringa and jantar along with inorganic fertilizers to enhance the yield and quality attributes of autumn maize at Agronomic Research Farm, University of Agriculture, Faisalabad. There were two factors, green manuring (No green manuring, moringa green manuring and Jantar green manuring) and differen...
Ehtisham Shakeel Khokhar1*, Amir Shakeel1, Muhammad Amir Maqbool1, Muhammad Waheed Anwar1, Zoraiz Tanveer1 and Muhammad Fahad Irfan2
...ton genotypes were field planted in randomized complete block design (RCBD) in three replications to assess the genotypes for plant height (cm), number of sympodial branches, number of monopodial branches, seed cotton yield (g), number of bolls, boll weight (g), lint percentage (%), fiber strength (g/tex), fiber length (mm) and fiber fineness (µg/inch). Analysis of variance revealed significant differences at 1% level ...
Imran Ali Rajput1*, Tajwer Sultana Syed1, Ghulam Hussain Abro1, Imran Khatri1 and Abdul Mubeen Lodhi2
Imtiaz Ahmed, Muhammad Abbas Khan, Noorullah Khan, Naveed Ahmed, Abdul Waheed, Fazal Yazdan Saleem, Sajjad Khan and Sohail Aslam
...to determine the optimum plant spacing in order to abate garlic rust and maximize garlic crop yield. The experiment was carried out in RCB design with three replications; garlic cultivar (china) and three levels of intra-row spacing (10, 15 and 20 cm) were included in the study. Data regarding disease occurrence, disease severity, plant height (cm), bulb weight (g), bulb diameter (mm), clove weight (g), number of cloves bulb...
Bibi Haleema1*, Abdur Rab1 and Syed Asghar Hussain2
...cation at 0.6% increased plant height (88.04 cm), number of primary (2.63) and secondary (7.15) branches, leaves plant-1 (182), leaf area (65.52 cm2), and fruit per plant (66.15). In case of B levels, more plant height (88.14 cm), number of primary (2.61) and secondary (7.44) branches, number of leaves plant-1 (177), n...
Riaz Alam* and Muhammad Sajid
..., 30 and September 14 in plants of olive cultivars Frontoio, Manzanilla, Ottobratica, Pendolino and Picual. Significant variations were recorded among olive cultivars regarding asexual propagation through air-layerage. The daughter saplings of cultivar Manzanilla took less number of days (47.94) to root appearance, produced more rooting percentage (38.89%), number of roots (4.31), root length (4.61 cm) and root weight (1.77g) with more number of re-sprouts (3....
Temel Gokturk1, Elif Tozlu2,* and Recep Kotan2
...auses harm in almost all plants that grow along the Eastern Black Sea coast. The chemicals used to control this pest are prohibited in this region due to tea cultivation. For this reason, new strategies are needed to control this pest. With the awareness on the negative effects of the chemicals used in the control against pests and with the increasing awareness on environmental issues, alternative methods were sought in the past; and in this context, studies w...
Rafiullah*, Muhammad Jamal Khan and Dost Muhammad
... weeks of seedlings transplantation. Each treatment unit consisted of 10 seedlings arranged in CR design with three replications. Plant height, shoot and root dry biomass of 6 weeks old seedling were significantly increased with each increment of foliar P suggesting effective absorption through leaf stomata and translocation to other parts of the plant body. The pl...
Muhammad Siraj-ud-Din1,2, Riaz Aziz Minhas1, Usman Ali3,*, Mayoor Khan2, Muhammad Siddique Awan1, Nuzhat Shafi1 and Basharat Ahmad1
...ltistan. Thirty-six (36) plant species were recorded to be consumed by the Ladakh urial in Gilgit Baltistan. Ladakh urial used Artemisia maritima (n=53) with 18.34% of observations followed by Olea ferruginea (n=28, 9.69%), Ephedra intermedia (n=25, 8.65%), Pistacia khinjuk and Ephedra gerardiana (n=23, 7.69%). Out of 36 plant species, 15 were consumed during summer (June to August), 10 in ...
Hayat Badshah1, Farman Ullah1, Paul-André Calatayud2, Hidayat Ullah3 and Bashir Ahmad1
... to the locality and the plants on which P. solenopsis is feeding. In this context, this experiment investigated under field and laboratory conditions the influence of the host plant of P. solenopsis on the parasitism success and the female fitness of A. bambawalei, Five plant species, commonly found to be host of P. solenopsis, were tested: hibiscus, pot...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...s urticae, on tomato plants, was tested under greenhouse and laboratory conditions. A sharp reduction in the population of T. urticae was obtained after one week of applying Huwa-San TR50 at a rate of 4000 ppm. This resulted in mortalities of 82.10 and 78.60% under greenhouse and laboratory conditions, respectively. The side effects of Huwa-San TR50 on predatory mite, Neosiulus cucumeris, were also tested to gain successful implementation of ...
Tariq Mahmood*1, Syed Wasif Ahmed Shah1, Muhammad Rais1, Hira Fatima1, Faraz Akrim1 and Muhammad Sajid Nadeem2
...s in studying utility of plant material by avifauna. The current study investigated nesting use of tree species by avifauna at Pabbi Range Forest Kharian (32.811°N and 73.865°E), District Gujrat, from September 2013 to June 2015. Data were collected from five selected sampling sites by searching and identifying nests of different bird species in various vegetation types and observing birds on the nest. The nests were monitored for breeding activity of ...
Ayesha Aihetasham1*, Khalid Zamir Rasib2, Syeda Rida Hasan1, Imran Bodlah3
...racts of three medicinal plants viz., Carica papaya (paw paw), Helianthus annus (Sunflower) and Bougainvillea glabra (Paper flower) against Heterotermes indicola. The leaf extract of C. papaya caused highest mortality i.e. 100% of 10%, 5% and 3% concentration. Bougainvillea glabra and H. annus caused 100% mortality at 10% and 5% concentration while 96.4% mortality on 3% concentration after exposure period of 10 hours. B. glabra extracts also caused 100% mortal...
Muhammad Mudassar Shahzad1*, Syed Makhdoom Hussain1, Farhat Jabeen1, Abdullah Ijaz Hussain 2,Sajjad Ahmad3, Abida Ashraf4,Muhammad Zubair-ul-Hassan Arsalan1
...(phytate) are present in plant by-products reduces the bioavailability of minerals to fish, resulting in poor fish erformance. Test ingredient was used as M.oleiferaleaf meal (MOLM) to prepare six experimental diets that were supplemented with graded levels of phytase (0, 300, 600, 900, 1200 and 1500 FTU kg-1). The fingerlings were fed at the rate of 4% of live wet weight twice a day and feces were collected from each tank. On the basis of results it was noted...
Faiza Hassan1, Mubshara Saadia1,*, Muhammad Sher1, Mian Anjum Murtaza2, Muhammad Arshad3,Asam Riaz4 and Mahmood Ahmad Khan5
...s were post treated with plant extracts (150 mg/kg) and serum samples were collected from overnight fasted diabetic rats on day 15 to observe thepercent changes in blood glucose levels and lipid profile. Garlic extracts have shown the significant (p<0.001) hypoglycemic activity with no considerable effect on mean body weight of rats (ns, p>0.05) as compared to diabetic rats. The AGE treatment has significantly reduced the blood glucose level (56%), howev...
Niamat Ullah Khan1*, Abdul Aziz Khakwani2, Sami Ullah2, Najeeb Ullah2, Abdur Rauf3 and Inam Ullah2
...pproach to ensure better plant population, save irrigation water, cut cultivation costs and increases cotton yield and quality on sustainable basis. Field trial was conducted in 2013 and 2014 at Cotton Research Station, Dera Ismail Khan, Khyber Pakhtunkhwa, Pakistan to study the effect of tillage systems [ridge tillage (RT) and flat tillage (FT)] and 5 nitrogen levels (0, 50, 100, 150, 200 kgN.ha-1) on cotton lint yields, quality and earliness. Experiment was ...
Abd El-Nasser Ahmed Mohammed*
... species.
...
Muhammad Zahid1*, Muhammad Ather Javed Khan2, Muhammad Idrees3 and Ahmad Kamran Khan4
...wers adopted thinning of plants, 91.3% knew pest scouting, 87.3% used pesticides after pest scouting while 74% farmers used pesticides both at morning and evening. It was concluded that integrated pest management project enhanced the skills of farmers and resulted in higher yields of quality cotton through reduction of pesticides sprays ...
Waqas Liaqat1, Mohammad Akmal1* and Jawad Ali
...well as morphology (i.e. plant height, ear height, including ear length) was affected (p<0.05)by sowing dates. Likewise, yield traits (i.e. rows per ear, grains per ear, thousand grain weight) were also adversely affected by sowing dates, which decreases both biomass and grain yield. Varieties did differ in phenology (i.e. emergence, silking, tasseling, maturity) and morphology (i.e. height, leaf area, ear height, cobs per plant
Syed Asif Imran Shah1*, Shah Jehan Khan2, Kalim Ullah1 and Obaid Ullah Sayal2
...ributes of interest were plant height, monopodia plant-1, sympodia plant-1, bolls plant-1, plant population, seed index, boll weight, lint index, staple length, lint %, fibre fineness,staple strength, uniformity ratio and seed cotton yield. The analysis of variance depicted significant (P>0.01) genetic variability a...
Tasleem Akhtar*, Muhammad Asif Aziz, Muhammad Naeem, Muhammad Sheraz Ahmedand Imran Bodlah
... and survival of several plant species. Agricultural productivity depends on population interactions of these pollinators. A field experiment was conducted at PMAS-Arid Agriculture University Research Farm, Koont, Gujar Khan during 2015 to compare the diversity and abundance of different insect pollinators on canola (Brassica napus L. Var. Chakwal Sarsoon) crops along with managed Apis mellifera. Thirty five insect species belonging to twenty fam...
Muhammad Ijaz Khan* and Amanullah Jan
...p growth rate, leaf area plant, plant height, biological yield (above ground parts of the plant), grain and straw N contents were found in five times irrigated plots as compared with lower irrigation regime. Results showed that growth characteristics and quality of maize were significantly affected by soil conditioners (SC). Farmyard manure incorporation produced significantly higher crop ...
Aqsa Waqar1, Sahir Hameed Khattak2, Sania Begum2*, Tayyaba Rehman1, Rabia1, Armghan Shehzad2, Wajya Ajmal2, Syeda Shahdana Zia2, Iqra Siddiqi2 and Ghulam Muhammad Ali2*
... - 100%, due to infected plants and shriveled grain. These problems can be overcome by knowledge about the disease, identifying resistance lines and subsequently develop resistant varieties with an aim to shorten the disease cycle. One of the quickest ways in this direction is the designing molecular markers for non-race-specific resistance genes. Use of molecular markers is efficient tool for screening diversity of rust genes in wheat germplasm and can facili...
Bashir Ahmad1*, Ahmad-Ur-Rahman Saljoqi1, Hayad Zada2, Shahid Sattar1, Toheed Iqbal3, Saddam Hussain1 and Muhammad Saeed4
...2.0 larvae and pupae per plant in the year 2012 and 2013 respectively. The population increased in September to highest number of larvae and pupae per plant (8.25 and 8.4) were recorded in the years 2012 and 2013 respectively. Then population declined from September to November 3.5 and 3.1 larvae and pupae was recorded per plant in both years as the lowest number. In the year 2012, mean ma...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5
... an endangered medicinal plant Neurada procumbens L. from Cholistan desert in Pakistan. Nodal segments from healthy grown plants were used as explants and cultured on standard Murashige and Skoog (MS) medium supplemented with different concentrations and combinations of benzyl amino purine (BAP) or kinetin for shoot induction and Indole acetic acid (IAA) for primary shoot and Indole...
Zahid Akram, Saif Ullah Ajmal, Ghulam Shabbir, Muhammad Munir and Nasir Mahmood Cheema
INHERITANCE MECHANISM OF SOME YIELD COMPONENTS IN BREAD WHEAT
...n weight and grain yield plant-1. The analysis of variance depicted that 56 F1 and their parents were significantly different for all the parameters. Uniformity of Wr-Vr over arrays as well as significant deviation of regression coefficient (b) from unity confirmed the suitability of additive-dominance model to account for the data analysis. The estimates of genetic component of variation in all the traits exhibited the preponderance of
over domina...
Z. A. Soomro, M.B. Kumbhar, A.S. Larik*, M. Imran** and S.A. Brohi***
...f Gossypium hirsutum for plant height, sympodia/ plant, bolls/plant, boll weight, seed index and seed cotton yield/plant was determined. It was found that all the populations alongwith parents differed significantly (P < 0.01) and exhibited genetic variability among the genotypes for all the traits except sympodia/plant...
Muhammad Asim, Muhammad Asif, Muhammad Munir* and Muhammad Aslam**
...culated and uninoculated plants of soybean [Glycine max (L.) Merr.] from the time of inoculation to root-nodule initiation (192 hours after inoculation). 3H-ABA was applied to the leaves of two soybean cultivars: cv. Williams-82 and its hypernodulating mutant, NODI-3. There was a significant difference in the percent uptake of 3H-ABA between the two varieties both in inoculated and uninoculated plants. A marked difference in...
Haq Nawaz Malik*, Iffat Ara**, Muhammad Naeem, Mozammil Hussain, M. Hanif Munawwar and M. Yousaf
...% tasseling and silking, plant height, ear height, number of kernel rows per ear, number of grain per row, 100 grain weight, grain moisture and grain yield. The hybrids NT-6622 and NT- 6651 ranked top and second in grain yield by producing 7842 and 7759 kg ha-1, respectively. Generally the hybrids produced more grain yield than the open pollinated varieties. Days to 50% tasseling ranged from 47.33 (EV-1098) to 64 (NT- 6632) while for silking varied from 47.67 ...
S.A. Khan*, M.M. Rahman Jamro** and M.Y Arain***
...o determine the suitable planting geometry for better yield from TPS mini tubers during autumn 2006-2007 and 2007-2008. It was revealed that even small size (5- 20g, 20-30g) tubers planted at closer row and plant spacing (60cm x 15cm,70cm x 15 cm) produced 31.00%, 31.33% and 28.33%, 32.33% medium size tubers (35-55 mm size). Whereas wider spacing (70cm x 20cm, 50cm x 20cm) produced relativ...
Naheed Akhtar, Muhammad Ashfaque, Waseem Ahmad Gillani*, Ata-ul-Mohsin**, Afzala Tashfeen and Irshad Begum*
... know the effect of host plants on the fecundity of R. padi. Two varieties Wafaq-2007 and Diamond were the least preferred for fecundity and one line V00125 was highly preferred for fecundity....
Sikander Khan Tanveer, Shaheena Yasmin, Imtiaz Hussain, M.Yaqub Mujahid*, Muhammad Munir and Muhammad Asif**
... variety, Chakwal-86 was planted in randomized complete block design (RCBD) with four replications. Because of different combinations of fertilizer NP and FYM, statistically significant differences in biological yield, grain yield and yield components of wheat were recorded. Maximum wheat grain yield of 4083 kg ha-1 was obtained with the application of full fertilizer and FYM. Minimum grain yield and biological yield were recorded with no fertilizer and only F...
Zafar Khokhar*, Imtiaz Hussain**, Badruddin Khokhar* and Muhammad Sohail**
...ring grain filling, late planting results in linear reduction in wheat grain yield. A study was undertaken to determine the effects of planting dates on growth and yield of different wheat genotypes in Sindh. The trial was laid out in RCBD with split plot arrangement having four replications during 2000-01 and 2001-02 at Sakrand, Sindh. Four sowing dates i.e. November 1 and 15, December 1 and 15 were in main plots, whereas s...
Badaruddin Khokhar*, Imtiaz Hussain** and Zafar Khokhar*
...nd Abadgar–93 were planted. Number of irrigation did not have any significant effect on plant height, whereas plant height was affected significantly in different cultivars. Application of five irrigations at different wheat growth stages resulted in higher spike length, higher number of grains and wheat grain yield. Wheat variety Abadgar–93 and V–7004, had taller
Aslam Memon, A. M. Khushk* and Umer Farooq**
... Majority of the farmers planted only one variety. Among recommended varieties, Thatta-10 and CP-77-400 were relatively the most commonly planted. Thatta-10 in Sindh, HSF-240 in Punjab and CP-77-400 in Khyber Pakhtoonkhwa Province (KP) captured significantly large area than other varieties. Based on varietal adoption indicators, although improvements were registered for most of the indicators, however, their magnitude was qu...
Abdullah Adil Ansari* and Kumar Sukhraj**
...he experiment along with plant growth parameters of Okra. The study revealed that combination organic fertilizers vermicompost and vermiwash combination [VW+VC] compared with control [CON] and chemical fertilizers [CHM], had great influence on plant growth parameters. The average yield of Okra during trial showed a significantly greater response in VW+VC compared with the control by 64.27 %. The fruits have a greater percent...
S. Shahid Shaukat*, Mian Sayed**, Aly Khan, M. Azhar Khan* and Babar Qazi***
...chemical nematicides and plant extracts significantly reduced the population densities of all three nematodes. Carbofuran was most effective against all the nematodes. Apart from other three treatments, Tridax procumbens emerged as an effective phytonematicide. Helicotylenchus indicus, Rotylenchulus reniformis and Meloidogyne incognita had similar population density levels and were more or less equally suppressed by all the treatments in the order: Carbofuran ...
Sumia Bint Zaman, Sidra Majeed and Shahid Ahmad*
...hieved in fourth year of plantation of Jatropha. The projected consumption in Pakistan for petro-fuel for 2025 is 35.1 mt, which is almost double of the current consumption. Thus, the target projections for replacement of petro-fuel with bio-diesel will be 3.51 mt for which 3.5 mha of land is required, as Jatropha has to be grown in marginal areas with marginal yields. Comparative economic analysis shows that for sunflower and canola all conditions are favorab...
Ahmed Aziz Kurd, Amanullah, Saifullah Khan, Basharat Hussain Shah and Munir Ahmed Khetran*
...uttings were immediately planted in polyethylene tubes (10 cm x 20 cm) filled with a sandy loam soil. In the control, the cuttings were planted directly in polyethylene bags without IBA application. Plants were kept in a shade house and humidity was increased manually by hand sprinkling (four times in a day). Highest rooting percentage (60%) was obtained in the cuttings treated with 3000 p...
Tariq Mahmood, M. Sudheer Tariq, Khalid Mahmood Khokar, Hidayatullah and Syed Ijaz Hussain*
...tive effect of different plant extracts (neem seed, neem leaves and tobacco leaves) and insecticide permethrin dust alone or mixed with dung, were conducted against red pumpkin beetle in the field at National Agricultural Research Centre, Islamabad during kharif 2008. Permethrin (0.5%) alone or mixed (0.05%) with dung ash as dust controlled the attack of red pumpkin beetle on the crop with no mortality of plants. Highest mor...
Barkat Ali*, Muhammad Shahid Iqbal, Muhammad Kausar Nawaz Shah, Ghulam Shabbir** and Nasir Mahmood Cheema***
...inheritance of different plant traits in upland cotton (Gossypium hirsutum L.). Six genotypes viz., BJA-592, ACALA-SJ-4, 4-F, CP-15/2, CIM-497 and PB-899 were included in diallel crosses. Results revealed that over-dominance type of gene action was controlling the inheritance of monopodial and sympodial branches plant height number of bolls and boll weight. The line CP-15/2 possessed maximum dominant genes for monopodial bra...
M. Yasin Mirza, Mubashir A. Khan, M. Akmal, Akbar S. Mohmand, Malik S. Nawaz, Nazakat Nawaz and Najeeb Ullah*
...stically significant for plant height, number bolls plant-1, 1000-seed weight and seed yield hectare-1. These studies were conducted at National Agricultural Research Centre, Islamabad, Pakistan during rabi 2002-03, 2003-04 and 2004-05. Pooled genotypic and phenotypic variances were maximum for seed yield and minimum for 1000-seed weight. Genotypic coefficient of variation and phenotypic coefficient of variation were observe...
Ashiq Saleem, Habib Iqbal Javed, Rashid Saleem,* Muhammad Ansar** and M. Amir Zia*
...(Pioneer MR-Buster) were planted in Randomized Complete Block Design with three replications having a plot size of 5m x 3m. Plant to plant distance was 25 cm and row to row was 75 cm. A field experiment was conducted to investigate the effect of split doses of potash fertilizer on maize and sorghum. Potash fertilizer was applied @ 0, 60 and 120 kgha-1 K2O as single, two split and three spl...
Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*
...ation, canopy and spikes/plant, florets/spike and leaf area. A UPGMA cluster, grouped the 9 Ocimum genotypes into two major clusters on the basis of total seed protein and phenotypic characters, except Siam Queen and Lime basil stand alone, respectively. Euclidian distance for morphological traits ranged from 3.60 to 7.26. Conversely on the basis of total seed proteins genetic distances ranged from 0.11 to 1.00. Due to greater genetic diversity in Ocimum germp...
Abul Hassan Faiz*, Fakhar-i-Abbas and Lariab Zahra Faiz
...ine six soil properties (plant biomass, saturation, electrical conductivity, pH, organic matter, phosphorus and potassium) in Pothwar Plateau (250 km long and 100 km wide). We compared 216 soil samples (mound soil and undisturbed soil), to collect data on percentage water saturation, electrical conductivity (E/C), pH, organic matter content, and phosphorus and potassium contents. We found significant differences (mound soil and undisturbed soil) in % water sat...
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2
...solated from a medicinal plant Azadirachta indica on the CNS enzymes of a stored grain pest, Tribolium castaneum and a socioeconomic insect, Apis mellifera. A comparative study was designed to identify the role of saponins on insect acetylcholinesterase (AChEs). The enzyme activities were tested for the effect of saponins. The AChE activity of T. castaneum was inhibited by the saponins and follows competitive inhibition kinetics. In...
Imtiaz Hussain*, Hassnain Shah, M. Azeem Khan, Waqar Akhtar**, Abdul Majid*** and M. Yaqub Mujahid*
Corresponding author:[email protected]
PRODUCTIVITY IN RICE-WHEAT CROP ROTATION OF PUNJAB: AN APPLICATION OF TYPICAL FARM METHODOLOGY
...ation of different wheat planting techniques in relation with residue management. These techniques may include farmer practice (partial burning, land preparation and broadcast); partial burning zero tillage ; Farm Machinary Institute seeder (planting with in the residue). ...
Nazakat Nawaz, Malik Shah Nawaz*, Nasir M. Cheema** and Mubashir A. Khan*
Corresponding author:[email protected]
ZINC AND IRON APPLICATION TO OPTIMIZE SEED YIELD OF MUSTARD
...result of increased pods plant , number of seeds pod and 1000-seed weight....
Parvez Khaliq*, Muhammad Azim Malik**, M. Aslam Gill*** and
Nasir M. Cheema*
Corresponding author: [email protected]
EFFECT OF TILLAGE AND FERTILIZER TREATMENTS ON MAIZE FODDER YIELD UNDER RAINFED CONDITIONS OF PAKISTAN
... , maize fodder biomass, plant height, number of leaves per plant and maize fodder yield enhanced, with the application of RF+FYM. However, the effect of FYM+RF and recommended dose of fertilizer was statistically non-significant and on average basis RF+FYM treatment -1 produced higher green fodder (19971.5 kg ha ) than fodder yield of 18349.1 kg -1 ha produced by applying recommended dose of fertilizer. However, green fodde...
Hidayatullah, T. Mahmood, M. Farooq, M. A. Khokhar and S.I. Hussain*
* Corresponding author: [email protected]
PLANT GROWTH REGULATORS AFFECTING SEX EXPRESSION OF BOTTLE GOURD (LAGENARIA SICERARIA MOLINA) PLANTS
...enaria siceraria Molina) plants cv. Faisalabad Round was investigated under field conditions in National Agricultural Research Centre, Islamabad. Plants sprayed with distilled water were considered as control. Among all foliar agents, the response of -l GA3 3 and MH was found better. Exogenous application with 30 µmol l GA maximally increased the pistillate flower production as compared to control. Moreover, the treatm...
Muhammad Arifullah, Muhammad Munir*, Abid Mahmood**, Saifullah Khan Ajmal and Ghulam Shabbir*
COMBINING ABILITY ANALYSIS OF SOME YIELD ATTRIBUTES IN INDIAN MUSTARD (BRASSICA JUNCEA L.)
...ost of the traits except plant height and siliqua length. UCD-8/4, KJ-119 and BRS-2 were good general combiners for yield related traits. A cross BRS-2 × UCD-8/4 showed best desired SCA for number of primary branches and siliquae per plant. S-9 × Canola Raya for siliqua length, Canola Raya × UCD-8/4 for number of seeds per siliqua, KJ- 119 × BRS-2, BARD-1 × NIFA Raya for 1000-seed weight while c...
Khalid Mahmood Qureshi, Fakhar ul Hassan, Qamar ul Hassan, Usman Shaukat Qureshi, Saman Chughtai and Adnan Saleem*
IMPACT OF CULTIVATION SYSTEMS ON GROWTH AND YIELD OF STRAWBERRY (FRAGARIA ANANASSA) CV. �CHANDLER�
..., Rawalpindi. The runner plants of the strawberry (Fragaria ananassa) cv. Chandler were collected from Swat (Mingora.) Different cultivation systems were adapted i.e., standard growing media in polyethylene bags (T ), soil less media (T ), high tunnel (T ), green house (T ), 1 2 3 4 including open field condition on ridges (T ) by keeping plant to plant 5 distance of 30 cm and row to row d...
Habib Iqbal Javed, Ashiq Saleem, Javed Fateh, Mozammil Hussain, Naheed Akhtar and Shamim-ul-Sibtain Shah*
DEVELOPMENT OF RESISTANT MAIZE GERMPLASM
...on the basis of survived plants, a total of 250 accessions including 150 exotic out of 350 and 100 indigenous out of 900 were selected. During autumn 1999, out of 250 accessions (progenies) 35 exotic and 10 indigenous could survive under artificial infestation. Under natural infestation, 100 progenies performed little better. The best plants among these progenies were advanced by self pollination. A total of 400 self pollina...
Zammurad Iqbal Ahmed, Muhammad Ansar*, Ashiq Saleem**, Zafar ullah Arif*, H.I. Javed and Rashid Saleem**
IMPROVEMENT OF MASH BEAN PRODUCTION UNDER RAINFED CONDITIONS BY RHIZOBIUM INOCULATION AND LOW RATES OF STARTER NITROGEN
... differences for all the plant characters under the study. -1 The crop maturity was earlier in control and inoculation + 20 kg N ha as compared to all other treatments. Inoculation in combination with 50 kg N -1 ha significantly delayed crop maturity. The maximum mean average grain -1 yield (681.5 kg ha ) was augmented with the application of inoculation alone and non significant differences were noted among the varieties. Biological yield were also significan...
Parvez Khaliq*, Azim Malik**, Nasir Mahmood Cheema* and Muhammad Umair***
ECONOMICS OF WHEAT BASED CROPPING SYSTEMS IN RAINFED AREAS OF PAKISTAN
...loss of wheat yield when planted after maize fodder. Application of recommended dose of fertilizer -1 along with FYM @ 5 tha will enhance the yield of wheat and maize fodder. The improved cropping system of wheat-maize fodder-wheat will help the farmers to sustain productivity of these crops, stable economic benefits and improvement in soil nutrients and organic matter over time....
Muhammad Tariq*, Raja Muhammad Omer**, Muhammad Ashraf Mian*, Obaid Ur Rehman***, Amjad Tahir Virk and Kazim Abbass**
PROMOTING CERTIFIED SEED AVAILABILITY OF WHEAT (TRITICUM AESTIVUM L) THROUGH PUBLIC-PRIVATE PARTNERSHIP AND ITS IMPACT ON YIELD IN RAINFED AREAS
... stand which enabled the plants to withstand abiotic stress especially drought during the crop season. The seed multiplication of crop varieties of rainfed areas can be done in irrigated areas to ensure the quality of seed and its availability in rainfed areas, which ultimately will increase the income of the farming community of the area....
Gulzar S. Sanghera and Wassem Hussain*
HETEROSIS IN RELATION TO COMBINING ABILITY PER SE PERFORMANCE IN TEMPERATE RICE (ORYZA SATIVA L.)
...ecks for grain yield per plant also showed significant heterosis for majority of other traits. The average proportion of restorers, partial restorers, partial maintainers and maintainers were 16:22:33:27, respectively. The best cross combination for grain yield was SKAU7A x K-08-61-2 and for early maturity SKAU11A x SR-2 over check variety SR-1 only. Cross combinations SKAU 7A x K-08-61- 2, SKAU 7A x SR-2, SKAU 11A x K-08-60-2, SKAU 11A x K-08-59-3 and SKAU 11...
Safdar Ali, Sahiba, M. Azim Malik, Fayyaz-ul-Hassan and M. Ansar*
GROWTH OF RAINFED FODDER MAIZE UNDER DIFFERENT LEVELS OF NITROGEN AND PHOSPHORUS
...e growth parameters like plant height, stem diameter and leaf area. It was concluded that fertilizers combination of -1 180:90 NP kg ha was recommended for obtaining higher maize fodder yield under rainfed conditions of Rawalpindi, Pakistan....
Naheed Akhtar, Yasmin Ahmad, Muhammad Shakeel, Waseem Ahmad Gillani, Javed Khan, Tahira Yasmin and Irshad Begum*
RESISTANCE IN PEARL MILLET GERMPLASM TO GREENBUG, SCHIZAPHIS GRAMINUM (RONDANI)
... The status of host-plant resistance was evaluated in pearl millet (Pennisetum glaucum L.) against aphid species greenbug, Schizaphis graminum (Rondani). It was determined by the ability of seedlings to resist for plant stunting caused by aphid's feeding at seedling stage. The results indicated that out of 135 pearl millet entries tested, 21 were resistant, 69 were moderately resistant and 45 were susceptible to greenbu...
Muhammad Yaqoob*, Rukhsana Anjum, Mumtaz Hussain and Muhammad Jahangir Shah**
GENETIC DIVERSITY ANALYSIS AND CHARACTER ASSOCIATION IN SOME CHINESE HYBRID RICE UNDER DRY CONDITIONS
...ons. The data on various plant traits including, days to panicle initiation, panicle length, spikelet fertility, days to maturity, plant height, number of grains per panicle, number of productive tillers, 1000 grain weight and paddy yield were recorded. The results of analysis indicated a high range of genetic variation among various hybrids for plant height, number of grains per panicle, ...
Arshad Ali, Muhammad Arshadullah, Syed Ishtiaq Hyder, Imdad Ali Mahmood and Badar-uz-Zaman*
RICE PRODUCTIVITY AND SOIL HEALTH AS AFFECTED BY WHEAT RESIDUE INCORPORATION ALONG WITH NITROGEN STARTER DOSE UNDER SALT-AFFECTED SOIL
...rity, data on tillering, plant height, spike length, number of grains -1 spike , 1000-grain weight, straw and paddy yields were recorded. Plant samples collected at maturity were analyzed for K, Ca and Na -1 concentration in grain and straw. Tillering, grains spike , 1000-grain weight and paddy yield significantly (P≤ 0.05) increased with different -1 levels of N doses. Maximum tillers plant
Syed Ishtiaq Hyder, Muhammad Arshadullah, Arshad Ali and Imdad Ali Mahmood*
EFFECT OF BORON NUTRITION ON PADDY YIELD UNDER SALINESODIC SOILS
...y. Data on tillering, -1 plant height, spike length, number of grains spike , 1000-grain weight, straw and paddy yields were recorded. Na, K, Ca and B concentration in grain and straw were estimated using atomic absorption spectroscopy. -1 Tillering, number of grains spike , 1000- grain weight and paddy yield significantly (P≤0.05) increased at different levels of B. 1000-grain weight -1 -1 (31.7 g) and grain yield was the maximum (5.0 t ha ) at 2 kg B ha a...
Muhammad Zubair Anwar, M. Azeem Khan, Ikram Saeed, Akhtar Ali*, Shafique Zahid and Abdul Majid**
SMALL FARMERS PERCEPTIONS REGARDING IMPROVED FODDER AND FORAGE VARIETIES: RESULTS OF PARTICIPATORY ON FARM RESEARCH
...ted the newly introduced plant species while about 17% have shown their interest in fruit trees....
A.A. Mengal* , M. U. Mallah, Z. A. Mirani* and B. N. Siddiqui**
AN ANALYSIS OF PUBLIC AND PRIVATE AGRICULTURAL EXTENSION SERVICES IN BALOCHISTAN, PAKISTAN
...ed advice for the use of plant protection measures. Significant differences were observed between public and private extension field staff on various statements regarding competency level and agronomic practices....
EVALUATION OF LEGUME HERBS NUTRITIVE VALUE AS A RUMINANT FEED AND NITROGEN SUPPLY ON SOIL IN WEST TIMOR, INDONESIA
...l NO concentration after planting was in CP (5.72 mg ), followed by CT 3 -l -l -l (4.21mg ), MB (3.44 mg ), and DL (2.83 mg ). The species of legume was obviously highly significant (P<0.01) to biomass production 90 days after planting. Moreover, dry matter (DM) and organic matter (OM) in vitro digestibility were statistically different among the species of legume (P<0.01). In DL the DM and OM were highest i.e., 74.84 ...
Wabekwa, J.W., I.A. Sodagni and F.K. Mohammad*
PHYSIOLOGICAL GROWTH AND YIELD EVALUATION IN PMINERALIZED SUNFLOWER (HELIANTHUS ANNUS L.) UNDER SUDANOSAHELIAN AGRO-ECOLOGY, NIGERIA
...erved that leaf area per plant and plant dry weight increased with -1 increasing P O rates (40-60 kg ha ) at 6, 8 and 10 weeks after sowing (WAS) 2 5 . Crop growth rates similarly increased with increasing P O rates (40-80 kg 2 5 -1 ha ) at 6 WAS in both years and the combined means for the two years, and at 8 WAS in 2011 and the combined analysis. Days to 50% flowering and head dry weight were not significantly influenced b...
Arshad Ali, Imdad Ali Mahmood, Muhammad Salim, Muhammad Arshadullah* and Abdul Rasool Naseem**
GROWTH AND YIELD OF DIFFERENT BRASSICA GENOTYPES UNDER SALINE SODIC CONDITIONS
...andomly (average of five plants per replication) at the time of crop maturity. Ionic concentration in plant tissues and oil content in seeds were also determined. Comparatively more number of branches and pods per plant were produced by cultivar Dunkled closely followed by BARD-I while maximum seed yield (241.7 and -1 235.1 kg ha ) was obtained from Dunkled and Sultan Raya, respectively wh...
Shafique Qadir Memon*, Muhamamd Safar Mirjat, Abdul Quadir Mughal** Nadeem Amjad***, Muhammad Azhar Saeed, Shabbir Kalwar, Asif Ali Mirani and Habib Iqbal Javed****
TILLAGE AND NPK EFFECT ON GROWTH AND YIELD OF SPRING MAIZE IN ISLAMABAD, PAKISTAN
...ze emergence percentage, plant height, -1 grains cob , 1000-grain weight and grain yield due to tillage practices and various fertilizer levels, between tillage practices. However, the NPK @ -1 200-100-100 kg ha and deep tillage produced the highest emergence percentage, plant height, grains per cob, 1000-grain weight and grain yield followed by other fertilizer levels and conventional tillage. The zero tillage -1 plots prod...
Muhammad Arshadullah, Syed Ishtiaq Hyder, Arshad Ali and Imdad Ali Mahmood*
CUMULATIVE EFFECT OF SULFUR AND CALCIUM ON WHEAT GROWTH AND YIELD UNDER SALINE-SODIC SOILS
...rity, data on tillering, plant height, spike -1 length, number of grains spike , 1000-grain weight, straw and paddy yields were recorded. Potassium (K), Na, Ca, S and Mg concentrations in grain were estimated using atomic absorption spectroscopy. Tillering, -1 grains spike , 1000-grain weight and paddy yield significantly (P≤0.05) enhanced by increasing the rate of gypsum (CaSO ). The maximum 4 -1 number of grains spike (60), 1000-grain weight (47 g) and gr...
Tahir Abbas, Bushra Nawab, Rahila Nazli, Rubina Saleem, Amrat Lal and Khalid Jamil*
EFFICACY OF COTTON WASTE COMPOST AND FERTINEMAKIL FERTILIZER ON THE GROWTH PARAMETER OF SUNFLOWER PLANTS
...treatment showed maximum plant growth character in terms of plant height, number of flowers, diameter of flowers, 1000 grains weight and oil contents. The highest significant improvement in plant growth characters were recorded in plots treated with cotton waste compost and cotton waste compost+ Fertinemakil fertilizer. The Fertinemakil alone showed less significant effect but it is a good...
Amir Khatam*, Sher Muhammad and Ijaz Ashraf**
ROLE OF FARMER FIELD SCHOOLS IN ENHANCING SKILLS OF FARMING COMMUNITY IN KHYBER PAKHTUNKHWA, PAKISTAN
...le, skill improvement in plant protection especially in the area of insect pests identification was ranked st 1 with mean value 3.22 closely followed by insect pests control by local nd rd recipes and their mass killing which were ranked 2 and 3 with mean values 3.03 and 2.84, respectively. Likewise, chemical and manual weed st nd control measures were ranked 1 and 2 with mean values 2.99 and 2.97, respectively. Correspondingly, farmers' skills in furrow irrig...
Muhammad Sohail*, Imtiaz Hussain*, Riaz-ud-din*, Syed Haider Abbas*, Maqsood Qamar* and Muhammad Noman*
EFFECT OF SPLIT N FERTILIZER APPLICATION ON PHYSIOAGRONOMIC TRAITS OF WHEAT (TRITICUM AESTIVUM L.) UNDER RAINFED CONDITIONS
....e. full basal N dose at planting and N application in two and three equal split doses at tiller formation and stem elongation stages. Maximum grain yield -1 -1 (5.20 t ha ) was achieved when N was applied @120 kg ha in three equal split doses at planting, tiller formation and stem elongation stages. N application in 2 and 3 split doses resulted in 25 - 50% grain yield advantage at all N rates as compared to single basal N d...
Sajida Taj*, Akhter Ali*, Nadeem Akmal*, Shujaat Yaqoob** and Mubarik Ali***
RAISED BED TECHNOLOGY FOR WHEAT CROP IN IRRIGATED AREAS OF PUNJAB, PAKISTAN
...f adoption of raised bed planting of wheat in irrigated areas of Punjab, Pakistan. Wheat is an important staple food of Pakistan. It contributes 13 % to the value added in agriculture and 2.6 % to the GDP. The agrarian economy of Pakistan is continuously under stress due to the low yield of almost all the crops and constrained with many problem. One of the most important issues of agriculture is water shortage which is increasing day by day and is a major chal...
Muhammad Farooq*, Hidayat Ullah*, Nausherwan Nobel Nawab* and Khalid Mahmood Qureshi**
EVALUATION OF INDIGENOUS TOMATO HYBRIDS UNDER PLASTIC TUNNEL
...maximum number of fruits plant (30.26) and followed by NTT- -1 04-08 and NTT-03-08 bearing 28.68 and 24.16 fruits plant , respectively. The highest mean fruit weight of 170.63 g was recorded in NTT-05-08 while minimum fruit weight (80.90 g) was observed in Sahel (check). Maximum fruit length of 7.89 cm was recorded in Sahel which is oblong in shape while minimum (5.70 cm) in NTT-14-08. Similarly a significant difference was ...
Sara Khalid*, Khalid Mahmood Qureshi*, Ishfaq Ahmad Hafiz*, Khalid Saifullah Khan* and Usman Shaukat Qureshi*
EFFECT OF ORGANIC AMENDMENTS ON VEGETATIVE GROWTH, FRUIT AND YIELD QUALITY OF STRAWBERRY
...ndler which included T = planting 1 media -1 (soil + silt + farm yard manure); T = planting media + 400 mgl humic 2 -1 acid; T = planting media + 200 g kg leaf manure; T = planting media + 200 3 4 -1 -1 g kg vermicompost; T = planting media + 200 g kg plant fertilizer and T = 5 6 -1 ...
Rabeea Tariq*, Khalid Mahmood Qureshi*, Imran Hassan*, Muhammad Rasheed* and Usman Shaukat Qureshi*
EFFECT OF PLANTING DENSITY AND GROWING MEDIA ON GROWTH AND YIELD OF STRAWBERRY
...ood quality. To make the plant growth successful in the container, the requirement of special media is very important step because plant growth is largely depended on the physiochemical properties of the growing media used. Winter strawberry production in a greenhouse using high plant densities and various media may be a viable alternative to openfield production system.
Muhammad Yasin Mirza*, Mubashir Ahmad Khan*, Muhammad Amjad* and Malik Shah Nawaz*
STABILITY ANALYSIS FOR ECONOMIC TRAITS IN SESAME ( L.)
...aits except branches per plant. Pooled deviation was significant only for yield indicating the differential genotypic response across the locations. The significant variance due to environment (linear) indicated that the performance of genotypes was under genetic control. The b-values of V-90005, T-89 and PARS-I were larger than unit regression; hence were suitable for favourable environments for yield. Whereas, V-III and SangharI were with b-values less than ...
Mubashir Ahmad Khan*, Muhammad Yasin Mirza*, Muhammad Amjad*, Nazakat Nawaz*, Malik Shah Nawaz* and Doulat Baig*
ASSESSMENT OF GENETIC DIVERSITY IN GERMPLASM OF LINSEED ( L.)
...ty, reproductive period, plant height, branches per plant, bolls per plant, plot biomass, harvest index and seed yield. Wide ranges between the mean values with high CV values were exhibited by plant height, bolls per plant, biomass and seed yield accompanied with maximum values of variances and standard deviation, rev...
Abdul Rehman Roonjho*, Waseem A. Gillani**, Awais Rasool**, Naheed Akhtar**, Tariq Mahmood**, Arsalan A.***, M. Afzal*, Iqbal Khan* , M. Asghar Ranjha**** , M. Irfan**** and Javed Khan**
REPELLENCY EFFECTS OF DIFFERENT PLANT EXTRACTS TO COTTON MEALY BUG, TINSLEY (HEMIPTERA: PSEUDOCOCCIDAE)
...pelling effects of peach plant L. (Rosales: Rosaceae), Eucalyptus, L. (Myrtales: Myrtaceae), Ashok, (Magnoliids: Annonaceae), Milk thistle, (Asterales: Asteraceae), and Sow thistle, (Asterales: Asteraceae) extracts each in petroleum ether, acetone and ethanol were evaluated at the concentration of 1000, 500 and 250 ppm against cotton mealy bug ( ) in a free choice bioassay for two weeks. The ethanol extract of was the most effective against cotton mealy bug ha...
Adnan Umair*, Safdar Ali**, Muhammad Sarwar***, Kashif Bashir**, Muhammad Javed Tareen**** and Muhammad Asghar Malik*****
ASSESSMENT OF SOME PRIMING TECHNIQUES IN MUNGBEAN (VIGNA RADIATA) : A GREEN HOUSE STUDY
...s significantly improved plant vigor in terms of final germination biomass, root, shoot length and nutrient uptake of mungbean seedlings compared to control (non-primed dry seedling). The application of seed priming also improved the protein concentration at the early stage of seedlings. Phosphorous application through priming significantly improved germination up to 95%, seedling -1 vigour index up to 23.05 and protein content up to 2.17 (g FW)....
Sadia Tehrim*, M. Yasin Mirza** and G. Mustafa Sajid*
COMPARATIVE STUDY OF DIFFERENT GROWTH REGULATORS FOR EFFICIENT PLANT REGENERATION IN GRAPES
... for culturing the grape plantlets, there was a corresponding increase in the number of shoots and root mass. Additionally, the shoot proliferation response to increasing level of BAP was found genotype dependent. Naphthaleneacetic acid (NAA) also showed a positive effect on in vitro growth responses (shoot proliferation and root induction) when combined with BAP. The media containing NAA, BAP and kinetin accelerated the growth in terms of shoot mass in two ac...
Shafique Qadir Memon*, Nadeem Amjad**, Muhammad Safar Mirjat***, Abdul Quadir Mughal***, Khalil Ahmad Ibupoto***, Shabbir Ahmad Kalwar****, Asif Ali Mirani**** and Muhammad Azhar Saeed****
EFFECT OF TILLAGE AND USE OF ORGANIC AND INORGANIC FERTILIZERS ON GROWTH AND YIELD COMPONENTS OF MAIZE
...els. Results showed that plant height, 1000-grain weight, grain yield and dry matter were maximum with deep tillage as compared to conventional and zero tillage. Comparing the seasons, the overall better plant height, 1000- grain weight, grain yield and dry matter were gained during autumn season due to its crop residue effect and supplemental fertilizer. Therefore, considering the environmental conditions, the deep tillage ...
Muhammad Sohail*, Imtiaz Hussain*, Riaz-ud-Din*, Sikandar Khan Tanveer*, Maqsood Qamar* and Syed Haider Abbas*
EVALUATION OF ADVANCE WHEAT LINES FOR AGRONOMIC TRAITS IN RAINFED ENVIRONMENT
...) and late (December 15) planting times to create variable growing conditions especially during reproductive growth period. The adverse effect of the late planting was significant (P<0.05) on grain yield of the crop. Late planting produced 29% lower grain yield than normal planting. Genotypes also showed significant variation (P<0.05) regarding gra...
Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
...design. Each species was planted on 2.5m x 3m plot, and repeated 6 and 4 times in experiment 1 and 2, respectively. Parameters measured include plant height, tillage number, dry matter (DM) yield, in vitro digestibility and nutrient contents. Plant height and tillage number were monitored at week 4, 6 and 8 then harvested at week 8. Results revealed that the Brachiaria mutica (8 weeks old)...
Nazakat Nawaz*, Malik Shah Nawaz*, Mubashir Ahmad Khan*, Mirza M. Yasin*, Doulat Baig*, Nasir Mehmood Cheema**, Muhammad Amjad** and M. Altaf Sher**
EFFECT OF BORON ON PEANUT GENOTYPES UNDER RAINFED CONDITIONS
... boron concentrations in plant shoot terminals -1 recorded were 22-48, 23-50 and 25-54 mg kg during 2008 and 27-51, 30- -1 55 and 31-58 mg kg during 2009 in BARD-479, ICG-7326 and ICGV-92023, respectively. Critical boron concentrations observed in pods of BARD-479, -1 ICG-7326 and ICGV-92023 genotypes were 17-34, 20-38 and 22-40 mg kg -1 during 2008 and 21-36, 23-39 and 24-44 mg kg during 2009, respectively. Total uptake of boron both in pods and haulm noted w...
Farman Ullah Shah*, G. Mustafa Sajid** and Sadar Uddin Siddiqui**
EVALUATION OF MULCHING MATERIALS AS INTEGRATED WEED MANAGEMENT COMPONENT IN MAIZE CROP
...y weight g m , number of plant plot , -1 stover yield (g), plant height (cm), number of cobs plant , number of leaves -1 -1 plant , average grain number of five cobs and grain yield (t ha ). With the -2 -2 exception of hand weeding, minimum number of weeds 128 m and 164 m were recorded in black plastic and weeds as mulch, respectively, compared -2 to 595...
Asghar Ali*, Muhammad Tahir**, Shahid Riaz Malik* and Muhammad Hanif Munawwar*
EVALUATION OF PRE AND POST-EMERGENCE HERBICIDES FOR WEED MANAGEMENT IN LENTIL (LENS CULINARIS MEDIK.)
...turon after one month of planting @ 2 kg ha . Both the treatments showed 193.9% and 109.2% yield increase, respectively, over -1 the check. It indicates that Isoproturon @ 2 kg ha can be used pre or postemergence in lentil fields to control the weeds without causing injury to lentil plants....
Maqsood Qamar*, S. Dilanawaz Ahmad Gardazi**, Riaz-ud-Din*, Muhammad Sohail* and Syed Haider Abbas*
PARTIAL RESISTANCE TO STRIPE RUST AND ITS EFFECT ON SUSTAINABILITY OF WHEAT YIELD
...usceptible cultivars are planted under favorable conditions. Level of partial plant resistance in bread wheat and its impact on sustainable wheat production was studied at the National Agricultural Research Centre, Islamabad under natural conditions in the field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using A...
Frasat Saeed*, Jehanzeb Farooq*, Abid Mahmood**, Tassawar Hussain***, Muhammad Riaz* and Saghir Ahmad****
GENETIC DIVERSITY IN UPLAND COTTON FOR COTTON LEAF CURL VIRUS DISEASE, EARLINESS AND FIBER QUALITY
..., sympodial branches and plant height. Principal component (PC) analysis showed first five PCs having eigen value >1 explaining 67.8% of the total variation with days to st -1 1 square and flowering along with plant height and sympodia plant which were being the most important characters in PC1. Cluster analysis classified 101 accessions into five divergent groups. The genotypes in st c...
Muhammad Ali*, Ghulam Mustafa Sajid**, M. Faisal Anwar Malik*** and Kalimullah****
ESTABLISHMENT OF IN VITRO CULTURE OF GRAPES
...culture from shoot tip explants (meristemetic tissue) of grapes was investigated through tissue culture technique. These explants were collected from gene bank of Institute of Agricultural Biotechnology and Genetic Resources (IABGR), National Agricultural Research Centre (NARC), Islamabad, Pakistan. Fifteen accessions of grapes were surface sterilized and tested on 75% MS media for germination and initial growth parameters. ...
Aniqa Iram*, Javed Khan**, Nadeem Aslam**, Ehsan-ul-Haq**, Habib Iqbal Javed**, Muhammad Irfan*, Awais Rasool*, Muhammad Ishaque Mastoi** and Sumera Aslam*
EFFICACY OF PLANT DERIVED OILS AND EXTRACTS AGAINST WHITEFLY, BEMISIA TABACI (GENNADIUS) ON SESAME CROP
...ed on more than 600 host plants worldwide. Different methods are being used for its control. The present experiment was conducted to determine the effect of some plant extracts of mint (Mentha spp.) and geranium (Pelargonium graveolens) and soybean oil (Glycine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data were recorded 24h before and 24h, 48h, 72h...
Muhammad Tahir*, Muhammad Irfan* and Aziz-Ur-Rehman*
EFFECT OF FOLIAR APPLICATION OF ZINC ON YIELD AND OIL CONTENTS OF FLAX
...s significantly improved plant height, stem 4 -1 length, fruiting zone length, fruiting branches, number of capsule plant , -1 number of seed capsule , 1000-seed weight, straw yield, seed yield, and seed oil contents compared to control. Therefore, for producing a higher seed yield and oil contents of flax, it is suggested that 3.00% zinc at bud initiation and after capsule filling stage of flax should be used....
Hassnain Shah*, Nadeem Akmal*, Waqas Farooq*, Muhammad Azeem Khan* and Shahid Munir**
SHIFT FROM SITE DEVELOPMENT TO SKILL DEVELOPMENT: A CASE STUDY OF WATER HARVESTING THROUGH MICRO CATCHMENTS
...r conservation for fruit plants but also cost effective, water, labor and resource saving along with farmer friendly under rainfed condition with scare supplemental water availability. The cost of adoption of technology including labor charges for its preparation and maintenance was recovered from irrigation cost saved from single rainfall at the demonstration site. One of the important implications drawn in this regard was the need of a shift from site develo...
Nosheen Zahra*, Ghulam Sarwar* and Sher Muhammad**
COMPARISON OF GYPSUM AND POTASSIUM SILICATE FOR RECLAMATION OF SALINE SODIC SOIL
...haheen Basmati) was transplanted in all the pots i.e., 3 plants per pot. Necessary N, P and K fertilizers were applied at the recommended rate. After crop harvest, soil samples were taken for analysis of pH, electrical conductivity (EC), sodium adsorption ratio (SAR) and exchangeable sodium percentage (ESP) of soil. All the amendments when used alone or in combination with each other improved the chemical parameters of soil....
Muhammad Ayub*, Rizwan Maqbool*, Muhammad Tahir*, Zoaib Aslam*, Muhammad Ather Nadeem* and Muhammad Ibrahim**
IMPROVED GROWTH, SEED YIELD AND QUALITY OF FENNEL (FOENICULUM VULGARE MILL.) THROUGH SOIL APPLIED NITROGEN AND PHOSPHORUS
...:45 kg -1 ha ) increased plant height by 44%, number of leaves per plant by 76%, 1000 seed weight by 44%, biological yield by 50%, seed yield by 296%, harvest index by 162% and protein content by 6%. However, fertilizer NP -1 (90:45 kg ha ) decreased oil content by 26%. Therefore, addition of NP fertilizer had the potential to increase fennel seed yield, but reduce oil content, under Faisalabad conditions....
Kalim Ullah*, Zahid Usman*,Niamatullah Khan*, Rehmat Ullah**, Fazal Yazdan Saleem***, Shahid Iqbal Khattak**** and Muhammad Ali*****
GENETIC DIVERSITY FOR YIELD AND RELATED TRAITS IN UPLAND COTTON GENOTYPES
...10.75 kg ha , 42.3 bolls plant , 3.57 g boll weight and 144.5 cm height in comparison to other eight genotypes. The cultivar Gomal-93 and SLH-373 also showed comparable yield and contributing parameters. The genetic variances of the studied parameters were higher in comparison to variances of environment and highly heritable in broad sense. These instant results suggest that these breeding materials have the room for further improvement and can be successfully...
Muhammad Zahid Kiani*, Arshad Ali**, Tariq Sultan** and Muhammad Munir Ahmed***
CHARACTERIZATION OF PLANT GROWTH PROMOTING RHIZOBACTERIA ISOLATED FROM ROOT SYSTEM OF SUNFLOWER (HELIANTHUS ANNUS L) GROWN UNDER SALT AFFECTED AREA OF PAKISTAN
... (PGPR) directly promote plant growth by providing indole-3-acetic acid (IAA), solubilization of inorganic phosphates, nitrogen fixation and siderophores and other organic acid production, whereas indirectly support plant growth by suppressing plant pathogens. The objective of this study was isolation and characterization of bacterial strains from rhizosphere, endosphere and rhizoplane of ...
Tosif Tabassam*, Tariq Sultan**, M.Ehsan Akhtar**, M.Mahmood-ulHassan** and Arshad Ali**
SUITABILITY OF DIFFERENT FORMULATED CARRIERS FOR SUSTAINING MICROBIAL SHELF LIFE
...y using locally isolated plant growth promoting rhizobacteria (PGPR) strains from maize rhizosphere. Different combinations of material were prepared using clay soil (35-50%), fly-ash (30-45%), press mud (5-15%) and lignite (5-15%). Clay soil (53% clay) was used for adhesion purpose but considering free of lump formation an important property of a good carrier, mixing 40% of soil with other material was found suitable. Using 40% of soil, six different treatmen...
Israr Ali*, Naushad Ali*, Riffat Tahira**, Sardar Ali*, Izhar Hussain* and Sher Aslam Khan*
GENETIC DIVERSITY ASSESSMENT IN BRASSICA GERMPLASM BASED ON MORPHOLOGICAL ATTRIBUTES
... to maturity (DM), -1 -1 plant height (PH), primary branches plant (PBPP), pod length (PL), seed pod (SP), -1 1000-seed weight (1000-SW), yield plant (YPP) and oil (%). Three checks (Pakola, CM and TA), were used to check the performance of collected materials with already available brassica varieties. Significant statistical differences were observed among the tested genotypes based on th...
Said Salman*, Shah Jehan Khan* and Javed Khan**
HETEROSIS AND HETROBELTIOSIS PERFORMANCE OF MORPHOLOGICAL TRAITS IN BREAD WHEAT CROSSES UNDER DROUGHT STRESS CONDITIONS
...es were -1 evaluated for plant height, number of tillers plant , days to 50% heading, -1 -1 spike length, number of spikelets spike , number of grains spike and 1000-grain weight. Maximum heterosis and heterobeltiosis interactions were noted in Pari-73 x Hashim-08 for 1000-grain weight (29% and 22%), grains per spike (19% and 11%) and spike length (33% and 22%). Promising results were obtained with respect to shorter
Ibrar Ali*, Abdul Mateen Khattak*, Muhammad Ali* and Kalim Ullah**
PERFORMANCE OF DIFFERENT TOMATO CULTIVARS UNDER ORGANIC AND INORGANIC REGIMES
...ivars, Roma gave maximum plant survival (93.8%), number of leaves plant -1 -1 (84.1), number of flower inflorescence (5.4), number of fruits inflorescence (4.3), -1 3 -1 number of fruit plant (25.4), fruit size (63.9 cm ), fruit weight plant (9.1 kg) and -1 total yield (22.9 t ha ). However, it was closely followed by cultivar Rio Grande for -1 -1 number...
Sameera Arshad*, Iftikhar Hussain*, Maqsood Anwar* and Sarwat Naz Mirza*
HABITAT SURVEY FOR RECOGNIZING BIRD ATTRACTANTS AROUND BENAZIR BHUTTO INTERNATIONAL AIRPORT, ISLAMABAD, PAKISTAN
...tracting sites. About 64 plant species and 34 bird species were recorded during the survey. Results indicated that habitat near BBIA is highly conducive for bird activity which in return is a serious safety concern for aircraft operation. Outcome of this study could be incorporated into off airfield bird management programme for monitoring bird activity and land use practices around the airfield....
Quratulain*, Muhammad Aslam**, Muhammad Khalid Rafique*, Mian Atiq Ahmad* and Rashid Mahmood***
POPULATION DYNAMICS OF ROSE APHID MACROSIPHUM ROSAE L. ON DIFFERENT CULTIVARS OF ROSA INDICA L. IN PAKISTAN
...earch field area on rose plants for rose aphid populations during 2008-09. Data were recorded on weekly basis. Nymphs, winged and wingless adults were counted from leaves (upper, middle and lower leaves), buds and flowers by visual observation from tagged plants. Aphid populations start to develop in November and its population decline with decline in temperature in December. While its population started rising again at the ...
Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**
EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...llected after 90 days of planting. Kjeldahl method and thin layer chromatography (TLC) were used for the quantitative and qualitative analysis of total protein and phenolic compounds, respectively. Proteins were greatly affected by fertilizer treatment and water stress, but phenolic compounds remained unchanged upon fertilizer treatment. However, they were greatly affected by irrigation and water -1 stress. Crop treated with 100 kg ha P O under water stress ma...
Raja Zoq-ul-Arfeen*, Aamir Saleem*, Sarwat Naz Mirza*, Muhammad Akmal**, Hafiz Muhammad Tayyab* and Obaid Afzal***
BIODIVERSITY AND PHYTOSOCIOLOGICAL STUDIES OF UPSTREAM AND DOWNSTREAM RIPARIAN AREAS OF PAKISTAN: SPECIAL REFERENCE TO TAUNSA WILDLIFE SANCTUARY AND KETI SHAH FORESTS
...e sanctuary. Total 14259 plants/individuals were recorded, which belong to 54 plant species with 18 different families. In Taunsa pre-monsoon survey, total 30 plant species were found with 4476 plants from 16 different families. In Taunsa post-monsoon survey total 3348 individuals were recorded from 20 plant species an...
Imran*, Shaheeda Naveed**, Asad Ali Khan* and Inayat Khattak*
IMPACT OF PHOSPHORUS LEVELS AND SEED RATES ON GROWTH AND YIELD OF LATE SOWN MAIZE ON HIGH ELEVATION IN SWAT, PAKISTAN
...s (P) is required by the plants relatively in large quantity and is the second most important crop nutrient that increases productivity of maize (Zea mays L.). An experiment on effect of different P O levels and seed rates on growth and yield of late sown maize cv. 2 5 Baber on high elevation during kharif season, was conducted at Farmer Field School, Swat, Pakistan during summer 2012. The experiment was laid out in randomized complete block design having thre...
Anwar Hussain* and Muhammad Rahman**
ROLE OF TRAININGS ON FARMERS' PROFITABILITY OF MEDICINAL AND AROMATIC PLANTS IN MOUNTAINOUS AREAS OF DISTRICT SWAT, KHYBER PUKHTUNKHWA
...n medicinal and aromatic plants (MAPs) in mountainous areas of district Swat. A convenient sample of 100 respondents, engaged in MAPs in Chail Valley Madyan was taken. Information about revenue from MAPs, marketing, prices and quantities was collected through a structured questionnaire. The respondents were given training under Swiss Development Cooperation Project at the time of collection, harvesting, cleaning, drying, packing and marketing of MAPs. The over...
Doulat Baig*, Fida Mohammad Abbasi*, Habib Ahmed*, Maqsood Qamar** and Muhammad Ayub Khan**
RESPONSE OF SUNFLOWER HYBRIDS TO DIFFERENT NITROGEN LEVELS FOR PHYSIOLOGICAL AND AGRONOMICAL TRAITS UNDER FIELD CONDITIONS
...vailable in soil for the plant use. A two year study was conducted in 2012 and 2013 at National Agricultural Research Centre (NARC), Islamabad, Pakistan. The experiment was aimed to –1 –1 evaluate the effect of different nitrogen (N) levels (N = 0 kgha , N = 60 kgha , N = 0 1 2 –1 –1 –1 –1 80 kgha , N3 = 120 kgha , N4 = 180 kgha and N5 = 240 kgha ) on two sunflower hybrids, SMH-0907 and SMH-0917 to optimize the N levels for ...
Azhar Usman Ali*, Ghulam Sarwar*, Muhammad Aftab* and Sher Muhammad**
EFFECT OF SOIL AND FOLIAR APPLIED COPPER ON GROWTH AND YIELD OF WHEAT (TRITICUM AESTIVUM L.)
...ni-2000) were sown and 3 plants were maintained in each pot after germination. Foliar application of copper was done at booting and tillering stage. At maturity, data regarding different yield components were noted and wheat plants were harvested. Grain yield and total biomass was also recorded. Soil samples were collected from all pots and analyzed for copper concentration by using wet digestion method. Results of the exper...
Muhammad Mudasar Aslam ⃰, Muhammad Jamil**, Ijaz Malook**, Amana Khatoon*, Ali Rehman*, Abdur Rahim***, Pirzada Khan*, Shakir Ullah Khan Shakir*, Shahid Irfan*, Faizan Ullah****, Khair Ul Bashar**, Mahideen Afridi** and Shafiq Ur Rehman*
PHYTOTOXIC EFFECTS OF CALOTROPIS PROCERA, TAMARIX APHYLLA AND PEGANUM HARMALA ON PLANT GROWTH OF WHEAT AND MUSTARD
...ytotoxic effects of many plants are known on growth of different useful crops. This research study was designed to find out phytotoxic effects of Calotropis procera, Tamarix aphylla and Peganum harmala on seed germination and seedling length of wheat and mustard. Results showed that seed germination of wheat was significantly decreased by 5%, 10%, 15%, 20% and 25% while mustard seeds were resistant and were affected by higher dilutions (15%, 20% and 25%) of al...
Salar Khan Yousafzai*, Shah Masaud Khan*, Khalil ur Rehman**, Junaid Khan*, Sher Aslam Khan*, Ijaz Hussain* and Ishrat Naz***
RESPONSE OF TOMATO CULTIVARS TO DIFFERENT ORGANIC FERTILIZERS UNDER AGRO-CLIMATIC CONDITIONS OF MINGORA, SWAT
...showed maximum number of plant survival percentage (98.33%), days to flowering -1 -1 (40.73), number of flowers plant (6.23), number of fruit plant (25.67), fruit -1 3 weight (8.84 kg), number of leaves plant (83.66), fruit size (64.70 cm ) and total -1 yield (25.67 t ha ) in Farm Yard Manure (FYM). Considering the overall performance, it was found that ...
Muhammad Farrukh Saleem*, Munir Ahmad*, Shakeel Ahmad Anjum*, Muhammad Aown Sammar Raza** and Abdul Shakoor*
EFFECT OF TOPPING UNDER DIFFERENT NITROGEN LEVELS ON EARLINESS AND YIELD OF COTTON
...nbsp;Cotton is perennial plant with indeterminate growth habit. However it has been adopted as annual, so efforts like topping and optimum nitrogen levels to modify its architecture can play a role in improving its success as annual. A field experiment to study the effect of topping under different nitrogen levels on earliness and yield of cotton (Gossypium hirsutum L.) was conducted at Agronomic Research Area, University of Agriculture, Faisalabad, during kha...
Tasawar Sultana*, Farah Deeba* and S.M. Saqlan Naqvi*
HIGH-THROUGHPUT AGROBACTERIUM-MEDIATED TRANSFORMATION OF MEDICAGO TRUNCATULA IN COMPARISON TO TWO EXPRESSION VECTORS
...catula as a model legume plant for molecular analysis resulted in the development of efficient Agrobacterium-mediated transformation protocols. In current study, M. truncatula transformed plants expressing OsRGLP1 were obtained through GATEWAY technology using pGOsRGLP1 (pH7WG2.0::OsRGLP1). The transformation efficiency of this vector was compared with expression vector from pCAMBIA series over-expressing same gene (pCOsRGLP...
Muhammad Tahir* and Nawal Zafar*
FORAGE YIELD AND QUALITY PERFORMANCE OF RABI CEREALS SOWN ALONE AND IN BLENDED POPULATION AT VARIABLE SEED RATIOS
...illers, number of leaves plant , leaf area, crop growth -1 -1 rate, fresh weight plant , dry weight plant , green forage yield and dry matter yield were obtained in plots where barley was sown alone at 100% seed ratio. The highest crude fiber and total ash percentage was observed in plots where oat was sown alone at 100% seed ratio and crude protein percentage was highest when oat was blen...
Muhammad Mansoor*, Noman Latif*, Zafar Islam**, Sher Muhammad**, Amanullah* and Muhammad Umair***
IMPACT ASSESSMENT OF SOIL AMENDMENTS ON SOIL CAPPING IN MUNGBEAN PRODUCTION USING CENTRAL PIVOT IRRIGATION SYSTEM IN CLAYEY SOILS
...s number of branches per plant, number of pods per plant, pod length, number of grains per pod, 1000-grain weight, and grain yield were significantly affected by different soil amendments at P>0.05, except for number of clusters per plant. -1 -1 Maximum of 6.2 branches plant , 62.6 pods plant , 8.3cm pod length, 8.9...
Muhammad Zahid Kiani*, Tariq Sultan**, Arshad Ali**, Ghulam Qadir*** Imdad Ali Mahmood**, Tauseef Tabassam**, Muhammad Arshad Ullah** and Nasir Abbas*
EFFECT OF PGPR STRAINS ON SUNFLOWER GROWTH AND NUTRIENT CONTENTS UNDER SALINITY STRESS
...y useful for stimulating plant growth under harsh environment. A pot trial was conducted to examine the performance of four isolated strains in five treatments viz., KS 44, KS 7, KS 41, KS 42 and KS mix under four different artificially developed -1 salinity levels (5, 8, 10 and 12 dS m ) at National Agricultural Research Centre, Islamabad. Hybrid seeds (SMH 0917) of sunflower (Helianthus annuus L.) were used. After six weeks of sowing, <...
Abdul Hameed Solangi*, Fateh Khan Nizamani*, Aqeel Ahmed Siddiqui*, Muzaffar Ali Khan**, Parwaiz Ahmed Baloch*, Riazuddin* and Khalil Ahmed Solangi***
FIELD COMPARISON AND MORPHOLOGICAL CHARACTERS OF GUAR (CYAMOPSIS TETRAGONOLOBA L. TAUB.) GENOTYPES UNDER AGROCLIMATIC CONDITIONS OF KARACHI, PAKISTAN
...esults revealed that the plant length was high in Acc. No.3 as compared to the other genotypes. Branches per plant were high in Acc. No. 8 as compared to Acc. Nos. 1-7 while, non-significant differences among Acc. Nos. 1, 3, 6 and 9. Moreover, results showed that high number of branches on Acc. Nos. 4, 10 and 11 as compared to Acc. Nos. 2 and 11 accessions, cluster/plant was high in Acc. N...
Nisar Ahmed Soomro*, Abdul Fatah Soomro**, Hamz Ali Samo* and
Muhammad Siddique Depar***
GROWTH AND YIELD COMPARISONS OF FOUR COMMERCIAL WHEAT VARIETIES TO IRRIGATION FREQUENCIES
...1% germination, 82.77 cm plant height, 10.88 tillers plant , 266.74 tillers m , 59.41 grains spike , 60.50 g 1000-seed weight and 5862.25 kg grain yield ha . The crop irrigated four times, showed bit adverse effects on growth and yield traits over 5 irrigations with 84.77% germination, 79.16 cm plant height, 10.07 tillers plant , 254.91 tillers m , 51.91...
Dilawar Khan*, Abid Saeed*, Junaid Ahmad*, Imtiaz Qamar**, Fazal Yazdan**, Saleem ud Din** and Muhammad Tariq**
ASSESSMENT OF RIPARIAN VEGETATION IN DHRABI WATERSHED AND CHAKWAL REGION IN PAKISTAN
...the study area. The five plant communities recognized in the Dhrabi watershed on the basis of importance value (IV) by using line transect sampling method. On the basis of top three highest IV plant community were identified at western side of the Kallar Kahar Lake while plant community was observed in eastern side by using 1x1 m quadrat method....
Ishaq Ahmad*, Abdul Rehman**, Ehsan –Ul- Haq*** and Arif Mahmood****
RESISTANCE RESPONSE OF RICE ( L.) GERMPLASM AGAINST RICE LEAF FOLDER ( G.) UNDER GREENHOUSE CONDITION IN PAKISTAN
... huge yield losses. Host plant resistance is an important component of IPM. It is easy to use, viable, durable, effective and long term method as compared to any other control measure. It was imperative to exploit the sources of resistance to cope with threat the pest and its environmental friendly control. Present study was carried out in greenhouse of Plant Genetic Resources Institute (PGRI), NARC. Twenty six Pakistani gen...
Syed Waqar Shah* and Muhammad Ather Rafi*
PIERID (LEPIDOPTERA: PIERIDAE) PESTS AND THEIR NEW CRUCIFERS HOSTS IN POTHWAR REGION OF PAKISTAN
...n-cultivated cruciferous plants, the known cultivated hosts such as , , ,, var. and were attacked by , and . Among above reported Pieridae species is reported for the first time however, is also a new record from districts Rawalpindi and Chakwal and from Jhelum, Rawalpindi and Chakwal. However, the non-cultivated host plants in the region were , , and . Among noncultivated hosts was the new host for . C. was found common hos...
Mohammad Umar Farooq* , Sarfraz Ahmad ** , Mohammad Islam and Imtiaz Ahmad Qamar ***
ASSESSING THE STATUS OF CARBON POOL IN TWO RANGELAND GRASSES ( ) IN POTHWAR, REGION, PAKISTAN
...otosynthesis process via plant biomass is the extent of this atmospheric gas. Data for above and below phytomass for two rangeland grasses was collected and carbon pool was estimated by Wet Combustion and Dry Combustion method. Four transect lines were drawn in each experimental plot. Twenty four samples of each experimental plot were collected with the help of ADC one m quadrat method, weighed and then oven dried at 60 C to find out the dry weight for above p...
Muhammad Bilal*, Zafar Abbas*, Ijaz Ahmad**, Muhammad Aslam*, Muhammad Ijaz****, Adnan Shakeel***, Mushtaq Ahmad*** and Kashif Bashir*****
RESPONSE OF DIFFERENT COTTON ( L.) GENOTYPES AT VARIOUS SALINITY LEVELS
... (AARI), Faisalabad. The plant height of NIAB-111 was more affected by soil salinity than that of other varieties. The number of bolls per plant also showed the similar fashion to salinity stress for all varieties. Maximum average weight of cotton boll was recorded in control practice as compared to salinity gradient treatments. Sodium (Na ), Potassium (K ) and Chloride (Cl ) contents in leaf sap were present more in salinit...
Muhammad Tahir* and Neelam Yasin*
EFFECT OF MICRONUTRIENTS FOLIAR APPLICATION ON YIELD AND QUALITY OF MAIZE
...s significantly improved plant height, cob length, number of grains rows cob , cob weight, 1000-grain weight, grain yield, biological yield, harvest index, grain protein and grain oil contents. However, micronutrients application at stem elongation stage showed non-significant effect on plant papulation and number of cobs plant . Therefore, for attaining maximum yield of maize, it is sugge...
Mehwish Kiran*, Muhammad Saleem Jilani*, Kashif Waseem*
and Muhammad Sohail**
EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON GROWTH AND YIELD OF RADISH ( L)
...100 kg ha . Data on leaf plant , leaf length (cm), fresh leaf weight plant (g), dry leaf weight plant (g), root length (cm), root diameter (cm), fresh root weight plant (g), dry root weight plant (g), total biomass plant (g), root yield pot (g) and root yield (t ha ) were recorded an...
Arshia Naeem*, Maria Anjum*, Mariam Rehman*, Zahid Mahmood** and Muhammad Asif Kamran**
AN INTEGRATED INFORMATION SYSTEM TO FACILITATE FARMERS IN WHEAT, SUGARCANE AND OTHER CROP DISEASES IDENTIFICATION
...ize yield losses in crop plants. An integrated application to facilitate farmers to communicate their crop related issues directly to agriculture scientists is proposed. This 'AXPERT Platform' consists of web application that provides user centered interface to farmers and a desktop application that facilitates agricultural scientists to identify crop diseases. A case study was developed from Faisalabad region where information about crops, their soil conditio...
ROLE OF HONEY BEES FORAGING ACTIVITIES IN INCREASED FRUIT SETTING AND PRODUCTION OF APPLES APIS MELLIFERA MALUS DOMESTICA
...eight gain in pollinated plants compared to non-pollinated plants. Maximum number of fruits per panicle were 5.33±0.51(Mean±SE) whereas the highest fruit weight 170±2.65g (Mean±SE) was recorded in plants provided with augmentation of honey bees along with natural pollination. The lowest fruit weight of 80±3.05g (Mean±SE) and the minimum 0.33±...
Asif ullah Khan*, Faizan Ullah*, Sultan Mehmood*, Muhammad Irshad* and Farhat Ullah Khan**
ALLELOPATHIC EFFECTS OF JATROPHA CURCAS L. LEAF AQUEOUS EXTRACT ON EARLY SEEDLING GROWTH OF L. PARTHENIUM HYSTEROPHORUS
...ng interest as biodiesel plant in Pakistan. Therefore, it is necessary to investigate the interaction of not only with crop plants but also with weed species before its introduction into agroforestry systems. During present investigation, allelopathic potential of leaf aqueous extract was investigated on seed germination and seedling development of L. Extracts were applied at 25%, 20%, 15%, 10% and 5% as seed soaking for 8 h...
Ehsanullah*, Muhammad Amjad Shahzad*, Shakeel Ahmad Anjum*, Ali Zohaib*, Muhammad Ishfaq* and Ejaz Ahmad Warraich*
EFFECT OF DIFFERENT SOWING METHODS AND PLANTING DENSITIES ON GROWTH, YIELD, FIBER QUALITY AND ECONOMIC EFFICACY OF COTTON
...erent sowing methods and planting densities. A field experiment was conducted to evaluate the influence of different sowing methods and planting densities on growth, yield, quality and economic returns of cotton. Sowing methods included pit planting (1 m × 1 m pits), bed planting (75 cm apart beds), ridge plantin...
Tassadduq Rasool*, Ali Zohaib*, Ehsanullah*, Riaz Ahmad*, Tasawer Abbas*, Tahira Tabassum*, Muhammad Ather Nadeem*, Mahmood-ul-Hassan*
FORAGE YIELD AND QUALITY IN PEARL MILLET-SESBANIA INTERCROPPING SYSTEM UNDER VARIOUS GEOMETRICAL PATTERNS
...forages following proper planting geometry is an important strategy to achieve higher yield of quality forage. A field experiment was performed to evaluate agroqualitative response of forage pearl millet sown as a base crop and sesbania as intercrop under different geometrical patterns (line sowing of sole pearl millet, line sowing of sole sesbania, cross planting of pearl millet and sesbania, blended seed sowing of pearl mi...
Muhammad Nawaz*, Anwar Javaid Wahla*, Muhammad Saleem Kashif*, Masood Qadir Waqar**, Muhammad Anjum Ali*** and Asim Raza Chadhar****
EFFECTS OF EXOGENOUS NITROGEN LEVELS ON THE YIELD OF RICE GRAIN IN SHEIKHUPURA, PAKISTAN
... rice cultivars was transplanted during the second week of July. The results indicated that different nitrogen levels had a significant effect on all studied parameters of both rice cultivars during all the years of experimentation. Both cultivars also differed significantly from each other in number of grains per spike, 1000-grain weight and paddy yield during all the years of experimentation. Application of nitrogen at 255 kg ha was the most suitable level o...
Syed Haider Abbas*, Ayesha Tahir**, Muhammad Asim***, Muhammad Sohail* and Riaz-ud-Din*
PRODUCTIVITY AND PROFITABILITY OF WHEAT PAK-13 AT DIFFERENT SEEDING DENSITIES UNDER RAINFED CONDITIONS
...ent of seeding densities planted at NARC, Islamabad during the rabi season of 2014-15. The experiment was done under Randomized Complete Block Design and was replicated four times having six different seeding densities (SD1: 50, SD2: 75, SD3: 100, SD4: 125, SD5: 150 and SD6: 175 kg/ha) The analysis revealed that the highest chlorophyll contents (49.5), number of tillers/m (240), biological yield (7125 kg/ha), and grain yield (2660 kg/ha) were achieved at seedi...
Nasarullah*, Raiz uddin*, Fakhar Uddin* and Muhammad Jamal*
INTERPRETING WHEAT GENOTYPES FOR GRAIN YIELD UNDER DIFFERENT REGIMES OF KHYBER PAKHTUNKHWA
...ading, days to maturity, plant height (cm), spike length (cm), spikelets spike , 1000-grain weight and grain yield. Flag leaf area (cm displayed non-significant differences across environments and its interaction with genotypes. Mean values across the environments range between 147.17 to 174.00, 190.83 to 202.83, 23.32 to 54.13,78.40 to 115.17, 9.72 to 13.08, 16.33 to 23.80 for days to heading, maturity, flag leaf area, plant
Muhammad Sharif1*, Shahzada Sohail Ijaz2, Muhammad Ansar3, Ijaz Ahmad4 and Syed Abdul Sadiq5
...ically same under CT (83 plants m-2, 6.02 Mg ha-1, 3.32 Mg ha-1, respectively), MT (83 plants m-2, 5.90Mg ha-1, 3.26 Mg ha-1, respectively) and RT(72 plants m-2, 5.92 Mg ha-1,3.20Mg ha-1, respectively)tillage systemswith retention of crop residues,whilesignificantly lower values were recorded...
Waqar Islam*
... under threat by various plant diseases worldwide. A sudden epidemic breakout of any plant disease can cause huge economic losses leading towards the famine. To cope with this situation, understanding plant disease triangle and disease epidemic forecasting is very important. So here we have briefly introduced plant disease epidemiology through highlighti...
Muhammad Zameer Kayani1,*, Tariq Mukhtar2 and Muhammad Arshad Hussain3
... the other hand, ages of plants at inoculation had negative correlations with reductions in these parameters at each inoculum density. The production of galls was found to be positively correlated with the inoculum densities and plant ages. However, rate of nematode build up decreased with an increase in inoculum density and appeared to be negatively correlated with inoculum densities and, on the contrary, was found to be po...
Mubashar Hussain, Muhammad Faheem Malik, Sehreen Siddique, Muhammad Umar, Tamkeen Zainab, Fatima Zafar
...ent pests and their host plants.
...
Ehtisham Shakeel Khokhar*1, Amir Shakeel1, Muhammad Amir Maqbool1, Muhammad Khubaib Abuzar2, Sumaira Zareen2, Syeda Sana Aamir4 and Muhammad Asadullah4
...types of gene action for plant height, number of monopodial branches, number of sympodial branches, numbers of bolls, boll weight, seed cotton yield, lint percentage, fiber length and fiber strength. The parents VH-259, CRS-456 and AA-703 among lines and PB-39 among testers displayed significant GCA effects for most of the traits. VH-259 × PB-39, CRS-456 × CIM-608 and AA-703 × PB-900 registered significant SCA effects and positive heterosis a...
Mei Li1, Di Zhang2 and Wan-Long Zhu1,*
...r to test the effects of plant secondary metabolite on energy metabolism and thermogenesis, changes in resting metabolic rate (RMR), nonshivering thermogenesis (NST) and energy intake were measured in Eothenomys miletus fed diets containing 0, 3.3% and 6.6% tannic acid, respectively. The results showed that E. miletus fed the diets with 6.6% tannic acid increased RMR compared with control on day 14, and reduced the gross energy intake (GEI) and d...
Nadia Mubarik1, Aqib Iqbal1*, Iqbal Munir1 and Muhammad Arif2
... foliar application, the plants were regularly irrigated upto one week and water stress was imposed by withholding water from half of the pots for 20 days. Data were recorded on the relative water content (RWC), proline, sugar content and transcripts abundance of Lhcb2 gene in the selected leaves. Application of CaCl2 increased the RWC, proline and sugar content as well as the Lhcb2 expression in the leaves under both irrigation conditions; however, the effect...
Muhammad Arshad,1* Sajjad Ahmad1, Muhammad Sufyan1, Zain-ul Abdin1 and Sumaira Maqsood2
...ation of 1.3 and 1.1 per plant in wheat monoculture respectively in the third week of March, The garlic (1.1/plant) and brassica (0.8/plant) showed maximum population while minimum population of coccinellid recorded in berseem (0.6 per plant) and alfalfa (0.5 per plant). Similar population level was reported in differe...
Hamza Khan1, Safdar Ali1, Ijaz Ahmad*2, Ihsanullah Khan3, Shujaat Hussain1, Bashir Ahmad Khan4 and Muhammad Suhaib5
...er, number of leaves per plant, plant height, head diameter, days to maturity, 100 seed weight, number of seeds per head and seed yield per hectare. Quality parameters were consisted upon oil content (%), protein content (%) and Fatty acid profile. Results showed that SMH-1001 and SMH-1215 hybrids performed best for yield and quality parameters, whereas, SMH-1006 and SMH-0909 were considered best for early maturing traits. &...
Muhammad Suhaib1, Ijaz Ahmad2*, Masooma Munir3, Muhammad Bilal Iqbal4 , Muhammad Khubaib Abuzar5 and Safdar Ali6
...l role in supporting the plant growth and development under salt stress. Keeping in view these factors a hydroponic experiment was conducted on wheat with two levels of salicylic acid (0.25 mM and 0.50 mM) under two salt levels (75 mM and 150 mM) to assess that whether the salicylic acid is helpful in coping the harmful effects of salinity on crop growth or not and if it has certain positive response then which level is more suitable for wheat crop growth alon...
Azhar Mehmood1,2,*, Muhammad Farrukh Saleem2, Muhammad Tahir2, Muhammad Aqeel Sarwar3, Tasawer Abbas4, Ali Zohaib2, Hafiz Tassawar Abbas5
...crop productivity. Among plant nutrient deficiencies, nitrogen and boron limitation is the most prevailing problem in the world, which is involved in the decline of sunflower production. Therefore, a field experiment was conducted to examine the combined effect of nitrogen and boron on growth, yield and oil quality of sunflower hybrids during 2009. Two nitrogen levels (0 and 150 kg ha-1) and three boron levels (0, 2 and 3 kg ha-1) were tested against two sunfl...
Najeeb Ullah1, Abdul Aziz Khakwani1, Niamat Ullah Khan2*, Muhammad Safdar Baloch1 and Ejaz Ahmad Khan1
...showed greater bolls per plant; weight per boll; seed cotton yield and ginning out-turn (GOT %). The results further showed that the genotype CIM-602 gave optimum yield owing bolls per plant, weight per boll, GOT % plus higher staple length compared to CIM-616 at 20 days irrigation interval. Thus it was concluded that the genotype-CIM-602 irrigated at 20 days interval suited well to the study area and had the potential to op...
Nadia Faqir1, Aish Muhammad2*, Ghulam Muhammad Ali2, Armghan Shehzad2, Hafeez Ur Rahman3, Farhatullah4 and Muhammad Zeeshan Hyder5
...cant relationship of the plant morphology with the chemical composition of fruit. ...
Feroza Haider1,2, Shamim Gul2,3*, Javaid Hussain4, Sadaf Asalam Ghori5, Muhammad Naeem Shahwani6, Muhammad Murad6 and Abdul Manan Kakar7
...ficantly the aboveground plant biomass by 28% - 34.3% under groundwater and 18.3% - 30.4% under wastewater irrigation. Dry weight of root biomass increased by 16.1% - 20.2% under groundwater and by 21% - 31.2% under wastewater irrigation in response to biochar amendment. Wood-derived biochar at higher application rates and manure-derived biochar at all application rates showed significant influence on crop growth performance of B. rapa. Wood-derived biochar at...
Sher Nawab Khan* and Ghulam Hassan
Zakirullah Jan1, Shamsher Ali1*, Tariq Sultan2, Muhammad Jamal Khan1, Zahir Shah1 and Farmanullah Khan1
...on with large numbers of plants and microbial mats. In this regard, a pot experiment was carried out with the aim to assess the impact of different strains of cyanobacteria on rice crop growth and nutrients uptake under saline soil condition at National Agricultural Research Center (NARC), Islamabad Pakistan during summer 2016. A total of 18 experimental pots were induced with salinity of 7.0 dS m-1 and arranged in Completely Randomized Design (CRD) with three...
Ghulam Muhae-ud-Din1,4, Anam Moosa1, Umer Farooq Ghummen1, Muhammad Jabran1, Amjad Abbas1, Muhammad Naveed2, Abdul Jabbar1 and Muhammad Amjad Ali1,3,*
...i> is the most dangerous plant parasitic nematode species that infects a huge number of crop plants. It also infects the ornamental plants resulting in a serious growth-limiting factor in ornamentals. In this study, the response of ten ornamental plants to M. incognita was assessed in pot experiments. All the ornamental pl...
Muhammad Suhaib1*, Ijaz Ahmad2, Masooma Munir3, Badar-Uz-Zaman1, Bushra Atta4 and Muhammad Khubaib Abuzar5
...ed that damage the vital plant organelles causing disturbances in the normal functioning of the plant and even may lead to death in severe cases. The results of this study conferred that there were genotypic variation found in two genotypes regarding salinity tolerance. SARC-4 was found to tolerate more salt stress as compared to Parwaz-94 and performed better at both salinity levels then Parwaz-94. Salicylic acid induced im...
Mehran Ali, Inamullah*, Sajjad Ahmad and Arsalan Khan
...s exhibited that, higher plant height (200.4 cm), grains ear-1(351), seed index (228.8 g), grain yield (3522 kg ha-1), and biological yield (10799 kg ha-1) were observed with nitrogen sources incorporated with mould board plough. In case of nitrogen sources; poultry manure (3507 kg ha-1), sheep manure (3468 kg ha-1) and mushroom spent (3450 kg ha-1) gave at par grain yield with urea (3667 kg ha-1). However, soil organic matter was significantly higher in organ...
Baharullah Khattak1*, Saifullah2, Shaukat Hussain2, Musharraf Ahmad2, Asad Ali2, Mohammad Junaid2, Ijaz Ahmad Khan3, Taj Ali Khan1 and Mubbashir Hussain1
... management of important plant pathogens including root knot nematodes (RKN). In the present studies, 15 isolates of Trichoderma harzianum were collected from different the root knot nematodes-infested tomato field of Malakand and Swat, Pakistan. These isolates were tested for their nematocidal effects against Meloidogyne javanica. Anti-J2 antagonistic test divided the isolates into 5 antagonistic groups or AGs. AG1 was observed as the most antagonistic group,...
Madeeha Alamzeb1, Shazma Anwar1, Asif Iqbal1,2*, Song Meizhen2, Mazhar Iqbal3, Sara4, Muhammad Ramzan2 and Afza Tabassum1
...titioning into different plant parts at heading and physiological maturity as compared to sheep and cattle manure. Application of nitrogen at the higher rates (125 to 150 kg N ha-1) enhanced dry matter partitioning at heading and physiological maturity than lower N rates and control. Likewise, wheat sown with deep tillage system resulted in increased dry matter partitioning into different plant parts than conventional tillag...
Safdar Ali1*, Obaidullah Shafique1, Tariq Mahmood2, Muhammad Amir Hanif1, Ijaz Ahmed3 and Bashir Ahmad Khan4
...s by DNA transfer in the plants or nanoparticle-mediated gene. Biofuel production from biomass is estimated to speed up using nanotechnology. Researchers and manufacturers have to demonstrate that the application of nanotechnologies have no harmful effect on the atmosphere against the anomaly based only on small amounts of toxicological research and concerns about the safety of nanomaterials....
Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4
...ile the distance between plants to plant was 30 cm. The seed was sown in the first week of August. The following parameters were studied in the experiment i.e. days to flower initiation, days to flower completion, plant height, days to maturity, stem diameter, head diameter, number of leaves, 1000 seed weight and seed yield per hectare. Quality parameters were consisted upon oil content (%...
Ghufran ul Haq1*, Muhammad Arif2, Asad Ali2 and Mian Inayatullah3
...eflies inoculated tomato plants. Transmission properties of the virus were determined by inoculation of tomato plants of susceptible cultivar, Roma-VF, by whiteflies, determining the minimum time required for acquisition and inoculation of the virus, latency period and the persistence capacity. The highest incidence of 9.47 percent of TYLCV was recorded in Mohmand Agency, followed by Malakand Agency with 8.2 percent, Shabqad...
Fayaz Ahmad1*, Noorullah Khan1, Farrukh Siyar Hamid1, Qamar uz Zaman1, Shamsul Islam1, Muhammad Abbas Khan1 and Sair Sarwar2
...replications. Mature tea plants (26 year old) of Qi-men variety were deeply pruned (30 cm from the ground level by completely defoliating the bushes) on five different dates i.e., November, December, 2012, January, February and March, 2013 having one month interval. Application of potash fertilizer @ 90,120 and 150 kg ha-1 was also compared with control for studying its role in the recovery and growth of deeply pruned tea. The earliest shoot sprouting (April, ...
Nadia Saeed1,Mian Sayed Khan2, Habib Ahmad3, Muhammad Abdullah4 and Muzafar Shah5,*
...lnut trees infested with plant parasitic nematodes were treated with different organic amendments pigeon manure, horse dung, cow dung, duck manure and castor oil cakes at the rate of 8 Kg/tree and saw dust at the rate of 10kg/tree, respectively. Untreated trees were kept for the comparison. Soil samples and sub samples of both treated and untreated trees after 3, 6 and 12 month from Abbottabad and Mansehra by using Bearmann funnel technique. After Quantitative...
Jun Chen1, Shuai Shang2, Xiaoyang Wu1, Jiakuo Yan1, Huaming Zhong1, Huanxin Zhang2, Weilai Sha1, Wanchao Zhu1 and Honghai Zhang1,*
... digest large amounts of plant material through microbial fermentation in the hindgut. So far, there has been no study of the gut microbiota of the cape oryx. Here, we provided the first description of the fecal bacterial populations of the cape oryx by using high-throughput Illumina sequencing technology. We analyzed 100,180 high-quality sequences of the 16S rRNA gene obtained from fecal samples from three cape oryx animals, one female and two males. At the 3...
Tengfei Lu1, Wenhua Pei1, Shuang Zhang2, Yangnan Wu1, Fenghao Chen2, Xiao Han2 and Weijun Guan1,*
...e a good option for transplantation for treatment and regenerative medical projects.
...
Shamsher Ali1*, Sarmad Khan1, Muhammad Jamal Khan2, Naveed ullah4, Muhammad Rashid3 and Wiqar Ahmad1
... regarding emergence and plant heights. From the interactions it is clear that under normal soil conditions, emergence percentage of Pirsabak-2004 variety was maximum (100 %), under moderate soil salinity, emergence percentage of Siren variety was maximum (27 %), while under high salinity, emergence percentage of Atta Habib variety was maximum (30 %). Under highly saline soil, the maximum plant growth i.e 1.03 cm, 1.80 cm an...
Sumaira Maqsood1,*, Muhammad Afzal2, Muhammad Anjum Aqueel2, Waqas Wakil3 and Hafiz Azhar Ali Khan1,*
...field condition. Minimum plant infestation (7.60±0.40%) was observed three days after application when B. thuringiensis and flubendiamide were applied in combination (@0.5 kg/ha+75ml/ha, respectively). Maximum infestation (11.60±0.97%) was observed in SpltNPV @ 1.0×109 POB/ml + B. thuringiensis @1.00 kg/ha. Similarly, five days after application minimum plant infestation was obser...
Syed Makhdoom Hussain1,*, Nosheen Aslam2, Arshad Javid3, Shehzadi Liaquat1,Muhammad Mudassar Shahzad1, 4, Muhammad Zubair-ul-Hassan Arsalan1 and Muhammad Adnan Khalid1
Ghulam Abbas1, Muhammad Jawad Asghar1, Muhammad Rizwan2*, Muhammad Akram1, Jaffar Hussain1 and Fiaz Ahmad1
...aturity and clusters per plant. Biological yield, harvest index and seed yield depicted high estimates of heritability (0.89, 0.85 and 0.84, respectively) coupled with greater genetic advance (61.57, 52.81 and 47.82, respectively) indicating the involvement of additive type of genes,and selection based on these traits may help to improve the germplasm. Seed yield showed positive and significant genotypic and phenotypic correlations with clusters per
Abdul Basit1, Muhammad Zeeshan Majeed1,4*, Sohail Ahmed2, Gohar Ali2 and Muhammad Javaid3
...estation on bitter gourd plants and compared it with reduced-risk insecticide formulations of spinosad. Refractive sheets of red, orange, yellow, green, blue, black and white were installed in M. charantia beds at three different angles (30º, 60º and 90º). Results revealed that control treatment exhibited significantly higher fruit fly infestation (60%) with minimum marketable fruit yield (374g/bed) than all other treatments. Among treatments, y...
Malik Muhammad Yousaf1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahmed1, Muhammad Zeshan1,2, Muhammad Mohsin Raza1 and Kazim Ali2
...te block design. Data on plant height, branches per plant, capsules per plant, number of seeds per capsule and yield was taken into account at maturity and statistically analyzed. All yield contributing traits showed positive response with increase in fertilizer rate. Maximum yield was found at T6 (NPK @ 40:30:15) and T6 and T7 (NPK @ 40:30:30) showed parity for seed yield. Significant dif...
Rizwana Qamar1, Maria Ghias1, Fida Hussain1, Sajida Habib1, Muhammad Khuram Razzaq2*, Muhammad Aslam1 and Imran Habib3
... inexpensive approach by plant breeders to manage with drought. A wire house experiment was conducted in Oilseeds Research Institute, Ayub Agricultural Research Faisalabad for the screening of genotypes against drought. Ten hybrids along with their 13 parental inbred lines were grown in polythene bags following factorial structured completely randomized design by three replications against three levels of water stress. Data was recorded on root length (cm), sh...
Muhammad Fiaz1*, Muhammad Afzal1 and Muhammad Zeeshan Majeed1,2
...c insect pests of citrus plants and a putative vector of Huanglongbing worldwide. Treatments were comprised of label-recommended (FD) and its half (HD) dose rates of spirotetramat and I. fumosorosea formulations. Both treatments were applied either alone or in binary combinations. There was a significant reduction in psyllid population for all treatment combinations as compared to control (F8, 107 = 70.36; P-value = 0.001 for 2016 and F8, 107 = 63.58; P-value ...
Sukirno Sukirno1,2, Muhammad Tufail1,3,*, Khawaja Ghulam Rasool1, Said El Salamouny1, 4, Koko Dwi Sutanto1 and Abdulrahman Saad Aldawood1
...ate the effectiveness of plant extracts to improve the persistence of Spodoptera littoralis multiple nucleopolyhedrovirus (SpliMNPV) against beet army worm, Spodoptera exigua(Hübner) under harsh sunny field conditions in Saudi Arabia. A preliminary test of SpliMNPV was performed to determine the lethal concentrations of this virus against the first and second larval instar of S. exigua. The potency of ten
Muhammad Mudassar Shahzad1,2, Syed Makhdoom Hussain2,*, Farhat Jabeen2, Abdullah Ijaz Hussain3, Arshad Javid4, Muhammad Asrar2 and Muhammad Zubair-ul-Hassan Arsalan2
... based diets. Phytate in plant by-products decreases the bioavailability of minerals and deposition of nutrients in fish body, resulting in poor fish growth. Results demonstrated that phytase supplementation showed significant (p<0.05) improvement in ADC% of minerals and carcass composition of fish. Maximum digestibility of minerals and improved carcass composition of C. catla fingerlings was noted at 900 FTU kg-1 level of phytase s...
Saeed Ullah1, Amanullah Jan1, Murad Ali2*, Wiqar Ahmad3, Hafeez Ur Rehman2, Muhammad Ishaq2 and Bilal Ahmad2
... four times. Pods number plant-1 (PN), grain yield (GY) biological yield (BY), and harvest index (HI) were significantly increased by 9, 4, 23 and 8%, respectively over the control with fertilizer banding compared with broadcast. Plots receiving 10 kg Zn ha-1 registered a significant increase of 8, 9, 4, 27 and 9%, in plant height (PH), PN, GY, BY and HI, respectively over the control, and recorded the lowest number of days ...
Imadud Din1*, Fazal Munsif1, Irfan Ahmad Shah3, Hamayoon Khan1, Fahad Ullah Khan1, Ibrarullah2, Shahab Uddin4 and Tauqir Islam1
...advance was recorded for plant height. Wheat genotype PR-110 out performed for grain yield, while PR-103 exhibited higher biological yield. Highest number of productive tillers m-2 was counted for PR-111, while intense leaf area index was displayed by PR-103. Hybrid-404 had relatively higher grain spike-1 while PR-114 was observed for highest 1000-grain weight. Among the genotypes Pirsabak-08 excelled for dwarf traits, while Hybrid-403 was found early maturing...
Muhammad Shoaib Saleem*, Muhammad Faheem Akbar, Amjad Sultan and Saqib Ali
...a devastans Dist.) on eggplant crop. The crops were grown in a Randomized Complete Block Design (RCBD) with three replications, each have five treatments inclusive of control. The recommended doses of Nitenpyram, Clothianidin, Momentum (combination of Nitenpyram+Chlorfenapyr) and Buprofezin were applied when population of insect pests reached at economic threshold level (ETL). Pre-treatment data were taken before 24 hours and post-treatment data were recorded ...
Syed Muhammad Hassan Raza1*, Syed Amer Mahmood1, Veraldo Liesenberg2 and Syed Shehzad Hassan1
... km2 was covered by rice plantations. Thermal datasets covered the area of 8627 km2 comprising 10663 pixels which returned 10663 spatially distributed temperature values. Six, thermal datasets were obtained for the duration between (April 03-June 22) 2014, with a temporal window of 16 days to delineate YSB vulnerability from egg laying to pupa evolution stage. The results obtained highlight that 73% of the investigation area were venerable for a female YSB to ...
Abdur Rehman and Zahir Shah
...35 %, N concentration in plant by 29 %, N uptake by 50 %, N2 fixation by 85 % over the control. Application of Mo and Fe at all levels alone or in combinations also improved soil organic matter, mineral N, P and K status that could be associated with more N2 fixation, enhanced plant and root growths of plants. These results suggested that application of both Mo and Fe is necessary for pea ...
Mudassar Javed1,Muhammad Zeeshan Majeed1,*, Muhammad Sufyan1, Sajjad Ali2 and Muhammad Afzal1
...was 1.87 and 2.12 larvae/plant in 2015 and 2016, respectively, compared with 6.5 larvae/plant in untreated control plots. For the botanicals, an average of 2.57 and 2.92 larvae/plant was recorded in 2015 and 2016 respectively, compared with 4.12 in untreated control plots. Among the synthetic insecticides tested, emamectin benzoate and indoxacarb caused the most significant reduction of ok...
Zhu-Mei Ren1,*, Xu Su2, Carol D von Dohlen3 and Jun Wen4,1,*
...y host. Its primary host plant is Rhus hypoleuca, whereas other Nurudea species are on R. chinensis.
...
Fiaz Ahmad1, Mumtaz Hussain2, Ghulam Abbas1, Muhammad Jawad Asghar1 and Muhammad Rizwan3*
...tents and number of pods/plant also showed significant differences among varieties. All physiological and yield parameters showed gradual reduction with increasing concentration of lead and water stress. Uptake of Na+, K and P was reduced significantly in all treatments but lead accumulation in shoot was increased in single lead treatment (80 mg Pb2+ 100% FC) as compared to combined lead and water stress treatment. Combined lead and water stress treatment (80 ...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
... incognita and other plant parasitic nematodes multiplied significantly more in untreated soil than in treated soil, which clearly indicated that L. muscarium effectively reduced the nematode infestation level in the soil.
...
Qudsia Yousafi1,*, Muhammad Afzal2, Muhammad Aslam3 and Allah Ditta Abid4
...attacking almost all the plant parts except roots. The effect of removal of BSFB infested brinjal shoots and use of light trap was studied for management of this insect pest. The study was conducted on spring sown crop during 2013 in Sahiwal, Pakitan using brinjal variety, Nirala. The experiment was laid out in Randomized Complete Block Design with four treatments each repeated three times. The treatments were T1= removal of infested shoots, T2= Use of light t...
Fazal Munsif1, Muhammad Zahid1, Muhammad Arif2, Kawsar Ali3 and Ijaz Ahmad1
...n in crop cycle or delay planting can be compensated by increasing the cropping intensity on same field. A field experiment was carried out during the year 2015-16 at Palatoo Research Farm of Amir Muhammad Khan Campus Mardan, The University of Agriculture Peshawar. The experiment was consisted of traditional cultivation of sugarcane both in winter season (20th September, 10th October, 30th October and 20th November) and spring season (20th February, 10th March...
Ansaar Ahmed1, Imtiaz Hussain2*, Ibni Amin Khalil3, Subhanulla3, Gulzar Ahmed3, Imtiaz Ahmad3 and Muhammad Imtiaz2
...ting of wheat and manual planting of maize on flat surface coupled with flood irrigation are used in irrigated maize–wheat system of Khyber Pakhtunkhwa (KP) province that requires skilled labor, intensive tillage and more water for irrigation. In this study, zero tillage and bed planting effect in comparison with farmer practice on maize-wheat system productivity was evaluated at five sites in district of Nowshera, KP ...
Muhammad Haroon Hullio1,4, Abdul Ghani Lanjar2, Abdul Rahman Dhuyo3, Imran Khattri4 and Agha Mushtaque Ahmed4*
...: justify;">White-backed planthopper (WBPH) Sogatella furcifera is one of the most important insect pests of rice throughout the Asia. The recent abundance of pest in Pakistan is in ascending order that requires high attention. Therefore, this study was designed to observe the emerging suitation of WBPH in Sindh province which is the main stack holding area of rice. Three different ecological zones of Sindh province including Larkana, Jacobabad and Badin were ...
Habib-ur-Rehman1*, Saima Mirza1*, Mansoor-ul-Hasan2, Qurban Ali3, Hafiz Abdullah Shakir4, Muhammad Yasir5
...g powders of each of the plant was extracted on rotary shaker using four solvents viz.; methanol, chloroform, petroleum ether and n-hexane separately. Periodic analysis for the repellent effects was carried by impregnating each filter paper (half-disc of filter papers) with micropipette at three concentrations (5, 10 and15%) of each of the plant extract. The repellence was recorded after 24, 48 and 72 h of the treatme...
Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2
... sprayed-glucose treated plants showed increasing trends in grain yield under drought. Physio-chemical attributes were also modulated by exogenously applied carbohydrates. Nitrate reductase activity and total soluble proteins were increased with increase in sugar treatments under drought. Osmotic and water potentials were reduced under drought but foliar glucose sprays of 10 mM and 50 mM applied at reproductive phase significantly reversed the adverse effects ...
Saima Siddiqui1*, Ghulm Hussain Abro1, Tajwar Sultana Syed1 and Abdul Sattar Buriro2
...and (0.66) predators per plant during 2011 and 2012, respectively. The studies indicated that on average maize intercropped with cotton as trap crop resulted in the lowest density of jassid, thrips and whitefly and the higher population of predators, G. ochropterus, Orius spp. and Zanchius sp. per plant. ...
Nevran Eylem Akman Gündüz1,* and Özgür Özcan2
...div>The influence of the plant growth regulator gibberellic acid (GA3) on the hemolymph contents of Galleria mellonella (Lepidoptera: Pyralidae) was examined. G. mellonella larvae were fed with a synthetic diet. The effects of GA3 on the hemolymph content of these larvae were tested through a diet incorporation assay. Different concentrations (2, 5, 10, 50, 100, 200, 500 and 1000 mg/L) of GA3 were added to the syn...
Xiaqing Chen, Yü Huang and Zhen Huang*
...bolites that can inhibit plant pathogens. Trichoderma hamatum isolated from infected mulberry fruits was evaluated for its efficiency to suppress plant pathogen S. shiraiana alone or in combination with fungicide carbendazim under laboratory conditions. The results showed that S. shiraiana was not detected on mulberry leaves and branches, whereas it was only detected in mulberry fruits. T....
Ali Sher1*, Khalid Naveed1, Gulzar Ahmad2, Ayub Khan1, Muhammad Saeed1 and Shah Masaud1
...rowth and development of plant. Improving N availability to plants improve biomass production and also increase the shoot Fe content and accumulation of Zn in wheat plants. Experiments were conducted at the Cereal Crop Research Institute (CCRI) Pirsabak, Noweshera, Khyber Pakhtunkhwa, Pakistan during 2014-15 and 2015-16 to study the response of wheat to N, Zn and Fe application. Treatments...
Muhammad Ishfaq1*, Nadeem Akbar1, Imran Khan1, Shakeel Ahmad Anjum1, Usman Zulfiqar1, Muhammad Ahmad1, Mumtaz Ahmad2 and Muhammad Umer Chattha1
Ashraf Khan1*, Suliman Shah2, Maid Zaman3 and Komal Habib2
...ortality was observed in plants treated with combination of Nitenpyram + Chlorfenapyr (99.20 and 99.89 %) followed by Flubendiamide (89.83 and 99.39 %) and Imidacloprid (89.31 and 98.77 %) after spray 1 and 2, respectively. Least effective insecticide was proved to be Melathion with 39.79 and 65.43 percent reduction in citrus psyllidspopulation except untreated plants with 9.27 and 15.94 percent decrease after first and seco...
Muhammad Faheem Jan1*, Asad Ali Khan1, Waqas Liaqat1, Haseeb Ahmad1, Muhammad Dawood Ahmadzai1 and Wazir Rehan2
...ea, leaf area index, and plant height) which resulted in different grain yield. Among hybrids DK-Garanon gave highest value for all the studied parameters as compared to others hybrids. Similarly, in K ratios higher values for the studied traits were recorded in plots which were treated with K 40% from organic (poultry manure) and 60% from inorganic (sulphate of potash) sources. It can be concluded that application of K at the rate of 80 kg ha-1 from both orga...
Madiha Naz1, Qudrat Ullah Khan1*, M. Jamil Khan1, Obaid Ullah Sayal2, Asim Afridi3 and Aziz Ullah Sayal3
...PK. Number of fruits per plant were recorded highest in the pots recieving poultry manure either with Foliar NPK or NAA. The yield of tomato was found greater in the treatments recieving soil applied NP, which was statistically similar in the treatment recieving poultry manure with foliar NPK. The treatments in the current study have shown to influence the qualitative parameter of tomato as total soluble solids, while the water content and fruit pH were non si...
Saif Ullah and Mohammad Akmal*
...h six rows were made and planted at 0.7m spacing on ridges. Results revealed that N 120 kg ha-1 resulted in the maximum days to flowering, leaf chlorophyll content, capitulum diameter and grains including their weight, which resulted in higher grains yield. Likewise, the increased in P rates have shown better results for all the observed traits with P 90 kg ha-1. Sulphur application of 30 kg ha-1 also showed better performance on sunflower yield traits. At som...
Muhammad Javed Iqbal and Muhammad Naeem*
... meal diets with cheaper plant origin crude protein diets in fish culture. A total of 15 aquaria having 20 samples each were arranged in triplicate for 90 days to study the effect of five feeding groups on Length-weight relation and external morphometric variants of Labeo rohita. A total of 75 fish samples @ 5 fish samples per aquaria were analyzed in present study. T1 showed the highest values for mean wet weight 11.32±1.78, Total length 10.54±0...
Tariq Aziz1, Iftikhar Hussain Khalil1, Quaid Hussain1,3*, Tariq Shah2,3, Nazir Ahmad1 and Amir Sohail1
... and grain yield (32.0 g plant-1). F3 population B-RF7 × Janbaz had 100-grain weight (4.5 g) and grain yield (31.9 g plant-1). Similarly, F3 population B-RF1 × Janbaz had more single spike weight (4.1 g). Population B-RF3 × Janbaz had maximum spike length (14.5 cm) and number of grains spike-1 (85.1). F3 populations B-RF7 × Pirsabak-08, B-IV(N)5 × Pirsabak-08, B-RF7 × Janbaz, B-IV(N)5 &tim...
Abdur Rehman1* and Shad Khan Khalil2
...uce drought tolerance in plants. Field trials were conducted at Agricultural Research Institute Tarnab, Peshawar-Pakistan to study the effects of moisture stress and foliar application of chemicals at different growth stages on canola growth and phenology during 2015-16 and 2016-17. The experiment comprised of four moisture levels (optimum water, 10%, 20% and 30% reduced irrigation water), three chemicals (salicylic acid 0.5mM, potassium nitrate KNO3 1% and me...
Shamsher Ali1, Zakir Ullah Jan1*, Zahir Shah2, Muhammad Jamal Khan2, Farmanullah Khan2, Inayat ur Rahman3 and Shah Fahad3
...he significantly maximum plant height of Azam cv. (260 cm) and hybrid (247cm) were recorded in treatment T5 (N- P2O5@ 130-90 kg per hectare + 20 ton per hectare FYM) followed by T6 (50-45) kg N, P2O5 ha-1 + FYM @ 20000 kg ha-1. The Azam plants were taller than hybrid. The treatment (T5) significantly yielded more grain (6806 kg ha-1) and (5106 Kg ha-1) from hybrid (CS-200) and a local maize Azam cultivar, respectively. Simil...
Yasir Ali1*, Muhammad Aslam Khan1, Muhammad Atiq1 and Muhammad Hussain2
...e will help as basis for plant pathologist, plant breeders and genetics to develop non-specific rust resistant wheat varieties through gene pyramiding or marker assisted breeding ...
Raza Ullah Khan*, Ahmad Khan, Mohammad Zameer Khan, Fayyaz Hussain and Sonia Saba
...astic container. Data on plant growth parameters (plant height, biomass and grain yield) was collected at the end of the experiment taking as an average of the three replications. Nutrients such as K, P and selected micronutrients concentration in shoot and root were determined once after harvest of crop and shown as mean of three replications. Results showed that different combination of P yielded significant response in
Zulqarnain and Zafar Iqbal*
...to the complete death of plant. None of the strategies in controlling the wilt have shown fruitful results. Dual culture assay was employed is this study to identify the fungal species with their potent antifungal activity against the Fusarium wilt of tomato. Six distinct fungal species including Penicillium sp., Aspergillus niger, Aspergillus flavus, Trichoderma harzianum, Alternaria solani and Pythium aphanidermatum showed growth inhibition (%) against the p...
Bushra Qadir1, Muhammad Asim2 and Mohammad Akmal1*
...ana) and water (H2O) and planted in pots on the next morning. The experiment was conducted in a completely randomized design at the University of Agriculture Peshawar during winter 2013-14. Periodic growth sampling was taken by harvesting three pots of treatments starting in early spring and thereafter during tHEgrowth to the maximum five samplings to study roots and shoot growth. Averaged across varieties and extracts, results revealed that
Arshad Iqbal1*, Syed Mehar Ali Shah1, Hidayat ur Rahman1, Faiza Aman2 and Aziz-ur-Rahman1
...ith their 8 parents were planted in a randomized complete block design (RCB) having three replications at The University of Agriculture, Peshawar during 2016 rice crop growing season. Data were taken on some of the morphological traits like number of days to heading (days), number of days to maturity (days), flag leaf area (cm2), culm length (cm), panicle length (cm), primary branches panicle-1 (no.) and secondary panicle branches (no.). Analysis of variance s...
Saeed Ahmad Shah Chishti1, Mudassar Iqbal1*, Nusrat Parveen1, Kashif Nadeem1, Muhammad Iqbal1, Umbreen Shahzad2, Rana Husnain Shabbir1 and Muhammad Najeebullah1
...and more No. of pods per plant. Sarsabz is 27 days earlier in pod bearing than Climax and five days than Pea-2009. It is suitable for early planting (mid of October) as well as for normal planting (Mid of November). Its seed is light green, round and bold and its average 100-fresh seed weight is 67.62 g which is greater than Climax (48.4 g), Pea-2009 (67 g) and Meteor (44.18 g). This varie...
Sher Nawab Khan* and Ghulam Hassan
... heading and grain yield plant-1. Significant differences were present for all the studied parameters. In diallel analysis highly significant dominant (b) and additive (a) genetic effects were detected for all the parameters except spikelets spike-1. Scaling test for the adequacy of the model was complete to partially adequate for the studied parameters. Similarly, both dominant (H) and additive (D) genetic components were observed significant for the studied ...
Aneel Salman1, Muhammad Iftikhar ul Husnain1, Inayatullah Jan2*, Muhammad Ashfaq2, Mudassar Rashid1 and Usman Shakoor1
...ent crop varieties, tree planting, and drip irrigation methods are prevalent in the research area. The major hurdles that farmers perceived in adaptation are limited access to credit, lack of access to information, and institutional support. As expected, no significant variations were found across districts in the characteristics of respondents (age and income) that can affect their perceptions, their adaptation strategies, and obstacles faced in adaptation. T...
Ambrin Rajput*
... parameters. The maximum plant height (85.00 cm), pods plant-1 (43.8), seed index (455 g per 1000 grains), seed yield (1896.0 kg ha-1), total biomass (5205 kg ha-1), straw yield (31050 kg ha-1), protein (15.77%), shoot N, P and K (2.1, 0.3 and 1.3 %) concencentration and N, P and K uptake (95.3, 16.4 and 49.9 kg ha-1) were recorded by combined application of N, P and K fertilizer application. However, the minimum values were...
Sabahat Noor*1, Shaukat Ali1, Hafeez-ur-Rahman1, Farhatullah2 and Ghulam Muhammad Ali1
...rmed and non-transformed plants. It was observed that under drought and salt stresses, proline contents, sugar contents, chlorophyll contents and relative water contents (RWC) were significantly higher in transgenic plants as compared to non-transgenic plants. From obtained results it is concluded that, increase level of RWC, proline, sugar and chlorophyll in transgenic
Shagufta Naz*, Saima Sharif, Hafsa Badar, Syeda Fareeha Tauheed
...nd leads to corneal transplantation. A cross-sectional, analytical study was carried out from August, 2015 to May, 2016 on and MCD patients were diagnosed by visiting different hospitals like, General Hospital, Al-Ehsan welfare Hospital, Mughal eye and Mayo Hospital with the help of ophthalmologist. The main purpose of such type of research was directed to find the prevalence of Macular corneal dystrophy in the families of Lahore. The techniques used for the d...
Umair Riaz1*, Muhammad Ali Kharal2, Ghulam Murtaza3, Qamar uz Zaman4, Sana Javaid4, Hina Ahmed Malik3, Humera Aziz3 and Zafar Abbas1
...stresses adversely upset plant growth and development via nutrient deficiencies, hormonal imbalances, ion toxicity as well as osmotic and oxidative anxiety. The most effective mechanism is the biosynthesis of secondary metabolites at cellular level which included organic compounds that help plants to cope with stress conditions by reducing the intensity of stress through enhancing antioxidants activities, detoxifying toxic i...
Shoaib Nawaz1, Muhammad Razaq1, Zahid Mahmood Sarwar1*, Muhammad Sajjad1*, Syeda Aneeza Ubaid1, Muhammad Asif Zulfiqar2 and Usman Haider1
...considered a heat loving plant cultivated in kharif and Rabi season. Okra fruit due to its nutrients like protein vitamin calcium potassium, value play an important role in Ghanaians diet. Sucking pest jassid become major problem on okra in tropical and subtropical regions and cause heavy losses. Neonicotinoid insecticide, like nitenpyram was used on calendar basis and ETL basis. Data was recorded on weekly basis. In first week jassid population in control and...
Muhammad Arshad*, Sabeeta Jan, Sundas Awan, Samra Azam, Shiguftah Khalid and Muahmmad Ayub Khan
...ighly significantly with plant height (PH) for both genotypic and phenotypic level. Correlation between plant height and oil content was found to be highly significant and positive. Seed yield had positive association but non-significant with DFI, PH 100SW, HD and OC percentage while negative association with DFC and DM. DFI, DFC, HD, 100 SW and OC percentage contribute positively toward seed yield. Present study depicts tha...
Ghazunfar Rashid1, Muhammad Avais1, Syed Saleem Ahmad1, Muhammad Hassan Mushtaq2, Rais Ahmed3,*, Mahboob Ali1, Muhammad Naveed-ul-Haque4, Mehtab Ahmad5, Mumtaz Ali Khan1 and Naimat Ullah Khan6
...rent parts of the fodder plants were estimated qualitatively through the Diphenylamine Filed Test (DFT) and quantitatively by spectrophotometry. The nitrate levels were highest in Jowar, followed by Jai, Shaljam, Makai, Bajra and Sarson. The concentrations were lower in the afternoon in the leaves and in mature crops as compared to stem parts, immature plants, and in samples collected from plant
Sajid Ali Khan1, Mazhar Hussain Ranjha1, Azhar Abbas Khan2,*, Muhammad Sagheer1, Amjad Abbas1 and Zeshan Hassan2
... two different medicinal plants (Dhatura alba and Calotropis procera) against two different strains of T. granarium. Plant extracts were obtained by Rotary Shaker apparatus by using acetone as solvent. Four different concentrations 5%, 10%, 15% and 20% were prepared by diluting in acetone. The data regarding mortality, growth regulation and repellency of T. granarium was observed. Repellency of
Muhammad Aqeel Sarwar*1, Shahid Riaz Malik1, Waqas Ahmad2, Muhammad Sajid Mahmood3, Muhammad Jawad1, Muhammad Asadullah1, Ijaz Ahmad4 and Muhammad Imran1
...luding yield. In case of planting times delayed sowing enhanced the maturity but July 05 reported best results especially for yield attributes like no. of clusters per plant, pods plant-1, biological yield, grain yield and harvest index, however it was statistically similar with planting time July 15 for all these traits. The interaction also exhibited s...
Syed Atif Hasan Naqvi1*, Ummad-ud-Din Umar1, Ammarah Hasnain2, Ateeq ur Rehman1 and Rashida Perveen1
...veral commonly available plant decoctions were investigated as the bioactive eco-friendly compounds, and as the possible alternatives to hazardous chemicals for the control of BLB of rice. Aqueous extracts of fifteen different plant parts either individually or in combination were tested at various concentrations under in vitro conditions by poison food and disk diffusion techniques while best effective seven were trialed in...
Muhammad Kashif Asghar1, Muhammad Aqeel Sarwar1,2*, Shahid Riaz Malik2, Waqas Ahmad3, Sumaira Zareen4, Safdar Ali5 and Abid Ali6
...cronutrient required for plant growth and development. So a field study was conducted to explore the potential of boron seed priming on yield and quality of sunflower hybrids at Agronomic Research Farm, University of Agriculture, Faisalabad. The achenes of two different sunflower hybrids i.e. Hysun-33 and FH-331 were subjected to different priming treatments including hydropriming, osmopriming (with 1, 0.1 and 0.01 mM B) using boric acid as a source of B. The ...
Zubina Hameed1, Muhammad Azim Malik1, Safdar Ali1*, Muhammad Ansar1, Farina Shaheen1, Ijaz Ahmad2 and Khisrao Kalim3
...igher number of tillers, plant height, spike length, and biological yield when compared with other treatments. The highest biological yield (10.55 t. ha-1) and grain yield (3.57 t. ha-1) were recorded in plots treated with Buctril-super along with highest benefit-cost ratio (2.52). Therefore, Buctril-super is recommended for best control of broad-leaved weeds and taking an economical yield of wheat. ...
