Submit or Track your Manuscript LOG-IN

Nicola J. Stonehouse

... RNA-dependent-RNA polymerase of foot-and-mouth disease virus. The aptamers are able to inhibit the function of the enzyme both in vitro and in the context of a sub-genomic replicon and highlight the future potential of this technology in many aspects of virus research as well as in diagnostics and therapeutics.

...

Simon Mwangi Kihu1*, George Chege Gitao1, Lily Caroline Bebora1, Njenga Munene John1, Gidraph Gachunga Wairire2, Ndichu Maingi1, Raphael Githaiga Wahome1, Davis Njuguna Karanja1, Julius Otieno Oyugi3, Ernest Lutomia3

...ranscription–polymerase chain reaction (qRT-PCR). Collectively, results indicate the continuous persistence of PPRV in Kenya.

...

Muhammad Ashraf Khan1, Hizbullah Khan1, Abid Farid2

...ergence (mean) of tiny parasitoid from host eggs treated during egg, larval and pupal stages with the virus at field dose (x), 2x dose, and 0.5x dose ranged from 83.2- 87.3%, 87.1- 91.6%, and 83.7- 89.7%, respectively, relative to control eggs treated with water. The parasitism rates by female parasitic wasps emerged from host eggs treated at x dose when paras

Thomas J. Coleman III

Science, Religion and Culture, Vol. 2, Iss. 2, Pages 39-41
...reclaim Darwin from the grasp of the New Atheists by charging him with uncovering “[t]he truth about religion.

 

...

Hayat Badshah1*, Farman Ullah1, Abid Farid2, Ahmad-U-Rahman Saljoqi1, Sajjad Ahmad3

...optera: Encyrtidae) (a parasitoid of the cotton mealybug) in the Laboratory, it is necessary to know the development capacity of the cotton mealybug, Phenacoccus solenopsis Tinsley (Sternorrhyncha: Pseudococcidae), on different host plants. Such studies would identify the best host plant for its efficient rearing. The present study investigated some basic life table parameters i.e. female life span, adult female weight, longevity and reproductive potential of ...

Reviewed by Dr William Patterson

...demonstrate that the contrasting mindsets underlying science (with its emphasis on rationality, evidence, experimentation, and observation) and religion (with its emphasis on faith) are intrinsically opposed and that all attempts to reconcile them must result in failure. Coyne has much of use to say on the topic and many of his points are powerfully made. His case is weakened, however, by his incoherent treatment of epistemology. This problem is serious in tha...

Mudasir Irfan Dar*, Fareed Ahmad Khan and Farha Rehman

E-mail | irfanmudasir@gmail.com

...ntioxidative enzymes in Brassica juncea L. cv. alankar was investigated. Forty-day-old pot plants were exposed to different concentrations of the insecticide, ranging from 0 to 40 grams active ingredient per hectare (g.a.i ha-1) through foliar spray. Analyses were done at days 3, 7, and 15 after treatment. Lipid peroxidation rates and contents of proline, ascorbate (ASC), glutathione (GLU), antioxidative enzymes; superoxide dismutase (SOD), catalase (CAT), asc...

Rick Repetti

...hat grace doesn’t erase the imperfection of creating imperfection. However, Adams’s theodicy arguably maintains two points: (a) non-existing superior beings cannot be harmed by not being created, and (b) if God must create superior beings, we wouldn’t be them. Setting aside whether God is justified in satisficing per se, I target one element of Adams’s satisficing theodicy, viz. (b), his “non-identity” thesis: we would not b...

Seyed Mohsen Mirbod

...the knee orthosis in contrast to normal walking. Moreover, the mediolateral moment applied on the knee joint decreased significantly. This new design of the orthosis improves the performance of the subjects during walking. It carried same performance as that of the knee cage, and additionally is more cosmesis, ease in use and is economical.

...

Khalid Ali1*, Amanullah Jan2

...omic returns of Canola (Brassica napus L. cv. Bulbul-98). The experiments were laid out in randomized complete block design with split plot arrangement having three replications. Findings of the experiment revealed that guar as previously green manuring crop considerably increased leaf area index (LAI) 4.4, crop growth rate (CGR) 5.7 g m-2 d-1, seed yield (2329 kg ha-1) and harvest index (22.10%). Incorporation of whole plant had significantly increased LAI (4...

Ilham Ulla, G. Arjumand, Nawab Ali and Mohammad Akmal*

...es decreased production drastically. Moreover, an increase of N from 120 kg ha-1 is not of much value under these circumstances but have the potential to investigate for increasing production of the sunflower crop in the region.  

...

Haq Aman Ullah1*, Aneela Zameer Durrani2, Muhammad Ijaz2 and Aqeel Javeed3

.../i> and Aspergillus parasiticus. Aflatoxin B1 is the most common metabolite highly toxic for humans and animals. In the present study contamination status of aflatoxin B1 in cotton seed cake, wanda, wheat bran and homemade concentrate mixture of dairy goats was investigated in district Lahore of Pakistan. A total of Twenty 20 goat farms were randomly selected and out of that 40 feed samples 2 from each farm were collected in the month of April. All...

Tahir Khan, Raziuddin, Fakharuddin* and Muazam Jamal Razi

...ortant attributes in Brassica napus using 10 parental lines and their 21 F4 populations. Significant differences were observed among genotypes, parents, F4 populations and parents versus F4 populations for days to 50% flowering, days to maturity, plant height, primary branches plant-1 and main raceme length. Among parents, CA2, DH8, DH4, CA4 and DH6 performed better for different traits. Whereas among F4<...

Qaizar Ahmed1, Fida Mohammad2, Hidayat-ur-Rahman2, Sheraz Ahmed2* and Fakharuddin2

...uo;KHG24’ with contrasting traits were crossed in all possible combinations to generate 7 x 7 diallel crosses. In 2008 and 2009, all F1 hybrids along with their parent cultivars were planted in randomized complete block (RCB) design with four replicates at Tobacco Research Station Mardan (plain) and Tobacco Research Substation Mansehra (hilly). Data for all traits were analysed in pooled analysis and individual environments. Heterosis over bet...

 Muhammad Ishaq and Raziuddin

 
...F1 crosses in rapeseed (Brassica napus L.) during 2011-2013 to scrutinized potential lines, hybrids, and nature of gene action involved in the inheritance of maturity and plant architecture traits. Analyzed data revealed highly significant differences among the genotypes for days to flowering, maturity, plant height, primary branches plant-1 and main raceme length. Analysis of combining ability revealed highly significant GCA (general combining ability), SCA (...

 Umed Ali Laghari, Ahmed Naqi Shah, Muhammad Nawaz Kandhro, Zia-ul-Hassan, Ghulam Murtaza Jamro and Khalid Hussain Talpur

...in Pakistan, especially grass pea (Lathyrus sativus L.). We evaluated K requirements of five elite grass pea genotypes in a field experiment. The experiment was organized in factorial block design with three replications. The study involved five commonly grown grass pea genotypes (Sel-B 111, Sel-449, Sel-190, Sel-1785 and Sel-945) and three K doses (0, 10 and 20 kg K ha-1). The results rev...

Jannatul Noor, Md. Ahaduzzaman, Mir Md. Afzal Hossain, Mohammad Alamgir Hossain, Sardar Abdur Rahim and Md. Samun Sarker

...are blood sucker, ecto-parasites of a wide range of mammals that enforce major economic threats to the livestock industry throughout the world. The present cross sectional study was conducted to assess the prevalence of tick in goat’s population of three different areas (Kaptai, Kattoli and Chittagong Veterinary and Animal Sciences University) of Chittagong, Bangladesh. A total of 60 goats were examined for tick infestation in three places using random p...

 Ian von Hegner

...Democracy is usually contrasted with the concept of dictatorship, and is defined as a type of government in which power flows from the citizens to the leaders of government, who are selected through free elections. This article argues, that if the concept of democracy is generalized to be universally applicable, then the concept of hypothetical gods’ right to rule results in dictatorship. Whereas the concepts of dictator and tyrant originally had a more ...

Rashid Mahmood1*, Saima Asad2, Waqar Ahmad1, Ghulam Sarwar1, Muhamamd Khalid Rafique1, Noor Islam1, Ziyad Abdul Qadir1 and Zain Ul Abiden2 

... trays on reducing ectoparasitic mite Varroa destructor Anderson and Trueman (Acari:Varroidae) populations in honeybee Apis mellifera linguistica (Hymenoptera: Apidae) colonies in the winter, spring and summer season (2013-14). Four honeybee colonies were exposed to oxalic acid (3.2%), thymol (0.5 g) and formic acid (65%) on screen bottom boards in winter, spring and summer seasons. The fourth group had screen bottom board trays but without any chemical. There...

Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek

..., Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata and Lecanicillium muscarium isolated from root and soil samples collected in Prague, Czech Republic, were cultured on agar media and tested against Meloidogyne hapla both in-vitro and in-vivo. All fungi proved to be efficient in reducing final population of northern root knot nematode M. hapla and giving vigour to the plants. In...

Felwa A. Thagfan1, Mohamed A. Dkhil1,2* and Saleh Al-Quraishy1

...ecreased the number of parasitic stages and the number of goblet cells in the jejunal villi in the infected mice. Moreover, the expression of the goblet cell mucin gene, muc2 was upregulated after treatment with the root extract. Based on our results, it could be concluded that, S. persica root extracts acts as anticoccidial agent.

...

Paul I. Ankeli, Mashood A. Raji, Haruna M. Kazeem, Moses O. Odugbo, Nendir J. Umaru, Idowu O. Fagbamila, Livinus T. Ikpa, Obinna O. Nwankiti, Issa A. Muraina, Pam D. Luka and Nicholas D. Nwankpa

...chemical tests and polymerase chain reaction (PCR), respectively. Six (6) were observed to ferment glucose, reduce tetrazolium chloride and hydrolysed casein. They had no phosphatase activity, did not produce ‘film and spots’ and neither hydrolysed arginine nor urea and were preliminarily identified as members of the Mycoplasma mycoides sub-cluster which comprises Mmm and Mycoplasma mycoides subspecies capri (Mmc). Three (3) of the 8 Mycoplasma iso...

Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1

... rats. Serum aminotransferases (ALT and AST), alkaline phosphatase (ALP), lactate dehydrogenase (LDH), total protein, total bilirubin, hepatic glutathione (GSH), nitric oxide (NO), superoxide dismutase (SOD) and lipid peroxides (LP) levels were estimated. Moreover these biochemical parameters were confirmed by histopathological examination using hemotoxylin and eosin (H&E) and Mason trichrome stains (MTC). Immunohistochemical investigations for the express...

Abida Saleem, Sajida Parveen and Muhammad Jamal Khan

... soil suggesting its contrasting effect at different IZnA levels.

...

Aqila Shaheen and Mehwish Matien

... uses viz. forest land, grassland, and cultivated land were quantified. These land uses belonged to two soil groups having different soil type and climate. Selected soil groups were Inceptisols (site 1) and Mollisols (site 2). Soil samples were analyzed for bulk density (BD), soil organic carbon (SOC), total nitrogen (TN), available phosphorus (AP), extractable potassium (K) and pH. Statistically (p ≤ 0.05) higher SOC contents of Inceptisols and Mollis...

Ai Ming Zhou1,2, Guang Wen Liang2, Ling Zeng2, Yong Yue Lu2 and Yi Juan Xu2*

...tly increased, and the parasitism of mealybug was obviously decreased, both in fire ant-infested plots and in fire ant-free plots. Colony growth rate of mealybug in fire ant-infested plots was greater than fire ant-free plots. These results suggest that S. invicta suppresses the exploitation of honeydew-producing hemipterans by ghost ant and occupies most of the honeydew resource.

...lyzed by real-time polymerase chain reaction (PCR), which demonstrated high expression level in the brain. During embryogenesis, SS1 mRNA was detected during early-stage embryonic development, decreased during subsequent developmental stages then increased gradually from the stage of midgastrula onward. This study provides some basic evidence that SS1 may play a role in growth, development and metabolism in C. nasus, and provides a basis for further study of S...

Mostafa A. Abdel-Maksoud1,2, Fathy A. Abdel-Ghaffar2, Azza El-Amir2, Gamal Badr3 and Saleh Al-Quraishy1*

...e and gamma irradiated parasite was not studied before. A total of 30 female BWF1 mice were randomly divided into three groups as follows: group (I) control group (lupus uninfected); group (II) live P. chabaudi infected group (lupus + live P. chabaudi infection); and group (III) irradiated P. chabaudi-infected group (lupus + irradiated P. chabaudi-infection). All groups were killed at day 14 post infection. Histological and biochemical investigations were perf...

Imed Ben Salem*, Aymen Ben Ibrahim, M’barek Chetoui and Said Nouira

Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2

...erse Transcriptase Polymerase Chain Reaction (RT-PCR). Out of 24 samples taken from each organ, 22, 21, and 18 samples from trachea, lungs, and intestine showed viral RNA, respectively. Taken together, results showed that the H9N2 is endemic and widely distributed in asymptotic layers. Furthermore results indicated that H9N2 subtype may survive in layers without showing any symptoms.

...

G.E. Odo1*, E.J. Agwu1, N.I. Ossai2, C.O. Ezea3, J. Madu1 and V. Eneje2

...LP), alanine aminotransferase (AST) and aspartate aminotransferase (AST). Similarly, aluminium phosphide enhanced levels of AST, ALT and ALP as both concentration and time dependent in elevation were recorded when compared to the control. The use of aluminium phosphide in agricultural fields near water bodies should be strongly monitored in view of the observed effects on this catfish fish physiology. The use of aluminium ph...

Sana Irshad Khan1*, Zafar Iqbal2, Hamid Ullah Shah2 and Shaukat Hussain3

...emonium sp., Alternaria brassicicola, Pythium sp. and Aspergillus flavus were screened against Wilt causing pathogens using the dual culture assay. Among them, Aspergillus flavus was found active fungus against the selected vascular Wilt causing fungus and bacteria, i.e. Fusarium oxysporum (87.50 ± 0.11% inhibition), Xanthomonas campestris (67.00 ± 0.46% inhibition) and Clavibacter michiganensis (72.00 ± 1.02% inhibition). The A. flavus wa...

Gökhan Kuş1,*, Hatice Mehtap Kutlu2, Djanan Vejselova2 and Emre Comlekci3 

...and JC-1 staining and ultrastructural alterations by transmission electron microscopy. Our data clearly shows that ceranib-2 is more effective than C2 ceramide in promoting apoptosis. The cytotoxic effects of these components cause ultrastructural changes in A549 cells.
...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahimand Ghada Kamal El Khalafawy2,*
...ic identification, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was applied for identification of Candida species, Cryptococcus albidus, Saccharomyces, Trichosporn, Torulopsis and Rhodotorula. Using universal primers ITS1-5.8S-ITS4 amplified ITS region. And it yielded a unique PCR size of approximately 376-930 bp. PCR amplicons were digested with enzyme MspI and the generated bans corresponded to the predicted size.
...
S. Bushra1,*, M. Tariq1, M. Naeem1, M. Ashfaq1, I. Bodlah1 and M. Ali2
...and performance of endoparasitoid of aphids, Diaeretiella rapae. Seven different treatments of semiochemicals and plant extract were applied on aphid pests, Sitobion avenae and Rhopalosiphum padi and parasitoid was released. The data regarding emergence, parasitism, sex ratio, tibia length, adult weight and adult longevity of parasit...
Muhammad Arshad1*, Hafiz Azhar Ali Khan2*, Faisal Hafeez3, Ravaid Sherazi1 and Naeem Iqbal4
...e aphid, Brevicoryne brassicae L.;pea aphid, Acyrthosiphon pisum Harris) was evaluated in the laboratory in no choice and free choice feeding assays. In the no choice feeding assay, the stages of beetle (adults, 3rd and 4th instar) consumed more aphids than early stages (1st and 2nd instar). In the free choice feeding assay, the consumption of pea aphid (77.647) was statistically high followed by spinac...
Naime Zülâl Elekcioğlu*
...developmental time and parasitization rate of Citrostichus phyllocnistoides was evaluated on Phyllocnistis citrella at nine constant temperatures ranging from 15ºC±1 to 35ºC±1 in 2.5ºC increments in the laboratory. Developmental periods of immature stages ranged from 34.98 days at 15ºC to 9.15 days at 35ºC. The lower developmental threshold for C. phyllocnistoides estimated was 8.93°C. Mortality r...
Lingtong Ye1, Chao Cao1,2, Bin Tang1,2, Tuo Yao1, Ruixuan Wang1 and Jiangyong Wang1*
...demonstrated that the intraspecific distance of P. websteri was 0.33%, whereas the interspecific distance of P. websteri ranged from 18.88% (with P. brevipalpa) to 24.79% (with Boccardia proboscidea). The intraspecific genetic distances of polydorids examined in the present study ranged from 0.33% to 1.67%, whereas the interspecific distances ranged from 18.88% to 24.79%. Such large barcoding gaps...
Mahanama De Zoysa1, Si-yun Ryu1, Hyeon-cheol Kim2 and Bae Keun Park1*
...fy;">A freshwater ecto-parasitic crustacean was isolated from the naturally infested goldfish (Carassius auratus) purchased from commercial aquarium in Korea. Based on the morphological comparison with all Argulus species, isolated fish lice was identified as Argulus japonicus Thiele, 1899. A. japonicus is native to Asia, which also is a habitat for its typical hosts, such as goldfish and common k...
Rashid Mahmood1*, Saima Asad2, Ghulam Sarwar1, Waqar Ahmad1, Ziyad Abdul Qadir1, Ammara Balouch1 and Muhammad Khalid Rafique1
...i> Linguistica) from Brassica campestris was examined during February - March 2015 at National Agricultural Research Centre, Islamabad. Twenty five honeybee colonies were used which had similar number of worker bees, brood and stored food. In order to study the foraging activity of honeybees in the field condition, the number of pollen foragers returning to the hive entrance was recorded for 10 min duration on hourly basis between 0800 h to 1600 h for 3...
Sumra Ashraf1, Zain ul Abdin1,*, Saqi Kosar Abbas2,Rao Sohail Ahmad Khan3, Muhammad Tahir1, Sehrish Rasool1, Maryam Anwar1 and Fiaz Hussain1
...tential, the adults of parasitoids mostly depend on supplemental food sources, such as sugars and other carbohydrates. These food resources are commonly obtained from animal secretions or plant exudates which include honeydew, fruit juices and both floral and extra-floral nectar. A direct behavioral assay was conducted to investigate the dietary preference and effects of different diets on the fecundity, sex ratio and longevity of B. hebetor. Three diff...
Sidra Ilyas1, Abdul Rehman1* and Qasim Ilyas2
... and Pb treatment in contrast to Cd, Cr and Cu exposure. GSH: GSSG ratio declined after As, Pb and Cr treatment, whereas non-protein thiol levels were higher after Cd and As treatment followed by those of Pb, Cr and Cu treatment. Candida sp. PS33 was able to remove 78% (Cd), 70% (As), 82% (Cu), 65% (Cr) and 87% (Pb) from the medium after 8 days of incubation. This multi-resistant yeast can be used efficiently for the removal of toxic metals from the was...
Tanzeela Riaz1, Farah Rauf Shakoori2* and Syed Shahid Ali3
...the possible role of esterases in development of tolerance/resistance in phosphine-tolerant populations. The level of total esterases, carboxyl esterases, choline esterases, acetylcholine esterases and aryl esterases were determined in 4th & 6th instar larva...
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
... justify;">Among plant parasitic nematodes, root knot nematodes are the major problem for vegetables including eggplant. Chemical control of nematodes is hazardous to health and causes environmental pollution by contaminating underground water. The bio-protectant potential of mycorrhizal fungus (Glomus mosseae) and neemex® (Azadirachtin) against invasion and development of Meloidogyne incognita was tested in eggplant roots in greenhouse pot t...
Muhammad Luqman Sohail1,*, Muhammad Sarwar Khan1, Muhammad Ijaz1, Muhammad Avais1, Muhammad Yasir Zahoor2, Omer Naseer1 and Muhammad Usman Saleem3
...), aspartate aminotransferase (AST), alkaline phosphatase (ALP), blood urea nitrogen (BUN) and creatinine which indicate renal and liver damage. Concentration of Na, K, Ca, Mg, P, Cu and zinc in serum were significantly decreased (P< 0.05), indicating tubular damage in kidneys. 
...
Amjad Islam Aqib1, Muhammad Ijaz1,*, Aneela Zameer Durrani1, Aftab Ahmad Anjum2, Riaz Hussain3, Saba Sana2, Shahid Hussain Farooqi1, Kashif Hussain1 and Syed Saleem Ahmad1
..., and cefotaxime. In contrast to this sulphaphenazole, gentamicin, amikacin, and ciprofloxacin were highly sensitive. Piperacillin, Tazabactam and cinxacin were moderately effective against Staph. aureus. The concluded remarks of research staged Staph. aureus to the most obvious pathogen and widely resistant to antimicrobials camel mastitogen. The risk factors were found soul determinants of pathogen spread among mammary glands of camels.
...
Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*
... from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids. The calculated molecular weight of crucian carp Wap65 protein (CcWap65) is 50.8kDa, containing a signal peptide cleavage site between amino acids 18 and 19. The CcWap65 is a hydrophilic protein and no trans-membrane topological proteins. The SMART analysis revealed that CcWap65 contains three hemopexin-like...
Fazal Said1,Mian Inayatullah2 and Hussain Ali3*
...nflower blossoms. In contrast, sunflower plots covered with insect-proof bags gave minimum seed production and oil contents, which most probably was because of bee visitors denied to forage on flowers of the crop. Results revealed that sunflower in blooming stage attracted large number of bee visitors particularly Apis mellifera and A. florea. Visitation/foraging of honeybee contributed significantly towards increase in the yield and quality of s...
Mürşide Dartay*, Tuncay Atessahin and Erdal Duman
...gher CPUE values. In contrast increasing depths gave rise to a decrease in CPUE values.
...
Sadaf Ijaz Malik1, Kiran Afshan2* and Mazhar Qayyum1
...e infected tissue. The parasites had formed pocked in the bile duct mucosa, glandular hyperplasia, thickened blood vessels. The results demonstrate that morphological markers, pathological, hematological and bile biochemical studies are effective tools that could be used as complementary in diagnosis of amphistome infections in ruminants. 
...
Akbar Ali1,*, Khalil Mohamed2 and Fawzia Toulah3

 

...>Toxoplasma gondii parasite, is one of the most worldwide parasitic infections of warm-blooded animals including man. In most adults it does not cause serious illness, but it can cause serious health problems in infants, pregnant women and immune compromised patients. Abortion is one of the most serious outcomes in pregnant women. In this cross-sectional study, a total of 162 women of child bearing age were included from...

Tuli Dey, Sonnet Poddar and Mukti Barua

...3rd lactation came to Madras veterinary college with the clinical sign of complete uterine prolapse which calved one day before. The cow was handled and the prolapsed mass was corrected so carefully that there could be saved the life without any complication. The prolapsed mass of cow was managed with lukewarm water and manual pressure replacement in non-raising condition of hindquarter. Vulvar Retention Suture (modified Bhuners suture) was given for not to re...

Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1

...to the generally poor infrastructure, lack of well-equipped poultry slaughter houses, lack or inadequate water supply at these markets which hampers the ability of handlers to maintain good sanitary and hygiene conditions of the carcass, environment and themselves. Data collected could be valuable for instituting effective intervention strategies for Salmonella control in Nigeria with the aim of reducing Salmonella spread from poultry to humans.

...
Mirza Imran Shahzad1,*, Anna Iqbal2, Farrah Ali1, Nuzhat Sial3, Muhammad Ashfaq4, Abul Hasanat5 and Azra Khanum6
... while the second for ultrasonication treatment, before conducting antimicrobial activities. Zones of inhibition were measured by using disc diffusion method. Supernatant fraction of E. coli was positive against Sal. typhi and supernatant fraction of P. multocida was positive against E. coli, which show that antimicrobial agents were secretory in nature. Sonicated fractions were on second order to produce antimi...
Sehrish Rasool1, Zain ul Abdin1,*, Saqi Kosar Abbas2, Sumra Ashraf1, Maryam Anwer1, Atif Manzoor1, Muhammad Tahir1 and Hoor Shaina1
...nt of a gregarious ectoparasitoid Bracon hebetor (Say.) (Hymenoptera: Braconidae). The number of adults, sex ratio and size of emerging adults were recorded. Smaller and larger host species were used to determine the survival potential of the wasp. It was observed that maximum number of adult wasps emerged from the hosts G. mellonlla (95 ±2.30 (se) and S. litura (81 ±1.15 (se)) by placing the lowest number of wasp eggs (4 egg...
Wali Khan*, Ghazal Mumtaz, Saima Bibi and Salma Afzal
...mine the prevalence of parasitic infection in vegetables collected from the vegetable markets in Lower and Upper Dir districts. A total of 520 vegetable samples were collected during April to October 2016. These vegetable samples were screened for parasitic contamination. The results showed that 10.7% of the vegetables were found to be contaminated with one or more than one species of paras

Muhammad Zafarullah Khan

... the present era led to drastic changes in the transformation of agriculture to produce more farm commodities in shortest possible time with minimum inputs. Agriculture is the pivotal source of producing food crops including dairy, fruit cultivation, poultry, bee keeping and edible and non-edible like forestry products etc. An Agriculture Extension Officer (AEO) plays the role of a hub in agricultural development and covers all the areas of Agriculture. The pr...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...nt life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of M. incognita infecting passion fruit. Pathogenic relationship with the passion fruit was proved through inoculation studies and inoculated plants also produced almost similar above-ground symptoms and profuse root galling. The pathogenic potential of M. incognita on passion fruit was de...
YaQiu Liu and ZhiJian Wang*
...bserve morphology and ultrastructure of intestinal tract of Paramisgurnus dabryanus with light and electron microscopies. Intestinal tract was divided into three parts. Morphologically complex folds were formed on surfaces of anterior and middle intestines where many secretory cells were present. Highly developed junction complex were seen in anterior intestine. Cytoplasm contained abundant mitochondria and pinocytotic vesicles. Epithelium of posterior ...
Mustafa Cengiz1*, Jama Hussein Ali2, H. Mehtap Kutlu2, Djanan Vejselova2 and Adnan Ayhanci3
...osphatase (ALP)). In contrast, in the groups given D-GaIN and EA, a decrease in the damage of the liver tissue, a significant decrease activated Bax and caspase-3-positive hepatocytes, while increase in the number of Bcl-2 positive hepatocytes, a decrease in the biochemistry markers levels were found. Group 4, given EA before D-GaIN, showed better results when compared to Group 5, given EA after D-GaIN, in terms of histopathological and biochemical values. In ...

Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty

Recent advances in geminivirus detection and future perspectives
...n blot techniques, polymerase chain reaction and other DNA polymerase-mediated assays, and microarray detection. Of these, microarray detection provides the greatest capability for parallel yet specific testing and can be used to detect individual or combinations of viruses with sensitivity comparable to ELISA. Methods based on PCR provide the greatest sensitivity among the listed techniques but are limited in parallel detec...

Neerja Agrawal, Mukesh Srivastava, Akhilesh Tripathi and Amrendra Singh

Survey and monitoring of pests, parasites and predators of pulse crops in central and eastern Uttar Pradesh
...d a total number of 16 parasites and predators were observed in these crops during the period of study. The bio-agents recorded belonged to Order Dictyoptera, Neuroptera, Hemiptera, Hymenoptera, Diptera and Coleoptera.

...

Sitansu Pan, Surojit Khalko and Amrita Das

Effect of some fungicides on seed mycoflora, germination, viability and their persistence in treated seeds
...eolus aureus Roxb.), A. brassicae in mustard (Brassica campestris L.) and Drechslera oryzae in rice (Oryza sativa L.). Propineb 70WP and prochloraz 45EC considerably reduced the appearance of A. alternata and flusilazole 40EC reduced Fusarium sp.in mungbean seed than untreated control.Amarked reduction in population of A. brassicae by difenoconazole 25EC and flusilazole 40EC was observed i...

S. K. Mukhopadhyay and M. V. Santha Kumar

Studies on the biosafety of botanical insecticides to native natural enemies of mulberry ecosystem
...d bio-control agents (Micraspis crocea, Micraspis discolor, Brumus suturalis and Scymnus bourdilloni ). All botanicals tested showed least mortality and was on par with unsprayed control. Dimethoate (0.1%) was highly toxic causing 100% mortality. Whereas, dichlorvos (0.1%) was least toxic in comparison to dimethoate. Botanical insecticides tested in different conc./combinations are compatible with natural enemies and may be ...

1Bikash Ranjan Ray and 2Mrinal Kanti Dasgupta

Management of root holoparasite Aeginetia pedunculata of (Orobanchaceae), causing wilt of sugarcane by trap and catch crops
...gement schedule of the parasite, crops, other than sugarcane, grown in the target area were evaluated for their potential as trap and catch crops of the parasite. Twelve crops, selected on the basis of germination induction test of A. pedunculata seeds on root exudates as compared to that of three germination inducing chemicals (viz.; NaOCl, TTC (2,3,5-triphenyl tetrazolium chloride) and GR24-a strigol analogue) and growth o...

K.N. Ahmed and M.R. Hasan

Sudden outbreak of mealy bug and armoured scale causing severe damage to economic crops in Bangladesh
...including hymenopteran parasites away from the mealy bug. The cottony cushion scale, Icerya purchasi Mask. (Homoptera: Margarodidae) is a soft-bodied mealy bug infesting guava leaves all over Bangladesh. It is reddish-brown and lays up to 600-700 eggs during her lifetime. The life cycle is completed within 46-240 days depending on different environmental conditions. The females develop parthenogenetically. It is a sucking pest and mainly feeds on citrus. Its s...

Sitansu Pan and N. K. Mishra

Epidemiological studies on some diseases of guava (Psidium guajava L.)
...phthora nicotianae var parasitica) of guava were analysed for predictive purpose from regression equations. The simple correlation coefficient matrix showed significantly positive correlation of canker severity with maximum relative humidity at 1% level whereas, anthracnose correlated well with minimum relative humidity, temperature and number of rainy days at 5% level. The negative correlation was obtained for stem canker and dry rot with all parameters at 1%...

S. Subharani, S. S. Thorat, N. Abem, L. Amit Kumar and T. K. Singh 

A database on parasitoid of insect pests of crops in Manipur, India
...ext-align: justify;">A Parasitoid database consisting of 62 (sixty two) species records gathered by conducting a systematic survey of parasitoids on insect pests of crops in different localities of Manipur was developed by using MS-Access. The database is for academic purpose and it includes the taxonomic details of the parasitoid, host insect, host plant, morphological characters, geograp...

Sitansu Pan and Someshwar Bhagat

Biological control of plant diseases
...ns are antibiosis, mycoparasitism, competition for space and nutrient, production of certain toxins and secondary metabolites, solublization and sequestration of immobilized plant nutrients, plant growth prowth promoting properties and induced resistance. Multiple interactions between bacteria-fungi-actinomycete, may exist in nature and that is why consortium of microorganisms is needed for tackling several plant pathogens simultaneously instead of only one bi...

Basudeb Dasgupta, Partha Dutta and Srikanta Das

Biological control of foot rot of betelvine (Piper betle L.) caused by Phytophthora parasitica Dastur
...caused by Phytophthora parasitica and growth, yield, and keeping quality by applying two bioagents, viz., P. fluorescens and Trichoderma harzianum. P. fluorescens inoculated in 500 kg oil cake ha-1 was applied once at pre-monsoon, twice during pre- and post- monsoon and four times at quarterly intervals. T. harzianum inoculated in 500 kg oil cake ha-1was applied at quarterly intervals. Bordeaux mixture (BM) was used to compare the treatments in preventing the ...

A. Regupathy and R. Ayyasamy

Initiatives of papain industry by private-public-farmer link-ages in classical biocontrol program for papaya mealybug in Tamil Nadu
...gether. Considering the drastic reduction in the wet latex supply, SPFP has taken up series of initiatives which are summarized in this paper. Initially, a survey made in more than 80 farmers holdings supplying wet latex to the industry to get the first hand information on the extent of mealy bug incidence. Secondly, it facilitated select cluster of papaya growers to meet the concerned authorities and scientists of Tamil Nadu Agricultural University (TNAU), Co...

Goutam Samui and Shantanu Jha

Branch gall of mango (Oligotrophus mangiferae Keiffer) its bioecology and management
...h. A single species of parasite (Tetrastichus spp.) was found to emerge from the gall. Pruning at 30 cm had been found to be most effective in managing the pest. Spraying of thiamethoxam @ 0.008%, imidacloprid @ 0.006% and monocrotophos @ 0.005% gave effective control of the pest.


...

Goutam Mondal

Plant growth promoting activity of some indigenous Tricho-derma isolates and their field performance against sheath blight of rice in old alluvial zone of North Bengal
... tested on cauliflower (Brassica oleracea var botrytis L.), chilli (Capsicum frutescens L.) and tomato (Lycopersicon esculentum Mill.) with culture filtrate of biocontrol agents and found both positive and negative effect on seed germination, plant growth and vigour. Maximum increase in germination by 13.64% (chilli), shoot length by 59.69% (tomato), root length by 84.51% (cauliflower) and biomass by 46.55% (cauliflower) were obtained by the isolate B16 follow...

Dipak Mandal, Paramita Bhowmik and M.L. Chatterjee

Evaluation of new and conventional insecticides for the management of mustard aphid, Lipaphis erysimi Kalt. (Homoptera: Aphididae) on rapeseed (Brassica juncea L.)
...erysimi K. on rapeseed (Brassica juncea L.). Experiment was laid out in Randomized Block Design with eight treatments. Insecticides used in the experiments were imidacloprid 17.8% SL at 27g a.i/ha, lambda-cyhalothrin 5% EC at 25g a.i/ha, chlorpyriphos 20% EC at 375g a.i/ha, dichlorvos 75% EC at 375g a.i/ha, thiamethoxam 25% WG at 27g a.i/ha, dimethoate 30% EC at 375g a.i/ha and chlorpyriphos 50% + cypermethrin 5% EC (Canon) at 375g a.i/ha. Chlorpyriphos (93.50...

M.A. Pendse, P.P. Karwande and M.N. Limaye

Past, present and future of nematophagous fungi as bio-agent to control plant parasitic nematodes
...g fungi as well as endoparasitic fungi. For more than a century scientists are studying different facets of biology of NF including their potential as a bioagents to control nematodes. Their inconsistent success in control of nematodes in field trials, however, is enigmatic. This paper takes a review of the researches done by various workers on the diversity, morphology ecology, physiology of nutrition, trap formation and mechanism of nematode capture as well ...

S. Patra, V.W. Dhote, SK F. Alam, B.C. Das, M.L. Chatterjee and A. Samanta

Population dynamics of major insect pests and their natural enemies on cabbage under new alluvial zone of West Bengal
... respectively. Highest parasitized larvae of diamond back moth by Cotesia plutellae were found on 15th and 8th March with 10.42 and 10.50% larval parasitisation during both the seasons, respectively, whereas maximum coccinellid was observed on 23rd February of 2011-12 and 2012-13 crop seasons with 11.67 and 9.67 coccinellids/ 5plants, respectively. Both maximum and minimum temperature had major role to build up the populatio...

A. K. Ganguly and Uma Rao

Decades of researches in biochemical and molecular nematology at IARI
...cular biology of plant parasitic nematodes during the early seventies of last century. The main research areas were biochemical mechanism of resistance against phytonematodes and diagnostics of economically important plant parasitic nematodes. Specific isozymes have been identified for differentiating the important root knot nematodes species of India belonging to the genus Meloiodogyne. Further, molecular markers like RAPDs...

Someshwar Bhagat and Sitansu Pan

Comparative ecological behaviour of some pre- and post-tsunami isolates of Trichoderma harzianum and T. viride from Andaman & Nicobar Islands
...isolates showed better parasitic ability and rhizosphere colonization when the competition of other organisms withdrawn compared to natural and sun dried soil. Both competitive parasitic behaviour and rhizosphere colonization was low in post-Tsunami isolates of Trichoderma. The chlamydospore inoculum was found best in percentage colonization of sclerotia of boh R. solani and S. rolfsii, followed by mycelial and conidial inoc...

V. S. Desai, S. D. Desai, A. J. Mayekar and V.G. More 

Infestation of coconut eriophyid mite, Aceria guerreronis Keifer in Konkan region of Maharashtra
... in Konkan region of Maharashtra from January 2002. Three orchards from this area were surveyed to record infestation level of this pest in April and October of 2004 and March 2005. The survey indicated that the infestation was higher in Thane district followed by Sindhudurg district.
 

 

...

Manidipa Chowdhury 

Incidence of saw fly, Athalia lugens proxima Klug. as influenced by level of irrigation and fertilizers on mustard
...d c.v. NC-1 (Jhumka) of Brassica campestris var. yellow sarson. Highest saw fly population (0.26 larvae/plant) was recorded on the crop grown without irrigation and medium level of fertilizers (60:30:30 Kg NPK ha-1) while lowest population level (0.10 larvae/plant) was observed at highest level of irrigation (three) coupled with medium level of fertilizers (60:30:30 kg NPK ha-1) and two irrigations coupled with lowest level of fertilizers (40:20:20 Kg NPK ha-1...

S. Choudhury and S. Pal

Population dynamics of mustard aphid on different Brassica cultivars under terai agro-ecological conditions of West Bengal
...the aphids on different Brassica cultivars seem to be governed by varietal characteristics of different germplasms. Brassica campestris varieties as a group harboured relatively higher populations of the aphid than Brassica juncea varieties.
 

 

...

V. N. Jalgaonkar, M. S. Gawankar, V. W. Bendale and P. D. Patil

Efficacy of some insecticides against cashew tea mosquito bug Helopeltis antonii Sign
... of Konkan region of Maharashtra State. Nearly 60 different pests have been reported on cashew. Among them the Tea Mosquito Bug, Helopeltis antonii Sign. is the most serious one, which is responsible for considerable yield losses in cashew. A field trial was conducted during 2005 at Cashew Research Farm, Regional Fruit Research station, Vengurle, Dist. Sindhudurg, (M.S.) with an objective to identify an alternative insecticide for management of Tea Mosquito Bu...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
... The alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly (P<0.05) high in infected groups A and B. On 3rd, 5th and 9th day five birds from each group were slaughtered and histopathological lesions observed in bursa, spleen and thymus and compared with control. Mild to severe hemorrhages and lymphocytic depletion, follicle necrosis, leukocytic infiltration...
Sohail Ahmed, Muhammad Arshad and Babar Hassan*
...pping application in contrast to coating method. Drying of woods prior to resin application was also effective in resisting termites’ infestation. The findings of treatment with resins are discussed with previously cited effects of resins and its implication in wood preservation.
...

Gadeeyya G and Ratna Kumar P.K.

...ated by inoculation of parasitized weed propagules like infected leaves, stems, root and floral parts on different fungal growth media. The diagnostic characteristic features of each isolate were critically studied using relevant literature. The pathogenicity of the isolates was examined to select biocontrol agent against host weed. 
...

Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1 

...mechanical as well as intrastadial and transstadial routes. Since capripoxviruses are serologically identical, their specific identification relies exclusively on the use of molecular tools. In this study, we analysed the G-protein-coupled chemokine receptor (GPCR) genes of two LSDV isolates from Ixodid (hard) ticks (Amblyomma hebraeum) in Egypt. Multiple alignments of the nucleotide sequences revealed that both isolates had nine nucleotide mutations in compar...
Baohua Chen1,2, Wenzhu Peng3, Jian Xu2, Jingyan Feng1,2, Chuanju Dong1,2 and Peng Xu2,3,*
...y;">Glutathione S-transferases (GSTs) comprise a large and diverse family of enzymes with a wide phylogenetic distribution. They are multifunctional enzymes that play a crucial role in cellular detoxification and oxidative stress tolerance. Comparing with that in mammals, investigation of GSTs is more complicated in teleosts because of the greater pressure they suffer in aquatic environment. In this study, we identified a set of 27 GSTs including 8 classes of ...
Muhammad Ayaz1,*, Muhammad Athar Abbas2, Pervez3, Noorulain3, Yasir Amin1, Zubair Ali3, Naila Siddique2 and Khalid Naeem2
...erse transcriptase polymerase chain reaction (RT-PCR) procedure. Out of 600 examined locations twenty two (22) H9N2 subtypes isolates were recorded. The total prevalence recorded was 3.66%and out of 498 broiler operations yielded 17 (3.4%) positive isolates and 44 golden type native chicken farms yielded 05 (11.36%) isolates of AIV H9N2 and 58 captive pheasant’s samples were negative. It was observed that frequ...
Nasar Khan1,2, Fahad Ali3,7, Sulaiman Bahadar5,*, Khalil ur Rahman3, Abdul Aziz3, Noor ul Akbar4, Muhammad Daud6, Azam Hayat5 and Mujaddad ur Rehman5
...r HBV by real-time polymerase chain reaction. Out of 659, 522 (79.21%) were found positive for HBV, of which 318 (over all 4.4%) were male, while 341 (over all 3.55%) were female. The HBV PCR positivity rate was 80.18% (n=255) in males and 78.30% (n=267) in females patients. Among different age groups HBV PCR positivity was highest (n=181, 83.41%) in the age group of 31 to 40 years. HBV genome was detected in 79.21% of HBsAg positive samples, showing that HBsA...
Muhammad Ashfaq,1 Shamim Akhtar,2 Saleem Akhtar2,* and Mariyam Masood2
...veloped to detect hyperparasitism in cotton mealybug. Cotton mealybug, Phenacoccus solenopsis (Hemiptera: Pseudococcidae) is an invasive and major pest on cotton. Aenasius bambawalei (Hymenoptera: Encyrtidae) is an effective parasitoid of mealybug and has been the backbone of the biological control program of cotton mealybug in Pakistan, but its multiplication for inundative releases has been impacted by a hype...
Azhar Abbas Khan1,*, Arif Muhammad Khan2 and Muhammad Afzal3
...leaves of rose, citrus, brassica and wheat (1.2±0.2006, 1.3556±0.1416, 1.5778±0.1829, 2.1444±0.2027, respectively) attracted significantly more numbers of C. septempunctata as compared to control and aphids alone (0.7667±0.1204 and 0.8333±0.1153). With every next hour (3, 6 and 12 h) of observation the movement of C. septempunctata toward target localities was elevated. Finding of the current investigatio...
Madiha Hashmi1, Abid Hussain1, Shafiq ur Rehman1, Farida Ahmed2, Shahbaz Aslam3,Nadeem Afzal4 and Zaigham Abbas1,*
...2 allele using polymerase chain reaction (PCR). While total level of Immunoglobulin E (IgE) was measured by enzyme linked immunosorbent assay (ELISA) in all serum samples. This study indicated that the frequency of both alleles HLA-DRB1*11and HLA-DRB1*12 in aero allergy patients is less as compared to healthy controls. HLA-DRB1*11 demonstrated significant association with aeroallergens and could have a protective role for allergy while...
Noor Islam1, Muhammad Amjad2, Ehsan ul Haq3, Elizabeth Stephen1 and Falak Naz4
...ustify;">The brood ectoparasitic mites, Tropilaelaps clareae is causing greater damage to Apis mellifera colonies and major economic losses (a serious threat) to beekeeping industry in Pakistan. Seven treatments including five essential oils of basil (Ocimum basilicum), lemongrass (Cymbopogon citratus), oregano (Origanium vulgare), lemon (Citrus lemon) and thyme (Thymus linearus
Ghulam Abbas1,Asif Nadeem1,*, Masroor Ellahi Babar2, Tanveer Hussain2, Muhammad Sajid Tahir3, Wasim Shehzad1, Rajput Zahid Iqbal3, Muhammad Tayyab1 and Maryam Javed1
...f gene was done by polymerase chain reaction. PCR products were sequenced bi-directionally, aligned and single nucleotide polymorphisms were identified. Bioinformatics tools were applied for construction of phylogenetic tree and genetic diversity analysis. Lower genetic diversity was observed. The finding of this research is prerequisite for future research.
...
Kanwer Shahzad Ahmed1, Muhammad Zeeshan Majeed1,*, Muhammad Ather Rafi2, Fatima Sellami3 and Muhammad Afzal1
...>(Fabricius 1781), Micraspis allardi (Mulsant 1853) and Propylea dissecta (Mulsant 1850) belonged to tribe Coccinellini (Latreille 1807) of subfamily Coccinellinae (Latreille 1807). Two species belonged to tribe Chilocorini (Costa 1849) of subfamily Chilocorinae (Mulsant 1846) i.e. Brumoides suturalis (Fabricius 1798) and Exochomus nigripennis (Erichson 1843). Two species namely Henosepilachna vigintioctopunctata (Fabr...
Talha Nazir1,2,*, Muhammad Dildar Gogi2, Muhammad Zeeshan Majeed1, Waheed ul Hassan2, Abdul Hanan2 and Muhammad Jalal Arif
...Glover, jassids Amrasca devastans Distant, whiteflies Bemisia tabaci Gennadius, thrips Thrips tabaci Lindeman, red cotton bugs Dysdercus koenigii Walk and dusky cotton bugs Oxycarenus hyalinipennis Costa, has been a challenge on transgenic (Bt) cotton crop all over the world. This study assessed the field efficacy of six commercial insecticides viz.; Blaster 72.5%WP (imidacloprid + acephate), Bugatti 50%SC (imidacl...
Muhammad Arslan Khan1,*, Sajid Aleem Khan1, Imran-ul-haq1 and Rashad Waseem Khan2
...tify;">Root rot is very drastic disease prevalent in major cotton producing areas of Pakistan. Complex nature of disease due to root rot fungi and root-knot nematode cause huge losses to cotton. Experiments were conducted to assess the role of fungi and root knot nematodes in root rot disease complex of cotton and to optimize their control. For this purpose fifteen cotton growing areas in Southern Punjab were surveyed in year 2013-14. Data were recorded on dis...
Omar S.O. Amer1,3,*, Mohamed I. Waly2,4 andSaeed A. Al-Zahrani1
...of reported intestinal parasitic infections for patients visiting Prince Sultan Military Medical City, Riyadh, KSA from 2010 to 2014. Our retrospective study estimated a total 775 case out of 11110 case were infected with one or more intestinal parasites, with prevalence rate 6.98 %. The prevalence of intestinal parasitic infection during the period of study was as follows; Ascaris lumb...
Mohammad Umar Farooq1*, Sarfaraz Ahmad2, Ghulam Nabi1, Ijaz Ali1 and Imtiaz Ahmad1
...h of root zone for each grass and the root portion was separated, weighed, oven dried at 60 Co for estimating below ground pytomass carbon Mg C ha-1. Carbon pool in above ground phtyomass was 0.08 MgCha-1 while below ground phytomass carbon was estimated as 0.05 MgCha-. In grazed and un-grazed sites, the SOC (%) MgCha-1 decreased depth wise as well as in total carbon MgCha-1. In grazed site, the...
Javeria1, Masroor Ellahi Babar1,2,*, Akhtar Ali2, Asif Nadeem1, Abdul Wajid1, Sajjad Ali Shah3, Sadaf Rashid4, Muhammad Wasim1 and Muhammad Abdullah1
...l O Methyl transferase (COMT) gene and association of these genes with obsessive compulsive disorder (OCD) in the Pakistani Patients. We selected OCD patients (n=100) following the Diagnostic Statistical Manual-IV (DSM-IV) criteria and controls (n=120) from Sir Ganga Ram Hospital and Panjab Institute of Mental Health, Lahore from August 2011 to January 2014. During the sample collection the factors like age/period, employment status and marit...

Abdur Rab1*, Muhammad Sajid1, Naveed Ahmad1, Khalid Nawab2, Syed Ghias Ali3

...cium application. By contrast, salinity increased the BER incidence but the salinity-induced increase in BER incidence was lower with calcium application as compared to control plants.

...
Asad Abdullah1, Muhammad Irfan Ullah1,*, Muhammad Waqar Hassan2,    Samina Khalid3, Yasir Iftikhar4, Muhammad Arshad1 and Jaime Molina-Ochoa5,6
...a: Aleyrodidae) and Amrasca biguttula Ishida, (Homopter: Cicadellidae) infesting Bt and non-Bt cotton cultivars. Foliar application of neem seed, Azadirachta indica extract was applied upon reaching economic threshold levels of B. tabaci and A. biguttula. The insect pest population was recorded 24 hours before and 24h, 72h and 168h after spray. Maximum reduction of 60.20% of B. tabaci on Bt cotton was rec...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Irfan Ullah1,*, Muhammad Arshad1, Mubasshir Sohail1,2 and Jaime Molina-Ochoa3,4
Nasira Kazi1, Muhammad Israr2 and Shahina Fayyaz1,*
...Paradorylaimus Andrassy 1969 is described and illustrated from Pakistan. Paradorylaimus dorsocaudali new species differ from all known species of the genus in having smaller body length, tail length and odontostyle length. The new species is characterized by 1.3-1.6 mm long female body, lip region truncate, offset by weak depression, odontostyle 21.4-23.2 µm long is and 2.8-3 µm wide, twice as long as the lip region width; vulva longi...

Ghani Akbar1, Steven Raine2, Allen David McHugh3, Greg Hamilton4 and Qurban Hussain5 

...sociated with altered infrastructure, new or modified machinery, or increased labour. 

...
Habibun Nabi1, Saher Islam2, Amna Arshad Bajwa2, Imran Rashid1,*, Haroon Akbar1, Wasim Shehzad2, Kamran Ashraf1, Nisar Ahmad1 and Aneela Durrani3
...is caused by coccidian parasite, Toxoplasma gondii. One third of human population of the world is believed to be infected with T. gondii. Cats serve as final host of Toxoplasma gondii and are the main source of contamination of soil and water. Fecal samples from cats at Pet center of UVAS (Lahore, Pakistan) were screened for coccidian parasites through microscopy examination. DNA was extracted fro...
Rabia Arif*, Shahar Bano, Muhammad Ishfaq and Muhammad Saleem
... were taken from two contrasting environments (Natural and Harsh) from the south facing and north facing slopes of Evolution Canyon, Israel. Sequenced amplicons were introduced to the NCBI database as a query in BLASTN. The query revealed >100% resemblance with the Ascomycota genus Sordaria and the topmost species in this investigation was fimicola. Circular Phylogram showed close relatedness among the strains under study and potential associa...
Rehmat Ullah1*, Kalim Ullah2, Inam Ullah3, Muhammad Zafarullah Khan1 and Asif Nawaz1 
... improved, for proper infrastructure and latest communication technologies so that extension workers may have far reaching approach to disseminate the improved technologies and give benefit to the farmers. 
...
Nehafta Bibi1, Muhammad Shafiq2, Munawar Saleem Ahmad3 and Haitao Wang1,4,*
...study, we investigated Eurasian siskin (Carduelis spinus) dominant individuals for neophobia and influence of social context on foraging. In our experiments, a subject (observer) was presented with three novel and familiar food in each of three contexts: asocial, first social context (conspecifics without food) and second social context (conspecifics with food). The results showed that individuals preferred to consume novel food only in social context c...
Tahira*, Muhammad Arshad, Muhammad Ayub Khan and Mubashar Ahmad Khan
...ncement in rapeseed (Brassica napus).For this thirty-six rapeseed hybrids were sown in a RCBD with four repeats at NARC, Islamabad during the cropping season 2014 and 2015. Cluster analysis based on WARD’s method showed considerable genetic variation among the hybrids. In the first year, thirty- six Brassica hybrids were grouped into thirteen clusters. Cluster-IV comprised of maximum number of hybrids (six). The...
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
...f the glutathione transferase isoenzyme P1-1 gene from Camelus dromedarius (CdGSTP1-1). The coding sequence was cloned using RT-PCR. Sequence analysis demonstrated significant differences between amino acid sequence of C. dromedarius and other mammalian GSTP1-1 enzymes. Phylogenetic relationship was studied with different organisms belonging to animal kingdom and revealed that CdGSTP1-1 is grouped with the enzyme from S. scrofa
Saba Khalid*, Muhammad Saddique Awan, Riaz Aziz Minhas, Nasra Ashraf, Khawaja Basharat Ahmed, Nuzhat Shafi and Sajid Abassi
...icultural activities, infrastructure and land sliding and disturbances by the increasing human population were major threats to the avian fauna of Rawalakot.
...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

...biochemical tests. Polymerase chain reaction was used to detect representative virulence factors or genes, including E.coli adherence factor (K88, CS31A, afaE-8), toxins (estA, estB, Stxl, Stx2, EAST1), pathogenicity island (eaeA, irp2, ETT2) and outer membrane protein (ompA). Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isol...
Wali Khan1,*, Noor-Un-Nisa2 and Aly Khan3
...c intestinal protozoan parasitic infection in farmers, education concerned and shepherds of Swat, Khyber Pakhtunkhwa, Pakistan. A total of 1041 stool samples were examined from January 2006 to December 2008 using direct smear and concentration methods. One hundred and fifteen (11.04%) participants were found infected with one or more than one intestinal protozoans. Forty one (35.6%) of the participants were infected with single paras
Jarosław Pytlewski1, Ireneusz Antkowiak1 and Ewa Czerniawska-Piątkowska2,*
...ht after calving. In contrast GG homozygotes had the longest intercalving period. The results prove the existence of dependencies between genu PIT-1 gene polymorphism in locus c.1178G>A, reproductive potential and body weight of cows and calves. More favorable results were observed in AA homozygotes. It is possible to use these dependencies in genetic selection of farm animals. In order to confirm the obtained results it would be advisable to conduct...
Hayat Badshah1, Farman Ullah1, Paul-André Calatayud2, Hidayat Ullah3 and Bashir Ahmad1
...the efficiency of this parasitoid is variable according to the locality and the plants on which P. solenopsis is feeding. In this context, this experiment investigated under field and laboratory conditions the influence of the host plant of P. solenopsis on the parasitism success and the female fitness of A. bambawalei, Five plant species, commonly found to be host of P. solenopsis, were te...
Sayyed Ghyour Abbas1, Muhammad Adeeb Babar1,*, Muhammad Akbar Khan1, Kiran Aftab2, Ayesha Riaz3, Abdul Ghaffar4 and Muhammad Akhtar1
...>salmontanus, Elachistoceras khauristanensis and Gazella lydekkeri. The boselaphines are predominant at the type locality. The taxa are consistent with a Late Miocene-Early Pliocene age of the deposits. The findings expand our knowledge on the dental anatomic features of the described species that existed in the Middle Siwalik Subgroup during the Late Miocene-Early Pliocene.
...
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
...nline software and luciferase reporter gene system were used to predict and verify the target relationship between miR-122 and DUSP4/PDK4, miR-449a and FKBP1B. Thereafter, comparison analysis was done on miR-122, miR-449a, DUSP4, PDK4 and FKBP1B mRNA expression levels in different bull testes tissues (1-day, 12-months-old and 24-months-old). In addition, genes mRNA and protein levels were detected after bull testicular...
Salma Javed, Saima Majeed, Nasira Kazi and Shahina Fayyaz*
...jpuri and Loof, 1968) Andrassy, 2009 is reported for the first time from Pakistan is briefly redescribed and illustrated.

 

...

Irfan1* , Arshad Javid2 , Muhammad Altaf3 , Muhammad Shahbaz3 , and Khalid Javed Iqbal4 

...l/L, alanine aminotransferase (ALT) 35.56±1.16iu/L and aspartate aminotransferase (AST) 44.16±1.83 iu/L were recorded for adult birds while alkaline phosphatase (ALP) values were significantly (P<0.05) higher 104.86±16.39 iu/L in grower birds. Similarly, the rearing systems also influenced biochemical parameters of M. gallopavo and significantly (P<0.05) higher values for cholesterol 6.18±0....

Naeem Iftikhar1, Qamar Zaman Qamar2, Usman Ali3, Muhammad Siddique Awan4, Syeda Shaista Bibi4, Riaz Aziz Minhas4*

...ck grazing and seasonal grass cutting, fire and hunting were identified as major threats to the survival of this species in AJK. This study recommended the immediate formulation and implementation of Cheer pheasant conservation action plan along with declaration of its potential habitats as protected area to ensure the further survival of this important species.

...

Ayesha Aihetasham*, Faiza Qayyum and Muhammad Xaaceph

Muhammad Zamin* and Abdul Mateen Khattak 

...its suitability as turf grass needed to be assessed for conservation and to combat salinity problem. For this purpose, various ecotypes of Sporobolus spicatus were investigated by conducting mowing tests in the year 2013 under UAE climatic conditions. Fifty ecotypes of Sporobolus spicatus were cut at various heights, i.e. 1, 2, 3, 4 and 5 cm. Significant differences were found among various ecotypes and mowing heights for different growth and quality parameter...
...hore Zoo (site 1) in contrast to lions at display at Safari zoo Lahore (site 2). The frequency of natural behavior was periodic in African lions housed at Safari zoo Lahore. In the present study stereotypic behavior in lions represented here as a tool to measure the level of comfort at housing sites. This behavioral display also defines the safety of these groups of lions kept in distinct captive environment. This is evident that the quality of lodging environ...
Tasleem Akhtar*, Muhammad Asif Aziz, Muhammad Naeem, Muhammad Sheraz Ahmedand Imran Bodlah
...llinators on canola (Brassica napus L. Var. Chakwal Sarsoon) crops along with managed Apis mellifera. Thirty five insect species belonging to twenty families under five orders were recorded on canola. Among the hymenopterans, abundance of managed A. mellifera was maximum (87.76%) followed by Apis florea (1.11%) and Apis dorsata (0.98%). Peak activity of the insect visitors was observed at the mid of the day i.e., 12:00...

Saima Akhtar Qureshi1 and Asim Anwar2*, Ather Maqsood Ahmed

... IPM technique natural parasites and predators are used to check pest growth instead of pesticides which reduces ecological and health damage. Pesticides are used at the last resort in IMP method so it reduces the cost of production and increases the farmers’ profit. However, concerns about production may hinder widespread adoption of this technology by farmers. The aim of the study is to evaluate economic feasibility of IPM method in Punjab. The study c...

Bashir Ahmad1*, Ahmad-Ur-Rahman Saljoqi1, Hayad Zada2, Shahid Sattar1, Toheed Iqbal3, Saddam Hussain1 and Muhammad Saeed4 

...la (L.) in Cauliflower, Brassica oleracea crop at District Haripur of Khyber Pakhtunkhwa. Field studies results showed that the population of P. xylostella gradually increased from mid of July where the population was 2.1 and 2.0 larvae and pupae per plant in the year 2012 and 2013 respectively. The population increased in September to highest number of larvae and pupae per plant (8.25 and 8.4) were recorded in the years 2012 and 2013 respectively. Then popula...
Wali Khan1,*, Noor-Un-Nisa2 and Muhammad Asif Nawaz3
...e infected with single parasite and one hundred forty four (13.8%) with multiple infections. Taenia saginata 32.6% (n=146/447), Ascaris lumbricoides 20.3% (n=91/447), Hymenolepis nana 19.7% (n=88/447), Trichuris trichura 14.3% (n=64/447), Enterobius vermicularis 6.48% (n=29/447), Ancylostoma duodenale 2.90% (n=13/447), Entamoeba histolytica 2.68% (n=12/447), and Giardia lamblia/intestinalis 0.89%(n=4/447)...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5

 

...d cultured on standard Murashige and Skoog (MS) medium supplemented with different concentrations and combinations of benzyl amino purine (BAP) or kinetin for shoot induction and Indole acetic acid (IAA) for primary shoot and Indole Butyric acid (IBA) for root proliferation. Best shoot proliferation (4.48 per explant) was observed in MS medium containing 0.2/0.4 mg/L BAP/IAA combination. For rooting of the micro shoots, MS medium was supplemented with 1.0 mg/l...

Ata-ul-Mohsin*, Ehsan-ul-Haq** and Muhammad Naeemullah*

...hodum (Walker) and its parasitoid Aphidius rhopalosiphi (De Steph.). High calcium and high phosphorus concentrations applied to a partially resistant wheat cultivar “Rapier” did not have a significant effect on the growth and development of the aphid or its parasitoid. However, the mean fecundity of the parasitoid was higher on plants with high phosphorus than those treated wit...

Haq Nawaz Malik*, Iffat Ara**, Muhammad Naeem, Mozammil Hussain, M. Hanif Munawwar and M. Yousaf

...m number of grains (51) Grast-8288 produced the lowest (29). One hundred grain weight ranged from 23g (EV-6098) to 39g (2512).

...