*Muhammad Waseem1, Dost Mohammad Baloch1, Ghulam Khaliq1,
M. Rashid1, Qurban Ali2 and Mustajab A. Khan3
INTENSIFICATION IN BAMBOO (Bambusa bambos L.) TRAITS IN RESPONSE TO ORGANIC AND CHEMICAL NITROGEN ALONG THE COAST OF ARABIAN SEA
...trient which effects the plant growth and development. To check the influence of nitrogen sources on bamboo traits a field experiment was conducted during 2014-15. Experiment were carried out using randomized complete block design (RCBD) with square system of transplanting which was consist of 3 repetitions contained a net field size of 4.5m to 4.5m. Experimental sites were 20 km away from the Arabian Sea with an altitude of...
Muhammad Akram and Faheem Aftab
THIDIAZURON INDUCES IN VITRO BUD BREAK AND SHOOT DEVELOPMENT FROM NODAL EXPLANTS OF ORTHOTROPIC SHOOTS OF MAIDENHAIR TREE (GINKGO BILOBA L.)
...e cut to prepare nodal explants (5-10 mm long), surface sterilized and inoculated on MS (Murashig and Skoog, 1962) medium supplemented with different concentration (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1,2,3,4 or 5uM) of TDZ for 24 days. Highest bud break (100%) was obtained at 0.005 uM TDZ after 14 days of initial culture. The same cultures were further maintained and subsequently obtained with 20.6 mm shoot length and 7.2 average number of leaves for another ...
Farah Deeba, Hafiz Abdullah Shakir, Muhammad Irfan, Javed Iqbal Qazi*
Chitinase production in organisms: a review
...life (bacteria to higher plants and animals) as one of the most durable, richest biopolymers distributed widely in nature both in the terrestrial and marine environments. Chitinase are chitin degradable enzyme have control of phytopathogens, physiological functions and degradation of chitinous waste. Interest in chitin wastes utilization is increasing day by day because of its natural resistance against degradation. The review focused on different sources of n...
Shaukat Ali1,*, Sundas Nasreen1, Sobia Safeer1, Saiqa Andleeb1, Mubashir Ejaz1, Saira Bano2, Hafiz Abdullah Shakir3
Medicinal plants as therapeutic agents for cancer treatment
... cancer....
Maleeha Manzoor1,2*, Ruijuan Ma2, Hafiz Abdullah Shakir1, Fouzia Tabssum1, Javed Iqbal Qazi1
Microalgal-bacterial consortium: a cost-effective approach of wastewater treatment in Pakistan
...a and flora of treatment plant. The use of algal-bacterial consortia for wastewater
treatments has proved more effective in biomass production, nutrient cycling and bioremediation of organic
pollutants, heavy metals and many other contaminants. The biodegradation approach of involving consortium might
attain self-sustaining level and may prove technically cheaper and advance technology. It will finally help in dealing
the dual missi...
treatments has proved more effective in biomass production, nutrient cycling and bioremediation of organic
pollutants, heavy metals and many other contaminants. The biodegradation approach of involving consortium might
attain self-sustaining level and may prove technically cheaper and advance technology. It will finally help in dealing
the dual missi...
Zubair Ahmed#, Muhammad Farhanullah Khan, Habiballah Rana*
Toxicological effects of Haloxylon recurvum Bunge ex Boiss (Khar Boti) whole plant extract and novel insecticide chlorantraniliprole against maize weevil, Sitophilus zeamais Motschulsky
...nsecticides derived from plants have increased popularity in
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
toxicity of crude methanol extract of whole plant of Haloxylon recurvum (Khar boti)
and a novel insecticide chlorantraniliprole. A serial concentration of extract i.e.,
1.2%, ...
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
toxicity of crude methanol extract of whole plant of Haloxylon recurvum (Khar boti)
and a novel insecticide chlorantraniliprole. A serial concentration of extract i.e.,
1.2%, ...
Hafiz Muhammad Tahir1*, Zafar Iqbal Khan2, Saira Batool2, Kafeel Ahmad2, Salma Begum2
Residual effect of lambda-cyhalothrin on abundance of insect pollinators in marigold field patch
...hat visited the marigold plant before and after insecticidal spray was
recorded. In semi-field experiment, honey bees were exposed to insecticide treated
plants for one hour. The mortality rate of honey bees in the control and insecticide
exposed group was compared. Overall, a significant decline in plant pollinators was
observed after application of lambda-cyha...
recorded. In semi-field experiment, honey bees were exposed to insecticide treated
plants for one hour. The mortality rate of honey bees in the control and insecticide
exposed group was compared. Overall, a significant decline in plant pollinators was
observed after application of lambda-cyha...
Zafar Iqbal1, Muhammad Farooq Nasir1, Imran Bodlah1*, Rahmatullah Qureshi2, Ayesha Aihetasham3
Notes on three morphs of Bulaea lichatschovii (Hummel) (Coleoptera: Coccinellidae) from Northern Pakistan
...s species
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given with illustrations and ne...
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given with illustrations and ne...
Muhammad Khalil Ahmad Khan1*, Muhammad Zafar2, Munazza Perveen3, Munir Ahmad3, Asia Iqbal4, Asmatullah3
Efficacy of malathion and carbosulfan against crop invadedaphid types Aphis craccivora (Koch) and Aphis gossypii (glover) on bean and brinjal plants
...ared on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii while carbosulfan was found to be least toxic with LC50 as 312.80 μg
cm-2 for A. craccivo...
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii while carbosulfan was found to be least toxic with LC50 as 312.80 μg
cm-2 for A. craccivo...
Masab Umair Khan, Syed Mehar Ali Shah, Hidayat-ur-Rahman, Arshad Iqbal* and Ezaz Aslam
...xperimental material was planted in randomized complete block design with three replications. Significant differences among the hybrids were observed for plant height, ear height, days to tasseling, days to anthesis, days to silking, cob length, cob diameter, kernel rows cob-1, 100-kernel weight and grain yield. Among the hybrids, ZH1610 was observed as the earliest maturing hybrid with minimum days to tasseling (91.7), days...
Atiq-ur-Rehman1,2,*, Abida Latif1,*, Rukhsana Anwar1, Nasir Abbas1, Sajid Nawaz2 and Hamid Turab Mirza3
...es type 2.
...
Faheem Ali1*, Muhammad Naeem Arbab1, Abdul Basit2, Muhammad Kashif Khan1, Gulzar Ahmad1 and Muhammad Amir1
...r, and could be used for planting, cultivating, pumping, harvesting, drying, cooking, baking, woodworking, forging and smelting etc. This results in lagging Volt-Ampere-Reactive (VARs), which must be balanced by the same number of leading VARs in order to ensure unity power factor, thus avoiding penalties on agricultural industry. Switched Capacitors and Voltage Regulators are used to cope with such a situation. Regulators results in higher line currents thus ...
Muhammad Shahzad Akbar, Muhammad Zeeshan Majeed* and Muhammad Afzal
...agricultural crops, tree plantations and wooden infrastructures all over the world including Pakistan. This study was aimed to evaluate the comparative efficacy of 10 commercial formulations of new-chemistry insecticides against Odontotermes obesus (Isoptera: Termitidae), one of the most economic subterranean termite species in Indo-Pak region. Label-recommended dose rates of insecticides were tested against worker termites using modified filter paper disc met...
Muhammad Muddassir Ali1,2 and İbrahim Hakkı Ciğerci1,*
... the world. Many endemic plants all over the world have magical therapeutic potential. These could be explored further for medicinal purposes and hence can be preserved for their proper propagation. Thermposis turcica is endemic to Turkey. It’s general anti-oxidant and anti-cancerous activities are explored, but no study has been observed on liver cancerous cell line in term of its genotoxicty. So, genotoxic evaluation was carried out for the alco...
Ali Zohaib1*, Saima Yousaf1,2, Shakeel Ahmad Anjum1, Tahira Tabassum1, Tasawer Abbas3, Wardah Muzaffar1 and Wasiq Ikram2
...use efficiency. However, plant growth promoting rhizobacteria (PGPR) are cheap and excellent alternate and can be applied as seed inoculation to enhance nutrient use efficiency along with reduced nutrient losses. A field experiment was conducted to evaluate the effect of seed inoculation viz. control (no treatment), Rhizobium japonicum (nitrogen fixing bacteria) and Pseudomonas fluorescens (phosphorus solubilizing bacteria) on growth, allometric traits and dry...
Mirza Imran Shahzad1, Hina Ashraf2,*, Muhammad Arshad3, Sabeeha Parveen4, Amna Aslam4, Nargis Naz4, Zahid Kamran1, Sumbul Gohar Khalid5, Sajid Hameed1, Muhammad Ashfaq6 and Muhammad Mukhtar7
...even selected Cholistani plants against New Castle Disease Virus (NDV)-LaSota strain. All of these plants were reported for their different pharmacological activities but their antiviral potentials were not known before. The methanolic extracts were made and concentrated by rotary evaporator and finally dissolved in distilled water before taking their antiviral trials in 7-11 days old chicken embryonated eggs. The viral load...
Fouzia Tabssum1, Qamar uz Zaman2*, Yinglong Chen3,4, Umair Riaz5*, Waqas Ashraf6, Ambreen Aslam2, Nusrat Ehsan2, Rab Nawaz2, Humera Aziz7 and Shamim ul Sibtain Shah8
...tage (15 days after transplanting, DAT), vegetative state (50 DAT) or at both stages. Results from pot experiment revealed that foliar applied 50 mM proline significantly improved the seedling growth under saline stress by reducing electrolyte leakage and improving the water related (relative water contents and water potential), and biochemical attributes (SOD, CAT, MDA, EL and T CHL). Under field conditions, exogenous application of optimized dose of proline ...
Imran Khan1*, Muhammad Iqbal1 and Malik Muhammad Hashim2
...content, photosynthesis, plant height (cm), number of leaves plant -1, leaf length (cm), leaf area (cm2), leaf weight plant-1(g), root weight plant-1 (g), root/top ratio, root length (cm), root diameter (cm), sucrose%, tss %, purity %, leaf yield (t ha-1), root yield (t ha-1), sugar yield (t ha-1) and harvesting index. The results indicated significant v...
Mubashir Ahmad Khan*, Nazakat Nawaz, Muhammad Arshad, Muhammad Ayub Khan, Tahira, Doulat Baig, Ihsan Ullah Khan and Shamim ul Sibtain Shah
...ity, pod filling period, plant height (cm), number of branches per plant, number of pods per plant, seed yield (kg/ha). Seed yield ranged from 352 to 878 kg/ha with a mean value of 521 kg/ha. A total of forty genotypes produced more seed yield than standard cultivar (517 kg/ha) with a range of 524 to 878 kg/ha. Maximum variation was showed by pods per plant<...
Muhammad Salman Wazir and Mohammad Akmal
... in maturity with taller plants at the split N application of NAT2 and NS3 as compared to the NS1. Likewise, better traits of wheat plant and hence the yield including grain wet gluten content were reported for the treatment NS3 as sole wheat crop, followed by the intercropped with fababean. Among the intercropping, IC-I with fababean showed better future scope of wheat crop production under the changing climate to produce h...
Muhammad Tahir Amin, Khalid Usman*, Muhammad Waqas Imam Malik and Nishter Ali
...l the parameters such as plant height, sympodial branches, seed cotton yield, and quality-related traits such as fiber length, fiber strength, micronaire, and fiber uniformity. Frequent irrigation interval (7th day) produced taller plants (139 cm) and more sympodial branches (18.3) compared to less frequent irrigations (10-19th day). However, 19th day irrigation interval significantly improved seed cotton yield and fiber qua...
Nighat Seema1*, Muhammad Hamayun1, Husan Ara1 and Raham Sheer Khan2
...culously with their host plants and may be more capable to solubilize nutrients from soil and provide it to their hosts. In current study, endophytic fungi inoculation significantly affected the soil properties such as soil texture, organic matters, EC and pH with or without 8% PEG induced drought stress. Upon inoculation of different endophytic fungi with or without drought stress, the trend in pH values of soil remain variable (7.61~7.96) compared with the p...
Muhamad Jawad*, Shahid Riaz Malik, Muhammad Aqeel Sarwar, Muhammad Asadullah, Israr Hussain and Rabia Khalid
...en lowest pod height and plant height. Cluster analysis performed for qualitative and quantitative traits separately. It was observed that genotypes with suitable plant type for mechanized harvesting belongs to different cluster and high yielding genotypes belongs to another cluster. It indicates that the genotypes suitable for mechanized harvesting are not high yielding. So, it is advisable to use genotypes in the ideotype ...
Effect of Seed Inoculation with Plant Growth Promoting Rhizobacteria on Yield and Quality of Soybean
Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6
...ent availability to crop plants. A field experiment was carried out to determine the effect of seed inoculation with PGPRs on yield and quality of different genotypes of soybean. Seed inoculation treatments [control (no treatment), nitrogen fixing bacteria (Rhizobium japonicum) and phosphorus solubilizer (Pseudomonas fluorescens)] were applied to three different cultivars of soybean (EBR4V4, Freedom and Swat-84). The results showed that seed inoculation with R...
Babar Tasim1, Tariq Masood1*, Zafar Ali Shah1, Muhammad Arif2, Ata Ullah1, Ghazal Miraj3 and Muhammad Samiullah4
...a punicea, SS), Chickpea plant (Cicer arietinum, CP), Maize cobs (Zea Mays, MC), Wheat straw (Triticum aestivum, WS), Sugarcane (Saccharum officinarum) bagasse (BG) and Animal dung (AD) were pyrolyzed at temperature range of 300-500 oC in order to compare the biochar samples obtained on the base of its physical and chemical properties. Physico-chemical characteristic such as pH, EC, proximate composition, macro and micronutrients, surface functional groups ide...
Muhammad Ilyas*, Sardar Ali Khan, Shahid Iqbal Awan and Shafiq-Ur-Rehman
...gher for grain yield and plant height, hence additive gene action was depicted. While, narrow sense heritability and genetic advance was lower for remaining parameters under both the environmental conditions which clearly specified that non-additive gene action was present. Results indicated that the said breeding material might be better suited for heterosis breeding under drought prone semi-arid areas. ...
Ali Bakhsh1*, Mashal Rehman1, Said Salman1 and Rehmat Ullah2
...so, it is imperative for plant breeders to develop cotton lines that can grow on minimum water availability. In this study performance of 23 cotton genotypes was compared for seed cotton yield and fiber quality traits under water stress and non-stress conditions. All the genotypes depicted significant differences for days to first square formation, days to first flower formation, plant height, monopodial branches per
Salman Ali*, Inamullah, Muhammad Arif, Mehran Ali, Muhammad Owais Iqbal, Fazal Munsif and Arsalan Khan
...op. Potassium is a major plant nutrient required in large quantity by crops and has a significant role in increasing crop growth and yield by reducing the adverse effects of drought stress. Although a large quantity of potassium can be found in soil but is mostly in an unavailable form. A field experiment was, therefore established at Agronomy Research Farm the University of Agriculture Peshawar-KP to evaluate the response of maize toward different K levels un...
Zakiullah1, Muhammad Farid Khan1*, Muhammad Mohibullah3, Muhammad Iqbal2, Irfanullah3, Faheemullah3, Madiha Urooj1 and Uzma Arif1
...for days to germination, plant height, leaf area, number of grains ear-1, grains moisture % at harvest, grain yield and biological yield. Mean square values due to general combining ability were highly significant (P≤0.01) for all the experimental parameters except grain yield and biological yield. Highly significant specific combining ability for direct and reciprocal crosses shows highly significant differences for all the studied parameters. PSEV-3 prove...
Shamesa Maryam1, Ajaz Ahmad Sandhu1, Imran Bodlah2*, Muhammad Asif Aziz2, Ayesha Aihetasham3
...ted from twenty two host plants at six different localities of Gujranwala area of Punjab province, Pakistan. Total 12 species namely; Aphis craccivora, Aphis fabae, Aphis gossypii, Aphis nerii, Rhopalosiphum padi, Lipaphis erysimi, Macrosiphum euphorbiae, Myzus persicae, Pentalonia nigronervosa, Sitobion avenae, Greenidea (Trichosiphum) psidii and Cinara (Cupressobium) t...
Sabi-ur-rehman1, Farooq Azam1, Shaheed Ur Rehman2, Tasbeeh Ur Rahman3, Ayeza Mehmood4, Afshan Gohar5 and Abdul Samad5*
...Conocarpus erectus. This plant was selected due to its great medicinal importance like its leaves and fruits have been using traditionally as antipyretic, anti diabetic, anti malarial and for the treatment of conjunctivitis, syphilis, gonorrhea, orchitis, diarrhea, anemia, prickly heat and swellings etc. The plant has also reported to have pharmacological active phytochemicals i.e. conocarpan, conocarpol, gallic acid, ellagi...
Aqeel Mehboob, Syed Muhammad Zaka*, Muhammad Sarmadand Maryam Bajwa
...fed almost every part of plant. Due to environmental pollution and the incapability of toxic agents in controlling the target pests at the recommended doses of synthetic pesticides, alternative methods like botanical extract in the control of this pest consider greater importance nowadays. The antifeedant and oviposition deterrent index of Moringa oleifera, Murraya paniculata and Piper nigrum leaf extracts were evaluated against S. litu...
Shamsher Ali1*, Muhammad Jamal Khan2, Zahir Shah2, Naveedullah3 and Abdul Jalal1
... were percent emergence, plant height, number of leaves, shoots and roots weight. The results revealed that all data parameters except number of leaves were affected significantly (p < 0.05) by different levels of salinity. Irrespective of maize varieties, the percent emergence, plant height, number of leaves, shoots and roots weight of Maize were reduced with linear increasing levels of salinity. Among the genotypes, max...
Muhammad Waqas Imam Malik1, Khalid Usman1*, Tahir Amin1, Muhammad Riaz2, Zafar Iqbal3 and Fiaz Hussain1
...branches (14) and higher plant height (131cm) as compared to other irrigation intervals. Higher bolls (19 / plant), boll weight (2.9 g), seed cotton (2424 kg ha-1), ginning out turn (GOT, 37%), fiber length (28.1mm), fiber strength (29.5 g per tex) and micronaire value (3.5 µg per inch) were achieved from irrigation interval of 25 days. Interaction effects (irrigation x varieties) revealed that variety CRIS-134 in comb...
Ejaz Ashraf1*, Hafiz Khurram Shurjeel2, Nosheen Fatima1, Raheel Babar3 and Ikramul Haq4
...ment including impact on plant, animal and human life. Hence, efforts to maintain a healthy biodiversity through conservation are needed. Since the life is passing through the time of global warming and climate variation, new issues for farming community are on the rise. These issues are related to protection of natural environment and biodiversity which is one of the critical problems encounter by farmers of Pakistan. It is vitally important to take proactive...
Muhammad Naveed Afzal1, Muhammad Tariq1*, Muhammad Ahmad1, Khuram Mubeen2, Muhammad Ayaz Khan3, Muhamamd Umer Afzal4 and Shakeel Ahmad5
...rate in conjunction with plant density is an important concern of cotton production. The two years’ field trials were conducted at Central Cotton Research Institute, Multan to test the hypothesis whether nitrogen (N) requirement varies with planting density (PD) for dry matter production, partitioning, nutrient use efficiency (NUE), lint yield and associated fiber properties. In this RCBD split plot experiment, two
Najeeb Ullah1, Niamat Ullah Khan2*, Abdul Aziz Khakwani1, Muhammad Safdar Baloch1, Ejaz Ahmad Khan1, Farkhanda Khan3 and Zaki Ullah4
...oduced highest bolls per plant, boll weight-g, seed cotton yield, staple length, strength and micronaire amongst the other sowing dates. Results further showed that CIM-602 ranked first in number of bolls/plant, weight per boll, seed cotton yield, staple length, strength and micrronaire in April 15 sowing. Former and later on cotton sowing than April 15 resulted in decreased cotton yield and fibre due to shorter growth phase...
Saira Zaheer1, Abrar Hussain1*, Aqsa Khalil1, Muhammad Mansha1, Muhammad Lateef2
...ines and local medicinal plants are being explored to control the parasitic worms. The aim of this study was to evaluate the anthelmintic potential of two local plants, Albizia lebbeck L. and Camellia sinensis L against H. contortus using Adult Motility Assay (AMA). Crude Ethanolic Extracts (CEE)of dried leaves of A. lebbeck L. and whole plant of ...
Ali Awais, Charassri Nualsri and Watcharin Soonsuwon*
.... The traits, especially plant height, panicle length, number of filled grains, number of grains per panicle, 1000 grain weight and yield per plant showed a clear fall off when compared to control while the panicle length in both mutants were higher than that of control. Several mutants also revealed some notable phenotypic variations in the roots, seeds, panicles and leaf morphology. Phenotypic observations determined that ...
Rizwan Ullah Shah* and Iqbal Munir
Ummad-ud-Din Umar1, Syed Burhan-ud-Din2, Muhammad Fahad Khan1, Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Muhammad Asif Zulfiqar3, Azhar Ali Khan3 and Naila Ilyas1
...e resistance in mungbean plants by triggering the SA pathway. Induced resistance was assessed by evaluating the appearance of symptoms and detection of virus titter through ELISA. Different concentrations of SA and BTH were exogenously applied to activate the inherent resistance of mungbean by the production of defense associated compounds. All treatments were supportive in suppressing plant infection as compared to infected...
Muhammad Aslam Rajput1,3, Imtiaz Ahmed Khan2, Rehana Naz Syed3 and Abdul Mubeen Lodhi3*
...ectively be minimized by planting smut resistant cultivars. For evaluating a large number of propagative materials; standardized germplasm screening protocols as well as optimized inoculation techniques are required. The pathogen inoculation method should be less cumbersome, simple, and rapid. Here, we compared the effectiveness of six different inoculation methods, i.e., dipping, paste, wound+paste, soil infestation, spraying and injection methods for the est...
Shakeel Ahmad Anjum1, Muhammad Mohsin Raza2, Sami Ullah1, 3*, Malik Muhammad Yousaf2, Ahmad Mujtaba1, Mumtaz Hussain2, Muhammad Jahangir Shah2, Bashir Ahmad2 and Ijaz Ahmad4
...s on yield of the autumn planted maize crop. The experiment was conducted in summer, 2014 at Agronomic Research Area, University of Agriculture Faisalabad, Pakistan in a randomized complete block design (RCBD) with four replications. Net plot size was maintained 7.0 m × 3.6 m. Different tillage practices, i.e., deep tillage, conventional tillage, minimum tillage, simple cultivation flat sowing, simple cultivation ridge sowing, zero tillage dibbling and z...
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...
...
Hafiz Abdullah Akbar, Zafar Iqbal, Waqas Raza*, MuhammadUsman Ghazanfar and Salman Ahmad
... the effect of different plant extracts /allelochemicals and salicylic acid on the growth of Penicillium digitatum causes citrus green mould by using 7 plant extracts alone and in combination with wax and 3 concentrations of salicylic acid alone and in combination with wax. The study revealed that in case of plant extracts maximum growth inhibition (35.90 %) was shown by Anar follow...
Sabi-Ur-Rehman1, Anwar Khalid2, Qazi Najam Us Saqib3, Farooq Ahmad1, Shaheed-Ur-Rehman4, Neelam Zaman3, Ayeza Mehmood5 and Abdul Samad6*
...biotic drugs resistance, plants provide source for discovery of new antimicrobial drugs. This study was carried out, include in-vitro antibacterial and antifungal screening of aqueous methanolic extracts as well as crude saponins isolated from leaves and roots of Sarcococca saligna, using disc diffusion method. The tested bacterial strains include, B. subtilis, E. coli, S. aureus, P. fluorescens and fungal strains were Aspergillus. niger, A. flavus, and D. tur...
Tahira Moeen Khan* and Amat ul Mateen
...reasing concentration of plant extract. XRD indicates CuO Nps particle size is in between 14-20 nm. CuO nanoparticle show very significant antibacterial activity against four bacterial strains three gram negative (Escherichia coli, Proteus mirabilis, Salmonella) and one gram positive (Clostridium tetani). The minimum concentration of leaf extracts needed against these bacterial strains were also calculated. The present study indicated that Mel...
Zafrullah Khan* and Shah Alam Khan
...sues of leaves of potato plant and significantly reduces the yield of potato. Antixenosis experiments were performed to assess the resistance potential of eight different potato cultivars against M. persicae under glasshouse conditions for three different durations of time (12, 24 and 48 hours) during spring and autumn potato growing seasons of 2016. Both the experiments were conducted using a completely randomized design. Each experiment having eight treatmen...
Syed Atif Hasan Naqvi1*, Sidra Mushtaq1, Muhammad Tariq Malik2, Ummad-ud-Din Umar1, Ateeq ur Rehman1, Shoaib Fareed3, Muhammad Asif Zulfiqar4
... is cultivated in forest plantation as well as avenues, road sides and canal banks. Because of greater strength, elasticity and durability, the wood is highly valued as constructional and general utility timber. This review article shows the work conducted on sheesham decline syndrome especially die back and wilt in Indian sub-continent. A diversity of plant pathogenic fungi has been identified and isolated from the various ...
Syed Turab Raza1,*, Zhu Bo1,*, Zulfiqar Ali2 and Tang Jia Liang3
... to recover nutrients of plants such as NPK (nitrogen, phosphorus, calcium). A vermicomposting system using the earthworm species (Eisenia fetida) and treating it with cattle dung, pig manure and biochar with crop (wheat straw and rapeseed) waste was established in upland areas of China. It was monitored for two months. Four treatments (T1 to T4) were prepared using crop residues i.e. wheat straw, rapeseed and cow manure in different concentratio...
Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2
...2015 growing season. The plant tissues were carrying more M. phaseolina cfu as compared to soil samples. However, cfu count of M. phaseolina was significantly varying among districts, locations and year of samplings (Df= 54, F= 4, P= 0.0000). Similarly, as soil samples collected from Badin, plant tissue samples also gave maximum cfu per gram of M. phaseolina from Badin and then reduced gradually in Thatta, Tando M. Khan, Hyd...
Abdul Khaliq1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Akhlaq Ahmad2 and Yasir Iftikhar3
...0% concentrations of all plants but E. Camaldulensis (5%) was least effective against all insects after control. Resurgence response in F1 generation in each experiment showed high multiplication rate at low concentrations and vice-versa also suppressed against N. tabacum and C. procera. Hence, developing PH3 resistance can be managed with bio-pesticides up to extant and need more work to make it applicable in field.<...
Xu Lijie, Obaid Ullah, Liu Haixing, Ihsan Ali, Zhongshu Li* and Nan-Zhu Fang*
...growth of mammalian preimplantation embryos. Peroxisome proliferators-activated receptor gamma (PPARγ) functions in the nuclear regulatory factor 2 (Nrf2) antioxidant pathways by binding to the promoters of antioxidant genes and regulates the expression of genes that associate with NADPH oxidase. To understand the role of PPARγ in the development of early embryos and define the mechanism responsible for the arrest in development during the maternal...
Azam Ali* and Amjad Farooq
...rved. Percentage of host plant susceptibility index (HPSI) for each cotton variety was also calculated. One way ANOVA was used to analyzed the data statistically. Variety and year had significant (P<0.05) effect on pest populations, eggs count and predator’s populations. It was found that Bt cotton was more resistant to pest attacks than non-Bt. Therefore Bt cotton should be grown to combat pest infestation....
Saqib Bashir* and Bashir Ahmad
...e m-2, days to maturity, plant height, thousand grains weight, biological yield and grain yield of wheat. The integration of pigeonpea green manuring with nitrogen levels significantly increased wheat growth, yield and yield components. In case of green manuring, plots in which pigeon pea crop was incorporated at the age of 90 days showed maximum plant height (103.3 cm), thousand grains weight (45.2 g), biological yield (101...
Muhammad Arshad Hussain1 and Tariq Mukhtar2,*
...t-knot nematodes in okra plantations, therefore, in the present studies surveys were conducted to record incidence, prevalence, and severity of root-knot nematode species associated with okra in the major vegetable growing districts of the Punjab province of Pakistan. The overall incidence of 39%, prevalence of 85% and severity of 4.1 in terms of the galling index was recorded throughout the province. Differences in the incidence of root-knot nematodes were re...
Guo-hai Wang1, Zai-xi Yang1, Pan Chen1, Wei-ning Tan2 and Chang-hu Lu1,*
.../p>...
Ihsan Ullah Khan*, Muhammad Arshad, Muhammad Ayub Khan, Muhammad Ashraf, Ashiq Saleem, Sundas Awan, Samra Azam and Shamim Ul Sibtain Shah
..., days to maturity (DM), plant height (PHT, cm), stem thickness (ST, mm), head diameter (HD, cm), 100-grain weight (100-GW, gm), oil content percentage (OC %) and seed yield (SY, kg ha-1) revealed statistically significant differences. All the crosses out-performed the standard check in terms of seed yield (kg ha-1) with significant differences in this regard. Positive and significantly high mid-parent heterosis was observed in all the hybrids for all the stud...
Ahmed Ali Samejo* and Riffat Sultana*
...ctive pest to the useful plants. Morphology and morphometry of immatures of desert locust in relation to gaining of body length and weight at each consecutive stage was carried out for the purpose of investigating the role of immatures in destruction of plants in Thar Desert, Sindh. Hatchlings of solitarious S.gregaria were light green at the time of emergence, but turned over to black with yellow strips after two hou...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
...in microbes, animals and plants. The asparaginase of bacterial origin has been extensively applied in the treatment of childhood lymphomas and leukaemia. However, the glutaminase activity of enzyme can cause serious side-effects triggering a search for highly specific and more stable enzyme. In the present study the gene consisting of 972bp coding for 323 amino acids was PCR amplified from Geobacillus thermodenitrificans DSM-465 was PCR amplified and re...
Ashfaque Ahmed Nahiyoon1,*, Shahina Fayyaz2 and Nasira Kazi2
...termine the diversity of plant parasitic and soil nematodes associated with cotton plants in Sindh. During 2017–2018 extensive surveys were conducted at the time of cropping and at harvesting and soil root samples were collected from different fields in the cotton producing regions of five districts of Sindh viz., Sanghar, Mirpurkhas, Umerkot, Mityari and Tando Allahyar. The analysis of samples resulted in the i...
Saud Khan and Inamullah*
...case of P levels, higher plant height (157.3 cm), higher number of achenes capitulum-1 (1028), thousand achenes weight (53.8 g), higher achene yield (2527 kg ha-1), oil yield (1146 kg ha-1) and maximum oil contents (38.5%) were observed in experimental units supplied with P @ 90 kgha-1. Finally, it was concluded that tillage operation with MB plough followed by cultivator or only rotavator and P @ 90 kg ha-1 were better to maximize grain and oil yields in sunf...
Qaizar Ahmed1, Fida Mohammad2, Sheraz Ahmed2*, Sultan Akbar Jadoon2, Imtiaz Ali2 and Ajmalud Din2
Javed Asghar Tariq1*, Bashir Ahmed2, Manzoor Ali Abro2, Muhammad Ismail1, Muhammad Usman Asif1 and Raza Muhammad1
... have ability to enhance plant growth as well as to have antagonistic effect against another pathogenic microflora. Current studies were designed with the aim to search out such type of antagonistic bacteria from rice crop. For this purpose, soil was collected from rice growing areas of Tando Jam. The isolation from rhizospheric soil was done by dilution plate technique. Among isolated isolates, 6 representative colonies were purified, multiplied and character...
Syed Atif Hasan Naqvi*
...z., exploitation of host plant resistance, cultural, physical, chemical and biological control. Studies on pathogen variation have revealed that breeding with single major gene for resistance may be unsuccessful due to breakdown in resistance. Up to this extent, multi cropping using resistant varieties appears to be better option for the disease’s management. Evidence from my laboratory suggest that biological control is the best option having ecofriendl...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...c enzymes, widespread in plants, fungi and microorganism, gain commercial importance for improving the yield and nutraceutical properties of juice processing industry, degumming of fibre plants and maximum oil recovery. These enzymes break down complex polysaccharide polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin w...
Aziz Ur Rahman* and Syed Mehar Ali Shah
...The genetic material was planted in alpha lattice design using three replications across different locations namely Peshawar, Swat, Manshera and Charsadda of the Khyber Pakhtunkhwa province of Pakistan during 2017. Pooled analysis of variance indicated significant (p≤0.01) differences among the environments, genotypes and GEI for spikelets panicle-1, grains panicle-1, 1000-grain weight and grain yield. Across four locations, AUP-30 showed the highest number...
Bushra Siddique1,*, Muhammad Tariq1, Muhammad Naeem1 and Muhammad Ali2
...ns between prey and host plant species. Recent studies exhibited that the use of natural enemy is an ecofriendly measure to control pests. The Seven spotted ladybird beetle, Coccinella septempunctata play a prominent role in aphid management. It exploits several different cues released by plants to increase the efficiency of foraging. Aphid endoparasitoid, Diaeretiella rapae (McIntosh) (Hymenoptera: Braconidae)...
Hamid Ali, Muhammad Arshad, Ibad Ullah Jan, Muhammad Zamin*, Junaid Khan, Ikram Ullah and Mushtaq Ali
...ornamental and perfumery plant. The research was conducted at University of Swabi during summer 2018 to evaluate the performance of tuberose under various concentrations of gibberellic acid and micronutrients. Experiment was laid in Randomized Complete Block Design (RCBD) using two factors i.e. gibberellic acid and micronutrients with three replications. Both the factors gibberellic acid (GA3) and micro nutrients had their significant effects. The best perform...
Muhammad Nasrullah1*, Liu Chang1, Khurram Nawaz Saddozai2, Asaad Osman Khalid1, Rachel Bayisenge1 and Gulnaz Hameed3
...rupees per hectare while planting cost was 61,476.68 and processing cost was 95,535 rupees per hectare. The highest cost incurred was 61,750 rupees for land followed by Fuel wood which was 39,957 rupees per hectare. Total product of tobacco was calculated as 44 mounds per hectare. The total revenue was Rs. 405,636 per hectare while total cost incurred was 242,889.68 having a profit of Rs. 162,746.32 per hectare. The data were checked through VIF found free of ...
Fraza Ijaz1*, Umair Riaz2, Shazia Iqbal3, Qamar uz Zaman4, Muhammad Furqan Ijaz5, Hina Javed1, Muhammad Amjad Qureshi1, Zuhra Mazhar3, Ahmad Hassan Khan6, Hassan Mehmood7 and Ijaz Ahmad8
...the nodule mass (0.523 g plant-1), highest plant height (103.45 cm), number of seeds per head, thousand seeds weight were recorded with Co-inoculation + Tryptamine @ 10-5 M (T8). Nutritious Parameters crude protein (30.23%), neutral detergent fiber (33.45%) and acid detergent fiber (26.56%) gave significant results as compared to control (T1). Results indicated that the combined application of Rhizobium species and Tryptamin...
Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2
...ial diets and ornamental plants on parasitoid performance. Among artificial diets tested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the fiel...
Faraz Akrim1,2, Tariq Mahmood1,*, Muhammad Sajid Nadeem3, Siddiqa Qasim1, Shaista Andleeb1 and Hira Fatima1
...d one domestic), and six plant species. The consumption of wild prey was 60%, while domestic prey contributed 19%, plants 14%, grits 2%, and anthropogenic matter (plastic bags, and threads) 5%. In comparison, 17 dietary items were recorded in the diet of small Indian mongoose, including 10 wild, 1 (one) domestic and 6 plant species. Consumption of wild prey was 60%, domestic prey 17%
Aliya Ayaz, Gohar Ayub, Maqsood Khan* and Syed Aizaz Ali Shah
...entage, number of fruits plant-1, fruit length, fruit weight, plant height, yield plot-1, total yield and survival percentage. In case of dipping durations, seeds dipped for 18 hours significantly reduced days to emergence and days to first flower, while increased germination percentage, number of fruits plant-1, fruit length, fruit weight, plant height,...
Asim Khan1, Shahid Ali1*, Syed Attaullah Shah1, Aftab Khan1 and Raza Ullah2
...ge is required regarding plantation of trees and afforestation ...
Abid Ali1*, Hidayat ur Rahman1, Farhatullah1 and Zahir Shah2
...cularly gene action help plant breeders in developing breeding strategies. The experimental material comprised three white maize (Zea mays L.) inbred lines which were developed at Cereal Crops Research Institute (CCRI), Pirsabak, Nowshera-Pakistan. Parental inbred lines were crossed with each other to get six F1s during kharif 2015 which were selfed to develop F2s and backcrossed with their parents to obtain backcrosses BC11 and BC12 generations during spring ...
Hayat Zada and Ahmad-ur-Rahman Saljoqi*
...wise, highest yield (kg/ plant) were produced by the plots having Apple + Trifolium intercrops (76.62±1.11), whilst minimum yield were attributed to Apple + Wheat (61.47±1.11) followed by sole (52.75±1.23). The results further confirmed that maximum yield losses (31.51%) were avoided by the intercrop Apple + Trifolium and gain in the yield (43.90%) over control was also featured to the same intercrop, whilst all other intercrops were infer...
Qingling Hu1,2
...us is provided. New host plant of the genus is discovered. New distinguishing characters between the two species are proposed. Specimens examined are deposited in the Entomological Museum, Northwest A&F University.
...
Shamsudin Bojang1, Idris Abd Ghani2, Jugah Kadir1, Adamu Saidu Paiko1, Yasir Iftikhar3 and Muhammad Kamran3,4,*
...age the greens and other plants in other part of the world then the probability for the specie to adapt to other hosts other than the family of poaceae under Malaysian climate should not be discounted. Therefore, screening and restriction of movement of planting materials be observed critically.
...
Muhammad Shoaib Saleem* and Muhammad Faheem Akbar
...rational insecticides in plant pest management in perspective of the public concern over the level of pesticide residues in food and environment causing health and ecological problems. The indiscriminate use of synthetics insecticides in crop protection has also led to development of resistant strains of pests and have adverse effects on non-target organisms including natural enemies and pollinators. Amongst bio-rational insecticides, neonicotinoids and insect...
Lichao Feng1,2, Shaoqing Zhang4, Dianyuan Chen2, Sina Adl3 and Donghui Wu1,4*
...ed to different types of plants associated with their farmland habitat, as follows: mixed pollen and nectar of flowers (Erigeron annuus, Trifolium repens, Heteropappus hispidus, Potentilla chinensis, Hibiscus trionum), or leaves of grasses (Poa annua, Echinochloa crusgalli), or maize leaves (Songyu 419, a hybrid variety) as food sources to feed the adult of A. fuscicollis. The larvae were reared...
Shakeel Ahmad Anjum1, Sami Ullah1*, Muhammad Mohsin Raza2, Mohsin Raza1, Muhammad Abbas3, Ijaz Ahmad4, Malik Muhammad Yousaf2, Muhammad Zeshan5, Adeel Abbas1, Mehmood Ali Noor1 and Mohsin Nawaz1
...tify;">Boron (B) affects plant growth and development by influencing vital processes like cell division, cell wall formation, water relations, meristematic tissue growth, carbohydrate metabolism, and pollen tube growth which suggests plausible effects on all these activities due to its deficiency. Therefore, a field trial was set up to assess the efficacy of different levels (control, 0.01 M and 0.05 M) of foliar applied B at booting, anthesis, and grain filli...
Imdad Ali Mahmood1, Muhammad Imran2, Muhammad Sarwar1, Matiullah Khan1, Muhammad Aqeel Sarwar2, Shoaib Ahmed1 and Shahid Riaz Malik2
...ed. Agronomic data i.e., plant height, pods per peduncle, seeds per pod, 100-seed weight, total biomass and grain yield were recorded. Plant samples were collected at maturity to determine Zn concentration in plant tissues and grains. A significant increase in pods per peduncle, seeds per pod, grain yield and total biomass of lentil was observed with Zn application even at lower rate (5 kg...
Muhammad Yasin1, Romana Shahzadi1, Muhammad Riaz2, Mahideen Afridi2, Wajya Ajmal3, Obaid Ur Rehman2, Nazia Rehman3, Ghulam Muhammad Ali1,3, Muhammad Ramzan Khan1,2,3*
...ue from upper portion of plant as compared to other tissues of “Pakola” and “Punjab Sarsoon 3”. Our results flaunt basic gene expression information about shattering genes for developing genome edited plants to prevent yield losses in canola in future. ...
Tahira Jatt1, Ghulam Sarwar Markhand1, Lane Rayburn2, Ray Ming3, Mushtaque Ahmed Jatoi1 and Ameer Ahmed Mirbahar1,4*
... a monocot and dioecious plant species having uncertain diploidy levels because of scarcity of cytogenetic knowledge. Khairpur district in Sindh is known as the biodiversity center of date palm. Investigations were carried on the chromosome number and karyotype one of the seven indigenous commercial date palm varieties and four wild type date palm of Sindh province, Pakistan by using the traditional Fuelgen squash method. Results indicated that all seven comme...
Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Asam Riaz and Muhammad Zeeshan Majeed
...oils of eight indigenous plant species for their insecticidal potential against 2nd instar D. mangiferae individuals. Standard twig-dip method was used for toxicity bioassays according to Completely Randomized Design. Mortality of mealybug individuals varied with plant materials and increased along with the extract concentration and exposure time. Botanical extracts of Azadirachta indica (neem) and <...
Kamran Aziz1*, Aamir Saleem1 and Arshad Mahmood Malik2
...ir role to decompose the plants parts such as roots, shoots, leaves and other parts. The present study was conducted to estimate the decomposition rate, litter fall production and elemental composition of Cedrus deodara and Pinus wallichiana in the study area Dungagali, Taohidabad, Kuzagali and Khanspur situated around the Ayubia National Park. The research was carried from September, 2016 to August, 2017. Litter bag technique was used to estimate the decompos...
Abdul A. Mirani1,2*, Chee H. Teo2, Adel A. Abul-Soad3, Ghulam S. Markhand1, Tahira Jatt1, Ameer A. Mirbahar1,4, Najamuddin Solangi1
...lm (Phoenix dactylifera) plants derived from immature inflorescences. In this study, three to four years old field grown tissue cultured date palm plants of cvs. Kashuwari and Gulistan derived from in vitro subculture 1-10 (block I) and 11-25 (block II) in multiplication stage were screened for type and nature of phenotypic abnormalities. Six phenotypic abnormalities were detected: 1) dwarfism, 2) excessive vegetative growth...
Asad Ullah Khan1, Wiqar Ahmad1*, Amir Raza2, Farmanullah Khan3 and Muhammad Sharif3
...ity among genotypes of a plant is responsible for variation in growth, yield and nutrients uptake performance. This research investigated the survival and growth efficiency of the 10 wheat (Triticum aestivum L.) genotypes under sand culture including Batoor-2007, Barsat (NRL 0320), Fakhr-e-Sharhad-99 (FS-99), Tatara-96 (WS 395), Paktunkhwa-15 (PR-103), NIFA Lalma (NRL 0517), Pirsabak 2013, NIFA Insaf (NRL 0707), Shahkar-2015 and Pirsabak 2015 (PR-105). Pots we...
Muhammad Affan Khan* and Abdur Rab
...stify;">The influence of plant spacing on the growth and seed production of okra varieties was studied at the Horticulture Farm of the University of Agriculture, Peshawar during spring seasons of the years 2012-13. The research experiment was conducted using RCB Design with 2 factors and 3 replications. Five okra varieties viz. Sabz Pari, Arka Anamika, Pusa Sawani, Punjab Selection and Green Star were grown at three plants s...
Umar Hayat1, Khalid Khan2, Saima Liaqat3* and Balach Rasheed2
...ture, it is suggested to plant more trees and arrange different types of awareness campaign through print media and electronic media. It is also recommended to conserve water through the construction of dams and proper irrigation system may be managed on new footings to irrigate more lands to achieve the ultimate objectives of economic growth in Pakistan....
Jie Zhang1,2,*, Baradi Waryani3,4 and Qihai Zhou2,*
Tariq Mukhtar1,* and Muhammad Arshad Hussain2
...It is concluded that the plants of moderately resistant cultivar Sanam suffered less damage and suppressed nematode infections at all inoculum levels and therefore, recommended for cultivation in root-knot nematode infested fields to abate yield losses and repress the nematode from further multiplication.
...
Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2
...tal number of leaves per plant, plant height, fruit length, root and shoot dry weight, fresh fruit weight, the total number of fruits per plant, fruit yield and total yield increase. No significant increase was observed in the yield and growth of okra under control and full NPK fertilizer treatment. Application of organic fertilizers like poultry manure and compost as well as its mixture w...
Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah
...or soil problem limiting plant growth and development. Application of plant growth promoting rhizobacteria (PGPR) is effective against this stress. Mung bean is an important crop that is used as food. Present experiment was conducted under natural environment to evaluate the effect of PGPR on biomass production, nitrogen and proteins percentage of four mung bean varieties under different NaCI levels in sand culture after 5,7...
Shaikh Abdul Lateef, Zhou Lin, Wu Jian, Junjie Qian, Jonathan Hartanto Tan and Zheng Shusen*
Munazza Yousra1*, Sair Sarwar1, Muhammad Mahmood Ul Hassan1, Muhammad Zameer khan1, Abdul khaliq2, Shahbaz Ahmad1 and Shamim Ul Sibtain Shah3
...roduction of 65 and 76 g plant-1 was recorded using Zn treatment @ 8 mg Zn kg-1 by ZnSO4.H2O and Zn-EDTA in both varieties, respectively. Similarly, the Zn uptake was also shown significant increase over control at the Zn rate applied @ 8 mg kg-1 with ZnSO4.H2O (3.97) and Zn-EDTA (5.03 mg plant-1) source in both varieties. The results indicated that Zn-EDTA is the most effective source of Zn as compared to ZnSO4.7H2O to meet...
Ammara Saeed* and Noor-ul-Amin
...rowth and development of plants. A Randomize Complete Block Design experiment was laid with split plot arrangement at Ornamental Horticulture Nursery, Department of Horticulture, The University of Agriculture Peshawar during 2014 and 2015. Cut flower rose cultivars were tested with treatments of 3 levels of phosphorus (30, 60 and 90 kg ha-1) and potassium (20, 40 and 60 kg ha-1) each as well as combined. Results showed that when plant<...
Waqas Raza*, Muhammad Usman Ghazanfar and Muhammad Imran Hamid
...bility of the crop under plantation ...
Aly Khan1,*, Khalil A. Khanzada1 and S. Shahid Shaukat2
...lochistan. A total of 13 plant nematodes were recorded. Out of these seven nematodes were encountered in only one locality. Most common species in maize fields was found to be Pratylenchus zeae that occurred in 5 out of eight localities, one-way of variance was performed for those nematodes that occurred in two or more localities. With one exception, the density differed significantly among the localities.
...
Khansa Nazir1,*, Tariq Mukhtar1 and Humayun Javed2
...ences, the management of plant parasitic nematodes using nanoparticles can be one of the important alternatives. In the present study, the nematicidal activity of silver nanoparticles (AgNP) was investigated against the most destructive root-knot nematode (Meloidogyne incognita). The maximum mortality of juveniles was recorded at a concentration of 100 mg/ml followed by 75 mg/ml of AgNP. The minimum mortality was recorded with 25 mg/ml of AgNP. With the...
Asad Abdullah, Muhammad Irfan Ullah*, Abu Bakar Muhammad Raza, Muhammad Arshad and Muhammad Afzal
...ure. Suitability of host plants is critical for the efficient management of this economically important insect pest. We studied the effect of various host plants on the growth, development and fecundity of S. litura. The larvae of S. litura were offered leaves of cabbage, alfalfa, sesbania and, maize in comparison to artificial diet under laboratory conditions (32±05 oC; 65±05 RH). Thel...
Jae-Kang Lee, Hyun-Su Hwang, Tae-Kyung Eom and Shin-Jae Rhim*
...h Larix kaempferi plantation in Mt. Maehwa, Hongcheon, South Korea. The mid-story, understory and ground vegetation coverage, the number of standing and downed trees ha-1 and the volume of downed trees ha-1 were significantly different between the pre- and post-thinning sessions. Mean density of Apodemus agrarius, A. peninsulae, and Myodes regulus were significantly different between sessions. Monthly captured ...
Muhammad Usman Ghazanfar, Muhammad Imran Hamid, Mubashar Raza, Waqas Raza*, Misbah Iqbal Qamar
...es promote growth of the plants and commercially used as bio-fungicide against soil borne plant pathogens. The present study was conducted with the aim to determine the efficacy of Trichoderma species using dual culture and pot assays against Phytophthora infestans (late blight) and Fusarium oxysporum (wilt) of tomato on different compost including carbon rich compost, nitrogen rich compost and nutrient enriched compost. The...
Rashid Iqbal1,2, Mathias Neumann Andersen1*, Muhammad Aown Sammar Raza2, Muhammad Adil Rashid1 and Salman Ahmad2
...ater may seriously limit plant growth as well as yield. A pot experiment was carried out to evaluate the effects of various irrigation strategies i.e. Full (FI), deficit (DI) and partial root-zone drying (PRD) on physiological, water relations, water use efficiency (WUE), and yield related attributes of wheat. These irrigation treatments were started at anthesis stage and maintained for 30 days. For FI and DI, 100 and 50% of evapotranspiration (ET) was replace...
Muhammad Tariq Adnan Khan*, Tariq Mukhtar and Muhammad Saeed
...gths and weights. As the plants of moderately resistant cultivar Brinjal Jamak suffered less damage and suppressed nematode infection considerably and therefore, recommended for cultivation in root-knot nematode infested fields to abate yield losses and repress the nematode from further multiplication.
...
Abd El-Nasser Ahmed Mohammed1,2,*
...ality after ovarian transplantation upon dietary supplementation of 1.0 and 2.0% of Nigella sativa (N. sativa) oil to female mice and secondly to explore if dietary N. sativa is effective in alleviation of hypothermia and hyperglycemia due to general anesthesia. Seventy-five albino female mice (21.74 ± 0.19) were distributed into three groups; control (G1; N=25; not receive N. sativa oil) and two N. sativa oil groups s...
Muhammad Amin1,2*, Khalid Mahmood2 and Imran Bodlah3
...ird-finding, 11 new host plants and 71 new locality records in Pakistan. Aphis gossypii and Aphis craccivora were found infesting 8 tree species in 8 genera and 6 in 6 genera respectively. Rosaceae with 5 species in 4 genera carrying 9 aphid species in 5 genera was the most aphid-prone family. Systematics, host range, distribution of the related aphids and catalogue of host plant-tree species in the studied area from Pakista...
Durr-e-Nayab*, Iftikhar Hussain Khalil, Fida Mohammad and Shad Khan Khalil
... and late (December, 15) planting environment using a triplicate Randomized Complete Block design. Genotype × environment interac tion across the two environments was significant for spikes plant-1, spikelets spike-1, grains spike-1, spike density, 1000-grain weight and grain yield plant-1. Line × tester interaction effect was also highly significant for all traits under both ...
Sanaullah and Urooba Pervaiz*
...35 years. Yield, income, plant spacing, seed rate, irrigation interval, and use of pesticide before and after training were computed with the help of paired sample t-test. Results revealed that in maize there is a significant decrease for seed rate (-11.6743 kg/acre) and irrigation interval (-16.03 days) after training, while significant increase in mean difference was recorded for row-to-row distance (38.7 cm), plant-to-
Mehwish Kiran1, Muhammad Saleem Jilani1, Kashif Waseem1*, Muhammad Sohail Khan1, Fazal Haq2, Muhammad Amjad Nadim3, Ghazanfar Ullah3 and Salma Shaheen4
... for leaves’ count plant-1, leaf length (cm), leaves weight (g plant-1), root size (length & diameter), root weight (g plant-1), total biomass (g plant-1), root yield (t ha-1) were collected and analysed. Results showed significant improvement in almost all studied parameters with the application of NPK and different organic manures. Highest me...
Muhammad Arshad1, Muhammad Irfan Ullah1*, Muhammad Afzal1, Mian Anjum Murtaza2, Ejaz Ahraf3, Zahoor Hussain4, Syed Muhammad Ali Zahid1 and Maryam Riaz1
...t pests attacking citrus plants in Pakistan. The study was conducted to quantify the leaf area damage of eight citrus cultivars caused by mining activity of CLM during summer 2016. The total leaf area and mine area per leaf were calculated by the image analysis method using Sigma Scan Pro 5.0 software. The results of the present study showed that CLM generated larger mines; 1.64 cm2 on Grapefruit, 1.44 cm2 on Kinnow and 1.40 cm2 on Succari compared to other fi...
Muhammad Ilyas* and Fida Mohammad
...xperimental material was planted using alpha lattice design in two replicates at Peshawar (E1and E5), Kohat (E2 and E6), Sarai Naurang (E3 and E7) and Dera Ismail Khan (E4 and E8) (Khyber Pakhtunkhwa) during 2014/15 and 2015/16. Locations in each year were considered as independent environments. Pooled ANOVA revealed significant interaction due to GE for days to heading, days to maturity, grain filling duration, grain growth rate, grains spike-1, 1000-grain we...
Wajid Khan* and Raziuddin
...turity, primary branches plant-1, pods main raceme-1, 1000-seed weight and seed yield plant-1, signifying the occurrence of considerable variability in the tested material. Mean performance identified parental genotype AUP-21 being the best for early maturity (167.0 days), pods main raceme-1 (65.3), 1000-seed weight (7.1 g) and seed yield (30.6 g). F1 cross combination AUP-10 × AUP-18 had high seed yield (36.5 g) and m...
Exogenous Application of Calcium Improved the Vegetative Attributes and Corm Production in Gladiolus
Masood Ahmad* and Abdur Rab
...ally important flowering plant famous for its excellent flowers worldwide. In order to meet the high demand for its quality plants especially cut flowers. Gladiolus is commercially propagated by corms. The quality and health of corm is one of the important factors that affect the production and quality of gladiolus florets and spikes as well as corm production. Keeping in view, the significant role of calcium in
Fiza Asif1,*, Muhammad Siddique Awan1, Nasra Ashraf1, Nuzhat Shafi1, Abdul Rauf1, Khizra Bano1, Muhammad Razzaq2 and Naeem Iftikhar Dar2
...technique. A total of 23 plant species were observed during summer and 15 plant species during winter season. During both the seasons Indian or Himalayan Chestnut Aesculus indica was found as the dominant plant species in the diet having relative importance value (RIV) 8.36 and 10.92 in summer and winter, respectively. Diet breadth of all the plant
Muhammad Zeeshan Manzoor1*, Ghulam Sarwar1, Mukkram Ali Tahir1, Noor-Us-Sabah1, Ayesha Zafar1 and Sher Muhammad2
...>The general response of plants to soil and water salinity depends upon climate, soil characteristics, topography and management strategies. Water, even may be saline, is becoming more precious natural resource. Hence, there should be more crops and jobs per drop while conserving the quality of present terrestrial and groundwater. Saline water has been used for production of fodder and forages in many countries. Managing soil and water salinity under prevailin...
Muhammad Zameer Khan1, Sair Sarwar1*, Ahmad Khan1, Razaullah Khan1, Munazza Yousra1 and Muhammad Ilyas2
...OAc extractable K, plant growth and yield parameters. The amounts of soil K had positive correlation with shoot K concentration and grain yield of wheat with r = 0.48 and 0.49, respectively for AB DTPA as compared to that of 0.40 and 0.42 for NH4OAc K. On the basis of the study it was concluded that AB-DTPA soil test method can safely be used for evaluation of K status of soils derived from diverse parent material.
...
Muhammad Mudassar Shahzad1*, Syed Makhdoom Hussain2, Afia Muhammad Akram1, Arshad Javid3, Majid Hussain5, Syed Zakir Hussain Shah4 and Asma Chaudhary1
...acid’s presence in plant by-products decreases the bioavailability of nutrients to fish, resulting in poor fish growth and low nutrient digestibility in the body. Experimental diet was divided into six groups and were supplemented with graded levels (0, 300, 600, 900, 1200 and 1500 FTU kg-1) of phytase. Cr2O3 was incorporated in all diets at the rate of 1% as a non-digestible marker. The fingerlings were fed at the rate o...
Nazish Mazhar Ali1, Asma Ashraf 2*, Iram Liaqat2, Bushra Mazhar2, Shaukat Ali2 and Saiqa Andleeb3
Naveed Ahmed1*, Abdul Waheed1, Farrukh Siyar Hamid1, Imtiaz Ahmed1, Muhammad Abbas Khan1, Sohail Aslam1, Muhammad Adil Younis2, Seemab Ali1, Nadia Khan1 and Madiha Bashir1
...66 cm), number of leaves plant-1(15.73cm), root length (27.53 cm), yield (55.63 t/ha) was recorded for cultivar cabbage red with the application of 60ppm of GA3.
...
Manzoor Hussain*, Marie Maňasová, Miloslav Zouhar and Pavel Ryšánek
...ion were observed in the plants treated with Lecanicillium muscarium and both chemicals. Lecanicillium muscarium treatments alone or with nematodes had significant (P = 0.01) positive effects on plant shoot and root growth among all other treatments in the experiment. After L. muscarium and the chemicals (Vydate and Basamid), Stropharia rugosoannulata ranked second in r...
Qudsia Yousafi1*, Muhammad Aslam2 andShahzad Saleem1
...rded on three leaves per plant and four plants per plot and averaged per leaf. Numbers of ladybeetles were recorded from the whole plant by sampling three plants per plot. Seasonal mean number of aphids per leaf was at the maximum on the variety Black Beauty and lowest on Nirala, during the 2013-14 growing season. During the 2014-15season the maximum num...
Shaikh Abdul Lateef, Zhou Lin, Wu Jian, Junjie Qian and Zheng Shusen*
...mplication of liver transplantation in patients with pre-established hepatitis B infections. Information gained through this study would be helpful to have better management and life style in these deadly infections. ...
Shagufta Naz1, Ayesha Javed1, Ayesha Saleem1, Khadija Murtaza1, Rukhama Haq1, Akbar Hayat2 and Neelma Munir1,*
...nt and widely cultivated plant. It is used as flavor in various dishes due to its constiuents.composition. Gamma radiation is one of the sterilization technique involves total demolition of all microorganisms and their spores in foods. In recent study garlic samples were treated with three different doses of gamma radiation such as 0.5, 1 and 2 kGy. Effects of gamma radiation were analyzed for different aspects like microflora, moisture, fat, ash, fiber, pheno...
Rafiq-ur-Rehman1*, Zahoor Ahmad1, Wiqar Ahmad2, Muhammad Mansoor3 and Shah Masaud1
...f branches, pod clusters plant-1, pods plant-1 and pods cluster-1, pod length, 1000-seed weight, number of seed pod-1 (by 37, 18, 53, 31, 14, 7 and 5%, respectively). Rhizobium strains TAL-169 exceeded NARC-BK with 6% increase only in root length. Only NARC-BK could produce the 5.85 nodules after 15 days after sowing whilst strains in number of nodules were in the order;...
Abdul Majeed1*, Muhammad Anwar-ul-Haq2, Abid Niaz3, Abid Mahmood4, Naeem Ahmad1 and Hafiz Muhammad Walyat Ali Khan1
...ns has drastic effect on plant physiology and growth. The current research experiment was performed to screen salt tolerant wheat varieties grown in hydroponic and soil medium on the basis of plant photosynthetic rate, potassium (K+) and sodium (Na+) contents. Twenty wheat genotypes/varieties were grown in hydroponic culture, having different residual sodium carbonate (RSC), electrical conductivity (EC)...
Wiqar Ahmad1*, Farmanullah Khan2, Muhammad Sharif2 and Muhammad Jamal Khan2
...The study concluded that plant nutrition under eroded conditions should be based on INM where half of the recommended N and recommended P and K fertilizers should be applied in combination with legume crop inclusion in cropping patterns for eroded soil yield and fertility restoration.
...
Tahsin Razzaq*, Muhammad Fareed Khan and Shahid Iqbal Awan
...to impact of NCLB. Maize plants were artificially inoculated at four to six leaf stages. Thirty genotypes were screened in first field trail in June 2016. Genotypes had significant differences for NCLB severity and reactions and were classified into resistant, susceptible and moderate categories on the basis of 0-5 disease severity scale. The percent disease incidence ranged from 20-60% and area under disease progressive curve (AUDPC) 22-362dsu (Development st...
Muhammad Khuram Razzaq1,2*, Saeed Rauf1, Mohsin Khurshid3, Shahid Iqbal1,4, Javaid Akhter Bhat2, Ayaz Farzand5, Adeel Riaz1,6, Guangnan Xing2 and Junyi Gai2
...the substantial stage in plants and fertile pollen are important for proficient plant reproduction. Abiotic stresses reduce the photosynthates production, thus genotypes also reduce the reserve mobilization for tapetum cells which induce the significant reduction in pollen fertility. Therefore, pollen fertility index can be exploited to discriminate resistant and susceptible genotypes under abiotic stresses. High heritabilit...
Muhammad Irfan Ullah1*, Muhammad Arshad1, Muhammad Imran Khan1, Muhammad Afzal1, Azhar Abbas Khan2, Syed Muhammad Ali Zahid1, Muhammad Saqib1, Asad Abdullah1, Saba Kousar1 and Maryam Riaz1
... modifies the ability of plants to resist against insect feeding is an interesting and important component in an integrated pest management program. In the present study, water stress was applied to field grown cotton with two Bacillus thuringiensis transgenes (CIM-602 and CIM-599) and one non-transgenic genotype (CIM-554) for the performance of H. armigera feeding The difference in leaf injury, relative consumption and growth rate of H. armigera was detected ...
Muhammad Shahzad Akbar*, Maria Aslam, Muhammad Rehan Khalid, Shahid Iqbal, Muhammad Luqman and Muhammad Zeeshan Majeed
...ricultural crops, forest plantations, wooden infrastructures and other cellulosic products. Their control is usually done by the application of highly persistent synthetic insecticides which often cause different non-target effects such as environment contamination. This laboratory study evaluated the toxicity of methanolic extracts of eight flowers i.e. Mexican marigold (Tagetes lucida), African marigold (Tegates erecta), tecoma (Tecoma stans), calendula (Cal...
Matiullah Khan1*, Motsim Billah2, Shoaib Ahmad1, Raza Ullah Khan1 and Muhammad Sarwar1
... of 5.42 mg kg-1and rice-plant P uptake (17.50 kg ha-1) were also recorded in the treatment PECat 6 Mg ha-1 as compared to other treatments. The residual effects of PEC applied at the rate of 6 Mg ha-was superior by producing 36.2%, 14.2% and 7.0%increased grain yields over those of control, PLC and SSP, respectively. The post-harvest soil extractable P value and plant P uptake were significantly higher in the treatment wher...
Aamir Saleem1, Arshad Mahmood Malik2*, Najam Ul Hassan1 and Imtiaz A. Qamar3
...llers, number of leaves, plant height, fresh land dry weight and crude protein) and meteorological data regarding rain fall, temperature, pan evaporation, sunshine and wind speed for interpreting results along with their statistical analysis as fixing legume with grass has improved the forage quality. Overall, these results has suggested that grass-legume mixtures can improve livestock and pasture productivity, sustainability and as well as to fix atmospheric ...
Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4
...orphological characters (plant height, tiller density and herbage yield) of Blue panic grass. With the advance in maturity of clipping stages, plant height and no. of tillers in the grass increased (P<0.05). Herbage yield showed (fresh biomass yield, dry matter yield) significant differences (P<0.05) at each clipping stage. With advanced plant maturity species, its herbage yield incr...
Muhammad Saleem1*, Ehsan Elahi1, Allah Wadhayo Gandahi1, Saleem Maseeh Bhatti1, Hajra Ibrahim2 and Muhammad Ali3
...The economical important plant growth parameters ; height of plant (cm), stem girth, diameter of flower disk (cm), quantity of achenes (head-1), weight of 1000 achenes, oil (%) in achene, yield (ha-1), and sulphur content (%) in plant straw were evaluated. The values among the treatments for higher plant height (161.80 cm), wide stem girth (4.80 cm), flo...
Hina Fatima1*, Abdul Jabbar2 and Khurram Nawaz3
... variation and effect of planting of wheat after BT and Non-BT-cotton varieties on wheat production. In this study, the average technical efficiency of wheat farms on collective level was around 0.76. The mean technical efficiency of wheat after Non-BT and BT-cotton was 0.78 and 0.74, respectively. The result of the study revealed that those farmers cultivated the wheat crop after Non-BT cotton were technically more efficient compared to those who cultivated ...
Arifa Khan1*, Shazia Erum2, Naveeda Riaz1, Abdul Ghafoor2 and Farhat Ali Khan3
...e recorded on sprouting, plant height, number of tubers per plant, average tuber weight per plant, tuber shape, skin, flesh color, number of eyes per tuber, sensory evaluation and proximate analysis. Results showed significant differences in all yields and phenotypic quality traits. High sprouting (100%) and plant height was observed in CIP8 (31.60 cm). ...
Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2
... play vital roles in the plant’s survival under abiotic and biotic stresses. Cysteine (Cys) is the first organic molecule in the cell containing reduced sulfur and acts as a precursor for many sulfur-containing compounds including Glutathione (GSH). GSH functions to protect the plants against different forms of stresses. In this study, the feedback-insensitive serine acetyltransferase (SAT); a rate-limiting enzyme for ...
Muhammad Naeem Khan* and Asad Jan
... is an annual herbaceous plant and has been utilized for the treatment of different ailments like asthma, cold, influenza, head ach, liver and digestive problems and healing of wounds. The aim of the study was to explore phytochemical constituents of methanolic crude extract (MCE) and various solvent fractions and in-vitro antimicrobial activities of whole plant of D. botrys. Qualitative phytochemical screening of MCE and so...
Tanveer Ahmad1*, Muhammad Mujtaba Rafiq1, Waqas Ahmed Dogar2, Abid Mahmood Alvi3, Qumer Iqbal4, Muhammad Azam5 and Arshad Ali Khan6
...tica L.). Healthy phalsa plants were fertilized with P2O5 @ 50g, 100g and 150g plant-1. Data were recorded on number of fruit bush-1, yield bush-1 (kg), single fruit weight (g), fruit diameter (cm), number of fruiting nodes, length of new shoot (cm), number of sprouted shoots cane-1 and leaf area (cm2). Treatments were applied under Randomized Complete Block Design (RCBD) in triplicates and means were compared by Tukey&rsquo...
Muhammad Abdul Qayyum1*, Farhat Bashir2, Muhammad Mudassar Maqbool3, Anser Ali3, Saqib Bashir1 and Qaiser Abbas4
...ered a severe threat for plants seed germination because it has highest concentration of soluble salts. This study aims to examine the effect of NaCl salt at 100 mM and 200 mM concentrations on linseed (Linum usitatissimum L.) germination, plant growth, nutrients and soluble salts uptake. The results revealed that tested four linseed genotypes showed an overall germination rate of 86-94% at 100 mM NaCl (T2) and 78-84% at 200...
Sibgha Noreen*, Sumrina Faiz, Muhammad Salim Akhter, Kausar Hussain Shah
...These molecules help the plants to regulate osmotic adjustment and to enhance abiotic stress tolerance in plants. This study was aimed to examine mitigation effects of different osmoprotectants (salicylic acid, ascorbic acid, proline and their admixture) @ 200 mgL-1 on sunflower (Helianthus annuus L.) grown under saline environment (150 mM NaCl). The results showed that salinity stress (150 mM) resulted into significant decr...
Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh*
...) and internode (100%) explants was observed in cv. Desiree using Agrobacterium strain GV2260, while the highest gene transfer efficiency rate for leaf and internode explants in S. chacoense M6 were obtained with AGL1. The highest callus formation for both cv. Desiree and S. chacoense M6 was obtained on cv. Desiree leaf explants, transformed via the Agrobacterium strain GV2260. The lowest ...
Muhammad Ramzan1*, Muhammad Nadeem1, Masood Maqbool1, Ghulam Murtaza2
...corded 5.43 and 3.49 per plant, respectively. The study revealed that NIAB-98 (4.92/plant) and NIAB-999 (4.92/plant) were found more attractive varieties against thrips population during the whole study period. The study concluded that NIAB-78 is best variety and shows resistance against insect pests like thrips.
...
Nadia Saeed1, Mian Sayed Khan2, Habib Ahmad3, Muzafar Shah4*
...to estimate the ratio of plant parasitic nematodes associated with Walnut (Juglans regia L.) in different areas of Hazara Division, KP, Pakistan. Soil samples collected from walnut trees showed that Abbottabad and Mansehra had both parasitic and saprophytic nematodes whereas Kohistan had only saprophytic nematodes. Helicotylenchus sp. was found in abundance from Abbottabad and Mansehra alongwith other parasitic nematodes including Aphelenchus ...
Manzoor1*, Ahmad Khan1, Amir Sohail2, Shahzad Ali1, Fawad Ali Shah3, Junaid Iqbal3, Muhammad Owais Khan4 and Sultan Nawaz4
...s) and role of different planting methods (Ridge, Flat and Broadcast) in soil moisture conservation for maize crop. The research was carried out using RCBD with split plot arrangement having 4 replications at Agronomy Research Farm, The University of Agriculture Peshawar, during May 2017. Deficit Irrigations were allotted to main plots, while planting methods were allotted to sub plots. Deficit irrigations had significant (P...
Iffat Nawaz1*, Farhatullah1, Fida Muhammad1, Sajid Ali2 and Ghulam Muhammad Ali3
Ghulam Hussain1, Muhammad Asrar1, Dilbar Hussain2, Khurum Zia3, Abdul Rashid4*, Hina Anwar5, Muhammad Azeem1, Saddam Hussain1 and Sabeen Asghar1
...d indigenously available plant extracts. The efficacy of following insecticides and plant extracts viz. Cascabela thevetia leaf extract @ 300ml/acre, Azadirachta indica @ 300ml/acre, Profenofos @600ml/acre., Crown 70WS @125gm/acre, Match 50EC@250ml/acre, Helmat 40EC@600ml/acre and Confidor 20SL@ 250ml/ acre were evaluated on cotton against 3rd instar cotton mealy bug. Data was collected after 3,6,12,24 and 48 hours. Maximum ...
Waseem Abbas1, Shakeel-ur-Rehman2, Abdul Rashid2, Muhammad Kamran3, Muhammad Atiq2 and Muhammad Ehetisham ul Haq3*
... Leaves extracts of four plant extracts i.e. Calotropis gigantea, Zingiber officinale, Allium cepa and Azadirachta indica were evaluated at 3 % concentration against eggs hatchability and adult emergence of the whitefly in lab condition. Two consecutive sprays were applied to assess the relative impact of different plant extracts against adult whitefly population and the disease incidence of cotton leaf curl virus disease in...
Hassnain1, Abdul Basit1*, Mehboob Alam1, Imran Ahmad1, Izhar Ullah1, Noor Alam2, Inayat Ullah3, Muhammad Areeb Khalid1, Muhammad Shair4 and Noor ul Ain1
...use a severe decrease in plant growth, development and yield. Application of chitosan helps to induce drought resistance and improved water use efficiency. Therefore, a research study was planned to investigate the effect of chitosan on growth and yield of tomato (Cv. Rio Grande) plant under water stress condition at Ornamental Nursery, Department of Horticulture, The University of Agriculture Peshawar, Pakistan, during 2018...
Roshan Ali1, Afsar Ali2, Shamsher Ali2, Muhammad Arshad Khan3*, Haroon Shahzad3, Noman Latif3, Muhammad Waheed4, Ashraf Khan5 and Murad Ali6
... was tested. The maximum plant height (90 cm) was recorded in T4 when silicon was applied at the rate of 150kg ha-1, followed by plant height (85cm) of T3, treated with 100kg silicon ha-1. The data on 1000 grain weight and straw yield of rice crop revealed that there were non-significant (P>0.05) pair wise differences among the means of the treatments. The significant maximum biological yield (9299 kg ha-1), grain yield (...
Noorullah Khan1*, Farrukh Siyar Hamid1, Fayaz Ahmad1, Sabaz Ali Khan2, Imtiaz Ahmed1, Muhammad Abbas Khan1, Shamsul Islam1, Abdul Waheed1, Basharat Hussain Shah1 and Hussain Shah3
... for ten second and then planted in polythene bags under green net shade. Application of all concentrations of IBA (1000, 2000, 3000, 4000, and 5000 ppm) significantly increased all the growth attributing traits over the control. However, the highest number of first-order adventitious roots (NFARP) plant-1 (9.5), seedling survival rate (SSR) (51.7), and plant height (85.5 cm) were recorded...
Fayyaz Hussain*, Raza Ullah Khan, Asim Hayat, Humair Ahmed and Ahmad Khan
...ee interval i.e. at transplanting (0 DAT), 15 days after transplanting (15 DAT), and 25 days after transplanting (25 DAT), in addition to control (no P), and farmer fertilizer practice (FFP).Results show that mean paddy yield across both sites range from 2.972 to 4.334t ha-1, and maximum with P applied at 15 DAT, and contrarily the lowest with control treatment.Paddy yield increase over co...
Jawad Ali*, Ibad Ullah Jan and Hidayat Ullah
...es the number of leaves, plant height, number of branches, stem dry weight, root dry weight, fruit diameter, number of fruit per plant and 1000 seed weight. Visually reduction in vegetative and yield parametric quality okra plant okra were significantly alleviated by the foliar application of Se under drought stress. Se application of 3 mg L−1 significantly increased the number of le...
Erum Iqbal*, Nasir Mehmood, Nasira Kazi and Shahina Fayyaz
... zapota L. van Royen)plantation at Hub, Balochistan and Gadab, Sindh a number of plant and soil nematodes were encountered. Soil sample analysis revealed two and a known plant parasitic nematode species viz., Paratylenchus manilkarii n. sp., P. sindhicus n. sp.,and Pratylenchus kralli Ryss, 1982 as a new record species. P. manilkarii n. sp., is characterized...
Umer Iqbal1,* and Tariq Mukhtar2
...fected significantly the plant survival of green gram and black gram over control. Maximum plant survival was observed where the seeds were treated with Benomyl followed by Carbendazim. However, Copper + Mancozeb and Copper oxychloride treated seeds gave the minimum germination and survival of plants. Doses also had a significant effect on the germination and plant...
Muhammad Sohail1*, Imtiaz Hussain2, Maqsood Qamar2, Sikander Khan Tanveer2, Syed Haider Abbas2, Zeshan Ali1 and Muhammad Imtiaz3
... sown on normal and late planting dates to create variable growing environments under field conditions. Wheat genotypes showed significant variation (p<0.05) under both normal and late planting dates. The genotypes showed a strong correlation among canopy temperature, spike sterility and grain yield under both planting dates. The canopy temperature and grain yield correlated negatively ...
Ghulam Murtaza1*, Ghulam Sarwar1, Noor-Us-Sabah1, Mukkram Ali Tahir1, Fakhar Mujeeb2, Sher Muhammad3, Muhammad Zeeshan Manzoor1 and Ayesha Zafar1
...est crop. Data regarding plant parameters such as height of sorghum plants, diameter of stem, number of plants/ m2, total biomass of fresh plants were noted. Among all the treatments, T7 (T1 + organic matter @ 10 Mg ha-1) performed the best which produced the highest values of growth parameters. However, the treatment T3 (water of EC 3.0 dS m-1) proved i...
Muhammad Sohail Memon1*, Khadim Ullah1, Altaf Ali Siyal1,2, Naimatullah Leghari1, Ahmed Ali Tagar1, Khalil Ahmed Ibupoto1, Syed Tahir Ata-ul-karim3, Muhammad Tahir4 and Noreena Memon1
...ugh water to support the plant growth in all treatments and RBFI with raised bed size of 0.8 m was more water use efficient and suitable method for water scarcity areas. ...
Muhammad Qaisar Nawaz*, Khalil Ahmed, Ghulam Qadir, Muhammad Rizwan, Muhammad Faisal Nawaz and Muhammad Sarfraz
...included were: number of plant/m-2, number of leaves/plants, root length, bulb diameter, forage yield and total bulb yield. Results revealed that all the studied parameters were significantly improved with nitrogen application @ 80 and 100 kg ha-1 in ridge sowing. However, 80 kg N ha-1 in ridge sowing documented maximum economic benefit as compared to other treatments and is suggested as most cost-effective technique for tur...
Basharat Hussain Shah*, Farrukh Siyar Hamid, Shams ul Islam, Naveed Ahmed, Fayaz Ahmad, Noorullah Khan and Qamar uz Zaman.
...s growth parameters like plant height, tillers per plant, stem diameter, flag leaf length, 1000-grain weight and yield per hectare. Except for stem borer attack no prominent disease attack was observed in the experiment during the growth period. Significant differences were observed in the genetic material for all the parameters studied. Maximum plant height of 165.8 cm was recorded for Li...
Saleha Ashfaq1, Manzoor Hussain1, Nazish Bibi2, Jan Alam1, Muhammad Junaid2 and Sabi-Ur-Rehman3*
....) C.C. a narrow endemic plants of northern areas of Pakistan. The antimicrobial potential of H. gilesii extracts in different solvents was assessed using agar well diffusion method against bacterial and fungal strains, while cytotoxic activity was studied in the methanolic extract using brine shrimp’s lethality assay. All the extracts showed significant biological activity against Gram positive, Gram negative bacteria and selected fungal strains. Aceton...
Abdul Samad1, Raheela Asmat2, Muhammad Naeem1, Hamida Ali3, Mohammad Zahid Mustafa1, Ferhat Abbas1, Jannat Raza1,3 and Muhammad Tauseef Asmat1*
...nsmission to food chain, plant material and animals. In present study, 800 food samples consisting of beef and chicken meat, milk, salads and fresh vegetables were collected from retail markets of Quetta, Pakistan. Multiplex PCR was employed to identify the prevalent species and genes associated with virulence. Only 10 (1.25%) samples were found contaminated with Listeria monocytogenes. Milk samples were the most contaminated as 4 samples collected from...
Ajmalud Din1*, Munir Ahmad2, Fahad Masoud Watto2, Sheraz Ahmed1, Imtiaz Ali1 and Muhammad Kausar Nawaz Shah2
Muhammad Ramiz Murtaza1, Tahir Mehmood2*, Aziz Ahmad2 and Uzma Arshad Mughal3
...5 where p<0.01. Mango plantations with intercropping were 76.6 percent lesser per acre yield as compared to without intercropping. Agri. extension workers should inform mango growers to give up intercropping in order to get a higher yield. ...
Yousaf Ali1, Muhammad Zamin1*, Ibadullah Jan1, Shahen Shah2, Muhammad Mazhar Hussain3, Fazli Rabbi4 and Muhammad Amin5
...RCBD) consisting of four planting medium treatments (compost, mixture, clay and sand) and six tomato genotypes (Nadir, Money Maker, Pakit, Nagina, Roma and Rio grande) with three replications. The results revealed that the combination of compost and mixture has significant effect on shoot height, number of leaves, stem and root length, however stem diameter was significantly affected by compost and non significantly affected by genotypes. As far as the genotyp...
Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1
... stress that reduces the plant productivity. The plant growth promoting rhizobacteria (PGPRs) play important role in eliminating the effect of salinity. Cicer arietinum L. is an important legume crop having high quantity of proteins. In the present study, four varieties (CM44, CM91, CM98 and CM2000) were grown in the presence and absence of PGPR inoculated media and nitrogen in different salinity levels (20, 50, 100, 200 and...
Mohammad Aquil Siddiqui1*, Muhammad Tahir Khan1, Ghulam Shah Nizamani1, Shafquat Yasmeen1, Imtiaz Ahmed Khan1, Abdullah Khatri1 and Nighat Seema Soomro2
...genetic structure of the plants as an indispensable tool for crop improvement. This field study was initiated to evaluate three potential mutant lines of lentil against their parent (M-85) and two check varieties (NIA-Masoor-05 and NIA-Masoor-16). The pooled data of the crop, after two years of evaluation, indicated the earliest maturity in the mutant AEL-40/30 (92.0 days). Plant height was observed to be low in all the stud...
Muhammad Ilyas1, Sardar Ali Khan1, Shahid Iqbal Awan1, Shafiq-ur-Rehman1, Waqar Ahmed1, Muhammad Riaz Khan2, Raja Mohib Muazzam Naz2, Muhammad Mohib Ullah Khan3 and Sumaira Hafeez1*
...s on as many as possible plant individuals in basic experimental generations. Initially, 108 inbred lines of maize were planted in two separate trails under water deficit and normal irrigation conditions in the experimental field of Department of Plant Breeding and Molecular Genetics. Selection of parents for further study was done with regards to grain yield and its component traits. Broa...
Masaud Khan1*, Muhammad Jamal Khan1, Shahab Ahmad2, Asad Ali3, Numan Khan3 and Muhammad Adnan Fahad4
...y-to-fresh weight ratio, plant height, days to 50% flowering, were found to be non-significant. Results indicated that deficit irrigation (I15, I30 and I45) had significant effect (P<0.05) on plant height and NUE. Plant height tends to decrease by 1.3 and 5.5% with deficit irrigation. NUE also decreased by 17, 16 and 24 with deficit irrigation. Compared to I0, while the effect on dry to...
Muhammad Ilyas1*, Sardar Ali Khan1, Shahid Iqbal Awan1, Shafiq-ur-Rehman1, Muhammad Riaz Khan2 and Sumaira Hafeez1
...08 inbred lines of maize planted in two separate trials under normal irrigation and water stress conditions. Parental selection for further study was done with regards to grain yield and its related traits. Inbred lines explained a broad range of genetic variability and displayed different levels of drought tolerance. Four inbred lines were selected i.e. VDR-51, DR3-126, DR-37 and 5CDR-53. Crosses were done among the selected inbred lines. Six generations as P...
Using Smartphone Application to Estimate the Defoliation Caused by Insect Herbivory in Various Crops
Muhammad Irfan Ullah1*, Muhammad Arshad1, Sajjad Ali2, Asad Abdullah1, Samina Khalid3, Hafiz Muhammad Aatif4, Syed Muhammad Ali Zahid1, Muhammad Afzal1 and Jaima Molina-Ochoa5
...ment....
Stanley Uchenna Onwudike* and Vivian Chizoba Edoziem
...e University during 2016 planting season and the region lies within the latitude of 5° 38¹N and longitude 6° 97¹ E. At 10 weeks after planting, both the rhizosphere soil (soils within 2 mm region of the test crops) and bulk soil or control (soils away from the root zone) from the experimental plots that were planted with bean, groundnut and okra were sampled, air dried an...
Muneer Abbas1*, Muhammad Ramzan1, Khalid Hussain1, Abdul Ghaffar1, Niaz Hussain1, Muhammad Irshad1, Mudassar Khaliq1 and Sohail Abbas2
...grain damage, 0.71 larva/plant with 32.28 % yield increase over control treatment. But Marginal Cost Benefit Ratio was -0.46. Light traps proved more efficient and feasible having low environmental risks having minimum percent foliage, pod and gain damage of 2.09, 0.71 and 0.29, respectively with 0.13 larval population/plant, maximum yield of 875 kg/ha with 68.84 % yield increase over control under current investigations. Li...
Muhammad Rasheed*, Tayyaba Naseer, Asma Hassan, Fayaz ul Hassan, Rifat Hayat, Ghulam Jilani, Samman Gul Vaseer and Muhammad Bilal Ali
...o fix nitrogen in legume plant through symbiotic association of legume-rhizobium by forming nodules on the roots of legume plants. To ensure an optimum rhizobial population in the rhizosphere is necessary that improves the nodulation, N2 fixation and growth of legume crops. The experiment was conducted to access the effect of isolated bacteria from nodules on growth and nodulation of the lentil cultivars. Different cultivars...
Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui2
... vegetatively propagated plants through in vitro culture. This study was conducted to establish the optimal concentrations of plant growth regulators and sucrose for micropropagation of sugarcane. Sugarcane is cultivated through cane sets and therefore, multiplication of any new genotype through traditional practices requires interminable period of time. Eight sugarcane genotypes viz. NIA-2004, SPF-234, NIA-2012, BL4, A...
Rafia Sadaf1, Ishrat Younus2*, Sidra Maqbool2, Talha Bin Fayyaz3, Sarah Jameel Khan1, Sidra Siddique1 and Rida Fatima1
...ral toxicity shows that, plant extract up to 5000 mg/kg produces no signs and symptoms related to toxicity and also no mortality was observed. Antianxiety activity of Pulsatilla nigricans was examined by using elevated plus-maze paradigm and hole-board paradigm in rats at two different doses i.e. 250 and 500 mg/kg, and significant anxiolytic effects were observed as compare to control.
...
Babar Khan1,2 *, Nazir Javed1, Sajid Aleem Khan1, Nasir Ahmed Rajput1, Muhammad Atiq1, Abdul Jabbar1, Abdul Rehman3, Anam Moosa1 and Muhammad Amjad Ali1*
...ora gossypiella), eggplant fruit borer (Leucinodes orbonalis) and armyworm (Spodoptera litura)at 27±2°C under laboratoryconditions. The results indicated that the larvae of G. mellonella and S. litura were better host as compared to P. gossypiella and L. orbonalis for multiplication of infective juveniles (IJs) of the S. kraussei. Four different concentrations(50, 100, 200 and 500 IJs) of tested E...
Sumaira Akram1, Sajid Aleem Khan1*, Nazir Javed1 and Saeed Ahmad2
..., bio control agents and plant extracts. Among chemicals, cartap was most effective with lowest egg hatching and among biocontrol agents Paecilomyces lilacinus (Thom) Samson (PL) produced highest egg hatching while, Trichoderma harzianum Rifai (TH) caused lowest egg hatching. In plant extracts the highest egg hatching was recorded in clove at S concentration and lowest by neem extracts at S/10 concentration. Ca...
Larysa Kladnytska1, Anatoliy Mazurkevych1, Natalia Bezdieniezhnykh2, Oleg Melnyc1, Sergiy Velychko3, Mykola Malyuk1, Vasyl Danilov1, Yuriy Kharkevych1 and Magdalena Gryzinska4*
... dog adipose tissue by explant method. The cells were cultured in CO2 incubator by standard procedure. Expression of cytoplasmic and membrane proteins on dog stem cells from fat tissue at the IVth and Xth passages was examined by immunohistochemical method using monoclonal antibodies. Determination the index of proliferationdogs adipose-derived stem cells (DADSCs) on IVth and Xth passages. Established that...
Amjad Usman1*, Arshad Khan1, Ruidar Ali Shah2 and Toheed Iqbal3
...entify the morphological plant characters responsible for resistance against S. dorsalis. For this purpose, five commercially cultivated tomato genotypes (Riogrande, Riogrande H, Bombino, Roma VF and Roma) were evaluated against thrips (S. dorsalis) at A.R.I. Tarnab, Peshawar, Pakistan during spring 2017 in randomized complete block design with three replications. Trichome study was also carried out to know the type of trichomes responsible for resistance. Res...
Muhammad Zamin1*, Abdullah Khan1, Ibadullah Jan1, Fazli Rabbi2, Shahen Shah3, Rashid Ali1, Kaleem Ullah1 and Muhammad Amin4
...lications. There were 10 plants in each replication. The highest number of florets per spike (11.42) were obtained at treatment combination of nitrogen and potash (100N +200K kg/ha) where other parameters of plant height, number of leaves, leaf length and spike length were at par with their respective maximum results. However, the lengthiest spike (88.10cm) was produced at 100kg/ha nitrogen. Similarly, the application of nit...
Pushpa1, Nighat Seema Soomro1, Shahla Karim Baloch2, Mehmooda Buriro1, Aijaz Ahmed Soomro1, Muhammad Tahir Khan3, Qamar Uddin Jogi1*, Muhammad Nawaz Kandhro1 and Farheen Deeba Soomro1
...ions. The powder of weed plants produced significantly (p<0.05) harmful outcomes on all growth parameters of wheat varieties as compared to the control treatment. The maximum seed germination (82.16a %), shoot length (27.70 cm), root length (14.90 cm), shoot fresh weight (2.19 g), root fresh weight (1.16 g), shoot dry weight (0.54 g), root dry weight (0.27 g), and seed vigor index (3483.5) were recorded in variety Amber under the control (where no allelopat...
Saeed Ahmed Shah Chishti1, Saba Aleem1*, Iram Sharif2, Kashif Nadeem1, Nusrat Parveen1 and Muhammad Najeebullah1
...°C. Tomato yield per plant, yield per cluster, number of fruits per cluster, fruit weight and fruit diameter were significantly improved by the application of 4-chlorophenoxy acetic acid. Highest yield per plant 13.50 kg was recorded with the application of 75 ppm in 4- chlorophenoxy acetic acid twicely when the minimum temperature was ranged between 12.5-23°C. Likewise, maximum yield per pla...
Humayun Saleem1, Faisal Sohail Fateh2*, Zia-Ur-Rehman1 and Muhammad Abu Bakar Siddique1
... a continental deciduous plant with cold winters that can withstand temperatures as low as -30 ° C. The apricot has been used as a treatment for various diseases in Folk medicines. Shot hole which is a fungal disease caused by Wilsonomyces carpophilus is one of the diseases that target apricot. The purpose of the current study was to record the prevalence of shot hole disease on Islamabad’s Federal Capital Territory markets. The frequency and severit...
Mohammad Ejaz1, Salma Javed2, Muhammad Hamza1, Sadia Tabassum2, Muhammad Abubakar3, Irfan Ullah4*
...ae isolated from Yew plant have the potential to produce an anti-cancer compound called Paclitaxel. Other different fungal endophytic species produce various other types of anticancer compounds like camptothecin, podophyllotoxin, torreyanic acid, vincristine, and vinblastine. This review is organized to describe the general study of natural bioactive molecules or secondary metabolites secreted by fungal endophytes as novel sources of anticancer drugs. The ...
Attique Ahmed1, Tariq Sultan1, Ghulam Qadir2, Obaid Afzal2*, Mukhtar Ahmed5, Shamim-Ul-Sibtain Shah3, Muhammad Asif4, Safdar Ali2 and Muhammad Zeeshan Mehmood2
... content, no. of leaves, plant height, ear leaf area, ear inter nodes girth, flag leaf area over T1 in pot experiment. Similarly, the inoculation of PGPR + PSB with T2 and in combination with T1 also at 75% of recommended NP significantly increased chlorophyll content, no. of leaves, plant height, ear leaf area, ear inter nodes girth, flag leaf area over control in the field experiment. Inclusion of PGPR and PSB significantl...
Fazli Ahad1, Raziuddin1, Nazir Ahmad1,2*, Muhammad Nauman1, Touheed Iqbal3, Nabeel Khan1, Fazli Hameed4 and Quaid Hussain2
...r days to 50% flowering, plant height, primary branches plant-1, main raceme length, pods main raceme-1, pod length, seeds pod-1, 1000-seed weight, seed yield plant-1 among genotypes, parents and F3 population. Similarly, parents vs. F3 population also showed significant differences for all the studied traits except primary branches plant-1 and pods main...
Rehman Ali Keerio1, Nighat Seema Soomro1, Aijaz Ahmed Soomro1, Mohammad Aquil Siddiqui2, Muhammad Tahir Khan2, Ghulam Shah Nizamani2*, Muhammad Nawaz Kandhro1, Maryum Siddiqui4, Hajra Khan3 and Farheen Deeba Soomro1
...eplications. The maximum plant height (203.33 cm), stem girth (11.67 cm), head diameter (19.71 cm), number of seeds head-1 (1300.0), seeds weight head-1 (62.74 g), seeds index (60.12 g), seed yield (1927.8 kg ha-1) and oil content (41.92%) were observed under 2.00% Zn, while and minimum plant height (143.67 cm), stem girth (6.19 cm), head diameter (12.65 cm), number of seeds head-1 (715.3), seeds weight head-1 (35.53 g), see...
Zulfiqar Ali Abbasi1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1, Naimatullah Leghari2, Muhammad Ibrahim Keerio3, Ahmed Naqi Shah1 and Musrat Begum Abro1
... different solutions and planting geometries on growth and yield of sunflower in agro-ecological conditions of Tandojam, Pakistan. The experiments were a randomized complete block design in factorial combination, replicated three times. An experimental unit was accommodated with three factors i.e. seed priming sources (No seed priming, seeds priming with canal water, seed primed with 1.0% Urea, and seed primed with 0.2% ZnSO4), plant<...
Nadia Mangrio1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1, Nihaluddin Mari3 and Zia-ul-Hassan Shah2
...an. Crop in 1st year was planted on an experimental field by shifting on another adjacent field in 2nd year, which was fallow. The sugarcane variety PSTJ-41 was used for the study of Zn and B as soil and foliar application. Zn levels included: 0 kg ha-1 (control), 15 k.g ha-1 (soil application) and 0.2% (foliary application). Boron levels consisted: 0 kg ha-1 (control), 1 k.g ha-1 (soil application) and 0.1% (foliary application). Soil application of Znn nd B ...
Ahmad Naeem Shahzad1, Muhammad Kamran Qureshi2, Samee Ullah1, Muhammad Latif3, Shakeel Ahmad1 and Syed Asad Hussain Bukhari1*
... a possible strategy for plants to survive under adverse environmental conditions. The current study emphasizes the ameliorative role of trehalose, in mitigating the detrimental effects of salt stress, in cotton plants. Three concentrations of trehalose (0, 5 and 50 mM) were applied to plant foliage, subjected to varying levels (0, 11 and 17 dSm-1) of salinity. Salt stress disturbed the so...
Muhammad Sarmad, Syed Muhammad Zaka* and Syed Muhammad Tahir Abbas Shah
... stems and seeds of host plants. Being a serious pest of many important crops, the present work will study on biology and bionomics of O. laetus on three different hosts Gossypium hirsutum, Abelmoschus esculentus and Helianthus annuus. Shorter nymphal duration was observed on Gossypium hirsutum 20.00±0.14 days as compared to Abelmoschus esculentus 21.00±0.26 days and Helianthus annuus
Peer Sikandar Shah1, Ghulam Nabi1, Maqsood Khan*1,2, Saddam Hussain1 and Jawad Ali Jan1
... significant role in the plant growth and development such as nitrogen support the vegetative parts of the plant and phosphorus have significant role in the development of the root and also producing the energy by forming ATP and potassium encourage carbohydrates metabolism, enzymes establishment and osmotic regulation This experiment was conducted at Agriculture Research Institute Tarnab, Peshawar during spring season (Mar...
Quratulain1, Ata-ul-Mohsin1, Muhammad Naeem1, Ghulam Shabir1, Muhammad Khalid Rafique2 and Rashid Mahmood2*
...of 15 cm and 10 cm onion plant-to-plant distance on each ridge. Fertilization, irrigation, weeding and all other agronomic practices were carried out in onion experimental fields except thrips management practices. Results revealed that thrips incidence occur after 6th week of transplantation. Saryab red found relatively susceptible against thrips with maximum mean population of...
Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad1
...ifferent doses of boron, plant extracts and a bactericide in different combinations on tomato plants. This research study was performed at Agricultural Research Institute, Tarnab, Peshawar-Pakistan. Different biochemical tests were conducted to confirm stem rot pathogen. Boron was applied at the rates of 1.97, 2.96 and 3.95 g seedbed-1. Plant extracts were neem (Azadirachta indica) and ghw...
Muhammad Safdar Hussain1*, Muhammad Farrakh Nawaz2, Muhammad Ayyoub Tanvir2 and Noor-E-Hira1
...ation, drought-resistant plants should be sorted out. The objective of this study was to explore the growth behavior of Eucalyptus camaldulensis (recommended for waterlogged areas) and Tamarix aphylla (recommended for arid regions) under water stress. Therefore, a pot experiment was carried out with three treatments: Well-watered, 25% and 50 % drought to achieve said objective. It was found that drought negatively affected plant...
Akbar Hayat*, Muhammad Nawaz Khan, Ehsan Ul Haque, Ahmed Raza, Faheem Khadeeja
...oot stock ratio. Maximum plant height attained in T0(Rough lemon) with max. canopy volume. All the exotic root stocks are compatible with Feutrell’s early. Objectively maximum fruit weight, fruit size, juice percentage and yield obtained in T1 Troyer citrange and T2 Cox mandarin as compared to local root stock rough lemon. Results depict that exotic citrus root stock Troyer citrange and Cox mandarin performed well with Feutrell’s early in the local...
Indigenous Soilless Substrate Compositions Affect Growth, Yield and Quality of Cut Antirrhinum majus
Aqsa Ahmad1, Iftikhar Ahmad1* and Malik Fiaz Hussain Ferdosi2
...ing development and transplanted at the two to four leaf stage into lily crates with the treatment substrates. Plants grown in substrates containing SD + PH + PM (experiment I) indicated that plants grown in these soilless compositions died before flowering, while those grown in silt (control) performed best. While in experiment II, the highest quality plant...
Daniel Masood1, Noor Khan1*, Khalid Javed Iqbal2, Sadaf Dogar1, Abdul Hanan1, Sadia Nazir1, Sheeza Bano1, Azra Anwar2, Sameul A.M. Martin3 and Chris J. Secombes3
... the cheaper alternative plant protein moringa meal (Moringa oleifera) on growth and body composition of Labeo rohita fingerlings. L. rohita (average weight 190.25±00g) were stocked randomly in glass aquaria for a 90 day feeding trial. Fish were fed twice daily with four different iso-nitrogenous diets at a feeding level of 3% of total biomass. The diets contained 26% crude protein in which moringa meal substituted soybean meal at 0...
Muhammad Usman Saleem, Nadeem Iqbal, Shawaiz Iqbal*, Usama Bin Khalid, Adila Iram, Muhammad Akhter, Tahir Latif and Tahir Hussain Awan
...rsery seedlings and transplanting them in puddled soils. Declining surface water, high cost of pumped groundwater, high labor costs, and drudgery in manually transplanted rice (TPR) have motivated researchers to develop alternated technology such as direct seeded rice (DSR). About 30% of total water used in rice cultivation is consumed for puddling of soil (land preparation) and transplant...
Bilal Atta1*, Muhammad Rizwan1, Arshed Makhdoom Sabir1, Muhammad Dildar Gogi2, Muhammad Sabar1, Bakhtawar3, Faizan Ali3 and Mehran Sarwar3
...al efficacy of different plant extracts viz. Ginger (Zingiber officinale), Neem (Azadirachta indica), Clove (Syzygium aromaticum) and Tobacco (Nicotiana tabacum) was compared against T. castaneum infesting stored wheat. The results have suggested that mortality and repellency in T. castaneum increased as the dose rate of crude plant extracts and exposure interval increased. The maximum mortality (86.67%) was achieved with th...
Aamir Mushtaq1,2, Rukhsana Anwar1 and Mobasher Ahmad1,2,*
...found by DPPH method) in plant extract. Higher inflexion ratio (0.25 ± 0.05), most of time spent in dark area (158.34 ± 4.88 sec), increased no of hole pokings (34.16 ± 2.01), significant (P < 0.001) elevation in superoxide dismutase (17.36 ± 0.49 U/mg), catalase (1.42 ± 0.05 U/mg) glutathione (37.56 ± 1.89 μ mol/mg) and reduction in malondialdehyde (7.83 &plusm...
Sajjad Ali1,*, M. Irfan Ullah2, Asif Sajjad1, Muhammad Zeeshan Majeed2, M. Aslam Farooqi1, M. Shahid Rizwan3, Qaiser Shakeel4, Sohail Akhter1,Muhammad Raheel4 and Muhammad Arshad2
...ters with different host plants in terms of their physicomorphic attributes has been the subject of great interest with point of their integrated pest management. Helicoverpa armigera (Noctuidae; Lepidoptera) -being highly polyphagous- is the pest of many crops and exhibits high fecundity and migrating efficiency. The present study aimed to evaluate its physicomorphic responses towards different host plants. The highe...
Sohail Ahmed1,*, Muhammad Waseem Saleem1, Abid Ali1, Muhammad Shahid Nisar2, Rashad Rasool Khan1 and Abdul Rashid3
...f biocontrol agents with plant chemical and insecticide against Thrips tabaci L. (Thripidae: Thysanoptera), release of Coccinella septempunctata and Chrysoperla carnea, spray of Neem Seed Kernel Extract (NSKE) 5% and spinosad 240 SL (Tracer) were integrated in all possible combinations, thus, making a total of 15 treatments including separate application of each above and a control where none was applied except water only. Results showed s...
Bala Gambo Jahun1,2*, Muhammad Yamin2,3, Desa Bin Ahmad2, Muhammad Razif Mahdi2, Shamsuddin Suleiman4 and Salihu Ahmad Abdulkadir5
...lching depth in oil palm plantation. The results show that about 79 % of the mulching depth variance is explained by blade lifting angles, tractor’s forward speed and tractor’s PTO speed. Blade lifting angle of 120° at tractor’s PTO speed of 1000 RPM and tractor’s forward speed of 5 km/h offered the most suitable mulching depth of 14.10 cm. Tractor’s PTO speed was a major predictor of mulching depth in an oil palm
Anila Latif, Zaheer Abbas, Farhatullah and Ghulam Muhammad Ali*
...alkaloid and produced by plants of family Berberidaceae. Berberine Bridge Enzyme (BBE) gene involved in the synthesis of berberine was isolated from Berberis lyceum and over expressed in Arabidopsis thaliana. The integration of the BBE gene in transgenic lines was confirmed through PCR while the expression was confirmed by Reverse Transcriptase PCR. Whole plant bioassay confirmed 100% mortality in DBM within 72 hours. The pr...
Muhammad Usman Ghazanfar1, Waqas Raza1*, Waqas Wakil2,3, Imtiaz Hussain4 and Misbah Iqbal Qamar1
...stify;">Pre-treatment of plants with chemical elicitors can induce systemic resistance against plant pathogens and insect herbivores. The plan of the study was to study induction of defense responses and protective effects against Phytophthora infestans (Mont.) de Bary and sucking insect pests of potato (Solanum tuberosum L.) with application of salicylic acid (SA) and β-aminobutyric acid (BABA). Concentration of SA and...
Shaheen Rahman1, Kafeel Ahmad1*, Niaz Ali2, Muhammad Idrees3 and Waqar Ali4
...ium tumefaciens is a plant pathogen that causes devastating Crown Gall disease. Current studies were aimed at the isolation of A. tumefaciens from local soil. Five soil samples were collected from research farm of Agricultural University Peshawar, Pakistan. Soil samples were processed for the isolation of A. tumefaciens. Various biochemical and morphological tests were conducted to confirm the identity of A. tumefaciens. The pathogenic...
Abid Khan*, Mukhtar Alam and Yousaf Jamal
... bacteria (Lactobacillus plantarum, Lactobacillus casei, Streptococcus lactis), yeasts (Saccharomyces cerevisae, Candida utilis), actinomycetes (Streptomyces albus, Streptomyces griesus) and fermenting fungi (Aspergillus oryzae, Mucor heimalis). Farm yard manure (FYM) and poultry manure (PM) were used as organic sources of nitrogen. Bio-primed (seeds soaked in 10% BM aqueous solution for 30 minutes just before sowing) and unprimed wheat seeds were tested under...
Muhammad Medrar Hussain*, Asad Jan* and Sayyar Khan Kazi
...se rice calli transgenic plants were regenerated and established in greenhouse. For the evaluation of OsTZF8 gene role in drought stress tolerance, two weeks old rice seedling were subjected to drought stress. OsTZF8-OX transgenic indica line A and B displayed 69% and 64% survival rates respectively compared to 33% of control. These results confirmed that due to overexpression of OsTZF8 gene, transgenic line A and B displayed considerable level of drought stre...
Muhammad Younis1, Shahen Shah1*, Inamullah1, Rozina Gul2, Arshad Jalal1, Farhan Khalil1, Iqbal Hussain1 and Muhammad Adnan Fahad3
...rameters of sesame. Pods plant‑1, grain yield, plant height, and harvest index (HI) were observed highest using P @ 50 kg ha-1, while flowering and maturity were delayed when no P and S applied. Pods plant-1and biological yield were recorded highest at sulphur level 45 kg ha-1. The HI attained its peak at 75 kg P ha-1 with no sulphur application. It was concluded that solicitation of pho...
Muhammad Salim1*, Ayhan Gökçe1, Muhammad Nadir Naqqash1 and Orkun Ersoy2
...when it is combined with plant extracts. ...
Gulnaz Parveen1*, Salma Gul2, Muhammad Ather Rafi3, Ashfaq Ali Khattak4 and Hikmatullah Jan5
... one of the most popular plant having a strong antifungal activity for different fungal pathogens and have compounds are more effective to promote the growth of tomato plant. Tomato (Lycopersicum esculentum) plant is highly susceptible to root rotting fungi causing huge losses each year in Pakistan. Acacia nilotica used as a biofertilizer and Significant (p< 0.05) enhanced the growth of...
Samman Gul Vaseer1, Muhammad Rasheed1*, Muhammad Ansar1, Yamin Bibi2, Saqlain Shah1, Asma Hassan1, Lubna Ayub Durani1, Muhmmad Asif3 and Zuhair Husnain1
...in the nodules of legume plants. However, the variable reports for Cobalt (Co) effects on plant growth and crop yields urged to research and verify if the Co is an essential component particularly for leguminous crops. A greenhouse study was
Ahmad Khan1*, Raza Ullah Khan1, Sadia Khan2, Muhammad Zameer Khan1 and Fayyaz Hussain1
...bad to see the effect of plant derived humic substances (PDHS) on chickpea crop grown in 5.50 kg soil container, consisting seven treatments, whereby HS was given either as soil applied (at the rate 0, 15,30,45,60 mg l-1) and as foliar ( 100,150 mg l-1) The experiment was laid out in CRD under greenhouse conditions. Three seeds of chickpea variety Dhasht was sown in each pot which was thinned to one plant. Results show that ...
Muhammad Iqbal1, Sami Ul-Allah2*, Muhammad Naeem1, Muhammad Ijaz2 and Muhammad Qadir Ahmad3
...y of quick selection for plant breeders on the basis of seed traits. ...
Ayesha Zafar1, Ghulam Sarwar1*, Muhammad Sarfraz2, Muhammad Zeeshan Manzoor1, Sher Muhammad3 and Ghulam Murtaza1
...culture in Pakistan. The plants in saline environment are negatively affected due to several issues like low osmotic potential, specific ion effect, and nutritional imbalance. The fertilizer behavior in salt stress conditions is quite different as compared to the normal soils. Linseed is an important oil seed crop. Its 50 % yield reduction occurs at ECe 5.9 dSm-1 and ESP value of 25-30. A field experiment was conducted on saline sodic soils to determine fertil...
Muhammad Jan1*, Safdar Hussain2, Muhammad Anwar ul Haq3, Javed Iqbal4, Ilyas Ahmad4, Muhammad Aslam4 and Aiman Faiz3
...ters number of bolls per plant, plant height, sympodial branches, monopodial and seed cotton yield as compared to compost and FYM individual application. Among the all varieties, Lalazar performed better by producing maximum monopodial and sympodial branches, plant height, bolls per plant and seed cotton yield as compared to BT-142 and BT-786 while minim...
Muhammad Mohibullah1*, Mehran1, Sundas Batool1, Muhammad Amin1, Zakiullah1, Muhammad Ilyas2, Irfanullah1, Abdur Rehman1 and Sardar Ali3
...,1st branches plant-1, 2ndry branches plant-1, plant height, hundred grain weight and grain yield plant-1. Overall, chickpea accessions CH30/12, CH10/12, CH44/12, CH14/12, and CH11/12 performed well, and recorded with maximum values for grains pod-1, hundred seed weight along with other co...
Wajiha Anum1*, Liaquat Ali1, Umair Riaz2*, Abid Ali1, Nadia Manzoor3, Laal Hussain Akhter4, Asad Ur Rahman5, Naeem Maan6 and Ijaz Ahmad7
...of metabolic function in plants. However, it is not readily available to the crop because of its immobile nature. In order to ensure its efficient uptake by crop, an experiment was conducted to appraise the effect of various P placement methods and fertilizer rates on wheat. The fertilizer treatments were F1=150-00-60 NPK kilogram/hectare, F2=150-30-60 NPK kilogram/hectare, F3=150-60-60 NPK kilogram/hectare, F4=150-90-60 NPK kilogram/hectare, F5=150-120-60 NPK...
Muhammad Rasheed1*, Zafar Ullah1, Muhammad Ansar1, Asma Hassan1, Shahzada Sohail Ijaz2, Muhammad Hussain Shah4 and Muhammad Arshadullah3
...ighest number of tillers plant-1 (11) for Oats was recorded in oats-vetch mixture under conventional tillage (CT) while comparing minimum tillage (MT) to zero tillage (ZT) 43 percent higher yield of oats was obtained under MT. The impact of cereal legume mixture on forage yield was optimistic. In economic analysis MT depicted the highest net benefit per hectare over both other tillage systems that are conventional and zero-tillage with values of 632.87 $ ha-1 ...
Fehmina Ashraf1*, Muhammad Irfan2, Hafiz Abdullah Shakir1, Shaukat Ali3, Muhammad Khan1
...ous species of bacteria, plants and in different genera of fungi. Laccases have been purified by various methods. It involves in di-oxygen to water reduction and 1e- oxidation of phenolic and its allied parts. Laccases are mostly used in different industries like food, paper and pulp, pharmaceutical and textile etc. Both laccases and mediators have been used in different process like delignification of pulp. Laccases from bacterial species are used in dye deco...
Zubair Aslam and Ali Ahmad*
...maize hybrid P30B74. The plants were harvested 45 days after sowing and the evaluation was done on the basis of various morphological (root length, shoot length, root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaf, leaf length, stem girth) and physiological parameters (relative water contents (RWC), chlorophyll contents and membrane stability index (MSI)). The obtained results indicated that vermi-fertilizers and chemical f...
Muhammad Rafiq1, Muhammad Tariq Mahmood2*, Mushtaq Ahmad2, Imtiaz Ali3, Muhammad Saleem1, Irfan Rasool1 and Zeshan Ali4
...eed weight (SW) and pods plant-1(NPP), while significant negative correlation was expressed by drought susceptibility index (DSI) to grain yield. Study of drought indices revealed that the highest DTE was presented by Punjab-2008 (84.13) followed by CH12/12, D-16004, CH-09/12, TG-1218 and TG-1221 (83.84, 80.10, 72.27, 69.93 and 69.31 % respectively) coupled with least DSI (0.39, 0.40, 0.49, 0.69, 0.75 and 0.76 respectively). Results indicated that the genotype...
Hafiz Abdul Ghafoor1*, Muhammad Afzal1, Muhammad Luqman2, Muhammad Arshad Javed2, Syed Wasim Hasan3 and Muhammad Zeeshan Majeed1
...) as compared to control plants. Results of 2nd experiment also clearly demonstrated a significant impact of different treatments on the mealybug infestation (F12, 103 = 58.75, P < 0.001; HSD at α = 0.05) as compared to control. At both 3 and 7 days post-treatment, maximum reduction of mealybug infestation was recorded in plots treated with spirotetramat (87.75±3.91%) and lambda-cyhalothrin (85.52±4.42%) in combination with EPF followed ...
Jawad Ali Jan1, Ghulam Nabi1, Maqsood Khan1,2*, Shehzad Ahmad1, Peer Sikandar Shah1, Saddam Hussain1 and Sehrish1
... are applied to the crop plants in different farms to improve its production and nutritional value. This experiment was conducted at Agriculture Research Institute (ARI) Tarnab, Peshawar during summer 2016. Two factors i.e. Chilli varieties (Magma and High fly) and humic acid levels (0, 25, 50, 75 and 100 g L-1) were applied in the field during experiment. The results of the experiment showed that High fly variety took minimum days to produce flowering (33 day...
Amjad Ali1, Awais Salman1, Gul Daraz Khan1, Aftab Ahmad Khan2, Sher Shah Hassan2*, Muhammad Arif Goheer2, Mahmood Alam Khan3 and Sajjad Ahmed3
...mum number of leaves per plant (19.16), leaf length (19.97 cm), leaf width (10.46 cm), plant height (39.27 cm), turnip length (17.24 cm), turnip diameter (7.84 cm), turnip yield (22.42 tons ha-1), turnip weight (256.62 gm) and harvest index (52.34 %) were recorded for I1. Maximum turnip length (18.09 cm), turnip diameter (7.69 cm), turnip yield (21.11 tons ha-1), turnip weight (304.22 gm) and turnip moisture content (93.62 %...
Javed Iqbal1, Ali Zohaib1*, Muzzammil Hussain1, Adnan Bashir1, Muhammad Hamza2, Wardah Muzaffer3, Muhammad Tahir Latif1 and Naeem Faisal1
... improved the emergence (plants per m2), number of productive tillers per m2 and grain yield (3-7%) of all wheat varieties although productive tillers per plant, number of grains per spike and 1000-grain weight was decreased. Faislabad-08 performed better regarding grain yield and related components among all varieties. Seed rate and varieties did not interact significantly for studied traits. Correlation analysis revealed t...
U. A. Al-Karim, A. A. Alshimaysawe, A. E. Mohammed† , W. A. R. Aljaafri and F. A. Al-Fadhal
Evaluation of biological seed treatments for management of Rotylenchulus reniformis on cotton
...d no negative effects on plant growth. The use of different biological control agents as seed treatments can manage plant-parasitic nematodes and limit the crop damage....
A. S. M. El-Nuby1† , S. A. Montasser2 and I. A. El-Khadrawy
Control of root-knot nematodes using wild plants colonized Sinai, Egypt
...al activity of some wild plant extracts located in North and South Sinai, Egypt was examined against root-knot nematode (RKN). The selected seven plants viz., Artemisia judaica, A. monosperma, Bassia muricata, Cornulaca monacantha, Salsola kali and Zygophyllum album with different dilutions (25%, 50%, 75% &100%). The potent nematicidal efficacy observed in the extract of A. judaica followed by A. monosperma. In vivo tria...
K. Osei1† , A. I. Adama1 , E. C. Tagoe2 and J. Sackey-Asante1
Biochar effect on nematodes and insects population density, soil improvement and yield of okra
.... Biotic factors such as plant parasitic nematodes (PPN) and foliar insects have been implicated as major constraints to okra production (Asare-Bediako et al., 2014b). The attack of root-knot nematodes (Meloidogyne spp.) has been reported as the most serious, widespread and alarming which causes tremendous yield losses (Hussain et al., 2011; Kayani et al., 2013; Barros et al., 2014). Flea beetle (Podagrica spp.) is the most important insect pest of okra in Gha...
M. M. A Youssef and W. M. A. El-Nagdi †
Effect of some temperature changes on the population density of some plant parasitic nematode species
...e parasitic nematodes on plants viz., date palm and olive in both soil and roots was investigated. These nematodes were negatively correlated with the prevailing average soil temperature during four seasons (autumn= 20°C; spring= 22°C; summer= 27°C and winter= 14°C)....
Muhammad Amjad*1, Abdur Rafai1, Saeed Badshah1, Rafi Ullah Khan1, Sajjad Ahmad1
FINITE ELEMENT ANALYSIS OF THE REAL LIFE LOADINGS ON THE TI-27NB HIP BONE IMPLANT
...i-27Nb hip bone
implant by using FEA. The model of the implant was generated using CREO PARAMETRIC software. Two weight
categories 75Kg and 100 Kg with four different daily life activities stand up, sit down, knee bend and walking were
considered in this study. The FEA analysis was performed using commercial FEA software ANSYS. The implant model
was meshed using...
implant by using FEA. The model of the implant was generated using CREO PARAMETRIC software. Two weight
categories 75Kg and 100 Kg with four different daily life activities stand up, sit down, knee bend and walking were
considered in this study. The FEA analysis was performed using commercial FEA software ANSYS. The implant model
was meshed using...
Riaz Muhammad1*, Naseer Ahmeda, Abdul Basit2, Rizwan Alim Mufti2
EXPERIMENTAL INVESTIGATION OF FRACTURE TOUGHNESS, HARDNESS AND LOAD-INDENTATION DEPTH RESPONSE OF TI-64 USING VICKERS INDENTATION TECHNIQUE
...ideal for spring, body implant,
dental fixtures and different sports equipment. Ti-64 accounting for more than 50 percent of titanium usage in today
modern world high-tech industries subjected to various nature of cyclic loading. This study includes the experimental
assessment of fracture toughness of Ti-64 using indentation technique which is easy and fast experimental techniques.
For this purpose Vickers-indentation technique is e...
dental fixtures and different sports equipment. Ti-64 accounting for more than 50 percent of titanium usage in today
modern world high-tech industries subjected to various nature of cyclic loading. This study includes the experimental
assessment of fracture toughness of Ti-64 using indentation technique which is easy and fast experimental techniques.
For this purpose Vickers-indentation technique is e...
Rashid Nawaz*1, Iftikhar Hussain1, Sikandar Bilal Khattak1
KEY PERFORMANCE INDICATORS IDENTIFICATION AND PRIORITIZATION FOR ENVIRONMENTAL SUSTAINABILITY IN THE CEMENT MANUFACTURING INDUSTRY IN PAKISTAN USING ANALYTICAL HIERARCHY PROCESS
...senting
24 cement plants were analyzed using Analytical Hierarchy Process (AHP). The proposed KPIs are supposed to
assist the decision makers in achieving environmental sustainability. Among the 11 KPIs identified, the KPI “Total
amount of Emissions in Metric tons of CO2 equivalent per year” was identified as having the highest impact on
environmental sustainability....
24 cement plants were analyzed using Analytical Hierarchy Process (AHP). The proposed KPIs are supposed to
assist the decision makers in achieving environmental sustainability. Among the 11 KPIs identified, the KPI “Total
amount of Emissions in Metric tons of CO2 equivalent per year” was identified as having the highest impact on
environmental sustainability....
Naseem Ahmad1, Sahar Noor1, Rehman Akhtar1*, Misbah Ullah1, Khizar Azam2
PERFORMANCE IMPROVEMENT OF COMPRESSOR TO RECOVER FLARE GAS USING DESIGN OF EXPERIMENT TECHNIQUES
...e help of a new proposed plant process. Some factors responsible for disturbing routine
of compressor are categorized and pertinent information is togethered from various resources. The information is
thoroughly studied to enhance factors performance and the factors were set up according to the modified compressor
compression system. The suggested equipped factors guide to enhance the recuperate of low pressure burn gas and
the prop...
of compressor are categorized and pertinent information is togethered from various resources. The information is
thoroughly studied to enhance factors performance and the factors were set up according to the modified compressor
compression system. The suggested equipped factors guide to enhance the recuperate of low pressure burn gas and
the prop...
Razaullah1*, Iftikhar Hussain1
A TWO-WAREHOUSE SUPPLY CHAIN NETWORK DESIGN AND OPTIMIZATION WITH CROSS-ROUTE COSTS AND BUDGET, MAXIMUM FLOW AND CAPACITY CONSTRAINTS
...oduction capacity of the plants, stocking capacity of owned and rented
warehouses and traffic factors on the supply routes in the mathematical model further broadened the problem. A case
study is solved to analyze how the model performs with the changing network characteristics. ...
warehouses and traffic factors on the supply routes in the mathematical model further broadened the problem. A case
study is solved to analyze how the model performs with the changing network characteristics. ...
Khizar Azam1*, Abdul Shakoor1, Shahid Maqsood2, Muddasar Habib3, Muhammad Fahad4, Akhtar Zaib1
IDENTIFICATION OF SITES FOR ESTABLISHING PHOTOVOLTAIC SOLAR FARMS IN PAKISTAN USING SOLAR GEOMETRY
...ic requirements for a PV plant such as availability of local grid, barren land, roads, water, and good
climatic conditions. The Average solar intensity (I) was calculated by using solar geometry on a daily basis, which
served as the basis for annual projections. It has been found that the best location for building a solar farm is district
QilaSaifullah (I = 9.79 kWh/m2/day) in Baluchistan province. In the Khyber Pakhtunkhwa province, dist...
climatic conditions. The Average solar intensity (I) was calculated by using solar geometry on a daily basis, which
served as the basis for annual projections. It has been found that the best location for building a solar farm is district
QilaSaifullah (I = 9.79 kWh/m2/day) in Baluchistan province. In the Khyber Pakhtunkhwa province, dist...
Nazish Huma Khan1, Mohammad Nafees1, Adila Bashir1, Farooq Ahmad1
STUDY OF POLLUTION LAOD IN PAPER MILL EFFLUENTS AND ITS RECYCLING BY SUNDRY PLANTS AT HAYATABAD INDUSTRIAL ESTATE, PESHAWAR
... via recycling of sundry plants. For this
purpose a detail study was conducted at paper mills and sundry plants at Hayatabad Industrial Estate. The plants
were examined for operation and sampled for waste water. Total 7 waste water samples were collected from selected
points of Paper mills, Industrial drain and Sundry plants. Samples...
purpose a detail study was conducted at paper mills and sundry plants at Hayatabad Industrial Estate. The plants
were examined for operation and sampled for waste water. Total 7 waste water samples were collected from selected
points of Paper mills, Industrial drain and Sundry plants. Samples...
Waqas Anwar, Iftikhar Hussain
COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...ty of skilled manpower / plant and machinery, non-acceptability of allied contractors, and larger operating distances of sites from base camps.
The paper identifies dynamics and variables in order of preference using multi-variant analysis for low productivity in restive regions. The author uses primary dataset and seeks feedback from the respondents through a comprehensive questionnaire containing twenty-six questions. Comparing circumstances and outc...
Waqas Anwar, Iftikhar Hussain
COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...ty of skilled manpower / plant and machinery, non-acceptability of allied contractors, and larger operating distances of sites from base camps.
The paper identifies dynamics and variables in order of preference using multi-variant analysis for low productivity in restive regions. The author uses primary dataset and seeks feedback from the respondents through a comprehensive questionnaire containing twenty-six questions. Comparing circumstances and outc...
Anjum and Ahmad Khan*
Phenology, Crop Stand and Biomass of Wheat in Response to Farmyard Manure and Soil Amendments
...area tiller-1 (107 cm2), plant height (96.5 cm) and biomass (11783 kg ha-1) were improved with 20 Mg FYM but were non-significantly different from plots having 15 Mg FYM ha-1 over two years averaged data. Among the amendments, greater days to anthesis (126 days) and physiological maturity (154 days) was noted with effective microbes over two years. Similarly, the addition of effective microbes has increased the emergence m-2 (123), leaf area tiller-1 (105.6 cm...
Inamullah Khan1*, Amjad Usman2 and Rahamdad Khan2
The Mortality Rate of Pupae and Adult of Fruit Fly Bactrocera cucurbitae Coquillett (Diptera: Tephritidae) Affected by Different Submerging Time and Soil Types under the Laboratory Treatment
...gation of fruit fly host plants standing in clay loam or silt clay loam soil texture may help in controlling the overwintering pupae in the orchards....
Hina Fatima1*, Sania Shaheen2, Lal Khan Almas3 and Sehrish Haroon4
Profit Efficiency among Transplanting and Direct Seeded Rice Producers (Case Study of Certain Rice Growing Areas of Province Punjab, Pakistan)
...rofit efficiency of transplanted rice production (TRP) and direct seeded rice system (DRS) is gaining greater attention in Pakistan. Profit efficiencies of TRP and DRS are estimated with data from farmers belonging to various districts of Punjab. Gujranwala, Hafizabad, Sheikhupura, Jhang and Sialkot are the major rice producing areas of Punjab. The primary data is collected from the above mentioned areas through random sampling. Stochastic Frontier Analysis (S...
Muhammad Zamin1*, Fazli Rabbi2, Shahen Shah3, Muhammad Amin4, Haroon Ur Rashid5, Hasnain Alam6 and Sabahat Ali1
Performance of Lilium (Lilium elegans L.) Genotypes using Different Planting Media
...stigate the best type of planting medium and selecting a particular genotype for District Swabi climatic conditions, an experiment was conducted in the horticulture nursery, University of Swabi, Pakistan in the year 2019. Five Lilium genotypes viz., Star gazer, Star fighter, BomiYellow, Red carpet and Yena were tested in four type of planting media viz., M1-sandy soil+ Compost (1:1; v/v), M2- sandy soil+Humic acid (20:1;v/v)...
Sajjad Haydar*, Zunaira Asif*, A. A. Bhatti**, Obaidullah Nadeem***, Ghulam Hussain*, Nadeem Abbas*
EFFICIENCY OF WASTEWATER TREATMENT PLANT IN THE PUNJAB TANNERY SECTOR: A CASE STUDY OF DADA TANNERY
...div>wastewater treatment plants to address the issue. This study aims to evaluate the performance of wastewater
treatment plant (WWTP) of a local tanning industry. Raw wastewater showed high concentration of organic matter
and Chromium. Phosphorous concentration was found deficient for satisfactory biological treatment. WWTP showed
overall removal efficiency of 88.81, 84.54 and 62.31% for ...
Muhammad Nafees*, Asim Nawab*, Wisal Shah**
STUDY ON THE PERFORMANCE OF WASTEWATER TREATMENT PLANT DESIGNED FOR INDUSTRIAL EFFLUENTS
...ormance of the treatment plant installed on the main effluent drain
of Hayatabad Industrial Estate (HIE) for reducing pollution load. The objective of the study was to know about the
pollution removal efficiency and suggest changes in the existent treatment plant, if required. For this purpose, samples
Waqas Anwar1*, Iftikhar Hussain1
COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...iv>of skilled manpower / plant and machinery, non-acceptability of allied contractors, and larger operating distances
of sites from base camps.
The paper identifies dynamics and variables in order of preference using multi-variant analysis for low productivity
in restive regions. The author uses primary dataset and seeks feedback from the respondents through a comprehensive
questionnaire containing twenty-six que...
Muhammad Irfan*, Saeed Gul*, Mohammad Younas*, Babar Nawaz*, M. Ishfaq*, M. Amir Durrani*, Abid khan*
FERMENTATION OF SUGARCANE MOLASSES BY SACCHARAMYCES CEREVESIA: EFFECTS OF OPERATING PARAMETERS ON ETHANOL PRODUCTION
...ntation process. A pilot plant has been designed and fabricated to investigate the effect ofprocess parameters for the sustainable production of ethanol from sugar cane molasses. The effect of various experimental parameters such as fermentation time, ...
Muhammad Khurram Ali*, Raft Javed Qureshi**, Mirza Jahanzaib***
SELECTING FACILITY LOCATION USING HYBRID METHODOLOGIES IN GLOBAL PERSPECTIVE: A CASE OF CEMENT PLANT
...uitable for a new cement plant installation among the list offour alternatives. The irreversible nature of the crucial decision requires analysis of wide range offactors with different optimization techniques. Therefore such factors were explored and prioritized from available literature and by recommendations ofpanel ofexperts followed by
Shahida Nasreen Zakir*, Samina Siddiqui**, Nasreen Ghaffar*
MAJOR ELEMENTS CONCENTRATIONS IN CALCAREOUS SOILS
... hence is unavailable to plants. Calcareous soil has more than 15% of CaCO3 at pH ranged from 7.5 to 8.4. Iron was also found to be low in calcareous soils. Such soils are required an improved nutrient management in such a manner that soil contact of P, K and Fe can be minimized.
...
Naeem Ejaz*, Daulat Khan**, Usman Ali Naeem*, Muhammad Ali Shamim*, Muhammad Fiaz Tahir*, Faisal Shabbir*, Jawad Hussain*
DETERIORATION OF ORDINARY PORTLAND CEMENT AND FLY-ASH BASED GEO-POLYMER CONCRETES DUE TO SULFATE ATTACK UNDER THE ACTION OF SULFURIC ACID AND WASTEWATER
...and wastewater treatment plants has been a major problem but this issue has not been resolved satisfactorily yet. Generally, deterioration happens due to sulfuric acid reaction with treatment units and sewer materials. Geo-polymer binders especially fly ash (FA) is an acid resistant and can be used as a substitute binder for sewer construction. This research work highlights the laboratory results of fly ash based geo-polymer concrete and ef...
Shahid Ali1, Habib Akbar2, Shamsher Ali3*, Adnan Nasim1, Muhammad Ismail1, Nur Ul Haq1 and Muhammad Usman4
Effect of Planting Sources, Cane Portions and Setts Placement Methods on Sugarcane Yield Attributing Traits
...d out the best sugarcane plantation source between trenched and fresh stocks, efficient method of setts placement, selection of paramount cane portions and the interaction of yield and yield components. The effect of planting sources (i.e. sugarcane fresh seed and the one obtained from stock buried underground), cane portions and setts placement methods on sugarcane yield attributing traits were examined at Sugar Crops Resea...
Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1
Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...es which not only affect plant health and yield but also the quality of the produce. Among biotic diseases, fungal stem and tuber rot are the most common diseases that cause significant loss in potato production in Punjab province, Pakistan. Neocosmospora rubicola was found as a new pathogen causing stem rot of potato in the potato growing area of district Kasur. Symptoms of the N. rubicola infected potato plants were necrot...
Saba Iqbal1*, Muhammad Luqman1, Hafiz Muhammad Nasrullah1, Asmat Ullah1 and Hafiz Muhammad Akram2
Response of Cotton to Application of Organic and Inorganic Source of Nutrients in Semi-Arid Climate
...(waste product of biogas plant that uses manure of all kind of farm animals to produce biogas) were investigated to figure out the best possible combination for cotton crop. Different combinations were; T1= control (recommended fertilizer dose 145-56-62 NPK kg ha-1); T2= poultry manure (8 t ha-1); T3= FYM (10 t ha-1); T4= slurry (10 t ha-1); T5= urea 30 kg ha-1+ poultry manure 6 t ha-1, T6= urea 30 kg ha-1+ FYM 8 t ha-1; T7= urea 30 kg ha-1+ slurry 8 t ha-1; T...
Feroza Arshad*, Aftab Ahmed Memon**, Muhammad Aslam Uqaili** and Arshad Habib Malik*
SYNTHESIS OF A NOVEL ROBUST INTELLIGENT CASCADED REACTIVITY CONTROLLER FOR CANDU REACTOR
...p;of CANDU nuclear power plant is a networked controller implemented on a Programmable Logic Controller (PLC). The new NICRC is designed based on two Intelligent Distributed Cascaded Power Controller (IDCPC) and Intelligent Cascaded Moderator Level Controller (ICMLC) for moderator level control in CANDU reactor core. The IDCPC is composed of three neural sub-controllers while ICMLC is composed of two neural subcontrollers The proposed NICRC...
Faizullah Mahar1, Syed Saad Azhar Ali1, Abid Karim1
DESIGN OF FIXED ORDER ROBUST CONTROLLER USING H∞ -NORM AND EVOLUTIONARY TECHNIQUES: COMPARISONS AND PERFORMANCE ANALYSIS
...er than that of the plant and it is complex in nature as well. Moreover, in these design methods the order of controller cannot be fixed a priori to control law design. In industrial applications it is hard to execute these controllers practically. To overcome this problem, this paper proposes the use of evolutionary techniques (i.e. genetic algorithm and immune algorithm) for the designing of a low, fixed order robust controller. To check ...
Arshad Habib Malik*, Aftab Ahmed Memon** and Muhammad Rafiq Khan***
DYNAMIC MODELING AND CONTROLLER DESIGN FOR NUCLEAR POWER PLANT
...ctor)-type nuclear power plant is presented in this paper. The nonlinear dynamic model of PHWR power reactor is developed based on reactor, logarithmic amplifier, moderator level control valve and reactivity system. The nonlinear model is characterized by 15 state variables and one input. This higher order nonlinear model is linearized at full power operating point. A standard higher order state space model is realized for controller design...
Parakriti Gupta1, Kapil Goyal2 and Mini Pritam Singh3*
Hepatitis E Virus and Zoonosis
...mmunosuppressed and transplant patients where prolonged virus shedding has been documented. The conventional diagnosis is established by detection of HEV antigen or anti-HEV IgM in acute sera. However, the detection of HEV RNA is important to establish the diagnosis in immunosuppressed patients. In transplant patients, decrease in immunosuppression is usually done, however ribavirin therapy has also shown a definitive role. ...
Sikander Hiyat1, Nazim Hussain1, Muhammad Ishaq Asif Rehmani2*, Muhammad Nasir Abbas2, Smana Raza3, Javed Shabbir Dar4 and Tauqeer Ahmad Yasir5
...liter ha-1). Vegetative (plant height, number of monopodial and sympodial branches, no. of nodes plant-1) and reproductive growth and yield (no. of flowers plant-1, no. of square plant-1, no. of open and un-open bolls plant-1, seed cotton yield and cotton seed yield) parameters were recorded. The results revealed that ...
Muhammad Mazhar Iqbal1*, Ijaz Ahmad2, Shahzad Maqsood Ahmed Basra3, Abu Baker Ijaz4, Zahid Hassan Tarar5, Muhammad Ansar6, Umer Iqbal7, Tayyaba Naz4, Bilquees Fatima8, Muhammad Akram9, Allah Wasaya10, Asif Iqbal11, Shakeel Ahmed Anwar12, Khalid Saif Ullah Khan13, Azeem Khalid14, Asif Aziz15 and Rashid Mehmood16
...eld. Maize, a monoecious plant, is adversely affected by high temperature during anthesis. Asynchronous fertilization and pollen desiccation reduce maize yield by reducing grain number and their size. Spray of hydrogen peroxide (H2O2), salicylic acid (SA) and ascorbic acid (AsA) may induce heat stress tolerance. Spray of SA, AsA, and H2O2 increased chlorophyll, relative water and nutrient contents, membrane stability index (MSI) and antioxidants activities in ...
Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh
...RC-Oats exhibit a medium plant height (110-120 cm), high crude protein (36.23% over check variety S-2000), thick stem (14.86% more than check variety S-2000) and higher leaf area per plant (21.55% over check variety S-2000). The variety is drought tolerant may be grown in semiarid and arid areas having minimum rainfall up to 300 mm, highly lodging-resistant, late-maturing i.e. stay green till mid May, having up to 12 % crude...
Zahid Hassan Tarar1, Muhammad Salik Ali Khan2*, Shahzada Munawar Mehdi3, Raza Salim4, Irfan Ahmad Saleem1, Saima Nazar5, Munir David2, Tahir Majeed6, Muhammad Sufyan Mughal7, Muhammad Saleem8, Umer Iqbal9, Muhammad Mazhar Iqbal10 and Muhammad Khalid Shaheen3
... visualize the spread of plant available micronutrients in district Mandi Bahauddin. Total 1194 georeferenced soil samples were collected at a depth of 0-15cm maintaining a sampling grid cell size of 10-acres (40469 m2) throughout the sampling area. These samples were analyzed for plant available Zinc (Zn), Copper (Cu), Iron (Fe), Manganese (Mn) following Diethylenetriamine Penta-Acetate (DTPA) extraction methodology. Quanti...
Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu1
...is a limiting factor for plant cultivation in many areas of China. In present study, the blackberry cultivar ‘Hull Thornless’ was chosen for drought stress analysis. All plants were grown in pots under greenhouse conditions, and were subjected to 20-day drought stress by withholding irrigation, followed by re-watering for 5 days. The changes in leaf water content (LWC), electrolyte leakage (EL), concentrations of...
Roni Koneri1*, Meis Nangoy2 and Pience V. Maabuat1
...undance was found in the plantation land, while the lowest was found in the primary forest or around the waterfall. The highest dragonfly richness index, species diversity index (H’), and species evenness index were found in the secondary forest, followed by the primary forest. The diversity of dragonflies at the observation site was influenced by vegetation cover and temperature.
...
Magbolah Salem Helal Alzahrani
...tablished as a medicinal plant. There are many different species of chamomile, the two most common being German chamomile (Marticaria chamomilla) and Roman chamomile (Chamaemelum nobile). The use of chamomile has been associated with calming and anti-inflammatory properties. The plant’s healing properties come from its flowers, which contain volatile oils including bisabolol, bisabolol oxides A and B, and...
Syeda Farzana Bibi* and Siraj-ud-Din
Fluorescence Analysis, Extractive Values and Cytotoxic Screening of Crataeva adansonii DC Leaf and Bark through Brine Shrimp Larvae Assay
...adansonii is a medicinal plant and many folklore uses of this plant are well known to us. Pharmacognostic studies like finding extractive values and nutritional values play a vital role in the determination of adulterated or exhausted drugs. It lays down parameters for authentication and standardization of drugs. The cytotoxic study helps in the evaluation of a drug for its toxicity, which is determined by the prevention of ...
Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood4
... tarits of horticultural plants. A field trial was carried out in 2018-19 aiming at the evaluation of impacts of new commercial products “Quantis” and “Acevit-C” on growth, yield and antioxidative behaviour of bottle gourd cv. Aakash F1. Three level of Quantis (6 ml, 8 ml, 10 ml) and Acevit-C (100 ppm, 150 ppm and 200 ppm) were applied as foliar treatment following RCBD design. Results showed that impact of foliar application of both Qu...
Ayesha Noreen1, Amina Elahi1, Dilara Abbas Bukhari2 and Abdul Rehman1*
...astewater, when used for plant growth, revealed an improved growth of Vigna radiata as compared to the original (untreated) wastewater. This multiple metal resistant bacterium’s ability to convert toxic arsenite into relatively less toxic form may find potential application in environmental biotechnology.
...
Mah Jabeen and Amjad Farooq*
...at weekly interval. Host plant susceptibility indices were also calculated. B. napus was found to be susceptible showing maximum population of aphids i.e., 6.80 per 10-cm inflorescence whereas B. compestris showed comparatively resistant response with minimum population of aphids i.e., 0.43 per 10-cm inflorescence. The population of aphid was recorded to be the highest (12.83 per 10-cm inflorescence) on March 11 which showed non-sig...
Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1
Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...: justify;">Twenty seven plant species of the Papilionaceae were collected from Dir Upper, with elevation ranges from 1200-4000 meters during 2015-2017. They were taxonomically determined with the help of key characters, the uses of these native plants were recorded such type of study was concluded for the first time in the selected area of Dir (Upper). In view of the fact that these plant...
Muhammad Rizwan1*, Bilal Atta1, Ana Maria Marino de Remes Lenicov2, Roxana Mariani2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Misbah Rizwan4, Muhammad Sabar1, Ch. Muhammad Rafique1, Muhammad Afzal5
...ze: small;">Diversity of planthoppers and their host plants were studied in the “Kallar” tract of the Punjab, Pakistan (an important growing area of the world for producing Basmati rice). Planthoppers are considered the most important pests of rice. Delphacidae and Cixiidae are families of planthoppers with the most harmful species. Delp...
Gregory Ejikeme Odo1,*, Juliana Ekenma Agwu1, Nkechi Nweze2, Clara Ikegbunam2,Felicia Ekeh N1, Vincent Ejere1, Ngozi Ezenwaji1, Reginald Njokuocha2, Godwin Ngwu1 and Fabian Okafor1
... the non toxicity of the plant extract of D. erecta to the kidney.
...
Amar Iqbal Saqib1, Khalil Ahmed1*, Abdul Rasul Naseem1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Muhammad Khalid2, Imtiaz Ahmad Warraich3 and Muhammad Arif4
... and gypsum. The maximum plant height, 1000-grain weight, paddy and grain yield of rice and wheat crops were obtained where the gypsum+ humic acid were used @75 % GR+ HA @ 30 kg ha-1 followed by gypsum @ 100% GR while the chemicals properties of soil (pHs, ECe, SAR) were under the safe limits in both treatments. Gypsum @ 75 % GR+ humic acid @ 30 kg ha-1 reduced the pHs (6.70%), ECe (27.60%) and SAR (54.96%), hydraulic conductivity (9.75%), and bulk density (3....
Arifa Khan1*, Danish Anwar2, Shazia Erum3, Naveeda Riaz1, Shahid Riaz4, Tariq Rafique3 and Zafer Iqbal2
Screening of Exotic Potato Germplasm against Potato Virus PVX, PVY and PLRV through Biological and Serological Test (ELISA)
...ber of tubers and shoots plant-1 while CIP-5 was a dwarf genotype with minimum tuber yield. Genotype CIP-6 produced more number of tuber plant-1 but CIP-22 followed by CIP-10 produced the highest tuber yield plant-1. Majority of genotypes produced round shape tuber with yellow, white skin color and cream flesh. Likewise, maximum genotypes had medium to shallow eye tubers except CIP-9 and C...
Muhammad Ismail1, Tufail Ahmad2, Shamsher Ali2*, Shahid Ali1, Nur Ul Haq1 and Naveedullah3
Heavy Metals (Pb and Ni) Pollution as Affected by the Brick Kilns Emissions
...etal content of soil and plants around the brick kiln chimneys was studied in 2009-2010. The research was carried out on Peshawar Ring Road’s south direction between chimneys of bricks preparation that were named A and B with distance of 300 m. The kilns were positioned such that Southern direction of chimney of A was north for the chimney B. A total of 36 (18+18) soil and wheat leaf samples were collected in four directions. Samples were collected at va...
Muhammad Qaisar Nawaz1, Khalil Ahmed1*, Ghulam Qadir1, Amar Iqbal Saqib1, Muhammad Rizwan1, Muhammad Faisal Nawaz1 and Imtiaz Ahmad Warraich2
Impact of Fertilizer and Planting Geometery on Garlic (Allium sativum L.) Yield in Saline-Sodic Soil
...phosphorus (P) rates and planting geometry for the successful garlic production under saline environment. The experimental design was split-plot with three repeats. Three planting geometry (10cm x 20cm, 15cm x 20cm and 20cm x 20cm) and four phosphorus levels i.e. (i) control (no phosphorus), (ii) P (60 kg ha-1) recommended dose (RD), (iii) 125% P of RD (75 kg ha-1) and (iv) 150% P of RD (90 kg ha-1) were used. Observations i...
Khalil Ahmed1*, Amar Iqbal Saqib1, Abdul Rasul Naseem1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Muhammad Khalid2, Imtiaz Ahmad Warraich3 and Muhammad Arif4
Use of Hyacinth Compost in Salt-Affected Soils
... for supply of essential plant nutrients and improving the health of salt-affected soil is a simpler technique. Therefore, present research work was carried out to appraise the efficacy of water hyacinth compost as an ameliorant for improving the deteriorated properties of saline-sodic soil. Treatments included were; T1, control, T2, gypsum @ 100 % GR, T3, gypsum @ 50 % of GR, T4, hyacinth compost @ 15 t ha-1, T5, gypsum @ 50 % of GR + hyacinth compost @ 5 t h...
Adnan Arshad1*, Huma Qamar2, Ristina Siti-Sundari3, Zhang Yue1, Muhammad Zubair2, Muhammad Ali Raza4, Muhammad Habib-ur-Rehman5 and Lizhen Zhang1*
Phenotypic Plasticity of Spineless Safflower (Carthamus tinctorius L.) Cultivars in Response to Exogenous Application of Salicylic Acid under Rainfed Climate Conditions
...r maturity, maximum seed plant-1, while SA3-C3 resulted in a significant increase in yield and oil content. SA3 and SA4 showed substantial plasticity to maximum phenology parameters of C3, C4, and C5. Safflower treated with salicylic acid could adapt to wide range even though in the extreme weather and drought conditions in rainfed agriculture. Spineless safflower cultivars could be a future way forward as a potential parallel crop to ensure a sustainable sour...
Shereen Zulfikar1, Zulfikar Ahmed Maher2, Attaullah Khan Pathan4, Imran Ali Rajput3*, Din Muhammad Soomro1, Muhammad Akbar Lashari1, Arsalan Memon3, Sibghatullah5 and Mir Zehri Khan5
Population Fluctuation and Weight Losses Caused by Khapra Beetle, Trogoderma granarium Everts on Different Wheat Varieties
...s recommended for future plantations. The present study will be useful to provide the information for controlling T. granarium on wheat....
Iram Bilqees1, Yasir Iftikhar1, Mustansar Mubeen1,2*, Qaiser Shakeel3, Ashara Sajid1, Zahoor Hussain4, Aqleem Abbas2, Muhammad Aamir Sohail2, Judith Jeruto Kiptoo5 and Shehzad Iqbal2
Use of Nutrients and Plant Extract to Manage Okra Yellow Vein Mosaic Disease (OYVMD) in Sargodha, Punjab, Pakistan
... different nutrients and plant extract. Plant extract and multi-nutrients were used to manage the disease to avoid the hazardous effect of chemicals on human health and being the eco-friendly. Four varieties of okra viz., Indian Rachna, Sabz Pari, Desi Bhindi, and Rama Krishna were grown under RCBD. Five treatments viz., 2% garlic extract, 2% multi-nutrients, silicon (1 and 1.5%) s and water as control were applied. Sabz par...
Kanwar Muhammad Raheel Mehboob1, Rashid Iqbal2*, Muhammad Israr3,4, Jaweria Shamshad5, Umair Riaz6, Muhammad Habib-ur-Rahman7,8, Fawad Ali9, Arif Nawaz10, Maliha Sarfraz11, Abdul Waheed12, Muhammad Tahir Khan13 and Muhammad Aslam2
Assessment of the Consequences of Heat Changes on Cotton Cultivars Growth, Phenology and Yield at Different Sowing Regimes
... factor comprised of six planting dates (for example April15 and 30, 15 and 30 May, 14 and29 June) and other factor comprising of three Bt. cotton cultivars (BH-184, MNH-886 and CIM-598). The after effects of the test indicated that both sowing dates and cultivars fluctuated fundamentally for development, phenology and yield. Highst leaf area index (LAI) 4.38, total dry matter (TDM) 1033 g m-2, leaf area duration (LAD) 275.6 days and mean harvest development r...
Hafsa Naheed* and Hidayat-Ur-Rahman
Genotype by Environment Interactions of Vegetative Growth Traits of Bread Wheat Genotypes
...e recorded on leaf area, plant height, biological yield and straw yield. Highest plant height was recorded for G02, G31 and G11. The exotic lines included in the study generally had more plant height in Peshawar as compared to other locations. The highest maximum mean for leaf area was observed for G17 and CSA while minimum was observed for G03 followed by G33 and G25. Among the seven envi...
Malik Muhammad Yousaf1, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahmad1, Rao Wali Muhammad1, Sami Ullah2, Adeel Abbas3, Ijaz Ahmed4 and Muhammad Zeshan5
Effect of Balance Use of Fertilizers on Performance of Wheat Under Arid Climatic Condition
... significantly increased plant height and the highest plant height (86.5 cm) was observed at 86:58:62.5 kg NPK/ha treatment. Maximum tillers/plant (3.1), spikelet’s/plant (2.9), and spike length (8.9 cm) was found in 86-58-62.5-3 kg NPK + Zn/ha treatment. Furthermore, highest grains/spike (83.4), 1000 grain weight (4.3 g), and yield (6381 kg/ha) wa...
Talib Hussain Solangi1, Bhai Khan Solangi1*, Muhammad Saleem Sarki2, Muhammad Akbar Lashari1, Mubeena Pathan3, Velo Suthar4, Barkatullah Qureshi4, Mitha Khan6, Razzak Amin Shah5 and Aeman Afzal6
Varietal Preference of Sucking Insect Pests on Mustard Varieties, Sindh, Pakistan
...tion of 2.88±0.37/plant was monitored on mustard variety ‘S-9’; while highest population of 4.36±0.42/plant was recorded on variety ‘Bard-2’. Thrips showed that lowest thrips population of 7.30±1.81/plant was recorded on mustard variety ‘S-9’; while the highest population of 10.63±2.84/plant...
Safina Naz1, Syed Atif Hasan Naqvi2*, Bushra Siddique3, Muhammad Asif Zulfiqar4 and Abdur Rehman5
Exogenous Application of Selected Antioxidants and Phyto Development Directors Influenced the Development, Output and Biochemical Attributes of Tomato (Lycopersicum esculentum Mill.)
... to significantly taller plants and greater leaf area while, shorter plants and lower leaf area was recorded in control. Greater leaf number per plant was obtained with application of GA3(100 ppm). This was followed by salicylic acid (200 ppm). Leaf number was significantly lesser in the plants grown in control. Significantly greater fruit count /
Safina Naz1*, Muhammad Akbar Anjum1, Bushra Siddique2, Syed Atif Hasan Naqvi3*, Sajid Ali1, Hassan Sardar1, Sakeena Tul Ain Haider1, Muhammad Asif Zulfiqar4, Hajra Azeem3, Sibghat Ullah5, Shah Pasand6 and Zehri Khan5
Effect of Sewage Water Irrigation Frequency on Growth, Yield and Heavy Metals Accumulation of Tomato and Okra
...th the production of the plant biomass were increased considerably with more repetitive (interval of five days) application of the sewage water. While reasonably less repetitive application (interval of fifteen days) of sewage water cause the less production of biomass, yield and growth. Moderately less repetitive applications (interval of ten days) of sewage water showed a significant increase in the addressed attributes of production in okra. The yield, as w...
Arshad Ali Essani1, Bhai Khan Solangi1, Muhammad Ilyas Abro2, Sultan Ahmed3, Karim Bakhsh Sial3, Muhammad Saleem4, Ali Asghar Gola5, Ghulam Ali6, Moula Dad6, Mujeeb ur Rehman6, Habibullah Kakar6 and Mitha Khan6*
Comparative Efficacy of Botanical Pesticides against Sucking Insect Pests of Mustard Crop
...extract (22.00%) and akk plant extract (19.83). Neem seed extract showed higher efficacy (81.01%) against thrips population on mustard crop followed by neem oil (66.13%), tobacco extract (58.20%) and akk plant extract (53.12%). Maximum reduction in whitefly population (13.00%) was observed in plot sprayed with neem seed extract followed by plot sprayed with neem oil (10.33%), tobacco extract (9.50%) and akk
Malik Gul Hassan Awan, Shahzada Sohail Ijaz, Muhammad Ansar, Adeel Anwar, Umber Abbasi and Hashmat Mahmood
Influence of Foliar Application of Mineral Nutrients on Biological Nitrogen Fixation of Rainfed Soybean
...bers increased from 0.12 plant-1 without nutrients spray to 0.99 plant-1 with nutrients spray. Number of pods increased 7.5 % to 45% with foliar application of nutrients. The highest number of pods (74 per plant) was recorded for Ajmeri-1 with foliar application spray. Increase in biomass yield with foliar application of nutrients was 18 % to 112%. The highest biomass yield was 4.8 t ha-1 ...
Tabassum Yaseen1*, Shehzad Ahmad1, Khushnood Ur Rehman2, Fayaz Asad1, Abdul Waheed1, Rani Gul3, Hussain Gulab4 and Naveed Akhtar2
Arbuscular Mycorrhizal Fungal Spore Density and Root Colonization in Weeds of Carrot field at Charsadda, Pakistan
...biotic associations with plants through roots. It forms the multi colonization systems with the roots and provide benefits to the host plants. The present study was conducted to evaluate the occurrence and distributions of Arbuscular mycorrhizal fungi in the rhizospheric soil of major weeds of District Charsadda. In the present study roots and rhizospheric soil of 15 weeds species belonging to 12 families were collected from...
Rao Wali Muhammad1, Hafiz Muhammad Wasif Ali2*, Amir Hamza1, Muhammad Qadir Ahmad2, Abdul Qayyum2, Waqas Malik2 and Etrat Noor2
Estimation of Different Genetic Parameters in Various Safflower (Carthamus tinctorius L.) Genotypes under Field Condition
... i.e. days to flowering, plant height, days to maturity, no. of primary branches per plant, no. of secondary branches per plant, pods per plant, 1000-seed weight and yield per plant of 200 safflower accessions. Analysis of variance and principal component analysis were carried out to estimate the extent of variability ...
Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi3
GIS Applications in Surveying and Mapping of Rice Weeds in Guilan Province, Iran
...ant species with 9 and 8 plants/m2, respectively. Echinochloa crussgalli and C. difformis with a density of 5 plants/m2. Weeds were non-uniformly distributed in various families including Cyperaceae, Poaceae, Lythraceae, Polygonaceae, Asteraceae, and Salviniaceae that accounted for 36 species (54.5 percent). Accurate and specific weed maps are the key to achieving all the benefits of weed management. When in an area the dist...
Iram Sharif1*, Amna Nazir1, Eram Shahzadi2, Shahid Munir Chohan3 and Ghulam Sarwar4
Influence of Sowing Dates on Cotton Growth (Gossypium hirsutum), Yield and Fiber Quality
...results showed that late planting produced less yield due to shorter growing period. Among fiber quality parameters, length and strength were not affected significantly while micronaire was affected significantly....
Shahid Nadeem1*, Taj Naseeb Khan1, Mushtaq Ahmad1, Adnan Younis2 and Iram Fatima3
Influence of Plant Growth Regulators by Foliar Application on Vegetative and Floral physiognomies of Gladiolus
...osition among ornamental plants due to its captivating spikes, with plane ruffle and deeply crinkled sepals, and it mainly used as cut flower and greatly demanded in floral markets. In order to achieve the maximum outcomes for the purchaser or community, a comprehensive study was conducted on gladiolus to enhance its vegetative and floral characteristics with the foliar application of growth hormones i.e. gibberellic acid (GA3) and salicylic acid (SA). The res...
Attiq ur Rehman1,2*, Iftikhar Hussain Khalil3 and Ihtisham Ali4
Genetic Diversity and Traits Association in Tetraploid and Hexaploid Wheat Genotypes in Khyber Pakhtunkhwa Province of Pakistan
...aturity, flag leaf area, plant height, tillers m-2, spikes m-2, spikelets spike-1, 1000-grain weight, grain yield and harvest index. Among the genotypes for various study traits, statistically significant differences were observed. Except for the flag leaf area and days to maturity, durum vs. spring wheat contrast was significant for all other studied parameters. The flag leaf area of durum wheat was more than that of spring wheat and it took fewer days to ini...
Tahseen Ullah* and Noor ul Amin
In Vitro Antibacterial Activity of Medicinal Plant Extracts
...vities of four medicinal plants, Silybum marianum, Berberus lycium, Peganum harmala and Curcuma longa and standard antibiotic tetracycline was carried out in the biosafety level 3 Microbiology Lab, Faculty of Life Sciences, University of Bradford, Bradford, UK. Two different concentrations (low, 5 mg/ml and high extracts, 300 mg/ml) of these plants were evaluate against two different bacterial strains i.e. Bacillus subtilis ...
Shaiza Rasool1, Iftikhar Ahmad1*, Khurram Ziaf1, Irfan Afzal2, Muhammad A.S. Khan1, Muhammad Aashir Sajjad1 and Muhammad Zain Ali1
Seed Conditioning Effects on Germination Performance, Seedling Vigor and Flower Production of Zinnia elegans
...TW) produced the tallest plants (104 cm) with longer internodes and the largest canopy diameter (42.4 cm). Using MLE along with MTW produced greater plant fresh weight (137 g), more flowers (27.5), and larger flower diameter (9.7 cm) similar to the results of using MTW alone. In summary, seeds primed with MLE in combination with untreated water or MTW resulted in improved plant growth and ...
Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4
Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...stigate the best type of planting medium and suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, University of Swabi, Pakistan in the year 2019. Three bulb sizes of tuberose viz., large (2.5cm dia), medium (1.5cm dia) and small (1cm dia) were planted in three type of planting media viz., M1(Sandy soil+ Compost; 3:1; v/v), M2 (S...
Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4
Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...stigate the best type of planting medium and suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, University of Swabi, Pakistan in the year 2019. Three bulb sizes of tuberose viz., large (2.5cm dia), medium (1.5cm dia) and small (1cm dia) were planted in three type of planting media viz., M1(Sandy soil+ Compost; 3:1; v/v), M2 (S...
Sri Nuryani Hidayah Utami*, Andin Muhammad Abduh, Eko Hanudin and Benito Heru Purwanto
Study on the NPK Uptake and Growth of Rice under Two different Cropping Systems with different Doses of Organic Fertilizer in the Imogiri Subdistrict, Yogyakarta Province, Indonesia
...xt-align: justify;">Rice plants are commonly cultivated in a grid system with a plant spacing of 25 cm x 25 cm. The modification of spacing to increase nutrient uptake by providing plant free area (PFA) for better air circulation and sunlight distribution needs to be further studied. This study examined the differences in NPK uptake and rice growth in organic farming using the grid system ...
Malik Abdul Rehman1, Shafqat Ali1, Muhammad Babar Shahzad Afzal1, Muhammad Nawaz Khan1 and Mujahid Ali2*
Efficacy of Chemicals and Botanical Extracts to Control Citrus Canker on Kinnow in Sargodha Region
...cy of both chemicals and plant-based extracts to find suitable chemicals against the canker in Kinnow. The study was carried out at the citrus farm of the Citrus Research Institute, Sargodha, Punjab-Pakistan during 2011-13 on ten-year-old bearing trees of Kinnow plants. There were nine treatments, control (no chemical was applied), Neemsol @ 5 ml, copper oxychloride @ 3 g, streptomycin sulphate @ 1 g, potassium acetyl benzoi...
Muhammad Imran1,2*, Shahbaz Talib Sahi1, Muhammad Atiq1 and Amer Rasul3
Brown Leaf Spot: An Exacerbated Embryonic Disease of Rice: A Review
...iodegradable. The use of plant activators as another new strategy that activates the defense system of plants and reduces the disease. The plants which are scarce nutrients are more prone to disease as compared to nutrient deficient. The pathogen damage is compensating by a specific nutrient that reduces the disease through tolerance. Good management practices are those which include all p...
Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2
Description of Seven New Species and One New Record of Plant-Parasitic Nematodes (Nematoda: Tylenchida) Associated with Economically Important Crops of Kashmir Valley, Jammu and Kashmir (Part-1 of the series)
...g the survey of soil and plant-parasitic nematodes of vegetable and fruit crops of Kashmir valley, Jammu and Kashmir, seven new species and one new record of following species were recovered: Helicotylenchus siddiqii sp. nov. from soil around roots of Glycine max L. Miller, from Kashmir University Campus, Hazratbal, Srinagar, Kashmir; H. fotedariensis sp. nov. from soil around roots of Brassica oleraceae var. botrytis L. from Zadibal, Srinagar, Kashmir; H. har...
Mushtaq Ahmad Khan*, Abdul Basir and Beena Saeed
Biochar Improves Phenological and Physiological Attributes of Wheat in Soil Amended with Organic and Inorganic Nitrogen Sources
..., leaf area index (LAI), plant height, number of tillers and spikes m-2 when compared to control. Whereas, application of 150 kg N ha-1 as urea, FYM and PM, delayed booting, anthesis, physiological maturity in wheat and increased plant height and spikes m-2 of wheat. Similarly, 120 and 150 kg N ha-1 applied from PM, FYM and urea resulted in higher LA, LAI, tillers and spikes m-2 over control plots. Hence, application of 120 ...
Abida Parveen1, Sajid Aleem Khan1, Nazir Javed1, Anam Moosa1*, Khushboo Javaid1, Hina Safdar1 and Asma Safdar2
...ignificantly enhanced in plants treated with MO extracts, SK and their combinations compared to MI treated control plants. The total number of infective juveniles/g root and soil, galls, egg masses, females were highest in MI treated plants while lowest in plants treated with a combination of MI + SK + aqueous MO + ethanolic MO after 60 days of inoculati...
Oluwatoyin Adenike Fabiyi1*, Olubumi Atolani2 and Gabriel Ademola Olatunji3
Toxicity Effect of Eucalyptus globulus on Pratylenchus spp. of Zea mays
...ytochemical basis of the plant was partly established using Infrared (IR) spectroscopy, Gas Chromatography – Mass Spectrometry (GC-MS), proton and carbon-13 Nuclear Magnetic Resonance (1H-NMR and 13C NMR) Spectroscopy analysis. Effect of application of plant phytochemicals on the planted maize was also examined in terms of growth rate and survival of Pratylenchus spp. The essential o...
Saeed Ahmad1, Abdul Ghaffar1, Muhammad Habib ur Rahman1,3*, Tanveer-ul-Haq2, Mahmood Alam Khan4 and Arshad Mahmood5
Evaluation of Different Production Systems in Combination with Foliar Sulphur Application for Sunflower (Helianthus annuus L.) under Arid Climatic Conditions of Pakistan
...on systems (nursery transplanted and direct seeded) and sulphur foliar spray (0, 50, 100 and 150 ppm) on sunflower in a randomized complete block, with split plots arrangement. Results revealed that tallest plant (175 cm) with maximum number of leaves (32.7) recorded with the application of foliar sulphur spray (150 ppm). Similarly, sunflower produced maximum head diameter (18.0 cm), number of achenes per head (1510), 1000-a...
Safiullah1, Azmat Ali Awan2, Mohammad Ilyas3, Fahim Ullah Khan3, Arshad Iqbal3*, Muhammad Adil3 and Asad Ullah1
Effects of Different Concentrations of Naphthalene Acetic Acid on Rooting of Various Olive Varieties
...hes cutting-1 (4.89) and plant survival percentage (50.36%) were noted in cuttings treated with 3000 ppm of NAA solution. Regarding interaction both varieties and NAA concentrations showed significant results for all variables except days to root appearance, length of shoot (cm), shoot diameter (cm), branches cutting-1, and plant survival (%). It was concluded that the variety, Nocellara treated with 3000 ppm of NAA solution...
Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4
Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...) are important group of plant parasitic nematodes belong to genus Meloidogyne with extensive host range. A comprehensive survey study was carried out to document host and non-host plants in cultivated fields of Bagh district, Azad Jammu and Kashmir. Total of 111 vegetable fields from 82 locations of study areas was surveyed during summer 2013, 2014, 2016 and 2017. Okra, Eggplant, tomato, ...
Ammara Gull-E-Fareen1, 3, Imran Bodlah1*, Muhammad Tariq Rasheed1, Yasir Niaz2, Muhammad Adnan Bodlah2, Muhammad Asif4 and Nasir M. Khokhar5
...h aphids on various host plants in Pothwar. For this purpose, seven ant species were selected, identified as Camponotus compressus (Fabricius, 1787), Formica fusca Linnaeus, 1758, Formica clara Forel, 1886, Lepisiota frauenfeldi (Mayr, 1855), Myrmica aimonissabaudiae Menozzi, 1939, Tapinoma melanocephalum (Fabricius, 1793) and Tetraponera allaborans (Walker, 1859). A lot of surveys were conducted during 2015-17 ...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
... and an antagonistic plant, Azadirachta indica was tested against M. incognita on tomato. The antagonistic fungus and plant caused significant hatching inhibition and larval mortality of M. incognita. The hatching inhibition and mortality was the maximum at 100% concentrations of both the agents while the minimum inhibition and mortality was obtained at 25% concentration. No statistical difference wa...
Imtiaz Hussain1, Azhar Mahmood Aulakh2, Muhammad Sohail1*, Khalid Hussain2, Ansaar Ahmed3, Abdul Hamid3 and Muhammad Imtiaz3
Impact of Zero Tillage on Productivity of Traditional Mung Bean-Wheat Cropping System of Punjab, Pakistan
... fertility. Zero tillage planting method provides an opportunity to improve crop yield, reduce production cost and GHG emission. Farmer participatory field trials were carried out at six locations in Punjab province, a major Mung bean-Wheat cropping zone to evaluate zero tillage based crop production system in comparison to the traditional tillage. The findings revealed that zero tillage produced 13% and 9 % higher wheat and mung bean yield, correspondingly in...
Amir Aziz1*, Mukkram Ali Tahir1, Noor-us-Sabah1, Ghulam Sarwar1 and Sher Muhammad2
Effect of Rice and Wheat Straw and K-Silicate Application on Maize Growth
...ortant for the growth of plants particularly under stress. Silicon is considered as quasiessential element for plant growth. The benefits of silicate fertilization are often correlated with the amount of silicon uptake by plants. In order to evaluate the growth and yield behavior of maize crop in response to different source of Si (straw and potassium silicate), a pot experiment was conduc...
Zulekha Zameer, Samreen Mohsin, Ammarah Hasnain, Asma Maqbool* and Kauser Abdulla Malik
Influence of Explant Sources on in vitro Callogenesis and Regeneration in Maize (Zea mays L.)
... efficiency of various explants sources for maize tissue culture, especially the immature embryos. However, the manipulation of immature embryos as explants is hampered due to its unavailability throughout the year and low regeneration response. The present study is aimed to investigate the effect of various explants sources for callogenesis and regeneration in maize (Pioner 3025). The mai...
Malik Abdul Rehman1*, Hafiz Muhammad Ehsan2, Tehseen Ashraf2, Zulfiqar Ali Gurmani3, Sajjad Khan3 and Mujahid Ali2
Effect of Growing Media on Plant Growth of Rough Lemon (Citrus jambhiri Lush.) and Poncirus (Citrus trifoliata)
...rowth media to check for plant growth of rough lemon and poncirus rootstocks. Five plants per treatment were growing in black polythene bags filled with the required media using a Completely Randomized Design with three replications. Data of stem length stem diameter, number of leaves, leaf area, and survival percentage was recorded. Chemical analysis of leaf was done by taking samples from treatments were analyzed for deter...
Muhammad Yaseen1*, Muhammad Luqman1*, Zahoor Hussain2, Usman Saleem3, Asif Nawaz1, Tahir Munir Butt4 and Muhammad Umer Mehmood1
Assessment of Knowledge Level and Information Sources of Vegetable Growers regarding Tunnel Farming in District Sargodha
...satisfactory response. Replantation of nursery and distance between plants and rows of plants were also answered quite satisfactorily. Farmers do not know how to overcome the increasing attack of insects, pests, and diseases in tunnel farming. Some areas were identified, which require the attention of responsible authorities for the relevant knowledge....
Syeda Farzana Bibi* and Siraj ud Din
Unraveling the Bioherbicidal Potential, Elemental Analysis and Nutritional Evaluation of Crataeva adansonii Dc Leaf and Bark
...ritional analysis of the plant parts was also done to accentuate this plant’s use in the nutritional and agricultural industry. Elemental analysis of C. adansonii stem bark and leaf was assessed through atomic absorption spectrophotometry to detect ten essential macro and microelements, including Na, Ca, Co, Cd, Cu, Mn, Zn, Pb, Ni, and Fe. In the bark part, the highest percentage of relative standard deviation was obse...
Taqi Raza1*, Sergio de Los Santos Villalobos2, Muhammad Shehzad3, Shakeel Imran4 and Derly José Henriques da Silva5
PGP Characterization of Rhizobacteria Associated with Apple Gourd (Praecitrullus fistulosus L.)
...oorganisms which improve plant and soil health by enhancing nutrient availability and protecting plant against stresses. The current study was carried out to characterization of rhizobacteria associated with Apple Guard (Praecitrullus fistulous L.). Morphological, qualitative and quantitative tests were performed to characterize the PGPR abilities of isolated rhizobacteria. Lab study indicated that isolated bacterial strains...
Atef Mohamed El-Sagheer
Status of Phytonematodes in a Main Commercial Banana Production of Upper Egypt
...prominence value of some plant parasitic genera e.g., Meloidogyne in Abo-Teg and East Mangabad has the most prominence value (17.20 and 19.80) followed by Longidorus and Radopholus in Manfalot (17.20 and 15.36), respectively. The lowest prevalent genus was Heterodera which was absent in two surveyed localities viz., Abo-Teg and Assiut regions but present in Manfalot and East Mangabad with the prominence value 1.82 and 0.22 and population densities 43 and 11, r...
Taqiur Rahman1, Tabassum Yaseen1*, Ali Mujtaba Shah2, Samiullah3, Ghulam Jelani3, Gul Nawaz1,Qudratullah Kalwar2
...fy the leading medicinal plants used by local communities for the treatment of animals and document the threatened herbal knowledge from the elder formers (R1, R2 and R4) this study labels the ethno veterinary practices in different villages of District Shangla, where the documentation process is carried out through semi-structured questionnaires in 2017 (R1) where about seventy plant species belonging to different families ...
Muhammad Javaid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1, Mirza Abdul Qayyum1 and Muhammad Arslan Khan1
Role of Nanotechnology in Crop Protection and Production: A Review
...es to control pathogens, plant diseases and nanoherbicides for the management of weeds. It also facilitate in precision farming, targeted use of inputs i.e. nanofertilizers and to overcome the environmental stress seed treatments with nanoparticles, to improve the crop yield use of smart gene delivery system. This technology can also be useful for sustainable water use and irrigation water filtration. It also plays an important role in pollution reduction. Gre...
Muhammad Zeeshan Majeed1*, Muhammad Shahzad Akbar1, Muhammad Afzal1, Muhammad Mustaqeem2, Muhammad Luqman3, Ijaz Asghar4 and Muhammada Asam Riaz1
...l oils of ten indigenous plant species were evaluated for their insecticidal and repellency potential against the subterranean termite Odontotermes obesus Ramb, a destructive insect pest of wooden infrastructures, agricultural crops, orchards and forest plantations. Standard filter paper disc method was used for both toxicity and repellency bioassays according to completely randomized design. The response of termite w...
Muhammad Zeeshan Majeed1*, Muhammad Afzal1,Muhammad Asam Riaz1,Kanwer Shahzad Ahmed1, Muhammad Luqman2, Mehar Zubair Shehzad1, Muhammad Bilal Tayyab1, Mujahid Tanvir1 and Saadia Wahid1
... extracts (10%) of forty plant species were evaluated against Asian citrus psyllid (Diaphorina citri), armyworm (Spodoptera litura), house mosquito (Culex quinquefasciatus) and subterranean termite (Odontotermes obesus) using twig-dip, leaf-dip, aqueous exposure and filter paper-dip bioassay methods, respectively. Results revealed that the extracts of Mentha longifolia, Sonchus asper and Nerium indicum were the ...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mudssar Ali and Hasan Riaz
...ok like branches of host plants. The male and female mean longevity was 6.0 ± 1.171 and 11.4 ± 1.70 days. Pale reddish brown lines were present on the dorsal side of female forewings. Female forewings were broader than male wings with dark reddish brown thorax, head and abdomen. Adult hind wings were grayish with reddish brown outer margins. The biological and morphological information of Trilocha varians described in current paper will le...
Agustine Christela Melviana1, Rizkita Rachmi Esyanti1*, Roy Hendroko Setyobudi2, Maizirwan Mel3, Praptiningsih Gamawati Adinurani4 and Juris Burlakovs5
Gene Expression Related to Steviol Glycoside Synthesis Produced in Stevia rebaudiana (Bert.) Shoot Culture Induced with High Far-Red LED Light in TIS RITA® Bioreactor System
... hence a large number of plant source is required to supply the industry. To overcome the hindrances in the propagation of Stevia plants using in vivo methods, an alternative technique of propagation using in vitro methods is needed. The micropropagation method with the RITA® (Recipient for Automated Temporary Immersion System) is used in the production of a large amount of stevia biomass in approximately a short period....
Samia Ikram1*, Riaz ur Rehman1, Farwa Batool2 and Atyab Amjad3
Evaluation of Bird of Paradise for Commercial Flower Production by using Organic Manures
... sewage sludge). Maximum plant height (93.53 cm), Number of suckers (4.20), Number of leaves (8.00), Number of flowers (4.11), Stem diameter (5.025 cm) and Spike diameter (5.03 cm) were contributed by T2whereas maximum spike length (61.21 cm) was recorded in T3 and maximum shelf life (14.81 days) was noted in T4. The present research study revealed that T2 significantly contributes to commercial cut flower production of Bird of paradise in agro metrological co...
Mohammad Mohsin Faqeer1, Muhammad Aquil Siddiqui2*, Nighat Seema Soomro1, Shameem Raja3, Muhammad Tahir Khan2, Ghulam Shah Nizamani2, Fareen Deeba Soomro4 and Muhammad Mahran Aslam2
Impact of Row Spacing on the Growth and Yield Parameters of Lentil (Lens culinaris L) under Semi-arid Region of Pakistan
...hat maximum germination, plant height, number of branches plant-1, number of pods plant-1, weight of 1000 seeds, seed yield, and early days to maturity were observed at 30 cm row spacing. Interaction of varieties x row spacing indicated that NIA Masoor 2016 showed the best performance at 30 cm row spacing. This genotype exhibited highest germination (97.02 %), plan...
Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo
The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...ene resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transproteins toxic to different plant parasitic nematodes can be expressed into tissues and cells feed upon ...
Zubia Rahim1, Gulnaz Parveen1*, Salma Gul2 and Khushnood-ur-Rehman3
Ameliorating Effects of Salt Stress (KCl, NaCl) on Growth and Germination Parameters of Pearl Millet (Pennisetum americanum)
...ced factor to effect the plant growth. This research was performed to assess the effects of NaCl, KCl, a mixture of NaCl + KCl in various concentrations on the growth and germination of Pearl millet (Pennisetum americanum), locally named as Bajra. Five seeds sown in petri dishes to observe the radical, plumule length and germination percentage after treatments to 100, 150, 200 and 250mM concentration of above mentioned salts. Control petri dishes/ pots were ir...
Arifa Khan1*, Arsalan Bashir1, Shazia Erum2, Jabar Zaman Khan Khatak1 and Aish Muhammad3
Effects of 6-Benzylaminopurine and Indole-3-acetic Acid on Growth and Root Development of Banana Explants in Micropropagation
...ot induction of banana explants micro-propagated in vitro. Explants were obtained from young suckers of 8818-william, Pisang and Brazilian varieties. The explants were cultured in vitro containing MS media and different BAP and IAA combinations. The results showed banana varieties exhibited differences for the shoot and root development and also for the number of shoots and leaves. Wialliu...
Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman
Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
...cts in mills, processing plants and storage facilities where these products are stored. The residual efficacy of spinosad was assessed by exposing the Oryzeaphilus surinamensis, Tribolium castaneum and Trogoderma granarium to the treated commodities (wheat, maize, rice and oats) at concentrations of 0.25, 0.50 and 1 mg Kg-1 under laboratory conditions maintained at 28 ± 2oC, 65 ± 5% RH and continuous darkness. Seven bioassays were conducted by re...
Yonghua Liu*, Xianhua Li, Xiongfei Yan and Gang Li
...the effect of the 4 host plants Armeniaca vulgaris (apricot), Malus pumila (apple), Prunus salicina (plum), and Amygdalus persica (peach) on the growth, development, survival, reproduction, and life table parameters of A. fimbriana were studied. Different host plants had significant effects on the growth, development, and reproduction of A. fimbriana. The overall developmental durati...
Adeen Kiran1, Umar Farooq Gohar1*, Ayesha Farooq1, Malik Muhammad Asif2 and Hamid Mukhtar1
Redressal of Antibiotic Resistance using Plant Extracts
...hytochemicals present in plants and its ability to kill these pathogens and microbial inability to develop resistance against these pathogens. Therefore, the trend has been shifting from using synthetic or semi-synthetic antibiotics to the use of medicinal plants which are the part and parcel of traditional medicines. Thus, this review article explains the different mechanisms adopted by microbial life to develop resistance ...
Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Shehzadi Saima4, Muhammad Suhaib2, Muzammil Husain3, Haris Khurshid1 and Shahid Ali Khan1
Effect of Temporal Application of Gypsum on Mineral Uptake and Economically Important Morphometric Traits in Groundnut (Arachis hypogea L) under Rain-fed Conditions
...a), root biomass (9.03g/ plant), and nodules (382/ plant) were observed in treatment T3. The calcium concentration (0.80 %) in shoots of T3 was the highest. In the present study application of gypsum at the time of sowing and pegging was found to have a positive effect on grain yield and mineral concentration. We recommend that optimum doses of the gypsum should be applied to enhance groundnut yield....
Anjali Khadka1*, Subodh Raj Pandey2, Subarna Sharma Acharya3, Amrit Poudel4 and Sushma Adhikari1
Morphological Evaluation and Multivariate Analysis of Soybean Glycine max (L.) Merrill Genotypes in Western Mid-Hills of Nepal
...ight, internodal length, plant height, number of branches, number of grains, pod length at maturity, leaf area was positively correlated with grain yield while days to 50% flowering, days to maturity, number of trifoliate, number of pods and fresh weight of the pod were negatively correlated with grain yield. The path analysis depicts that the internodal length and days to maturity had the highest direct positive and negative effect on yield respectively. Thou...
Muhammad Ali Shah, Faiz Ur Rehman, Abbas Mehmood, Fareed Ullah, Sayed Irfan Shah and Syed Majid Rasheed*
Combining Ability, Heritability and Gene Action Assessment in Rapeseed (Brassica napus L.) for Yield and Yield Attributes
...000 seed weight and pods plant-1(PPP) were observed for those F1 hybrids where genotype 2702 was used as seed setter, i.e. 2702 × P1-119 and 2702 × DUNCLED. Higher broad-sense heritability and non-additive type of genetic variability indicated that it could be integrated as a valuable tool in breeding strategies to choose genotypes of B. napus L. for high yielding traits. ...
Ghulam Rabbani1, Uzma Javed1*, Javed Iqbal2, Ruqeah Mustafa3, Ghulam Shabbir2 and Fida Hassan Shah4
Barani Mash a Newly Developed Disease Resistant and High Yielding Mash Cultivar for Rainfed Areas of Punjab, Pakistan
... were number of pods per plant, number of primary branches per plant, yield per plant and 100-kernal weight. Based on desirable traits and higher yield, this line was approved with name of “Barani Mash” by the Punjab Seed Council for its cultivation on commercial level in rainfed areas of Punjab. “Barani Mash” will prove to be a good alternative of existing cultivar...
Muhammad Shahzad Akbar, Farrukh Sajjad, Muhammad Afzal, Muhammad Luqman, Muhammad Asam Riaz and Muhammad Zeeshan Majeed*
Field Evaluation of Promising Botanical Extracts, Plant Essential Oils and Differential Chemistry Insecticides against Subterranean Termites Odontotermes obesus (Isoptera: Termitidae)
...rops, forest and orchard plantations and wooden infrastructures. A wide range of persistent synthetic chemicals are employed to prevent and control the infestations of subterranean termites. Most of these chemicals have high mammalian toxicity and environmental hazards. This study was, therefore, aimed to evaluate the efficacy of some promising botanical extracts (Dodonaea viscosa, Gardenia jasminoides and Nerium indicum), plant...
Amjed Ali1, Rafi Qamar1*, Muhammad Ehsan Safdar1, Salman Saleem2, Sami Ullah3, Muhammad Arshad Javed4 and Syed Wasim Hasan5
Development and Growth: Influence of Sowing Dates on Performance of Cotton Cultivars
... fluctuation during crop planting is the leading hindrance in its production. Therefore, this one-year field experiment was performed to assess the result of varying cultivars and sowing dates on developmental and allometric traits of cotton (Gossypium hirsutum L.) under the agro-ecological conditions at Sargodha, Punjab, during Kharif season, 2015. The study consisted of i) three cultivars viz. Bt. FH-142, Bt. MNH-886 and FDH-170 and ii) three sowing dates vi...
Sajid Ali1, Abdul Basit1,3*, Abdul Mateen Khattak1, Syed Tanveer Shah1, Izhar Ullah2, Noor Alam Khan3, Imran Ahmad1, Kamran Rauf1, Salman Khan1, Irfan Ullah1 and Intizar Ahmad1
Managing the Growth and Flower Production of Zinnia (Zinnia elegans) through Benzyle Amino Purine (BAP) Application and Pinching
...11N5) generally act as a plant metabolite and growth retardant. It encourages the growth and cell division of dormant buds and bushiness of plant by reducing its height. Similarly, pinching of terminal branches increase the cytokinins and decrease auxin concentrations flourishing the axillary buds. A research study on the growth and production of zinnia flowers through application of BAP (25, 50, 75 and 100 mg L-1) and pinch...
Ali Zohaib1*, Habib Ullah2, Shakeel Ahmad Anjum2, Tahira Tabassum2, Muzzammil Hussain1, Mohsin Nawaz3, Ghulam Abbas4 and Sohail Irshad5
Effect of NPK Fertilization Strategies on Growth, Yield, Nutrient Use Efficiency and Economic Benefits of Relay Intercropped Wheat in Cotton
...d maximum improvement in plant height, fertile tillers, grains per spike, biological yield, grain yield and NUEA. Economic analysis also manifested that the greatest net returns and benefit cost ratio (BCR) were obtained by same NPK application timing (i.e. T4). In conclusion, fertilization timing substantially affected the yield, NUEA and economic benefits of relay intercropped wheat in cotton; and application of ½ N and all PK at sowing and ½ N...
Zohaib Ahmad Hassan1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Usman Saleem3, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz4, Khurshid Ahmad Mufti5 and Aamer Sattar2
Toxic Effects of Sodium Bicarbonate (NaHCO3) on Growth and Yield of Rice
...n, rice nursery was transplanted in all the pots. Various agronomical operations were carried out as per crop requirement. At maturity, rice was harvested from all pots. Various yield contributing components like plant height, fertile tillers, total biomass, straw and paddy yield were noted for all pots of the experiment. Statistical analysis of all collected data was accomplished. It was noted from the results that control ...
Bilal Pervaiz Khan1, Neelam Ara1, Shujaat Ali1,2*, Kamran Khurshid Baigh1 and Abdul Wahab1
Effect of Seed Priming on Radish with Different Nutrients at Various Soaking Durations
...emergence (9.1), tallest plant height (41 cm), yield of leaves plant-1 (14.4), leaf area (295.8 cm2), root length (20.6 cm), root weight in g (522.4) root diameter in cm (4.51), and total yield (23.8 tones ha-1) were obtained when seeds were soaked in DAP solution. In case of storage duration, The maximum germination percentage (82.5 %), survival percentage (84.4 %), plant height (43.7cm),...
Shawaiz Iqbal1*, Nadeem Iqbal2, Usama Bin Khalid1, Muhammad Usman Saleem1, Adila Iram1, Muhammad Rizwan1, Muhammad Sabar1 and Tahir Hussain Awan1
Growth, Yield and Economic Analysis of Dry-Seeded Basmati Rice
...o evaluate the different planting methods. Three dry-seeded rice (DSR) planting methods viz. (i) DSR-broadcast, (ii) DSR-drill, (iii) DSR-ridges were compared with the conventional transplanting (TR) method in lines having row to row and plant to plant distance of 22.5cm distance, and farmer trans...
Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3 and Waqas Raza1*
Influence of Resistance Inducers on Nitrogen, Phosphorus and Potassium Contents of Susceptible Chickpea Cultivars after Inoculation with Ascochyta rabiei
...f the disease. Normally, plants are stressed by different environmental confines may be weakened and susceptible to disease and these include nutrient scarce plants. Tissue contents of potassium, nitrogen, and phosphorus of above parts of the ground of plant in three cultivars of chickpea (‘C-44’, Bittle-98’ and ‘Pb-91’) after treatment with Bion® (acibenz...
Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Mushtaq Ahmad1, Muhammad Saleem2, Ali Aziz2, Irfan Rasool2, Zeshan Ali3 and Muhammad Amin2
An Update on Biology, Extent of Damage and Effective Management Strategies of Chickpea Pod Borer (Helicoverpa armigera)
...control measures (use of plant extracts, virus/bacteria based insecticides). In case of pod borer outbreaks, chemical insecticides remain as last option for farmers. However, management of chickpea pod borer through use of resistant cultivars, adopting recommended cultural practices and biological control measures have been found more effective, economical, sustainable and eco-friendly....
Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Sher Muhammad3, Usman Saleem4, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz5 and Aamer Sattar2
Impact of NaCl Toxicity on Yield and Yield Components of Rice (Oryza sativa) Grown in Aridisol
... free can be absorbed by plants. A pot study was performed to assess the poisonous impact of NaCl salinity on rice growth parameters. Selection of soil with customary characteristics was done. Various levels of salinity; < 4, 4, 6, 8, 10, 12 and 14 dS m-1 were established using NaCl salt. Soil was left for appropriate period for accomplishment of salinity. Completely randomized design (CRD) was used for layout of the experiment. Trans<...
Zaheer Ahmed Deho*, Saifullah Abro and Muhammad Rizwan
Assessment of Stability for Seed Cotton Yield of Cotton Genotypes Across Different Environmental Conditions of Sindh Province
...Sadori and CRIS-342 were planted under four different locations Tando Jam, Mirpurkhas, Sakrand and Ghotki environment conditions. Seed cotton yield data was recorded from each location and stability analysis (genotype x environment interaction) was performed. The pooled analysis of variance for seed cotton yield, showed highly significant (P< 0.05) differences for varieties, locations and varieties × location interaction. The analysis depicted the sig...
Muhammad Rizwan1*, Jehanzeb Farooq1, Muhammad Farooq1,2, Aqeel Sarwar4, Abid Ali3, Farrukh Ilahi1, Muhammad Asif1 and Ghulam Sarwar1
Quantitative Studies in Upland Cotton (Gossypium hirsutum L.) using Multivariate Techniques
...fifteen parameters viz., plant height (cms), days taken in 50% flowering, monopodia plant-1, sympodia plant-1, boll weight (g), No. of bolls plant-1, ginning out turn (%), lint index(g), seed index(g), 2.5 percent span length(mm), bundle strength(g/tex), micronaire (µg/in), fibre elongation (%), uniformity ratio and yield p...
Iqtidar Hussain*, Muzafar Ali, Imam Bakhsh and Muhammad Waqas Imam Malik
Effect of Different Levels of Naphthalene Acetic Acid at Various Phenological Stages of Hybrid Sorghum to Enhance Fodder Productivity
...dquo; was used as tested plant material. Four levels of NAA (40, 80, 120 and 160 ml ha-1) were kept in main plots, while three crop growth stages (seedling, tillering and booting) of sorghum were kept in sub-plots. The crop was sown in month of July, while a seed rate of 25 kg ha-1 was used with manual drill. The crop received irrigation at interval of 15 days whilst fertilizer was applied @ 120-90-60 kg NPK ha-1. Results revealed that levels of NAA affected s...
Abid Mahmood Alvi1*, Naeem Iqbal1,2, Javid Iqbal3, Kazam Ali4, Muhammad Shahid1, Waqar Jaleel5,6,7, Hafiz Azhar Ali Khan8 and Tiyyabah Khan8
Aamer Sharif1,*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2
...ional water vortex power plant is certainly one of such low head hydro turbines in which the potential energy of free surface flowing water is converted into kinetic energy through vortex turbine that tangentially passing the water into the basin, which forms a powerful water vortex. This study is the experimental analysis of novel runner which has the ability to maximize output power and efficiency. Computational fluid dynamic (CFD) is carried out on novel ru...
Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3
Application of Nanotechnology for Insect Pests Management: A Review
...ory” comprising of plants, algae, fungi, yeast, etc. which are consists of wide array of biomolecules. There is various size and shapes of nanoparticles to be synthesized by using the naturally occurring biomolecules. These biomolecules acting as a driving force for the designing of greener, safe and environmentally benign protocols for the synthesis of nanoparticles. Insect pests are main density dependent factors that deteriorate the quality and produc...
Inam Ullah1,2, WU Qing-Ming1*, Ruqia Bibi2 and Najam Un Nisa2
Comparison of Nesting Site Preferences and Breeding Ecology of Red-Vented Bulbul, Baya Weaver, and Grey Bush Chat in Sheikh Badin National Park Dera Ismail Khan, Pakistan
...ation between a bird and plant species is considered to be the central aspect of wildlife and biodiversity , which makes the nesting behavior a vital factor when investigating the life of birds. This study was conducted to know the trees used for nesting by avifauna species of Sheikh Badin National Park. The current study was conducted at Sheikh Badin National Park from October 2018 to September 2019 . Most birds’ breeding was observed from M...
Sabina Noor1*, Fatimah Abang1 and Hamady Dieng2
Biology of an Exotic Butterfly Acraea terpsicore (Linnaeus, 1758) (Nymphalidae: Heliconiinae), in a Newly Invaded Region, Sarawak, Borneo
...rded as the primary host plant of this species. Fecundity in a single cohort varied from 30 to 85 eggs, whereas eggs were oriented on the underside marginal areas of host plant leaves. The developmental time of A. terpsicore to complete its life cycle took an average of 30 ± 3.01 days with a total of five larval instars. The ontogenesis of larvae was accomplished without any disruption of diapause. The female adults w...
Luka Anthony*, Olugbenga Omotayo Alabi, Elizabeth Samuel Ebukiba and Vandi Gamba
...5), the quantity of seed planted (P<0.01), the volume of chemical applied (P<0.05), labour input (P<0.01), and contract farming (P<0.05). Quantity of fertilizer and expected price of output was negative and significant at (P<0.01), and (P<0.05) probability levels respectively. The coefficient of the multiple determinations (R2) in the production model was 0.51. This signifies that the explanatory variables included in the model acc...
Alam Zeb* and Amanullah Jan
...5) produced more: leaves plant-1 (243), leaves area plant-1(444.35cm2), branchesplant-1(9), plant height (198.51cm), and seed yield (1339kg ha-1), were recorded as compared with other sowing methods. It was also resulted from findings that N (180 kg ha-1) had significantly delayed flower a...
Tofique Ahmed Bhutto1, Mahmooda Buriro1, Niaz Ahmed Wahocho2, Safdar Ali Wahocho2, Muhammad Iqbal Jakhro3*, Zulfiqar Ali Abbasi1, Reema Vistro1, Fehmeeda Abbasi1, Sanam Kumbhar1, Fateh Muhammad Shawani4 and Nadar Hussain Khokhar5
Evaluation of Wheat Cultivars for Growth and Yield Traits under Agro-Ecological Condition of Tandojam
...emergence (m-2), tillers plant-1, plant height (cm) and biological yield (kg ha-1). However, TD-1 proved to superiority in yield-related contributes such as spike length (cm), spikelets spike-1, grains spike-1, 1000 grain weight (g), and grain yield (kg ha-1) under both seasons. Among all cultivars, Imdad-2005 revealed the lowest values for all the scored traits. Based on the finding of the current study, it is concluded tha...
Zafar Abbas1*, Shahzada Munawar Mehdi2, Muhammad Nasir3, Muhammad Ashraf4, Salma Kausar5, Nadeem Iqbal6, Muhammad Zahid Khan Nazar7, Iftikhar Ahmad3, Ghulam Murtaza1 and Ijaz Ahmad8
Evaluation of Best Dose of Micronutrients (Zinc, Iron and Boron) to Combat Malnutrition in Brinjal (Solanum melongena L.)
...(0.5%) exhibited maximum plant height, fruit weight, total yield, number of fuits plant-1 and survival percentage except number of leaves plant-1 which were maximum in T4 i.e. (100-60-50)+ ZnSO4 0.5%. Concludingly, growth parameters of all the theree cultivars of egg plant showed maximum performance i.e plant height (8...
Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz3, Abid Niaz2, Khurshid Ahmad Mufti4 and Muhammad Arif2
Deleterious Impact of Sodium Chloride (NaCl) Toxicity on Chemical Properties of Soil and Ionic Composition of Rice
... of the experiment. Transplantation of seedlings was performed in all pots. Application of mineral fertilizers @ recommended rates was done. Crop was grown till maturity and plant samples were collected from each pot for chemical analysis (Na and K). Soil samples were also collected from all treatment pots and subjected to laboratory for determination of various chemical properties (pH, EC and SAR). To calculate SAR values o...
Saba Aleem1*, Mehvish Tahir2, Iram Sharif3, Muqadas Aleem4, Muhammad Najeebullah2, Ali Nawaz1, Amina Batool1, Muhammad Imran Khan1 and Waheed Arshad1
Principal Component and Cluster Analyses as Tools in the Assessment of Genetic Diversity for Late Season Cauliflower Genotypes
...e genotypes. Traits i.e. plant weight, curd weight, curd yield, leaf length, plant height to extreme, and the number of leaves contributed significant positive component loading to these principal components (PCs). Biplot analysis among the first two PCs found the Casper RZ, AA Cauli-08, and Snow queen as diverse genotypes. Cluster analysis based on Euclidian distance grouped the genotypes into 3 distinct clusters. Some of t...
Hafiz Hammad Ahmad1, Mukkram Ali Tahir1*, Noor-us-Sabah1, Ghulam Sarwar1, Sher Muhammad2, Muhammad Aftab3, Muhammad Zeeshan Manzoor1 and Aneela Riaz4
Growth and Yield Response of Sunflower to Organic Amendments in Aridisol
..., dry biomass (25.73 g), plant height (110.90 cm), head size (21.36 cm), number of achene haed-1 (864) and achene yield plant-1 (32.16 g) of sunflower was observed with application of NK + Rock phosphate at 7 g pot-1 + Wheat straw at 28 g pot-1 (T6) in cultivar Hysun-33. While, lowest value of fresh biomass (72.73 g), dry biomass (15.72 g), head size (16.63 cm), achene head-1 (711), achene yield plan...
Muhammad Umair Hassan1, Muhammad Aamer1, Muhammad Nawaz2, Abdul Rehman3, Talha Aslam3, Ubaid Afzal4, Bilal Ahmad Shahzad3, Muhammad Ahsin Ayub5, Faryal Ahmed1, Ma Qiaoying1, Su Qitao1 and Huang Guoqin1*
Agronomic Bio-Fortification of Wheat to Combat Zinc Deficiency in Developing Countries
...ny irregularties in both plants and humans. The Zn deficiency considerably reduced the plant growth, tillers production, chlorophyll synthesis, and crop yield. Moreover, in the case of humans’ Zn deficiency causes blindness, lower intelligence quotient (IQ) levels, weaker immune system, and impaired physical and mental development. Wheat crop play a chief role in daily food requirement and calories need in developing c...
Ghulam Sarwar1, Amna Nazir1*, Muhammad Rizwan1, Eram Shahzadi2 and Abid Mahmood3
... loading of sympodia per plant and seed cotton yield. In PC-II, there was maximum positive factor loading of bolls per plant and GOT % while negative factor loading for CLCuV % and fiber length. A biplot between PC-I and PC-II showed that major contribution towards variability of fiber fineness and earliness traits among the studied genotypes. In cluster analysis, 25 genotypes were allocated in four clusters. Cluster-I was t...
Faiza Altaf1, Shamim Gul1,2*, Tasawar Ali Chandio3, Gul Bano Rehman1, Attiq-ur-Rehman Kakar4, Sami Ullah4, Naqeebullah Khan4, Umbreen Shaheen5, Muhammad Naeem Shahwani6, Muhammad Ajmal7 and Misbah Manzoor8
... increase in aboveground plant biomass of lettuce. These fertilizers also increased significantly water use efficiency by ~3.5 – 12.5 times (364.8% - 1166.6%) of tomato plants (as only tomato plants were analyzed for WUE). Furthermore, these amendments reduced concentration of heavy metals in plants of both crops. As compared to contaminated contro...
Muhammad Muhsin1, Muhammad Nawaz2, Imran Khan1, Muhammad Bilal Chattha3,Sadia Khan4, Muhammad Talha Aslam1, Muhammad Mahmood Iqbal5, Muhammad Zubair Amin6, Muhammad Ahsin Ayub7, Usman Anwar8, Muhammad Umair Hassan1 and Muhammad Umer Chattha1*
... and resulted in maximum plant height (81 cm), grains per spike (44.5), productive tillers (321.5), spike length (10.2 cm), 1000 grain weight (37.2 g), and grain yield (3.83 t ha-1) and maximum time to start emergence (11 days) and minimum plant height (60 cm), grains per spike (35.7), productive tillers (273), spike length (8.6 cm), 1000 grain weight (32 g), and grain yield (2.7 t ha-1) was recorded in...
Javeria Afzal, Muhammad Abid, Faisal Hussain* and Alia Abbas
... activities of different plants viz., Amaranthus viridis, Chenopodium album, Solanum nigrum, Carica papaya and Euphorbia hirta have been evaluated against root-knot nematodes. Plants were collected from different areas of Karachi. Aqueous extracts (2, 6 and 10%) of these five plant species were made for the experiment. All selected <...
Małgorzata Dzierzęcka1, Sławomir Paśko2, Marcin Komosa3, Karolina Barszcz1, Bartłomiej Jan Bartyzel1 and Ewa Czerniawska-Piątkowska4*
...ecise description of the plantar margin and the inclination of the parietal surface of the bone may contribute to a better understanding of the biomechanics and strength of the hoof, in particular in horses with higher body weights. The study material included coffin bones of the thoracic limb, isolated post-mortem from 39 cold-blood horses. The study employed a scanner projecting a hybrid set of images, consisting of sinusoidal stripes preceded by a Gray code...
Muhammad Mohsin Raza1*, Hera Gul2, Malik Muhammad Yousaf1, Sami Ullah3, Ghulam Sabir Hussain4, Mumtaz Hussain1, Jahangir Shah1, Bashir Ahmad1, Rao Wali Muhammad1, Ijaz Ahmad5 and Muhammad Zeshan6
...fy;">Effect of different planting patterns on the productivity of first ratoon of sugarcane genotype SPSG-394 was determined under field condition throughout the year 2017-18. Planting patterns under study comprised 100 cm spaced 30 cm wide single row ditches, 100 cm spaced 60 cm wide double row ditches, 100 cm spaced 90 cm wide triple row ditches, 100 cm spaced 100 x 100 cm, pits, 90 cm spaced single rows and 90 cm spaced d...
Muhammad Ayub1*, Munir Hussain2, Sher Ahmad2, Syed Arif Hussain Rizvi3, Shahid Hussain1, Muhammad Qasim2, Muhammad Din2, Muhammad Ishaque Mastoi4 and Tajudin2
Malik Muhammad Yousaf1*, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Jahangir Shah1, Rao Wali Muhammad1, Sami Ullah2,3, Hera Gul4, Ijaz Ahmad5 and Muhammad Zeshan6
...normal;">Among arid zone plant species, Jojoba (Simmondsia chinensis), being an evergreen, perennial, multi-stemmed, and multipurpose plant has attracted wide attention due to its economic value, potential by-products and ability to withstand vagaries of the desert environment. By realizing the economic importance of this high-value desert plant, a pioneer study on seed germination ...
Mashal Malik and Mudassar Nawaz Khan*
...cal growth parameters of plant height, total number of leaves, leaf width, leaf length and leaf weight, while line B29G11 revealed the lowest. The maximum plant height (128.03 cm) was found for line B20G16. A maximum number of 48 leaves with leaf width of 2.34 cm, leaf length of 3.34 cm leaf and leaf weight of 156.11 mg were recorded in line B20G16. The line B29G11 grew with the least plant
Wali Muhammad1*, Humayun Javed1, Munir Ahmad1 and Tariq Mukhtar2
...e infestation on brinjal plants sown at different times was at par at both the locations and was found slightly higher at farmer field. The maximum average fruit infestation (52.8 %) was observed at URF Koont on early sown crop (1st of March) while the minimum (46.3 %) was observed on crop sown on 20th of March. At Rawat, the maximum mature infestation (54.5%) was observed on late sown crop (30th of April) while the minimum mat...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
...esses are played role in plant adaptations to drought stress. However, antioxidant defense system and lipid peroxidation play a key role in drought tolerance. The current study was intended to investigate physiological adaptations for drought tolerance in different wheat varieties. Three weeks old seedlings of each wheat cultivar were challenged with drought stress by skipping irrigation. After the drought stress of two weeks, plant
Muneer Abbas1*, Dilbar Hussain2, Muhammad Saleem2, Abdul Ghaffar2, Sohail Abbas3, Niaz Hussain1 and Abdul Ghaffar1
... protein based baits, D= plant extracts and E= A+B+C+D were used during 2015-16. Data of % infested fallen fruits, total flies/trap, total flies captured/year, % fruit punctures, pupal population, % fruit infestation and market value of fruits was collected at regular intervals. Results indicated that when all the components were applied in a combined way they gave significant reduction of fruit losses. As a result of continuous sanitation practices the fruit ...
Ijaz Haider1*, Muhammad Akhtar1, Ali Noman2 and Muhammad Qasim3
... Pyralidae), whitebacked planthopper Sogatella furcifera (Horvath) (Homoptera: Delphacidae), and pink stem borer Sesamia inferens (Walker) (Lepidoptera: Noctuidae) on light trap. The effect of some abiotic factors like temperature, relative humidity and rainfall on the adult population of these pests was also studied. The population of these pests was monitored on the light trap from March to November from 2000 to 2014 in rice wheat cropping syst...
Muhammad Aman Ullah Khan1*, Muhammad Talha Aslam1, Abdul Rehman1, Muhammad Nawaz2, Muhammad Jahanzaib Khan1, Muhammad Ahsin Ayub3, Arbaz Ahmad Khan1, Muhammad Adil Rehman1, Bilal Ahmad Shahzad1, Sajid Hussain1, Muhammad Umair Hassan1 and Riaz Ahmad1
Saleem Maseeh Bhatti1*, Aslam Khan Gadehi1, Inayatullah Rajpar1, Muhammad Nawaz Kandhro2, Mukesh Kumar Soothar1 and Zohaib Ur Rehman Bughio1
...m-1). Spinach plants were irrigated with defined EC levels at 80% field capacity of a clay loam, non-saline soil. Results indicated that the growth and yield parameters of spinach genotypes were constantly decreased with an increase in EC levels of irrigation water. The plants irrigated with EC 6.0 and 8.0 dS m-1 had less fresh weight of leaves (> 30%) than the plant
Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Haris Khurshid1, Muzamil Hussain2 and Shahid Ali Khan1
...elation (-0.850 **) with plant width. Similarly, the trait of dry pods yield was in significant positive correlation (1.216**) with plant height, while was significant negatively correlated (-.850**) with number of branches. A strong positive direct effect was observed between twenty pods length (5.548), shelling percentage (4.630), 100-kernels weight (3.738), and leaflet length (2.950) with dry pods yield, indicating the im...
Ahmad Ur Rahman Saljoqi, Muhammad Salim* and Iftikhar Ahmad
...erla carnea @ 3 eggs plant-1,were applied three times. A total of 30 plants in each treatment were selected randomly for the data collection at 1, 2, 3, 6, 9 and 12 days intervals. Peak population of thrips (51.27 plant-1) was noticed during the last week of April. Results regarding different treatments showed that Emamectin was effective exhibiting minimum mean n...
Sana Khan1*, Faiza Aman1, Muhammad Ismaeel2, Zafar Ali2, Mehboob Alam1, Sadeed Iqbal1 and Taimur Khan3
...ers of randomly selected plants in each treatment and replication. Results showed that phosphorus levels significantly affected all growth parameters. Maximum absolute growth rate (3.31cm day-1), leaflets plant-1 (102.61), pods plant-1 (16.43), pod length (9.53 cm), root weight (4.67 g), nodules plant-1 (19.97)...
Faiza Aman1,*, Neelam Ara1 and Syed Mehar Ali Shah2
.... Highest number of pods plant-1 (37.67), hundred green seeds weight (57.33 g) and green pod yield (10.19 tons) was recorded for genotype UAP-47. Maximum pod length (9.87 cm), seeds pod-1 (9.33) and hundred green pods weight (583.00 g) was recorded for variety Green Gold. However, minimum pods plant-1 (15.00) was recorded for pea variety Rizwaan. The lowest pod length (3.57 cm) was displayed ...
Saba Shabeer1, Riffat Tahira2 and Atif Jamal3*
...genic species can attack plants at different stages causing considerable damage amounting to millions of rupees. One of the plant pathogenic fungi is Fusarium spp. Fusarium species are very well-known soil-inhabiting fungi that cause many economically important diseases of crops.Many species are included in the Fusarium genus, which are not only pathogenic to plant
Hafiz Hammad1, Mukkram Ali Tahir1, Noor-Us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Aneela Riaz3, Abid Niaz4 and Muhammad Arif4
...egarding P accumulation, plant P concentration, P uptake efficiency and PE ratio were recorded using standard procedures and obtained data was analyzed statistically with a statistical software Statistix 8.1 analysis of variance technique and significant of treatments was tested using LSD test at probability level of 5%. The maximum P accumulation (178.37 mg P pot-1), P uptake efficiency (1.90) and PE (phosphorus efficiency) ratio(747.15 g DM (g
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
...arch Institute (RRI) and plantation was carried out in one acre in barani condition. The area was laid down and plant to plant distance was 60 cm and row to row distance 90 cm kept in the research study area in RRI, NARC. The parameters of this experiment were included biomass production (BP) kg/ha, carrying capacity (CC) kg/ha and carbon stock (CS) kg C /ha after interval of 21, 45 and 60...
Kartika Noerwijati1*, Sholihin Sholihin1, Tinuk Sri Wahyuni1, Rohmad Budiono2, Nguyen Van Minh3, Roy Hendroko Setyobudi4, Zane Vincēviča-Gaile5 and Lulu Husna6
...ecause the F1 plants’ ability to form tubers was not optimal, and there were even plants that only produce roots. However, there were F1 plants which had higher tuber yields than the average yield of the check varieties. The harvest index in F1 population ranged from 0.25 to 0.96 with an average of 0.75. The analysis cluster based on fresh tuber yield...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
...gn. The data showed that plant height in centimeter, buds, flower, leaves and leaflets in numbers per plants with a range of 131.33 to 176.67 cm, 60 to 105, 41.5 to 60.0, 50.66 to 77.167 and 7.607 to 15.33, 30.33 to 82.0, respectively were significantly affected (P<0.05) by the interaction of selenium application in irrigation and foliar spray in relation to season. The effect was also significant (P<0.05) on some mine...
Muhammad Ihtisham1, Noor Amjad2, Muhammad Nauman3, Asghar Ali3, Khawar Riaz3, Muhammad Sajid3, Muhammad Owais Shahid*3
...gation. However, several plant species have water-impermeable hard seeds which take a long time to germinate. The hard seed coat can be scarified successfully through acid treatment. Sophora is a beautiful ornamental plant and its seeds have the same issue. In this experiment, seeds of Sophora secondiflora were treated with H2SO4 and then sown at different dates. Both H2SO4 scarification and sowing time had a significant eff...
Asima Batool1, Ghulam Abbas2*, Zuhair Hasnain3, Nasira Perveen4 and Muhammad Naeem Akhtar5
...inated maize seedlings / plants were placed in the glass fitted canopies, where canopy temperature was found 7-10°C higher than ambient temperature along with light reflection was enough for optimum photosynthesis. The plants were raised under heat stress environment for 15 days and harvested. Data regarding seedling parameters
Javaria Sherani1,2*, Muhammad Saleem Jilani1, Tanveer Ahmad2, Sohail Kamaran3, Abdul Manan2, Tehseen Ali Jilani2 and Mateen Sajid2
...has a great influence on plant growth and development, including fruit ripening. However, the presence of a cross-interaction between grafting and rootstock is often neglected. To explore cross-interaction between grafting and rootstock on different fruit yield and quality traits, we examined the scion-root interaction of four scion cultivars viz. Delhi White, Suffen, Karela and Mahmud Wali during March-April 2013-14. After the establishment of
Muhammad Nawaz Kandhro1*, Nadia Mangrio1, Aijaz Ahmed Soomro1, Zia-ul-Hassan Shah2, Ghulam Sughra Mangrio3, Nihaluddin Mari4, Zulfiqar Ali Abbasi1 and Shazia Parveen Tunio5
... application of suitable planting methods and NPK level play a major role in improving sugarcane yield and quality. Experiment was performed under field conditions at Sugarcane Research Institute, Tandojam, Sindh, Pakistan (located at 250 25.19 N 680 32.07 E) during 2016-17, repeated in 2017-18 and data was averaged. The sugarcane variety PSTJ-41 was used for this study. The experiment was laid out in spilt plot design. Main-plot consisted of
Md. Sabbir Ahamed1, Md. Rayhan Chowdhury1, Md. Atik Mas-ud1, Sujat Ahmed2, Md. Shahadat Hossain1 and Mohammad Nurul Matin1*
...t most traits including, plant height (PH), panicle length (PaL), leaf length (LL), leaf breath (LB), 100-grain weight (100-GW) as well as filled and unfilled grain per panicle (FGPa, UFGPa), and primary branch (PB) obtained significant variation in case of treatment. The genotypic variance (σ2g) obtained ma...
Haseeb Khattak1, Imran Ahmad1, Abdul Basit1*, Izhar Ullah1,2, Syed Tanveer Shah1, Humaira Wasila3, Inayat Ullah4, Intizar Ahmad1 and Noman Ahmad1
...ber of leaves and fruits plant-1, leaf area, fruit length, fruit diameter and total yield were observed under vertical gardening pattern. Data recorded for genotypes observed an increase in total yield and fruits plant-1 of Damaz while and increased number of leaves plant-1, leaf area, fruit diameter and length were observed by SCM-01. The interactive respo...
Umair Riaz1*, Shazia Iqbal2, Muhammad Irfan Sohail2, Tayyaba Samreen2, Muhammad Ashraf1, Fatima Akmal2, Ayesha Siddiqui3, Ijaz Ahmad4, Muhammad Naveed5, Naveed Iqbal Khan5 and Rao Masood Akhter6
...e medicinal and aromatic plants (MAPs) are current hot topic in the industries for their products. MAPs used in various items like pharmaceutical industry, health care items, cosmetics, organic food items etc. MAPs are gaining global admire and most of the pharmaceutical companies filing patents on medicinal plants and their derivatives and about 40% newly approved drugs during last two decades are formulated from natural or...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
... L.) is a rich source of plant protein. A number of diseases attack chickpea crop but wilt disease is the principle one. In mineral contents i.e. nitrogen, phosphorus, potassium, calcium, magnesium, sodium, zinc, iron and copper were decreased in chickpea plants affected with wilt disease. Leaves of three resistant and susceptible (un-inoculated and inoculated) chickpea lines/varieties were tested to find out their ionic sta...
Hafiz Imran Iqbal1*, Zahir Ahmad Zahir2, Obaidur Rehman1, Rizwan Khalid1*, Abdul Waheed1, Raja Abad Raza1, Shahid Saleem1, Muhammad Rashid1, Sarosh Tariq Alvi1 and Asia Munir1
...normal;">Growth of maize plant affect by saline stress conditions. Salt stress can be reduced through beneficial rhizobacteria that may increase the growth of plants. An experiment in pot was conducted to assess the effect of combined use of rhizobia and plant growth promoting rhizobacteria (PGPR) (containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase) on the growth and yield of mai...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
... consumed a diversity of plant species. Milk collected from Kilis had 15.27-16.10% total solids,5.70-6.50% fat and 4.80-5.10% protein. The lactose content did not differ significantly between milk samples from the two locations (3.90-4.20%). Total unsaturated fatty acid levels were significantly higher than total saturated fatty acid contents, irrespective of the lactation period (p<0.05). Milk from Hatay was high in saturated fatty acids, aromatic hydrocar...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
...that positively regulate plant growth and development that govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA
Praptiningsih Gamawati Adinurani1,*, Sri Rahayu1, Endang Dwi Purbajanti2, Devi Dwi Siskawardani3, Karina Stankeviča4 and Roy Hendroko Setyobudi5
...-height: normal;">Peanut plants use nitrogen sources from the atmosphere with the help of Rhizobium bacteria. Rhizobium was requiring P elements for root nodules formation. This study aims to determine the effects of the application of mycorrhizae at different levels that play an essential role in increasing P elemental uptake and rhizobia inoculants to improve N element fixation and root nodule formation. Rhizobia inoculant applications were allotted to main ...
Shehzadi Saima1, Maqsoda Perveen2, Muhammad Nawaz1, Khalid M. Ahmad1,* and Haider Sultan1
...evelopment and growth of plants. Therefore, the present study was planned to test the effects of potassium on Gladiolus by different treatment methods, and to find out which method is more promising. The corms of Gladiolus hybrid cv. yellow stone was used for plantation. Experiment was carried out in complete randomized design (CRD) with four replications and three fertilizer treatments (control, 2g/pot with side dressing, 2...
Saima Siddiqui1, Ghulam Hussain Abro1, Tajwar Sultana Syed 1, Abdul Sattar Buriro2, Sohail Ahmad3, Muhammad Zeeshan Majeed4 and Muhammad Asam Riaz4*
...ulation. The use of host-plant resistance is an alternative tool to control cotton insect-pests. The current research was aimed to identify the cotton physio-morphological marker to manage pressure of sucking pests such as jassid (Amrasca bigutulla bigutulla Ishida), thrips (Thrips tabaci Lind.) and whitefly (Bemisia tabaci Gen.) on cotton. To this end, the present research was conducted on various cotton varieties classified on the basis ...
Saira Batool1, Safdar Ali Shirazi1 and Syed Amer Mahmood2*
...om RUSLE technique. Tree plantation, check-dams and strip cropping can also reduce soil loss when implemented in critical areas highlighted in this research.
...
Uzma Ayaz1,* and Muhammad Fareed Khan2
...R x R space of 75 cm and plant to plant space of 20 to 25 cm. The average temperature was varying between 24.3°C (75.7°F) and 34.8°C (94.6°F) throughout the season with 112.8 mm (4.44”) of precipitation. By randomly selecting ten plants per plot data was recorded for various traits i.e. germination percentage, flower initiation days, full flowering days, f...
Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2
...of foliar application of plant growth regulators and plant extracts. Wheat genotypes (Triple dwarf-1, Aas-2011; Faisalabad- 2008) were exposed to critical drought stage. The plants were exposed to normal irrigation, application of bio stimulants like 2µM ABA, 10 mM SA, 15% MLE and 10% MBLE were applied at grain filling stage but skipping irrigation. Maximum growth related parameters ...
Ijaz Ahmad* and Bakhtiar Gul
...years. The maximum wheat plant height (38.1 and 39.4) was recorded in wheat, having no weeds competition during the year 2018 and 2019 respectively. Whereas, the minimum plant height (cm) 30.4 and 31.9 was recorded in wheat infested with Avena fatua and Silybum marianum. Due to the large leaf canopy of S. marianum, it is not possible for other species to sustain, because several broadleaf weeds are highly competitive and mak...
Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3, Waqas Raza1* and Mahmood Ahmad Randhawa4
...here is scary of data on plant amino acids after induction of resistance. Here we investigated the amino acid contents in induced and un-inoculated and invaded region after induction of resistance. The quantities of methionine, iso-leucine, leucine, tyrosine and phenylalanine contents in three (Pb-91, C-44 and Bittle-98) chickpea cultivars increased after induction and stress of A. rabiei and comparatively higher than induced unstressed <...
Khaliq Dad1, Muhammad Nawaz2*, Rumsha Hassan2, Kainat Javed2, Asma Shaheen2, Fengliang Zhao3, Muhammad Imran4, Syed Tansir Hussain Shah4, Muhammad Faraz Anwar5 and Muhammad Aurangzaib6
...growth and physiology of plants. The experiment was conducted to study the impacts of biochar on the growth and physiology of tomato grown in Cd contaminated soil and activity of biochar in the contaminated soil. In this study different treatments of Cd were applied in the presence of certain portion of biochar. The order of treatments was 0 mg Cd as control with biochar (12%), low Cd (10mg), high Cd (15mg), low cadmium + biochar (10mg+12%) and high cadmium + ...
Raza Ullah Khan1*, Ahmad Khan1, Mohammad Zameer Khan1, Fayyaz Hussain1, Zafar Islam2 and Muhammad Asad Hameed2
...e used to supplement the plant needs for nutrients by incorporation of humic substances along with commercial inorganic fertilizers. Though findings in this study showed KOH as cost effective extractant vis a vis NaOH. However, further characterization could not confirm it. The presence of hydrophobic and hydrophilic nature of sites could be utilized to develop slow release plant nutrients based on humic substances....
Saleem Maseeh Bhatti1*, Muhammad Aslam Panhwar1, Zohaib ur Rehman Bughio1, Muhammad Saleem Sarki1, Allah Wadhayo Gandahi1, and Niaz Ahmed Wahocho2
...nd sprayed to strawberry plants before flower initiation. A continual increase in number of leaves, number and weight of berries, fresh weight of strawberry plants, and Zn concentration in strawberry fruit was observed as a function of foliar application of zinc. Plants sprayed with 66 and 99 mg Zn L-1 had significantly more number of leaves (27.4 ± 1.14 and 29.9 ± 1.36) and ...
Ch. Muhammad Rafiq1, Qasim Raza1*, Awais Riaz1, Misbah Hanif2, Wajiha Saeed2, Shawaiz Iqbal1, Tahir Hussain Awan1, Syed Sultan Ali1 and Muhammad Sabar1
...s over conventional transplanting culture, however, poor crop establishment due to reduced germination in variable field conditions greatly hampers its large-scale adaption. To address subordinate germination issues, we investigated the effects of five salicylic acid (SA) concentrations (0, 75, 150, 225 and 300 ppm) on polyethylene glycol (PEG) induced drought stress conditions (0, -0.2, -0.4, -0.6 and -0.8 MPa). Highly significant (p < 0.01) effects of dro...
Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Naeem Iqbal3, Muhammad Idrees3, Muhammad Nawaz4, Muhammad Yasir Nawaz5, Muhammad Kashif Munir6, Ahmad Kamal1, Ehsan Ullah1, Muhammad Ahsan Jamil1, Yousuf Akram1, Tanveer Abbas1 and Muhammad Mohsin Aziz1
...ty of soil and growth of plant. The worms increase the biological decomposition of organic substrates by maintaining the aerobic conditions of the organic substrates. Experiments on earthworms and the vermicast production by different species are also included in review. The paper also reveals fitness or compatibility of different species of earthworms to ‘bioprocess’ variation in different forms of organic waste. The review also presents the basic...
Muhammad Junaid*, Musharaf Ahmad and Saifullah
... decreased the chance of plant survival to 68.06% while maximum (89.72%) number of plants survived for 1% amendments concentration. Significantly high number (87.22) of plants survived for green manure as compared to FYM with 78.47. C2 amended was found to be best with lowest (1.19) disease ratings. Significantly higher (i.e. 1.75 and 1.89) disease was observed for C1 and C3 amended soils....
Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2
...g the survey of soil and plant-parasitic nematodes of vegetable and fruit crops of Kashmir valley, Jammu and Kashmir, ten new species including two new genera of following were recovered: Fotedaronema kashmiriensis gen. n. sp. nov., from soil around roots of Pyrus communis L. from Sonamarg, Parasicagutter chitwoodi gen. n. sp. nov., from soil around roots of Pyrus malus L. in Pattan, Kochinema pahalgamiensis sp. nov., from soil around roots of Brassica olerace...
Celalettin Gözüaçık1, Ecevit Eyduran2 and Mohammad Masood Tariq3*
...the infected 675 alfalfa plants were evaluated with the objective to predict height of eggs laid by the alfalfa weevil at the plant stem from plant height, number of eggs per cluster, number of egg clusters at the plant stem, and location as potential predictors. In the prediction of height of eggs, CHAID (Chi-square Automatic Interaction Detection) and ...
Bushra Baig and Saeeda Yousaf*
...s along with a healthier plant growth. The highest yield of Okra (52 kg) and Potato (272 kg)and their plant growth was recorded in plots sprayed with mix-biopesticides. It is concluded that biopesticide from these two plants could be utilized for their efficacy against various pests of okra and potato. Keeping the environmentally friendly nature of these biopesticide, compared to synthetic...
Imran Ullah Khan*, Noor Ul Amin, Sayyed Hamad Ahmad Shah, Maqsood Khan, Shehzad Ahmad and Syed Aizaz Ali Shah
...ed on days to flowering, plant height (cm), number of leaves plant-1, leaf area (cm2), number of branches plant-1, number of flower plant-1, diameter of flower (cm), fresh flower weigh (g), flower stalk length (cm) and flower vase life. The above mentioned parameters are highly influenced by most of humic acid levels. The increment value were shown on hu...
Jabeen Farheen1,2*, Simeen Mansoor1 and Maria Abid1
...y using onion as a model plant. The study was designed in a complete randomized design where the grown onion roots were exposed to 0%, 0.001%, 0.01%, 0.1%, and 1% concentration of FCA for 120 hours for macroscopic and 36 h for microscopic evaluation. The onion root tips morpho-physiology was severely affected as the concentration of FCAs increased. The macroscopic analysis manifested that allura red had 95% broken-ended extremely thin and transparent root tips...
Umar Farooq1, Muhammad Akmal1, Qadeer Ahmad2, Zahid Akram2, Adnan Arshad3, Huma Qamar4*, Hafeez Ullah5, Muhammad Zubair4 and Muhammad Rizwan Khurshid4
... like number of pods per plant, plant height; seed yield per plant and improved the quality by increasing iron concentration in grains. The pH and electrical conductivity (EC), organic matter and NPK of the soil were also significantly affected through Fe-enriched organic amendments....
Fayaz Ahmad, Noorullah Khan, Farrukh Siyar Hamid, Abdul Waheed, M. Abbas Khan, Imtiaz Ahmad, Shamsul Islam, Basharat Hussain Shah, Sohail Aslam and Qamar uz Zaman
...hree replication and 100 plants per replication. Data were recorded on plant height (PH), number of branches per plant (NBP), number of leaves per plant (NLP), stem diameter (SD), main root length (MRL), root diameter (RD), number of lateral roots per plant (NLRP), dry shoot weight (DRW) and dry root weight (DRW)...
Mohammed Akinlabi Rufai1*, Abideen Akinkunmi Wahab2, Kamil Ayo Fasasi1, Quadri Olusegun Adeshina1 and Mary Tolulope Awotidebe1
...from the pot of a tomato plant in the botanical garden of Osun State University. Extraction of H. bacteriophora was done using decantation and centrifugation method of nematodes extraction. The five different concentrations of H. bacteriophora were made in distilled water (µg/l); one sample not treated with nematode was served as control. Biocidal efficacy was achieved by collecting soil samples, sterilized and kept into experimental plastic plates label...
Muhammad Nawaz1*, Muhammad Dawood1, Kainat Javaid1, Muhammad Imran2, Fengliang Zhao3, Shahzadi Saima4 and Syed Tansir Hussain Shah2
...ere may adversely affect plants and ultimately cause serious negative consequences on the development, growth and maturity of crops. In this regard, this study was conducted to examine the possible health effect of fluoride pollution in the form of sodium fluoride on the growth and physiological parameters of cotton plant. The cotton plants were grown in the pots. Six different concentrati...
Muhammad Afnan Rabbi, Iqtidar Hussain*, Ejaz Ahmed, Muhammad Saad and Aitezaz Ali Asad Shahani
...decade. Use of synthetic plant growth regulators with nitrogen supply seems to be fruitful in this regard. So, an experiment was designed to assess the effect of various doses of N and P2O5 with combination of exogenous application of naphthalene acetic acid levels in late sown wheat in agro climatic conditions of Dera Ismail Khan, KP., Pakistan. Data registered on agronomic parameters i.e. plant height (cm), spike weight (g...
Qaiser Shakeel1*, Rabia Tahir Bajwa1, Yasir Iftikhar2, Mustansar Mubeen2, Muhammad Luqman3, Waqas Ashraf1 and Ifrah Rashid4
...de extracts of different plants and fungicides were performed for determination of antifungal activity against Penicillium digitatum, a plant pathogenic fungi responsible for ginger soft rot. Petri dish were used to conduct bioassay through poisoned food technique with triplicates. The crude extract of all the plants showed a better inhibitory effects on the pathogen’s (P. digitatum)...
Tanweer Fatah Abro1, Asif Ali Kaloi1, Jay Kumar Sootaher1*, Piar Ali Shar1, Tarique Ahmed Baloch2, Tanveer Ali Soomro1, Muhammad Saleem Chang3, Kirshan Kumar Menghwar1 and Waqar Hussain Shah4
...ritability estimates for plant height (95.24%). The maximum heritability for sympodial branches plant-1 (85.30%) and seed index (82.02%) were exhibited by the F4 population CRIS-342 x IR-3701. The F4 population CRIS-342 x Neelum-121 manifested the highest heritability values for bolls plant-1 (90.81%) and boll weight (96.85%). For seed cotton yield plant...
Imtiaz Ahmed*, Naveed Ahmed, Abdul Waheed, Muhammad Abbass Khan, Noorullah Khan and Fayyaz Ahmed
...lications. There were 45 plants in each replication. The treatments comprises of two growing methods i.e. vertical growing method and horizontal method which was assigned to the main-plot and two direction of sowings i.e. east to west and north to south which were allotted to the sub-plot. The results of the experiments revealed significant variation among studied parameters. In case of growing methods, maximum vine length (4.55 m), number of leaves vine-1 (41...
Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sher Muhammad3, Muhammad Latif4, Ayesha Zafar1, Imran Shehzad1, Sarfraz Hussain5, Aneela Riaz6 and Abid Niaz2
...treatments. At maturity, plant samples of maize were collected from all pots. Laboratory analysis for collected plant samples was carried out. Data were statistically analyzed. Results indicated that treatment (T8) produce maximum nitrogen (3.27%), phosphorus (1.0%) and potassium (2.85%) concentration in shoots of maize plants. The same trend of improvement was noted for maximum nitrogen (...
Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1
...e was experienced by the plants during the curd development stage. Heat tolerance ability of the genotypes was assessed by their ability to curd induction and development at high temperature and also based on different physiological traits. Heat susceptible genotypes showed lengthened curd induction stage. Further, decrease in chlorophyll and osmoprotectants contents was also seen in heat susceptible genotypes. TSX-C40 was identified as most susceptible genoty...
Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sarfraz Hussain3, Ayesha Zafar1, Imran Shehzad1 and Aneela Riaz4
... before harvesting maize plants. Laboratory analysis for collected soil samples was carried out. Data were statistically analyzed. Results indicated that treatment (T8) produce maximum plant height (115.0 cm), biomass (64.34 g) and root length (27.083 cm) of maize. Organic matter content (1.78 %), phosphorus (16.67 ppm) and potassium (213.0 ppm) concentration in soil was also increased in this treatment....
Allah Bakhsh1, Attiq Akhtar1*, Fiaz Hussain1 and Shabbir Ahmed2
... of light and air in the plants, as a result of leaf removal, decreases the occurrence and severity of bunch rot to less than 5%.This method is extremely useful for maintaining grape quality and quantity without the use of chemicals to combat disease. As a result, this strategy is both environmentally and health-friendly. In Pakistan, we consider using leaf removal therapy to treat grape bunch rot disease because it is the least expensive....
Suman Bhattarai1*, Subodh Raj Pandey2, Jaya Prakash Dutta3, Meghnath Timalsena4 and Rajendra Bam5
...maintenance of flowering plants (p=0.057) have significant effect on honeybee productivity. Labour cost and migration cost had positive coefficient and significant relation at 1% level of significance with gross return whereas expenses on baiting materials had positive coefficient and significant relation at 5% level of significance with the gross return. Thirty-six percentage of total visit for foraging of honeybees was contributed by East Chitwan. The overal...
Mukkram Ali Tahir1, Noor-us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Abdul Moeez1, Muhammad Zeeshan Manzoor1 and Aneela Riaz3
...akistan. Silicon role in plant growth and especially strengthening of plant defence system is well documented particularly upon exposure to salt stress. Present research was performed using wheat variety Punjab-2011 with Randomized Complete Block Design (RCBD) under field conditions using three treatments and each replicated three times. Treatments were wheat florae were developed in plots having normal soil (EC= 2.32 dS/m) ...
Mukkram Ali Tahir1, Noor-Us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Abdul Moeez1, Humaira Ramzan1, Mudassar Hafeez1, Muhammad Zeeshan Manzoor1, Aneela Riaz3, Sher Muhammad4 and Muhammad Latif4
...a essential nutrient for plants; although it has shown to be beneficial for plant development. Crop production is seriously affected by salinity worldwide. This research was performed in the research zone of Department of Soil and Environmental Sciences during the summer, 2018 in College of Agriculture, University of Sargodha, Sargodha, Pakistan. In the present study growth response of rice under normal and saline soil condi...
Qudsia Nazir1, Muhammad Aftab1*, Ghulam Sarwar2, Aneela Riaz3, Sarfraz Hussain1, Ifra Saleem1, Amina Kalsom1, Noor-Us-Sabah2, Mukkram Ali Tahir2, Ateeq-ur-Rehman4 and Muhammad Arif1
...nt not only for animals, plants but for humans as well. Its importance cannot ignore for the plants to improve overall quality and yield. The overall physiology, quality and biochemical parameters also enhanced with optimum application of Zn. By keeping in mind, the facts, it was hypothesized that the use of ZnO (a cheap source of Zn) impregnated urea for rice may enhance grains (paddy) yield. Three types of urea were prepar...
Muhammad Rafique1, Inam Ul Haq1*, Humara Umar2, Muhammad Jan2 and Muhammad Azhar Iqbal2
...t past, mass scale olive plantation over an area of 10,000 acres was done in these parts of the country. So, in order to ensure the sustainability of olive orchard development in Pakistan, a research trial was conducted to improve the rooting ability of olive cuttings to strengthen the local olive nursery setup. A practical problem is that the commercial production of potentially important olive cultivars is limited by poor rooting. Therefore, this research wa...
Muhammad Ahsan1*, Aneela Ramzan1, Muhammad Nafees1, Adnan Younis2, Muhammad Amin1, Gulzar Akhtar3, Khansa Saleem1 and Azka Sabeeh1
...er (T0). There were four plants in each treatment with three replications which were arranged according to completely randomized design (CRD) under room temperature. The results showed that maximum fresh weight (g) was obtained in T4 (acetic acid), flower head diameter (mm) and flower color was ideal under T3 (salicylic acid). Maximum dry weight (g), highest flower freshness on 1st and 3rd day, minimum petal discoloration which leads to productive market accep...
Habiba ur Rehman, Muhammad Usman Ghazanfar and Waqas Raza
...33 cm), number of leaves/plant (6.33, 7.67 and 11.33), minimum disease incidence (12.33, 11.12 and 10.13 %), minimum disease severity (26.80, 24.67 and 11.37 %) and maximum plant survival (89.62, 94.35 and 98.37%) at 15, 30 and 45 days after treatment, respectively. The application of Success @ 6mM was also good but lowers than the Nativo. The poor performance and maximum disease incidence and disease severity were recorded ...
Amjed Ali1, Kamran Arooj1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Imran1,2, Muhammad Ehsan Safdar1, Muhammad Mohsin Amin1, Amir Aziz3 and Muhammad Fraz Ali4
...dex, leaf area duration, plant height (cm), number of pod bearing branches per plant, number of grains per pod,1000-grain weight (g), grain yield (kg ha-1), biological yield (kg ha-1) and harvest index (%) of mungbean were recorded by using standrd procedure. Results of experiment revealed that sowing date of 1st march and varity AZRI-2006 result in maximum leaf area index (3.43), leaf area duration (24.14),
Maqsood Ahmad1, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha2*, Faqir Hussain Anjum3, Sadia Afzal4, Muhammad Faran1, Fiaz Hussain3, Muhammad Talha Aslam1, Abdul Jabbar5, Muhammad Sultan Ali Bazmi5, Mahnoor Mehmood6 and Muhammad Umair Hassan1
...at significantly affects plant growth, development and final production. Similarly, suitable cultivar also plays an appreciable role in final productivity. Therefore, the present study was conducted to determine the effect of variable sowing dates and cultivars on the growth and productivity of mungbean. The study was conducted in RCBD with a split arrangement having three replications at Agronomic Research Area, University of Agriculture Faisalabad. The exper...
Khan Tamoor1*, Hafsa1 and Hanif Maryam2
...our indigenous medicinal plants viz., Ferula oopoda, Zataria multiflora, Achillea santolina and Nepeta cateria against Meloidogyne incognita at banana orchards of District Lasbela, Balochistan, Pakistan. Crude extracts, essential oils and fixed oil of these selected plants were tested separately. The crude extracts of Z. multiflora and F. oopoda showed higher mortality as compared to A. santolina and N. cateria. The results ...
Muhammad Iqbal1, Muhammad Mahmood Iqbal1*, Saghir Ahmad1, Athar Mahmood2, Muhammad Akram1, Hammad Husnain1, Muhammad Shahid1, Saeed Ahmad1, Ali Raza1, Ansar Hussain3, Allah Ditta Abid4, Qaisar Abbas5, Mussarrat Hussain5, Muhammad Akram6 and Muhammad Umair Hassan2
...n genotypes under varied planting times at cotton research institute, Multan during 2018 and 2019. The experiment was comprised of four cotton genotypes IUB-13, MNH-1016, MNH-1020 and MNH-1026 and eight different sowing times viz 1st March, 16th March, 1st April, 16th April, 1st May, 16th May, 1st June and 16th June. The experiment was performed in RCBD with split plot arrangement and was repeated thrice. Sowing times were placed in main plot and cultivars wer...
Fazal Subhan1,2, Abdul Malik1, Zia Ul Haq1 and Tariq Mahmood Khalil1,3*
... of cauliflower. Data on plant parameters were collected periodically and analyzed with statistical software (Statistix 10). The study indicated significant differences in yield and WUE. The highest yield 36.12 tons/ha was observed under CFI with 100% water application. Among the three furrow irrigation systems, AFI gave the highest WUE, while minimum WUE was associated with CFI. It can be concluded from this research study that AFI with full irrigation is the...
Rabia Iqbal and Muhammad Naeem *
...act of varying levels of plant based protein diets (15%, 20%, and 25% crude protein) prepared from cheaper plant proteins, to keep minimum use of fish meal, on growth performance, survival and production of hybrid fry (Labeo rohita♀ x Catla catla ♂). The hybrid fry of mean 1.05±0.08 g body weight and 4.36±0.40 cm mean length were acclimatized and transferred to 8 X 6 X 3 ft. hapas. Fry were fed with fish me...
Sajid Ali, Shahen Shah* and Muhammad Arif
...l processes of the wheat plant. Low Zn and Fe contents in soil and/or their low availabilities for plant uptake not only affect the final yield but also decrease their harvestable levels in the wheat grains. The research trials were conducted for two consecutive years (2016-17 and 2017-18) on the foliar supply of Zn and Fe to wheat at different growth stages in the Agronomy Research Farm, the University of Agriculture, Pesha...
Weenghar Ali Chandio1, Tajnees Pirzada1*, Abdul Majid2 and Farzana Rashid3
...d effects of HA on other plants....
Sagir Hussain*, Qamar Abbas, Abdur Razzaq and Sher Wali Khan
...d economically important plant parasitic nematode genus. During the present investigation of plant-parasitic nematode fauna from Gilgit-Baltistan, Pakistan, four cyst nematode species viz., Heterodera avenae Wollenweber, 1924; H. mani Mathews,1971; H. schachtii Schmidt, 1871 and H. zeae Koshy, Swarup and Sethi, 1971 were detected from all four districts....
Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1
... variation was found for plant height ranging from 36cm to 50cm, days to flowering range from 130 to 133 days), while 100 seed weight ranged from 36 to 86 g and plant biomass range from 50 to 199.5 g per plant. SDS-PAGE analyses of total seed storage protein resulted in a total of 18 polymorphic bands. Total genetic diversity on the basis of total seed storage protein analysis was 17.5%. I...
Shaista Shafi* and Amjad Farooq
...highlight the outcome of planting date on the emergence of aphids in different species of brassica at Agricultural College of Bahauddin Zakariya University Multan, Punjab (Pakistan) during 2014-2015 and 2015-2016. Four brassica species (B. carinata, B. rapa, B. napus and B. juncea) were seeded from October to November at different dates (Octo 20, Nov 05, Nov 20) in RCBD design (Randomized Complete Block Design) with standard cultivation procedures to detect th...
Tahseen Ullah* and Noorul Amin
...s an important medicinal plant. An investigation to find out the effect of rooting hormones and types of stem cutting on the rooting of Berberis (Berberis lycium L.) was conducted at Horticulture Research Institute, National Agriculture Research Centre, Islamabad, Pakistan during the year 2016-2018. The experiment was laid out in Complete Randomized Design, with two factors i.e. three different level of indole butyric acid (IBA 2000, IBA 4000 and IBA 6000 ppm)...
Gulnaz Parveen1*, Naila Mukhtar2, Shumaila Irum3 and Nain Bukhari4
...potato, carrot, okra, eggplant, turnip, cucumber, round gourd, cauliflower, and chilli. These losses result in about a 30% reduction in the yield of these vegetables. By reducing the post-harvest losses, it could be possible to overcome the need of food as the world population is in dare need of research relating to crop sustainability....
Hussan Ara Begum1, Muhammad Hamayun1, Noor Shad1, Waqar Khan3, Jawad Ahmad1, Muhammad Ezaz Hasan Khan2, David Aaron Jones2 and Kishwar Ali2*
...g economically important plants. The current study assesses the effects of UV radiation on germination, growth, chlorophyll content and fresh and dry weight of Brassica rapa L. and Eruca sativa L. Some seeds of Brassica rapa L. and Eruca sativa L. were placed in petri plates, and were exposed to UV light for 30, 60 and 120 mins daily. The source of UV light was a UV box having a UV Tube. The UV exposure on the seeds reduced the germination percentage in both s...
Shafaq Fatima1,*, Farkhanda Manzoor1, Humaira Amman1, Zakia Kanwal1, Asma Latif1, Zeeshan Ali2, Hamid Iqbal Gondal2, Sumera Sajjad1 and Raja Shahnawaz Janjua3
...n economically important plant source of n-3 polyunsaturated alpha-linolenic acid (ALA) which can be used as supplemental dietary lipid in fish feed particularly carps. In developing countries where fish oil is not an ingredient of fish feed due to its high cost, the addition of economical plant oils rich in n-3 PUFA in fish diet can remarkably improve its quality. The present study evaluated the effect of the addition of li...
Hesham M. Abd El Halim1, Maysa M. Hegazy1,2, Aishah Alatawi3, Imtiaz Ali Khan4 and Munawar Saleem Ahmad5*
...font-size: small;">Since plant extracts have long been known to be chitin inhibitor and agents for developmental arrest, chitinase genes and genes that are vital for starting the differentiation program of cells at discrete steps during development are major targets for biocide plant extracts. The current study evaluates the in vitro toxic effects of golden piller (Cupressus macrocarpa) and galangal (Alpinia offici...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Muhammad Umair Sial2, Naeem Iqbal2 and Shafqat Saeed2
...ae) are a large group of plants grown for landscape and medicinal purposes in various regions and also known for absorbing various toxic pollutants from the environment. Several insect pests like thrips, whiteflies, mealy bugs and caterpillars attack on these plants. Among them, leaf eating caterpillar, Trilocha varians (Lepidoptera: Bombycidae) is serious insect pest for these precious plant<...
Huma Qamar1, Mariam Hassan1, Muhammad Zubair1*, Adnan Arshad2, Muhammad Qusain Saeed3, Muhammad Umar3, Sundas Shahzad1, Tariq Mahmood1 and Muhammad Aftab1
...ighly significant except plant height. Correlation in plant’s height and branches, days required for flowering and days required for maturity was positive at genotypic as well as phenotypic levels. Correlation between numbers of branches and days required for flowering was positive, while negative association of branches’ number was observed with days required for maturity and the obtained yield of a
Sami Ul Haq1, Abid Hussain1*, Umair Riaz2, Muhammad Baqir Hussain1, Adnan Fareed1, Nabeel Ahmad Ikram3 and Fahim Nawaz3
...considerable increase in plant height (67.60%), chlorophyll b content (92.10%), stomatal conductance (158%) as well as shoot P content (50.25%) that ultimately increased the yield (80%) of sunflower plants grown in soil fertilized with 75 kg S kg ha-1 plus Compost (750 kg ha-1). The application of Compost is one of the effective strategies to enhance the availability of nutrients, including S, to obtain high quality and prod...
Ahmed A. Kheder
...ion including strawberry plants. SLRSV was detected and characterized using serological (DAS-ELISA), biological and molecular diagnostic techniques. Virus incidence was performed in different locations in five governorates during 2018-2020. Forty-one samples out of 693(5.94%) reacted positively to SLRSV. Specifically, the percentages of infection were 7.3, 6.7, 5.4, 5.16 and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia governorate...
Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*
...ediately weighed, and 10 plants were subsampled from each sample for morphological evaluation. Ten plants were weighed and separated into stem and leaves portion, subsequently weighed and analysed for dry matter (DM) content. The remaining samples were air dried, ground and analysed for chemical composition and in vitro digestibility (IVDMD) and in vitro gas production (IVGP). The results revealed large variability (P < 0...
Fahrauk Faramayuda1,2*, Totik Sri Mariani3, Elfahmi1,4 and Sukrasno1
...nsetin. The O. aristatus plant’s potential as traditional medicine is established, so it is necessary to produce its active compounds abundantly and to propagate purple and white-purple varieties of O. aristatus. A strategy that can be adopted to achieve plant tissue culture (callus induction). This research aim is to identify secondary metabolite in callus using thin layer chromatography (TLC). The profiling of ...