 Ghulam Shabbir*, Muhammad Aftab, Abid Mahmood** Muhammad Kausar Nawaz Shah* and Nasir Mahmood Cheema***

...seed research including Brassica crops. Long and consistent breeding efforts on Brassica improvement programme by the breeders has resulted in the development of a high yielding and drought tolerant elite line SPS-5, selected from the segregating progenies of a cross between Ganyou-4 x Westar. Breeding was carried out by the pedigree method and the elite line was evaluated for its yield potential in various yield trials cond...
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2

 

...n insect acetylcholinesterase (AChEs). The enzyme activities were tested for the effect of saponins. The AChE activity of T. castaneum was inhibited by the saponins and follows competitive inhibition kinetics. In case of A. mellifera enzyme activity was not inhibited. In vitro and in vivo inhibition was observed for T. castaneum at larval stages, in dose dependent and time dependent manner. LC50 was determined to be 0....
Haixia Liu, Yuwei Ye, Yang Li, Xiaolin Liu, Dongmei Xiong* and Lixin Wang
...among population. In contrast, the majority of diversity (88.98%) occurred among individual within a population. Results from Nei’s genetic distance indicated that the YX and TB populations were grouped in one cluster, which was clustered with the ZZ population, the LX population was grouped in a separated cluster. Low genetic diversity and strong genetic differentiation have been found in this study. The baseline population genetic information supplied ...
Jaime Molina-Ochoa1, 2, 6,*, Edelmira Galindo-Velasco2, Ana María Rosales-Gutiérrez2, Martín González-Ramírez3, Roberto Lezama-Gutiérrez3, Wilberth Chan-Cupul3, Steven R. Skoda4, Muhammad Irfan Ullah5, Luis Jorge García-Márquez2 and  John E. Foster6
... ticks. Soil cores from grasslands were baited with last instars of the great wax moth (GWM), Galleria mellonella L., and an EPN isolate was obtained, it belonged to the genus Heterorhabditis and identified as JMO71. The nematodes were cultivated in GWM larvae, and the emerging infective juveniles (IJs) were collected from White traps, and pooled in canted neck vented plastic flasks. The susceptibility of an important livestock arthropod, the cat...
Muhammad Kashif Maan1, Muhammad Arif Khan1, Shehla Gul Bokhari1, Muhammad Ijaz2, Hamid Akbar1, Sajid Umar 3 and Muhammad Luqman Sohail4,*
...) in serum alanine aminotrasferase, aspartate transaminase and blood urea nitrogen as compared to isoflurane anesthesia; whereas, no statistical difference (P>0.05) was observed for alkaline phosphatase, creatinine and bilirubin between the two groups. Heart rate, blood pressure and saturation of oxygen were decreased in both groups but this decline was significantly lesser (P<0.05) in isoflurane administered group com...

 Nazakat Nawaz, Malik Shah Nawaz*, Nasir M. Cheema** and Mubashir A. Khan*

Corresponding author:nazakat_nawaz@yahoo.com

ZINC AND IRON APPLICATION TO OPTIMIZE SEED YIELD OF MUSTARD
... and 2006. The mustard (Brassica juncea) variety BARD-1 was treated with various -1 levels of Zn and Fe, (0-0, 0-1.5, 0-3, 2.5-0, 2.5-1.5, 2.5-3, 5-0, 5-1.5 kgha and -1 -1 5-3 kgha ), respectively. A basal dose of 90N and 60P kg ha was applied, in the form of Urea and triple super phosphate (TSP) with Zn and Fe. The increase in -1 Zn and Fe fertility from 0-1.5 to 5-1.5 kg ha increased yield of BARD-1. The maximum yield response was recorded when 5 kg ha-1 -1 ...

 A. N. Naqvi and K. Fatima*

INCIDENCE OF LIVESTOCK DISEASES IN NOMAL AND NALTAR VALLEYS GILGIT, PAKISTAN
...oductive diseases, endoparasites, ectoparasites, wounds, hematuria, respiratory diseases, emaciation, hemorrhagic septic-emia, tumour, blue tongue, cow pox, enterotoxaemia, tetanus, paralysis and arthritis. In precise, endoparasites were found in 25.3% animals followed by respiratory diseases (24.74%). Most of the cattle (2053) and sheep (926) were found affected with endopa

 Arshad Ali, Imdad Ali Mahmood, Muhammad Salim, Muhammad Arshadullah* and Abdul Rasool Naseem**

GROWTH AND YIELD OF DIFFERENT BRASSICA GENOTYPES UNDER SALINE SODIC CONDITIONS
...d yield response of six Brassica cultivars (BARD-I, Dunkled, Rainbow, BRS-II, Sultan Raya and cv. 95102-5) under saline sodic conditions. Data on growth and yield parameters were collected randomly (average of five plants per replication) at the time of crop maturity. Ionic concentration in plant tissues and oil content in seeds were also determined. Comparatively more number of branches and pods per plant were produced by cultivar Dunkled closely followed by ...

 Rizwana Sultan*, Javed Khan, Ehsan ul Haq, Tariq Mehmood**, Roshan Zada Khattak***, and Naheed Akhtar**

BIOLOGICAL PARAMETERS OF TRICHOGRAMMA CHILONIS ISHII (TRICHOGRAMMATIDAE: HYMENOPTERA) FEEDING ON SITOTROGA CEREALELLA EGGS AT THREE CONSTANT TEMPERATURES
...d that maximum rate of parasitism was 95.70 ± 1.94 at 28 ± 1 °C while minimum was 61.30 ± 1.70 at 32 ± 1 °C. Maximum adult emergence and female ratio from parasitized eggs were 96.30% with 59.2± 5.83 female ratio at 28 ±1 °C while minimum was 51.10% with female ratio of 58.1 at 32±1 °C. The maximum developmental duration (9.6 ± 0.32 days) and adult longe...

 Muhammad Shahzad*, Akhter Ali**, Abdul Hayee Qureshi**, Naveed Jehan*, Imran Ullah* and Majid Khan*

ASSESSMENT OF POST-HARVEST LOSSES OF PLUM IN SWAT, PAKISTAN
...ng materials and poor infrastructure. Total post harvest losses in the marketing channel of the plum were 21.51% of which 5.12% occurred at farm level, 1.44% at wholesale level, 6.31% at retail level, and 8.64% at the consumer level. Harvesting at proper maturity, using experienced labor and storage facility can reduce extent of post harvest losses of plum.

...

 Nasia Batool*, Imtiaz Ahmad Qamar**, Imdad Hussain Mirza** and Muhammad Fateh Ullah Khan**

MIXING LESS PALATABLE GRASSES WITH UREA, MOLASSES AND EFFECTIVE MICROORGANISMS AND ITS EFFECT ON CHEMICAL COMPOSITION AND DIGESTIBILITY IN GOATS
...tation of low palatable grasses with urea, molasses and Effective Microorganisms (EM) on chemical composition and digestibility in goats. (HC), (CA), (SH) and (DB) were used and the combinations were grass + 4% molasses, grass + 4% urea, grass + 4% urea + 4% molasses, grass + 4% urea + 1:100 EM, g...

 Shahida Khalid*and Shahida Nasreen Khokhar*

INTERACTION OF HERBICIDES AND BIO-INOCULANTS WITH AGRICULTURAL CROPS AND WEEDS
...oratory conditions were Brassica spp. and Zea mays while Phalaris minor was the test weed. In first experiment, Brassica and maize, grown in soils having residues of either Triasulfuron+Terbutryn (Logran) or Sulfosulfuron (Leader), were found to significantly mitigate (% increase in root length, shoot length, fresh weight and dry weight) the inhibitory effect of residues , when inoculated with Azospirillum A4. In second expe...

 Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*

 
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
... and nutritive value of grasses namely Brachiaria brizantha, B. mulato, and B. mutica and five legume herbs such as Clitoria ternatea, Dolichos lablab, Macroptilium bracteatum, Centrosema pascuorum and Centrosema pascuorum in Central Sulawesi, Indonesia using completely randomised block design. Each species was planted on 2.5m x 3m plot, and repeated 6 and 4 times in experiment 1 and 2, respectively. Parameters measured include plant height, tillage number, dr...

 Nazir Ahmad*, Sultan Ayaz*, Sumaira Shams**, Karimullah*** and Riaz Ahmad****

PREVALENCE AND MORPHOLOGY OF HELMINTH PARASITES OF FISH FROM RIVER SWAT, KHYBER PAKHTUNKHWA
... study of the Helminth parasites of fish of River Swat was conducted from September, 2012 to August, 2013. A total of 250 fish belonging to five genera and six species were examined. The parasites collected were Diplozoon khyberensis, Bathybothrium rectangulum, Bothriocephalus, Nippotaenia, Cucullanidae, Proteocephalus, Rhabdochona charsaddiensis, Rhabdochona schizothoracis and Neoechynorhynchus devdevi. They were identified...

 Aniqa Iram*, Javed Khan**, Nadeem Aslam**, Ehsan-ul-Haq**, Habib Iqbal Javed**, Muhammad Irfan*, Awais Rasool*, Muhammad Ishaque Mastoi** and Sumera Aslam* 

EFFICACY OF PLANT DERIVED OILS AND EXTRACTS AGAINST WHITEFLY, BEMISIA TABACI (GENNADIUS) ON SESAME CROP
...cine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data were recorded 24h before and 24h, 48h, 72h and 168h after application of each spray material. The results showed that whitefly population was significantly suppressed by both the botanical oils and extracts as compared to the control treatment but in general botanical oils showed significant results as compared to plant extracts. Soy...

 Mian Sabahatullah*, Manzoor Ahmad Mashwani**, Qurratul Ain Tahira* and Mian Inayatullah*

NEW RECORD OF SUBFAMILY CHARMONTINAE (BRACONIDAE: HYMENOPTERA) IN PAKISTAN WITH THE DESCRIPTION OF A NEW SPECIES
...e larval and pupal endoparasitoids of lepidopterous insect pests and their recorded hosts belong to 16 families of Lepidoptera.

...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Abdul Razzaq*

EFFECT OF MIXING LOW PALATABLE GRASSES AND IPIL IPIL LEAVES ON FORAGE QUALITY
...of mixing low palatable grasses namely Heteropogon contortus, Desmostachya bipinnata, Sorghum halepense and Chrysopogon aucheri with tree leaves of Leucaena leucocephala (Ipil ipil) in the ratio of 75:25, 50:50, 25:75, along with sole species on their chemical composition. Samples were analyzed for proximate parameters (crude protein (CP), crude fiber (CF), total ash and ether extract (EE)). The results revealed that there were significant differences in dry m...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*

EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
...of mixing low palatable grasses of Heteropogon contortus (HC), with tree leaves of Leucaena leucocephala (Ipil ipil, II) in the ratio of 75:25, 50:50, 25:75, along with sole species on their digestibility in small ruminants. Goats fed II , HC II , HC II , HC II and HC had similar 100% 25% 75% 50% 50% 75% 25% 100% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI...

 Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed**** 

INOCULATION AND INTER-CROPPING OF LEGUMES IN ESTABLISHED GRASS FOR INCREASING BIOMASS OF FODDER
...67%) of Panicum maximum grass and legumes (Vicia sativa and cowpeas) coupled with inoculation was studied under rainfed conditions at National Agricultural Research Centre (NARC) Islamabad, Pakistan. Intercropping significantly increased tillering of grass. Seed inoculation of legumes also gave maximum tillers. The grass and legumes biomass without any treatment were recorded as 7.09 and -...

 Riaz Hussain*, Muhammad Riaz**, Mushtaq A. Saleem*** and Muhammad Ishaque Mastoi**

BIOCHEMICAL ABNORMALITIES INDUCED BY ABAMECTIN IN SIXTH INSTAR LARVAE OF THE RED FLOUR BEETLE, TRIBOLIUM CASTANEUM (HERBST)
...ctivities of carboxylesterase (CE), total esterases (TE), alpha-amylase, glucoamylase, alkaline phosphatase (AkP), acidic phosphatase (AcP), total protein, soluble protein and free amino acids (FAA). The sixth instar larvae of T. castaneum were released and exposed for 48h without food on abamectin treated glass petri dishes. The surviving ones were then homogenized in saline and centrifuged prior to biochemical analyses. Re...

 Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed**** 

IMPROVING FODDER QUALITY OF PANICUM GRASS THROUGH INTERCROPPING OF LEGUMES AND THEIR INOCULATION
...ntercropping of Panicum grass with legumes (33%, 50% and 67%) with or without inoculation to investigate its fodder quality. The study clearly indicated that quality of fodder increased significantly both with the legumes and inoculation. The intercropping of Panicum grass with 67% inoculation proved the best combination. The 6-7% higher crude protein (CP) of mixed fodder was recorded from 67% intercropping in comparison to ...

 Israr Ali*, Naushad Ali*, Riffat Tahira**, Sardar Ali*, Izhar Hussain* and Sher Aslam Khan*

GENETIC DIVERSITY ASSESSMENT IN BRASSICA GERMPLASM BASED ON MORPHOLOGICAL ATTRIBUTES
...Genetic diversity of 28 Brassica genotypes was studied using different morphological attributes. Data were recorded on days to maturity (DM), -1 -1 plant height (PH), primary branches plant (PBPP), pod length (PL), seed pod (SP), -1 1000-seed weight (1000-SW), yield plant (YPP) and oil (%). Three checks (Pakola, CM and TA), were used to check the performance of collected materials with already available brassica varieties. S...

 Sameera Arshad*, Iftikhar Hussain*, Maqsood Anwar* and Sarwat Naz Mirza*

HABITAT SURVEY FOR RECOGNIZING BIRD ATTRACTANTS AROUND BENAZIR BHUTTO INTERNATIONAL AIRPORT, ISLAMABAD, PAKISTAN
...ng society with covered trash transfer facility (with rank, 1.3) had least bird attracting sites. About 64 plant species and 34 bird species were recorded during the survey. Results indicated that habitat near BBIA is highly conducive for bird activity which in return is a serious safety concern for aircraft operation. Outcome of this study could be incorporated into off airfield bird management programme for monitoring bird activity and land use practices aro...

 Umar Ijaz Ahmed*, Liu Ying**, Muhammad Khalid Bashir***,
Muhammad Amjed Iqbal*, Muhammad Rizwan*, Muhammad Mazhar
Iqbal****, Muhammad Rafi Qamar***** and Aftab Nazeer******

SPATIAL PRICE TRANSMISSION IN PAKISTAN: THE CASE OF WHEAT AND RICE MARKETS
...cations and transport infrastructure. All the wheat markets are adjusted to price changes in the long run equilibrium except few markets. Unidirectional and bidirectional causality exists between wheat and rice markets. Bad and poor infrastructure is a major impediment to price transmission among the markets. These market imperfections lead to food insecurity in the country. Government should formulate better policies and de...

  Sohaib Arshad*, Sarwat Naz Mirza*, Imtiaz Ahmad Qamar** and Maqbool Shahbaz**

DETERMINATION OF FORAGE QUALITY OF INDIGENOUS AND EXOTIC RHODES GRASS ACCESSIONS UNDER RAINFED CONDITIONS
...;"> Utilization of grasses as fodder and forage is the most important source of nutrition for cattle as it provides them with metabolizable energy, carbohydrates, proteins and other important minerals. As global warming is increasing, overall water scarcity is resulting in deterioration of natural resources, and it is need of the hour to find fodder crop resources which are more accustomed to change climatic conditions. Hence, different exotic and indigen...

 Khalid Mahmood Aujla* and Abid Hussain*

MARKETING SYSTEM OF LIVE CAMELS IN THE DESERT ECOLOGIES OF PAKISTAN
...lack of proper market infrastructure/facilities compel farmers to sell camels at village level to the village dealers and fellow farmers at relatively low prices. Percent difference in prices at wholesale market and village levels were 28.6, 12.9, 6.0 and 0.5 for adult male, wet female, dry female and young stock, respectively. The prevailing marketing situation of live camels is an indicative of exploitation farmers from the village dealers/market intermediar...

  Mohammad Umar Farooq* , Sarfraz Ahmad ** , Mohammad Islam and Imtiaz Ahmad Qamar ***

ASSESSING THE STATUS OF CARBON POOL IN TWO RANGELAND GRASSES ( ) IN POTHWAR, REGION, PAKISTAN
...ducted in two rangeland grasses and in field area of Rangeland Research Institute (RRI), National Agricultural Research Centre, (NARC), Islamabad. Carbon is considered as the most important component of green house gases. Carbon sequestration during the photosynthesis process via plant biomass is the extent of this atmospheric gas. Data for above and below phytomass for two rangeland grasses was collected and carbon pool was...
Rabia Faiz and Dilara A. Bukhari*
...(B.t.) produces parasporal inclusion bodies Cry and Cyt proteins. The present study focuses on determining the insecticidal activity of cyt positive B.t. strains against 3rd instar larvae of mosquito. Larval mortality was noted after 24 h and GCU B.t. 4 (400± 1.15) was found to be the most toxic against 3rd instar larvae of mosquitoes. Spores LC50 values of other isolates were 451± 0.90...
Selçuk Kaplan1,* and Sertaç Atalay2
...s were examined by polymerase chain reaction- restriction fragment length polymorphism method. The single nucleotide polymorphism (SNP) in the regulatory region of the IGF1 gene was detected by amplification of the 294 bp region using specific primers and cleavage with the BfoI enzyme. Allele frequencies of A and B were found with 0.915 and 0.085 respectively. The genotype frequencies of IGF1 gene were 0.85 (AA), 0.13 (AB) and 0.02 (BB). T...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Arshad1, Rashid Mahmood2,* and Ziyad Abdul Qadir2
...oa destructor. Ectoparasitic mite, V. destructor is considered the most important parasite of A. mellifera L. that badly affects the development and performance of bees. Main objective of our study was to assess the effectiveness of five synthetic acaricides (Bayvarol®, Apivar®, Apistan® Apitol® and Perizin®) against
David Beckwith Greene
...s seeking: Both a fresh grasp on the discontinuity between humankind and other moments of natural history and a new kind of continuity.
...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
...erse transcriptase polymerase chain reaction to real time reverse transcriptase polymerase chain reaction and reverse transcriptase loop mediated isothermal amplification over the last decade. These diagnostic assays vary in their sensitivity, specificity, reliability and reproducibility. Although these assays are detecting PPRV with precision but there is need to develop some cost effective diagnostic assays which would be ...
Zheng Quan Jiang1,2, Feng Shan Li3, Jiang Hong Ran1,*, Chen Hao Zhao1, Man Zhang1 and Hua Li4
...i> natural island nest, grass mound nest, dirt mound nest and floating grass nest. The nest length, nest width, nest height and nest volume among the four types of nests all were significantly different in the order: floating grass nests >dirt mound nests >grass mound nests >natural island nests, indicating that nest size was related to nest typ...
Muhammad Zeeshan Majeed1,2,*, Abu Bakar Muhammad Raza2, Muhammad Afzal2,Hafiz Salah-ud-Din2, Imtiaz Sarwar2, Muhammad Yahya2 and Khurram Shehzad3
...es viz. natural (grassland, forest/silviculture, barren) and agricultural (lemon, guava, lychee orchards, rice-wheat crop) lands on soil macroinvertebrate fauna. Random sampling was done in winter 2015 and summer 2016 using monoliths and pitfall traps. Results revealed that land-used types exert a differential impact on the diversity and population abundance of macrofaunal communities. Highest indices of macroinvertebrate diversity, richness and evennes...
Zhiping Hu, Hussain Ahmad, Jingfei Zhang, Lili Zhang and Tian Wang*
... and alanine aminotransferase were significantly increased compared to CON group at 42d in broilers. Serum globulin content (21d) and total protein content (42d) were lower in T2 group than that of CON group. Serum total antioxidant capacity was higher and malondialdehyde content was lower in T1 group than that of CON group at 21d. Serum glutathione peroxidase enzyme activity was significantly increased in T1 group compared to CON group at 42d. Malondialdehyde...
Abdul Nabi Jatt1,*, Sarfraz Ali Tunio1, Shaista Bano Memon1, Abdul Sattar Qureshi2 and Muhammad Aqeel Bhutto
... and trypsin. While, esterase, esterase lipase, α-chymotrypsine, α-galactosidase, β-glucuronidase, α-glucosidase, β-glucosidase, N-acetyl- β-glucosaminidase, α-mannosidase, and α-fucosidase were recorded as negative. Moreover, S. dysenteriae IM showed elevated alkaline-phosphatase, leucine arylamidase, trypsin, and acidic-phosphatase activities. The present study reveals th...
Grace Chinenye Onyishi, Ifeanyi Oscar Aguzie, Joseph O. Okoro, Christopher Didigwu Nwani*, Ngozi Ezenwaji, Ndubisi Stanley Oluah and Fabian C. Okafor
...Nigeria is affected by parasites they harbour. Some of these parasites endanger humans as well. This study was conducted to determine the terrestrial snail species and associated helminth parasites in Ugwueme agricultural zone of Enugu State, Nigeria. The snails were collected from two communities. Light and teasing methods were used for recovery of paras
Naimat Ullah1,3,*, Aneela Zameer Durrani1, Muhammad Avais1, Nisar Ahmad2, Sana Ullah3, Muhammad Shuaib Khan3, Khalid Mehmood5, Mumtaz Ali Khan1 and Ikramul Haq1
...in Aspartate aminotransferase, Alanine aminotransferase, serum creatinine, urea whereas decrease in glucose level in diseased animals. The current study concluded that paying close attention to animal feeding, housing and keeping may reduce the occurrence of theileriosis in sheep.
...
Muhammad Arshad,1* Sajjad Ahmad1, Muhammad Sufyan1, Zain-ul Abdin1 and Sumaira Maqsood2
...th strip intercropping (brassica, alfalfa, berseem and garlic) and wheat monoculture. Results showed that the first aphid was seen in the last week of January while the predator population was first recorded during the first week of March. Aphid population was maximum on wheat monoculture when 130 specimens were recorded per tiller. Among strip cropping garlic showed maximum population (113 per tiller) followed by brassica (...
Farhan Ahmad1,*, Muhammad Waris Sanjrani1, Shah Nawaz Khuhro1, Asif Sajjad2, Abid Ali3, Rashad Rasool Khan3, Farooq Ahmed3 and Junhe Liu4,*
...ly populations and its parasitism with connection to temperature and relative humidity was conducted in fourteen cotton growing districts of Sindh province (southern Pakistan) for 2012 and 2013 seasons. There was a significant difference in whitefly population and percent parasitism among the fourteen districts. The highest average whitefly populationof two consecutive years was recorded in Khaipur, Sukhur, Sangar and Nausha...
Sherin Reda Rouby
...owed by 30 kDa RNA polymerase subunit gene-based polymerase chain reaction (PCR) (RPO30) together with tissue culture-adapted cattle LSDV/Ismailyia88 strain and two Sheep poxvirus vaccinal strains as control. LSDV yield amplicon differed in length by 21 nucleotides from those produced from SPPV either field or vaccinal strain. Among different LSD clinical samples, skin nodules and scabs are proved excellent sample material a...

Nadia Faqir1, Aish Muhammad2*, Ghulam Muhammad Ali2, Armghan Shehzad2, Hafeez Ur Rahman3, Farhatullah4 and Muhammad Zeeshan Hyder

...alysis of two genes (maturase k and geranyl geranyl biphosphate reductase) from chloroplast region. Analysis of variance has revealed significant variation among the studied date palm samples pertaining to the studied physical traits and chemical composition of fruit. Sequences of the maturase k gene has complete identity to the reference genome of ‘Khalas’ cultivar. While geranyl geranyl biphosphate reductase ha...
Amna Kausar1,2, Sana Anwar1, Naila Siddique2, Safia Ahmed1 and Javid Iqbal Dasti1,*
...erse transcriptase polymerase chain reaction (RT-PCR). Same samples were further processed for the isolation of virus by embryonated egg inoculation technique. Moreover, out of 507 samples, 479 serum samples were scrutinized by enzyme linked immunosorbent essay (ELISA). Sero-prevalence of AIV among different species of wild birds was as follows; peacock (n=35; 14%), duck (n=5; 2%), migratory water fowl (n=3; 1%), pheasant (n=2; 0.8%), grey leg goose (n=1; 0.4%...

Feroza Haider1,2, Shamim Gul2,3*, Javaid Hussain4, Sadaf Asalam Ghori5, Muhammad Naeem Shahwani6, Muhammad Murad6 and Abdul Manan Kakar

...edible parts (roots) of Brassica rapa (turnip) under groundwater and wastewater irrigation. Biochars were applied at 0.25, 0.5 and 1 kg m-2 to soil. Amendment of biochar increased significantly the aboveground plant biomass by 28% - 34.3% under groundwater and 18.3% - 30.4% under wastewater irrigation. Dry weight of root biomass increased by 16.1% - 20.2% under groundwater and by 21% - 31.2% under wastewater irrigation in response to biochar amendment. Wood-de...
Muhammad Khalid Mukhtar1,*, Hummaira Iqbal1, Hafiz Muhammad Tahir2, Haseena Ghulam Muhammad1 and Muhammad Irfan1
...citricola were more drastic than bifenthrin. It was also recorded that at low prey density, predation by C. citricola was delayed as compared to higher prey densities. C. citricola showed the type I functional response. It is concluded that both studied insecticides are not suitable for IPM program in the study area.
...
Ghulam Muhae-ud-Din1,4, Anam Moosa1, Umer Farooq Ghummen1, Muhammad Jabran1, Amjad Abbas1, Muhammad Naveed2, Abdul Jabbar1 and Muhammad Amjad Ali1,3,*
...e most dangerous plant parasitic nematode species that infects a huge number of crop plants. It also infects the ornamental plants resulting in a serious growth-limiting factor in ornamentals. In this study, the response of ten ornamental plants to M. incognita was assessed in pot experiments. All the ornamental plant species showed varying degree of infection of M. incognita. Rhapis excels and Ophiopogan japonicas were moderately r...
Ayesha Munir, Hafiz Muhammad Umer, Anjum Nasim Sabri and Imran Sajid*
...i>which is an obligate parasite. In this study eleven S. mutans strains were isolated from carious lesions on Mitis Salivarius Bacitracin agar along with twenty potentially active Streptomyces strains were isolated from the soil of agriculture farmlands. The biochemical and physiological characterization along with the molecular identification by 16S rRNA gene sequencing confirmed that caries isolates are pathogenic S. mutans and soil isol...
Niamatullah Kakar, Farhat Abbas, Muhammad Shafee and Tauseef Asmat*
...er investigated by polymerase chain reaction (PCR). Three samples were found positive by PCR test while other detection methods were not that sensitive to detect the tuberculosis at that stage. Two patients were reported with history of tuberculosis but were effectively treated before imprisonment. On age basis, 128/186 (68.88%) patients were of younger age (18-30 years) and 10 (5.37 %) were above 50 year. Illiteracy, unemployment (daily wages) and tobacco smo...
Ambrina Hafiz1, Tanzeela Riaz2 and Farah Rauf Shakoori1,*

 

...the level of various esterases in deltamethrin-resistant populations of Trogoderma granarium collected from some godowns of Punjab. The level of various esterases like total esterases, cholinesterase, acetylcholinesterase, arylesterase and carboxyleste

Ashraf Sayed Awaad1 and Mohamed Zaki Fathy2*  

...dural space guided by ultrasonography (US). This study was conducted on seven lumbosacropelvic regions of goat cadavers and five live goats of both sexes ranged between 25-30 kg body weight. Longitudinal and cross anatomical sections were done on these samples; the sections were photographed and compared with coronal and sagittal sections of CT images. While transverse and parasagittal US were performed in goats over the sel...
Fazul Nabi1,2, Hui Zhang1, Muhammad Kashif Iqbal1 , Mujeeb ur Rehman1, Muhammad Shahzad3, Khalid Mehmood1,3 and Jiakui Li1,* 
...e in alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities in the serum along with decrease in level of antioxidant enzymes and significantly increase in the MDA contents in TD afflicted chickens compared to control group. The SM administration to TD affected birds significantly ameliorated lameness, stimulated ALP level with a decrease in ALT and AST contents, increase in antioxidant parameter and d...
Nadia Saeed1,Mian Sayed Khan2, Habib Ahmad3, Muhammad Abdullah4 and Muzafar Shah5,*
...es infested with plant parasitic nematodes were treated with different organic amendments pigeon manure, horse dung, cow dung, duck manure and castor oil cakes at the rate of 8 Kg/tree and saw dust at the rate of 10kg/tree, respectively. Untreated trees were kept for the comparison. Soil samples and sub samples of both treated and untreated trees after 3, 6 and 12 month from Abbottabad and Mansehra by using Bearmann funnel technique. After Quantitative analysi...
Muhammad Asim Khan1,*, Shahid Niaz Khan1, Sanaullah Khan2, Abdul Jabbar Khan3, Muhammad Adnan4, Nawab Ali5 and Ijaz Ali6
... detection of malarial parasites. In the Southern districts, the overall incidence of Plasmodium slides positivity was 52.47% of which 91.07% were identified as Plasmodium vivax and 6.23% as P. falciparum and 2.69 was 43.62%, of which Plasmodium vivax were 91.2%, Plasmodium falciparum were 6.09% and 2.68% were identified as mixed infections. Malaria was most prevalent in the age group 11 - 20 years (61.68 %,) and 40 -50 > ...
Hazrat Nabi1, Irshad Hussain2, Muhammad Adil3, Amar Nasir3,*, Arbab Sikandar3, Saeed Khan1 and Nasrullah Khan3

 

...ed from Aspergillus parasiticus were mixed in the feed measuring 150 ppb and fed to various broiler groups. Mycotoxin binders were also added into the feed and offered to group E and F from 14th-42nd day of age. The impact of mycotoxin binders on antibody titer against New Castle disease virus, feed consumption, weight gain, relative weights of lymphoid organs and feed conversion ratio (FCR) of broilers were investigated. Chicks fe...

Fatma Abdallah1*, Ola Hassnain2, Elsayed Attar3, Haytham Ali3,5, Mohamed Megahed1 and Venugopal Nair

...ains together with the Eurasian origin viruses in an independent taxonomic unit distant from the North American strain.  

...
Danyu Zhang1, Ying Liu1, Qinxin Shi1, Zhiwei Peng1, Yan Hua1 and Zhijun Hou1,2,*
...about gastrointestinal parasite and bacterium of the sable, but it was important for its health. Five parasitic species and two hundreds thirty four gut bacteria (genus) of the sable were detected by the saturated NaCl floating and next sequencing methods. The parasites were Capillaria sp., Baylisascaris devosi, Echinochasmus sp., and two Coccidian...

Muhammad Shoaib Saleem*, Muhammad Faheem Akbar, Amjad Sultan and Saqib Ali 

...(IGRs) against jassid (Amrasca devastans Dist.) on eggplant crop. The crops were grown in a Randomized Complete Block Design (RCBD) with three replications, each have five treatments inclusive of control. The recommended doses of Nitenpyram, Clothianidin, Momentum (combination of Nitenpyram+Chlorfenapyr) and Buprofezin were applied when population of insect pests reached at economic threshold level (ETL). Pre-treatment data were taken before 24 hours and post-...
Matiyar Rahaman Khan1,*, Sabayasachi Pal2, Amit Singh2, Ashok Dhananjaybhai Patel3, Bhagubhai Ambaram Patel3Tushar Manohar Ghule2 and Victor Phani1
...escriptions and beta-esterase phenotyping. The present study elucidated information on M. indica for its easy detection, diagnosis, dimension of damages on citrus, and Bt-cotton under Indian conditions.
...

G. Venkatesan* and Amit Kumar  

...ort term immunity in contrast to other pox viruses and also produce localized skin lesions in humans who are in contact with infected animals and their products. Unique and specific virulence genes located at termini of ORFV genome with their encoded products are attributed to host immune evasion, short-term immunity both in natural infection post-vaccination in target species and repeated host susceptibility. However, these genes are variable among ORFV isola...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

 

...iformis, Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata, Lecanicillium muscarium, Trichoderma harzianum, T. viride, Pleurotus ostreatus, and Monacrosporium ellipsosporum demonstrated a prominent attraction intensity. The attraction intensity of all these fungi increased with time, while that of two fungi, Dactylaria gracilis and A. dactyloides, remained neutral throughout the ...

Muhammad Khalid1,2 and Muhammad Naeem2* 

... Results indicated that Grass Carp is a rich source of protein (58.35%) in dry body weight, additionally, the pioneer reference to the proximate analysis for this species from farming system of southern Punjab, Pakistan is provided. 

...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek
...ta and other plant parasitic nematodes multiplied significantly more in untreated soil than in treated soil, which clearly indicated that L. muscarium effectively reduced the nematode infestation level in the soil.
...

Jam Ghulam Mustafa Sahito1*, Tajwer Sultana Syed1, Ghulam Hussain Abro1 and Inayatullah Rajper2  

... i.e., Bemesia tabaci, Amrasca biguttula biguttula and Scirtothrips dorsalis was recorded on weekly basis cotton grown with both green manure and IPM treatments. The green manure treatments suffered comparatively higher population of B. tabaci (0.83±0.09) and S. dorsalis (3.43±0.47) than IPM treatment with population of 0.46±0.05 whiteflies and 1.98±0.72 thrips, respectively. However, IPM cotton suffered higher A. biguttula biguttul...
Jam Nazeer Ahmad1,2,*, Rashid Mushtaq1, Samina Jam Nazeer Ahmad1,2, Sumaira Maqsood3, Ishita Ahuja4 and Atle M. Bones4
...apid and sensitive polymerase chain reaction (PCR) technique was used for the molecular detection of NPV gene from native NPV diseased insect. Multiple sequence alignment and phylogenetic analysis were performed to compare SlNPV- FSD15 based on Lef-8 with other Lef-8genes sequences clearly showed that our SlNPV-FSD15 isolate belongs to Spodoptera litura associated NPVs. The biological activities of this NPV isolates were investigate...
Dan Yü, Chuchu Li, Yü Huang and Zhen Huang*
...ic metabolites and mycoparasitism. In vitro bioassays were used to evaluate the efficacy of T. hamatum and difenoconazole alone or its combinations against S. sclerotiorum. The results showed that T. hamatum could infect and destroy the mycelia and sclerotia of S. sclerotiorum by mycoparasitism. The cell-free culture supernatant and ethylacetate extracts from T. hamatum inhibited myc...

Malik Muhammad Yousaf1*, Muhammad Zeshan1,2, Mumtaz Hussain1, Muhammad Mohsin Raza1, Muhammad Jahangir Shah1, Bashir Ahmed1 and Sabir Hussain Shah3 

Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
...atients. However, the intraspecific association was noticed among these genes. Coa and spa polymorphism and association analysis indicated that spa negative isolates possess Coa of 1200 and 900bp, whereas spa positive isolates contain Coa of 650bp and 750bp. The most prevalent genes, spa, CPs8 and sea may be considered as molecular targets in designing treatment and control strategies.
...

Mian Noor Hussain Asghar Ali, Liaquat Ali Jamali, Shakeel Ahmed Soomro*, Shakeel Hussain Chattha, Khalil Ahmed Ibupoto, Naseer Ahmed Abbasi and Noor Mehdi Qumi  

... covered with sugarcane trash. The samples of sugarcane were taken at an interval of 24 hours to determine different quality parameters i.e. cane weight, brix, pol/sucrose, purity, fiber and commercial cane sugar. The results revealed that weight loss and fibre content throughout increased with increasing storage period. However, a decrease was observed with increasing storage period for brix content, sucrose content, purity percentage and commercial cane suga...
Zain ul Abidin1, Aisha Khatoon2, Abdul Whab Manzoor1,*, Nida Arooj1, Sajjad Ali1 and Muhammad Numan1
...erse transcriptase-polymerase chain reaction (RT-PCR) performed for both samples gave a product of 443-bp amplifying the highly conserved “N”-region gene of virus confirming the rabies infection in both cases.
...
Amtur Rafeh, Rana Manzoor Ahmad, Ayesha Iqbal, Abdul Majid Khan*
...liocene from Africa to Eurasia. The morphological characteristics indicate this genus as a conservative bovid with simple morphology. 
...

Muhammad Abu Sufyan Ali, Syed Attaullah Shah*, Ghaffar Ali and Muhammad Fayaz 

...pment of agricultural infrastructure. Provision of subsidized inputs could help in raising farmer’s return from agriculture and changing their perception in favor of using their lands for crops and livestock production 

...
Faxiang Wang, Yan Chen, Sai Chen, Xianghong Li, Jian Yu, Jianhui Wang and Yongle Liu*
...ition and properties of grass carp protein. The results show that muscle proteins of grass carp were degraded and underwent conformational changes when stored at 4 °C, and significant changes of the proteins content, as shown by the SDS-PAGE fingerprint, was observed after 6 days of storage. Protein’s surface hydrophobicity and total SH content increased during the first 4 days and then decreased gradually up to 10...

Abdur Rehman1* and Shad Khan Khalil2 

...lign: justify;">Canola (Brassica napus L.) is a rich source of vegetable oil. Its production is often limited by shortage of water during reproductive stages. Salicylic acid, potassium nitrate and methanol are considered to induce drought tolerance in plants. Field trials were conducted at Agricultural Research Institute Tarnab, Peshawar-Pakistan to study the effects of moisture stress and foliar application of chemicals at different growth stages on canola gr...
Li Lv1, Liuan Li1,*, Ruibo Zhang1, Zhichao Deng1, Tianming Jin1 and Gaimei Du2
...d then plateaued. In contrast, these parameters initially increased and subsequently decreased for the high-dose group. Increasing levels of selenium supplementation proportionately increased egg white, egg yolk and total egg selenium levels, as well as egg production (P < 0.05). Dietary supplementation with selenium enriched yeast increases the egg white, egg yolk and total egg selenium levels, as well as egg production of North China hens (P...

Amar Razzaq1, Abdur Rehman4*, Abdul Hassan Qureshi2, Iqbal Javed3, Raheel Saqib5 and Muhammad Nadeem Iqbal6 

... concentration of HEI infrastructures installed on the farms. Sprinkler irrigation system was mainly installed on wheat crop while the drip irrigation systems were installed on mango orchards. Therefore, one half of the sample consisted of modern and conventional farmers growing wheat crop and the other half of the sample consisted of modern and conventional farmers growing mango orchards. Economic analysis measures of benefit-cost ratio (BCR) and net present ...
Hans Van Eyghen
...ints to the effect of infrasound, and an explanations that points to the effect of magnetic variance. I argue that the argument is not convincing because all three explanations are not sufficiently backed up by empirical data and do not have a sufficiently broad scope.
...

Inzimamul Haq1*, Shahid Sattar1, Bashir Ahmed1, Qamar Zeb2 and Amjad Usman

...ichogramma chilonis as parasitoid in the integrated pest management of Chilo partellus in maize field, basic studies on the efficacy of some insecticides against Chilo partellus in Jalal variety of maize and selectivity for the bio-control agent, T. chilonis were carried out under field conditions at Agricultural Research Institute, Tarnab Peshawar during 2016. Treatments viz Proclaim (Emamectin benzoate® 1.9 EC) + T. chilonis, Confidor® (Imidacloprid ...

Waqas Ali* and Mudasser Habib 

...ccination campaigns and drastic environmental conditions strains under negative selection has the ability to make escape mutants. 

...
Asima Bano1, Hafiz Muhammad Tahir2, Hira Sherawat3, Muhammad Mutlib4, Muhammad Arshad5, Muhammad Akram Qazi6, Sajida Naseem5, Rabia Ishaq1, Iram Liaqat2 
...and glucathione S-transferases with breast cancer. For enzyme estimation plasma samples from the patients suffering from breast cancer and age matched healthy individuals (control) were collected. The results revealed decline in the level of these enzymes in breast cancer patients as compared to healthy individuals because of this decline the overall level of protein was also found to be decline. It is concluded from the study that these enzymes can be used as...

Umair Riaz1*, Muhammad Ali Kharal2, Ghulam Murtaza3, Qamar uz Zaman4, Sana Javaid4, Hina Ahmed Malik3, Humera Aziz3 and Zafar Abbas1 

...alyzed by O-methyltransferase. It has been concluded that exogenous application of cafeic acid may be a best option to cope with salinity, ion toxicity, drought and heavy metal stress. 

...

Shoaib Nawaz1, Muhammad Razaq1, Zahid Mahmood Sarwar1*, Muhammad Sajjad1*, Syeda Aneeza Ubaid1, Muhammad Asif Zulfiqar2 and Usman Haider

Saleh S. Alhewairini
...m mite, Oligonychus afrasiaticus (McGregor) was evaluated. This includes the potential of Injo200 and Huwa-San TR50 in increasing the effectiveness of oxamyl against all developmental stages including eggs of O. afrasiaticus. Oxamyl was found to be very effective in controlling the adult of O. afrasiaticus with a little effect on its eggs under laboratory conditions. T...
Ghazunfar Rashid1, Muhammad Avais1, Syed Saleem Ahmad1, Muhammad Hassan Mushtaq2, Rais Ahmed3,*, Mahboob Ali1, Muhammad Naveed-ul-Haque4, Mehtab Ahmad5Mumtaz Ali Khan1 and Naimat Ullah Khan6
...na sativa (Jai), Brassica rapa (Shaljam) and Brassica Campestris (Sarson) were estimated twice a day i.e. early morning and afternoon. The fodder samples were collected from different villages of Okara, Pattoki and Ravi areas of the Province Punjab. Nitrate contents of different parts of the fodder plants were estimated qualitatively through the Diphenylamine Filed Test (DFT) and quantitatively by sp...
Tariq Mahmood1,*, Ijaz Ahmad1, Faraz Akrim1, Abdul Hamid1, Muhammad Waseem1, Abid Hussain1 and Muhammad Sajid Nadeem2
...of dry leaves of annual grass Poa annua, small twigs of bushes and downy feathers. The depth of nest ranged between 5-10 cm. Clutch size ranged from 8-20 eggs while the incubation period was found to be 22-24 days. Hatching success was up to 85% (range 75 to 85%) in different nests. The dense vegetation consisting of Dodonaea viscosa and Poa annua provided shelter, cover and abundant supply of insects to the chicks. The study concludes tha...
Saba Irshad*, Aruba Muhammad, Ammara Muazzam, Farah Sarfraz Anmol and Rehman Shahzad
... platelets counts in contrast to control. The reported polymorphism was meant to be lowering the frequency of blood transfusions and to some extent responsible for diminishing the disease burden among ‘Thalassemia Major’ patients. 
...
Zafar Iqbal*, Farah Ansar, Zil-e-Huma
...cies were examined for parasitic, fungal and bacterial infection. The fish species studied were; Carassius auratus and its six varieties (shubunkin, comet, black moor, oranda, double tail and fantail); molly Poeciliasphenops; platy Xiphophorus maculates; sword tail Xiphophorus helleri; guppy Poecilia reticulata; tiger oscar Astronotus ocellatus; koi carp Cyprinus carpio; ...

 Muhammad Akram and Faheem Aftab

THIDIAZURON INDUCES IN VITRO BUD BREAK AND SHOOT DEVELOPMENT FROM NODAL EXPLANTS OF ORTHOTROPIC SHOOTS OF MAIDENHAIR TREE (GINKGO BILOBA L.)
... and inoculated on MS (Murashig and Skoog, 1962) medium supplemented with different concentration (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1,2,3,4 or 5uM) of TDZ for 24 days. Highest bud break (100%) was obtained at 0.005 uM TDZ after 14 days of initial culture. The same cultures were further maintained and subsequently obtained with 20.6 mm shoot length and 7.2 average number of leaves for another 10 days. Similarly, all other TDZ’s concentrations below 1 u...

 Hafiz Muhmmad Tahir1*, Rabia Yaqoob2

Comparing the efficiency of Taq DNA polymerase and PuRe Taq Ready-To-Go PCR beads in amplifying 12S and 16S ribosomal genes
...iciency of Taq DNA polymerase, an enzyme traditionally used in gene amplification, was compared with the newly developed amplification method, PuRe Taq Ready-To-Go PCR beads. One hundred seventy samples, including both fresh and up to five years old tissue samples, were compared. Taq DNA polymerase was found to be less efficient compared to the PuRe Taq Ready-To-Go PCR beads for amplification of the 12S rDNA gene. However, d...

 Phong Huy Pham

Nesting biology of a spider wasp Auplopus sp. (Hymenoptera: Pompilidae) in Vietnam
...us Heteropoda, family Sparassidae. Developmental time of egg, larva, pre-pupa, pupa, and pre-adult was 6 - 7, 13 - 14, 5 - 7, 41 - 43, and 3 - 4 days, respectively. The duration of egg to adult development ranged from 68 to 75 days.

...

Muhammad Babar Khawar, Nadeem Sheikh*

Effect of paper industry leachate on various serological indices and serum proteins of wistar rats
...um aspartate aminotransferases (AST) (P<0.0001), cholesterol (P<0.0001) and High density lipoproteins (HDL) (P<0.0001) while a significant negative change in triglycerides (P=0.0002) and creatinine (P=0.0370) level in both experimental groups. Alanine aminotransferases (ALT) level showed a significant increment in Group 1 and a decrement in Group 2 compared to control group (P<0.0001). SDS page analysis revealed ...

Muhammad Zafar*1, Muhammad Khalil Ahmad Khan2, Asmatullah3

Efficacy of methamidophos, fenpropathrin and metasystox against aphid population within the response of Brassica campestris at Multan
... of aphid population on Brassica campestris. The experiment was conducted during October 2013 to April 2014. Crop season following a randomized complete block design (RCBD) with four replications and six treatments in the research farm of Babar Agricultural Farm at Old Shuja Abad Road, Multan. Different insecticides showed different mortality of aphid population. Of the three insecticides tested, methamidophos resulted in more than 80% mortality in the aphid p...

 Muhammad Moosa Abro1, Ali Murtaza Dharejo2, Muhammad Munif Khan2, Nadir Ali Birmani2, Saima Naz2*

Description of first record of Petasiger exaeretus Dietz, 1909 (Trematoda: Echinostomatidae) in avian host from Pakistan.
... exaeretus is a common parasitic species of Cormorants. However, it has not been reported from
Pakistan in Little Cormorant, Phalacrocorax niger prior to the present study.

...

 Saima Naz*, Adil Ali Rajpar, Abdul Hameed Chandio

New Records of some Phthiraptera (chewing lice) of birds from urban areas of Hyderabad, Sindh, Pakistan
...n house crow; Anaticola crassicornis (Scopoli, 1763) from wild
goose; Brueelia nebulosa (Burmeister, 1838) and M. eurysternus (Burmeister, 1838) from common myna and bank
myna; Neopsittaconirmus lybartota (Ansari, 1947) from Indian Parakeet; Degeeriella regalis (Giebel, 1866) from black
kite. All were new records from Hyderabad. Bank myna was recorded as new host for M. eurysternus and black kite
was reported first time harbouring D...

 Zafar Iqbal*, Hafiza Madhia Imtiaz

Parasites of double tail goldfish, Carassius auratus L. imported to Pakistan
...planned to investigate parasitic infection of imported ornamental fish, double tail goldfish,
Carassius auratus. A total of 25 experimental fish were examined for parasitic infection. One fish
specimen showed head lesion (1x1cm). Eight different species of parasites were observed on the fish.
The gills showed 100% infection by Dactyl...

 Asma Karim1, Wajid Ali1*, Noreen Ahmad1, Muhammad Irfan2, Hafiz Abdullah Shakir3

Histological and biochemical study of liver of silver carp (Hypophthalmichthys molitrix) after acute exposure to pyrethoride (deltamethrin)
...is [alanine amino transferase (ALT), and aspartate amino-transferase (AST)]. Liver histology
revealed that necrosis, nuclear pycnosis, hypertrophy of hepatocytes, vacuolization, nuclear atrophy and congestion
of blood vessels were observed as compare to control group. This result was also supported by the significant
increase in levels of hepatic enzymes AST and ALT in blood plasma of exposed fish as com...

 Bushra Siyal1, Sanjota Nirmal Das1, Rafia Rehana Ghazi2, Aly Khan3

Heterotestophyes gibsoni sp.n. (Trematoda: Heterophyidae) from the bird little tern (Sternula albifrons) in Sindh, Pakistan
...estigation on helminth parasites of birds, a new species of trematode genus Heterotestophyes gibsoni
sp. n. was recorded from the intestine of little tern (Sternula albifrons) collected from Jamshoro, Sindh, Pakistan. The
new species is characterized by having small body, maximum width attained at the level of mid body region and
twisted at the level of pharynx. Oral sucker terminal, rounded and broader than long. Esophagus long, intestina...

 Zafar Iqbal1, Muhammad Farooq Nasir1, Imran Bodlah1*, Rahmatullah Qureshi2, Ayesha Aihetasham3

Notes on three morphs of Bulaea lichatschovii (Hummel) (Coleoptera: Coccinellidae) from Northern Pakistan
...of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given with illustrations and new distributional
records.

...

 Zafar Iqbal

A review of fisheries education in University of the Punjab, Lahore, Pakistan
...rch facilities in Fish Parasitology, Fish
Mycology and Fish Bacteriology to researchers. Over 60 students have completed
their research projects in fish disease and health management. The future aspects
of “Fisheries Education” needed in aquaculture industry in Pakistan and Asia
Pacific Region is discussed.

...

 Raazia Kiran1, Alya Riaz1, Muhammad Irfan1*, Hafiz Abdullah Shakir2

An overview of pre-treatment methods used for bioconversion of lignocellulosic biomasses into valuable products
... steaming or boiling, ultrasonication, and bursting, chemical methods i.e.,
solvents, acids, salts, bases, the physicochemical processes include liquid hot
water and AFEX (ammonium fibre explosion), biological methods involving whiterot/
brown-rot fungi and bacteria, and quite a few combinations thereof to
breakdown the lignocellulose into its components. Pre-treatment process changes
cellulose morphological, chemical and phy...

Muhammad Shahzad Akbar, Muhammad Zeeshan Majeed* and Muhammad Afzal 

...lantations and wooden infrastructures all over the world including Pakistan. This study was aimed to evaluate the comparative efficacy of 10 commercial formulations of new-chemistry insecticides against Odontotermes obesus (Isoptera: Termitidae), one of the most economic subterranean termite species in Indo-Pak region. Label-recommended dose rates of insecticides were tested against worker termites using modified filter paper disc method according to completel...

Akshay Sharma*, Mohit Mahajan, Madhumeet Singh and Pravesh Kumar 

...ustify;">Trans rectal ultrasonography of a 7 year old crossbred Jersey cow was done at weekly interval from 21 to 63 days post artificial insemination. Monochorionic diamniotic monozygotic twins were confirmed on the basis of different amniotic sacs and corpus luteum on one ovary. Color Doppler study was done to assess the vascularity and functional activity of corpus luteum present on the left ovary. Ultrasonography was emp...
Qingling Hu1,2,3,* and Jinian Feng3
...etae on pronotum, the ultrashort chapped craspedum on posterior margin of abdominal tergites, and the shape and relative locations of setae on tergite IX.
...

Fouzia Tabssum1, Qamar uz Zaman2*, Yinglong Chen3,4, Umair Riaz5*, Waqas Ashraf6, Ambreen Aslam2, Nusrat Ehsan2, Rab Nawaz2, Humera Aziz7 and Shamim ul Sibtain Shah8 

... rice cultivars with contrasting salt tolerance: Super basmati (salt susceptible) and Shaheen basmati (salt tolerant) in both nursery and field conditions. For pot experiment, salinity stress was imposed by applying 50 mM of NaCl solution to the soil daily for three continuing days, and applications of proline (0, 25, 50, 75 and 100 mM) was applied 25 DAS. For field experiment, the same cultivars were grown in a saline soil (EC = 5.05 d Sm-1) for two growth se...

Muhammad Salman Wazir and Mohammad Akmal 

...one other crops rows of Brassica (Brassica juncea), Fababean (Vicia faba) and Sunflower (Helianthus annuus), hereafter, referred as IC-I and IC-II. The N splits were applied of the total recommended 120 kg ha-1 N in splits, i.e. N splits application (NS) viz. NS1 (50% sowing and 50% tillering), NS2 (25% sowing: 50% tillering and 25% anthesis) and NS3 (25% sowing, 25% tillering and 50% anthesis). Experimental design was a ran...
Xiao-Ying Ren1, Di Zhang2 and Wan-Long Zhu1,*
...ficant differences in intraspecific skulls, some differences were shown in interspecific skulls, such as the point between the anterior tip of suture nasal and premaxilla, anterior tip of suture between nasal and premaxilla, anterior and posterior most ventral points of the upper incisor alveolus, and coronoid process, angular process ascending ramus and condylar process on the mandible. The genus Eothenomys could be classified into two subgenera. Moreo...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...g at a low level. In contrast, PTGES2b expression significantly increased during spawning. These results provide basic knowledge of the new PTGES2s of C. nasus.
...
Asim Faraz1,*, Muhammad Younas2, Abdul Waheed1, Muhammad Yaqoob2 and Kashif Ishaq3

 

...e kikar, phulai, beri, siras, jand, khagal, dhaman, persain, khawi, bui, bhakra, kari, laana, phog, karir and khar laana. Regarding hair mineral status Ca, Mg, Cu, Zn, Fe and Mn concentrations were found to be significantly different (P<0.05) between calf groups being higher in IMS as (685.07±15.86, 595.67±15.86; 104.33±5.12, 101.17±5.12; 7.08±0.34, 6.73±0.34; 65.33±2.25, 59.33±2.25; 322.20±8.67...
Jair Millán-Orozco1,*, Jersson Millán-Orozco2 and Luz María Tejada-Ugarte3
...kg, stocked on a Taiwan grass (Pennisetum purpurem) pasture maintained at a sward surface height of 30 cm. Observations were conducted during daylight hours (06:00-18:00) from May to April of the next year for three consecutive days every month of the following year. The highest (P<0.05) grazing activity was observed during September (38.9±11.4 min/h), while in May (27.1±14.3 min/h) was the month with least activity (P<...
Muhammad Saqib Shahzad1, Amina Arif1,*,Saeeda Kalsoom2, Javed Iqbal3, Shahnam Shafique2, Muhammad Shahid Nadeem4 and Rafique Ahmed5
... and alanine aminotransferase (ALT) values were recorded and analyzed for rapid virologic response (RVR), non-rapid virologic response (NRVR), sustained virologic response (SVR) and non-sustained virologic response (NSVR). Among the evaluated patients RVR was found among 81.5% and NRVR among 18.5%. Out of RVR patients, SVR was found in majority (80.2%). However, among NRVR equal percentage of SVR and NSVR was found. An inverse association of SVR was found agai...

Mudassar Javed, Muhammad Zeeshan Majeed*, Muhammad Luqman and Muhammad Afzal 

...g with the biological (parasitoid Trichogramma chilonis egg cards) and cultural techniques against okra lepidopterous borers. According to results, maximum shoot and fruit infestations (i.e. 19.86 and 15.63%, respectively) by okra borers were recorded in control (unsprayed) module, while minimum (i.e. 6.76 and 2.89%, respectively) were found in IPM module. Mean shoot and fruit infestations in farmers’ routine module were 13.91 and 10.83%, respectively du...

Salman Ali*, Inamullah, Muhammad Arif, Mehran Ali, Muhammad Owais Iqbal, Fazal Munsif and Arsalan Khan 

...l crop growth stage can drastically reduce crop yield, therefore, five times irrigation each at (mentioned) crop growth stage along with 75 kg ha-1 K is recommended for higher maize production. 

...
Muhammad Asad Saleem1,*, Mirza Abdul Qayyum1, Mudssar Ali1, Muhammad Amin2, Muhammad Tayyab1,3 and Sumaira Maqsood4
...ecrease in weight gain, frass production and cumulative gain in size was found when larvae were treated with integrated effect of Bb and Nit. Depending on the lethal of treatment, development duration of RPW was disturbed. Integration of Bb and Nit delays the development and diet uptake in RPW which can be used for agent of control for this cryptic insect.
...
Tamoor Azeem1,*, M. Yasin Tipu1, Asim Aslam1, Sajjad Ahmed2, Salman Ahmed Abid1, Abdullah Iqbal3, Naeem Akhtar4, Muhammad Saleem4, Aamerzish Mushtaq4 and Sajid Umar4
...;0.05).
...
Pingping Cang1, Mingming Zhang1, Guo Qiao1,Qirui Sun1, Dehai Xu3, Qiang Li1, Xinghua Yuan4 and Wenbin Liu2,
...iv>...
Sumaira Maqsood1,*, Muhammad Afzal2, Muhammad Saleem Haider1, Hafiz Azhar Ali Khan1, Muhammad Ali1, Muhammad Ashfaq1, Muhammad A. Aqueel2 and Muhammad Irfan Ullah2
...prising cauliflower (Brassica oleracea var. botrytis). Current inspections were carried out to determine their impact on larval mortality, pupal and adult emergence by exposing three field strains of S. litura (Faisalabad, Chiniot and Sargodha), under laboratory conditions. Both NPV and Bt were applied using diet incorporation method. Two concentrations of a NPV based formulation (Somestar): 1x107 and 1x108 POB...
Huseyin Cetin1,*, Oner Kocak2, Emre Oz1, Samed Koc1, Yesim Polat1 and Kalender Arıkan2
...ic bacteria, fungi and parasites. The use of synthetic pyrethroid (SP) insecticides is recommended by the World Health Organization for the control of adult houseflies. Despite the fact that SPs have been used effectively, this insect has developed resistance in many regions/countries of the world. The use of synergistic substances to overcome insecticide resistance is widespread. Piperonyl butoxide (PBO) is used as a synergist in combination with SPs for the ...
Samiah Shahid1,Jawaria Shaheen1, Wajeehah Shahid2, M. Waheed Akhtar1,3 and Saima Sadaf1,*
...titative real time polymerase chain reaction PCR (qPCR) may be utilized as a sensitive and reliable technique for the determination of circulating miRNA expression. Despite recent advancements, there is not a single consensus on the use of reference gene for quantification of circulating miRNAs through qPCR analyses in ALL. In the current study, we identified the reference gene that is the most suitable for qPCR normalization in patient and control plasma samp...
Tafail Akbar Mughal1, Muhammad Zubair Saleem2, Shaukat Ali3,*, Khawaja Khurshid Anwar1, Muhammad Majid Bashir1, Muhammad Babar4 and Muhammad Adeeb Khan1
...LAT (alanine aminotransferase), ASAT (aspartate aminotransferase) and LDH (lactate dehydrogenase) and biochemical components like glucose, urea, lipids, cholesterol and protein contents both in the liver and blood while DNA and RNA contents only in liver. The administration of CCl4 resulted in increase in plasma ALAT and decrease in LDH. Vitamin E pre-treatment abolished CCl4-induced changes in the acti...

 Saira Zaheer1, Abrar Hussain1*, Aqsa Khalil1, Muhammad Mansha1, Muhammad Lateef2

..., is highly infectious parasite of small ruminants, and is a major cause of diseases and significant mortality in various cattle, sheep, deer, buffalo and goat, etc. Various synthetic anthelmintics have been used, on wide scale, to control the helminths infections.But the parasite worms have developed multiple resistances against the synthetic anthelmintics. Hence, various biological controls, vaccines and local medicinal pl...
Imran Bodlah1, Ammara Gull-E-Fareen1, Muhammad Tariq Rasheed1, Muhammad Amin2, Ayesha Aihetasham3
...e first time as larval parasitoid of Coccinella septempunctata (Linnaeus, 1758) and Menochilus sex maculata (Fabricius, 1781) from various areas of Pothwar. Main identification characters of N. mirabilis supported with measurements and illustrations are provided here with notes on distributional range.
...

Rizwan Ullah Shah* and Iqbal Munir 

...nd root regeneration of Brassica carinata. Seeds were sterilized and germinated, of which one week cotyledon and hypocotyl were used for callus formation and shoot regeneration at five different level of 1-naphthaleneacetic acid NAA (0.05, 0.1, 0.5, 1.0 and 1.5 mg/l) and 6-benzyl amino purine BAP (0.1, 0.5, 0.7, 1.0 and 1.5 mg/l), and root regeneration at four levels of indole butyric acid IBA (0.05, 0.1, 0.2 and 0.5 mg/l). Results showed that at NAA 0.05 mg/l...
Jam Nazeer Ahmad1,2,*, Muhammad Jafir1, Muhammad Wajid Javed1, Sumaira Maqsood3 and Samina J.N. Ahmad1,2,*
...) was done through Polymerase chain reaction and sequencing. In PCR, mitochondrial cytochrome oxidase I (COI) gene based primers were used for identification of this pest collected from various cotton fields in Punjab. Phylogenetic analysis was also complemented to differentiate DCB identified from other countries of the world. The PCR bands obtained in gel electrophoresis amplified PCR fragments from all DCB species at 710 bp. The sequencing results and phylo...
Muhammad Usman Ahmadand Ikram-ul-Haq*
...f Emulsiflex prepared oxyrase extracted from cytoplasmic of membrane fragments of E. coli. For this purpose, 88 E.coli isolates from 30 intact poultry intestines were cultured and identified preliminary on the basis of microscopy and biochemical testing. E. coli strain EC4 was screened as best oxyrase producer with activity of 0.41±0.008U/mL/min with 41% reduction in dissolved oxygen at pH 7.5, te...
Osman Ergene1,*, Isfendiyar Darbaz1, Serkan Sayiner2 and Selim Aslan1
...ion (AI). Transrectal ultrasonography (TRUS) was performed on all cows on days 30 and 40 after AI. Measurements were carried out on 9 cows whose pregnancy was confirmed and 9 cows whose embryonic mortality (EM) was determined. In PAG-Serum, there was a statistically significant difference (P <0.05, P <0.01) between the measurements on 40th day when EM was detected and on the 28th and 32nd days of pregnancy. In the PAG-Milk and PSPB-...
Luo Lei1, Xingxing Deng1, Dengyue Yuan2, Zonglin Zheng1, Chengke Zhu1, Hui Luo1, Baohai Li3, Hua Ye1,* and Chaowei Zhou1,3,*

 Tung-Yi Kho

...odernization in all its grasping materiality and technological glory, my paper reveals that the capacity of a modernist lifestyle to engender well-being, much less the good life, is far from assured. Meanwhile, my research in Shenzhen disclosed an alternative, Relationist, conception of well-being that was seldom expressed or associated with the good life despite also being ever present. This was a mode of well-being that was constantly being re-created in the...
Jason Shepard1 and Tyra Turner2
...ng specific cultural contrasts (Study 2 and Study 3). Taken together these three studies provide evidence that the relation between future-oriented thought and well-being is robust across cultures. This research also provides an example of how big data can be leveraged for cross-cultural research. 

...

Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2 

... database (100%); In contrast, alignments among the same genera and species demonstrated 91–98% identity. We then predicated that isolated encoded culture (MPS16) predetermine with Macrophomina sp. 

...

Arjumand Nizami1, Jawad Ali1 and Muhammad Zulfiqar2* 

...es and other physical infrastructure. In order to overcome these losses, communities apply short-term coping strategies by spending limited means and hard-earned cash reserves. These unsustainable strategies further exacerbate vulnerabilities and give way to new ones. Taking empirical example of Chitral, the study recommends to formulate policies and encourage investment to substitute short term coping strategies with long term climate change adaptation measur...

 Xu Lijie, Obaid Ullah, Liu Haixing, Ihsan Ali, Zhongshu Li* and Nan-Zhu Fang*

...DUOX1, and NOXA1. By contrast, embryo treatment with pioglitazone after H2O2 exposure promote embryo development, significantly decreased the ROS level, downregulates the expression levels of NOX2, DUOX1, and NOXA1, and upregulated the expression levels of PPARγ, Nrf2, and the antioxidant enzyme genes GPx3, GPx4, SOD1, SOD2, and SOD3. In conclusion, pioglitazone can reduce intracellular oxidative stress during in vitro development b...
Saleha Gul1,2, Muhammad Khisroon2, Ajmal Khan2, Attaullah1, Saira Gul3 and Gul Nabi Khan1,4,*
... other narcotics like charas and snuff (p˂0.05). The passive smokers using snuff were having significantly higher TCS values then the control (p˂0.05). Reduction in TCS values of active smokers using green tea on daily basis were statistically significant (p˂0.05). Taking together, our results indicate that tobacco smoking highly induces DNA damage in blood cells. Additionally, green tea significantly reduces the toxic effects of smoke ...

 Şaban Çelebi

...ificantly (P<0.05) incrased GSH-Px, SOD and CAT activities in treatment groups. In conclusion, results indicated that Vitamin E and selenium supplementation of laying hen diets could protect these animals from detrimental effect of free radicals by increasing activity of antioxidant enzymes.

...

Huma Khalil1*, Muhammad Afzal1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Sajjad Khalil1, Farghama Khalil2 and Hafiz Khurram Shurjeel1 

...odiversity of braconid parasitoids in citrus orchards of Sargodha, Pakistan. Surveys were done during January 2014 to December 2015 from various citrus growing localities. A total of 3,176 parasitoids belonging to five subfamilies (Alysiinae, Aphidiinae, Braconinae, Microgastrinae and Opiinae), 12 genera and 16 species were collected. Out of them, two genera and 12 species were recorded for the first time from this area. Aph...

Bata Shalangwa Ishaku1, Batim Turdam1, Maimadu Abdullahi1, Waziri Ibrahim Anjili2 and Mayowa Olabode2 

...d risk factors for endoparasitic infections in donkeys at Ganawuri district market, Plateau State, North Central Nigeria. Fecal and blood samples were collected from 300 donkeys and analyzed using a standard laboratory procedure. Coprological examination conducted using flotation and sedimentation techniques showed that 276 (92.0%) were positive for gastrointestinal nematodes. A greater proportion (70.7%) of the nematodes were Strongyles followed by mixed infe...

 Tazeen Jamil, Saba Ijaz, Rabia Arif*, Faiza Akram and Muhammad Saleem

...recollected from two contrasting environments of Evolution Canyon i.e. harsh South facing slope and neutral North facing slope. Retroelements profiles were generated in order to detect retrotransposons. Strains from South facing slope exhibited more copy number of Ty3-gypsy, LINEs and Ty1-copia as compared to strains from North facing slope. In total, 52 fragments of Metaviridae (Ty3-gypsy), 104 fragments of LINEs and 66 fragments of Ty1

Amer Mumtaz2*, Muhammad Suhail Ibrahim1, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Masooma Munir2, Aqsa Qayyum2, Sahar Shibli2 and Muhammad Khalid Ibrahim3 

...nd DNA fragmentation. Ultrasounds have diversified application in meat industry, extraction of bio actives, dairy industry, Enzyme technology, fruit and vegetable juice industry, water, waste water treatment, starch modification and removal of food allergens from food. 

...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...ecomes altered when the Kras gene is mutated. The most common Kras mutations are found in codon 12 and 13 and 61. Some other noncanonical mutations have been reported in codon 11, 14, 15, 17, 18, 19, 20, 22, 27, 30, 31, 117, 146 and 154. We aimed to demonstrate the conformational changes induced in two novel K RAS variants, p.E31K and p.G138V, identified...
Sumreen Hayat1,6, Muhammad Hussnain Siddique2, Bilal Aslam1, Habibullah Nadeem2, Asma Ashraf3, Muhammad Saqalein1, Mohsin Khurshid4, Naveed Shahzad5 and Saima Muzammil1,*
...was carried out by polymerase chain reaction (PCR). Of 392 blood and urine samples, 120 were found positive for microbial growth. Antibiotic susceptibility testing of K. pneumoniae isolates illustrated high resistance to ceftazidime (95.6%). Phenotypically,52.17% of K. pneumoniae isolates were found to be ESBL producers as observed by double disc synergy test while the tested ESBL genes were detected in 56.52% of isolates. The studyrevealed multi...
Ashfaque Ahmed Nahiyoon1,*, Shahina Fayyaz2 and Nasira Kazi2
...the diversity of plant parasitic and soil nematodes associated with cotton plants in Sindh. During 2017–2018 extensive surveys were conducted at the time of cropping and at harvesting and soil root samples were collected from different fields in the cotton producing regions of five districts of Sindh viz., Sanghar, Mirpurkhas, Umerkot, Mityari and Tando Allahyar. The analysis of samples resulted in the identification of one new species of soil nem...
Huma Naz1,*, Sajid Abdullah2, Khalid Abbas2, Wardah Hassan3, Moazama Batool4, Shakeela Perveen5, Sadia Maalik4 and Sajida Mushtaq4
...and glutathione S-transferase in different organs (liver, gills, kidney, brain, heart and muscle) of fish, Labeo rohita. The LC50 of chlorpyrifos+endosulfan mixture was calculated as 1.95±0.02 μgL-1 for 96 h with the 95% confidence limits. The fish expose to the mixture (1:1) for 96-h. The results obtained from this study showed that superoxide dismutase, peroxidase and glutathione S-transferas

Syed Atif Hasan Naqvi* 

...s. Climate change has a drastic effect for the development of this disease and still there are no remedies to tackle this problem. Environmental issues are also needed to be addressed in the future research agenda of this disease.
 

...
Bushra Siddique1,*, Muhammad Tariq1, Muhammad Naeem1 and Muhammad Ali2
...of foraging. Aphid endoparasitoid, Diaeretiella rapae (McIntosh) (Hymenoptera: Braconidae) have an ability to locate itshosts by responding to odours from aphid hostplants or by visual searching.The treatments with different combinations of plant extracts and semiochemicals were used for natural enemypreference experiment. The experiment was conducted with seven treatments and five replications at Glass house situated in Pir Mehr Ali Shah Arid Agricultu...
Ailing Huang, Lingyu Meng, Wei Zhang, Junyan Liu, Guangyao Li, Huihua Tan, Wen Lu and Xialin Zheng*
...ermethrin on Carboxylesterase (CarE) was the most obvious than other four pesticides; activity of glutathione-s transferase (GST) was inhibited by abamectin, while the trend was in the opposite direction for other four pesticides; activity of superoxide dismutase (SOD) was promoted by beta-cypermethrin and chlorpyrifos, and inhibited by abamectin and bisultap; Activity of catalase (CAT) was promoted by beta-cypermethrin, chl...

Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2 

...d ornamental plants on parasitoid performance. Among artificial diets tested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the field for conser...
Sheng Niu1, Ali-Raza Jahejo1, Fa-jie Jia1, Xin Li1, Guan-bao Ning1, Ding Zhang1, Hai-li Ma1, Wei-fang Hao2, Wen-wei Gao1, Yu-jun Zhao1, Shi-min Gao1, Jian-hui Li1, Gui-lan Li1, Fang Yan1, Rong-kun Gao1, Huan-chun Chen1,3 and Wen-xia Tian1,*
...ant glutathione-S-transferase A3 (rGSTA3) proteins. We explored the responses of HDPs in erythrocytes to thiram-induced TD and rGSTA3 protein by quantitative real time PCR (qRT-PCR). The results showed many HDPs expressions were suppressed by thiram-induced TD, and the expressions of HDPs were upregulated by rGSTA3 protein. These findings demonstrated that mRNA expressions of HDPs are highly related to thiram-induced TD, and rGSTA3 protein enhanced the immune ...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
...05). Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), superoxide dismutase (SOD), cortisol and lysozyme in serum showed no significant differences between the two stocking groups (P>0.05). Fish reared at high stocking density had significant lower total protein (TP), cholesterol (TC), triglyceride (TG) and glucose (Glu) content in serum compared with those reared at low ...

Abdur Rehman1*, Iqbal Javed2, Zhang Nannan3, Muhammad Niamatullah1, Raheel Saqib4 and Allah Bakhsh

... ranked first for the infrastructure of agricultural information, the capital city Shijiazhuang in Hebei province as ranked first in the agricultural informatisation and human resources index. The Hengshui city ranked first in the agricultural informatisation subject to environmental index. Recently the Park in Hebei province, although more modern and high standard basic farmland and so on the basis of the modern agriculture construction, but still incomplete ...
Hayat Zada and Ahmad-ur-Rahman Saljoqi*
...rough intercropping (Brassica campestris, Brassacicacae), Glycine max, leguminacae), Trifolium alexandrinum, Fabaceae) and Triticum aestivum, Poaceae) in the apple orchard were a substantial effect on the management of C. pomonella (L). Minimum mean fruit drop were recorded for the intercrop Apple + Trifolium (2.87) which were significantly lower than all other intercrops including control ...
Wang Zaigui1,*, Guo Panpan1, Ye Miao1, Sun Linghong1, Zhang Hongfu2 and Liu Chaoliang1,*
...nificantly decreased contrasting to the blank group (P<0.05). (2) In the larval duration of 4th instar silkworm, adding B. subtilis to the feed could significantly increase the AWG and RFC and decrease of RAML (P<0.05) (3) In the larval duration of 5th instar silkworm, maximum growth parameters level were achieved with silkworm in the experiment group, that the AWG, RFC and RAML, were very significantly affected...
Wali Khan1,*, Mudassar Iqbal2 and Israr Khan2
...trolling of intestinal parasitic diseases in children.
...
Shamsudin Bojang1, Idris Abd Ghani2, Jugah Kadir1, Adamu Saidu Paiko1, Yasir Iftikhar3 and Muhammad Kamran3,4,*
...>infections on the turf grasses. Samples were collected based on the sparsely growth and chlorotic appearance of the greens. A total of 36 soils and roots sample were collected. Scanning electron microscopy (SEM) was used to identify the parasitic nematode. Both the field symptoms and SEM micrographs confirmed that the nematode isolate was M. graminis. Since this nematode has been known to damage the greens and other ...
Iqra Jaffar, Zainab Sehzadi, Muhammad Adeel, Khalid P. Lone and Mehwish Faheem*
... of glutathione-S-transferase (GST), catalase (CAT), glutathione (GSH) and by measuring lipid peroxidation (LPO). Catalase activity increased significantly in liver and gills of fish exposed to 10μg/l of DBP. Level of GSH and LPO increased significantly in gills while a non-significant decrease was recorded for GSH and GST in liver. These results showed that exposure to low concentrations of di-n-butyl phthalate are capable of inducing oxidative stress in v...
Abid Hussain Shahzad1, Abdul Sattar1,*, Nasim Ahmad1, Ijaz Ahmad2, Deniz Nak3 and Yavuz Nak3
...y was diagnosed using ultrasonography on d30, d60 and d90 post AI. Ovulatory follicle diameter was measured at timed AI and progesterone profile (ng/mL) on d30 and d60 post AI. Pregnancy rate was analyzed by Chi-square procedure while ovulatory follicle diameter and Progesterone profile by one way ANOVA (α=0.05). Ovulatory follicle diameter (Mean±SEM) was 15.19±0.17 (OVP0), 15.30±0.21 (OVP5) and 15.24±0.19 (OVP7), respectively...
Abdur Rauf Nizami*
...emblages of the Middle Jurassic Samana Suk Formation, Chichali Gorge Section, Surghar Range, Sub-Himalayas-Pakistan”. The Samana Suk Formation is a carbonate sequence of the Middle Jurassic age and is widely distributed in the Upper Indus Basin, northern Pakistan. This formation belongs to the Baroch Group and is mainly comprised of limestones, which were thought to be a prospective fossils archive. The Samana Suk Form...
Lichao Feng1,2, Shaoqing Zhang4, Dianyuan Chen2, Sina Adl3 and Donghui Wu1,4*
...onum), or leaves of grasses (Poa annua, Echinochloa crusgalli), or maize leaves (Songyu 419, a hybrid variety) as food sources to feed the adult of A. fuscicollis. The larvae were reared on roots of the same grasses and germinated maize seedlings. Additionally, potato tuber the common food used to grew the beetles that was selected as a reference to demonstrate that blooming wildflowers through their...
Xiaona Cao1,3-5, Yuanyuan Ren2-5, Xiaoteng Cui2-5, Baoxin Qian2-5, Chunyan Zhao 2-5, Jie Yang2-5, Chao Su2-5,* and Xingjie Gao2-5,*
...f stressed cells; in contrast, 87% of cells with strong hnRNP A1 signal within nucleus reduced to 50% during stress. In addition, transport receptor importin-β pathway seems to be involved in the nuclear import of hnRNP A1, rather than HuR and TIA1. However, the slightly enhanced cytoplasmic accumulation of hnRNP A1 can not influence the formation of hnRNP A1 granules during oxidative stress. Timely and effective dynamic distribution of specific st...

Essossinam Ali* 

...ent of transportation infrastructure in order to reduce farmers’ risk aversion in the study areas. 

...

Shakeel Ahmad Anjum1, Sami Ullah1*, Muhammad Mohsin Raza2, Mohsin Raza1, Muhammad Abbas3, Ijaz Ahmad4, Malik Muhammad Yousaf2, Muhammad Zeshan5, Adeel Abbas1, Mehmood Ali Noor1 and Mohsin Nawaz1 

...ng grain filling, in contrast to late application rate. 

...

Hala Mohamed Nabil Tolba1, Naglaa Fathy Saeed Awad1*, Gamelat Kotb Farag Kotb2, Amany Adel3 

...erse transcriptase polymerase chain reaction (RT-PCR). The nucleotide and deduced amino acid sequences for VP2 hypervariable region of selected five IBDV field isolates were determined and compared to well characterized reference and vaccine strains worldwide. The IBD virus was detected in 9 out of 16 (56.25 %) investigated chicken flocks. Sequence analysis revealed that the analyzed Egyptian isolates identified as very virulent Infectious bursal disease virus...

Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2 

...n the other hand, in contrast to all other treatments, the joint use of 50% NPK+50% PM exhibits the most significant impact on okra growth. 

...
Saeed Murtaza1,*, Nazir Ahmad2, Muhammad Asif Raza3, Muhammad Saleem Akhtar1, Muhammad Mazhar Ayaz4, Muhammad Ali5 and Rais Ahmed6
...epididymis.
...
Wen-Feng Li1, Rong-Yue Zhang1, Chun-Hua Pu2, Jiong Yin1, Zhi-Ming Luo1, Xiao-Yan Wang1, Xiao-Yan Cang1, Hong-Li Shan1 and Ying-Kun Huang1,*
...vided into two groups: parasites and predators. The dominant species include Apanteles flavipes (Cameron), Sturmiopsis inferens Townsend and Trichogramma sp., which parasitize the sugarcane borer; Synonycha grandis (Thunberg), Lemnia biplagiata (Swartz), Cheilomenes sexmaculata (Fabricius) and Thiallela sp., which prey on Ceratovacuna lanigera Zehntner; and Euborelli...
Naheed Ikram and Nafisa Shoaib*
...pagrus sp. Parastromateus niger, Nemipterus sp., Pampus argenteusIlisha sp., Alepes djedabaEpinephelus sp., Teraponjarbua, Terapon puta, Scomberomorus koreanus, Epinephelus coioides, Lutjanus sp., Pomadasys sp. and Lutjanus johnii procuredfrom Kemari fish harbor (Pakistan). Our study shows that fresh fishes were not contaminated by incidence of fungi. As...

Attaullah Khan Pathan1, Imran Ali Rajput1*, Agha Mushtaque Ahmed2, Muhammad Waseen Kalroo1, Muhammad Munir Shahid4, Abdul Qadir Baloch3 and Faheem Ahmed Rajput2 

...umentation of braconid parasitoids of pink bollworm on cotton crop at lower Sindh was conducted during the cotton season 2016. The results found that maximum parasitoid mean population 175.85±0.16 was recorded from Sanghar and lowest population 139.42±0.45 from Umerkot district. The highest population was recorded in the month October. Highest number of Bracon gelechiae found than other in all selected district...
Khansa Nazir1,*, Tariq Mukhtar1 and Humayun Javed2
...he management of plant parasitic nematodes using nanoparticles can be one of the important alternatives. In the present study, the nematicidal activity of silver nanoparticles (AgNP) was investigated against the most destructive root-knot nematode (Meloidogyne incognita). The maximum mortality of juveniles was recorded at a concentration of 100 mg/ml followed by 75 mg/ml of AgNP. The minimum mortality was recorded with 25 mg/ml of AgNP. With the increas...
Constance Obiageli Ejilibe1, Helen O. Nwamba2, Ifeanyi Chinedu Atama3,*, Chiamaka Lynda Ani2, Ifeanyi Oscar Aguzie3, Josephine C. Madu3 and Christopher Didigwu Nwani3
... The Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and total protein (TP) concentrations in homogenized muscle samples was determined by standard procedures. ALT, AST and ALP increased significantly in response to concentrations of Butaforce® (7.00, 9.00 and 11.00 µgL-1) and Termex® (15.00, 20.00 and 25.00 µgL-1) us...
Kun Wang1,2, Yinglin Cui2, Xu Zhao2 and Changjiang Hu1*
...sion of DNA methyltransferase 3b (DNMT3b) and Matrix metalloproteinase-9 (MMP-9) was evaluated by western blot. And microRNA-29b was identified using quantitative real-time PCR. 3). Compared with the Model group, the group treated with XN had a significantly reduced number of dead neurons in hippocampus and cortical regions of ICH rats. Furthermore, this treatment significantly increased protein expression of claudin-5, ZO-1 and VE-cadherin while protein expre...

Chukwuemeka Calistus Okolo1*, Ikenna Onyema Ezeh2, Chinelo Nnenna Uju3 and Nwakaego Ernestina Nweze1 

...cted control (F). When parasitaemia peaked, groups A and B received 7mgKg-1 and 3.5mgKg-1 of diminazene aceturate (DA) respectively alongside ongoing probiotics supplementation. Group C received only probiotics. Group D received 3.5mgKg-1DA only. Group E (infected control) received no treatment. Parasitaemia, haematobiochemical, and oxidative stress markers were determined. At day 13 PS, there were no significant (p< 0.05...

Obaidul Islam*, Shameema Khatun and Mustasim Famous 

...P>0.05). In case of parasitic diseases, the highest prevalence was observed in DVH (34.61%) and lowest in CVASU (28.57%). The prevalence of nutritional diseases was lower than in other clinical conditions. The highest prevalence of diseases according to age, breed and sex was observed in younger (<1 year), Local breed and male respectively. Keeping in view these findings, an appropriate control strategy could be designed and applied, which helps to preve...
Sikander Ali1, Muhammad Kamil Malik1, Muhammad Zubair1*, Muhammad Jawad Saleem2, Kanwal Hanif2 and Saira Azmat3
...ustard aphid.
...

Sajjad Ali1, Atta-ur-Rahman1 and Sher Ali2* 

... land utilization for infrastructure instead of farming remains at the same speed till 2055, there will be no agricultural land in the tehsil for farming. Population increase is the main cause of such firm land loss. Statistical technique like central tendencies, dispersion and co-efficient of correlation were applied on population, area under built-up environment, cultivated area and crop production in the study area. During the study period from 1985-2015, r...
Laiba Shafique1,*, Muhammad Afzal2, Syed Zakir Hussain Shah3, Mahroze Fatima4, Huma Naz5, Saif ur Rehman1, Youchuan Wei1 and Qingyou Liu1,*
...e proximate analyses of grass carp (Ctenopharyngodon idella). Four experimental diets viz. FD1, FD2, FD3 and FD4 having formic acid (%) and vitamin D3 (IU/Kg) 0, 0; 2, 0; 0, 5000 and 2, 5000, respectively were prepared. Fish were fed with experimental diets for 90 days. Growth performance of fish was observed on fortnightly basis throughout the trail. At the end of feeding trail, fish were dissected to obtain the samples of mu...
Muhammad Waseem1, Ahmed Raza1, Hamera Aisha1, Muhammad Naeem Awan1, Tariq Ahmad2, Rabia Nazir2 and Tariq Mahmood2,*
...dian pangolin (Manis crassicaudata) found in Pakistan is threatened by the rampant trade of the species, and has been listed as endangered since 2014 and also included in Appendix-I of CITES. The IUCN estimates indicate a decrease of ≥ 50% in the global Indian pangolin population over the next 21 years, highlighting the need for protecting the species against illegal trade. In the current study, we investigated the scale of its poaching and illegal t...
Manzoor Hussain*, Marie Maňasová, Miloslav Zouhar and Pavel Ryšánek
..., Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata, Lecanicillium muscarium,Trichoderma harzianum and Pleurotus ostreatus,along with two chemicals,Vydate and Basamid (G),were evaluated against northern root-knot nematodes, Meloidogyne hapla, on carrots in a greenhouse. All fungi and chemicals proved to be efficient in reducing the infestation l...
Mubasshir Sohail1,2,*, Raza Muhammad1 and Qadeer Ahmed Soomro1
...lla. Bervicornye brassicae was performed well than A. nerii but was found least successful as compared to eggs of S. cerealella. Both aphid species were significantly good in performance when fed to C. carnea larvae with S. cerealella eggs than their solo effect. Results depicted that mortality factor and life parameters of C. carnea larvae are influenced by its prey type which they fed on. These results of the stu...
Ping Jiang1 , Zhihui Zhao1, 2, Xiaohui Li2, Mengyan Wang2, Lixin Xia2, Yang Cao3, Runjun Yang2 and Xibi Fang2*
...titative real-time polymerase chain reaction (qRT-PCR), Western blot, cell TG Assay and RT2 Profiler PCR array. The results showed that ABCA1 knockdown reduced the TG content in BMECs. On the other hand, the RT2 Profiler PCR array demonstrated that the expression levels of 12 genes, including fatty acid binding protein 4 (FABP4), acyl-CoA dehydrogenase short/branched chain (ACADSB), ELOVL fatty acid elongase 3 (ELOVL3) and solute carrie...

Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Rashid Mahmood2, Ziyad Abdul Qadir2, Muhammad Arshad1 and Mubasshir Sohail3 

Qi Ren, Shufeng Sun, Chen Niu, Yuhong Li, Yingzhi Chong, Biao Li, Guoying Zheng and Fumin Feng*

 

...sion of DNA methyltransferases (DNMTs). And then the CYP1A1 mRNA and protein expression decreased with cell damage, thus suggesting that elevated methylation of the promoter region of the CYP1A1 gene may affect its expression and could be associated with cell damage. After treatment of the cells with AZA, increases in methylation rate and DNMTs expression were reduced, CYP1A1 mRNA and protein levels increased, and cell damage was ameliorated; these results ind...
Abdul Majeed1*, Muhammad Anwar-ul-Haq2, Abid Niaz3, Abid Mahmood4, Naeem Ahmad1 and Hafiz Muhammad Walyat Ali Khan1
...climatic conditions has drastic effect on plant physiology and growth. The current research experiment was performed to screen salt tolerant wheat varieties grown in hydroponic and soil medium on the basis of plant photosynthetic rate, potassium (K+) and sodium (Na+) contents. Twenty wheat genotypes/varieties were grown in hydroponic culture, having different residual sodium carbonate (RSC), electrical conductivity (EC), and sodium adsorp...
Zahra Eftekhar1, Morteza Naderi2,*, Mohammad Kaboli3, Hamid R. Rezaei4 and Nematollah Khorasani3
...revealed considerable intraspecific evolutionary divergence among the local populations settled in the Hyrcanian forests of northern Iran. Geometric morphometric approaches in this study confirm the presence of multiple cryptic refugia for Fat dormouse as a small forest-dwelling species during paleontological oscillations. Such findings correspond to those of previous molecular and niche analyses. Our research also confirms an ideal capability of morphological...
Zelle Huma1*, Ahmad-Ur-Rahman Saljoqi1 and Farman Ali2
... positively recorded in grassy land, tomato field, forest land and poplar trees land in six selected districts of Chitral, Kohat, Haripur, Mardan, Swat, and Peshawar of Khyber Pakhtunkhwa. Furthermore, the EPNs is positively investigated to maximum  level in Chitral, Peshawar, Mardan, Haripur, Swat, and Kohat respectively. The EPNs positive sample indication is directed that the environment of these districts are appropriate for EPNs presence.
...
Shou-Hong Zhang1*, Ying Zhang1, Kun-Ming Wen2, Wei Wu3 and Wen-Yan Li3
...rried by biotinylated ultrasound microbubbles plus biotinlated cationic nano-liposome composites (Bio-MB+Bio-CNLP) in bile duct-ligated (BDL) rats. In addition, we investigated the staging of hepatic fibrosis by using Perfusion-Weighted Imaging (PWI). We established a BDL rat model of hepatic fibrosis. HGF carrier was administered through tail-vein injections. The gene therapy efficacy was evaluated in vivo. Before and after treatment the rats were exam...
Beenish Zahid*1,2,7, Javed Iqbal Qazi2, Amir Zohaib2, Asim Aslam3, Raheela Akhter3, Haleema Sadia4, Qurat ul Ain5, Razia Sultana6, Irfan Irshad3 and Sobia Alyas7
...erse transcriptase-polymerase chain reaction (RT-PCR). Out of 50 field samples 11 cloacal swabs (34%), were positive and out of 50, nine oropharyngeal swabs (18%) were positive for NDV through RT-PCR. DNA sequencing was performed by amplifying the RT-PCR amplicon targeted the F gene. Phylogenetic tree was constructed. It was concluded that virulent strains were existed in ducks and more than one genotype of NDV was prevalent in ducks.
...

Muhammad Shahzad Akbar*, Maria Aslam, Muhammad Rehan Khalid, Shahid Iqbal, Muhammad Luqman and Muhammad Zeeshan Majeed 

...t plantations, wooden infrastructures and other cellulosic products. Their control is usually done by the application of highly persistent synthetic insecticides which often cause different non-target effects such as environment contamination. This laboratory study evaluated the toxicity of methanolic extracts of eight flowers i.e. Mexican marigold (Tagetes lucida), African marigold (Tegates erecta), tecoma (Tecoma stans), calendula (Calendula officinalis), ba...

Aamir Saleem1, Arshad Mahmood Malik2*, Najam Ul Hassan1 and Imtiaz A. Qamar

...growth and yield of Rye grass (Lolium multiflorium L). Data regarding the physical-chemical analysis of the soil (ph, electrical conductivity, total nitrogen, organic matter and available phosphorus), crop parameter (Number of tillers, number of leaves, plant height, fresh land dry weight and crude protein) and meteorological data regarding rain fall, temperature, pan evaporation, sunshine and wind speed for interpreting results along with their statistical an...

Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4 

...">A study on Blue panic grass (Panicum antidotale Retz.) was conducted during early 2012-13. Stubbles of the grass were grown on a site at NARC, Islamabad, Pakistan. Four clipping stages i.e. D1, D2, D3 and D4 (clipped after 20, 40, 60 and 80 days, respectively) were studied. The response variables were morphological characters (plant height, tiller density and herbage yield) of Blue panic g

Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2 

...tive serine acetyltransferase (SAT); a rate-limiting enzyme for Cys biosynthesis from tobacco i.e. NtSAT4 was successfully cloned into three types of overexpression constructs i.e. pBinAR_NtSAT4 (targeted to cytosol), pBinAR-TKTP_NtSAT4 (targeted to plastids) and pBinAR-SHMT_NtSAT4 (targeted to mitochondria). For stable transformation of B. napus floral-dip and tissue culture based approaches were tested using different formulations of phytohormones for calli,...
Hanif Ullah1, Muhammad Inayat Ullah Khan2, Suleman3, Sawar Khan1,Salma Javed4, Abdul Qadeer1, Mohsin Nawaz1, Sardar Azhar Mehmood4
...se caused by protozoan parasite of the genus Plasmodium. In Pakistan, P. vivax and P. falciparum are common species. The current study was designed to investigate the prevalence of malaria infection in District Lower Dir Pakistan. A total of 1750 blood samples were collected from seven tehsils of District Lower Dir (January to December 2013). The data were analysed tehsils wise, month wise, gender wise, age wise and species wise. Thick and...
Muhammad Furqan Shahid1*, Tahir Yaqub1, Muhammad Yasin Tipu2, Asim Aslam2, Saima Yaqub1, Aziz-ul-Rahman3, Muzaffar Ali1
...L), alanine amino transferase (31-58 U/L) and blood urea nitrogen (11.21-22.58 mg/dl). 
...

Shwe Yee Win1, Lat Lat Htun1, Myint Myint Hmoon1, Hla Myet Chel1, Yu Nandi Thaw1, Nyein Chan Soe1, Htet Lin Oo3 and Saw Bawm2* 

...ce of gastrointestinal parasites in village chickens from four Townships (Mawlamyine, Nyaung U, Zay Yar Thi Ri and Katha) of Myanmar from April to June 2019. A total of 200 faecal samples were randomly collected from village chickens. Centrifugal sugar floatation and sedimentation methods were carried out to detect the gastrointestinal parasites. The overall occurrence of gastrointestinal paras
Nadia Saeed1, Mian Sayed Khan2, Habib Ahmad3, Muzafar Shah4*
...ate the ratio of plant parasitic nematodes associated with Walnut (Juglans regia L.) in different areas of Hazara Division, KP, Pakistan. Soil samples collected from walnut trees showed that Abbottabad and Mansehra had both parasitic and saprophytic nematodes whereas Kohistan had only saprophytic nematodes. Helicotylenchus sp. was found in abundance from Abbottabad and Mansehra alongwith other pa
Naila Riaz1, Hafiz Muhammad Tahir2, Muhammad Khalid Mukhtar1, Ali Hassan2, Shaukat Ali2, Shafaat Yar Khan1
...city and acetylcholinesterase activity of selected venom fractions were determined using of Musca domestica adults. Only one fraction (out of 7) from H. tamulus venom and one fraction (out of 5) of A. finitimus venom were selected on the basis of their maximum yield. The approximate molecular weights of these selected venom fractions were determined by SDS Gel electrophoresis. The molecular weight of venom fractions of H. tamulus an...
Hafiza Sadaf Zahra1, Asia Iqbal2, Sayyeda Hira Hassan1, Hafiz Abdullah Shakir1*, Muhammad Khan1*, Muhammad Irfan3, Chaman Ara1, Shaukat Ali4
...activity by methyltransferase enzyme which results in inactivation of tumor suppressor genes (TSG), while in hypomethylation, demethyltransferase enzyme causes the activation of oncogenes by promoting transcriptional activity. Contrary to DNA methylation, histone acetylation and deacetylation results in chromatin opening and closing, respectively; leading to transcriptional activation and inactivation of genes. Histone acety...
Haq Aman Ullah1,*, Aneela Zameer Durrani2, Muhammad Ijaz2, Aqeel Javeed3, Muqadder Shah1 and Ikramul Haq1
...or aspartate aminotransferase (AST), alanine aminotransferase (ALT) and alkaline phosphatase (ALP) levels. Aflatoxin M1 (AFM1) was detected in all milk samples of the Group B, C, and D in concentration higher than 0.05 ppb. The AFB1 was excreted in milk as metabolite AFM1 @ 1.35-1.59%. Udder health and milk quality deteriorated as SCC and TVC increased. Levels of serum enzymes AST and ALT increased with ingestion of dietary ...
Chaman Ara1*, Asmatullah1, Sehrish Kanwa1, Asma Chaudhary2, Ayesha Siddiqua1
...tal alkaline aminotransferase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP) and bilirubin was observed in blood plasma. Urea level showed a remarkable decrease, whereas creatinine level increased but not significantly. Histological examinations exhibited pyknosis, necrosis, vacuolations, increased sinusoidal spaces, karyomegaly, glomerulosclerosis, glomerulonephritis, epithelium degeneration, spermatocytes exfoliation, tubular degeneration an...

Imran1*, Amanullah1, Muhammad Arif1, Zahir Shah2 and Abdul Bari3 

...iochar) and Trichoderma drastically reduced weeds frequency, weeds biomass at flowering, pods formation and physiological maturity stages. However, P highest and moderate (100 and 75 kg P ha-1) rates were remained the same for weeds biomass. When compared with the economic analysis and profitability of soybean the highest net returns (NR) in Pakistani Rupees (PKRs) (PKR 62.082 ha-1) were noted with the biochar amendment followed by compost (PKR 60,168 ha-1), w...

Sana Munir1, Muhammad Kamran Qureshi1*, Ahmad Naeem Shahzad2, Ismat Nawaz3, Muhammad Shahzad Anjam4, Sumaira Rasul4 and Muhammad Asif Zulfiqar5 

... genotypes, inter and intraspecific hybrids were assessed for yield, yield contributing and fiber traits using various multivariate analysis such as principle component analysis and linkage cluster analysis. Principle component analysis (PCA) exhibited that first four PC out of nineteen PC, with eigen value >1, contributed about 80.326 % of total variability. Positive contribution towards PC1 was given by seed traits such as lint/seed, seed weight/seed, bol...

Sanaullah1, Fazli Rabbi2*, Shahid Ali2, Zeeshan Khan3 and Muhammad Zamin4 

...developed in terms of infrastructure, tourists’ information facilities, telecommunication, affordable public transport system, and comfortable accommodation for the tourists. In the past few years, the development of this tourists’ spot has been neglected in the public development budget. Moreover, due to the war against militancy in Swat, the frequency of tourists was declined in the valley. As a consequence, the livelihoods of the local populatio...
Rana Manzoor Ahmad1,2, Abdul Majid Khan2*, Ayesha Iqbal2, Amtur Rafeh2, Muhammad Tahir Waseem2 and Muhammad Ameen2
...ogical conditions, with grasslands expanding at the expense of forests and woodlands and the climate gradually becoming less warm and humid. The current enamel hypoplasia results indicate that warm and humid dense forests were the preferred habitats for extinct tragulids present during the middle Miocene in the Siwaliks.
...
Qamar Zeb1*, Silvia I. Rondon2, Hayat Badshah,1 and Arsalan Khan1
...aphids, and numbers of parasitoids and predators were recorded at weekly intervals. Rhopalosiphum padi Linnaeus, Schizaphis graminum Rondani, and Sitobion avenae Fabricius were the predominant aphid species (Homoptera: Aphididae). Two species of parasitoids Aphidius ervi L. and Aphidius colemani Viereck were recorded. Coccinella septempunctata L. (Coleoptera: Coccinellidae), Chryo...
Zübeyde Kumbıçak1,* and Hatice Poyraz2
...omosomal analysis of Drassodes bifidus and Drassodes serratichelis using a classical Giemsa staining method. We collected specimens from different populations in Nevşehir and used totally fourteen male spiders. The two Drassodes species had karyotypes comprising 10 pairs of autosomes plus sex chromosomes which were X1X20 (♂) type. All chromosom...
Sumaira Abbas1, Muhammad Sultan Haider2,*, Fatima Kafayet1, Sana Ashraf2, Atifa Masood3 and Moazma Batool4
... color of gold fish Carassius auratus. Citrus peels were collected from local market dried and grinded. Organic solvent extraction was carried out by hexane and acetone mixture (1:1 v/v). Carotenoid concentration was determined by thin layer chromatography (TLC) and found satisfactory. By mixing fish meal, sunflower meal and rice polish four treatment diets, T1, T2, T3, were prepared and citrus peel powder was added @ 20...
Tanweer Kumar1, Sahib Zada2,3,Muhammad Irfan4,*, Huma Batool5 and Wasim Sajjad2,6
...erse transcription polymerase chain reaction for the existence of antibodies against HBV. It was observed that 307 (12.8%) out of the 2382 individuals harbored antibodies in their blood against HBV. Among the different age groups, the highest number of incidences of HBV antibodies was found in the 16-25 age groups (7.01%). ICT positive samples were further screened by nested polymerase chain reaction (PCR) to determine the e...

Rahat Naz*, Mussawar Shah, Asad Ullah, Intikhab Alam and Younas Khan 

...hat, climate change has drastically affected the agricultural practices, resulting into low crop production, soil erosions and water logging salinity. Taking climate change adaptation measure’s to minimize the impacts on agriculture and economy as well as policy formulation and implementation to cut short the emission of greenhouse gases were major recommendations. 

...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...y, hot spots of Kras gene were analysed in a 40 years old male patient, presented with NHL located in ascending colon with worst prognosis of disease. Through mutagenic PCR, codon 12 was analysed by creating a single nucleotide mismatch at the 3′-end of primers to produce a BstNI recognition sequence at codon 12 while codon 13 was analysed by introducing HaeIII recognition sequence. By using RFLP and sequencing, point mutat...
Kadry A. El-Bakry1, Lamiaa E.M. Deef1*, Lotfy Z. Habbak1 and Samia S. El-Naeli2
...ated alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities and significantly increases serum level of malondialdehyde (MDA) but decrease the activity of superoxide dismutase (SOD) enzyme. On the other hand, in patuilin injected rats and treated with ginger, the activity of ALT, AST and SOD were improved and level of MDA was decreased significantly. The liver and kidney tissues showed markers of impro...
Erum Iqbal*, Nasir Mehmood, Nasira Kazi and Shahina Fayyaz
... two and a known plant parasitic nematode species viz., Paratylenchus manilkarii n. sp., P. sindhicus n. sp.,and Pratylenchus kralli Ryss, 1982 as a new record species. P. manilkarii n. sp., is characterized by the lateral field with four incisures; stylet 28-29 µm long; vulval lips protruding with vulval flap; lip region rounded or truncated without submedian lobes, tail ventrally curved with pointed or acute terminus. P. ...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4

 

....75±0.04). In contrast, the protein of carcass (19.02±0.11, 18.44±0.12 and 17.82±0.15%), hepatosomatic and visceral fat index were not significantly (p>0.05) affected by stocking density. The high survival and fast growth rates of gurami sago stocked demonstrated that the synthetic sheet ponds are a viable alternative method as standard ponds for the commercial production of gurami sago.
...
Mustafa Koyun1*and Şenol Çelik2
...ation and recorded ectoparasites variables in host fish. In the study, MARS algorithm was formed to evaluate the effects of M. heteranchorus, U. pictorum recorded in the gills, and D. spathaceum recorded in eyes selected as independent variables. To estimate the MARS algorithm, goodness of fit statistics were examined. In order to determine the most suitable for each individual MARS model, different second, third and fourth-degree interact...

Muhammad Qaisar Nawaz*, Khalil Ahmed, Ghulam Qadir, Muhammad Rizwan, Muhammad Faisal Nawaz and Muhammad Sarfraz 

Muhammad Rehan3, Asim Aslam3, Javeria Umber4, Muti-ur-Rehman Khan3, Waqar Azeem3, Hassan Aftab5, Ahsan Anjum3, Muhammad Abid6, Abdul Hameed Khan3, Hafiz Hasnain Ayoub5, Altaf Hussain2 and Muhammad Farooq Khalid1* 

...rent viral, bacterial, parasitic infections and non-infectious disorders.  

...
Anam Tariq, Alina Gul, Majida Atta Muhammad, Samia Falak and Naeem Rashid*
...oding a carbohydrate esterase, from Thermococcus kodakarensis was cloned with its native signal sequence and expressed in Escherichia coli. Heterologous gene expression resulted in production of recombinant protein in the cytoplasm which secreted gradually to the extracellular culture medium. Determination of the N-terminal amino acid sequence of the recombinant protein, in the extracellular medium, revealed that the 19 amino acid signal peptide ...

Muhammad Israr1*, Helen Ross2, Shakeel Ahmad3, Nafess Ahmad4 and Urooba Pervaiz5

...ness of the area, low infrastructure, and poor access to markets and to social and communal services. The study suggests that multi-sectorial interventions and investment in terms of education, infrastructure, environment, financial services and agriculture development are necessary to overcome the situation and improve the likelihood of achieving the targets of the SDGs. 

...

Hamoudi Naoual1, Alloui Nadir2*, Barberis Abdelhak2 and Boudaoud Amine2 

... (Anas platyrhynchos), Eurasian teal (Anas crecca), Gadwall (Anas strepera), Eurasian wigeon (Anas penelope) and Common shelduck (Tadorna tadorna). Our observations confirm the diversity of migratory bird species, particularly Anatidae infected with AIV, in the wetlands of Eastern Algeria. Molecular characterization of circulating avian influenza viruses in these wild birds will help assess the potential for spread of these ...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

...NaCl concentrations but drastically decreased at higher levels. While in varieties CM44 and CM2000 a gradual decrease of biomass with increasing salinity levels were observed. Number of pods, flowers and fresh weight of pods were not affected at salinity levels of 0-50mM and decreased at 100 mM NaCI in all the four varieties. In varieties CM91 and CM2000 nodules were formed at all levels of salinity treatments, while in varieties CM44 and CM98 nodules were for...
Dilara Abbas Bukhari*, Mehwish Faheem, Shamoona Arshad and Khalid P. Lone
...T), glutathione-S-transferase (GST), reduced glutathione (GSH) were determined to evaluate oxidative stress while urea and creatinine, was used to evaluate kidney function. It was found that there was an increase in weight (p<0.05) of both males and female mice fed with diet containing ghee. Kidney LPO and CAT were significantly increased in both male and female mice. GSH level showed decreasing trend in female while increase was observed for male kidney. C...
Nahed H. Ghoneim, Maha A. Sabry, Zeinab S. Ahmed and Esraa A. Elshafiee*
...were identified by polymerase chain reaction (PCR) as C. jejuni (63.6 %) and C. coli (36.4 %) through the detection of the Map A and Ceu E genes, respectively. The antibiotic resistance of the Campylobacter isolates was determined via the disc diffusion method and was observed most frequently to nalidixic acid (81.8 %), tetracycline (72.7 %), ciprofloxacin (54.5 %), and erythromycin (54.5 %), while low resistance to ceftriaxo...
Gasem Mohammad Abu-Taweel
...nd gamma glutamyl transferase (GGT) activity were elevated in treated animals. Liver was damaged and the liver sections showed vacuolization of the cytoplasm of the hepatocytes, necrosis of hepatocytes, polymorphism of tissue, nuclei and vessel congestions when compared with control group. The development, behavioral, biochemical and histological disorders were observed due to exposure to mercury via placenta during pregnancy and / or during lactation through ...
Derya Kocamaz* and Elif Oruc
...ed that acetyhcholin-esterase, catalase and estradiol/testosterone levels decreased, while the amount of etoxyresorufin-O-deetylase (EROD), superoxide dismutase (SOD), glutathione S-transferase (GST), glutathione (GSH) and protein carbonil (PCO) increased in comparison to the control. After the recovery period, EROD, GST, malondialdehyde, estradiol/testosterone levels were found to be lower than the control. In the pesticide...
Fatima Hashim Abbas1,2* and Alaa Tareq Shakir Al-Hassnawi1
...tal effects induced by parasitic or vial infections.
...
Farzana Rashid1, Rabia Masood1 and Mariam Faiz2*
... was determined by polymerase chain reaction. Among 240 strains, prevalence of MBL in K. pneumoniae, P. aeruginosa, E. coli and Acinetobacter Species was 26%, 52%, 27% and 5% respectively. Prevalence of blaNDM-1 gene was 51% identified in 14 strains of P. aeruginosa, 2 strains of A. Baumanni, 29 strains of E. coli and 18 strains of K. pneumoniae. In conclusion, high prevalence of blaNDM-1 in our strains is a serious concern. A careful use of carbapenems is imp...
Mubashra Salim1, Omeira Ibrahim1, Hugo Vilhena2,3,4, Carla Maia5, André Pereira5, Maria Shahzeen1, Shabana Kalsoom1, Asim K. Mahmood6 and Furhan Iqbal1*
...cs in Pakistan, by Polymerase Chain Reaction (PCR), using 16S rDNA as the target sequence. Clinical and epidemiological data was collected in all animals included in the study. M. haemofelis and C. Mycoplasma haemominutum DNA was detected by PCR respectively in 6.8% (10/148) and in 18.2% (27/148) of cat blood samples. Of these, two animals were co-infected with both agents. Sequencing and phylogenetic analysis was performed in M. haemofelis
Saeed Murtaza1, Abdul Sattar1*, Nasim Ahmad1, Muhammad Ijaz2Maqsood Akhtar3 and Muhammad Shahzad4
... calving for 48 days. Ultrasonography was performed twice a week to monitor involution changes while milk composition analysis was done once a week. Results depicted that initially, anechoic lumen filled areas with echogenic border in cervix and uterus was found but at involution, cervix and uterus became moderately hyperechoic without any fluid filled areas. Moreover, there was non-significant effect (P>0.05) of treatment on cervix, uterine body, non-gravi...

Asmaa A. Darwish 

...erchromic anemia. On contrast, a neutrophilic leukocytosis and lymphocytopenia was described in the three diseased groups. Biochemically, a significant (P< 0.05) increase in total protein, globulin, liver enzymatic activities, kidney function tests, total lipids, triglycerides, MMP-2 and MMP-9 concentrations was depicted in the three diseased groups. On the contrary, the total cholesterol, HDL-cholesterol, LDL-cholesterol, minerals, electrolytes, trace elem...
Zhi Yi Jin and Shao Ming Qin*
...ganser viz., Carassius auratus, Misgurnus anguillicaudatus, Noemacheilus fasciolatus, Silurus asotus, Tachysurus fulvidraco and Siniperca chuatsi, which were relatively common and present in all the four rivers, indicating that this bird was an opportunist predator. It is important to reduce human activities and protect woodland and aquatic environments because Scaly-sided Merganser have high requirements for safety an...
Housh Muhammad Solangi1, Javaid Ali Gadahi1*, Mansoor Tariq2, Bachal Bhutto1Zubair Ahmed Laghari1, Jamila Soomro3, Taufeeq Ahhmed Khosa1 and Abdullah G Arijo1
...king abomasal nematode parasite of small ruminants producing the economic losses. The present study was conducted to explore the immunogenic properties of H. contortus crude proteins (HcCP). Protein profile of HcCP was checked by SDS PAGE and immunogenic proteins were recognized by the antisera produced by using the HcCP as antigen. Infective stage of the H. contortus (L3) was used for the challenge infection. Protein band pattern ranging from 10...

Amit Sharma1* and Pankaj Sood2 

...ry results. It causes ultrastructural, biochemical and functional damage to the spermatozoa leading to reduced motility, viability, impaired transport and fertility. Caprine sperms are extremely sensitive to cryopreservation compared to other species which is mainly attributed to the compositional variation of the sperm plasma membrane. Different factors affect affects the semen cryopreservation viz. species, breed, semen collection technique, collection seas...
Muhammad Yahya1, Muhammad Afzal1, Muhammad Zeeshan Majeed1*, Imtiaz Sarwar1, Khurram Shehzad2, Muhammad Luqman3 and 
Sher Muhammad Shahzad2
...guava orchards, natural grassland, bare land and wetland peripheries) using population abundance and dynamics of edaphic springtails (collembola) and mites (acari) as bioindicators. Using metallic soil corer (10 cm length and 10 cm diameter), extensive random soil sampling was carried out from selected localities in district Sargodha (Punjab, Pakistan) and soil microarthropods (i.e. springtails and mites) were extracted from composite soil samples using...
Asim Faraz*
...tica) among bushes, grasses and trees, respectively for male and female calves in EMS.
...

Saima Sharif*, Farkhanda Manzoor, Tasnim Farasat, Shaugfta Naz and Raheela Tabasum 

...up was 67.3 mg/dl in contrast to 34.6 mg/dl in controls. The eGFR in ischemic stroke patients was calculated to be 54.62ml/min/1.73m2, compared to 85.90 ml/min/1.73m2 for controls. Prevalence of eGFR <60 ml/min/1.73m2 in patients with stroke was 63%, significantly higher (p<0.05) than in controls. Moderate to severe reduction of eGFR in patients with ischemic stroke indicated renal impairment and kidney dysfunction. The risk of first ever ischemic stroke...
Bo Gao1,2, Fengmei Yang3, Wei Chen2, Xiaojia Song4, Xiaobo Liu5 and Dongmin Li1*
...-time quantitative polymerase chain reaction (RT-qPCR) in tumor, adjacent, and non-cancerous tissues. The tumor markers were detected with COBAS 6000. The prognostic value of relative MDR1 expression level in malignant tumors was investigated by univariate survival and Cox regression model analyses, and survival times were compared using the log-rank test. At the same time, through receiver operating characteristic (ROC) curve analysis, their diagnostic thresh...
Muhammad Rizwan Ashraf1, Asif Nadeem1,2, Eric Nelson Smith3, Maryam Javed1, Utpal Smart3, Tahir Yaqub4, Abu Saeed Hashmi1 and Panupong Thammachoti3
... 12S rRNA) through Polymerase Chain Reaction (PCR). Nucleotide data was used for DNA polymorphism analyses and homology was measured among different species of genus Echis. Using the concatenated nucleotide data, Maximum likelihood and Bayesian phylogenetic trees were constructed that divided all Echis species into four groups. Saw-scaled viper in this study from Pakistan showed similarity and close relationship with Western India and UAE while showing differe...
Celalettin Gözüaçik1,*, Mustafa Güllü2, Ayda Konuksal3, Reşat Değirmenci3 and Ercan Akerzurumlu3
...to identify the larval parasitoids and to determine the parasitism rate of S. temperatella. These studies were conducted in 42 cereal fields of 18 villages in Lefkoşa, Girne, Güzelyurt, Gazimağusa and İskele townships in 2012-2013 years, and 1567 and 862 larvae were collected in the two years, respectively. Larvae were kept inside boxes covered with nets in the laboratory at 25±1◦C and 65±5% r....

Fazli Ahad1, Raziuddin1, Nazir Ahmad1,2*, Muhammad Nauman1, Touheed Iqbal3, Nabeel Khan1, Fazli Hameed4 and Quaid Hussain2 

Qaisra Siddique1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3

 

...ate glutathione S-transferase (GST) activityand total protein contents (TPCs) in tissues viz. brain, gills, kidney, heart, muscle and liver of Labeo rohita kept under sub-lethal dose (4.13 µgL-1) of chlorpyrifos. Fish was kept under chlorpyrifos stress for two months and samples were collected on weekly basis. It was noted that GST level varied significantly with duration. The GST level was raised in first 28 days after that it was drop...
Mubashar Hussain1*, Misbah Younas1,Muhammad Faheem Malik1, Muhammad Umar1, Maimoona Kanwal1, Moazama Batool2
...complished by surveying grassy fields, croplands, old dung piles and fresh dung pats from selected localesofSialkot during 2016. Specimens were collected by hand picking and cattle dung baited pitfall traps. Sixteen species representing three guilds i.e. Paracoprid (10 species), Endocoprid (4 species) and Telecoprid (02 species) were recorded. Onitis excavatus (27.68 %)and Onitis crassus (9.59 %)showed maximum ...
Hina Habib Syed1, Muzafar Shah2*, Shahid Sherzada3 and Masroor Elahi Babar1
... infected with malaria parasite. Data was also collected sfrom other labs of District Swat which accumulated to a total of 9255 patients, among which 932 (10.07%) patients were found positive for malaria parasite. Male infected were 558 (59.87%) while 374 (40.13%) were female. The collective data showed majority of the infected patients belonged to age group 1-10 years (41.42%). The least infected were aged above 60 years (0...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...che, hemorrhage and body rashes. Although in the past decade millions of people in several continents like Asia, Africa and some islands of Indian Ocean have faced the major outbreaks of Chikungunya virus because of its travel associated febrile nature. An inexplicable paralyzing disease has trapped thousands of people in Karachi region of Pakistan and the symptomatology among suspected cases was compatible with Chikungunya fever. Thus Chikungunya outbreak was...
Weihao Chen1,2, Zhilong Tian2, Lin Ma2, Shangquan Gan3, Wei Sun1,4,* and Mingxing Chu2,*
...titative real-time polymerase chain reaction was used to investigate the expression level of six genes in the brain, cerebellum, hypothalamus, pituitary, testis, epididymis, vas deferens, and adrenal gland in high fecundity (Small Tail Han sheep) and low fecundity (Sunite sheep) rams. The results were as follows: BMPR1B, GDF9, Smad1, Smad5 and Smad9 were expressed in all selected tissues, but BMP15 was specifically exp...

Jie Yang

...-16 and using dual-luciferase reporter assay, qRT-PCR and Western blot, the mRNA and protein expression were detected, respectively. Cellular apoptosis were examined by flow cytometry and Western blots was applied to assess the cleaved caspase-3, -8, -9, and cleaved poly-ADP-ribose polymerase. Protein expression of extracellular-regulated kinase were detected. Finally, data analysed statistically to determine significantly d...

 Muhammad Rafay1,*, Ghafoor Ahmad1, Tahira Ruby2, Muhammad Abdullah3, Fahad Rasheed4, Muhammad Abid1, Sohail Akhtar5, Zulfiqar Ahmad6 and Riaz Hussain7

... nests were made of dry grass and roots by a group of individuals of jungle babbler on Albizzia species having an average clutch size of 4 eggs. Average peripheral and core diameter, depth of nest was 13, 9 and 7 cm, respectively. Breeding completed in 36 days including incubation, nestling, post nestling and fledgling stages of 13, 5, 4, and 14 days, respectively. Overall predation during these stages was 57%. Adults consumed grains, insects, termites ...

Muhammad Jamal Nasir*, Anwar Saeed Khan, Said Alam and Riyasat Sultan 

... management of forests, grasses and agriculture resources. According to field survey, availability of fodder (grasses) at the pastures, ban on cutting of grasses and grazing in the village, management of land at pastures, refuge from scorching heat of summer are the major causes of seasonal migration. There used to be a time when almost every household use to move to pasture before the ons...

Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad

...dirachta indica) and ghwaraskay (Dodonaea viscosa). Morphological traits such as plant height, maximum number of fruits plant-1 and yield were observed and severity of disease was investigated for supplement efficacy. The biochemical results obtained were all positive, which confirmed stem rot pathogen as Erwinia carotovora sub spp. chrysanthemi (gram-negative bacteria). Highest plant height (75.3 cm) and maximum number of fruits plant-1 (14.3) were recorded w...

Gulnaz Hameed1, Abdul Saboor1, Khuram Nawaz Sadozai2*, Ghaffar Ali2, Dawood Jan2 and Mansoor Rasheed

...ove education related infrastructure. 

...

Faisal Hafeez, Asad Aslam*, Ayesha Iftikhar, Afifa Naeem, Muhammad Faheem Akhtar and Muhammad Jawad Saleem 

...were evaluated against Amrasca devastans Dist. on farmer field located in Bahawalpur district at recommended field doses. The treatments were applied on cotton crop when the jassid population was above ETL level. The most effective insecticide found was Nitenpyram, having minimum population per leaf (0.35, 0.23 and 0.31 in 2018 and 0.53, 0.33 and 0.42 in 2019 after 1, 3 and 7 days of spray), followed by Chlorfenpyr both years. However, Acephate was ineffective...
Ke Zhang1, Shuai Liu2, Qiu Chen1, Yu Wang1, Li Liu1, Bingjie Li1, Kai Ma1, Xiaoya Wei1, Aijun Li3 and Junyan Li2*
...d Protein Disulfide Isomerase-2 (PDI-2) have been reported as antigens and even vaccine candidate proteins in ticks or other pathogens but not in H. longicornis. Few reports have described dual specificity phosphatase 3 (DUSP-3) in parasites as an antigen. We successfully screened four potential antigens and found that DUSP-3 is a potential novel antigen for ticks.
...
Yuhong Li1, Dongxue Wu1, Xue Wang1, Mi Zhang1, Hanyu Zhu1, Zhe Shi1 and Fumin Feng1,2*
... and alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities changed, indicating the occurrence of liver injury. Compared with the baseline group, the content of malondialdehyde (MDA) in each drug group gradually increased, and the activity of superoxide dismutase (SOD) gradually decreased, suggesting that oxidative stress reaction occurred in all drug groups. Compared with the baseline group, the mRNA...
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...e, aspartate aminotransferase and alanine aminotransferase remained unchanged amongst the groups during the transition period. In conclusion, dietary yeast supplementation has resulted in better DMI and has a potential to improve the ability of Beetal goats to counteract the metabolic stress imposed by the transition period.
...

Tingting Li, Shuangshuang Geng, Long Xie, Huiyan Xu, Aolin Luo, Pengwei Zhao, Huan Yang, XingWei Liang, YangQing Lu, XiaoGan Yang* and KeHuan Lu*

...titative real-time polymerase chain reaction (qRT-PCR) results showed that the GDNF gene expression in the PB-GDNF-Sertoli cell line was significantly increased compared with that in the control Sertoli cell line (p<0.01). Enzyme-linked immunosorbent assay (ELISA) results showed that GDNF gene secretion was also significantly increased in PB-GDNF-Sertoli cells compared with that in control Sertoli cells (p<0.05). We further compared two types of spermato...
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Saliha Khalid1, Rana Manzoor Ahmad1,2, Ayesha Iqbal1, Muhammad Ameen1
...nting grazing on coarse grasses and shrubs in the Late Miocene Siwalik habitats of Potwar Plateau. At the apex of molar, crown is narrow and represents selenodonty in Selenoportax, while a broader crown in Pachyportax which indicates strong hypsodonty. The present sample add valuable information on systematics, dental morphology and dietary habits of the Late Miocene (7-5 Ma) boselaphines which are represented today by their living kin Boselap...
Mian Adnan Kakakhel1, Faryal Gohar1, Zahid Anwar2, Raza Ullah1, Muhammad Attaullah3, Shahbaz Ahmad4, Aamir Khan5, Kalimullah5*
...;;">Toxoplasmosis is a parasitic disease caused by T. gondii, which infects warm-blooded animals worldwide. This study was conducted with the main objectives, determination of seroprevalence of T. gondii infection in pet dogs. To evaluate the main associated risk factors related with T. gondii exposure to this region. A total of a hundred number of ...