Muhammad Akhtar1, Muhammad Tariq Mahmood2*, Kaiser Latif Cheema1, Mushtaq Ahmad2, Muhammad Jahanzaib Khalid1, Amir Amin1, Javed Anwar Shah1, Zeeshan Qadeer1 and Zeshan Ali3
...ng higher number of pods plant-1, more root length and maximum grain weight were comparatively least susceptible to moisture stress along with higher yield potential. Results regarding drought indices also indicated that relatively higher DTE, less DSI and minimum yield reduction percentage were revealed by KK-10001, KK-10015, KK-10019 and Bhakkar-2011. Therefore, these advance lines possess best genetic constitution for moisture stress tolerance and may be ut...
Ain-ul-Abad Syed1*, Zaheer Ahmed Khan1, Shakeel Hussain Chattha1, Irfan Ahmed Shaikh2, Mian Noor Hussain Asghar Ali1, Zohaib ur Rehman Bughio3, Shahzad Hussain Dahri2 and Ghous Bakhsh Buriro4
...ght was used to meet the plants’ light requirements. The stock solution (a combination of water and nutrients) was used to feed the transplanted plants during hydroponic cultivation. On average, relative to water use under geoponic agriculture, the hydroponic model’s productivity was 97.42 percent. The growth efficiency of the hydroponic spinach crop was much higher than that o...
Asmaa A.M. Abd El-Ghani *; Ahmed B.M.; Abdel-Raouf A. ; Nagwa S. Ata* and H.A. Hussein
...n (non-cytotoxic) of the plant extract under study on MDBK cells was 0.1
mg/ml.The plan extract showed a significant antiviral effect against BHV-1 at
simultaneous treatment experiment. The virus titeration assay showed a marked decrease
from 105 TCID50/ml to 103 TCID50/ml in adsorption step simultaneouslly incubated
with Salvadora persica extract . In contrast, the plan extract didn’t show any activity
El-Dougdoug K.A.1, Sofy A.R.2, Rehab A. Dawoud3 and Korkar H.M.4
...herapy of virus infected plant materials is a new method for virus
eliminationbased on osmopreservation techniques. Osmotherapy wasapplied for
eliminationbanana bunchy top virus(BBTV) through preservation of shoot tips on
MS media containing high sucrose concentration at low temperature. Shoot tips and
subculture 1st of banana plantlets were preservedsuccessfully for 12 months ...
Mandour, A. M. 1, Abdel Maksoud, H. M. 2, Amal, A. Khalil 3 and Mohga, A. El-Tahlawey 4
...naturally infected maize plants at El-Monfia. These samples were checked
for virus presence using Indirect ELISA. A number of cultural practices were
evaluated as control measures against MDMV to minimize the virus
infection in maize crop.
...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef*
...>
BBTV in infected plants and banana aphid (P.nigronervosa) using specific primer
of DNA-1 for BBTV. The results showed that amplified PCR product with the
expected size 476 bp for both infected banana and aphid. PCR was used to detect
component 6 of BBTV-DNA using specific primer at expected size 813 bp.The
isolated component was cloned into PCR™-4-TOPO vector (3.956~kb) and were
transfor...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
...ed faba
bean plants exhibiting blotchy mottle,vein-clearing and deformation. BBMV was able
to infect limited host range ten out of thirty three tested plant species, and
cultivarsbelonging to six different families. It was transmitted mechanically and not
transmitted by seeds or aphids. The isolated virus was inactivated by 10 min exposure
to 95°C, but not at 97...
Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.
...rnamental species widely planted in Egypt. The
Phytoplasma associated witches‟-Broom has been detected on symptomatic hibiscus
plants. Samples of hibiscusleaves were collected from El Giza, Alexandria, Qlubia,El-
Fayom, and El-Mansouragovernoratesand analyzed for phytoplasma infection.The
collected hibiscus plants showed characteristic symp...
Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2
...y sub-cloned into binary plant expression vector PBI-121. HSV-2gD subunit-containing binary vector PBI 121 were transformed into Agrobacterium tumifaciens LBA 4404 strain for Agro-inoculation. Tomato plants were transferred into regeneration medium and genetically transformed with the HSV-2gD-PB21 binary vector through Agrobacterium co cultivation. Agro-inoculated tomato plants were tested...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1
...btained from common bean plants were collected from
Qaliobeya governorate, Egypt, and tested for Squash Leaf Curl Virus (SLCV) infection by
PCR using both degenerate and specific oligonucleotide primers. SLCV (bean isolate) was
transmitted from naturally infected common bean onto twenty two species and varieties
belonging to six different families i.e. Moraceae, Solanaeae, Cucurbitaceae,
Leguminoceae,...
Samah A. Mokbel, Ahmed K. El-Attar
... rays to produce healthy plantlets, the
hibiscus witches' broom phytoplasma was transmitted by grafting into healthy
hibiscus plants, the in vitro-infected hibiscus explants were exposed to gamma
radiation at different doses - 5 gray (Gy), 10Gy, 15Gy, 20Gy and 25 Gy- emitted
from cobalt 60 (60Co) for 30 minute. All applied doses resulted in p...
Samah A. Mokbel1, Ashraf A. Abd El-Mohsen2
...6%) of PLRV- or PVX-free plantlets was achieved with meristem tip excision (0.1-0.2mm) from thermo-treated tubers at (38ºC) with survival rate 96.6% or 83.3% respectively. DAS-ELISA method was applied to the tubers directly, in vitro cultures and young acclimatized plantlets to detect these viruses. After direct transplant of in vitro virus-free plant
Hanaa H. A. Gomaa1; Entsar A. A. Nassar2; K. A. El-Dougdoug3
...ert. These are important plants used for treatment of various liver diseases. All the studied genetic parameters showed variations among milk thistle and parent varieties (plant height, main branch, total branches, head flower, fruit yield per plant). Concentration and yield amount of seven detected silymarin compounds using HPLC showed wide variations among varieties. They ranged from 9.2...
Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed
...the OYDV infecting onion plants in
Egypt and to obtain OYDV-free plants from infected onions through tissue culture
techniques. To achieve our aim, the virus has been isolated from naturally infected onion
plants grown in five Egyptian Governorates, Gharbia, Qalyobia, Giza, Fayoum and Beni-
Suef then mechanically transmitted onto healthy onio...
K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2
... isolate-infected pepper plants confirmed by DAS-ELISA and isolated on
Chenopodium amaranticolor L. where gave chlorotic local lesions. Eleven potato cultivars
(Solanum tuberosum) mechanically inoculated with PVY isolate under greenhouse condition
were divided to three categories, resistant (Diamond, Execusa, Hermes and Valor), tolerant
(Sisi, Lady Balfor, Nikola, Ditta and Lady Rosetta), susceptible (Anabel and ...
Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2
...n the tissues of healthy plants, indicating the effect of the virus of these tissues.
...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1
... common bean
plants grown in Egypt. Symptomatic leaf samples were collected from bean fields
cultivated in different governorates and tested by PCR using Geminivirus degenerate
primers and Squash Leaf Curl Virus (SLCV) specific primers. All bean varieties grown in
surveyed governorates were found susceptible to Geminivirus infection and the dominant
Geminivirus affecting bean fields was SLCV. Percenta...
M. A. S. El-kady1; A. B. Badr2; Ahmed K. El-Attar1, Hoda M. A. Waziri1 and Kh. E. A. Saker1
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2
...of BSV.
...
A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2
...racters of infected bean plants. The thickness of
leaflet blades, palisade and spongy tissues were increased than the healthy plants. In
contrast the thickness of upper and lower epidermis layers were reduced. Also the
thickness of midrib zone was slightly reduced. Moreover, vascular tissues lost their
normal shape and arrangement as xylem arms. The most interesting finding, le...
Rehab A. Dawood1; Entsar A. Nassar2; and K.A. El-Dougdoug 3
...hs at 210C. All survival plantlets revealed viability and resumed growth on fresh medium within three weeks. PVY was eliminated from infected potato plants using osmotic potential (Osmotherapy) applied 50 , 60 and 70 gl -1 sucrose at 210C with 73 , 89 and 92 % respectively . In addition to production of microubers in vitro under osmotic potential 8.8 (50 gl-1); 8.2 (60 gl-1) and 6.2 (70 gl -1) number per 5
Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³
...rally infected faba bean plants growing in the experimental fields of Giza Agricultural Research Station showing mottle and distortion of leaves. The identity of the virus was confirmed biologically, serologically and by light and electron microscopy. It was found that BBMV reacted systemically with 12 species belonging to Fabaceae and locally with 2 species belonging to Chenopodiace. It was transmitted mechanically and by Sitona lineate. It was detected serol...
Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4
...ight and yield of squash plants....
Aly M. Abdel-Salam
... (Saccharum officinarum) plants in Giza and Assiut
governorates showing leaf symptoms of pronounced flecks or freckles and vein
banding which turn later to chlorotic and necrotic strips. Polymerase chain reaction
(PCR) utilizing degenerate primers for badnaviruses for the reverse trancriptase,
RT/RNase genome regions of ORF III detected the virus in infected sugarcane leaves
and in its vector Sacchari...
Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1
...m symptomless strawberry plants and identified with a specific antiserum (Loewe Biochemica GmbH) using Double Antibody Sandwich ELISA (DAS-ELISA). Virus survey was carried out during 2013 - 2014 in different locations on commercial strawberry fields. The percentages of infection were 3.7, 4.5, 15.7 and 20% in El-Behera, El-Kalubeia, El-Ismalia and El-Menofia respectively. SLRSV was transmitted either by Xiphinema americanumas nematode vector or mechanically fr...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1
...eased
tomato plants (Solanum lycopersycum L.), and to identify and classify the phytoplasma
involved. A detection of infected tomato plants, which showed symptoms of big bud,
witches'-broom and phyllody, in all regions of the screened governorates, reacted
positively when assayed by nested polymerase chain reactions (PCR) using universal
phytoplasma-specific primer ...
Samah A. Mokbel, Soad H. Taha, Mahmoud M. Abd-El Hamid, Ali H. Hamed
...oduce quality and health plantlets for rapid and large scale in vitro production....
M. A. Kararah1, Om-Hashem M. El-Banna1, Salwa N. Zein2 and Abd-Elrehiem, A.F.3
...ected
cowpea plants, showing mosaic and choloratic ring spot symptoms, which
had been grown in the experimental fields of Giza Agricultural Research
Experimental Station (A.R.E.S) in 2008. Identification studies based on host
range, symptomatology and seed transmission through cowpea and different
hosts belong to Fabaceae.The results indicated that the host range of the
virus was expanded ...
Arshad Abdulkhalq Yaseen1,2* and Mária Takácsné Hájos1
...ign: justify;">Improving plant quality and increasing the yield, using environmentally friendly products are essential for human health and environmental protection. This research was aimed to assess the possible role of moringa (Moringa oleifera) leaf extract (MLE) in improving some quality parameters of lettuce (Lactuca sativa L.) grown under plastic tunnel conditions. In this regard, three different lettuce varieties (May King, Kobak and Great Lakes) were g...
Maryam Yousaf1, Salman Ahmad1*, Romana Anjum2 and Muhammad Zeeshan Majeed3
...nching method. Untreated plants served as control. First disease symptoms appeared after seven days of inoculation and seedlings became wilted within 30 days post inoculation. Stems from wilted as well as control seedlings were cross sectioned to observe the histopathological modifications. Wilted cross sections represented the cell wall disintegration and disruption of the tissues along with the blockage in xylem and phloem vessels due to the tylone productio...
Megahed, A.A.1; Kh. A.El-Dougdoug2 and B.A. Othman2
...ormed by examination 915 plant samples from 149 fields in two seasons (2009/2010 and 2010/2011) symptomatology. During survey, 464 of naturally infected sugar beet plants showing distincted for one or more viruses were collected from 73 fields in season 2009/2010, while from 76 field, the total of examined plants were 451 through the second season (2010/2011), upon external symptoms. All s...
A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3
...s isolated from cucurbit plants growing in Eastern Province area in Saudi Arabia and characterized using reverse transcription-polymerase chain reaction (RT-PCR). The nucleotide sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the i...
Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2
... naturally infected rose plants collected from different rose farms in Taif, KSA exhibiting a wide range of foliar disease symptoms including necrotic spots, wavy lines, oak leaf pattern, leaf deformation, reduction in number and diameter of flowers , color breaking and necrotic spots on flower petals .The virus was biologically purified from single local lesion formed on Chenopodium quinoa. The isolated virus was identified on the basis of symptomatology, tra...
Badr, A. B. 1, Abou-zeid, A. A2. and Al-Naggar, A. M1.
...um tuberosum L.cv. cara) plants during the winter season at 2011 to investigation the abnormalities changes of potato leaflets and tubers infected with Potato virus Y. Anatomical features of terminal leaflets i.e. mean of thickness both, midrib zone, leaflet blade, upper epidermal layer, palisade and spongy tissues, length and width of protoxylem and metaxylem vessels were reduced. However, lower epidermal layer was increased. Stomatal characters i.e. number o...
Eman A. Ahmed1, Osama Y. shalaby2, Emad F. Dwidar2, Samah A. Mokbel1 and Ahmed K. El-Attar1
...that infection of tomato plants with phytoplasma led to an increase in stem diameter by 10.23% as well as greatly increase in measurements of the other stem components while the diameter of pith was decreased by 38.46%. This infection was led to an increase in the diameter of petiole by 109.2% and also the other components of flower petiole. At the same time, tomato leaves were greatly affected as a result of the infection with phytoplasma. The thickness of le...
Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3
...aturally infected tomato plants collected from Taif governorate, Saudia Arabia for the first time. Observed symptoms circumvented mosaic, curling, bronzing and/or purpling, chlorosis and necrotic spot on the leaves. Disease symptoms of infected fruits produced from inoculated healthy tomato seedling showing discoloration, faint concentric rings, necrotic and chlorotic spot on mature tomato fruits. The virus was biologically purified from a single local lesion ...
Ramy A. Qabel1; Tarek F. El-Arabi2; Adel A. Shoukry1; Hassan H. Elsebaay1; Abdel-Aziz F. El-Hamahmy1
...ul symbiosis with legume plants is governed by many factors. The foremost factor that could affect the rhizobia is bacteriophage infection. In this context, this study aimed to investigate the abundance of rhizobiophages in Egypt. Rhizobiophages were isolated from the rhizosphere of different legume plants. While no temperate phages were detected, two groups of phages were determined based on their virulence. Highly virulent...
Radwa M. Shafie 1 and Soha S. M. Mostafa2
...ctively in particular in plants treated with algal filtrates by mixed with virus inoculum immediately before inoculation. Spraying plants with the algal filtrates 24 hrs. before inoculation produced a higher inhibitory effect against BYMV than that obtained by spraying 24 hrs. after inoculation. The same trend of inhibition effect that was detected with algal biomass was lower than with filtrates. The indirect ELISA was carr...
Shahida Sabir1, Anwar Ali Shad1, Tariq Masood1*, Zafar Ali Shah1, Nasiruddin2, Yaseen Ahmad1 and Syed Sartaj Alam3
...emented with a medicinal plant (Berberis lycium L) was documented on days to 50% colonization, days to 100% colonization, yield per bag and % bio-efficacy of Pleurotus eryngii. It was found that maximum 20 and 34 days were taken by 50% and 100% colonization, respectively on 25% supplemented B. lycium substrate compared to control treatment (17 days). The yield and bio-efficacy of mushroom was observed around 596.7 g per bag and 99% respectively at 25% suppleme...
Salama M. El-Saghir1, 2
...rus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence o...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...dicator (Vollka marina ) plants. The Phytoplasma was
transmitted from naturally infected Lemon (Citrus limon) to healthy periwinkle (Catharanthus roseus)
by dodder (Cuscuta reflexa Roxb) and Lemon (Vollka marina) plants by eye bud grafting.
Cytopathological detection referred to Diene's stain was used to differentiate the phloem tissues of leaf
petiole sections from infected tr...
Maha A. El-Abhar1, Moustafa A. Elkady1, Khaled M. Ghanem2, Hussieny A. Bosila3
...ange among weed and crop plants which produces a variety of symptoms. It can cause problems in potato
in some regions where vectors easily move into potato fields from reservoir host, particularly if a tuber
necrosis-causing strain is involved.
Objective: : The purpose of this study is to characterize biologically and serologically AMV infecting
potato (Solanum tuberosum L.) in Egypt. Moreover, the study describe...
Asma Kaouachi1, Mohcen Menaa1*, Abderraouf Chouaib Rebbah2 and Mohamed Cherif Maazi1
...eason). We identified 16 plant species of which four were recorded through on-site observations and 12 species were collected from bird crops. The biomass contained in the alimentary tract showed that fruits dominated the bird diet but the proportion of food items varied among seasons reflecting their seasonal availability in the study area. The pattern of seasonal variation of the diet was similar to most studies on wood pigeon diet. During the autumn and the...
Mohsen M. Elsharkawy1, Salem H. Homayed1, Mohamed M. Elsawy2 and Amr A. Khedr1
...asion of CMV in cucumber plants.
Methods: The fan was operated two times per day (8:00 am and 18:00 pm, each time for 30 min).
Moreover, cucumber plants were treated with cell free filtrate (CF) of GF 19-1 at 1 day before virus
inoculation.
Results: The wind velocity (2.6 m/s) resulted in decreased virus severity and titer compared with the
control. However, the pot...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...ptomatic infected potato plants during growing seasons for
the cultivated commercial local tuber seeds using Double Antibody Sandwich-Enzyme Linked
Immuno-Sorbent Assay (DAS-ELISA). The PVM was mechanically isolated on potato cv. Diamant.
Host range was carried out by mechanical inoculation of PVM on a set of different plant species.
Electron Microscopy was used to examine the ...
Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2
... of aromatic and medical plants. In March 2016, several symptoms of leaf
necrosis, bright yellow mosaic and malformation of leaves suggested viral infection of AMV on
basil plants grown in Beni Suef governorate.
Objectives: The present study aimed to characterize the virus at the molecular level and
described the ultrastructural changes or other histopathological alterations in...
Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2
...al commercial ornamental plants, leads to serious economic losses all over the world. During
2017-2018, gazania showing phyllody, yellowing, proliferation, virescence and little leaf symptoms
was observed Giza, Egypt.
Objective: The current work aims the detection and molecular identification of phytoplasma infecting
Gazania in Egypt.
Methods: Phytoplasma disease was detected and isolated from natural...
Ahmed M. Soliman
...he largest host range of plants.
Aim: The present study was conducted to identify four Saudi CMV isolates (cucumber, tomato, pepper and watermelon) using biological, serological and molecular assays.
Methods: Survey of some vegetable crops exhibiting mosaic, yellowing, blisters, shoestring leaf, mottling and stunting in different regions of Al-Ahsaa at Eastern Province in Saudi Arabia was conducted during the spring of 2016 and 2017. Th...
Mohsen M. Elsharkawy1, Sara E. Hanbal2, Samir A. Sidaros1, Mohamed M. Elsawy2, Ali H. Hamed2
...re the efficiency of the plant growth promoting fungi (PGPF) of Penicillium simplicissmum GP17-2, Fusarium equiseti GF19-1 and Trichoderma asperellum SKT1 as a sustainable method to control the invasion of BYMV in faba bean plants.
Methods: Faba bean plants were treated with PGPF isolates at 2 days prior to BYMV inoculation. Disease severity and virus titer were estimated at 1,...
Shimaa A. Khalaf1 , Mohsen M. Elsharkawy2, Samir A. Sidaros2, Shawky A. El Kewey2, Ayman F. Omar2, Ali Hamed1
...ring positive effects on plant growth and health..
Objective: The aim of this study is to evaluate the effects of GU23-3 on cucumber growth and resistance against PRSV..
Methods: Disease severity and virus titer were evaluated in cucumber plants treated with barley grain (BGI) or culture filtrate (CF) of GU23-3 under greenhouse conditions. Additionally, the expression levels of defense genes were asse...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...rapevine and pelargonium plants and detected
using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA). Host range study
was carried out using mechanical inoculation into fourteen different diagnostic host plant species and
cultivars belonging to 6 families. Tomato seeds were treated with four different concentration of
NaN3and EMS (1.0, 2.0, 3.0 and 4.0 mM) ...
Tahsin S. Shoala1, Ahmed K. El-Attar2, Ahmed I. Abd El Maksoud3
...Methods: Infected potato plants (Solanum tuberosum L. var. slany) were externally sterilized
and cultured in Murashige and Skoog media (MS media). Four weeks later, potato plants were
tested for PLRV using RT-PCR technique, and all of the plants were PLRV positive. MS
media were prepared, autoclaved, and active natural materials (Glycyrrhizic acid ammoni...
Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder
...n to occur in sugar beet plants in Egypt and may
produce severe damage to infected plants. However, studies on the effect of the CMV on the cellular
and internal structures of sugar beet leaves were rare.
Methods: The CMV was isolated from sugar beet samples collected during November 2018 from the
Fayoum governorate, exhibited symptoms of mosaic and leaf malformation. Detection...
Gulnaz Ismaylova
...ng of existing and newly planted mulberry orchards was carried out. Orosanga japonica first recorded on Morus sp. in the Sheki-Zagatala region located in the northwest, and then in the Khachmaz region, located in the northeast of Azerbaijan. Representatives of this family have not yet been registered in Azerbaijan. Besides of mulberry, the pest was registered in 11 more plant species. The article provides information on the ...
Anila Kousar, Muhammad Naeem*, Samrah Masud, Abir Ishtiaq, Zara Naeem and Rabia Iqbal
...0%CP, 25%CP) composed of plant protein ingredients, on elemental concentration in Genetically Improved Farmed Tilapia (GIFT) fingerlings, a developed strain of Nile tilapia (Oreochromis niloticus). Feed preparation criteria was based on cost effectiveness and local availability of cheaper plant protein feed ingredients. Ten specimens were randomly selected from each treatment hapa for evaluating the concentrations of selecte...
Bakhtiar Gul*, Saleetha Rabial and Haroon Khan
... duckweed mortality (%), plant growth, root length, frond diameter, growth of microscopic algae and macrophytes associated with duckweed, and water surface coverage (%). Results revealed that herbicides had a significant effect on duckweed fresh biomass, budding % and water surface coverage. Minimum fresh biomass (2.98 g pot-1), budding (24 %) and water surface coverage (14.67 %) were recorded for glyphosate as compared to weedy check (4.45 g pot-1, 58.7 % and...
Ayesha Manzoor1, Muhammad Saqib Naveed1, Sayed Rashad Ali1, Danish Ibrar2, Sairah Syed1, Sharmin Ashraf1 and Rafiq Ahmed1*
...ect of steckling size on plant growth and seed yield of radish.Steckling of different lengths (5cm, 10cm, 15cm) and width (4.9cm, 6.3cm, 8cm) along with random size steckling and control treatment (full size steckling) were planted and evaluated for different vegetative and reproductive parameters. Results showed that control (T1) and random sizesteckling(T2) improved plant growth by incre...
Iftikhar ud Din* and Yousaf Hayat
...ated responses yield and plant height. Data on two parameters (say plant height and yield) are simulated with varying magnitude (low, moderate, and high) of correlation coefficient between the two response variables. The comparative analysis of MANOVA and ANOVA reveals that even a small amount of correlation between the dependent variables creates huge change on the status of main effect and interaction of the three independ...
Muhammad Rafique1, Muhammad Azhar Iqbal2, Inam Ul Haq1*, Muhammad Ramzan Anser2, Humara Umar2 and Muhammad Ashraf Sumrah2
...ns. The demand for local plants is increasing and no scientific study has been previously carried out to standardize propagation technology concerning optimization of light intensity under greenhouse conditions. The current study was conducted at Izhar farms (Pvt.) Ltd. under the collaboration with Barani Agricultural Research Institute (BARI) Chakwal to find out the appropriate light intensity for successful olive propagation under greenhouse conditions. The ...
Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2
...a mixture of all 3 herbs/plants at 2ml/L; mixed with distilled water and another with citric acid. The dressing percentage was observed significantly (P < 0.05) higher in compound II supplementary group F and lowest in control group A. Whereas, the fat pad percentage recorded significantly (P < 0.05) lowest in the compound II supplementary group F and highest in control group A. The relative weight of organs; liver, pancreas, spleen, heart, duodenum, jej...
Hassan Shahzad Khan1, Muhammad Tariq1*, Tariq Mukhtar2 and Asim Gulzar1
...y, the toxicity of eight plant extracts and their green synthesized nanoparticles was evaluated against A. albopictus. The maximum mortality of 88% of 3rd instar larvae of A. albopictus was caused by datura extract followed by neem and clove. On the other hand, neem and clove extracts caused the maximum mortality (80%) of 4th instar larvae followed by datura extract (78%). Similarly, the minimum mortalities of 3r...
Haroon Ur Rashid1*, Nazia Tahir2, Muhammad Zamin3, Naveed Shehzad4, Aman Ullah2, Bibi Zainub5 and Farooq Azam6
...eed management in spring planted maize at Agricultural Research Station, Swabi (KP), Pakistan during spring both years 2014 and 2015. The experiment was laid out at silt loam soil in Randomized Complete Block Design (RCBD) with a split plot arrangement having three (03) replications. Different tillage regimes namely minimum, conventional, and deep tillage regimes were assigned to main plots (Factor A) and various allelopathic plant
Muhammad Jan1*, Muhammad Ashraf Sumrah1, Shoaib Akhtar1, Inam Ul Haq2, Muhammad Ramzan Anser1 and Iqra Yasmin1
...live. In Pakistan, olive plantation is an initiative to minimize the Olive import, and to maximize olive plantation in Pothwar area as well as control climate change. There is no trend for fertilizer application among the Pakistani farmers. The increasing demand of olive oil and value added products like pickles jams and squash enforcing the farmer to produce more and more. The increasing demand creates the competition among...
Pengfei Liu*, Xuexue Qin and Fei Shang
...t preference for nesting plants between the two species. However, the nest predation rate and breeding success were not different significantly. Our study suggested that the space segregation of nesting site contribute to the extensive stable coexistence of these two species.
...
Fahrauk Faramayuda1,2*, Totik Sri Mariani3, Elfahmi1,4 and Sukrasno1
...The cat’s whiskers plant (Orthosiphon aristatus Blume Miq) is empirically used in Indonesia, Malaysia, Australia, and Southern Asia as an antibacterial, antidiabetic, antihypertensive anti-inflammatory. The country of Indonesia has three varieties of O. aristatus, namely purple, white-purple and white. The purple and white-purple population has started to decline. Efforts are needed to maintain the two varieties’ population, one of which is
Muhammad Madni Afzal1*, Shahbaz Talib Sahi1, Amer Habib1, Waqas Ashraf2, Muhammad Ahmad Zeshan3, Muhammad Raheel2 and Qaiser Shakeel2
...cidal efficacy of desert plant extracts against basal rot of onion in the laboratory, greenhouse and field. Completely randomized design (CRD) was used for in-vitro study and randomized complete block design (RCBD) for greenhouse and field experiments. Three desert plants i.e. Gossypium thurberi, Calotropis procera and Suaeda fruticose were used at 50 ppm, 100 ppm and 150 ppm concentrations. Maximum basal rot disease reducti...
Ghulam Muhiyuddin Kaloi1* and Mehrunisa Memon2
...water is a nutrient rich plant material well known for its high biological oxygen demand, chemical oxygen demand and soluble salts. Its injudicious use may be hazardous for soil health. Study was conducted to evaluate significance of wastewater in context of sugarcane juice quality and soil health. Wastewater was tested on experimental field of Matiari Sugar Mills in a randomized complete block design with factorial combination of five concentrations of wastew...
Javed Anwar Shah1, Azhar Iqbal1, Muhammad Tariq Mahmood2, Muhammad Aslam3, Muneer Abbas4 and Ilyas Ahmad5*
...cept to exploit the host plant resistance mechanism. The present study for screening of 60 elite chickpea lines was carried out for two consecutive years during 2017-18 and 2018-19 under controlled environment at pulses research Institute Faisalabad, Pakistan. Favorable conditions for disease incidence were developed by maintaining the temperature between15-20 °C and humidity >70%. Test entries were inoculated equally by spraying fungal suspension durin...
Gulzar Ullah* and Gohar Ayub
...owth chamber before transplantation and Randomized Complete Block Design (RCBD) with two factors and three replications after transplanting to the field were used. Tomato seedlings at their 4-leaf stage were subjected to a 350C temperature stress for 10, 15 and 20 hrs as a pre-transplant hardening method. Both groups HP (heat pretreatment) and NHP (Non-heat pretreatment or Control) were th...
M. Azam, Iqtidar Hussaian*, Ghazanfar ullah, A.A. Khakwani, M.S. Baloch, K. Waseem, M. Amjed Nadeem and M.K. Javaid
... determine suitable transplanting time for rice in this changing climate scenario to have better yield. The experiment was conducted to study the response of transplanting dates and seedlings densities on fine rice variety “Super Basmati” at Agronomic Research Farm, Faculty of Agriculture, Gomal University, Dera Ismail Khan during 2017. The experiment was laid out in a Randomized complete block design with three ...
Muzamil Farooque Jamali1, Fayaz Ali Jamali1, Tanveer Fatima Miano1, Zulfiqar Ali Abbasi2, Sohail Ahmed Otho3, Khalid Hussain Talpur4, Niaz Ahmed Wahocho1 and Muhammad Iqbal Jakhro5*
...rieties of marigold. The plants irrigated with canal water (control) having EC of 0.7 dSm-1 showed better results for both seed and flowering related traits. The plants treated with canal water showed better seed germination (82.56 %), seed germination index (2.04), plant height (21.31 cm), branches/plant (45.61), leaves/plant
Arshad Khan1, Mohammad Ihsan1, Ali Hazrat1*, Mohammad Nisar1, Muhammad Laiq1, Maryam Bibi1, Nasir Ali2, Ulfat Naz1, Muhammad Zakria1, Nausheen Nazir3, Adam Khan4 and Muhammad Asif Nawaz5
...he most important annual plants globally. The current study was conducted to evaluate Celtis australis genotypes through morphological and biochemical characterizations. A total of 80 genotypes were collected from different regions of district Dir and Swat, Khyber Pakhtunkhwa Pakistan, and were characterized for 11 phenotypic traits (4 qualitative and 7 quantitative). A significant diversity was found for leaf length with the range of 4 to 15 cm, leaf width 1 ...
Izaz Hussain, Ahmad Khan* and Habib Akbar
...uting parameters (leaves plant-1, leaf area and index, ear length, and plant height) were improved in treated plots than control plots. The application of 50 L BM ha-1 improved maize growth contributing parameters over 25 L BM ha-1. Increasing the application rate of HA from 3 to 9 kg ha-1 had increased leaves plant-1, leaf area, leaf area index, plant h...
Masudul Haq Wani and Arshad Bhat*
...hat under medium density plantation at 2×2.5m (2000 trees/ha) resulted in the productivity of at least 3 mt/ha, the average productivity gain will shoot up from 0.96 MT/ha to about 3.00 MT/ha. thereby, improving the productivity by 3 fold, employability which went up from 260 to 810 man-days/ha. The results further revealed that with an expected expansion of medium density almond orchards over 30 per cent of the target area will provide NPV 1348.5 Billio...
Muhammad Irfan Ullah1*, Muhammad Arshad1, Abu Bakar Muhammad Raza1, Nimra Altaf1, Muhammad Afzal2
...of both ACP adults (1.80/plant) and nymphs (10.4/plant) was observed after exposure to imidacloprid than the rest of the chemicals. Similarly, CLM larval population was also observed lower (1.13/plant) when imidacloprid was applied. The least affected chemical was spirotetramat, as the population of both pests was recorded higher on citrus plants after a...
Tanmoy Mandal1 and Sunil Kr. Ghosh2*
... reared on leaves of som plant (Machilus bombycina King) because of their high nutritional value. Rearing becomes difficult due to attack of large number of insect-pests on som plant. Leaf miner(Phytomyza spp.)(Diptera: Agromyzidae) is a major pest and very harmful to som plant leaves. From observation it is found that leaf miner was found active throughout the year on...
Hui Wang1,2, Yuchen Zhao1 and Xinpu Wang1,*
...anic matter, phosphorus, plant coverage, and plant density in enclosure areas and mowing areas. But soil temperature and pH were the main factors in grazing areas. This study implied that conservation of biodiversity requires consideration of different environmental condition in different grassland management regimes. Moreover, soil and vegetation restoration were more important for enhancing biodiversity in a grazed area th...
Kawa A. Ali1*, Sazar S. Noraldeen2 and Arshad A. Yaseen2, 3
...ta for tomato and pepper plants where higher levels with atLEAF instrument comparing to SPAD chlorophyll meter. Higher chlorophyll levels were recorded in open field plants comparing to lath and plastic houses plants. Chlorophyll a content was related to carotenoid levels in both destruction methods. There was positive correlation between SPAD and atLEAF. Nondestructive methods could be us...
Muhammad Waheed* and Dost Muhammad
...t up its availability to plant in calcareous soils. For this purpose, a pot experiment was conducted in the green house of the University of Agriculture Peshawar to assess changes in P fractionations and wheat seedlings growth in two diverse calcareous soils. The pretreated composts were prepared by mixing 0, 2 and 4 % P with FYM on dry weight basis either from RP (rock phosphate) or TSP (triple super phosphate fertilizer). The prepared composts were then appl...
Khaliq Dad1, Muhammad Nawaz2*, Muhamamd Ibrahim3, Fengliang Zhao4, Rumsha Hassan2, Humaira Nawaz5, Muhammad Usman Saleem6, Kinat Javed2, Ayesha Komal2 and Hajra Naz2
...aken up from the soil to plants and finally becomes the part of human body which warrants serious health concerns. Cadmium causes mild to severe effects on plants, animals and environmental health. Humans are exposed to cadmium through food, water intake, inhalation (cigarette) and dermal contact which then produces heart disease, kidney failure, lung cancer, orthopedic disease, nervous system failure, low immunity level, me...
Yanhong Hu* and Linkai Cui
...lized glands of animals, plants as well as other organisms via well-characterized biosynthetic pathways. Fatty acyl alcohols are the key components for synthesis of wax. A fatty acyl-CoA reductase (FAR) is often essential in this biosynthetic pathway. The subcellular localization of FARs is crucial for understanding the process of synthesis and transport of wax to the surface of body. In this study, we characterized the subcellular localization of EpFAR from t...
Nasir Mahmood Cheema1*, Ghulam Shabbir2 and Nazakat Nawaz3
...-7/1, PR101, Local) crop planted at National Agricultural Research Center, Islamabad. Randomized complete block design (split plot) having three replications was followed by sowing dates and varieties. Castor bean oil was analyzed for fatty acid profile and oil content by using soxhlet extr action apparatus and gas chromatography. Results revealed significant differences among oil quality components among castor cultivars and differ significantly (p<0.05) f...
Muhammad Aftab1*, Aneela Riaz2, Ghulam Sarwar3, Muhammad Arif1, Qudsia Nazir1, Ifra Saleem1, Sarfraz Hussain1, Abid Ali4, Abid Niaz1, Fakhar Mujeeb4, Khalid Mahmood5 and Sarfraz Nawaz6
...ried out to evaluate the plants tolerance under combined stress of B and salt. In combined stresses of (B and Salt) causes oxidative stress in plants due to increase in production of the reactive oxygen species (ROS) including hydroxyl radicals (OH-), hydrogen peroxide (H2O2) and superoxide (O2-). However, on their side, efficient antioxidant defense system developed in plants, which havin...
Ayesha Gul1, Mohammad Sayyar Khan1*, Mazhar Ullah1 and Iqbal Munir3
...cer of osmotic stress in plants. In the present research, PEG stress was applied to sugarcane calli of CP-77/400 and the physiological and biochemical responses of the stressed and the control calli were measured. The calli were grown on MS media and were then transferred to different PEG concentrations (0%, 2.5%, 5% and 7.5%). Data was taken after 30 and 60 days of treatment. Relative growth of call showed significant decrease after 30 and 60 days. Control ha...
Hidayatullah1*, Sammia Mahroof1, Saleem Abid2, Naveeda Anjum3, Noor Habib4, Akhter Saeed5 and Muhammad Arshad Farooq1
... could be recomended for planting under different type of sites. NARC Chilli-6 and NARC Chilli-4 could be suitable for adequate environmental conditions while NARC Chilli-1, NARC Chilli-3 and NARC Chilli-5 for inadequate environmental conditions. Environment of Chakwal was found most productive and that of Faisalabad was poorest....
Muhammad Zubair Ishaq1, Umar Farooq1, Muhammad Asim Bhutta2*, Saghir Ahmad2, Amna Bibi2, Hafeez UR Rehman3, Umar Farooq3, Javaria Ashraf4 and Samaria Nisar4
...ll studied genotypes for plant height, boll weight, and seed cotton yield. The mean seed cotton yield during both years ranged 1434.58 to 1983.77 kg ha-1. Maximum seed cotton yield during both years was showed by SLH-8 that was 1726.82 and 2240.71 kg ha-1. Correlation analysis showed that seed cotton yield was positively correlated with the boll weight (0.738**) and number of bolls per plant (0.53**). Sowing dates in March, ...
Muhammad Bilal Tayyab1, Muhammad Zeeshan Majeed1*, Muhammad Asam Riaz1, Muhammad Anjum Aqueel2, Sylvain Nafiba Ouedraogo3, Muhammad Luqman4, Kanwer Shahzad Ahmed1 and Mujahid Tanvir1
...or alternate biorational plant protection measures such as botanical pesticides. This study evaluated the potential toxicity of acetone extracts of 40 indigenous plant species of Soon valley and surrounding salt range (Punjab, Pakistan) against D. citri and A. gossypii using standard twig-dip and leaf-dip bioassay methods, respectively. Results of initial screening bioassay showed the highest mortality of D. citri by 10% ext...
Azra Nadeem1*, Shaukat Hussain2, Saeedullah2, Asma Akbar3, Zahoor Ahmad4, Maryam Tariq5, Robina Karim6 and Muhammad Huzaifa7
...weight, number of tubers/plant, fresh root weight and plant height at the time of harvest of the crop. The biocontrol agent (T. viride) showed lowest disease incidence (53.73%) and severity (1.27) at 8% moisture level. There was a reduction of 43.33% and 63.29% over control by T. viride for disease incidence and severity respectively at this moisture level. The effect of soil moisture was highly significant and maximum tuber...
Ayu Suci Wulandari1, Siwi Indarti1,2*, Muhannad Illayan Massadeh3 and Nguyen Van Minh4
...undance and diversity of plant parasitic nematode in garlic crops, this research was conducted Sampling was carried out in four locations: Brebes, Magelang, Tegal and Temanggung, Central Java, Indonesia. Samples of soil, roots and tubers were collected. Soil abiotic factors are taken measurements such as pH, temperature, and organic matter. The altitudes are measured using the Geograpichal Positioning System (GPS). The results showed that there were five...
Hasnain Raza1*, Maryam Maqsood2, Muhammad Muzamil Nazir1, Iqra Tariq1, Kaynat Ahmed1, Qurat-ul-Ain1, Ali Raza2, Huda Bilal3, Muhammad Bilal Shoukat1, Attiq ur Rehman1, Awais Rasheed1 and Muhammad Zeshan Gulzar1
...ediation attributes as a plant-based cleanup solution for wastewater remediation....
Huda Bilal1, Hasnain Raza2*, Kaynat Ahmed2, Iqra Tariq2, Qurat-ul-Ain2, Sana Sarfaraz1, Sanaullah1, Maryam Maqsood3 and Ali Raza3
... that is affecting land (plants, soil, microbes, animals, and arthropods) and aquatic biodiversity (waterbodies, phytoplankton, coral reefs, and fishes) drastically....
Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4
...useful variation in crop plants has been a major thrust of early farmers since the dawn of agriculture. This study aimed to estimate genetic variability, heritability, and genetic advance for quality characters in Brassica carinata L. A total of 22 genotypes comprised of six parental lines and their 16 bulked F2 populations were evaluated in a randomized complete block design with three replications at The University of Agriculture Peshawar during 2013-14. Dat...
Amir Muhammad Khan1, Laila Fayyaz2*, Raziuddin2, Sajid Ali1, Israr-ud-Din1, Sheraz Ahmad2, Haidar Ali1 and Ijaz Ahmad2
...ary branches mainstem-1, plant height, main raceme length, pods mainraceme-1, pod length, 1000-seed weight and three seed quality traits; oil content, glucosinolate and erucic acid. The analysis of variance (ANOVA) found significant variation among Brassica napus L. lines for all the studied morphological and seed quality traits. Furthermore, analysis of correlation revealed that 1000 seed weight was significantly correlated with primary branches on main stem,...
Nagarathinam Arunkumar*, Jainullabudeen Gulsar Banu, Nagarajan Gopalakrishnan and Arkalgud Hiriyannaiah Prakash
...s and in waste treatment plants proved their importance. In this study, 23 wax-degrading bacterial strains isolated from four mealybug species infesting cotton were screened for lipase production. On the basis of the 16S rRNA gene sequences, lipase-positive strains were classified into six genera, namely, Pseudoxanthomonas, Acinetobacter, Klebsiella, Providencia, Enterobacter, and Serratia. Acinetobacter lwoffii...
Yonghua Liu*, Xianhua Li, Xiongfei Yan, Gang Li, Caiyun Luo and Ying He
...Hippophae rhamnoides plantations in North China. To study the effects of short-term high temperatures on its feeding, mating, longevity, and fecundity, T. vishnou gigantina were cultivated at 30, 35, and 40°C for 1, 2, and 4 h. The results showed that the different intensities and durations of the high temperatures had significant impacts on the moth’s survival and reproduction. With increased temperatures and durations of exposure, the de...
Dilek Şahin1*, Meryem ÖZ2, Orhan Aral2, Mehmet Bahtiyar2 and Selda Taşçi2
...erent amount of purslane plant extracts (3%, T3; 6%, T6; 9%, T9) and each group had 3 replicates. The fish with an average live weight of 2.55±0.08 g were selected randomly from a fish stock of 250 fish and were 13 fish were placed in each aquarium (15 L). The growth, survival and coloring parameters were determined at the end of 60th day of the study. The best growth parameters were recorded in the T9 group. The best weight gain, specific gr...
Mukhtar Iderawumi Abdulraheem1*, Muhammad Ihtisham2*, Abiodun Yusuff Moshood3, Nawab Khan4, Muhammad Owais Shahid5, Shafiq Hussain6, Kumail Abbas6 and Fawad Zaman7
...led that all of the okra plants tested were susceptible to virus infections regardless of treatment. Those who had a treatment combination of three weedings and polythene mulching, on the other hand, had the lowest incidence and severity of viral infection, while those who received no weeding and no mulching had the highest. At the 7th week after planting, the treatment combination of thrice weeding with polythene mulching h...
Dia Mamadou1,2*, Meissa Beyah1, Sow Amadou Harouna1, Ba Samba Alassane1, Bouzouma Moustapha1, Braham Cheikh Baye1 and Beibou Ely1
...or at lobster production plants of this species at the time of their sorting and packaging. A total of 31770 individuals were measured and weighed; their level of maturity and moulting state were noted. This deep-sea species, reproduces all year round with a period of intense reproduction between August and December. The size of the smallest mature female mature female encountered during this period of experimentation (February 2015 to June 2018) is 213.5 mm T...
Muhammad Zohaib1, Muhammad Sajjad Ansari1*, Bushra Allah Rakha2* and Ali Akhter2
...l and other positions of plants were recorded as 17%, 10% and 25%, respectively. The preferred height for nest construction was recorded 1-2m (58%) followed by 2-3m (17%), 0-1m (16%), 3-4m (7%) and 4-5m (1%). The bulbul prefers to make nests on northern white cedar (Thuja occidentalis; 32%) followed by guava (Psidium guajava; 19%), mango (Mangifera indica; 9%), white mulberry (Moris alba; 9%), sweat orange (Citrus X sinensis;...
Madiha Nawaz and Shoaib Freed
...st of cotton, ornamental plants and many other crops due to its polyphagous nature. A study was conducted to check the efficacy of different local isolates of entomopathogenic fungi on 2nd nymphal instar of P. solenopsis under laboratory conditions by immersion method. Three entomopathogenic fungi; Beauveria bassiana (isolates Bb-01, Bb-08), Metarhizium anisopliae (isolates Ma-11.1, Ma-2.1) and Isaria fumosorosea (isolate...
Salma Javed1* and Daniyal Siddiq2
...lity. The use of natural plant products as biopesticides in the prevention and control of pests and diseases has been increasing. Nematicidal activity of “Black plum Syzygium cumini, leaf aqueous, ethanol and methanol extracts were investigated for managing the population of Meloidogyne javanica, in tomato. In laboratory conditions second-stage juveniles (J2) mortality was recorded after 24, 48 and 72 h of incubation in concentrations of 0.25, 0.5 or 1%....
Asma Hanif* and Shahnaz Dawar
...atode infection on roots plant....
Ilker Kepenekci1, F. Dolunay Erdoğuş2 and Adnan Tülek3*
...serious pests of several plants worldwide including straw berry. So far, no record of any plant parasitic nematode (PPN) exists detailing the species found in strawberry growing areas of Kyrgyzstan. This research aimed to provide a faunistic and taxonomic record of PPNs from soil and plant samples collected from strawberry orchards in 10 different locations in Tokmok area of northern Kyrgy...
Mohammed Abdel-Mageed Abdel-Aziz Abdel-Mageed1, Eman Alsayed Hammad2*, Nashaat Abdel-Aziz Mahmoud1 and Anas Farag El-Mesalamy1
...n 500 ppm applied to the plants as foliar sprays alone, foliar sprays with chelates and soil drenches were tested against root-knot nematode M. javanica infecting tomato plants cv. Strain-B under greenhouse conditions. Almost tested materials have significantly reduced nematode parameters compared to Oxamyl 24% L. and the untreated plants (check). The degree of nematode reduction varied ac...
Mahmoud M.A.Youssef and Wafaa M. A. El-Nagdi
...can work for controlling plant-parasitic nematodes. Higher soil temperatures with transparent or black plastic cover reduced citrus nematode, Tylenchulus semipenetrans on navel orange and reniform nematode, Rotylenchulus reniformis on sunflower. Also, dry heat was used to control rice root nematode, Hirschmanniella oryzae on rice soil and root and wheat soil. Several investigators reported that number of galls and egg-masses of root-knot nematode, Meloidogyne ...
Christopher Oche Eche1*, Juliana Iye Oluwatayo1, Demben Moses Esang2, Paul Madina2 and Alexander Uloko1
...educed the population of plant-parasitic nematodes by 21.6%, and 37.8%, respectively. Although yields obtained from plots treated with the two rates of mixed formulation were 0.51 t/ha and 0.49 t/ha, the observed difference was not statistically significant but was higher than yields obtained when either eucalyptus biochar or sawdust was applied singly. The study showed evidence of nematode population control and yield improvement when mixed formulations of sa...
Thomby Paul, Sreekanta Biswas, Sabiha Zarin Tasnim Bristi, Debashish Sarker, Saroj Kumar Yadav and Bhajan Chandra Das*
...onfirm the position of implants. On 30th day of post-surgical observation, mediolateral radiograph revealed migration of implants but callus formation was observed between the fracture ends of olecranon in order that the implants were removed. On 45th day of clinical observation, the dog showed good weight-bearing in right forelimb and walked normally....
Muhammad Junaid Yousaf 1, Farhad Ali2*and Fawad Ali2
...a moderate salt-tolerant plant cultivar that shows varying effects and adaptations to different concentrations of salt stress (i.e. NaCl) to which it is exposed. When three days old seedlings of maize were subjected to aerial salt stress of concentrations; 0.2%, 0.6% 1.2%, and 2% after a week in soil, the seedlings revealed the antagonistic effects which increased with elevated concentrations of salt stress. The experiment was kept for 5 weeks and the chloroph...
Mohamed S. Khalil
... javanica in roots of eggplants. Milbemectin (Milbeknock 1% EC) was applied at 0.1% (1 ml/l) and 0.5% (5 ml/l) in compared with the non-fumigant nematicide fenamiphos (40% EC). Results revealed that all tested doses of milbemectin suppressed galls (ranged from 50.59 to 75.50%, of both experiment) and egg masses (ranged from 66.67 to 87.01%, of both experiment) significantly, while fenamiphos recorded moderate reductions. Also, the measured
Vishal Ambidi 1,3, Sanjeev Bantewad2, Suraj Prasad Mishra1, Anupama Hingane1 and Jagdish Jaba1*
..."font-size: small;">Host plant resistance is an important component for minimizing the losses due to the pod borer, Helicoverpa armigera and other pod borer complex. Among pod borer, which is the most devastating pest of pigeonpea. An understanding of different morphological and biochemical components of resistance is essential for developing strategies to breed for resistance to insect pests. morphological and biochemical components associated with exp...
Mubeen Zahra1,2, Muhammad Nawaz3, Muhammad Umer Chattha4, Imran Khan4, Muhammad Bilal Chattha5*, Muhammad Ashraf Bhatti6, Abdul Rehman4, Faryal Ahmed4, Faran Muhammad4, Mina Kharal7 and Muhammad Umair Hassan4
...of water at any stage of plant life can be damaging for growth, physiological processes and yield. Thus, present study was executed to determine the impact of drought on growth and yield of different wheat cultivars. The study was comprised of early drought treatment such as I0 (control), I1 (fist irrigation 30 days after sowing), I2 (first irrigation 45 days after sowing) and I3 (first irrigation 60 days after sowing) and wheat cultivars Faisalabad-2008 (stan...
Muhammad Usman Hanif, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad, Muhammad Irfan Ullah
... extracts of three local plant species (i.e. Eucalyptus camaldulensis Dehn., Citrus limon L. and Azadirachta indica A. Juss) against the grubs and adults of E. vigintioctopunctata. Three concentrations of each synthetic insecticide (i.e. 2.5, 2 and 1.5%) and botanical extract (i.e. 10, 7.5 and 5%) were bioassayed using standard leaf-dip method. Results revealed that spinosad and 10% A. indica aqueous extract exhibited maximum mean cumulative mortality of hadda...
Atef El-Sagheer1*, Anas El-Mesalamy1, Abdel-Monem Anany2 and Nashaat Mahmoud1
...avanica infecting squash plants under greenhouse conditions. Data indicated that treatment with P. guilliermondii filtrate (1012) caused best percentage of nematode reduction (71.46%). Followed by S. roseus at (1012) (42.95 %), then in third treatment with C. albidus (103) by (40.50 %). On the other hand, all tested treatments decreased the negative effects of nematodes and enhanced growth characters of squash plants. The hi...
Sonam Khatri1, Shaheen Faizi2, Shahina Fayyaz1 and Erum Iqbal1*
...he useful effect of this plant against nematodes. Phytochemistry of the C. colocynthis and the secondary metabolites isolated from the plant i.e. alcohols, esters, fatty acids terpenes, flavonoids and steroids are assembled in this article which further provide a basis for a noteworthy nematicidal effect....
Oluwatoyin Adenike Fabiyi
...on is the infestation by plant parasitic nematodes most notably, the cyst nematode Heterodera sacchari. Broadly, synthetic nematicides are utilized in the suppression of soil nematode infestation of sugarcane, with positive outcome in yield. However, emergence of resistant nematode strains and health hazards are associated with the ceaseless use of the synthetics. The efficacy of furfural (2-furanaldehyde) from agricultural biomass waste was examined as a prac...
Mazhar Ullah and Mohammad Sayyar Khan*
...m callus and regenerated plantlets. In this research, different auxins [Dichlorophenoxy Acetic acid (2,4-D), Nephthalene Acetic Acid (NAA)], cytokinin [Benzyl Amino Purine (BAP)] either alone or in combination with each other and carbon sources [sucrose, glucose and fructose] with varying concentrations (2, 4 and 6%) were evaluated for their effect on the tissue culture of sugarcane variety-CP 77/400. For callus induction 2,4-D as an auxin was found to be most...
Rasool Bux Kalhoro1, Ghulam Mustafa Laghari2*, Ghulam Hyder Jamro2 and Muhammad Ibrahim Keerio2
...results exhibited higher plant 55.24cm and 55.14cm at 45 cm row spacing under the interaction of seed rate 60 and 75 kg ha-1, respectively. Whereas maximum leaf area 190.72 cm2 and 190.0 cm2 were observed from 60cm row spacing. The maximum days to flowering 45.06 and days to maturity 117.28 were recorded at row spacing 60cm with a seed rate of 90 kg ha-1. The row spacing 45 cm with a seed rate of 75 and 90 kg ha-1 showed minimum days 41.67to 41.94 to leghaemog...
Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi
... important parameters of plant growth promoting bacteria. Earthworms, along with soil sample, were collected from different areas of Lahore. Bacteria were isolated, purified and further characterized morphologically, biochemically and at molecular level. Bacteria after isolation were labelled as EPF1 while by molecular confirmation this bacterial strain was named as Exigoubacterium auranticum. Optimum bacterial growth response was recorded at pH 7.0, temperatu...
Samreen Khan*, Salma Javed, Tabassum Ara Khanum, Nasira Kazi
...ental flowers, medicinal plants and other commercially important trees from different four sites of district Lakki Marwat and subsequently assessed the presence of EPNs using last instar larva of greater wax moth Galleria mellonella L. as baited host. After completion of requisite process, resultantly the corresponding recovery rate of EPNs was found 10.9% which includes only genus Steinernema comprising two isolates of S. balochiense (24%), two isolates of S....
Muhammad Rizwan1*, Bilal Atta1, Misbah Rizwan2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Muhammad Sabar1, Muddassar Ali1 and Muhammad Yasir Ali4
... and high levels to rice plant significantly extended the larval development and reduced survival rate of both larvae and pupae. Si amendments reduced larval and pupae weight as compared to control treatment. However, the consumption of green matter increased in Si treated plants by 3rd instar larvae of C. medinalis. Results also showed that enhanced Si level in rice plant
Abdullah Abdo Albegali1, Tayyaba Aftab1, Atiq-ur-Rehman1*, Amir Rashid1 and Mayada Mohammad1,2
...natus, a traditional plant is used for the treatment of various ailments. It has been investigated that this plant has supportive treatment, for combating diabetes complications, blood pressure, oxidative stress and haematological disorders. This study was done in the investigation of antihyperlipidemic effects of methanol extract of seeds of this plant in hyperlipidaemia Wistar albino...
Muhammad Waryam Warraich1, Mukkram Ali Tahir1, Noor-us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Fakhar Mujeeb3, Muhammad Zeeshan Maznoor1, Aneela Riaz4 and Sarfraz Hussain2
...y enzymatic reactions in plant body. The deficiency of bio-available potassium is pronounced throughout the world. In Pakistan due to dense plantation and minimum use of artificial potassium fertilization the yield and supply potential is diminishing day by day. The cost of potassium fertilization is very high and awareness for external nutrition of potassium benefits is also on the minimum side. To overcome potassium bio-av...
Muhammad Taqi1, Shazia Erum2, Shamaila Rasheed2, Sadar Uddin Siddiqui2 and Shakeel Ahmad Jatoi2*
...on Caralluma tuberculata plants resulting in the disappearance of its wild populations in different mountainous regions in Pakistan. A proficient way for large-scale and fast propagation of C. tuberculata through in-vitro organogenesis was carried out at in-vitro lab, Bio-resources Conservation Institute, NARC, Islamabad, Pakistan. Nodal-tips as explants were grown on MS salts enriched with diverse p...
Hongbin Li1,2, Lei Fang1, 3 and Lei Cao1,2*
... MODIS satellite-derived plant production data to relate the timing of spring migration to that of the green wave index (GWI) at different staging regions and on breeding areas. Results showed that, at stopovers south of 52°N, eastern tundra bean geese fed mainly on cropland and arrived at stopover sites ahead of 50% GWI. At all subsequent stopover sites in Russia, eastern tundra bean geese fed exclusively on natural forage land, and followed GWI northward...
Sanjeela Sabahat1*, Juliya Abbasi2, Mushtaq Ahmad1, Saima Mumtaz1, Taj Naseeb Khan1, Sudheer Tariq1 and Muhammad Imran1
...p where runners are transplanted every year. Owing to its short growing period and high profitability, it is mostly produced by small scale farmers. However, the changing climate from the past few years has affected strawberry production in Pakistan. Heavy rainfall, along with hailstorms causes damage at the fruit initiation stage. Moreover, the rainfall also lead to the leaching down of the essential micronutrients in strawberry farms. In this study we have t...
Aftab Ahmad Sheikh1, Khalil Ahmed1*, Belqees Akhter1, Ghulam Qadir1, Muhammad Qaisar Nawaz1, Hafeezullah Rafa1, Abdul Wakeel1, Abdul Manan Saeed2
...crop. Data regarding the plant height, fresh/dry fodder yield, nitrogen free extracts (NFE), crude fat, crude protein, crude fiber, phosphorus, and calcium contents were envaulted at the physiological maturity of crop, four months after the sowing of crop. Results revealed that water salinity adversely affected the quantitative and qualitative attributes of sorghum crop and negative effects were more pronounced with higher level of salinity ECiw (10 dS m-1). I...
Vahid Mollasadeghi1,2* and Samaneh Elyasi1,2
...sed to infect the potato plant. This paper measured chlorophyll a, b, leaf area, number of leaves, stem length and tuber weight. The results showed that the symptoms of PVY were completely distinguishable on the leaves of tobacco plants compared to PVY on the leaves of Agria. PVY-infected leaves were more curled and paler than healthy leaves of cultivars Agria. The results of analysis of variance of the evaluated traits show...
Samaria Nisar1, Tariq Manzoor Khan1, Muhammad Ahsan Iqbal1, Rahmat Ullah2, Muhammad Asim Bhutta3*, Saghir Ahmad3, Amna Bibi3, Hafeez ur Rehman4, Umar Farooq4 and Muhammad Zubair Ishaq5
... boll weight (BW), bolls/plant (BP), ginning out turn (GOT percent), hundred seed weight (100SW), yield/plant (YP), fiber fineness (FF), fiber length (FL), and fiber strength (FS) all revealed substantial variation in the analysis of variance (FS). The goal of this research was to quantify variability and conduct a correlation analysis to see potential for selection in the F2 population. Plant...
Zahoor Hussain1,2, Yasir Iftikhar3, Mustansar Mubeen3, Muhammad Zia Saleem3, Muhammad Umer Naseer3, Muhammad Luqman4, Raheel Anwar5, Faheem Khadija6 and Aqleem Abbas7
...ied on selected diseased plants in combination. Afterward, different vegetative, physiological, and biochemical parameters of citrus greening infected fruit include fruit diameter, fruit weight, flavedo thickness, total soluble solids, ascorbic acids, juice percentages, TSS/TA ratio, total soluble solids, and titratable acidity were statistically analyzed. The application of Zinc sulphate (0.75 g/L) combined with Manganese sulphate (0.75 g/L) had significantly...
Stefan Pratama Chandra1, Yoanes Maria Vianney1, Theresia Liliani Christie2, Merlyn Wongso2, Melisa Widjaja2, Deok-Chun Yang3, Se Chan Kang4, Manar Fayiz Mousa Atoum5,6 and Johan Sukweenadhi1*
...e of the most well-known plants in traditional medicine that contains bioactive compounds called ginsenosides. It is widely used as raw material in many pharmaceutical industries in Indonesia. However, to supply for this purpose, they still rely on imports. PT. Kalbe Farma (through its subsidiary, PT. Bintang Toedjoe), University of Surabaya (Ubaya), and Hanbang-Bio Laboratory (holding company of Kyung Hee University) established the Kalbe Ubaya Hanbang-Bio La...
Ali Ikhwan1*, Dian Indratmi1, Faridlotul Hasanah1, Manar Fayiz Mousa Atoum2,3 and Irum Iqrar4,5
...nment. The purple Cleome plant (Spider plant – Cleome rutidosperma Linn.) can be extracted and function as an organic fungicide for environment-friendly control. This research aimed to examine the type and concentration of purple cleome extract metabolites and understand their effectiveness in inhibiting C. capsici. Purple cleome leaf is extracted with 1:1 w/v absolute methanol and concentrated with 1:1 v...
Niamat Ullah Khan1*, Umbreen Shahzad2, Azhar Abbas Khan2, Sami Ullah2, Muhammad Arshad Farooq2, Muhammad Kashan2 and Shitab Khan2
...duced tillage had higher plant population (32454), plant height (114.8cm), bolls per plants (18.9), bolls weight (2.42g), seed cotton yield (1812 kg ha-1) and lint percentage (36.72%) than conventional tillage. Likewise, frequent irrigation interval of 10 days produced taller plants compared to less frequent irrigations (20-25 days). Irrigation at 20 day...
Qurban Ali1, Muhammad Faheem Akhtar1, Asad Aslam1*, Muhammad Shehzad2, Muhammad Jamal2, Humaira Malik1, Imran Nadeem1, Aqsa Abbas1, Muhammad Jawad Saleem1, Tamsila Nazir1 and Kanwal Hanif1
...th Asian countries. Host plant resistance, physio-morphic characters counteract the ability of insect to demage and to cause minimum reduction in yield. The experiment was conducted under natural and semi-natural conditions to determine the host plant resistance of nine (09) chick pea advance genotypes viz., (K01211, K01216, K01241, K01242, K09012, KO1308, K014001, K014002, K-14003) and one (1) control (Noor). Antixenosis wa...
Imran Ali Chandio1, Muhammad Nawaz Kandhro1*, Qamaruddin Jogi1, Ghulam Murtaza Jamro2 and Siraj Ahmed Channa3
...nutrient deficiencies of plants. A field study was conducted in Tandojam for two consecutive years in autumn 2018 and 2019. The experiment was replicated thrice in randomized complete block design. Different doses of nitrogen as broadcasting and fertigation (0, 75, 100, 125 kg N ha-1 in two and three equal splits given at sowing time, 1st, 2nd and 3rd irrigations, respectively) were applied to two sunflower genotypes (HO-1 and Hysun-39). Data analysis revealed...
Muhammad Iqbal Jakhro1*, Nadeem Sadiq1, Javed Ahmed Abro1, Amanullah1, Fateh Muhammad2, Maqbool Ahmed3, Syed Ishtiaq Ahmed Shah3 and Qasid Hussain4
...ties. One-year old Olive plants were applied with organic and inorganic mineral fertilizer application for six months. The results showed that in comparison to control, plants fertilized with T2 (N 50g/plant), T3 (P 25g/plant), T4 (K 25g/plant), T5 (NPK 50:25:25/plant), T6 (Biochar 2...
Ali Zohaib*, Muzzammil Hussain, Iftikhar Ahmad and Adnan Bashir
...ustify;">Mechanical transplanting with mat type nursery is quite a new planting technique for rice. However, optimization of seeding rate for producing mat type nursery is crucial to acquire suitable seedlings and planting density for better yield of mechanically transplanted rice (MTR). Current 2-years field study was conducted to determine effect of se...
Muhammad Rizwan1*, Jehanzeb Farooq1, Amjad Farooq1, Muhammad Farooq1,2, Ghulam Sarwar1, Muhammad Nadeem1, Muhammad Riaz4, Muhammad Rafique Shahid3, Hafiz Ghazanfar Abbas1 and Muhammad Kashif Shahzad Sarwar1
...ibution was presented by plant height whereras maximum negative factor loadings were showed by GOT % and seed index. PCA also confirmed the results of correlation studies by presenting significant positive association among leaf chlorophyll contents, seed cotton yield, No. of sympodia, seed index and boll weight. These results will be helpful in further breeding strategies for selection of genotypes with respect to chlorophyll contents, yield and associated tr...
A.M. Abdul Azeem, Ashraf M. Mounir and Amr N. El-Shahat*
...atural antioxidants from plant materials have been consumed to replace synthetic ones as supportive therapy in the treatment of diabetes. This research was aimed to explore the influence of gamma (γ)-irradiation on the total phenolic compounds and total flavonoid contents of dried pumpkin seeds as well to determine the hypoglycemic influence of γ-irradiated pumpkin seeds dried powder (GPSDP) on diabetic rats. In this work, the level of total phenol...
Mirza Gul1*, Muhammad Zahid1, Ikram Ilahi2, Hazrat Ali2*, Fida Hussain3 and Muhammad Anwar Sajad3
...xtracts of two medicinal plants, Artemisia scoparia and Anisomeles indica against larvae, pupae and adults of Culex quinquefasciatus. The study also evaluated the predatory effects of the diving beetle, Agabus cybister, against various instar larvae of Cx. quinquefasciatus. Bioassay of whole-plant extracts was performed following WHO methods, with slight modifications. LC50 values for A. scoparia and A. indica against early ...
Agha Mushtaque Ahmed*1, Ali Zachi Abdulqader Alhilfi2, Fahad Nazir Khoso1, Imran Khatri1, Jamal-U-Ddin Hajano3, Qurban Ali4, Imran Ali Rajput5 and Muhammad Akbar Lashari1
...tship behaviour of brown planthopper (BPH) is followed by numbers of strides by both genders and influenced with age. In the present study, the age of male for 1-7 days and female 1-10 days was selected to observe the different parameters {male response time (MRT), male arrival time (MAT), male arresting time (MATt), number of times male extended genitalia (MEG), total pre-mating time (TPMT), mating duration (MD), female calling latency and female rejecting ra...
Abdul Haleem1*, Ghulam Hassan1, Arshad Iqbal2, Fahim Ullah Khan3, Muhammad Sajid3, Farhad Ahmad4, Rafi Ullah Khan5 and Mohammad Ilyas2
...ines were Atta-Habib for plant height (95.10cm) and tillers plant-1 (12.30), Janbaz for economic yield per plant (20.93g) and spike length (10.87cm), Khatakwal for 100-grain weight (3.27g). Among F2 progenies, best combinations were Khatakwal × Lalma-13 for plant height (93.96 cm), Janbaz × Pirsabak-05 for tillers pla...
Hera Gul Mohmmand1, Rozina Gul1, Hamayoon Khan2, Sheraz Ahmed1*, Laila Fayyaz1, Ajmalud Din1 and Imtiaz Ali1
...ial nutrients needed for plant growth and development. The P has a significant ecological and economic importance; therefore, its application is considered to maximize the yield of various crops, including chickpea. The current experiment was performed to assess the impact of phosphorus application on yield of 15 chickpea genotypes during the growing season of 2017-18 at the University of Agriculture, Peshawar. A randomized complete block design was used with ...
Abdul Jabbar*, Anees-Ul-Hussnain Shah, Abdul Basit, Ghulam Ahmad, Aftab Ahmad Khan, Suleman Raza, Muhammad Sultan Ali Bazmi, Imtiaz Akram Khan Niazi and Ahmad Hussain
Dyah Roeswitawati1*, Iva Kristova1, Muhidin Muhidin1, Otto Endarto2, Manar Fayiz Mousa Atoum3,4, Irum Iqrar5,6 and Luqman Ali Shah7
Nour El-Hoda Khayrat Hammad1*, Yousef Y. El-Seady3, Azza E. Hassan1, Sara T. Elazab2, Magdy S. Amer2
...y, Antifungal, Medicinal plant, Testosterone hormone, Aromatase ...
Sajad Ali Solangi1, Jamal-U-Ddin Hajano1*, Rehana Naz Syed1, Sohail Ahmed Otho2, Khadim Hussain Wagan1, Agha Mushtaque Ahmed2, Fahad Nazir Khoso2, Aftab Raza Jarwar3 and Suman Tarique Qazi1
... week after date of transplantation. Additionally, relationship among the disease and vector insect was determined. The minimum incidence of the disease was recorded in variety Advanta-1211 (13.85%) and Lima (18.85%) followed by T-1359 (23.30%), Early king (25.51%), TO-1057 (27.21 %), Advanta-1225 (29.41%). Minimum 1-rating score was recorded in Advanta-1211, Lima and T-1359 varieties. Significantly minimum number of whiteflies was recorded in variety Lima (2....
Evaluation of Temporal and Differential Fertilizer Application on Growth, Yield and Quality of Wheat
Raheela Naz1*, Muhammad Aftab1, Ghulam Sarwar2, Ana Aslam1, Qudsia Nazir1, Asifa Naz3, Abid Niaz4, Farah Rasheed1, Amina Kalsom1, Nisa Mukhtar1, Sadia Sultana1, Ifra Saleem1, Arfan ul Haq1, Muhammad Arif1, Aamer Sattar1, Sarfraz Hussain5 and Muhammad Adnan Rafique6
...ecome available when the plant needs them and to make maximum benefits, fertilizers should be applied at the right time. In this experiment, impact of fertilizer applying methods for nitrogen and potash at different times was investigated on wheat crop. Wheat was sown as a test crop with six different fertilizer application methods at varying times under RCBD arrangement with three replications. The experimental soil was high in pH, low in fertility status and...
Ahmad-Ur-Rahman Saljoqi1, Sumayya Amin1, Muhammad Salim1*, Taufiq Nawaz2 and Farida Anjum3
... infestation (8.92%) per plant and fresh weight (92.57g) were recorded from fruits after 3 days of the post treatments, while the lowest mean percent fruit infestation (8.35%) and fresh weigh of tomato fruits (83.46g) were recorded from plants after 7 and 10 days, respectively. Significantly highest ascorbic acid concentration (9.68 mg/100g) was recorded on day 10 while lowest (9.19 mg/100g) was recorded on 3rd day post trea...
Saba Iqbal, Asmat Ullah*, Muhammad Luqman, Hafiz Muhammad Akram, Muhammad Kashif Munir and Nawal Zafar
...t (Triticum aestivum L.) planting techniques (broadcast and drill) with the water efficient planting techniques (ridge and bed planting) to evaluate their water use efficiency and their economic feasibility. Results of this study revealed that sowing of wheat on ridges and beds gave higher productive tillers (384 ha-1 and 401 ha-1, respectively), grains per spike (47 and 47, respectively),...
Javed Khan1, Abdul Majid1, Mohammad Nisar2*, Ali Hazrat2, Nausheen Nazir3, Muhammad Zahoor3, Mohammad Ihsan2, Azhar Hussain Shah1, Muhamad Ajmal Khan4 and Muhammad Yahya1
...enotypes among different plant species and its knowledge help the breeders and farmers to select the best variety. Alnus nitida is one of the native and most important plants in District Dir Lower, Khyber Pakhtunkhwa, Pakistan, mostly used for medicinal purposes. In the present study, total 50 genotypes of Alnus nitida were collected from Dir lower and evaluated for morphological traits (leaf, petiole, nut, and catkin size)....
Noor Muhammad* and Shah Alam Khan
...es (TI) and proportional plant dry weight change (DWT) to identify tolerance of canola crop. Results revealed that commercial cultivar ‘Zahoor’ comparatively performed well despite higher number of aphids found on itas compared its other counterparts “Abaseen, Omega and KS-75” and hence, was identified as tolerant to mustard aphid. This cultivar also exhibited strong vigor against mustard aphid and minimal symptoms of damages were obser...
Zein Ahmad Baihaqi1,2, Irkham Widiyono3*, Bambang Suwignyo4, Amado A. Angeles5
... metabolite compounds in plants. These studies are interesting to be continued and explored in an effort to reduce methane production through in vitro and in vivo, because it is proven that there are many types of biological or agro-industrial waste in the world different contents, structures and benefits. This review of the last 5 years related to the utilization of tannin active compounds showed the effect on the reduction of methane production. Condensed ta...
Muhammad Faisal Riaz1, Abu Bakar Muhammad Raza1*, Muhammad Zeeshan Majeed1 and Talha Nazir2
...ultural and agricultural plants. This study determined the prevailing diversity of aphids on different economically important plantations in district Sargodha. From November to April 2018-2019 and 2019-2020, about 51,000 apterous adult aphid specimens were collected from various plantations from all six tehsils of district Sargodha and were identified up to species level. Richness and rela...
Hafiz Ghulam Muhu-Din Ahmed1, Aziz Ullah2, Muhammad Asim Bhutta3*, Amna Bibi3, Hafeez-ur-Rehman4 and Umar Farooq4
...effects were observed on plant growth and productivity under drought conditions. Total 40 wheat genotypes with diverse genetic makeup were assessed in glasshouse for seedling attributes against limited water conditions using completely randomized design during the season 2019-20 in the Islamia University of Bahawalpur. Based on mean values reasonable variations were noticed in evaluated genotypes for studied attributes. Results from radar analysis, performance...
Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Sher Shah Souri1, Bibi Amina3, Wajia Noor4, Abidullah1 and Muhammad Adil1
...nificantly improved pods plant-1 (29), seeds pod-1 (11), thousand seeds mass (38 g), biological and grain production (2960 and 777 kg ha-1) while highest nodules plant-1 (26), plant height (79 cm), protein (21.70 %), carbohydrates (60.53 %) and seed N content (3.76) was recorded with molybdenum applied at rate of 2.5 kg ha-1. Similarly in case of phosphorus application at rate of 60 kg ha-...
Hussain Ali1, Shahid Sattar Khan1, Fazal Maula2, Said Hussain Shah3* and Misbah Uddin1
...a incertulas) infest the plants from seedling to maturity, which is one of the key pests that infest the rice crop at regular intervals. It is pivotal to find out management strategies for this pest for higher production of rice. Research experiments were conducted to investigate the impact of different rice varieties and synthetic insecticides on the population density of rice stem borer. Experiments were conducted in randomized complete block design (RCBD) r...
Muhammad Shoaib1*, Muhammad Nawaz2, Muhammad Ilyas3, Muhammad Shafique1, Imran Khan1*, Muhammad Talha Aslam1, Muhammad Sultan Ali Bazmi4, Muhammad Arshad5, Ghulam Ahmad4, Muhammad Irfan6, Muhammad Umer Chattha1 and Muhammad Umair Hassan1
... sizes maximum LAI, CGR, plant height (94.32 cm) productive tillers (PT) (364 m-2), thousand grain weight (TGW) (42.67 g), biological yield (BY) (10.61 t ha-1), grain yield (GY) (4.49 t ha-1) and harvest index (HI) (41.94%) was obtained with 150 kg ha-1 seeding rate and lowest LAI, CGR, height (88.65 cm) PT (283.11 m-2), TGW (38.30 g), BY (9.57 t ha-1), GY (3.66 t ha-1) and HI (38.66) was noted in seed rate of 100 kg ha-1. In case of seed size maximum LAI, CGR...
Lethal and Sub Lethal Effects of Plant Extracts and Green Silver Nanoparticles against Culex pipiens
Abdul Jabbar1, Muhammad Tariq1*, Asim Gulzar1, Tariq Mukhtar2 and Tayyaba Zainab3
...h. Biopesticides such as plant extracts and green synthesized nanoproducts have received much attention as potentially useful bioactive compounds against mosquitoes. In the present study, the effects of extracts of four plants i.e. Azadirachta indica, Zingiber officinale, Syzygium aromaticum and Datura stramonium and their green synthesized silver nanoparticles (AgNPs) were evaluated against 3rd and 4th instar larvae of C. p...
Muhammad Tahir Jan1, Sarfraz Ali Shad2, Mushtaq Ahmad Saleem3 and Muhammad Binyameen2,*
...a eggs within the cotton plant. Out of 240 plants inspected, E. vittella females laid 204 and 194 eggs on 40.9% and 36.9%of the plants in 2011 and 2012, respectively. Spearman Rank Correlation showed that a significant and positive relationship (association) existed between the number of infested plants or plant parts ...
Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1
...Solanum lycopersicum L.) plants and these were liberated to healthy plants for transmission of viruses. It was evident from the results that the whiteflies were incapable to acquire and transmit chickpea chlorotic dwarf virus (CpCDV)-a mastrevirus and mastrebegomo chimeric virus (MCV) from the symptomatic tobacco and tomato plants to healthy plants. Whit...
Doaa Sh. Mohamed1, Nema S. Shaban2 , Mai M. Labib3, Olfat Shehata4
...l compounds derived from plants have medicinal and antioxidant properties. The purpose of the current investigation was to investigate if almond oil could protect male mice against doxorubicin-induced cardiotoxicity. The experimental mice were divided into three groups; control group: received 0.9 percent saline, doxorubicin group: Mice were intraperitoneal injected with doxorubicin (5 mg/kg) ithree times over a period of two weeks (dose every five days) and a...
Naima Din1, Misbah Ashraf1, Muhammad Rizwan2*, Muhammad Babar Shahzad Afzal4, Hafiz Ghazanfar Abbas2, Farrukh Ilahi2, Amir Hameed5, Muhammad Ahsin Ayub6, Qurban Ali1 and Muhammad Farooq2,3
...morphic characters viz., plant height, number of branches, area of leaf lamina, hair density on midrib, chlorophyll contents and moisture percentage were also evaluated for the tested varieties. Among the tested varieties, OK Advanta-803 was most resistant to the jassid (13.36/leaf), whereas NS-810 was most susceptible to the A. devastans (23.93/leaf). A. devastans population showed a significant and positive correlation (r = 0.8573*) with area of leaf lamina ...
Ranjhan Junejo1*, Shahabuddin Memon1, Muhammad Usman Shar2, Ayaz Ali Memon1 and Fakhar-un-Nisa Memon3
...rtant pest for date palm plantation in all over the world. The present study deals with the optimization of different parameters for trapping of red palm weevil by utilizing pheromone traps. Different field trials have been performed at district Khairpur Mir’s, Sindh-Pakistan. Therefore, different field trials have been performed at date palm orchards of district Khairpur Mir’s, Sindh-Pakistan. During the field trials, various parameters such as ag...
Nuzhat Naseem, Sajid Abdullah and Sana Aziz*
... minerals, is present in plant products and it cannot be consumed by fish because there is no phytase activity in agestric fish. This study was performed to determine the impact on proximate composition of whole-body of Labeo rohita (fingerlings) fed distiller’s dried grains with solubles based diet, supplemented with phytase. Six different feeds were formulated by supplementing different concentrations of phytase. i.e. D1 without phytase supplementation...
Fei Kong1,2, Qingjun Zhu1, Fanrong Xiao1, Jacob Mueti Ngwawa1, Hongxing Zhang2 and Haitao Shi1*
...sified into nine groups: plant (4), fish (1), frog (1), earthworm (1), insect (9), mollusk (3), shrimp (2), and other miscellaneous items....
Afsheen Noman Saddar1, Anila Naz Soomro2*, Sadaf Tabasum Qureshi1, Syeda Saleha Hassaney1 and Mukhtiar Ahmed Mahar2
...lity enhancing medicinal plants viz root of sweet flag, seed of radish, root of land-calotrops, leaves of peppermint and flower of red cabbage through brine shrimp toxicity assay. Brine shrimp eggs hatching was optimized by applying three temperature levels (25°C, 27°C and 29°C), three salinities (10 ppt, 30 ppt and 35 ppt), two food demands (0.8 g and 1.6 g) and two levels of shrimp egg (1 g/l and 1.5 g/l). Five concentrations (1200, 2500, 5000, 1...
Muhammad Salman*, Muhammad Hamayoon Khan, Muhammad Zahid, Gul Zamin Khan, Fazli Rahim and Usman Khalique
...s belonging to different plant families, viz., banana (Musa acuminate), persimmon (Diospyros kaki), apple (Malus domestica) and tomato (Solanum lycopersicum). The study was performed under free choice conditions by exposing all the tested fruits in the same arena to B. zonata female adults. Results revealed that tested biological parameters were significantly affected by the tested host except sex ratio. However, banana was found the most preferred host with m...
Hassan Ali1, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1* and Muhammad Imran Hamid2
... potential of four local plant extracts and two promising microbial formulations against 5th instar larvae of T. granarium. Toxicity bioassays revealed that the extracts of Citrus reticulata L. and Solanum nigrum L. were most effective against T. granarium causing significantly higher larval mortality (35 – 40%) than other botanical treatments. Similarly, the highest concentration (15%) of C. reticulata extract exhibited maximum repellency (88%) of larva...
Muhammad Rizwan, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad
...phs and adults on citrus plants. Results showed that the average population of mealybug nymphs (9.92 individuals per branch) and adults (14.55 individuals per branch) was higher in Bhalwal as compared to Kotmomin and Sargodha. The maximum population of nymphs (31.93 individuals per branch) was observed during April and the adult population was maximum (34.86 individuals per branch) during May. The nymphs and adults were remained lower in January and February. ...
Noor-us-Sabah1*, Mukkram Ali Tahir1, Ghulam Sarwar1, Muhammad Luqman2, Amir Aziz1, Muhammad Zeeshan Manzoor1 and Muhammad Aftab3
...r pH, conversion of P to plant unavailable forms take place. Chemical P fertilizers are needed to be applied at higher rate to fulfill crop demand. Farmers are unable to apply adequate levels of fertilizers due to poor economy and unavailability of fertilizers at the time of crop requirement. Among alternative cheaper sources of P, one is use of phosphate rock (PR). Pakistan is blessed with huge reserves of PR but poor solubility at higher pH makes it unsuitab...
Ali Zohaib1*, Muzzammil Hussain1, Iftikhar Ahmad1, Mushtaq Ali2, Tahira Tabassum3 and Adnan Bashir1
...16 produced the greatest plant height. However, Kissan Basmati and NIAB Basmati 2016 matured earlier while Super Basmati matured at last. The highest productive tillers and grains number per panicle were produced by Super Basmati and Chenab Basmati, respectively; however, maximum 1000-grain weight was produced by Noor Basmati and PK-1121 Aromatic. Among all varieties, the Chenab Basmati was highest yielder while NIAB Basmati 2016 produced the lowest yield. How...
Nazakat Nawaz1, Nasir Mahmood Cheema2*, Malik Muhammad Yousaf3, Muhammad Jahanzaib1, Mubashir Ahmad Khan1 and Muhammad Munir4
...tive selection as single plant progeny rows along with parents. PG-1090 being medium duration showed overall higher mean yield (4912 kg ha-1) in preliminary, advance, national uniform yield and on-farms trials compared to other lines and check cultivars BARD-479 and Golden. Its attributes include 70% shelling, 100-kernel weight 66g, 20-pods length 58 cm, oil content 53% and protein content 28%. It was also evaluated under natural field condition to check its p...
Doaa Khairy1, Mohamed Ali Osman2 and Fatma Abdel Mohsen Mostafa1*
...tectable augmentation in plant biomass better than other treatments. However, triple application of canola, moringa and neem leaf extracts (41.0%) surpassed all treatments and improved tomato length. All treatments significantly (P<0.05) suppressed nematode population, root galling and number of egg masses. The highest nematicidal activity was performed by leaf extracts mixture of moringa, neem and canola. NPK, chlorophyll Aand B, salicylic acid, phenols an...
Ishrat Younus1,2 and Afshan Siddiq1*
...udatus belongs to Radish plant has been reported for analgesic potential thus it might have antipyretic potential. The present investigation was undertaken to evaluate analgesic and antipyretic activities of ethanol extract of Raphanus sativus var. caudatus in albino mice. The analgesic and antipyretic activities were determined at three different doses (50, 100 and 200 mg/kg) using different pain models (writhing induced, tail flick) and yeast induced pyrexia...
Zunaira Noreen* and Khawar Sultan
...lecting tree species for planting....
Muhammad Ammar Dilawar1,2, Hong Seok Mun1, Myeong Gil Jeong1, Eun Ju Yang3, Hyeoung Seog Park4 and Chul Ju Yang1,2,*
...e that certain ratios of plant extracts and liquid minerals can be used to enhance the performance and meat quality in poultry....
Hosny Kesba1, Ashraf Suloma2, Samy Sayed3*, Abdullah Abdel-Rahman1 and Shaimaa Diab1
...n the production of many plants and is a major problem in organic systems. This study was carried out to examine the influence of irrigation with different effluent water sources, including semi-intensive tilapia pond (STP), intensive tilapia biofloc (ITB) systems, and well water (WW), on the reproduction of Meloidogyne incognita infecting eggplants7 or 45 days after planting in sandy loam...
Muhammad Tahir Jan1,2, Mushtaq Ahmad Saleem3,*, Muhammad Binyameen1,* and Sarfraz Ali Shad1
Treatment Approaches of Ovine Fungal Diseases using Antibiotics and Ethnoveterinary Medicinal Plants
Djadouni Fatima* and Meliani Amina
Tehseen Ali Jilani1*, Muhammad Saleem Jilani2, Javeria Sherani3, Kashif Waseem2, Muhammad Sohail Khan2, Hasnain Saleem3, Abdul Manan2, Rashid Jawad2 and Sami Ullah4
...imax and Green feast for plant height (81.33 and 80.77 cm), number of pods plant-1 (18.64 and 17.77), weight of pods plant-1 (51.74 and 50.89 g), pod length (11.09 and 11.31 cm), pod width (2.51 and 2.31 cm), number of grains pod-1 (8.02 and 7.64), and pod yield (5.61 and 5.50 t ha-1), respectively. Almost similar results were obtained in S2. Results concluded that the best yielding capabi...
Saima Naz1*, Ahmad Manan Mustafa Chatha2, Sajjad Ali2 and Muhammad Irfan Ullah3
...s with other insects and plants. Exposure of toxic level of heavy metals can cause DNA damage, learning, sensory disability and memory deficit. Major portion of insects have malformed growth and mortality rate affected by heavy metals, mainly with the exposure of pesticides. On the other hand, pesticides not only alter the behavior, growth and developmental physiology, gut microbiota, but also cause mitochondrial abnormalities. The use of different antibiotics...
Muhammad Tahir Latif1*, Muzzammil Hussain1, Ayesha Latif2, Majid Hamid Bajwa1, Iftikhar Ahmad1, Ali Zohaib1, Naeem Faisal1 and Muhammad Hamza3
...sis of mechanically transplanted rice (MTR) in comparison to conventional manual transplanting (CT). Convenience and snow-ball non probability sampling method was used due to less adoption rate of MTR with a sample size of 240. Among targeted MTR growers 72% had 6-row riding type mechanical transplanters (MT), 18% had 4-row walk after type MT and 10% had 8-row riding type MT. Super Basmati...
Syarif Husen1*, Devi Dwi Siskawardani2, Setiawan Deny Rexmardi1, Erny Ishartati1, Muhidin Muhidin1, Jumpen Onthong3 and Ivar Zekker4
...o high-qualitypotatoseedsplantedby thefarmers.Inincreasingpotatoproductivity,innovativetechnologyinpotatoseed productionintubersorseedscuttingisrequisite.Thisresearchinvestigatestheeffectof growingmediacompositiononthepropagationofstemcuttingpotato(G0)plantedinthe screenhouse.ConductedinSumberBrantasVillage(1700ma.s.l.),BumiajiRegency,City ofBatu,EastJava,Indonesia,thisresearchutilizedRandomizedCompleteBlockDesign withseveng...
Judith Kiptoo1*, Daniel Mutisya2, Paul Ndegwa1, Ruth Amata3, Lucy Irungu4 and Rotich Godfrey5
... crop losses by damaging plant roots and causing reduced absorption of soil nutrient elements. A two-year survey in 2018 and 2019 was conducted in most citrus growing regions in Kenya to assess the abundance, distribution and diversity of plant parasitic nematodes from different soil rhizosphere. Nematode population in 200cc of soil and 5g of roots were collected for PPNs extraction by using modified Baermann’s techniq...
Eman Alsayed Hammad and Atef Mohamed El-Sagheer
...ne of the most important plant pathogens in most Pomegranate cultivation regions. By studying the structure of the plant-parasitic nematodes community inhabiting the rhizosphere of Pomegranate fields, it was found that Meloidogyne is the most common genus and harmful one. So, the efficacy comparative of Chitosan, Marjoram emulsion oil, Trichoderma asperellum, and Vermicompost as alternative eco-friendly control agents for ro...
Jiang Wu*
...tration of T. officinale plant increased from 1/2 MIC to MIC, the intracellular ATP content further decreased (P<0.05). We concluded that the chemical constituents of T. officinale have antibacterial activity against the two Gram-positive and two Gram-negative bacteria. The chemical constituents of T. officinale can inhibit the growth of foodborne pathogens by inhibiting the expression of virulence genes and reducing permeability of cell membranes, thereby ...
Dali Wang1,2, Yujing Zhu1,2, Wancai Xia1,2, Mei Zhao1,2,3, Chan Yang1,2 and Dayong Li1,2*
... ten years. In total, 27 plant species were observed within the debris field, all classified as either shrubs or herbaceous plants. Gnaphalium hypoleucum had the highest importance value of the herbs (27.48%), while Leycesteria formosa had the highest importance value of the shrubs (17.33%). The Shannon-Wiener diversity index was significantly higher in the lower section and the Bray-Curtis distance was significantly lower, ...
Mubasshir Sohail*, Qadeer Ahmed Soomro, Raza Muhammad, Muhammad Usman Asif and Imran Rauf
...us approaches to utilize plant cellulose for energy development and its study would be of a great importance in the field of bioenergy and integrated pest management. The study was aimed to evaluate cellulolytic activity which was detected in the gut of mango mealybug, (Drosicha stebbingi). Initially, cellulolytic activity was detected from crude proteins using substrate-agar plate assay and laterally confirmed by endoglucanase assay. Enzyme activity measured ...
Shuhuan Li1*, Yongheng Bo2, Youzhi Li3 and Xiuzhen Yang2
...nergic drug from natural plants, and has been widely used in the clinical applications of animals and humans. However, in livestock production, excessive or improper use of atropine will lead to atropine residues in meat. When people eat animal meat from these sources, it will pose a potential threat to human health. Thus, in production practice, atropine residues in meat are usually determined quantitatively. In this study, high performance liquid chromatogra...
Muhammad Anwar Ul Haq1*, Tariq Mukhtar1, Muhammad Inam-ul-Haq1 and Azeem Khalid2
...tan, the low yield of eggplant is ascribed to legions of biotic constraints. Among biotic restraints, root-knot nematodes, Meloidogyne spp. are economically very important and cause losses to the tune of $ 125 billion per year throughout the world. The present studies were aimed to evaluate 21 eggplant genotypes against the most destructive nematode, Meloidogyne incognita, under greenhouse conditions. Of all the genotypes/va...
Tabassum Ara Khanum, Nasir Mehmood* and Shahina Fayyaz
...ara zapota L. van Royen) plantation at Saedabad, Karachi, Sindh, Pakistan, several soil sample analysis revealed one new and one known free-living soil nematode species, Neorhabditis andrassyii n. sp., and Poikilolaimus oxycercus which represents a new record of this species from Pakistan. Neorhabditis andrassyii n. sp. is characterized by having male (1109-1222) µm long body, spicules 32-44 µm long, gubernaculum slightly curved, boat shaped with f...
Jae-Kang Lee, Hyun-Su Hwang, Tae-Kyung Eom, Dong-Ho Lee and Shin-Jae Rhim*
... larch (Larix kaempferi) plantation in South Korea. Study animals were captured using Sherman live traps. We surveyed slope gradient and microhabitat conditions at multiple trapping points. We focused on two rodent species for statistical analysis, the striped field mouse (Apodemus agrarius) and the Korean field mouse (A. peninsulae). A. agrarius preferred microhabitat with dense ground vegetation, whereas A. peninsulae preferred understory vegetation. Ground ...
Mujahid Tanvir1, Muhammad Asam Riaz1*, Muhammad Zeeshan Majeed1, Mazhar Iqbal Zafar2, Muhammad Tariq3 and Muhammad Bilal Tayyab1
...xtracts of 40 indigenous plant species collected from Soon Valley and surrounding salt range of Pakistan bioassayed against C. quinquefasciatus larvae, eighteen botanicals exhibited more than 50% larval mortality in 48 h exposure. The most effective botanical extracts were Maerua arenaria Forsk, Nerium indicum Mill., Withania coagulans Dunal, Suaeda fruticosa (L.) Delile, Olea ferruginea Wall., Adiantum capillus-veneris L. and Dicliptera bupleuroides Nees exhi...
Nausheen Irshad1, Maria Akhter1, Tariq Mahmood2*, Faraz Akrim3, Muhammad Rafique Khan1 and Muhammad Sajid Nadeem4
...and pigeon), while among plant food it consumed seeds and twigs of wild mulberry, Japanese fruit, wild fig and cucumber. The study concludes that Altai weasel in Bunjosa Game Reserve occurs at an elevation range between 1773 m to 1875 m, and consumes most frequently insects, followed by small mammals, birds and reptiles, along with seeds and twigs of some wild plant species....
Eman Alsayed Hammad1* and Mahmoud Mohamed Hassanin Hasanin2
...rium oxysporum on coleus plants, Coleus forskohlii in vitro and greenhouse conditions. Nanoemulsions of thyme (droplets size was in the range of 25.4–32.9 nm) and spearmint (droplets size was in the range of 5.91–9.77 nm) at concentrations 4000 and 5000ppm separately, recorded the best results in vitro investigations, completely prevented F. oxysporum growth at all concentrations, and increased M. javanica mortality by 100%, in comparison to the no...
Erum Iqbal*, Firoza Kazi and Saboohi Raza
I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2, I Gede Mahardika1, I Gusti Nyoman Gde Bidura1
...af was a native tropical plant that contains saponin that may be used as de-faunating agent in ruminants. In some areas, these plants commonly being used as an alternative feed for ruminant, particularly during the dry season, but the study of its effect was limited. This study aims to determine the effect of additional Hibiscus leaf flour (HLF) in the concentrate on protein balance, blood metabolic profile, and body composi...
Asmaa Khamis1, Osama Abdalla1, Mohamed Hashem2, Noha Abdelnaeim1*
...go major (PM) are herbal plants that are supposed to have hepatoprotective properties. This study aimed to compare the effects of both medicinal plant extracts on rats intoxicated with carbon tetrachloride (CCl4). A total of 60 male albino rats were equally distributed in six groups. The first group received purified water and was kept as a control. The second and third groups were given oral PN and PM (500 mg/kg/day) for 31...
Iram Liaqat1*, Umaima Bibi2, Muhammad Arshad3 and Najma Arshad2*
...cted medically principal plants; Hyssopus officinalis, Origanum vulgare, Thymus vulgaris, Glycyrrhiza glabra, Cordia latifolia and Zizyphus jujuba. Antioxidant activity was determined by total phenolic content determination, Pyrogallol method, 2,2-diphenyl-1-picrylhydrazyl (DPPH), hydroxyl radical scavenging assay, and free-radical-scavenging assay. Results revealed that O. vulgare and T. vulgaris possess high free radical scavenging capability and significant...
Junaid Ali1, Muhammad Nawaz2, Muhammad Ilyas3, Muhammad Umer Chattha1, Imran Khan1, Muhammad Bilal Chattha4*, Muhammad Arshad5, Muhammad Akram6, Mina Kharal7, Ehsan Ullah1, Muhammad Talha Aslam1, Fareeha Athar1, Ayesha Mustafa1 and Muhammad Umair Hassan1
...lentil crop. The maximum plant height (47.66 cm), branches per plant (11.66), pods/plant (85.33), biological yield (5204 kg/ha), 1000 grain weight (20 g) and grain yield (1145.30 kg/ha) were recorded in ridge sowing with three irrigations applied 30, 60 and 90 days after sowing (DAS) and minimum plant height (38.33 cm) branches/p...
Adil Ali Gadahi1, Wajid Ali Jatoi1, Saima Mir Arain2, Jay Kumar Sootaher1*, Piar Ali Shar1, Sadaf Memon1, Muhammad Saleem Chang3, Zeeshan Majeed Kumbhar1 and Kirshan Kumar Menghwar1
...d index, grain yield per plant and harvest index. The genotype, V2-10-15 manifested minimum decrease for days to 75% maturity and spikelets per spike at zero irrigation and two irrigations. C7-98-4 gave minimum decrease for flag leaf area and V2-10-3 caused smaller amount of reduction for biological yield plant-1 at zero irrigation and two irrigations. The genotypes like V3-10-34, V2-10-15, C7-98-4 and V2-10-3 could be recom...
Muhammad Musa1*, Saba Saeed2, Azher Mustafa2, Muhammad Ussama Yasin2, Saima Naseer2 and Iftikhar Haider3
...liar application of five plant defense activators i.e., salicylic acid, citric acid, benzoic acid, KH2PO4 and K2HPO4 were tested against potato leaf roll virus (PLRV) in field conditions while two nutrient solutions i.e., macronutrients (N, P, K) and micronutrients (B, Zn, Cu, Mn, and Fe) were tested against the disease under glass house conditions during the years 2018 and 2019. All plant defense activators and nutrients we...
Muhammad Zeeshan Nadeem1, Muhammad Farrukh Saleem1*, Muhammad Ashfaq Wahid1 and Muhammad Anwar ul Haq2
...d that seed germination, plant growth, fodder yield and quality were improved by all seed priming agents over the control, but CaCl2 priming outclassed all other priming agents for all the attributes. For example, seed priming of CaCl2 increased plant height significantly during both years of study over the other priming agents. Similarly, maximum fodder yield during both growing seasons (67 t ha-1) was observed under C...
Noor Muhammad Khan1,2, Tariq Mahmood Khalil1,3*, Rashid Rehan2 and Iftikhar Zeb4
...of two locally available plant species Arundo donax (A.d) and Typha latifolia (T.l) for removing HM from the untreated wastewater of Hayatabad Peshawar used for irrigation downstream. The wastewater analysis showed that HM concentration exceeds the limits of thresholds values. For phytoremediation the T.l was tested in both on-site (in-situ) and laboratory conditions (ex-situ) while A.d was applied only in an ex-situ setup. For T.l, the average uptake of coppe...
Muhammad Bakhtiar1*, Fayaz Ali Niaz2, Asim Muhammad2, Mamoona Munir3, Wajiha Seerat4, Sadiqullah Khan5, Ghulam Yaseen6, Muhammad Noman Khan7 and Asma Bibi8
...nd sulfur act as the key plant nutrients that promote the plant growth and also raise the quality of its oil. It is very crucial to find a suitable dose of N and S for the oil crops, so keeping in view this experiment was designed in RCB design with 4 replications (each has one control plot) in research area of agriculture university Peshawar. Two factor were studied in this experiment i.e. 5 N doses (40, 80, 120, 160, 200 k...
Evaluation of Wheat (Triticum aestivum L.) Performance under Different Levels of Zinc and Phosphorus
Abdul Qadoos1, Muhammad Bakhtiar2*, Wajiha Seerat3, Asma Bibi4, Sohail Rahman1, Muhammad Noman Khan5, Ghulam Yaseen6, Mamoona Munir7 and Sadiqullah Khan8
...tiller m-2 (304), taller plants (95.40 cm), maximum spike length (10.72 cm), more grain spike-1(49), greater 1000-grains weight (42 g), greater biomass (10719 kg ha-1), maximum grain yield (4148 kg ha-1) and highest economical yield (38%). Regarding Zn levels Plots treated with Zn @ 16 kg ha-1 produce more plants m-2 (295), taller plants (93.5 cm), maximum spike length (10.57cm), more grai...
Naseem Sharif1,2*, Imran Muhammad Siqqique2, Muhammad Kashif Raza3, Urwa Irshad1, Muhammad Ikhlaq Khan4, Ammara Noreen4 , Muhammad Ahsan Qureshi1, Mohsin Abbas5, Muhammad Maaz Aziz5, Sitwat Riaz5, Komal Aslam5 and Naseem Akhtar6
...s. Management of natural plantation of Ziziphus nummularia in Thal zone is highly favoured to save rich genetic resources of this unique jujube specie....
Oluwatoyin Adenike Fabiyi
... the base of each tomato plant on the field. Significant (p<0.05) increase was noted in the vegetative growth of treated tomato plants. Fruit weight per plant and number of fruits per plant increased notably as opposed to the untreated tomato plants. Nematode population in root and soil of treated tomato
Rana Aamir Shehzad1, Ghulam Sarwar1*, Sabir Hussain Shah2, Mukkram Ali Tahir1, Noor-Us-Sabah1, Sher Muhammad2, Muhammad Aftab3, Muhammad Zeeshan Manzoor1 and Imran Shehzad1
... maximum increase in all plant parameters were recorded in T11 [T2 + all P from PROM (phosphorus rich organic manure)] followed by T13 (T2 + all P from phosphocompost). In case of soil characteristics, application of recommended NPK from chemical fertilizer (T2) recorded the highest pH (8.66) of soil, while the maximum EC (2.75 dS m-1) of soil was noted under the application of (T13) (T2 + all P from compost). Soil organic matter (0.90 %) was found to be maxim...
Inam Ul Haq1*, Muhammad Ramzan1, Mansoor Khan Khattak1 and Ahmad Khan2
...ring 2019. The levels of planting technique factor were; 0 m high raised seed bed (P1), 10 cm high raised seed bed (P2) and 20 cm high raised seed bed (P3). Compost from domestic residues (C2), a combination of urea with compost (C3), and urea (C4) were compared with control, no N-fertilizer (C1) in integrated nutrient management factor. The result showed that the treatments had a significant effect on the plant height, spik...
Teguh Wahyono1,2*, Wahidin Teguh Sasongko3, Wijaya Murti Indriatama4, Setiawan Martono5, Slamet Widodo3, Widhi Kurniawan6, Muhamad Nasir Rofiq7
...o degradability of whole-plant sorghum. Three sorghum varieties (Numbu, Super 1 and Samurai 1) were ensiled either fresh or wilted and evaluated in a 2 x 3 factorial arrangement. Based on sensory evaluation, colour, smell and sensory index increased after wilting treatment (P < 0.01). Based on chemical quality, pH and NH3-N values were lower in wilted groups than in unwilting sorghum silage (P < 0.01). Compared with non-wilted materials, higher dry-matte...
Farzana Begum* and Gohar Ayub
... in seeds harvested from plants sown on March 30 as compared to seeds harvested from late sown plants on May 9. Highest hard seed (23.69 %) was recorded in seeds collected from late sown plants on May 9 as compared to other sowing dates. As for as harvesting stages are concerned, maximum seed weight pod-1(3.57 g), 1000 seed weight (61.33 g), seed yield (1.67 t ha-1), germination (81.21 %) ...
Saima Mehar1 and Salma Javed2*
...ferent concentrations of plant extracts. During in-vitro condition inhibition of egg hatchability and J2 juveniles’ mortality varied according to the concentration of plant extract. WC=1 showed 100% mortality after 48 hrs of exposure at 1% with the lethal concentration (LC50) values 0.168 mg/land all four concentration are 100 % toxic at 72 h of exposure. W-56D proved to be 100 % lethal at 0.1 and 0.5 % concentration a...
Mohamed E. El-Speiy1, Tarek A. Sadak1, Mohamed A. Abd-Elaal1, Ayman M. Khalifah2, Amr S. Morsy2*
...owing rabbits, Medicinal plants, Synergistic effect
...
Ch. Muhammad Rafiq1, Muhammad Rizwan1*, Bilal Atta1, Arshed Makhdoom Sabir1, Misbah Rizwan2, Muhammad Arshad3, Muhammad Zeeshan3, Hamza Latif3, Usama Bin Khalid1, Shawaiz Iqbal1
...squo;s population. Brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae) is a serious insect pest of rice crops throughout Asia. In case of a severe attack, the whole crop turns brown called ‘hopperburn’ and farmers face great yield losses. The experiments were performed to evaluate the planting geometry and nutritional effects on N. lugens abundance and yield attributes of the crop using su...
Amany R. Sultan1, 2, Gamal A. Morsi2, Hoda El-Fayoumi1, Abdel-Azeem S. Abdel-Baki1*
...ate, Egypt. During first plantation in the first plantation, The results revealed that T. absoluta started to appear after one month from the plantation on the 3rd August week and increased gradually to show 5 peaks in the 7th September, 2nd November, 30th November, 28th December and 11th January. During second plantation in the first season, the populat...
Atta Ullah*, Nasrullah Khan, Ataur Rahman and Rafi Ullah
... gathered randomly about plants’ medicinal and folk uses in the park. One hundred and sixteen plants species belonging to 99 genera and 50 families were recorded and identified with the help of available literature. Of these, monocots were represented by 17 species under 15 genera and 5 families, while dicots were represented by 99 species belonging to 84 genera and 45 families. The results reflect that 24% of
Najmul Saqib* and Himayathullah Khan
...acticed as boundary line plantations; while in Swat intercropping is more common characteristics. A total of 390 households involved in agroforestry practices were interviewed. The study investigated the effect of agroforestry practices on farm income of rural households in KP. A Multiple linear regression model was used to find out the effect of area under agroforestry, number of fruit and wood trees on farm, schooling level of household head, number of farm ...
Sameena Gul1, Sayyeda Hira Hassan1, Amara Maryam1, Hafiz Abdullah Shakir1, Muhammad Khan*1, Muhammad Irfan2, Farah Rauf Shakoori1 and Javed Iqbal Qazi1
... dry leaves of green tea plant (Camellia sinensis). It has been observed to potentiate the apoptosis and also inhibit cancer cell growth by affecting various signaling molecules and cell cycle regulatory proteins. Clinical studies demonstrated that EGCG treatment of different type of cancers has synergistic effect in combination treatment with other common clinical drugs (cisplatin, taxol, doxorubicin and vinblastine) by modulating chemotherapy response to can...
Abdul Ghaffar*, Niaz Hussain, Muhammad Nadeem, Khalid Hussain, Muhammad Aslam, Mudassar Khaliq, Muhammad Irshad, Zubeda Parveen and Muhammad Younas
...mary & secondary per plant, days for maturity, plant height as well as potential yield were recorded. The measured data were analyzed to principal component analysis (PCA), correlation, and path coefficient analysis. Analysis of variants revealed good variation among the accessions for the data recorded traits. Principal coefficient analysis differentiates all the traits into six PCs. Two components expressed more than o...
Tooba Ather1, Muhammad Rafiq Shahid2*, Muhammad Ahsin Ayub3, Javed Iqbal2, Muhammad Asim Bhutta2, Muhammad Akram2, Naveeda Anjum4, Muhammad Rizwan6, Hafeezur Rehman5 and Umar Farooq5
...eed on diversity of host plants. Different concentrations of Pyriproxyfen and Buprofezin are Insect Growth Regulator (IGR) were bio-assayed against 3rd instar of CMBat Integrated Pest Management Laboratory, Department of Entomology, University of Agriculture, Faisalabad, during 2016. The results revealed that mortality of 3rd instar of P. solenopsis increased with increase in concentration of Pyriproxyfen and Buprofezin at three days of post application interv...
Muhammad Waqas Imam Malik1, Khalid Usman1*, Amir Hamza1, Muhammad Saad1, Said Ghulam2 and Azmat Ullah1
...of K2SO4 produced higher plant height, sympodial branches plant-1, bolls plant-1, 100 cotton seed weight, seed cotton yield, ginning outturn, fiber length, and fiber strength compared to other K-levels. Moreover, tillage × potassium interaction indicated that reduced tillage along with 250 kg K ha-1 plus 5 foliar sprays was superior to conventional tillage for producing higher sympod...
Waleed Asghar1,2*, Ahmad Mahmood1, Farhan Iftikhar2,3, Bushra Ahmad4, Rehmat Ullah5, Muhammad Bilal5, Abdul Latif6*, Muhammad Arsalan6, Madeeha Khan6, Rizwan Latif7 Muhammad Ehsan7
...fungal biomass influence plant growth. An incubation and pot experiments were carried out to investigate the effect of organic wastes [Poultry compost (PC), Poultry fresh manure (PFM), Chemical fertilizer (CF), and only soil (S)] was used at the quantity of 200 mg N kg-1. We observed that soil amended with PC have produced more phosphatase and β-glycosidase enzyme activities and nitrogen mineralization (36.96 mg kg-1), indicating that it could be contribu...
Muhammad Ajmal Khan1, Muhammad Yahya2*, Ali Hazrat2, Javed Khan3, Saeed Jan4, Tabinda Nowsheen2 and Inam Ullah5
...cork borer and 6μl of plant extract was added to the wells). The antioxidant activity of methanolic leaves extract was evaluated through a well established protocol 2,2-diphenyl-picrylhydrazyl hydrate (DPPH) at various concentrations (50, 100, 150, 200, and 250 µL). The phytochemical analysis of methanolic leaves extract of T. camphoratum showed 2.80% alkaloids, 4.90% flavonoids and 1.80% terpenoids content. The antibacterial activity of the methanoli...
Umair Faheem1*, Qurban Ali2, Mussurat Hussain1, Abrar Ahmad3, Tamsila Nazir2, Ghayour Ahmad3, Idrees Ahmad3, Madiha Mobeen4, Hammad Hussnain3 and Nadia Hussain Ahmad3
...ous insect pests. Cotton plants shows genetic resistance or tolerance against these insect pests. In the current experiment six varieties of cotton i.e. CIM-496, CIM-534, NIAB-111, MNH-786 and Bt-121 were sown in the field under sprayed and un-sprayed condition to check the genetic resistance or tolerance against these insect pests and to also check the population of the parasitoids. It was observed that MNH-786 and Bt-121 were the most resistant or tolerant v...
Syed Wajahat Husain Jaafry1* and Amber Fatima2
...is well established that plants can communicate with each other under different stressful conditions through (signals, cues, and rhizosphere interactions). Numerous studies have been conducted to find how plants respond to different neighbors at various points of genetic affiliation. Contrasting results and lack of molecular evidence in species recognition studies have made this topic more curious and complex. Some
Lyudmila Yakovlevna Rodionova*, Irina Valeryevna Sobol, Lyudmila Vladimirovna Donchenko, Artem Vasilevich Stepovoy and Andrey Georgievich Koshchaev
...and chemical analysis of plant materials were used. The biochemical parameters of pumpkins were studied: the content of dry substances, sugars, titratable acidity, the content of ascorbic acid and carotene. Data on the content and fractional composition of pectin substances in different parts of pumpkins are presented. The kinetics of changes in the content of pectin substances in pumpkins after harvesting and storage for 90 days are shown. To assess the quali...
Muhammad Jamil1*, Kamran Javed1 and Imran Akhtar2
...rains for disease index, plant population and micronaire value at (p<0.05), while means for all other study traits were found highly significant at (p<0.01). Descriptive statistics illustrated presence of sufficient range in the studied traits. Out of 11 principal components (PC), first 5 PC indicated Eigen value >1 and contributed 75.826% towards cumulative variability. Yield related traits plus lint quality attributes depicted positive loading behav...
Khaliq Dad1, Fenliang Zhao2, Rumsha Hassan3, Kainat Javed3, Humaira Nawaz4, Muhammad Usman Saleem5, Tahreem Fatima6 and Muhamad Nawaz3*
...e used for prevention of plant diseases, weeds and being used widely for increasing the quantity as well as quality of food products. Naturally, these pesticides interact with environment by altering the properties of host substances by producing the adverse impacts because most of the famers have no idea of using these chemicals substances. Pesticides are absorbed by soil particles which are transported to plants as well as...
Amina Batool1*, Saba Aleem1, Ali Nawaz1, Muhammad Imran Khan1, Waheed Arshad1, Muhammad Aslam2, Shiraz Ali3 and Muhammad Zeeshan3
...gnificantly affected all plant traits except days to 50% heading, plant height and germination percentage. Contrarily, the interactive effect of genotype and seeding rate on all growth and yield attributes was found non-significant. Whereas, seeding density of 120 kg ha-1 exhibited more germination percentage (85 %), shoot length (11.57 cm), coleoptile length (3.97 cm), days to 50% heading (130), pla...
Muhammad Furqan and Zulfiqar Ali
...ostly the kalij consumes plant matter as the major diet. We recovered 45 plant species in major, minor, and trace forms which consisted of seeds, leaves, flowers, fruits, rhizomes, and bulbs. Invertebrates including ants, insects, larvae, and grit were also recorded. According to respondents the highest sighting (62.4%) of kalij pheasant was recorded from the forest, followed by cultivated land (20.4%). Major threats to kali...
Deepesh Kumar Bhuptani1, Atta Hussain Shah1*, Gul Bahar Khaskheli1, Zubair Ahmed Laghari2, Ghulam Shabir Bahram1, Muneer Ahmed Jamali1, Tarique Ahmed Khokhar1
...F) occurring in foods of plant origin (B1, B2, G1, and G2) and animal origin (M1 and M2). Aflatoxin M1 (AFM1) is a geno-toxic carcinogen and is less lethal but it is still cytotoxic. The present study was conducted on prevalence and quantification of AFM1 in raw buffalo milk in Sindh province. A total of three hundred and fifteen raw milk samples (n=315) from dairy farms of three regions in Sindh province i.e., southern (Karachi, Thatta, Hyderabad), central (M...
Hakan Kececi1*, Yasin Ozturk2, M. Bahaeddin Dortbudak3, Seda Yakut4, Gurdal Dagoglu5 and Merve Ozturk1
...lebur, potentially toxic plants is found abundantly in meadows and pastures. One of the most significant ingredients that causes toxicity is atractyloside (ATR). In this study, the concentration of ATR in cocklebur seeds was determined as 4 mg/g seed. The study involved 54 rats which were divided into a total of 9 groups including one control group. A single dose of cocklebur seed extract was provided by gavage after being concentrated by 2 ml for each animal ...
Jiacheng Du and Yuping Cao*
...icantly higher rate in implantation rate, high-quality embryo rate, biochemical pregnancy rate as well as clinical pregnancy rate (P<0.05), while the incidence of early miscarriage, pregnancy-induced hypertension, and gestational diabetes of patients in Group A is significantly lower (P<0.05). AMH level showed high specificity (77.52%) and sensitivity (81.46%) in predicting IVF-ET clinical pregnancy in PCOS patients. PCOS patients with lower AMH levels s...
Chemoprotective Effect of Daphnetin against Benzene Induced Leukemia Cancer via Alteration of CYP2E1
Junling Liu, Chen Sun, Qiao Yu, Yanzhi Liang, Shanshan Lin and Meng Tian*
...py, allogeneic cell transplantation and radiation therapy with side effects. Due to side effect linked with the treatment, medicinal herbs treatment having the more attraction to treat the leukemia. The current study was to scrutinize the anti-leukemic effect of daphnetin against benzene induced leukemia in rats and explores the underlying mechanism. Benzene was used for the induction of leukemia in experimental rats. The rats were divided into different group...
Umar Farooq Gohar, Attia Majeed, Bushra Muneer* and Hamid Mukhtar
...n lignan produced by few plant species and endophytic fungi is used as precursor for the chemical synthesis of the anticancer drugs. In the present study, for the isolation of podophyllotoxin producing endophytic fungi 30 plant (Podophyllum hexandrum) samples were collected from different localities of Pakistan. About 261 fungal strains isolated, among them 22 strains had the ability to produce podophyllotoxin. Maximum podop...
Maria Endo Mahata1*, Hamdan Sukri Lubis1, Takayuki Ohnuma2, Yose Rizal1
...ing pellet made of Miana plant as poultry feedstuffs. This experiment was administered in a completely randomized design with two factors. The first factor was natural pellet binders composed of brown seaweed Sargassum binderi, taro tubers (Colocasia esculenta (L.) Schott), and tapioca flour (Manihot utilissima), and the second factor was dosage (1.5; 3; and 4.5%) of natural pellet binders. Each treatment was repeated three times. The measurements were mo...
Nguyen Hai Quan, Nguyen Huu Van*, Nguyen Thanh Thuy, Vo Thi Minh Tam, Le Duc Thao, Le Duc Ngoan
...ling techniques of whole-plant sunflower Aguara 6. In Exp. 1, whole sunflower plant was harvested at the seeding period (SP) to measure biomass yield, chemical composition and energy values. Results showed that, fresh biomass yield was 62 tonnes/ha, in which, heads consisting of 46.8% with the highest, leave accounting for 35.5% and stems consisting of 17.7% as fresh matter with the lowest proportion. The dry matter (DM) con...
Muhammad Rizwan, Abu Bakar Muhammad Raza*, Muhammad Zeeshan Majeed and Muhammad Arshad
... toxic effect of various plant extracts against D. mangiferae. Three concentrations (i.e. 6.25, 12.5 and 25.0%) of leaf extracts of neem, Azadirachta indica A. Juss (Meliaceae), eucalyptus Eucalyptus camaldulensis Dehnh. (Myrtaceae), datura Datura stramonium L. (Solanaceae), batho Chenopodium album L. (Amaranthaceae) and Indian lemongrass Cymbopogon citratus (DC.) Stapf (Poaceae) were tested against 3rd instar nymphs of mealybug. Results showed that mean morta...
Shahbaz Ahmed1, Mubeen Ahmad1, Muhammad Razaq1* and Farhan Mahmood Shah1,2*
... have profound impact on plant physiology. The altered physiology of stressed plant can also modify trophic interactions in that plant environment. Aphids are important pests of wheat crop causing direct or indirect injury to the crop. The pest is routinely managed through use of insecticides. Insecticides due to their toxic effects are mostly not desired for use on food crops. Thus, alter...
Iqtidar Hussain1*, Shakeel Ahmad Jatoi2, Muhammad Jawad Nazir1, Ehtesham Ul Haq1, Faheem Abbas1 and Muhammad Saqib Raza Shah1
...lelopathy from perennial plants (trees) surrounding our crops in the field is our focus in agroforestry. To quantify its severity, the phytotoxic impact of popular (Populus deltoides L.) leaves aqueous extract was determined in cultivated oat (Avena sativa L.), maize (Zea mays L.), rice (Oryza sativa L.), pearl millet (Pennisetum glaucumL.), bread wheat (Triticum aestivum L.) and sorghum [Sorghum bicolor (L) Moench. Response of aqueous leaves extract was asses...
Muhammad Riaz Gondal1,2*, Sobia Ijaz1, Nauman Ali1, Muhammad Saeed Ashraf1, Muhammad Naeem Khan1, Muhammad Arshad3, Muhammad Arif1, Jamil Akhtar4, Naeem Iqbal1 and Bushra Zulfiqar5
...eeding rate consequently plant density on forage and seed tonnage in order to enhance the net return. Experiment treatments comprised of seven seed rates viz., 10, 12.5, 15, 17.5, 20, 22.5 and 25 kg ha-1. Sowing was completed up to 7th October in each year of study using seed of new cultivar Punjab Berseem. All forage contributing characters were recorded at each cut of fodder and grain tonnage at harvesting were evaluated and documented. Data of agronomic cha...
Allah Bakhsh1, Attiq Akhtar2, Fiaz Hussain3, Hafiz Wasif Javaad4, Inam ul Haq5* and Humara Umar5
...d that maximum yield per plant (15.20 kg) was fetched by Black Ball cultivar in contrast to Swat Local cultivar (9.37Kg). Results of biochemical parameters declared Black Ball as a superior cultivar owing to the maximum value of TSS (15.55%), total sugars (10.85%), antioxidant activity (75.75%) and minimum value of titratable acidity (0.15%). The results suggested that among studied fig cultivars, Black Ball is a premium fig cultivar having superior physical a...
Ghulam Qadir1, Khalil Ahmed1*, Muhammad Ashfaq Anjum1, Quais Muhammad Affan2, Muhammad Zaighum Mushtaq3, Muhammad Amjad Qureshi4, Amar Iqbal Saqib1, Hafeezullah Rafa1, Abdul Wakeel1, Ghulam Shabir1, Muhammad Rizwan1, Muhammad Qaisar Nawaz1 and Muhammad Faisal Nawaz1
...ening of available local plants which can grow or survive under salt stress and have considerable economic importance to the farming community. Therefore, a three-years pot experiment was executed to explore the salinity tolerance of medicinal plants i.e., Podeena (Mentha spicata), Hina (Lawsonia inermis), Qulfa (portulace oleracea), Methi (Trigonella foenumgraceum), Dill (Anethum graveolens) and Kalwanji (nigella sativa), u...
Muhammad Umer Chattha1, Muhammad Ilyas2, Imran Khan1, Athar Mahmood1, Muhammad Bilal Chattha3*, Ambreen Fatima4, Muhammad Iqbal5, Muhammad Tahir Akbar6, Muhammad Mahmood Iqbal5, Faran Muhammad7, Muhammad Talha Aslam1 and Muhammad Umair Hassan1
...nd EI. Likewise, maximum plant height (PH: 68.20 cm), root length (RL: 7.70 cm), shoot length (SL: 16.67 cm), root fresh weight (RFW: 0.45 g) and shoot fresh weight (SFW: 5.22 g) were recorded in control condition while minimum was observed under high salt stress. Cultivars Bhaker-2011 had maximum PH (67.70 cm), SL (14.02 cm), and SFW (5.27 g) while cultivar NIAB-2016 had minimum PH (57.10 cm), SL (14.02 cm), and SFW (4.54 g) among the cultivars. The maximum c...