Iram Fatima1*, Imran Pasha1, Ambreen Saddozai2, Shahid Nadeem3, Amer Mumtaz4 and Saqib Jabbar4 

... poor slums. This low infrastructure business is rising day by day due to growing urbanization. The study aimed at exploring the safety status of various snacks and beverages sold in the streets of Faisalabad, Pakistan. The three zones of city were selected for the purpose of sample collection. Mean prevalence of E. coli 61.7% was indicated by Spread plate method. Prevalence of Total plate count ...
Ayesha Iqbal1, Ghulam Sarwar1, Abdul Majid Khan1*, Muhammad Tahir Waseem1, Ayesha Iqbal1, Rana Manzoor Ahmad1,2, Muhammad Ameen1
...d mandibular values in Eurasian and Japanese wild boar may be attributed to some evolutionary, climaticor hunting pressures. 

Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5* 

...t might not be fully contrasted by current vaccines. 

...

U. A. Al-Karim, A. A. Alshimaysawe, A. E. Mohammed† , W. A. R. Aljaafri and F. A. Al-Fadhal

Evaluation of biological seed treatments for management of Rotylenchulus reniformis on cotton
... spp., seeds treatments drastically suppressed the number of eggs isolated from cotton roots compared with the non-treated control. Abamectin also inhibited the number of vermiform life-stages found in the soil as compared to the nontreated control. Biological seed treatments produced no negative effects on plant growth. The use of different biological control agents as seed treatments can manage plant-parasitic nematodes an...

 K. Abbasi 1 , R. Wick2† and D. Zafari1

Chitinase activity of biocontrol fungi cultured from the golden potato cyst nematode, Globodera rostochiensis
...based on the number of parasitized juveniles and eggs in water-agar. Greenhouse trials showed T. atroviridae and B. bassiana had the highest dry root weight and tuber yield.

...

K. Osei1† , A. I. Adama1 , E. C. Tagoe2 and J. Sackey-Asante1

 

Biochar effect on nematodes and insects population density, soil improvement and yield of okra
... factors such as plant parasitic nematodes (PPN) and foliar insects have been implicated as major constraints to okra production (Asare-Bediako et al., 2014b). The attack of root-knot nematodes (Meloidogyne spp.) has been reported as the most serious, widespread and alarming which causes tremendous yield losses (Hussain et al., 2011; Kayani et al., 2013; Barros et al., 2014). Flea beetle (Podagrica spp.) is the most important insect pest of okra in Ghana and N...

 M. M. A Youssef and W. M. A. El-Nagdi †

Effect of some temperature changes on the population density of some plant parasitic nematode species
...;C).

...

Ebtisam Mirza1, Nadeem Ehsan1 

DEVELOPMENT OF PROJECT EXECUTION COMPLEXITY INDEX
...projects, PECI(I) for Infrastructure development
projects and PECI(O) for Other projects. A complexity scale starting from 0 = least complex to 10=highly
complex has also been proposed in order to rank and compare the projects. This ranking will help the decision makers
to decide which projects to include in their portfolio and which projects to give priority while assigning resources
more efficiently. Moreover, project managers wil...

Ghani Akbar1, Muhammad Munir Ahmad1, Abdul Ghafoor1, Matiullah Khan1, Zafar Islam1 

IRRIGATION EFFICIENCIES POTENTIAL UNDER SURFACE IRRIGATED FARMS IN PAKISTAN
...ficant
cost to infrastructure, machinery or labour. 

...

Shabana Rafique1, Shahnaz Parveen Khattak1, Tanveer Hussain2, Faiza Tauqeer1, Bashir Ahmad3 

EVALUATION OF FLEXURAL RIGIDITY AND ABRASION RESISTANCE OF POST AND META-FINISHED PIGMENT DYED P/C FABRICS
... flexural rigidity and abrasion
resistance. The simultaneous finishing and pigment dyeing is more economical than conventional method, since, more
energy can be conserved by using same machinery for dyeing, finishing, drying and curing. Furthermore, elimination
of post wash treatment in this method caused little or no contamination. Despite its manifold advantages, the rubbing
fastness and fabric stiffness of pigment dyed fabrics in...

Anwar Ullah*, Sabir Islam*, Sikandar Bilal Khattak*, Safi Ur Rahman**, Shahid Maqsood*, Misbah Ullah*, Rehman Akhtar*, Rashid Nawaz* 

MAINTENANCE SYSTEM FOR HEAVY EARTH MOVING EQUIPMENT
...ons are part of these infrastructure development projects. Usually the delays are due to
the inefficient and ineffective maintenance procedures of the heavy earth moving equipment’s. Poor record keeping
and un-systemized maintenance procedures leads to reducing the machine effective life cycle. To avoid catastrophic
losses in production and, market share, a maintenance model for such equipment is developed. Heavy equipment
ava...

Gulzar Ahmad, Muhammad Inyatullah Babar, Muhammad Irfan 

A NOVEL WIDEBAND MICROSTRIP PATCH ANTENNA FOR SATELLITE COMMUNICATIONS IN KU-BAND
...s been increased using parasitic patches. The size of the proposed antenna is 15x8 mm2. It has been observed that the antenna has a bandwidth of 4.08GHz, a return loss of 49.07 dB at the center frequency, a maximum gain of 8.25 dBi and total efficiency of more than 90%. This antenna can be prospective candidate for satellite communications.

...

Waqas Anwar, Iftikhar Hussain 

COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...

Huge gap exists in infrastructure development between restive regions of Pakistan like Federally Administered Tribal Areas, Provincially Administrative Tribal Areas (FATA/ PATA) / hinterland of Baluchistan and remaining part of Pakistan. Government realized the importance of this under development in the aftermath of 9/11 and consequent unrest and trouble. Construction projects unleashed efforts to bring restive regions in line with rest of country. Project...

Waqas Anwar, Iftikhar Hussain 

COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...

Huge gap exists in infrastructure development between restive regions of Pakistan like Federally Administered Tribal Areas, Provincially Administrative Tribal Areas (FATA/ PATA) / hinterland of Baluchistan and remaining part of Pakistan. Government realized the importance of this under development in the aftermath of 9/11 and consequent unrest and trouble. Construction projects unleashed efforts to bring restive regions in line with rest of country. Project...

Numan Habib, Naseer Ahmed, Riaz Muhammad, Himayat Ullah, Muftooh Ur Rehman, Kareem Akhtar 

ANALYSIS OF CHIP PRODUCED IN FREE MACHINING OF TI-6AL-7ZR-3NB-4MO-0.9ND AND TI-5AL-7ZR-7NB-0.7ND ALLOYS
...ncrease productivity. Ultrasonically assisted turning (UAT) was used to further improve its machinability. In addition, machinability of both newly developed alloy and Ti-6246 is studied by analyzing chip compression ratio, chip thickness and shearing angle. Overall, chip compression ratio is greater for UAT as compared to CT, which shows improved machinability. 

...

Ihsan Rabbi*, Sehat Ullah**, Aftab Alam**

MARKER BASED TRACKING IN AUGMENTED REALITY APPLICATIONS USING ARTOOLKIT: A CASE STUDY
..., the brightness and contrast level of a camera on tracking a single marker.
Experiments were conducted to produce the analysis of these factors.
...

 Gulzar Ahmad1*, M. Inayatullah Babar1, M.Irfan1

A NOVEL WIDEBAND MICROSTRIP PATCH ANTENNA FOR SATELLITE COMMUNICATIONS IN KU-BAND
...s been increased using parasitic patches. The size of the proposed antenna is 15x8mm2. It has
been observed that the antenna has a bandwidth of 4.08GHz, a return loss of 49.07dB at the center frequency, a
maximum gain of 8.25dBi and total efficiency of more than 90%. This antenna can be prospective candidate for
satellite communications.
...

Waqas Anwar1*, Iftikhar Hussain1

COMPARATIVE STUDY ON CONSTRUCTION PROJECT MANAGEMENT BETWEEN RESTIVE REGIONS OF PAKISTAN AND REMAINING PART OF COUNTRY
...sp;Huge gap exists in infrastructure development between restive regions of Pakistan like Federally Administered

Tribal Areas, Provincially Administrative Tribal Areas (FATA/ PATA) / hinterland of Baluchistan and remaining part
of Pakistan. Government realized the importance of this under development in the aftermath of 9/11 and consequent
unrest and trouble. Construction projects unleashed efforts to bring restive regions in ...

 Numan Habib1, Naseer Ahmed1, Riaz Muhammad1*, Himayat Ullah2, Muftooh Ur Rehman1, Kareem Akhtar3

ANALYSIS OF CHIP PRODUCED IN FREE MACHINING OF TI-6AL-7ZR-3NB- 4MO-0.9ND AND TI-5AL-7ZR-7NB-0.7ND ALLOYS
...ncrease productivity. Ultrasonically assisted turning (UAT) was used to further improve its machinability.
In addition, machinability of both newly developed alloy and Ti-6246 is studied by analyzing chip compression ratio,
chip thickness and shearing angle. Overall, chip compression ratio is greater for UAT as compared to CT, which
shows improved machinability
...
Khizar Azam٭, Abdul Shakoor٭, Riaz Akbar Shah٭, Afzal Khan٭, Shaukat Ali Shah٭,
Muhammad Shahid Khalil٭٭
COMPARISON OF FATIGUE RELATED ROAD TRAFFIC CRASHES ON THE NATIONAL HIGHWAYS AND MOTORWAYS IN PAKISTAN
... causes of Road Traffic Crashes (RTC) in Pakistan . An attempt has been made in this research to compare the proportion of driver fatigue related RTC on the Motorways and National Highways of Pakistan. Data were collected from the National Highways and Motorway Police (NHMP). Data for 2003 to 2012 of all RTC on Motorways and 2003-2011 on the National Highways (N-5) were examined extensively by applying Australian Transportation Safety Bureau (ATSB) criteria fo...

Gul Rukh*, Iftikhar Khan* M. Naeem Arbab*, Uzma Nawaz*

DESIGN AND IMPLEMENTATION OF AN EFFICIENT MICRO-HYDROELECTRIC SCHEME FOR LOW HEADS
...the standard equations, trash rack, penstock and turbine is designed thus keeping the power losses as low as 4%. Hence finally an electrical power of 25kW is produced, suitable to run a farm in villages where electricity supply is not available and where cost of transmission and distribution is high. The location where it has been installed and tested is village Kandar, Tehsil Mathra, Peshawar. The present project is compared with the existing and is much cost...

M. Rizwan Gul*

COMPARISON OF THE OF MECHANICAL AND WEAR BEHAVIOURS OF DIFFERNT TYPES OF POLYETHYLENES AND THE EFFECT OF RADIATION CROSS-LINKING ON THESE BEHAVIOURS
...n to failure, with dry abrasive wear properties comparable to UHMWPE. Unirradiated LDPE on the other hand exhibit low strength and strain to failure, and comparatively high wear rate. UHMWPE has the highest cross-linking efficiency, while HDPE and LDPE show low cross-link densities. Cross-linking induces brittleness in the materials except in case of LDPE, and improves wear rate of LDPE and UHMWPE. However, the wear rate of HDPE increases with cross-linking.

 Amjad Ali*, Amir Nawaz Khan*, Atta-ur-Rahman*, Muhammad Saeed*

ANALYSIS OF SITE, SITUATION AND THEIR IMPACT ON RESETTLEMENT OF PROPOSED NEW BALAKOT TOWN, PAKISTAN: AN EX POST EVALUATION OF 2005 KASHMIR EARTHQUAKE
... The basic activities infrastructure is not attractive for the residents of the Balakot town as there are least business and other employment opportunities. It was found that initially the property business and high level of non-basic activities and later on the basic activities will support the growth and development of this new town.

...

Asadullah Saleem* and Nadeem Ehsan*

STATUS OF PERFORMANCE MEASUREMENT SYSTEMS IN INFRASTRUCTURE CONSTRUCTION FIRMS OF PAKISTAN
...ence that most of the infrastructure firms find their PMS in need of urgent attention while one third of the surveyed firms consider their system needs improvement. Analysis of the results points out that current PMSs ignore the performance information needs of critical stakeholders like employees, customers and suppliers. Further the system design is marred by short-termism and less attention is paid to non-financial

Shahrukh Khalid* and Athar Mahboob**

A SURVEY ON AUTO-CONFIGURATION MECHANISMS FOR MOBILE AD-HOC NETWORKS (MANETS)
...networks (MANETs) are infrastructure-less networks. Moreover, due to inherent characteristic of mobility of nodes, network merging and partitioning, issues and problems of MANETs are peculiar in nature. Current networking software stacks and services are based on TCP/IP model which is IP address centric. All nodes which want to communicate must have unique IP addresses. Auto-configuration refers to assignment of unique IP addresses to the n...

Altaf Hussain Rajpar1, Abdul Hameed Memon1, Mohammad Akram Shaikh2, Weimin Zhang3

HAND-EYE COORDINATION FOR OBJECT GRASPING TASK OF HUMANOID ROBOT (BHR-02)
...ay vital role in object grasping task of humanoid robot. A method proposed for hand-eye coordination addresses four distinct problems i) Integration of vision control and motion control ii) hand-eye coordinate transformation iii) orientation of hand with target object iv) hand-eye localization. For hand localization and to limit the orientation problem a blue colored rectangle block was pasted on the robot hand. The blue colored rectangle b...

 Riaz Sayed1, Khizar Azam1, Waqar Shah1, Inayat Babar1, Hamidullah1, and Sahar Noor1

A REVIEW OF DRIVING UNDER THE INFLUENCE OF FATIGUE
...causes close to 100,000 crashes in the United States. These accidents results in1,544 fatalities, 71,000 injuries, and $12.5 billion in monetary losses in the US alone. Around the world, thousands of lives are lost each day due to road accidents. The National Road Safety Secretariat (NRSS) Pakistan estimates, the annual economic cost of highway crashes over rupees one hundred billion (over US$ 1.6 billion) for...

 Iftikhar Ahmad1, Sahar Noor1

CHARACTERIZATION OF CERAMICS WALL TILES USING LOCAL TALC AS A FLUXING AGENT
...c percentage which drastically boosted fired strength, stabilized thermal shrinkage, thermal expansion to an optimum level and controlled the excessive water absorption. All these properties variations are in favor of good and free of defects wall tiles. The use of talc indicated that a normal strength (200-220 kg/cm2) can be acquired using 20% talc even at lower temperature of 1030-1050°C compared to 1160-1167°C used in local indus...

 Usman Ali Naeem*, Hashim Nisar*, Habib-ur-Rehman** and Naeem Ejaz*

DEVELOPMENT OF FLOOD DISCHARGE MODELS USING GIS
...en altering beneath the crash of mutually environment disparity and human actions in the overall milieu. With the advent of technology it is now possible to model the complete resource allocation of any hydrological network duly integrating both natural and artificial networks. Advance applications allow an excellent automated system to monitor, control and manage water allocations to better utilize water resources, minimize wastage and pre...
Dibyendu Biswas1*, Shib Shankar Saha2, Shankar Biswas3 and Md. Abu Sayeed4
Outbreak of Lumpy Skin Disease of Cattle in South-West Part of Bangladesh and its Clinical Management
...reatment protocol in contrast to recovery from LSD. However, dexamethasone, chlorpheniramine maleate, combination of oxytetracycline and meloxicam showed apparently good results. Interestingly, most of the household in this study area never used mosquito curtains at their cattle house at the night. From this data, it was concluded that LSD affects both sex of animals and young female are most susceptible. Poor intra-herd hygienic conditions and managemental pr...

Ghulam Murtaza1, Ghulam Sarwar1*, Muhammad Ashraf Malik2, Muhammad Zeeshan Manzoor1, Ayesha Zafar1 and Sher Muhammad3 

.... Saline irrigation has drastic effects, limiting normal physiological activity and productive capacity of crops. The saline water irrigation leads to salt accumulation in the vicinity of roots which results in reduced yield along with soil deterioration. Organic matter application can prove helpful in keeping the salt level low in root rhizosphere. To check the efficacy of organic matter in mitigating the harmful impacts of salty water irrigation on soil char...

Kamran Ghasemi1*, Mostafa Emadi2, Asghar Bagheri3 and Mehdi Mohammadi1

Casing Material and Thickness Effects on the Yield and Nutrient Concentration of Agaricus bisporus
...nce, however, the CP procrastinated the first flush. Overall, the highest average weight of mushroom and the mushroom cap diameter were observed in 4 cm depth casing. No significant deference was observed in the phosphorus and potassium concentration of treated mushrooms but nitrogen concentration was affected by casing layer soil materials and thickness. The lowest nitrogen concentration was in 4 cm depth of CP casing layer that was not si...
Anum Feroz1, Abdul Rauf Shakoori2 and Farah Rauf Shakoori1*
...ecific activities of esterases in the 4th and 6th instar larvae of susceptible laboratory strain (Lab-S) and deltamethrin resistant population (GUW) of stored grain pest, Trogoderma granarium. After exposure to LC20 of bifenthrin, chlorpyrifos and their combinations of 3:1 and 1:3, the activities of total esterases, cholinesterase and carboxyl...
Mah Jabeen and Amjad Farooq*
...ll;">Four species of Brassica viz,. B. napus, B. juncea. B. compestris and B. rapa were studied for their relative resistance/susceptibility against aphids, under field conditions for three consecutive crop seasons i.e., 2009-2010, 2010-2011 and 2011-2012. The data on the incidence of aphids were recorded at weekly interval. Host plant susceptibility indices were also calculated. B. napus was found to be susceptible sh...
Muhammad Khan1, Tehmina Ameer Khan1, Aziz Ud Din2, Muhammad Fiaz Khan1, Irfan Ullah3,*, Kalim Ullah4, Sadia Tabassum1,*
...were amplified via polymerase chain reaction (PCR). The amplified gene products were sequenced and compared with the revised Cambridge Reference Sequence (rCRS) Accession-No. N_012920.1. Four mutations in 16S-rRNA gene have been identified viz mt-2552T>A, mt-1811A>G, mt-1888A>G and mt-2467A>T and two are novel, mt- 2552T>A and mt-2467A>T while others have been previously reported, in patients of German and French population. For...
Zubair Ahmad1, 2,5, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Kavita Pandey4 and Farhat Khan5
...of chelonine leafminer parasitoids from the Indian subcontinent is also provided.
...
Kui Li1, Lijun Li1, Jialun Fu2, Yi He2, Zhaohui Song2, Shuiping Zhou2Luobu Gesang1* and Rui Liu2*
...avated (P=0.0475) in contrast to those in the group with administration of CDDPs (LLSS=2.31). Besides, arterial oxygen saturation (SaO2) value for those taking CDDPs was significantly higher than that in the CON group (87.86% vs. 85.72%, P=0.0388) on day 10. These preliminary findings suggested that CDDPs might be regarded as an effective prophylaxis for AMS to a certain extent without any specific adverse effects, relieving clinical manifestations ...

Oluwatoyin Olagunju1* and Luqman Abiodun Akinbile2

Farmers Perceptions of the Effect of Rural Transportation Systems on Farming Income in Ondo State, Nigeria
...roads with sufficient infrastructure and the establishment of an agency or board capable of monitoring rural infrastructure, in particular, transport infrastructure to promote easy movement and improve the provision of medical services in the area.

...
Jam Nazeer Ahmad1,*, Samina J.N. Ahmad1,2,*, Mubashir Ahmad Malik1, Abid Ali1, Muhammad Ali3, Ejaz Ahmad1, Muhammad Tahir2 and Muhammad Ashraf2
...y known as short horned grasshopper is one of the most dangerous agricultural pests worldwide. There are various important species of large swarms forming of desert locusts found in different regions of the world. In early 2020, in Pakistan, huge swarm of desert locust infestation was observed in different provinces of Pakistan. Precise and correct identification of any pest is very important to start a proper control strategy against it. The current study was...
Zhi Yijin, Shao Mingqin* and Li Quanjiang
...iche (0.727), utilizing grasslands and farmland after crops were harvested, where it ate vegetation (roots) or seeds. Shorebirds have narrow habitat niches, and are limited largely to shallow water areas. Of species pairs, the pied avocet Recurvirostra avosetta and Eurasian spoonbill Platalea leucorodia have the highest habitat niche overlap, as their diet and foraging pattern are similar; these two species red...

Tao He1,2,3, Cheng-jing Chen4, Jian-guang Qin3, Yun Li1,2, Rong-hua Wu1,2 and Tian-xiang Gao4,*

...s long as substantial intraspecific variations exist in sagittae shapes, geometric morphometrics for otolith shapes could be used as a complementary tool along with body morphology to distinguish L. haematocheilus stocks.
...

Muhammad Riaz Gondal1,2*, Aqib Riaz4, Sultan Ahmad Rizvi2, Bushra Zulfiqar2, Waqas Naseem2, Humara Umar3, Ahmad Hussain1 and Mazher Iqbal

...ides to eradicate weedy grasses (S. brevifolius, D. aegyptium, C. dactylon, S. halepense, B.decufeedipedia.org. and P. hysterophorous) in multi-cut sorghum sudan grass hybrid (S.S. Hybrid). Four herbicides namely Clodinafop-propargayl (Clodinafop) @ 0. 25 and 0.375 kg ha-1, Paraquat and Glyphosate @ 1.5 and 2 L ha-1 and Fenoxaprop-p-ethyl (Puma super) @ 1.0 and 1.5 L ha-1 were applied on Pak Sudac variety of S. S. Hybrid and...
Safia Arbab1, Rehana Buriro1, Shams Uddin Bhugio1, Atta Hussain Shah2,  Jamila Soomro3,Qudratullah Kalwar4, Saqib Ali Fazilani1 and Waseem Ali Vistro5*
...sitive reactions. In contrast, ethanol extract of Aloe Vera showed better result as compared to crude Aloe Vera at both concentration i-e 30 µl and 60 µl. Among isolates, S. aureus showed high sensitivity (15-22 mm), followed by E. coli (14-18 mm), Shigella (13-15) and Salmonella spp (11-14 mm) both concentrations. The results of this study revealed that ethanol extract of Aloe Vera showed better antibacterial activity a...
Sumaira1, Syed Mohsin Bukhari1, Maqsood Iram2, Arshad Javid1Ali Hussain1, Waqas Ali1, Khalil Ur Rehman3, Shahla Andleeb3, Irfan Baboo4 and Nimra Khalid1
...seasons while internal parasite species belong to genus Pseudomonas, Staphylococcus and Streptococcus were recorded from Python molurus. Higher temperature and humidity accelerated the ecdysis process.
...
Zubair Ahmad1, 2, 4, Hamed A. Ghramh1, 2, 3,Khalid Ali Khan1, 2, 3*, Farhat Khan4 and Shujauddin5
...>adversely affects the parasitoid effectiveness of Lysiphlebia mirzai and Aphelinus desantesi. The aphids got 31% and 26.3% parasitism when attended by C. compressus and C. subnuda Mayr., respectively. Further in the presence of these two dominant species the other ants viz., Paratrechina longicornis (Latr) and Tapinoma melanocephalum (F.) are unable to make contact with the aphids a...

Olugbenga Omotayo Alabi1*, Ayoola Olugbenga Oladele2 and Ibrahim Maharazu3

Profitability Analysis and Marketing Efficiency of Soyabean (Glycine max) Value Chain among Actors in Abuja, Nigeria
...ilities, and bad road infrastructures. The retained components observed explained 93.24% of the variations in the component retained in the principal component model. The study recommends that marketers should develop new marketing strategies that will increase their profit margin. The sales price instability as a result of poor marketing arrangement could be addressed if processing firms were linked to soyabeans marketers and there is the need for mobilizatio...

Talib Hussain Solangi1, Bhai Khan Solangi1*, Muhammad Saleem Sarki2, Muhammad Akbar Lashari1, Mubeena Pathan3, Velo Suthar4, Barkatullah Qureshi4, Mitha Khan6, Razzak Amin Shah5 and Aeman Afzal6

Varietal Preference of Sucking Insect Pests on Mustard Varieties, Sindh, Pakistan
...tabaci Lind.), jassid (Amrasca devastans Dist.) and aphid (Lipaphis erysimi Kalt.) varied significantly among varieties (P<0.05), observation dates (P<0.01) as well as varieties × observation dates interaction (P<0.01).The lowest whitefly population of 2.88±0.37/plant was monitored on mustard variety ‘S-9’; while highest population of 4.36±0.42/plant was recorded on variety ‘Bard-2’. Thrips showed that lowes...
Muhammad R. Khan1, Bushra A. Rakha1,* and Muhammad S. Ansari2
...othoraicthys facing drastic decline in their distribution range and within River Swat due to introduction of exotic salmons and overfishing.
...

Amit Sharma1* and Pankaj Sood2

Sonographic Assessment of Ovarian Follicular Dynamics during Breeding and Non-Breeding Season in Gaddi Goats
...di goats. Transrectal ultrasonographic ovarian examinations were carried out during a full estrous cycle in breeding (B; January-February, n=7) and 21 days in non-breeding (NB; May-June, n=11) seasons. Blood sampling on alternate days was done during both the seasons for serum progesterone (P4) estimations. Follicular growth was characterized by presence of three to five numbers of follicular waves in both seasons. Significantly higher (P<0.01) number of fo...

Md. Aminul Islam1*, A.N.M. Aminoor Rahman2, Mohammad Shah Alam3 and Md. Taimur Islam4

Gastrointestinal Nematodiasis in Quail in Bangladesh
...gnosing other types of parasitic diseases in quails in Bangladesh.

...

Abdul Jalal, Abdur Rab* and Naveed Ahmad

Aloe Vera Gel Coating Retains Persimmon Fruit (Diospyros kaki) Quality during Storage at Room Temperature
...room temperature. By contrast, fruit treated with 30% Aloe vera gel retained high fruit firmness (2.46 kg cm-2), acidity (0.19%), ascorbic acid content (29.76 mg/100g) as well as lower TSS (20.2%) and decay incidence (43.85%) after 35 days storage at room temperature.

...

Shahid Nadeem1*, Taj Naseeb Khan1, Mushtaq Ahmad1, Adnan Younis2 and Iram Fatima3

Influence of Plant Growth Regulators by Foliar Application on Vegetative and Floral physiognomies of Gladiolus
...gn: justify;">Gladiolus grasps an exceptional position among ornamental plants due to its captivating spikes, with plane ruffle and deeply crinkled sepals, and it mainly used as cut flower and greatly demanded in floral markets. In order to achieve the maximum outcomes for the purchaser or community, a comprehensive study was conducted on gladiolus to enhance its vegetative and floral characteristics with the foliar application of growth hormones i.e. gibberel...

Attiq ur Rehman1,2*, Iftikhar Hussain Khalil3 and Ihtisham Ali4

Genetic Diversity and Traits Association in Tetraploid and Hexaploid Wheat Genotypes in Khyber Pakhtunkhwa Province of Pakistan
...rum vs. spring wheat contrast was significant for all other studied parameters. The flag leaf area of durum wheat was more than that of spring wheat and it took fewer days to initiate heading as well. In contrast, spring wheat genotypes had more average plant height, tillers m-2, spikes m-2, 1000-grain weight, grain yield and harvest index than durum wheat genotypes. Correlation analysis revealed that tillers m-2 and spikes ...

Zahir Shah1*, Saima Munawar1, Ihsan Ullah2, Taif Shah3, Haq Aman Ullah1, Saqib Nawaz1, Farhan Anwar Khan1 and Manoj Kumar Shah4

Combined Physico-chemical and Analgesic Effects of Electroacupuncture Plus Clonidine in Goats
...ne/aspartate aminotransferase activities, and hematological variables for differently treated groups were insignificant. In conclusion, EA combined with a low dose of 10µg/kg of clonidine provided better analgesia in experimental animals.

...
Muhammad Zahid Mengal1, Hamida Ali2, Raheela Asmat3, Muhammad Naeem1,4, Ferhat Abbas1, Abdul Samad1, Mohammad Zahid Mustafa1, Jannat Raza2 and Tauseef M. Asmat1*
...d mutations in RNA polymerase beta (rpoB) gene of M. tuberculosis within 81-bp RRDR in Quetta, Pakistan using GeneXpert® MTB/RIF assay.In total, 2300 clinical specimens were collected from suspected TB patients at Fatima Jinnah General and Chest Hospital Quetta, Pakistan between January and August 2017. These specimens were analyzed by GeneXpert® MTB/RIF assay. The data was statistically analyzed using SPSS software....

Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2

Description of Seven New Species and One New Record of Plant-Parasitic Nematodes (Nematoda: Tylenchida) Associated with Economically Important Crops of Kashmir Valley, Jammu and Kashmir (Part-1 of the series)
...rvey of soil and plant-parasitic nematodes of vegetable and fruit crops of Kashmir valley, Jammu and Kashmir, seven new species and one new record of following species were recovered: Helicotylenchus siddiqii sp. nov. from soil around roots of Glycine max L. Miller, from Kashmir University Campus, Hazratbal, Srinagar, Kashmir; H. fotedariensis sp. nov. from soil around roots of Brassica oleraceae var. botrytis L. from Zadiba...

Joseph Anejo-Okopi1*, Dorcas Yilger Gotom1, Noble Allison Chiehiura1, Julius Ocheme Okojokwu1, David Ochola Amanyi2, John Otumala Egbere1, Joshua Adetunji1, Otobo Innocent Ujah3 and Onyemocho Audu4

The Seroprevalence of Zika Virus Infection among HIV Positive and HIV Negative Pregnant Women in Jos, Nigeria
...ellow fever vaccination, rashes and parity was found for anti-ZIKV IgG positivity in the groups. Our results showed high seroprevalence among the pregnant women, an indication that the ZIKV antigen that triggered the antibodies response is in circulation, therefore, suggest the need for ZIKV surveillance and larger study on specific IgM antibodies in Nigeria.

...

Asif Ali Abro1* and Iqbal Ahmed Panhwar2

Impact of Various Factors on Crop Diversification Towards High Value Crops in Pakistan: An Empirical Analysis by using THI
...he impact of improved infrastructure; the length of the road was adopted and showed a positive and significant relationship with crop diversification. Per capita income, urbanization, and profitability of minor crops were taken as demand side factors. Per capita income, urbanization and profitability of minor crops regression coefficients showed positive and significant impact on crop diversification. The technology was determined using fertilizers, the number...

Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4

Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...portant group of plant parasitic nematodes belong to genus Meloidogyne with extensive host range. A comprehensive survey study was carried out to document host and non-host plants in cultivated fields of Bagh district, Azad Jammu and Kashmir. Total of 111 vegetable fields from 82 locations of study areas was surveyed during summer 2013, 2014, 2016 and 2017. Okra, Eggplant, tomato, cucumber, chilies, beans and cucurbits were found most frequently cultivated veg...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
...etter control of plant parasitic nematodes.
...
Muhammad Umer Khan1,2*, Muhammad Farooq Sabar1, Atif Amin Baig3, Arif-un-Nisa Naqvi4 and Muhammad Usman Ghani1
...e predominance of West Eurasian lineages in the Shin population (59.49%), followed by South Asian lineages (25.32%) and then East and Southeast Asian lineages (15.19%). Shin population presented a high genetic diversity of 0.9996 and a low random match probability of 0.0129. To the best of our knowledge, this is the first report of mtDNA profiles of the Shin population, providing a complementing dataset for curative generation of future mtDNA databases in Paki...

Sehrish Ashraaf1, Hafiz Muhammad Tahir1* and Sajida Naseem2

...nce was more than the intraspecific value of divergence for all seven families which described a clear barcode gap. Nooverlap was recorded in intraspecific and interspecific divergence value. Furthermore, distance to NN was higher than the
Atef  Mohamed El-Sagheer
Status of Phytonematodes in a Main Commercial Banana Production of Upper Egypt
...ce value of some plant parasitic genera e.g., Meloidogyne in Abo-Teg and East Mangabad has the most prominence value (17.20 and 19.80) followed by Longidorus and Radopholus in Manfalot (17.20 and 15.36), respectively. The lowest prevalent genus was Heterodera which was absent in two surveyed localities viz., Abo-Teg and Assiut regions but present in Manfalot and East Mangabad with the prominence value 1.82 and 0.22 and population densities 43 and 11, respectiv...

 Majid Shahi Bajestani1, Esmat Mahdikhani Moghadam2*, Reza Aghnoum3 and Hamid Rohani2

Study of Plant Parasitic Nematodes and Description of New Record (Rotylenchus alius) Associated with Barley (Hordium vulgare L.) in Khorasan Razavi Province, Northeast Iran
...vulgare L.) fields of Khorasan Razavi Province, Northeast Iran, during 2015-2017. A total of 120 soil and root samples were collected to examine the prevalence of Plant parasitic nematodes. In morphological and morphometrical identification 18 species were recorded belonging to nine genera. Among these species, Rotylenchus alius was found as a new record from Iran and Basiria gracilis, Boleodorus thylactus, Ditylenchus apus ...
Faryal Saad1,3, Zia Ur Rahman2, Aamir Khan3, Rabia Noushin4, Irfan Ullah5, Farman Ullah Dawar3,Shahid Naiz Khan3, Rafiqe Hussain6, Kenza Javed2Abid ur Rehman7, Amna Fayaz3, Zohra Saifullah3 and Kalim Ullah3*
... Assay (ELISA) and Polymerase Chain Reaction (PCR) for CMV. Out of total 88 samples, 73.40% were positive for CMV through ELISA and 57.44% were positive for CMV through PCR respectively.

...
Feng Xu1,2,3*, Weikang Yang1,2,3*, Ming Ma1,2,3 and David A. Blank4
...ation density and big intraspecific competitions for resources.
...
Mushtaq Ahamd Khan1, Ziaul Islam2, *, Amin Ullah Jan3, Kamran Khan2 and Abdullah Shah3
... is the most prevalent parasitic zoonotic disease caused by Toxoplasma gondii that infects a wide range of warm-blooded animals including humans. Congenital infection with T. gondii during pregnancy can result in severe abnormalities in infants such as hydrocephalus and mental retardation. The present study was conducted to estimate seroprevalence and potential risk factors in acquiring T. gondii infection by child-bearing age women in Dir...
Mudussar Nawaz1, Iahtasham Khan2, Muhammad Shakeell*, Arfan Yousaf1, Zahid Naseer1, Munibullah1, Ali Zohaib3, Riaz Hussain4 and Qudrat Ullah5
...lk i-ELISA tests. In contrast, history of stillbirth had no significant association with anti-Brucella antibody titers. In conclusion, brucellosis is prevalent in Islamabad Capital Territory.
...
Muhammad Zeeshan Majeed1*, Muhammad Shahzad Akbar1, Muhammad Afzal1, Muhammad Mustaqeem2, Muhammad Luqman3, Ijaz Asghar4 and Muhammada Asam Riaz1
...insect pest of wooden infrastructures, agricultural crops, orchards and forest plantations. Standard filter paper disc method was used for both toxicity and repellency bioassays according to completely randomized design. The response of termite workers varied with plant species, botanical concentration and exposure time. The extracts of Azadirachta indica (neem) and Nerium indicum (oleander) appeared to be most effective against the termites with...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...xic to different plant parasitic nematodes can be expressed into tissues and cells feed upon by nematodes. Transgenic products with a potential to interefere with nematode physiology such as digestive enzymes or structural proteins of the intestine are considered.

...

Muhammad Abdullah1, Syed Attaullah Shah1, Khurram Nawaz Saddozai1, Jahangir Khan1*, Mohammad Fayaz1, Irfan Ullah1* and Sabeeh Ullah2

Analysis of Agricultural Land Price Determinants and Policy Implications for Controlling Residential and Commercial Encroachments: Facts from District Swabi (Pakistan)
...sities and gas supply infrastructure in the surroundings of Swabi city are resulting human influx from rural areas, and are increasing demand for residential and commercial units in the suburbs. This high demand is pulling land prices and causing utilization of fertile agricultural land for residential and commercial units’ construction. Around 50% of the sampled agricultural lands were used for residential and commercial purposes. Results from HPM revea...
40th PAKISTAN CONGRESS OF ZOOLOGY (INTERNATIONAL) Department of Parasitology, Sindh Agriculture University, Tandojam
...ATIONAL) Department of Parasitology, Sindh Agriculture University, Tandojam

...

Ghulam Murtaza1*, Muhammad Ramzan2, Amna Razzaq4, Muhammad Numan3, Rukhsar Beanish4, Ayesha Zafar4, Muhammad Shan Latif3 and Muhammad Adnan3

Screening of Brinjal (Solanum melongena) Varieties against Jassid, Amrasca bigutulla bigutulla
...h nymphs and adults of Amrasca bigutulla bigutulla suck the cell sap from underside the leaves resulting in leaves curling and yellowing. Jassid (Amrasca bigutulla bigutulla) inject toxic materials into leaves which results necrosis. An experimental study was conducted by using randomized complete block design (RCBD) during 2018 to check the resistant brinjal varieties (Nirala, Dilnasheen and Bemisal) against jassid (A. bigu...
Yongmei Gao1, Peihong Gao2, Yanjun Wang3, Jinhua Han4 and Yang Shu1*
... quality nursing. In contrast, the control group was treated with only mifepristone therapy and applied with routine nursing measures. The therapeutic and nursing effects of the two groups were compared. After the implementation of different treatment and nursing mode, the overall treatment effective rate of the research group patients was 97.50%, which was significantly higher than 75.00% of control group, p<0.05. Through comparing the changes of fibroid v...

Muhammad Ali Shah, Faiz Ur Rehman, Abbas Mehmood, Fareed Ullah, Sayed Irfan Shah and Syed Majid Rasheed*

Combining Ability, Heritability and Gene Action Assessment in Rapeseed (Brassica napus L.) for Yield and Yield Attributes
...stify;">An F1 hybrid of Brassica napus L., derived from 5 × 5 diallel, was studied to estimate combining ability, heritability and gene action of morphological and yield associated traits, utilizing randomized complete block design (RCBD) with two replications, at Bacha Khan Agricultural Research Farm (BARF), Charsadda, Khyber Pakhtunkhwa, Pakistan during the growing season of 2017-18. The data were collected for pods related traits and total yield. The ...

Sidra Shehzadi, Sher Bahadar Khan*, Umar Sadique and Saqib Nawaz

Isolation and Molecular Identification of Clostridium perfringens Type D in Goats in District Peshawar
...chemical tests and polymerase chain reaction (PCR) . Results revealed that 25 feacal samples collected from suspected goats were positive for C. perfringens  Type D  and the overall prevalence of enterotoxaemia in goats in district Peshawar was 25%. The prevalence of enterotoxaemia was 24%, 44%, 20% and 12% in zone I, II, III and IV respectively.  Zone II showed the highest prevalence rate of 44%. However, the colony morphology, microscopy, bioc...

Muhammad Shahzad Akbar, Farrukh Sajjad, Muhammad Afzal, Muhammad Luqman, Muhammad Asam Riaz and Muhammad Zeeshan Majeed*

Field Evaluation of Promising Botanical Extracts, Plant Essential Oils and Differential Chemistry Insecticides against Subterranean Termites Odontotermes obesus (Isoptera: Termitidae)
...lantations and wooden infrastructures. A wide range of persistent synthetic chemicals are employed to prevent and control the infestations of subterranean termites. Most of these chemicals have high mammalian toxicity and environmental hazards. This study was, therefore, aimed to evaluate the efficacy of some promising botanical extracts (Dodonaea viscosa, Gardenia jasminoides and Nerium indicum), plant essential oils (Allium sativum, Citrus aurantium and Cymb...

Numan Habib1*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2

Thermal Simulation of Grain During Selective Laser Melting Process in 3D Metal Printing
...m and UNS C85500 yellow brass are investigated. A Gaussian distribution type laser having 100-watt power and 100 m spot size is used. Simulation is carried out on a single grain, directly exposed to the laser. The prime goal of this study is to investigate the effect of different process parameters on temperature distribution in grain and capability of the specified laser to melt and fuse above mentioned material powder grain. Three different 2D models of 1&mi...

Yuan Xing, Congming Tan, Yan Luo and Wenjun Liu* 

...ce caused by OVA. In contrast, there was no significant effect in the body weight of mice treated with quercetin. Based on the result, we may infer that quercetin demonstrates an inflammatory mechanism for the therapeutic effect of inflammation in allergic asthma.
...

Said Sajjad Ali Shah1*, Muhammad Ilyas Khan1, Aziz Ullah1, Hayat Ullah2 and Faisal Ahmad2

Coprological Examination of Small and Large Ruminants in Central Zone of Khyber Pakhtunkhwa
..."text-align: justify;">Parasitic infections especially gastrointestinal parasites are a major constraint for blooming dairy industry of Pakistan, because it limit, the productive performance of animals. Aim of the project was to find out the prevalence of internal parasites in small and large ruminants in central zone of Khyber Pakhtunkhwa. For this purpose, a total of 1700 fecal samples w...
Arnab Tanveer, Shabana Naz*, Azhar Rafique and Asma Ashraf
...the prevalence of endo-parasites in Pavo cristatus and the comparative efficacy of Albandazole and Levamisole against the endo parasites at three different locations viz. Jallo Wildlife Park Lahore, Wildlife Park Murree and Wildlife Park Bahawalnagar. Freshly dropped fecal sample were collected once before treatment with anthelminthic drug and twice after treatment and brought to laboratory for qualitative and quantit...

Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Mushtaq Ahmad1, Muhammad Saleem2, Ali Aziz2, Irfan Rasool2, Zeshan Ali3 and Muhammad Amin2

An Update on Biology, Extent of Damage and Effective Management Strategies of Chickpea Pod Borer (Helicoverpa armigera)
... insect responsible for drastic decline in chickpea productivity across the world. Management of H. armigera is of prime importance to achieve sustainable chickpea yields. Its life cycle passes through egg, larvae, pupae and adult stages in about 4-5 weeks. 1st to 3rd instar larvae generally feed on leaves, twigs and flowers. In later stages larger larvae (4th to 6th instar caterpillars) shift to developing pods by making holes/bores and consume entire develop...
Shikang Deng1,2, Yan Jin2, Jing Xu2, Xiufang Zhu2, Pinghai Hu2, Jiao Li2, Li Zhang2 and Jianzhong Tang2,*
...lls; and real-time polymerase chain reaction was used to detect the expression levels of TGF-β1, cyclinD1, and CDK4 mRNA in each group of cells. The results showed that after 5-FU intervention, the proliferation of bile duct scar fibroblasts was inhibited, and the expressions of TGF-β1, cyclinD1, CDK4 mRNA and protein in the cells were down-regulated (P<0.05), showing concentration-dependence. In conclusion, 5-FU may have a role in inhibiting bile...
Pengfei Liu1*, Hongxia Liu2 and Jiajia Xiao1
...edation risk and brood parasitism, and it could be viewed as an indicator to assess the pressure of sexual selection between two sexes.
...
Maria Syafiqah Ghazali1, Azlan Che’ Amat2 and Nor Azlina Abdul Aziz1*
...tic resistance against parasitic infection mainly due to low exposure towards the parasites themselves. However, when herds of these wild animals are kept in captivity, or in zoological gardens, parasitic infections might be worse and pose a serious threat to endangered species. The present study was conducted to observe the occurrence of gastrointestinal paras

Rahat Afza, Muhammad Asam Riaz*, Muhammad Afzal and Muhammad Zeeshan Majeed

Adverse Effect of Sublethal Concentrations of Insecticides on the Biological Parameters and Functional Response of Predatory Beetle Coccinella septempunctata (Coleoptera: Coccinellidae) of Brassica Aphid
...se after feeding on the brassica aphids (Brevicoryne brassicae) treated with thiamethoxam, lambda-cyhalothrin and cypermethrin, while imidacloprid, profenophos and chlorpyrifos treated aphids altered the functional response of larval coccinellids from type II to III. The change in response was linked to unconsciousness and disorientation induced by the insecticides targeting insect nervous system. Conclusively, none of the i...

Shishir Sharma* and Laxmi Prasad Joshi

Current Insights on Stemphylium Blight of Lentil with its Management Strategies
...nmental concerns and contrasting morphological characteristics among species. The frequency and intensity of this disease depends on environmental and climatic factors that are mainly favored by high humidity, temperature greater than 220c, and cloudiness. The pathogen mainly persists in crop debris and occasionally in seed during the offseason. Mapping QTLs by utilizing wild varieties and landraces may be used to develop disease-resistant varieties which it i...

Bina Khanzada1, Arfan Ahmed Gilal1*, Bhai Khan Solangi1 and Imtiaz Ahmed Nizamani2

Effect of Morphological Characters of Indigenous Sugarcane Varieties on Population of Chilo infuscatellus (Snellen) and its parasitoid, Cotesia flavipes (Cameron)
...nfuscatellus, thus, on parasitism of C. flavipes, this study was conducted in 2013 and 2014. Ten sugarcane varieties i.e., NIA-98, NIA-2004, Thatta-10, Gulab-95, BL-4, L-116, SPS-26, AEC86-223, AEC82-1026 and Larkana-201 were used in the study, each sown on half acre area at Experimental field of Nuclear Institute of Agriculture, Tando Jam, Pakistan. Observations were taken on morphological characters of varieties i.e., cane length, number of internodes, lengt...

Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz3, Abid Niaz2, Khurshid Ahmad Mufti4 and Muhammad Arif2

Deleterious Impact of Sodium Chloride (NaCl) Toxicity on Chemical Properties of Soil and Ionic Composition of Rice
...le trend of K was in contrast to Na which decreased with the increasing level of Na. Injurious impact of NaCl was more pronounced as the concentration of salt increased in the treatments. All the data were subjected to statistical analysis for the assessment of significance level of various treatments.

...

Inam Ul Haq1*, Humara Umar2, Naeem Akhtar3, Muhammad Azhar Iqbal2 and Muhammad Ijaz1

Techniques for Micropropagation of Olive (Olea europaea L.): A Systematic Review
... besides having basic infrastructure and necessary facilities. Therefore, authors planned to document different critical stages of olive micropropagation like; media preparation, culture establishment, shoot and root proliferation and acclimatization which would be applied for micropropagation of olives at Barani Agricultural Research Institute (BARI), Chakwal. Resultantly, olive expansion through micropropagation can be predicted in near future for sustainabi...

Muhammad Farooq1*, Elham Azadfar2, Zohre Bahrami3, Mahniya Sharifi3, A. Shakoor4, Shabir Ahmed5, Iftikhar Ahmed Solangi1, Muhammad Noman Khan6, Memona Siddique7, Naila Ilyas8*, Muhammad Bakhtiar9, Mohamed El-Fatieh Ismael1 and Wang Yunyang1

Optimization of Drying Process of Rambutan by Combined Method of Osmosis Ultrasound and Complementary Drying of Hot Air
...tables. Using osmosis-ultrasound before drying with hot air causes the preservation of nutrients in products and reduces heat energy to remove the produc water. In this study, after osmosis pretreatment, samples were put under an osmosis dehydration process. First, using Osmosis-ultrasound with 40.5% concentration in Sekanjabin solution then dried in an oven at a temperature of 70°C. The characteristics of solid gain, wa...
Umair Faheem1*, Qaisar Abbas1, Saghir Ahmad2, Ghayour Ahmad2, Abdul Karim2and Mussurat Hussain1
...these insect pests, Amrasca biguttula biguttula ‘Jassid’ are the most destructive ones. Beside these insect pests, environmental factors also affect the cotton production as well as population fluctuations of insect pests. The current study was designed to measure the impact of different meteorological limitations i.e. temperature (oC), relative humidity (RH) and rainfall (RF) on population fluctuation or dynamics of the A. big...
Abdul Rauf Bhatti1*, Ahmed Zia1, Falak Naz2, Amjad Usman3, Rukhshanda Saleem4, Ghulam Sarwar5 and Amad Ud Din6
 
 
...) trees and Khabbal Grass (Cyanodon dactylon), which highlight their importance. Keeping in view topographic gradients, ecological complex in Pothohar plateau and pest status of curculionid weevils, further surveys are suggested to unveil more important records from the area.
...
Humza Sami1, Mahnoor Sagheer1, Muhammad Amir Altaf1, Javaid Iqbal2 and Muhammad Zubair1,*
 
...ignals from the high contrast objects emulating the tumor characteristics have been processed through an open-source imaging algorithm, known as MERIT, to construct the image. To get the best results, images are constructed by comparing different algorithms and the varying number of channels. Simulated and measured results are successfully verified for different locations and sizes of conducting objects in a given imaging domain. The proposed system can be use...
Faiz Muhammad Khand1,Allah Bux Kachiwal2, Zubair Ahmed Laghari2, Shakeel Ahmed Lakho1, Pershotam Khattri2, Saeed Ahmed Soomro2, Nazar Ali Korejo2 and Ambreen Leghari1*
... teddy goat by B-mode ultrasound measurement of embryonic or fetal parts and uterine diameter throughout pregnancy by transrectal approach. Three parameters crown rump length (CRL), trunk diameter (TD), and uterine diameter(UD)were selected for measurement of gestational age with the weekly interval from 3rd week to 15 weeks of gestation of 12 pregnant teddy goats, all three parameters were significantly (P<0.01) corelated with gestational...
Faheem Ahmed Khan1*, Sarzamin Khan2, Qurat-ul-Ain3, Saqib Ishaq1Muhammad Salman1, Abdul Rehman1, Ikram Ullah4, Kalsoom5 and Johar Jamil5
...ed by conventional polymerase chain reaction (PCR) and were characterized for production of single cell microbial protein (SCMP). Out of 60 different fruit samples, a total number of confirmed S. cerevisiae isolates were 1, 2 and 1 from orange (Citrus sinensis), grapes (Vitis), and peach (Prunus persica), respectively. Utilizing yeast extract, peptone and dextrose maximum biomass was produced by S. cerevisiae isolate recovere...
Muhammad Younis1, Muhammad Irfan-ur-Rehman Khan1*, Mustansar Abbas1Ali Murtaza1, Imran Mohsin2, Muhammad Shahzad3 and Muhammad Zahid Tahir1
...g B-mode trans-rectal ultrasonography during the breeding season (Sep-Nov 2018). Plasma progesterone and estradiol-17β concentrations were determined throughout the cycle using radioimmunoassay. The average length of the estrous cycle in Lohi sheep was 17.0±0.1 days and follicular and luteal phases were 4.6±0.2 and 11.3±0.2 days long, respectively. Estrous cycles had either three or four follicular waves; 3-wave cycles were more frequ...
Kamal Al-Samawi1, Mohamed Al-Hassan2, Hussein Migdadi3,4*, Megahed Ammar5 and Salem Alghamdi3
...d to progesterone and ultrasound (US) were evaluated. Female goats were synchronized using the ovsynch protocol level in combination with natural mating (NM). Blood samples were collected at 1, 7, 15, 23, 35, and 60 days post NM. Levels of ISG15 and ISG17 mRNAs were assayed using real-time PCR, and serum progesterone (P4) concentrations were assayed using an ELISA kit. Pregnancy detection was performed by US on 23, 35, and 60 days p...
Muhammad Tahir Waseem1, Abdul Majid Khan1*, Abdul Ghaffar2, Ayesha Iqbal1 and Rana Manzoor Ahmad1,3
... mosaic of woodland and grassland with predominant C3 vegetation which latter shifted to C3/C4 grasses. For this purpose, fifteen dental samples (Five for each Hipparion species) from well dated late Miocene localities between 8.8-7.7 Ma are analyzed. All the δ13C values (V-PDB) are in range of -11.27‰ to -3.36‰ which represent that these horses dominantl...
Muhammad Bilal Anwar1, Mirza Azhar Beg1, Amjad Rashid Kayani1, Muhammad Sajid Nadeem1*, Syed Israr Shah1, Sajida Noureen2
Muhammad Mushtaq1 and Tariq Mahmood3
...>Athene brama) and eurasian eagle owl (Bubo bubo) are different sized avian predators coexisting in the Wildlife Park Lohi Bher, Rawalpindi district of the Punjab province of Pakistan. These crepuscular and nocturnal owls are the least studied group of birds in northern regions. In this study, we compared seasonal differences in the diet of three owl species in an uncultivated area with rapid urbanization all around to better understand their ecolog...
Ammara Gull-e-Fareen1,2, Imran Bodlah1,*, Muhammad Adnan Bodlah3, Muhammad Tariq Rasheed1, Habib Ali4 and Muhammad Asif5
... that C. notata parasitizes the immature of Ischiodon scutellaris (F.) like other reported species of this genus. Main diagnostic characters, brief description, morphometrics and illustrations are provided. Comparison of recorded species with type species has been provided. World distribution and distribution in Pakistan has been given using Arc GIS tools.
...
Iftikhar Hussain1, Sardar Azhar Mehmood1, Muzafar Shah2*, Mohammad Salim3, Shabir Ahmed1, Sana Ullah1,Sidra Batool4, Nadia Saeed1 and Khalid Usman1
...e sequences. The mean intraspecific divergences of C. sphinx were 0.011%. The nucleotide composition of the sequences showed higher concentration of A+T as compared to G+C. The A+T contents were 53.1% and C+G were 46.8%. In phylogenetic tree the sequences of C. sphinx clustered together with 100% bootstrap support. The relationship between C. sphinx and C. horsefield was supported by 83% bootstrap value. ...
Hina Habib Syed1, Muzafar Shah2*, Shahid Sherzada3 and Masroor Elahi Babar1
... infected with malaria parasite. Comparative Data was also collected from other labs of District Swat which accumulated to a total of 9255 patients, among which 932 (10.07%) patients were found positive for malaria parasite. Male infected were 558 (59.87%) while 374 (40.13%) were female. The collective data showed majority of the infected patients belonged to age group 1-10 years (41.42%). The least infected were aged above ...
Rashid Mahmood1*, Muhammad Abu Bakar2, Muhammad Fahim Raza3, Ziyad Abdul Qadir1 and Muhammad Yahya2
... is a destructive ecto-parasite of honey bee (Apis mellifera L) colonies. The main objective of this study was to examine the role of naturally occurring chemicals against Varroa mites of A. mellifera. Nine colonies of A. mellifera were selected to check the infestation of V. destructor randomly. Treatment was applied once and post-treatment data was recorded after 12, 24, 48 and 72 h after all applications of the tested mate...
Eman Khalifa1*, Riad Khalil2 and Haitham Elaadli3
...chemical tests and polymerase chain reaction (PCR) at 500bp diagnostic for M. bovis, as well as (2) to determine the therapeutic efficacy of the various antimicrobials (9 types) on the isolated M. bovis by using different antimicrobial sensitivity plate method. A total number of 100 samples of mastitic milk from native lactating buffaloes’ breed were collected aseptically from 4 private farms in Cairo-Alexandria desert road in the north par...
Rahmat Ullah Khan, Asif Sadam and Sajid Mahmood*
...egetation slopes and 3) grassy mountainous slopes near agricultural fields. The average monthly population density was 0.198±0.04/ha by line transect method. During the period June, July, September and October 2017, significantly (P<0.05) high population density was recorded as compared to the population density recorded during May, August, November and December 2017and January-April 2018 both in the morning and evening. Significantly (
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
... energy demands. Napier grass (Pennisetum purpureum) has turn out the promising nutritious forage to the livestock on the sustainable basis, feedstock for biofuel and also has proven to be environmental friendly. The purpose of this study is to assess the biomass production of mott grass and its capability to sequester Carbon from the environment in the barani areas of Pothwar region in Pakistan. The research study wa...

 Muhammad Ajmal1, Saima Mustafa1, Fizza Ibrahim Bajwa1, Cheng Zhou2, Guangdong Wen2, Soe Lwin Myint2, Syed Irfan Raza3, Ihtasham Bukhari4, Mubashir Hassan5, Muhammad Faisal6 and Furhan Iqbal1*

... other body parts. Polymerase chain reaction (PCR) was used to amplify all the over lapping intron exon regions of HR gene followed by DNA sequencing. Analysis of the DNA sequence revealed a novel deletion c.429delC in exon 2 of HR gene. Due to this deletion Proline at 144 changed into Lysine causing frame shift leading to premature termiation of the protein after 23 amino acid residues (p.P144LfsX23), resulting in a truncated HR protein with 166...
Chen Tongde1, Fakher Abbas1, Jiao Juying1, Shahzada Sohail Ijaz2*, An Shoshan1, Muhammad Ansar3, Qaiser Hussain2, Mah-Noor Azad2 andAyaz Ahmad2
...erosion of woodland and grassland was relatively light with sheet erosion as the main type. Soil erosion mainly occurred in construction land. Gully erosion was caused by rainfall and runoff on excavated slopes, dump slopes, roadside slopes and brick factories. Due to overgrazing, gravity erosion and gully erosion also occurred in some natural hillsides. The range of soil erosion of the 15 investigation units was about 5.14~133.89 t ha-1 year-1...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
...s well as realtime polymerase chain reaction by using standardized NDV specific primers and finally eight viruses were selected for further sequencing for the partial fusion protein, The eight NDVs isolates of velogenic genotype VII and contain the unique cleavage site motif 112RRQKRF117 with high relation to very virulent NDV Chinese strain Chicken /China/SDWF07/2011 strain with nucleotide identity percentage (99.3% -100%). The main causative agent of recent ...

 Caner Öztürk1*, Mücahid Onay1 and Neşe Hayat Aksoy2

...;C for 30 s. A phase-contrast microscope (400x) was used to determine the sperm motility. PNA-FITC staining was used to examine the acrosome integrity under a fluorescence microscope. Total oxidant status (TOS) and total antioxidant status (TAS) were measured using ELISA. The methionine group showed an increase in the post-thaw motility (53.08 ±3.6%) and viability (47.5 ±2.9) percentages compared to the control group (46.68 ±...
BamideleAkinsanya1, Isaac O Ayanda2,*, Benson Onwusa1 and Joseph K Saliu1
...vestigated in the fish parasite Tenuisentis niloticus, as a reflection of the extent to which these compounds are present in the lagoon. One hundred (100) samples of Heterotis niloticus were investigated for parasitic infection for a duration of six months, while the parasites encountered were used as sentinel organisms to check for the presence of PAH and BTEX. GC-MS was use...
Chaogang Yao, Daxin Pang, Chao Lu, Aishi Xu, Peixuan Huang, Hongsheng Ouyang* and Hao Yu*
...erse-transcription polymerase chain reaction (qRT-PCR) array. Our results showed that three lipid metabolism-related biological processes lipogenesis, fatty acid transport and fatty acid oxidation in these two pathways showed significant differences in activation between Large White and Min pigs. The activation of the PPAR and fatty acid metabolism signaling pathways may play a positive role in reducing IMF content in pigs.
...
Saima Siddiqui1, Ghulam Hussain Abro1, Tajwar Sultana Syed 1Abdul Sattar Buriro2, Sohail Ahmad3, Muhammad Zeeshan Majeed4 and Muhammad Asam Riaz4*

 

...sts such as jassid (Amrasca bigutulla bigutulla Ishida), thrips (Thrips tabaci Lind.) and whitefly (Bemisia tabaci Gen.) on cotton. To this end, the present research was conducted on various cotton varieties classified on the basis of their genetic characteristics such as nectard (CIM-554, CIM-557and MNH-786), nectariless (Stoneville-701, Stoneville-697, and Stoneville-857), high gossypol (CIM-496 and LAHG 1838-1488) and gossypol free (Gre...
Canan Vejselova Sezer*
...for morphological and ultrastructural changes. Based upon our findings, it can be concluded that silymarin-loaded solid lipid nanoparticles significantly reduced the growth of A549 and MCF-7 cells compared to silymarin. Also these nanoparticles induced apoptosis both in A549 and MCF-7 cells in higher percentages than that of silymarin. In microscopic investigations, it was shown clearly that apoptotic cell death hallmarks in silymarin and silymarin-loaded soli...

Salma Javed and Samreen Khan*

...port mass culturing of parasitic Aphelenchus avenae and their relationship and further explore these nematodes under field circumstances to control many pathogenic soil-borne fungi because this is the first study conducted on the subject experiment in Pakistan.

...
Tai-hua Jin1, An-gang Lou2,Jiu-xiu Ji1, Cheng-dou Cui2, Long-zheng Yu2 andLi-zeng Guan1*
... software and Dual-Luciferase reporter gene system was used to analyze the regulation mechanism between miR-1468 and GH. The results showed that the GH mRNA and protein level in pituitary cells of Yanbian yellow cattle could be significantly decreased by adding miR-1468 mimics (P<0.01), while these were significantly increased by adding miR-1468 inhibitor (P<0.05). The results of bioinformatics analysis and double lucife
Sara Sultan Alomran1, Muhammad Nasir Khan Khattak1,2, Amir Ali Khan1,2*, Sallam Hasan Abdallah2, Abeer Maher Fayyad1 and Khalid Bajou1,2
...fferentiation from telomerase-transformed Mesenchymal Stromal Cells (iMSC3). The transfection of iMSC3 with miR-22-3p suppressed adipocyte differentiation as evident by reduction in lipid content and number of lipid droplets. While AKT3 is reported to be a target of miR-22-3p, our study indicated otherwise. Moreover, while miR-22-3p is known to target more than 500 genes, MAPK has not been identified as one of the more than 500 gene targets of miR-22-3p, thoug...