Ghalib Ayaz Kachelo1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Shahbaz Talib Sahi1, Nasir Ahmad Khan1, Akhtar Hameed2, Noor Muhammad1 and Muhammad Saqib Mushtaq1
...ficacy of fungicides and plant extracts against leaf spot disease of spinach caused by Alternaria alternata five plant extracts and five fungicides were evaluated under in vitro and field conditions by using complete randomized design (CRD) and randomized complete block design (RCBD). In plant extracts moringa (Moringa oleifera) showed minimum fungal growth (20.790) mm followed by ginger (...
Husmaini1*, Sabrina1, Firda Arlina1, Linda Suhartati1, Yozella Martilova2
...f probiotics Lactococcus plantarum and Pediococcus pentasaceus using a purple sweet potato carrier on laying hen’s performance and egg quality. This study used 210 layers of medium-type laying hens, Strain Isa Brown, 38 weeks old. The method used was an experiment with a completely randomized design (CRD) with seven treatments and three replications. The observed variables were ration consumption, ration conversion, egg mass production, hen day producti...
Rashid Al Zeidi1, Haitham Al Masruri2, Aiman Al Mufarji3, Abd El-Nasser Ahmed Mohammed3, Al-Hassan Mohammed4*
...rgo fertilization, pre-implantation and post-implantation embryo development. Oocyte meiotic maturation in vivo starts after LH hormone surge whereas it starts in vitro upon release of oocyte from the ovarian follicle. Rodent oocyte maturation lasts 15-17hr. whereas that of ruminant oocyte lasts 24hr. Several factors affect on oocytes maturation either in vitro or in vivo and therefore affect development of the resulting emb...
Sajid Ali1*, Shahen Shah2, Muhammad Amin3, Asad Ali Khan2, Sajjad Khan4, Dawood Ahmad5, Faiq Ahmad2, Maaz Khan2, Sikandar Azam1, Siddique Ahmad2 and Bismillah Khan2
...d silking (55), leaf areaplant-1 (4180 cm2), leaf area index (2.8), plant height (255 cm) and days to harvest maturity (89 were significantly affected when120 kg P ha-1 was applied. Days to tasseling (53), days to silking (55), leaf areaplant-1 (4400 cm2), leaf area index (3.1), plant height (258.6 cm) and days to harvest maturity (89) were significantly...
Tertia Delia Nova1*, Yulia Yelita2, Rizky Machicula1
...ntally friendly. Aquatic plants belong to the duckweed family which can be found in swamps, lakes, and rice fields. This feed is classified as an unconventional feed that can be used as an alternative feed ingredient for fibrous protein sources. In addition, it contains several minerals, xanthophyll pigments and -carotene which are important nutrients for ducks. However, the practical use of this plant has not been fully stu...
Nagina Zeb* and Noor ul Amin
...tudy impact of different planting dates during 2016-2017 (July 01, July 16, July 31, August 15 and August 30) and two cutting types i.e. Hard wood and Semi-hard wood cuttings on rooting response of Silvery treated with various concentrations of IBA (control, 2000, 4000, 6000 and 8000 ppm) at Ornamental Nursery, Horticulture Department, The University of Agriculture Peshawar. The trial was arranged in Randomized Complete Block Design (RCBD) with split-split plo...
Hassan Raza1, Muhammad Zeeshan Majeed1*, Muhammad Irfan Majeed2, Mujeeb-Ur-Rehman1 and Muhammad Asam Riaz1
...ticultural crops, forest plantations and wooden infrastructures. Farmers rely primarily on direct applications of liquid insecticides which usually get off the target site resulting in unsatisfactory and short-term termite eradication along with environmental contaminations. This situation necessitates looking for more target-oriented and ecologically safer strategies such as baiting insecticides with some cellulose attractant. In this study, 5% technical grad...
Waqas Raza1*, Muhammad Usman Ghazanfar1, Muhammad Asif2, Ikram-ul-Haq3, Muhammad Zakria4 and Laith Khalil Tawfeeq Al-Ani5,6
...ical characteristics for plant-pathogen may add knowledge of the taxonomic behavior of pathogen. The usage of various growth media is providing a useful pattern of the growth that can be utilized in determining the best possible control of late blight disease....
Entesar Z. Eliraqy1*, Basant M. Shafik2, Yasser S. Hussein1, Abdelwahab A. Alsenosy3, Emad A. Abd allah1, Mohamed F. Saad1
Muhammad Waseem Akhtar1*, Khalid Mahmood Khawar2, Muhammad Naeem Akhtar3, Muhammad Rafique1, Khalid Hussain4, Sharmin Ashraf1 and Muhammad Fida Hassan1
...n-target organisms. Host plant resistance against insect pests is considered best ecological approach to pest management. Keeping this in consideration, the current research activity is planned to screen out available germplasm of chickpea against dhora beetle (Callosobruchuschinisensis). For this purpose, 8 genotypes of chickpea genotypes were taken from Ayub Agricultural Research Institute, Faisalabad. 1 kg of each genotype was taken in plastic jars. There w...
Shou-Dong Zhang1,2,3, Dao-Xin Liu1,2, Dan Mou1, Tong-Zuo Zhang2, Jian-Ping Su2 and Jiu-Xiang Xie1*
...aring the composition of plant species present in overwinter caches and inside nearby quadrats of zokor burrow systems on the Qinghai-Tibet Plateau. Based on human volunteer taste-testing, or assignment using the Chinese Materia Medica Monographs, we divided the collected plant species into four different taste groups (sweet, bitter, other-taste, and tasteless) and then compared Ei values to determine whether
Muhammad Younas1*, Khalid Hussain1, Abdul Ghaffar1, Muhammad Atiq2, Niaz Hussain1, Wasim Abbas3, Muhammad Azeem Khan4, Muhammad Nadeem1, Muhammad Irshad1, Nasir Ahmad Khan2 and Muhammad Zubair5
...t of some fungicides and plant extracts was determined for disease suppression on a susceptible variety of onion. During both years of study, eight accessions (Phulkara, Texas Early, Cylon, Sunset, Red Gystal, Rubi F1, Red Flame, ON-14133) exhibited resistant response with minimum percent disease index (PDI) which ranged between 5-10%, followed by Mirpurkhas, Nasarpuri, HON-1069, Pania, Rubi F2, GSL-132, Red Moon, PK-1032, F-1122, Red Imposta, Early Red, Desi ...
Olufemi Bolarin, Sijuade Adebukola Adebayo and Sola Emmanuel Komolafe*
...le the farmers preferred planting of early maturing yam seed (Mean=3.58), use of mulching (Mean=3.46), crop rotation (Mean=3.27), organic fertilizer (Mean=3.07) and cover crops (Mean=3.05). The result of regression analysis showed that coefficient value of farm size (p=0.017) and membership of cooperatives (p=0.013) positively enhanced resilience building used to mitigate the effects of climate change. The study further averred that inadequate finance, traditi...
Oluwatoyin Adenike Fabiyi
... evaluation of medicinal plants as probable sources of nematicides. A study was conducted in the screenhouse to evaluate the nematicidal potential of Tridax procumbens and Sida acuta (weeds) on root knot nematodes Meloidogyne incognita infesting lettuce and carrots. T. procubmens and S. acuta was applied as soil amendment (400, 600 & 800g) and organic solvent crude extracts (40, 60, 80g/kg soil) in M. incognita infested lettuce and carrot
Zulqarnain Haider1*, Muhammad Akhter2, Syed Sultan Ali1, Tahir Latif1, Rana Ahsan Raza Khan1, Awais Riaz1, Tahira Bibi1, Muhammad Ijaz3, Qasim Raza1, Mohsin Ali Raza4, Samina Sarfaraz1, Muhammad Iqbal1 and Muhammad Rafiq1
...positive relationship of plant height with days to maturity and highly negative with panicle length and thousand grains weight. Dendrograms divided the genotypes into six distinct Clusters. Based on GGE biplots, PK10324-1-1 followed by PK9444-8-1-2 and PK10029-13-2-1 were identified to be most superior and potential candidate Basmati lines with better yield and stability across three years (growing seasons). Whereas, Super Basmati (check), PK 10436-2-1-1, PK10...
Muhammad Shafiq1, Tehseen Ashraf2*, Sehrish Mushtaq1, Naveeda Anjum3, Muhammad Asim4, Muhammad Aqeel Feroze3, Malik Abdul Rehman4 and Marja Aziz3
...es. A Protocol for chili plant regeneration with hypocotyl and cotyledon explants was established. The study was conducted to observe the effect of genotypes, culture conditions and growth regulators on plant regeneration of chili pepper genotypes (Seedex Pepper (SP), Loungi, Tatapuri, and Sanam) grown in Pakistan including. For both hypocotyl and cotyledon explant...
Hurriya Alzahra1, Susmiati Susmiati2*, Sri Melia3
...a, specifically the Lactiplantibacillus pentosus HBUAS53657. This study aims to determine the antioxidant activity, total phenol, and organoleptic characteristics including the taste, aroma, and texture of fermented milk with orange juice added (Citrus nobilis L.). The study was based on a Factorial Completely Randomized Design (CRD), with starter concentrations of 4 (A1), 5 (A2), and 6% (A3), as well as orange juice concentrations of 10 (B1), 15 (B2), and 20%...
Hafiz Kashif Ali1, Iftikhar Ahmad1, Mujahid Ali2*, Zahoor Hussain3, Muhammad Ather Nadeem4, Malik Abdul Rehman5, Barkat Ali6, Muhammad Iftikhar7
... after one month of transplanting, while the other two were applied at fortnight intervals after the first spray. Fisher’s Analysis of variance revealed that Isabion at 1 ppm as 1 spray, 3 ppm as 3 sprays, and 5 ppm as 3 sprays produced the highest plant height for three cultivars of stock. ‘Cheerful White’ had the highest stem length when plants were sprayed once at 1 pp...
Riaz Hussain1*, Adnan Ihsan2, Azaz Ali Shah2, Najeeb Ullah2, Hamza Iftikhar3 and Ranra Jalal4
Habib Ullah Habib1, Malik Muhammad Akram2, Mujahid Ali1*, Tahir Mehmood3, Muhammad Manzoor4, Maqsood Ahmad3, Hasseb Ahsan1, Muhammad Mazhar Iqbal3, Malik Abdul Rehman5, Muhammad Mohsan1 and Ahsan Mohyo ud Din6
...hrough Crop Watt. Kinnow plants showed significant results regarding plant canopy, plant height, the average weight of fruits, the weight of large size fruits, the weight of medium size, the weight of small size fruits, number of fruits per plant, number of small fruits per plant, number of medium-size fruits per
Zain-ul-Aabdin Abro1*, Naheed Baloch1, Raza Muhammad Memon2, Niaz Hussain Khuhro2 and Waseem Akbar Qazi2
...terious pests of several plant species. Trybliographa daci (Weld.) and Diachasmimorpha longicaudata (Ashmead) are natural enemies of fruit flies widely used as bio-agents in biological control programs against Bactrocera species. In current investigations we inspected the infected guava and mango fruits from lower (Hyderabad) and upper (Larkana) Sindh regions for population surveillance of parasitoids during 2019. The results shown (P<0.05) maximum number o...
Dhiya Altememy1, Mohammad Darvishi2*, Samira Shokri3, Saber Abbaszadeh4
.../mm on day 21. Medicinal plants Origanum vulgare and Hypericum perforatum, especially their active ingredients hypericin and carvacrol, reduce wound microbial load and inflammation and ultimately repair wounds in diabetic rats due to antimicrobial and anti-inflammatory activities. They can therefore be used as an effective remedy for healing wound infections in diabetics.
Keywords | Nanoparticle, Herbal plants, Diabe...
Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Ehsan Ullah1, Ali Raza1 and Muhammad Asif3
..., macro-micro nutrients, plant-immobilized microflora, growth regulators and promoters and cellular portion degrading enzymes (cellulose, proteases, lipase, amylases, chitinase), which degrade organic substrates even after they have been secreted. Earthworms change the chemical and physical characteristics of organic substrates, over time reducing the C:N ratio, increasing the surface area exposed to bacteria, and improving the microbial degradability of organ...
Kokab Nazim1*, Asghari Bano1 and Ghulam Jellani2
...lling stress. After transplanting tomato plants were divided into controlled and chilling stressed. Chilling stressed set was placed in open field to apply stress while control treatment was kept in polytunnel. All the genotypes showed significant variability in cold tolerance during two growing seasons. A significant reduction in plant height, setting %age and fruits per
Chooi Lin Phooi1, Elisa Azura Azman1* and Roslan Ismail2,3
... and eventually enhanced plant growth and yield production. Bokashi enhances the plant’s initial and later growth performance, including seed germination, seedling survival rate, fruit diameter, fruit size, fresh and dry matter, chlorophyll content, leaves the area, leaves number, plant nutrient, sugar, total soluble solid, organic acid, and ascorbic acid. No doubt,
Ishtiaq Ahmad1,2* and Muhammad Akbar Anjum1
...lusmn; 0.82 cm), maximum plant height was gained in genotypes AZRI-Selection-06-1C (71.35 ± 4.63 cm), while maximum yield per plant was calculated in genotypes Sky Line 2 (325.95 ± 19.48 g), maximum number of leaves per plant were counted in genotypes AZRI-Selection-02-A2 (516.91 ± 22.29), however maximum leaf area was recorded in genotypes Kot Sultan (62.24 ± 2...
Asma Hassan*, Zuhair Hasnain, Muhmmad Asadullah, Syed Saqlain Hussain and Muhammad Abbas Anees
...d of quinoa. The maximum plant height (66.133cm) and the number of branches (5.667) were with N 95 kg ha-1. Leaf area plant-1 from 0 to N85 kg ha-1 was increased gradually but later on, decreased. Gradually the Dry matter formation increase with an increase in N level, but above 85 kg ha-1 dry matter formation was regressively declined. The highest dry matter accumulation and harvest index 66.6g plan...
Muhammad Jamil1*, Muhammad Ihsan Ullah2, Taj Muhammad2, Syed Waqar Hussain Shah3, Khezir Hayat4, Muhammad Zahid Aslam5 and Abdul Sattar6
...eld (209 kg ha-1) on the planting date of 16th June. The finest lint-bearing micronaire value (3.9656) was obtained by normal season sowing in 1stMay. Late sowing on 16th June resulted in coarse lint with (4.8189) micronaire value. Tough staple was found (33.511 g tex-1) at 1st March sowing, while frail staple (28.856 g tex-1) resulted in 16th May planting. In prevailing climatic conditions sowing of cotton on the earliest d...
Qurban Ali1, Habib-ur-Rehman2, Muhammad Abdullah3, Asad Aslam1*, Muti Ullah4, Ali Sher5, Muhammad Faheem Akhtar1, Humaira Malik1, Muhammad Umar Qasim1, Muhammad Yasir6, Ijaz Haider1, Tamsila Nazir1 and Muhammad Jawad Saleem1
...the highest reduction in plant infestation (96.08%) and no of dead hearts (93.65%) was noticed inthecase of Chlorpyriphos 40% EC while the lowermost infestation reduction i.e. 55.12% was noted in case of Fipronil 0.3% G treated plots. Results of mean infestation values of C. partellus depicted that maximum mean infestation was 72.11% and 59.11%was noted in control during the peak population months, August and September. Results of population dynamics with abio...
Shabana Ehsan1*, Aneela Riaz2, Muhammad Amjad Qureshi1, Abid Ali1, Ifra Saleem3, Muhammad Aftab3, Khalid Mehmood4, Fakhar Mujeeb1, Muhammad Asif Ali1, Hina Javed1, Fraza Ijaz1, Anwar-ul-Haq5, Khaliq-ur-Rehman3 and M. Usman Saleem4
...y and development of the plant. In Fe-limiting conditions, plants and plant growth-promoting rhizobacterial (PGPR) have a siderophore production mechanism. Inoculation with seed soaking of such siderophore-producing bacteria can be a cost-effective biofortification technique. The current study includes the collection of rhizobacterial isolates from wheat, maize, sorghum, millet, and maize ...
Khalid Khan1*, Mahmood-ul-Hassan2, Ihsan Ullah1, Haris Khurshid1, F.Y Saleem Marwat1, Salman Saleem1, M. Jehanzeb1 and Zubair Ahmad1
...SR90, highest leaves per plant (11.68) were reported of hybrid combination ICSA220XICSR90, maximum leaf to stem ratios (0.02) was recorded for hybrid combinations ICSA233XICSR90, high stem weight (327g) was recorded for hybrid combination ICSA216XICSR-1, maximum days to 50% flowering (77) was recorded for hybrid combination ICSA88019XICSR93012,excellentcrop stand depicted by hybrid combinationICSA220XICSR55, maximum panicle length (25.23cm) was recorded for hy...
Ahmad Nadeem1,2 and Rubina Arshad1,2,*
... was designed to explore plant-associated endophytic lactic acid bacteria (LAB), enhance their plant growth promoting efficacy by induced mutation and unlock their potential as bio-inoculant. Lactobacillus plantarum specific medium and non-selective media were used for isolation of LAB from plant cuttings. A total of seven isolates were isolated on the b...
Azra Kalhoro1, Abdul Aziz Mirani2, Fozia Khan Siyal1, Tahira Jatt2*, Abdul Razak Mahar1, Sadia Iram3 and Muhammad Abbas Bhutto4
...cated and accumulated in plants and subsequently transferred to human body through the food chain, yet it has become the most commonly used water source for irrigating vegetable crops in peri-urban or urban areas of several countries including in Pakistan. Karachi, the metropolitan city of Pakistan, is the largest industrial and financial hub of the country with an estimated 16 Million population of multilingual, multi-cultural and multi-religious peoples. The...
Xibin Liu1,2,3, Weijun Guan2,* and Dong Zheng1,*
...ntal basis for cell transplantation therapy in tissue engineering....
Ahmad-ur-Rahman Saljoqi, Muhammad Tayeb and Muhammad Salim*
...3, PS-5, NIFA-lalma were planted in Randomized Complete Block design (RCBD) having three (3) replications. Data regarding the population trends of R. padi and its associated natural enemies were recorded on weekly basis. The result showed significant differences among different wheat cultivars with respect to the time interval for most of the parameters. Aphid’s population was at its peak during the 3rd week of February but later on, the aphid’s po...
Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2
...bserved in leaves of fig plants. To evaluate the presence of Fig latent virus (FLV -1) in fig plants. One hundreds fig trees were collected with virus-like symptoms and symptomless fig trees. The virus was detected by DAS-ELISA. Infected fig leaves were mechanically inoculated on Chenopodium amaranticolor L. and reinoculated on Ch. amaranticolar L. and Nicotiana glutinosa for virus propagation. Fresh wood cuttings (4-6 nodes...
Reza Aghnoum*, Hamid-Reza Sharifi, Masoud Ghodsi and Ahmad Zare Fizabadi
...t of CA practices on non-plant pathogenic nematodes is not well understood. This study was carried out to determine the effect of CA on population density of fungivorous (Aphelenchus avenae) and free-living nematodes under four crop rotation patterns. The experiment was arranged as a split plot in randomized complete block design with three tillage systems (conventional tillage, minimum tillage and no-tillage) as the main plots and three level of crop residue ...
Jeki Mediantari Wahyu Wibawanti1,3, Sri Mulyani2*, Rudy Hartanto1, Ahmad Ni’matullah Al-Baarri2, Yoyok Budi Pramono2, Anang Mohamad Legowo2
... apple and Lactobacillus plantarum in the characteristics of goat milk. This study used a Completely Randomized Design (CRD) with five treatments and four replications, with differences in the addition of synbiotics inulin from extracted mangrove apple and Lactobacillus plantarum. Yogurts with no synbiotic were used as a control, while yogurts with synbiotics of 2, 4, 6, and 8% (v/v) were used in another treatment.The result...
Hasnain Raza1*, Tanveer-ul-Haq1, Muhammad Imran1, Nabeel Ahmad Ikram2 and Muhammad Bilal Shoukat1
...ake wastewater treatment plants for the elimination of hazardous contaminants....
Madad Ali1, Muhammad Ahsan1, Muhammad Zubair Akram*2 and Samreen Nazeer3
...notypic correlation with plant height (r = 0.784) followed by number of leaves per plant (r = 0.715). Grains yield also showed the highest positive and significant phenotypic correlation with plant height (r = 0.469) followed by total biomass (r = 0.431). Number of grain rows per cob (r = 2.662) exhibited the highest positive direct effect on grain yield per plant<...
Samina Kausar1, Rana Badar Aziz2, Muhammad Waseem3, Muhammad Ahmad3, Hamza Shafiq4, Muhammad Asim5, Usama Zia6, Sobia Afzal7, Wanpeng Xi8*, Mansoor Hameed1* and Muhammad Usman Shoukat9
...ynthetic organisms e.g., plants, bacteria, and algae, while carotenoids also be synthesized in some non-photosynthetic fungi or bacteria. The color gamut of carotenoids is from colorless to yellow, orange to red color, with variations reflected in many vegetables, fruits and flowers. They are categorized into two types: (1) xanthophylls and (2) carotenes. For instance, lycopene is found in tomatoes and watermelon, beta carotene in sweet carrots and potatoes, l...
Maize Yield Performance Under Planting Patterns and Row Spacing in Semi-Arid Zone of Pakistan-Mardan
Shakir Ali1, Zia Ul Haq1, Abdul Malik1, Tariq Mahmood Khalil1,2* and Ijaz Ahmad Khan3
... the effect of different planting patterns and row spacing on maize yield in the semi-arid zone of Pakistan–Mardan. The experiment was set in Randomized Complete Block Design (RCBD) with three replicates. Effect of five planting patterns i.e. P1 (Flat planting, row spacing 60 cm), P2 (Ridge-Furrow planting, row spacing 60 cm), P3 (Ridge-Furrow
Ishtiaq Ahmad1*, Muhammad Nafees1, Maryam2, Irfan Ashraf3, Ambreen Maqsood4 and Muhammad Saqib5
... collected from mulberry plants growing at the experimental area, The Islamia University of Bahawalpur, Pakistan. Analysis of variance showed significant effect of drying methods on fruit quality of mulberry (p ≤ 0.05). There was significant difference (p ≤ 0.05) in fresh and dry fruit weight, fruit width and area, and Cu contents of both the species in spectrophotometer. Reduction in fruit weight, fruit area and moisture percentage were significantly hi...
Mahmut Islamoglu
... are many pests of wheat plants, Sunn pest Eurygaster integriceps Put. (Heteroptera; Scutelleridae) is the most important pest in Turkey and West Asian countries. In our country, it causes important economic losses in wheat with the epidemics it has made from time to time. E. integriceps spends most of its life in overwintering sites. It is thought that knowing the wintering characteristics of Sunn pest will provide important advantages in the fight against th...
Faiq Ahmad1, Shahen Shah1*, Muhammad Amin2, Ikram Ullah3, Sajid Ali4, Maaz Khan1, Muhammad Shakur5 and Sajjad Khan6
...tiller-1 (118.9 cm2) and plant height (92.4 cm) were noted with addition of 120 kg N ha-1 applied as 50% from FYM and 50% from PM with beneficial microbes. Likewise, nitrogen sources application one month before sowing has increased leaf area tiller-1 (121.6 cm2) and plant height (91.3 cm). Therefore, it is recommended that 120 kg N ha-1 compensated as 50% each from FYM and PM with the combination of beneficial microbes and ...
Zarnosh Habib1, Muhammad Ibrahim2*, Nasir Shah2, Israr Ullah3 and Norman Javed Gill4
... 1, 2, 3, 4 and 5 cm) in plant debris and at different host pupae ages (24, 48, 72 and 96 h) in laboratory at 25 ± 2ºC, 60 ± 5% relative humidity and a photoperiod of DL 14:10 h. The observations indicated a significant effect of different depths of host pupae and its age on the amount of parasitism by parasitoid. Maximum significant (F = 10.78, P < 0.0001) parasitized pupae were recorded at 72 h of age at surface of the debris, while min...
Muhammad A. Ahmad1, Shabbir Hussain2*, Humera A. Awan3, Muhammad Riaz4 and Muhammad Saeed1
... justify;">The growth of plants and their productivity can be improved by the use of plant growth regulators (PGRs). The PGRs have pronounced effects on the yield, biochemistry, physiology and plant morphology of wheat crop. Current studies were performed to investigate the effect of PGRs on the yield of wheat crop in Sayban International, Lahore (Pakistan). The field experiments were perf...
Muhammad Mansoor1, 2, Sheheryar1 and Shahid Ali Khan1*
...t the percentage of pods plant-1, weight pod-1, 1000 grain weight, grain yield, and harvest index were significantly affected by different varieties, and their interaction with the harvest at various flowering flushes. Inqelab Mung give higher yield compared to other varieties by producing 26 and 37 percent (63 percent) of its total yield in the 1st and 2nd flushes, respectively, with maturity for both flushes in around 63 days. In addition, its yield was high...
Muhammad Mansoor1, 2, Sheheryar1 and Shahid Ali Khan1*
...t the percentage of pods plant-1, weight pod-1, 1000 grain weight, grain yield, and harvest index were significantly affected by different varieties, and their interaction with the harvest at various flowering flushes. Inqelab Mung give higher yield compared to other varieties by producing 26 and 37 percent (63 percent) of its total yield in the 1st and 2nd flushes, respectively, with maturity for both flushes in around 63 days. In addition, its yield was high...
Rezqita Putri Pitaloka1, Kartiawati Alipin1, Mas Rizky A.A Syamsunarno2, Gemilang Lara Utama3, Ramdan Panigoro2, Ratu Safitri1*
...can be done with natural plants. Sappan wood (Caesalpinia sappan L.) contains active compounds, such as brazilin and flavonoid with the ability to chelate Fe. This study aims to determine the effect of sappan wood ethanol extract (SWEE) as an adjuvant and substitute for iron chelator. The adjuvant test group was given 60 mg/kg BW iron dextran (ID), 75 mg/kg BW deferiprone (DFP), and 50 to 200 mg/kg BW SWEE, while the substitute group was administered with 60 m...
Nosheen Jehajo*, Nasreen Memon, Mansoor Ali Shah and Naheed Shah
...seeds of neem and castor plants can be used to manage the stored grain pest up to the tolerable limits in integrated pest management. Moreover, the present study suggests further work on the efficacy of some other local plant extractions as an alternative to chemical pesticides....
Hafiz Ghulam Muhu-Din Ahmed1*, Aziz Ullah2, Muhammad Asim Bhutta3, Ammara Yasmeen4, Hafeez ur Rehman5 and Umar Farooq5
...e (NGS), grain yield per plant (GYP), grain length (GL), grain width (GWD), grain area (GA) and grain sphericity (GS) differed significantly among all genotypes, indicating the presences of genetic variability. Yield related traits like SPS, NGS, and GYP is positively and highly correlated with GL, GW, GA and GS which exhibited the importance of these indices in studied germplasm. It was therefore suggested that positively and significantly correlated traits c...
Humaira Gul1*, Muhammad Junaid Yousaf1*, Fawad Ali1, Mamoona Rauf1, Farhad Ali2 and Iqthedar Ali3
.... During the experiment, plants were grown in eleven sets of soil combinations texture wise with varying ratio of sand and clay along their chemical properties. Different growth parameters based on physiological functioning and biochemical aspects were observed for various physical and chemical properties of soil provided to plants for growth optimization.. Barley flourished only well in sandy soil. The number of leaves, bra...
Noor-us-Sabah1*, Mukkram Ali Tahir1, Tayyab Boota1, Muhammad Luqman2, Ghulam Sarwar1, Amir Aziz1 and Ameer Hamza1
...al fertilizers increased plant growth and quality attributes (plant height, plant stem diameter, total leaf chlorophyll contents, leaf are index (LAI), shoot and root dry weight, seed germination %, leaf P %, and leaf K %) significantly as compared to control. Similarly, soil chemical properties including organic matter (O.M %) contents, available and extractable concentration of P (ppm) a...
Abdullah Al Musabbir1, Md Abedur Rahman2*, Naveed Anjum2, 3 and Mustajab Ali4,5
...esidue management in the planter. A new rotary blade (Blade B) along with roller cutter was designed and their effect on the residue management was investigated. However, to justify the effectiveness of newly designed rotary blade, the traditional blade (Blade A) was also considered in addition to Blade B. Experimental results showed that the straw accumulation in strip tillage in anchored residues by using Blade A in straw heights of 20, 30, and 40 cm was fou...
Agha Mushtaque Ahmed1*, Fahad Nazir Khoso1, Ali Zachi Abdulqader Alhilfi2, Sohail Ahmed Otho1, Qurban Ali3, Din Muhammad Soomro1 and Zubair Ahmed Soomro1
Ifrah Amjad1, Muhammad Nouman Khalid1*, Muhammad Kashif1, Muhammad Noman1, Sajid Ali2, Rizwan Ahmed Shaikh3, Muhammad Babar4, Muhammad Asim Bhutta5 and Amna Bibi5
...at chlorophyll contents, plant height, number of productive tillers per plant, panicle length, total spikelets per panicle, number of grains per panicle and 1000 grain weight were affected by submergence stress. While in another experiment drought stress was applied for 30 days on five Sub1 genotypes along with Nagina-22 (Drought tolerant check) and IR-64 (drought susceptible check) in split plot design with three replicatio...
Emtiaz Ibrahim Ghoniem, Gaber Mamdouh Abdelgalil, Amira Farouk Gad* and El-Sayed Hassan Eshra
...ricultural pest for many plants. Copper sulfate (CuSO4) is extensively used for controlling a number of molluscs in many areas. In this study, CuSO4 toxicity indices against T. pisana after 24, 48 and 72 h using the topical application technique were estimated. Additionally, in vivo evaluation of acetylcholinesterase (AChE), alkaline phosphatase (ALP), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities in T. pisana intoxicated with ...
Shama Sadaf1*, Komal Hassan1, Ayesha Saeed1 and Zeeshan Ahmad2
...rma and Litchi chinensis plants and applied on 100% cotton. Before and after applying antimicrobial finish mechanical property was checked. The antimicrobial finish was applied by pad dry cure method and finish was fixed by using of poly urethane binder. The presence of microorganisms was checked by ASTEM E2149 shake flask method before and after applying antimicrobial finish and after successive 25 washes. The results were analyzed through MANOVA. The fabric ...
Muhammad Khalid Bhatti, Khalil Ahmed*, Ghulam Shabir, Muhammad Irfan, Muhammad Ashfaq Anjum, Muhammad Sarfraz, Amar Iqbal Saqib, Abdul Wakeel, Hafeezullah Rafa, Nadeem Iqbal, Muhammad Qaisar Nawaz, Ghulam Qadir, Muhammad Rizwan and Muhammad Faisal Nawaz
...37, and SRI-38 were transplanted in cemented block at electrical conductivity of soil extract (ECe) 6 dS m-1 and sodium adsorption ratio (SAR) 25. Data about plant height, shoot fresh/dry weight, root fresh/dry weight, panicle length, No. grain/ panicle, No. of tillers/plant, grain yield and 1000 grain weight were recorded at maturity while Na and K contents were determined in leaves. Over...
Hafiz Husnain Nawaz1*, Ayesha Ahsan2, Amir Afzal1, Muhammad Ashraf Sumrah1, Muhammad Jan1, Kashif Ali1, Muhammad Arsalan1 and Rizwan Latif3
... recognize the C. sativa plant’s wonderful physiochemical qualities and socioeconomic benefits. Antioxidants abound in C. sativa extract, thanks to its high phenolic content. It’s a high-polyunsaturated acid crop that’s strong in antioxidants. Extraction from C. sativa seeds yielded a 33% yield of C. sativa oil, which was then analyzed for TPC and antioxidants in comparison to commercially available C. sativa oil. The Folin-Ciocalteu reagent ...
Shahrokh Mojarradgandoukmolla* and Hasan Akan
...e oldest known medicinal plants in the world which is used in the treatment of many diseases due to its various effective compounds. Trigonella strangulata, Trigonella filipes and Trigonella uncinata are three widely used species and folk medicine that grow well in the northern suburbs of Iraq. Therefore, the present study was designed to evaluate and identify the effective compounds of these species and to investigate their physiological ...
Monis Hussain Shah1*, Rizwan Rafique2,6, Munawar Almas1, Muhammad Usman3, Sadia Yasin4 and Sajida Bibi5
...urseries stocks of fruit plants should be certified, the small land holders should be supported by the government incentives for specific fruit production. Research according to the modern steps regarding plant protection measures, introduction of exotic varieties and use of Biotechnological tools for crop improvement should be adopted for better yield and production....
Riaz Noor Panhwar1*, Abdul Fatah Soomro1, Muhammad Chohan1, Illahi Bux Bhatti1, Ali Hassan Mari1, Samia Arain1 and Sagheer Ahmad2
...iments were conducted in plant crop for two consecutive years 2018-19 and 2019-20 during the autumn cropping season at Makli farm of PARC-National Sugar and Tropical Horticulture Research Institute (NSTHRI), Thatta, Pakistan. A total of four sugarcane genotypes i.e., YtTh-1701, YtTh-1705, YtTh-1707, and YtTh-1730 against standard variety Thatta-10 as check were tested. The genotypes were developed from the exotic fuzz of China. The trials were conducted under ...
Khunsa Khakwani1*, Muhammad Asif1, Zaheer Ahmed2, Ghulam Sarwar1, Yasmeen Abbassi2 and Ghulam Murtaza2
...0. Data was recorded for plant height (PH), number of monopodial branches (MB), number of sympodial branches (SB), number of bolls/plant (BP), boll weight (BW), ginning out turn (GOT), fiber fineness (FF), fiber length (FL), fiber strength (FS) and seed cotton yield (SCY). FH-414 proved to have very good GCA for BW and FL. FH-415 showed good GCA for FL and monopodial branches. Similarly, FH-490 for GOT and FF, FH-492 for SB,...
Umair Faheem1*, Madiha Mobeen Khan2, Qurban Ali3, Muhammad Jamil4, Wajiha Anum2, Mashal Rehman2, Imran Akhtar2, Mussurrat Hussain1, Qaisar Abbas1, Ghayour Ahmad5 and Abrar Ahmad6
... the world as well. Host plant resistance is one of the most useful tools for the management of aphids in Brassica crop. This trial was executed at the farm of Regional Agricultural Research Institute, Bahawalpur to report the impact of aphid damage on yield and yield parameters on Brassica juncea. Five varieties/strains i.e. BRJ-9070, BRJ-9072, BRJ-1004, BRJ-1104 and KP Raya were grown in two sets with Randomized Complete Block Design (RCBD) and there were th...
Ergi Bahrioglu1, Mustafa Hac Isa2, Sibel Cengiz2 and Ertan Ercan2*
...orms were either given a plant-based diet or a fish feed-based diet (commercial extruded Seabass feed) in four different culture substrates (rice husk, peat, cocopeat, garden soil). There were altogether eight experimental groups with triplicates. The initial stocking density of white worms was 150 worms/unit (2.2 Liters of cylindrical containers), and all the experiments were carried out in the dark at a constant temperature at 18oC. Worms were collected from...
Sumaria Maqsood1*, Muhammad Ali 2, Amna Shoaib3, Shahbaz Ahmad2 and Noor-ul-Ain2
...hreatening pests of many plants including tomatoes. In vitro, mass-rearing of S. litura is essential to attain a large number of insects with good quality for bio-ecological studies and biological control programs. In the current study, a modified diet was formulated and assessed against two diets used for mass rearing of S. litura, and tomato fruits were taken as a natural diet. Results revealed that development attributes based on mass rearing of S. litura o...
Maha Mostafa1, Sohail Soliman1, Reham I. Mohamed2 and Wael M. El-Sayed1*
...l compounds, and natural plant extracts. The aim of this approach is to lower the population size of pests by reducing the natality rather than by increasing mortality. Male (20) and female (40) albino mice were orally administered testosterone at 25 mg/kg for 35 days. The males were allowed to mate with females to estimate the fertility index. After the end of treatment, mice were sacrificed, blood was collected for biochemical analysis, and sex organs were d...
Zaheer Ahmed Lashari1, Muhammad Saleem Sarki1, Saleem Maseeh Bhatti1, Muhammad Sachal Khokhar1 and Zohaib ur Rehman Bughio2*
...fertilizer that enriches plants and soil. The present research was undertaken to prepare composts utilizing organic wastes and to testify their impacts on onion cultivation. Three dissimilar composts with variable recipes viz. banana plants + poultry manure (Compost 1), banana plants + goat manure (Compost 2) and banana plants + cattle manure (Compost 3)...
Farah Abid1,2, Mohammad Saleem1,3*, Tahir Maqbool4, Tania Ahmed Shakoori5, Faheem Hadi4, Tahir Muhammad4, Saira Aftab4, Yasir Hassan7 and Shabana Akhtar4,6*
...ia modesta extract whole plant extract (E-AM) in process of inflammation and also in arthritis by using animal model of rat. Thirty-six healthy wister rats were chosen for in vivo experiments and divided into six groups. Arthritis was induced in rats using Complete Freund’s Adjuvant (CFA) and treated with different concentrations of E-AM (250, 500 or 750 mg/kg), and with standard treatment, piroxicam (10 mg/kg). Antioxidant assays (superoxide dismutase a...
Saima Rubab1,3*, Ghazala H Rizwani2, Arjumand Iqbal Durrani3, Iram Liaqat4*, Urooj Zafar5, Mahjabeen6, Farah Batool7, Noor-E- Seher3, Naveera Younas3 and Ayesha Sadiqa8
...of traditional medicinal plants have been used for thousands of years in different region of the globe for the treatment of various diseases. In developing countries, traditional medicines are used as source of primary health care. Keeping in view the importance of Camellia sinensis L., present investigation was aimed to evaluate the phytochemical and pharmacological potential of different morphological parts of C. sinensis L. Successive extractions of all
Alia Tajdar1,3, Shaghef Ejaz2, Muhammad Shah Zaib1, Anum Ishfaq1, Syed Muhammad Zaka1*, Hafiz Muhammad Safeer1 and Khalid Abbas1
Ibrahim Samir Abd El-Hamid1, Alaa Emara Rabee2, Moustafa Mohamed M. A. Ghandour2, Rasha Salah Mohammed3, Ahmed Mohamed. Sallam4
...ed with 10 g/head/day of plant herb mixtures (PHM), along with turmeric (Curcuma longa), ginger (Zingiber officinaleor), and garlic (Allium sativum). The third group (n=5) supplemented with 5 g/head/day of commercial Quebracho tannins extract (QT). The findings showed that the PHM and QT groups had higher (P≤0.05) mean values of sperm concentration, mass motility, sperm motility, sperm viability, and cell membrane integrity. Plasma testosterone concentratio...
Samiya Rehman*, Eman Mustafa, Ali Ahmad Faiz, Maheen Kanwal, Farkhanda Yasmin and Arooj Fatima
Shahid Hameed Khan Khalil1*, Abdus Subhan3, Ghani Akbar1, Muhammad Asif1, Zafar Islam1, Adnan Shakeel1 and Fawad Anwar2
...f wheat growth including plant height, days to harvest, and number of tillers per plant and grain weight per ear were significantly changed by the application of different amounts of water (treatment) during the two years of the experiment. Conventional irrigation showed significantly higher values of growth parameters, but was comparable to the irrigation regime applied to 50 and 75% of the field capacity. Similarly, ...
Huma Abbas1*, Nazir Javed1, Muhammad Kamran2, Sajid Aleem Khan1, Abdul Jabbar1, Akhtar Hameed1, Hira Abbas3, Azhar Iqbal2 and Ehetisham-ul-Haq2
...o (Solanum lycopersicum) plants. Tomato seedlings were transplanted in sterilized soil amended with Cartap, Virtako, Cure and Azadirachtin at their recommended doses and inoculated with 500 freshly hatched juveniles (J2s) of M. incognita. Data were recorded after 7, 14, 21 and 28 days to check the invasion and development stages. All the treatments significantly reduced invasion and subsequent development of M. incognita in ...
Mohamed M. Bahr1, Mohamed S. Amer1*, Khaled Abo-EL-Sooud2, Shaimaa M. Kamel3, Marwa A. Fouly4, Ahmed N. Abdallah5, Ashraf A. Shamaa1, Omar S. El-Tookhy1
...superior to corneal transplantation and live stem cell therapy.
Keywords | Mesenchymal-stem-cell, Xeno-Exosomes, corneal-ulcer, histopathology, corneal-transplantation, AS-OCT, New-Zealand-rabbits, paracrine-signaling.
...
Wafaa M.A. El-Nagdi1, Ahmed E.A. Mahgoob2, Mahmoud M.A. Youssef1*, Entesar H. Taha2, Mona M.S. Zayed3 and Nora R.A. Saleh1
...yne incognita (Ne) on eggplant as influenced by time of addition. The obtained results proved that, the tested isolates adversely affected reproduction of root-knot nematode, M. incognita, either when bacterium was added before, after or at the same time with Ne inoculation. On the basis of the average overall percentages nematode reduction, bacterial isolates added before and after nematode inoculation were equal in decreasing M. incognita numbers, as they ac...
Oluwatoyin Adenike Fabiyi1*, Mariam Temitope Baker2 and Gabriel Ademola Olatunji2
...al activities. Medicinal plants are rich source of acid esters, hence Alstonia boonei (Apocynaceae) leaves were extracted cold in ethyl acetate. This yielded crude extract that was subjected to column chromatography (silica gel 100-120 mesh grade), which afforded fractions that were analysed with GCMS and FTIR for constituent identification. The result shows octanoic acid; hexanoic acid methyl ester; ethyl octanoate; 9, 12-octadecadienoic acid methyl ester; do...
S. Samina and Y.I. Erum†
...certain the diversity of plant parasitic nematodes at different locations of Kurram Agency, Pakistan. For this purpose, surveys were conducted and 150 samples of root and soil were collected from different locations of Kurram Agency. The detail morphological and taxonomical studies revealed a total of 26 species of plant parasitic nematodes belong to 17 genera, 13 families, 15 subfamilies and 3 orders while free-living soil ...
M. M. A. Youssef† and W. M. A. El-Nagdi
...ifferent densities of eggplant (Solanum melongena L.) on the reproduction and population density of root-knot nematode, Meloidogyne incognita was studied under screen house conditions. It was found that there is a positive correlation between eggplant density and population density of root-knot nematode, M. incognita in roots i.e., when number of plants in the same pot increased (1-4
W. M. A. El-Nagdi1†, M. M. A.Youssef1, H. Abd-El-Khair1, M. M. M. Abd Elgawad1 and M. G. Dawood2
...tive growth, the highest plant growth increase (69.0%) was observed in combined treatment of Bs+Bp followed by 55.6% in single treatment of Pf and the least plant growth was obtained in combined treatment of Pf + Bs + Bp (54.8%). The highest percentage of yield increase (70.2%) was recorded in Bs+Bp treatment followed by 49.3% by B. pumilus (Bp). The highest percentage (116.7%) in the number of bacterial nodules on roots of ...
A. Beyan1, A. Seid†2 and H. Shifa1
...here one week after transplanting except the control which was not inoculated. The result revealed that concomitant inoculation of MJ and FOL (NF) followed by MJ first and FOL ten days after inoculation (N1F2) was found to be highly significant in reducing the tomato growth, biomass and pathogen related parameters compared to the un-inoculated control or single pathogen inoculated treatments. Among the three tomato genotypes evaluated, Assila was found to be m...
N. Hajra
... Standley, a mycorrhizal plant of family Cucurbitaceae. Biochemical analysis including carbon and nitrogen profiles was taken into account.The estimation of carbon profile comprising of carbohydrate, glucose, sucrose and total soluble sugars and nitrogen profile comprising of proteins, amino acids protease and proline. Results showed that carbon profile in plant treated with AM fungi have high to low and varied amount of car...
A. Ghasemzadeh1, S. Jamali1†, M. Esfahani2 and H. Pedramfar1
...s create restrictions in plant growth. In this article, the physiological effects of root-knot nematode (Meloidogyne incognita Race 2) stress was assessed on photosynthetic fluorescence attributes in two tomato cultivars, Falat Y as a susceptible, and Gina VF as a tolerant cultivar. The experiment was done in a completely randomized split plot design under greenhouse conditions with four nematode populations, 0 (as control), 500, 1000 and 2000 second stage juv...
R. Hadadfar1, E. Mahdikhani-Moghadam2†, S. Baghaee2 and M. S. Bajestani1
...nce of Iran, 50 soil and plant samples from pistachio roots rhizosphere (Depth 30-50 cm) were collected during years 2016-2017. Samples were transferred on ice to laboratory and nematodes were extracted by centrifugal methods. Psilenchus species were identified on morphological and morphometrical characters based on recent valid keys. Seven species from Psilenchus genus were identified viz., Psilenchus curcumerus, P. aestuarius, P. iranicus, P. hilarus, P. bil...
H. M. Hassan, M. M. Tantawy*, A. M. Younes and M. O. Sayed
...ed for the prevalence of plant parasitic nematodes in Maghagha, Samallot, Minia and Abokorkas Districts of Minia Governorate. Soil and root samples were collected during fruiting seasons of grapevine in 2012 and 2013. The nematodes encountered were identified as Meloidogyne spp., Helicotylenchus spp., Longidorus spp., Pratylenchus spp., Tylenchulus semipenetrans and Hoplolaimus spp. Community analysis of these plant parasiti...
S. Miheret1, A. Seid2† and N. Hailu3
...lls, egg-mass and J2 per plant as compared to the inoculated tomato-sole cropping and with other antagonistic plants. Further research is needed to evaluate the effectiveness of the antagonistic plants in the management of root-knot nematodes under farmer’s field conditions....
I. K. A. Ibrahim1, Z. A. Handoo 2†, A. M. Zid1 and M. R. Kantor2
W. M. El-Nagdi,1†, Z. , E. Ghareeb2 and E. M. Zayed3
...wed that root weight per plant, gall index, number of leaves per plant and dry weight per plant were the most important contributing traits to root yield (R2= 94.76%). Hence, the selection among these traits would be accompanied by high yielding and more effective for the improvement of fodder root yield in the same conditions....
A.H. Choshali1, S. Rezaee2, S. Jamali3, H. Reza3, Zamanizadeh4 and F. Rejali5
...ere studied. Mycorrhizal plants which pre-colonized for 7 weeks inoculated with 1500 J2 per 1 kg soil. The quantitative activity of chitinase and ß 1, 3 glucanase enzymes was assessed on 2, 4, 6 and 8th days after M. incognita inoculation based on split- plot in time design. Also the results showed that AMF pre-inoculation caused a significant decrease in RKN pathogenicity factors (number of galls, eggs, egg sacs and J2) in both tolerant and susceptible ...
F. Shahina†, K. Nasira, K. Firoza and Y. I. Erum
...sive indexed resource of plant parasitic, soil, marine and entomopathogenic nematode species described and reported during last sixty nine years (1952-2019) from Pakistan. The information compiled in this paper came gradually from many and diverse sources. It is the product of the efforts of several authors who contributed to gather knowledge on the biological diversity through systematics and faunistic studies. Information published in different scientific jo...
M. Israr1†, M. Habib1 and K. Nasira2
...khtunkhwa provinces. The plant parasitic nematodes were extracted from soil samples by Cobb’s sieving and decanting method (Cobb, 1918) followed by modified Baermann technique (Baermann, 1917). After processing, the nematode genera and species were identified (Siddiqi, 2000). Tylenchorhynchus usmanensis is reported from the first time from Pakistan is briefly redescribed and illustrated....
Y. Danso†, J. Adomako, K. Osei and B. Abugri
...dy was carried out under plant house condition to assess the reaction of three maize varieties to M. incognita parasitism between May and July 2017. A pot experiment was carried out in a Completely Randomized Design with five replications. Meloidogyne incognita eggs @ 2000 eggs were applied per plant. Mamaba, Obaatanpa and Abeleehi maize varieties exhibited resistance potential by suppressing reproduction, development and es...
Hira Anwar1, Muhammad Jabran1,3, Anam Moosa2, Usman Arshad2, Abdul Haseeb1, Abdul Jabbar1, Muhammad Burhan4, Amjad Abbas1, Muhammad Naveed5 and Muhammad Amjad Ali1*
...des (RKNs) are important plant parasitic nematodes that affect vegetable crops worldwide including okra. Among the RKNs, Meloidogyne incognita [(Kofold and White) Chitwood] is one of the major constraints to okra production. In this study, the effect of different bacterial strains i.e., Bacillus sp. MN54, Enterobacter sp. MN17 and Burkholderia. phytofirmans PsJN alone and in different combinations was assessed on plant growt...
Muhammad Shahid Nadeem*, Jalaluddin Azam Khan and Firoz Anwar
...nisms including animals, plants, fungi and microbes. The enzyme has a clinical applications in the diagnosis of many diseases. In the present study we have produced a recombinant of ALT from Pyrococcus abyssi in BL21 (DE3) strain of E. coli. The recombinant enzyme was purified by anion exchange chromatography, it displayed a 45kDa band on SDS-PAGE, with 58.1% final recovery, 15.3 fold purification and 139 U/mg specific activity. Maximum enzyme activity was fou...
M. Israr1, F. Shahina2† and K. Nasira2
...urnip (Brassica rapa L.) plants collected from Mianwali, Punjab, Pakistan. Aphelenchoides turnipi n. sp. belongs to the Group 2 of Aphelenchoides species sensu Shahina with one or sometimes two mucronate structures in female tail terminus and is characterized by small body size (0.29-0.38 mm); two lateral incisures in the lateral field; small stylet with minute basal swellings (stylet: 7-9 μm); vulva at 67-69 percent of body, tail short with pointed mucro (...
S. Aatika, K. Nasira and F. Shahina†
...div>In a recent study of plant parasitic nematodes, the following species of nematodes were encountered from maize and
its adjoining crops from Punjab, Pakistan. New species Filenchus maqbooli n. sp., characterized by small body with
short stylet and tail long, filiform has been described. Five new record species of plant parasitic nematodes viz.,
Helicotylench...
M. S. Bajestani1, K. Dolatabadi2†, E. Mahdikhani-Moghadam1
...tory effect of medicinal plant extracts viz., marigold (Tagetes spp.), rosemary (Rosmarinus
officinalis L.) and nigella (Nigella sativa L.) on root-knot nematode, Meloidogyne javanica @ 1500, 2500 and 5000
juveniles were studied on susceptible tomato cv. Karoon under greenhouse condition. Although all the treatments
reduced root infections rate and significantly effect on root weight (P ≤ 0.05). It was observed that when ...
A. S. A. Saad1, M. A. Radwan2†, H. A. Mesbah1, H. S. Ibrahim3 and M. S. Khalil3
...) in the soil as well as plant
growth characteristics. All nematicidal treatments reduced the incidence of root-knot nematodes when compared
with the untreated check. However, fenamiphos and oxamyl were proved to be the highest chemical compostions
that decreased galls by 91.73 and 89.53% and egg-masses by 90.80 and 88.65%, respectively. Whereas, avermactin
has relatively least effect...
S. Feroza1, A. G. Arijo1† and I. R. Zahid2
...Azadirachta indica) plant seeds on Ascaridia galli infectivity in broiler chicken. A total of eighteen broiler birds were randomly selected that were divided into three groups (A, B and C) with 6 birds in each group. The birds were then artificially infected with Ascaridia galli @ 2000 eggs/bird. Ethanolic extracts of papaya and neem were applied to Group B and C, respectively while Group A was left untreated that served as control. The fecal eg...
I. K.A. Ibrahim1, Z.A. Handoo2† and A. B. A. Basyony1
...ated with different crop plants: Heterodera avenae on wheat, H.
daverti and H. trifolii on Egyptian clover, H. leuceilyma on Bermuda grass, H. lespedezae on lentil, H. goldeni on
qasabagrass, H. schachtii on cabbage and sugar beet, H. zeae on corn and wheat and Globodera rostochiensis on
potato. The cyst nematodes H. leuceilyma and G. rostochiensis are new records of the country and H. lespedezae on
lentil is a n...
M. Behdani1†, F.J. Afshar2, M.R. Mirzaee1
...s
L.) shrubs planted in Birjand (Ghattargaz region), South Khorasan province of Iran infected with root-knot
nematode. On the basis of perineal pattern the nematode was identified as Meloidogyne javanica and is the first
report on B. vulgaris in Iran.
...
C. C. Famina1†, A. Usman2 and M. K. M. Nasser1
... population densities of plant parasitic nematodes in soil
samples associated with banana (Musa paradisiaca), a survey was conducted in the Kondotty Taluk of Malappuram
district, Kerala, India. A total of 12 genera of nematodes including six commonly occurring nematodes in the banana
rhizosphere, three new records from banana and one new unidentified genus were obtained during the survey. Two
Mutala’liah, S. Indarti † and N. S. Putra
...iotic factors and coffee plant varieties in three fields. The research was conducted in
Malangsari, Getas and Candiroto feilds. Samples of soil and roots were collected and various parameters of soil
abiotic factors (pH, soil moisture, soil temperature, soil texture and organic matter) were obtained from each of the
three fields. Vertical distribution was assessed using two soil sample depths (30 cm and 50 cm). This research...
M. A. Radwan†, M. M. Abu-Elamayem, S. A. A. Farrag and N. S. Ahmed
...cting tomato
plants was investigated under greenhouse conditions. The results showed that all tested organic acids as well as the
application methods significantly reduced tomato root galls and 2nd stage juvenile numbers in soil compared with
control. Except DNSA and AA, foliar application of tested organic acids was more effective in reducing nematode
galls than soil drench application. Foliar application of ASA...
M. Bajestani1†, E. Moghadam2 and K. Dolatabadi3
...s and Birjand cities ten plant parasitic nematodes
species were identified on morphological and morphometrical characters viz., Boleodorus thylactus, Filenchus
cylindricaudus, Geocenamus tenuidens, Irantylenchus clavidorus, Merlinius brevidens, M. communicus, M.
pistaciei, Neopsilenchus magnidens, Pratylenchus neglectus and Zygotylenchus guevarai. Among these species M.
communicus and...
H. Ravindra1, N. Adivappar2, M. Sehgal3 D. M. Soumya4 and H. B. Narasimhamurthy4
...e conducted of coriander plantations from open and protected cultivations at Karnataka for the
prevalence of nematode. Heavy infestation of root-knot nematode was observed on coriander with small to big sized
galls or knots on the roots. Soil and root samples were collected for analysis of nematode infestation. Coriander
plants also exhibited poor growth showing stunting and chlorosis due ...
D. A. Darban1†, S. R. Gowen1, B. Pembroke1 and F. Hussain2
... egg-masses, females per plant, over all the crop cycles were compared by accepting a parallel line,
logarithmic model. The number of egg-masses per plant over all the crop cycles decreased significantly (P < 0.05)
more in the ten females treatment as compared with control. A highly significant difference was found in total
number of females per plant...
M. M. A. Youssef† and W. M. A. El-Nagdi
...aris L.) cv. Gazelle was planted under screen house conditions to assess its ability as a trap
crop to reduce population density of root-knot nematode, Meloidogyne incognita on subsequent common dry bean
(Phaseolus vulgaris L.). Treatments were made by removing whole plant or cutting sugar beet above the surface of
soil in each pot 6, 12, 18, 24, 30 and 36 days after nematode inoculation. ...
A. M. Khan1,†, S. Naz1 and M. Abid2
...
growth of the okra plant and proved that the alga under investigation possessing some level of fertilizing potential.
...
I. K. A. Ibrahim1 and Z. A. Handoo2†
...zosphere of the surveyed plants. Twenty-three genera of phytoparasitic nematodes were detected in the
collected soil and root samples. In soil samples from Alexandria governorate, the sugar beet cyst nematode
(Heterodera schachtii) was very common on sugar beet while the root-knot nematodes Meloidogyne incognita and
M. javanica were very common on guava, olive trees and sugar beet. Helicotylenchu...
I. K. A. Ibrahim1, M. A. EL-Saedy2, S. F. A. Awd-Allah3 and Z. A. Handoo4, †
.... goldeni as compared to plants inoculated with M.
incognita concurrently or a week beforehand. When H. daverti or H. zeae were inoculated one week after
inoculation with M. incognita on rice cultivars Giza 178 or Sakha 101, respectively, the final population of these
cyst nematodes increased. Treatments with M. incognita alone or one week before inoculations with the tested
cyst nematodes induced a significant
M. M. A. Youssef1†, Wafaa M. A. El-Nagdi1, and Mona G. Dawood2
... percentages increase of plant
growth, yield and number of nodules. It is clearly noticed that soluble carbohydrates, total carbohydrates, phenols
and soluble proteins in seeds increased at the different treatments compared to those of the untreated check and the
effect, in general, was higher by using the highest rate compared to the lowest one. On the other hand, the contents
of chlorophyll a, chlorophyll b and...
A. A. Galal1,2, S. F. Abou-Elwafa1,3, F. J. Kopisch-Obuch1 and C. Jung1
...tocol for testing barley plants against root lesion nematode (RLN) had
been standerdized. The plants were grown in 150 cm³ instead of 20 cm³ tubes and we increased the inoculum size
from 400 to 1000 nematodes/plant in combination with a nutrient solution better adapted to the barley crop. Six
barley accessions were tested with Pratylenchus negl...
Fawzia, I. Moursy1, Amira, Sh.Soliman1, A. E.M. Khalil2,Samaa, M. Shawky2 and A. A. Taher2 †
...resh weight of the whole plant which was greatly improved in all treatments.
...
K. Taimoor1† and F. Shahina2
...s medicinal and aromatic plants viz., Perovskia abrotanoides, Valeriana wallichii, Artemisia
vulgaris, Peganum harmala, Saphora alopecuroides, Artemisia absinthium, Carum copticum, Berberis
balochistanica, Matricaria lasiocarpa, Ephedra procera, Centratherum anthelminticum, Zatoria multiflora,
Lallemantia royaleana, Mentha spicata, Withania coagulans, Achillea santolina, Ferula oopoda, Nepeta cateria,
Teucrium st...
A.W. Aseffa1, F. F. Addisu2, G. N. Roge3, L. T. Hadis4, T. B. Abera5, M. G. Gero6 and B. H. Meressa1†
M. M. A. Youssef †and Wafaa M. A. El-Nagdi
...oidogyne incognita on eggplant under screen house conditions. Three solutions of yeast and sucrose (as a bio-fermenter) at different yeast concentrations (1, 2 & 3% yeast) + a fixed concentration of 2% sucrose and three solutions of sucrose and yeast at different sucrose concentrations (2, 3 & 4% sucrose), a fixed concentration of 2% yeast were applied. The results indicated that there was a positive correlation (R= 0.097) between average percentage ne...
I.K.A. Ibrahim1 and Z. A. Handoo2†
...soil treatment with some plant materials, stems of oyster mushroom (Pleurotus ostreatus), the biocontrol agent Bacillus thuringiensis, the bionematicide abamectin, and the nematicide fenamiphos on Mi 1 on rice cv. Sakha 101. All the applied control treatments were effective in reducing nematode infection on rice plants....
S. Anwar1, K. Wieczorek1 and E. Inselsbacher2 †
.... schachtii infection in plants....
S. Fatemy†1 and H. Ghasemi2
...6-week period. Pots were planted with a single sprout of each cv. and the soil was inoculated with a suspension of 400 freshly hatched J2. There was a significant difference in the numbers of J2 that had entered the roots as well as a delay of 1-2 weeks in the rate of development of juveniles in the resistant compared to the susceptible cvs. Overall, 44%, 23%, 10% and 4% of inoculated J2 were found in the roots of susceptible Marfona, and resistant Satina, Agr...
S. Ahmed†, Q. Liu and H. Jian
...hemically and grouped as plant growth promoting bacteria (PGPB). In the green house experiments identified isolates; B.cereus XZ 24-2-1, B. cereus XZ-33-3, B. weihenstephansis MH-58-60-01, B. thuringiensis MH 032-003 and a nematicide (Avermectin) were used as seed coating. All four Bacillus isolates significantly reduced nematode infection of wheat roots when juveniles were used as inoculum after 10 days post inoculation. Noteworthy reduction in white female c...
A. S. A. Saad1, M. B. Al-Kadi1, A. A. A. Deeabes2 and A. M. El-Kholy2†
...ncognita) affecting okra plants in vitro as well as in vivo conditions. Five concentrations of all chemicals were prepared. Data of in vitro studies showed a marked nematicidal and nematode hatching inhibitory activity against root-knot nematode (M. incognita). However, the nematicidal activity differed between treatments as compared to control. Fosthiazate was found as the most toxic compound against J2 of M. incognita after 24 and 48 hour exposure time as we...
M. Israr†1, F. Shahina1 and M. Habib2
...ted and un-infected host plants. Data indicates that highest reproduction rate and root-knot index was observed in vegetable plants infected with root-knot nematodes after three months as compared to un-infected (control). The physiological parameters as well as biochemical contents showed significant difference in different growth criteria and amount of nutrients between infected host plant
Farwa Batool1*, Riaz ur Rehman1, Samia Ikram2 and Maham Zahara3
...ficant factor in foliage plant production and low-cost growing substrate is critical factor in nursery business profitability. The soil substrates must be non-toxic, environmental friendly, highly sustainable and good in nutrients capacity for better plant growth and economical plant production. The agriculture waste is a good option for soil substrate source in nursery
I. Jafri, A.A. Shahid, A. Ibrahim† and M. Atif
...Meloidogyne incognita on plant health and production of
tomato in field. Various strains of bacteria were examined for their influence on shoot, root length, plant
height, egg-mass, number of juveniles and number of knots per root system. Outcomes revealed that
Controlled (C1) Meloidogyne sp., Bacillus sp., (T1), Meloidogyne sp., and Bacillus thuringiensis (T2)
remarkably suppr...
A.S. Ardakani
... control (1368 galls per plant). Also the treatment of H. indica @ 160 J3/g soil alone, reduced the
number of galls (433) significantly in comparison with inoculated control (only M. incognita J2/g soil). All
the treatments resulted in improved plant growth characters such as root length, shoot length, root fresh
weight and shoot fresh weight at P 0.05 significance level in comparison wi...
C. Azhagumurugan† and M.K. Rajan
...div>20 and 25 egg-masses/plant) with different concentrations (5, 10, 15, 20 and 25 ppm). The control and treated plants
were analyzed for various growth characteristics such as, root and shoot length, fresh and dry weight of root and
shoot, leaf area, root gall index and chlorophyll content after 65 days. These growth characteristics found decreased
with increasing inoculum levels of egg-...
A.M. Korayem, M.M.M. Mohamed† and S.M. EL-Ashry1
...udied on common dry bean plants under natural
infestation in the field at two different seasons of planting. In the first season, bean was grown in Autumn, 2012
while, the second season in early Spring, 2013. For the first season, the relation between nematode initial population
density and bean yield was significantly negative (r = -0.6). A significant reduction in bean yield (P = 0.05) w...
A. Khan†, S.S. Shaukat1, K.A. Khanzada and M.S. Khan2
...each seedlings were transplanted. Various soil
amendments were applied including sawdust, sugarcane bagasse, neem (Azadirachta indica) leaf powder and
marigold (Tagetes erecta) flower powder used alone and in combination with Fertinemakil. Untreated pots were
kept as control. Carbofuran a chemical nematicide was used for comparison. Subsequently after 8 weeks nematode
populations were...
S. Ahmed†, A. Munir, S. Hameed, S. Asad, M. Fayyaz, M. Zakaria and M. Umer
...sence of eight genera of plant parasitic and soil nematodes. The most frequently isolated
nematode population from all the soil samples were Tylenchorhynchus sp., Xiphinema sp., and Cephalobus sp.
Prevalence of nematodes were high in districts Mandi Bahauddin and Gujranwala with soil cropping history of
maize and rice cultivation.
...
R.R. Arain, R.N. Syed, A.Q. Rajput, M.A. Khanzada1, N.A. Rajput and A.M. Lodhi1†
...en of tomato
plants. The artificial inoculation of M. incognita developed a large number of galls and suppressed the tomato
plant growth significantly. Three different concentrations of neem extract, furadan and Trichoderma harzianum
were evaluated to control the M. incognita. All concentrations proved effective in reducing the disease
development in nematode inoculated tomato ...
M.M.A. Youssef† and W.M.A. El-Nagdi
...n combination with their plant vigor. The highly resistant or resistant sugar beet varieties
determined in this study could be recommended for breeding programme and could be introduced in integrated pest
management program of root-knot nematode.
...
C. Azhagumurugan and M.K. Rajan
...control and experimental plants were analyzed for various biochemical constituents such as,
carbohydrate, protein, amino acid, lipid, proline and phenol content after 65 days of treatment. Carbohydrate and
protein were found decreased with increasing inoculum levels of egg-masses and increased with increasing
concentrations of leaf extract treatment and lipid, amino acid, proline and phenol content found increased with
...
W.M.A. El-Nagdi, M.M.A. Youssef† and M.F.M. Eissa
...ending
their plant growth vigor. It is concluded that younger date palm seedlings seem to require root tissue maturation
before expressing full resistance against root-knot nematode.
...
S.A. Khan†, M. Abid and F. Hussain1
...tack nearly all types of plants. In
this study 32 seaweeds were evaluated to determine nematicidal activity against Meloidogyne javanica (egg
hatching and larval mortality tests) in vitro. Results revealed that seaweed biochemical potential in two different
solvents viz., water and methanol @ ratios 2.5, 5 and 10%. It is observed that Sargasssum tenerrimum, Padina
tetrastromatica and Melanothamnus afaqhusainii sh...
D.A. Darban†, S.R. Gowen, B. Pembroke, F. Hussain1 and R.A. Memon2
...number of egg-masses per plant between the 3
weeks and other treatments. Infected females (%) over both crop cycles were compared by the estimated coefficients
of the fitted lines and increased significantly with degradation period and significantly higher in the second crop.
The 3 week duration apparently allowed more spores to disperse which was reflected in the observations of more
infected female nematodes an...
W.M.A. El-Nagdi and M.M.A. Youssef†
...cowpea, maize and sesame plants
replacing sugar beet for controlling root-knot nematode, Meloidogyne incognita resulted that sugar beet-Hybrid
maize and sugar beet-sesame cropping sequences proved most effective against root-knot nematode as they reduced
nematode parameters as indicated by the number of galls, egg-masses and hatched juveniles on roots. Consequently,
they lowered rates...
N. Hajra
... soil components treated plants. Higher proline concentrations
reflected in leaves of treated plants as compared with mycorrhizal treated plants. The decrease in shoot length,
number of leaves and leaf area were observed in non mycorrhizal and plant treated with other biotic and
abiotic stresses. Higher amount of proli...
I. Kepenekci
... 240 nematode species of plant parasitic nematodes belonging to 56 genera of
Tylenchida detected in Turkey. These nematode species found associated with 66 plants from 48 different
localities of the country.
...
M.A.M. El-Saedy, A.A. Mokbel*† and S.E. Hammad**
...icacy of seven essential plant oils and cultivation of two garlic cultivars: Balady and Sods-40 were
evaluated for controlling root-knot nematode, Meloidogyne incognita infecting tomato plants under laboratory,
greenhouse and field conditions. Treatments with essential oils of arugula, camphor, castor, garlic, nigella, onion
and sesame resulted in 48.0-92.7% reduction in numbers of root ga...
A.W. Amin† and A.W. Mona*
...
root antagonistic plant and Rugby as a nematicide (two formulation, Rugby 10G and Rugby 20L) for control of
Meloidogyne incognita cucumber root-knot were evaluated in nematode naturally infested soil under greenhouse
conditions in two successive spring seasons (2011 and 2012). Cucumber, Cucumis sativus var. Sinai was planted as
a scion. Results indicate ...
T. Shiferaw†, N. Dechassa* and P.K. Sakhuja*
... before
transplanting the seedlings. The experiment laid in RCBD factorial arrangement. Application of poultry litre
except 5 ton/ha significantly reduced eggs per egg-mass, root galling and final population of root-knot nematode
at p < 0.001. Rapeseed cake at 200 kg/ha significantly reduced final population and eggs per egg-mass compared
to control treatment at p < 0.05. Applications of poultry litter at 5...
A.E. Ismail† and A.M. Kheir*
...ngest than on the oldest plants.
...
I. Umar† and A. Mamman*
...X-Gurin and EX-Yobe were planted separately into the pots containing the amendment. Pots
were inoculated with 1000 J2/pot. The results of the study showed that the crude extract gave better egg inhibition
and 85% juvenile mortality. In the screen house pots treated with 25 t/ha gave better growth parameter, yield and
better nematode control than the other treatments. It is suggested that field trial be conducted to determine...
F. Shahina†, K.A. Tabassum and M.A. Habib*
...e number of bollworms on plants before and 24 hrs after
EPN spray @ 1000 and 2000 juveniles/ml water were assessed for mortality percentage. All four species of insects,
viz., Helicoverpa armigera, Earias insulana, E. vitella and Pectinophora gossypiella were found susceptible to
infective juveniles of the four EPN species; S. pakistanense was the most virulent EPN species. There is a dire need
to focus further r...
O. A. Fabiyi
... significant increase in plant height, number of leaves,
number of fruits per plant and fruit weight per plant as compared with Carbofuran (p<0.05). In the laboratory,
chromatographic fractions from acetone extract had the highest percentage juvenile mortality. The infrared analysis
of the fractions revealed the presence of anhydride and carbonyl stre...
Z. Gill and K. Firoza†
...evealed that twenty five plant parasitic and seven free-living soil nematode species associated
with date palm plantations in district Khairpur, Sindh, Pakistan. Population density and frequency of all nematodes
varied considerably at all surveyed sites. Occurrence of plant parasitic nematodes was found high at Gambat
(33.3%) and low in Kingri (15.38%). ...
M.A. Haq†, K. Mahmood*, M. Shahid*, S.A. Khan and A. Tahir**
M. Shahi-Bajestani† and E. Mahdikhani-Moghadam
M.M.A. Youssef and A.M.S. Lashein†
...>Egypt on clay loam soil planted to date palm cv. Zaghlool infested with plant parasitic nematodes, Rotylenchulus
reniformis and Helicotylenchus sp. An experiment was carried out to investigate the efficacy of acetyl salicylic
(ASA) and γ-amino-n-butyric acids (GABA) as chemical resistance inducer at the concentrations of 5, 10 and 20
mM against nematodes and consequently on date pal...
A.A. Mokbel
...he rhizosphere of peanut plants.
Meloidogyne arenaria was the most common nematode in all collected soil samples followed by Tylenchorhynchus
spp., Helicotylenchus spp., M. javanica and Pratylenchus penetrans. All tested peanut cultivars were resistant to M.
incognita race 2 and moderately resistant to M. javanica. Whereas, peanut cvs. Balady, Ismailia 1 and Giza 6 were
found highly s...
A.A. Anter, A.W. Amin†, A.H. Ashoub* and A.S. El-Nuby*
...gyne incognita in tomato plants cv.
Castel Rock was investigated under greenhouse conditions. All inducers were applied as soil dren ch to
tomato plants grown in 25 cm-diam. earthen pots. Three days-before nematode inoculation time treatment
maximized the efficacy of tested chemicals in reducing nematode galls, egg-masses and eggs numbers
followed by synchronized addition with ...
A.W. Amin†, A.A. Anter, A.H. Ashoub* and A.S. El-Nuby*
...s, B. firmus, Klebsiella planticola, Lactobacillus agilis, L. fermentum,
Methylomonas methanica, Neisseria elongata, Obesumbacterium proteus and Pseudomonas aeruginosa recovered
from tomato rhizosphere and tested for their ability to induce systemic resistance or bio-control agent against
Meloidogyne incognita in tomato under greenhouse condition. Results showed that all tested bacterial strains
showed significan...
W.M.A. El-Nagdi†, M.M.A. Youssef and M.G. Dawood*
...e incognita infecting eggplant
Solanum melongena with aqueous extracts of garlic Allium sativum mashed clove and oil. The plant materials were
diluted with distilled water at concentrations of 2.5, 1.25 and 0.625% and drenched in each plot. Results showed that
the plant extracts showed nematicidal and nematode-hatching inhibitory activity reduced nematod...
O.A. Fabiyi†, G.A. Olatunji* and A.T. Aramide*
A. Khan†, S.S. Shaukat*, N. Khatoon**, J. Akhtar and A.G. Rizwana**
Jax Vincent Gamulo, Maye Pearl Bolina, Jessica Serena Brion, Via Crishiela Nicole Dela Rosa, Roxanne Francesca Maglaya, Carl Lexter Tan, Aimee Caye Chang*
...ty time between tropical plant extracts and commercially available drugs posed a significant difference (P < 0.05), while ten (10) among the plant species differed in fasciolocidal activity (P < 0.05). Albendazole (62.5%) was the most used reference drug, along with Piperazine Citrate, and Triclabendazole, wherein ANOVA showed no significant difference in mortality time among them (P > 0.05). Notably,
Rukhsana Anwar1*, Ammara Abd-Us-Sattar1, Afifa Noor2, Kanwal Ashiq1,3 and Shah Jahan4
...sitifolia is a medicinal plant that contains many therapeutic constituents. Till now, research has not been conducted related to this plant’s effect on hepatic drug-metabolizing enzymes and glutathion S-transferase. For this purpose, different cytochrome (CYP450) modulators were selected to determine pharmacokinetic interactions. Cimetidine, rifampicin, dexamethasone, and tamoxifen were selected as CYP450 modulators. I...
Nuzhat Munawar1, Abrar Hussain1, Imran Sajid2, Zahra Noreen1, Muhammad Aslam3*, Zeeshan Rehman1 and Aamir Ali3,4
...ery valuable therapeutic plant being used as herbal medicine to cure various diseases due to the variety of biologically active compounds present in it. Neem leaves of the plant were collected, dried, powdered, and extracted by using ethyl acetate, chloroform, and acetone as solvents. Qualitative phytochemical analysis showed the presence of active compounds. The antibacterial potential of various pl...
Najam-ul-Sehar Afshan1*, Javeria Majeed1, Abdul Rehman Niazi1, Saima Khanum2, Maria Riaz1, Muhammad Fiaz2 and Shaila Anjum1
...ed in Pakistan. Infected plants were collected from districts Mansehra and Abbottabad of Khyber Pakhtunkhwa, and district Lahore of Punjab, Pakistan, during phytopathogenic surveys in 2015–2020. The causal fungus was observed and identified on the basis of morpho-anatomical and molecular analyses. This is the first report of powdery mildew infection caused by Erysiphe necator var. necator from Punjab and Khyber Pakhtunkhwa provinces of Pakistan....
Kalsoom1, Nasir Shah2, Muhammad Ibrahim3*, Tahira Bibi1, Kazim Ali4 and Zahir Shah2
... salt in MS media, while plants of all the tested varieties were dead at concentrations more than 50 mM of NaCl in in vitro condition (75, 100 mM). Variation was observed in the level of tolerance to salinity in these potato varieties. Increasing NaCl (mM) level reduced the overall plant growth, number of shoots, number of nodes and leaves, root and shoot lengths (cm), fresh as well as dry root and shoot weights (g). In cont...
Saima Mumtaz1,3*, M. Imran Kasana1, Riaz Alam1, Noorullah Khan1, Muhammad Noman1, Sanjeela Sabahat1 and Hussain Shah2
...survival rate of layered plants, more requirement of mother stock and labor intensive method. To address these issues an alternative technique has been employed for quick multiplication of litchi. In the present study we have investigated the influence of various levels of Indole Butyric Acid (IBA) on four Litchi cultivars (Gola, Surahi, China and Bedana) for root induction, its development and success rate of survival in hardwood cuttings. Six treatments of I...
Sri Setyaningrum*, Dini Julia Sari Siregar, Tengku Gilang Pradana
...ubers with Lactobacillus plantarum (CGLp) on the performance, carcass, hematological parameters, and gut microflora of broiler chickens. The research used 144 one-day-old broiler chicks (44.33±1.09 g). The research was conducted with a completely randomized design. The treatments included of T0: diet + 0% CGLp (control), T1: diet + CGLp 1.0%, T2: diet + CGLp 1.5%, T3: diet + CGLp 2.0%, T4: diet + CGLp 2.5% and T5: diet + CGLp 3.0%. The treatment of CGLp...
Malik Muhammad Yousaf1, Wali Muhammad1, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahamad1, Annum Sattar2, Hera Gull3, Sonia Sumreen4, Malik Waqar Yousaf5, Nazakat Nawaz6 and Nazim Hussain7
...), number of tillers per plant (NTPP), plant height (PH), spike length (SPL), number of spikes per plant (NSPP), days to maturity (DM) and seed yield per plant (SYPP) were recorded. Estimates of heritability values were high in SYPP and DF ranged from 0.998 to 0.930, respectively, like all characters except DFI noted as 0.658 whereas genetic advance rang...
Malik Muhammad Yousaf1, Wali Muhammad1, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahamad1, Annum Sattar2, Hera Gull3, Sonia Sumreen4, Malik Waqar Yousaf5, Nazakat Nawaz6 and Nazim Hussain7
...), number of tillers per plant (NTPP), plant height (PH), spike length (SPL), number of spikes per plant (NSPP), days to maturity (DM) and seed yield per plant (SYPP) were recorded. Estimates of heritability values were high in SYPP and DF ranged from 0.998 to 0.930, respectively, like all characters except DFI noted as 0.658 whereas genetic advance rang...
Zubair Aslam1, Ali Ahmad1*, Korkmaz Bellitürk2, Hira Kanwal1, Muhammad Asif1 and Ehsan Ullah1
...uit length, fruit weight plant-1, plant-1 no. of fruits, plant-1 fruit yield, and yield ha-1) and physiological traits (membrane stability index, relative water content of leaves, total carotenoids, chlorophyll a, chlorophyll b, total chlorophyll (a+b) contents, SPAD value of chlorophyll and photosynthetic rate). The obtained results indicated that treatment T5 had significantly (p<0.05...
Tariq Mahmood1*, Mamoona Wali Muhammad2, Sami Ullah1, Bilal Ahmad3, Zarmina Aslam4, Naveed Ahmad Khan5, Muhammad Shahzaib Tariq6, Muhammad Ali Raza6, Rana Usama Iqbal7 and Samia Zain8
...advantageous not only to plants and insect colonies but also to humans. Honey bees helps preserve ecosystems as they offer pollination to many wild flowering plants. These pollinators are now under attack from a variety of sources. Pesticides, habitat degradation, genetic diversity loss, inclusion of genetically modified crops, and parasites are among the main threats to these pollinators. As a result of their decrease, ther...
Aamir Mushtaq1*, Fatima Habib2, Umar Farooq Gohar3, Abdul Malik4 and Mobasher Ahmad2
... toxicity indicated that plant extract did not affect the level of erythrocytes, leukocytes, thrombocytes, hemoglobin, hematocrit, creatinine and liver enzymes (SGOT, SGPT and TB) in mice. However, it significantly (P ≤ 0.05) increased the level of ALP in mice but on the other hand it lowered the blood glucose and cholesterol levels significantly along with increase in body weight of mice. It is concluded that P. anisum methanolic extract has a broad therap...
Tilahun Bekele* and Abebaw H. Georgis
...pt for days to maturity, plant height, and thousand seed weight. Based on the over-year combined analysis, the highest capsule number per plant (10.4), yield per plant (2.46), and total yield (703.9kg/ha) were noticed for the Darbera variety treated with a 15 kg/ha seed rate. The highest seed number per capsule (87.2) was also recorded for this treatment in the 2017 growing season. Essenti...
Hendrikus Fatem1,3, Abdul Latief Toleng2, Muhammad Yusuf2*, Herry Sonjaya2
...ween cattle and palm oil plantations is Indonesia. The objective of this study was to characterize the reproductive potential of Bali cows kept under palm oil fields after the application of artificial insemination (AI). This study was designed as field research that involved farmers and Bali cows reared under palm oil plantations. A total of 71 heads of Bali cows that have been calving for two consecutive times were used in...
Aqleem Abbas1, Mustansar Mubeen2, Yasir Iftikhar2, Qaiser Shakeel3*, Hafiz M. Imran Arshad4, Maria del Carmen Zuñiga Romano5 and Sarfaraz Hussain6
...ops which are engaged in plant defensive responses and responsible for various biological processes, including growth, development, stress, embryogenesis, and resistance to RSB disease. Conventional fungicides are now being replaced with eco-friendly fungicides and biological agents, including mycoviruses that can effectively control RSB disease and minimize the hazardous effects of chemicals. Here, we summarize the disease cycle, symptoms, and effects of envi...
Muhammad Adeel Qureshi1*, Raza Ahmad2, Bilal Ahmed1, Tanzim Ullah Khan1 and Muhammad Yasin3
...for callus induction and plant regeneration of potato (Solanum tuberosum L.). The experiment was carried out in complete randomized design (CRD). Leaves and internodes of potato cv. Desiree were used as explant for callus induction and plant regeneration. Two types of callus induction media (CIM) were used, i.e. CIM1 and CIM2 with concentrations of 2, 4-D 2mg/lit and 3 mg/lit respectively....
Syed Shah Mohioudin Gillani1, Muhammad Naveed Tahir1, Adeel Anwar1*, Syed Ijaz Ul Haq2, Muhammad Awais3, Mujahid Iqbal4, Javed Iqbal5, Hina Ahmed Malik3, Syed Muhammad Zaigham Abbas Naqvi6, Raza Ullah7 and Muhammad Abdullah Khan1
...orophyll pigmentation in plants is a supreme factor to assess the health of plants and ultimately leads to crop yield estimation. The present experiment evaluated the capacity of high-resolution satellite imagery to estimate wheat chlorophyll content coupled with ground-based information for accurately monitoring crop chlorophyll status under rainfed conditions. Images with zero clouds from LANDSAT 8 and ground data collecti...
Muhammad Umair1,2, Muhammad Naeem1, Asad Jamil3 and Muhammad Younas2,4*
...owed maximum increase in plant height (51.82%). Similarly, maximum increase in shoot dry weight (160.24%), root dry biomass (169.52%), root length (15.87%), and chlorophyll contents (53.62%) was also found for rice husk biochar @ 0.3% as compared to saline-sodic control. rice husk biochar @ 0.3% was found most effective in improving maize growth and soil properties under saline-sodic conditions....
Mishal Bano1, Amir Shakeel1, Waqar-ul-Haq1, Muhammad Nouman Khalid1*, Nadia Hussain Ahmad2, Muhammad Sajid Sharif3, Sadia Kanwal2, Muhammad Asim Bhutta2, Amna Bibi2 and Ifrah Amjad1
...s and their parents were planted in the fields, Plant Breeding and Genetics department, University of Agriculture Faisalabad using two replications with randomized complete block design (RCBD). Results of ANOVA revealed that all the genotypes were highly significant for most of the plant height, sympodial branches/plant, monopodial branches/
Muhammad Afzal1,3*, Shafqat Saeed1, Hasan Riaz1, Muhammad Ishtiaq1, M. Habib ur Rahman2
...ectly by transmission of plant viruses that reduce the crop yield and quality. Cotton leaf curl virus (CLCuV) management is difficult due to multiple virulent strains and higher recombination rate that is a serious threat to the cotton crop of the last two decades in Pakistan. Alternate host plants belonged to vegetables, weeds, and mixed farming practices helped the evolution of new viral and whitefly species. The CLCuD dev...
S. A. Khanzada, M. Naeemullah, A. Munir†, S. Iftikhar and S. Masood
... their rhizospheres. Six plant parasitic and six saprophytic nematode genera were found associated with mint rhizosphere. Tylenchorhynchus spp., was found to be assoc...
M. A. Radwan†, S. A. A. Farrag, M. M. Abu-Elamayem and N. S. Ahmed
..., 255);">) as well as on plant growth characteristics in a glasshouse. The rate of the formulated form of oxamyl, carbofuran or cadusafos was 0.1 g/kg soil, while it was 0.125 g / kg soil for fosthiazate and 0.25 g / kg soil for ethoprop. All nematicides caused reduction in root galls and J2
...
B. K. Goswami, C. Bhattacharya, R. Paul and T. A. Khan
...b(255, 255, 255);"> plants. Among the tested treatments, Trichoderma viride,
A.E. Ismail and M. M. Mohamed
...infesting sugar beet and plant growth, yield and total soluble sugars (TSS %) under new reclaimed sandy loam field. Results indicated that all treatments at their rates significantly (p≤ 0.05 and / or 0.01) reduced females, galls and egg-mass numbers as compared to un-amended plants. All rates of Ch M treatment gave best results in protecting sugar beet plants and diminishing the nemato...
D. S. Srivastava, M. Sehgal†, A. Kumar, S. Verma, B. K. Dwivedi and S. P. Singh
...t for the infestation of plant parasitic nematodes associated with vegetable growing fields i.e., tomato and okra. Soil and root samples were collected from 238 tomato fields represents 16 different locations (villages) where TSS-1 to TSS-238 varieties and 227 soil and root samples from the okra fields were collected (OSS-1 to OSS-227) represents 16 different locations (16 villages) to identify the hot spots of plant-p...
B. Archana and R. Saxena
...ous extract of medicinal plants viz., Amaranthus spinosus,Chenopodium album, Catharanthus roseus, Solanum nigrum and Ocimum sanctum were investigated for their nematicidal activity against second stage juvenile of Meloidogyne incognita by in vitro technique. Aqueous extract of all plant roots exhibited nematicidal activity. LC50 values calculated as 1024 ppm for C. roseus, 1867 ppm for S. nigrum, 1968 ppm for A. spinosus, 34...
Mohamed S. Abbas1*, Adel E.M. Mahmoud2, Hemat S. Mohamed3, Adam Cieślak4 and Małgorzata Szumacher-Strabel4
... effect of dietary forge plants (grasses, legumes and forbs) contents and concentration on ruminal fermentation, pH, ammonia (NH3), total gas production (TGP), methane and volatile fatty acids (VFA) concentration. Twenty-six wild palatable forage plants were identified and analyzed for pH, NH3, TGP, methane and VFA. The results indicated that in grasses the highest pH and NH3 concentration was found in Aeluropus lagopoides, ...
Rehman Shabbir1, Ghulam Sarwar1, Noor us-Sabah1, Mukkaram Ali Tahir1, Muhammad Luqman*2, Muhammad Fahad Ullah3, Muhammad Zeeshan Manzoor1 and Imran Shahzad1
...ies and growth of tomato plants. The physiochemical parameters of the soil such as pH, EC, organic matter, heavy metals and physiological parameters of the tomato plants were observed. Most of the soil parameters were proved higher with the irrigation of the industrial wastewater effluents than the soil irrigated with canal water. The tomato plants were grown at the different ratios of ind...
Esam A Razin1, Hassan Sobhy2, Tarek R. AboElnaga1, Asmaa A. Darwish1*, Rasha S. Mohammed1
...ultifunctional medicinal plant. It confirmed its anti-trypanosomal activity in vitro before. This research aimed to study its effect against T. evansi in vivo. For this purpose, 28 parasite-free female rats were used, seven non-infected (control group (CG)), while the others were intraperitoneally injected with T. evansi and then equally divided into Trypanosoma Group (TG): which remained without treatment. Diminazene aceturate group (DAG): injected with Dimin...
Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*
...s rhamnosus supplemented plant by products based feeds. The study comprised of two experimental and one control groups. In treatment 1 (T1), fish were fed with soybean meal along with L. rhamnosus. In treatment 2 (T2), fish were fed with sunflower meal along with L. rhamnosus. The control group was served with commercial feed. Initial mean weights of the experimental fish was recorded as 40.00 ± 1.00, 40.33 ± 0.76 and 40.01 ± 1.00 g for T1...
Rana Aamir Shehzad1, Ghulam Sarwar1*, Sabir Hussain Shah2, Mukkram Ali Tahir1, Noor-us-Sabah1, Sher Muhammad2, Muhammad Aftab3, Muhammad Zeeshan Manzoor1, Imran Shehzad1 and Usman Saleem4
...d that highest height of plant (71.42 cm), shoot dry weight (10.74 g), length of spike (13.33 cm), tiller numbers in a plant (7.16), weight of dry root (0.335 g), root length (11.68 cm), weight of 1000 grains (37.88 g) and wheat biomass (48.63 g) were recorded with T11 (T2 + all P from PROM). Thus, P application improved the wheat growth and yield traits significantly (T1) and T11 was found more effective for achieving the o...
Rahmat Ullah Khan1*, Karim Gabol1, Asif Sadam2, Waheed Ali Panhwar3, Hamidullah4 and Abdul Rahim1
...or on the branch fork of plants. The nests were mainly constructed using local dry grasses (48%) followed by crop leaves (35%), plastic string (10%), and unidentified materials (7%). The average outer diameter of the nest 12.00±1.1 cm, inner diameter 9.13±2.3 cm and inner cup depth was 4.99±2.1 cm. This bird has one brood per season. Overall breeding cycle lasted for 90 days. The shape of the eggs was oblong and white pinkish, with darker ...
Shabana Memon1*, Aamir Ali Abro1, Muhammad Iqbal Jakhro2, Aqsa Farid3, Maliha Habib4, Maqbool Ahmed5, Liaquat Ali Bhutto6, Saba Ambreen Memon7 and Muhammad Farooq8*
Syed Hilal Sardar1, Yousaf Jamal1*, Iltaf Ullah2, Abdul Basir1, Hidayat Ullah1 and Mukhtar Alam1 and Ikramullah3
... three replications. The planting was done on ridges following recommended planting geometry of row to row distance of 75cm and plant to plant distance of 25 cm. Our findings revealed that plant height (cm), ear weight (g), grains ear-1, 1000 grain weight (g) and grain yield (kg ha-1) varied significantly (P≤0.05) a...
Saleem Hussain1, Muhammad Tayyab1, Tauqir Anwar1, Talha Nazir2*, Muhammad Zeeshan Majeed3, Zohaib Asad2,4, Muhammad Adnan3 and Tajwar Alam5
...potential of seven local plant species (i.e. parthenium Parthenium hysterophorus L., eucalyptus Eucalyptus camaldulensis Dehnh., milkweed Calotropis gigantean (L.) Dryand., bakain Melia azedarach L., neem Azadirachta indica A. Juss., tobacco Nicotiana tabacum L. and thorn apple Datura stramonium L.) against wheat aphid (Schizaphis graminum Rondani) under laboratory and field conditions. Using foliar spray method, toxicity bioassay was conducted with three diff...
Ambrin Rajput1* and Mehrunisa Memon2
...ortant part in enhancing plant productivity of the crop. Keeping in view the role of plant nutrition, research trial was led to determine various rates of P 0, 25, 38, 50, 75, 100, 125, 150 P2O5 kg ha -1 on yield, uptake, P utilization efficiency of Mungbean. For this, randomized complete block design was arranged with three times. The outcome showed that Phosphorus application 50 kgha-1 P2O5 with nitrogen (N), and potassium...
Ali I. Al-Ameedi1, Zahraa M. Ayad2*, Wed Abbas Mohammed3, Salim K. Hajwal4
...is a potential medicinal plant used traditionally to treat various diseases. The present study aimed to evaluate the protective effect of Ginkgo Biloba against Genotoxicity Induced by Hyroxyurea in Mice. Forty male albino mice were randomly divided into 4 groups of ten animals. The first group received hydroxyurea (80mg/kg B. W) orally daily for 30 days, while second and third group received Ginkgo Biloba (100 mg/ kg.BW) and omega3 (150 mg/kg.BW) orally daily ...
SYED ZULFIQAR ALI ABIDI, HAFIZ ABDULLAH SHAKIR, SYED SHAHID ALI, & JAVED IQBAL QAZI*
... potential. Total thirty plants were collected on the basis of their availability and abundance around the year from different locations of Punjab, Pakistan. The aqueous and alcoholic extract of fresh and dried parts of each plant were used for qualitative estimation of thirteen metabolites (alkaloids, carbohydrate, cardiac glycoside, flavonoid, phenol, phlobatannine, free amino acids, saponins, tannins, terpenoids, quinine,...
SAEED AHMED*1, ZIA-UR-RAHMAN1, SALMA KHALID2, TARIQ KHAN1, ARSHAD IQBAL3
& ZAMARUD SHAH4
...inking water. Filtration plants, proper chlorination and awareness program should be carried out for safe drinking water.
Key Words: Drinking water, Microbial contamination, waste management.
...
SADAF SARFRAZ1*, SAFDAR AMEER1, REENA AMBREEN1, SHOMAILA SIKANDAR 2, SHAISTA NAWAZ3 AND YASIR SALEEM3
...ally occurring medicinal plants, Cinnamaldehyde, owing to its acid generation, acid tolerance and virulence gene expression has gained a considerable attention. Keeping in view its beneficial aspects, the present study has been conducted to investigate the contents and compare the nutritional and antimicrobial activities of Cinnamon collected from various regions of Asia. In this study, antimicrobial activity of cinn...
MUHAMMAD MUDASSAR SHAHZAD1*, FATIMA KHALID1, MEHWISH FAHEEM2, SYED ZAKIR HUSSAIN SHAH3, SANA BASHIR1 & SYED MUHAMMAD KHAN1
...p at a 4 g/kg level in a plant-based diet.
Arief1, Roni Pazla2*, Rizqan1, Novirman Jamarun2
...
Tithonia diversifolia plants and cassava leaves have the potential to be used as a substitute for field grass. Palm kernel cake is a waste of the palm oil processing industry and can be used as a concentrated alternative. This study aims to determine the impact of giving Tithonia diversifolia plants, cassava leaves, and palm concentrates on the milk production and quality (fat and lactose), intake, and digestibility of Et...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Shafia Saba2, Madiha Mobeen Khan3, Umair Faheem4, Asad-ur-Rehman3, Naeem Arshad Maan3 and Waseem Hassan5
...lected from the infested plants grown in lawns of Muhammad Nawaz Shareef University of Agriculture, Multan, Pakistan, and were brought to the lab for rearing and identification. After emergence of moths, specimens were killed and identified using available taxonomic keys under stereomicroscope. After identification, it was revealed that the insect under study was identified as T. varians. After going through the relevant literature, it was found that this spec...
Ubaida Hussain1,2*, Amtul Jamil Sami1*, Shazia Rafique3*, Muhammad Idrees khan3 and Ahmad Ali Shahid3
...ities of local medicinal plant Azadirachta indica (A. indica) extracts on expression of NS3 and NS5A nonstructural proteins of HCV 3a genotype. Owing to the fact that HCV patients can develop HCC, plant extract has also been tested for cytotoxic activity. Colorimetric analysis was done to determine the vitality of HepG 2 cells for 24 h after treatment with methanolic seed extract and minimum inhibitory concentration was calc...
Amber Khalid1*, Amjad Rashid Kayani1, Muhammad Sajid Nadeem1, Muhammad Mushtaq1, Mirza Azhar Beg1 and Surrya Khanam2
...l predominately consumed plant matter in its diet (74.5%) along with animal matter (25.5%). Among plant matter, Triticum aestivum (wheat) was the major consumed item followed by Brassica campestris (mustard) and Arachis hypogaea (peanut). Sorghum bicolor (millet) and Vigna radiata (mong bean) was also consumed in small proportions. Pearson chi-square was used to calculate the significance difference among every food item and...
Ahmed Ali Chandio1, Asghar Ali Kamboh1*, Nazar Ali Korejo2, Riaz Ahmed Leghari3 and Muhammad Ali Chandio4
... an indigenous medicinal plant of Asia, which has long traditional use, having anti-inflammatory, anti-pyretic, anti-nociceptive, anti-oxidant, anti-ulcer, antihyperglycaemic and anti-microbial activities. The current investigation aimed to explore the immunomodulatory and gut microflora modulatory effects of dietary P. pinnata in broilers. Day old broiler chicks (n=125) were purchased from local hatchery and equally divided into the five groups, i.e., C (cont...
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
...ter, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazard...
Riaz Muhammad1*, Aamer Sharif2 and Muftooh ur Rehman Siddiqi³
...ional water vortex power plant is an emerging technology among various micro hydro-power plants because of its low head, cost-effectiveness, environmentally friendly and minimal installation and setup time. In the present study, the performance of single-stage gravitational water vortex turbine assembled in a conical basin with curved blade has been analyzed at different head and flow rate to investigate the performance para...
Muhammad Arabi Awan1, Hafiz Husnain Nawaz2*, Naeem Akhtar2 and Azmat Ali Awan3
...ae, which includes other plant-sucking insects. The psyllid can cause significant damage to the olive tree, affecting its growth and yield, and also reducing the quality of the olives produced. A study conducted in 2020 at the agricultural research center in Tarnab, which evaluated the effects of different pesticide treatments on the population of olive psyllids in an olive orchard. The study tested three treatments: CHLORPYRIPHOS 50% EC (T1), THIAMETHOXAM 25 ...
Ijaz Haider1,2*, Muhammad Riaz2, Sikandar Ali2, Qurban Ali1, Ali Noman3, Dilbar Hussain1, Imran Nadeem1, Muhammad Faheem Akhtar1, Aqsa Abbas1, Asad Aslam1, Hafiz Saad Bin Mustafa2, Ejaz Ul Hassan2, Muhammad Zubair2, Muhammad Saleem1 and Muhammad Kamil Malik1
...lts that SA has enhanced plant resistance against whitefly and thus reduced the damage of pest. SA can be used as alternative combination for the management of cotton whitefly and the amount of insecticide can be reduced for the control of whitefly....
Muhammad Ehsan Safdar1, Muhammad Asif1, Amjed Ali1, Ahsan Aziz1, Naeem Akhtar2, Muhammad Shahid Gulrez1 and Waqas Raza3*
... NAR (34.4 g m-2 day-1), plant height (195.0 cm), and silique length (6.06 cm) biological yield (15.67 tons ha-1), seed yield (3.85 t ha-1) and oil yield (1188.3 kg ha-1) of canola were recorded with 2 kg ha-1 B + 10 kg ha-1 Zn treatment. The enhancement in seed and oil yield of canola seems to be due to improvement in seeds per silique (29) and 1000-seed weight (4.25 g). A synergistic relationship might exist between these two nutrients as their combined appl...
Mostafa Mohamed Attia Hammam, Moawad Mohamed Mohamed Mohamed* and Mahfouz Mohamed Mostafa Abd-Elgawad
... was not detected at pre-planting soil samples of two consecutive field seasons. However, the potential of field weeds as hosts/reservoirs for M. arenaria to transfer from weeds and build-up on ‘Giza 843’ faba bean roots was apparent at harvest. Significant relations were established between the M. arenaria population levels at harvest and weights of faba bean pods. Consequently, the gain thresholds were calculated based on the combined costs of ne...
Usama Saleem1, Muhammad Asrar1*, Dilbar Hussain2, Saddam Hussain1, Abdul Ghaffar2, Hassan Usman1, Muhammad Imran1, Mubshar Saleem3 and Maryam Hamid1
...ecting a poison into the plant, eliminating photo-assimilates, and spreading plant-destroying viruses. This study aimed to investigate the effectiveness of botanical extracts and synthetic insecticides in combating wheat aphids. Data regarding the aphid population was recorded 24, 48, 72, and 168 hours after the application of plant extracts and insecticides. Maximum mortality recorded aft...
M. A. Amer1; M. H. El-Hammady2; H. M. Mazyad1; A. A. Shalabyl and F. M. Abo-El-abbas
A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1
... YN isolated from potato plants cultivated at Monofyia Governorate. RNA was extracted from virus-infected tissues of D. metel leaves by the use of degenerate primers through polymerase chain reaction (PCR). Large-scale amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolati...
Characterization and Molecular Detection of Tomato spotted wilt Tospovirus Infecting Tomato in Egypt
Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2
...m and Physalis peruviana plants. Total nucleic acids were reverse transcribed using Retrotool reverse transcriptase enzyme and the PCR reactions were performed for 30 min in a capillary thermal cycler. RFLP analysis of the PCR products was performed using Msel restriction enzyme. The results showed a dimorphic restriction digestion profile that "as suitable for identifying the two isolates. The method described here is rapid. reliable and highly rec...
E. K. Allam1; Kh. A. El-Dougdoug1; M. A. Amer2; A. A. Abou-Zaid2; and S. M. Amin2
...) was detected in potato plants grown in Egypt using return-polyacrylamide gel electrophoresis (R-PAGE) and molecular techniques. The method involved the extraction of circular nucleic acids followed by electrophoretic analysis of the extracts on 5% polyacrylamide gel. A reverse transcription-polymerase Chain reaction (RT-PCR) assay was used for the isolation and identification of PSTVd cDNA from infected plant materials usi...
Sahar. A. Shoman1 and B. A. Othman2
... RNA extract of infected plant and RNA of purified TMV particles were subjected in this method with four degenerate and undegenerate primers. The primer pairs generated two specific PCR fragments of 3428 base pair (bp) and 3836 bp of the whole TMV genome. The intensity of these RT-PCR amplified products was estimated, and it indicated relatively to the amount of the virus in the infected plant, The specificity of amplificati...
A. S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik2; Nashwa M. A. Abd El Mohsen1; and H. M. Abdelmaksoud1
...fy;">The infected potato plants showed aucuba symptom characteristic to this virus (brilliant and extensive yellow mottle on lower and middle leaves reaches their tips, brown patches and sunken brown areas were frequently observed on the tubers surface) were used as a virus source. Isolation and identification of the virus was performed through studying biological, serological, and molecular characters. Electron microscopy helped for illustration Of Morphology...
S.A. El-Kewey1; R.A. Omar1; S.A. Sidaros2 and Samaa Abd El-Khalik3
...erity symptoms on garlic plants of both cultivars. The electron microscope preparations of crude sap extracted from naturally infected garlic plants and negatively stained with 2% PTA showed flexuous rod-shaped particles 657-714 nm long. Biological relationships between the virus and insect vectors were studied....
Salwa N. Zeinl and Hanaa S. Zawam2
... was transmitted to bait plants grown in soil containing Xiphinema spp. nematodes, The virus was identified according to host range, mode of transmission, particle morphology, serological tests, and SDS-Polyacrylamide gels. Purification of ACLSV was performed using bentonite/polyethylene glycol. Electron micrograph of purified virus preparation revealed flexuous filamentous virus particles of 700 nm length and 12 nm wide. The average yield was 1.14-1.7mg/100 g...
Waheed Khan1, Muhammad Ajmal Khan2, Bakhtawar Khan1*, Aftab Amin3, Muhsin Ali4, Awais Farid, Ali Hazrat5 and Muhammad Yahya5
...prove DM treatment. Thus plant-based management could be a possible antidiabetic strategy. The objective of the most recent study was to assess Verbascum thapsus’s ability to combat hyperlipidemia and diabetes. Mice were given an intraperitoneal injection of alloxan (150 mg kg-1, b.w.) to cause diabetes. There were five groups of mice (n=10): group 1 (normal control) received normal food and water, group 2 (diabetic control) received normal food and clea...
Bismillah Khan1*, Muhammad Mehran Anjum1,2*, Maaz Ullah1, Izharullah1, Aftab Ahmad3 and Jawad Akbar1
...gher weeds density (79.6 plants m-2), (64.0 plants m-2) and (39.6 plants m-2) 30, 60 and 90 DAS, respectively. Similarly, local check PS-15 produced higher weeds fresh weight (219.6 g m-2), (253.7 g m-2) and (303.0 g m-2) 30, 60 and 90 DAS, respectively. Moreover, weeds dry weight was recorded higher (61.3 g m-2), (88.6 g m-2) and (111.6 g m-2) 30, 60 and 90 DAS in local cultivar PS-15, re...
Riaz Hussain2*, Adnan Ihsan1*, Waqar Khan1, Shiraz Malik1, Hamza Jameel1, Hidayat Ullah3, Shahab Ahmad4, Jawad Anwar5 and Murad Ali6
... the efficacy of various plant extracts viz., (Green Chili (Capsicum spp.), Garlic Fresh Cloves (A. sativum), Chinaberry Fresh leaves (M. azedarach), Eucalpytus leaves against pea aphid Acyrthosiphon pisum. The research experiment was design randomize complete block (RCBD) with three replications and two sprays were applied at 14 days interval. After 7 and 14 days of 1st and 2nd application the minimum means density of aphids were recorded in plot treated with...
Muhammad Akram¹,²*, Rashid Mahmood³, Fahim Arshad4 and Umer Farooq Gohar5
...is a promising medicinal plant of the family Solanaceae, but its survival is under threat, and limited long-term conservation approaches are available. We employed an in vitro plant tissue culture technique to develop a mass propagation system for the effective multiplication and conservation of P. minima. Juvenile leaves were cultured on MS basal medium supplemented with 0.1, 0.5, 1.0, 2.0, and 5.0 µM thidiazuron (TDZ...
Yisi Chen*, Jun Zhang and Fayin Li
...p (general anesthesia of plantar incision, inhalation of 2.5% isoflurane, 3 groups, n=15), propofol group (general anesthesia of plantar incision, intravenous infusion of propofol to the lateral tail vein through the implanted catheter with the infusion rate of 1.5 mg kg-1 min-1, 3 groups, n = 15). The paw withdrawal threshold was used to evaluate the mechanical pain before and after the i...
Saiwa N. Zein
...eedlings and tested host plants. Host range of the virus studied was restricted in Chenopodiceae. Cucurbitaceae. Ebenaceae. Leguminosae and Solanaceae. The identity of the virus to TRV was confirmed by mode of transmission. particle morphology and serological typing. Examination or the purified virus preparation 1» electron microscopy revealed rod-purify the Egyptian isolate of TRV. The yield of the virus was 2.6-5.7 mg/ 100 g tissue of Nicotiona rustica...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
... SCMV-E-infected sorghum plant cells proved the presence or the cytoplasmic inclusions characterized to the potyviruses. The virus was purified and an antiserum containing polyclonal antibodies specific to SCMVE strain was raised. Western blot immunoassay (WBIA) successfully used to study the specificity of the produced antiserum to SCMV-E strain. On the level of the molecular studies of SCMV•E strain. a single protein band "ith a size of about 35-37...
Maria Endo Mahata1*, Oriyanti Br Situngkir1, Yan Heryandi2, Takayuki Ohnuma3, Yose Rizal1
...e of pellet binder Miana plant (Plectranthus scutellarioides [L]R.Br) on crude fiber digestibility, nitrogen retention, and energy metabolism in broiler chicken. The study used 30 broiler male chickens with an average body weight of 1.5 kg at five weeks of age. This study used an experimental method with a completely randomized design (CRD) of a 3x3 factorial pattern which was repeated three times. Factor A (type of pellet binder): A1 (brown seaweed), A2 (tar...
Adel B. Salama and Reham M. Sabry*
...rown as a single purpose plant for its flowers or recently for its seeds, whereas information for calendula cultivation for both flowers or petals and seed production is very scarce. A field study was conducted on two seasons to evaluate the effect of petal harvesting on flower heads fresh and dry weights, monthly and cumulative number of flower heads/plant, seed yield, fixed oil percentage and fatty acid analysis of pot mar...
Najamuddin Solangi1*, Mushtaque Ahmed Jatoi1, Adel Ahmed Abul-Soad2, Abdul Aziz Mirani1, Muhammad Aslam Solangi3 and Ghulam Sarwar Markhand1
...omatic embryogenesis and plantlet regeneration in commercially important date palm cvs. Begum Jungi and Ajwa. Spikelet explants of spathes (avg. 17, 28, 32 cm) excised at different intervals were used as initial explants. Results revealed that sterilization of spathes with 50% sodium hypochlorite (NaOCl) solution resulted in significantly highest survival, lowest mortality and contaminatio...
Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5
Luqman1*, Zahid Hussain2, Tamana Bakht3, Fazli Wahab1, Miftah-ud-Din1, Haroon Khan2, Imran Shinwari1, Ata Ullah1, Liaqat Khan1 and Sara Hidayat4
... weed biomass (kg ha-1), plant height (cm), no. of leaves plant-1 and biological yield (kg ha-1). The results of the investigation showed that both the cropping patterns and weed control measures significantly affected all the studied parameters except plant height at maturity (cm). Furthermore, the N-S sowing direction proved to be more effective in terms of weed control and enhancing the...
Muhammad Saad Waqas, Li Xia, Tian-Ci Yi*, Liang-Yu Sun, Rong Xiao and Dao-Chao Jin*
...ing behavior on the host plant surface. Waste management behaviour of many Stigmaeopsis species are well described by many scientists but waste management behaviour of S. inthanonsis is still unknown. Here, we studied nest relocation and waste management behaviour of S. inthanonsis. Results showed that fecal piles, dead bodies and exuviae are the waste materials of S. inthanonsis nests. The defecation behaviour showed that S. inthanonsis deposited the less fec...
Rahma Boukarine*, Leila Hamdi and Kamel Khelili
...have been extracted from plants and fruits, especially antioxidants which aid protect against oxidative stress. This study was conducted on Albino Wistar rats to investigate the antioxidant effect of Eruca sativa on the hepatic and renal profile damaged by xylene. Seventy rats were divided into seven equal groups and treated by gavage for 30 days as follows: Control group (C), group (CO), positive control group (RE) was received 350 mg / Kg bw of Eruca sativa ...
Anwar ul Haq1, Maqsooda Parveen2, Shehzadi Saima3* and Khalid Masood Ahmad1*
...ping losses of these pot plants. Optimum concentration of appropriate auxins is used to promote effective rooting. Completely randomized design (CRD) is adopted and it consisted of five treatments including control and different concentration of both auxins viz. 1-Naphthalene acetic acid (50 mg/L,100 mg/L) and Indole-3-acetic acid (100 mg/L, 200 mg/L) on tip cuttings of chrysanthemum. In this experiment, 15 pots of 9-inch diameter were used which were filled w...
Hassan Raza1, Muhammad Kashif Afzal2, Muhammad Luqman1*, Tahir Munir Butt3, Muhammad Yaseen1 and Muhammad Umer Mehmood1
...ist with a minimum of 50 plants was collected from the Department of Agriculture (Extension). A total sample size of 310 farmers was selected through a purposive sampling procedure by using Morgan and Krejcie table as the total population (Olive growers in the targeted research areas) is 1500. Data were collected through a face to face interviews with the help of an interview schedule. The SPSS (Statistical Package for Social Sciences) and MS. Office software ...
Faiza Siddique1, Muhammad Shahzad Ahmed1, Rana Arsalan Javaid1, Alvina Hanif1, Maria Rabnawaz1, Muhammad Arshad2, Irum Raza3 and Abid Majeed1*
... especially during early plant developmental phases and germination and seedling stage, an experiment was carried out from June to July 2021 at the Rice Molecular Breeding Laboratory of the Rice Research Program, Crop Sciences Institute, National Agricultural Research Centre, Islamabad. Ten elite coarse rice lines were subjected to varying degrees of drought stress as 0, 10, 15 and 20% through the application of Polyethylene glycol (PEG-6000). To carry out exp...
Abid Hussain1*, Hassnain Shah1, Muhammad Nadeem Iqbal2 and Tariq Sultan3
...der technology sites for planting wheat. Use of micronutrients resulted in better fruit setting and productivity in citrus by 12.5 percent and 15.0 percent, respectively. Sample farmers reported that use of the technology resulted in premium prices of the produce by ten percent. Benefit cost ratio of micronutrients use for citrus orchards was 5.71. Use of micronutrients for off-season vegetables resulted into even better gains; increased productivity of chili ...
Sahar Ezeldien1,2, Foromo Dramou2, Fatma M. Yousseff3*, Alexander A. Nikishov2, Sergy B Seleznev2
...e most popular medicinal plants known for its antibacterial, anti-inflammatory, and antioxidant properties. This study was conducted to determine the effect of chamomile aqueous extract on the productivity, egg quality, and serum biochemical parameters of laying Japanese quail. A total of 42 Japanese quail were separated into two groups of 21 birds each, with three replicates per group (7 birds) at random; the control group without any additives and the supple...
Mahpara Fida Ahmed1, Abdul Hanan2* and Sher Ahmed2
...to T5) of row to row and plant to plant distance/spacing viz: T1= 15 cm, T2= 20 cm, T3= 25 cm, T4= 30 cm and T5= 35 cm were used. The results indicated that only large corms produced the flowers while medium and small corms failed to produce flowers. Large corms emerged out in less (46) days, survived higher (95.33 %) with a maximum leaf height (25.32 cm), higher number of leaves/plant (7....
Jawad Ali1,*, Samiya Rehman1, Aqsa Aslam1, Fouzia Tanvir2, Rida Liaqat1, Muhammad Ahmad1, Aamir Riaz1, Muhammad Shafique3, Hassan Ali1 and Amjad Ali1
...aceae family is a useful plant holding an important place in Ayurvedic medicines. Presence of biomedical compounds polyphenols, carotenoids, vitamins, and trace elements as secondary metabolites imparts antidiabetic, hepatoprotective, hypolipidemic, antidepressant, immunosuppressive, anti-microbial properties to the W. coagulans Dunal. Plant samples from Mianwalli, Kohat, and Sargodha city were gathered for antioxidant poten...
Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Summer, Ali Haidar Gormani, Saira Nawaz and Ayesha Muzamil
...ferent parts of mulberry plants. Mulberry leaves possess different physiological and biological potentials. Inflammation is the most common factor involved in various chronic diseases. This research study was conducted to evaluate anti-inflammatory and analgesic potentials of hot water extracts of mulberry leaves (mulberry tea) of two species i.e., Morus alba and Morus nigra. Mice were fed orally with mulberry leaves extract (200mg/kg, 100mg/kg and 50mg/kg) mi...
Muhammad Usman Shafi1, Hafiz Azhar Ali Khan1*, Tiyyabah Khan2, Waheed Anwar2, Adnan Akhter2 and Muhammad Zubair3
Hafiz Muhammad Walayat Ali1, Hafiz Basheer Ahmad1*, Zaheer Ahmad Nazar2, Muhammad Akhlaq Mudassir1, Mahmood-Ul-Hasan1, Abdul Khaliq1 and Muhammad Shahzad Afzal1
...und resistant to smut in plant and ratoon crop respectively. Principal component analysis showed that first eigenvalue was equal to (1.78) and represented that (35.6%) of the total variation. The 2nd eigenvalue (1.077) and represented of the total variation (57.2%) for the crop plant. For the ratoon crop, the first eigenvalue was (1.83) and presented (36.6%) of the total variation while 2nd eigenvalue (1.15) and represented ...
Muhammad Zahid Rashid1, Amina1*, Hafiz Wasif Javaad2, Muhammad Asim Rashid3 and Amina Rashid3
...umber of seeds survived, plant height, leaf area, suckers evolved and other parameters were noted for better yield and quality of date palm for purpose of chance seedlings development. This research experiment was arranged at Progeny orchard of Horticultural Research Institute, Faisalabad during the year 2019-2021.The research was designed according to Randomized Completely Block Design (RCBD) with eighteen treatments having four replicates. The documented dat...
Imtiaz Khan1*, Bashir Ahmad1, Ahmad ur Rahman Saljoqi1, Shah Alam Khan1, Javed Khan3 and Muhammad Azim Khan2
...b 2020. Each variety was planted in sub-plot size 3×2 meters having 3 rows and 5plants/row in randomized complete block design (RCBD) with three replications. The data was recorded from Mar-Nov from fresh and ratoon crops of the year 2020 and 2021, respectively. The leaves (top, middle, and bottom) of five plants in each subplot was observed randomly for data collection every fortnig...
Peng Xu1, Yankuo Li2*, Shusong Zhang1 and Bin Liu3
...tribution ranges. Bamboo planting areas were found to possess more rodent species than other habitats. Crocidura Dracula, Micromys minutus, Lepus sinensis, A. agrarius, Rattus nitidu, Tamiops swinhoei and R. norvegicus were each trapped in only one habitat. Among habitats, bamboo planting areas showed the highest diversity index and richness index of rodent community, while farmland harbored the highest dominance index and l...
Aqleem Abbas1, Mustansar Mubeen2, Waqar Younus1, Qaiser Shakeel3, Yasir Iftikhar2*, Sonum Bashir2, Muhammad Ahmad Zeshan2 and Azhar Hussain1
...f Pakistan was free from plant diseases and pests. However, plant diseases and pests intensities are increasing and threatening the food security of GB. These plant diseases and pests seem to be exacerbated by climate change and transmitted to GB from other regions with food supplies and spillover. In addition, the evolution of new pathogen and pest strains causes catastrophes to GB’...
Mohamed Adam1*, Hassan Sobhy2, Mohamed Abouzid3, Dalia Elhafny4 and El-Desouki Ibrahim5
... any negative impacts on plant and soil....
Guo-Hai Wang1,2,3, Chuang-Bin Tang1, Yuan-Xin Yang1, Yan-Ling Huang1, Wei-Ning Tan4, Qi-Hai Zhou3* and Chang-Hu Lu2*
...hat leaf litter covering plant seeds may be beneficial for seed survival, but it is unclear whether leaf litter contributes to the survival of Kmeria septentrionalis seeds in karst habitat. Herein, we investigated the seed removal of K. septentrionalis by rodents at different locations (beneath and away from the mother tree) using two treatments (leaf litter coverage and control) to clarify the effect of leaf litter coverage on seed survival. The average seed ...
Sarwat Yousuf1, Shaista Emad2 , Mohammad Misbah ur Rehman3, Zehra Batool4, Sara Qadeer5, Yousra Sarfaraz1, Sheeza Sheikh1, Sana Sadaf6 and Tahira Perveen1,*
...e therapeutic potency of plants has been known for ages and the ability to divulge their biological activity is an area of great interest. Citrus lemon is traditionally used as an antioxidant, antibacterial and anti-inflammatory agent. This study intended to determine the potential role of lemon peel oil in neurobehavioral function and oxidative stress. Rats were treated with lemon peel oil at a dose of 0.7, 1.4, 2.1, 2.7, 3.5 g/kg for 14 days. Results showed ...
Amina Rahat1, Zahin Anjum1*, Sehlina Zehra2, Fatima Umal Baneen3 and Rabia Chishti1
...are present in medicinal plants. These bioactive chemicals serve as a foundation for the creation of antibiotics that are utilized to cure infectious illnesses. Allium sativum is being used traditionally since ages for many purposes. It is extensively used in numerous dishes throughout the world and due to its aromatic nature, as a fragrance and Plantago ovata is traditionally used for many therapeutic purposes; laxative ant...
Monis Hussain Shah1*, Riaz Ur Rehman2, Riaz Ali Shah1, Farwa Batool3, Rizwan Rafique4, Muhammad Usman5, Sajida Bibi6, Sadia Yasin7 and Samida Qamar8
...lbs of each variety were planted in the bed. The performance of the plants during 2017-18 were judged by observing the bulb germination percentage, leaf width (cm), leaf length (cm), scape length (cm), flower size (mm), primary color of the flower, secondary color of flower, no. of large, medium and small size of bulbs and number of bulbs harvested. The bulbs were harvested and stored at 5±2oC (In Refrigerator). The m...
Isatay Tusupovich Jakupov, Gulzhan Tursunovna Yeszhanova, Gulnur Kurbanalievna Mamytbekova*
...obtain dosage forms from plant raw materials Calligonum leucocladum, to study their pharmacotherapeutic activity and use for the treatment of endometritis in cows. A total of 270 cows were examined by clinical methods after calving, of which 45 cows showed signs of acute endometritis. Subsequently, the bacterial background of uterine mucus in sick cows was investigated and St. pyogenes, E. faecalis, and E. coli were isolated. For the complex treatment of acute...
Altaf Ur Rahman1, Muhammad Ajmal Khan2*, Ali Hazrat3, Awais Farid4, Muhammad Yahya3* and Inam Ullah5
...terial strains. Numerous plants act as a source of novel compounds that could be used to develop new drugs. Therefore, the current study was aimed to investigate the methanolic extract of Corylus jacquemontii for phytochemical, antibacterial, antioxidant potential. The methanolic fraction of C. jacquemontii was evaluated for quantitative phytochemical constituents. The antibacterial efficacy was investigated via well diffusion method by using a concentration o...