Zafar Ahmad Handoo1*, Mihail Radu Kantor1 and Ekramullah Khan2

...rvey of soil and plant-parasitic nematodes of vegetable and fruit crops of Kashmir valley, Jammu and Kashmir, ten new species including two new genera of following were recovered: Fotedaronema kashmiriensis gen. n. sp. nov., from soil around roots of Pyrus communis L. from Sonamarg, Parasicagutter chitwoodi gen. n. sp. nov., from soil around roots of Pyrus malus L. in Pattan, Kochinema pahalgamiensis sp. nov., from soil arou...
Fuhua Zhang, Yishuang Yu and Shibao Wu*
...ere diagnosed using B-ultrasonography in three Sunda pangolins (MJ-X2, MJ-X3, and MJ-X4) that had mated with males. B-ultrasonography revealed embryos in pangolins MJ-X2 and MJ-X3, but not in MJ-X4. Pangolins MJ-X2 and MJ-X3 gave birth to cubs 102 and 123 days, respectively, after B-ultrasound detection; pangolin MJ-X4 did not give birth to a cub. This study showed that B-ult
Naimat Ullah Khan1*, Muhammad Hassan Saleem2, Aneela Zameer Durrani2, Nisar Ahmad2, Muhammad Shafee3, Ayesha Hassan2, Mumtaz Ali Khan2 and Nadeem Rashid3
...ium is a protozoan parasite causing diarrhea in human and animals. This study has been aimed to find out its prevalence and chemotherapy of cryptosporidiosis in goats in three selected districts of southern Khyber Pakhtunkhwa (KPK), Pakistan. A total of 1440 fecal samples were collected from goats, 120 samples per month from each of 3 districts for twelve months. Identification of oocysts was done through conventional acid fast ZN staining. Prevalence in D...
Khurram Goraya1,*, Qais ALRawahi1, Sultan ALBalushi1, Hani ALSaadi1, Sami ALRahbi1, Zahir ALAlawi1, Muhammad Hammad Hussain2 and Madad Hussain1
...ult worms. However, no parasite was observed in these animals. These findings demonstrated that more than 50% mortalities could be reduced by only controlling aggression-related injuries and taking precautionary measures against natural disasters like a cyclone. On the other hand, the absence of internal worms could be related to good husbandry conditions at WWR.
...
Saqib Nawaz1, Sher Bahadar Khan1*, Umar Sadique1, Muhammad Israr2
Mumtaz Ali Khan3, Hameed Ullah Khan4, Muhammad Irshad5, Ihsan Ali1 and Haq Aman Ullah1
...ion test (GLT) and polymerase chain reaction (PCR), respectively. Out of total, 85 (31.3%) were positive for C. perfringens type D on PCR. The results revealed 6-34% prevalence of C. perfringens type D in different regions. Similarly, significantly (P˂0.001) higher prevalence was observed in lambs (54%) as compared to sheep (23%). For gross and histopathological lesions a total of 50 animals we...

Talat Farid Ahmed1*, Shamim-ul-Sibtain Shah1, Ashfaq Ahmed Sheikh2, Hashim Nisar Hashmi3, Muhammad Atiqullah Khan1 and Muhammad Azeem Afzal1

...damages to prevailing infrastructure, without stoppage of Canal breaches, minimized damages to standing crops in command area, and will ensure improved irrigation supplies in the Koh e Suleman (Pachad) area, enhancement in economic condition of the area, stable farming in the Pachad area and providing maximum use of flood water for agriculture to increase production and ultimately for socio-economic uplift of the area. The data regarding flood levels and topog...

Mahwish Munawar1, Xu Shiwei1, Yu Wen1 and Muhammad Luqman2*

...onsumption, even at the grass-root level. For upgrading the livelihood patterns and food security situation, a stable economy is an essential factor. Policymakers should modify food security plans according to the ever-changing needs of the population. The national poverty and food insecurity management departments of developing countries should be improved so that vulnerability to food security and food loss can be predicted more accurately.

...

Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1 

Muhammad Suhail Ibrahim1*, Asif Ahmad1, Anwaar Ahmed1, Amer Mumtaz2, Muhammad Javaid Asad3, Saqib Jabbar2, Ahmad Mujtaba1 and Muhammad Nadeem4

...ood safety policy and infrastructure. Food being an important intake is a major source of human exposure. Finally, risk of unsafe communication is required for management and prevention of consumer-based food borne illness, most prevailing illness. We ignore food safety challenges at our peril as potential consequences of a lapse are huge; keeping the food supply safe is a never-ending task.

...
Sadaf Aslam1*, Abdul Majid Khan1 and Muhammad Akhtar2
...ted to Potwar land when grasslands became established. It has typical suine characters with hypsodont dentition and complex infolding of enamel surfaces. The described material consists of isolated molars. This discovery will provide a new insight to understand the diversity and geographic distribution of Siwalik Suids.
...

Muhammad Qaddafi Khan Wali, Arif Alam* and Ikram Shah

...ing better social and infrastructure facilities to minimize hazards of remoteness.

...

Sagir Hussain*, Qamar Abbas, Abdur Razzaq and Sher Wali Khan

...ically important plant parasitic nematode genus. During the present investigation of plant-parasitic nematode fauna from Gilgit-Baltistan, Pakistan, four cyst nematode species viz., Heterodera avenae Wollenweber, 1924; H. mani Mathews,1971; H. schachtii Schmidt, 1871 and H. zeae Koshy, Swarup and Sethi, 1971 were detected from all four districts.

...

Shaista Shafi* and Amjad Farooq

...in different species of brassica at Agricultural College of Bahauddin Zakariya University Multan, Punjab (Pakistan) during 2014-2015 and 2015-2016. Four brassica species (B. carinata, B. rapa, B. napus and B. juncea) were seeded from October to November at different dates (Octo 20, Nov 05, Nov 20) in RCBD design (Randomized Complete Block Design) with standard cultivation procedures to detect the effect of sowing date on Bre...

Hussan Ara Begum1, Muhammad Hamayun1, Noor Shad1, Waqar Khan3, Jawad Ahmad1, Muhammad Ezaz Hasan Khan2, David Aaron Jones2 and Kishwar Ali2*

...fresh and dry weight of Brassica rapa L. and Eruca sativa L. Some seeds of Brassica rapa L. and Eruca sativa L. were placed in petri plates, and were exposed to UV light for 30, 60 and 120 mins daily. The source of UV light was a UV box having a UV Tube. The UV exposure on the seeds reduced the germination percentage in both species. The germination percentage in control was recorded as 19.35%, while it was 18.65% in 30min a...
Shafaq Fatima1,*, Farkhanda Manzoor1, Humaira Amman1, Zakia Kanwal1, Asma Latif1, Zeeshan Ali2, Hamid Iqbal Gondal2, Sumera Sajjad1 and Raja Shahnawaz Janjua3
... fatty acids profile in grass carp (Ctenopharyngodon idella); an important commercial carp in Asia. The present study investigated the effects of three different diets (A, 5% linseed flour; B, 5 % LO; C, 2.5 % linseed flour + 2.5% LO) on growth and fatty acids profile (C12:0– C22:6) in grass carp (age = 12 months). The trial continued for 31 days at ambient temperature. The control group wa...
Arshad Ali1, Muhammad Nasir Khan Khattak2*, Muhammad Ali Nawaz3 and Shoaib Hameed3
... loss to property and infrastructure, damage to crops, and depredation on livestock. In northern Pakistan where large carnivores like common leopard (Panthera pardus), snow leopard (Panthera uncia), Asiatic black bear (Ursus thibetinus), Himalayan brown bear (Ursus arctos isabellinus)), grey wolf (Canis lupus), and lynx (Lynx lynx) often encounter humans and contribute to significant economic losses. The present study ...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Muhammad Umair Sial2, Naeem Iqbal2 and Shafqat Saeed2
...otential egg and pupal parasitoids of T. varians in many countries of the world. The present paper is an attempt to bring and summarize the basic information on majoraspects like distribution, biological parameters and control strategies of bombycid moth T. varians.

...

Huma Qamar1, Mariam Hassan1, Muhammad Zubair1*, Adnan Arshad2, Muhammad Qusain Saeed3, Muhammad Umar3, Sundas Shahzad1, Tariq Mahmood1 and Muhammad Aftab1

...yze the 18 genotypes of Brassica juncea L. for correlation and their path co-efficient analysis. Mean square for five traits was constructed which was highly significant except plant height. Correlation in plant’s height and branches, days required for flowering and days required for maturity was positive at genotypic as well as phenotypic levels. Correlation between numbers of branches and days required for flowering was positive, while negative associa...

Ahmed A. Kheder

...erse transcription polymerase chain reaction (RT-PCR) was used to amplify ~497bp for coat protein gene in RNA 2, the amplified product was confirmed with direct sequences. Phylogenetic analysis results indicated that SLRSV-Eg isolate under study (acc. no. MT648777.1), showed 65.9 – 99.5% nucleotide similarity with available homologous sequences from other crops. Reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of ...

Muhammad Shahzad1*, Syed Amer Mahmood2, Athar Ashraf3, Amer Masood2 and Saira Batool4

...justify;">The Indo-Pak-Eurasia collision has caused recent fault activation and surface deformation in the Nanga Parbat Syntaxis (NPS) region. This investigation deals with the Shuttle Radar Topographic Mission Digital Elevation Model (SRTM DEM) based surface dynamic indices (drainage density-DD, topographic surface roughness-TSR) to constrain the neotectonics of Nanga Parbat Syntaxis (NPS) in Gilgit-Baltistan (Northern Pakistan). This study aims to assess the...

Shahzad Khan1*, Munir Khan1, Arif Alam2, Ikram Shah2, Mahfooz Khan1 and Fida Muhammad Khan1

...85, respectively. In contrast, labour and animal costs were noted negatively. For the larger benefit of the farmers’ and the growth of the agriculture sector, the study recommends a reduction in the prices of fertilizers and suggested to the Government to develop high yielding certified seed and provision of certified/tested seed to the growers.

...
Samina Tahir Kiani1, Abdul Rauf1, Syed Ayaz Kazmi1,*, Nuzhat Shafi1, Madiha Khalid2, Naeem Latif1, Samina Gul2, Saghir Yousaf3 and Muhammad Arshad4
... assay (ELISA) and polymerase chain reaction (PCR). Nine samples were found positive in both ICT and ELISA test for HCV while PCR showed six positive cases for HCV. HBV were found positive in three samples after ICT and ELISA, but was found negative after PCR. MTB was found positive in seven cases after ICT, while six gave positive PCR. Blood transfusion (p=0.0001) was found significant risk factor regarding spread of hepatitis B and C in the studied populatio...

Muhammad Akhtar1, Muhammad Tariq Mahmood2*, Kaiser Latif Cheema1, Mushtaq Ahmad2, Muhammad Jahanzaib Khalid1, Amir Amin1, Javed Anwar Shah1, Zeeshan Qadeer1 and Zeshan Ali3

...ion are major causes of drastic decline in chickpea productivity in Pakistan. Systematic breeding efforts are required for evaluation of available genetic material to evolve drought tolerant chickpea cultivars for drought prone regions of the country. For this purpose, a research experiment was conducted in moisture stress (drought) and non-stress conditions (irrigated) at Gram Breeding Research Station, Kallurkot, Pakistan during 2019-20. Mean performance of ...

NawalM. Abdulla1, M. Haroun1*,Mohamed A. Shalaby2and Ahmed A. Elsanousi2

...erse transcriptase polymerase
chain reaction (rRT-PCR) used as a confirmatory technique, successfully amplified and
detected cDNA fragments corresponding to the NDV RNA extracted from amnioallantoic
fluids (AAF). Sequence analysis and phylogensis of the NDVQF13 strain using 150bp
primer sets revealed 112R-R-Q-K-R-F117 amino acid motif confirming velogenicity of the
strain and its relation to genotype ...
Asmaa A.M. Abd El-Ghani *; Ahmed B.M.; Abdel-Raouf A. ; Nagwa S. Ata* and H.A. Hussein
...persica extract . In contrast, the plan extract didn’t show any activity
against BHV-1 neither in pre- nor post- treatment experiments. Indeed, the present study
confirms that ethanolic extract of Salvadora persica roots had an antiviral effect against
BHV-1.
...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef* 
...lonianigronervosa .Polymerase chain reaction (PCR) was used to detect
BBTV in infected plants and banana aphid (P.nigronervosa) using specific primer
of DNA-1 for BBTV. The results showed that amplified PCR product with the
expected size 476 bp for both infected banana and aphid. PCR was used to detect
component 6 of BBTV-DNA using specific primer at expected size 813 bp.The
isolated component was clo...

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

...
plants. Nestedpolymerase chain reaction(PCR) was performed using the universal -
phytoplasma specific primers; P1/P7, R16F2n/R16R2.Witches‟ broom specific primers
SR1/ SR2, at the spacer region (SR), were used for the direct PCR. Amplicons of
expected size characteristic for phytoplasma associated witches‟ broom were obtained
from infected hibiscus samples. DNA sequencing and phylogenetic analysis of the...

Mai A. Kilany1; Hanaa H.A. Gomaa1; Yousry E. Abo El-magd2 and Nermin Raafat2.

...g was performed by polymerase chain reaction and re-striction fragment length polymorphism (PCR-RFLP) method. The homozygous Ala/Ala (CC) was significantly more frequent in HCV-related HCC patients com-pared to HCV-infected patients and control group (67.5%, 12%, and 15% respective-ly, p ˂ 0.05). Moreover, the C allele was more often associated with HCV-related HCC patients compared to HCV-infected patients and control group (50%, 10%, and 15% respectively, p...

Amal Mahmoud1&2 and Medhat H. Hashem3

... were confirmed by polymerase chain reaction (PCR), resulted in 1110 nt correspond to partial sequence of polymerase (pol) and envelop (env) genesTwo HBV isolates were associated with HCC (Sohag1 and 7). Phylogenetic analysis of the nucleotide sequence and the amino acid of the pol or env genes revealed that 7 out of the 8 isolates were closely related to genotype D. Only Sohag 1-HCC isolate was clustered with genotype C whi...

Enas K. Abo-Elmagd,Kouka S. Abd El-Wahab,Azza H. El- Salakawy

...erse transcription polymerase chain reaction (RT-PCR). Furthermore, to study the frequency of RV infection in Egyptian infants and young children during the summer season 2012 and the effect of certain risk factors including age and gender on the extent and impact of RV infection. The study included 73 infants and young children attending the pediatric Clinic,Al-Zhraa University Hospital in the period from May to October 2012. Their age ranged from six to twen...
Nader M. Sobhy,1 Sunil K. Mor,2 Mohammed E.M. Mohammed,1
Iman M. Bastawecy,3 Hiam M. Fakhry,4 and Sagar M. Goyal2
...erse transcriptase polymerase chain reaction( Rt. PCR) nucleotide of FMDV ID and 3D genes were determined using standard automated sequencing technique. Phylogenetic analysis of FMD / SAT-2 /3D/Egypt/Sharkia/2013/ FMD / (KJ210080) revealed (99–100%) identity with Egypt 2012/ and Palestinian-Gaza virus. Phylogenetic analysis of serotype O of this study from Ismailia (KJ210076) , Alexandria (KJ210074) and El-Mania (KJ210077) showed 100% identity with each ...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...haracterization by polymerase chain reaction PCR for (31) samples as FMD Serotype O , (2) Serotype A and (3) serotype SAT2 the samples collected from outbreaks in period November 2013 –July 2014 the season Autumn and winter for forming an Epidemiological map for 10 governorates of the circulating strains during this period
...

El-Bagoury, G.F., El-Nahas, E.M., El-Habbaa, A.S.

...erse transcription polymerase chain reaction (RT-PCR). Both cattle and buffalo isolates behaved the same pattern for serological and molecular identification in correlation with BEFV Webster reference strain and showed an amplicon size 473 bp for G2 gene. In conclusion, BEFV field strains from cattle and buffaloes seem like but further molecular characterization was required to study their homology.

...

Nelson D. Zambrano1, Wilber Arteaga1, José Velasquez2 and Dorys T. Chirinos1*

...ted with low levels of parasitism. Further, A. gossypii were high and their parasitism low, in both treated and untreated plots. Individuals of T. palmi, B. thurberiella, H. virescens and A. vestitus were low in the treatments; while individuals of Dysdercus spp. were lower in the plots treated with the chemical insecticide. However, the predators, Coleomegilla maculata, Cycloneda sanguinea, Cheilomenes sexmaculata and Zelus...

Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed

...erse Transcriptase-Polymerase Chain Reaction (RTPCR)
using virus-specific primers. The molecular characterization for the Egyptian
isolate has been performed through cloning and sequencing for the OYDV CP gene
which amplified by RT-PCR then cloned and sequenced in the TOPO cloning vector. The
CP gene sequence has been submitted to the GenBank and compared to other available
isolates of OYDV. Sequence ...

Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2

...serum. Anatomical and ultrastructure changes in leaf tissues of both Tomato and Grapevine artificially infected with Tomato ringspot virus were studied by light and electron microscopy. By light microscopy viral infection resulted in the presence of amorphous inclusion bodies in the cytoplasm of infected leaves.Phloem tissues were also affected by infection. Investigations of leaf tissues of both tomato and grapevine by Transmission Electron Microscope (TEM) r...
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2
...sing immunocapture-polymerase chain reaction (IC-PCR) and a
specific antiserum for BSV. IC-PCR indicated the episomal presence of BSV in
Williams and Pradica banana varieties. In addition, IC-PCR analysis on vitroplants
collected from tissue cultures (TC) showed the significant role of TC in spreading out
of BSV. PCR amplicons for the reverse transcriptase and RNaseH motifs of ORF III
for four BSV iso...

A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2

...ants. In
contrast the thickness of upper and lower epidermis layers were reduced. Also the
thickness of midrib zone was slightly reduced. Moreover, vascular tissues lost their
normal shape and arrangement as xylem arms. The most interesting finding, lengths
of both , protoxylem and metaxylem were reduced while their widths were increased.
Ultrathin sections of symptomatic leaf tissue showed several cy...

Mohamed I. Azzam1, Safaa M. Ezzat1, K. A. El-Dougdoug2, Badawi A. Othman2

...se transcriptase - polymerase chain reaction
(rt-qRT-PCR). Eight coliphage isolates were detected in both Rosetta Branch and
drainage water samples. Transmission Electron microscopy revealed that, the isolated
coliphages have an isometric head and long-contractile tail; some particles revealed a
short tail with full heads, resembling those belong to the myoviridae and siphoviridae
family. Restriction ...

Aly M. Abdel-Salam

...d necrotic strips. Polymerase chain reaction
(PCR) utilizing degenerate primers for badnaviruses for the reverse trancriptase,
RT/RNase genome regions of ORF III detected the virus in infected sugarcane leaves
and in its vector Saccharicoccus sacchari and in another unidentified
Pseudococcidae- mealybug. Amplicons for the RT/RNaseH motifs of the two virus
isolates were cloned, sequenced, and submitted...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...erse transcription polymerase chain reaction (RT-PCR) was used to amplify 497 bp fragment using PCR primers specific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
... assayed by nested polymerase chain reactions (PCR) using universal
phytoplasma-specific primer pairs P1/P7 and R16F2n/R16R2. Similar assays were used
to detect phytoplasma interactions with experimentally host plant. Dienes’ stain was also
used for detection of natural infection of phytoplasma. The phloem of infected tissues
showed scattered area stained bright blue. Different techniques for transmission o...

AdlyAbd-Alla1,2, MahaNada3, Francois Cousserans1, and Max Bergoin1

...vealed the presence of paraspherical virus like-particles with diameter
of 25 nm. Virus purification on cesium chloride gradient showed one band at a buoyant
density of 1.362. Extraction of nucleic acid from purified virus particles revealed a ~9 kb
ssRNA linear genome and analysis of capsids showed two major proteins of 31 and 32 kDa
and a minor 78 kDa protein. Infection of third instar nymphs by feeding on cont...

Aly M. Abdel-Salam1 and Samah A. Mokbel2

...transcriptase (RT) polymerase chain reaction (PCR), RT-PCR, using
degenerate primer pair for the coat protein (CP) gene of Ilarvirus amplified products
similar to those produced from peach and apricot isolates of NRSV-infecting stone
fruits. Dot blotting immuno-binding assay (DBIA) showed positive reaction between
NRSV-infected apple sap and an Egyptian antiserum for NRSV. Purified preparation
from in...

Sherif .M. Ibrahim*, Abd El-Razek. B. Abd El-Razek*. Hanan. M. El-Zahed Amal. A. Fatouh* and Ayatollah. I. Ibrahim*

...d pock lesions and polymerase chain reaction amplifying 578bp fragment of P4b gene and 1800 pb of fpv140 for FPV and PPV isolates and vaccine strains. Phylogenetic analysis for the amplified P4p product revealed close similarity of the FPV isolate (FPLH) and fowl pox vaccine (FPVV) with the published sequences for FPV in the Genebank. Unexpectedly, PPV isolates (PPLA, PPLR) and PPV vaccine (PPVV) showed high similarity to the published FPVs-P4b sequence in gen...

Sahar Abd El Rahman1; Mohamed Eladl2 and Mohamed M. El-Diasty3

...erse transcriptase polymerases chain (RT-PCR) reaction was performed directly on buffy coat samples for molecular identification of the virus showed 470 bp clear band in gel electrophoresis. The sensitivity of the utilized techniques in the identification and diagnosis of bovine ephemeral fever disease revealed that the virus isolation is a gold standard technique, as well, the immunofluorescence technique. RT-PCR proved to be a rapid, sensitive and specific t...

Safaa M. Mohammed*, Shahira A. Abdelwahab**,Fetaih,H⃰ ⃰ ,Neveen,R⃰ ,Abdel satar ,A⃰ and Mohamed S. Elshahidy**

...ipitation test and polymerase chain reaction .Two main types of TKPV infection were observed in examined flocks ,cutaneous and diphtheritic forms. Morbidity rate ranged from 5-15%with no mortalities .75% of examined serum reacted positive to TKPV .All TKPV isolates were amplified using specific P4b primers and visualized by gel electrophoresis at 578bp.

...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...erse transcription-polymerase chain reaction (RT-PCR). The nucleotide sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the isolates from Sudan, Iran and the other isolate from Saudi Arabia. The analysis showed that the highest nucle...

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...ere carried out by polymerase chain reaction (PCR) and clinco-pathological investigation. Results: The results showed that 11/30 biopsies were positive by AGPT, 19/30 by IFAT and 30/30 by PCR. While results of sero-diagnosis showed that 45/100 from apparently healthy non vaccinated cattle and 68/100 from vaccinated cattle were positive by SNT respectively and in general 90/200 of tested cattle give protective antibody titer, while 23/200 gave non protective ti...

Lamya A. F. Ateya1, Said A. Ahmed 2, Mansour H. Ayman3, Khamees K. Ashraf 4, Heba A. Abdel-Hady 5

...ere carried out by polymerase chain reaction (PCR). Results: 15 samples were +ve for LSDV by conventional PCR.The results showed that 11/23 biopsies were positive by IFAT. Molecular identification of LSD virus by using RT-PCR, revealed positive for amplification of bands at the predicted molecular size (1926bp). Neutralizing antibodies against LSDV were (55) out of total 100 serum samples by serum neutralization test. Conclusion: Selection and processing of cl...

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

...erse Transcription-Polymerase Chain Reaction (RT-PCR) then subjected for nucleotide and amino acid sequence detection. Results: NDV Giza 2014 isolate and NDV Qualubiya 2014 were characterized as velogenic and lentogenic strains, respectively using Mean Death Time (MDT), Intracerebral Pathogenicity Index (ICPI) and studying amino acid motif of the F protein cleavage site. Phylogeny put NDV Giza 2014 in a separate branch independent from other Egyptian isolates,...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and Mohammed A. Shalaby2

...erse transcriptase polymerase
chain reaction (RT-PCR) and real time RT-PCR in identity test of PPR vaccine.
Methods: Four batches of PPR vaccines that produced in Egypt by Veterinary Serum and Vaccines
Research Institute (VSVRI) were collected and tested for identification of PPRV by conventional RTPCR
using two primer sets targeting F-gene and N-gene and real time RT-PCR.
Results: By F-gene based RT-...
Muhammad G. Khodary1, Ayman H. El-Deeb2, Mohamed M. Emara2, Othman E. Othman1, Hussein A. Hussein2
...erse transcriptase polymerase chain reaction (rRT-PCR) for detection of
FMDV. The highly viral loaded FMDV positive samples were typed by conventional reverse
transcriptase polymerase chain reaction (RT-PCR). Sequencing and phylogenetic analysis of 6
representative samples were performed.
Results: Testing of 80 collected samples of Oropharyngeal, oral epithelial tissue and/or v...

Maha A. El-Abhar1, Moustafa A. Elkady1, Khaled M. Ghanem2, Hussieny A. Bosila3

...s, in addition to the ultrastructural changes produced in potato
leaf cells infected with AMV .
Results: Reaction of thirteen plant species and cultivars belonging to four families (Amaranthaceae,
Solanaceae, Fabaceae and Laminaceae) to AMV infection was demonstrated. The presence or
absence of the virus was verified by back inoculation onto healthy indicator host plant and/or ELISA
test. AMV was read...
Asma Kaouachi1, Mohcen Menaa1*, Abderraouf Chouaib Rebbah2 and Mohamed Cherif Maazi1
...l 2017 within the Souk Ahras region, in North-eastern Algeria. This work was carried out by using a combination of digestive-contents analysis (86 contents) and field observations (during the breeding season). We identified 16 plant species of which four were recorded through on-site observations and 12 species were collected from bird crops. The biomass contained in the alimentary tract showed that fruits dominated the bird diet but the proportion of food ite...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
... by a rickettsial parasite Anaplasma marginale. This study investigated the prevalence of A. marginale in cattle on different commercial farms in subtropical conditions of Khyber Pakhtunkhwa (KP). A total of 120 cattle from different farms were randomly sampled and tested for the presence of A. marginale between May to August 2016. The study revealed that 15.0%, 20.8% and 29.1% of sampled animals wer...

Ayman S. El-Habbaa1 and Mervat E. Radwan2

...erse transcription-polymerase chain
reaction (RT-PCR) and subsequent gel purification of the amplified products of G gene of BEF virus.
Results: BEF virus was circulating in this region. Sequence analysis of G-gene of this Egyptian strain,
comparing with sequences of BEF virus circulating globally and regained from GenBank, showed
100% nucleotide homology with BEF virus from Egypt 2014 but nucleotide and deduced ...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...erse transcription-polymerase chain reaction (RT-PCR) in the sprouts
after dormancy breaking for the harvested potato tubers.
Results: The obtained results demonstrated that, PVM isolate causes severe symptoms on potato plants
under the greenhouse conditions. The infected potato cv. Diamant gave positive DAS-ELISA result
using polyclonal antibodies against PVM. Moreover, the RT-PCR confirmed PVM in tuber sprouts<...
Samira M. Bolis1, Magda Mahmoud2, Salah E. Gumma3, Naser E. Bilal1 and
Isam ElKhidir4
...used the multiplex polymerase chain reaction (PCR) to detect the most
common HPV genotypes associated with FEH in children, beside the Papanicolaou (Pap.) stain to
show the cytological features which are usually seen in FEH. Results were analyzed using Statistical
Package for Social Science (SPSS) version 16. The Chi-Square test tested the significance difference
between the HPV genotypes PCR findings and the Pap...

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

...>
described the ultrastructural changes or other histopathological alterations in basil cells
following infection by AMV.
Methods: Studies were conducted to elucidate the etiology of the disease. The diagnostic tools
used were the transmission electron microscope for rapid diagnosis, host reactions, serological
double-antibody sandwich (DAS)-ELISA, reverse transcription (RT)-PCR and nucleotide
s...

Riham H. Bassam, Hussein A. Hussein, Mohamed M. Amer and Ahmed A. El-Sanousi

...erse transcription polymerase
chain reaction (rt-RT-PCR) for the presence of H9N2 in different types of chickens including broilers,
breeders, laying hens, backyard chickens and ducks. Tracheal swabs were collected from flocks raised
in different governorates in Lebanon.
Results:Testing of samples with rt-RT-PCR revealed that 6 flocks reared in 4 Lebanese governorates
were positive (CT ranged from 20....

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

...template in nested polymerase chain reaction (nested-PCR) using universal primer pairs
P1/P7 and R16F2n/R16R2. Sequencing and phylogenetic analysis were performed to identify the
detected phytoplasmas.
Results: Phytoplasma was transmitted successfully from naturally infected gazania to healthy
ornamental plants by dodder and insect. Transmission electron microscopy (TEM) revealed that,
phytoplasma-lik...

Ahmed M. Soliman

...erse transcription-polymerase chain reaction (RT-PCR) with specific primers designed for the coat protein gene of CMV were used to detect the virus. RT-PCR products (657 bp) of coat protein gene of CMV were cloned and then sequenced.
Results: CMV was isolated from four vegetable crops (cucumber, tomato, pepper and watermelon) using ELISA and RT-PCR assays and the coat protein gene of the four isolates were submitted to GenBank. The CMV isolates sho...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...ach, cherry, apricot and raspberry. Both of sodium azide (NaN3) and ethyl
methanesulfonate (EMS) are known as chemical mutagens.
Objective: Study the effect of chemical mutagens (NaN3and EMS) on the resistance of (ToRSV) on
two different tomato cultivars and characterization induction mutagens by ISSR molecular method.
Methods: ToRSV was isolated from infected tomato, grapevine and pelargonium plants and detected...

Tahsin S. Shoala1, Ahmed K. El-Attar2, Ahmed I. Abd El Maksoud3

...
and cultured in Murashige and Skoog media (MS media). Four weeks later, potato plants were
tested for PLRV using RT-PCR technique, and all of the plants were PLRV positive. MS
media were prepared, autoclaved, and active natural materials (Glycyrrhizic acid ammonium
salt (GAS), Glycyrrhizic Acid (GA), Curcumin (CU) and Rosmarinic Acid (RA) were
sterilized and added to MS media at different concentrations.
Ahmed A. ElWakil1, Ausama A. Yousif2 , Adel A. Fayed3, Ibrahim M. elsabagh2, Mahmoud
El Gamal2, Omnia H. Refaei3
...al
DNA polymerase mRNA and metagenomics analysis using MinIon technology.
Methods: A total of 34 adult female ticks were collected from three LSD clinically disease cattle that
were previously vaccinated using the Egyptian sheep pox (SPPV) vaccine, apparently healthy cattle in
contact with the diseased cattle, and one healthy animal located in a previously infected zone. LSDVspecific
PCR was used to d...
Soad, E. Elsayed 1, Mohammed A. Shalaby2, Ausama A. Yousef2, Abu bakr A. Agor1,
Sherouk E. Aly1
...d through
ultrasonication of Montanide ISA 206 in the presence of Tween 80 as a detergent. The physical
characteristics were studied and imaged by TEM.
Results: Images showed particle size ranged from 200-400 nm instead of 1 micron of the original.
Immunological evaluation by serum neutralization test showed enhanced immunogenicity of
developed formula when compared to the conventional one. Challenge ...
Shourok E. Aly 1, Karim Zaki1, Soad E. Elsayed2, M. Elgamal2, Ausama A. Yousef1, Mohamed A. Shalaby1
...e formulation through ultrasonic dispersion of aluminum
hydroxide adjuvant.
Methods: This was achieved by ultrasonication of aluminum hydroxide gel in the presence of
trehalose as dispersant and measuring different physical characters including particle size, Zeta
potential, loading capacity and imaging of adjuvant before and after formulation.
Results: Ult

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

...erse transcriptase-polymerase chain reaction (RT-PCR),
and the appearance of 678 bp bands confirmed the expected size of such gene. Light and transmission
electron microscopy were used to study the cytological and histological changes that occurred in the
leaves of the sugar beet plant by the pathogen, as well as, to determine some morphometric parameters
such as upper and lower epidermis thickness, midrib thickn...

Md. Abdullah Al Mamun1,2*, Shamima Nasren1,3, Sanjay Singh Rathore1 and Kavalagiriyanahalli Srinivasiah Ramesh1

... of the specimens, the parasites were identified as Argulus japonicus. Moribund fishes were examined and up to 350±50 lice were hand-picked from a single fish. Microscopic examinations of A. japonicus revealed that most of these were at juvenile stages. Infested fish were transferred to the glass aquaria (60 L) and treated with 4 treatments for 15 days: I) Potassium permanganate II) Aquarium salt III) Formalin and IV) Mechanical. The significant lower (...

Pukhtoon Yar1*, Salman Khan2, Du Ying1 and Muhammad Israr3

...the energy sector and infrastructure development will boost the agricultural output, provide job opportunities and poverty eradication. 

...

Shakeel Ahmad1, Muhammad Israr2*, Muhammad Amin3, Muhammad Sadiq Hashmi4, Nafees Ahmad5 and Rasheed Ahmad6

...green forest, savannas, grasslands, permanent wetlands, croplands, natural vegetation, and barren land. The result indicated that grasslands (17.04–12.84%) and cropland (34.73–18.12%) decreased significantly due to over population pressure coupled by natural hazards, while savannas (40.63–49.25%), permanent wetlands (0.03–0.07%), and natural vegetation (3.13–14.96%), were increased significantly...
Bingjie Zhou1, Hitesh Bhagavanbhai Mangukiya1, Siva Bharath Merugu1, Fakhar-un-Nisa Yunus1, Yuchen Fan1, Zhenghua Wu1,* and Dawei Li1,2,*
...e protein disulfide isomerase (PDI) gene family. AGR2 exists in both intracellular and secreted form, it is overexpressed in many types of cancer cells and also detected in extracellular space of solid tumor interstitial fluids. The intracellular AGR2 is critical in protein folding while secreted AGR2 function as a paracrine signal promoting tumor microenvironment formation. Beside cancer progression and drug resistance, the abnormal expression of AGR2 is also...
Aamer Abbas1, Jabbar Khan1*, Mir Abid Hassan2, Asif Qayyum3 and Hamed Shafiq4
...ted to characterize the drastic effects of heavy metals on male infertility, the hormone analysis and genetic determination of SRY gene as some of infertile human had smaller sized testis. Blood and semen samples were collected from clinically diagnosed 130 oligozoospermic males throughout D. I. Khan. The patients included had been married for 3 to 19 years, their wives had normal reproductive capabilities; the couples were living together for more than...
Muhammad Noman Koondhar1, Asghar Ali Kamboh1,*, Muhammad Ammar Khan2, Riaz Ahmed Leghari3 and Parkash Dewani4
...i(12/14), S. Cholerasuis (8/10) and S.Enteritidis(13/15) isolates were exhibited resistance against ampicillin antibiotic. A 78.6% isolates of S. Typhi were recognized as MDR isolates. While, 80% isolates of S. Gallinarum, S. Cholerasuis and S.Enterit...
Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
...ndash;99.8%) and these parasites showed a 99.1%–100% homology to previously reported isolates. The E. canis derived from R. sanguineus in the current study showed a similarity of 98.7%–99.7% to previously published isolates. Our results indicate that precaution should be employed for the potential threat posed by these ticks, especially to pet owners.
...
Nianhong Huang, Yan Wu, Yuanyuan Li* and Jinhong Zhao*
...e the most common haemoparasites infecting snakes. High parasitemia of Hepatozoon can negatively impact snake fitness, growth rate and reproductive output. Given that snakes are a valuable source of traditional Chinese medicinal materials and food consumption, stresses the importance of conducting a study on snakes and its parasites. The present study investigated three kinds of sna...

Javed Anwar Shah1, Azhar Iqbal1, Muhammad Tariq Mahmood2, Muhammad Aslam3, Muneer Abbas4 and Ilyas Ahmad5*

... factor responsible for drastic decline in productivity. Other disease management approaches are not more efficient and economical except to exploit the host plant resistance mechanism. The present study for screening of 60 elite chickpea lines was carried out for two consecutive years during 2017-18 and 2018-19 under controlled environment at pulses research Institute Faisalabad, Pakistan. Favorable conditions for disease incidence were developed by maintaini...
Arbab Zubair Ahmad1, Farman Ullah1, Hayat Badshah2, Muhammad Shehzad Khan1* and Bashir Ahmad1
...realella and enhancing parasitism along with sex ratio of T. chilonis raised on eggs from moths reared on cereals. The response of cereals to S. cerealella in no choice test revealed significantly greater adult emergence (18.9±12.6) and egg laying efficiency (82.2±6.8 eggs/female) with shortest developmental time (27.6±0.6 days) in wheat, while adult emergence (9.62±6.1) was less in maize grains. In choice test, significant effect o...
Kai Jin1,2,3, Chen Chen 1,2,3, Xinyu Sun1,2,3, Caiye Zhu1,2,3, Mahmoud F. Ahmed1,2,3,4, Qisheng Zuo1,2,3, Jiuzhou Song4 and Bichun Li1,2,3*
...) stearoyl-CoA desaturase 1 (SCD1) plays a crucial role in fatty acid metabolism including milk and muscular fatty acid. This study investigated the expression of SCD1 gene in goat and examined its inheritability and expression in transgenic SCD1 mice and goats. Our results suggested the possibility of generating transgenic goats by sperm-mediated gene transfer (SMGT). The expression of SCD1 gene and fatty acid metabolism genes in goat mammar...
Aftab Raza Khan1, Azhar Abbas Khan2*, Javed Iqbal3, Arif Muhammad Khan4, Zeshan Hassan2, Hafiz Muhammad Aatif2 and Umbreen Shahzad2
...of arthropods including grasshoppers, crickets and locusts.
...
Hui Wang1,2, Yuchen Zhao1 and Xinpu Wang1,*
...oduction of the natural grasslands in China. The effects of grassland management on invertebrate diversity and its associated environmental factors were less reported in northern China. The relationship between the activity-density of carabid beetles and environmental factors was conducted under three different grassland management regimes (typical enclosure, enclosed mowing, and farmer gr...
Chaochao Hu1,2, Xue Xu1, Wenjia Yao1, Wei Liu3, Deyun Tai1, Wan Chen4 and Qing Chang1*
...font-size: small;">The Eurasian oystercatcher Haematopus ostralegus is a relatively large migratory wader with an extremely large distribution range.The objective of this study was to determine the complete mitogenome sequence of H. ostralegus, and illustrating mitogenomes structure and investigating their evolutionary relationship by comparing 31 species in Charadriiformes.The complete mitochondrial genome of H. ostralegus is a circular m...
Mengke Wang1, Shucheng Huang2, Cai Zhang1*, Haizhou Gong1
Shunan Cuan1, Shuaishuai Wang1, Qi Shao1, Wenhao Xu1, Sudan Meng1
Pengfei Li1, Yuqin Wang1 and Zijun Yang1
...y of alanine aminotransferase (ALT) (p<0.05), the content of total protein (TP), albumin (ALB) and globulin (GLB) (p<0.05). Furthermore, supplementation of MAG increased the activity of total superoxide dismutase (T-SOD) (p<0.05), slightly increased the activities of total antioxidant capacity (T-AOC) (p>0.05) and catalase (CAT) (p>0.05). And the concentrations of malondialdehyde (MDA) were reduced in MAG groups, yet the differences were not sig...
Arsalan Khan1*, Navid Anjum2, Muhammad Shuaib Khan3, Shakeeb Ullah3
Ali Zaman3, Kamran Safdar3, Khalid Muhammad3, Ambrina Tariq4
Muhammad Inam Malik3, Muhammad Kamal Shah3, Atiq ur Rehman3 
and Hamza Maris3
...estation of tick borne parasitic infections. Conventionally acaricides are used in the treatment of tick infestation in livestock but potentially satisfactory alternative technique is the immunological control against ticks infestation. Therefore, this study was planned to investigate the effect of crude extract of hard ticks and its application as a vaccine against hard ticks of the cattle. For this purpose, ticks were collected from cattle and crude extract ...

 Yanqiang Zhou1, Lixin Wang1, Chunxiao Hao1, Xiuyun Li2, Shakeel Hussain1, Dongdong Shen1, Zhiwei Peng1, Qi`an Zhai1 and Zhijun Hou1,*

...ce of gastrointestinal parasites in blue wildebeest, alpacas, and goats with same husbandry and fence site in Harbin Zoo, China. From August 2015 to August 2016, 507 fecal samples of blue wildebeest (188), alpacas (195) and goats (124) were examined for gastrointestinal parasites by saturated sodium chloride floatation technique. The microscopic analysis, based on the morphology of oocysts, indicates that the present pa

Fahima Khatun1, Abdullah-Al-Maruf2, Md. Mizanur Rahman2, Afroja Yasmin1, Mohammad Ali Zinnah3, Md. Aminul Islam4 and Mohammad Shah Alam5*

...ce of gastrointestinal parasitic diseases in cattle that were sick and brought to veterinary hospitals for treatment. Fecal samples were collected from the rectum and examined by direct smear method and helminths identified by the presence of characteristic eggs in the feces. This study was carried out with three age groups: calves (<1 year), young (1-3 years), and adult (>3 years) and three different consecutive seasons (winter, summer, and rainy) durin...
Ayu Suci Wulandari1, Siwi Indarti1,2*, Muhannad Illayan Massadeh3 and Nguyen Van Minh4
...height: normal;">Plant-parasitic nematodes are one of the most prominent type of pests in garlic (Allium sativum L.). To determine the influence of elevation and soil abiotic factor to abundance and diversity of plant parasitic nematode in garlic crops, this research was conducted Sampling  was carried out in four locations: Brebes, Magelang, Tegal and Temanggung, Central Java, Indonesia. Samples of soil, ro...
Naveed Farah1*, Izhar Ahmad Khan1, Asif Ali Abro2, Jehanzeb Masood Cheema3 and Muhammad Luqman4*
...conversion into urban infrastructures. The present study compares the patterns of land use changes and the resulting livelihood transformation of farmers at urban fringes in two contrasting cities of Punjab province of Pakistan. A mixed method approach was employed for data collection and at first, a longitudinal analysis of Landsat imagery of land use was done through GIS and Remote Sensing for a time period of 2001-2016. T...

Huda Bilal1, Hasnain Raza2*, Kaynat Ahmed2, Iqra Tariq2, Qurat-ul-Ain2, Sana Sarfaraz1, Sanaullah1, Maryam Maqsood3 and Ali Raza3

...oral reefs, and fishes) drastically.

...

Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4

...r quality characters in Brassica carinata L. A total of 22 genotypes comprised of six parental lines and their 16 bulked F2 populations were evaluated in a randomized complete block design with three replications at The University of Agriculture Peshawar during 2013-14. Data were recorded on oil content, protein content, oleic acid, glucosinolates, erucic acid, and linolenic acid. Significant genetic differences were observed for all the traits studied. Among ...

Amir Muhammad Khan1, Laila Fayyaz2*, Raziuddin2, Sajid Ali1, Israr-ud-Din1, Sheraz Ahmad2, Haidar Ali1 and Ijaz Ahmad2

...="text-align: justify;">Brassica napus L. is one of the essential oilseed crops playing a significant role in commercial edible oil production. To determine diversity within this specie, ten different genotypes of B. napus L. including Chinese (CA-2, CA-4, CA-5) and doubled haploid lines from a population were field-tested at the University of Agriculture, Peshawar (UAP). Genotypes were examined for seven morphological traits including days to flowering, prima...
Mona Mohammed EL-Derbawy1, Eman Naser Hafez2*, 
Mona Abdel Daym Abd Rabbo1, Nagwa Ibrahim Toaleb3,
 Saedia Abdel Hady Sayed El-Ahl1 and Bahaa Eldkeen Wade EL-Aswad4 
...and negative for other parasitic infections; Group ІІ included 18 sera from patients who were negative for schistosomiasis and positive for other parasitic infections; (3) fascioliasis, (5) amoebiasis, (7) toxoplasmosis and (3) hydatidosis and Group ІІІ included (13) sera from healthy individuals all were diagnosed parasitologically and serologically. Although both antigens achieved 1...
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
...meria tenella is a parasitic disease affecting chickens. In Pakistan, there has been no previously published report on phylogenetic analysis of Eimeria tenella. In this retrospective study, tissue samples were collected from a flock of clinically infected chicken followed by haematology, serum biochemistry, and histopathology. Species specific PCR based on polymorphic site of the ITS1 gene was developed and used to identify the organism. Haem...
Meiping Deng1, Xiaowen Ye1, Jiashan Wu1, Lijuan Chen1, Xiaoxia Jiang1, Changzheng Zhang1, Peiling Zhou1* and Yi Luo2*
...nomimetic effects with parasympathetic features. This study was aimed to determine the role of arecoline on systemic blood pressure (BP) modulation and the modulatory characteristics. After rats were anaesthetized, saline or arecoline was intravenously administrated, and the systemic BP signals were recorded. We calculated the reaction times, the mean arterial pressure (MAP), the maximum changes in MAP, and the area under the curve (AUC; MAP change relative to...
Li Qiao1,2, Quan Zhang1, Shubao Geng1,2, Fangmei Zhang1,2, Junhua Chen1,2 and Shibao Guo1,2,*
...%, 41.88% and 35.11% contrast to the control. The average oviposition rate reduced 16.61%, 11.44%, 11.81% and 8.86% respectively with the supply of four wave lengths at night. Meanwhile, the pre-oviposition period and oviposition period were affected by the four illumination deals of wave lengths. The longevity of male and female adult was decreased, and the male adult was longer than that of female adult under each treatment of E. grisescens Warren. Th...
Liyun Chang1, Yingbin Chen1, Qian Kang1, JianhuaQin1,* and Zhiyong Liu2,*
...m (C. parvum) is a parasitic protozoan that causes cryptosporidiosis in mammalian intestinal tract. In this study, C. parvum infection model was established in Balb/c mice, followed by extraction of total RNA from small intestine of infected mice at 1, 3, 7 and 14 dpi, respectively. The relative expression of IFN-γ, TNF-α, IL-2, IL-4 and IL-6 in the small intestine of Balb/cmice infected with C. parvum, were then detected using Ct...
Azhar Abbas Khan*, Humaira Kanwal, Sumair Batool, Zeshan Hassan, Jawad Munawar Shah, Hafiz Muhammad Aatif, Ahmad Nawaz, Hasan Taha and Yasir Ishfaq
...inst Thrips tabaci, Amrasca biguttula and their impact on bio-control agents in Bt cotton. More reduction in T. tabaci was observed with Radiant® and Talstar® forboth years at the first application as compared to other treatments through 9 days after treatment. The second application of treatments also showed minimal differences from first application and again plots treated with Radiant® showed...
Dilek Şahin1*, Meryem ÖZ2, Orhan Aral2, Mehmet Bahtiyar2 and Selda Taşçi2
...tation of goldfish (Carassius auratus L, 1758). The study was carried out with 4 experimental groups of which composed of control (0%, T0) and different amount of purslane plant extracts (3%, T3; 6%, T6; 9%, T9) and each group had 3 replicates. The fish with an average live weight of 2.55±0.08 g were selected randomly from a fish stock of 250 fish and were 13 fish were placed in each aquarium (15 L). The growth, survival and coloring parameters w...

Mukhtar Iderawumi Abdulraheem1*, Muhammad Ihtisham2*, Abiodun Yusuff Moshood3, Nawab Khan4, Muhammad Owais Shahid5, Shafiq Hussain6, Kumail Abbas6 and Fawad Zaman7

... i.e., no mulching, dry grasses mulching, and polythene mulching. The findings revealed that all of the okra plants tested were susceptible to virus infections regardless of treatment. Those who had a treatment combination of three weedings and polythene mulching, on the other hand, had the lowest incidence and severity of viral infection, while those who received no weeding and no mulching had the highest. At the 7th week after planting, the treatment combina...

Usman Asghar1*, Muhammad Faheem Malik1, Umer Rashid2, Naeem Mahmood Ashraf2, Sumera Afsheen1 and Muhammad Hashim1

...s was designed for Polymerase Chain Reaction (PCR) of the cytochrome b gene fragment. All PCR was accomplished at the same reaction conditions. Amplified products had a length of 400 bp, which was our estimated length. After the sequencing of these amplicons, In silico restriction analysis was performed for each specie. Restriction endonuclease TfiI was selected for further analysis. Restriction fragment length polymorphism (RFLP) was performed at the same rea...

Raheela Noor Memon1*, Nadir Ali Birmani1, Naeem Tariq Narejo2 and Shahnaz Rashid3

...prevalence of helminth parasites in Cyprinuscarpioat Chilya, Fish Hatchery, Thatta, Sindh from February 2019 to January 2020. A total of 107 samples of Cyprinuscarpio were tested during the research and helminths were found in 17 out of 107. Various helminths groups were identified including trematode and acanthocephalan. Other helminths groups, such as cestodes and nematodes were not noted. These helminths infected the gut of Cyprinuscarpio including trematod...

Tajnees Pirzada1*, Weenghar Ali Chandio1, Mansoor Ali Kalhoro2, Mir Munsif Ali Talpur1, Waheed Ali Mirbahar1, Abdul Ghafar Solangi1, Zulfiquar Ali Jumani1 and Rehana Kerio1

...t in earliest stages contrasted with clinical and mechanical areas. The effect of, zinc oxide nanoparticles and humic acid (HA) coated nanoparticles were evaluated for Brassica campestris seed germination. A simple one-pot method was used to synthesize HA/ZnO NPs involving zinc oxide nanoparticles (ZnO) core (20-35 nm in diameter) and humic acid shell. HA/ZnO NPs were used to investigate the effect on the germination profile...

Ilker Kepenekci1, F. Dolunay Erdoğuş2 and Adnan Tülek3*

... in the economy. Plant parasitic nematodes (PPN) are serious pests of several plants worldwide including straw berry. So far, no record of any plant parasitic nematode (PPN) exists detailing the species found in strawberry growing areas of Kyrgyzstan. This research aimed to provide a faunistic and taxonomic record of PPNs from soil and plant samples collected from strawberry orchards in 10 different locations in Tokmok area ...

Mahmoud M.A.Youssef and Wafaa M. A. El-Nagdi

... for controlling plant-parasitic nematodes. Higher soil temperatures with transparent or black plastic cover reduced citrus nematode, Tylenchulus semipenetrans on navel orange and reniform nematode, Rotylenchulus reniformis on sunflower. Also, dry heat was used to control rice root nematode, Hirschmanniella oryzae on rice soil and root and wheat soil. Several investigators reported that number of galls and egg-masses of root-knot nematode, Meloidogyne incognit...

Christopher Oche Eche1*, Juliana Iye Oluwatayo1, Demben Moses Esang2, Paul Madina2 and Alexander Uloko1

...he population of plant-parasitic nematodes by 21.6%, and 37.8%, respectively. Although yields obtained from plots treated with the two rates of mixed formulation were 0.51 t/ha and 0.49 t/ha, the observed difference was not statistically significant but was higher than yields obtained when either eucalyptus biochar or sawdust was applied singly. The study showed evidence of nematode population control and yield improvement when mixed formulations of sawdust-eu...

Yonis Abukar Mohamed1, Shafii Abdullahi Mohamed1,2, Abdiaziz Idiris Mohamud1,3*, Abdiaziz Ahmed Mohamud1,3, Kassim Abdullahi Jimale1,2 and Said Ali Ibrahim2

...bronemiasis 59.1%, ectoparasite 35.7%, Sarcoid 5.1%. Results that were obtained from the indirect assessment of donkeys’ welfare indicated that most donkey owners in the region have little or no knowledge and information on donkey’s welfare matters. Limitation of taking sick donkeys to veterinary clinics 2.0% abandon of donkeys after stopped working 96.6%, lack trimming hooves of donkeys 78.9%, and beating of donkeys 79.7%. Donkeys are beneficial t...
Manar M. Farouk1*, Amal El-Molla1, Fayez A. Salib1 and Yousef A. Soliman2
...was detected using polymerase chain reaction assay (PCR), and the PCR amplicons of nine randomly selected strains were purified, sequenced and deposited in the GenBank. The obtained data about disease occurrence were statistically analyzed using Chi-square test in order to identify disease-associated factors. The overall prevalence of salmonellosis among diarrheic sheep and goats was 3.86%, and the disease prevalence per each flock ranged from 0% to 7.55%. The...
Wei Luo 1,2,3, Yongtao Jin 1,2,3, Xuqing Li 1,2,3 and Ke Liu 1,2,3*
...provided by the General grassland station of Qinghai province, the difference percentage of Tibetan sheep, yak, and horse is 7.5%, 8.1%, and 18.7%, respectively.
...
Shoaib ur Rehman1, Jabbar Khan2*, Raaza Malja Khan3, Maimoona Azam4 and Zeeshan Mutahir5
...ry mutation system-polymerase chain reaction (ARMS-PCR) technique, all samples were analyzed for the most common β-thalassemia mutations reported in Pakistani population. The most common mutations detected in karak region were frameshift codons (FSC) 8/9 (þG) (HBB: c.27_28insG), followed by IVS-I-5(G>C), FSC 5 (–CT) and Codon 15 (G>A). The present study hence showed differences with previous results from other regions of the Pashtun ethn...

Oluwatoyin Adenike Fabiyi

...e infestation by plant parasitic nematodes most notably, the cyst nematode Heterodera sacchari. Broadly, synthetic nematicides are utilized in the suppression of soil nematode infestation of sugarcane, with positive outcome in yield. However, emergence of resistant nematode strains and health hazards are associated with the ceaseless use of the synthetics. The efficacy of furfural (2-furanaldehyde) from agricultural biomass waste was examined as a practicable ...
Monif AlRashidi1*, Sami Saeed M. Hassan2 and Mohammed Shobrak3
...nesting attempt of the Eurasian Spoonbill (Platalea leucorodia) in Al-Fanateer Island, located about 1.5 km east of Jubail Industrial City, Eastern Province, Saudi Arabia. A trail camera was used to record and describe the nest attendance behavior of this species over 24 h. The results showed that the egg was incubated more than 80% in each two-hour period except for the periods (00:00 - 01:59 h; 02:00 - 03:59 h and 20:00 - 21:59 h) when it was incubate...
Hailong Dong1, Fubin Gan2, Khalid Mehmood3, Jiang-Yong Zeng4, Rao Zahid Abbas5, Mushtaq Ahmad Gondal6, Zhenyu Chang1 and Qingxia Wu1*
...rne zoonotic trematode parasitic disease infection worldwide. However, yak’s fascioliasis is rarely reported on Tibetan Plateau. In this study, serological survey and associated risk factors of Fasciola hepatica (F. hepatica) infection in Tibetan yaks was investigated using an ELISA assay. The results showed that the 305/849 (35.92%) studied animals were sero-positive for F. hepatica with the further distribution of 24...
Shabana Naz1*, Nishat Ali Khan1, Arnab Tanweer1, Shifa Moazzam1, Qudrat Ullah2, Farkhanda Asad1, Irfan Khattak3, Sajida Batool4 and Rifat Ullah Khan5
...ainst gastrointestinal parasites. For this purpose, the fecal samples were collected from 30 peafowl. Sampling was done thrice from same birds i.e., once before treatment and twice after treatment with Albendazole and Levamisole. The efficacy of Albendazole and the Levamisole against parasites was calculated. The fecal samples were examined by using flotation and modified Macmaster’s egg counting technique. The result...
Junli Liu1, Tongfang Yang2 and Lisheng Wu3*
...titative real-time polymerase chain reaction (qRT-PCR) to assay LINC00857 and miR-340 expression. Bioinformatics and dual luciferase reports analyzed the targeting relationship between LINC00857 and miR-340. Cells were transfected with pcDNA3.1-LINC00857 or anti-miR-340, and treated with homoharringtonine to observe their effects on U2OS protein expression, survival, clone formation and apoptosis. We found that different con...
Iqra Mobeen1*, Rabia Arif1*,Maimoona Ilyas1, Siu Fai Lee2 and Muhammad Saleem1
...al N-lysine methyltransferase1 (RKM1) and Ribosomal N-lysine methyltransferase4 (RKM4) in Sordaria fimicola using SNP markers. A total seven SNPs in the RKM1 gene and nine in RKM4 gene were identified. A subset of SNPs were unique in SFS strains and others were fixed in the NFS strains of S. fimicola. These polymorphisms might be adaptive in stressful environmental conditions. Genoty...

Mohammed Naji Ahmed Odhah1,2*, Dhary Alewy Almashhadany6, Abdullah Garallah Otaifah7, Bashiru Garba5, Najeeb Mohammed Salah2, Faez Firdaus Abdullah Jesse4*, Mohd Azam Khan G.K3 

...tant emerging zoonotic parasitic diseases worldwide. This disease causes considerable economic losses and adverse public health challenges in most countries, including the Middle East countries. This study was designed to investigate the current prevalence of hydatidosis and to determine the fertility of hydatid cysts among some ruminants (both local and imported breeds of cattle, sheep, and goats) slaughtered in the abattoirs in Dhamar Province-Yemen. The sam...
Abdullah Abdo Albegali1, Tayyaba Aftab1, Atiq-ur-Rehman1*, Amir Rashid1 and Mayada Mohammad1,2
...in, asparate aminotransferase and alkaline aminotransferase. The plant maintains the level of HDL to a normal range. It is concluded from the study that the plant may be supportive treatment in combating hyperlipidaemias.
...

M. Hanafy1, Rehab Elhelw2, Soliman M. Soliman3, Sherif Marouf2* 

...d genotypically by polymerase chain reaction (PCR). At the level of biochemical characterization, the incidence of Pasteurella multocida was 40.4%, and Mannheimia haemolytica was 7.1%. Using KMT1 gene for identification of the isolates for P. multocida and SSE gene for identification of the isolates for M. haemolytica, the results revealed that six isolates showing positive PCR for Pasteurella multocida and were subject to further phylogenic characterization. ...

Dewi Ratih Ayu Daning1,2, L.M. Yusiati1, C. Hanim1, B.P. Widyobroto1*

...and 120 µL. In contrast, protozoa significantly decrease (P<0.05) across all treatments. Furthermore, 30 and 60 µL of galangal EO and cineole does not affect (P>0.05) microbial protein but 120 µL dose of galangal EO significantly decrease the microbial protein. At the genus level, galangal EO increases the abundance of Succinivibrio when added cineole showed a higher relative abundance than the controls. Methane production is ...

Muhammad Rizwan1*, Jehanzeb Farooq1, Amjad Farooq1, Muhammad Farooq1,2, Ghulam Sarwar1, Muhammad Nadeem1, Muhammad Riaz4, Muhammad Rafique Shahid3, Hafiz Ghazanfar Abbas1 and Muhammad Kashif Shahzad Sarwar1

...ted by plant height whereras maximum negative factor loadings were showed by GOT % and seed index. PCA also confirmed the results of correlation studies by presenting significant positive association among leaf chlorophyll contents, seed cotton yield, No. of sympodia, seed index and boll weight. These results will be helpful in further breeding strategies for selection of genotypes with respect to chlorophyll contents, yield and associated traits.

...

Mohammed Sirajul Islam1,2*, Nurhusien Yimer1*, Wahid Haron1 , Faez Firdaus Abdullah Jesse1, Mark Hiew Wen Han1, Mamat-Hamidi Kamalludin3, Wan-Nor Fitri1, Ubedullah Kaka4, Abdul Quddus1,5 

...nd quantity Guinea grasses and palm kernel cakes. Body weight was measured at monthly basis by using a digital animal weighing scale. Age at sexual maturity was determined by the time of semen ejaculation and quality. The results revealed significantly (p<0.05) greater body weight in KK × Brangus bulls (230.50±9.3 kg) as compared to the pure-bred KK bulls (204.5 ±13.2 kg) a...

Li Wei, Wei-wei Shao and Zhi-hua Lin*

...charis tadpoles did not drastically differ under treatment with all four individual pesticides. In contrast, the survival rates of M. fissipes showed significant differences under treatment with three of the four pesticides (except for pymetrozine). Our results suggested that individual pesticides and their combinations exerted different effects on organisms and implied the existence of pesticide- and species-specific toxici...

Shireen S. Aboelwafa¹, Alsagher O. Ali², Rania Hamada³, Hassan Y.A.H. Mahmoud2* 

...ntracellular protozoan parasites that are distributed worldwide and of major economic importance in the livestock industry especially sheep and goats. Sheep and goats are thought to be biological indicators of environmental contamination with T. gondii and N. caninum oocysts. In addition, in developing countries such as Egypt, where sheep and goat meat is commonly consumed, T. gondii and N. caninum infection in small ruminants may also affect public health ris...

Muneeb M. Musthafa1,* and Fauziah Abdullah1,2,3

...the beetle diversity at Fraser’s hill, Gunung Besar Hantu and Gunung Angsi at lower altitudinal (500 m) cline was selected for sampling, where light, malaise and pitfall traps were utilized during 2013-2014 season. Altogether from these three sampling sites 1,575 beetle samples were collected and they went through with some diversity analysis. The Margalef index for Gunung Besar Hantu, Fraser’s Hill and Gunung An...

Sadaf Shahid1, Abdul Razzaq2, Gul-Makai1, Asim Shamim3*, Hafiz Muhammad Rizwan4, Rana Hamid Ali Nisar5, Qaiser Akram6, Mohsin Nawaz3 

...quo;s communities. Ectoparasites are one of the greatest dangers to livestock and among ectoparasites, ticks are the most common one. The current study was completed in district Quetta, Balochistan, Pakistan to determine the tick infestation in different breeds of goat and sheep. A total of 840 animals were investigated during the winter and summer seasons to determine ticks prevalence. The overall prevalence of tick infesta...

Sameh Abdel-Moez Ahmed Amer1*, Mohamed Abdel-Aziz Kutkat1, Mohamed Mahmoud Abdel-Baki1, Asmaa Mahmoud Maatouq1, Omnia Mohamed Kutkat2, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1 

...erse transcription polymerase chain reaction (RT-PCR) using specific primers to amplify 1681 base pair (bp) of the whole NDV F-gene was carried out to confirm the presence of NDV and then sequenced. Our results demonstrated that, RT-PCR was successfully detecting 62 NDV samples. While, Sequencing and phylogenesis of six selected isolates revealed that, all isolates were virulent NDV with amino acid motive 112RRQKRF117 at F protein cleavage site. Furthermore, a...

Yuan Zhang1, Qingyue Han1, Peiquan Du1, Yi Lu1, Lianmei Hu1, Sadaqat Ali2, Khalid Mehmood2, Sajid Hameed2, Zhaoxin Tang1, Hui Zhang1* and Ying Li1*

 

...ffusion of the dog; B-ultrasound showed nodular lesions in the spleen and enlarged lymph nodes in the abdominal cavity. Subsequent cytological examination of smear made from lymph node FNA and peritoneal fluid revealed a large number of lymphoblasts. The above symptoms could be combined to make a preliminary diagnosis of lymphoma in dogs. To further determine the type of lymphoma, the H and E, and immunohistochemistry were done. The immunohistochemical test ex...

Yuan Zhang1, Qingyue Han1, Peiquan Du1, Yi Lu1, Lianmei Hu1, Sadaqat Ali2, Khalid Mehmood2, Sajid Hameed2, Zhaoxin Tang1, Hui Zhang1* and Ying Li1*

 

...ffusion of the dog; B-ultrasound showed nodular lesions in the spleen and enlarged lymph nodes in the abdominal cavity. Subsequent cytological examination of smear made from lymph node FNA and peritoneal fluid revealed a large number of lymphoblasts. The above symptoms could be combined to make a preliminary diagnosis of lymphoma in dogs. To further determine the type of lymphoma, the H and E, and immunohistochemistry were done. The immunohistochemical test ex...

Neven Waheeb1*, Sherif Marouf2, Essam Nasr3, Shaymaa Abdelmalek2 

... assay (ELISA) and polymerase chain reaction (PCR) in the diagnosis of infection with H. Pylori in human stool and fasces of dogs and cats. Two hundred stool samples from humans and eighty-eight fecal samples from dogs and cats were collected with gastric disorders. The presence of H. Pylori infection in stool and fecal samples were tested by ELISA and PCR methods. In ELISA the test utilizes H. pylori antibodies to selectively detect H. pylori Antigen in human...

Saeed Ahmed Essote1, Asim Iqbal1, Muhammad Kamran Taj2*, Asmatullah Kakar1, Imran Taj2, Shahab-ud-Din Kakar1 and Imran Ali 3,4*

...stocophis (2.4%), Psudocerastes (2.9%) and Vipera (3.5%). The Typhlopidae (Ramphotyplops 5.8%, Typlops 4.6%) and Elapidae (Bungarus 6.3%, Naja 5.3%) families were represented with two genera each. While Boidae (Eryx 4.48%) and Leptotyphlopidae (Leptotyplos 7.5%) families had only one genus each. The highest diversity was recorded in Sibi Division and the lowest diversity in Kalat Division. Seven snake species, Eryx tetaricus, Typhlops ductuliformes, Bungarus s...

Grace Chinenye Onyishi, Chinedu Ifeanyi Atama*, Fejiokwu Esther Chioma, Ifeanyi O Aguzie, Godwin I Ngwu and Christopher Didigwu Nwani

...ical studies of donkey parasites in the world in general and in Nigeria in particular are fragmentary and not readily available. Given this paucity of information, the present work is aimed at investigating gut parasites of donkeys and horses of Udenu Local Government Area (LGA), Enugu state, Nigeria. Standard procedure of parasite search in vertebrates was used. A total of 23 donkeys and ...

Syukriah Syukriah1, Ulinnuha Nur Faizah2, Hendry T.S. Saragih3*, Rizki Fitrawan Yuneldi4, Soenarwan Hery Poerwanto5, Raden Roro Upiek Ngesti Wibawaning Astuti5, Stephan Immenschuh6 

...of post-treatment, the parasite level was calculated. Malondialdehyde (MDA) levels of mother’s and offspring’s liver and spleen were observed by using the TBARS Assay Kit, also the superoxide dismutase activities. As supporting data the histological analysis of the mother’s and offspring’s liver and spleen were prepared by using the paraffin method. There were sigificant results in the parasites level...

Fulencio Ferretiz-Rodríguez1, Jose Alejandro Roque-Jiménez1, Héctor A. Lee-Rangel1*, Gregorio Alvarez-Fuentes1, Juan Carlos Garcia-Lopez1, Rolando Rojo-Rubio2 

...tation. Aspartate transferase activity decrease (P ≤ 0.05) with BIO supplementation. Results indicate that the herbal BIO and OP present some productive and metabolic changes.

Keywords | Dairy cows, Choline, Methionine, Herbal formulas, Phytogenic sources 

...

Martha Echioda Ogbole*, James Agbo Ameh, Samuel Mailafia, Olatunde Hamza Olabode and Bridget Jessica Adah

... LV- transcription polymerase chain reaction (LASV-RT- PCR). The number of suspected and confirmed cases as well as total deaths and case fatality rates in the years under review were collated. Out of the total number of 17,777 suspected cases, 2959 cases were confirmed positive for LF by a laboratory test, while 781 deaths were recorded. Annual distribution of LF showed significant increase in number of cases with 152 (9.6%) confirmed cases recorded in 2016, ...

Oce Astuti1, La Sara2*, Muzuni3 and Safilu4

... mouth (station B), sea grass (station C), and water depth of > 30 m (station D) using collapsible crab pots and gillnets were recorded, identified its species, sexed, counted its number, and analyzed its spatial and temporal CC and SR. The Chi-square test (α = 0.05) was used to test significant differences of expected 1: 1 SR. It was 12 DC species had been identified which BSCs were found at the entire stations and all years round. It had high CC at ...

Yongjie Xue1, Jinling Yan1, Huifeng Zhao1*, Haijing Zheng2 and Changhai Ma1

...n and beef trade. In contrast to previous studies, we put beef and soybean imports into the same model and studied them simultaneously, which is more in line with actual industrial development. Based on the Error Correction Model (ECM) and Vector Autoregression Model (VAR), we found that: (1) soybean and beef import is impacting the domestic beef price in both the long- and short-term, but the short-term effects can be corrected to coincide with the long-term ...

Fujun Miao1, Chunlan Shan2, Wei Yang3, Hao Wang3, Shuxiang Geng1 and Delu Ning1*

...erum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the ethanol + walnut oil (ETH + WO) and ETH + silymarin positive group (PC) groups significantly decreased, and the lesions of ethanol-induced liver injury were relieved compared with the ethanol (ETH) group. Walnut oil significantly increased the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) in the liver of ALD. Walnut...
Damat Damat1*, Roy Hendroko Setyobudi2, Juris Burlakovs3, Zane Vincēviča-Gaile4
Devi Dwi Siskawardani1, Rista Anggriani1 and Anas Tain5
...ger, turmeric, and lemongrass) were applied, and a Randomized Block Design with three replications was used. Subsequently, observation variables included analysis of water content, ash, carbohydrate, protein, fat, antioxidant activity, fiber content, water absorption index, color intensity, and sensory evaluation. The data were analyzed by ANOVA and continued according to Duncan’s multiple range test. The results showed that all formulas of analog rice p...

Saima Parveen1, Altaf Mahmood2*, Ayesha Azad3, Sajid Umar4, Nosheen Shoukat6, Mirza Muhammad Arsalan Azam5, Qurat-Ul-Ain5 and Nausheen Akhtar Malik1

...wed by viral (40.32%), parasitic (5.80%) and fungal (5.20%) diseases. This epidemiological data represents true picture of study population and is a valuable tool for planning of prevention strategy and research priorities.
...

Noor Muhammad* and Shah Alam Khan

...lign: justify;">Canola (Brassica napus L.) is one of the economically important crops of Pakistan and mustard aphid, Lipaphis erysimi Kalt. (Hemiptera: Aphididae), is a serious threat to this crop. This experiment was conducted with an aim to screen out selected canola cultivars for their tolerance against L. erysimi infestation under glass-house conditions. Experiment was carried out using completely randomized design with ten replications for each treatment ...

Maid Zaman1*, Imtiaz Ali Khan1, Amjad Usman1 and Ahmad-Ur-Rahman Saljoqi2

...st attacked followed by grasses and acacia while in district Swabi most attacks were noted on maize, Pinus and wood. In habitat study, almost similar number of percent attack for forest in Haripur (46.15%) and Buner (47.92%) was noted with lower number of attacks in Swabi (34.21%). In structural study, 35.42%; 34.21% and 30.77% of structures were attacked in Buner, Swabi and Haripur respectively. It is pertinent to mention that agriculture fields in district S...
Muhammad Faisal Riaz1, Abu Bakar Muhammad Raza1*, Muhammad Zeeshan Majeed1 and Talha Nazir2
...t Sargodha. Brevicoryne brassicae was recorded as the most abundant species with 8,470 (16.6%) specimens, followed by Myzus persicae with 6,655 (13%) and Aphis gossypii with 5,348 (10.5%) specimens. While, Sitobion rosaeformis with 276 (0.5%) and Aphis nerii with 210 (0.4%) specimens were recorded as the least abundant species. Maximum aphid diversity was recorded on cereal and oilseed crops, while minimum was observed on loquat and citrus plantations. Moreove...

Mohammed H. Galhoum1, Hamza M. Eed2, Essam S. Soliman1* 

...ular means (cyclic polymerase chain reaction; cPCR) targeting the invA gene. The isolated Salmonella culture revealed higher resistance incidence up to 100% against amoxicillin-clavulanic acid (AMC; 30 μg), ampicillin (AMP; 10 μg), and nalidixic acid (NAL; 30 μg), 90% against enrofloxacin (ENR; 5 μg), and 80% against doxycycline HCL (DO; 30 μg). The conventional culture method revealed up to 83% sensitivity and 90% specificity while the molecula...

A.H. Alqhtani1, A.S. Alharthi1, N.J. Siddiqi2, S. Zargar2 and A.M. Abudabos1*

...), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) increased after feeding on growth promoters. However, total serum protein, gamma glutamyl transferase (GGT) and alkaline phosphatase (ALP) showed no significant differences between the groups. Thus, it can be concluded that probiotic, prebiotic and symbiotic in feed may cause some degree of liver damage as indicated by ...

Kanakuntla Sandhyarani*, Dhoppalapudi Madhuri, Yadala Ravikumar 

...), aspartate aminotransferase (AST), alkaline phosphatases (ALP), serum total proteins, serum albumin and glutathione stimulating hormone (GSH). Grossly, chalky white deposits of urate crystals on the serosal surface of pericardium, liver, intestines, air sacs, kidneys and ureters. Microscopically, tissue sections show urate crystal deposition in parenchyma of the organs along with infiltration of inflammatory cells. Incorporation of low protein diets, jaggery...

Naima Din1, Misbah Ashraf1, Muhammad Rizwan2*, Muhammad Babar Shahzad Afzal4, Hafiz Ghazanfar Abbas2, Farrukh Ilahi2, Amir Hameed5, Muhammad Ahsin Ayub6, Qurban Ali1 and Muhammad Farooq2,3

...for resistance against Amrasca devastans (Dist.) at the farm area of Vegetable Research Institute, Ayub Agricultural Research Institute (AARI), Faisalabad in 2018-19. Observations regarding the population of A. devastans were recorded from 20 leaves per treatment at random (upper, lower, middle leaves), Physio-morphic characters viz., plant height, number of branches, area of leaf lamina, hair density on midrib, chlorophyll contents and moisture percentage wer...

Hong Liu and Rui Xu*

...concluded that 3D-CPA ultrasonography could be used to quantitatively analyze fetal kidneys with gestational hypertension in pregnancy, providing a quantitative basis for prenatal diagnosis of fetal renal blood perfusion in patients with gestational hypertension. It could also be used to detect risk pregnancy in early pregnancy.

...

Qaisra Siddique1*, Sajid Abdullah1, Huma Naz2, Khalid Abbas1, Laiba Shafique1 and Qingyou Liu3

... as glutathione S-transferase (GST) activity and total protein contents in various tissues (gills, hepatic, renal, brain, muscle and cardiac) of Labeo rohita was determined. Fish was exposed for 60-day and sampling was done after 7-day. Results showed that the GST activity was considerably increased in L. rohita as compared to control. The GST activity was enhanced in various tissues (hepatic, brain, cardiac, gills, renal and muscle) of CPF treated fish as com...

Shahid Sherzada1,2*, Muhammad Naeem Khan1 and Masroor Ellahi Babar2

...espectively. The mean intraspecific and intragenric K2P genetic distances were 0.2% and 1.2%, respectively. Rate of transitional and transversional substitution was 16.68% and 4.16%, respectively. The transition/transversion bias value R was 1.25. The negative values of Tajima D test as well as Fu and Li D and F tests supported the process of population expansion with excess of rare alleles. The overall results showed a lack of neutral evolution and low geneti...

Chandrakala Rana1*, Deepak Subedi1*, Shanti Kunwar1, Rajesh Neupane1, Birendra Shrestha2, Khan Sharun3, Dinesh Kumar Singh4 and Krishna Kaphle2

...ence. Radiography and ultrasonography revealed the presence of calculus in the urinary bladder. Cystolithotomy was performed and the dog responded to the intervention and recovered uneventfully.

...

Mohamed Saeed M. Hassan¹, Hitham Abdel-Saeed1*, Kawkab Abd El Aziz Ahmed2, Ossama Mohamed Abdou1 

...f diseased cases), ectoparasitic infestation (sub-group 2): 18 cases (32%), malnutrition (sub-group 3): 7 cases (12%) and hepatic or renal diseases (sub-group 4): 10 cases (18%). The most recorded clinical manifestations in diseased dogs were pale mucous membranes, tachycardia, tachypnea and low performance. Haematological parameters included haemoglobin (Hb), total erythrocytic count (TEC) and haematocrit (HCT) revealed significant (P≤0.001) decrease in al...

Heba El-Zahar*, Zeinab Abd El-Rahman, Abbas El-Naggar 

...nical, laboratory and ultrasonographic examination 21 IBD dogs with symptoms of chronic gastrointestinal diseases were chosen for the study. In addition to 11 healthy dogs served as control group. In comparison to controls, hematological analysis revealed significant variations (p<0.05) in total leukocyte count, hemoglobin, and mean platelet volume and significant variation (p<0.01) in neutrophils and platelet count. The biochemical analysis revealed a s...

Arman Sayuti1, Hamdan Hamdan2, Miftahul Jannah3, Safriadi Safriadi3, Teuku Nasri3, Tongku Nizwan Siregar2*

...ncy examination using ultrasound was carried out on the 19th day after rabbits were mated. The average concentration of estrogen on day 0, progesterone concentration on day 7 and 14 of K1 vs K2 gropus were 116.17±10.84 vs 118.46±39.69 pg/mL, 3.72±1.04 vs 10.00±5.30 ng/mL, and 1.01±0.65 vs 11.95±5.38 ng/mL, respectively (P>0.05). Additionaly, the average number of fetuses of K1 and K2 rabbits were 5.20±1,095 a...
Aly M. Ghetas1*, Dalia M. Sedeek1, Hanaa S. Fedawy1, M.A. Bosila1, Asmaa M. Maatouq1, Hoda M. Mekky1, Kh. M. Elbayoumi1,2, Mohamed M. Amer3
...erse transcription polymerase chain reaction (RT-PCR) technique and gene sequencing of partial portion of VP2 gene. The two isolates (Genbank accession numbers MW925051 and MW9250522) were characterized as very virulent IBDV (vvIBDV). The obtained nucleotide sequences of partial portion of VP2 gene of 2 isolates revealed 97.0 - 100% and 91.2-92.5% identity with the Egyptian strains and vaccine strains respectively. Finally, significant genetic changes in our ...
Ilvir Khabibullin1*, Ruzel Khabibullin1, Irina Mironova1, Lyalya Musina2, Elmira Akhmadullina1, Victoria Morozova1 
...hamsters consuming lemongrass tincture showed the maximum efficiency, exceeding the control by 21.3 minutes (P≤0.001), animals receiving drone brood overran by 0.5 minutes (Р≤0.01). Heart muscle of animals fed with pantocrine and lemongrass seed tincture at physical load had fewer dystrophic changes in muscle cells. The wall structure of most vessels did not have obvious pathological changes. Consequently, greater phy...

Fan Da1,3, Zheng-Yong Wen1,2*, Xiao-Dong Wang4 and Yu Luo5

...ssion in mammals. In contrast to mammals, the roles of this protein are still rarely known in fish. Here, we first identified the ucp2 gene in yellow catfish (Pelteobagrus vachelli) and investigated its transcriptional changes in response to fasting and refeeding. The cDNA of pvucp2 was 1,193 bp long and possessed a 939 bp open reading frame (ORF) encoding 312 amino acids. Multiple protein sequences alignment revealed that UCP2 protein sequences were highly co...
Mubashir Ali Rather1, Ambreen Hamadani2*, Syed Shanaz2, Nusrat Nabi2, Showkat Ahanger1, H. Hamadani2, Ruksana Shah2
..., and gastrointestinal parasitism were reported to be among the main threats responsible for high economic losses in Kashmir Merino sheep. The fodders scarcity during winters, lack of awareness among farmers, non-availability of proven sires, small flock size, lack of infrastructure, and non-availability of digital records were reported among major constraints in exploiting the genetic worth of Kashmir Merino sheep. However,...
Maha Khalil1, Gamal Shams2, Hosny Abdel Fadil2, Nagah Edrees2, Mostafa Abonorag1, Nasser El-Sabbagh3, Eman A. Ahmed4*
...e, aspartate aminotransferase, alkaline phosphatase, lipid peroxidation, and raising TNF-α and IL-6 as pro-inflammatory cytokines. Moreover, elevating the reduced levels of glutathione peroxidase, catalase, and superoxide dismutase were reported. Conclusively, the results of our experiment suggest that that GSPE is a good feed additive for alleviating the negative impacts induced by aflatoxin B1.
 
Keywords | Aflatoxin B1, He...

Safaa M. Barghash1*, Amani A. Hafez2

...t ubiquitous protozoan parasite with a wide geographical distribution. The current study aimed to investigate if Trypanosoma evansi induces immunosuppression that may interfere with the development of immunity after vaccination in rats against Pasteurella multocida. T. evansi-infected and non-infected Wester Albino rats immunized against pasteurellosis with two vaccines; one is commercial, and the other is a formalin-killed vaccine (prepared from a local strai...

Magdy M. Fahmy1, Nisreen E. Mahmoud 1*, Mohamed R. Mousa2, Manal M. Zaki3, Elshaimaa Ismael3, Mai Abuowarda1 

...the prevalence of fish parasitic infestation and water quality deterioration thus evaluated their role in mass fish mortality event in Manzala Lake and its corresponding fish farms. Fish samples together with water samples were collected from 3 affected farms and 6 locations along Manzala Lake. Field observations and physicochemical analysis of water revealed deterioration of water quality indicating marked pollution. Parasi...

Abid Hussain1*, Saifullah Khan2, Shamas Liaqat3 and Shafiullah4 

...evelopment of related infrastructure. It would require strenuous medium to long term efforts and substantial investments. Similarly, forest land with wood and non-wood products and grazing pastures along with farming and toursims realted
activities have good potential to fulfill livelihood needs of the people along with farming and tourism related activities. Public and private sector initiatives to improve agricultural resource base of the area ha...

Doaa Khairy1, Mohamed Ali Osman2 and Fatma Abdel Mohsen Mostafa1*

...ferent parts of canola (Brassica napus L.) extracts to alleviate the deleterious effect of Meloidogyne incognita as well as ameliorate tomato growth in vivo. A mixture of moringa or neem aqueous leaf extracts with different parts of canola viz. leaf, stem and root gave better results than did single ones. Dual application of neem leaf extracts and canola parts extracts exhibited detectable augmentation in plant biomass better than other treatments. However, tr...

Tiyyabah Khan1, Hafiz Azhar Ali Khan1*, Muhammad Rizwan Khan1, Muhammad Umer1, Adnan Akhter1 and Waseem Akram2

...pergillus flavus or A. parasiticus. The results revealed that all the tested insecticides proved to be more toxic against C. ferrugineus as compared to T. castaneum. C. ferrugineus showed complete mortality at the highest concentrations of spinosad (1 ppm) and thiamethoxam (4 ppm), while >95% mortality was recorded at the highest concentrations of imidacloprid (4 ppm) and indoxacarb (4 ppm). In the case of T. castaneum, about 51%, 98%, 54% and 62% mortality...

Mohamed Mohamady Ghanem1*, Yassine Mahmoud Abdelraoof1, Abdelghany Hefnawy Abdelghany2, Eman Abdelhamid El-Ebissy3, Ahmed Ragab Askar4,5, Attia Ahmed Eissa6  

... haemato-biochemical, ultrasonographical and ruminal examinations, and to evaluate therapeutic interference by Rumitone (herbal product). To achieve these objectives, three healthy she camel at Ras Sudr Research Station, belonging to Desert Researcher Center, aged from 8-10 years old and weighting 350- 400 kg were used. Lactic acidosis was induced with oral sucrose (14 gm/ kg BW) for 24hs after which camels were treated with oral Rumitone daily for a week. Cli...

Taghreed Mohamed Nabil1, Randa Mohamed Hassan1, HebatAllah Hamdy Mahmoud2, Mohamed Gomaa Tawfiek2, Usama Kamal Moawad1* 

...s of the oviduct. In contrast, acid mucopolysaccharides were dominated in the infundibulum, magnum, isthmus, and vagina but were absent in the proprial glands. Sperm host glands were prominent in the uterovaginal portion. The vaginal tunica muscularis was the thickest compared with other oviduct parts forming the vaginal sphincter. In conclusion, the five portions of the turkey’s oviduct varied concerning the length, shape, number, height of the mucosal ...

Hosny Kesba1, Ashraf Suloma2, Samy Sayed3*, Abdullah Abdel-Rahman1 and Shaimaa Diab1

...align: justify;">Plant-parasitic nematodes particularly the genus Meloidogyne are a primary limiting factor in the production of many plants and is a major problem in organic systems. This study was carried out to examine the influence of irrigation with different effluent water sources, including semi-intensive tilapia pond (STP), intensive tilapia biofloc (ITB) systems, and well water (WW), on the reproduction of Meloidogyne incognita infecting eggplants7 or...

Mashakgene Isaac Senoamadi, Thobela Louis, Tyasi Teedzai Chitura* 

...tus and other internal parasites in a communal farming system of Limpopo province, South Africa. Twenty-six sheep and one-hundred and sixty-three goats were evaluated for clinical haemonchosis using the FAMACHA© diagnostic system. Information on the methods of control used by the smallholder farmers was gathered through a questionnaire-based survey that was carried out by interviewing forty-seven Small ruminants farmers (both males and females) of mixed a...

Min Li1, Shiwu Deng2*, Yiqian Peng3 and Hong Li2

...ted by real-time PCR. Ultrastructural changes of myocardial mitochondria were observed by transmission electron microscope. The activity of Caspase-3 in heart tissue of SD rats was measured, and the expression of p-JNK, GRP78, Caspase 12 and CHOP in heart tissue of SD rats was determined by Western blot. We found that LVEDd and LVESd in MIRI group and MIRI + DEX group were significantly higher than those in sham operation group (P<0.05), and LVEF was signif...

Santosh Kumar1*, Riffat Sultana2* and Martin Husemann3

... We found 25 species of grasshoppers, crickets and tree crickets. Caelifera were more diverse than Ensifera with 16 and 9 species, respectively. This work is provided an extended list of Orthopterans registered from Cholistan desert for the first time. 

...

Xian Zhang1, Erjiang Lin1, Shizhe Hong1 and Zhengjie Zhu2*

...ermine-N(1)-acetyltransferase (SSAT) on the proliferation and apoptosis of prostate cancer LNCaP cells under hypoxic conditions. Prostate cancer LNCaP cells were transfected with the eukaryotic expression plasmid pcDNA3.1 (D)/V5-His-SSAT, and cultured at 1% oxygen concentration. Western blotting was used to detect expression of SSAT, Akt, GSK-3β and β-catenin proteins; and flow cytometry was used to detect cell apoptosis rate and mortality rate. SSAT...

Arab Khan Lund1*, Atta Hussain Shah2, Gul Bahar Khaskheli2, Mool Chand Malhi3, Ahmed Sultan Jatoi4, Abdul Samad Mangsi5 and Asad Ali Khaskheli6

...t heat treatments in contrast to control (T0). The variation was also observed in conductivity, refractive index, moisture, fat, protein and lactose content, however, it was non-significant (p>0.05). Results are concluded that the nitrogen fractions markedly affected by different heating and time combinations followed by physical properties while less effect on the chemical components of milk ultimately nutritive value.

...

Nabila Khan1, Imran Ahmad2 and Muhammad Bilal Sadiq1*

...text-align: justify;">Ultrasonic assisted extraction (UAE) of total phenolic content (TPC) from almond hull was optimized by response surface methodology (RSM). TPC and 2, 2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity were used as response variables. Almond hull extract was chemically characterized by Fourier transform infrared spectrometer (FTIR) and gas chromatography mass spectrometer (GCMS). The extraction conditions were optimized by usin...

Wael Felefel1*, Mohamed EL-Beskawy2, M. F. El -Dakroury3, Mohamed Morsi Elkamshishi4, Eman Sayed Mohammed5 

...>...

Ibrahim Samir Abd El-Hamid1*, Wafaa Adel Abd Fouda1, Hesham Attia Shedeed1, Safaa Ali Mostafa1, Ahmed Mohamed Elbaz2, Salah Abo Bakr2, Baliegh Hamdy Mosa1, Ali Saber Morsy1, Amal Mohamed Hasan1, Khamis Refaay Emam3 

...nd aspartate aminotransferase (AST) decreased (P<0.05) in Tr2 compared with Tr3 or Tr1. While alanine aminotransferases (ALT) and creatinine (CRA) concentrations decreased in treated groups compared with control. Value of total antioxidant capacity (TAC) increased (P<0.05) in treaded groups compared with control. Serum phosphorus (P) increased (P<0.05) in treated groups compared with control, while calcium (Ca) leve...

Asim Faraz1*, Bernard Faye2, Cem Tirink3, Ayman Balla Mustafa4, Amal AlKharusi5, Morteza Bitaraf Sani6, Nasir Ali Tauqir7, Muhammad Arslan Akbar8, Muhammad Usman Saleem9, Rana Muhammad Bilal7, Abdul Waheed1, Muhammad Shahid Nabeel10

...auspicious livestock in drastic weather conditions. The location of Pakistan is at the hotspot regions where the disasters of environmental changes hit severely. The future hope for food security is a camel particularly for drought-stricken areas of the country, such as Cholistan, Thal, in Punjab, and Thar Deserts in Sindh. Camels have the ability to adapt to the harshest climatic conditions when kept for milk, meat, wool, and hides production. Camel productio...

Uzochukwu Ephraim Emeto, Chukwuemeka Calistus Okolo* and Nwakaego Ernestina Nweze

...e control of these endoparasites relies on periodic use of anthelminthics, epidemiological evaluations are necessary for deploying meaningful intervention strategies. Such investigations are lacking in the region; hence, the occurrence, risk-factors and nature of cestodiasis and nematodiasis of horses at Obollo-Afor southeastern Nigeria were investigated. Horses billed for slaughter were randomly selected (N = 304) for sampling. About 5grams of faeces and 2ml ...
Didiek Hadjar Goenadi1,2*, Roy Hendroko Setyobudi3,4, Erkata Yandri3,4, Kiman Siregar5,6, Aris Winaya7, Damat Damat7, Wahyu Widodo7, Ahmad Wahyudi7, Praptiningsih Gamawati Adinurani4,8
Maizirwan Mel9, Ivar Zekker10, Muhammad Zul Mazwan7, Devi Dwi Siskawardani7
Endang Dwi Purbajanti11 and Ida Ekawati12
....) Merr.], rapeseed (Brassica napus L.), and sunflower (Helianthus L). Relatively affordable in price, palm oil is in high demand in Asia. Further than a food source, Crude Palm Oil also serves as feedstock for biodiesel – an environmentally friendly renewable energy. In Indonesia, the palm oil industry plays an essential role in the national economy. However, negative issues in oil palm cultivation bring certain apprehension towards its in...

Judith Kiptoo1*, Daniel Mutisya2, Paul Ndegwa1, Ruth Amata3, Lucy Irungu4 and Rotich Godfrey5

...align: justify;">Plant-parasitic nematodes (PPNs) cause major crop losses by damaging plant roots and causing reduced absorption of soil nutrient elements. A two-year survey in 2018 and 2019 was conducted in most citrus growing regions in Kenya to assess the abundance, distribution and diversity of plant parasitic nematodes from different soil rhizosphere. Nematode population in 200cc of soil and 5g of roots were collected f...

Eman Alsayed Hammad and Atef Mohamed El-Sagheer

...structure of the plant-parasitic nematodes community inhabiting the rhizosphere of Pomegranate fields, it was found that Meloidogyne is the most common genus and harmful one. So, the efficacy comparative of Chitosan, Marjoram emulsion oil, Trichoderma asperellum, and Vermicompost as alternative eco-friendly control agents for root-knot nematode M. incognita infected Pomegranate were evaluated under greenhouse and open field conditions. Results indicated the ab...

Md. Serajul Islam1,2, Hongxin Wang1,2,*, Amer Ali Mahdi1, Mohamed Ismael Ahamed2, Zaixiang Lou1 and Fu An Wei3

...ll, bone, and skin from grass turtle (Chinemys reevesii) by direct QUENCHER procedure. The results showed that the highest ABTS capacity was found in cooked muscle at 10 min (110.133± 4.153 g trolox Eq./kg). On the other hand, DPPH and FRAP capacity were found in cooked muscle at 20 min which were 68.966±0.937 and 37.437±1.027 g trolox Eq./kg, respectively, and raw liver 31.508±1.091 and 58.237±0.919 g trolox Eq./kg, respecti...

Noora Hassan Hezam Al-Aqmer1*, Zain Aamir2, Muhammad Farooq Hanif3, Soumble Zulfiqar4, Sibgha Zulfiqar1, Mateen Izhar5 and Abdul Rauf Shakoori4*

...or DNA extraction, polymerase chain reaction and restriction fragment length polymorphism analysis. After restriction, samples were run on 2% agarose gel followed by visualization under UV light. Data analysis was done using IBM SPSS 24. We found that the distribution of ApaI genotypes was 28 (42.4%), 27 (40.9%), and 11 (16.7%) for the genotypes AA, Aa, and aa in responders and 22 (33.3%), 26 (39.4%), and 18 (27.3%) in non-responders. The allelic distribution ...

Haroon1, Chen-Xu Ye1, Yu-Xin Li1, Hong-Xin Zhang1, Qing Liu1, Xiao-Hong Su1,2,3 and Lian-Xi Xing1,2,3,*

...ion from pathogens and parasites.

...

Seun Eui Kim1,2*, Myoung-Hoon Lee1, Hye Myoung Jang2, Garam Park2, Wan-Taek Im3, Gwang Joo Jeon2,4* 

Tabassum Ara Khanum, Nasir Mehmood* and Shahina Fayyaz

...species, Neorhabditis andrassyii n. sp., and Poikilolaimus oxycercus which represents a new record of this species from Pakistan. Neorhabditis andrassyii n. sp. is characterized by having male (1109-1222) µm long body, spicules 32-44 µm long, gubernaculum slightly curved, boat shaped with flat distal end eight pairs of bursal papillae were present. Tail (46-68) µm long conical with fine tip, leptoderan burs...

Erum Iqbal*, Firoza Kazi and Saboohi Raza

...align: justify;">Plant-parasitic nematodes are potential pests of agricultural crops including wheat and cause quantitative and qualitative loss to crop production worldwide. They cause serious damage to many important agricultural crops and add to the problem of food security worldwide. Wheat (Triticum aestivum L.) is the most important economic cereal crop in the world and Pakistan stands in eighth position in global wheat production. The wheat crop is susce...

Feng Xu, Weijing Fan and Guobin Liu*

...analysis. The dual luciferase experiment was applied to verify the targeted relationship betweenNEXN-AS1 and miR-410-3p. HUVECs were transfected with NEXN-AS1 overexpression vector, and then treated with ox-LDL for 24 h before detecting the activity, apoptosis rate and oxidative stress level of HUVECs. The low concentrations (25, 50, 100 μmol/L) of rutin had no toxic effect on HUVECs, and the activity of HUVECs was significantly reduced after intervention w...

Weam Mohamed Baher1, Wageh Sobhy Darwish2*, Abdelazim Elsayed Elhelaly3,4 

...50%, respectively. The parasite infested mainly (100%) the visceral organs of the positive samples in the two fish species; while infested the muscles in 30% and 10% of herrings and sardine, respectively. The highest prevalence rates for the two species were recorded in the collected samples from Damietta, followed by Alexandria, Port Said, Ismailia, and Suez, respectively. The public health significance of Anisakis larvae was further discussed.

Keywor...

I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2,  I Gede Mahardika1,  I Gusti  Nyoman Gde Bidura1

...as follows: A: elephant grass + concentrate A (without HLF); B: treatment A + concentrate B (with 5% HLF); C: treatment A + concentrate C (with 10% HLF); and treatment D: Treatment A+ concentrate D (with 15% HLF). The protein balance, blood metabolic profile, body composition, and nutrient deposition were measured. The results showed that the goats that were treated D had the highest protein retention up to 9.89 g/head/day, but it was not significantly differe...
Tri Eko Susilorini1*, Ahmad Furqon2, Wike Andre Septian1, Desinta Wulandari3, Suyadi Suyadi3
...was analysed using Polymerase Chain Reaction-Restricted Fragment Length Polymorphism method. The result showed that three genotypes (CC, CT, and TT) and two alleles (C and T) were found. The frequencies of CC, CT, and TT genotypes were 0.450, 0.500, and 0.050 respectively, while the frequencies of C and T allele were 0.702 and 0.298, respectively. The different genotypes didn’t significantly affect milk production and compositions. Descriptively, Senduro...

Aiman Batool1, Muhammad Sohail Sajid1,2*, Hafiz Muhammad Rizwan3**, Asif Iqbal4, Imaad Rashid5, Ibadullah Jan6, Faiza Bano7, Fiaz Ahmad8, Waqas Ahmad1, Muhammad Nisar Khan1 

...tors with endo and ectoparasites in the small ruminant population of district Dera Ismail Khan, Khyber Pakhtunkhwa, Pakistan. Faecal and blood samples were collected along with ectoparasites directly from the animal rectum, jugular vein and skin, respectively. The examination of gastrointestinal (GI) parasites and haemoparasites was carried out through q...

Barirah Rehman Talpur1, Zaheer Ahmed Nizamani1*, Imdad Hussain Leghari2, Mansoor Tariq1, Aisha Rehman3, Shahnawaz Kumbhar1 

...erum Alanine aminotransferase (GPT), Alkaline phosphatase (ALP), Gamma glutamyl transferase (γGT), uric acid and creatinine levels and significant (p<0.05) decrease of serum calcium levels were noted in all treatment groups of both species as compared to control. In rabbits and broilers, necropsy findings included mild inflammation and discoloration of liver along with nephritis. While in broilers, toxic lesions wer...

Hye-myoung, Jang 1,3, Ju-Hyeun, Kim3, Garam Park1, Yoon Dong Choi4, Sun-Eui Kim1,5, Gwang Joo Jeon1,2* 

...ied Agarwood (Aquiralia crassna) extract (AE) and its effects on prevention of dementia related diseases through ICR mice experiment. The mice were fed with 5 mg of AE per day for 16 weeks to see the effect of AE on inhibition of two major biomarkers of beta-amyloid (Aβ) and tau-protein (τ-protein) formed in the brain tissues. Under the hypothesis of obesity inducing potential dementia, mice were fed with high-fat energy diet to gain excessive weight....

Hany M.R. Elsherif1, Ahmed Orabi2, Hussein M.A. Hassan3, Ahmed Samy3*

...hile alanine aminotransferase (ALT), aspartate aminotransferase (AST), and urea levels remained not affected. Adding SF, SA, or SP to broiler diets significantly improved immunological state (P<0.05) via enhancing avian influenza (H5) and Newcastle disease (ND) titers. Accordingly, OAS’s as natural feed additives could improve broiler performance and immunological state. Chicks fed SF or SP had the best productive p...
Gamalat Y. Osman1, Elham M. Hassan1*, Tarek A. Salem2, Azza H. Mohamed1
...-align: justify;">Anti-parasitic activity of the fenugreek crude seeds water extract (FWE) on Schistosoma mansoni infected mice was studied in the present work and Praziquantel (PZQ) was applied as a standard drug. FWE was chemically analyzed by the high-performance liquid chromatography (HPLC) technique. The main recorded constituents were rutin, P-coumaric, hydroxyl-benzoic acid, ferulic acid, and sinapic acid. Results of the present study indicated that FWE...
Mohamed Lebdah1, Sahar Abd El Rahman2*, Ahmed Attia3, Reham Karam2, Naglaa Fathy Saeed Awad1, Mohamed Ibrahim El Bagoury1
...erse transcription polymerase chain reaction (RT-PCR) and partial sequencing targeting F gene of amplicon size (362) bp containing the region 112RRQKRF117 motif, which is the determinant part of virus virulence. The sequenced isolate was grouped in class II genotype VII.1.1 with small distance from NDV strains in chickens and turkeys which is alarming for the potential transmission of NDVs from quails to other poultry species.
 
Ke...

Mimi Syazwani Jaapar1, Eric Lim Teik Chung1,2*, Nazri Nayan1, Mamat Hamidi Kamalludin1,2, Mookiah Saminathan3, Kalai Vaani Muniandy2, Muhammad Hazziq Mohd Hamdan1, Shokri Jusoh1, Faez Firdaus Abdullah Jesse2,4 

...the utilization of this grass is limited due to the presence of steroidal saponins. Therefore, the main objective of this study was to determine the effects of different levels of B. decumbens diets on the in vitro gas production and ruminal fermentation characteristics. Graded levels of B. decumbens were mixed with P. purpureum, where 10% was identified as the low-level B. decumbens diet (T2) and, 60% was identified as the high-level B. decumbens diet (T3) ba...
Ahmed Mohamed Elmahdy1*, Naglaa Mohammed Alkalamawy2
...s (Aspartate aminotransferase (AST), Alanine aminotransferase (ALT), alkaline phosphatase (ALP), g-Glutamyl transferase (GGT) and total bilirubin, also the levels of Cholesterol, Triglycerides, HDL-cholesterol, LDL- cholesterol and VLDL-cholesterol were also estimated. The degree of renal protection was measured using creatinine, urea, sodium, potassium, also the levels of total protein, A...

Hend K. Sorour, Mohammed A. M. Saleh, Azhar G. Shalaby* 

... research, we used polymerase chain reaction (PCR) for the detection of the mcr-1 gene, and phylogeny was performed on three isolates to detect mcr-1 gene mutations and relationships. The percentage of isolated E. coli was 25.5%. All isolates showed resistance to colistin in disc-diffusion assay, while in MIC (minimum inhibitory concentration) method 68.8% exhibited resistance. Colistin was recorded as 33.7% in chicken breast by HPLC. Furthermore, mcr-1gene wa...

Mahreen Hanif*, Shafqat Saeed, Mudssar Ali, Muqadas Younas, Huda Bilal, Syeda Fatima Bukhari

...ne (green) packet in contrast to polyethylene (gauge 2) and china lamination. Significant differences were observed in the overall adult population of T. castaneum (p<0.05) and chickpea percentage weight loss (p<0.05) than its larval population (p>0.05) during the storage period. However, more adult population and weight loss (%) occurred after more time period (after 90 days) as compared to the low time period (after 30 days). These results are impor...

Rizwana Abdul Ghaffar* and Kamil Nadeem

...t aspects. They become parasitized by many of the parasites through their feeding and feeding habitat or by some infected birds that live in association with them. The majority of the nematode parasites that inhabit the body of the pigeon reside in the intestine. Nematodes are the worms that inhabit the intestines either by making coils in the tunnels of the intestine or by attaching thems...

Teguh Wahyono1,2*, Wahidin Teguh Sasongko3, Wijaya Murti Indriatama4, Setiawan Martono5, Slamet Widodo3, Widhi Kurniawan6, Muhamad Nasir Rofiq7

...ro degradability. In contrast, variety difference had a significant impact on in vitro degradability (P < 0.01). Results of the current study indicate that wilting treatment influences the sensory score and chemical quality of sorghum silage. There was no effect on nutrient composition or in vitro digestibility. The effect of different variety on the nutrient value of sorghum silage was more pronounced than the wilting variable.
 

Yasmin M. M. Mahmoud* 

...of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were significantly (P<0.05) increased while, glucose, total cholesterol, uric acid and creatinine were significantly decreased (P<0.05) in G1 as compared to unsupplemented group. Kids in G1 group recorded the highest (P<0.05) concentrations of hemoglobin, mean corpuscular volume and mean corpuscular hemoglobin, while, G0 had the lowest value. Mea...
Dalia M. Aboelhassan1*, Inas S. Ghaly1, Noha E. Ibrahim2, Nermeen M. Shaffie3, Mariam G. Eshak1, Aboelfetoh M. Abdallah4, Ibrahim M. Farag1
...d kidney tissues. In contrast, FCE treatment with different doses (3.3 g/Kg., 4.2 g/kg. and 5.0 g/kg) can inhibit the upregulation of such gene expressions and enhance the histopathological changes of liver and kidney organs. These ameliorations increase by increasing the dose of FCE, through its utilization either as a protective or therapeutic agent. Using FCE as a therapeutic agent, particularly in the treatment with the highest dose (5.0 g/Kg), produces th...

Amany R. Sultan1, 2, Gamal A. Morsi2, Hoda El-Fayoumi1, Abdel-Azeem S. Abdel-Baki1*

... Tuta absoluta and its parasitoids as well as the rate of parasitism, the parasitoids assemblages and the relative impact of parasitoids on its population over two seasons on tomato in the experimental farm of the Agriculture Research Center, Sids in Beni Suef Governorate, Egypt. During first plantation in the first plantation, The results revealed that ...
Basel A. Abokhadra, Samah M. Mosad, Sahar Abd El Rahman*
...was established by polymerase chain reaction (PCR) targeting glycoprotein B (gB) gene. Six PCR positive samples were isolated on chorioallantoic membranes (CAMs) of 11 days old Embryonated Chicken Eggs (ECEs) for three blind passages. The CAMs showed thickening and congestion at 1st passage and typical pock lesions appeared at 3rd passage. Indirect immunofluorescent technique (IFT) was used for confirmation of BoHV-1 presence in CAM; the CAM with clear pock le...
Genevieve R. Tabon1,2, Noraine P. Medina2, Mary Rose D. Uy-De Guia3, Claro N. Mingala2,3*
...native pigs (PNP). Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) was done to evaluate the genotypes of ESR1 gene. Target gene was amplified and then subjected to RFLP using PvuII restriction enzyme. Results showed that all of the samples were found to be of AA genotype which is not the favorable genotype according to previous studies. The litter sizes of the PNP were also determined. Results showed that the genotype of ESR1 gene...

A. El-Shemy1*, Hoda M. Mekky2, M. A. Bosila2, A. M. Allam1, Kh. M. Elbayoumi2, M. M. Amer3 

...erse transcription polymerase chain reaction (RT-PCR) for processed livers using specific primers aiming the 3D gene of duck hepatitis A virus-1 (DHAV-1) showed the output of the amplified band in all examined specimens at the certain supposed size of the 3D encoding gene (467 bp). The successfully amplified 3D gene of DHAV-1 isolates, namely DHV/Duck/Egypt/Monofia-Shemy-1/2018, DHV/Duck/Egypt/Al-Gharbia-Shemy-3/2018, and DHV/Duck/Egypt/Monofia-Shemy-2/2018, w...

Ngoc Tan Nguyen1*, Minh Thanh Tram1, Thi Thu Pham1, Tan Loi Le1, Thi Khanh Ly Nguyen1, Tuan Thanh Hoang2, Cong Thieu Pham3, Nguyen Khang Duong4 

...p in the D-loop by polymerase chain reaction (PCR) followed by sequencing to analyze nucleotide polymorphism, haplotype diversity and genetic distance to construct a phylogram. Results showed that the fragment of 687 bp was successfully amplified. Examination of 49 sequence variants in 599 bp of the control region revealed the nucleotide composition was Adenine (A) = 32.55%, Thymine (T) = 28.33%, Guanine (G) = 14.67%, Cytosine (C) = 24.87% and G+C content was ...

Abdullah Channo1*, Asmatullah Kaka1, Qudratullah Kalwar2, Imdadullah Jamali3, Ghulam Jelani2, Muhammad Bakhsh4, Ghulam Nabi Dahri5 and Jai Parkash Goil6

...tion and trans rectal ultrasonography methods have been used. COD should be treated by using different treatment protocols such as hormonal, medicinal and homeopathic medicines.

...

Xiaojing Liu and Zhongxin Li*

...UA), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) significantly reduced in rats treated with TSG (20 mg/kg) (P<0.05), blood total protein (TP) and albumin (ALB) significantly increased (P<0.05), VEGF expression significantly reduced (P<0.05) and MMP-9 expression significantly increased (P <0.05). The present study results showed that TSG could reduce proteinuria levels, slow down the progre...
Tariq Mehmood1, Muhammad Arif Khan1, Ayesha Safder Chaudhry1, Kamran Ashraf2, Muhammad Mohsin Ali1,3, Muhammad Faisal Ayoob3*, Mudassir Hussain4, Farrukh Saleem3 and Muhammad Fayaz3
... of post-surgery. In contrast, the concentration of chloride, potassium, and bicarbonate ions was found to be insignificant. A significant difference (P<0.05) was reported in various blood parameters in group A and B when compared with group C. However, all the observed values were within the normal range. It was concluded that resection of jejunum up to 20% in cats makes natural body weight gain while ≥40% jejunal resection increases morbidity and morta...

Umair Faheem1*, Qurban Ali2, Mussurat Hussain1, Abrar Ahmad3, Tamsila Nazir2, Ghayour Ahmad3, Idrees Ahmad3, Madiha Mobeen4, Hammad Hussnain3 and Nadia Hussain Ahmad3

...ins the populations of parasitoids i.e. Trichogramma spps., Braconid wasps and Encarsia spps., which act to reduce the population of these notorious insect pests. Cotton plants shows genetic resistance or tolerance against these insect pests. In the current experiment six varieties of cotton i.e. CIM-496, CIM-534, NIAB-111, MNH-786 and Bt-121 were sown in the field under sprayed and un-sprayed condition to check the genetic resistance or tolerance against thes...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...genetic affiliation. Contrasting results and lack of molecular evidence in species recognition studies have made this topic more curious and complex. Some plant species compete more vibrantly for below-ground resources when an encounter with neighboring unrelated conspecifics as compared to related conspecifics (kin recognition). Some species increase competition when interacting with related and unrelated conspecifics (niche partitioning); some species do not...

Ochieng Onunga George*, Owuor Ndonga Millicent Florence, Mario Kollenberg  

...bones, and hairs. In contrast, liquid parts consist of blood, dissolved solids, urine, gut contents, and wastewater from slaughter operations and floor cleaning. It has been reported that Abattoir wastes can have negative impacts on the areas surrounding them by causing pollution and public health concerns. Therefore, this research was initiated with the main objective being to evaluate the Parasitological and Microbiologica...
Eman M. Aboelela1, Mohamed A. Sobieh2, Eman M. Abouelhassan3, Doaa S. Farid4, Essam S. Soliman2*
...prevalence (PP) of ectoparasitic infestations in dogs and cats concerning some host, agent, and environmental determinants. A cross-sectional study was designed to last for four successive seasons from September 21st, 2020 to September 20th, 2021. A total of 1393 cats and 1511 dogs were admitted and examined for parasitic infestations. PPinfestations revealed highly significant (P < 0.01) increases during fall and spring ...

Peyman Mohammadzadeh1*, Aida Rasuli2, Bahman Noroozi Gorgani2, Sajjad Mohammadi3

...e to intracranial and intraspinal courses, temporal were seen. Due to unilateral brain herniation, the tonsillar hernia was associated with hemorrhage and linear necrosis rather than only bulging. The corpus callosum and fornix had small areas of hemorrhage that indicated a sign of diffuse traumatic axonal injury. In histopathology, activated microglia and reactive astrogliosis were seen. The cause of death was TBI followed by eye blindness caused by toxoplasm...

Amina Batool1*, Saba Aleem1, Ali Nawaz1, Muhammad Imran Khan1, Waheed Arshad1, Muhammad Aslam2, Shiraz Ali3 and Muhammad Zeeshan3

... seeding density. In contrast, 16FJ17 stood second in all parameters except root length and number of tillers m-2. The value for grain per spike (40.0) and shoot length (10.55 cm) is at par with Fatehjang-2016 and Dharabi-11, respectively at 120 kg ha-1 of seeding level. It is evident from the results that wheat variety Fatehjang-2016 can effectively be planted at an optimum seed rate of 120 kg ha-1 for general cultivation and better economic returns in Barani...

Xiaoguang Su1,*, Yanjun Gao2, Yanling Wang1 and Yaohui Ma2

...of EPHB2. The dual luciferase report experiment verified the targeted binding relationship between miR-128-3p and EPHB2. Western blot was used to detect the expression of Ki-67, PCNA, Bcl-2 and Bax. Our findings showed that after HAE treatment, the cell viability was significantly reduced (P <0.05), the apoptosis rate was significantly increased (P <0.05), the levels of Ki-67, PCNA, Bcl-2 protein were significantly reduced (P <0.05), and the level of ...
Muhammad Kashif Iqbal1*, Khalid Mehmood2,4, Shakeel Ahmed3, Fazul Nabi4, Muhammad Arif Rizwan1, Muhammad Kaleem1, Mushtaq Ahmed1, Abdul Waheed1 and Jiakui Li5
...-time quantitative polymerase chain reaction (RT-qPCR) on day 10 and 14 post-hatch. Liver damage caused by thiram was analyzed through levels of antioxidant enzymes (SOD; GSH-Px) and serum biomarkers and the protective effects of the medicine was assessed through these values. Results showed that VEGF mRNA levels were significantly (P<0.05) up-regulated; however, the Flk-1 receptor levels were down-regulated in TD-affected birds significantly (P< 0.05) a...

Amira Adel Taha AL-Hosary1, Walaa Mostafa2* 

...e mite is a common ectoparasite that affects pets. The current study aimed to investigate the most common clinical signs associated with ear mange in household cats, as well as to assess its epidemiological pattern and the most effective treatment. Individual clinical and parasitic examinations were performed, and infested cats were assigned to one of four treatment groups. Each group was treated with one of the following dr...

Muhammad Haris Raza Farhan1*, Qamar Iqbal1, Tariq Jamil1, Muhammad Fayaz2, Abdul Kabir2,3, Eid Nawaz2, Marjan Ali2, Shumaila Manzoor2 

...t infections including parasitic infestation. A referral clinical examination was carried out on a small ruminant farm with a mixed population of sheep and goats. History taken from the farm owner revealed the mortality of 8 animals within the duration of 14 days following a pattern of anorexia, no fever, emaciation, recumbency, and ultimately death. A detailed physical and clinical examination of animals revealed signs of dehydration, emaciation, anorexia, nu...

Guang Yin, Wencheng Kong, Yuqiang Shan, Jian Zhang, Rongchao Ying and Sixin Zheng*

...s measured by dual luciferase reporter gene experiment. According to results of our study, compared with the control group there was no significant difference in the parameters of Hep-3B cells after transfection of NC-siRNA (P> 0.05), but the expression level of TINCR and cell proliferation, invasion and migration ability were significantly reduced, and the expression level of miR-646 in the cells was significantly increased, which were statistically signif...

Shujaat Hussain1*, Muhammad Saqib1, Khurram Ashfaq1 and Zia ud Din Sindhu2

...), gamma-glutamyl transferase (11.66±0.63µ/L), aspartate aminotransferase (70.63±0.65 µ/L), alkaline phosphatase (94.10±0.89 µ/L) and calcium (9.48±0.39mg/dl). On the other hand, a significant decline (p<0.05) in WBC count (11.94±0.04), eosinophils% (3.10±0.20), basophils% (0.76±0.06), platelets count (103.2±0.56103µ/l), glucose (55.13±...

Muhammad Akram1*, Muhammad Imtiaz Shafiq2, Amber Malik3, Farmanullah Khan4, Munir Ahmad Bhinder5 and Muhammad Sajjad6

...and glutathione S-transferase (GST). GST neutralizes reactive oxygen species to regulate physical homeostasis in the body. The target of this study was to evaluate the molecular role of GST genotypic polymorphism involved in the development of CVD. For this case-control study, a total of 504 participants including 261 CVD patients and 243 healthy individuals were enrolled after taking informed consent. The analysis of the three allelic variants GSTM1, GSTT1, a...

Junling Liu, Chen Sun, Qiao Yu, Yanzhi Liang, Shanshan Lin and Meng Tian*

...erse transcription polymerase chain reaction (RT-PCR) was used for the estimation of messenger RNA (mRNA) expression of cytochrome P450 2E1 (CYP2E1). Daphnetin treated rats showed the up-regulation of body weight as compared to other groups. Moreover, daphnetin reduced the blasts in leukemic rats. It also altered the hemotological parameters such as red blood cell (RBC), white blood cell (WBC), lymphocytes, neutrophils, monocytes, eosinophils, monocytes and ba...
Afifa Yaqub1, Mehroze Amin1, Qindeel Fatima1, Rabail Hassan Toor1,3, Saira Aftab1 and Abdul Rauf Shakoori1,2*
...is a lysine methyltransferase that has been reported to downregulate the expression of tumor suppressor genes in a variety of cancerous cells. The present study explores the anti-cancer activity of UNC0642, a novel potent inhibitor of G9a in MCF-7 breast cancer cell line. Analysis of growth and proliferation parameters by various cell-based assays such as neutral red assay and BrdU cell proliferation assay showed that higher concentrations were lethal for the ...

Muhammad Rizwan, Abu Bakar Muhammad Raza*, Muhammad Zeeshan Majeed and Muhammad Arshad

...haceae) and Indian lemongrass Cymbopogon citratus (DC.) Stapf (Poaceae) were tested against 3rd instar nymphs of mealybug. Results showed that mean mortality was higher (76.67%) after the application of A. indica extract, followed by E. camaldulensis (66.67%) at 72 h post-exposure. The least effective botanicals were C. citratus and C. album showing 26.67 and 20.0% mean mortality of mealybug, respectively. The mortality rate was increased by increasing the con...

Malik Fiaz Hussain1, Atif Akbar2, Muhammad Asif1, Laraib Nisar3, Muhammad Naeem Ashiq3 and Furhan Iqbal1*

Abdulkhaliq A. Al-Janabi1*, Mohammad S. Alsalami1, Arkan B. Mohammed1, Abdulkhaliq A.R. Al-Douri2 

...he aspartate aminotransferase (AST) and alanine transaminase (ALT), were significantly decreased in both Omega-3 treated groups compared to the control. In conclusion, the supplement with Omega-3 (150 and 300 µl) induced the growth rate, and liver enzymes, and reduced their lipid profiles, suggesting it would be a beneficial dietary supplement for rabbits.

Keywords | Omega-3, Polyunsaturated fatty acids, Dietary supplement, Albino rabbits, Animal...

Tarek A. Wrshana1, Yousry A. Dowidar1, Bahgat A. El-Fiky2, Ali M. El-Rify1, Walaa A. El-Sayed3, Basem M. Ahmed4* 

...s at the cellular and ultrastructural level in the infected cells, and it was able to maximize the production of interferon-gamma (IFNγ) and interleukin 2 (IL2), interleukin 6 (IL6) and interleukin 12 (IL12). In conclusion, our data represent a preliminary step in vNDV immunotherapy where MSCs media could be used for the treatment of vNDV in infected flocks.

Keywords | Newcastle Disease Virus (NDV), mesenchymal stem cells (MSCs), IFN-γ, IL-...

Allah Bakhsh1, Attiq Akhtar2, Fiaz Hussain3, Hafiz Wasif Javaad4, Inam ul Haq5* and Humara Umar
...ack Ball cultivar in contrast to Swat Local cultivar (9.37Kg). Results of biochemical parameters declared Black Ball as a superior cultivar owing to the maximum value of TSS (15.55%), total sugars (10.85%), antioxidant activity (75.75%) and minimum value of titratable acidity (0.15%). The results suggested that among studied fig cultivars, Black Ball is a premium fig cultivar having superior physical and chemical features which can be used in future breeding p...

Misbah ud Din1, Shah Alam Khan1, Said Hussain Shah1,2* and Najeeb Ullah3

...ith Thiamethoxam. In contrast, the maximum mean number of aphids was observed (28.80) in the control plot. In the case of cultivar, Swabi the highest mean numbers of aphids were noted (53.86) in an untreated plot, whereas the lowest mean numbers of aphids were found (19.72) in Thiamethoxam treated plot, respectively. After 2nd spray in cultivar China the lowest aphid was (7.45) in the thiamethoxam treated plot, while the maximum mean numbers of aphids were (29...

Misbah ud Din1, Shah Alam Khan1, Said Hussain Shah1,2* and Najeeb Ullah3

...ith Thiamethoxam. In contrast, the maximum mean number of aphids was observed (28.80) in the control plot. In the case of cultivar, Swabi the highest mean numbers of aphids were noted (53.86) in an untreated plot, whereas the lowest mean numbers of aphids were found (19.72) in Thiamethoxam treated plot, respectively. After 2nd spray in cultivar China the lowest aphid was (7.45) in the thiamethoxam treated plot, while the maximum mean numbers of aphids were (29...

Sri Suharyati, Siswanto, Madi Hartono, Kusuma Adhianto* 

...ed descriptively. In contrast, the volume, individual motility, concentration, and percentage of live sperm were analyzed using analysis of variance ANOVA. The results showed that the administration of vitamin E and L-carnitine exerted a very significant effect on motility (P<0.01), the concentration, and the percentage of live sperm (P<0.05) but did not affect the sperm volume and abnormalities (P>0.05). In conclusion, the combination of vitamin E an...

Hassan Raza1, Muhammad Zeeshan Majeed1*, Muhammad Irfan Majeed2, Mujeeb-Ur-Rehman1 and Muhammad Asam Riaz1

...lantations and wooden infrastructures. Farmers rely primarily on direct applications of liquid insecticides which usually get off the target site resulting in unsatisfactory and short-term termite eradication along with environmental contaminations. This situation necessitates looking for more target-oriented and ecologically safer strategies such as baiting insecticides with some cellulose attractant. In this study, 5% technical grade fipronil was formulated ...
Irfan Shahzad Sheikh1, Syed Haseeb Shah1, Niamatullah Kakar2*, Mohammad Masood Tariq1, Muhammad Essa Kakar3 and Muhammad Zahid Mustafa1
...h as alanine aminotransferase (ALT) and aspartate aminoransferase (AST) on day 42. A non-significant effect was seen on hematological and biochemical profile of liver and kidney of broiler chicken on days 14th and 28th. In conclusion, the study showed significant synergistic effect of TP and OXY on the Hb, RBC and liver enzymes such as ALT and AST that ultimately lead to promote the growth and can be used safely at sub-thera...