Abdur Rauf1*, Muhammad Jawad1, Farooq Jan1, Muhammad Qayash2, Muhammad Yasin4, Samrin Gul5, Wisal Khan3, Ikramullah Khan1, Farkhanda Bibi1, Wajid Khan6, Tanweer Kumar6, Muhammad Arif6 and Khilwat Afridi7
...s including genotype and planting time. An experiment was conducted to study the yield performance of 10 different wheat advanced genotypes (PR-133, PR-135, PR-136, PR-137, PR-138, PR-139, PR-140, Khaista-17, Gulzar-19 and Pirsabak-19) at different sowing times of 15-days interval. A pooled analysis across the same environment revealed a significant difference (P ≥ 0.01) for all the parameters i.e., days to heading, days interval, p...
Shujaullah Khan1, Zahid Hussain1*, Haroon Khan1 and Omer Suha Uslu2
...ts. However, the tallest plants and the highest number of grains spike-1 were observed in hand weeding. The highest thousand-grain-weight, biological yield and grain yield were recorded in the hand weeding treatments. However, the results of hand weeding treatments were statistically at par with the treatments of artificial intelligence (robotic weeding). The artificial intelligence got the highest CBR followed by the broad-spectrum herbicide and hand weeding....
Abdur Rauf1*, Muhammad Sadiq1, Farooq Jan1, Muhammad Qayash2, Wisal Khan3, Ikramullah Khan1, Khilwat Afridi4, Muhammad Shuaib5, Muhammad Khalid6 and Samrin Gul7
...heading, flag leaf area, plant height, tillers per plant, spike length, spikelets per spike, grain yield per plant, biological yield per plant, and 1000-grain weight. The analysis of variance showed significant differences for all the mentioned parameters (P ≤ 0.05). In local germplasms, all parameters revealed significant results excluding the 1000-g...
M.A.M.M. Shehab-El-Deen1,2*, S.A. Al-Dobaib1 and K.A. Al-Sobayil1
...ease the quality of preimplantation embryos as indicated by the incidence of apoptosis....
Malik F.H. Ferdosi1*, Arshad Javaid2, Iqra Haider Khan2 and Muhammad Kaleem Naseem1
...c flower extract of this plant were identified through GC-MS. A total of 13 compounds were found in the extract. These included heptacosan-9-ol (15.01%), 2-hexanamine (13.28%), n-hexadecanoic acid (10.38%), eicosane (10.37%), 4H-pyran-4-one, 2,3-dihydro-3,5-dihydroxy-6-methyl (9.69%), cyclohexane, 1,1’-(2-propyl-1,3-propanediyl)bis-(8.81%), hexadecane-1,2-diol (6.34%), pentadecanoic acid, 14-methyl-, methyl ester (5.76%), methyl linolenate (5.38%), octad...
Arshad Javaid1*, Iqra Haider Khan1, Malik F. H. Ferdosi2, Aneela Anwar3 and Mujahid Manzoor4
...y important wild shrubby plant that generally grows at moist places in Pakistan. There are only a few scientific reports on I. carnea especially on phytochemical profile of its flowers. In the present study, flower extract of this plant was analyzed by GC-MS in search of identification of medicinally important constituents. The dried and crushed material of flowers was extracted in analytical grade methanol for one week and ...
Atef M. El-Sagheer1*, Aline F. Barros2, El-Sayed M. Abd El-Aal3, Mohamed M. Gad4, Doaa S. Mahmoud4 and Amr M. El-Marzoky3
...align: justify;">Several plant-parasitic nematodes have been associated with banana (Musa cavendishii) and some of the most economically important ones are Radopholus similis and Meloidogyne spp. the purpose of this study is mainly to clarify the pathogenic effects of both nematodes (Radopholus similis and Meloidogyne incognita, alone or in combination), as a histological modification in root tissues under natural conditions of banana cultivation. R. similis w...
Ahmed El-Sayed Ismail
...tors respecting the corn plant affect the virulence of the corn cyst nematode, Heterodera zeae such as corn genotype, corn age, corn nutritional status, and cropping sequence regime. For the first factor, when two local corn cultivars, namely, Giza 2 (susceptible) and Kahera 1 (resistant), were subjected to the infection by H. zeae to determine the biotic effect of the host susceptibility on development and reproduction of the nematode, the final population an...
Ramzan Ali1, Erum Iqbal1*, Muhammad Ismail Bhatti2 and Saboohi Raza1
Yuliaty*, Brigida A. Correia, LigiaT. Correia, Joao Americo, Mateus Da Cruz De Carvalho, Joana da C. Freitas
...However, in Timor-Leste, planting has not been as intensive as staple food crops such as rice, corn and other popular food sources. Many technological innovations to produce high sorghum crop productivity have been produced such as using fertilizer and planting distance set. The research aims to investigate production potency of sorghum which cultivated with vary of level fermented organic fertilizer (FOF) and
Farooq Jan1*, Abdur Rauf1, Ikramullah Khan1, Muhammad Yasin2, Muhammad Qayash3, Hazrat Wali1, Muhammad Luqman1, Fayaz Asad4 and Muhammad Khalid5
...ng RotoRod sampler. Many plants pollen are allergenic that cause different types of allergenic diseases globally. Pakistan also faces the problem of pollen allergy caused by various plants pollen. Among these allergenic pollen producing plants are Broussonetia papyrifera, Alternanthera pungens, Cannabis sativa, Eucalyptus globulus and Taraxacum officinales pollen grains are dominant. These...
Zia Gul1, Muhammad Sajid1, Muhammad Noman Khan1*, Faheem ul Haq1, Zohra Nawaz1, Muhammad Bakhtiar2, Sajid Siddique1, Komal Aslam3 and Muhammad Irshad1
...d parameter of Aloe vera plant. However, irrigation intervals exhibited the highest leaves (number) (9.9) plant-1, plant height (34.5 cm), leaf length (36.8cm), leaf area (173.5 cm2), leaf breadth (4.0 cm), leaf thickness (3.1 cm) leaf weight (181.3 g), number of suckers (5.5) plant-1, amount of gel (149.3 g) leaf-1, and survival percentage (80.8) was re...
Akbar Hayat1*, Muhammad Asim1*, Tehseen Ashraf2, Ehsan-Ul-Haque1, Rabia Zulifqar2, Maryam Nasir3, Ahmed Raza1, Fahim Khadija1, Sohaib Afzal1 and Shafqat Ali1
... of healthy and vigorous plants in the nursery. The trial was designed with seven treatment combinations of growing substrates that was five times repeated for each treatment in Completely Randomized Design (CRD). The rough lemon rootstock was tested for growth with all different types of media as T1 = Soil + silt + sand (2:1:1), T2 = Rice husk + sand + soil (2:1:1), T3 = Bagass + sand + soil (2:1:1), T4 = Wheat straw + sand + soil (2:1:1), T5 = Rice husk + sa...
Ayoub Hadjeb1,2*, Ismahane Lebbouz3 and Yasmine Adjami4
...ical quality of the host plant plays an important role in the population dynamics of insects. The dates moth Ectomyelois ceratoniae is considered one of the most dangerous pests threatening date production in Algeria. Our results show that the highest relative rate of intake (RRI) and relative growth rate (RGR) were observed in larvae fed by Deglet Nour variety just as The efficiency of biomass conversion of digested food (ECD) and ingested food conversion eff...
Ghulam Sarwar Channa1*, Abdul Razak Mahar1, Inayatullah Rajpar2, Abdul Aziz Mirani3, Saleem Maseeh Bhatti2, Muneer Ali Bhagat1 and Wazir Ali Maitlo4
...ival percentage, average plant height, shoot dry weight, percent reduction over control (PROC) for plant height and shoot dry weight, the accumulation of less Na+ and more K+ as well as the higher K+/Na+ ratio in shoot dry matter, than rest of the cultivars at low to high salt-stress (NaCl) conditions. The results show that the non-aromatic rice cultivar DR-92 can survive and give better yield in moderately (40-120 mM NaCl) ...
Afifatul H.A. Adilah1, Junun Sartohadi2* and Suci Handayani1
...ia. Coconut and Mahogany plants have been cultivated as intercrops in most dry-land agricultural fields by many people for different purposes of income generation. The differences in canopy characteristics between the two plants significantly affect the production of runoff. Field evidence is needed to support it as a suitable plant for soil and water conservation efforts. The study was co...
Ertika Fitri Lisnanti1,4, Widya Paramita Lokapirnasari2*, Eka Pramyrtha Hestianah3, Mohammad Anam Al Arif2, Zein Ahmad Baihaqi4,5
...bane leaf is a medicinal plant that can be used as a natural alternative feed to increase the production of poultry such as broilers. This study was conducted to determine the effect of marsh fleabane leaf extract on the blood profile and glucose concentration of broilers. This study used a completely randomized design (CRD). Treatment is carried out as follows: P0: Control / without adding Marsh fleabane leaf water extract in drinking water, P1: Drinking wa...
Sagir Hussain1, Erum Iqbal2*, Nasira Kazi2, Sher Wali Khan1, Qamar Abbas1 and Abdul Razaq1
...characterization of some plant parasitic nematode populations, recovered from agricultural fields during surveys of the districts Gilgit and Nager, Gilgit-Baltistan, Pakistan. The analysis of samples yielded a new nematode species and two new reported species belonging to the order Tylenchida as new geographical records for Pakistan. Hemicycliophora pyri n. sp., is characterized by the broadly rounded lip region with two indistinct annuli, closely fitting shea...
Umana Niazi, Muhammad Mushtaq*, Mehwish Kanwal and Momina Raheem
Ramanathan Baluchamy* and Gnanamani Radhakrishnan
...site I which favours the plant growth, in turn increases the quantity of leaf litter which supports the life of millipedes. Millipedes play an essential role in enhancing the fertility of soil and ecosystem functioning in this tropical dry deciduous forest of Alagar hill (Eastern Ghats), South India. In forest ecosystem, conservation of millipede is an essential step to improve the fertility of soil and maintaining the forest ecosystem....
Lili Zhao1, Fan Zhao1 and Yaping Jin2*
...portant role in embryo implantation and placenta formation. However, the molecular mechanism of trophoblast cell proliferation, invasion and hormone secretion remains elusive. In this study, we explored the role of GRP78 in the functionalities of goat trophoblast cells (GTCs). The Grp78 gene was efficiently knockout by using the CRISPR/Cas9 system, which resulted in altered morphology and function of GTCs. The cell shape showed a subrounded configuration, and ...
Deny Anjelus Iyai1*, Ambo Ako2, Sitti Nurani Siradjuddin2, Budiman Nohong2
...ypical areas of oil palm plantations and land-use change are open gates to biodiversity loss. The aim of the research was to find out the types of plants that can be a source of natural food for livestock both inside and outside the oil palm land. The study area was purposively selected from 9 districts (subdistricts) as many as 4 districts (44.44%). Withdrawal of grass clippings is done using a quadrant measuring 1 x 1 m2. ...
Zaib Ullah1*, Sajid Mahmood2,3, Zafar Iqbal4, Fakhar-i-Abbas5, Naveed Akhtar1 and Abdul Majid Khan6*
...hese 1213 dig marks, 186 plants uprooting and two setting places. An average of 49.95 signs/km2 was recorded; this is a very high encounter rate. According to BBC (British Broadcasting Corporation) Science and Nature, the home range size of Asiatic black bears is 10 to 20 km2, so we concluded that more than 24 black bear were present in both valleys....
Muhammad Noman Khan* and Ghulam Nabi
Bushra Allah Rakha1*, Farah Qayyum1, Muhammad Sajjad Ansari2, Ali Akhter1, Komal Shakeel1, Javeria Batool1, Faryal Akhtar1 and Sehrish Hina1
...nd other position of the plants 16.25%. Preferable height for nest construction by white-cheeked bulbul was 1-2m (60%) followed by 2-3m (23.7%) and 0-1m (16.25%). Outer diameter of nest was recorded (16.0 ± 4.22cm) while inner diameter was (10.8 ± 2.95cm). The preferred plant species used by white-cheeked bulbul for nest construction was garanda (Carrisa opaca; 58.7%) followed by sanatha (Dodonaea viscosa; 26.2...
Saeed Ahmad1, Muhammad Iqbal1*, Muhammad Akram1, Muhammad Rafiq Shahid1, Muhammad Shahid1, Taj Muhammad1, Muhammad Ihsan Ullah1, Zunera Saeed2 and Mazhar Ali3
...its (Number of bolls per plant, boll weight, boll retention %, seed germination %, seed index and fiber characteristics). However, T3 (organic matter (1.5%) showed maximum increase in all characteristics. In T2 (organic matter 1%) varieties showed 15.8 to 19% increase in bolls per plant and 33.3 to 36.8% in T3. In treatment with organic matter (0.5%) the boll weight was (2.46gm), number of bolls (19.0), boll retention (38.0%...
Arshad Khan, Mohammad Ihsan, Maryam Bibi, Gul Rahim, Fazl Ullah, Komail Khan and Ali Hazrat*
Tasleem Akhtar1*, Muhammad Farooq Nasir2, Imran Bodlah2 and Muhammad Adnan Bodlah3
...ids were released on pea plant provided with pea aphid, mean period of life for male and female was 4.75 and 6 days respectively. Sex ratios of field collected mummies were female biased (60%). Two species of hyperparasitoids viz. Asaphes suspensus (68%) and Pachyneuron aphidis (54%) were involved. Examination for phenotypic polymorphism showed that field population of A. smithi contained both dark and light pigmentation pattern of abdominal segments while lab...
Muhammad Hussain1, Yasir Ali2*, Baber Iqbal1, Muhammad Azhar Iqbal1, Salman Ahmad3, Muhammad Zeeshan Majeed4, Hafiz Muhammad Aatif2, Muhammad Saeed1 and Muhammad Jawad Yousaf1
Kandiah Pakeerathan*, Konesalingam Jeyavithuyan, Aruchchunan Nirosha and Gunasingham Mikunthan
...n was planned to recycle plant waste into biologically fortified vermicompost. Four substrates paddy straw, garden waste (banana and maize leaves), sawdust, and kitchen waste were used as mushroom substrate and then mushroom grown waste was converted into bio-fortified vermicompost using exotic earthworm Eisenia foetida+ Trichoderma viride + Pseudomonas fluorescens. Onion growth parameters, yield, and DSI were recorded from the experiment conducted in a comple...
Mehran Ali* and Inamullah
..., make it unavailable to plants. Inoculation of arbuscular mycorrhizal (AM) fungi could be helpful in the sustainable management of immobile P in soil. However, their use in releasing P from alternative sources in alkaline calcareous soils have been little investigated. To explore the influence of AM fungi and P management on wheat productivity, two years of field experiments were carried out at Agronomy Research Farm, The University of Agriculture Peshawar du...
Yasir Ali1, Muhammad Shahbaz2, Hafiz Muhammad Aatif1-2, Salman Ahmad3*, Muhammad Zeeshan Majeed4, Saqib Saeed2, Mohsin Iqbal1, Mozam Ejaz1 and Saima Naseer5
Shaista Ilyas1, Safdar Ali1, Amer Habib1, Misbah Ali1,2, Muhammad Ahmad Zeshan3*, Yasir Iftikhar3, Muhammad Usman Ghani4,5 and Muhammad Umair1
...everity and enhanced the plant growth. ...
Tahir Abbas Khan1*, Imran Ashraf1*, Athar Mahmood1, Muhammad Ilyas2, Sardar Alam Cheema1, Muhammad Mahmood Iqbal3 and Muhammad Umair Hassan1
...s nutrient necessary for plants growth and development. Similarly, cultivars also differed significantly in terms of growth, yield and P utilization. Therefore, present study was performed to assess P efficient maize genotypes on the basis of growth and yield. The study was comprised different maize genotypes; CS-2Y10, KSC-SB 9663, FH-949, 30Y87, NT-6621 and DK-6789 and of diverse P levels; control (No P), 40 and 80 kg P ha-1. The maximum root length (RL), sho...
Muhammad Hasnain1*, Ghulam Mustafa2, Asif-ur-Rehman3, Ali Raza4, Abrar Ahmad4, Taj Muhammad4, Muhammad Rafiq Shahid4, Umair Faheem5, Muhammad Shahid4, Muhammad Akram4 and Muhammad Kashif Nadeem5
...ld, Izabi on was 105.9kg/plant, whereas Promise and Flagon showed 96.65kg/plant and 95.86%, but both were non-significantly different. Fruit ripening caused changes in those factors, which were noted. Spraying amino acids had no appreciable impact on the physical features of fruit during storage, such as weight loss, fruit colour, hardness, length, and lenticel burn. Fruit fly punctures were non-significant among the differe...
Nadeem Akmal1, Abid Hussain1*, Muhammad Yousaf2, Waqar Akhtar1 and Hassnain Shah1
...conventional manual transplanting techniques revealed that costs of raising the nursery and its transplanting through mechanical method are higher than conventional sowing method by 13.55 percent and 2.33 percent, in case of Basmati Super and Basmati-386, respectively. While, all other cost items of the crop production are more or less the same across both methods. Thus, it is reaffirmed that mechanical trans
Muhammad Nadeem1, Jamshaid Iqbal2, Tariq Mustafa3, Gul Rehman2, Muhammad Faisal Shahzad2, Muhammad Younas4,5*, Aftab Ahmad Khan6, Ameer Hamza2, Abdul Ghaffar1 and Muneer Abbas1
...e maximum number of pods/plant (56) followed by M. anisopliae which produced 180.8 flowers and 51.27 pods per plant at the same concentration. Moreover, a B. bassiana caused a maximum (36.31%) flower shedding reduction. However, flower shedding, total number of flowers, yield deformed pods and total pods was influenced by the applications of different concentrations of EPFs. Overall, B. bassiana at 7.5 % concentration signif...
Rahamdad Khan1, Saad Muhammad2, Muhammad Haroon3, Saad Jan1 and Syed Majid Rasheed1*
...has an important role in plant growth development and allows plants to work properly. Therefore, the aim of this study was to determine the effect of light duration on the growth performance of Parthenium hysterophorus and Cannabis sativa. The results showed that under reduced light duration (2 hours), plant growth performance (i.e., biomass, plant heigh...
Fatimah A. Al-Saeed
...fect humans, animals and plants. Cadmium (Cd) is a heavy metal known as a toxic factor to humans, animals and plants. Saudi Arabia is enriched with medicinal plants whose therapeutic effects are not sufficiently known and not exploited properly. Medicinal plants play an important role in treatment of human health problems since past decades until now. Th...
Mahmoud Mohamed Ahmed Youssef and Wafaa Mohamed Abd - El-Hameed El-Nagdi
...use conditions, the same plant parts of khella as residues at the rates of 5.0 and 10.0 g or their aqueous extracts at concentrations of 5.0 and 10.0 % were treated to pots (5kg soil) planted to cowpea cv. Baladi infected with M.incognita. The greatest percentages of nematode reductions, 84.8 and 84.0% caused by mashed leaf and flower residues on cowpea at their highest rate (10g), respectively followed by other rates. In ad...
Fariha Qahar and Muhammad Sayyar Khan*
...cation of xenobiotics in plants. The genetic manipulation of GSH biosynthesis-related genes is considered a prime strategy to achieve higher in planta GSH contents. In this study, stably transformed Brassica napus lines harboring the feedback-insensitive isoform of Serine acetyltransferase (SAT), a rate-limiting enzyme for cysteine (Cys), and GSH biosynthesis, were subjected to H2O2, metolachlor, and atrazine-induced oxidati...
Azam Khurshid1*, Jawad Sarwar1, Kamran Sohail1, Hafiz Muhammad Faisal Ayub2, Farooq Muhammad1, Fida Muhammad Khan3 and Adnan Ihsan1
...he efficacy of different plant extract combinations against Whitefly (Bemisia tabaci) and Jassid (Amrasca devastans) on okra crop at Kalu khan district Swabi, in 2022. Treatments included a synthetic insecticide, six plant extract combinations, and control. The results revealed that the minimum number of whitefly plant-1, after 1st and 2nd spray application, was observed in plots treated w...
Muhammad Altaf1*, Arshad Javid2, Abdul Majid Khan3, Sadia Nazer4, Irfan5, Khalid Javed Iqbal6, Muhammad Sultan Haider7 and Sana Ashraf7
...d landscapes, cultivated plantations, semi-urban and urban areas. The data on diversity and distribution of various mammalian species of the study area were collected through linear count method viz., direct observation (personal count and record voices) and indirect observation (presences of carcasses, fecal pellets, pug marks and meeting with local communities). The habitat preferences of large, medium and small mammals varied significantly. A decrease in ma...
Jaffar Hussain*, Zeenat M. Ali and Syed Farman Ali Shah
...ficial photosynthesis in plants to produce the raw material for biodiesel production The fourth generation was not available on commercial scale. The biodiesel produced by esterification (one step) and Transesterification process (two step). The catalysts used were homogenous, heterogenous and enzymatic. The homogenous were alkaline and acidic. The alkaline catalyst undergoes saponification reaction when free fatty acid concentration was high. The acidic catal...
MISBAH RAZZAQ, MUHAMMAD RAIS*, MUHAMMAD ARSLAN ASADI, SALEHA ABBASI &
ABDULLAH IBRAHIMv
...items, ten (59%) were of plant origin and seven (41%) were of
animal origin. Pyrus pashia (80%) and Isodon rugosus (0.37 ml) were
recorded as the most frequent plant species in fecal samples and
stomach contents, respectively. The majority of insects consumed by the
lizard species were Coleopterans (0.22 ml) followed by Hymenopterans
(0.18 ml) and Hemipterans (0.18%). The similarity index s...
animal origin. Pyrus pashia (80%) and Isodon rugosus (0.37 ml) were
recorded as the most frequent plant species in fecal samples and
stomach contents, respectively. The majority of insects consumed by the
lizard species were Coleopterans (0.22 ml) followed by Hymenopterans
(0.18 ml) and Hemipterans (0.18%). The similarity index s...
SHEHLA AKBAR*, SAIQA ISHTIAQ*, KHALID HUSSAIN, ANS MUNIR & SAIRA REHMAN
...opriateness of medicinal plants or their extracts orally taken by the
marginal communities. Primary and secondary metabolites of Misopates
orontium (L.) belongs to Plantaginaceae family were screened out and
tested for therapeutic values through in-vitro biological assays.
Quantitative analysis was done on powder of Misopates orontium by
using standard methods for e...
FARZANA SIDDIQUE*1, NAZIMA FIRDOSE2, MUHAMMAD ARSHAD2, WARDAH HASSAN2
& SHAFAAT YAR KHAN2
...milk samples from citrus plantation zone in district Sargodha were
collected and analyzed for the presence of deltamethrin and malathion
pesticides using HPLC technique. Results showed that 100 % of milk
samples were contaminated with pesticide residues. Maximum
concentration of malathion (0.72±0.02 μg/kg) and deltamethrin (0.75±0.04
μg/kg) was found in cow milk samples collected f...
IRAM MUJAHID IQBAL1*, ASAD SHABBIR1, 2, KANZA SHABBIR1, MAHAM NAVEED1, FAREIHA UROOJ1,
AQSA BUTT1, RAEES KHAN3, NIDHAN SINGH4 & FIRDAUS-E-BAREEN1
...The living collection of plants in botanical gardens and academic
institutions play an important role in scientific research, education, and
conservation. The University of the Punjab (PU) is one of the oldest and
largest seat of higher education learning in Pakistan with its two main
academic campuses located in the city of Lahore. Besides several oncampus
plantati...
ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2
...ign having ten replicate plants for each salt (NaCl) treatment. Initially the plants were raised by irrigating with tap water and then after their establishment, with NaCl (50, 100 and 200 mM) containing water. Various growth and biochemical characteristics were found to be adversely affected by saline treatments i.e., root length, shoot length, fresh weight, dry weight, amount of protein and antioxidant enzymes. The higher ...
Orooba Mohammed Saeed Ibrahim1*, Rawaa Saladdin Jumaa2, Nibras Zeyad Yahya1
...treat diseases today was plants. This study aims to ascertain the antibacterial activities of fruit Citrus aurantium and Citrus limonum juice on isolated Staphylococcus aureus, Sterptococcus pneumoniae and Klebsiella pneumonia. The antibacterial activity of fruit juice extract on bacterial strain was determined using macro-broth dilution, agar well diffusion methods and time kill curve. Results revealed that the used juice extracts were variously bacteriostat...
Fariha Javaid1*, Zahoor Qadir Samra1, Madeeha Shahzad Lodhi1,2, Aroosha Hussain1 and Gulnaz Pervaiz1
...l enzyme market. Being a plant-based cysteine protease, it has various pharmaceutical and biotechnological applications. The isolation and purification cost of the enzyme is highest, so there is a need to develop cost-effective purification methods. This research work aims to purify BRM by using magnetic nanoparticles. After purification, BRM enzyme was characterized and utilized in the detergent industry due to its stability at a wide range of pH and temperat...
Baoxuan Nong1,2, Biqiu Wu3, Anlong Xu2, Wenai He2 and Yongfu Qiu2*
...ustify;">The whitebacked planthopper (WBPH), also named Sogatella furcifera (Horváth), has become a significant threat to rice production. Identification of WBPH-resistant germplasm and genes can promote the development of resistance varieties and effectively limit pest damage. In this study, fourteen varieties of rice were surveyed for insect resistance by assessing growth rates via seedbox screening, feeding activity via measurements of honeydew excre...
Getulio A. Barcenas Jr.1* and Luisa Marie I. Barcenas2
...justify;">The effects of plant growth regulators gibberellic acid (GA3), paclobutrazol (PBZ), naphthaleneacetic acid (NAA), benzyl amino purine (BAP); and ethrel at 100 ppm concentration on the vegetative and reproductive expression of cucumber were studied at the cotyledonary and two-leaf stages. The study was laid out in a split-plot randomized complete block design with 3 replications. Results showed significant differences in plant...
Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Farooq Bhatti, Muhammad Summer and Ali Haidar Gormani
...lign: justify;">Mulberry plants belonging to the Morus genus are widely planted across Asia. Almost all parts of these economically and medically important plants including fruits, root bark, stem and leaves are of equal importance in terms of uses but their leaves are the most excessively used part. Traditionally leaves have been used in different folk remedies, dietary supplements and he...
Muhammad Mudassar Shahzad1*, Tehreem Shabbir1, Syed Makhdoom Hussain2, Fatima Yasin1, Humayoun Huma Maqbool1, Aasia Karim3
...y meal (BM), competitive plant proteins, as a fishmeal replacer in the formulation of diets, to evaluate its effects on the carcass composition, immunity, and mineral absorption in common carp. Six experimental diets using BM as an alternative protein source containing different graded levels of BM (0%, 10%, 20%, 30%, 40%, and 50%) were prepared. Three replicates were used for each treatment having fifteen fingerlings per tank. Fingerlings were fed at the rate...
Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1
...asses a diverse range of plants, each possessing its own characteristic physical and biological traits that contribute to its individual ability to adapt, grow, and produce. While some generalizations can be made, it is vital to recognize the quality differences between various plant species and even different cultivated varieties. This study was conducted to evaluate the relationship between nutrient content, di...
Mohammed M. Jassim, Mohammed R. Abduljaleel*, Zainab B. Abdulkareem, Noor H. Sanad, Ibrahim M.H. Alrashid
...osteotomy space and an implant have been investigated in the current work. After avian bone implantation and mid shaft femorus osteotomy, bone healing has been evaluated within a 22-days-period in control rabbits (n = 5) and the rabbits that have been exposed to the SMF (300 gauss) (n = 5). The healing of the bones has been assessed through the quantitative and qualitative evaluation of the serial radiographs each couple of ...
Mervat M. Fath- Allah, Amal A. Ahmed, Hala A. Amin
...%)....
.... The infected indicator plants featured severe mosaic on Lentil cv. Giza51, mottling on cv.Giza9, mild mottle on cv. Giza 4, yellow mild mottling on cv. Giza370. Seed transmission tests of PMoV confirmed of the virus transmission through Lentil seeds. Peanut Mottle Virus was detected in the testas, cotyledons and embryo dissected from seeds of each Lentil cultivates. Electron microscopy of PMoV showed virus particles a...
Iftikhar Ahmad1, Tahir Saeed1, Umair Faheem2*, Qaisar Abbas2, Muhammad Saleem Akhtar Khan3, Mussurrat Hussain2, Tanveer Ahmad4, Gulzar Akhtar4, Asifa Hameed5, Muhammad Hasnain6 and Muhammad Jamil7
...the feeding of thrips on plant tissues. Thrips commonly feed upon the gladiolus and different vegetative and floral parts of gladioli are attacked by them. Application of chemical insecticides provides effective control of insect pest in short period of time. The present investigation was carried out on Jasminum sambac against flower thrips for efficacy of insecticides. To conduct this experiment, six insecticides viz., imidacloprid 20Sl, Spinosad 240SC, Spint...
Siddique Ahmad1*, Basit Ullah1, Sajid Ali2, Ali Zaid1, Zeeshan Ahmad3, Muhammad Usaid1, Muhammad Zeeshan1 and Saif Ullah3
... cell and root division, plant growth, productivity, suppress harmful microorganisms, and enhance the decomposition of organic matter. Results showed that integrated use of PM and N (120 or 160 kg ha-1) along with the application of bio-aab significantly (P≤0.05) improved tillers m-2 (12%), grains spike-1 (15%), biological yield (31%) and grain yield (39%) as compared to control plots. Results of the bio-aab treated plots were found (8%) superior yield than...
Salma Sharif1, Rana Arsalan Javaid2*, Abid Majeed2, Muhammad Shahzad Ahmed2, Qurat ul Ain Sani2, Faiza Siddique2, Muhammad Arshad3 and Niaz Ali1
...ading, days to maturity, plant height, number of tillers, panicle length, flag leaf area, leaf length, culm length, culm diameter, number of grains per panicle, grain length, grain diameter, chlorophyll content, net differential vegetation index, thousand grain weight and grain yield. The overall mean for Grain yield ranged from 1.71 tons/ha to 6.18 tons/ha. Grand mean of all genotypes for Grain yield was 4.1 tons/ha. Maximum Grain yield was observed in GSR 11...
Sona Salem El-Nwehy1*, Assem Abbas Mohammed El-Naggar2 and Adel Badr El-Nasharty1
...as undertaken during the planting seasons of 2020 and 2021 in the Antoniades Botanical Gardens, Horticulture Research Institute, Alexandria, Egypt. There are 7 treatments which consist of 3 percent of the suggested soil amendment NPK (50%NPK, 75%NPK, 100%NPK) were applied as a combined with two concentrations of EM1 (Effective Microorganisms) (1% EM1 and 2% EM1). On the other hand, the control treatment used the entire prescribed NPK soil amendment proportion....
Muhammad Raza Salik1, Muhammad Babar Shahzad Afzal1,2*, Ayesha Komal3, Muhammad Nawaz Khan1, Muhammad Ihsan Ullah4, Faheem Altaf5, Akbar Hayat1 and Hira Tariq1
...impact of four different plant spacing (T1: 10` × 10`, T2: 14` × 14`, T3: 18` × 18`, and T4: 22` × 22`) upon various physio-chemical parameters of Citrus reticulata. The experimental design was randomized complete block (RCB). The parameters evaluated were: plant height, plant spread, canopy volume, month wise incremental trend of fruit growth, fruit size, fruit wei...
Shiferaw Demissie Tola1, Diriba Muleta2, Fassil Assefa2 and Beira Hailu Meressa1*
...nal nematode population, plant growth, and yields decreased as initial nematode inoculums increased. Maximum suppression fresh weight of shoot (43.8%) and fruit (52%) was recorded at Pi ≥ 8 J2 (g soil)-1. The analysis of Seinhorst’s yield loss model indicated the highest tolerance limit (T=0. 64 egg + J2 (g soil)-1) recorded for leaf number, while the relative minimum yield (m) of 0.91 and 0. 86 were the highest m values for root length and shoot heig...
Khalid Hussain1*, Tanvir Hussain2 and Muhammad Inamullah Khan3
Aishat Adetola Anifowose*, Nkechi Betsy Izuogu and Benoit Katchitche Sossou
.... incognita juveniles at planting. Compost manure was incorporated a week before planting at 1.5 t/ha for the single treatments and at 0.75 t/ha at planting for the combined treatments. EM was applied twice at a two-weeks interval at 4000 l/ha and 2000 l/ha for the single and combined treatments, respectively. The nematode-inoculated, untreated pots and plots served as negative controls. G...
Mahmoud M.A. Youssef1, Wafaa M.A. El-Nagdi1*, Hassan Abd- El-Khair2, Usama S. Elkelany1, Mahfouz M.M. Abd-Elgawad1 and Mona G. Dawood3
...s applied in soil before planting. However, such reductions were 83.7 and 78.7%, respectively, when Tv or Tvr were used as single treatments indicating more efficacy on M. incognita populations in the absence of PP. All treatments significantly (P ≤ 0.05) increased weights of plant branches and tubers; especially by individual than combined treatments. Biochemical compounds were influenced by different treatments of the t...
Nurul Fajrih1,2, Komang Gede Wiryawan1*, Sumiati1 and Suraya Kaffi Syahpura3
...lactic acid bacteria (L. plantarum and L. rhamnosus) and pathogenic bacteria (E. coli and Salmonella). Bacterial growth Media using control media without sugar sources, MRS + glucose media, and MRS + banana corm extract (BCE) media. Based on the results of the study, BCE contains glucomannan by 33.59% with a yield of 14.15%, and in vitro test results show that BCE is only able to be fermented by the lactic acid bacteria but not by pathogens. In addition, BCE c...
Irfan Safdar Durrani*, Noreen Asim and Ammar Sohail
...the ubiquitous family of plant proteins that belong to the cupin superfamily and have been reported to play a major role in plant defense against pathogens attacks and different abiotic stresses. Current research deals with the study of cis-regulatory elements located in the promoter region of OsGLP12-3 gene of Nipponbare and newly sequenced Oryza sativa L. cultivar Dilrosh-97 using bioinformatics approach. The possible cis-...
Ahmad Khan1, Muhammad Amjad Ali1, Muhammad Tahir1, Samreen Nazeer2*, Muhammad Zubair Akram3*, Muhammad Arslan Azmat1 and Sabina Asghar4
...fourteen different wheat plant varieties to root knot nematode and their impact on plant growth parameters. Impact of morphological plant characters on galling population and egg mass index was assessed. Results revealed that Ujala-16 yielded best crop stands with plant height (92.79 cm), root weight (0.94 g), tillering capacity (12.4), grain count per s...
Muhammad Mukhtar*, Syamsul Bahri, Syahruddin
...meters measured were (1) plant growth, namely plant height and tiller number, (2) biomass production, namely fresh matter weight, dry matter weight and leaf blade percentage and (3) nitrogen uptake. The results showed that the treatment had a very significant effect (P<0.01) on growth and biomass production, and a significant effect (P<0.05) on nitrogen uptake. The highest yield for plant
Ehtesham Khan, Talha Ahmed, M. Irfan Anis* and Syed Ahsan Rehman
...ming is the procedure of plant cultivation in a mist environment by spraying micro droplets of nutrient solution on the roots of plant in a closed habitat in order to procure fast and healthy plant growth. It is a soil-less culture as soil is just the medium for the plant for nutrients ingestion. As nutrients are supplied in an air water culture in the f...
Hafiz Nawaz1*, Kashaf Nawaz2, Attiq ur Rehman1, Muhammad Bashir3, Mussera Hira2 and Mariyam Nawaz4
... viral disease. Infected plants have uneven yellow-green spots. Diseased plants develop late and produce few flowers and pods. MYMD causes 85% of economic losses. Begomovirus is a Begomovirus. DNA-A and DNA-B make up its single-stranded genome. The virus’s virulence and symptoms need both components. The sequencing of both components showed considerable variation between old-world and new-world viruses. Cultural practi...
Promising Immunomodulation Potential of Ganoderma lucidium and Oregano as Mixture on Broiler Chicken
Fateh A. Badi*, Anwar A. G. Al-Kubati, Naif Al-Gabri
...e groups. The mixture of plant and mashroom insignificantly increased the total WBCs compared with G group. Mixture and Ganoderma groups was significantly decreased the heterphiles/lymphocytes ratio in comparing with C (p=.004, .03 respectively). The eosinophils were significantly increased in the GO group in comparing to G and C groups (p=.04, .05 respectively). G group result in significantly increase (p<.05) of lymphocytes count compared with other grou...
Imtiaz Khan1*, Abdullah1, Muhammad Ibrahim1, Muhammad Ishfaq Khan1, Saima Hashim1, Shomayela Afzal2 and Khalid Nawab3
... of A. tenuifolius Cav., plant height (cm), number of nodes and branches plant-1, leaf area index (LAI), number of pods plant-1, number of grains pod-1, 500 seed weight (g), biological yield (kgha-1), grain yield (kgha-1) and cost benefit ratio (%).The data analysis revealed that the herbicide Pendimethalin showed the lowest A. tenuifolius Cav. density (6.10 m-2), fresh weight (1.30 kgm-2)...
Afsheen Khattak1, Shahida Naveed1*, Naila Khalid1, Inayat Ullah Khan2 and Tamana Bakht3
...ect, respectively. Whole plant of V. encelioides was collected, dried, powdered, and aqueous extracts were prepared at room temperature. Randomized Complete Design (RCD) with four treatments and one control were used in the experiment. Data was recorded for seed germination rate (%), shoot length (cm), radical length (cm), fresh biomass weight (g), dry weight (g), and moisture content (%) of wheat and maize seedling. Result revealed that V. encelioides extract...
Zahir Muhammad1, Muhammad Zubair Anjum1*, Shamim Akhter1, Muhammad Irfan1, Saira Amin1, Yousaf Jamal1, Sharjeel khalid2 and Shakira Ghazanfar2
...c bacteria Lactobacillus plantarum and Pediococcus pentosaceus on the growth performance of the genetically improved farmed tilapia (GIFT) (Oreochromis niloticus). A total of 120 fingerlings were acquired, assigned randomly into 4 groups (n=30/group) received one of four experimental diets each (30% crude protein supplemented with either T1-L. plantarum1×108 cfu), T2-(P. pentosaceus 1×108 cfu), T3-(L.
Zain Ali1, Amjed Ali1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Asif1, Adnan Ashraf1, Muhammad Ehsan Safdar1, Iram Inayat2, Aneela Nijabat3 and Rameez Hussain3,4
...unflower heads and maize plants have better combination for the silage production and the quality parameters like pH, moisture content, protein content, fat content and ash contents. The moisture contents of both the samples and combined silage had not much difference among them, but the protein content, fat content and the pH of the combined silage had remarkable difference among them. The Syngenta-8711 + sunflower and Monsanto-6142 + sunflower varieties were...
Hafiza Mehwish Iqbal1, Salman Khurshid1*, Saqib Arif1, Qurrat-ul-Ain Akbar1, Saba Iqbal2, Shahid Yousaf3, Kainat Qureshi1, Abdul Karim Khan5, Abdul Ahad6, Aqeel Ahmed Siddique4 and Neelofar Hamid7
.... basilicum and S. asoca plants have21 and 22mm MIZD. Methanol 20%has maximum antioxidant activity in O. basilicum whereas, in S. asoca and M. koenigii 20% aqueous showed maximum activity. Total phenolic content (TPC) 80%methanol exhibited high value in O. basilicum and S. asoca and aqueous 0% has a high TPC content in M. koenigii. The study of medicinal plants is an important area of research in modern medical science for b...
Waheed Ali Panhwar1*, Mehtab Ali Mahar2 and Abdul Manan Shaikh3
...defoliator of cultivated plants and plants of barren areas. Survey was conducted to collect beetle fauna from different localities of Sindh Province. 46 specimens were captured and sorted out into Genus Melolontha Fabricius, 1775 of subfamily Melolonthinae with two species i-e: Melolontha indica Hope, 1831 and Melolontha furcicauda Ancey, 1881. In addition to this, M. indica constructed as a new regional record for Pakistan ...
Abdul Hayee Gabol1, Arfan Ahmed Gilal1*, Lubna Bashir Rajput1, Jamal-U-Ddin Hajano2, Muhammad Ishaque Mastoi3, Ghulam Qader Mangrio1 and Jam Ghulam Mustafa Sahito4
...teen days of tomato transplanting depending on its characteristic damage symptoms. Both local tomato varieties were found significantly more susceptible than hybrid varieties that also differ in their relative resistance against T. absoluta. Overall, significantly the highest T. absoluta infestation on tomato leaves and fruits was recorded on Desi local (27.19±9.10 and 9.10±0.44%) and Shimlo (26.47±8.76 and 8.76±0.43%) varieties, wh...
Muhammad Ayub1*, Syed Arif Husain Rizvi2, Ishtiaq Hussain3, Musa Ali Hashmi4, Iqbal Hussain5, Shahid Hussain1, Zakir Hussain1 and Rehmat Kabir6
Amna Ali Mohammed Makoof Zabanoot, Al Wafaa Ahmed Suhail Qatan, Amal Salim Mahad Hubais, Khadijah Hamid Musallam Bait Said and Selvaraju Sivamani*
...een gram (Vigna radiata) plant. The soil samples were collected from eastern (16.9931° N, 54.7028° E) and western (16.7118° N, 53.1857° E) mountainous ranges of Dhofar Governorate, Oman. Soil and rejected lime samples were evaluated for pH, electrical conductivity, particle size, moisture. In addition, the collected soil samples were mixed with various proportions of rejected lime (10 to 50% of rejected lime in soil-rejected lime mixture with f...
Saboor Naeem and Amjad Usman*
...urther revealed the host plant susceptibility indices (HPSI) values was lower for resistant and higher for susceptible genotype. Over all, Baharat kaveri F1 gave better results as it was resistant to L. orbonalis as well as high yielding than other tested genotypes is recommended to incorporate in IPM program for the management of L. orbonalis....
Muhammad Luqman1*, Muhammad Talha Shoaib1, Muhammad Yaseen1, Umair Safdar2 and Hassan Raza2
...of pesticides on overall plant growth (x̅=3.67) and regular application of pesticides disturbs the pH of soil (x̅=3.64). Above 68% of respondents consider harmful impacts of pesticides on human health and 86% of respondents experienced ill heath symptoms after pesticide application. The study recommends public and private extension organizations should encourage adoption of biological control measures among farming community and regular training workshops sh...
Danish Kamal2, Muhammad Abbass Khan1, Ghulam Mujtaba-Shah1, Naveed Ahmed1, Maryam Iqbal¹, Basharat Hussain Shah1 and Imtiaz Ahmed1*
... girth, number of leaves plant-1 leaf length, leaf width, leaf type, leaf apex, leaf base, leaf shape, distance between nodes, pedicel length, flower colour, and flower diameter. Tea samples were analyzed for anatomical parameters such as epidermis cells, mesophyll cells and epidermal anatomy of leaves. The stem length, stem girth, number of leaves plant-1, leaf width, leaf length, distance between node, pedicel length and f...
Agha Mushtaque Ahmed1*, Ali Zachi Abdul Qadeer Alhilifi2, Fahad Nazir Khoso1, Muhammad Ibrahim Kubar1, Tehniyat Naz Shah3 and Touseef Ahmed1
... polyphagous nature. The plants on which it feeds possess variable chemical and physical properties which may influence its biology particularly for growth and reproduction. This study evaluated the growth and fecundity of S. frugiperda on artificial diets. The FAW larvae were reared on two distinct composed artificial diets (bean D1 and chickpea flour D2) and one natural diet D3 (fresh and healthy maize leaves). In both artificial diets, only the flours were ...
Sidra Hafeez1, Tayyaba Sanaullah2, Hafsa Naeem3, Mah Noor Hassan4, Muttalib5, Farhana Kausar6, Muhammad Salman Hameed7*, Muhammad Anayat Ullah8, Abdul Samad9, Memoona Bashir10 and Sadaf Shabbir11
...taceae) is a heat-labile plant, having nutritional value containing large number of active compounds like carotenoids, alkaloids and flavonoids and necessary for food security against disease causing agents like bacteria, fungi etc. Black rot is a serious disease in pumpkin caused by fungus (Didymella bryoniae) and damaged fruit with the symptoms of dark brown lesions but causal organism identification through DNA is still unknown. We collected infected leaf f...
Jinwen Liu, Hong Li, Jinhua Zhang, Jianping Li and Xiujuan Yan*
...unities interact through plant-associated processes. How the interactions between the aboveground and belowground herbivores communities affect plant development remains unclear? In this study, Holotrichia diomphalia Bates, the belowground herbivore grub that feed on the roots, and Rhopalosiphum maidis, the aboveground herbivore aphid that feed on the leaf were chosen as research objects. Four groups were set based on field ...
Anas M. S. Al-Haj Afandi*, Ahmed H. F. AL-Bayati
...roscopic estimation of implantation site revealed that neovascularization was distributed in group (B) more than that in group (A) while, the deposition of fibrous connective tissue in group (A) treatment group was denser than that in group (B). Highly incorporation between the sheet and surrounding tissue was observed in group (A) more than that in group (B). At the same time, the macroscopic changes in the caprine acellular dermal matrix treatment group incl...
Khansa Jamil1, Muhammad Ramzan Khan1, Asad Jan2 and Ghulam Muhammad Ali1*
...ign: justify;">Medicinal plants have played a vital role in drug production. Herbal medicines have proved to be safe to use. Crude extract of Caralluma tuberculata stem was used to examine its antibacterial activity and phytochemical screening. Antibacterial assay was carried out by well diffusion method. A maximum number of compounds were eluted by methanolic extract by thin-layer chromatography and a total of 70 compounds were identified by GC-MS analysis. T...
Shamsher Ali* and Naheed Baloch
...l oils of two indigenous plant species i.e., colocynth, Citrulus colocynthis, and Akk, Calotropis gigantea by using different 03 and 06ml/L concentrations of each plant seed oil against the lesser grain borer, Rhyzopertha dominica, and Khapra beetle, Trogoderma granarium infesting wheat grains. Observations were made on mortality, weight loss, and insect damaged grain. The results show the maximum mortality 62.0% of R. domin...
Nusirat Aderinsola Sadiku1, Oluwatoyin Adenike Fabiyi2* and Tesleem Taye Bello3
...). Two weeks old lettuce plants were inoculated with 1,000 juveniles of Meloidogyne incognita. BPL was applied at three concentrations of 100, 200 and 400 mg/ml. Results revealed that nematode infected lettuce plants treated with BPL recorded significantly higher (P< 0.05) mean number of leaves, plant height and yield compared to the untreated control. In addition, BPL at 400 mg/ml had ...
Farhana Umer1, Muhammad Sheryar2 and Sangam Khalil3*
...rgy transfers from power plants generation to substations then to consumers and its own environment is tremendous. Among various hazards, the overhead wires associated with power lines are the most fatal hazard to birds. The power lines and poles have caused fatal risks for birds and have affected their habitats significantly. Dangerous types of power poles in the middle voltage lines which have small distances between the lines and short insulators cause shor...
Qingsen Ran1,2, Manjing Li3, Jiayin Han3, Lifang Wang3, Han Wang3,4, Shaobo Liu5* and Yanping Wang1*
...compounds from medicinal plants exhibit anti-glycation effects. Therefore, it is of potential significant to find biomarkers based on glycolysis-related genes in predicting the prognosis of colon cancer (CC), a common invasive gastrointestinal tumor. In this study, clinical and gene data were collected to identify glycolytic genes that significantly associated with overall survival (OS) rate of CC patients through gene set enrichment analysis (GSEA) and Cox re...
Hanaa H.A. Gomaa1*, Dalia Y.A. Amin1, Mona A. Ismail1, Basma Hamdy2, Khaled A. El-Dougdoug3
...o virus infection in fig plants. The fig (Ficus carica L.) cv. sultani) plants were grafted by infectious blind eye from Fig latent virus (FLV) infected plants. Infected and healthy plants were foliar sprayed with nanochitosan (ChNPs), biomagic (BM) or combination (ChNPs and BM). Microtome and ultrathin sections were carried out on healthy ...
Rabiea Pervaiz, Shaista Bano*, Sarfraz Ali Tunio, Abdul Nabi Jatt and Aisha Amber Soomro
...Mangifera indica (mango) plant. Identification of the isolated strains was determined by sequencing their 16S rRNA genes. The isolates identified as B. pseudomycoides were screened for their antibacterial potential. In order to circumvent the trouble created from rhizoidal colony morphology of B. pseudomycoides, a colony mutant of a strain showing strong antibacterial activity was obtained by screening/selection method and designated as B. pseudomycoides strai...
Rahmat Elahi1, Gulnaz Parveen1*, Nazara1, Faryal Ali2, Nain Tara3 and Saba Iqbal1
Daniel Offiong Etim1*, Idorenyin Asukwo Udo2, Rosemary Anietie Bassey1, Victoria Barrong Ogar1 and Etim John Umana1
...tode density in soil per plant and nematode reproduction factor (Rf). The combination of different rates of poultry manure with either species of Trichoderma at various spore densities were significantly (P<0.05) inhibited root galling and nematode population more than single application. The combination of T. viride at 2.65 x 107 spores/ml or T. harzianum 2.40 x 107 spores/ml with 20 t/ha poultry manure produced okra with the least GI (2.00). The combinati...
Abdul Aleem Memon1*, Inayatullah Rajpar2, Ghulam Murtaza Jamro2, Javaid Ahmed Shah3
... potassium (K) uptake by plants possibly due to K-fixation and variation in cation ratios. Soils in country are thought to be well supplied with K, little or no K fertilizer is applied to majority of the crops, including sunflower. However, recent studies have shown that the sunflower is becoming more responsive and exhibiting superior growth and yield with the addition of K. To determine the impact of K fertilizer sources on the growth and development of sunf...
Rana Mahmood Ahmad*, Orooba Mohammed Maeed Ibrahim
...tic qualities. Medicinal plant extracts are non-toxic, safe, and have no harmful side effects. Available in abundance, researchers have turned their attention to using these plants as anti-inflammatory. This study was designed to highlight and compare the effects of Syzygium aromaticum extracts oil and Piroxicam on inflammation circumstances. Extraction of clove bud with petroleum ether revealed a bright yellow extract with ...
El-Dougdoug. K.A.1, Mervat, M. Fath Alah2, Reham A. Hassen3,Rehab A . Dawoud2
...istance (SAR) to control plant viruses and increased growth in vitro. Through this study, it was and proved to induced SAR in potato plants using bacterial and fungal contaminants in tissue culture against Potato virus Y. These biotic inducers were Pseudomonas sp., Bacillus sp., Xanthomonas sp. as well as Trichoderma, Aspergillus and Fusarium as contaminants microbial of potato micropropagative in vitro. The occurrence of in...
Mohga A. El-Tahlawey1, Samah. A. Mokbel1, A.M. Mandour1,and H. A. Mohamed2
...v. Giza 51. The infected plants feature severe mosaic on lentil cv. Giza51. mottling on cv. Giza9. mild mottle on cv. Giza4, yellow mild mottling on cv. Giza370, Seed transmission tests Of PMoV confirmed of the virus transmission through Lentil seeds. 
Pe...
Pe...
Mohga A. El-Tahlawey l, L.R. Rizkallal , S.A. El-Arnaouty 2 and Amal A.Khalil 3
...ing FBNYV from 44.50% in plant without treatment to 8% only when used the concentration 2 g / kg seeds. The results in 2008/09 growing season showed that seed dressing with Gaucho was effective in reducing FBNYV from 52.6% in plant without treatment to 5.6% only when used the concentration 2 g / kg seeds. In 2007-2008 growing season from the obvious results found that the better result when we used insecticide Peremore ...
Johan Sukweenadhi1*, Stefan Pratama Chandra1, Finna Setiawan2, Christina Avanti2, Kartini Kartini2, Arief Koeswanto3 and Deok-Chun Yang4
El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.
... Egypt. Different potato plants were collected from an experimental station in Giza Governorate, Egypt and were tested using RT-PCR. PVY was amplified using primers represented portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was ...
El-Bramawyl , M . A. S. A. and El-Beshehy2, E. K. F.'
...nd susceptible faba bean plants were investigated under artificial infection by BYMV in the green house during two successive seasons (2008/09 and 2009/010). Faba bean population's plants were evaluated for the resistance to BYMV using a four-class scale of increasing susceptibility to the BYMV disease, which took into a account the infected main percentage and disease severity for the faba bean population's
Elbeshehy, E. K.F. and Sallaml, A.A.A.
...urally infected cucumber plants Cucumis sativus L. grown in various garden and greenhouses of Ismailia Governorate, Egypt exhibiting systemic mosaic, blistering, fruit malformation and stunted plant growth and identified by biological, serological and molecular analysis. The isolated virus gave positive reaction with CMV antiserum but not with antibodies of WW and SqMV using DAS-ELISA. CMV was able to infect different host <...
El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.
...n and in 2nd experiment, plants treated with CF showed variable visible viral symptom9compared with the broth media treated control 15 days post inoculation and remained symptom less throughout the study period. Such five Streptomyces species identified were able to produce an antiviral component in the culture filtrate, non phytotoxic and effective in local as well as systematically control of CMV infection....
Mahdyl , A.M.M.; Hafezl , M.A.; EL-Dougdoug2, Kh. A.; Fawzyl , R.N. and Shahwanl , Eman S.M.•
...iotic inducers on tomato plant against Cucumber mosaic cucumovirus (CMV), salicylic acid (SA) activities were determined in the inoculated and non-inoculated tomato plants. Identify of CMV was confirmed by some differential hosts and dot blot immunoassay (DBIA) using polyclonal antibody specific CMV. Water extracts of Mirabilis jalapa, Clerodendrum inerme and Kombucha as antiviral to control the virus infection and detection...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...ymptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antiserum for the isolated virus had a titer 1\1024. 600 bp DNA fragments from the coat protein gene (CP) of TMV—Ch—EG was amplified with Rt-PCR technique. Phylogenetic analysis of the TMV-Ch-EG/CP- gene showed 89% nucleotide sequence homolo...
Aboud*, K. A; Gomaa**, Hanaa H. A.; El—Taholowy***, Mohage, A. and El - Sugher**, S.
... because infected banana plants produce no fruit. -The tissue culture approach was used to permit the recovery of BBTV-free plantlets, genetic stability followed by chemotherapy and early screening to facilitate the efficient production of virus-free plantlets. Results demonstrated that application of 10,20,30,40 mg/L thiouracil in vitro gave an 85,72,35,20 survival and 60, 83, 91 an...
Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.
...PCR from infected garlic plants, such fragnent were not obtained from healthylooking plants and/or virus-free seedlings of shoot-tips. The amplified products of OYDV was cloned into pGEM@-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared with corresponding viral nucleotide sequences reported in GenBank. The ...
Eisa*, Nawal A.; Abd El-Ghafar **, N. Y. Abd EL-Mageed*, M.H.; Mohamed* , F.G. and Hasan*, Eman O.
El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.
...m infected Chrysanthemum plants. It is a member of Pospiviroidae. In order to study the structure of CSVd-EG, it was reverse transcribed in total RNA from infected leaves and then amplified by polymerase chain reaction (PCR) using Pospiviroid-CCR specific primers. Purified gel RT-PCR product (⁓199) was cloned into the PCR Il TOPOvector then it was sequenced. Partial sequence 199 bp of CSVdEG is almost identical to that of the prototype 199 bp Canada and USA ...
Nasr-Eldin1 , M. A.; El-Dougdoug2, K. A.; Othman2, B. Ahmedi , Sabah A, and Abdcl-Azizl , S. Il.
...iroid-infected grapevine plants than dot-blot hybridization, the number Of HSVd-infected grapevine plants were 10 plants, PSTVd were 10 plants and the CEVd was detected with high incidence level in grapevine, where 12 out of 100 grapevine trees analyzed were infected. The frequency of HSVd, CEVd and PSTVd naturally infected grapevine trees recorded diffe...
Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.
... from infected faba bean plants. The UV absorption spectrum had a maximum at 260 nm and a minimum at 240m. The ratios of Amax /A min and A 260/A 280 were 1.48 and 1.71, respectively. The yield of purified BBTMV preparation was about 1.57 mg/Kg infected leaves. Production of specific antiserum against BBTMV was obtained by rabbit immunization using three different methods of injections. The titer Ofthe prepared antiserum as determined by indirect ELISA with dil...
El.-Kadyl, M.A.S; Badr2, A.B.; zein3, Saiwa N. and Khalifa4, M.A.A.
...ection in pepper treated plants: Actellic application gave superior results (46.7%) in decreasing the infection percentage followed by either Sumithion or K.Z. oil (55.0%), whereas Potassium Soap spray gave infection percentage of 60.0% followed by Bio-fly (61.7%). Moreover Supper Royal treatment gave the lower effect in the percentage of virus infected plants (63.3%). Although, actellic treatment produced a higher yield as ...
Ahmed, AmalA.; Zein, Salwa N. and Khatab, Eman A. H.
...aturally infected celery plants showing mosaic symptoms suspected to be caused by viral infection, also, it was isolated from other hosts. The isolated virus was biologically purified from single local lesions formed on Chenopodium amaranticolor. CeMV was identified by its host range, symptom expression, modes of transmission and particle morphology. CeMV able to infect only 20 plant species and varieties from 22 teste...
Zein Salwa N; Abd El-khalik, Samaa; Khatab , Eman A.A.H and Azzam4,Clara R.
...rally infected sunflower plants growing in Giza Res. Station, showing systemic mosaic and spots. Purified TMV-S migrated as a single zone in density gradient column. Ultraviolet absorbance ofTMV-S was typical of nucleoprotein with minimum and maximum at 247 and 260 nm respectively. The ratios of A260/280 and Amax/min were 1.2 and 1.1 respectively. Electron microscopy of purified virus showed the presence of rod shape particles with a size 300 nm. Titer of the ...
Ahmed*, Amal A.; Khatab*, Eman A.H. ; Dawood*, Rehab A. and Ismeil*, Amira .M.
...irus affecting carnation plants .The two viruses were detected serologically by DAS-ELISA using specific antibodies . Shoots from plants infected with ( CLV & CarVMV ) which maintained in green house were used for tip culture . Murashige and Skoog medium (MS ) supplemented with (0.2 mg/L BA ) and (Img/l BA and 0.5 mg/L kinetin ) were used for proliferation and micropropagation of the infected shoot clumps respectively. T...
Alhudaib, Khalid
...ext-align: justify;">Fig plant, Ficus carica L., is grown in Saudi Arabia and is being affected by fig plant mosaic diseases (Fig leaf mottle-associated virus, Fig mosaic virus). The main symptoms are chlorotic mottling, blotching and various types of leaf deformation. Samples were collected, with consideration of the economically importance and distribution of the cultivars, from different areas of Hofuf Saudi Arabia. Each ...
*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'
...uberosum, L. cv. Spunta) plants, showing bright yellow blotching or mottling «Calico» and aucuba symptoms suspected to be due to virus infection. Leaf samples were collected from different localities in Minufyia Governorate, Egypt. AMV was readily mechanically inoculated by sap extracted from infected potato leaves to host plants (bioassay). The identity of AMV isolate was confirmed by sequence analysis of their ...
Ahmed, Amal A. and Fath-Allah, Mervat M.
...s able to infect only 20 plant species and varieties out of 24 tested plants by either grafting or mechanical inoculation, and PPV was able to infect only 19 plant species and varieties. CMV and PPV can be transmitted by Aphis gossypii and Myzus persicae from cucumber to cucumber and woody plants. The best time for leaf sampling was to detect the viruses...
El-Sayed • l , Eman H; Mahfouze , Sherin A.; Shaltout ,A. D.; El-Dougdoug3 ,Kh. A. and Sayed1 , R. A.
...gative effects on banana plants. The chemical mutagens such as create mutations in the genome of plants. Selection of plant mutants is based on morphological and ISSR-PCR markers. The DNA based marker is reliable and reproducible for mutant selection for BBTV and BMV resistance banana plants used in the study. Explants...
Karl Maramorosch
...e agents of yellows-type plant diseases were classified as viruses because no fungi or bacteria could be detected in diseased plants. The inadequate characterization of viruses delayed the discovery of the pathogens of yellows-type diseases by forty years. In 1967 Japanese plant pathologists and entomologists announced the discovery of mycoplasma-resembling pathogens in diseased
Mazharul A. M. 1, Md. S. Sarwar ,M. Nurullah 2, Keshab K. Adhikary I and M. Rahmatullah 1
...titiofiers (Vaidyas) and plant-based formulas to treat such viral diseases. Ethnobotanical surveys were carried out amongst three ethnic groups (Garo, Khasia and Santal) and five districts of Bangladesh to identify medicinal plants used for the treatment of the above diseases. It was observed that six plants Nyctanthes arbortristis, Swertia chirata, Vitex negundo, Andrographis panicul...
S.A. Sidaros, S.A. El-Kewey , Hala A. Amin;Eman A.H. Khatab , A.A. Emeran l , Samaa Abd El-Khalilk and M.A.S. El-Kady
...rus isolated from pepper plants grown in Egypt has been characterized. Pepper mild mottle Tobamovirus (PMMoV) was isolated from naturally infected pepper plants grown in Kafr El-sheikh Governorate. RT-PCR using a specific non:åegenerate primer pair for the PMMoV coat protein gene (PMM-F and PMM-R) revealed 470 bp amplified product. Dot blot hybridization was used to establish the authenticity and specificity to the RT-...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2
...-ELISA), woody indicator plants, differential hosts, peroxidase isozymes and activity, total RNA content and reserves transcriptionpolymerase chain reaction (RT-PCR). The severe isolate (ARC) gave the highest OD. value (2.204) in ELISA, followed by the mild isolate (TB) (1.958) and the last latent isolate (N) (1.669). These isolates differed also in incubation period, intensity of symptoms and response to sensitivity of woody indicator
Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar
...o (Solanum tuberosum L.) plants is very important due to their effect on potato yield and degeneration of seed tubers. This study aimed to eliminate potato virus Y (PVY) by tissue culture technique using different therapies, such as thermo-, chemo- and electrotherapies. Potato plants cv. Diamond cultivated at Faculty of Agriculture farm, Sohag University were tested by direct antigen coatingenzyme linked immunosorbent assay ...
Sahar, A. Youssef t ; M.M.A. Al-Dhaher 2 and A.A. Shalaby
... two viruses. Virus free plants were produced within six months using meristem tip culture. Woody plant medium supplied with benzylamino purine (BAP) (1.5 mg/L) for shoot proliferation, and Indol butyric acid (IBA) (0.05 mg/L) for plants rooting. Before acclimatization, the plantlets were submitted to DAS-ELISA and RT-PCR in order to evaluate virus eradi...
*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,
... from infected carnation plants and identified by host-range, serological detection and maintained on Carnation (Dianthus caryophyllus L.) and / or Gompherena globosa. Morphological studies of CarVMV were conducted by light and electron microscopy. Light and electron microscopy revealed amorphous cytoplasmic inclusions in infected leaf cells. In some cases, however, inclusions have a characteristic shape, spindle, circular or sledge-like. Pinwheel inclusions c...
* Amal Abou El-Ela, A.
...uring the survey of rose plantations in Orman Garden, showing Ilarvirus-like symptoms. To identify the causal virus, the plants were tested by enzyme-linked immunosorbent assay using antibodies against different Ilarviruses i.e., Apple mosaic virus (ApMV), Prunus necrotic ring virus (PNRSV), Rose mosaic virus (RNIV) and Tobacco streak virus (TSV) Preliminary results revealed the presence of PNRSV in tested rose shrubs. The i...
Manal A. El-Shazly1, A. s. 2 Abdel Wahab and Salwa N. Zein3
...role as vectors of these plant viruses. Both TSWV and IYSV had a wide host range the differences in host reactions were studied. TSWV differed in its stability properties from IYSV in dilution end point (DEP) and longevity in vitro (LIV) but the two viruses are heat-inactivated at 55 oc. Purified TSWV and IYSV each migrated as a single zone in density gradient column. Ultraviolet absorbance of both TSWV and IYSV were typical of nucleoprotein with minimum and m...
S. A. Sidaros*, S. A. EL-Kewey*, Eman A. H. khattab**, M. M. ELsharkawy*
...rom faba bean and cowpea plants, respectively using two different methods. The UV absorption spectrum had maxima and minima at 260 and245 nm, respectively for the two viruses. The absorbance ratios of A and A260/280 of the combined lower bands of purified BBSV preparations were 1.19 and 1.62, respectively. Infected faba bean plants yielded up to 0.48 mg/100g tissue. The corresponding data for CABMV were 1.20&1.22 and its...
S.Y.M. Mahmoud1 and M. Hashem2
...VV coat protein and bait plants test, respectively. The results confirmed the presence of BNYVV in 46 out of 184 and 24 out of 50 root and soil samples, respectively. The virus was found with percentage of 65% in root samples collected from Kafr EI-Sheikh. The transmission experiments indicated that BNYVV was mechanically transmitted to Chenopodium amaranticolor, C. quinoa, Beta Vulgaris cvs. Pleno. Tripl and Gloria. D. macrocarpa and B. maritema inducing chlo...
Amal Abo El-Ela Ahmed; Eman A.H. Khatab; and M.S. Shafie
...an Garden for ornamental plants, Giza Governorate and it was found to be widely spread in rose fields. The virus was transmitted mechanically and by grafting (chipbudding) but not by aphids. It was successfully purified from infected N tabacum L. cv. White Burley leaves. Only one band of purified virus preparation was observed 3.5 cm below the meniscus of the density gradient. Infectivity test of the viral zone was found positive. The absorption spectrum of th...
A.A.Farrag; I.A.M. Ibrahim and, H.M. Mazyad
...ct the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other published sequences of the Same virus shows 79.4% - 84% homology....
A-New-Whitefly-Transmitted-Geminivirus
...re collected from tomato plants grown at different locations in Egypt. The collected plants were subjected to biological analysis, the viral causal agent vector of the two types of symptoms was found to be Bemisia tabaci (Gennadius). Based on diagnostic host species and back inoculation assay two different types of symptoms were found. The first consists of identical Tomato yellow leaf curl virus (TYLCV) symptoms such as sev...
M.A. Abo-EInasr l, Kh.A. EL-Dougdougl, M.H. El-Kattan2 and L.A. Salem2
...d be induced in cucumber plants using different concentrations of seven nutrient chemicals against Zucchini yellow mosaic Potyvirus (ZYMV). These chemicals were. Potassium sulfate, Magnesium sulfate, Ammonium sulfate, Chelated iron, Chelated zinc, Chelated manganese, and salicylic acid. SAR was determined via disease severity. virus concentration and some biochemical changes i.e., the high level of endogenous salicylic acid, proteins related to inducers and ac...
E.F. Mohamed1 and I.M. Sabra2
...to is grown ToMV affects plants and yields. Virus was isolated and identified on the base of symptomatology on tomato plants, host range, diagnostic hosts, physical ptoperties, mode of transmission, and ELISA detection. ToMV had a longevity in vitro (LIV) of 90 days at room temperature. dilution end point (DEP) Of 10-6 and thermal inactivation point (TIP) of 90oC. ToMV was easily transmitted by sap. The obtained results reve...
E.F. Mohamedl and A.A. Owayss2
...rally infected faba bean plants in Fayoum Governorate. The virus was identified as Faba bean mottle Virus (BBMV) according to symptomatology on Faba bean plants, host range, diagnostic hosts, virus stability and ELISA detection. The host range of the isolate was restricted to Fabaceae. BBMV lost infectivity after 10 min at 95 on dilution of 10-3 and after 21 days storage at room temperature. BBMV was easily transmitted by sa...
S.A. Sidaros1; R.A. Omar; S.A. El-Kewey l and Samaa Abd El-Khalik2
...ion of garlic virus free plant was attempted by means of chemotherapy, meristem-tip culture, and thermotherapy techniques. Three different meristem sizes (5, 3 and 1 mm long) were excised from three garlic cultivars (Chinese. Italian and Balady). Meristems were cultured on MS medium amended with 0.5 mg/L BA (Benzyle adenine). The best size for virus elimination and survival plants was 3 mm long whereas 5 mm long produced hig...
M. Osman1, Kh. El-Dougdoug2, E. T. Abd El-Salam3, R.M. Taha4 and R.M. El-Hamidl
... (CMV) infected cucumber plants was detected by DAS-ELISA and confinned by inoculation of Chenopodium amaranticolor. CMV-isolate was propagated on squash plants var. Eskandarani. After 15 days. systemic symptoms appeared in the newly formed leaves in the form of vein banding, severe mosaic, yellowing, malformation, and leaves wilting. Histopathological studies of CMV-infected squash leaves showed changes such as compact meso...
Hanaa H.A.Gomaa1, A. F. Moustafal, Kh.A.El-Dougdoug2, A.A. Abou-Zeid3 and S. Y.M. Mahmoud4
...the metabolism of potato plants. It was found that detectable decrease or dry matter, total nitrogen, tuber Starch, number of starch granules, and total protein. The nucleic acid content of infected plants increased than healthy ones. The investigated hydrolytic enzymes of amylase and protease were reduced in infected potato plants while the level of polyphenol oxidase and peroxidase was i...
B. A. Othman; Kh. A. El-Dougdoug; M. H. Abdel Ghaffar and T. F. El-Arabi
...trogen content of clover plants. While Barseem IP2 (mutant) was not affected by phages since the growth characters and nitrogen content of clover plants were increased. ...
Firda Dimawarnita1*, Edwina Gabriela Tesalonika Mustamu2, Yora Faramitha1, Haryo Tejo Prakoso1, Wildan Aulia Noorsy1, Komang Gede Wiryawan2
...-product of the palm oil plantation industry. EFB has tremendous lignin content and low palatability. We aimed to assess the impact of EFB supplementation by the delignification process and in-vitro rumenal fermentation. The treatments were raw EFB (P0) and delignified EFB (P1). We evaluated rumen pH, total volatile fatty acids (VFA), ammonia concentration (NH3), dry matter digestibility (DMD), crude fiber digestibility (CFD), organic matter digestibility (OMD...
Ahmed Kadhim Munahi1* , Hameed A. Al-Timmemi2
Xiaojun Li
...ive pest on Brassicaceae plants family around the world. The present study investigated the feeding selection behavior of diamondback moth larvae with an approach to the acetone extract effects of Salvia Miltiorrhiza Bunge (SMB). It was found that acetone extracts of Salviami ltiorrhiza Bunge (SIB) represented by cryptotanshinone and dihydrotanshinone had lethal effect on diamondback moth larvae, and the correlation coefficient was 0.972. Through further antif...
Ali Zohaib1*, Muzzammil Hussain2, Ishtiaq Hassan3, Muhammad Tahir Latif2, Tahira Tabassum1 and Naeem Faisal2
...ity of mechanically transplanted rice (MTR). Study was performed to evaluate different puddled soil settling periods (24, 48 and 72 hours) and seedling age (20, 25 and 30 days) for decreasing the missing hills while improving plant and root growth, and consequently grain yield of MTR. Experiment was conducted using randomized complete block design (RCBD) with split-plot arrangement and three replications during 2020 and 2021...
Shakir Ullah1* and Lubna Shakir2
...composition of medicinal plants. Euphorbia helioscopia, (sun spurge or madwoman’s milk) (Euphorbiaceae) is a wild medicinal plant that grows nearly in all phytogeographical zones of Bajaur. The plant location, age, and their interactions had a significant influence on the phytochemical composition of E. helioscopia. The plant location had the highe...
Nael Abutaha, Fahd A. AL-Mekhlafi*, Khalid Elfaki Ibrahim,
Mohammed S. Al-Khalifa and Mohamed A. Wadaan
...icidal potential of this plant against different genus and species of mosquitoes....
Julieta M Lopez-Martinez and Imran Ahmad*
...entral America. Amaranth plants are well adaptable in different climatic conditions, and easy to grow. Amaranth grains have several beneficial features such as high-quality protein, high content of fiber and micronutrients such as iron and calcium. Furthermore, amaranth seeds are a good source of phytochemical compounds with health-promoting effects such as squalene, phytosterols, and polyphenols. Amaranth seeds have gained popularity in recent years due to th...
Alveena Izhar1*, Basit Ullah2, Rabia Asghar1, Aqeel Ahmad1 and Hassam Bin Mujahid1
...he radish crop. Maximum, plant height (65 cm), number of pods plant-1 (187), pod length (7.9 cm), pod diameter (3.70 mm), seed pod-1 (8), 1000 seed weight (22.6 g), seed yield plot-1 (25.8 g), seed yield (170.5 kg ha-1) and seed germination viability (97.8) with less number of days to 50% flowering (32) were noted in the plants supplied with phosphorus at the rate of 100 kg ha-1, while the...
Nurul Fajeriana1*, Akhmad Ali1 and Retno Puspa Rini2
...age and contour-oriented planting models with the aim of minimizing erosion and surface runoff. This research was carried out on land with a 23% slope and featured three treatments, i.e., N0 (plots with soil loosening only), N1 (erosion plots with contour-aligned soil bunds), and N2 (erosion plots with bench terraces along the contour). All plots were planted with kale (Ipomoea aquatica) as ground cover. According to the res...
Nasir Shah1,4, Muhammad Ibrahim1*, Zarnosh Habib2, Kalsoom3 and Zahir Shah4
...es of peach fruit fly to plant extracts having insecticidal properties. Extract of three native plant species (Azadirachta indica, Zataria multiflora, Achillea santolina) and their various concentration (2, 1, and 0.5%) were used for the purpose. Firstly, the artificial diet of fruit flies was subjected to these treatments, while on the other hand chikoo fruits which were used for flies to settle on, were dipped in same conc...
Aimal Zeb1, Abdur Rauf1*, Nabila Bano2, Muhammad Qayash3, Muhammad Yasin4, Ikramullah Khan1, Syed Abidullah1, Wisal Khan5, Muhammad Asmat Ullah2, Abdul Ghaffar Khan6 and Samrin Gul7
...PT-G-28, and K-399). The plant height, leaf dimensions, green leaves, cured leaves weight, nicotine, and reduced sugar contents were examined. Analysis showed highly significant differences (P>0.01) among varieties for examined traits. The maximum number of green leaves (28), was produced by PVH-2324 at first picking, while PVH-1600 showed the maximum number of leaves (22), leaf area (1241cm2), green leaves (29.3 Kg) and cured leaves weights per plot (4.6 K...
Shakir Ullah1*, Lubna Shakir2, Ghani Subhan3 and Mohammad Sohail4
...except the weight of the plant. The pod full stage is more affected by the drought than other stages on most of the parameters tested. Irrigation regimes at pod full stage reduced the number of pods plant-1 by 38.4% and 26.0%, the weight of pods plant-1 by 23.7% and 53.6%, the number of seeds plant-1 by 29.0% and 28.8%, seeds weight
Yongtao Xu1, Dandan Wang1, Xiaolong Hu1, Minling Li1, Ming Tang1, Wuhua Liu2, Jianwen Zhan2 and Weiwei Zhang1*
...ndicated that the forage plants of sika deer belong to 82 families, and 110 genera. An alpha diversity analysis showed that there was no significant difference (p > 0.05). The NMDS analysis found considerable overlap at the three sampling sites, and the niche breadths of SS (Fir forests), MP (The nursery base), and NJS (Nie Jiashan) were 9.593, 9.426, and 9.419, respectively. High-throughput sequencing and metabarcoding trnL could provide higher taxonomic r...
Amina1, Muhammad Zahid Rashid1*, Muhammad Asim Rashid2 and Amina Rashid2
...search was to assess the plant, flower and fruit characteristics of three exotic strawberry genotypes. In this respect, an experiment was conducted in the research area of the Horticultural Research Institute of Ayub Agricultural Research Institute, Faisalabad, Pakistan during the year of 2019-2021. Results revealed that Sogoya germplasm have maximum survival (85.71%), number of leaves (16.55), leaf area (62.41 cm2), No. of flowers (38), No. of fruits (46), fr...
Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2
... both biotic and abiotic plant stresses, alone or in combinations. This demands their substitution with new and improved genotypes possessing higher productivity and inherent resistance/tolerance against yield-limiting stresses. In this context, this editorial reports the development of a new chickpea kabuli variety “Noor-2019”. This cultivar has improved yield potential, dietary elements (proteins, fat, ash), and more importantly, resistance again...
Muhammad Usman1*, Muhammad Uzair Khalid2, Muhammad Hasnain3*, Muhammad Tauseef4, Ali Raza4, Muhammad Akram4, Muhammad Shahid4, Abrar Ahmad4, Muhammad Shoaib Ismail1, Rabia Afzal2, Atta-Ulla2 and Muhammad Hussnain Babar3
...t method to increase the plant height (94.74cm), tillers (311.49 m-2), spike length (10.18cm), number of grains per spike (43.24), grain yield (4244.8kg ha-1), straw yield (8330.5kg ha-1) and Harvest Index (33.81%) especially in late-sown wheat. It should help to reduce the time to germinate and increases metabolic actions in plants. Healthy seedling germination will increase the yield of the crop. Moreover, it was concluded...
Muhammad Akram1, Anirban Mandal2*, Mehwish Iqbal3, Arindam Mukherjee4, Ritika Bandyopadhyay5, Surendar Rangasamy6, Rida Zainab1, Muhammad Talha Khalil1, Pragnesh Parmar7 and Umme Laila1
...ivity exists in numerous plants, for instance, rutin, a flavonoid glycoside generally found in a range of botanicals, is efficient against herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), and influenza A virus. Ascorbic acid, beta carotene and lots of phenolics play active parts in decreasing inflammation, postponing aging, and averting certain kinds of carcinomas. There are some phenolic compounds such as tannins, flavonoids, vitamins...
Ida Indrayani*, Andi Andri, Tevina Edwin
...ilizing agricultural and plantation waste becomes an essential factor in developing a sustainable beef cattle business. We aimed to determine the potential for beef cattle development, and analyze the index and sustainability status based on four sustainable dimensions. We collected data from 60 beef cattle farmers in Pesisir Selatan Regency, West Sumatra, Indonesia. Livestock feed requirements are based on dry matter digestible (DM) originating from food crop...
M. Imran Kasana, Rashid Iqbal Khan*, Noor Ullah Khan, M. Noman, Shahid Ali, Saima Mumtaz, Shamaila Rasheed and M. Qamar-Uz-Zaman
...gh-quality, true to type plants. The current study was planned to evaluate four different grafting techniques (Cleft, Tongue, Patch and T-budding) in ten different cultivars of avocado. The outcomes suggested that Cleft grafting was most suitable one among all other evaluated techniques. The highest survival rate (27.40%) was recorded in cleft grafting. Moreover, vegetative characters, i.e., no. of leaves and leaf area, no. of internodes and internodal length,...
Muhammad Qazzafi Khan1, Iqtidar Hussain1, Ejaz Ahmad Khan1, Sara Zafar2*, Zuhair Hasnain3* and Moneeza Abbas4
...all which may delays its planting in the season. Between November 10 and December 20, there were five planting dates that were spaced 10 days apart in a 3 replications of a split-plot layout in a randomised complete block design. The impact of planting dates on types and advance lines was examined using both main plots and sub plots. On days to maturity, the data were kept, spike length, g...
Shahid Iqbal1, Arshad Khan, Ali Hazrat1*, Gul Rahim, Mohammad Ihsan1, Umar Zad Gul1, Maryam Bibi1, Khadija Bibi1 and Muhammad Mukhtiar2
...iole length, biomass per plant (0.49%), and pod per plant (0.41%), whereas the minimum coefficient of variance showed by leaf width (0.25%), followed by leaf length (0.27%) and internode length (0.29%). Coefficient correlation analysis was computed for all the quantitative traits, where a positive correlation was recorded for plant height (0.37), leaf length (0.18), and seed per
Shamsa Jabeen and Javed Iqbal Qazi*
...3, 5, 7 and 14 post-transplantations. CK activity of control and EDL muscle grafted mice with probiotics showed 157% and 130% increase, respectively on day 5, whereas on 14th days post-transplantation CK values showed 45.6% and 4%, respectively increase compared with the values of intact control. The LDH activity increase 52.27% and 19.46%, respectively on day 7 when compared with intact control. On 14th days post-trans
Faris Sahib Imran1*, Layth Hamzah Merzah2, Mohammed Mohsin Kareem3
..., is a submerged aquatic plant native to many parts of the world. C. demersum is used in aquaria and pond gardens for its fast growth rateability to improve water quality by excess nutrients, and toxins, and can be included in the sheep diet as a protein source at certain levels. The study was conducted in Karbala province, using the Al-Husseiniya River as the source of C. demersum. A total of 40 Awassi sheep were divided into two groups. The experimental grou...
Zaryab Murad1*, Sobia Bibi1, Shehr e Yar Ahmad1, Mohsin Ali Khan1, Rimsha Sadaf2, Mauz ul Haq1, Umair Manan1 and Muhammad Younas2
...n soil and reducing rice plant uptake rates. All the pots were filled with 10 Kg of soil and were spiked with 20 mg kg-1 of Cd. CdNO3 was used as the source of Cd, and biochar amendment effectively stabilized soil toxic metals. The treatments in the present research were followed as (1, 2, and 4% w/w means 100g/10 kg soil, 200g/10 kg soil and 400g/10 kg soil) of biochar were thoroughly mixed in each specified pot before spiking and were kept ...
Kashif Abdaal, Aneeza Batool, Muhammad Tariq Navid*, Saeed Ahmed, Asma Saleem Qazi, Waseem Safdar, Haidar Ali, Mobeen Ur Rashid, Somia Rafaqat
..., nanoparticle-based and plant-based delivery mechanisms have proven as more targeted and adaptable approaches to boost immune responses. Hence, it proves the vaccines as a big breakthrough in preventive and therapeutic medicine over 200 years and named “Future Medicine”. To assess vaccine safety and efficacy, scientists are now using various model animals like mice, ferrets, pigs, and nonhuman primates before using them for human trials. The other...
ISHRAT FATIMA1, MOAZZAM JAMIL1, AZHAR HUSSAIN1*, MUHAMMAD ZAHID MUMTAZ2, MUHAMMAD LUQMAN1, SAJID HUSSAIN3, SAIF UR REHMAN KASHIF4 & MAQSHOOF AHMAD1
...7 and 71%, respectively, plant height up to 30%, shoot fresh weight up to 19%, shoot dry weight up to 31%, root length up to 79%, root fresh weight up to 58%, root dry weight up to 66%, number of fruits plant-1 up to 89%, fruit fresh weight up to 79%, fruit dry weight up to 78%, concentration of N up to 20%, P up to 65%, K up to 20%, and protein contents up to 20% as compared to uninoculated control. It is concluded that ino...
SYED MUJTABA HAIDER1, KHIZAR HAYAT BHATTI1*, EJAZ HUSSAIN SIDDIQI1, SYED MAZHAR IRFAN1,`2, & ALLAH BAKHSH GULSHAN2
...important worldwide used plant having nutritional as well as medicinal value. It plays an important role in antimicrobial action. The current study was aimed to assess of antibacterial activity of ethanolic, methanolic and aqueous extracts of Aloe vera L. against six bacterial strains (Staphylococcus aureus; Streptococcus pyogenes; Shigella sonnei; Escherichia coli (1) (4C11); Escherichia coli (2) (ATCC 13048) and Neisseria gonorrhoeae). Agar well diffusion me...
ZOHAIB SAEED1, SHAHID IQBAL*1, UMER YOUNAS1,2, MUHAMMAD PERVAIZ*3, SYED MOHSIN ALI NAQVI3 & RANA RASHAD MAHMOOD KHAN3
.... Lagenaria siceraria L. plant was grown in various amendments of soil and sewage sludge to check the tolerance of the plant and to select the optimized mixing of sewage sludge with soil for this particular plant. Estimation of biochemical parameters like chlorophyll content, carotenoid content, and protein content along with total biomass of the plant s...
ZARYAB KHALID SIAL & FARAH KHAN
...dable life from infected plants of Potatoes. The present study was aimed to confirm the presence and identification of potato spindle tuber viroid (PSTVd) on potato plants in Pakistan. RNA was extracted and purified using optimized Trizol reagent and RNeasy Miniplant Kit. The RNA obtained was converted into cDNA on the same day and amplified. The identification of PSTVd was carried out by ...
ZAFAR IQBAL KHAN1*, KAFEEL AHMAD1, KHALID NAWAZ2, MUHAMMAD NADEEM3, ASMA ASHFAQ1,
BABAR MUNIR1, HAFSA MEMOONA3, MADIHA SANA3, FARZANA SHAHEEN1, NAUNAIN MEHMOOD4, HIRA MUQADAS4, MAHPARA SHEZADI5, IJAZ RASOOL NOORKA6, HUMAYUN BASHIR1,
MUDASRA MUNIR1, ILKER UGULU7 & YUNUS DOGAN7
...biochemical processes in plants. Any of these metals, at high concentrations in soil, can cause severe damage to physiological and biochemical activities of plants. Scarcity of fresh water in agricultural area enforced farmers to use industrial effluent and domestic wastewater for irrigation purpose. Ramzan sugar mill industry located at Chiniot discharges high amount of effluent which is used by farmers for irrigation purpo...
Cis-acting regulatory elements and transcription factors as a key regulator in plant gene expression
HIRA MUBEEN1, 2*, AMMARA NASEEM1, AMMARA MASOOD2, SHAHID RAZA3 & NAUREEN NAEEM3
...ession level of genes in plants. The expression of genes is regulated by certain regulatory elements including, Cis-acting regulatory elements (CRE), transcription factors (TFs) and promoters. Cis-acting elements are actually specific class of DNA binding proteins that act at particular site of DNA. Promoters are part of DNA fragment essential for transcriptional regulation of genes with certain transcription factors. These transcription factors could be usefu...
AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2
...iochemical attributes of plants was analyzed by launching a petri dish and pot experiment. The analysis spread out in a totally block design (randomized) with ten replicates for each salt (0 and 120 mM NaCl) and SA (0, 0.1, 0.5 and 1mM) treatment. The commercially available cultivar (cv. Faisal) of maize was planted in earthen pots for 15 days. After fifteen days of growth, seedlings were irrigated with saline water (120 mM ...
ARIFA ZEREEN & ALMAS JAHAN
...y had a well-established plant cover. In order to meet the needs of increasing population, the infrastructure such as new residential colonies, roads etc. had to be developed which seriously affected indigenous plant communities. This has caused destruction of local vegetation growing there and exposed land for colonization of invasive and exotic plant species. Besides this many exotic spe...
Adriana Beatriz Sánchez-Urdaneta1,2*, Gisela del Carmen Rivero-Maldonado2, Cecilia Beatriz Peña-Valdivia3 and Dianelis del Carmen Sánchez-Urdaneta4
...on of the Opuntia plants to certain extreme environments. This is because a thicker cuticle, epidermis, collenchyma, and parenchyma in these plants can improve survival and growth in arid conditions. At the same time, these characteristics can optimize the efficient use of water, while providing greater protection of the inner tissues. All of the above has applicability for the selection and cultivation of promising g...
ASIFA BASHIR1, AAMIR MUSHTAQ2* & TOOBA MEHBOOB3
...l scavenging activity by plant extract was observed as 68±0.33 % as compared to rutin (58±1.15 %) at concentration 2.56 mg/ml. Similarly, in vivo studies indicated that Phyllanthus emblica 80 mg/kg significantly reduced the glucose level in diabetic rats up to 166 ± 0.7 mg/dl on day 8th at 8th h as compared to diabetic rats 380 ± 0.7 mg/dl. Similarly, it also reduced the weight in rats up to 274.11 ± 0.97 g as compared to 310...
MUBEEN RIAZ1, KIRAN ZAHID1, SUMAIRA ASLAM CHOHAN1, MUHAMMAD ASHFAQ*2, MUHAMMAD ALI2, RIFFAT SIDDIQUE1, NUDRAT ANEES1 & FARAH KHAN1
...rolled and NaCl stressed plants, the extracted DNAs were subjected to RAPD markers, using PCR amplification. For this purpose a total of seven primers viz, OPH_01_F, OPH_01_R, OPH_01_RC, OPI_05_R, OPI_05_RC, OPG_10 and OPC_06 were used. PCR amplification was followed by gel electrophoresis (1.2% agarose gel) and visualized by UV light, which revealed the presence of monomorphic and polymorphic bands in the amplified products. During this analysis, two primers ...
SEHRISH MUSHTAQ1, MUHAMMAD SHAFIQ1, MUHAMMAD ASHFAQ*1 FAIZA KHAN1, SOHAIB AFZAAL1, UMMAD HUSSAIN1, MUBASSHIR HUSSAIN1, RASHID MUKHTAR BALAL2 & MUHAMMAD SALEEM HAIDER1
...tes are colonized inside plants and have antagonistic potential for fungal pathogens. These endophytes should be further explored for disease control. Ongoing study in this area will help to the innovate biological control of plant pathogenic fungi....
ABRAR HUSSAIN1, AQSA KHALIL1, SAIRA ZAHEER1, MUHAMMAD LATEEF2 & MUHAMMAD MANSHA1
...In this connection local plants/ their parts are being used to explore their anthelmintic potential. The aim of the present study was to determine the anthelmintic activity of Tribulus terrestris L. and Ziziphus mauritiana Lam. Whole plant of Tribulus terrestris L. and leaves of Ziziphus mauritiana Lam. were used. The plant materials were dried, ground firmly, macerated in ethanol and then...
Floral and edaphic data recorded from Sahiwal District, Pakistan analyzed by multivariate techniques
*ARIFA ZEREEN1, ALMAS JAHAN1,SHEIKH SAEED AHMAD2 & ZAHEER-UD-DIN KHAN3
...s compiled. Thirty eight plant species belonging to twenty one families were recorded. TWINSPAN bifurcated the flora of entire study zone into two main communities that had been again separated into smaller i.e., sub communities. Canonical correspondence analysis recognized the relation of vegetation assembly to underlying environmental factors. This correlation was studied by CANOCO analysis. In the Canonical correspondence analysis of species for Sahiwal, it...
UROOJ SAEED1, SAJID RASHID AHMAD2, HAMMAD GILANI3*, RAB NAWAZ4, NAEEM SHAHZAD5, IRFAN ASHRAF6 & WAQAS AHMED QAZI3
...vation through mangroves plantation in Keti Bunder (Indus delta), Thatta district, Sindh province, Pakistan. From the visual interpretation of repeat terrestrial photographs and Google Earth high-resolution satellite images, healthy growth of mangroves plantation was observed on previously barren mudflats. Even the canopy of sparse mangroves trees became enriched in various areas. In a small area of 372 km2 around the
ALIA NASEEM, *SUMERA IQBAL & KHAJISTA JABEEN
...Cr treated and untreated plants. In comparative analysis compost appeared as more beneficial for okra than farmyard manure. Overall, the application of compost at 5 percent was found to be effective in improving yield characters, chlorophyll and sugar contents of Cr affected okra plants....
MUHAMMAD NADEEM1, MUHAMMAD WASEEM MUMTAZ1&MUHAMMAD DANISH1
...d for formulation of new plant based functional food sornutraceuticals to improve human health....
HAFIZ MUHAMMAD ARSALAN1,2*, SUMMARA TABASSUM1, MUHAMMAD SHERAZ YASIN3, FAROOQ SALEEM4, ZEEMAL SEEMAB AMIN1, MUNIB ASHFAQ1, UMAR FAROOQ GOHAR5 & RASHIDA BASHIR6
... family Piperaceae. This plant is used for the treatment of different diseases like diabetes, cancer, inflammatory responses, oxidant injuries etc. in the present study ethanolic extract of Piper betle leaf was used (300 mg/kg). Diabetes was induced in male albino rats by using Alloxan (150 mg/kg). Glutathione (GSH), Catalase (CAT), Malondialdehyde (MDA), Nitric oxide (NO), micronutrients (Vitamin A, Vitamin C and Vitamin E), serum glucose level and Advance gl...
*AMNA SHOAIB, AROOJ SHEZAD, ARSHAD JAVAID, SUNDUS AKHTAR & ZOIA ARSHAD AWAN
Olaolu Fadeyi1,2, Oluwatoyin Fabiyi3*, Tesleem Bello4 and Gabriel Olatunji5
... to the use of different plant extracts with known pesticidal properties. This current research was conducted to determine the nematicidal status of Anacardium occidental fractions. Analysis of ethanol extract of A. occidentale using gas chromatography spectrometry revealed the presence of several phyto constituents such as phenol, triterpenoids, flavonoids and other bio-active compounds. The array of fatty acid esters revealed in the GCMS result of the fracti...
Bela Putra1*, Budi Prasetya2
...totalling 700 seeds. The plants were grown in acidic soil with a pH of approximately 4.5–5. After two months of growth, the plants were harvested, and various parameters were analyzed. The results of the research indicated that the application of a 15 Gy dosage significantly enhanced the absorption of P (p<0.01), N (p<0.01), and Ca (p<0.01) in the plant. Additionally, gamma ...
Habibeh Jabbari
...cultivars and other host plants. High incidence of this nematode revealed by soil and root samples in the vegetable growing farmlands in Tabriz, Iran. Different populations of H. cruciferae were collected from the region and characterized based on morphological, morphometric and molecular features, four out of those populations isolated from the rhizosphere and roots of four different cabbage cultivars were subjected to further studies. All the populations sho...
Faheem Akbar1, Naveed Ahmed4*, Maria Mussarat1, Imtiaz Ahmed4, Dost Muhammad1, Toseef Ahmad2, Muhammad Afaq Akbar1, Shehryar Rafique3, Seemab Ali4, Sohail Aslam4, Basharat Hussain Shah4, Fayaz Ahmad4 and Muhammad Abbas Khan4
...siderably improved onion plant height, leaf area, bulb weight, fresh yield and as well as sulfur contents in onion bulbs and phosphorous concentration in onion leaves. When the data were averaged over trichoderma levels, these parameters showed linear increases with sulfur levels up to 50 kg ha-1 and then remained unchanged or showed declining trend with further increase in sulphur levels. The mean onion fresh bulb yield increased from 14.11 t ha-1 o 18.91 t h...
Mehwish Zafar1, Muhammad Shahzad1*, Muhammad Zubair Akram2, Quratulain3, Mehak Shehzad4 and Samreen Nazeer5*
... salts hampers growth of plants and its yield of biomass by impacting major physiological mechanisms i.e., ionic, oxidative and osmotic stress. One possible and climate resilient strategy is to introduce new crops that can bear high level salinity and allow irrigation with saline water. Quinoa has great potential to grow under saline conditions having outstanding nutritious value. Pot based complete block design was conducted in COMSATS University Abbottabad, ...
Tianhoun Denté Fidèle1,2*, Meda Nãg-Tiéro Roland2, Zabré Geneviève3, Koama Benjamin2, Kaboré Adama1, Tamboura H. Hamidou1, Bélem Adrien Marie Gaston4
... on the use of medicinal plants. Thus, the present study was carried out to assay total phenolics and evaluate the in vitro anthelmintic efficacy of aqueous and hydroacetone extracts of Combretum micranthum leaves on the parasite Haemonchus contortus. Following phytochemical assay, five increasing concentrations (0.6; 1.2; 2.4; 4.8 and 9.6 mg/ml) of the two extracts were prepared and tested for egg hatching and larval development in the presence of positive (A...
Nadia Kèmi Assana Chabi1, Gildas Codjo Tchemadon1,2*, Olaïgbé Lydie Hounkpatin3, Paul Kouété Jimmy4 and Leonard Antoine Chaffara Afouda1
...ing stage of sweetpotato plants. They observe the presence of aphids or whiteflies in their fields at 53.3% (AEZ II); 65.0% (AEZ VI) and 75.6% (AEZ VIII). Moreover, 100% (AEZ II); 92.5% (AEZ VI) and 93.0% (AEZ VIII), of farmers do not apply any management strategy for sweetpotato viral diseases. However, 5.0% (AEZ VI) and 7.0% (AEZ VIII) of them use chemical insecticides and 2.5% (AEZ VI), ash to control these diseases. To limit the impacts of these diseases a...
Iqtidar Hussain1*, Muhammad Inam Ullah Qaisrani1, Abdul Aziz Khakwani1, Zuhair Hasnian2, Umar Khitab Saddozai1, Muhammad Naeem4, Hadia Gul5 and Moneeza Abbass3
.... Growth parameters like plant, root, shoot lengths and their respective weights were also adversely influenced by contaminated soil. Whole photosynthetic efficiency and plant physiological characters were also severely affected. 25% to 50% germination physiology was disturbed by 15% and 20% parthenium mixed soil respectively. Similar trend of decrease is found in plant biomass and photosy...
Muhammad Adnan1*, Muhammad Nauman Khan2,3, Barkat Ullah2, Faisal Zaman2, Alevcan Kaplan4, Hubert O. Dossou-Yovo5, Sajid Ali Khan Bangash6, Sana Wahab7, Mehreen Ghazal8 and Muhammad Hassan Sarfraz9
... first domesticated crop plants and is the most widely grown crop in the world, both in terms of cultivated area and yield, and wheat is known to be consumed by about two-thirds of the world’s population. The study was carried out to investigate the elemental and proximate composition of wheat against boron induced stress. Greenhouse experiments were conducted in October 2019 under natural light conditions to assess the chemical status of
Syed Makhdoom Hussain*, Hafiza Hina Shafqat, Muhammad Faisal, Mahnoor Saleem, Zeeshan Yousaf and Muhammad Amjad
...th test diet-VI-based on plant mixture oil. When compared to a control diet (0%) and other oil based experimental diets, such results were significantly different. While minimum growth i.e. WG % (148.13), maximum FCR (1.43) and minimum SGR (1.29) was noted when fingerlings were fed with test diet-IV. In the current study, the best digestibility results of crude fat (CF) (81.25%), crude protein (CP) (69.39%), and gross energy (GE) (71.74) were seen in VI-level ...
Ali Hassan1, Javaria Ashraf1*, Salman Wahid1, Kamran Alyas1, Samaria Nisar1, Sadia Kanwal2, Nadia Hussain Ahmad2, Amna Bibi2 and Rameen Nawaz3
...ybrids in different crop plants. In cotton, heterosis of morphological and yield related traits using line × tester design is very important to identify best performing parents in future cotton breeding program. Therefore, in this study five lines (MNH-1020, MNH-1035, FH-152, CIM-632 and BS-20) were crossed with three testers (CEMB-100, RH-662 and NIAB-5) using line × tester crossing design, which resulted 15 F1 hybrids. The analysis of variance fo...
Shishir Sharma1*, Suk Bahadur Gurung2, Ritesh Kumar Yadav1, Bibek Phulara1 and Laxmi Prasad Joshi1
... and infected leaves per plant (IL/P) that were mostly connected to quantitative resistance; PC2 was related to lesion number and lesion breadth; PC3 was mostly concerned with grain yield, while PC4 with sporulation (spores/ml). Inbred lines were divided into three groups using cluster analysis, with 27 inbred lines being placed in cluster II. The mean values of the disease parameter were found to be the lowest in Cluster II, while the grain yield was the grea...
Shakil Ahmed1, Mahin Das2, Md. Rayhan Sojib3*, Shishir Kanti Talukder4, Sadia Sultana5, Prantika Datta1, Shofiqul Islam1 and Gazi Md. Mohsin2
...fruit weight, fruits per plant, fruit length, seeds per plant, and yield. The study compared local hybrids (Saba, Lalbeni, Tokii, and 1070) and exotic hybrid (White Beauty, imported from Thailand) using a Randomized Complete Block Design (RCBD). The results revealed that exotic hybrid varieties had a positive significant difference (p<0.001) in the number of seeds per fruit compared to other local hybrids. Local hybrids s...
Iqra Munir*, Farrah Iftikhar, Hira Fatima, Sunbal Khalil Chaudhari and Roha Ramash
...ign: justify;">Medicinal plants serve as a natural source of herbal medicine employed in treating numerous diseases within local communities across various countries. They also constitute the raw ingredient for the pharmaceutical industry. This study was conducted during year 2020-2021 to gather the native indigenous knowledge about therapeutic uses of medicinal plants in Mandi Bahauddin, District Gujrat, Punjab, Pakistan. E...
Shahzad Aslam1*, Amjad Rashid Kayani2, Muhammad Irfan Ashraf3, Muhammad Azhar Jameel2 and Kiran Sahar4
...e presence of 29 dietary plant species as compared to 30 plant species observed in the field. No animal derived food component was noticed in the diet. The results revealed that food composition consisted of 83% plants diet, 14% provisioned food items and 03% scavenging on garbage bins. To study food resource preference, the monkeys were classified into five age/sex classes: Adult males, a...
Philip O. Akporhuarho1, Ufuoma Godstime Sorhue1*, Adimabua Mike Moemeka2, Onyinye Stella Onwumere-Idolor3, Jonathan Ujomu1, Emmanuel Abadah1, Jennfer Aaron1
... Meat quality, Medicinal plants
...
Bushra AL-Khaqani, Amira Mohammed*
...ch is present in several plants, red wine, and grapes, has been researched for its potential anti-inflammatory, and antioxidant qualities, and to induce relaxation of airway smooth muscle. The current study investigated whether Resveratrol (RES) could lessen allergic asthma that ovalbumin (OVA) causes in rats. Current results revealed that RES improved significantly (P<0.05) allergic asthma attenuation by decreasing the number of infiltrated mononuclear cel...
Ndubuisi Chinedu Adikuru1*, Paul Inyang2, Abraham Agwu Ngwuta1, Chinyere Prisca Anyanwu1 and Rosemond Adaohuru Alagba1
... and a landrace) and two planting years. The experiment conducted in the field was according to split-plot arrangement in a randomized complete block design. Treatments were established in three (3) replicates. The time to anthesis, time to silking, interval between anthesis and silking (ASI), time to maturity and time to filling of grains were measured. Other parameters measured were the rows of grain per cob, grains per row, grains per cob, 100 seed weight a...
Gilmar Jesús Cañarte-Cañarte1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1 and Fernando David Sánchez-Mora1*
...spacing between rows and plants on the growth, development, and production of the cotton variety BRS-336. Twelve plant densities were used: 55 556, 37 037, 27 778, 50 000, 33 333, 25 000, 45 455, 30 303, 22 727, 41 667, 27 778 and 20 833 pl ha-1, with single row planting arrangements. A randomized complete block design, in factorial arrangement (A x B), with four replications wa...
Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Gilmar Jesús Cañarte-Cañarte1 and Fernando David Sánchez-Mora1*
...quat chloride (MC), as a plant growth regulator (PGR), in the Coker cotton commercial variety. This field trial was carried out during February-August 2020 in La Teodomira experimental farm of the National Institute of Agricultural Research (INIAP, Lodana, Manabí, Ecuador), with three periods of application and four doses of growth regulator in addition to control (without regulator). A randomized complete block design in additive factorial arrangement ...
Julio Adolfo Corzo-Bacallao1*, Carlos Alfredo Salas-Macías1, Osvaldo Fonseca-Rodríguez2,3, Felipe R. Garcés-Fiallos1, Erika Isabel Alcívar-Muñoz1 and Henry Fabricio Baque-Loor1
...of the Sarchimor variety planted at 1.5 x 1.5 m, interspersed with tree species typical of the dry forest. The system involves manual weed control, without fertilization, irrigation, phytosanitary control, or shade regulation. In this scenario, and during an experimental period of 90 days (03/08/2022 - 26/10/2022), phenological variables of coffee trees maintained in a study area of 50 x 50 m at a high (S1: 51-70%) and low (S3: 1-30%) shade level was compared ...
Thuong Thi Nguyen1*, Nhu Quynh Ho1, Thuan Khanh Nguyen2, Tuan Phong Vu Anh Vo3, Hai Thanh Duong4
...ftware. SCR chips were implanted in cow’s necks to monitor their rumination indexes and physical activities. Based on rumination time and milk yield data, the alerts of Health–milked from cows HIS < 75 units were reported daily. Of 250 cows 0-90 days of milking, 205 cows had at least one disease, and 45 were healthy. The SCR system sensitivity was 58.33%. Rumination alerts recorded 345 alerts, including 203 alerts of diseases after clinical exam...
Muhmmad Asif1, Khunsa Khakwani1, Muhammad Hasnain1*, Farrukh Ilahi1, Muhammad Hussnain Babar1, Shahid Munir Chuhan1, Jehanzeb Farooq1, Hafiz Ghazanfar Abbas1, Iqra Parveen1, Ghulam Sarwar2, Saeed Ahmad2 and Hammad Hussnain2
...imum number of bolls per plant was recorded for FH-492 (76.33) and the highest yield was observed in FH-492 (3052.95 Kg/ha). FH-492 has shown remarkable lenience of morphological and entomological features, and resistance to insect pests and CLCuD. The demands of farmers, laborers who harvest crops, and other investors including those in the cotton industry may be met by the introduction of this variety. The present study signifies for recommended as the most ...
Wajid Ali1, Muhammad Noman Khan1*, Ghulam Nabi1, Shahid Ur Rahman1, Saira Sattar2, Muhammad Fawad Khan1, Saeed Ur Rahman1, Sayed Zubair1, Qurat Ul Ain1, Muhammad Sabeeh1 and Afsar Ali3
...eld of okra. The maximum plant height (226.1cm), flowers plant-1 (34.5), number of fruit pickings (28.3), pod length (9.5 cm), pod diameter (14.6 mm), individual pod weight (11.3 g), pods plant-1 (34.5), yield ha-1 (14.6 tons) were noted with dry Moringa powder extract solution. Among different levels of Moringa leaf extract solution, the maximum flowers plant
Faisal Ali1, Abdul Aziz Khakwani1, Iqtidar Hussain1, Ghazanfar Ullah1, Atiq Ahmad Ali Zai2, Moneeza Abass3, Zuhair Hasnain4* and Sara Zafar5*
...een fodder yield (t ha), plant height (cm), net photosynthesis rate (u mole m-2 sec-1), crop growth rate (g cm2 day1), (%), brix (%), bagasse (%), purity (%), reducing sugars and pol (%). Though, there was not a noticeable impact on the amount of chlorophyll (u g cm3) or the number of leaves on the plant. The most significant interaction between the Sudan grass hybrid and fertilizer increased the crop growth rate (16.43 g da...
Muhammad Ayyub, Mitha Khan*, Syed Abdul Malik, Sakhawat Ali, Syed Shamsullah, Mujeeb ur Rehman, Ikhlaq Ahmed, Ameer Uddin, Habibullah Kakar, Mohammad Zahid, Khalil Ahmed, Mana Khan, Mukhtiar Ahmed, Muhammad Rafiq Khetran, Zia ul Haq and Muhammad Azam
...highly important for the plant breeders. It has been used for selection of suitable parents for true development of the hybrids. The current research was carried-out to determine heritability, general combing ability (GCA) and specific combing ability (SCA) during (Rabi Season 2018-19) at Directorate of Oilseed Crops, ARI Sariab, Quetta, Balochistan. The research trial was arranged in a Randomized Complete Block design (RCBD) with three repeats. The results fr...
Evy Rossi1*, Fajar Restuhadi1, Raswen Efendi1, Yusmarini1, Rahmayuni1, Emma Riftyan1, Bisma Panca Winata2, Yolanda Ashara2, Usman Pato1
...arter were Lactobacillus plantarum TMW 1.1623 and Streptococcus thermophilus in a 1:1 ratio. The research results showed that yogurt made from ultra-high temperature milk UHTM had a water content of 84.18–86.12%, protein content of 3.52–3.78%, a fat content of 3.34–3.38%, pH 4.72–5.05, titratable acid (TTA) 0.74-1.24%, total lactic acid bacteria (LAB) 7.69–12.07 log CFU/mL, viscosity 285.15–2417.9cP, and Syneresis 0.00-0, 14...
Huma Naz1*, Sajid Abdullah2, Tanveer Ahmed3*, Khalid Abbas2, Syed Qaswar Ali Shah1, Muhammad Rizwan1, Fareeha Latif4, Adnan Ahmad Qazi1, Muhammad Adeel Hassan5
...ops as well as the fruit plants. However, terrestrial and aquatic biodiversity is directly affected by overuse of insecticides. Present study was conducted to find out the genotoxic effect of insecticides on DNA damage and nuclear anomalies in RBCs of Labeo rohita after exposure to chlorpyrifos+endosulfan (CPF+END) by using Comet and Micronucleus Assay. Twenty fingerlings of L. rohita was kept in LC50 concentration of CPF+END, (1.95±0.02 μgL-1 for 96...
Muhammad Irfan Ullah1*, Khadija Akram1, Abu Bakar Muhammad Raza1, Muhammad Arshad1, Samina Khalid2, Hamza Latif1, Aqsa Amjad1, Nahdia Perveen1, Emaan Sajid1
...o assess the efficacy of plant essential oils against T. castaneum. The study found that cinnamon oil exhibited the highest insecticidal activity, with a 100% mortality rate for all tested concentrations and time intervals for adult beetles. Clove oil also displayed significant insecticidal activity, resulting in mortality rates between 68.0% to 86.6% for the highest concentration (6.0%). However, lemon and orange oils exhibited the lowest insecticidal activit...
Asmahan M.S. Lashein1, Al-Kazafy H. Sabry2 and Mahmoud M.A. Youssef1*
...e incognita infecting eggplant (Solanum melongena L.) cv. Baladi i.e. at the recommended and other two lower concentrations. The tested materials at the highest concentrations were more effective in reducing nematode criteria than the other concentrations compared to untreated control. The moderate and highest concentrations of methoxyfenozide caused the highest percentages of reduction in nematode final population (81.36 and 81.06% respectively) followed by l...
Saad Parvaiz1, Khuram Mubeen1*, Mudassir Aziz1 and Tanveer-ul-Haq2
...v>
parameters like plant height (178.49 cm), cob weight (27.88 g), cob length (28.72 cm),
stover yield (10.20 t ha-1), kernel yield (6.86 t ha-1) and growth parameters like crop growth
rate, leaf area index, leaf area duration and net assimilation rate in weeds free (whole
season). In treatment (horse purslane free 40 DAE) kernel yield was higher as compared to
treatments such as horse purslane free 20 DAE ...
Arshad Javaid1* and Iqra Haider Khan
...2.5% extract of the each plant part completely inhibited germination of parthenium
seeds. The lowest extract concentration (0.5%) of leaf and stem reduced germination by 56
and 46%, shoot length by 43 and 12%, root length by 59 and 62%, and biomass of whole
plant by 44 and 15%, respectively. Root and flower extracts were less herbicidal and
reduced ...
Rahamdad Khan1, Abdul Basit, Syed Majid Rasheed* and Syed Salim Shah
...>Allelopathic effects of plant parts of two invasive weeds on seed germination and
seedling growth of open pollinated maize varieties was investigated at the Agriculture
Graduate Laboratory of the Bacha Khan University Charsadda Pakistan during summer,
2018. The experiment was carried out in CRD design with factorial arrangements repeated
thrice. Five maize varieties viz., ‘Azam’, ‘Babar’,...
Gulwaiz Akhter1* and Tabreiz Ahmad Khan
...O. aegyptiaca in brinjal planting was
recorded in all the 20 examined localities. The highest (59.28%) and lowest (14.44%)
weed incidence in brinjal fields was found in Chilla and Gazipur, respectively. The maximum
(78.57 %) and minimum (28.33%) frequency of occurrence of O. aegyptiaca was found in
Kurrahi and Palhari. The infestation of O. cernua in brinjal crop was observed in 14
localities, where t...
Mona Adel El-Wakeel1*, Salah El-Din Abd El-Ghany Ahmed, Sanaa Abd El Rahman Mohamed
and Nadia Khalil Messiha
...yield of Capsicum annuum plants
and both associated weeds: Phalaris minor (grassy weed) and Malva parviflora (broad-leaf
weed). PLP was mixed with in the soil surface at successive rates (15, 30, 45 and 60 g pot-
1). In the corresponding treatments PLP at the same sequenced rates were mixed with the
soil then sprayed with acetic acid 5% immediately. Moreover, sole spraying of acetic acid
5% treatment ...
Nimra Javaid1, Mukhtar Hussain Shah1, Iqra Haider Khan2, *Arshad Javaid2 and Syed Muhammad Waleed1
...he significant effect of plant part bioassay and extract concentration on germination as well as various root and shoot growth parameters. Leaf extract was found as the most herbicidal where a 10% extract completely inhibited the germination and growth of parthenium. Root and inflorescence extracts were also highly inhibitory in suppressing the germination up to 89% and 95%, shoot length up to 80% and 89%, root length up to 86% and 91%, and
Ali Hazrat1
... highest number of seven plant species belonged to genus Prunus, five to genus Rosa, three to genus Potentilla, two to each genus Cotoneaster, Rubus and Pyrus and one to each genus Crataegus, Eriobotrya, Fragaria, Malus, Sibbaldia, Sorbus, Sorbaria and Spiraea. It was concluded that members of the selected family need devotion not only for its cultivation, but emphasis must be made on conservation for sustainable utilization of plant
Adil Hussain1*, Muhammad Qasim Hayat22 and Syed Ali Imran Bokhari1
... be included in the rare plant species list in the flora of Pakistan following the criteria of IUCN....
Mona Adel El-Wakeel1 and Ibrahim Mohamed El-Metwally1
... response of common bean plants.
Two successive pot experiments were conducted with twelve treatments. The first four
treatments were applied by incorporating of orange peels powder with the soil surface at
successive rates (10, 20, 30 and 40 g/pot) one week pre-sowing of common bean. In
the other corresponding four treatments, the orange peels powder was incorporated with
Farrukh Hussain1, Sajid Aziz1, Gul Hassan2, Khalid Aziz1 and Sapna Raisham1
...cies. Interestingly male plant is respected as part of the crop till the pollination and fertilization of female flowers; and thereafter it is weeded out. There is need for extensively surveys and ecological analysis from more localities in the valley to get further information about the weed flora, their distribution, population size and possible losses due to these weeds. It is an established cash crop in the entire valley that can be respected for improving...
Felix O. Takim*1, Gideon Z. Nayan2, Oluwafemi O. Osatuyi1and Israel O. Olayiwola1
...etermine the appropriate planting time and optimal density of sweet potato in a maize-sweet potato intercropping system that will minimize weed infestation and improve yield of the component crops in a drought-prone southern Guinea savanna of Nigeria. The experiment was laid as a randomized complete block design with a split-plot arrangement and 3 replications in 2018 and 2019 growing seasons. The main plots were planting ti...
Syed Awais Hussain Shah1*and Rizwan Ali2 2
...h period, we reported 59 plant species which belongs 54 genera and29 families, among the reported families Lamiaceae and Fabaceae were dominant families having six species each, followed by Asteraceae with five species. These plants are utilized by habitants from centuries as Ethnomedicine against various diseases like cough, cold, malaria, fever, stomach disorders, mouth and throat sour etc. This research provides a lot of ...
Muhammad Ehsan Safdar1, Muhammad Ather Nadeem1, Abdul Rehman1, Amjed Ali1,
Nasir Iqbal2, Qaisar Mumtaz1, Amir Javed1
.../div>
increases in plant height (up to 85%), pod bearing branches (up to 77%), number of
pods per plant (up to 83%), 100-seed weight (up to 37%) and seed yield (up to 160%)
of soybean. Among herbicides, topramezone at 21.5 g a.i ha-1 gave significantly the
highest (1234 and 1272 kg ha-1 in years 2018 and 2019) seed yield of soybean and HEIs
(1.28 and 1.03 in year 2018 and...
Arshad Javaid, Amna Ali, Iqra Haider Khan and Amna Shoaib
...rne pathogen of over 500 plant species, causes collar rot
disease in chickpea plant and reduces its survival rate, growth and yield. This study was
undertaken to assess the benefits of soil amendment with a weed Chenopodium album L.,
on growth, yield and physiology of chickpea var. Bakhar-2011, against S. rolfsii. For this
purpose, soil was sterilized by fumigation with formali...
Hussain Shah1, Hamida Bibi2, Ali Hazrat1and Khan Sher3
...anical uses of medicinal plants were documented in tehsil Utman Khel
district Bajaur Khyber Pakhtunkhwa Pakistan. 76 plant species belong to 47 families of
herbs, shrubs, mushrooms, trees and vegetables were recorded for their medicinal use.
These include 74 plants (96%) of angiosperms, 1 (1%) of gymnosperms, 2 (2%) of fungi
and 1 (1%) of Pte...
Tabassum yaseen1*, Muzamil shah1, Khushnood Ur Rehman2 Ali Mujtaba Shah3, Gul
Nawaz1,Rani Gul4
...ity in
weeds plants of soil selected from the Tehsil Tangi. The spore density was observed in all
weeds plants in the host growth stage. The maximum arbuscular Mycorrhizal Fungi (AMF)
spore density was found in the Chenopodium album (93.00±74.02) and Scandix iberica
(89.00±92.08) at the vegetative stage. The Glomus species is dominant in the rhizospheric
Muhammad Bilal Niaz1, Abdul Ghaffar1, Khuram Mubeen1, Mahmood Alam Khan1
and Wazir Ahmed2
...ced the height of cotton plants by
26.51%, crop growth rate in terms of biomass by 28.44%, total dry matter 28.46% and
seed cotton yield by 45% as compared to weed free treatment for whole season. The
increase in yield in horse purslane free crop for whole season (23.45%), horse purslane free
crop for 30 DAS (14.27%), horse purslane free crop for 60 DAS (18.07%), horse purslane
and other weeds free cr...
Muhammad Ather Nadeem1, Bilal Ahmad Khan 1, Sadia Afzal2, Muhammad Azim
Khan3, Tasawer Abbas4, Muhammad Mansoor Javaid1, Muhammad Mohsin Amin1,
Naila Farooq5 Amir Aziz5
...oncentrations of various plant parts of C. tinctorius significantly inhibited the mean
emergence time, emergence index, emergence percentage (%), time taken to 50%
emergence as well as growth of O. punctata weed. However, maximum mean emergence
time (4.73 days), time taken to 50% emergence (4.19 days) was noted at 8%
concentration and emergence index of O. punctata was noted at 0.25% concentration when
Luqman1, Zahid Hussain1, Mohammad Ilyas2, Azmat Ali Awan3, Javed Rahman 2,
Mazhar Ali2 and Tamana Bakht4
...fresh biomass, number of plants ha-1 and fruit
weight. The results showed significant effect for all the parameters during both years. Weed
biomass was the highest (2971 and 3595 kg ha-1, respectively) in weedy control treatments,
and lowermost in the hand weeded treatments (68 and 83 kg ha-1) in 2012 and 2013,
respectively. Moreover, the effect of the mulching treatments and the herbicidal treatments
Fawad Khan1, Zahir Muhammad1, Khushdil Khan2 , Shabir Ahmad2, Muhammad Jamil Khan3, Tamana Bakht4 And Asif Kamal2
...study. Among the studied plants, most of the
species belong to the Asteraceae family. For morphological studies of pollen through light
microscope (LM) and scanning electron microscope (SEM), the samples were prepared via
acetalization process. We done the fieldwork for the collection of weed plants and also
performed the experimental work i.e. SEM and LM for the pollen morphol...
Muhammad Ather Nadeem1, Bilal Ahmad Khan*1, Sadia Afzal2, Ahsan Aziz1,
Rizwan Maqbool3, Muhammad Mohsin Amin1, Amir Aziz4, Amjed Ali1, Muhammad
Adnan1, Durrishahwar5
Muhammad Ather Nadeem1, Bilal Ahmad Khan1, Sadia Afzal2, Hasnain Abbas3, Muhammad Khuram Dar3, Muhammad Ehsan Safdar1, Ishtiaq Hassan4, Muhammad Asif1, Muhammad Adnan1, Amir Aziz5
...ous extract of different plant parts (leaves, stem and flower) was used at various concentrations (0.25%, 0.5%, 1%, 2%, 4% and 8%) along with distilled water as control. The aqueous extracts of leaves, stem and flower of P. somniferum significantly inhibited the emergence, seedling growth as well as root length (cm), shoot length (cm), fresh weight (g) and dry weight (g) of O. punctata. Maximum mean emergence time (9.18 days) and minimum shoot length (1.13 cm)...
Khalid Ali1, Asif Tanveer1, Naila Farooq2, Tasawer Abbas3*, Ghulam Sarwar2, Muhammad Ather Nadeem4, Ishtiaq Hassan3, Muhammad Mansoor Javaid4, Anees-ul-Hussnain Shah5, Bilal Ahmad Khan4 , Ali Raza6
...d under stress than crop plants....