Jun Wang*, Xiaoming Jiang and Zhiwei Sun

...rpio (Linnaeus, 1758); Carassius auratus (Linnaeus, 1758); Hypophthalmichthys molitrix (Valenciennes, 1844); Hypophthalmichthys nobil (Richardson, 1845); Gymnocypris eckloni (Herzenstein, 1891); Schizopygopsis pylzovi (Kessler, 1876); Triplophysa siluroides (Herzenstein, 1888); Silurus lanzhouensis (Chen, 1977); Silurus asotus (Linnaeus, 1758); Channa argus (Cantor, 1842). The b values of the LWRs ranged from 2.598 for Ctenopharyngodon idella to 3.271 for Para...

Indyah Aryani 1,3*, Suyadi Suyadi2, Hartutik Hartutik2, Kuswati Kuswati2 

...e gastrointestinal endoparasite in Madura cattle at four Madura regency, East Java, Indonesia. A total of 400 samples of Madura cattle were collected from four sub-district at Pamekasan Regency as follows: Pakong, Pasean, Batumarmar, and Waru (PAPABARU). The collected feces were examined using whitlock sedimentation methods. The specific species was identified by their morphology. A total 43 Madura cattles were infected by nematode worm as follows: Oesophagost...

Sajjad Ali1*, Atta ur Rahman1 and Sher Ali2

...agricultural land and infrastructure. Built-up is necessary; however, it is worth mentioning to feed 11.23 million people in the district. The region’s land is the most fertile and productive in the Khyber Pakhtunkhwa province. Data were taken from the Agricultural Bureau of Statistics from 1990 to 2020, and the satellite imageries of the region were acquired from the United States Geological Survey (USGS). ARIMA technique is employed to get the forecast...

Muhammad Halim Natsir*, Osfar Sjofjan, Yuli Frita Nuningtyas, Danung Nur Adli, Lizar Basnelda, Dimas Frisky Apriyanto, Wahyu Tri Utami 

...obial population. In contrast, the result showed no significantly difference (p > 0.05). In conclusion, combinations of nano-fountain clerodendrum and avocado seed flour help to increasing villus height and adverse microbial on Lohmann broiler chickens.

Keywords | Avocado, Clerodendrum, Growth Performance, Intestinal Profile, NanoTechnology 

...

Reem M. Ramadan1, Fady Sayed Youssef2, Gehad Genidy Mohamed3, Sameh Hamed Ismail4, M.M. El-Bahy1, Shimaa Abdel-Radi1* 

... group. This with in contrast to the group inoculated by LC50 exposed sporulated oocysts. The study concluded that C-Oo.Nc is a promising effective anticoccidial compound for controlling infection in chickens.

Keywords | Curcumin -olive oil nanocomposite, anticoccidial activity, Comet assay, Poultry, coccidiosis. 

...

Sidrah Ashfaq1, Muhammad Nadeem1*, Muhammad Yamin1, Talha Afzal1, Muhammad Waqar Akram1, Rabia Anam1 and Ali Mehboob2

...version processes in contrast to direct combustion of agricultural waste. Other than controlled burning of biomass, it can be subjected for different purposes like a thermal, synthesis of ethanol, engine running, and for fuel cell applications. An excessive amount of impurities like char, ash, tar, and particulate matter are making these syngas non-feasible for thermal or engine applications. To overcome the above-stated problem, a downdraft gasifier with cycl...

Zayed M.A1, M.F. Shehata1, I.M. Ismail1, Mona Mohammady1, M.A. Radwan2*  

...ormance. In addition, ultrasound technique is commonly used in the livestock sector, such as a diagnostic tool and a tool in animal science and veterinary research. So, the present study was performed to study the effect of different weaning weights on growth performance, ultrasound measurements, carcass characteristics and meat quality of Barki ram-lambs. Moreover, this investigation aimed to examine the relationship among ...

Al-Hassan M. Mostafa1*, Gehan Mohammed Sayed2 

...Catalase and SOD, in contrast there was an obvious increase of GSH. Histopathologically, Abomasum tissue restored completely normal histological features in Garlic treated goats, however the abomasum was partially restored to the normal histological feature in coriander treated goats. In conclusion, the high flavonoid and phenol content of A. sativum ingredients have the ability to repair the degenerative hazards induced in a goat infested by Haemonchus contor...

Mai A Fadel1*, Ahmed M Elmahdy1, Jihan Mostafa Badr2, Mohammed AM Saleh3, Mona A.A. AbdelRahman3 

...d. Aspartate aminotransferase, alanine aminotransferase, urea, and creatinine serum level were also estimated. From our findings, we concluded that the usage of a half-dose combination of enrofloxacin and amoxicillin is safer and more efficient in the treatment of Escherichia coli and Salmonella enteritidis mixed infection in broiler chickens than the usage of these antibiotics in a full-dose combination or solely.

K...

Shakeel Ahmad1, Muhammad Israr2*, Rasheed Ahmed3, Anam Ashraf1, Muhammad Amin4 and Nafees Ahmad5

...hrublands (0.33-0.17%), grasslands (45.83-41.74), and cropland (12.71-10.47) were decreased significantly. At the same time, savannas, permanent wetlands, urban and built-up lands, natural vegetation, permanent snow and ice, and barren lands increased substantially over the entire period. Due to the lack of baseline data, the LULC map will play an essential role in the sustainable management of LULC in the Hindu Kush, Karakoram and Himalayan regions of Pakista...

Bilal Dik1, Saima Naz2*, Muhammad Sohail Sajid3,4 

.... maximum, 2 species of Craspedorrhynchus: Cr. fraterculus, Cr. platystomus, 2 species of Falcolipeurus: F. suturalis, F. quadripustulatus and one species of Kurodaia fulvofasciata. Among birds, Buteo (Buzzards) were the most prevalent (73.63%), with 6 species of lice on B. buteo and 5 on B. rufinus; 3 each on Aegypius monachus, Aquila heliaca, Aq. nisus, and Circus aeruginosus; 2 each on Pernis apivorus, Ci. pygargus and Milvus migrans; and one each on Circae...

Zain-ul-Aabdin Abro1*, Naheed Baloch1, Raza Muhammad Memon2, Niaz Hussain Khuhro2 and Waseem Akbar Qazi2

...lation surveillance of parasitoids during 2019. The results shown (P<0.05) maximum number of Trybliographa daci were (55.60±4.52, 46.40±5.47) obtained from guava infested fruits of both regions. Moreover, Maximum number of Bactrocera zonata were emerged from infected guava (381.00±10.85, 259.40±16.95) collected from lower and upper regions of Sindh. The current studies recognised that larval cum pupal par...

Farheen Shaikh*, Saima Naz and Nadir Ali Birmani

...iraptera: Insecta) are parasitic insects of variety of birds belonging to the large family of Phasianidae (Aves: Galliformes). The lice have strong mandibles with biting mouth parts and develop specific host-parasite relationship. They cause acute to chronic infestation to hosts directly. These parasitic insects are the source of various diseases, like flue, and also serve as a vector of s...

Kanwal Hanif1, Dilbar Hussain1, Qurban Ali1, Asad Aslam1*, Tamsila Nazir1, Muhammad Saleem1, Muhammad Faheem Akhtar1, Muhammad Zubair2, Najuf Awais Anjum3 and Muhammad Umar Qasim1

...matidae) is a genus of parasitic wasps that are powerful biocontrol agents against a variety of insect pests. These biological control agents retain their importance due to their easy mass rearing, high searching ability and effectiveness against many crop insect pests. In this study the toxicological effect of seven insecticides viz Flubendiamide (Belt 480 SC)@ 500 ul/l, Pyriproxyfen (Priority 10.8 EC) @ 2000 µl/l, Chlorantraniliprole + Thiamethoxam (Vo...

Othman E. Othman1*, Lingjiang Min2, Amira M. Nowier3  

...than that in LFG. In contrast, the levels of methylated C in contexts CHG and CHH are higher in HFG than those in LFG groups. Despite this small difference in the methylation levels, there are many DMR and DMG were identified in the two groups. One-hundred and seventy fertility-related genes with different frequency in methylation levels were selected for functional enrichment analysis and the results declared the strong relation between methylation patterns o...

Bnar Shahab Hamad1, Bushra Hussain Shnawa1*, Rafal Abdulrazaq Alrawi2 

...ified as a significant parasite that should be prevented and controlled globally. This work investigated the immune response and apoptosis expression in hepatic cystic echinococcosis. Experimentally hydatid cysts infection of BALB/c mice was established, and the manifestation of immune actions and apoptosis were detected histopathologically and by immunohistochemical markers staining. The infected livers with hydatid cysts from the mice were processed for rout...

Tinda Afriani*, Endang Purwati, Yurnalis, Jaswandi, Mangku Mundana, Adisti Rastosari, Anna Farhana  

...mplified using the polymerase chain reaction (PCR) technique. Then the amplified products were sequenced. The results showed that the population of Pesisir cattle used in this study was polymorphic. There were 5 polymorphisms in the exon 9 and intron 9 regions, which were located at the 18 A>G, 213 T>C, +49 A>T, +232 A>C, and +252 G>A. There were 3 transition type mutations (at positions 8, 213 and +252) and 2 transversion type mutations (at pos...

Lobna M.A. Salem, Nashwa O. Khalifa, Marwa O. Abd El-Halim* 

...wide. Fasciola species parasitize a variety of mammals, caused by Fasciola hepatica, and Fasciola gigantica. Traditional morphological techniques to differentiate the two species can be inaccurate, especially when hybrid forms are present. The definitive identification of Fasciola species, including their hybrids, has been made possible by advanced molecular techniques. Our study aimed to estimate the prevalence of Fascioliasis and identify the phenotypic feat...

Jie Yang1, Wenjun Zhou2, Qi Zhang2, Lei Chu2, Zhenshi Chen1, Xiajun Zhang2, Weidong Wu3*, Shaoru Zhang1* and Lihui Wang1*

...analyzed. Thirdly, polymerase chain reaction (PCR) and DNA sequencing were used to analyze the genes related to AZM resistance (AZM-R), including 23s rRNA allele mutation, mtrR promoter and coding region mutation, rplD and rplV mutation. Finally, the clinical isolates resistant to AZM were typed by N. gonorrhoeae multiantigen sequence typing (NG-MAST). 388 clinical isolates of N. gonorrhoeae were identified, of which 373, 329, 298, 5, 11 and 5 strains were res...

S. M. Ashraful Karim1, Md. Shohel Al Faruk2* 

...einuria, and Glucose. Ultrasonography was performed to check the condition of the kidney. Increased levels of BUN, Serum creatinine, Proteinuria, and thickened cortex of the kidney confirmed that the cat was suffering from CKD. The diagnosis and management of CKD at all stages requires the use of substantial evidence-based guidelines and principles.

Keywords | CKD, Polyuria, Ultrasonography, Biochemical Parameters, U...

Rani Winardi Wulan Sari1, Novirman Jamarun2*, Suyitman3, Khasrad4, Elihasridas2, James Hellyward5, Gusri Yanti1 

...a apiculata) and native grass based on phytochemical contents, nutrient and cells fiber digestibility, rumen fluid characteristic, and gas production using an in vitro methodology. Samples of Hay Mangrove Leaves (HML) (Rhizophora apiculaca) and Native Grass (NG) were arranged into dietary tretmeants (Dry Matter (DM) Basic). The experimental design used is a randomized block design consisting of 4 treatments with 5 replicatio...

Nishim Bhusal1, Bhuwan Raj Bhatt2*, Saroj Shrestha3 and Arjun Chapagain4

...asciolosis is a common parasitic disease affecting cattle and other ruminants, commonly sheep, and caused by Fasciola hepatica and F. gigantica. The disease is cosmopolitan in distribution and can cause extensive economic losses to the farmers. A cross-sectional study was conducted to determine the prevalence of fasciolosis in commercial cattle farms of Tilottama Municipality, Rupandehi district, Nepal. A total of 270 fresh faecal samples were collected purpos...

Shahid Amin1*, Jabbar Khan1, Imran Khan2, Dost Muhammad1, Kamran Ullah Khan1, Naqeeb Ullah Khan1, Muhammad Azhar Jameel3 

...rs, Anemia 

...

Man Wang1 and Fengmei Yang2*

...significance of topoisomerase IIA in liver hepatocelluar carcinoma (LIHC) were analyzed to explore the possible mechanism of topoisomerase IIA in the development of liver cancer based on bioinformatics analysis. GEPIA, UALCAN, cbioportal and other tools were used to analyze the correlation between TOP2A gene expression and methylation, prognosis and immune cell infiltration in databases. The expressions of TOP2A gene and pro...

Muhammad Mudassar Shahzad1*, Hamna Rashid1, Syed Makhdoom Hussain2, Sana Bashir1, Fatima Khalid1 and Nisar Ahmad3

...catla fingerlings in contrast to the control and other test diets.

...

Adefunke Fadilat O. Ayinde1*, Peter Allison Johnston2, Olanrewaju Olusoji Olujimi3, Purnamita  Dasgupta4 and Dare  Akerele5

...states should provide infrastructure support to improve the cassava-based farmers’ adaptive capabilities to climate variability and reduce their vulnerability.

...

Sherif Abdelghany1, Hossam Mahrous Ebeid2*, Ahmed Abdelkader Aboamer2, Mohamed Ali Radwan1, Rania Agamy1 

... districts, where water grass (Echinochloa crus-galli) was the major fodder in both districts, followed by corn fodder and clover. The feed intake of concentrate and green fodder for fed buffaloes and cows was higher (P < 0.05) in Nile Valley district. A significant difference (P < 0.05) observed in daily milk and fat-corrected milk (FCM) yields between both districts. Cattle in all areas under this study showed a lower Fat : protein ratio than the optim...

Ayma Aftab, Samia Afzal* and Muhammad Idrees

...lying on real time polymerase chain reaction (RT-PCR) that can give false negative result. Nasopharyngeal samples from a 22 years old man were detected as negative for COVID-19 for consecutive three RT-PCR tests. Complete blood count (CBC), D-dimer, serum ferritin, eosinophil sedimentation rate (ESR) test, tuberculosis test, real time PCR and high-resolution computed tomography (HRCT) were done to rule out the cause of flu like symptoms. HRCT reveals a haze ar...

Shahid Iqbal1,2, Zulha Javed1, Mushtaq Hussain Zahid3, Qurat ul Ane Gillani4 and Furhan Iqbal1,*

...05), alanine aminotransferase (P = 0.04) and significantly increased mean corpuscular hemoglobin levels (P = 0.04) as compared to control group. Our results indicated that both leaf extracts had tendency to disturb the blood biochemistry of healthy male albino mice. The effects were more pronounced in mice orally treated with E. camaldulensis leaf extract for 15 days.

...

Zarnosh Habib1, Muhammad Ibrahim2*, Nasir Shah2, Israr Ullah3 and Norman Javed Gill4

...ts the effect of pupal parasitoid Dirhinus  giffardii on oriental fruit fly Bactrocera dorsalis (Hendel) at various host pupae depths (0, 1, 2, 3, 4 and 5 cm) in plant debris and at different host pupae ages (24, 48, 72 and 96 h) in laboratory at 25 ± 2ºC, 60 ± 5% relative humidity and a photoperiod of DL 14:10 h. The observations indicated a significant effect of different depths of host pupae and its age on the amount of pa

Bilal Saeed Khan1*, Muhammad Arslan1, Abdul Ghaffar2, Muhammad Farooq2, Saghir Ahmad3, Sami Ullah4 and Awais Rasool5

...eiidae, Macrochelidae, Parasitidae, Phytoseiidae, Uropodidae, and Bdellidae. Macrochelidae and Parasitidae were the most prevalent familities while Pachylaelapidae and Bdellidae were recorded in the lowest numbers. The abundance of soil-inhabiting mites with respect to different locations in various months revealed that maximum abundance of mite families were recorded from Kotla Gurmani (38.5) followed by Kot Chutta (37.0) d...

Hams M.A. Mohamed1*, Katreen K.G.2, M.W. Abd Al-Azeem1, Faysal A. Wasel2, Ahmed M. Abd-Eldayem3 

...pp. contamination. Polymerase chain reaction (PCR) using the Listeria iap gene identified 13 of the 22 isolates that were reported as biochemically positive Listeria spp. Eight isolates of Listeria monocytogenes were molecularly confirmed, while the remaining five were subjected to 16S rRNA sequence analysis and identified as L. innocua (three isolates) and L. welshimeri (two isolates). The antibiotic susceptibility profiling revealed multidrug resistance of L...

Reda Hassan*, Bahaa Abou-shehema, Sherif Zayed, Micheal Gorgy, Shama Morsy, El-Sayed Abu El-Hassan, Mahmoud El-Gbaly, Hanaa Basuony, Ebtehal Hassan 

...ons, alanine aminotransferase (ALT), aspartate aminotransferase (AST) activities and significantly (P<0.05) reduced the antibody titer against sheep red blood cells (SRBC), total protein, albumin values in broilers serum compared with ngative control. Aflatoxins supplementation significantly (P<0.05) increased malondialdehyde values in liver and significantly (P<0.05) diminished the reduced glutathione (GSH), glutat...

Phan Truong Khanh* and Tran Thi Hong Ngoc

...nd upgrade irrigation infrastructure and manage water allocation to meet for rice production.

...

Rezqita Putri Pitaloka1, Kartiawati Alipin1, Mas Rizky A.A Syamsunarno2, Gemilang Lara Utama3, Ramdan Panigoro2, Ratu Safitri1* 

...ne, deferiprone, and deferasirox have been used to treat iron overload, but their uses are inconvenient caused by their side effects. Therefore, the invention of an alternative chelating agent with a more efficient effect, convenient uses, and affordable is essential, which can be done with natural plants. Sappan wood (Caesalpinia sappan L.) contains active compounds, such as brazilin and flavonoid with the ability to chelate Fe. This study aims to determine t...

Chanathip Thammakarn1*, Sawanya Umphonphison1, Paitoon Kaewhom2, Kanokrat Srikijkasemwat1 

... further tested by polymerase chain reaction (PCR) to detect ORF2 gene. The results revealed that 81.17% of pigs had low positive level antibody against PCV2, while 10.29% had high positive titer. On the other hand 8.54% of pig had no antibody to PCV2. The low positive antibody level was found in most population in all farm sizes as well as all types of pig as in age categories. The PCR result illustrated that there was no viral gene in seronegative serum. Whi...

Agha Mushtaque Ahmed1*, Fahad Nazir Khoso1, Ali Zachi Abdulqader Alhilfi2, Sohail Ahmed Otho1, Qurban Ali3, Din Muhammad Soomro1 and Zubair Ahmed Soomro1

... L.) and mustard seeds (Brassica nigra L.). The effect of these oils was recorded on insect mortality, number of adult insects, seed damage (punctured seeds and weight loss of chickpea seeds), seed germination percentage, root length (cm) and seed vigour index. The insect mortality was recorded at different intervals such as 24, 48, 72 hrs and 1 week) and the results indicated that E. sativa gave a consecutively higher mortality at each interval, meanwhile the...

Emtiaz Ibrahim Ghoniem, Gaber Mamdouh Abdelgalil, Amira Farouk Gad* and El-Sayed Hassan Eshra

 
...ation of acetylcholinesterase (AChE), alkaline phosphatase (ALP), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities in T. pisana intoxicated with two sublethal doses of CuSO4 (0.25 and 0.5 of LD50) after 24, 48 and 72 h were examined. The results indicated that the LD50 values of CuSO4 were 166.5, 92.59 and 70.63 µg/g b.w for 24, 48 and 72 h, respectively...

Samantha Shiuan Erl Lee1, Nurul Huda2*, Yetti Marlida3, Eng-Keng Seow4 

...;

...

Md. Aminul Islam1*, SM Mostafizur Rahaman Sumon1, ANM Aminoor Rahman2, Fahima Khatun3 

...helmintics 

...

Monis Hussain Shah1*, Rizwan Rafique2,6, Munawar Almas1, Muhammad Usman3, Sadia Yasin4 and Sajida Bibi5

...9 Pakistan builds the infrastructure for agricultural development due to that; significant increase in production were observed during second, third and fourth development plan. Small land holdings, poor quality/low quantity of inputs and lack of crop improvement programs with respect to the disease, lack of disease and problem oriented research in major fruits such as Guava, Grapes and Banana. Addressing these challenges of fruit production industry can furth...

Umair Faheem1*, Madiha Mobeen Khan2, Qurban Ali3, Muhammad Jamil4, Wajiha Anum2, Mashal Rehman2, Imran Akhtar2, Mussurrat Hussain1, Qaisar Abbas1, Ghayour Ahmad5 and Abrar Ahmad6

...torious insect pests of Brassica crops in Pakistan and throughout the world as well. Host plant resistance is one of the most useful tools for the management of aphids in Brassica crop. This trial was executed at the farm of Regional Agricultural Research Institute, Bahawalpur to report the impact of aphid damage on yield and yield parameters on Brassica juncea. Five varieties/strains i.e....

Marwa S. Khattab1*, Ahmed H. Osman1, Huda O. AbuBakr2, Rehab A. Azouz3, Asmaa A. Azouz4, Heba S. Farag5 

... leather products. Ectoparasites are one of the major problems that hinder the quality of the skin and urge the use of insecticides to control them. One of the commonly used anti-parasitic drugs is ivermectin in many food-producing animals. This study investigates the harmful effect of ectoparasites, and the side effects of commercial ivermectin drugs on the quality of skin collected from ...

Rahman Ullah1*, Muhammad Junaid2, Nabila Gulzar2, Rahat Ullah Khan3, Baseer Ahmad4, Ambrina Tariq5, Aamir Iqbal6, Mushtaq Ahmed7 and Mirwaise Khan8*

...through scientific polymerase chain reaction (PCR) method including other microbiological laboratory techniques (Total plate count, Gram staining, Hydrogen sulphide, Citrate, Urease and Indole Tests). A high level of total plate count (TPC) and E. coli was observed from both raw and pasteurized milk. The results also indicated a high incidence of ETEC i.e. 63.63% and 50% in raw and pasteurized milk, respectively. The most occurring enterotoxins are ST-I and ST...

Khalid Farooq, Muhammad Tahir and Nazir Ahmad Khan*

...ing maize silage and ryegrass forage blend based fattening rations. Five diets containing maize silage and ryegrass in the ratios of 30:70; 40:60; 50:50; 60:40 and 70:30 on dry matter (DM) basis in the forage mixture were evaluated in comparison with a control/traditional diet. A total of 18 calves were allocated to the six experimental diets according to a randomized complete block designed and the dietary groups were balan...

Maha Mostafa1, Sohail Soliman1, Reham I. Mohamed2 and Wael M. El-Sayed1*

...eight in both sexes. It drastically affected the histology of testes and ovaries, causing a reduction in the sperm count and motility with a parallel reduction in the acid phosphatase activity. It also directly reduced the concentration of free testosterone and estradiol in both sexes without any apparent effect on LH or FSH hormones. It increased the total cholesterol in males only and elevated the triacylglycerols and glucose levels in both sexes. The admini...

Abdurakhim E. Kuchboev1*, Mehmonjon Kh. Egamberdiyev2 

...icta candacharica, Deroceras reticulatum and Candaharia levanderi. The infection rate of Pulmonata snails by protostrongilids larvae was 28.2% and that of slugs - 6.8%. In addition, the first informs of P. maydanica, C. levanderi and D. reticulatum as natural intermediate hosts for M. capillaris are given.

Keywords | Lungworms, Protostrongylids, Land molluscs, Morphological, Molecular identification, Prevalence 

...

Ghazala Nasreen1, Ali Hussain2, Komal Tayyab1, Muhammad Rashid3 and Sumaira Aslam1*

...), aspartate aminotransferase (AST, 30.25 ± 1.62 IU L−1) and superoxide dismutase (SOD, 19.75 ± 1.78 IU L−1) were recorded in the liver samples of the fingerlings of the treatment group T1, while the lowest corresponding figures were noted for the fingerlings of the treatment group T4. These values were lower than found in the control group having 10.50±0.23, 77.25 ± 1.19, 24.50 ± 0.96 and 18.25± 1.19 IU L&...

Umar M. Bello1*, Samuel A. Ojo1, Abdurrahman Ghaji1, Ambrose A. Voh (Jr)2, Muazu N. Bappah3, Casmir O. Igbokwe4  

... Metestrus phase showed drastic reduction in number of superficial cells and the proportion of leucocytes in smears began to rise while the desquamation of parabasal and intermediate cells with leucocytosis characterized the diestrus phase. In thermal study, there was significant (P< 0.05) difference in both mean rectal temperature (MRT) and mean vaginal temperature (MVT) values on day of estrus, the same not the case during the three other stages of the ...

Ibrahim Samir Abd El-Hamid1, Alaa Emara Rabee2, Moustafa Mohamed M. A. Ghandour2, Rasha Salah Mohammed3, Ahmed Mohamed. Sallam4 

...ever alanine aminotransferase, cholesterol, total antioxidant capacity and glutathione peroxidase levels were reduced (P≤0.05) in both treated groups. It can be noted that, supplementing of plant herbs mixtures had positive effects on some reproduction and immunological traits in goat males under heat stress conditions.

 

Keywords | Herbs additives, Quebracho tannins, Antioxidants, Sperm quality, Damascus goats. 

...

Jin-Ming Zhao1,2, Yun Fang2 and Yue-Hua Sun2*

...demic Chinese grouse (Tetrastes sewerzowi) is categorized as class I national protected animal species in China. Lower breeding performance has been suggested as a main factor influencing the population viability of Chinese grouse. Nest predation, which might be time-varied, is a main contributor to the nest failures of Chinese grouse. Therefore, it is urgent to estimate nest age of Chinese grouse accurately before taking appropriate conservation actions. In t...

Hanaa H.A. Gomaa1*, Shimaa A.S. Hasan1, Nashwa Harb1, Amal H.A. Gomaa2 and Maha Anani3

...LISA and real-time polymerase chain reaction (RT-PCR) techniques. Our findings revealed a very high frequency of HSV-1 and 2 infections among the studied pregnant women with percentages of 74.5% and 98.9%, respectively. Upon the interpretation of the HSV serological profiles, the past latent infection with HSV-1 and 2 were the most prevalent types of infection representing 74.5% and 92.5%, respectively, followed by HSV-2 recurrent infection which was more prev...

Rubab Malik, Nasira Khatoon* and Samina Waheed

...prevalence of nematode parasites in different birds of Karachi, Hyderabad, Jacobabad and to find out the histopathological changes caused by Heterakis gallinarum in the intestine of common quail. The overall prevalence of nematodes parasitic infection was 7.48% while the overall intensity was 9.62. The histopathological study revealed complete destruction of villi and crypt glands. The intestine showed heavy infiltration of ...

S. Samina and Y.I. Erum†

...the diversity of plant parasitic nematodes at different locations of Kurram Agency, Pakistan. For this purpose, surveys were conducted and 150 samples of root and soil were collected from different locations of Kurram Agency. The detail morphological and taxonomical studies revealed a total of 26 species of plant parasitic nematodes belong to 17 genera, 13 families, 15 subfamilies and 3 orders while free-living soil nematode...

R. Hadadfar1, E. Mahdikhani-Moghadam2†, S. Baghaee2 and M. S. Bajestani1

... pistachio gardens of Khorasan Razavi Province of Iran, 50 soil and plant samples from pistachio roots rhizosphere (Depth 30-50 cm) were collected during years 2016-2017. Samples were transferred on ice to laboratory and nematodes were extracted by centrifugal methods. Psilenchus species were identified on morphological and morphometrical characters based on recent valid keys. Seven species from Psilenchus genus were identified viz., Psilenchus curcumerus, P. ...

H. M. Hassan, M. M. Tantawy*, A. M. Younes and M. O. Sayed

...he prevalence of plant parasitic nematodes in Maghagha, Samallot, Minia and Abokorkas Districts of Minia Governorate. Soil and root samples were collected during fruiting seasons of grapevine in 2012 and 2013. The nematodes encountered were identified as Meloidogyne spp., Helicotylenchus spp., Longidorus spp., Pratylenchus spp., Tylenchulus semipenetrans and Hoplolaimus spp. Community analysis of these plant parasitic nemato...

W. M. El-Nagdi,1†, Z. , E. Ghareeb2 and E. M. Zayed3

... to M. incognita; in contrast Starmon genotype had highly susceptible reaction while Jary, Mnro andVorosch genotypes had moderately resistant. Fodder root yield was positively and significantly correlated with root weight; meanwhile, it was negatively and significantly correlated with damage index and gall index, respectively. These findings indicate that selection for root weight and infestation involved in this study affected the variability of root yield. S...

F. Shahina†, K. Nasira, K. Firoza and Y. I. Erum

...exed resource of plant parasitic, soil, marine and entomopathogenic nematode species described and reported during last sixty nine years (1952-2019) from Pakistan. The information compiled in this paper came gradually from many and diverse sources. It is the product of the efforts of several authors who contributed to gather knowledge on the biological diversity through systematics and faunistic studies. Information published in different scientific journals, ...

M. Israr1†, M. Habib1 and K. Nasira2

...a provinces. The plant parasitic nematodes were extracted from soil samples by Cobb’s sieving and decanting method (Cobb, 1918) followed by modified Baermann technique (Baermann, 1917). After processing, the nematode genera and species were identified (Siddiqi, 2000). Tylenchorhynchus usmanensis is reported from the first time from Pakistan is briefly redescribed and illustrated.

...

Y. Danso†, J. Adomako, K. Osei and B. Abugri

...ieties to M. incognita parasitism between May and July 2017. A pot experiment was carried out in a Completely Randomized Design with five replications. Meloidogyne incognita eggs @ 2000 eggs were applied per plant. Mamaba, Obaatanpa and Abeleehi maize varieties exhibited resistance potential by suppressing reproduction, development and establishment of the obligate parasite. Gall index, stem girth, plant height and shoot dry...

Hira Anwar1, Muhammad Jabran1,3, Anam Moosa2, Usman Arshad2, Abdul Haseeb1, Abdul Jabbar1, Muhammad Burhan4, Amjad Abbas1, Muhammad Naveed5 and Muhammad Amjad Ali1*

...align: justify;">Plant-parasitic nematodes (PPNs) are a serious threat to food security. Root-knot nematodes (RKNs) are important plant parasitic nematodes that affect vegetable crops worldwide including okra. Among the RKNs, Meloidogyne incognita [(Kofold and White) Chitwood] is one of the major constraints to okra production. In this study, the effect of different bacterial strains i.e., Bacillus sp. MN54, Enterobacter sp....

Muhammad Shahid Nadeem*, Jalaluddin Azam Khan and Firoz Anwar

...ate, alanine aminotransferase (ALT) is an enzyme which operates at the cross roads of amino acid and carbohydrate metabolism. The enzyme has been reported from a wide range of organisms including animals, plants, fungi and microbes. The enzyme has a clinical applications in the diagnosis of many diseases. In the present study we have produced a recombinant of ALT from Pyrococcus abyssi in BL21 (DE3) strain of E. coli. The recombinant enzyme was purified by ani...

M. Israr1, F. Shahina2† and K. Nasira2

...nd the roots of turnip (Brassica rapa L.) plants collected from Mianwali, Punjab, Pakistan. Aphelenchoides turnipi n. sp. belongs to the Group 2 of Aphelenchoides species sensu Shahina with one or sometimes two mucronate structures in female tail terminus and is characterized by small body size (0.29-0.38 mm); two lateral incisures in the lateral field; small stylet with minute basal swellings (stylet: 7-9 μm); vulva at 67-69 percent of body, tail short wit...

S. Aatika, K. Nasira and F. Shahina†

... recent study of plant parasitic nematodes, the following species of nematodes were encountered from maize and
its adjoining crops from Punjab, Pakistan. New species Filenchus maqbooli n. sp., characterized by small body with
short stylet and tail long, filiform has been described. Five new record species of plant parasitic nematodes viz.,
Helicotylenchus certu...

I. K.A. Ibrahim1, Z.A. Handoo2† and A. B. A. Basyony1

.... leuceilyma on Bermuda grass, H. lespedezae on lentil, H. goldeni on
qasabagrass, H. schachtii on cabbage and sugar beet, H. zeae on corn and wheat and Globodera rostochiensis on
potato. The cyst nematodes H. leuceilyma and G. rostochiensis are new records of the country and H. lespedezae on
lentil is a new host plant record in Egypt.
...

M. Behdani1†, F.J. Afshar2, M.R. Mirzaee1

...targaz region), South Khorasan province of Iran infected with root-knot
nematode. On the basis of perineal pattern the nematode was identified as Meloidogyne javanica and is the first
report on B. vulgaris in Iran.
...

C. C. Famina1†, A. Usman2 and M. K. M. Nasser1

...ion densities of plant parasitic nematodes in soil
samples associated with banana (Musa paradisiaca), a survey was conducted in the Kondotty Taluk of Malappuram
district, Kerala, India. A total of 12 genera of nematodes including six commonly occurring nematodes in the banana
rhizosphere, three new records from banana and one new unidentified genus were obtained during the survey. Two

Öznur Özil*, Öznur Diler, Mevlüt Nazıroğlu, Aşkın Atabay 

...etween 1-75 cysts. The parasites were determined encysted in the base of the fins, muscle, inner wall of the operculum, gill arches, lips, upper jaw, body cavity and palate, forming small 2-3 mm diameter white-yellowish nodules, easy to detect in macroscopical observation. The highest prevalence of the metacercariae was in C. complanatum with 59.73% in gill tissue. The parasites were found encapsulated by a thin connective t...

Nadia A Eltablawy1, Ibrahim El Tantawy El Sayed2, Hamed Mohamed Abdel Barry2, Marwa A. Ibrahim3*, Maha Nageib Ahmed Serag ElDein2 

M. Bajestani1†, E. Moghadam2 and K. Dolatabadi3
...rjand cities ten plant parasitic nematodes
species were identified on morphological and morphometrical characters viz., Boleodorus thylactus, Filenchus
cylindricaudus, Geocenamus tenuidens, Irantylenchus clavidorus, Merlinius brevidens, M. communicus, M.
pistaciei, Neopsilenchus magnidens, Pratylenchus neglectus and Zygotylenchus guevarai. Among these species M.
communicus and M. pist...
M. M. A. Youssef† and W. M. A. El-Nagdi
...the most periods. In contrast,
plant growth parameters were higher for dry bean plants replacing uprooted sugar beet than parameters for plants
replacing cutting sugar beet.
...

K. A. Tabassum, F. Shahina†, K. Nasira and Y. I. Erum

...of the genus Oscheius Andrassy, 1976 viz., Oscheius citri n. sp., O. cynodonti n. sp., O. cobbi n. sp.,
O. esculentus n. sp., O. punctata n. sp. and O. sacchari n. sp., are described by both morphological and molecular
means from different agro-climatic regions of Sindh, Punjab and Azad Jammu & Kashmir, Pakistan. All species
belong to insectivora group on the basis of leptoderan bursa, crochet needle-shaped spicules, nor...

I. K. A. Ibrahim1 and Z. A. Handoo2

...y-three genera of phytoparasitic nematodes were detected in the
collected soil and root samples. In soil samples from Alexandria governorate, the sugar beet cyst nematode
(Heterodera schachtii) was very common on sugar beet while the root-knot nematodes Meloidogyne incognita and
M. javanica were very common on guava, olive trees and sugar beet. Helicotylenchus pseudorobustus, M. incognita,
...

A. Sattar1, †, A. Khan2, N. Khatoon1 and A. Mujahid3

...occurrence of helminth parasites in catfish
species belonging to family Ariidae (Blecker, 1862). Four species of catfishes namely Arius arius (Hamilton, 1822),
Arius caelatus (Valenciennes, 1840), Arius dussumieri (Valenciennes, 1840) and Arius sona (Hamilton, 1822) off
the Karachi coast were screened for the occurrence of helminth parasites. Fish were examined after washing
co...
A.W. Aseffa1, F. F. Addisu2, G. N. Roge3, L. T. Hadis4, T. B. Abera5, M. G. Gero6 and B. H. Meressa1†

S. Riffat†, S. Kumar and A. Soomro

...="text-align: justify;">Grasshoppers are subjected to attack by a wide range of predators and parasites at all stages of their life cycle. Fecundity of these predators and parasites of the insects was affected when grasshoppers were contaminated with Mermis spp. Mostly, the females laid fewer eggs than normal. The numbers of eggs produced were 17.5&plusm...

S. Ahmed†, A. Munir, S. Hameed, S. Asad, M. Fayyaz, M. Zakaria and M. Umer

... eight genera of plant parasitic and soil nematodes. The most frequently isolated
nematode population from all the soil samples were Tylenchorhynchus sp., Xiphinema sp., and Cephalobus sp.
Prevalence of nematodes were high in districts Mandi Bahauddin and Gujranwala with soil cropping history of
maize and rice cultivation.
...

S.A. Khan†, M. Abid and F. Hussain1

...m, Padina
tetrastromatica and Melanothamnus afaqhusainii showed maximum egg hatching (96%) and larval mortality (99%)
and (100%), respectively in water and methanol extract @ 10% concentration after 72 hours exposure time.
Similarities between Ward’s cluster analysis of hatching egg and larval mortality in water and methanol extract of
different seaweeds showed significant difference. Methanol extract was m...

H. Ravindra†, M. Sehgal*, A.S. Pawan, B.S. Archana, S.A. Shruti and H.B. Narasimhamurty

... growth parameters with drastic reduction in root-knot index.
However, the treatment combinations of acasia compost with different bioagents performed well with highest
growth shoot, root length, root weight, yield and lowest root-knot indices. Among the integrated treatments, P.
lilacinus with acacia compost recorded maximum growth parameters and yield with least root-knot index. In
cont...

Z. Gill and K. Firoza†

...that twenty five plant parasitic and seven free-living soil nematode species associated
with date palm plantations in district Khairpur, Sindh, Pakistan. Population density and frequency of all nematodes
varied considerably at all surveyed sites. Occurrence of plant parasitic nematodes was found high at Gambat
(33.3%) and low in Kingri (15.38%). In free-living soil nematodes Nara has found...

M. Shahi-Bajestani† and E. Mahdikhani-Moghadam

...f Razavi and Northern Khorasan provinces resulted 16 species of
nematodes viz., Psilenchus curcumerus, Ditylenchus apus, D. medians, Basiria gracilis, B. graminophila,
Aphelenchus isomerus, A. avenae, Boleodorus thylactus, Zygotylenchus guevarai, Pratylenchus thornei, P.
neglectus, Irantylenchus clavidorus, Neopsilenchus magnidens, Neopsilenchus paragracilis, Nothotylenchus
ferepolitor, Filenchus pratensis. Among...

M.M.A. Youssef and A.M.S. Lashein†

...ol infested with plant parasitic nematodes, Rotylenchulus
reniformis and Helicotylenchus sp. An experiment was carried out to investigate the efficacy of acetyl salicylic
(ASA) and γ-amino-n-butyric acids (GABA) as chemical resistance inducer at the concentrations of 5, 10 and 20
mM against nematodes and consequently on date palm yield. The results showed that number of R. reniformis in soil
and roots and H...

Belema Robert1, Favour Welenya1, Deborah Achi1, Cynthia Onyeagwara1, Soala Obie Minimah2, Ebele Anulika Obichi2, Chidinma Charity Amuzie1* 

...rcoralis is a nematode parasite causing the disease condition referred to as strongyloidiasis in man. Part of its life cycle is spent on the soil qualifying it as a geo-helminth. This research examined the geo-helminth species associated with selected edible vegetables from markets and farms in Port Harcourt metropolis, Nigeria. Methodology: Vegetables (fluted pumpkin leaves, waterleaves, bitter leaves and scent leaves) were purchased and harvested from select...

Jax Vincent Gamulo, Maye Pearl Bolina, Jessica Serena Brion, Via Crishiela Nicole Dela Rosa, Roxanne Francesca Maglaya, Carl Lexter Tan, Aimee Caye Chang* 

...terborne and foodborne parasitic disease, involving species Fasciola hepatica and Fasciola gigantica. This systematic review with meta-analysis (SR-MA) explored the potential of phytotherapy against fascioliasis and as alternative to commercially available anthelmintic drugs. Eligibility criteria for inclusion and protocol was defined for systematic publication database searching. Final reference database consisted of eight (8) published journal articles with ...

Rinat Islamov*, Dinara Turegeldieva, Altyn Rysbekova, Kuralay Sarmantayeva, Victor Semenuyk 

...rats were realtime polymerase chain reaction and enzyme-linked immunosorbent assay. A high prevalence of some pathogens among conventional laboratory animals used by some academic institutes and universities of Almaty has been shown. Rodentibacter pneumotropicus has been detected in the SPF animals, while no other pathogens from the FELASA list have been detected. The obtained results show the importance of not only regular health monitoring, but also the need...

Rukhsana Anwar1*, Ammara Abd-Us-Sattar1, Afifa Noor2, Kanwal Ashiq1,3 and Shah Jahan4 

... and glutathion S-transferase. For this purpose, different cytochrome (CYP450) modulators were selected to determine pharmacokinetic interactions. Cimetidine, rifampicin, dexamethasone, and tamoxifen were selected as CYP450 modulators. In a sub-acute in vivo study, 200 mg/kg BW of both extracts were orally administered once daily for 19 days to different groups of rats. CYP modulators were administered to respective groups for last 5 consecutive days. Real-tim...

Ronny A.V. Tuturoong1*, Sony A. E. Moningkey1 and Nova L.I.M. Ogi2

...n corns stover and king grass on Holstein Friesians (HF) Dairy cattle. Twenty-one HF (2.5-3.5 years old, weighted 250-300 kg) was adapted for 2 weeks by feeding with experimental feed. The experimental feed was formulated into three combinations: T1 (70% corn stover+0% king grass+30% concentrate; T2 (35% corn stover+35% king grass+30 % concentrate; T3 (0% corn stover+70% king g

Kalsoom1, Nasir Shah2, Muhammad Ibrahim3*, Tahira Bibi1, Kazim Ali4 and Zahir Shah2

...arieties were grown on Murashige and Skoog (MS) media subjected to (0, 25, 50, 75 and 100 mM) of Sodium Chloride (NaCl). Potato varieties showed an adverse in vitro growth response to all levels of salt in MS media, while plants of all the tested varieties were dead at concentrations more than 50 mM of NaCl in in vitro condition (75, 100 mM). Variation was observed in the level of tolerance to salinity in these potato varieties. Increasing NaCl (mM) level redu...

Ayesha Bakhtiar1, Sardar Azhar Mehmood2, Abdul Rauf Bhatti3*, Shabir Ahmad2, Naqash Khalid2, Javed Iqbal5, Azra Nadeem4 and Waqas Ahmad1

...bution, communication infrastructure, and climate.

...

Sofiane Tamendjari1,2*, Farida Bouzebda Afri1,2, Lina Chaib1, Hebib Aggad3, Zoubir Bouzebda1,2 

... in the wilaya of Souk Ahras with respect to these strains, and to evaluate their degrees of resistance to certain antibiotics used in human and veterinary medicine
A total of 90 samples of sheep, chicken and turkey meat were collected and analyzed. Modified Baird-Parker medium was used for enumeration and isolation of strains, free coagulase and thermonuclease tests were performed as well as other biochemical tests. Antibiotic susceptibility testing wa...

Asmatullah Kaka1*, Wahid Haron2, Nurhusien Yimer3, Abdullah Channo1, Ali Raza Jahejo2, Mahdi Ebrahimi3, Dildar Hussain Kalhoro4 

...some integrity with contrast-phase microscope (eosin-nigrosin staining) was investigated. Moreover, superoxide dismutase (SOD) assay, a fatty acid composition with gas chromatography and lipid peroxidation TBARS (Thiobarbituric acid reactive substances) content were used for oxidative stress evaluation. Frozen-thawed results showed significant (p < 0.05) enhancement in all sperm parameters with 10 ng/ml of DHA supplementation. DHA improved (p < 0.05) SO...

Majid Ali*, Hafiz Abdul Majid, Farman Ullah, Tahir waseem, Muhammad Rashid Khan 

...gainst blood protozoal parasite.

Keywords | Epidemiology, Haemoprotozoan, Small ruminants, Arid zone, Kohat. 

...

Laveena Shekhawat, Sheethal S* 

...ion: Hydatid cyst is a parasitic infection caused by Echinococcus granulosus commonly termed as dog tapeworm. However, man is an accidental host and develops symptoms of the disease in organs where the eggs get lodged, the most common being the liver. Case report: A 29-year-old male presented with pain in the right upper quadrant with radiation towards the back along with abdominal fullness for 5-7 days. Physical examination and imaging investigations were per...

Muhammad Furqan1*, Zulfiqar Ali1, Muhammad Mudassar Shahzad2, Rida Ahmad1, Haqnawaz Yousaf3 and Imad Ul Din Zangi4

.... Nests were made up of grasses and leaves of cheer pine. The clutch size of seven eggs was recorded from two nests. The eggs shell was buffy white or creamy, oval shaped, elongated and pointed towards one end. Camera trap recorded the hatching activities on 15th July 2020. It was observed that incubation period varied from 22-25 days. Hatching rate was 100% and 85.71% while survival rates 57.41% and 49.98 % were recorded for two nests, respectively.
...

Eman S Ramadan, Mohamed E Ali, Mohamed A Elkhiat 

...xamination, abdominal ultrasonography, serum biochemical analysis as well as rapid feline infectious peritonitis (FIP) test and Rivalta test for the diseased cats. On basis of these results, six cats diagnosed with feline infectious peritonitis (effusive form) involving liver injury. Serum microRNA-122 was estimated by real-time polymerase chain reaction in all cats. Effusive form of FIP with liver injury was manifested by a...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel4, Abdelwahab M. Abdelwahab1,5
...linear and quadratic contrasts of increasing the BSFL levels on all the parameters. The results of this study showed a linear improvement (p < 0.05) in the egg production (by 3.38 percent points than control), egg weight (by 1.54 g than control), feed conversion (by 20% than control), and egg quality traits, such as Haugh unit, yolk color, shell strength, and shell thickness, with the increase in the BSFL inclusion levels into the layer diets. The BSFL trea...

Tariq Mahmood1*, Mamoona Wali Muhammad2, Sami Ullah1, Bilal Ahmad3, Zarmina Aslam4, Naveed Ahmad Khan5, Muhammad Shahzaib Tariq6, Muhammad Ali Raza6, Rana Usama Iqbal7 and Samia Zain8

...ly modified crops, and parasites are among the main threats to these pollinators. As a result of their decrease, there has been a significant loss of ecological activities, negatively influencing the global economy. This work covers the management of foraging activities, factors influencing this behavior, foraging preference, subspecies variations, monitoring approaches, and the need of preservation and conservation of these essential pollinators. To determine...

Bashir Ahmad1*, Ali Muhammad Yousafzai2, Waqar Ali1, Ikram Ilahi1, Farman Ullah3, Saeed Ahmad1, Ayaz Ali Khan1, Umair Ahmad2 and Hafsa Maria2

...ly. The results were contrasted with those of the common hepatoprotective medication silymarine (50 mg/kg body weight). When contrasted to toxic control rabbits, the highest dose of garlic aqueous extract i.e. 300 mg/kg b.w excellently decreased the high serum rates of alkaline phosphatase (ALP), alanine transaminase (ALT), and aspartate transaminase (AST). The outcomes of the extract-treated rabbits were comparable to those...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Mohammad A. Al-Mahaish4, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel5
...r diets up to 6%. In contrast, some traits of carcass composition and meat quality as well as physiological parameters deteriorated when adding higher levels of the MWM (8-10%) to the diets, compared to the control. Economically, there was a linear and quadratic (p < 0.05) decrease in the protein cost of the diet and a linear increase in birds’ total revenue and profit margin in response to increasing MWM levels in the broiler diet. However, MWM linea...

S.H.M. Faruk Siddiki1*, Md. Golam Morshed2, Md Robiul Karim1, Lutfun Naher1, Md. Sodrul Islam3

...jor diagnostic groups. Parasitic diseases (30.16%), infectious diseases (21.84%), general systemic states (20.12%), digestive disorders (18.55%), gyneco-obstetrical diseases (4.37%), and surgical cases (3.06%) were recorded as major clinical problems, with other diseases having a prevalence of less than 1% for each. Among the ten categories, the prevalence of parasitic diseases, infectious diseases, general systemic states, ...

Zarema Alimsultanova Magomedova1, Kheda Khalitovna Dadaeva1, Roza Said-Akhmedovna Zakhkieva1, Islam Khasanovich Shakhbiev1*, Boris Kazievich Laipanov2 

...ogical studies of soil, grass and water samples in the lowland, foothill and mountainous zones of the North Caucasus region (Chechen Republic) revealed a different degree of their infection with eggs of nematodes of the genus Nematodirus Ransom, 1907. In the lowland zone of the Chechen Republic, 37.50% of soil samples, 23.00% of water samples were contaminated with invasive elements, respectively, in the foothill zone, 41.00% and 26.50% of samples, in the moun...

A. Yu. Aliev1*, A.A., Aliev1, A.M. Musaev1, M.Z. Magomedov2 

...mained homogeneous, pale raspberry colored, with a dubious (+) - it contained traces of the formation of the color of raspberry jelly. To detect latent mastitis in sheep, we proposed the rapid test of the A1 test, which is an aqueous solution of sulfanol and cresol red. Unlike a 2% mastidine solution, it is more sensitive. We also recommend for the treatment of serous mastitis in lactating sheep, intramuscularly administer D...

Muhammad Humayun Kabir* and Md. Saiful Islam

...arming abilities. In contrast, 59.55 % of farmers thought the same for public sectors extension. The independent sample t-test explored a significant difference between public and private extension services regarding farm and home visits, demonstration, and training programs. These services of public extension organizations were more effective than the private sector. The public extension organizations should strengthen their services that were not more effect...

Ayaz Ahmed1*, Muhammad Zulfiqar1 and Saadutullah Khan2

...ese were lack of road infrastructure, communication, storage and market facilities, no information about product price, negative role of middleman and informal money lending process. Based on these findings this study made following recommendations. Road, communication and storage facilities should be built in the study areas. Villager’s access to information about certain NTFP price and its market should be enhanced through radio and other media. Forest...
Safika1*, Ni Luh Putu Ika Mayasari1, Juliadi Ramadhan2
..., bacteria, fungi, and parasites can cause feline respiratory conditions. Antibiotics can be used to treat diseases caused on by bacterial organisms. This research aims to determine antibiotic resistance and the gene coding for antibiotic resistance in Klebsiella pneumoniae isolated from clinical cats in Bogor, Indonesia. This study’s total sample comprised of 58 clinical cat laryngeal swabs. Samples were isolated and biochemically and molecularly identi...

Hussein Jabar Jasim1*, Amer Murhum Al-Amery2

...ST, ALP, and GGT. In contrast, the serum total albumin showed a significant decrease in infected buffaloes. Moreover, the results of the gross pathological examination revealed that cirrhosis and paleness of the liver with multiple abscesses appearing as pale necrotic areas, as well as thickness and calcification with fibrinous exudates of bile ducts, were the most frequent gross lesions. Meanwhile, the histopathological examination showed hyperplasia, fibrous...

S. A. Khanzada, M. Naeemullah, A. Munir†, S. Iftikhar and S. Masood

...hizospheres. Six plant parasitic and six saprophytic nematode genera were found associated with mint rhizosphere. Tylenchorhynchus spp., was found to be associated wi...

W. Khan, N. U. Nisa, A. Khan and S. M. H. M. Naqvi

...of nematode intestinal parasites among individuals relevant to education under and above 15 years age in Swat, Pakistan. Stool samples were randomly collected during January 2006 to December 2008 and examined from a total of 420 individuals including 238 and 182 under and above 15 years age, respectively from Urban and Rural area of Swat, Pakistan. The techniques used were wet mount (WMT), sedimentation and centrifugation. A number of 171 individuals were foun...

D. S. Srivastava, M. Sehgal†, A. Kumar, S. Verma, B. K. Dwivedi and S. P. Singh

...e infestation of plant parasitic nematodes associated with vegetable growing fields i.e., tomato and okra. Soil and root samples were collected from 238 tomato fields represents 16 different locations (villages) where TSS-1 to TSS-238 varieties and 227 soil and root samples from the okra fields were collected (OSS-1 to  OSS-227) represents 16 different locations (16 villages) to identify the hot spots of plant-parasitic...

Saima Akter1, Md. Rasel Prank1, Shariful Islam1, Sharmin Akter1, Injamamul Hasnine1, Murshed Uddin Ahmed2, Md. Shohel Al Faruk3* 

...icant economic factor. Parasitic infestations create a risk that impairs the livestock industry. The objective of this study was to determine the prevalence and factors of parasitic infestation of cattle in the Livestock Office and Veterinary Hospital, Ullapara, Sirajganj, Bangladesh. A total of 121 fecal samples were collected and examined through a direct smear to detect the presence of the egg and oocyst of pa

Mohamed S. Abbas1*, Adel E.M. Mahmoud2, Hemat S. Mohamed3, Adam Cieślak4 and Małgorzata Szumacher-Strabel4

...f dietary forge plants (grasses, legumes and forbs) contents and concentration on ruminal fermentation, pH, ammonia (NH3), total gas production (TGP), methane and volatile fatty acids (VFA) concentration. Twenty-six wild palatable forage plants were identified and analyzed for pH, NH3, TGP, methane and VFA. The results indicated that in grasses the highest pH and NH3 concentration was found in Aeluropus lagopoides, TGP in Am...

Esam A Razin1, Hassan Sobhy2, Tarek R. AboElnaga1, Asmaa A. Darwish1*, Rasha S. Mohammed1

.... For this purpose, 28 parasite-free female rats were used, seven non-infected (control group (CG)), while the others were intraperitoneally injected with T. evansi and then equally divided into Trypanosoma Group (TG): which remained without treatment. Diminazene aceturate group (DAG): injected with Diminazene aceturate (3.5mg/kg) at 0, 14th, and 28th days. Basil group (BG): treated with essential oil of basil (850μL/kg) at 0, 14th, and 28th days. Blood sam...

Trisiwi Wahyu Widayati1*, Aris Triyono Syahputra2, Andoyo Supriyantono1, Onesimus Yoku1, Deny Anjelus Iyai1, Priyo Sambodo1, Iriani Sumpe1 

...oil around the yard by parasites from pig feces and urine. The study was conducted in Minyambouw District, Arfak Mountains Regency on 30 local pigs with a body weight of 10-15 kg and a minimum EPG of 2000, before and after the application of laleken. Stool samples come from fresh feces. Water samples were collected from pools around the farmer’s house in both systems, vegetable samples were collected from three points ± 0 m, ± 1 m, and &plu...
Ferzana Bhatti1, Fiaz Hussain2, Zain ul Abdin1*, Muhammad Arshad1, Saqi Kosar Abbas2 and Muhammad Zeeshan Shabbir3
...om injection by an ectoparasitoid, Bracon hebetor (Say) (Hymenoptera: Braconidae) in inducing paralysis and developmental arrest in its host, Galleria mellonella (L.) (Pyralidae: Lepidoptera) was studied. Bioassays were performed with microinjections carrying crude and diluted venom and secretion of Dufour’s gland of B. hebetor into healthy and mature host larvae. To observe the effects of venom injection on development of paras<...

Hasnain Raza1,2, Qun Liu1*, Muhammad Tariq Hanif2 and Yanan Han1

...eromorus commerson and Parastromateus niger were overfished and Lutjanus argentimaculatus was strongly overfished. However, all the stocks were subjected to overfishing. Therefore, the parameters estimated from our study may be used as indicators for the sustainable management of the fisheries in the country.

...

Songruo Tao1, Cuiyi Liao1, Jinju Peng1, Yuexia Ding1,* and Yi Ma1,2,*

...tergenic consensus-polymerase chain reaction (ERIC-PCR) method. The results showed that the number of Operational Taxonomic Units (OTUs) types decreased with the increase of florfenicol concentration, and the percentage of OTUs number to bacteria were the lowest at 100 mg·kg-1 florfenicol concentration after 21d treating, which was 8.33%. The phosphorus-solubilizing bacteria were amplified by ERIC-PCR after 21d treating, the fingerprint type of ERIC-PCR...

Rahmat Ullah Khan1*, Karim Gabol1, Asif Sadam2, Waheed Ali Panhwar3, Hamidullah4 and Abdul Rahim1

...tructed using local dry grasses (48%) followed by crop leaves (35%), plastic string (10%), and unidentified materials (7%). The average outer diameter of the nest 12.00±1.1 cm, inner diameter 9.13±2.3 cm and inner cup depth was 4.99±2.1 cm. This bird has one brood per season. Overall breeding cycle lasted for 90 days. The shape of the eggs was oblong and white pinkish, with darker red spots. The average incubation and nestling periods were...

Muhammad Sohail1* , Zubair Ali1, Hamidullah1, Yasir Amin1, Mehwish Malik1, Said Sajjad Ali Shah2 

...ce of Gastrointestinal Parasites in Small ruminant was found highly significant (p-value˂0.001). Mixed infections were more pronounced in Kaghani sheep (33.5%) followed by Rambouillet (31.3%), Angora (28%), Beetal (23.5%) and Ramghani (21.1%). It was found that mixed infections were more pronounced (32.4%) in females as compared to males (16.9%). The Strongylus was higher (20%) followed by Eimeria (12.3%) and Haemonchus (8.2%). It is evident from the results ...

Shabana Memon1*, Aamir Ali Abro1, Muhammad Iqbal Jakhro2, Aqsa Farid3, Maliha Habib4, Maqbool Ahmed5, Liaquat Ali Bhutto6, Saba Ambreen Memon7 and Muhammad Farooq8*

... and shoot fresh weight drastically decreased under laboratory conditions due to osmotic stress. The genotype SDW-3 showed the greatest decrease under increased osmotic stress brought on by PEG-6000 (-5.0 MPa). As a result, the genotypes AST-1(V1), SDW-1, and SDW-2 may be employed in future breeding programmes and are drought resistant.

...

Imdad Hussain Soomro1, Gulfam Ali Mughal1, Naeem Rajput1, Rameez Raja Kaleri2,6*, Deepesh Kumar Bhuptani3, Raza Ali Mangi4, Ghulam Mustafa Solangi5, Sheva Dhari6, Abdul Wahid Solangi6 and Zoya Parveen Soomro

...as fed with fresh maize grass and Group B was fed with maize feeding silage). After completion of 2 months trail results was collected and analyzed. The result for weekly weight gain statistical analysis showed that non-significant (P≥0.05) difference between groups from 1st to 4th week. However, showed significant (P≤0.05) effect was recorded from fifth week to eight week of age, respectively. Final weight was also significantly higher in B group when c...

ASIMA BANO1, HAFIZ MUHAMMAD TAHIR*2, AROOSA RASHEED3, MUHAMMAD ARSHAD4, SHAFAAT YAR KHAN1 & RABIA YAQOOB5

...vels of non-specific esterases in breast cancer patients. For study blood samples were collected from various diagnostic laboratories of Sargodha city. Levels of non-specific esterases were determined in the normal and breast cancer patients. The levels of non-specific esterases were higher in healthy individuals than the breast cancer patients. So, levels of non-specific este
ASMA ABDUL LATIF*1, SAMREEN MUSHTAQ1, SABIHA FAZAL1, MUHAMMAD MANSHA2, & ATIF YAQUB3
... a neglected protozoan parasite commonly infects humans worldwide. One third of human population has become victim of T. gondii and its infection in pregnant women has serious consequences on women as well as on fetus health. Present study was conducted to assess the seroprevalence of Toxoplasma gondii among pregnant women of Lahore, Pakistan.
239 blood samples of pregnant women were collected from Lady Walingdon hospital, Lahore along with other d...

Subramaniyam Suresh, Saravanakumar Marimuthu*, Prashanth D’Souza 

...z. aspartate aminotransferase (AST), alanine transaminase (ALT), and gamma-glutamyl transferase (GGT). Results revealed that 4% FCM was numerically improved on week 1 (0.11), week 2 (0.46), week 3 (0.56), and week 4 (0.54) as compared to baseline in PTF supplemented group. Milk fat (%) was also significantly (p < 0.001) improved on weeks 2, 3 & 4 as compared to baseline in PTF supplemented group. Serum total cholester...

Chun Ik Lim, Hyeon Kwon Kim, Kang Nyeong Heo, Are Sun You, Hyo Jun Choo* 

.... Aspartate amino transferase (AST), cholesterol (CHOL), and triglyceride (TG) concentrations were significantly (P < 0.05) decreased in the FGP2.0 group than in the CON group. Serum IL-2 level was significantly (P < 0.05) higher in the FGP2.0 group than in the CON group, although IL-6 level showed no significant difference. These findings suggest that dietary supplementation of FGP as a feed additive might improve productive performance and health of la...
 