Iqra Haider Khan1 and *Arshad Javaid1
... a medicinally important plant, generally grows as a weed in waste lands in Punjab, Pakistan. In the present study, antifungal effect of leaf extract of this weed was assessed against Aspergillus flavipes. Methanolic leaf extract of the weed was partitioned into five fractions using organic solvents of variable polarities. A range of concentrations (1.562 to 200 mg mL-1) of each fraction was used in laboratory bioassays. n-Butanol fraction showed the highest a...
Haroon Khan1*, M. Mubassir Khan1, Bakhitar Gul1, M. Fawad1 and Imtiaz Khan1
... status among the native plant community, a field survey was carried out from July - September 2017 at New Developmental Farm (NDF), Malakandher, The University of Agriculture, Peshawar (UAP). Data were recorded from three sites i.e. field crop area, non-field, and orchards with a quadrate randomly thrown 50 times at different locations. A total of 39 weeds species from 16 families (14 dicots and 2 monocots) and 36 genera were identified. The major monocot fam...
Shazia Shafique1, Sobiya Shafique1 and Sonia Sahar1
...mus serpyllum against eggplant leaf spot pathogens i.e., Exserohilum rostratum, Cladosporium cladosporioides and Curvularia clavata. For this, 10 concentrations of methanolic extract of plant (0.5% to 5%) were employed against the pathogens. Data analysis depicted that development of all the pathogens was greatly inhibited by all the concentrations while 5% concentration found to be the utmost operative in subduing the growt...
Amir Ehsan1*, Muhammad Ehsan Safdar1, Amjed Ali1
...ded 0, 22, 44, 66 and 88 plants m-2 densities of each of Echinochloa colona and Digera arvensis laid out in randomized complete block design. Augmented densities of E. colona (0, 22, 44, 66 and 88 weed plants m-2) enhanced its plant dry biomass up to 348 and 353%; and relative competitive index maximally to 80 and 77% in years 2015 and 2016, respectively. While the corresponding increases ...
Muhammad Ather Nadeem1 , Bilal Ahmad Khan*1, Saima Anwar2, Ahsan Aziz1, Rizwan Maqbool3, Muhammad Kashif Sohail4, Muhammad Ehsan Safdar1, Muhammad Mansoor Javaid1, Muhammad Mohsin Amin1, Muhammad Kashif Iqbal1, Amir Aziz4
...
Aqueous extracts of plants are used to control weeds being inexpensive and
environment friendly. Present study was undertaken to investigate the effect of aqueous
extracts of Sonchus oleraceus L. on the red rice (Oryza punctata Kotschy ex Steud.)
emergence and initial seedling growth. Treatments included in the study were aqueous
extract of leaves, stem and fruit of Sonchus oleraceus at varying concentration...
Farrukh Avais1, Anser Ali1, Hamza Javed2, Muhammad Saleem3, Tehreem Tahir4,
Muhammad Rafiq5,*
...rom selected
plants (Garlic and Peppermint) to explore their tyrosinase inhibition activity. Tyrosinase is
a key enzyme of melanogenesis which determines the mammalian skin, hair and eye
colour. Hyper-pigmentation leads to various skin disorders like melasma, sunspots, age
spots and freckles. Moreover, abnormal skin pigmentation is a serious aesthetic concern
which leads to psychosocial problems. Thus...
Barkatullah1, Sumayya Noreen1.Khushnood Ur Rehman1, Zahid Ali Butt2, Tabassum
Yaseen3, Kamran Akbar3, and Salma Noreen3
...m different parts of the plants, which include bark, fruit, leaves,
mulching, and rainwater. In all applications the growth of plumules and radicles of three
test species was retarded. It was determined that the allelopathic effect of extracts is
directly related to the duration of soaking i.e. 48 h extracts were more effective than 24 h.
among all parts the highest activity was shown by leaves followed by fruit,...
Naeema Khatoon Khaskheli1 , Muzafar Hussain Sirohi11, 2,*, Ameer Ahmed
Mirbahar1, Abdul Razak Mahar1, Mumtaz Ali Saand1, Mirza Hussain3
...iv>Weeds are the noxious plants that stunt growth and yield of many crops. This study
recorded the community composition of weeds in maize crops grown at District Khairpur,
Sindh, Pakistan. The weeds were collected from the maize crop at three different localities
using the quadrat method (60 quadrats/site). The species were identified and herbarium
samples were preserved in Herbarium, Shah Abdul Latif University...
Haseeb Ahmad1*, Muhammad Shafi1, Waqas Liaqat1, Muhammad Faheem Jan1,
Shahzad Ahmad2 and Muhammad Farooq3
...tavator produced tallest plants
(221.22 cm) with maximum grain rows ear-1 (16) and shelling percentage (78.14%).
Among weed control methods, hoeing 15, 30 and 45 days after sowing showed maximum
plant height (226.41 cm), grain rows ear-1 (16), and shelling percentage (79.11%). All weed
control methods showed significant reduction in weeds m-2, weeds fresh
...
Imtiaz Khan,1 Muhammad Kabir, Muhammad Ishfaq Khan, Haroon Khan, Saima
Hashim and Muhammad Azim Khan
... dry weed biomass (kg) , plant height (cm),
spike length (cm), leaf area (cm), number of tillers (m-2), number of grains spike-1, 1000
grain weight (g), biological yield (kg ha-1) and grain yield (kg ha-1), Harvest index (%).
These data parameters were formally observed with great care to avoid any repetition or
error of the data. Noxious weeds were observed and recorded in the field viz. Avena fatua,
Kamran Ahmed Pathan1 , Waheed Ali Panhwar1,*, Abdul Manan Shaikh1, Safdar Ali
Ujan1, Javed Ahmed Ujan1, Khadim Hussain Memon1, Irfan Ahmed Pathan1 and
Shabana Mangi1
...e association of various plants with the
species is provided for the first time. This study will be a baseline for the future research
associated with longhorn beetles.
...
*Arshad Javaid1, Syeda Fakehha Naqvi1 and Iqra Haider Khan1
...div>identified. The weed plants were collected from Jehlem, Pakistan. Its roots were dried,
powdered and extracted in methanol. After evaporation of the solvent, the remaining
extract was mixed in water and partitioned with n-hexane, chloroform and finally with ethyl
acetate. The last fraction was analyzed through GC-MS that indicated the presence of 15
compounds. These included the three major compounds namely o...
Shabnam Javed1, Amna Shoaib2 and Zaid Mehmood1
...ae, is a wild, medicinal plant, native
to the Himalayas. Proximate composition gives important information to assess the
suitability of medicinal flora or their extracts taken orally by the trivial communities. In the
current study, different proximate parameters like carbohydrate, ash, protein, moisture
content and fat, along with carbon, hydrogen, nitrogen and sulphur were analyzed in whole
Muhammad Saleem Chang*[1], Muhammad Nawaz Kandhro2, Zulfiqar Ali Abbasi4, Jay Kumar Sootaher*3, Piar Ali Shar3, Kashif Ali Buriro2, Nadia Mangrio5, Zafarullah Channa3
... (355.6 m-2), plant height (106.3 cm), spike length (11.5 cm), grains spike-2 (47.3), seed index (51 g), biological yield (11737 kg ha-1), grain yield (4493 kg ha-1) and harvest index (41.9%) were recorded under T7 = Puma super 7.5% emulsifiable water at 0.625 liters ha-1 50% reduced (30 Days after sowing) + Purple nutsedge water extract at 15 liters ha-1 (45 Days after sowing). Hence...
Muhammad Sikander Hayyat1*, Muhammad Ehsan Safdar1, Muhammad Mansoor
Javaid1
...opathic potential of its plant leachates and soil-decomposition plant residues towards
emergence and seedling growth of rice. In first experiment, aqueous extracts from various
plant parts of red sprangletop (stem, root, leaves, flower and entire plant) at their 5% (w/v)
concentration were applied to germinating rice s...
Khushdil Khan1, Mushtaq Ahmad1, Muhammad Zafar1, Khafsa Malik2, Shazia Sultana1, Shabir Ahmad1, Fawad Khan3, Asif kamal1, Kalim Ullah3
...ferent weedy bee foraged plants belong to 10 various families from Southern Khyber Pakhtunkhwa were collected, identified, and studied using light microscopy (LM). The plants were Asphodelus tenuifolius, Euphorbia helioscopia, Parthenium hysterophorus, Rhazya stricta, Datura innoxia, Eruca sativa, Convolvulus arvensis, Anagallis arvensis, Galium aparine, and Anethum graveolens. Slides for light microscopic studies were prepa...
Iqtidar Hussain1, Ejaz Ahmed Khan1, Jawad Nazir and Ehtesham-ul-Haq1
... phenomenon by which one plant releases some chemicals in the environment that affect the rate of germination, seedling emergence, physiology and overall growth of neighbouring plants is called allelopathy. The significance of study was checked allelopathic phytochemical potential of white cedar vern. Bakain (Melia azedarachL.) leaves on wheat.Leaveslitter was used to examine the allelopathic effects of M.azedarach at five c...
Muhammad Ather Nadeem1, Bilal Ahmad Khan1*, Saima Anwar2, Rizwan Maqbool3, Mohsin Amin1, Amir Aziz4, Iram Batool3, Athar Mahmood3, Abdul Rehman1, Aafaq Ali5, Aneela Nijabat5
...oncentrations of various plant parts significantly inhibited the mean emergence time, emergence index, emergence percentage (%), time taken to 50% emergence as well as growth of O. punctata. However, maximum mean emergence time (5.26 days), minimum germination index (1.69), germination percentage (40%), root length (2.04 cm), shoot length (5.71 cm), fresh weight (59 g), dry weight (4.06 g) was noted at 8% concentration with fruit aqueous extract. Seeds of O. p...
Abdullah1, Syed Mukarram Shah2, Adnan Ali Shah1, Murad Muhammad1, Muhammad Abdussalam1, Khushnood Ur Rehman3 and Haroon Khan4*
...o June 2020. Overall, 95 plant species associated with 31 families have been recorded. Among them Poaceae (22 species), Asteraceae (10 species) followed by Amaranthaceae and Papilionaceae (6 species each), Brassicaceae and Polygonaceae (5 species each), Euphorbiaceae and Solanaceae (4 species each), Chenopodiaceae and Convolvulaceae (3 species each), Apiaceae, Caryophyllaceae, Cyperaceae, Malvaceae and Verbenaceae (2 species each) were the dominant
Muhammad Ather Nadeem1, Bilal Ahmad Khan1* Sadia Afzal2, Rizwan Maqbool3, Hasnain Waheed1, Aneela Nijabat4, Muhammad Ikram5, Amir Aziz6, Muhammad Adnan1, Qaisar Mehmood7, Hasnain Umer3
...ify;">Weeds are unwanted plants in crop that can be controlled by different methods among them use of aqueous extracts of crops is an imperative method. In this method allelochemicals present in crop plant help in suppressing or inhibiting weeds. Therefore, this study was planned to investigate the allopathic potential of aqueous extract of winter crop Papaver somniferum (opium) on summer weed Echinochloa cruss-galli (barnya...
Mushtaq A.Alabodi1*, Imad Majeed Almeeni2
...fficiency of melatonin implants as a single subcutaneous dose to suppress or delay the estrus cycle in queens. Ten domesticated non-pregnant cats of known origin aged between 1-3 years were used. The cats were divided randomly into two groups. The first group (G1, n=5) was left without treatment and served as control group, and the second group (G2, n=5) was administered 18 mg melatonin implants as a single-dose subcutaneous...
Wafaa M. A. El-Nagdi1*, Ahmed E.A. Mahgoob2, Mahmoud M.A. Youssef1, Mona M.S. Zayed3, Entesar H. Taha2 and Nora R.A. Saleh1
...yne incognita (Ne) on eggplant (Solanum melongena L.) were evaluated. In general, the combined treatments by AMF and Pf isolates decreased significantly (P≤0.05) root-knot nematode as indicated by numbers of egg masses, eggs and galls per root system more than single treatments. Co-toxicity% for the two applied combined treatments of each bacterial isolate+ AMF, added at the same time with nematode (Ne) or added at 7 days before Ne inoculation, showed addit...
Salim Saifullah, Muhammad Ilyas, Bashir Ullah and Sanam Zarif Satti*
...which directly influence plant growth and metabolism. Rosehips are used in the production of a variety of sweets and beverages, including syrup, marmalade, jellies, and jams. Therefore, high vitamin C content as well as TDW and TSS characteristics for rosehips are desired and preferable....
Zia Ur Rahman1*, Naveed Ahmad1, Adnan Ahmad2, Hammad Ud Din1 and Fazli Amin1
...e cultivated as a forage plant in hot and dry climate regions, and it can be used to increase the food security of a herd. A field experiment was conducted in 2022 at Medicinal Plants Farm, located in the Peshawar region of Khyber Pakhtunkhwa, using seven improved varieties of Sesame under irrigation conditions with a conventional watering frequency of once per month. The objective of the study was to identify the best-perfo...
Amir Afzal1*, Sairah Syed1, Hafiz Husnain Nawaz2, Ruqeah Mustafa1, Marjan Aziz1, Madeeha Khan1, Azra Khan3, Uzma Javed1, Attiq Ur Rehman4, Rubab Altaf 5 and Qamar Shakil6
...anagement strategies for plant diseases. Pst has a complex life cycle that entails both sexual and asexual reproduction, facilitating the rapid evolution of new strains. The evolution of new races is primarily driven by the selection pressure imposed by the deployment of resistance genes in wheat cultivars. Work documented by prominent researchers conducted in diverse regions of the planet has been reviewed in this article to understand how disease perpetuates...
GUL HASSAN,Khan Bahadar Marwat,NAEEM KHAN,MUHAMMAD AZIM KHAN
Mohamed A. Balah,Amal H. Bu-Atiq,Helal S. El-Harer
Muhammad Shahid, Bashir Ahmad, Riaz Ahmad Khattak , Gul Hassan , Haroon Khan
Mohammad Islam, Habib Ahmad, Abdur Rashid, Abdur Razzaq, Naveed Akhtar , Ikarmullah Khan
NAVEED AKHTAR,Maqsood Anwar,WISAL MUHAMMAD KHAN,Amjad Siddique,MUHAMMAD SALEEM KHAN,SAMIN JAN
Muhammad Alam Zeb,Adeela Haroon,SULTAN MEHMOOD,MANZOOR ULLAH,REHMAN ULLAH KHAN,SAAD ULLAH KHAN,ASIM MUHAMMAD,IHSAN ULLAH,Saira Abbas
EHSAN ULLAH,MOHSIN TANVEER,SHAKEEL AHMAD,IMRAN KHAN,UMAIR ASHRAF
Muhammad Anees Afsar,SHAD KHAN KHALIL
Abdullah, Gul Hassan, Ijaz Ahmad Khan, Sheraz Ahmad Khan , Hussain Ali
Abdur Rashid,Asad Ullah,SYEDA NIGHAT PARVEEN
Muhammad Sarwar Cheema, M. Nasrullah, Muhammad Akhtar , Liaquat Ali
Sairah Syed,EJAZ AHMAD KHAN,IQTIDAR HUSSAIN,ASGHAR ALI KHAN,MUHAMMAD MANSOOR
Siraj Ahmad[1], Asghar Ali , Hanifa Beg , Altaf Ahmad Dasti , Zabta Khan Shinwari
KASHIF ALI,Muhammad Shuaib,SAJJAD ALI,Tanweer Kumar,SHARIFULLAH,IKRAMULLAH KHAN
Muhammad Nabeel,Ali Ahsan Bajwa,Sehrish Sadia,Wahaj Nafees,SHAHIDA KHALID
INDIGENOUS USES OF THE PLANTS OF MALAKAND VALLEY, DISTRICT DIR (LOWER), KHYBER PAKHTUNKHWA, PAKISTAN
NAVEED AKHTAR,WAHEED MURAD,IKRAMULLAH KHAN,SAMIN JAN,HABIB UL HASSAN,AKASH TARIQ
SHABNAM JAVED,Amna Shoaib,Arshad Javaid
MOHAMMAD KHAN,Fazli Subhan,GHULAM HYDER JAMRO
Md. Jasim Uddin,Sultan Ahmed,Md. Mahmudul Hasan,Md. Nizamul Hassan
ABDUL GHAFOOR,Muhammad Saleem
Syed Rehmat Ullah Shah, Muhammad Qasim , Ijaz Ahmad Khan , Syed Azmat Ullah Shah
SULTAN MEHMOOD,MANZOOR ULLAH,SAAD ULLAH KHAN,IHSAN ULLAH,ASIM MUHAMMAD,REHMAN ULLAH KHAN
Dinusha Debarawatta,Tilak Attanayake,Kapila Yakandawala
QAYUM NAWAZ,WAHEEDULLAH,MISBAHUDDIN,Ghulam Sarwar Khan
Abdul Qayyum,EJAZ AHMAD KHAN,Muhammad Ayaz Khan,Kalim Ullah,MUHAMMAD SADIQ,INAYATULLAH AWAN,HABIB UR REHMAN
M. INAYAT KHAN,R.A. SHAD,NASEER A. KHAN,ABDUL GHAFOOR
Khair Ullah,Zahid Hussain,LUQMAN,Ikram Ullah,Mohammad Ilyas,IJAZ AHMAD KHAN
GUL HASSAN,QAYUM NAWAZ KHAN,NAQIB ULLAH KHAN,SANA ULLAH KHAN,ABDUL AZIZ KHAKWANI
ATTIQ ULLAH,Mohammad Safdar Baloch,MUHAMMAD SADIQ,EJAZ AHMAD KHAN,MUHAMMAD AMJAD NADIM,KHALIQ NOOR
Gul Hasan,Khan Bahadar Marwat,BUSHRA FAIZ,MOHAMMAD KHAN
Masood Ur Rahman,Muhammad Hanif,Muhammad Amin,Salim Shah,Subhan Uddin,SAJJAD ALI,Rafi Ud Din,Anwar Ali Shad
Zahid Hussain,SAJJAD AHMAD,ANEES AMIN,MUHAMMAD NAEEM,HUSSAIN ALI,GUL HASSAN
Abdul Razaq,Baber Khan,Hassan Ali,Sajida Perveen
MUHAMMAD SALEEM KHAN,IQBAL MUNIR,SYED ZAHIR SHAH,NAVEED AKHTAR,Haroon Khan,WISAL MUHAMMAD KHAN
ABID SUHAIL,MUHAMMAD SALMAN,FAWAD AHMAD,FAQIR GUL,MIDRAR ULLAH,MUHAMMAD ANWAR KHAN
Aziz Ur Rehman,Asad Ullah
Z.A.CHEEMA,M.MUBEEN,A.KHALIQ
SAEED UL HAQ,MIAN INYATULLAH,IJAZ AHMAD KHAN,MAID ZAMAN,FAZAL SAID,SAJJAD AHMAD
Shamsher Ali,Zahid Hussain,Khair Ullah,Zakir Ullah Jan,Muhammad Adnan Khan,Ikram Ullah
Haji Khalil Ahmad,FATEH ULLAH KHAN,Muhammad Ayaz Khan,HAJI HIMYAT ULLAH KHAN,EJAZ AHMAD KHAN
Syed Majid Bukhari,Asma Zaidi,Asma Zaidi,Shamyla Nawazish,Muhammad Arshad Parvez,IKRAMULLAH KHAN,Muhammad Aamir,Syed Majid Bukhari
Amna Ali,MUHAMMAD SALEEM HAIDER,UZMA BASHIR,NAUREEN AKHTER
Fatemeh Bena Kashani , Eskandar Zand , Hasan Mohammad Alizadeh
Inamullah,SAFDAR SHAH,SHAHIDA BIBI,ABDUL MAJID,SAJJAD ZAHEER,HABIBULLAH,Zahid Hussain,ALAM ZEB
Habib Ur Rahman,Rehmat Ullah,MUHAMMAD SADIQ,EJAZ AHMAD KHAN,Kalim Ullah,Muhammad Saeed Khattak,Abdul Qayyum,INAYATULLAH AWAN
Shad Ali Khan, Lajbar Khan, Iqbal Hussain, Khan Bahadar Marwat , Naveed Akhtar
MUHAMMAD AZIM KHAN,Subhan Uddin,MUHAMMAD ILYAS,Rahamdad Khan,Salim Shah,SAJJAD ALI
Arshad Iqba,INAMULLAH KHAN,FAZL E RABBI,SIRAJ UD DIN,SAMIN JAN
SAMIN JAN,SUMERA AFZAL KHAN,SHER WALI,MUHAMMAD HUMAYUN KHAN,IZHAR AHMAD
Mirza Hasanuzzaman , Kamrun Nahar , Md. Rezaul Karim
Bilal Muhammad Khan,Safdar Hussain Shah,Jehan Bakht,MUHAMMAD SHAFI
Hakoomat Ali , Dilbaugh Muhammad , Shoukat Ali Abid
MUHAMMAD ILYAS,IJAZ AHMAD KHAN,Imtiaz Khan,MUHAMMAD ISHFAQ KHAN,Zahid Hussain,LUQMAN,FARHAT UN NISA SHEHZAD,Muhammad Ashfaq Khan,Bushra Khan
NASEER A. KHAN,R.A. SHAD,M. INAYAT KHAN,ABDUL GHAFOOR
Sehrish Sadia,Rahmatullah Quresh,SHAHIDA KHALID,Ali Ahsan Bajwa
Abdullah , Gul Hassan, Ijaz Ahmad Khan , Mohammad Munir
GHAZANFAR ULLAH SADOZAI,Md. Khairul Alam Bhuiyan
QAYUM NAWAZ KHAN,SANA ULLAH KHAN,Gul Hasan,NAQIB ULLAH KHAN
MUHAMMAD SALEEM HAIDER,Amna Ali,SANA HANIF
Khan Bahadar Marwat,M.NAVEED KHAN,GUL HASSAN,M.ZUBAIR
MUHAMMAD MANSOOR,ABDUL AZIZ KHAKWANI,INAYATULLAH AWAN,EJAZ AHMAD KHAN,Mohammad Safdar Baloch,ASGHAR ALI KHAN
Ramesh Kumar Singh , Siya Ram
Irum Mukhtar , Ibatsam Khokhar , Sobia Mushtaq,Muhammad Azam Khan , Mir Ajab Khan , Mazhar Hussain
P. Janaki,S. Jeyaraman,C. Chinnusamy,P. Muthukrishnan
M H ALI,M F KARIM,M S ISLAM,S M MASUM
S.R. Weerakoon,W.J. Nimanthika
Amalia M. Belgeri,Steve W. Adkins,Sheldon C. Navie
SHAH ALAM KHAN,HASHMATULLAH,Zahid Hussain,NAEEM KHAN,KHALID NAVEED
Gregory E. Macdonald
Ct. Sathappan , K. Arivukarasu, S. Rameshkumar, G. Murugan , Rm. Kathiresan
Waheed Murad , Ashfaq Ahmad , Ghulam Ishaq , Muhammad Saleem Khan , Amir Muhammad Khan , Ihteram Ullah , Azizullah , Ikramullah Khan
MUHAMMAD MANSOOR,ABDUL AZIZ KHAKWANI,NAJIBULLAH KHAN,INAYAT ULLAH AWAN,EJAZ AHMAD KHAN,Mohammad Safdar Baloch,ASGHAR ALI KHAN
Kee-In Lee,In-Taek Hwang,Soo-Jin Cho,Ha-Young Song,No-Joong Park,Hee-Kyung Lim,Dal-Rye Kim
Syuntaro Hiradat,Kozo Shishido,Tsunashi Kamo,Mitsuru Shindo,Yoshiharu Fujii
Asim Iqbal, Amjad Usman, Maqsood shah and Syed Sartaj Alam
Ahtisham Arshad, Aleem Ahmed, Maryam Arshad and Muhammad Shafiq
Muhammad Shahbaz , Sher Muhammad, Faqir Ahmad, Sajjad Ali, Muhammad Riaz and Ghulam Nabi
Shahid Ali , Asad Shabbir and Sohaib Muhammad
Afza Tabassum, Shad Khan Khalil, Ziaur Rahman , Misbahullah, Madeeha Alamzeb, Sajid Khan and Muhammad Ilyas
Hazrat Ali , Zahir Muhammad, Wisal Muhammad Khan, Ghulam Jelani, Abdul Majeed and Rehmanullah
Tauseef Anwar , Maria Khan Panni , Shahida Khalid and Huma Qureshi
Shahida Naveed , Madeeha , Inayatullah Khattak and Khan Bahadar Marwat
Shazia Saeed, Alia Ahmed, Syed Haider Shah , Sania Begum , Muhammad Zeeshan and Waheed Khan
Ihsan Ullah , Siraj Ud Din , Sultan Mehmood Wazir, Saad Ullah Khan, Alamgir Khan and Zulqarnain
Muhammad Bilal Zia1*, Ashar Farooq1, Hammad Ud Din1, Barkat Ullah Khan1 and Samee Ud Din2
... The studies for optimal planting stock and propagation methods for Paulownia indicated that the root stumps grew substantially taller, having straight stems and symmetrical crowns. Highest survival was observed for Paulownia fortunei, Paulownia tomentosa and Paulownia elongata. Paulownia fortunei and Populus deltoides; both had comparable growth in diameter and physico-mechanical properties. Apart from its utilization in wood works, its scope is also emerging...
Chika Bright Ikele1*, Ugwu Venita Uju1, Chioma Faith Ikele2
... 0.1 g/ml (A-E) (for all plant extracts used) in a 96 micro-wells chambers, with 3 sub-replicates of approximately 160 theronts. Mortality occurred in all groups except in the control group during the exposure period. 24-h theront mortality was highest in bitter leaf extracts and least in cashew leaf extract. Mortality was also dependent on extract concentration and extraction solvent. The two highest mortalities of 54.2% and 53.1% occurred at 0.1 g/ml ethanol...
Muddasir Khan1, Siraj-Ud-Din1, Muhammad Farooq2* and Sanam Zarif2
Chun Shi*, Ziyu Cao, Mingyuan Yang and Meijing Zhai
... group, low (10 mg/kg of plant complex sterility agent) and high dose (20 mg/kg of plant complex sterility agent) groups. Hematoxylin and eosin staining is used to observe the pathological changes of testis tissue. The testis organ index, male seminal vesicle, and sperm were also detected. The expression of FAM209, and PICK1protein in testis tissue are detected by Western blotting. Compared with the control group, the cell s...
Sara Brikat1*, Imane Kherrab1*, Yassine Taaifi2*, Sara Haida3, Laila Ibouzine-Dine1, Oumaima Abouyala1, Ilhame Fitah1, Abdelhalim Mesfioui1, Aboubaker Elhessni1
...a rhizomatous herbaceous plant used as a spice and food supplement, known for its valuable natural bioactive compounds. This study aims to investigate the acute toxicity, antidepressant effects, antioxidant activities, and memory enhancement potential of methanolic extract of Curcuma longa (MECL) in high fructose-treated rats. To assess acute toxicity, rats were divided into five groups treated with different doses of MECL (2000, 3000, and 4000 mg/kg) for 14 d...
Zeinab A. El-Moaty1,2*, Hoda Ahmed1,3, Wafaa Sorour4,5 and Tarfa H. Alsheddi6
...d, and Ni), in the soil, plant (Zygophyllum decumben) and ground beetles (Anthia duodecimguttata) at two sampling sites. The selected sites located in the Eastern region, Saudi Arabia. The first site was around to the cement factory, in Al-Ahsa (cement site). While the second one was at 15 Km away (reference site). The obtained results showed that there were no differences in the heavy metals (MHs) concentration in soil collected from the two sites (p>0.05)...
Basheer Ahmad, Nowsherwan Zarif, Saif Ullah Khan, Salman Ahmad and Anwar Ali*
...solution in Pakistan. To plant trees on private lands, agroforestry enables pure rights of timber resources and, when well-managed, can significantly enhance agriculture and mitigate wood shortages. Despite concentrated efforts to familiarize and encourage innovative agri-forestry practices in Pakistan, the achievement of such initiatives is influenced by various factors. This paper examines the current limitations to agri forestry promotion in the country, wh...
Roshan Ara1, Muhammad Ali Khanzada1, Amir Khan Korai1*, Abdul Mubeen Lodhi, Anam Mehwish Khanzada1, Khalid Hussain Qureshi1, Shakal Khan Korai2*
...ita) infection on chilli plants and evaluated the efficacy of various chemical nematicides in controlling the infection. Infected plants exhibited symptoms such as pale green to yellow discolouration, stunted growth, and the development of knots on roots containing egg masses and female nematodes. Pathogenicity tests on “Ghotki” chilli plants revealed a direct correlation betwe...
Manahil Wahab1 and Anwar Ali2
...ed that all farmers have planted trees on their farmlands. Poplar is the main species, followed by Eucalyptus, Bakain, Ailanthus and Kikar. Though farm forestry is practiced in the area since ancient times, the modern commercial farm forestry has been started in the last three decades. Driving forces for adoption of farm forestry include inspiration from other farmers, self-initiatives and quick economic return. Majority of the respondents (72%) have
Muhammad Ilyas1 *, Sanam Zarif Satti2 , Bashir Ullah3 and Salim Saif Ullah4
Salman Ahmad1, Anwar Ali1, Basheer Ahmad1, Nowsherwan Zarif1* and Saif Ullah Khan1
... significant reasons for planting as well as the primary advantages obtained from agroforestry in order to comprehend the effects of agroforestry practices on farmers in Tehsil Thana, District Malakand, KP. A structured questionnaire was used to gather the necessary data from 40 respondents using a two-stage random sampling procedure. According to our findings, 72% of respondents are farmers, 20% work for the government, and 8% are labourers. Poplar is the spe...
Muhammad Umair1, Nowsherwan Zarif1*, Zahid Rauf1, Anwar Ali1, Ghayyas Ahmed1, Basheer Ahmed1, Salman Ahmad1 and Saifullah1
...kets were less likely to plant trees in between and on the border of the fields. Cultivators should be aware of the potential benefits that might be derived from agroforestry systems and should strive toward making the growth of these systems economically and environmentally. Further, in order to ensure sustainable economic development and prosperity for all, it is necessary to encourage active community-based management practices. The establishment of model ...
Syed Farooq Shah1, Nowsherwan Zarif1*, Zahid Rauf1, Anwar Ali1, Ghayyas Ahmed1, Basheer Ahmed1, Salman Ahmad1 and Saifullah1
...ce can be established by planting trees on privately owned farms, and well-managed systems have a tremendous deal of potential to both improve agriculture and ease the wood crisis. However, agroforestry practices are being adopted slowly in the province for several reasons. The main causes for Khyber Pakhtunkhwa's slowdown adoption of agroforestry practices are farmers' attitudes and perceptions, tiny landholdings, the land tenure structure, restricted marketi...
Ashar Farooq1 and Shakeel Ahmad2
...Asrait site, 62.53% were planted species and 37.46% were indigenous; at Niam site, the planted species were 37.98% and 62% were indigenous; in Kullaly site, 63.4% were planted species and 36.57% were indigenous; in Dabargai site 91.25% were planted species and 8.93% were indigenous. Physical inspection of sites depicted that the techniques adopted to reh...
Afra Siab1, Saif Ullah Khan1, Anwar Ali1, Nowsherwan Zarif1, Basheer Ahmad1, Salman Ahmad1
...no idea which species to plant and how to plant, that can lead to more production. The study also recommends to solve the sale problems, that is wood based industries be established in the rural area to make the efficient use of wood grown on farmlands....
Basheer Ahmad1, Anwar Ali1, Salman Ahmad1, Nowsherwan Zarif1* and Saif Ullah Khan1
...% of their firewood from plantations, 24% from farms, and 22% from local purchases. The study revealed that 64% of respondents believe that the increasing usage of firewood in the area as a result of more trees means that people's consumption patterns have changed. When it came to the availability of timber, the data showed that 24% of respondents bought their wood from plantations and 32% bought it from marketplaces, farms,...
Muhammad Rayyan1, Basheer Ahmad1, Anwar Ali1, Nowsherwan Zarif1*, Saif Ullah1 Khan and Salman Ahmad1
... and their intentions to plant trees on their farmland, as well as potential hindrances to their efforts. Two-stage random sampling was adopted to collect the required information from forty respondents through a structured questionnaire. Our results revealed that about 72.5% of respondents have the primary reason for planting is economic return, while 15% plants for shelterbelt purposes. ...
Muhammad Farooq1*, Lal Badshah2 and Sanam Zarif1
...ies and NGOs to make the plant resources sustainable. There is a dire need to provide an alternate source of energy to overcome the burden on rangeland resources.
Key words: Spectrum, Rangeland, Life form, Leaf size, Ashkhel, Shekhmalkhel...
Key words: Spectrum, Rangeland, Life form, Leaf size, Ashkhel, Shekhmalkhel...
Khush Bakht Arooj1, Muhammad Salman2 and Naveed Ahmed3
...d income, pollination of plants to increase crop yield, maintains biodiversity and to protect the environment. The current status of apiculture in district Bannu is evaluated in the study as it is also a famous area for honey production in Khyber Pakhtunkhwa. In this study the primary data was collected through well-designed questionnaire and the study was carried out in different villages of Tehsil and District Bannu. A general survey was also conducted to kn...
ASM Helal Siddiqui, Md. Najmus Sayadat Pitol, Md. Akramul Islam and Sk. Mehedi Hasan
...trees and seedlings were planted in three salinity zones of Sundarbans from 2010-2017. Plantations at fresh water zone always showed the high growth in height (m) and high survival rate (%). Mean height and survival rate (%) for Sundri plantations were 1.82m and 58.95% respectively. The mean height for less, moderate and strong saline zones were 2.31m, 1.63m and 0.73m where mean survival r...
Socio economic impact of community plantation in Salarzai valley, Bajaur Agency, Khyber Pakhtunkhwah
Kaleem Mehmood1, Sultan Muhammad2 and Altaf Hussain3
...n of the people as these plantations have a potential to address the menace of rural poverty besides increasing the forest cover in the area. Two-stage Random sampling was adopted for the selection of respondents. The sampling intensity was kept as 12.5%. Major source of income in the area is farming. The plantation in the study area increases fodder production to fold for livestock for fulfilling their daily needs. Firewood...
Sanam Zarif Satti1, Tanvir Ahmad Quereshi2, Mehwish Zarif3 and Iftikhar Ahmad4
...ent. ...
Ch. Muhammad Muslim1, Hassan Sher2, Junaid Khan2, Shahid Hussain2, Ashfaq Ali2 and Atif Majeed3
... 40 herbaceous medicinal plants belonging to 33 different angiosperm families used by local people to cure different ailments. Lamiaceae was represented by maximum number of 6 species followed by Apiaceae and Solancaceae represented by 4 species each. Alliaceae was represented by 3 species while Amaranthaceae, Asterceae, Brassicaceae, Fabaceae and Pllygonaceae were represented by 2 species each. All other families were represented by 1 species each. Documented...
Muhammad Yousaf Khan and Pervez Manan
...e facts about Eucalyptus plantations in Malakand District after a protest of few participants organized and brought by NGOs based at Peshawar and Islamabad with Play Cards in their hands against Eucalyptus trees planted in Billion Trees Project of the KP Government. The protest organized in front of Malakand Press Club Batkhela on 31st August, 2018 got wide spread publicity in print and electronic Media. In response local m...
Ahmed Zamir, Muhammad Waqas Khan and Saeed Anwar Wazir
... to variety of medicinal plants and has been called as the floral emporium of medicinal plants. It has about 6000 species of wild plants, among them almost 4000-6000 are considered to carry or of medicinal importance. During the ethno botanical elaboration of Leepa valley 106 plant species of 55 families were recorded. Among them 93 are considered to car...
Asad Abbas Khan1, Amina Batool2, Muhammad Aslam1, Muhammad Ehtesham Asghar3, Abdul Ghafoor1 and Muhammad Arif1
...ing number of leaves per plant, plant height, number of inflorescence and number of tillers per plant at three different growth stages i.e., vegetative, flowering and maturity of grasses was analyzed statistically by ANOVA using RCBD. Significant results were observed among selected grass species in terms of biomass production and growth potential and revealed that Cynmbopogan distans
Asad Abbas Khan1, Amina Batool2, Muhammad Aslam1, Muhammad Ehtesham Asghar3, Abdul Ghafoor1 and Muhammad Arif1
...ing number of leaves per plant, plant height, number of inflorescence and number of tillers per plant at three different growth stages i.e., vegetative, flowering and maturity of grasses was analyzed statistically by ANOVA using RCBD. Significant results were observed among selected grass species in terms of biomass production and growth potential and revealed that Cynmbopogan distans
Alam Zeb, Fawad Habib, Sajid and Tilawat Khan
...ncial analysis of poplar plantation in District Mardan. Data was collected through a well-designed pre-tested questionnaire. A total of 60 respondents including 31 Owners, 19 Owner cum Tenants and 10 Tenants were selected randomly from Gadar, Sawaldher and Gujar Garhi villages. Owner category was found dominant in the above mentioned target villages in the parameters of productivity, formal education, planting experience, kn...
I. Mukhtar, R. Bajwa and G. Nasim
...ogical review of shisham plantations is often carried out as part of the working of forest/plant pathologists and encomiasts multidisciplinary team meetings. This review describes the author's experience regarding the major issues identified during this process. Current research article covers; actual problems in shisham plantations and reason of controversy in pathology of dieback disease...
Ashar Farooq1; Farid Shah2; Saifullah Zahri2 and Samiullah Jaffar2
...d. Leaves of intercepted plants were removed at a distance of 5 meters. The cover and height of the same plants was also measured. Quadrat method was used to measure the number of individuals per unit area of Seriphidium at both sites. For measuring the concentration of Fe+, the plant samples were dried, digested and analyzed on AAS (Atomic Absorption Spectrometer). It has been conc...
Mamoona Wali Muhammad1, Syed Ajmal Rahim2, Junaid Mumtaz3 and Syed Akmal Rahim4
...private nursery and tree plantings and to determine their role, influencing factors and constraints in the socio economic uplift of the rural communities. A random sampling procedure was adopted to select the five villages per division to collect the relevant data from 50 respondents, according to the pre tested structured questionnaire.
The average household size in the study area was 6 persons with 1-2 earning members per household. 60% were litera...
Farah Samuel and Syed Kamran Hussain
...sadda districts. Various plant species, native to the area, are found on the river banks. As far as its significance is concerned, conservation is the need of the hour for various threatened species such as fish fauna, freshwater turtles, migratory birds and otters. Illegal hunting and trade along with many harmful human activities are posing a serious danger to the River Kabul ecosystem. This study quantifies the ongoing unsustainable hunting and poaching pra...
Mamoona Wali Muhammad1, Hakim Shah1, Nowshad Khan2 and Mohd Zaki Hamzah3
...h more forest trees were planted under PWSMP. The participants planted more trees than non-participants. The programs succeeded in getting significant involvement (p=0.000) of people in forest protection activities. These two accomplishments serve the forest management and development aims of the programs, but do not materially improve the livelihood of the people at this time.
Key Words: Participatory forest managemen...
Saif-ur-Rehman Saif Abbasi & Saeed Akbar
...on in shape of medicinal plants, wood for making their farm implements i.e. wooden plough, spade, blade etc. and domestic goods of daily usage i.e. charpoy, stool, baskets, furniture etc. The use of cheep and easily available forest vegetation, based on indigenous knowledge, has reduced household expenses on one hand but has also put tremendous pressure on forest vegetation on the other hand. There is need to create awareness on sustainable forest resource man...
Abdul Khaliq Chaudhry1, Ashar Farooq2 and Ghulam Muhammad3
...ombax ceiba boundary plantations on the growth and yield of cotton crop. Data were collected from seven different farmlands. Analysis of data revealed non-significant effect of tree rows on plant density in all the farms. Crop height was significantly affected up to 3.0 m distance from the base of tree rows on eastern and western aspects with north-south orientation while it was non-significantly affected on northern and...
Muhammad Tahir Laeeq and Maqbool Hassan
...the contractors. A Mazri plant can produce leaves for fifty years at an average yield of 10 kg per annum, but due to over exploitation, Mazri forests are decreasing at an alarming rate. About 66% of population generates annual income up to Rs.5000 from Mazri products....
Muhammad Bilal Zia and Muhammad Tahir Laeeq
...ter one and two years of plantation. The results showed highly significant differences in the tested traits among the four species. Paulownia catalpifolia was top ranking followed by Paulownia tomentosa. The genotypic and phenotypic coefficients of variation were higher i.e. 23.43% and 24.36% for DBH. During the study of both years this trait also showed genetic consistency for these coefficients, broad sense heritability (0.93, 0.96) and genetic...
Muhammad Tahir Laeeq and Muhammad Asif Aziz
...healthy and good quality planting stock appropriate nursery techniques are imperative.
The study was initiated to assess the effect of various nursery techniques on the growth improvement of neem seedlings for obtaining healthy planting stock. The study comprised of four experiments including (i) application of fertilizer (urea) @ 0.2 gm/seedling at 2, 4, 6 and 8 days intervals. (ii) application of a hydroabsorbant...
Syed Said Badshah Bukhari, Muhammad Yousaf Khan Syed Zakir Hussain Shah and Khalid Jan
...carbons in thermal power plants is reducing the oxygen four times the weight of hydrocarbon used in the power plants and is therefore detrimental to the very existence of life on this planet.
The arrangements proposed in this study will not only regulate the flow of water for agriculture but power generation on cheaper rates will be ensured. The additional water storage of 40 million Acre feet will be sufficient fo...
Muhammad Shabir Mughal and Abid Hussain
...raints of raising Hurrie plantation in the three Union Councils; Seri, Hatri and Masoo Bhurgri of Hyderabad district. Among 24 respondents 21% farmers have 1-5 acres of Hurrie plantation, 13% have 6-10 acres, 29% have 10-16 acres and 37% have more than 16 acres. The results show that 58.3% farmers raised hurrie by themselves and 41.7% grow through tenants. The cost for raising hurrie varied from 7000/acre/rotation (15% respo...
Ch. Muhammad Muslim and Sohail Sikander
...esearch on the medicinal plants was started by the researchers in the last century in order to allocate different valuable alternative resources to the increasing demands of population especially to those communities totally dependable on forests and other non-renewable natural resources. Linum usitatisimum is a renowned medicinal herb of the world of herbaceous plants because of its multipurpose uses in different dis...
Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...MT and DT-2 will enhance plant growth, while greater temperature increase and precipitation decrease over AP and SA will have negative effects on plant growth. These findings emphasize early initiation of adaptation and mitigation action plans to combat impacts of climate change on coniferous forests.
Key words: Climate change, Temperature, Precipitation, Alpine, Sub-Alpine, Dry Temperate, Moist Temperate, Sub-Tropical P...
Ashar Farooq and Mubashir Hassan
... desert to determine the plant species composition, forage production and carrying capacity of the area to evaluate the current condition of the rangeland. Systematic sampling with random start procedure was adopted to collect the data. The study revealed that species composition of Cenchrus ciliaris was maximum (42.08%) followed by Eleusine flagellifera (27.41%) and Elionurus hirsutus (16.22%) respectively on the basis of cover percent da...
Anwar Ali, Ayaz Khan and Hakim Shah
...tunities and shortage of planting material are the main reasons for slow adoption of agroforestry practices in Khyber Pakhtunkhwa. There is an urgent need to promote agroforestry in the province which will diversify farm income, reduce land degradation, improve agro-biodiversity and enhance carbon stocks in the farming systems. This can be achieved by strengthening research and extension services in the agroforestry sector, providing incentives to farmers to g...
Ch. Muhammad Muslim and Sohail Sikander
...egeneration of medicinal plants is adversely affected by a number of climatic and edaphic factors (earthquake). Drug plants occurring at higher elevations acquire perennial nature due to short growing season of 4 to 6 months and hence require a prolong growth periods of 6 to 10 years depending upon plant species concerned. Disturbance in the regeneration pattern is also affected by heavy g...
Muhammad Shabir Mughal and Muhammad Muslim
...he objectives to explore plant wealth and examine the status of biodiversity. The plain area falls under dry subtropical broad leaved thorn forests and hilly area under dry subtropical Chir pine forests. Bhimber district is very rich in biodiversity, enchanting valley present panoramic views to the visitors and is important from Archaeological point of view. During survey visited many places, notable among these were Surela plant
Muhammad Yousaf Khan, Ayaz Khan and Syed Zakir Hussain Shah
...es and establishing more plantations by involvement of the communities in the forestry activities joint management of the government and communal forest lands. Communities have realised that the development of forestry sector in Chitral is catalysed by extension agents. All the segments of the society expressed their interest in cooperation with the Forest Department for increasing tree cover in the area The objective of the current research is to assess the r...
Muhammad Shabir Mughal and Muhammad Muslim
...he objectives to explore plant wealth, Identification of floristic composition, current status of indigenes tree species, medicinal, aromatic and economic plants growing in the area and evaluation of future prospects of endemic tree species including medicinal and economic plants that need in-situ conservation of sustainable utilization having market potential and income generation activit...
Syed Said Badshah Bukhari, Ghulam Ali Bajwa and Miskeen Ali
...n number of branches per plant (NB). The highest phenotypic coefficient of variation (PCV) was 48.19% in TSL, and the lowest PCV was 4.01% in moisture content. The PCV was slightly greater than GCV in all the traits. The heritability (h2), in broader sense, was ranged between 0.50% and 1.0%. Seven agronomic traits have h2 >0.80%. The highest genetic advance (GA) was in TSL (75.95%) and the lowest in inter-nodal distance (0.7...
Rahim Muhammad Akmal Syed1, Hasnain Shahida2, Mamoona Wali Muhammad3 and Jabeen Farkhanda4
....59 % excluding farmland plantations) of its area, which is insufficient to provide the material needs for the growing population, expanding industry and to retard and arrest the ongoing environmental and ecological degradation process. Based on physiographic, climate and ecology, Pakistan is divided into nine major ecological or vegetative zones, which are further sub-divided into 18 habitat types, an arrangement for the development of Protected Areas System ...
GPS Dhillon, Avtar Singh and DS Sidhu
...ing 12 poplar clones was planted at Regional Research Station, Bathinda in semi-arid region of Punjab following randomized block design with three replications and plot size of ten trees. The data collected on diameter at breast height, tree height and volume per tree at 2, 3, 5 and 7-year age were analyzed and genetic parameters were worked out. Significant differences among clones were noticed for all growth traits at all ages. Clones S7C8
Enefiok S. Udo1, Opeyemi Olajide1 and Eyo A. Udoh2
...respectively. Forty six plant species comprising 16 tree species, 17 shrub species, 8 herb species and 5 climber species were encountered. Apart from Baphia nitida, Pentaclethra macrophylla and Brachystegia eurycoma with populations of 6, 4 and 3/ha respectively, all other tree species had one frequency each/ha. In the shrub category, Lasianthera africana had the highest population of 255/ha and Alchornea cordifolia, the least of ...
Ch. Muhammad Muslim1, Yahya Karamat2, Muhammad Shabbir Mughal3 and Imtiaz Hussain4
...esearch on the medicinal plants was started by the researchers in the last century in order to allocate different valuable alternative resources to the increasing demands of population especially to those communities totally dependable on forests and other non renewable natural resources. Nigella sativa is a renowned medicinal herb of the world of herbaceous plants because of its multipurpose uses in different disease...
Ashar Farooq, Abdul Khaliq Chaudhry and Ghulam Muhammad
...maldulensis boundary plantations on the growth and yield of cotton crop. With north-south oriented tree rows, more reduction in yield (per acre) was observed on eastern aspect (20.0 %) as compared to western aspect (19.40 %). With east-west oriented tree rows, more reduction in yield was observed on northern aspect (16.90 %) as compared to southern aspect (15.80 %) respectively. The reduction in yield of cotton crop grown along the east-west oriented tree ...
Muhammad Afzal, Aqeela Mobeen Akhtar and M. Mahboob-ur-Rahman
...he Earth's surface where plants developed in relative isolation over long periods of time and are separated from one another by geologic features, such as oceans, broad deserts or high mountain ranges, that formed barriers to plant migration. Forest Ecozones are characterized by the evolutionary history of the plants they contain. These are divisions of the Earth's surface based on
Muhammad Shabir Mughal, Asif Raza Wazir and Ch. Muhammad Muslim
... were analyzed and three-plant communities viz. Pinus-Abies-Sophora, Abies-Cedrus and Abides-Pinus communities were determined on the basis of the highest important value (HIV). The dominant species were Cedrus deodara, Pinus wallichiana, Abies pindrow, Picea smithiana, Pinus gerardiana and Quercus dilatata, Quercus incana etc. These plant species were the main source of income of the inhabitants....
Mamoona Wali Muhammad and Iftekhar Ahmed
... of them were willing to plant coconut or date palm at their village, otak or house. Only 4% of the respondents reported that mangrove deterioration is severe due to livestock pressure and decreased fresh water flow downstream in Indus Delta; which resulted in high salinity and stunted growth of mangrove trees and animal life. The measures suggested by respondents included; increased fresh water down stream and control on camels, rotational grazing for livesto...
Waqar Ahmad, Zahid Ali, Muhammad Rafique and Tariq Mahmood
... Fresh and dry weight of plant was adversely affected by partial shade. Similarly the root-shoot ratio was not found to be affected by partial and no shade treatments. It was statistically confirmed that the Albizia lebbeck should be raised under full sunlight for better results....
Maqsood Anwar1, Abdul Wahid Jasra2 and I. Ahmad3
..., a number of animal and plant species have become threatened or endangered mainly due to over-exploitation and loss of natural habitat. Deforestation, overgrazing, soil erosion, salinity and water logging have become major threats to Pakistan's remaining biodiversity.
The Government of Pakistan being aware of the situation recognized the importance to protect country's environment and prepared the National Conservation Strategy (NCS) in 199...
Tahir Laeeq1, Tariq Mahmood2 Mohammad Amin3 and Khurshid Alam4
...through a proper system, plantation along with protection of local as well as exotic species should be carried out and soil conservation technique should be adopted if lands are to be cultivated. ...
Ch. Muhammad Muslim, Muhammad Shabbir Mughal and Imtiaz Hussain
... Mother corms (DFM) were planted on ridges 30cm apart with a plant to plant distance of 15cm. The treatments are highly significant at 95% and 99% level of confidence. LSD at 5% shows that all the treatments are highly significant among themselves while the T1 (Daughter) corm is highly significant. Furthermore, it is recommended that the cultivation of Colchicum luteum should be don...
Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...d reproductive growth of plants, and depending habitat characteristics. In addition to biologists and ecologists, this study provides guidelines to policy makers for adaptation of mitigation measures.
Key words: Climate change, temperature, rainfall, evaporation, wind
...
Shakeel Haider Zaidi, Ch. Muhammad Muslim, Muhammad Shabbir Mughal and Imtiaz Hussain
...Psoralea corylifolia plant is reputed for its psoralen content, largely used in psoriasis and certain immune diseases. To assess the possibility of its introduction and cultivation as a specialized crop, yield trials with different levels of nitrophos fertilizer (20:20 NP) on the seed yield were conducted for three consecutive years at Medicinal Plant Farm of Pakistan Forest Institute, Peshawar. The
Tanvir Hussain
...inth by taking different plant-parts (root, stem, leaf, anther, stolon, ovules, embryos/embryos with stem) as explants in different culture media i.e. Murashige & Skooge (MS) medium, Gamborgs B5-salt (B5)and Basal nutrient medium (BNM) alone and in combination with Auxins and Cytokinins. It was found that only the axillary buds gave good response to all media. For callus initiation, same ex-plant
Md Golam Moula
...angrove species for underplanting in the established coastal plantation. Nine major mangrove species namely Ceriops decandra, Aegiceras corniculatum, Phoenix paludosa, Excoecaria agallocha, Heritiera fomes, Lumnitzera racemosa, Xxlocarpus mekongensis, Cynometra ramiflora and Bruguiera sexangula were tried. The highest survivability was found in A. corniculatum and P. paludosa (87.67%) and lowest i...
Muhammad Afzal and A. Razzaq
...m farmers fields, forest plantations, roadsides and canalsides where shisham trees were badly damaged by the dieback. The soil samples were analyzed for their physico-chemical and nutritional properties. The objective was to find out, if any of the unfavourable soil properties or nutritional deficiencies had been the cause of the dieback. About 3 % of the samples were found to be too sandy to retain and supply water to trees over a longer period of time and 60...
Amjad Ali Ch., Tariq Mahmood, Shahzad Fazal and Nowsherwan Zarif
...sses were established by planting tuft splits in 1x3 m plots at 0.3x0.3 m spacing. No fertilizer was applied and frequent irrigation was done to ensure adequate soil moisture. Four clipping stages i.e. CS1, CS2, CS3 and CS4 (clipped after 1, 2, 3 and 4 months, respectively) were studied. Response variables were dry matter (DM), organic matter (OM), crude protein (CP), Neutral detergent fiber (NDF), acid detergent fiber (ADF) and acid detergent lignin (ADL).Wit...
Ghayyas Ahmad, Mian Muhammad Shafiq, Muhammad Shabir Mughal and Mahr Muhammad Asif
...upport a wide variety of plant and animal life. These forests are facing an increasing problem of forest degradation and species loss. This study is aimed at the assessment and comparison of plant diversity of a Reserve forest with a Guzara forest in the Chir pine zone of Murree hill, so as to see which forest is richer and more diverse in plant diversity.
Systematic sampling des...
Kanwar Muhammad Suleman, Ghulam Mustafa Nasir and Tanvir Ahmad Qureshi
Sarfraz Ahmad, Sarwat N. Mirza and Muhammad Islam
... and production of range plants in Balochistan. Salsola vermiculata a Mediterranean perennial shrub was evaluated under natural rainfall regimes to assess its potential of germination and establishment under drill and broadcast seeding treatments for range improvement in highland Balochistan. Seeds of S. vermiculata germinated in both treatments with higher germination percentage in drill seeding. Apparently, no differences were observed for seed...
Shad K. Khalil, John G. Mexal, Abdur Rehman, A. Z. Khan and Iftikhar Hussain Khalil
...eedy germination of most plant species. Eldarica pine seeds were osmoconditioned with the objective to evaluate its response to priming. Seeds were preconditioned in an aerated solution of polyethylene glycol (PEG) 8000 and water for 1, 4, 8, and 12 days. The osmotic potential of PEG solution was -0.5 and -1.8 MPa. In two other treatments, the seeds were aerated in distilled water for 1 day and refrigerated having 100% moisture content (MC) or reducing MC t...
Ghayyas Ahmad, Anwar Ali, Miskeen Ali and Irfan Akhtar
...rid poplar that has been planted on a large scale in Pakistan for the production of low to medium quality timber. This long term study, covering almost the complete rotation length of the Hybrid poplar, was conducted to find out the effects of three different intensities of pruning i.e. pruning upto ½ height, pruning upto ⅓ height and no pruning, on its diameter and height growth rate. The Randomized Complete Block Design was used. Data were analyse...
A. W. Jasra and I. Ahmad
...ant issues. Multipurpose plant species like seabuckthorn and fourwing saltbush together with improved irrigation system and urea molasses blocks as supplemental feed have been identified as viable interventions for livelihood improvement. A policy dialogue is needed to resolve the problems of nomadic community.
Key Words: Pastoralists, livelihood, Juniper Forest, Balochistan, Pakistan
...
Majid Azizi and Mohammad Modarres
... to feed paper producing plants. The decision-making is examined within the framework of benefits, opportunities, costs, and risks (BOCR). A hierarchy is used to prioritize the BOCR themselves are prioritized using the Analytic Hierarchy Process (AHP) ratings approach. A control hierarchy is then created and prioritized using the Analytic Network Process (ANP) to evaluate the control criteria of the system. There are a total of 19 control criteria in the syste...
A.W. Jasra and Imtiaz Ahmad
...
...
Asad Ullah, Abdur Rashid and Sher Aman
Majid Azizi
...ishment of Wood industry plants.
Keywords: Wood industry, TOPSIS, Analytical Hierarchy Process, Location, Priority
...
Ashaer Farooq, Abdul Khaliq Chaudhry and Ghulam Muhammad
...bergia sissoo linear planting on the growth and yield of cotton crop. The crop density was significantly affected on northern, eastern and western aspect upto 3.0 m from the base of tree rows. There was non-significant affected of tree rows on southern aspect. Crop height was also significantly affected upto 3.0m distance from the base of trees on northern and western aspects while it was non-significant on eastern and southern aspects. Boll formation and ...
Muhammad Afzal, Aqeela Mobeen Akhter and Masood Amjad
...rue to type Shisham tube plants can be produced vegetatively through the application of rooting hormones, which are fit for field planting with in a period of 4 months. NAA with a concentration of 100 mg/l among the other rooting hormones proved to be more economical for production of these true to type tube plants. These tube plants showed promising gro...
Ghazala Yasmeen
...ules, weight of nodules, plant height, weight of shoots and weight of pods per plant. The study reveals that rhizobial strain Thal 8 being more efficient as compared to TAL 620, can be used to increase root nodulation and yield in chickpea (Cicer arietinum)....
Raza-ul-Haq and Mohammad Khan
...d Changa Manga irrigated plantation (Punjab). The data on diameter and height growth of trees of different Paulownia species after 5 years of planting indicated that Paulownia catalpifolia, P. fortune and P. elongate are faster growing tree species than the other Paulownia species tested in the trials. Fast growth rates, sparse crowns and deep root system of these species make them ideal for
Muhammad Afzal and Aqeela Mobeen Akhter
... rooting hormones. These plantlets showed a good growth response in earthen pots and 85% survival of plants in soil was recorded....
J. Kayode and P. O. Tedela
...eucaena leucocephala planted in three different soil samples was subjected to three different watering treatments. Though the rates of growth of the seedlings, their root lengths and the number of lateral roots produced improved with the frequency of watering, Statistical analyses at 5% level revealed that the different watering treatments had no significant effects on these growth parameters in different soil samples. Both the soil type and the frequency ...
Sardar M. Rafique and Ghulam Ali Bajwa
...on, training of mulberry plants should be carried out before the autumn rearing to get young nutritious leaves.
Key words: Silkworm, Bombyx mori, Rearing, Efficiency, Mulberry leaf.
...
Muhammad Aftab Majeed
...e.
...
Muhammad Afzal1, Sahibzada M. Hafeez2 and Aqeela Mobeen Akhter3
...artment, at Changa Manga plantation has an economic benefit on sale of Shisham timber by giving 2.54 cm bark allowance per foot girth'instead of selling it on under bark volume basis. Moreover, results revealed better quality timber production at Changa Manga as compared to Chichawatni plantation.
Keywords: Formula, volume measurement, shisham logs.
...
Kiramat Khan1, Tahir Sajjad2, Nasrullah Jan Malik2, Hassan Sher3, Farrukh Hussain4 and Muhammad Iqbal1
...ormance of six medicinal plant species (Bergenia ciliata, Crocus sativa, Dioscorea deltoidea, Paeonia emodi, Polygonum amplexicaule and Viola serpense) at four different locations in upper Swat valley during 2000-2001. The altitude of these locations ranged from 1200 to 1900 m.a.s.I. Suitability of ex-situ cultivation of these medicinal plant species and their economic feasibility was also worked out. The highe...
Bashir Ahmed Wani1, Shakeel Haider Zaidi2, Hakim Shah3 and Muhammad Muslim4
... Herbal drugs, Medicinal plants.
...
Nasreen Fatimah Rao, Muhammad Tahir Laeeq and Kanwar Muhammad Suleman
... and 7 years old compact plantations, 3 years intercropping plantation and 8 years linear plantations It was found that simple regression equations showed better predictability in terms of F-value and R-square estimates. The highest correlation between girth and leaf area was estimated at the age of two years because of higher photosynthetic activity due to large leaf surface area, while t...
Chaudhry Abdul Rashid1, Raja Muhammad Omer2, Chaudhry Muhammad Faisal2, Waqar Ahmed3, Zahid Ali4
...s conducted in irrigated plantation of Chichawatni, Pakistan to measure the effect of four leguminous species (Parkinsonia aculeata. Albizzia lebbek Leuceana leucocephala and Dalbergia sissoo) on the growth of fast growing species (Eucalyptus camaldulensis) Eight plants of E camaldulensis were replicated thrice in each treatment with a spacing of 2m x 3m. Plant ...
Sardar Muhammad Rafique and Saliheen Khan
...are inhospitable to good plant growth There are frequent droughts and the plant growth fluctuates greatly with precipitation.
Pakistan is blessed to possess some of the most productive lands in the world and in addition to feeding its own population is also capable of producing surplus food for other countries Trees and associated natural vegetation are essential for maintaining the productive capacity of the land In...
Muhamamd Arif Chaudhary and Ejaz Ahmed
...campus road side Shisham plantation was conducted. Data of 5 randomly selected trees of road side plantations, each of 1 km indicated that only 16% of the 535 trees were healthy, 20% top die, 30% vertically half dead, 20% thinned canopy and 14% completely dead. There were observed the presence of termite on 49%, black or red blood like exudation on 32%, insect borer or bore holes on 29%, canker on 26%, white threads or black...
Muhammad Afzal and Aqeela Mobeen Akhter
...oplar nursery and poplar plantation together instead of growing them separately. This amount was saved because some operations do not need repetition when these two activities are combined. The combination of one-year-old poplar plantation with second stage poplar nursery gave net return of Rs.13098/ha. While, poplar plantation raised without nursery proved to be uneconomical with net loss...
Altaf Hussain and Raja Muhammad Zarif
... introduction of foreign plant and animal species The main objective of introduction of exotic forest tree species was to fill the gap between supply and demand of timber, fuel-wood and fodder. Out of 700 alien species 2 forest tree species viz Broussonetia papyrifera, and Prosopis juliflora were recognized as high impact invasive. Eucalyptus camaldulensis is another example highlighting the invasive behaviour. In addition, Robinia pseu...
Syed Shahinshah Gilani, S. M. Chaghtai and Umbrin Khan
...cts from different dried plant parts, soaked for 48 hours, inhibited radicle growth, plumule growth and seed germination of Pennisetum glaucum cv Bari-Hairy. However, no serious inhibition of seed germination was occurred. The toxicity varied from part to part and was related to concentration and soaking duration Root exudates were highly toxic to the radicle growth followed by leaves, stem and whole plant material Fo...
Hassan Sher, Midrarullah, A. U. Khan, Z. U. Khan, Farrukh Hussain and Siraj Ahmad
...A study of the medicinal plants of Udigram, District Swat was conducted during spring and summer 2003. The study revealed 78 species under 37 genera belonging to 47 families, of which 68 plant were dicotyledons, 6 monocotyledons, 1 gymnosperm, 2 pteriodophytes and 1 fungus. The largest family was Lamiaceae (9 species) followed by Asteraceae, Poaceae (each with 5 species), and Rosaceae (4 species). The family Apiaceae, Asclep...
Muhammad Arif Chaudhary and Ejaz Ahmed
...inter rains. The maximum plant height of 14.5 cm and minimum of 2.5 cm are noted. While the maximum cap width of 14.0 cm and minimum of 2.5 cm are measured among its different members. The present colour shade of the specimens includes the golden brown (37.5%), brown (12.5%), light brown (12.3%), dark brown (6.3%), copper (6.3%), deep red (12.5%), pale cream-(6.3%) and country cream (6.3%).
More than 66.6% members of Schizophyllaceae are recor...
Kanwar Muhammad Suleman, Muhammad Tahir Laeeq, Nasreen Fatima Rao and Altaf Hussain
...e produced annually from plantations raised on saline and waterlogged lands in Pakistan per year. This supply of pulpwood is sufficient for the sustained production of 1.225, million tonnes/annum of kraft pulp. After meeting the domestic demand, about 0.625 million tonnes/annum, pulp in surplus would be available for export to earn foreign exchange of about 15.112 billion rupees. Additional benefits like land reclamation, employment generation, import substitu...
Shams-ur-Rehman, Altaf Hussain and Riaz A. Khattak
... training in nursery and planting techniques. A bare minimum annual net income of US$ 80 to 90 per acre could be obtained if a 5-6 year old plantation of Eucalyptus camaldulensis (Source No. 15441) is sold to a nearby pulp mill. Simultaneously, growing nitrogen fixing tree species on these problematic sites in the region would not only improve fertility level but could also reduce the problem of fodder and fuel wood t...
S. M. Rafique
...hat the area was rich in plant bio-diversity and there were 36 plant species. Out of it 18 were grass/grazing species, 2 forb species, 10 shrub species and 6 tree species. The bio-mass production was 752 kg (AD)/ha which was quite low. The study further indicated that range condition was poor to fair and the range trend was downward. The study has recommended application of specialized grazing system like; intensive repeated...
Sarfaraz Hussain Bangash
...o: Functions of boron in plants The exact and specific function of boron in plant vegetative life is not understood as yet. However, investigations have shown that it causes death of the terminal growing point, breakdown of the conducting tissues and results in the brittleness of stem and petiole which finally causes brown coloration and cessation of roots and height-growth (Bangash & Gardiner, 1985). Boron deficiency causes...
Md. Aktar Hossain , Mohammad Kamaluddin and M. Serajuddoula
...ct of etiolation of stockplants on rooting ability to cuttings of Guava (Psidium guajava Linn.). Fifteen months old sun grown containerized stockplants of guava were etiolated in a darkroom. Cuttings from the etiolated and control stockplants were tested for rooting ability. The study revealed that the cuttings of the stockplants etiolated or cont...
Mohammad Ayaz
...e reasons, Eucalyptus is planted in blocks and linear rows on farmlands, dry areas, marginal lands, as shelter belts and control of waterlogging and salinity in the plains of Pakistan.
At the same time, Eucalyptus is facing many accusations like lowering of water table and recent water shortage. With this prospective, the validity of these accusations is very essential before making any decision to use or not to use this species for
Rizwana Aleem Qureshi*, Mushtaq Ahmad**, Zaheer Yousaf* and Muhammad Arshad*
...lia Wall. Ex DC. For plant size, leaf-shape and size, petiole length, inflorescence type and capitulum, were studied on the herbarium specimens preserved at Herbarium of Quaid-i-Azam University, Islamabad. Medicinal properties and uses of these species were determined by interviewing Hakims and also from the literature. Characters recorded are head and receptacle, number of florests per head were taxonomically important to differentiate these species. It w...
Aman Ullah Bhatti, Shamsher Ali and Farmanullah Khan
...d K. The total number of plants were 410 in agro-forestry field and were about 5 years old Data collected on soil properties were statistically analyzed. In the field of agro-forestry, the percent co-efficient of variation (% CV) for EC (1:5) and P were 57.4 and 35.2 for surface soil and 49.8 and 72.7% for sub soil, respectively. Based on critical level for soil P. all the soil samples in both the depths were deficient, except one sample which was medium in su...
J. O. Adegbehin
...ent of the species....
Bashir Ahmad Wani, Shakeel Haider Zaidi, Muhammad Shabir Mughal and Hakim Shah
...s....
Muhammad Ibrar Shinwari, Maryum Ibrar Shinwari and Mir Ajab Khan
... as marketable medicinal plants collected by the inhabitants, drug dealers and herbalists for their socioeconomic value. Among the species sold in the local market, 3 species i.e., Asparagus adscendens Roxb., Berberis lyceum Royle. and Viola canescens Wall, ex Roxb. found vulnerable to harvesting....
Abdul Ghaffoor, Kashif Waseem and Hafiz Sabir Ali
...ting, number of branches/plant, length of branches, number of fruit clusters/plant and weight of clusters. Among different pruning intensities, 100 cm pruning gave the maximum number of clusters/plant (1771) and the highest yield/plant (18.41 kg). Various pruning dates significantly affected the days taken to sprouting, number of leaves/branch and number...
Ghulam Ali Bajwa and Muhammad Nawaz Rajpar
...08%) was otherwise....
Raza-ul-Haq and Muhammad Tahir Laeeq
...> (6%) after 4% years of planting....
Muhammad Afzal, Muhammad Mushtaque, Aqeela Mubeen Akhtar, Nighat Chughtai and Shaheena Ramzan
...ugh multiplication of ex-plants produced from aseptically raised germinates of the species. In the basal media (MS + 5 micro molar BAP), ex-plants started differentiating shoot buds at high frequency. These aseptically developed plantlets were shifted to earthen pots for rooting without applying any root-promoting hormone. These plantlets showed a good g...
Syed Zainul Arifeen
...pecies, their care after planting and integration of other technical soil conservation measures with planting. Participation of the local people in watershed management activities is also suggested in the paper.
...
Ghulam Akbar
...ementsian model based on plant succession and climax (Friedel, 1991, Laurenroth & Laycock, 1989). New thoughts are provoked on the way of this discussion and new ideas and approaches are emerging. The necessity of new ecological models was realized keeping in view the limitations of the successional model in meeting the management objectives of a particular range resource in a given set of ecological conditions. The paper reviews the major approaches of three ...
G.A. Bajwa and H. Gul
.......
Raza-ul-Haq and Abdul Khaliq Chaudhry
...h conventional method of planting on four species viz. Eucalyptus camaldulensis. Leucaena leucocephala, Acacia nilotica and Acacia modesta at Kharian. Data on survival and growth of these species were recorded.
The survival under different water conservation techniques i.e. contour trenches, micro-catchment and Gradoni was 79%, 78% and 82% respectively while in simple pits it was only 70%. The average highest survival percentage of three wate...
J.O. Adegbehin and J.E. Onyibe
...ent of the species....
Muhammad Naqash, Anwar Ali, Ahmad Hussain, Mamoona Wali Muhammad, Ahmad Zamir, Ikram Ul Haq
...nd growth performance of plantations grown under BTAP in Swat Forest Division. Twelve study areas were randomly selected and investigated for data collection in September-October 2017. A total of 88 sample plots of 0.1 ha area were laid out in the randomly selected plantations in the area. Data on type of species, natural regeneration, the density of pits, and number of seed bearers, soil, survival rate and occurrence of any...
Anwar Ali, Kamran Khan, Ayaz Khan Marwat, Sajid Aman and Irfan Ullah
...ht and survival of seven plant species planted in 2017 in hillside ditches under semi-arid conditions at Paya Muslimabad, District Kohat was carried out. Seven drought resistant tree species were planted in three replications on RCB design. After plantation in 2017 the survival and height data of each species were collected every year in June till 2020 a...
Ayaz Khan Marwat, Kamran Khan, Anwar Ali, Sajid Aman and Irfan Ullah
...t and survival of twelve plant species planted in 2017 in Roaded Catchments under semi-arid conditions at Mujahid Town, District Lakki Marwat was carried out. Twelve drought resistant tree species were planted in three replications on RCB design. After plantation in 2017 the survival and height data of each plant speci...
Siraj-ud-Din and Abdul Waheed Baloch
... and height of different plant\tree species at Karak and Mianghundi (Quetta) and Mastung districts of Balochistan.
Rainwater harvesting and dry afforestation techniques were compared with conventional method of planting (simple pit planting) of three species viz. Pistacia khinjak, Elaeagnus angustifolium and Atriplex spp. at Mianghundi Quetta. The above techniques were also compared...
Rainwater harvesting and dry afforestation techniques were compared with conventional method of planting (simple pit planting) of three species viz. Pistacia khinjak, Elaeagnus angustifolium and Atriplex spp. at Mianghundi Quetta. The above techniques were also compared...
Muhammad Muslim and Hafiz Muhammad Sufyan Babar
...und vegetation....
Anwar Ali, Muhmmad Ayaz, Saz Muhammad
...f Kaghan. There were 332 plants per ha in the forest area. Reserved forests have significantly higher number of regeneration than Guzara Forests. It was astonishing to know that the highest number of regeneration was recorded for Fir which was 43%, followed by Kail as 27%, deodar 14%, Spruce 12% and Taxus wallichiana as 4%. The study recommends adoption of assisted natural regeneration techniques and opening of canopy for improvement of stand structure...
Iqtidar Hussain and Adnan Noor Shah
...r of weed control in our planting systems....
Ahmed Zamir, Muhammad Waqas Khan, Muhammad Waqas Khan, Waseem Ullah and Rizwan Ullah
...nstraints in way of tree planting on farmlands. The results showed that about 70% of the farmers predicted the advantage of the tree planting as being the source of fuel wood and tobacco kilns. They further perceived the role of tree planting as; 50%, 40%, 30% role in shade, income and other environmental benefits respectively. It was observed that educated farmers favored tree farming as ...
Sanam Zarif Satti, Tanvir Ahmad Qureshi, Iftikhar Ahmad and Sumara Zarif
.......
Naveed Ahmed
...ted localities of Poplar plantations of Pakistan. From each locality 9 Poplar plantations were surveyed with random sampling, a total of 315 plantations were surveyed. Most of the survey was conducted from Populus deltoides plantations. Insect pests representing 5 orders, 35 families and 76 species were recorded during the study. Lepidoptera repre...
Sarfaraz Hussain Bangash
... Nutrients. Many plant disorders have been recognized as trace element deficiencies. Recommendations have, therefore, been made to use minimal supplements of trace elements for all chemical fertilizers to minimize the fluctuations and availability of these elements to plants. Amongst the micro-nutrient elements, boron is perhaps the most important and plays a very important role in soil-plant...
G. A. Bajwa and Hanif Gul
...nightly on nurseries and plantations at
the Pakistan Forest Institute Campus, Peshawar showed
that the Paulownia spp. Fell prey to the attack of
fourteen insect species like Agrotis ypsilon Rott.
(Noctuidae), Aleuroplatus pectiniferus Quiint.
(Aleyrodidae), Catopsilia crocale Cram. (Pieridae),
Cyrtopeltis tenuis Reut. (Miridae), Drosicha stebbingii
Gr. (Margarodidae), Heliothis armigera Hueb.
(Noctuidae)...
Muhammad Rafique and Muhammad Afzal
...not
recommended for out-planting as these gain more height
alongwith more cost for retaining them for longer time
in the nursery.
The study was designed to find out the optimum and
economical age/size of Eucalyptus camaldulensis tubed
nursery plants for transplanting in the field. Six
different age groups of seedling were planted for this
...
Abdul Samad Mumtaz, Mir Ajab Khan and Tanweer Akhtar
... which resemble in their plant forms (gross
morphology). Characters like pollen shape, polar
diameter 'P', equatorial diameter 'E', 'P/E' ratio,
exine thickness and pore diameter are found considerably
important. Artemisia japonica and A. desertorum are
distinguished due to pollen grain size and the absence
of operculum on the pore of A. dubia is distinguished
due to pollen grain size and the absence of operculum o...
Mohammad Ibrar
...k hypoglycemic medicinal plant. All the three elements were present in very high amounts as compared to some other hypoglycemic medicinal plants....
Shams-ur-Rehman
...commendations to improve plantations of the species in northern Pakistan and other countries....
Muhammad Tahir Laeeq
...0, 69/55 for large scale planting in different parts of the country....
Babar Sohail and Kanwar Muhammad Suleman
...the impact of Eucalyptus planting on farmlands. The information collected through the questionnaire was analyzed statistically. Economic comparison between Eucalyptus tree raising and agriculture crop production has shown that the former is a profitable practice having high benefit cost ratio than the later. Moreover, out of total sample population, 45 percent of the farmers have sold 66,300 Eucalyptus trees earning 13.2 million rupees which is a handsome amou...
Jehan Zeb, M. Aslam, Shahid Ahmad, Aamir Kabir and Taj Ali Khan
...ne bags. The increase in plant height for E. camaldulensis was 16% in bag size of 20" x 30" as compared to control (without bags). For A. nilotica, the increase in plant height in bags size of 18" x 24" was about 59% that of the control (without bags). E. camaldulensis gained 82-88% and A. nilotica 75-89% of its height during May-August. The peak daily potential evapo-transpiration (ET...
Mamoona Wali Muhammad and Sumaira Saeed
...n number when it came to planting activities. The study also revealed that fuelwood was a major source of energy for domestic cooking. The demand for the biofuel expected to increase with increasing human population and decreasing private forest resources....
Muhammad Ibrar Shinwari and Mir Ajab Khan
...ve always used medicinal plants for various ailments and have for a long time been dependent on surrounding plant resources for their
food, shelter, fodder, health care and other cultural purposes. However, encroaching industrialization and the accompanying changes in their life styles are responsible for the decline in the local practice of uses of these plants before the information is ...
Asif Kamal and Rizwan Ahmad
...encies. Trees and shrubs planted in track belts along the roads with a dense foliage can also attenuate traffic noise effectively.
...
Zafar Iqbal
...onducted on 12 years old plantation using R.C.B. design with five replications. The results are quite encouraging and suggest that Eucalyptus camaldulensis can be raised successfully through coppice. Growth of coppice shoots was about 2-3 times more than the crop of seed origin. Volume production was not affected by the number of shoots retained or removed. However, reduction in number of shoots would be required to obtain bigger sized wood in relativel...
Shams-ur-Rehman
...gged
areas. Large scale planting of these species is therefore, recommended in the country....
M. Ayaz and M. Nauman Arshad
...tion with shrubs must be planted along the highways, as a measure to cut down traffic noise in addition to other environmental benefits....
Mian Muhammad Shafiq
...ely and 11%
low (5% for plants, 4% for mammals, none for birds, 10% for reptiles for fish) but the blending of elements from different origins has ensured a diverse and interesting flora and fauna....
Muhammad Afzal
...ly Bambusoideae.
The plant has a many jointed cylindrical hollow stems called the culms. The stems are connected to a rhizome network that spreads out horizontally beneath the soil, forming a bush known as clump. The propagation of bamboos by seed is most successful but many of the bamboos flower and seed after long intervals. Seeding cycles vary from species to species and may be 30-100 years (Banik, 1980). Due to long inter-seeding intervals, the propag...
Syed Zainul Arifeen and Abdul Khaliq Chaudhry
... treatments
namely; mix plantation with engineering techniques, mix
plantation, pure chir pine plantation with engineering
techniques and pure chir pine plantation with range land
improvement practices were randomly applied to four
sub-catchments, while the 5th one was kept untreated and
open to grazing. Nine year's (1986-1995) average data
showed...
Muhammad Shabir Mughal and Shams-u-din Jalbani
...cant affected and better plant
growth and height was observed in all treatments. The
grain yield was higher and significant in doses of
manure than control. It is concluded that Paulownia
leaves manure shows positive effect on wheat and
improves the grain yield of the crop. On account of
this, Paulownia spp. are ideal for agro-forestry in
Pakistan....
Muhammad Rafique Sardar
...ses the existing forests plants preparation, important characteristics and objectives of forestry projects and evaluation processes. The paper suggests that forestry
activities must be integrated with rural development. It further suggests that the importance of Planning, Monitoring and Evaluation (PME) of forestry projects must be recognized and evaluation must be made an integral part of the plans....
Ghulam Akbar, Muhammad Arshad and Taj Naseeb Khan
...listan....
Muhammad Ayaz
...n are rich in important
plant drugs. Presently the supplies of these drugs,
especially Kuth (Saussurea lappa) are dwindling mainly
because of over and uncontrolled extraction. As a
result, Kuth has been listed as
Threatened with Extinctionin Appendix II of CITES. Therefore, the production and utilization of this drug plant need to be regulated through management plans and in situ and ex-situ cultivatio...
J. S. A. Osho
... of an even-aged forest
plantation. The plantation is being managed for timber
production on fifteen years rotation and on a 5-year
periodic planning. The solution of the LP showed that
about 5.8 x 107 m3 of wood was maximized. The optimal
solution preserved 2,945 ha (20, 730, 202 m3) of wood
was maximized. The optimal cut in Period-I (1995-2000),
3,766 ha (22,158,071 m3) in Period-II ...
Md. Serajuddoula, A. S. Khan, M. R. Islam and M. A. H. Shahjalal
...ctares of land have been planted with keora (Sonneratia apetala), baen (Avicennia officinalis) gewa (Excoecaria agallocha), kankra (Bruguiera sexangula) and goldpata (Nipa fruticans). Among them keora and baen are the major (80 and 20 percent, respectively) planting species. This established man-made mangrove forest along the coastal belt and off shore islands face major problems viz. site ...
Kanwar Muhammad Suleman and Nadeem Kausar
...hment of Paper mulberry
plantations on private and government land in the country....
Zafar Iqbal
...onducted on 12 years old plantation using
R.C.B. design with five replications. The results are
quite encouraging and suggest that Eucalyptus
camaldulensis can be raised successfully through
coppice. Growth of coppice shoots was about 2-3 times
faster than that crop of seed origin. Volume production
was not affected by the number of shoots retained or
removed. Reduction in number of shoots would be,
however, required to obtain bigger sized wood ...
Kanwar Muhammad Suleman and Muhammad Ayaz
...tter profitability
from planting Eucalyptus. Beside many other marketing
and utilization measures the export potential of
Eucalyptus wood chips from Pakistan could be an
alternative to improve eucalyptus marketing and hence
its profitability and production. In the present study
benefit cost analysis has been carried out to determine
the economic feasibility of manufacturing Eucalyptus
chips at the stump for export purposes. The results of
this analysi...
A. G. Wilkinson
...two million poplars were planted in
government subsidized planting has declined dramatically in the late 1980's and 1990's with the emphasis shifting to sustainable land management systems. Radiata pine affoestation, poplar silvipastoral systems, and various plant combinations including poplars and willows for riparian management were introduced. To prevent long term degradation by soil e...
Shad K. Khalil, J. G. Mexal and M. Ortiz
... germination of the most plant species. The objective of this study was to evaluate the
effect of osmoconditioning on germination speed of Eldarica pine were assessed by seed treatment with different polyethylene different experiement. In experiment 1, seeds were 7, 9, and 11 days with three PEG concentration having water potential of -0.5, -1.1, and -1.8 MPa. In experiment 2 seeds were treated with PEG for 1, 4, 8, and 16 days having water potential of 0, -0...
Wang Shiji and Li. Huqun
...2000 ha euphrate poplar
plantations have been established in Xinjiang and Gansu
provinces of China. This paper describes the nursery and
afforestation techniques for P. euphratica....
Mohammad Noor and Bashir Hussain Shah
...ass of five tree species planted in 1983
in a roaded catchment under rainfed conditions at
Dagarkotli, were compared. Twenty plants of each of the
five fodder tree species were planted in each of 6
replications on RCB design. Survival, growth and
airdried biomass data were collected in January, 1994 on
each tree species, and analyzed statistically. Acacia
modesta, Prosopis cinera...
A. U. Khan, S. Siddique and F. Naz
...f exposure dosage on the plants, alongwith plant physiology and the energy and chemical balance in the plant micro-environment created on the road determine to what extent pollution can be absorved or emitted by these trees....
Abdul Khaliq Chaudhry, Sahibzada Muhammad Hafeez and Muhammad Jahangir Ghauri
...ensis potted nursery plants and its effect on
the out-planting success. Survival percentage and height
and diameter growth of seedlings at nursery as well as
field phase were found non-significant. Economy in
irrigation water and use of labour for irrigation
without affecting the growth of plants was also worked
out....
Muhammad Hafeez, Liaqat Hussain Jafri and Mohammad Rafiq
..., direct sowing vs tubed planting, an
experiment was laid out in Shakaragarh Tehsil during
July, 1987. Costs incurred on raising of Acacia nilotica
by two methods was calculated. Results indicate that
although the method of direct sowing is easier and
apparently cheaper but in the long run, the method of
raising kikar woodlots on farm lands by planting tubed
plants is prefera...
Hanif Gul
...ive trials, influence of plant stress on termites
infestation. Population assessment trial carried out in
different localities showed the species wise
distribution along with their strength. Wood resistance,
trials showed the Dalbergia sissoo, Cedrus deodara and
Acacia nilotica as the most resistant wood while
Salmalia malabarica and Populus x-euramericana were
found as the most susceptible woods. Extractive of the
resistant...
Mohammad Hafeez and Muhammad Rafique
...and make it available to plants in
their tender age. An experiment was laid out at
Maujghar in Cholistan to study the effectiveness of
such a chemical 'alkasorb' for its water retaining
capacity and its ultimate effect on the survival and
growth of tree species....
Muhammad Rafique
..., number of
tillers per plant, hight of crop and yield of wheat crop
were studied which were statistically insignificant....
Abdul Khaliq Chaudhry and Jehangir Ghauri
S. M. Raidh, M. K. Hossain and S. Akhtar
...e.
But, for large scale plantations, the polybags of T2 treatment (23 x 15 cm size) is the optimal size for raising quality seedlings of Acacia auriculfiormis and the polybags of (30.5 x 15cm size) is optimal size for Chickrassia tabularis....
Mohammad Rafique and Mohammad Hafeez
..., number of tillers per
plant, height of crop and yield, (straw and grains) of
wheat crop were studied which were statistically
insignificant....
Ghulam Ali Bajwa and Hanif Gul
...ays after treatment were plant height,
number of leaves per plant, fresh weight of leaves,
fresh weight of stem, dry weight of leaves, dry weight
of stem and percent dry matter. Five plants per
treatment were selected at random, then data were
converted on per plant basis. Plant height was the only
parameter whic...
Bashir Hussain Shah
...onservation benches with planting of trees on slopes, conservation benches with natural grass on slopes and bench terraces. On the risers of bench terraces and conservation benches ipil ipil was planted. In strip cropping Eucalyptus camaldulensis, Acacia modesta and L. leucocephalla were planted in 3 rows at 1 x 1m spacing along the contour. At the outlet of each catchment, d...
Bashir Hussain Shah and Mohammad Noor
...under barani conditions
planted in the roaded catchments with a trench. The
experimental design was randomized complete block with
six replications. The plot size was twenty seedlings.
In January, 1994 the survival, height, diameter at breast height (dbh) and biomass data were collected. There was no significant difference among the tree in survival. Acacia albida showed significantly greater growth in height dbh and biomass followed by P...
Maqsood Ahmed and H. Verplancke
...
improve the supplies of plant available water, thus
helping in better plant establishment and growth. The
effects of polyacrylamide co-plymers on germination and
growth were investigated in this study. The polymer was
mixed with dune sand at different percentage by weight
and soil-hydrogel mixtures were saturated with saline
solutions prepared by mixing NaCl at different
proportions in deionized water after sowing se...
K. M. Siddiqui
... and graceful group
of plants and are of multiple utility. About 14
million hectares of the earth surface is covered
by bamboo forests with 80 percent of their total
area falling in Asia. They are well represented
in all continents except Europe and their
distribution extend from 15° North latitude in
Japan to 47° South latitude in South Argentina
in the areas of Tropic of Cancer and Tropic of
Capricon. The altitudinal range is from just
a...
Zakaullah
...na A. BJackson) crop planted during
1984-85 in Compartment Nos. 9 and 10, Naran
Forest Range. The incidence of attack was
found to vary from 20-30%. It was observed
that most of the infected plants had already
died while the remaining exhibited blisters,
swellings and girdling of stem, death of small
shoots, needles turnings to reddish brown, resin
exudation and eventually leading to the death of
entire
Wali-ur-Rehman
...he fruits of a medicinal plant Nigela sativa in the medicinal plant garden at the Pakistan Forest Institute, Peshawar during 1993. It caused complete seed losses in 73% of the infested fruits. In rest of the 27% fruits
seed loss rated as heavy (8%), medium (8%) and Light (11%)....
Mohammad Arif Chaudhry
...nology of three-year-old plants of 5 Paulownia species namely P. australis, P. elongata, P. fortunei, P.tomentosa and P. forgesii indicated that flower bud production occurred in the month of August in the first four species . P. forgesii did not produced any flower buds. The blooming took place in first week of March before foliation. P. elongata flowered earliest of the species in the first followed by P. fortunei in...
Sahibazada M. Hafeez
...ed from CSIRO Australia, plants raised in the nursery and then out planted in the field trial during September, 1990. Three years survival and growth data have been analysed and better performing salt tolerant species have been identified.
...
Sahibzada M. Hafeez and M. Hafeezullah
...t a suitable pattern
of planting Poplar (Populus deltoids) in AF system for
inter-cropping with agricultural corps. A replicated
experiment involving agricultural crops (maize and
wheat) and silvicultural crop. (Poplar) was initiated
during 1990-91 at PFRI Research Garden. Poplar was
planted in rows 6.1 m, 9.2 m, and 12.2 m apart with a
uniform distance of 1.5 m from tree to tree within the
rows. Poplar crop. ...
K. M. Siddiqui and Muhammad Tahir Laeeq
...74,700 hectares will be
planted in Pakistan during the 8th Five Year Plan
(1993-94 to 1997-98) for which 1309.4 million plants
will be raised. On the basis of these targets, 992,710
kg seeds of various tree species would be required
during this period....
Chaudhry A. Khaliq
...f which
covered an area planted with Pinus radiata in one of
four different age classes....
Mohammad Saleem and C. A. Call
... were implemented when plants were 32 weeks old; and consisted of: equally clipping (3-cm stubble height) plants in monoculture and mixture zero, one, two or three times at 4-week intervals (32, 36. and 40 weeks after emergence), and clipping (3-cm stubble height) one species in mixture zero, one, two or three times at 4-week intervals (32, 36 and 40 weeks after emergence) without clipping the associated species. The final...
Javed Afzal, Abdul Sattar Alvi and Sarwat Naz Mirza
...on, adversely affect the plant built-up. Adding to the woes, whatever meager plant
cover is available that is also depleting rapidly.
The depletion is being caused mainly by an
absolute lack of grazing management by the flock
owners and by the extraction of shrubs and bushes
for fuel. Valuable grasses like Washta/Hadden
(Stipa pennata), and Granang/Rangai (Enneapogon
persicum) have almost vanished. The...
Raza-ul-Haq
...ised
3 and 12 month old planted seedlings. Vegetation
treatments included cutting and killings with herbicide
applications. Seedling age in relation to competition
from other vegetation is important for the survival of
seedlings. Total shrub (Viburnum) control and soil
working improved survival (77% of 3 months old seedlings
as compared to control (67%). The highest survival of
85-87% was achieved in the plots where herbs and shrubs
were killed with h...
K. M. Siddiqui and B. H. Shah
...ervation, harvesting and planting techniques were
investigated for the establishment of tree plantations
in the dry regions. The roaded catchments,
microcatchments, and individual basins proved effective
and economical for dry affoestation. Plastic mulching,
drip irrigation, pitcher irrigation and deep planting
were also successfully used for this purpose. A number
of multipurpose t...
Muhammad Arif Chaudhry and Altaf Hussain
...8 to 1.580%, on soil pH, plant height and apical
dieback in Leucaena leucocephala, Albizzia lebbek,
Acaica nilotica and A. ampliceps. The results indicated
that the highest salt concentrations (.0.878% - 1.580%)
produced deleterious changes in soil pH and resulted in
dieback injury in A. nilotica, A. lebbek and L.
leucocephala in an increasing order. Although the growth
of A. ampliceps was reduced appreciably but it sh...
Raja Atta Ullah Khan
... over-emphasized because planting stock is the
basic and most important ingredient of tree
plantation. Shisham (Dalbergia sissoo) is the most
important multipurpose tree species in Punjab
which is extensively cultivated on public as well as
private lands. It is propagated with root shoot
cuttings. Prevailing technique of raising of shisham
nursery consists of broadcasting sowing of shisham
pods on raised beds...
M. Ismail Chaudhry and Ghulam Ali Bajwa
...rent parts
of four drug plants Azadirachata indica, Dhatoora alba,
Melia azedarach and Calotropis procera were used to
determine their efficacy against Plecoptera reflexa
larvae, an important defoliator of shisham plantations.
In case of A. indica and M. azedarach seed powder was
used for making 10% water extract and for D. alba and C.
procera leaves, branches and stem ...
Raza-ul-Haq
...kept (in
poly bags) and planted bare-rooted at age 3, 12 and 24
months, under four cover conditions in the experimental
site at Kund. The survival and growth of the seedlings
were monitored over time. Both 3-month-old and
12-month-old plants in polythene tubes gave best
survival rate under shade in all three cover condition.
Under similar condition the survival rate was
comparatively low for the seeding
Muhammad Khan
...ing
genetically uniform planting stock. The stem cuttings
are difficult to propagate as compared to root
cuttings. This paper reports results of the study on
determination of suitable size of paulownai root for
vegetative propagation....
Shakeel Haider Zaidi, Anwar Ahmad Khan and Muhammad Muslim
...ropa acuminata Royle plant is well-known for its
active constituents extracted from leaves and roots. It
is widely used in a number of pharmaceutical
preparations. In order to develop regeneration
techniques of the plant for its conservation experiments
on regeneration and cultural studies were conducted for
3 consecutive years in its natural habitat. Standardized
techniques of raising seedlings from seeds or by
...
Rash Khan and Faridullah Khan
...oth the
treatments. The plant height and fresh yield of the
covered crop during the first year was high as compared
to that uncovered crop due to high temperature under the
polyethytene sheet It is also brought about early
germination, whereas the low temperatures delayed the
germination by70 days....
Mohammad Rafique Sardar
...s. Its total biomass per plant
was 184.4 kg, and was followed by Acacia tortilis, which
yielded 80.3 kg. per plant....
Mirza Hakim Khan
...y Quadrat method. Three
plant communities were recognized, namely Juniperus
macropoda, Ephedra nebrodensis, Daphne oleoides
community, Sophora griffithii, Artimisia maritima
community Juniperus macropoda, Perovskia abrotanoides
community First two communities were found the best for
food and shelter of Markhor-Hazarganji and Chiltan in
summer and winter seasons. The third community was found
in the habitat of Markhor in Takatu hill...
Mohammad Rafique Sardar
...Tecoma undulata were planted under 5
planting methods viz; Surface planting, pit planting,
trench planting, slope planting and slope with trench
planting in Peshawar during August, 1983. The main
objective of the study was to test the survi...
Hakim Shah and Malik Illahi Bakhsh
...nt to 0.73 million ha of plantation forests....
Bashir Hussain Shah, Altaf Hussain and Raja M. Omer
...nt vegetation e.g. tree
plantations, grass cover and bare soil differed
significantly although other physical characteristics
were not significantly different....
Shakeel Haider Zaidi and Anwar Ahmad Khan
...thaea officinalis L. plant in reputed for its healing
and anti-inflammatory properties and is largely used in
indigenous and allopathic medicines. To assess the
possibility of its introduction and cultivation as a
special crop, yield trials with various spacings were
conducted for 3 consecutive year (1989 to 1992) at
Medicinal plants farm, Peshawar. The plant has
successfully ad...
Wasif Hussain Bokhari
...pt.
There are extensive plantations of Siris in Nepal
and in central and southern India (NAS, 1983).
Siris is characterized by a spreading umbrella
shaped crown of thin foliage and bipinately
compound leaves. Its pods are conspicuous
during most of the year because they hang on
the tree long after they ripe and throughout the
hot weather when the tree is bare of leaves.
When rattled by hot winds, the pods sound like
frying fish; hence, the tree is ...
Hanif Gul and M. Ismail Chaudhry
...eplications keeping five plants in each
treatment. A total of 243 plants were found dead at
D. I. Khan during the period of experiment out of which
termite damage was recorded on 27 plants only. At Peshawar mortality of plants was less than that at
D. I. Khan. A total of 175 plants died over a period of a
year and...
Ghazala Nasim
...y a Glomus sp....
Mohammad Noor
...ge number of established plants of the ecotypes from India (269), Australia (426) USA (235) and Pakistan (229) was significantly hider than those of other ecotypes. The ecotype from Pakistan (390) produced minimum air-dried for age and had minimum number of established plants....
Pazir Gul and Muhammad Farooq
...rably well with oil from plants grown in colder
climate but less unsaturated than Russian oil. It was
also observed that the oil was of fair standard and
could be used in place of oil from other Ricinus spp....
Some observations on the effect of forest tree species on ground vegetation at Pabbi Forest, Kharian
Bashir Hussain Shah
...ion under four years old plantation
showed that Eucalyptus camaldulensis, Acacia nilotica
and Leucaena leucocephala have a higher allelopathic
effect on the growth of grasses under them as compared
to Zizyphus mauritiana, Acacia modesta, Dalbergia sissoo
and Albizzia lebbek. The cover percent of the vegetation was lowest (8.25%) under Eucalyptus camaldulensis and
highest under Zizyphus mauritiana (83%). The cover...
Anwar Ahmad Khan and Shakeel Haider Zaidi
...ensis is a well-know plant reputed for its
menthol control content all- over the world. In order to
determine the possibility of its cultivation as a crop,
introduction and fertilizer trials were conducted for
two consecutive years at Medicinal Plants farm, Peshawar.
Yield data indicated that 3-cuttings proved better as
compared to two cuttings/annum.Application of split
doses of NPK at the rate of 150:30:30 kg/ha...
Editor
... and water use of forest plantation. Published by John Wiley and Sons Ltd, England
2. ILO, (1992). Fitting the job to the forest worker: An illustrated training manual on ergonomics. International Labour Office, Geneva, Switzerland...
M. Bashir Khan
...oids.Total
alkaloid per plant.Ornithine decarboxylase (ODC)
activity, arginine decarboxylase (ADC) activity,
arginine were determined separately in roots, stems and
leaves of Atropa acuminate fed with nutrient solution
having different source of nitrogen fertilizer. All
sources of nitrogen fertilizer increased the total
biomass and the highest increase (27.2% of control) was
in the plants fed with both ammoniu...
Zahid Javid and R. F. Fisher
...ssimilation....
Zahid Javid and R. F. Fisher
...ssimilation....
Bahauddin Sirhindi
...n hectares are irrigated plantations, while the
rest of the 0.756 million ha. constitute mangrove
forests (0.288 million ha) and range lands (0.467
million ha), only about 30% of the total forest area
falls under productive category while the rest of
the area is of protective nature. Riverine and
irrigated forest plantations, the productive category
constitute about 2.3 percent of total land area of
the province....
K. M. Siddiqui
...sis for 8
types of tree plantations in different parts of
plantations in different parts of Pakistan. Financial
analyses were carried out for 5 multiple purpose tree
species planted in the form of both linear and block
plantations in the irrigated plains on state as well
as on private farmlands through the country. The results
indicate that cost b...
Editor
...promotion of
medicinal plants was held on 6th and 7th
March, 1991 at the Pakistan Forest
Institute, Peshawar, organized at the
initiative of Mr. Amir Gulistan Janjua,
Governor, NWFP. The objectives of the
Workshop were to bring together research
scientists, pharmaceutical industrialists, traders, professional foresters,
farmers,'attibas' and personals engaged
in the manufacturer of medicines used in
the traditional system, to initiate
dis...
Altaf Hussain and Pazir Gul
...y five tree species were planted to determine their
suitability for salt tolerance under waterlogged
conditions. Analysis of the soil of the experimental
site indicated that it was dispersed and varied from
saline to saline-sodic in chemical composition with
salinity in water. Performance of species was determined
on the basis of their survival and height growth. Local
species, such as, Tamarix aphylla, Acacia modesta and
as well as exotic speci...
Mirza Hakim Khan Dr.
...raun Bkanquet. Two major plant communities were
identified, namely Olea cuspidate, Pistacia cabulica
community at the lower elevation and Pinus gerardiana,
Ephedra nebrodensis, Cotoneaster nummularia community at higher elevation of the habitat. T he first community
was found to be the best habitat for Suleiman markhor
because it possessed ample number of food plants,
shelter and spring water for the anim...
S. H. Iqbal and Firdaus-e-Bareen
...ronds of ferns and other plants in
the rock crevices start senescing. The fine rhizoids of mosses and liverworts were observed penetrating the
decaying aerial portions of Adiantum capillus-veneris L., making them heavily VA mycorrhizal. Vesicular and
arbuscular infections were observed in thestem and fronds of Adiantum....
M. Tahir Laeeq and Raja Walayat Hussain
...ts....
Shakeel Haider Zaidi and Anwar Ahmad Khan
...orea deltoidea Wall. plant is known for its
steroidal sapogenin extracted from rhizomes and is
widely used as a precursor for synthesis of various
steroidal drugs and sex hormones. In order to develop regeneration technology and its sustained supply, a
number of long-term experiments on effect of cultural
and fertilizer requirements on growth performance of the
plants were under-taken in its natural habitat. Result...
Bashir Hussain Shah
... establishment of forest plantation,
an experiment was laid out at two sites, Kharian and
Raisan (Kohat). Microcatchments, conservation trenches,
gradonii and simple pits were used for planting
Eucalyptus canaldulensiss, Leucaena leucocephala, Acacia
nilotica and A. modesta seedlings. Preliminary results based on the years data
are presented in this article. All the three techniques
proved effective for ...
K. M. Siddiqui
... establishment of energy plantations to
reduce the need for fossil fuels and improve the lot of
rural poor in third world countries. In the latter case, the
efforts made little impact on existing enegry situation due
to a number of reasons. The finanical inputs were rather
small and that too scattered over large tracts of land. The
requisite technical experience in developing woodfuel
resources in rural areas on the farmers' land was also
lacking on ...
Mir Baz Khan
...ce where mulberry trees
plants are found in .abundance. The following sericulture centres have been established
over the years in the province....
Mian Muhammad Muslim
...nd the irrigated forest
plantation where mulberry was available in abundance to support the silkworm rearing
programme. Since then it made a slow but steady progress in Punjab. Presently,
sericulture is one of the major cottage industries in rural areas of the province. The
activity is mainly concentrated around irrigated forest plantations of Changa Manga,
Daphar, Chichawatni, Kamalia, Khanewal, Bhagat, Kundian and ...
M. Iqbal Ahmad and I. A. Hafiz
...s found that density of
planting in directly related to the mulberey leaf
yield. The spacings of 1 x 1 meter was found optional for
improved management and high yield of mulberry
plantations. The application of 200 Kg N per hectare, if
applied 50% after sprouting of plants in spring and 50%
after 20 days of leaf plucking, increased mulberry leaf
yield by more then 100%. The PFI-1 ea...
K. M. Siddiqui
...nce of adequate mulberry plantations, non-existence of local training
facilities and constraints in processing and marketing of silk cocoons and raw silk. The
prices of cocoons also fluctuate considerably from year to year, thus adversely affecting
economic returns to the farmers....
M. Khan and M. Kleine
...ng growth. About a10,000 plants per hectare, which
are more than 20 cm tall, and sufficient to constitute
future stands of desirable densities, are the result of two years of protection from fire and biotic factors.
Strong indications could be found for a substantial
reduction of the regeneration period which would lead to
an increased productivity of these forests. ...
M. Kleine
... the evaluation of large plantation areas in the
North-West Frontier Province. Major considerations for
designing such an inventory are elaborated and the
complete procedure of selecting an appropriate design,
implementing it in the field, data processing and
interpretation of the results are described....
M. Ayaz
... in Changa Manga forest
plantation in 1984-85 for the comparison of conventional
and improved tools in timber harvesting on the basis of
technical labour productivity under an equal and
maximum work stress. Result of the study reveal that the
technical labour productivity of conventional and
improved tools at maximum work stress is 0.47 and 0.61m3
of timber and firewood per man hour respectively.
Improved tools were found to have (30%) highe...
J. A. Khan
...e at Changa Manga forest plantation. Four
different species viz ; Shisham (Dalbergia sissoo) ,
Mulberry (Morus alba) , poplar (Populous spp.) and Semal
(Salmalilia malabarica) where tested for loss of
strength in relation to storage time. The results
indicated that both popular and semal were severely
decayed even after a storage period of few months while
the other two species were least affected....
Zakaullah
...the pollarded trees, for planting. The cut ends provide infection courts for
many bacteria and decay fungi....
Bashir Hussain Shah
...ested along with simple
planting and control at one site and only three
biotechnical techniques were tested along with simple
planting and control at the second site. All techniques
were quite successful in the latter....
K. M. Siddiqui and M. Khan
...ions as naturalized wild plantation tree (Beckjord et al., 1984; Hardie et al., 1989). It
also grows in Japan, Brazil, Paraguay and Argentina. Presently, the interest in the
Paulownia species is increasing due to its ability in rooting and its tolerance of rocky,
disturbed and relatively infertile soils. It is grown as an ornamental and in shelterbelts
(Beckjord and Melhuish, 1983)....
S.A. Khan and A. R. Beg
...rest Institute, (PF1-B), plants collected from three localities in Chitral District were identified as Buxus microphylla Sieb. and Zucc. The plant was referred to Mr. I. C. Hedge of Edinburgh for confirmation who named it B. wallichiana Baill.var. microphylla Hook.f. The taxon represents a new record for Pakistan and is reported....
Anwar Ahmad Khan and Shakeel Haider Zaidi
...iod of growth, effect of planting season and
application of N&P alone or in combination on the yield
of Dioscorea diltoidea rhizomes at Kuza Gali, its
natural habitat. Results indicated that yield of rhizomes significantly increased with the increase in
duration of time. The yield was optimum after 6 years
growth period followed by progressive decline in yield
of rhizomes harvested after 8th and 10th years of
growth. Monsoon
M. B. Bhatti, M. I. Sultani, M. Aslam and Ehtesham Ali Syed
...3 x 1.5 m. While the per plant height
differed significantly, plants being taller under closer spacing, the variations in per-plant fresh weight were found insignificant....
Jehandar Shah and Zakaullah
...ticultural and medicinal plants....
M. I. Sultani, Zafaruddin and Ghulam Akbar
...r unit area. All managed plantation of one hectare dwarf mulberry can yield enough leaves to provide 750 kg of green silk cocoons or 93 kg raw silk (Zafarud Din et al., 1983). Dwarf multicut varieties of mulberry with plant height less than 10 feet are generally cultivated for sericulture in many countries like Japan, China, and Korea while in Pakistan major source of mulberry leaves for silk worm rearing is the high ...
Anwar Ahmad Khan and Shakeel Haider Zaidi
Mahmood Iqbal Sheikh
...ees can be successfully
planted if some micro catchment is provided for
harvesting extra quantity of water for the plants.
Acacia tortilis and A.victoria turned out to be the
most outstanding exotic species and P. cineraria and T.
undulate which are local to our deserts but never tried
before gave very indicative results. These species
should be propagated on a large scale for bringing back...
Bashir Mohammad Khan and M. Ismail Chaudhry
...s....
Mohammad Bashir Khan, Pazir Gul, Muhammad Farooq and F. W. Khan
...rved that the
change in plant locality had a remarkable effect on the
yield of oil and phenol contents and had no effect on
the physico-chemical characteristics of the oil. The
leaves collected from various localities of Baluchistan
contained more oil (1.45% to 2.64%) as compared to those
of N.W.F.P. (0.35% to 0.75%). Plant material found kin
Baluchistan can be commercially exploited in order to
save the amount of fo...
S.H. Bangash and F. W. Khan
...lains, canals, road-side plantations, and also from some scattered plantations of Farm lands. Thus, the country had no critical shortage of wood; of course, there has still been dependence on selective importing of assorted timber wood from abroad....
Mahmood Iqbal Sheikh
... conditions affected the plants adversely. Some studies on spacing were laid out
in the country in 1969 but the treatments were not properly replicated and distributed. To
find a possible answer to these questions this PL-480 study was started in Change Manga
irrigated plantation in February, 1976....
Qaisar Ali, Perveen Abdullah and Muhammad Ibrar
...
and development of the plant was achieved under full
light and on garden loam, followed by clayey soil....
M. I. Shiekh
...ced in 1912 and has been planted in Lahore
(Compounds of the old forest office) etc. While Prosopis glandulosa is occasionally a tree of
6 m high with a trunk of one meter in girth. Prosopis juliflora is the comments tree form
in the country.
...
Mahmood Iqbal Sheikh
...fruit
orchards and tree plantations. Education and medical
facilities were brought at the door step of villagers.
Although this programme greatly disturbed the ecological
complex of the desert and had a very disconcerting
effect on the indigenous fauna and flora but it clearly changed the social and economic conditions and pattern
of life of the people in that part of the country....
M. I. Sheikh
...rious nursery and field
planting techniques, species trials, rate of growth and
yield management of the plantations, water requirement
etc. have been discussed....
Ghulam Sarwar Khan
...t increase in tillering, plant
height, fresh and dry matter yield. Flowering was
earlier in 5 to 15 KR and delayed for other doses.
Germination was not much affected. Pollen fertility
gradually decreased with the increase in radiation
dosage....
Qutabuddin Marwat and Naseer Ahmad Khan
...was classified into four plant communities, viz: Boissiera squarrosa, Stockisa brahuica, Poa sinaica (BSP), Artemisia maritime, Poa bulbosa, Haloxhlon griffithii, (APH), Poa sinaica, Boissiera squarrosa, Artemisia maritime (PBA), Artemisia maritime, Boissiera squarrosa, Stocksia brahuica (ABS) on the basis of highest importance value. There are 81 plant species in the area, including 15 medicina...
Mohammad Hafeez
...systematically in forest plantations particularly in semi-arid and marginal lands where other more valuable forest species cannot be successfully grown. Mesquite grows fast and can tolerate heat and drought and a variety of soils. It is excellent for firewood and makes superior charcoal. It is an exceptionally high yielder of biomass....
Moinuddin Ahmad
...,
temperature altitude, plant cover and vegetation
composition show wide variation in the different sectors
of the study area....
Mohammad Ismail Zafar, Mohammad Shafiq and Ali Gohar
.../i>
can be successfully planted (86%survival) to obtain
short time forage and firewood in addition to its
effective in soil conservation even under the drought,
severe and unfavorable climatic conditions.
...
J.O. Adegbehin, S. Nokoe, J. A. Okojie and G. O. Otegbeye
...anagement....
F. O. C. Nwonwu
...t and 50% fine sand. The plants were watered daily for four weeks and the height gains by plants measured. At the end of 4 week watering was stopped and two plants from mixes A and B were selected and observed for the length of survival without watering. Results showed that height gains due to weeks of watering and soil mix are both significant at the 1% level with LSD (0.01) of 6.9 cm and...
Mahmood Iqbal Sheikh, Saliheen Khan and R. W. Hussain
...om Kashmir and irrigated plantations of the Punjab. Presently, 250 manufacturing units are engaged in production of sports goods; 50 units working on large scale and the rest on small scale. The export earnings during 1984-85 was 350.0 million rupees. Data were collected from 35 units. The annual installed capacity of the surveyed units is 400, 291, 377 + 156 and 219 thousand pieces for hockey sticks, cricket bats, cricket bats + hockey sticks and all type of ...
Zakaullah, Jehan Ara and Abdul Jabbar
...timber species,
orchard plants, condiments, medicinal herbs and weeds. However, earlier workers (Ahmad
1956, 1956, 1978; Spaudling 1961; Sadiq and Shah 1986) have significantly contributed to
the records of fungi and their hosts occurring in different regions of the country. The present
article describes the fungi comprising 3 Classes: Ascomycetes, Basidiomycetes and Fungi
Imperfect with information on habitat, locality and date of collection etc. Five ...
A. B. I. Igboanugo
...he potential for raising planting stocks of E.
cloeziana and the other eucalypts from lignotubers.
...
Mirza Hakim Khan Dr.
...res. The average annual
plantation programme is 133,000 hectares. Most important
species in plantation are: Poplar, Willows, Equalyptus,
Alder and Pines. Natural geographical regions are Black
sea, Marmara sea, Aegean sea, Mediterranean and Central
Anatolia. Successful mechanical operations in the
forests are carried out during all plantation campaigns....
S. Hasan Abbas and M. Hanif
...gement practices (mainly planting)on runoff and sediment release an experiment was conducted at two sites in Hazara. The analysis of 6 years data collected, reveled that planting coupled with closure to grazing on the slops proved to be extremely helpful in reducing the runoff and sediment release form 30% to 1% and 239 gms/plot to 10 gm per plot respectively. The reduction was highly significant....
Raja Walayat Hussain and M. I. Sheikh
...of biomass production by planting cuttings of two important poplar clones viz., P. deltoides cv-I-63/51 and AY-48, an evergreen clone, with two size of pits and
four spacings....
Hanif Gul and M. Ismail Chaudhry
...atodes may damage forest plantations which are usually established on poorly stocked natural forest areas, or planted on areas which have been recently cleared out, or on abandoned farm-land. Changing to closely spaced planting of tree species susceptible to nematodes may promote an increase in the nematode population that result in an unacceptably large decrease in rate of growth. Nematod...
Raja Walayat Hussain and M. Afzal Cheema
...ecially in the irrigated plantations of the Punjab and Sind quite sometime back. The species adopted well to the prevalent climatic and edaphic conditions....
Qaisar Ali, Mohammad Yousaf Wazir and Mirza Hakim Khan
...r, 1979 to June, 1980, 4 plant communities were recognized, viz. 1.Desmostachya-Suaeda community 2. Saccharum-desmostachya community 3. Desmostachya-Saccharum-Alhagi community and 4. Phragmities community. Some environmental, particularly the edaphic factors were also studied. Investigations indicated that some tree species like Phoenix dactylifera and fodder plants like Diplachne fusca and Juncus maritimus<...
Abdul Aziz Memon
...e economic importance of plantation of Tendu (Diospyrose - melanoxylon), commonly called
Biri-LeafTree species, in Sind province, arises out of the necessity, which can be measured and is underlined with the following figures of foreign exchange being spent on the import of Biri-Leaves and distribution thereof among the four provinces. (T.C.P.)...
M.Ismail Chaudhry and Ashiq Ahmad
... in young as well as old plantations almost throughout the country. The pest completes its life cycle in about 30 days and has 9 generations in a year. During severe infestation premature leaf shedding is caused, resulting in a poor and stunted growth of this valuable crop. In insecticidal trials, out of 5 test chemicals Lebayucid 50%proved most effective against larvae at 0.05%level and against pupae at 0.1%level. Ekalux gave 92%kill in 0.05%dose and 100% kil...
Raja Walayat Hussain and M. I. Sheikh
...aid out in
Chichawatni plantation in August, 1977 by the P.F.I. The objective of the study as is clear from
the title, was to find out the optimum quantity of water best suitable for growth of species/
poplar clones. Original spacing was 10' x 6' (3 x 2 m) and one year old entire plants were
transplanted at the above spacing in RCB design with four replications. First thinning was
do...
Laskar M. Rehman and M. I. Sheikh
...d growth of a variety of plants and
animals. Due to over exploitation and very little input
for their perpetuation this erstwhile resource is fast
disappearing. The present paper summarizes the mangroves
of Pakistan, the area and distribution, flora and funa,
management, utilization, and causes of degradation.
Suggestions have also been made to improve the
situation....
M.I. Sheikh
...e the effect of depth of planting on the survival and growth of Acacia aneura. Acacia modesta and Tecoma undulata under barani conditions in July, 1980 using six replications. Twenty five plants of each species were planted in a replication in each depth of planting at 2 x 2 metres spacing. The plants w...
M. I. Shiekh and S. M. Khan
...artment N.W.F.P. started planting Eucalyptus camaldulensis at 3 x 3 m in late seventies at Jamrud, near Peshawar (Av. Ann. rainfall 350 mm). Since lot of intervening space was available, it was decided to reseed the area with grasses such as Cenchrus ciliaris and Panicum antidotale. The selection of these two grasses was based on the fact that both of these are hardy, high yielders, palatable and nutritious.
...
M. I. Sheikh
...elts
of Eucalyptus were planted with a view to assessing the effect of trees on crop yields as well
as to find out quantity of wood available to the farmers over a period of time. A rectangular
piece of land measuring 1,000 m x 630 m was selected for planting of shelterbelts. 9-month
old plants of Eucalyptus camaldulensis in polythene tubes were plant
K.M. Siddiqui and Iqbal Mahmood
...rently extensively being planted in Pakistan. The strength properties of three species viz. E. tereticornis, E.kitsoniana and E. sidropholia were determined and found to better than those of commonly grown local species of hard-wood. The results of current study indicate good utilization potential of these Eucalyptus species for many purposes....
Charles D. Bonham, Javed Ahmed and Larry L. Larson
...measurements of vascular plant species and
the physical attributes of the site. Data analyses
included principal component, McNaughton and Wolf's
niche index, and discriminate and canonical analyses.
The analyses techniques identified under story
sensitivity to aspect, elevation, and soil profile
attributes that influence soil moisture. The under story species studied exhibited a relative independence to
over story composition and dominance....
Shams-ur-Rehman and Altaf Hussain
... discussed in
irrigated plantations of Pakistan.
...
M. I.Sultani, Akhtar Ali, M. S. Khan and M. A. A. Qureshi
...ree water surface....
Aaron S. M. Mgeni
...ia with
30,000 hectares planted by 1983. Its final target is
65,000 hectares. It supports a state owned sawmill and a
pulp and paper mill. Managing this forest on a
non-declining yield basis is the main objective. Since
the forest structure is abnormal, yield regulation is
necessary. A Feasibility study was conducted using the
area-volume check method which is currently identified
as a feasible model. It is suggested that management of
this forest on ...
K.M. Siddiqui, M.I. Sheikh and S. Rehman
...nies and clones in test
plantations. These investigations suggest that a
suitable breeding strategy would further bring about
genetic improvement in Populus ciliata....
Iqbal Ahmad
... that after one year of
planting 78.8%, 120%and 175% increase in annual leaf
yield occurred in 100kg N 200kg N and 300 kg N
respectively, per hectare as against check where no
fertilizer were applied. After two years of planting the
total annual increase in leaf yield was 55% 100% and
120% kg per hectare in 100kg N 200kg N and 300kg N
respectively as against check where no fertilizer were
applied. It was found that a...
Mahmood Iqbal Sheikh
...
in February, 1978. 120 plants of each species were planted in 16 subplots at a spacing of
4 x 4 m. In each subplot, 30 plants were planted, 480 plants in all. Planting was done in a
randomised complete block design in 4 replications.
...
Muhammad Shafiq and M. I. Nizami
...shortage of moisture and plant nutrients, in these gullied lands are challenging for a desirable land management practices. Therefore, the purpose of this study was to explore the potential capabilities of the gullied land for establishment of tree plantations and also to test the adoptability/ suitability of some tree species. Four tree species (Leucaena leucocephala, Euclayptus camaldulensis, Morus alba and Ailan...
K. M. Siddiqui, S. Rehman and A. Hussain
...this genus. Large scale
planting of this species is recommended in afforestation
programmes in the country....
Safdar Ali Kayani*, Tanweer Ahmad*, Abdul Kabir Achackzai* and Abdul Qadeer**
... distribution in various plant communities
of Eastern Baluchistan was studied. On the basis of
termite nest density and extent of termite infested area
it was concluded that out of 19 plant communities, four
have serious (nest density >124/ha, infested area
115m2/ha, five have mild nest density 62-124/ha, 23
115m2 and three have minor nest density <62/ha, infested
area >23m2/ha, termite infestation problem, while
rem...
Sultan Maqsood Khan
... boot stage, seeding and planting of
desirable adaptable species, soil and water
conservation, range suitability classification, crossing
local cattle with yak, preventive medication, increasing
off takes and extension practices....
M. A. Ogigirigi and A. B. I. Igboanugo
...jacent to tree stands in plantation
at four vegetative zones of varying dryness and soil
types (Afaka, Miango and Nimbia ) in Nigeria. Root size
and distribution were measured and compared at three
determined depths along the soil profiles. Although all
the soil types have a layer of hard iron crust
(plinthite layer) with in a depth of 40-60 cm in the
soil the roots of the exotics were able to penetrate
beyond the plinths. Among the exotic, Eucalypts p...
M.I. Sheikh
...r, 2-year and 6-year old plants of some of the
clones which are represented in the populetum and other experiments, established on the
premises of Pakistan Forest Institute, Peshawar. Trees of P. euratnericana cv. 1-214, aged 10
years, were measured from Changa Manga plantation as old trees of this clone were not available in the Peshawar area.
...
Mahmood Iqbal Sheikh
... can only be met through planting of local
and exotic fast growing tree species such as poplars and
willows in climatically suitable areas. Exotic poplars
were, therefore, introduced in late fifties. Over a
period of time techniques of scientific production of
nursery stock and field planting have been developed and
streamlined. Spacing studies and clonal trails have
given quite indicative results.
M. Kamaluddin and M. K. Bhuiyan
...ation of 5 years....
M.I. Sheikh, R. W. Hussain and M. Khan
...wth of four tree species planted in the agricultural fields has been compared. Populus deltoides I-63/51 has come out the best after six years for all the three parameters, viz, diameter, height and volume. For quantity of wood available on first thinnings Populus deltoides I-63/51 is followed by Salmalia malabarica, Eucalyptus citriodora and Datbergia sissoo.
...
M. A. Latif, S. A. Khan and M. K. Bhuiyan
...agong, 80 seedlings were planted in 1979. At the age of 4 and half years the trees attained an average height of 10.3 m with 10.4 cm diameter at breast height. The growth rate is comparable to that of Eucalyptus camaldulensis and better then that of Pinus caribaea and Swietenia macrophylla which were planted simultaneously. The species, therefore, shows great promise for afforfestation in Bangladesh and ...
M. I. Shiekh, S. H. Bangash and S. Hasan Abbas
...under taken at different planting
sites in Azad Kashmir during 1979. The effect alone or
in combinations, measured for diameter and height growth
and Foliar nutrient composition was recorded during
1979-82. At Sharda, the analysis of height measurements
recorded in 1981 gave a significant response to NPK
combined treatment whereas over all diameter and height
growth from 1979--82was not affected. Also the diameter
and height measurement recorded at Aut...
Mohammad Noor
...he number of established plants among themselves except
Festuca elatior (Kenwell) which had significantly more
number of established plants as compared with other
ecotypes/species.
...
Anjum Amin
... survey of ten medicinal plants was
conducted in Leepa Valley of Jhelum Valley Forest
Division in Azad Kashmir, during the year1978-79 to
ascertain the productivity of medicinal plants available
in the area. It was found that medicinal plants are
available not only in considerable quantities for
commercial exploitation but also it is imperative to
initiate concerted efforts both by ...
Wulf Killmann
...g: remove stems from the plantation immediately after felling and convert them quickly - use tungsten carbide or stellited saw blades - apply large bites as recommended for hardwood - maintain saw properly - dip the timber in fungicide after sawing - segregate and stack the sawn timber in accordance with at least two, preferably three density classes - Seasoning: air season the timber properly stacked (in airy place under cover, off the ground, with fillets be...
Abdur Rashid Tariq and Haji Moosa A. Tayab
...d be established by tuft planting on flood irrigation with water containing up to 15000 ppm of dissolved salts....
M. N. Malik, A. R. Beg and M. Iqbal Khan
...ifferentiate and discern plant communities as units
indicating type and degree of salinity. An exploratory
work was done in Peshawar basin, and several communities
were marked specifying salinity status of land....
Zakaullah, Mohammad Irfanul Haque and Khial Badshah
...tus was parasitizing the plants in the higher range and L. longiflorus in the lower range. They were found attacking 32 timber and fruit plant species some of which had been reported earlier L. longiflorus was more prevalent particularly on old trees of Acacia modesta, while L. pulverulenrus had comparatively low incidence. Only four host species were found commonly attacked by both parasites. For...
M. I. Shiekh and S. H. Bangash
...onducted in Changa Manga plantation in 1978. Nitrogen, Phosphorus and Potash fertilizers alone and in different combinations were tried in these studies. Data on height and diameter of plants were recorded from
1978-82. The results did not reveal any significant differences in plant height and diameter. However, the nutrient uptake by the leaves of treated plant
A. R. Beg and Mirza Hakim Khan
...revealed that three more plant communities, viz Diospyros lotus, Cotoneaster nummularia, Sophora mollis and Quercus baloot, Impatiens bicolor occur in the area. Prospects of renewable resource development have also been indicated....
M.I. Sheikh and Raza-ul-Haq
...x 5.5 meter, a study was planted in Changa Manga irrigated plantation. Assessment of the study after six years has indicated that growing space provided to the trees has a highly significant effect on diameter, and height growth. Spacings had also highly significant effect on volume production; highest volume under 1.8 x 1.8 m spacing and the least under 5.5 x 5.5 m....
Amjum Amin, Zafar Uddin, Rukhsana Roohi and Tayyab Jamil
...of data resulted in four plant communities, i.e. Chrysopogon montanus, Heterioigib contortus, Desmostachya bipinnata, Desmostachya bipinnata, Saccharum spontaneum, Cymbopogonschoenanthus, Capparisdcidua and Chrysopogon montanus, Adhatoda vasica, Eleusine compressa. The communities were finally named by combining the physical and biological features....
Yasin J. Nasir
...sted as uncommon or rare plants for the area. The maximum numbers of uncommon or rare plants are to be found in the Poaceae (27), followed by Papilionaceae (10) and Orchidaceae (8). Information including the locality, the vernacular name and flowering period, where ever possible, are given for each taxon....
M.I. Sheikh
...
out in Bhagat Reservoir plantation over an area of 2.5 ha in February, 1975. The area, an old
shisham and mulberry plantation was cleared off all the trees and 1 - year old plants of the
following 15 clones transported from Pakistan Forest Institute, Peshawar were planted at a
spacing of 4.5 x 4.5 m in 0.5 m deep pits.
...
Mohammad Shariq Khan, Altaf Ahmad and Anwar Ahmad Khan
...ment of Baluchistan. The plant is being used in medicine from very ancient times and its curing properties are because of the presence of an alkaloid ephedrine (C10 H15 N0). Ephedra plants are a good remedy for curing bronchial asthma, cold, cough, urticaria, renal colic, itching, typhoid, hey fever and body pains. It can also be used as a tanning material for curing goats and lamb skins. Thi...
M.I. Sheikh, Afzal Cheema and Raza-ul-Haq
Mahmood Iqbal Sheikh and Fazle Subhan
...nting of Chir plants in polythene
tubes was started in early seventies and it has now been adopted as the standard practice for
artificial regeneration in all Chir pine areas of the country....
Anwar Ahmad Khan and Shakeel Haider Zaidi
...leaves and shoots of the plant are used as garnish and for
flavouring salad. Pakistan is importing aniseed and essential oil from Iran to meet the local
requirements of food processing and allied pharmaceutical industries and the demand is on the
increase....
S. Rehman
...getative growth however, plant sprouted vigorously
during next season i.e. February - March 1982 and
produced fodder at the rate of 19.7075 metric tons per
hectare and seed collected from the crop was 600.96 kg.
Per hectare. It was observed that plant can withstand
high rate of soil moisture stress and is suited to arid
conditions prevailing in Mastung Valley.
...
M.I. Sheikh, Bashir Hussain Shah and Abdul Aleem
... A. torrilis were planted with plastic apron,
stone pitching, and grass mulch and without mulch in
March, 1981. Observations after one year and two months
revealed that the mulches did not have any effect on the
survival of plants. However, out of the lour treatments,
plastic aprons were significantly effective in improving
the growth rate of both the species; stone pitching and
grass mulch had rather negative ...
M.I. Sheikh and Sultan Maqsood Khan
...a is not....
M.I. Sheikh and Abdul Aleem
...e of the most profusely
planted trees in Islamabad. Yellowing of its foliage and
subsequent death caused considerable alarm in the
nation's capital. A study was started in 16 and 6 year
old blocks to find out if irrigation, spray with
dieldrin and use of N.P. could improve the situation.
The study was maintained for five years and was assessed
recently. It was found that fertilizers improved the
growth of 16 year old plant
Mohammad Noor
...e number of
established plants...
M.I. Sheikh and Sultan Maqsood Khan
...
conservation, medicinal plants, sericulture, wildlife
and outdoor are also described.
...
M.I. Sheikh
... the correct spacing for planting of bamboo in conjunction with agricultural crops a study was laid out in the P.F.l. over an area of 0.3 ha in 1977. One year old tube plants of bamboo were planted at 2 x 2, 3 x 3 and 6x6 m spacing, replicated 3 times using 180, 84 and 24 plants in all the treatments respectively. In the first three years of the study, i...
M.I. Sheikh
...f poplars.
One year old plants of P. euramericana CV-I-214 were grown for four years with and without
agricultural crops. In the control plots no agricultural crop was grown but nevertheless, soil
cultivation was done.
2. In another study, weeds were allowed to grow in one set of plots while the second set was regularly ploughed. The average height and diameter after three years Were 5.85 m, 4.3 cm for the control plots, these were 7.71 and 5.6...
M. I. Shiekh and B. H. Shah
... camaldulensis were
planted around the pitchers at a distance of half a
meter from the centre of the pitchers. Using diluted
bitumen the pitchers were half surface painted,2/3rd
surface painted and whole surface painted except four
circular areas left on the four opposite sides to reduce
the perculation rate of water. It was found that pitcher
irrigation is a useful technique for the establishment
of tree vegetation in the arid conditions. The resu...
M.I. R. Khan
...ising and maintenance of plant nurseries in Abu Dhabi is a recent activity which started in the late sixties to provide plants and seedlings for the plantation and afforestation projects which were started about the same time on the initiative and under the directives of
H.H. Sheikh Zayed bin Sultan Al Nahyan, the Ruler of Abu Dhabi. Since then, with the expansion of
R. W. Hussain and S. Hasan Abbas
...le at the above age i.e. planting was done with a spacing of 10″ x 6″ and no thinning was done and only 26 trees were lost on account of mortality or other factors. Under proper management the actual number of trees constituting main crop at the above age is almost half of the above figures. Therefore mean annual increment is less and ranges between 250cft to 400cft per acre for this spacing....
M.I. Sheikh
...he size and shape of the plants of mulberry and the number of branches is controlled and the size and quality of the leaves remains consistent and it is possible to estimate the annual quantity of leaf crop from a given area....
M.I. Sheikh and S. H. Bangash
...t (Juglans regia) plantations in Kaghan
and Azad Kashmir revealed significant difference in
height and diameter growth in the younger crop. Also the
foliar mineral composition of the young stands had
significantly increased, while there was no such
indication for the older plants. Higher dose of the
fertilizers is recommended for future trials.
...
M. I. Shiekh-Raza-ul-Haq
...00 year or so, irrigated plantations are being raised
in Pakistan for fuel wood and timber. Except for Shisham
(Dalbergia sissoo), the quantity of water required by
different tree species for their survival and optimum
growth has not been known. A study was started in
Chichawatni plantation to ascertain the effect of three
deltas of water viz.3,4.5 and 6 feet in four
species Eucalyptus camaldulensis, Bombax ...
K.M. Siddiqui and Shamsur-Rehman Khan
...d in Pakistan....
M. N. Malik and M.I. Sheikh
...icultural crops and tree plants. This menace of land was realized even long before the creation of Pakistan, and full-fledged Department of Land Reclamation was established to counter-check the malady; nevertheless, it attained alarming proportion and threatened the very basis of economy of Pakistan. Of course, vast physical outlays in the form of SCARP have been the outcome of very serious deliberations, even involving the expertise at international level; al...
M.I. Sheikh, B. H. Shah and A. Aleem
... the effect of depth
of planting on the survival and establishment of trees
in conditions at Rakh Dagar Kotli (Thal Desert) 200mm
av. annual rainfall and 45°C av.minimum and 45°C av. max
temperature. Pits were prepared having 0.5 meter
diameter and 0.2 meter deep. Plants were raised in 30 cm
and 15 cm long polythene tubes. Three tree species viz:
Acacia aneura, A. tortilis and Tecoma undulata were
...
Anjum Amin and Raja Mohammad Ashfaque
...ce and frequencies. Five plant communities i.e., Depression community (indicated
by Acacia modesta Cannabis sativa), Level ground community (Acacia modesta-Cynodon dactylon), Foot hill community (Acacia modesta-Themeda anathera), Hill slopes community (Acacia modesta-Dodonaea viscosa) and Hill tops community (Acacia modesta-Lantana camara) were recognized on the basis of physiognomy, floristic composition and Importance valu...
M.I.R. Khan
...eclaimed, afforested and planted in the last about a little over a decade. Most of the afforestation work has been carried out and is being maintained with artificial drip irrigation utilizing the locally available brackish underground waters.
...
Mahmood Iqbal Sheikh
...an old bed. One year old plants of 3 species viz. Acacia victoriae, Acacia aneura (Australia) and A. tortilis (Sudan) were planted in August 1979. One hand watering was given at the time of planting. 16 plants of each species were planted in one plot at 2 x 2 m, in 5 replications; 80
Mahmood Iqbal Sheikh, Ali Akbar Khan and Mohammad Khan
... polythene tubes and its planting out was started quite a few years back, the methods adopted in actual practice left much to be desired. Under the Hazara Preinvestment Project, World Bank authorities desired that in view of the extensive planting programme involved in the project it would be better if these practices were standardized for the benefit of the field foresters. The job was assigned to the Pakistan Forest Instit...
Raja Mohammad Ashfaque and Anjum Amin
...anic matter suitable for plant growth. Pinus roxburghii forms the major overhead storey with shrubs Myrsine africana, Berberis lycium, Indigofera spp. as understorey. The ground flora is occupied by grasses like Digitaria spp., Agrostis gigantea, Agropyron dentatum, Cymbopogon spp., Eleusine compressa, Themeda anathera, Panicum antidotale, Heteropogon spp., Chrysopogon aucheri, Dicanthium annulatum, whereas Trifoli...
M.I. Sheikh and Raza-ul-Haq
...am) is the major species planted in the irrigated plantations and riverain forests over a period of time. It can be regenerated from root suckers, from coppice and by planting root-shoot cuttings. For the last one hundred years the tree has been planted at a conventional spacing of 6 x 10 ft. To release the congestion and depending on the condition of t...
Mahmood Iqbal Sheikh and Raza-ul-Haq
...abarica, a study was planted in Peshawar on 13-2-1978. 120 plants of each species were planted in 16 sub-plots at a spacing of 4 x 4 m. In each sub-plot a randomised complete block design, replicated 4 times....
Mahmood Iqbal Sheikh and Raza-ul-Haq
...bruary, 1975 a study was planted in the Pakistan Forest Institute to compare the survival and growth of three species viz. Eucalyptus camaldulensis, Ceratonia siliqua (Carbo) and Zizyphus mauritiana (Ber). While major treatments were deep and shallow ploughing, minor treatments were (i) shallow planting with mulch, (ii) shallow planting without mulch, (iii) deep
Mahmood Iqbal Sheikh and Muhammad Rafique
... age on survival of transplanted seedlings. Both major and minor treatments were found non-significant. However, seedlings placed in open showed better growth and form....
Mohammad Ayaz and K. M. Siddiqui
Mahmood Iqbal Sheikh
...istan. The cuttings were planted in
the nursery and after one year it was decided to lay out a comparative study in
the Research Garden of Pakistan Forest Institute, Peshawar (average rainfall
300 mm)....
Raja Walayat Hussain and Mahmood Iqbal Sheikh
...
the above age, that is, planting was dine with a spacing
of 10'x 6', no thinning was done up to the age of 6
years and only 26 trees were lost on account of
mortality and other factors up to this age. This
plantation was however not maintained properly, no soil
cultivation was done and irrigation was erratic. Since
hybrid poplar had been tried in different plantations
with va...
Mahmood Iqbal Sheikh
...ent No. 55. One year old plants were planted at 5 x 5 m spacing. Their performance was evaluated in 1981 and the ten clones were found to be the best amongst all clones....
Sultan Maqsood Khan
...biomass. The underground plant biomass was collected to 40cm depth. Fifty percent ( 1004 g/m2 ) of the total collected biomass (2008g/m2) was found in the 0-10cm soil section; 24%(482 g/m2) in the 10-20cm layer; and 26%(522 g/m2) in the 20-40cm depth. The middle slope out-produced (2370g/m2) the upper slope (1741g/m2) and lower slope (1911g/m2) in root biomass. The belowground production of ridges (2064g/m2) was not significantly different from that of the dep...
M. Iqbal Ahmad, Hanif Gul and Wali-ur-Rehman
...trunks. They hide
under plant debris during day and become active at dusk and dawn. Moths spend the night sitting on tree trunks and on fresh needles....
Adil Al-Kinany
...randomly picked and transplanted stayed till the end of the experiment. The results of the study indicated that hot water treatment not only markedly increased the germination percentage but it also led to shortening the germination period of the species seed. This treatment excelled all others tested on this score.GA3 at a concentration of 200 ppm significantly enhanced the length of transplant roots, while P5 had no signif...
Sarfaraz Hussain Bangash and Mahmood Iqbal Sheikh
...One year old healthy plants of Pinus roxburghii (Bazkhan Seed source) grown in polythene tubes (7.5 x 18 cm) filled with 50:50 sand-soil mixture, were arranged for this study. Initial height of plants was recorded. The fertilizers were added in a water solution, 50 ml to each tube, on 1-5-1979:...
M. Ihsanur Rahman Khan
...letely devoid of natural plant life. Certain areas like the
Sabkha(salty flats) or extremely arid and moving sand dunes may have no worthwhile plant life but varied and specialized type of plant life does exist in some cases in small patches and in other cases in fairly extensive areas of the Emirate. In fact in the pre-oil period natural vegetation was a major source of livelihood...
Mahmood Iqbal Sheikh
...tudies one year old tube plants were used. Planting was done just after rain....
Relph R. Stewart
...e. I had never collected plant fossils and was glad to be able to go with him. Most of the fossils were the leaves of forest trees which had blown on to the surface of the lake or had floated down from higher levels. They had sunk to the bottom and there were many layers of leaves in the clay along with Trapa fruits and a few seeds. Many of the leaves were of oaks, maples, birch and willows which seemed to be similar to modem species and some I could not ident...
Mirza Hakim Khan Dr.
...quet. The following four plant communities were recognized:(1) Caragana ambigua, Thymus serpyllum community (2) Ephedra nebrodensis, Juniperus excelsa community (3) Perovskia abrotanoides, Juniperus excelsa community (4) Sophora griffthii, Othonopsis intermedia community Community 1 was found the best both from food and shelter point of view, while the others stand in descending order of importance....
Hanif Gul and M. Ismail Chaudhry
...sa attacking nursery plants. Baylucid gave 75% and 100% mortality in 0.05% and 0.1% concentration respectively, 72 hours after treatments while Barestan gave 70% and 80% mortality in 0.1% and concentrations as against a natural mortality of 23% to 33%. Nogas and Sodium Chloride were less effective....
G. M. Khattak and M. I. Sheikh
...abarica (semal) were planted in the Pakistan Forest Institute in January to February 1978 in RCB design with four replications. The size of plot was 444 m2 and trees were planted at 4.3 x 4.3 m spacing with entire plants of poplar and Eucalyptus and root-shoot cuttings of shisham and semal.
On 22-10-1979 the area was irrigated to prepare it for wheat sowing. On 5-11...
A. R. Beg and Mirza Hakim Khan
...iterranean climate. Four plant communities have also been described in the zone....
Mahmood Iqbal Sheikh
...raight stemmed healthy plants for getting seed and clonal material for large scale propagation...
Adil Al-Kinany
... and number of roots per plant than 200 ppm or
control, the differences among these treatments were
non-significant. However, there are indications of
obtaining promising results if higher concentrations
than 4000 ppm are tried. The work with Juniperus communis cuttings showed encouraging results in survival
percentage with IBA at 400 ppm and pointed to the need
for trying higher concentration then this in order to
enhance the survival percentage...
Hanif Gul and M. Ismail Chaudhry
...at the rate of 30gms per plant pit while Disyston killed 55-66% grubs as against 11 to 44% natural mortality of grubs. Spray treatment of systemic and penetrative insecticides with Dimecron, Carbicron,
Orthene and Decis against freshly boring grubs of poplar borer,Melanophila picta Pall proved ineffective. ...
Q. N. Javeed, Rehana Perveen, Imtiazul Haq and Ihsan Elahi
...cated that size of the explant, presence or absence of apical bud, controlled conditions of light and temperature are important factors in callus formation. A successful callus could only be raised on MS medium supplemented with 1.0mg/1 of 2, 4-D, CM10%, sucrose 2%in diffused light at 25 ± 20°C in shoot segments having apical bud. For further growth of callus, addition of1.0mg/1 of BAP to this medium was beneficial.
...
Raja Walayat Hussain
...he species in irrigated plantations of the Punjab, data were collected from 230 trees, ranging in diameter at breast height from 2 in. (5 cm) to 14 in. (36 cm). These trees were removed in thinnings. Data from about 1070 trees were made available by Genetics branch of Pakistan Forest Institute who felled some plots of this species last year. The latter group of data consisted of small sized trees. In order to get an adequate representative sample for eac...
Mohammad Amjad and Iqbal Mohammad
...he state owned irrigated plantation of the Punjab. The entire supplies of willow come from the form lands of Peshawar district. Current export earnings from all sports goods are Rs.199 million; from wooden sports goods Rs.105 million. The export earnings have shown an upward trend during the last 25 years. The exports of hockey sticks are rising steadily, of tennis rackets, steady, of cricket bats, downward; of badminton rackets, insignificant. The increase in...
K.M. Siddiqui and Altaf Hussain
... In addition to commonly planted species of Eucalyptus, other species have also shown promising growth in this study.
...
G. M. Baloch and M. A. Ghani
...ffect a wide variety of plants, some economically important. Loranthus spp. infest about 274 hosts which include citrus, limes, tea. rubber, fruit, forage, park and many other broad-leaved trees (Mushtaque and Baloch, 1979). The dwarf mistletoes, Arceuthobium spp., attack coniferous forest trees (e.g., pines, fir, spruce, junipers, larch) while Viscuni spp. infest deciduous trees in parks, boulevard planti...
Khial Badshah and Zakaullah
...sariosis) in basil. The plants in the nursery were found severely attacked by a species of Fusarium causing longitudinal stripes on the stem and chlorotic spots on leaves which wilt and fall prematuiely. The pathogen was found to invade the plants through injured roots. Plant debris, infected young transplanting mateiial and seeds se...
Mahmood Iqbal Sheikh
...y of water direct to the plant roots through sub-surface irrigation. Since there would be no loss of water due to evaporation or seepage, the plants are supplied with a quantity just sufficient for their survival and growth....
Ali Asghar Khan
...neration, mainly through planting.
Necessary planting stock is being raised in the nurseries consisting of conifers with emphasis on deodar (Cedrus deodara) and Kail (Pinus wallichiana). The prognosis of this approach is discussed briefly, to create awareness about the effects of unwarranted
changes in environment and need for studying the factors involve don pilot basis.
...
Wali-ur-Rehman and M. Ismail Chaudhry
...ta)in 20,25 and 30 g per plant of 60,150and 240cm height.
Termik gave 100%kill of nymphs and adults within 3 to 7 days in each height groups of plants. Terracur gave 100%mortality of nymphs in 10-20 days only in the smaller plants. Disyston rated 3rd by giving 96%mortality of nymphs only in highest dose and smaller
plants. Disyston other insecticides o...
Mahmood Iqbal Sheikh
...t has been extensively planted to cover the bare hill slopes. The plant being leguminous improves and binds the soil and is a nutritious fodder. The plants in the first instance were raised in Silvicultural Research Nursery, Lahore and planted in different climatic zones in the country. The sites include Bhurban in Murree hills, Islamabad, Peshawar...
M. Ismail Chaudhry and Wali-ur-Rehman
...xycedri M. Bieb.), a plant parasite. Trichodes sp. Healthy trees in Sasnamana, Ziarat and Chautair were found free from the attack of these borers. Trichodes sp. and Teretrius sp. were recorded as predators and Heterospilus sp. and Agathis sp. as parasites on these borers mostly in Sasnamana area. Fruit berries were heavily infested by fruit moth larvae in all the localities....
Mahmood Iqbal Sheikh and Abdul Aleem
...ally. Usual methods are: planting one year old bare rooted nursery raised stock, and dibbling of seed. In the Murree Hills, dibbling of seed has been the usual method with poor results. This investigation was started to find the best method of growing walnut in that area....
Mirza Hakim Khan Dr.
...vere frost period. Three plant communities' viz. Rhazya stricta, Salvadora oleoides, Acaia modesta, Olea cuspidata, Dodonaea viscosa and Cymbopogon jwarancusa, Cenchrus ciliaris, Dodonaea viscose occur.
...
Munawar Ashfaq and Anwar Ahmad Khan
...ddish brown rhizome. The plants occur in the hilly areas of Swat, Dir, Hazara, Kaghan, Murree Hills, Chitral, Kurram Agency and Azad Kashmir....
Mahmood Iqbal Sheikh
...chinar stock has been to plant cuttings in dormant season. Although sprouting of cuttings does take place, the root take is hardly 5%. In view of the increasing demand for plants of chinar, an effort has been made to raise the plants from seed. The fruit which ripens in December is a globose head 2.5 to 7.5 cm in diameter, consisting of numerous one seeded achenes densely covered a...
Anwar Ahmad Khan, Shakeel Haider Zaidi and Zainul Arifeen
...optimum age to which the plant should be grown, economical method of cultivation and effect of different fertilizers on the .yield of Dioscorea deltoidea rhizomes at Sharan in their natural habitat. Data collected revealed that there is significant increase in the weight of rhizomes with increase in the duration of time (number year). Soil working and application of NP135 kg per hectare gave higher yield as compared to control. Interim result based on t...
K. M. Siddiqui
...is not a problem in crop plant breeding because most crop plants are raised for their seed and heavy and regular seed production is taken for granted. Most trees however, are not grown for their seed, and many trees that otherwise have desirable characteristics, seed only occasionally or not at all. Then fore, a tree breeder is concerned with seed production. Considerable research is underway in almost all countrie...
Mohammad Noor
...ference in the number of plants of species established did not show any significance.
...
Mahmood Iqbal Sheikh and M. Ismail Chaudhry
...r by importing grafted plants from France, Italy, Spain and Turkey or by budding or top working on the indigenous wild olive (Olea cuspidata). The history of these attempts carried out in the Punjab, Azad Kashmir and N.W.F.P. has been well documented by Chopra (1), Khan (3) and Chaudhry (2). Khairimurat Plantation: Of all the work done, the most productive effort has so far been the Khairimurat
Islam Mahmud Khan, Gulzar Ahmad Khan and Shoukat Islam
...e also conducted.
...
Mahmood Iqbal Sheikh
...es of bamboo have been planted by the agriculturists around Sargodha. One of these is Denderocalamus strictus and the other one is yet to be identified, although it is indicated as Denderocalamus by the Forest Botanist. Denderocalamus strictus is a tropical species and its extreme limit is the Margalla Hills in Rawalpindi District. It also grows naturally in the salt range. Forest Department, Punjab has been trying this ba...
Abdul Aleem
...ng Lal Suhanra irrigated plantation and Lal Sunhanra lake) were declared as National Park in July 1972. On February 11, 1978, the number in the enclosure had increased to 22. Pneumonia, and snake bites appeared to be responsible for the slow increase....
Anwar Ahmad Khan, Munawar Sultana and Shakeel Haider Zaidi
...e at one meter depth and planted after the storage period. Two months storage period gave significantly high (at 5%level) sprouting as compared to one month storage. Planting of full size rhizomes were tested against rhizome pieces (5, 7.5 and 10 cm). though full rhizomes gave significantly higher sprouts, planting 5 cm pieces with one or two buds each would give a higher total number of <...
Mahmood Iqbal Sheikh
...dy laid out in irrigated plantation to find the effect of spacing in the rate of growth of Populus euramericana cv.I-214 has indicated that so far as diameter growth is concerned wider spacings (4.6x4.6 m and 5.5x5.5 m) are highly significant at 1% level as
compared to closer ones (3.7x3.7 m and 1.9x1.9 m). As regards height, the closet spacing has an edge over the rest.
...
Mahmood Iqbal Sheikh
...: Effect of depth of planting on survival and growth of Eucalyptus camaldulensis (A not for tree planters)....
Musarrat Nasreen Ali and Anwar Ahmad Khan
... and violet berries. The plants are distributed throughout the hilly areas of Pakistan, from Baluchistan to Dir, Chitral, Gilgit, Hazara, Murree and Azad Kashmir at an elevation of 900-3,000 metres (4)....
Raja Walayat Hussain
...ex relationships between plants and their environment and for the simulation of biological and economic situations. In forest management it finds its
use in financial control of forest operations, for estimating and controlling forest production, for allocation of resources and for planning and control of new planting programs. In information management it finds its application in maintaining upto- date records of long rang...
Amjad Mahmood Chima
...re imported from Holland planted at Peshawar in December, 1976. The objective was to study their performance of sprouting, growth and multiplication. All varieties sprouted and flowered and
flowered well but susceptibility to damage by nematodes varied. The quality and durability of blooms was good in all varieties except one variety of daffodils. Varieties resistant to nematode attack differed in their multiplication rates....
Ashiq Ahmad and M. Ismail Chaudhry
...ts and bark of succulent plants, agricultural crops and perennial grasses. Trees are debarked, young plants and shisham stumps are uprooted. They breed twice a year and usually give birth to tow young ones who live initially in mother's milk switching to tender barks 2-3 months later.
...
M. A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
...fforts are being made to plant it.
The aim of the present investigation was to gain information about the water balance factors of this species under natural conditions....
The aim of the present investigation was to gain information about the water balance factors of this species under natural conditions....
Islam Mahmud Khan, Shaukat Islam and Qaisar Ali
...es from 31% to 0% in the plants growing in the similar environmental conditions. The point of attachment and the T.S. of the gynophores and ovary are given. The probable mode of inheritance is also discussed.
...
M. I. Shiekh and Abdul Aleem
...s have successfully been planted at the lower elevational limits of the chir-pine forests where regeneration had failed to establish. Planting in February and June gave equally good survival....
G. M. Khattak and Abdul Aleem
... in polythene tubes were planted on 18-2-1975 in deep alluvial clay loam soil at Peshawar and each plant irrigated with four gallons of water at planting. The rainfall during 1975 and 1976 was 439 and 554mm respectively (annual average 377mm). On 5-1-1977 the survival of E. camaldulensis was 97% against 52 for Z. mauritiana and 53 for C. siliqua. The mean height of ...
Mohammad Shahid and Abdul Qayyum
...tar and pollen
yielding plants for honey-bees. A detailed list of 122
such plants both wild and cultivated, their scientific
names, time of blossom and their distribution in the
Province has been prepared. Of the 122 bee-foraging
plants, the shisham (Dalbergia sissoo), phulai (Acacia
modesta), bhaikar (Adhatoda vasica), apple (Malus
sylvestris ), loquat (...
Ghaus Mohammad Khattak
...ditionally the irrigated plantations of the Punjab have been managed under the two storeyed high forest system with an understorey of shisham and mulberry and an overstorey of shisham standards. The lower storey has been managed on a rotation of 16 to 22 years at different times. Shisham standards have been retained for three rotations. Yield is regulated by areas without allowing for variation in site quality.
The Sind plant
The Sind plant
Abdul Khalique and A. R. Beg.
... - a species extensively planted under irrigated conditions in Pakistan (Khan, 1955). Presented here is the description of an ectomycorrhiza in this species which is adversely affected by soil salinity....
Abdul Aleem and Mahmood Iqbal Sheikh
...indicates that season of planting plays the most important role in root formation in cuttings; sandy loam soil is better than sand and clayee loam; frequency of irrigation, weekly or fortnight has no significant effect
...
Abdul Aleem
... Feeding habits and food plants preferred by the animal were observed and the results of the analysis for nutritional contents of food plants have been reported.
...
Islam Mahmood Khan Dr.
...eny of the X-ray treated plants a haploid was discovered which was then made diploid by treating it with colchicines. The pollen mother cells in the auto diploid petunia showed a remarkable shape with continuous cytoplasm and without partition walls. The chromosomes were scattered in lots of different sizes. These pollen grains resembled the synocytes described by Levan 1914.
...
Anwar Ahmad Khan and Altaf Ahmad
...>Importance of medicinal plants and their use as a remedy of certain diseases was known to human beings from times immemorial. Knowledge of medicinal plants lead to its logical conclusion, that is, gradual evolution of science of Taxonomy. In the present age because of synthetic products some of the medicinal plants have lost their old value but still a considerable number of drugs menti...
Iqbal Ahmad Alizai and Himayat Hussain Naqvi
...ere carried out and five plant communities were established.
...
Raja Walayat Hussain and Zaheer Ahmad
...the necessity of raising plantations of fast growing trees for quite some time. In this context they became interested in Hybrid poplars, in general, which ranked high among fast growing tree species owing to their intrinsic qualities and in Poplar clone 1-214, in particular, which is a natural selection and has widely been cultivated in Europe (Sheikh)....
Miss Munawar Sultana and Anwar Ahmad Khan
... with a fetid smell. The plants are commonly distributed in Karachi, Sind, North Waziristan, Khyber and Kurram Agencies, Dir, Chitral, Swat, Lower
Hazara, Rawalpindi and Jhelum district upto an elevation of 1200 meters (3).
The plant is much valued for its powerful expectorant and anti-spasmodic properties. Leaves are used in asthma, chronic bronchitis and all kinds of coughs. The powdered leaves are used in malari...
The plant is much valued for its powerful expectorant and anti-spasmodic properties. Leaves are used in asthma, chronic bronchitis and all kinds of coughs. The powdered leaves are used in malari...
Bashir Hussain Shah and M. Ismail Chaudhry
...ditida....
Mahmood Iqbal Sheikh and Raja Walayat Hussain
... seven tree species were planted in an irrigated plantation to assess their rate of growth. Although the experiment was not statistically designed due to some unavoidable circumstances and requisite silvicultural requirements of the species were not met either, a definite trend in the rate of growth is indicated. Reasons for poor performance of some of the species which otherwise are quite promising have been discussed point...
M.Ismail Chaudhry and Bashir Hussain Shah
...try. Raising of poplar plantations would be needed to feed these industries. In Pakistan poplars grew very well in hilly areas with enough rainfall such as Murree, Hazara, Swat, Tribal belt of N.W.F.P. and Azad Kashmir. The poplars are very heavily infested by leaf stitchers and defoliatois in the plains but are quite safe from their attack in hills. Unfortunately hybrid poplars are seriously attacked by poplar stem and root borer, Ap...
M.I. Sheikh, Abdul Aleem and Mohammad Hafiz
...nsignificant survival of plants.
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type of plastic was mere durable....
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type of plastic was mere durable....
K.M. Siddiqui
...d orchard of shisham was planted in February, 1975 for production of genetically superior seed of shisham for planting. Each of 24 blocks in 1.3 acres plantations contains one plant from each of 40 open- pollinated families of selected trees of this species. Seedlings within families were selected for straightness of stem and height growth. Selection thi...
Mohammad Hafeez
...nsignificant survival of plants.
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type plastic was more durable. ...
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type plastic was more durable. ...
Mahmood Iqbal Sheikh
...und that bulblis must be planted in well manured and well irrigated nurseries for a period of one and a half to two years before these are planted out.
...
Mohammad Shamsul Hasan Khan
...k-chafers, white ants, plant lice and some important insect pests of forest plantations like defoliators and borers has been comprehensively reviewed. Ekalux, Azodrin, Lebaycid and Bidrin against leaf eating insects and Dieldrin, Aldrin and Heptaclhor against white ants and wood borers have been recommended....
Javed Ahmad
...sing of irrigated forest plantation was attempted
over about 8,442 hectares in the Kotri Barrage area of
Sind from 1958 to 1973%. In only about 50% of the area
could a crop exceeding 50% stocking be got established.
Future performance can be improved if the trench system
is replaced by flood system of irrigation, and due care
is given to ploughing and leveling of the land either by
tractors or through forest lessees settled in the land
with suitable in...
M. Farooq and Jalal-ud-Din
...oil survey of Bahawalpur plantation. Of the total area
about 400 hectares are normal silty soil without any
problem. Moderately saline-alkali cover and area of 106
hectares whereas slightly saline-alkali occupy 41
hectares. An area of 7 hectares is occupied by
moderately deep slightly saline-alkali soils are
underlain by fine sand at about, 6 meters depth. A brief
description of different kinds of soil and suggestions
for their improvement are discusse...
Jalal-ud-Din and M. Farooq
...the Lalsohanra irrigated plantation are of various kinds with different problems. Main kinds of soils and their problems have been identified and described. Some reclamation measures have been suggested. The soils are dominantly loamy and are homogenized. At places they are clayey and stratified. These soils occur in the valleys locally known as 'dhars'. About 50 per cent of the area is occupied by sand dunes having irregular relief. Salinity and sodicity, den...
Abdul Aziz Khan and M. N. Malik
...d availability of common plant nutrients.
Mulberry (Morus spp). and Shisham (Dalbergia sissoo) plants are well acclimatized to the climatic and edaphic conditions generally prevailing in the plains of West Pakistan, where they normally exhibit vigorous growth and, comparatively, do not require much care after germination....
Mulberry (Morus spp). and Shisham (Dalbergia sissoo) plants are well acclimatized to the climatic and edaphic conditions generally prevailing in the plains of West Pakistan, where they normally exhibit vigorous growth and, comparatively, do not require much care after germination....
Mahmood Iqbal Sheikh
...ed compact blocks or row plantations. The targets which to many looked rather ambitious in the beginning, have fully been achieved through proper planning, execution, and above all, cooperation between the growers and the consumers to the benefit of both the sides. In view of the chronic shortage of raw material to feed the pulp and paper industry in Pakistan, planting of fast growing species in irrigated forest
Jalil Ahmad Khan and Pervaiz Akhtar
... nurseries as well as in plantations. The number of species which have been planted in different areas is somewhat limited the most common being Eucalyptus tereticornis and Eucalyptus carnaldulensis. According to Parker (7), Eucalyptus tereticornisisthe most common species found in the Punjab and with the possible exception of Eucalyptus rudis it has the fastest rate of growth. It has been ...
M. Hafeez and M. I. Sheikh
...biting their large scale planting. Experiments were under� taken both with cuttings as well as entire plants exposing them to a number of treatments such as time of planting, different rooting media, frequency of irrigation and position of cutting on the plant etc. and using clones like P. deltoids 63/51, 90/60, 69/55 and 18/62, P. eura...
Mohammad Amin Siddiqi
...pindi. It deals with two plant species which have not been previously described in Hooker�s Flora of British India or any other regional or local floras of this sub-continent. These two plants belong to a very small genus Emex australis with only two species, of the family Polygonaceae. One of the species is Entex australis and the other is Emex spinosus. The first one is native of Cape of Good Hope, Sou...
Mahmood Iqbal Sheikh
...ave remained confined to planting of cutting insitu. Also the tree has been grown with little regard to the origin of the stock and its quality. An attempt has been made to collect willow material from different sources and to propagate the same by growing at close (3x3 ft) and wide spacing (3x3 ft) and planting out the latter when one year old. The results at the nursery stage as well those of field
Zaka-Ullah
...phytotic form on nursery plants. Absence of large scale and compact plantations of Willows seemed to be a limiting factor in the appearance of few other pathogens in epiphytotic forms. No bacterial or virus disease was observed....
Raja Walayat Hussain and Muhammad Afzal Cheema
...ns is not dense. Closely planted, the trees along the border of the fields act as a live hedge against cattle and a useful wind break....
Ishtiaq Ahmad Qazi, Raja Walayat Hussain and Muhammad Afzal Cheema
...g grown in the irrigated plantations of the Punjab for over a century. The main object of raising these plantations was to produce fuelwood initially for railway engines and later for meeting fuel requirements of the big cities of the province. The object of management was, in due course of time, modified to include timber production also. At present almost all the plantations are being ma...
Muhammad Ikram Ullah Malik1*, Aamir Saleem1, Lubna Ansari1 and Arshad Mahmood Malik2
...kanals were used for the plantation of tree species (Poplar and Sheesham), to increase the soil fertility and production of income for the household. 2 kanals were used for the growth of agricultural crops such as wheat (Triticum aestivum), to meet the basic needs of the local communities. The wheat was sown by broadcasting of seed. 2 kanals were used to grow the fodder crop such as Berseem (Trifolium alexandrinum). 1 kanal was used for livestock and poultry, ...
Sura Ayed Radam*, Inam Badr Falih
...ound Concanavalin-A is a plant lectin neither antibodies, nor enzymes which has four binding sites for glucose and act as an antigen-independent mitogen, frequently used to stimulate proliferation of T-cells and activate the immune response. Aims The present study conducted for showing effect of Concanavalin-A, whole killed lyophilized Streptococcus pyogenes antigen(WKLA) on immune response of rat. Methods To achieve this purpose, 20 Albino male rats were divi...
Danh Mo
..., 7 to 9 weeks following planting and regeneration. With a yield of 22.4 tons/ha/year, the harvest period of 9 weeks had the best yield. Wedelia tends to lose nutritive value (P<0.05) when harvesting time increases (crude protein, CP 10.4-18.8% DM and acid detergent fiber, ADF 20.1-33.5% DM). Significantly (P<0.05) lower in CP and higher in ADF, the regenerated Wedelia was compared to the planting period. The second ex...
Syed Saqlain Hussain1*, Muhammad Rasheed2, Zammurad Iqbal Ahmed2, Ghulam Jilani3, Muhammad Irfan4, Muhammad Kashif Aziz5, Fiaz Hussain1, Muhammad Akhlaq Mudassar1 and Zuhair Hasnain2
...stablishment stages in a plant life. Moreover, the escape of crop from salt injury at these stages is direly needed. Melatonin is known as N-acetyl-5-methoxytryptamine with chemical formula melatonin as C13H16N2O2. It is a versatile molecule with the speciality to lessen salt stress on the plant. However, mechanism of melatonin which is involved in salt stress mitigation is still under inspection of ...
Javaria Sherani1*, Tehseen Ali Jilani2, Jalil Ahmad3, Rashid Jawad1, Shabana Nazeer4 and Muhammad Jan5
...: (500 g NP + 300 g P2O5 plant-1), zinc sulphate spray (0.3%); T3: (500 g NPK+ 300 g P2O5 plant-1), zinc sulphate spray (0.5%); T4: (500 g NP + 300 g P2O5 plant-1), zinc sulphate spray (0.7%). Each cultivar shows a different response to the different amendments due to its genetic makeup. The morphological attributes showed good performance with the application of treatment T3 as compared t...
Abdul Aleem Memon1*, Inayatullah Rajpar2, Ghulam Murtaza Jamro2, Javaid Ahmed Shah3 and Saima Kalsoom Babar2
...or field-grown sunflower plants. Among interaction of Kfs x Kft, seed and oil yields were obtained to be highest in T3 when NoP>SoP>MoP were sprayed with 0.67% spray each at LDS, IES and FS stage. It can be concluded that under the calcareous conditions of Sindh, foliar application of 2% K (2 or 3 equal splits at LDS, IES and FS) through NoP, SoP, and MoP sources increase the growth, seed and oil content of sunflower....
Rafiullah1, Said Sajjad Ali Shah1*, Muhammad Ilyas Khan2, Anwar Ali3, Imtiaz Ali Shah1 and Sohaib ul Hassan4
... feeding of indigoferous plants by camels....
Mohammad Umar* and Gohar Ayub
...rs of broccoli. Broccoli plants irrigated early in the morning resulted in early curd formation (66.8), maximum plant height (45.21cm), leaves plant-1 (15.84), leaf weight (11.00 g), primary curd weight (340.94 g), secondary curd weight (189.50 g), primary curd diameter (8.60), secondary curd diameter (7.56cm), curds plant-1 (8.73), yield (8.03 t ha-1) a...
Luqman1*, Zahid Hussain2, Tamana Bakht3, Miftah-Ud-Din1, Haroon Khan2, Muhammad
Rameez Khan1, Ata Ullah1 and Faraz Ali Shah1, Imtiaz Khan2 and Abdul Majid Khan Dawar2
...s belong to 17 different plant families in the soil samples of district Chitral..
Out of the 31 different weeds, 23 were broad leaves, 8were grasses and 1was sedge.
Moreover, 24 weeds were annuals, while the rest were perennials. A. Among the different
locations of Chitral, the highest weed seed bank was recorded in the soil samples of ARS
Shen Lasht area.. The lowest seed bank was recorded in the soil samples of...
Fawad Khan1, Zahir Muhammad1, Tahseen Ullah1, Khushdil Khan2 , Shabir Ahmad2, Asif Kamal2 and Khafsa Malik2
...rsity of
the plant consists of 143 species belonging to 47 families including 42 dicots and 5
monocots. Poaceae was the dominant family containing 18 species followed by
Brassicaceae, Fabaceae, Asteraceae and Solanaceae. Therophytes were dominant class
having 89 species (62.23%) followed by Microphanerophytes with 19 species (13.28%),
Hemicryptophytes with 13 species (9.09%), Chamaephytes 8 species (5...
Javairia Mehboob1, Syeda Hafsa Ali1*, Fahima Ashraf Kasi1, Syeda Ayesha Ali2, Safa
Farooqi3, Muneeza Arbab4,
...ies of
three plant extracts and utilizing it in biosynthesis of silver nanoparticles. Green Silver
nanoparticles (AgNPs) were synthesized from 1mM Silver Nitrate (AgNO3) solution incubated
with leaf extracts of Cynara scolymus (Artichoke), Alkanna tinctoria (Alkanet), and
Lavandula angustifolia (Lavender), respectively. The synthesized nanoparticles were
characterized visually, UV-Vis spectrophotomete...
Maqsood Anwar, Shah Khalid and Naveed Akhtar1*
...d that a variety of weed plants
infest wheat crop in the study area that may cause a loss to crop yield. For acquiring better
yield, it is necessary to take the appropriate chemical, mechanical and biological
measurements for weed control.
...
Muhammad Naeem Korejo1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1 and Niaz
Ahmed Wahocho2
...mbination of
plants extracts and herbicides at reduced doses controlled weeds efficiently and optimum
enhancement in seed yield of mungbean was noticed at three irrigations.
...
Rizwan Maqbool1, Bilal Ahmad Khan*2, Sumbal Parvez3, Muhammad Ather Nadeem2, Azhar
Hassan1, Jamshaid Qamar2, Ali Nawaz1, Muhammad Adnan2, Rafia Khalid3, Muhammad
Usman2
...t high concentration and plant growth promoter at low concentration. Therefore, this study
was planned at the Weed Science laboratory, Department of Agronomy, University of
Agriculture Faisalabad-Pakistan, during winter 2018 to evaluate the hermetic effects of
Althaea officinalis L. (Khatami) on Radish (Raphanus sativus). The experiments were laid
out under completely randomized desig...
Rizwan Maqbool1, Bilal Ahmad Khan*2, Sumbal Parvez3, Muhammad Ather Nadeem2,
Muhammad Mughees Ud Din4, Jamshaid Qamar2, Muhammad Waqas1, Muhammad Mohsin
Amin2, Burhan Khalid1
...v>high concentration and plant growth hormone at low concentration. Therefore, this study
was planned at the Department of Agronomy in Weed Science Laboratory, University of
Agriculture Faisalabad during Winter 2018 to evaluate the allelopathic effects of A. officinalis
on weed Wild Pea (Pisum sativum subsp. elatius). The experiments were laid out under
completely randomized design (CRD) having three replications...
Mamoona Arooj1, Bilal Ahmad Khan*1, Muhammad Ather Nadeem1, Muhammad Mansoor
Javaid1, Erum Rashid2, Muhammad Saleem Jilani3, Jamshahid Qamar1, Faryal Ali4, Sadaf
Javeria5, Muhammad Faisal4
...evealed that increase in plant chlorophyll content, fresh weight, dry weight, root length and
shoot length were observed after spraying of atrazine @ 5, 10 and 20 g a.i. ha-1 at 100 %
water concentration. Doses of atrazine above 20 g a.i. ha-1 negatively affect the growth of
Tribulus terrestris.
...
*Arshad Javaid1, Iqra Haider Khan1 and Malik F. H. Ferdosi2
... sativa L.), a medicinal plant of family Cannabaceae, growing
wild in most of the rainfed areas of Punjab, Pakistan. In this study, phytochemical
profile of methanolic extract of root was assessed through GC-MS analysis and
various biologically active compounds were identified through literature survey.
There were 14 compounds in the root extract. The most abundant compounds were
γ-sitosterol (2...
Muhammad Yahya1, Muhammad Ajmal Khan2, Fazle Subhan3, Ali Hazrat1*, Javed Khan5, Aftab
Amin4, Hayat Ullah1 and Tabinda Nowsheen1
...t>.
...
Abdul Basit1, Ayesha Zahid1, Syed Tanveer Shah1, Inayat Ullah2, Sana Ullah3*, Muhammad
Kashif Nawaz4, Muhammad Areeb Khalid1, Izhar Ullah5, Fawad Ali1, Shaukat Ali1
...dy the effect of various planting beds and picking time on yield of okra, a
research study was conducted at Horticulture Research Farm, Malakander, The University of
Agriculture Peshawar, Pakistan. Okra seeds of cultivar Swat Green were planted into two
different types of sowing methods (ridges and flat beds), and reduced to various number of
picking (3, 4, and 5 intervals). Th...
Abdul Basit1 and 2Sana Ullah*
...l which provides healthy plant resources in the
context to plant distribution and urban biodiversity visualization for human being. The
current survey study was carried out at Peshawar Development Authority Nurseries
Hayatabad Peshawar-Pakistan. This survey was based on the current situation and various
methods practiced by the gardeners to manage their nurseries, and distribut...
Hina Gul1, Amjad Usman1*, Karishma1 and Seema Zubair2
...s extracts of indigenous plant extracts in
comparison with synthetic insecticide against Thrips (Scirotothrips dorsalis) on tomato was
conducted under natural field condition during spring 2019. Experiment consisted of 8
treatments (neem extract, tobacco extract, garlic extract, datura extract, lantana extract,
eucalyptus extract, flonicamid (synthetic insecticide) and control followed RCB Design with 3
Abid Hussain Khoso1, Mahmooda Buriro1*, Bakht-un-Nisa Mangan1, Naimatullah Laghari1, Muharam Ali Qambrani1, Allah Ditta2, Muhammad Saeed3, Taufiq Nawaz4
...ximum sympodial branches plant-1 (27.93), opened bolls plant-1 (47.53), weight of seed cotton plant-1 (124.55 g), seed index (8.73 g), seed cotton yield (5394.4 kg ha-1), staple length (30.33 mm), ginning out-turn percentage (37.96%) and oil contents (22.45%) were recorded in Sindh-1 with banana leaves as mulching material. The same treatment caused the maximum leaf area (136.56 cm-2), and...
Rizwan Maqbool1, Bilal Ahmad Khan2*, Muhammad Ather Nadeem2, Sumbal Parvez3, Muhammad Mohsin Amin2, Jamshahid Qamar2, Azhar Hassan1, Muhammd Alam Elahi1, Jamshed Haider1, Muhammad Irfan4 and Memuna Ghafoor Shahid5
...xt-align: justify;">Crop plants release biochemicals into surrounding environment that help in obtaining maximum yield of crop by acting as bioherbicide at high concentration and plant growth hormone at low concentration. Therefore, this study was planned at the Department of Agronomy in Weed Science Laboratory, University of Agriculture Faisalabad during Winter season of 2018 to evaluate the hermetic effects of Cinnamomum v...
Imran Khan1*, Muhammad Iqbal1, Malik Muhammad Hashim2, Muhammad Saleem Jilani1, Mohammad Safdar Baloch3, Muhammad Sohail Khan1, Asif Latif1, Muhammad Amjad Nadim3, Muhammad Mamoon-ur-Rashid4
...g m-2), number of leaves plant-1, leaf area plant-1 (cm2), leaf and root weights plant-1 (g), sucrose (%), TSS (%), root and sugar yields (t ha-1). The results showed significant variation among the treatments for all parameters during both years of study. Among the treatments, the dual gold (S-metolachlor) applied as pre-emergence reduced weed fresh and dry biomasses (g m-2) and also enha...
Zara Naeem1, Khajista Jabeen1*, Muhammad Khalid Saeed2, Sumera Iqbal1
...of various infections in plants and their post-harvest produce that pose a serious threat to humans and animals. In the current study, the objective was to examine the in vitro efficacy of different concentrations of methanolic leaf extract of Sorghum halepense (L.) Pers. against target pathogenic mycotoxin producing fungal species (Trichoderma viride Pers., Trichoderma harzianum Rifai. and Cladosporium cladosporioides (Fresen.) G.A. de Vries. For this purpose...
Tariq Ahmed Keerio1*, Muhammad Nawaz Kandhro1, Ahmed Naqi Shah1, Muhammad Ibrahim Keerio2, Ghulam Murtaza Jamro3
...
immature and mature plant extracts under various seed rates on weeds density and yield
of m aize cultivar Dadu Maize I The experiment includes different we ed control practices
i.e., control (No weeding) weeding), various levels of sorghum immature and mature plant extracts
herbicides and hand weeding under various seed rates (20, 25, 30 and 35 kg per ha )).
The results sh...
Arshad Javaid1*, Malik F. H. Ferdosi2, Iqra Haider Khan1, Amna Shoaib1, Hafiz Muhammad Saeed2, Muhammad Abrar Ul Hassan1
Sumaira Abdul Raouf1, Nadia Jabeen1* and Sundus Akhtar1
...t as bioherbicide and as plant growth promoter agent to decrease the T. portulacastrum allelopathic stress and to enhance the growth of V. mungo. Amendment of Pseudomonas sp. (PF-097) increase V. mungo percentage of germination (8-42%), seedling length (12-54%), fresh biomass of seedling (8-17%) and dry biomass of seedling (0.47 g to 1.2 g). In vivo pot experiment bioassay revealed that of T. portulaacstrum significantly suppress the shoot length (46 cm to 18 ...
Siti Fatonah*, Herman and Dewi Yuni Safitri
...itratus are fast-growing plants, easy to find and contain various secondary metabolites. Therefore, these two types of plants can be used as an alternative bioherbicide for weed control. This study aims to determine the effect of aqueous extracts from fresh leaves of C. citratus, M. bracteata and a mixture of both on the germination and growth of Paspalum conjugatum and Borreria alata weeds.Treatments consisted of extracts o...
Naveed Hussain1*, Muhammad Arif Khan1, Asim Khalid Mahmood2, Muhammad Yasin Tipu3, Mamoona Chaudhry4, Hamad Bin Rashid1, Haroon Akbar5 and Abdul Aziz6
...t. Objective was to transplant as many cells as possible with osteogenic potential along with the graft. These three regimens were evaluated in terms of clinical vital parameters, hematology, serum analysis, bone biomarkers, mechanical assessment, radiographic evaluation and histomorphometry. We concluded that Bone-BMA combination showed best results in fracture healing and bone remodeling while Bone-PRP combination was below par than Bone-BMA but was superior...
Muhammad Nadeem1, Jamshaid Iqbal2, Muneer Abbas1*, Niaz Hussain1, Muhammad Tariq Javeed1, Abdul Ghaffar1, Muhammad Irshad1, Muhammad Aslam1, Gul Rehman2 and Shahar Yar Ahsan1
... practices, such as host plant resistance, imidacloprid seed treatment combined with the use of blue sticky traps, neem seed kernel extract, the entomopathogenic fungus Beauveria bassiana and synthetic insecticides (acephate and chlorfenapyr), were tested individually and in various combinations for managing thrips (Megalurothrips distalis). A mungbean genotype, 13TM-04, known for its comparative resistance, was chosen for these trials. The treatments, whether...
Muazzam Hashmi1, Braima Pascal Komba1, Muhammad Waqas Alam Chattha2*, Almazea Fatima1, Muhammad Farooq Hyder3
...cilities and appropriate planting materials for florists to produce effectively and efficiently. In addition, infrastructural facilities like good roads leading to the farms and storage facilities are made available to the florists for suitable marketing....
Hafiz Ishtiaq Ahmad1, Jinlong Zhang1, Fuxun Luo1, Owais Iqbal2 and Yuying Wang1*
... plays a crucial role in plant growth and development and extends mere illumination it’s a pivotal environmental factor shaping plant physiology and morphology. To gain a comprehensive understanding, an experiment was designed to investigate the impact of various light-emitting diode (LED) spectrums including red, blue, yellow, green, and their composite lights on the plant growth pa...
Muti Ul Hannan1, Wazir Ahmed1, Muhammad Naeem Akhtar2*, Muhammad Baqir Hussain1 and Khuram Mubeen1
...zers boosts the soil and plant health and mitigates the deteriorative effects of heat stress on plants. Based on past studies, the objective of the study was to integrate pre-tested compost, SA, Zn-Fe-B consortia and foliar K with conventional fertilizers for ameliorating detrimental effects of heat stress on morphological and fiber characteristics of cotton. During study, salicylic acid based Fe, Zn, B consortia (S-N consor...
Hafiz Muhammad Usama Shaheen1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Ghalib Ayaz Kachelo1, Hadeed Ahmad1, Muhammad Wahab1, Muhammad Faran Tahir1 and Abuzar Hasnain2
Nazish Huma Khan1*, Mohammad Nafees2, Tooba Saeed3, Sarzamin Khan1, Hazrat Hussain4, Adila Bashir2 and Nida Naz1
...ucture projects of power plants, dams, and highways. For such developmental activities, the role of the crushing unit is tremendous in providing the basic raw material for infrastructure. The literature revealed that the majority of stone-crushing units are operating illegally as 567 units have been declared hazardous to health and safety in the Peshawar region. Due to the lack of safety measures, workers involved in stone crushers were exposed to significant ...
Anwar Ali1*, Muhammad Ayaz Khan2, Muhammad Atif Majeed1 and Nowsherwan Zarif1
...ocked riverine forest or plantation. The average diameter at breast height (DBH) was recorded as 12.49 cm, and the average tree height was estimated as 6.78 m. The average canopy cover is 30% in the area. The total growing stock in the landscape was estimated as 51,978 m3. The average growing stock was determined as 7.94 m3 per ha. The growing stock level in riverine forests in the study area is far lower than that of the normal riverine forest. The study reco...
Rauf Khan1, Shazia Mansuri1,2*, Muhammad Abid1, Muneeba Khan2, Anjum Perveen2, Afshan Rehman3 and Rubina Noureen1
Nematode Community Structure in Musa acuminata Colla (Lakatan) Farms with Continuous Cropping System
Baby Nhor K. Ambel1*, Nneka Djen A. Matandog1, Neil Pep Dave N. Sumaya2, Florence Roy P. Salvaña1, Bryan Lloyd P. Bretaña1 and Ma. Teodora N. Cabasan1*
... increased population of plant-parasitic nematodes compared to free-living nematodes. Nematode family Hoplolaimidae was recorded as the most dominant (59.59%-80.49%) across all monocropping durations. Shannon and Simpson’s diversity indices were lowest at 10-15 years of continuous monocropping period, as compared to 2-4 years and 5-9-years. Maturity index (MI, 2.26) was highest at 5-9 years of continuous cultivation while structure index (SI, 68.93), and...
Saddam Hussain1, Muhammad Asrar2*, Usama Saleem2, Dilbar Hussain3, Muhammad Sohail Qadir3, Muhammad Saleem3, Rashid Ali2, Zeeshan Javed2 and Mubshar Saleem4
...nd above-ground parts of plants. They bite and chew on tubers, young and old leaves, stems, lower branches of the plants, and peanut seeds. Termite infestation is a considerable problem in the livelihood of the farmers of Pakistan. Termite swarming is a major problem and revenue constraint in the area, destroying crops in the field and store. Forests and orchards are rarely termites free, particularly when conditions are fav...
Agus Subhan Prasetyo, Tutik Dalmiyatun, Siwi Gayatri, Kadhung Prayoga, Wulan Sumekar and Joko Mariyono*
...y cropping rotation with plantation crops under the control of state-owned enterprises. This study employed economic production theory as the fundamental analysis. Brebes district was selected as the study site since the region is one of the centers of shallot production at the national level. Samples for the study were obtained from farmers who grew shallot in the glebagan and conventional systems, with a sample size of 100 for each group. The sample selectio...
Cristian Mendoza1*, Adriana Celi-Soto2, Ernesto Cañarte3 and George Cedeño-García2
...3%, depending on how the plant is managed. The present study aimed to evaluate the influence of physical barriers (mulching) using different parts of oil palm plants on controlling root borer (S. valida) in the interspecific oil palm hybrid OxG. The study was conducted at the Palesema plantation, situated in Mataje Parish, San Lorenzo Canton, Esmeraldas Province, Ecuador, located at...
Jagdish Jaba1*, Sumit Vashisth2, Sivakumar Golla1 and Suraj Prashad Mishra1
...sts population, and host plant resistance with special reference to pod borer Helicoverpa armigera (Hubner) in pigeon pea (Cajanus cajan (L.) ecosystem was studied on two cultivars namely, ICPL 87 and ICPL 88039. The insect pest population on two cultivars differed significantly across sowing dates. ICPL 87 was most vulnerable to insect pests as it suffered more damage by the pod borer H. armigera, pod sucking bugs (Clavigralla tomentosicollis Stal.) than ICPL...
Shoaib Zawar1, Muhammad Waqas Yonas1,2*, Muhammad Mujahid Akbar1 and Abeer Ahmad1
...s due to its ability for plants to maintain optimum density per unit area, reduced intraspecific competition, and enhanced grain formation, leading to higher grain yield (5562.38 kg ha-1 in 2020-21 and 5220.22 kg ha-1 in 2021-22). Adapting an appropriate sowing method is crucial to maximize wheat production which has been proved in the augmented furrow method over a broadcast and/or the usual drill sowing methods. The relatively better performance of augmented...
Wadood Shah* and Sanam Zarif Satti
... stress worse and limits plant growth and productivity by reducing nutrient uptake and increasing osmotic load. In addition, dramatic climatic changes can reduce water availability, leading to a variety of problems, including the ongoing limited water condition. The present review article intends to critically analyze morpho-physiological and growth, responses of plants to various levels of drought stress as well as their ab...
Tariq Zaman1*, Fawad Khan2, Sajjad Ahmad2*, Alia Mehsud2, Atta Ur Rahman3, Muskaan Zaman2 and Sumaira Noor2
...e (2.38%) each. Based on plant parts used, leaves were the topmost part used of 21 species (50%), followed by whole plant 18 species (42.85%), seeds of 9 species (21.42%), stem of 8 species (19.08%), root of 5 species (11.90%), latex, shoots of 2 species (4.76%) and flowers of 1 specie. The most significant number of plant species that helped alleviate digestive problems was 12 (58.57%) of...
Tamara Natik Dawood*
...ed from the milk thistle plant (Silybum marianum). Silymarin has various pharmacological properties, including hepatoprotective, antioxidant, anti-inflammatory, anticancer, and cardioprotective effects. The study aims to determine the influence of several levels of silymarin on the productive and biochemical parameters in local lambs. A total of 30 lambs are classified into three groups. G1 (ten lambs) received Silymarin (420 mg/kg) orally, G2 (ten lambs) rece...
Hafizuddin1, Sri Wahyuni2, Tongku Nizwan Siregar1*, Amalia Sutriana3, Ririn Triyuliani4, Siti Hanyyah Herviani4, Muhammad Farhan Syuhada4, Nur Salimah4, Muharni Mardiah Eriswandi4, Ratu Permata Ayu4, Putroe Hayatun Nufus4
...ddition, the number of implantation site showed a significant difference between R1 with R2 and R3 (P<0.05). The concentration of estrogen in R3 increased on day 5 after mating, while FSH and LH showed no significant differences between all groups on days 1, 3, and 5 after mating. Based on these findings, the administration of BPE could be considered as an alternative superovulation preparation in local rabbits in terms of ovarian and hormonal positive resp...
Noorullah Khan1, Shahid Ali1, Azher Zeb2, M. Noman1, M. Imran Kasana1, Rashid Iqbal Khan1*, Saima Mumtaz1, Shumaila Rasheed1, M. Muneer3 and M. Qamar-Uz-Zaman1
...three replication and 10 plants per replication. Data were recorded on plant survival rate (PSR %), bud sprouting rate (BSR %), shoot length (SL cm), shoot diameter (SD cm) and number of leaves per plant (NLP). The outcomes exhibited that peach scion cvs., “Coronet” and Early Maria Delizia exhibited the maximum plant survival rate (97.67 and ...
Muhammad Wasif Gulzar*1, Riffat Maqsood1, Hussain Abbas1, Musharraf Manzoor1, Muhammad Suleman1, Hassaan Ahmad Bajwa2, Ali Hamza2, Shaher Yar1, Muhammad Zain1, Abdul Wadood1 and Noman Aslam3
...aterials can be found in plants, soil, water, air, food, and feed. Through the food chain, their residues build in humans and animals after entering plants and animal products.They destroy useful species in the ecosystem and put our lives and health in peril. This review highlights the current standing of the impact of insecticides on viral diseases in man and animals. We observed that in addition to their surroundings, peop...
Chinenye Maria-Goretti Ohanu, Chika Bright Ikele*, Okoye, ChukwuEbuka Kingsley, Charity Chidera Eze
...simum is a good anti-ich plant material favouring 500mg/l and 1500mg/L ELEOG in bath treatment against I. multifilis.
Keywords | Ichthyophthirius multifllis, Ocimum gratissimum, Clarias gariepinus, Aquaculture
...
Kashif Haleem, Basheer Ahmad, Muhammad Rayyan, Nowsherwan Zarif, Saif Ullah Khan, Salman Ahmad and Anwar Ali*
... primary motivations for planting trees were income (67.5%) and timber (31.25%), with firewood being a minor reason (1.25%). A significant majority (78.75%) of respondents grow trees on their farmland to sell them and support their families, while 21.25% use the trees for personal purposes. Most respondents (61.25%) use LPG for cooking and heating due to its availability, while 32.5% also use firewood, and 6.25% use crop residues along with firewood. Of the 80...
Asad Ali, Anwar Ali, Muhammad Farooq and Basheer Ahmad*
...nd growth performance of plantations established under BTAP in Karak district. A total of 99 sample plots measuring 0.1 hectares were established across the selected sites. Data collection included information on regeneration, species planted, pit density, survival rate, aspect, and species composition. Analysis of the field data revealed a pit density below the required 10x10 spacing, with only 663 pits found compared to th...
Ameer Sultan1, Abdur Rauf1*, Farooq Jan1, Muhammad Qayash2, Muhammad Yasin3, Tanweer Kumar4, Wajid Khan4, Muhammad Arif4, Kashmala Jabbar5, Wisal Khan6, Farhan Ullah1, Syed Shabab Hussain1 and Ikramullah Khan1
...n of a 50%-DSW increased plant height, cane diameter, leaf count per plant, and tillers per plant, while 60%-DSW had a diminishing trend compared to the other concentrations. ...
Nask Jawher Ahmed and Kawa A. Ali*
...ironmental constraint on plant optimum growth and development, which adversely affects yield of all crop. Salicylic acid (SA) induces the responses to biotic and abiotic stresses. A field experiment was designed in Randomized Complete Block having three replications to determine the effect of foliar application of (SA) on sesame plant vegetative parts under drought with focusing observation on morphological and physiological...
Atyab Amjad1*, Riaz-Ur-Rehman1, Muhammad Shafique Khalid2, Samia Ikram1, Riaz Bukhari1, Muhammad Shafique3 and Muhammad Luqman4
...torial arrangements. All plant growth parameters were measured at maturity. Results demonstrated that variety Crystal Blanco exhibited the greatest plant height (86.9 cm) under green shade netting. This cultivar also produced the thickest stems (8.4 mm) under both shade lath house and green netting conditions. Additionally, Crystal Blanco displayed the largest leaf area (153.9 cm²) when grown in polyethylene tunnels. Th...
Aysha Fatima1, Safdar Ali1, Saira Azmat2, Luqman Amrao1, Muhammad Usman Ghani3*, Yasir Iftikhar4, Muhammad Ahmad Zeshan4*, Adeel Ahmad5 and Humaira Kalsoom6
... management purpose. The plants were treated with zinc sulphate (ZnSO4), copper sulphate (CuSO4), manganese sulphate (MnSO4) and boric acid were used in different combinations i.e., T1 (ZnSO4+CuSO4), T2 (MnSO4+CuSO4), T3 (boric acid+CuSO4) and T4 (ZnSO4+MnSO4+CuSO4+BA). The combination of ZnSO4+MnSO4+CuSO4+BA showed minimum disease severity (5.85%) and disease incidence (23.15%) as compared to control (28.59%). The outcomes of present study would be the way fo...
Efi Rokana1, Iin Rohmatul Fatimah1, Brilian Desca Dianingtyas1, Niswatin Hasanah2, Wulandari3, Zein Ahmad Baihaqi1,3*
...rs: elephant grass, corn plants, and rice straw. Employing a completely randomized design (CRD) with three treatments and nine replications, the research examined dry matter intake, body weight gain, feed efficiency, and income over feed cost (IOFC). Results indicated that feeding with different types of forage did not significantly impact dry matter intake (P>0.05) but significantly affected body weight gain, feed conversion, feed efficiency (P<0.05), a...
Hamid Ullah Khan1*, Muhammad Anas1*, Rozina Gul1, Waseem Ullah Shah1, Abdul Haleem2, Muneeb Ahamd Khan1, Muhammad Taimur1, Tahreem Shah1, Sajjad Ur Rahman1, Noman Anjum1 and Muhammad Saqib3
...ergence, days to flower, plant height, pods per plant, seed per pod, 100 seed weight, grain yield, larval infestation, pod damage percentage and biological yield. The pooled analysis of variance showed highly significant differences (P<0.01) between years and between genotypes and genotype-year interaction (GYI) for all traits examined, except plant height. On average over two years, a ...
Iswahyudi Iswahyudi1,2, Wahyu Widodo1*, Warkoyo Warkoyo1, Roy Hendroko Setyobudi3, Damat Damat1,
Dyah Roeswitawati1, Shazma Anwar4, Thontowi Djauhari Nur Subchi1, Irma Rahmaita Utarid5, Marchel Putra Garfansa2, Mohammad Shoimus Sholeh2, Ida Ekawati6, Rusli Tonda7, Wahyu Alvina Mujianti2, Dody Sukma RA8, Sri Utami Lestari8 and Choirul Anam9
...act global attention. On plants, MPs have detrimental effects such as interfering with nutrient absorption, slowing germination and roots development. Of all the stages of growth, seeding has an important role in the crop yields obtained. The examined the impact of three polymer MPs (1 % w w–1) on paddy seeding and control as a comparison with four repetitions by using soil culture experiment for 20 d. Plant...
Arba Aleem, Norrizah Jaafar Sidik*, Wan Razarinah Wan, Abdul Razak and Norfatimah Mohamed Yunus
...ucial for crop yield and plant development. Root exudates are secreting into the soil via the plant roots where they shape the soil microbiology and helps to create the symbiotic interaction. It is controlled by a complex network of mechanisms impacted by symbiotic interaction which incorporates the complex network mechanism of biotic and abiotic method. In abiotic conditions, plant exudat...
Murad Muhammad1,2,3*, Shahid Ullah1, Nimrah Ameen4, Abdul Wahab3,5, Abdul Basit6, Muqadas Batool7, Muhammad Nazim2,3 and Haroon Khan8
...htunkhwa. Many medicinal plants grow wild or as weeds worldwide, including in Pakistan. The Dir Upper district boasts a diverse weed flora with significant medicinal value for daily use. Surveys using semi-structured open-ended questionnaires were carried out in distant villages of the Larjam subdivisions, specifically interviewing 120 local respondents (85 males, including herbalists and pansiris, and 35 women) regarding the naturally occurring medicinal weed...
Marriyam Batool1*, Ahmed Zia2, Shabir Ahmed1, Imran Bodlah3, Waheed Ali Panhwar4, Muhammad Ashfaque5, Falak Naz6 and Muhammad Muneer5
...ltivated as well as wild plants grown at variable altitudes of the valley. A total of 398 individuals were collected from 26 host plants of which, 23 species and 13 genera are reported for the first time for this valley. Within the recorded fauna, Macrosiphum euphorbiae was found to be abundant with 103 individuals followed by Myzus persicae and Aphis craccivora, respectively. Impact of altitudinal variations over the distri...
Daniel Offiong Etim1*, Etim Johnson Umana1, Idorenyin Asukwo Udo2, Ndarake Eden Ini-Ibehe1
...trol. Two weeks old okra plants were inoculated with 5,000 larvae of M. incognita and one gram of S. rolfsii (3 Sclerotia g-3) in a heat sterilized soil. The obtained results showed highly susceptibility of okra to M. incognita and S. rolfsii infection without neem cake and Trichoderma species infestation. Amendment of soil with neem cake at 4.00t/ha in combination with T. viride significantly (P≤0.05) reduced root galling, nematode population and nematode ...
Marwa M. El-Deriny1,2*, Rania H. Wahdan1, Marwa S. Fouad3 and Dina S.S. Ibrahim1,2*
...ct various horticultural plants, including eggplants (Solanum melongena, L) and cause destructive loss in crop yield production. The purpose of this study was to evaluate the impact of individual or concomitant treatments with Trichoderma viride and some plant growth promoting rhizobacteria (PGPR) on root knot nematode in eggplant.In greenhouse, a standa...
Malik Muhammad Yousaf1*, Abou Bakar Siddique1*, M. Jahangir Shah1, Mumtaz Hussain1, Bashir Ahmad1, M. Bilal Zafar1, Maryam Hayat1, Shamsa Rasool1, Zainulabdeen1, Muhammad Mohsin Raza3, Malik Ibrar Yousaf2 and Usman Majeed1
...nal and modern medicinal plants due to its pharmacological properties and placed in leading medicinal crop in worldwide. Research plot was located at Bahawalpur divisions at different location under (Pakistan Agriculture Research Council PARC), Arid Zone Research Institute in two crop seasons 2022-2023. Five different germplasm were used for the study 21213, 21474, 20617, 21260 and 21988. The study was carried out to calculate the effects of chemical
Noor Rahmawati*, Dea Indriani Astuti and Pingkan Aditiwati
...ic exchange between host plants and endophytes, endophytic fungi can produce the same secondary metabolites as their host plants. Numerous research on the bioactive elements of secondary metabolites from endophytic microorganisms, particularly endophytic fungi, have been undertaken on plants that are able to produce secondary metabolites with unique properties. When tested using the DPPH r...
Gunel Arzuman Ramazanova1, Gulnara Fakhreddin Abbasova2*, Khalsa Ibrahim Nasibova3 and Sait Engindeniz4
... and Fakhri were used as plant material. In order to infect healthy plants, samples infected with blister smut disease collected from the maize cultivated areas of the Garadagli village and brought to the Plant Diseases Diagnostics of Azerbaijan State Agrarian University, transferred to artificial nutrient medium and multiplied. In the study, the intensity of spread of the disease, disease...
Masoumeh Hosseynikhah
...ne and sodium content in plant tissues and decreased the absorption and accumulation of potassium by plants. In addition, plant weight, 100 seed weight, relative water content, chlorophyll content and photosynthesis were also affected by different levels of NaCl. However, the external application of silicon and potassium nitrate decreased sodium absorption, increased potassium, and as a re...
Junaid Khan* and Muhammad Sajid
...ustify;">The guava fruit plants produce heavy fruit yield during summer season but these plants then produce very little fruit yield during winter season due to low carbohydrates. To increase guava fruit production during winter season, this experiment ‘effect of nitrogen doses (0, 75, 150 and 225 kg ha-1) and timing (September, October and November) on fruit quality of guava in winter’ was conducted at farmer fi...
Muhammad Iqbal1*, Saba Iqbal1, Asmat Ullah2, Arbab Jahangeer1, Naveed Akhtar3, Tahira Tabassum3, Ali Zohaib3, Naveed Ramzan3
...ered in the root zone of plants causing ionic and osmotic disproportion. However, by way of a superior field-management opportunity, buildup of soluble salts in rhizosphere can be managed by applying soil mulching which reduces water evaporation from soil hence limits upward movement of salts. Moreover, it also reserves soil moisture, increases utilizing efficiencies of nutrient and water hence improves crop yield. Critical research gaps exist in understanding...
Shruti Yadav1,2*, Kamana Singh2, Pratap Adinath Divekar3 and Suhas Gorakh Karkute1,3*
...text-align: justify;">Eggplant or brinjal (Solanum melongena L.) is an important fruit vegetable of Solanaceae family that has originated from India and is widely cultivated in tropical and temperate regions across the world. The major constraint for brinjal production is severe damage caused by a Lepidopteran insect pest brinjal shoot and fruit borer (BSFB; Leucinodes orbonalis) leading to almost 60% lossess. In the present study, a codon-modified synthetic C...
Suhair Sh. Al-Siraj1, Jihan M. Badr2 and Dalia M.A. El-Masry3*
...NA). As conclusions: The plant extracts and nanoemulsion may prevent pathogenic microorganism-induced deterioration and provide antibacterial agents for gram-positive and gram-negative bacterial infections.
Keywords | Plant extract, Bay leaf, Nanoemulsion, Antibacterial, Pathogenic bacteria, Gene expression, Resistance
...
Barkat Ali Jatoi1*, Amjad Hussain Mirani1, Abdul Latif Bhutto1, Ambreen Laghari2, Abdul Samad Magsi3, Ahmed Sultan Jatoi4, Aneela Sultan Jatoi5, Muhammad Mohsen Rahimoon6, Aarab Khan Lund7, Om Parkash1, Atif Ali Malak8
...ucalyptus camaldulensis) plant extracts against Pasteurella multocida. A total of 10 farms of each taluka of Shaheed Benazirabad district (i.e. Nawabshah, Qazi Ahmed, Daur and Sakrand) were visited to examine animals suspected of being infected with HS. A total of 2244 buffaloes and 576 buffalo calves were investigated. Among the suspected animals 100 (blood samples) were cultured, and P. multocida isolates were biochemically characterized. The overall prevale...
Byamungu Mayange Tomple1*, Ik-Hwan Jo2, Rajaraman Bharanidharan1, Seun-Gun Won2 and Muhammad Mahboob Ali Hamid3*
... 120, and 130 days after planting - DAP) and four manure fertilization levels (0, 150, 200, and 250 kg N/ha), each replicated thrice. The findings revealed a positive correlation between manure fertilization application and kenaf growth, with the greatest plant height observed at the highest manure fertilization levels. The manure fertilization application level of 200 kg N/ha resulted in the highest dry matter (DM) yield, c...
Sairah Syed1, Rafia Urooj Saman1, Ayesha Manzoor1, Muhammad Arsalan1, Abdul Latif1*, Madeeha Khan1, Rehmat Ullah2, Muhamad Bilal2, Rizwan Latif3, Ejaz Ahmad4, Muhammad Amjad1, Muhammad Aslam5, Sair Sarwar6, Sabir Hussain Shah7 and Amaima Masood8
... the growth and yield of plants are well studied. However, studies related to its utilization and effect in combination with reduced chemical fertilizers on plant growth are still limited. Therefore, this experiment was conducted to evaluate the effect of varying levels of VC (0 and 2.5 tons/ha) and NPK (60:80:60 kg/ha or RDF, 75% RDF, 50% RDF, 25% RDF) fertilizers on the growth and yield of spinach, peas, and radish. In a R...
Catur Suci Purwati1, Chusnul Hanim2*, Lies Mira Yusiati2, Budi Prasetyo Widyobroto3
...te derived from cinnamon plants. This research aimed to investigate effect of cinnamon powder on protein balance, and blood profile of etawah crossbreed goats. A total of 15 goats with an average initial body weight of 15 - 23 kg and age 8 - 12 months, were used in the study with completely randomised design (CRD) consisting of three treatments and six replications. The three treatments tested were as follows: A: without adding cinnamon powder (0 g/kg feed DM)...
Yusra Karim1, Munawar Saleem Ahmad1, Javed Khan2, Imtiaz Khan3*, Said Hussain Shah2, Syeda Anika Shamsher4, Imran Qazi5, Habib-Ur-Rehman Kakar6 and Wajih Ullah7
...to contain the vegetable plants in a small field. B. thuringiensis with active CRY1F was cultivated in Luria-Bertani (LB) media under controlled laboratory conditions. The goal was to maximize colony growth for the preparation of spore/crystal mixtures at various concentrations. The larvae of S. litura and H. armigera were reared in a laboratory under control. Following tests, the LC50 (96-hours) of the CRY1F protein-crystal mixture against lepidop...
Bilal Ahmed Qazi, Nowsherwan Zarif, Anwar Ali*, Faizan Ahmed, Asim Karim and Ali Nawaz
... of soil moisture to the plants for a longer period to enhance survival and growth. Various water harvesting techniques such as mud plaster, conservation contour trenches, V-shaped micro-catchments, hillside ditches, roaded catchments, water spreading, and individual basins were investigated to determine their efficiency and effectiveness. Deep planting and plastic mulching were extensively used for this purpose. Several mul...
Muhammad Shahid Hassan1, Nargis Naz2, Hassan Raza Javeed1*, Sabahat Zafar1, Laraib Kanwal1, Seerat Mariyum1, Areej Fatima1, Areeba Bashir1 and Muhammad Imran Atta3
...Weeds compete with wheat plants for essential resources (nutrients, light, space, and gases) and ultimately reduce yield. The current study was conducted during 2021 – 2022 in the wheat fields of three tehsils of district Layyah to investigate the weed biodiversity. Weeds biodiversity data was recorded by a random quadrate sampling method using the quadrate of 5 m2. Phyto-sociological attributes such as density, frequency, cover, relative density, relati...
Mukondwa Olivia1, Rugare Joyful Tatenda1, Mabasa Stanford1 and Mandumbu Ronald2*
...by the addition of their plant material to soil under laboratory and glasshouse conditions. A randomized complete block design with three replicates was used and the experiment was repeated twice over time. Results showed that there was a significant (P < 0.01) effect of sorghum and pearl millet cultivars on germination / emergence and dry weight of goose grass and blackjack. It was established that sorghum and pearl millet cultivars has no significant (P &...
Muhammad Ehsan Safdar1*, Muhammad Sikander Hayyat, Muhammad Zeshan Maajid, Mubashar Nadeem and Amjed Ali
... (0, 4, 8, 12, 16 and 20 plant m-2) of Convolvulus arvensis. The weed densities were maintained by thinning the excess weed seedlings one week after crop emergence. Wheat variety Galaxy was sown as a test crop. Results exhibited that increasing densities of C. arvensis increased its dry weight m-2 but reduced its plant height. A significant reduction in wheat growth and yield was recorded by increasing C. arvensis density. W...
Fasih Ullah Haider1,2, Sardar Alam Cheema1and Muhammad Farooq1,3
...ion. Cover crops are the plants grown inn field in such a way that these plants give soil cover despite it may be incorporated in field or not and also facilities weed suppression, control soil erosion, improve soil fertility and also manage diseases and pests present in that field. Cover crops normally comprise of legumes and grasses. Cover crops lead to be one of the better options that reduce the dose of herbicides and th...
Abdessatar Omezine1
...of two or more different plant species interacting with each other in different manners. Interspecific competition, resource complementarity and facilitation may modulate better performance of a mixture. It is difficult to interpret the results of a simple mixture experiment, if the phenomena act together. An experimental design is used to study interactions between chilies or peppers, Capsicum annuum L. var. ‘Baklouti’ and Setaria verticillata (L....
Shahida Naveed1, Salma2, Inayatullah Khattak3 and Khan Bahadar Marwat4
Umm-e-Kulsoom1, Saima Hashim2, Fazli Wahid3, Haseena Gulzar4 and Tamana Bakht5
... of these species (donor plants) were collected and stored. After drying, the plant materials were grinded. The powder of each species and each part were soaked separately at 100 g per liter and 150 g per liter to get two different aqueous extracts. The objectives of the studies were to investigate the allelopathic effect of extracts of different parts of donor species on weed seed germination and growth of potato. Weed seed...
Fawad Ali1, 2, Gul Hassan2*, Naveed Akhtar3, Muhammad Jamal Babar3 and Ataullah Jan4
Iqtidar Hussain1*, Mohammad Safdar Baloch, Ejaz Ahmad Khan and Asghar Ali Khan
...ic response of different plant extracts on the morpho-physiological traits of maize crop. The experiment was carried out in a completely randomized design having three repetitions. Water extracts of ten different plants viz., neem (Azadirachta indica L.), eucalyptus (Eucalyptus camaldulensis L.), tobacco (Nicotiana tobacum L.), Indian lilac (Melia azadirach L.), acacia (Acacia nilotica L.), poplar (Populous deltoids L.), sun...
Gul Hassan, Anees Amin, Haroon ur Rashid, Naqib Ullah Khan and Hussain Ali1
...olled environment. Fresh plants of Parthenium and berseem were collected before flowering stage, chopped into about 1 cm pieces, dried and then incorporated into soil 30 days before planting. The treatments included NPK at recommended dose alone and NPK + 1, 2, 3 and 4% dried parthenium (w/w of soil). For comparison, treatments like dried berseem 2% (w/w) and untreated (0 NPK and 0 Parthenium or berseem); were also employed....
Huzaifa Hammad1, Bakhtiar Gul1, Haroon Khan1, Muhammad Fawad1*, Hafizullah2, Haidar Ali3 and Tamana Bakht4
..., silking, and maturity, plant height, fresh weed biomass, dry weed biomass, weed species composition, biological yield, thousand grain weight, grain yield, harvest index and cost benefit ratio. The results showed that both the herbicides (Atrazine and Stomp 300 EC) were effective in weed control having lowest fresh weed biomass of 29.31 and 32.65 kg ha-1, respectively. Maximum biological yield (8309.7 kg ha-1) was recorded in cowpea as living mulch while mini...
Safaa Sabbar Atiyah1*, Ali Abdullah Zuairi Al-Sadoon2, Shifaa Kadhum Jieish2
Muhammad Farooq* and Sanam Zarif
...t invasive species, both plant and animal. These species, which are non-native to the area, seriously threaten native biodiversity and disturb local ecosystems. Invasive species spread more quickly as a result of increased worldwide travel and trade, necessitating management and control. This review study examines the numerous facets of invasive species in Pakistan, illuminating their effects, methods of management, and related difficulties. The necessity to s...
Mohammad Wasiullah Khan* and Abdur Rab
...e total number of fruits plant-1 (916). Among application stages, Zn sprayed 15 days after fruit set increased leaf protein content (6.70 %), total number of fruits plant-1 (932). Various attributes studied for storage duration of plum fruit were significantly affected by zinc concentration less weight loss (11.91%), TSS (13.76 ºBrix) were recorded with fruit plant sprayed with zinc s...
Abdel Fattah A. Khalaf1, Karam T. Hussein1, Shehta A. Ali2, Doaa K. Barakat2*, Mohamed I. Gad1
Muhammad Luthfi Hidayat, Istna Mangisah, Lilik Krismiyanto, Vitus Dwi Yunianto*
...capsulated Lactobacillus plantarum and Peperomia pellucida plant extract (ELPPP) on performance, protein digestibility and immunity of broiler chickens. A total of 200 Ross strain broilers were arranged in a completely randomized design with 5 treatment groups and 4 replications. The treatments include: T0 (control), T1 (0.1% ELPPP), T2 (0.2% ELPPP), T3 (0.3% ELPPP), T4 (0.4% ELPPP). ELPPP was applied from day 8 to 35. The p...
Saima Maher1*, Salma javed2*, Gul mina1, Rizwana Salam1, Farah Mukhttar1, Noureen Khan3 and Fakhra Batool3
... Six Pakistani medicinal plants, from which five different extracts methanol, ethanol, ethyl acetate, hexane, and chloroform were prepared from various plant. Preliminary phytochemical analysis of these extracts revealed the existence of main phytochemical constitutes, including alkaloids, glycosides, flavonoids, tannins and phenolic compounds. These compounds were found to contribute to the observed anti-nematicidal activit...
Mehak Muhammad Ashfaq1*, Aqsa Naeem Chawla1, Muhammad Umaid Ali1 and Adnan Ahmed Bhutto2
...gated chemicals found in plants that comprise the group of polyphenols, which also include epicatechin, catechin, and procyanidin. Based on a ground-breaking study, eating foods high in flavonoids is linked to a lower risk of cancer, cardiovascular disease (CVD), and other neurological conditions, including Alzheimer’s, Parkinson’s, and others. Nevertheless, due to research constraints and confounding variables such as study design, population size...
Auras Muhi Taha*, Ibrahim Ahmed Ibrahim, Hassanein Abduladeem, Mohammed Qais Yassen, Omaima Khalid Ahmed and Tabark Najim Abdul-Allah
... impact on soil uses and plant densities based on Landsat sensor data. The results showed that the very severe drought type dominated throughout the study period, followed by the severe drought type, while the moderate drought type was constantly decreasing with alternating drought periods, and he significant differences between drought level rates over 35 years. This study indicated a decrease in SAVI values over thirty-five years, i.e., the absence of a larg...
Niaz Hussain1, Muneer Abbas1*, Abdul Ghaffar1, Muhammad Aslam1, Mudassar Khaliq1, Khalid Hussain2, Muahammad Nadeem1, Muhammad Irshad1, Zubeda Parveen1, Fiaz Hussain3 and Azhar Mahmood Aulakh4
...dquo; using conventional plant breeding procedures. This variety expressed higher yield potential, bold seed size and resistance to various diseases. The breeding process commenced in 2006-07 by crossing two local genotypes, 97086 (female parent) and 950130 (male parent), to create genetic variability for bold seed size. Recombinants having higher yield along with bold grains were selected from the F2 population raised from the F1 seed. Subsequent single
Aasma Rasheed1, Dilbar Hussain2, Usama Saleem1, Saddam Hussain3, Zeeshan Javed1, Mashal Shahzadi1, Muhammad Sohail Qadir2, Muhammad Saleem2, Abdul Ghaffar2, Mawra Rafique4, Ayesha Ikram5, Saad Rasheed1 and Muhammad Asrar1*
...cotton, sunflower, fruit plants, and vegetables. C. septempunctata is the free living predatory specie of sucking insect pests such as aphids, mealybugs, and whiteflies and consume many preys during its lifetime. C. septempunctata larvae and adults are both active predators. The present study regarding toxicity of new chemistry insecticides against C. septempunctata was conducted under laboratory conditions. The toxic potential of six synthetic insecticides Em...
Mohammad Moneruzzaman Khandaker1*,Nuratiqah Emran1, Nurul Elyni Mat Shaari1, Arba Aleem2, Zanariah Mohd Nor1 and Ali Majrashi3
...ch is easily absorbed by plants. The metal makes living organisms susceptible to its acute and chronic toxicity through plant food. Similarly, Cd hinders the growth of plants by causing the loss of chlorophyll, which in turn negatively impacts the activities of photosynthesis. Therefore, this current study aims to evaluate the effects of Cd on the germination behaviour, morphology, growth ...
Ngele Blessing Alfred, Agba Mary-Ibenreh Ogaboh*, Bassey Rosemary Anietie and Egeh Ajah Egwu
...h and dry weights of the plants decreased significantly (P≤0.05) as detergent concentration increased, with fresh and dry weights at 0 g/l being 1.68g and 0.69g, respectively, and at 5g/l being 0.50g and 0.69g, respectively. Seedlings irrigated with 5 g/l detergent solution showed higher peroxidase and polyphenol oxidase activities (1714.14 µmol product/L/min and 40.43 µmol product/L/min, respectively), while catalase activity decreased with hig...
Hina Yasin1,2*, Shaukat Mahmud2, Hina Abrar1, Kaneez Fatima3, Rabia Bushra1 and Saima Zahid2
...le of phytochemicals and plant based drugs in curtailment of diseases has already been established. Croton bonplandianus plant has found to be popular in the healthcare system for treatment of various complaints. In the present study, plant leaves were screened for analgesic and cytotoxic activities using animal models for the safe and effective utilization of plan...
Iqrar Hussain1, Ibrar Hussain2, Fazal-i-Wahid2, Ghani Gul3, Waseem Ullah Shah*4, Muhammad Numan5 and Muhammad Anas4*
...7.77 %), number of tuber plant-1 (5.22), tubers weight plant-1 (0.659 g), tuber diameter (3.28 cm), tuber yield ha-1 (25.57 tons) and minimum days to emergence (17.44 days). Among the three cultivars, Desiree showed maximum sprouting percentage (62.08 %), number of tubers plant-1 (4.58), tuber weight plant-1 (0.55 g), tuber diameter (2.970 cm) tuber yiel...
Kouakou Yadom Yao François-Regis*, Kra Kouamé Daniel and Atta Diallo Hortense
...cidal efficacy of castor plants was usually assessed using leaves, regardless of maturity or plant phenology. Under these conditions, the efficacy of each leaf type is unknown. This study aimed to identify the maturity level of castor leaves that exhibit the highest nematicidal activity against okra root-knot nematodes. Aqueous extracts of five types of castor leaves were prepared. These were immature (ILV) and mature (MLV) ...
Estrelle Anne Tacbas1, Neil Pep Dave Sumaya2 and Nanette Hope Sumaya1,3*
...ids, and tannins in both plant crude extracts. Different developmental stages of C. elegans (i.e., 1st to 4th larval stages (L1-L4), young adult (YA) and adult nematodes) were used for in vitro anthelmintic assay, mortality, development of life stages, and reproduction of the nematode. Both plant extracts caused high mortality in the L4 stage for their LC50 and LC90 values. Notably, the crude extracts of both
Muhammad Jan1*, Muhammad Ashraf Sumrah2, Muhammad Azhar Iqbal1, Inam-ul-Haq1, Attiq Ur Rehman1, Javeria Sherani3, Muhammad Imran3 and Rizwan Latif4
... than 5.00 million olive plants had been planted over an area of 40450 hectares in the area of Balochistan, Khyber Pakhtunkhwa (KPK), Punjab, Azad Jammu Kashmir (AJK) and Gilgit Balistan (GB). This is only possible due to availability of certified olive plants in a bulk quantity. Center of Excellence for Olive Research and Training (CEFORT) is playing a pivot role in this regard as a sourc...
Emad M. Gad1, Haidy G. Abdel-Rahman2, Mohy Eldin Abd-El-Fattah1, Merna M. Kamal1, Ahmed Shaker Eltahan3, Amina A. Dessouki3*
... dialysis or kidney transplantation. So,the development of new prevention and treatment strategies of diabetic nephropathy is required. The existent study looked at the impact of dapagliflozin, mulberry fruit and leaves extracts and their combination on the kidney of diabetic rats. To induce diabetic nephropathy, experimental rats were supplied with 10% fructose (Fr) in drinking water for the first two weeks. Each Fr-fed animal received an intraperitoneal inje...
Shiguftah Khalid1, Muhammad Jahanzaib2*, Haris Khurshid2, Rabia Khalid3, Sundas Waqar3, Faiza Siddique3, Fazal Yazdan Saleem Marwat3 and Zahid Akram1
...al part of the groundnut plant and enhance the market value of groundnut. The experiment was conducted in the Department of Plant Breeding and Genetics, Pir Mehar Ali Shah, Arid Agriculture University, Rawalpindi during Kharif, 2020 with RCBD Design 15 genotypes keeping in view, 15 important yield-related parameters were selected to study under correlation and path analysis. Correlation analysis revealed a significant relati...
Aisha Khalid1,2, Roheela Yasmeen1*, Farah Ahmad1, Mudassar Aslam2, Muhammad Tayyab2
...been utilized in poultry plant-based diets to enhance nutritional value by neutralizing anti-nutritional factors. This study investigated the effects of a recombinant thermostable cellulase from Thermotoga naphthophila (CELTN) on the growth performance of broiler chicks when added to corn-based feed. The thermostable cellulase was produced using BL21 CodonPlus cells with the pET28a-Cellu vector under optimized conditions. A total of 150 one-day-old, unsexed br...
Bingzhao Yan1, Guiping Chen2, Lulu Ding1, Ruxue Huang1, Wenjing Yu1 and Jicang Wang1*
...istributed in fruits and plants, belongs to the class of flavonoids and is thought to have health benefits and protect many tissues from heavy metals. This experiment aimed to explore the effect of Que on Cd-induced PERK-CHOP apoptosis pathway in rat testis. A total of 24 8-week-old Sprague–Dawley rats were divided into four groups: control group, CdCl2 group, CdCl2+Que group, and Que group. The control group was gavaged daily with distilled water and 0....
Pangesti Nugrahani1*, Hery Purnobasuki2, Arif Nur Muhammad Ansori3, Jatuporn Anuchai4 and Anugerah Dany Priyanto5,6
... root growth in banana explants. 6-benzyl amino purine (BAP), a form of cytokinin, plays a significant role in stimulating cell division and differentiation. This study aimed to assess the impact of BAP on various growth parameters, including shoot initiation, root initiation, leaf initiation, shoot and root length, plantlet weight, root number, leaf number, and shoot number. The study followed a completely randomized design...
Aytan Ilham Zeynalova1*, Fariz Shahin Alakbarov1, Dunya Ali Isayeva1 and Sait Engindeniz2
Shahid Ali Khan1*, Farooq Ahmad1, Muhammad Zubair Akram2, Yan Tongyu3, Fatima Urooj1, Kamran Ahmad1, Saeed Ullah4, Sharmeen Zulfiqar5, Tahira Batool6, Aqsa Sarwar1, Yaqoob Sultan7 and Samreen Nazeer8*
... the Anthophyta class of plants. it consists of 340 genera and 9000 species and is cosmopolitan distributed throughout the world. The habits of plants are annuals, perennial herbs, shrubs, and trees. The identifying characteristic feature of plants in this family is the formation of milky latex, because of their succulent nature; they can tolerate or resist water deficit conditions. Differ...
Muhammad Nauman Hanif1*, Tanveer-ul-Haq1, Muhammad Naeem Akhtar2*, Abid Hussain3 and Amar Matloob4
...ancozeb. The cauliflower plant and soil samples were collected with the frequency of 1, 3, 5, 7, and 15 days after the application of pesticides. The collected plant and soil samples dried and extracted to determine pesticide residues using the modified QuECHERS method. Pesticides residues assessment was performed on High performance liquid chromatography (HPLC) at the Pesticide Quality Control Laboratory, Multan. There were...
Elkhan Rajaf Allahverdiyev1*, Azer Agazade Khalilov2, Araz Mustafa Gasimov2, Zahid Gurban Khalilov2, Parvana Bahlul Bayramova2, Kamala Fatiaga Abilova2 and Sait Engindeniz3
...rowth and development of plants sown in intercrops. The height of the mixed sowing sorghum plant increased to 245-255 cm, and the height of the pea plant increased to 100-110 cm in the variant with 10 t/ha+N70P125K90 of mineral and organic-mineral fertilizers. The researches prove that in the variant applied with organic-mineral fertilizers at the rate of 10 t/ha+N70P125K90, along with the...
Shaiqah Mohd Rus1*, Anika Z.M.R.2, Awis Sukarni Mohmad Sabere3, Mohd. Rushdi Abu Bakar4,5, Farahidah Mohamed4 and Abd Almonem Doolaanea6*
Nur Amira Idayu Romzi1, Aina Zahirah Mohd Suhaili1, Norhayati Ngah1,2 and Mohd Fahmi Abu Bakar1*
... crude proteins in maize plants. This study focuses on the determination of the crude protein production from different amounts of nitrogen composition in the fertilizers. A total of sixty maize seeds (GWG 888) were planted at Universiti Sultan Zainal Abidin (UniSZA) Kampus Besut Farm. Four different fertilizer treatments were used for the plant species, including control, NovaTec, foliar,...
Sami ul Haq, Basheer Ahmad* and Bilal Ahmed Qazi
...alysis (CCA) revealed 22 plant species distributed along environmental variables. Key soil factors influencing species distribution include pH (7.38), electrical conductivity (4.67 Sm/cm), moisture content (2.73%), and organic carbon (2.08%). The Shahpur Valley is characterized by coniferous forests, with Pinus wallichiana as the most prevalent conifer species. However, primary threats include illegal logging for fuelwood and construction. To address these cha...
Mok Sam Lum, Nurul Fadhilah binti Aldam and Clament Fui Seung Chin*
...eived AE foliar spray in plant height (p = 0.0098), stem diameter (p = 0.0419), leaf area (p = 0.0364), cob length (p = 0.0077), and number of grains per cob (p = 0.0207) compared to the control plant received an optimal rate of 120 kg ha-1 urea without AE. No significant differences were recorded for chlorophyll content, cob fresh weight, and weight of 100 grains. It is found that sweet corn received high N with ...
Nur Anis Hashim1, Nor Hasima Mahmod1*, Abubakar Abdullahi Lema2, Lee-Hoon Ho3 and Mohammad Moneruzzaman Khandaker1
...x roselle from different plants. Calyx samples were labeled as fresh calyx (FC), air-dried (AD), oven-dried (OD), and freeze-dried (FD) according to treatments. Four extracting solvents, which were methanol, ethanol, aqueous, and hexane, were evaluated for their efficiency in extracting antioxidant components from the differently treated roselle calyx, and these extracts were used to determine antioxidant activities and contents by assessing DPPH scavenging ac...
Salim Saifullah1* and Achyut Adhikari2
...ia vulgaris, a medicinal plant with various pharmacological properties, has a longstanding history of global utilization. The biochemical components substantially impact the economy and pharmacological sector, providing various advantages. Nepetin, a flavonoid found in Artemisia plants, has been shown to possess various biological effects including anti-oxidant, anti-inflammatory, anti-cancer, and anti-apoptotic properties. ...
Ahmad Ibrahim Jalali1, Mudssar Ali1*, Hafiz Mohkum Hammad2,4 and Fawad Zafar Ahmad Khan1,3
...options (including dried plant powders and sand mixtures, and eucalyptus based biopesticides) on fall armyworm control, as well as their effects on non-target fauna. The results showed that fall armyworm damage was lowest in synthetic pesticide treatment, followed equally by eucalyptus-based biopesticide, sand mixtures of neem, red pepper, ash and turmeric, while the highest damage was recorded where no management was done. For the occurrence of the non-target...
Aimen Raza1, Muhammad Muzamil Ijaz1,2*, Adnan Younis1, Nasir Ahmad Khan3, Ahsan Akram1, M. Abdul Salam khan2 and M. Nadeem4
...r and outdoor ornamental plant. In horticulture, using sustainable growing substrates is an appropriate method of environmental management and provides nutrients to the plants. The goal of this study was to use plant-based substrates as growing mediums for ponytail palm production. The research was conducted at Lalazar Nursery, Gardening Wing Estate Management, University of Agriculture, F...
Farhan Anjum1*, Sheraz Ahmad Khan1, Raees Muhammad2, Yousaf Jamal1, Durrishahwar1, Jawad Ali Shah1 and Hidayat Ullah1*
...hi’ had the lowest plant height, whereas genotype ‘Bamkhel-2’ had the highest. Genotype ‘Bamkhel-2’ had the highest leaf area measured, whereas ‘Eidhi’ had the lowest. The highest grains per ear were noted for genotype ‘Bamkhel-2’ (567.40), and the minimum was recorded in ‘Saleem Khan-2’ (448.53). The genotype ‘CIMMYT Yellow’ achieved the highest thousand-grain weight (331.40g), wher...
Dietary Habits of Indian Gerbil Tatera indica Inhabiting Agro-Ecosystem of Pothwar Plateau, Pakistan
Anum Razzaq*, Tariq Mahmood, Ammara Saman, Ammara Baig, Nadeem Munawar and Muhammad Farooq
...eding on wheat-groundnut plants and grains as the crops approached maturity, wild flora (viz: herbs, grasses, seeds and tubers) invariably amongst crop stages and seasons. During spring season, wheat was the most frequently consumed cereal. But during winter, as groundnut crop approached towards maturity/harvested, gerbils consumed mainly nuts and grains, while in autumn and summer (non-crop periods), the rat species switched its diet to wild flora, and consum...
Faisal Noor1, Shahid Iqbal1, Muhammad Irfan Shan2, Muhammad Zeeshan Majeed3*, Abbas Sheer4, Muhammad Shahroz Khan3
...fruit production. Modern plant protection strategies predominantly based on synthetic pesticides have led to considerable decline in insect pollination services and sustainable production. The present study was aimed to compare the impact of different pollinator conservation techniques on fruit and yield parameters of round gourd (Praecitrullus fistulosus L.). The trial was conducted at College of Agriculture, University of Sargodha using randomized complete b...
Nesreen Z. Eleiwa1, Radwa A. Lela2, Eman K. Fathalla2
...especially Lactobacillus plantarum, have been frequently used as a starter culture for fermented sausage production. Water Kefir is another valuable product that causes sausage fermentation and enhances its flavor, quality, and shelf life. Therefore, this study was conducted to compare Lactobacillus plantarum, which acts as a control group, and different concentrations of Kefir 1%, 3%, and 5% in the fermentation process of o...
Muhammad Iqbal1*, Saba Iqbal1, Arbab Jahangeer1, Muhammad Arshad1, Naveed Akhtar2, Ansar Hussain3, Mussarrat Hussain4, Muhammad Shahid5 and Qaisar Abbas4
...losely linked to optimal plant population. However, many farmers adhere to traditional plant spacing practices, which often result in lower yields. Thus, standardizing plant spacing based on the crop’s requirements is essential for maximizing yield. Moreover, excessive vegetative development has been observed a major factor limiting yield improvement in cotton cultivation. Excessive ...
Muhammad Salim1,2*, Muhammad Zakria2, Ahmad Ur Rahman Saljoqi2, Shahid Sattar2, Ayhan Gökçe1, Amjad Usman3 and Hayat Badshah4
... P. hysterophorus (whole plant, stem, leaves and flower extracts) and control (only water) which were applied randomly within each block. Wheat variety “Faisalabad 2008” was sown in the first week of December and general agronomic practices were applied as per the recommendations for wheat sowing. The pre- and post-spray data were collected after 1, 2, 3, 7, 14 and 21 days. The aphids population was found on the decreasing trend after spray applica...
Shahid Ali Khan1*, Farooq Ahmad1, Fatima Urooj1, Shabana Ehsan2, Yan Tongyu3, Tahira Batool4, Aqsa Bibi1, Muhammad Bilal1, Amrat Eman1, Javeria Tariq1, Ansa Asghar1, Yang Yan5, Asima Shabbir2 and Samreen Nazeer6*
... the Anthophyta class of plants and has 340 genera and 9000 species and is found in many parts of the world. Plants of this family exhibit various habits, including annuals, perennial herbs, shrubs, and trees. The distinguishing trait of plants in this family is the production of milky latex due to their succulent nature, enabling them to withstand or withstand water scarcity conditions. V...
Khaled A. El-Dougdoug1, Wael S. El-Araby2* and Rehab A. Dawoud3
...al;">The viromes of land plants are enormous and diverse, and they are dominated by RNA viruses. However, reverse-transcription and single-stranded (ss) DNA viruses also make significant contributions to the viromes of land plants. In this article, we present a thorough taxonomy of viruses that was recently adopted and is based on phylogenomic investigations. This taxonomy is then applied to the plan...
Soumia Ed-Day1*, Meryam Laanaya1, Chaimae El Kourchi3, Radia Elgui1, Fatima Ezzahra Kacimi2, Latifa Didou1, Samira Boulbaroud2, Hicham Harhar3, Fatima-Zahra Azzaoui1
...uable insights into this plant’s safety and physiological impact.
Keywords | Acute toxicity, Schinus terebinthifolius Raddi, Glycemia, Lipid profile, Behavioral assessments, Wistar rats
...
Muhammad Umair Khan1*, Abdur Rehman1, Mansoor Ali Khan1, Abdur Rahman Khan1, Sajid Ali1 and Zeeshan Ahmad2
...se of fibers of non-wood plants in paper production is also linked to a number of issues, such as collection, transportation, challenges of chemical recovery, alteration of morphological properties and slow water retention. The main consumers of non-wood fibers, small mills, usually have poor pollution control systems. Non-wood materials are now a more viable option as raw materials for papermaking due to a number of considerations. Several pulping methods can...
Muhammad Ashfaq Khan, Basheer Ahmad, Sami Ul Haq, Bilal Ahmed Qazi*, Saifullah
...tion and analysis of the plant species present in the ChirPine forest. The study area is characterized by a dominant presence of Pinus roxburgii, accounting for a substantial 73.0% of the total trees. However, this forest is not a monoculture; it boasts a diverse array of tree species. Robinia pseudacacia, Pyrus pashia, Alianthus altissima, and Eucalyptus camaldulensis make up significant portions of the forest at 6.4%, 0.1%, 4.6%, and 4.3%, respectively. Othe...
Wan Nurfarzana Wan Mohamad Zani1, Norrizah Jaafar Sidik1*, Asmah Awal2, Nurul Izzati Osman3, Lyena Watty Zuraine Ahmad1 and Mohd Khairi Nordin4
...plusmn; 0.8 shoots per explant in media supplemented with 0.5 and 4.0 mg L-1 BAP. The longest shoots were observed in liquid media with 0.5 mg L-1 BAP, with an average length of 3.57 ± 0.44 cm. Subsequently, the explants underwent rooting in both semi-solid and liquid MS media, supplemented with various IBA concentrations over a 5-week period, with rooting observed solely in the cultures in liquid media. The rooted
Ahmed Shamkhi Jabbar1* and Saadoon Murad2
...of P. solenopsis on host plants can cause significant economic losses and damage. The effectiveness of commercially available chemical insecticides and biopesticides against cotton mealybugs was evaluated under lab and field conditions by using the secreted toxins of symbiotic bacteria Xenorahbdus nematophlia, Blaiser® as a biopesticide, and chemical pesticide Sivanto®. Our results indicate that the efficacy of secreted toxins by symbiotic bacteria X. ...
Bounthan Sounyvong1, Yohan Lee2 and Eun-Jae Lee3*
...ds than in burned rubber plantation stands. The value of overstory to understory vegetation coverage and the volume of coarse woody debris were strongly associated with small-mammal abundance in the PKKNPA. Thus, post-fire silvicultural practices should take the differences in small rodent abundance as well as forest structure into account. Long-term experiments may help illuminate the potential effects of management strategies after forest fires in the Lao PD...
Kamal Ahmed El-Shazly1, Amira Abd El-Latif1, Nagwa Elhawary2, Asmaa F. Alswaf1, Foad Farrag3, Samy Sayed4, Mohamed El-Sharnouby5 and Mustafa Shukry6*
... tenella parasite were implanted orally into all but the negative control groups. According to the current findings, G2 demonstrated a significant increase in feed conversion rate, oocysts count, lesion score, mortality rate, count total leucocytic, ALP, ALT, AST, total bilirubin, creatinine, urea, uric acid, and MDA level, the body weight significally reduction, weight gain in the body, feed consumption, hematological parameters, lymphocytes%, cholesterol lev...
Jumiati Asis1, Nur Aainaa Hasbullah1, Mohamadu Boyie Jalloh1, Noor Khairani Mohamad Basri1, Palanivell Perumal2, Peter Mojiun2 and Mohd. Rashid Mohd. Rakib1*
...i>in vitro and in planta inhibition of G. boninense using Trichoderma isolates were evaluated. A total of 20 Trichoderma isolates were collected. Among the isolates, T4RH and T8R were selected for further in planta experiments as they showed significant inhibitory activity against G. boninense via in vitro dual-culture and dual-plate assays. Isolates T4RH and T8R were iden...
Heni Suryani1, Sri Novianti2*, Fatati2, Jul Andayani2, Saitul Fakhri2, Muhammad Ambar Islahudin3
Nbaa Mutea Abid AL-Alh1, Nuha Hatem Khalaf1, Nagam Khudhair1*, Ahmed Khalid2
...anolic extract of costus plant at a dose of 5 mg/kg. Groups G3, G4, and G5 served as a prophylaxis group dosed 1 hour after CPZ administration. Oral doses are given once daily for 4 weeks. The results of G2 showed increased body weights in rats and liver weights (286.250±13.750 Body Weight) (10.525 ± 0.217 Liver Weight). In contrast a decrease in body and liver Weight is observed among control and Prophylaxis groups (G3, G4 and G5) while no signi...
José J. Cedeño-Díaz1, Caridad A. Torres-García1, Marina García1, Freddy Zambrano-Gavilanes1, Naga Raju Maddela2* and Felipe R. Garcés-Fiallos3*
...t on seedlings and adult plants of INIAP H-603 maize under semi- controlled and field conditions at the Pacific coastal Ecuador. Unfertilized and urea-fertilized plants were used as controls in both environments. Under the greenhouse conditions, different phytometric characteristics were evaluated at 21 days after sowing (DAS). In the field conditions, the incidence (%) and severity (%) of Curvularia leaf spot (Curvularia...
Asfand Yar Khan1, Syed Saleem Ahmad1*, Muhammad Avais1 and Kamran Ashraf2
...of 5 different medicinal plant extracts against Shiga toxin (E. coli O157:H7) based on the in-vitro and in-vivo trial. A total of twenty-one (n=21) PCR-confirmed isolates were selected for detection of virulent genes in-vitro trial (zone of inhibition). For in-vivo trial, forty-two (n=42) day-old chicks were divided into seven equal groups randomly (n=6 birds/group), and were classified as: G1 (Azadirachta indica @ 18.25 mg/ml), G2 (Melia azedarach @ 15.75 mg/...
Sadaf Aman1, Yung Fu Chang2, Javed Iqbal Qazi1*, Rahman Ullah3* and Farah Aman4
...in the feed derived from plant origin ingredients. This practice will economize, promote growth and prevent feed associated stress in the aquaculture industry in this country in an environmentally sustainable way....
Rukayat Omolara Folarin1,2, Nurhadirah Hairil1, Nurafiqah Anis Ismail1, Putri Athirah Zamrifana1, Lina Nadhirah Abdullah1, Muhammad Afiq Zabhin1, Ariff Imran Alkaf1, Farrah Izzuanie Zainudin1, Hanisah Basir1, Asmad Kari1, Enike Dwi Kusumawati3, I Wayan Karyasa4 and Connie Fay Komilus1*
...ernative to conventional planting, providing a constant supply of green fodder for livestock year-round. It involves growing plants without soil in water or a nutrient-rich solution in a greenhouse. All parts of the hydroponic fodder (leaves, stems, roots, and grain) are fed to livestock by the farmers. This experiment aimed to identify the effect of goat manure liquid fertilizer on growth performance, production yield and p...
Norsyasya Shari1, Nur Nabilah Husin1, Zalilawati Mat Rasid1, Maaruf Abdul Ghani2 and Noroul Asyikeen Zulkifli1*
...onut milk drink (CMD) is plant-based milk that has been formulated into ready-to-drink beverage in response to the changing lifestyles and the growing health concerns among people nowadays, which influenced people towards choosing dairy product alternatives. The aim of the research was to ascertain the physico-chemical, nutritional properties and sensory characteristics of formulated CMD. Formulated CMD contains coconut milk, water, carboxymethyl cellulose (CM...
Masoumeh Younesabadi1*, Parviz Sharifi Ziveh2 and Sepideh Hatami3
...eflan 2.5 L ha-1) as pre plant, bentazon (Basagran 1.5 L ha-1) as post-emergence, thifensulfuron-methyl (15, 30, 45 and 60 g ha-1) and imazethapyr (Pursuit 0.8 L ha-1) as pre-emergence, and weed free treatment. Weed density was measured at 30 days after treatment and weed dry weight was measured before soybean harvesting. Data were analysed with SAS 9.2 and means comparison was done by LSD at p=0.05. Based on the results, the highest weed control efficiency (W...
Sherine Abbas1, Heba M.A. Abdelrazek2*, Eman M. Abouelhassan3, Nayrouz A. Attia4, Haneen M. Abdelnabi4, Seif El-Eslam E. Salah4, Abdelrahman M. Zaki4, Mohamed A. Abo- Zaid4, Nadia A. El-Fahla5
...lign: justify;">The neem plant, Azadirachta indica, is one of Asia’s and Africa’s most important medicinal plants. This research intended to explore the immunological potential of dietary neem leaves extract prenatal exposure on male Wistar albino rats’ offspring. In this experiment, 18 adult female and 6 male Wistar rats were used. All experimental animals were kept in the same environment which was suitab...
Bassant Mahmoud Emam1, Jehan Abd Elrazek Hassanen1, Abeer Gaffer Ali Hassan3, Azza Mahmoud Abdullah1, Hadeer Said Aboelnaga2, Amina Ali Dessouki2*
...APA). However, medicinal plant remedies, e.g., Fenugreek (Trigonella foenum-graecum), are efficiently utilized for DM treatment with low side effects. Accordingly, the study aimed to compare the effects of DAPA and Fenugreek seeds powder (FSP) or extract (FSE) on hyperglycemia, dyslipidemia, and hepatic alterations of streptozotocin (STZ)-provoked DM rats. Here, DM was triggered by administrating 10% fructose (Fr) for two weeks, then intraperitoneally injected...
Mohamed E. Enany1, Ahmed M. Hamouda2, Reem M. Khashaba3*
...combination with natural plant extracts. Turkey poults were assayed for the presence of Enterobacteriaceae species with prevalence 40% (40/100) of the tested samples. Escherichia coli has the highest prevalence rate with 77.5% followed by klebsiella spp and Salmonella spp. with7.5%and 5% respectively.Resistance of the collected Enterobacteriaceae strains was determined by the Kirby-Bauer disk diffusion test against a panel of antibiotics.. The isolates were hi...
Asim Karim*, Anwar Ali, Bilal Ahmed Qazi, Nowsherwan Zarif and Wadood Shah
... These are regions where planting has been practiced extensively in the past. The cultivation of Paulownia today is usually achieved with hybrids of selected traits produced in vitro propagation. The major hybrids include in vitro clone 112, Cotevisa 2 and Shan Tong. Compared to Southern European countries, Central European countries have slower rates of growth and lesser manufacturing capacities. Paulownia breeding experiments are new and often replicate cult...
Bakht Zada1, Ahmed Zia2, Sardar Azhar Mehmood1, Abdur Rehman3*, Toheed Iqbal4*, Kiran Shahjeer5 and Shabir Ahmed1
...a prevalent pest in pine plantations globally. This study aimed to investigate the aphid complex affecting pine trees in the district, revealing two speciesCinara atrotibialis and Cinara atlanticathat are newly recorded in the country. The study provides detailed information on morphometry, taxonomic descriptions, host plants, and global distribution for each of the identified species. ...
Muhammad Usman Saleem*, Tahir Hussain Awan, Bilal Atta, Arshed Makhdoom Sabir and Muhammad Ijaz
...tiller per square meter, plant height, panicle length, and rice yield were recorded. The combined results indicated that the NP + CAN treatment consistently produced the highest values for key agronomic traits. Specifically, this treatment resulted in the greatest tiller density (344.00 tillers/m²), tallest plants (148.50 cm), longest panicles (28.93 cm) and highest 1000-grain weight (23.21 g). Moreover, the NP + CAN co...
Sanjita Gurau1,2 and Ram L Ray1*
...wed significantly higher plant spreading in Sunny House. The highest number of male flowers plant-1 (29.56) and female flowers plant-1 (13.81) were recorded in Shlesha 1214, while the lowest number of male and female flowers were recorded in grey zucchini, i.e., 24.43 and 11.68, respectively. Similarly, a higher number of days to 50% female flowering (29.56), higher number of pickings
Qasim H.A. Aljboori* and Saadoon Murad Saadoon
...e has been increased and plant diseases management has become one of the most important challenges in agriculture. Moreover, plant diseases remain a major factor limiting agricultural production. F. solani is one of the most important pathogens that causes rot disease in rice and affects plant growth. Many Fusarium species can infect rice plants and affe...
Eman Abdelrazik1, Sahar H. Abdel-Baset2*, Abdelghafar M. Abu-Elsaoud3,4 and Shimaa M.A. Mohamed5
...ction of peanut crops is plant-parasitic nematodes, which are the most destructive pathogens that affect peanuts globally. A survey of plant-parasitic nematodes (PPNs) in peanuts was conducted in Ismailia, Egypt. The host suitability of four Egyptian peanut cultivars for Meloidogyne arenaria cultivation under greenhouse conditions was also examined. Additionally, the effects of fulvic acid, compost, and cattle manure, either...
Jalal Ahmed Khan1, Ishfaq Ahmed Hafiz1, Ayesha Maryam2, Sher Muhammad2 and Rashid Iqbal Khan1,3*
...e maximum no. of leaves, plant height and lateral branches were found in 40 ppm AgNo3 application. Similarly, the best outcomes regarding reproductive parameters were observed from 40 ppm AgNo3. Thus, the use of nanoparticles is suggested as a promising technique to create a healthier environment for optimizing growth and productivity of Gloxinia flower....
Subscribe Today
Receive free updates on new articles, opportunities and benefits
Interact with ResearchersLinks
Guidelines and Support
ResearchersLinks Initiatives
Information and Help
Follow Us
 |
 |
 |
 |
© 2024 ResearchersLinks. All rights Reserved. ResearchersLinks is a member of CrossRef, CrossMark, iThenticate.