 SAFDAR ALI KHAN1, FARHEEN ANSARI1, SANWAL ASLAM2*, AMJAD HUSSAIN3, MUREED HUSSAIN1, MAJID MAHMOOD4, ALI MUHAMMAD4, RAHMAT ALI1 , ASAD ASLAM3 AND FATIMA ALI
...d for the existence of parasitic helminthes. Among the desi chicken, 61 were reported positive for helminthes parasites by gross examination of gastrointestinal tract. In these 61 positive cases, 42 (68.85%) were found positive for nematodes, 6 (9.83%) for cestodes and remaining 13 (21.31%) had mixed infection; Ascaridia galli, Heterakis gallinarum and tapeworm. However, no adult helminthes were observed in far...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...normal;"> Dextransucrase is used for the production of dextran, a commercially important product, with numerous applications in many industries such as food, medical, pharmaceutical, and cosmetics. In the current study, dextransucrase producing microorganisms were separated from different vegetables, fruits, and milk samples collected from the local market of Lahore, Pakistan. Sucrose-based medium, supplemented with van...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...normal;"> Dextransucrase is used for the production of dextran, a commercially important product, with numerous applications in many industries such as food, medical, pharmaceutical, and cosmetics. In the current study, dextransucrase producing microorganisms were separated from different vegetables, fruits, and milk samples collected from the local market of Lahore, Pakistan. Sucrose-based medium, supplemented with van...
 
 USMAN AHMAD*1, AMTUL JAMIL SAMI1, MADEEHA KARAMAT1, MADEEHA KHALID1, FAIZAN NAEEM2 & MUHAMMAD JAMIL YOUSAF
...now done by chemical, ultrasonic and electrical methods. Drug delivery through the largest organ (skin) by dermal patches of psyllium based hydrogels was observed. In this article we have fabricated different psyllium based dermal patches of hydrogels for insulin delivery. Psyllium, a natural polysaccharide, is a dietary fiber and widely utilized in gel forming. To study the structural aspects of these various polymeric webs were categorized with FTIR, SEM and...

Arief1, Roni Pazla2*, Rizqan1, Novirman Jamarun2 

... a substitute for field grass. Palm kernel cake is a waste of the palm oil processing industry and can be used as a concentrated alternative. This study aims to determine the impact of giving Tithonia diversifolia plants, cassava leaves, and palm concentrates on the milk production and quality (fat and lactose), intake, and digestibility of Etawa Crossbred Goat. The supplemented treatments were: A; control ration (60% forage (CF) + 40% concentrate (CC)), B (30...

Ahmed Abdel-Rady3*, Mohamed Karmi2, Menna_allah Youssef1, Aml M. Abdel-Ra’ouf1, Bahaaa Madkour1 

...lasms inside RBCs..Polymerase chain reactions of T. annulata merozoite-piroplasm surface antigen Targeting gene: (Tams1) revealed positive 29 (58%) animals confirmed by visualization of specific bands at 768 bP. Positive results could be detected in suspected cattle that showed positive or negative blood smear results that proved the high sensitivity of PCR test compared with the conventional method for diagnosis of bovine tropical Theileriosis. PCR proved a h...

Zubair Ali, Muhammad Sohail*, Yasir Ameen, Hamidullah, Ishtiaq Ahmed and Mehwish Malik

...text-align: justify;">Ultrasonography is modern technique being utilized for management of reproductive efficiency of dairy cows all over the world. The ultrasound facility was not available in the study area due to which farmers were complaining about reproductive issues of their animals. Therefore, this study was conducted for assessment of reproductive health of cow genital tract using real time B mode Ult

Amber Khalid1*, Amjad Rashid Kayani1, Muhammad Sajid Nadeem1, Muhammad Mushtaq1, Mirza Azhar Beg1 and Surrya Khanam2

...nsumed item followed by Brassica campestris (mustard) and Arachis hypogaea (peanut). Sorghum bicolor (millet) and Vigna radiata (mong bean) was also consumed in small proportions. Pearson chi-square was used to calculate the significance difference among every food item and among seasons. Significant difference (p<0.05) was observed among consumption of different food items and among different seasons. Non- significant difference (p>0.05) was calculated ...
Ayesha Ahsan1, Rabia Arif2*, Samina Nazir1, Muhammad Saleem2 and Memunna G. Shahid1
...sequences of Neurospora crassa and Sordaria macrospora by using different PTMs predictor servers. Phosphorylation and glycosylation in different species of Sordaria as well as N. crassa was calculated on Serine (S), Tyrosine (Y) and Threonine (T) residues by NetPhos and YinOYang.

...

Irene S. Gamil1* and Dalia Fouad1,2

...and de Chambrier, 2012 parasite of the endemic snake Madagascarophis colubrinus from Madagascar; both infect African colubrid snakes.

...

Lei Jiang, Yi Huang, Runfeng Yang, Xiaohui Jiang* and Hao Yan

...verified by double luciferase. Our results showed that circ_0009910 and PAX2 genes were significantly up-regulated in SKOV3/DDP cells, and miR-455-5p was significantly down-regulated in SKOV3/DDP cells. circ_0009910 could enhance cisplatin sensitivity of SKOV3/DDP cells. circ_0009910 targeted miR-455-5p, and knockdown of circ_0009910 up-regulated the expression of miR-455-5p in SKOV3/DDP cells. Overexpression of miR-455-5p can enhanced cisplatin sensitivity of...

Doungnapa Promket1,2,4*, Khanitta Pengmeesri2,4, Jennarong Kammongkun3, Thassawan Somchan2

...for each gene, and polymerase chain reaction-restriction fragment length polymorphism was used to identify the genotypes (PCR-RFLP). Three genotypes were found for each gene as BB, Bb and bb for NPY; TT, TC and CC for DRD2 and II, ID and DD for VIP. Genotype frequencies of NPY (range 0.13-0.58), DRD2 (range 0.06-0.55) and VIP (range 0.14-0.57) were reported. For the NPY gene, allele frequency of b (0.72) was greater than allele frequency of B (0.28), while for...

Fathin Faahimaah Abdul Hamid1, Mohd Farhan Hanif Reduan1*, Jasni Sabri1 , Faez Firdaus Jesse Abdullah2,Mohammed Naji Odhah1, Nur Athirah Binti Abdul Manaf1, Mohd Jefri Norsidin2 , Siti Nor Che Yahya1, Intan Noor Aina Kamaruzaman1, Nur Zul Izzati Mohd Rajdi1 

...nd gamma glutaryl transferase however there were increased lactate dehydrogenase levels post-infection with Mannheimia haemolytica (p<0.05). In conclusion, oxytetracycline and flunixin meglumine treatments does not have a great influence on the parameters evaluated in goats experimentally induced with Mannheimia haemolytica pneumonia. 

...

Omnia M. Khattab1, Morcos I. Yanni2, Hala K. Abdelmegeed2, Mahmoud Eliwa1, Naglaa M. Hagag1, Sara M. Elnomrosy1

...re positive with a polymerase chain reaction assay (PCR) targeting VP2 gene. Three positive fecal samples in animal showing sever and moderate leukopenia were successfully sequenced Partially. Sequence analysis results showed no variation in their sequence across all isolates when compared to the published FPV genome, which could imply that FPV appears to be in genomic stasis as compared to other Parvoviruses. Genomic stasis appears among the three Egyptian sa...

Riswandi1*, Ali Aim1, Muhakka1, Afnur Imsya1, Agus Wijaya2

...ts given were A (guinea grass and concentrate, 7:3), B (guinea grass, water mimosa and concentrate, 4:3:3), C (guinea grass, giant molest and concentrate, 4:3:3), D (guinea grass, water chestnut, and concentrate, 4:3:3). The value of dry matter digestibility (DMD), organic matter digestibility (OMD), pH, N-Ammonia (N-NH3), total volatile fatty acids (TVF...

Anhar Ibrahim Elhanafy*, Amr Mohamed Mousa, Amaal Mohamed Kamal 

...in aspartate aminotransferase, alanine aminotransferase, serum total bilirubin, direct bilirubin and in direct bilirubin, serum creatinine, urea content, serum total cholesterol, triglycerides, and low-density lipoprotein, and vice versa regarding the high-density lipoprotein concentration was observed, compared to control. Moreover, BV caused a decrement in malondialdehyde and nitric oxide levels whilst it enhanced GPx act...

Khitam J. Yahya*, Mohammed T. S. Al-Zubaidi

...a ubiquitous protozoan parasite causing gastrointestinal disorders in various hosts worldwide. The current study was undertaken to study the biology of Cryptosporidium meleagridis and examine the anti-Cryptosporidial efficacy of curcumin in experimentally infected quails compared with that of paromomycin. This study carries out from September 2022 to January 2023 in Baghdad city, Iraq. Oocysts were isolated from naturally infected quails identified as Cryptosp...

I Nyoman Sulabda1, Anak Agung Gde Oka Dharmayudha2, I Wayan Nico Fajar Gunawan3, Dwi Fortuna Hashilonda4, Luh Gde Setyawati5, I Ketut Puja6*

...ancy was confirmed by ultrasound 25 days post-AI. To our knowledge, this is the first successful case of AI in a Kintamani dog. From these results, it can be concluded that freezing the semen of Kintamani dogs could fertilize female dog eggs.
 
Keywords | Kintamani dogs, fertilization, Insemination, Intravaginal, Pregnancy
...
Lubna Anjum Minhas, Abdul Samad Mumtaz*, Muhammad Kaleem, Rooma Waqar and Jamila Annum 
...amydomonas, Eudorina, Tetraspora, Chlorella, Westella, Pediastrum, Acutodesmus, and Stigeoclonium. Hence, the current study reveals that Gujar Khan, District Rawalpindi is a rich source of green algae and an ideal place for their cultivation.

...

Riaz Hussain1*, Ata-ul-Mohsin1, M. Farooq Nasir1, Zahid Akram2, Muhammad Sajid Qureshi1 and Abdul Mannan Hamzah1

...an insect herbivores of brassica crops. Globally efforts have been undertaken to develop integrated management strategies for its control, based principally on manipulation of its parasitoids including Diadegma insulare. The research study was conducted to investigate the effects of two cabbage varieties on fitness parameters (i.e. percent parasitism, offspring sex ratio and developmental ...

Muhammad Ehsan Safdar1, Muhammad Asif1, Amjed Ali1, Ahsan Aziz1, Naeem Akhtar2, Muhammad Shahid Gulrez1 and Waqas Raza3*

...tion on canola’s (Brassica juncea) growth, quality and yield, a field trial was performed at research farm, Agriculture College, University of Sargodha, Punjab, Pakistan during winter season 2020-21. Treatments comprised of three B (0, 1, and 2 kg ha-1) and three Zn (0, 8, and 10 kg ha-1) levels and their all-possible combinations as their basal application to soil as boric acid and ZnSO4 fertilizers, respectively. RCBD with three blocks was applied. See...

Enas K. Abo El-Maged, Azza H. El-Salakwy, Safia A. El-Gamal and Gehn Allam

...ted for HPV-DNA by polymerase chain reaction (PCR) amplification using one pair of general primers which allowed for the amplification of HPV types 16, 18, 31, 33, 52, & 58. These primers were designed to amplify E6/E7 gene junction sequences. Twenty nine out of 100 (29%) samples of aborted products of conception were positive for HPV E6/E7 sequences. In comparison. only one of the placental tissue specimens was positive. All the specimens were positive fo...

M. A. Amer1; M. H. El-Hammady2; H. M. Mazyad1; A. A. Shalabyl and F. M. Abo-El-abbas

...rse transcription- polymerase chain reaction (RT-PCR) amplified product of the expected size of 801 bp was cloned into the Pinpoint Xa-l protein expression vector. The accury of each PCR amplified PVY CP gene was tested by PCR, restriction analysis, and translation. Analysis by in vitro translation using western blotting assay on nitrocellulose membrane using monoclonal antibodies verified that the PVY-CP gene correctly encoded and expressed a protein reacting...

A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1

...te primers through polymerase chain reaction (PCR). Large-scale amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation of plasmid DNA. then used restriction enzymes Bam HI and Bgl II to identify clones containing inserts. To confirm the fragment inserted of CP gene seque...

A.Y. Ahmad1, M. A. Amer2, T. A. Mostafa1, F. M. Abo El-Abbas1, and M. El-Hammady1

...erse transcription-polymerase chain reaction (RT-PCR). hemi-nested and nested-RT-PCR were used to study their molecular characters. Three pairs of primers were selected to react with 5'-non-translation region (5'-NTR) and PI gene from the PVY genome. PCR products yielded by one primers pair reached 835 bp. while reached about 1 kb (974, 926 bp) by the other primers. Partial sequencing or fragment 835 bp was performed. Comparing with standard PVY strains showed...

E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2

...erse transcription-polymerase chain reaction (RT-PCR) using two primers specific for the coat protein gene or GFLV. Nucleotide sequences of the RT-PCR products confirmed that these sequences were amplified from the GFLV coat protein gene. A specific GFLV Dig labeled DNA probe was prepared by PCR and detected the GFLV virus in fresh leaves up to 10-5 dilution in dot blot hybridization assay. It was suggested that the inhibitory compounds released during the ext...

E. K. Allam1; Kh. A. El-Dougdoug1; M. A. Amer2; A. A. Abou-Zaid2; and S. M. Amin2

...erse transcription-polymerase Chain reaction (RT-PCR) assay was used for the isolation and identification of PSTVd cDNA from infected plant materials using a specific primer to PSTVd. A major cDNA product of approximately 360 bp was successfully hybridized with digoxigenin labeled PSTVd cDNA probe.

...

Om-Hashem M. El Banaa l, A.A. Abou Zeid2, Fawzia I. Moursy3 and Azza, G. Farag

...The Immunocapture- Polymerase Chain Reaction (IC-PCR) technique was applied for detection of S. citri Saglio et al in which the Spiroplasma was captured with the specific polyclonal antibodies on a solid-phase. Specific primers based on the sequence of the Morocco strains of S. citri Saglio (R8A2HP and G113) were used. Two pairs of primers SC. SC’ and SC8. SC9 were used. PCR fragment of correct size 330bp was amplified with primers SC. SC expressing spir...

Sahar. A. Shoman1 and B. A. Othman2

...iption followed by polymerase chain reaction (RT-PCR) with availability of the database sequences (GenBank) provided a sensitive method for the detection or Tobacco mosaic virus- Egyptian strain (TMV-E). Total RNA extract of infected plant and RNA of purified TMV particles were subjected in this method with four degenerate and undegenerate primers. The primer pairs generated two specific PCR fragments of 3428 base pair (bp) and 3836 bp of the whole TMV genome....

Shabana Mangi1*, Abdul Manan Shaikh1, Waheed Ali Panhwar1, Javeed Ali Ujjan1, Fakhra Somroo1, Shazia Praveen Solangi2, Sumbul Mureed Mastoi3 and Ranjeet Kumar1

...alia were taken with cameras fitted on the microscope. This revealed the occurrence of 46 specimens and identified 05 species under the subfamily Asopinae. Z. caeruleas (Linnaeus 1758) predatory stink bug is premalinary described from the district Khairpur Sindh province of Pakistan. Photographs of the adult as well as male and female aedeagus, conflicting on the biodiversity table are provided.

...

Galuh Chandra Agustina1*, Erwin Syahfitri1, Viski Fitri Hendrawan1, Siska Aditya1,2 

...ibit the acetylcholinesterase, resulting cell apoptosis and hormonal disruption of the reproductive system. The major of this study was to evaluate the effectiveness of black cumin seeds as antioxidants on the expression of caspase-3 and sertoli cells in spermatogenesis. A total of 20 male mouses were divided into five groups, K- (negative control, no treatment), K+ (positive control, 40 mg diazinon/kg BW); P1 (40 mg diazinon/kg BW + 200 mg black cumin/kg BW...

Xiaoying Liang1,2, Xiaofang Jiang3, Honglin Jia1, Ru Zhang1, Li Gao4* and Qing Yang5*

...ected by real-time polymerase chain reaction. In addition, in vitro experiments with Jurkat cells were used to verify the effect of methylase inhibitor 5-Aza-2’-deoxycytidine on the expression of cytokines and genes in the T cells. The expression of Th2 cells, cytokine proteins and genes after allergen sensitisation revealed a significant increase in CD4+ T cells. However, analysis of regulatory T cells revealed the opposite results. The decrease of Th2 ...

Fang Chen

...mutant 3’UTR luciferase of PTEN (P>0.05). The miR-4728-3p inhibitor group had less cell migration and invasion, and its apoptosis rate increased (P<0.05). The abnormal expression of miR-4728-3p mediated the apatinib resistance of SCLC by targeting PTEN and regulating PI3 K/AKT pathway.

...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...used transcription-polymerase to amplify the coat protein chain reaction (CP) gene (RT-PCR) Of SCMV-E to amplify strain. the ThecDNA that directly amplified cp gene was used as a template using the internal primer combination in PCR for confirmation its specificity to the SCMV-cp gene as a PCR product with a size Of about 400 bp was amplified. The cp gene PCR product was cloned into the pGEM-T easy vector and introduced into Escherichia coli strain DH5_ and th...

Saad Zaghlou El-Damrawy1, Reda Ali Hassan2*, Ahmed Maher Bakhaty1, Adel M. Nasr2, El-Sayed A. Abu El-Hassan2  

...s of alanine aminotransferase (ALT), aspartate aminotransferase (AST), uric acid, creatinine, and malnodialdhyde (MDA) dramatically rose. After 35 days of feeding, AFB1-treated chicks showed a significant decrease in their total erythrocyte count (TEC), total leukocyte count (TLC), haemoglobin concentration (Hb), haematocrit levels (HCT), mean corpuscular haemoglobin (MCH), mean corpuscular volume (MCV), and mean corpuscular...

Wuritunashun*, Burenbatu, Narenqiqige, Jiuguniang, Eerdunduleng, Shuanglian Wang, Cuiqin Gong, Hashengaowa, Huizhi Jin, Baiwurihan and Chunhaizi

...f vasculitis is a purple rash that often affects the thighs and buttocks. The Zhenbao pill, containing several medicinally important compounds, has been found to be effective against a variety of neurological and immunological illnesses. We used a label-free quantification (LFQ) proteomics approach to investigate the effect of the Zhenbao pill on the differential serum protein expression of HSP patients. Out of 14 significantly differentially expressed protein...

Kétomon Pierre Challaton1*, Coovi Guénolé Akouedegni1, Kadoéito Cyrille Boko2, Goué Géorcelin Alowanou1,3, Pascal Venant Houndonougbo4, Aboudou Habirou Kifouly1, Mawulé Sylvie Hounzangbé-Adoté1  

...system, animals harbor parasites that cause economic losses related to growth and reproduction performance, which strongly affect farm productivity. The objective of this study was to evaluate the gastrointestinal parasite burden of goats in Benin. Thus, feces were sampled from 572 and 497 goats in the rainy and dry seasons, respectively, in southern, central and northern Benin. The parasi...

Yue Guo1,2*, Hui Zhang1, Chun Sheng Wang1 and Hong Chang Zhou1

...ed with metabolism and parasitism of adult female A. cantonensis were highly expressed.In this study, the transcriptome of adult female Angiostrongylus cantonensis was analyzed and successfully annotated. Metabolism and parasitism related genes were highly expressed at adult female A. cantonensis.

...

Lalu Ahmad Zaenuri*, Rodiah Rodiah, Adji Santoso Dradjat, Oscar Yanuarianto, I Wayan Lanus Sumadiasa , Lukman Hy 

... a daily diet of native grass equal to 10% of body weight from day 1 to day 20. From days 21 to 35, they received a diet the same as days 1 to 20, in addition to SGtab. Semen was collected using an artificial vagina for 6 consecutive ejaculates at an interval of 120 h from each experimental buck. Fresh semen was evaluated for volume, pH, spermatozoa concentration/ml and concentration/ejaculates, plasma membrane integrity, viability, progressive motility, and m...

Khitam J. Yahya*, Mohammed T. S. Al-Zubaidi 

...s that Cryptosporidium parasites, which cause zoonotic disease transmission, are widespread among Baghdad quails. 

...

Abdulaziz A. Alaqil

...lymphocyte ratio. In contrast, the productive traits and immunological aspects were significantly (p < 0.05) augmented by PR supplementation to the broiler diets. Furthermore, PR supplementation successfully restored the broiler production and immune response after challenge with EC infection and elevated (p < 0.05) all PR+EC group measurements relative to the EC group. The results concluded that supplementing dietary with 1 g/kg PR could be implemented ...

Aqleem Abbas1, Mustansar Mubeen2, Waqar Younus1, Qaiser Shakeel3, Yasir Iftikhar2*, Sonum Bashir2, Muhammad Ahmad Zeshan2 and Azhar Hussain1

...es and whiteflies, and parasitic weeds are considerably affecting GB crops. These diseases and pests can jeopardize GB’s food supply if not monitored regularly. The consequences of these biotic agents range from minor symptoms to catastrophic events that destroy whole fields. Plant protection units are needed to tackle these challenges to prevent future outbreaks. Herein, we describe significant diseases and pests that are catastrophic to GB’s crop...

Salvator Minani1,2*, Eric Nsengiyumva1, Anatole Bigirimana1,2, Arnaud Cubahiro1,2, Dieudonné Ntakirutimana1,2 and Vénuste Bizoza1,2

...fy;">Fascioliasis is a parasitic zoonosis caused by Fasciola hepatica and Fasciola gigantica affecting mainly domestic ruminants and occasionally humans. Due to the lack of epidemiological studies of fascioliasis in Burundi, this study was carried out to assess the prevalence of fascioliasis by liver inspection in slaughtered ruminants at Muyinga slaughterhouse. The liver of each slaughtered domestic ruminant was inspected, palpated and incised to look for flu...

Muhammad Aijaz1, Nasir Mahmood2, Ghulam Mujtaba3 and Imran Riaz Malik1*

...An allele-specific polymerase chain reaction determined polymorphism at a position (-1082 G/A). PCR products were analyzed by agarose gel electrophoresis to detect polymorphism. Further analysis was done by sequencing the PCR products from some randomly selected samples. Urban locality, drinking of non-filtered water, poor hygiene, and poor socioeconomic status are the risk factors for the onset of breast cancer in the Pakistani population. Molecular analysis ...
Muhammad Rizwan1, Hamid Akbar1*, Aftab Ahmad Anjum1, Muhammad Arif Khan1, Aneela Zameer Durrani2, Muhammad Abid Hayat3, Anjum Masood4, Muhammad Talha Sajjad1 and Nadeem Raza2
...inical assessment and ultrasonography, and then was surgically treated through Dirksen technique. Blood samples of both groups were collected on days 0, 7, 14, 21, and 28. Levels of various oxidative, metabolic and hematological parameters were measured by authenticated standard methods. We observed that serum levels of MDA and BHBA were higher at day 0 to day 14 (P<0.01), while the level of nonesterified fatty acid (NEFA) was higher at day 0 to day 7 (P<...

Trinil Susilawati1*, Aulia Puspita Anugra Yekti1, Amir Firdaus2, Dinda Ayu Damayanti2, Rizki Prafitri1, Nanang Febrianto1, Kuswati1, Achadiah Rachmawati1, Sri Wahjuningsih1, Nurul Isnaini1 

...e were observed using ultrasound. A Chi Square was performed using SAS OnDemand for Academics (ODA, Cary, NC, USA). Moreover, probability values were calculated using the least significant different testing. The results showed that NRR-1 was 83.75% and 85%, while NRR-2 was 62.5% and 68.75% on T1 and T2, respectively. Furthermore, the failure of AI was mainly caused by repeat breeders, which were 28.75% on T1 and T2. It consists of 95.65% and 87.5% of normal ov...

Siswanto Imam Santoso*, Agus Setiadi, Wahyu Dyah Prastiwi 

...eed, dried-cooked rice, trash fish, processing, business pattern, marketing, technology, and production; the endogenous variable was sustainability. Structural equation modeling (SEM) using TETRAD-IV software was employed to establish the analytical model. The results show that duck farming is sustainable regarding social, economic, and environmental aspects. Medical and technological factors significantly affect production. Social factors, egg processing, tec...

Abdulaziz A. Alaqil*

...production rates. In contrast, the elevated stress markers and HSP70 expression in the challenged birds were significantly (P<0.05) alleviated when LA was given to laying hens, and the GSH-px activity was noticeably increased by 13.7% in the LPS+LA compared to the LPS group. Furthermore, LA increased egg production by 8.5 and 3.1 percent points and improved feed efficiency by 6.11 and 4.56% in both LPS-challenged and non-challenged birds, respectively....

Shujaullah Khan1, Zahid Hussain1*, Haroon Khan1 and Omer Suha Uslu2

...enoxaprop-p-ethyl) as a grassy weeds killer applied @ 500 ml ha-1, and Cleaner 6% OD (florasulam 2%+mesosulfuron methyl 4%) as a broad-spectrum herbicide @ 102 ml ha-1. The fourth was an AI treatment (robotic weeding), along with a hand weeding (HW) and a weedy check (WC) treatments. The treatments had a significant effect on the performance of wheat crop and also on the weed control. The HW treatment was statistically the m...

Abdur Rauf1*, Muhammad Sadiq1, Farooq Jan1, Muhammad Qayash2, Wisal Khan3, Ikramullah Khan1, Khilwat Afridi4, Muhammad Shuaib5, Muhammad Khalid6 and Samrin Gul7

...abak-19, 59.4 g). In contrast, exotic wheat had more flag leaf area (Akuri#1, 55.6 cm2), plant height (Quaiu#2, 97.3 cm), tiller per plant (Navojoa-M-2007, 13.8), spike length (Kenya Tea, 16.9 cm). All parameters showed higher values for the phenotypic coefficient of variation (PCV) compare to the genotypic coefficient of variation (GCV). We also observed high heritability (h2) value for days to heading (93.0) and flag leaf area (66.0), which shows that high h...

Dede Kardaya*, Deden Sudrajat, Dewi Wahyuni 

...te inclusion into field grass-based diets of lamb maintained feed intake level, improved dry matter (DM), organic matter (OM), neutral detergent fibre (NDF), acid detergent fibre (ADF) and hemicellulose digestibility (P<0.05), and increased feed efficiency and live weight gain of lambs (P<0.05). It is implicated that zeolite or urea-impregnated zeolite improves lamb performances probably as a result of the cation exchange capacity of zeolite or slow-rele...

Komal Javed1, Sohaib Muhammad1*, Zarghaam Khan1, Sehar Fatima1, Hassan Nawaz1, Mahrukh1, Tahira Khalid1 and Shariat Ullah2

...wed by Fabaceae with 5, Brassicaceae and Solanacea having 4 species each, Polygonaceae with 3 species, Chenopodiacea and Cyperaceae with 2 species each, Aizoaceae, Commenlinaceae, Convolvulaceae, Euphorbiaceae, Lamiaceae, Malvaceae, Marsiliaceae, Papaveraceae, Primulariaceae, and Scorpulariaceae with 1 species each. Brassica campestris, Lathyrus aphaca, Melilotus indicus, Medicago polymorpha, Dicanthium annulatum, Setaria gl...

Supawadee Piratae1*, Noraphat Khiewkham2, Nattawut Maungmungkun2, Chanakan Tippornwong2, Tossapol Seerintra2, Sirikanda Thanasuwan3, Luyen Thi Phung4 

...ortance of regular ectoparasite control which is an effective strategy to control ehrlichiosis and anaplasmosis. 

...

Atef M. El-Sagheer1*, Aline F. Barros2, El-Sayed M. Abd El-Aal3, Mohamed M. Gad4, Doaa S. Mahmoud4 and Amr M. El-Marzoky3

...ustify;">Several plant-parasitic nematodes have been associated with banana (Musa cavendishii) and some of the most economically important ones are Radopholus similis and Meloidogyne spp. the purpose of this study is mainly to clarify the pathogenic effects of both nematodes (Radopholus similis and Meloidogyne incognita, alone or in combination), as a histological modification in root tissues under natural conditions of banana cultivation. R. similis was obser...

Ramzan Ali1, Erum Iqbal1*, Muhammad Ismail Bhatti2 and Saboohi Raza1

...align: justify;">Plant parasitic and soil nematodes were found associated with different vegetation of the Thar Desert, Sindh, Pakistan. Taxonomic studies of Tylenchorhynchus neoclavicaudatus Mathur, Sanwal and Lal, 1978, Tylenchorhynchus mashhoodi Siddiqi and Basir, 1958, Pratylenchus curvicauda Siddiqi, Dabur and Bajaj, 1991, Pratylenchus elamini Zeidan and Geraert, 1991, Hemicyclophora punensis Darekar and Khan, 1981, Tylencholaimus shamimi Islam and Ahmed,...

Sumbul Zulfiqar and A.G. Rizwana*

... caused by invasion of parasite especially due to Philometra species is considered very much problematic in fish culture and aqua tilling. There are number of complications in fishes that arose due to presences of Philometra sp. Presence of these parasites directly affect fish reproduction and ultimately decline their populace. This research work was done to collect, observe and identify variety of nematodes (Philometrids) f...

Muhammad Adeel Farooq1, Shaukat Ali1*, Ali Hassan1, Rida Sulayman1, Muhammad Ahsan Kaleem2, Hafsa Shahzad1, Muhammad Summer1, Arooj Latif1, Tahreem Tanveer1

...ly characterized. In contrast to wild and all other mutant strain BSAA-25 and BLAA-25 strains showed the optimum production of α-amylase 331.4±6.9 U/mL and 310.8±11.3 U/mL, respectively, at 37±0.5°C and pH 7.0±0.2 for 48 h on wheat bran-based broth. BSAA-25 demonstrated maximum biosynthesis of α-amylase as compared to BLAA-25. Optimum α-amylase activity was measured at 40±0.5°C, pH 7.0±0.2 and...

Yoshio Hamano1*, Yasuji Kurimoto2 

...scle disappeared. In contrast, AWP increased a component of polyunsaturated fatty acids in the breast meat. Therefore, this study suggested that growth and metabolic responses to LIP and AWP occur almost independently, and the results are different depending on feeding conditions or post-mortem metabolism. 

...

Akbar Hayat1*, Muhammad Asim1*, Tehseen Ashraf2, Ehsan-Ul-Haque1, Rabia Zulifqar2, Maryam Nasir3, Ahmed Raza1, Fahim Khadija1, Sohaib Afzal1 and Shafqat Ali1

...t on rough lemon, in contrast to others media. In this experiment, an eight-month-old seedling of uniform height were used. The container was a 14′′x8′′ size plastic bag.

...

Dajun Su1, Tao Deng2* and Mingshui Xie2

...s detected by dual luciferase reporter gene assay. CCK8 and flow cytometry were used to detect the proliferation and apoptosis of ovarian cancer cells in each group. Compared with normal ovarian epithelial cell FTE187, the expression of LOXL1-AS1 in ovarian cancer SKOV-3 cells was significantly up-regulated and the expression of miR-761 was significantly down-regulated; compared with the miR-NC group, the expression level of miR-761 in SKOV3 cells was signific...

Alisher Safarov1*, Nasreen Nasreen4, Firuza Akramova5, Shukhrat Djabbarov1, Adolat Mirzaeva5, Javokhir Esonboev5, Djalaliddin Azimov5, Mourad Ben Said2,3 

...

...

Amirul Faiz Mohd Azmi1,4, Hafandi Ahmad1, Norhariani Mohd Nor1, Goh Yong Meng1, Mohd Zamri Saad2, Md Zuki Abu Bakar1, Norafizah Abdul Rahman5,6, Agung Irawan7,9, Anuraga Jayanegara8,9, Hasliza Abu Hassim1,3,9*

 

...ng Brachiaria decumbens grass (G) received either concentrate (C) or mixed with bypass fat (B) supplement on the in-vitro rumen fermentation and microbial ecosystem of Murrah cross and Swamp buffaloes. Three males Murrah cross and Swamp buffaloes consuming 100% DM of fresh B. decumbens were used as rumen contents donors. The in-vitro ruminal fermentation and microbial population profiles were investigated. The study revealed that Diet C had the highest ether e...

Yao Xixi1, Zhou Rui2* and Ma Yinshan3

...ng management of alpine grassland and the production performance of yaks (milk yield and milk quality).

...

Rashid Saraz1, Saiqa Amur1, Zia-ul-Hassan1*, Naheed Akhter Talpur1, Inayatullah Rajpar1, Muhammad Sohail Memon2, Muhammad Nawaz Kandhro3, Khalid Hussain Talpur1 and Nizamuddin Depar4

...heat, sugarcane, mango, brassica. Soil texture (Bouyoucos Hydrometer method), electrical conductivity and pH (1:2 soil-water extract), organic matter (Walkley-Black method), and ABDTPA (Ammonium bicarbonate diethylene triamine penta acetic acid) extractable phosphorus (P) and potassium (K) were determined using standard protocols, with no further alterations. Soil variability mapping was done using ArcGIS ver. 10.7. through IDW interpolation. The results revel...

Nadia Jabeen1, Abdul Mubeen Lodhi1*, Rehana Naz Syed1, Muhammad Ali Khanzada2 and Alia Gul3

..."text-align: justify;">Marasmiellus agrianum N. Jabeen and M. Lodhi was added as a new science species in the genus Marasmiellus (Omphalotaceae ), collected from the lawn and grassy soil of Hazara University, Mansehra. The comparative studies revealed that Marasmiellus agrianum N. Jabeen and M. Lodhi was grown on lawn soil and is a  flattened convex...

Sagir Hussain1, Erum Iqbal2*, Nasira Kazi2, Sher Wali Khan1, Qamar Abbas1 and Abdul Razaq1

...rization of some plant parasitic nematode populations, recovered from agricultural fields during surveys of the districts Gilgit and Nager, Gilgit-Baltistan, Pakistan. The analysis of samples yielded a new nematode species and two new reported species belonging to the order Tylenchida as new geographical records for Pakistan. Hemicycliophora pyri n. sp., is characterized by the broadly rounded lip region with two indistinct annuli, closely fitting sheath with ...

Elihasridas, Mardiati Zain*, Roni Pazla, Simel Sowmen, Qurrata Aini 

...sp;

...

Yingying Wang, Jianyi Yu and Lichen Zhou*

...his study, we used polymerase chain reaction to detect DNA, and enzyme-linked immunosorbent assay to test for T. gondii antibodies. Antibodies (S/P>0.31) to T. gondii were found in 20 (26.32%) of the 76 tigers, while all blood samples tested through nested PCR were negative. This is the first investigation of T. gondii infection in South China tiger.

...

Deny Juniwati1, Hadri Latif2*, Trioso Purnawarman2, Zhang Shuqi3

 

...O water combined with ultrasonic waves to reduce nitrite level of EBN. The result of this study illustrated the effectiveness of reducing nitrite levels in EBN from two different methods. Nitrite levels in the samples were measured using a UV-Vis spectrophotometer. Utilizing an ultrasonic wave frequency of 40 kHz for 20 seconds could reduce nearly 80% of nitrite levels. It was considered more effective than standard methods,...

Khalid M. Al-Syaad1,2

...ALT; alanine aminotransferase and AST; aspartate aminotransferase), creatinine and urea in the blood serum and lipid peroxidation product (TBARS). While decreased (P<0.001) the total antioxidant capacity (TAC) and number of spermatozoa compared with control group. The histological examination of the kidney revealed alterations induced by CC, including atrophy, tubular necrosis, enlargement of the glomeruli, dilatation and...

Lichun Jiang1,2*, Lan Zhu1, Meiqi Li1, Xinyue Bao1, Zhenkun Zhao2, Haifen Qin2 and Wei Chen3*

...r, by using a long polymerase chain reaction (PCR) technique. The entire mtDNA sequence is 16,196 bp in length, which compared with previous studies is the least, containing 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and a non-coding control region (CR, D-loop). The overall base composition included 33.37 % A, 29.33 % T, 23.94 % C, and 13.36 % G. According to 13 protein-coding genes and phylogenetic analysis, Elaphodus may have a ...

Kiran Afshan1*, Sobia Baseer1, Shanza Kiran1, Ghulam Narjis2 and Sabika Firasat1

...ly found intracellular parasite that infected a large proportion of the world population, it remained asymptomatic in immunocompetent patients but the acquisition of the infection during pregnancy can lead to abortions and other congenital defects. The present study aimed to find the seroprevalence of T. gondii among suspected women who visited local hospitals in Khyber Pakhtunkhwa (KP), Pakistan. Sera of 425 suspected women were screened by latex agglutinatio...

Deny Anjelus Iyai1*, Ambo Ako2, Sitti Nurani Siradjuddin2, Budiman Nohong2 

...(44.44%). Withdrawal of grass clippings is done using a quadrant measuring 1 x 1 m2. Quadrant laying is done diagonally in a land area of ​​100 m2. Dominance Index, Species abundance using Shannon-Weiner Diversity Index, Similarity index, Species richness). The number of plant families identified was 751 families spread over 4 districts, with 890 species of grass, legume and non-grass/...

Ishtiaq Ahmed1*, Hamid Ullah2, Zubair Ali2, Muhammad Sohail2, Yasir Amin2 and Afrasyab1

...ruminants. Substantial parasitic load in these animals is characterized by symptoms like diarrhea, poor weight gain, rough body coat, gastro intestinal disturbance like lack of appetite, reduced milk production, alopecia and bottle jaw. The study on prevalence of gastrointestinal helminths parasite of large and small ruminants was conducted in and around district Haripur. Faecal samples (n=633) were randomly collected and we...

Imbang Dwi Rahayu1, Ali Mahmud1*, Wahyu Widodo1, Adi Sutanto1, Apriliana Devi Anggraini1, Devi Dwi Siskawardani2, Wisnu Nurcahyo3, Tri Untari3

...), aspartate aminotransferase (AST), and all parameters of the blood profile. However, the herbs’ addition significantly (p<0.05) affected albumin, triglycerides (TG), low-density lipoprotein (LDL), alanine aminotransferase (ALT), and malondialdehyde (MDA). Adding herbs through drinking water gave lower TG and LDL levels than through feed or the control. The control had the lowest level of ALT, which increased along...

Reza Esmaealzade Dizaji1, Arasb Dabbagh Moghaddam1*, Arash Ghalyanchi Langeroudi2, Mohamad Foad Heydari3, Seyyed Javad Hosseini Shokouh4 and Ana Shirzad Shahrivar5

... untreated group. In contrast, those in the untreated group had significantly higher expression levels of those genes. The PRP/BNF and PRP promote wound epithelization by raising the expression of EGF, VEGF, TGF-, HIF-1, and Integrin 3, while boosting the release of Integrin 1 and other mechanisms, reducing healing time and improving healing quality.

...

Sameh Abdel-Moez Ahmed Amer1*, Aly Mohammed Ghetas1, Asmaa Mahmoud Maatouq1, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1, Mohamed Abd El-Rahman Bosila1, Ahmed Ali El-Shemy2

...he shedding of NDV with drastically blocked shedding 7 days PC compared to group B with little clinical protection, higher mortalities, lower antibody titers and longest viral shedding PC. In conclusion, the NDV genotype VII-based vaccines homologous to challenge virus ensure a significant control on VNDV in terms of clinical protection, mortality, and virus shedding than the genotype II classic vaccines heterologous to the endemic virus in broiler chickens.&n...

Xu Yun-Ming1*, Sun Zhi-Yuan1, Yang Jian-Bo1, Bian Rong-Rong2, Ren Hong-Lin3, Zhong Si-Yuan1, Cai Yu-Hong1, Peng Jing1 and Bao Hua-Xia1

...r, 1 μL Bst DNA Polymerase (8U/μL), 1 μL template DNA, at 65 ℃ incubating 60 min. Two strains of B. cereus out of 18 strains were positive result by LAMP assay. The detection limit of B. cereus genomic DNA(gDNA) by LAMP was 0.755 pg/μL which was 100 times more sensitive than conventional PCR assay. The CFU limit of LAMP assay was 14×103 CFU/mL. The artificial polluted samples (chicken meat) can be detected by LAMP, when at least 45 min must...

Ming Wang1, Nan Yang2, Xiaolin Zhang2 and Wei Liu1*

... a critical part of the grassland ecosystem, but at a high population density, they trigger grassland desertification, unsustainable development of animal husbandry, increase in the incidence of rodent-borne diseases and the potential for zoonoses. The Sichuan Tibetan area is ecologically fragile and has reported the most serious rodent damage in China. The rodent control technology is presently advanced and diverse, however...

Wei Wang1, Meifeng Zhou2, Yuebo Liang1, Fan Zhang1, Zhong Wu3, Shaowei Mo4* and Yi Qing Wang1*

...developed resistance of trastuzumab remained a problem for clinical therapy of HER2-positive breast cancer. However, effects of YAP/TAZ pathway on resistance of trastuzumab have not been explored. Tumor tissues were collected from 40 breast cancer patients for clinical studies. For in vitro studies, human breast cancer cell lines SK-BR-3-TS was obtained, and trastuzumab resistant model SK-...

Tasleem Akhtar1*, Muhammad Farooq Nasir2, Imran Bodlah2 and Muhammad Adnan Bodlah3

...a) is an important endoparasitoid of pea aphid (Acyrthosiphon pisum) which has been utilized to determine the effectiveness of this agent in reducing pest damage. Biology of the A. smithi reared on A. pisum in the laboratory at 23± 1°C has been studied. The development cycle of A. smithi from larvae to adult was completed in about 11 days. The pre-mating period of males (n=10) varied between 5 and 8 min (mean: 4 min). Copulation time (n = 10 pairs) ...

Mehran Ali* and Inamullah

...ngi provides improved infrastructure to transfers P to plants for growth promotion under reduced P level, and had more potential to improve wheat yields and P uptake on sustainable basis in P deficient calcareous pH soils.

...

Nasir Ali1,2,6, Muhammad Ilyas2,3, Nazia Akbar1,2*, Gohar Rahman2, Shakirullah Khan4, Mujaddad Ur Rehman6, Abdul Samad5, Habib Ahmad1,2 and Bibi Nazia Murtaza7*

...r origin from the West Eurasian and South Asian stocks. These results we have offer a reference to better understand the biological linkage of ancient and modern inhabitants living in Khyber Pakhtunkhwa, Pakistan.

...

Asifa Majeed*, Amir Rashid, Palvasha Waheed, Asma Faryal, Aden Razaq and Ayesha Maryam

...d subjected to the polymerase chain reaction using primers of the APOA1 gene and ABCG1 gene. The amplicons were subjected to Sanger sequencing on Automated DNA Genetic Analyzer. The sequence data was analyzed on BioEdit7.2 biological software and Basic Local Alignment Search Tool against the human genome database to find any genetic variation. It has been found that ABCG1 gene and APOA1 gene exhibited a pattern of the normal nucleotide sequence in all subjects...

Amistu KU1,2*, Monahan FJ2, Wims P2, Yonatan KY1 , Fahey AG2, Takele TA3 

...he dry season are Desho grass (30.7%), hay (15.0%), and crop residues (14.7%) as basal diets, whereas for the rainy season fatteners almost fully depend on natural pasture (97.7%). However, fatteners use corn/fresh maize (87.7%), coffee leaf boiled together with water (44.4%), haricot bean (40.5%), cassava root (28.8%), mixed concentrates (21.6%), enset root (14.7%), and local brewery by-product (9.8%) as supplementary feed. The mean age of cattle when fatteni...

Arnold Christian Tabun*, Ferdinan Suharjono Suek, Cardial L Leo Penu, Johanis A. Jermias, Thomas Lapenangga  

...as DNA extraction, Polymerase Chain Restriction, DNA sequencing, and identification of DNA sequences nucleotide. Bali cows with sorrel, black and white coat colors are used with an age range of 3-5 years. DNA sequencing conducted multiple alignments, the identification of the genetic distance, and the preparation of phylogenetic trees using the software Mega X. The results of PCR sequencing of Bali cows with different coat colors in Kupang were 464 bp. Identif...

Muhammad Nadeem1, Jamshaid Iqbal2, Tariq Mustafa3, Gul Rehman2, Muhammad Faisal Shahzad2, Muhammad Younas4,5*, Aftab Ahmad Khan6, Ameer Hamza2, Abdul Ghaffar1 and Muneer Abbas1

... organisms, Predators, parasitoids and microorganisms likewise fungi, bacteria and viruses has proven to be a viable and sustainable pest management technique. Entomopathogenic fungi (EPF) are currently used as biocontrol agents and are alternatives of synthetic insecticides in sustainable agriculture. The bio-efficacy of entomopathogenic fungi (EPF); Metarhizium anisopliae (PacerMA), Verticillium lecanii (Zimm) (Mealikil-VL), Isaria fumosorosea (Wise) and Bea...

Haiyan Nan, Ran Feng, Guiling Zhang and Jingqin Liu*

...rrelation between the ultrasonographic findings of lower extremity vascular disease and plaque formation and the formation of carotid atherosclerosis in patients with type 2 diabetes mellitus (T2DM). In this study recorded patients who were admitted to the No.1 hospital of Baoding from August 2017 to January 2020. We continuously observed the comprehensive diabetes complications screening or blood glucose of 517 hospitalized patients with T2DM. 67 subjects wer...
Akram Ali Baloch1*, Adeel Ahmad2, Kaleem U. Kakar3, Sara Naudhani1, Samiullah Khan1, Agha Muhammad Raza3, Imrana Niaz Sultan1, Humaira Zahid4, Saadullah3 and Shakeela Daud1*
...A was amplified by polymerase chain reaction and subsequently sequenced to confirm any genetic variability in the affected individuals of the families. As a result, two different missense mutations (c.830C>A resulting p.Ala277Glu and c.332C>T resulting p.Pro111Leu) in affected individuals in two of the families were identified. The nonexistence of mutations in EPM2B in the other two families could be due to presence of mutations in noncoding or non-teste...

Khadija Begum, Azizunnessa and Md Ahaduzzaman*

...ical examination, and ultrasonography. Descriptive and multivariate statistical analysis was done to study the prevalence and associated risks of different reproductive disorders. Results show that 12.41% (382/3079) reproductive disorders in does were recorded during the study period. The major reproductive disorders were anestrous (72.25%, 276/382), followed by retained placenta (6.8%, 26/382), and repeat breeding syndrome (4.19%, 16/382). Significant variati...
Muhammad Abdul Mannan1,2, Sharmin Chowdhury2, Md Abul Hashem3,4 and Md. Hazzaz Bin Kabir1,5*
...s a highly destructive parasitic nematode in small ruminants that causes significant economic losses to sheep and goat breeding operations worldwide. To combat this problem and minimize economic damage, effective preventative measures should be aimed at high-risk populations and a thorough understanding of the epidemiology is crucial. This study aimed to improve the understanding of the molecular epidemiology of Haemonchus contortus in sheep and goat carcasses...
Skorykh Larisa Nikolayevna1*, Fominova Irina Olegovna1, Kovalenko Dmitriy Vadimovich1, Skokova Antonina Vladimirovna1, Dmitrik Irina Ivanovna1, Kizilova Natalia Igorevna2 and Violeta Caro Petrovic3
...was carried out by polymerase chain reaction (PCR) with further study of restriction fragment length polymorphism (RFLP). Three genotypes were identified for the GH gene (AA, AB, and BB) and two for CAST (MM and MN). The highest frequency of occurrence for the GH gene was characterized by the heterozygous AB genotype (42.8%), for the CAST gene - the homozygous MM genotype (87.9%). These genotypes were correlated with quantitative and qualitative parameters of ...

Swagata Das Gupta1, Majharul Islam1, Towhida Kamal2,Md. Rayhan Faruque3,Md. Shohel Al Faruk4* 

...allinae is a protozoan parasite that causes the avian trichomonias is disease known as “canker,” which primarily affects the esophagus and upper digestive tract in pigeons.A common case of pigeon cankers was diagnosed in two pigeons 40 days of age who came to S.A. Quaderi Teaching Veterinary Hospital, Chattogram Veterinary and Animal Sciences University (CVASU).Clinical history indicated that the birds were taking both food and water from...

Tehreem Iqbal1, Roheela Yasmeen1* and Faheem Hafeez2

...and alanine amino transferase) and kidney (Blood Urea Nitrogen, Creatinine, and Uric acid) biomarkers were assessed. The highest levels of ALT and ALP were linked to liver injury and a higher weight in the liver were observed in BPA treated rats as compared to the control group. Similarly, an increase in blood parameters were recorded in BPA treated rats followed by post -treated rats and pre- treated group. It was concluded by the study that BPA have pronounc...

Muhammad Fiaz Qamar1*, Tahir Hussain1, Iram Liaqat2, Madiha Kiran1 and Abdur Rahman Ansari1

...y was to determine the parasitic burden in doves through the routine laboratory procedures. The prevalence of Eimeria and Capillaria spp. were recorded as 75% and 25% respectively in district Jhang. Whereas, mixed infection (Eimeria spp. + Capillaria spp.) was not detected in the examined birds. Eggs per gram (EPG) counted through McMaster technique for the Eimeria was 700, while that for Capillaria was 850. Proper control measures, good management and public ...

Fariha Qahar and Muhammad Sayyar Khan*

...udy, stably transformed Brassica napus lines harboring the feedback-insensitive isoform of Serine acetyltransferase (SAT), a rate-limiting enzyme for cysteine (Cys), and GSH biosynthesis, were subjected to H2O2, metolachlor, and atrazine-induced oxidative stress. The overexpression of the NtSAT4 gene from Nicotiana tobacco under 35S promoters in various compartments of the cell, which includes cytosol, plastids, and mitochon...

Azam Khurshid1*, Jawad Sarwar1, Kamran Sohail1, Hafiz Muhammad Faisal Ayub2, Farooq Muhammad1, Fida Muhammad Khan3 and Adnan Ihsan1

...ia tabaci) and Jassid (Amrasca devastans) on okra crop at Kalu khan district Swabi, in 2022. Treatments included a synthetic insecticide, six plant extract combinations, and control. The results revealed that the minimum number of whitefly plant-1, after 1st and 2nd spray application, was observed in plots treated with lambda-cyhalothrin (2.65 and 2.20) followed by (bakain leaf extract + neem seed extract) (3.67 and 2.74) and the maximum number of whitefly pla...

Ahmed Jaafar Mousa*, Nothaila Rasheed Hamid 

...wild birds, causes the parasitic disease known as “avian trichomoniasis”. The complications of this illness include lesions in the upper gastrointestinal tract. The present study’s goal would be to study the prevalence and genetic characteristics of T. gallinae in racing pigeons in Thi-Qar province, Iraq, utilizing the ITS1-5.8s rRNA-ITS2 gene. 100 samples were collected from racing pigeons between September and December 2022. The swabs were ...
Mohamed I. El-Katcha1, Mosaad A. Soltan1, Seham M. El-Kassas2*, Mahmoud M. Arafa3, El-Sayed R. Kawarei 3, Karima M. El-Naggar1*
...ts (P > 0.05). In contrast, the organic and Nano-CuO salts reduced egg yolk cholesterol contents (P < 0.05). Besides, they caused an interesting reduction of cracked egg percentage (P < 0.05). Additionally, both organic and CuO-NPs increased serum Cu levels, MDA and SOD activities while reduced serum glutathione peroxidase activity compared with CuO (P < 0.05). Moreover, serum lipid profile was significantly altered as triglycerides concentration w...

Syed Shakeel Shah1, Ayesha Jameel1, Sabila Afzal1*, Muhammad Zubair2, Iram Fatima Bokhari1

... nutritious intake and parasitic transmission to humans. Vegetables contaminated with parasites play a vital role in the cycle of intestinal parasitic transmission. A study on vegetables collected from shops, wholesale markets and vendors in Narowal were analyzed for parasitic contamination. Five vegetables, including coriander (Corriandum sativum), spin...

Ihab G. AL-Shemmari1*, Ali Hussein Fadhil1, Mohammed Assad S. Alkabi1, Eman Jawad Jabber2 

...RBT), culture, and polymerase chain reaction (PCR) on blood and uterine tissue samples collected from 139 brucellosis-infected ewes. Results. The PCR identified 37 (26.61%) positive cases of brucellosis, which was less than the 41 (29.49%) instances identified by the Rose Bengal test and greater than the percentage identified by the culture, which was 35 (25.1%). In comparison to the results of the culture test, the polymeras
MISBAH RAZZAQ, MUHAMMAD RAIS*, MUHAMMAD ARSLAN ASADI, SALEHA ABBASI &
ABDULLAH IBRAHIMv
...oody vegetation such as grasses, herbs
and shrubs and also ingests insects.

...

SHEZA AYAZ KHILJI1* ZAHOOR AHMAD SAJID2 & SONIA GHULAM BARI1

...nd growth of Eichhornia crassipes L. in different concentrations of industrial effluents of district Shiekhupura. Eichhornia crassipes was grown for 15, 30 and 45 days in different concentrations of the industrial effluents (5, 10, 15, 20 and 100%) prepared with tap water. All physico-chemical parameters in the different concentrations of the industrial effluents were recorded. The values of these parameters increased with i...
ZAHID FAROOQ1, RUQIA BIBI2, IRFAN BABOO3*, KAMRAN ABBAS4, MUHAMMAD SHAHBAZ5, KHALID
JAVED IQBAL6, DILAWAR HUSSAIN7, MUHAMMAD ABRAR8, ASMA CHAUDHRY9 & TANVEER
HUSSAIN10
... the prevalence of endoparasites in Indian peafowl (four
mutant form; black shoulder, pied, white and common peafowl), freshly
egested fecal samples (n=100) from six different captive facilities were
collected. The prevalence of endoprasites among all the Indian peafowl
ranged from 46.6%-66.7%. The highest prevalence was recorded in black
shoulder peafowl 66.7% foll...

ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2

...) in this investigation drastically suppressed the growth of plants of Suaeda fruticosa L. in the form of stunted growth. The overall increase in antioxidant enzyme activities during this study seems to be their scavenging role by neutralizing the reactive oxygen species produced during salt stress episode. It is therefore, suggested from the results of this research work that biochemical characteristics were related to a transferring of plants from being salt...

KHADIJA SUMMIA*1, ROHEELA YASMEEN*2, ALEEM UN NISA3, SAMIA DJEFFAL4 & TAHIRA JABEEN1

...nomius and Aspergillus parasiticus that are famous for Aflatoxin B1, B2, G1, and G2. The present study was conducted to quantify the aflatoxins in bovine feed provided to cattle found in and around Lahore. Total 50 samples were collected from two different localities of Lahore and categorized in two groups: Group A (Raiwind, 30 samples), Group B (Bedian Road, 20 samples). All samples were analyzed for estimation of aflatoxins level using thin layer chromatogra...

HIRA SOOFI1*, ARIFA BHUTTO2, ABDUL RASOOL ABBASI3 & GHULAM SARWAR GHACHAL1

...t-align: justify;">The parasitic study on catfish Rita rita of river Indus, Jamshoro, Sindh, Pakistan. A total of 22 host catfishes were collected from study area and brought to the Parasitological Laboratory, Department of Zoology University of Sindh Jamshoro. During examination of helminths a total of 28 trematodes were collected from intestine and stomach. The trematodes were resemble with species Aphanururoides lethrini ...

Nusrat Habiullah1*, Shah Nawaz Kumbar1, Fahmida Parveen Samo1, Shamusuddin Bughio2, Asghar Ali Kamboh3, Burirah Rehman Talpur1 

...ike Gamma-glutamyltransferase (GGT), bilirubin, albumin, uric acid and creatinine. After necropsy examination, the liver and kidney samples were collected for gross and histopathological examination. The mild clinical signs like reduced feed and water intake, and weight loss in group C, D, E and F was noted; whereas diarrhea, muscular tremors, and lethargy were observed in group C and D. Significantly increased (p <0.05) GGT, bilirubin, creatinine and uric...

Qasim Ali1, Mudssar Ali1*, Muhammad Awais Ahmad1, Asif Sajjad2 and Shafqat Saeed

... was facilitated, in contrast to cases where no insect visits were allowed. Furthermore, chemical properties were also found to be superior in scenarios involving free insect visits. The study underscored the efficacy of A. dorsata and syrphid flies (E. balteatus and I. scutellaris) in terms of visitation rates. Thus, conserving these insect pollinators bears the potential to significantly augment litchi fruit yield in the Punjab region of Pakistan.

...

Ali Mosa Rashid Al-Yasari1, Zahid I. Mohammed2, Haider S. Almnehlawi3,4, Ali F Bargooth5, Nawar Jasim Alsalih1, Huda F. Hasan6*, Mohenned A Alsaadawi1 

... secretion cells. In contrast, considerably more glucagon-producing cells were seen in the STZ group. Data from the camel milk group demonstrated its capacity to lessen the effects of STZ, but it did not completely eliminate the consequences of diabetes as there were still some disparities between the camel milk group and the control group. In conclusion, although camel milk didn’t completely restore the body’s health condition, our research showed...

Erkinjon B. Shakarboev1*, Abat S. Berdibaev2

...>Keywords | Helminths, Parasites, Carnivora, Mammals, Uzbekistan
...

Arief1*, Roni Pazla2

...uality forages such as Mirasolia diversifolia (Md), Indigofera zoolingeriana (Iz), and Gliricidia sepium (Gs) with palm concentrate (PC). We used a completely randomized design, implementing four treatments with four replicates as follows: Treatment T1: Control; 60% Company Ration + 40% Company Concentrate, T2: 60% (Md+Gs) + 15% CC +25% PC, T3: 60% (Iz+Gs) + 15% CC + 25% PC, T4: 60% (Md+Iz) + 15% CC +25% PC. The findings indicated that there were no significan...

Nur Saptahidhayat1, Claude Mona Airin1, Yanuartono1, Dyah Ayu Widiasih1, Soedarmanto Indarjulianto1*, Sri Handayani Irianingsih2, Meta Iqomah3

... virus examined by Polymerase Chain Reaction (PCR). This result presents a significant difference (p<0.05) in milk production, which is a combination of basal feed with Protelis® concentrate supplementation. However, the milk quality presents insignificant differences (p>0.05). In summary, the composition between basal feed and Protelis® concentrate increased milk production by 28.3% and improved the quality of milk protein, milk fat, lactose, so...

Aamir Shakeel1*, Anwar Ali2, Tahir Iqbal1 and Ziad Raza1

... cropland, forest land, grassland, other land, settlements, and wetlands. Notable trends include a decrease in cropland area by 13.72%, possibly due to urbanization and shifts in agricultural practices. Forest land experienced a 5.30% decrease, likely due to deforestation and land conversion. Grassland saw a modest increase of 1.94%, potentially resulting from natural processes and land management changes. An expansion of 5....

Wisit Ketpanyapong1, Kulisara Marupanthorn2*

...). Supplementing Duroc boras with MOLE increased leukocyte, erythrocyte, and hemoglobin levels, and significantly influenced serum antioxidant concentrations. The 50 mg/kg showed the highest serum antioxidant capacity, followed by 10 mg/kg. The boars in the MOLE-supplemented group exhibited a significant (P=0.004) reduction in the percentage of total sperm abnormalities. MOLE in the diet can notably enhance blood parameters in breeding boars and improve antiox...

Ahmed Al-Hasnawi*, Wafaa Kadhim Jasim

...ymes GST and GSH. In contrast to the control group, azathioprine treatment led to a considerable rise in MDA levels when liver function enzymes were measured, but aloe vera administration caused them to revert to normal levels. aside from the liver’s histological alterations brought on by the administration of azathioprine, there were also impacts and enhancements brought on by the use of the aloe vera extract. Based on the results, the current study cam...

Tevina Edwin, Arfa’i*, Olivio Dickresna

...g good facilities and infrastructure for breeding in the Luak Sub-district. Farmers must focus more on their livestock business and increasing livestock productivity.
 
Keywords | Beef Cattle, Entreprises, Income, Rearing, System
...

Muhammad Mukhtar*, Syamsul Bahri, Syahruddin 

... production of elephant grass (Pennisetum Purpureum). This study used a completely randomized design consisting of 4 treatments and 4 replications. The study treatment was liquid organic fertilizer (LOF) from various manufactured products, namely Genetic-plus and Bio-love, and as a comparison, LOF Bio-urine produced from the biogas process. The research treatment is as follows: T0 = Without using LOF (Control); T1 = Using LOF Genetics-plus; T2 = Using LOF Bio-...

Kristina Morkūnienė*, Rūta Insodaitė, Laimutis Kučinskas, Renata Bižienė 

...sing the real-time polymerase chain reaction method. Statistical analysis was performed with SPSS Statistics 20 and PLINK software. SNP at position 7454459 (Asn → Thr) of Mblk-1 gene mutant allele A was more common in untreated domestic and wild honey bees (18.90% and 8.14% respectively; p=0.001) compared to treated domestic bees which persistently infected with the disease. Regression analysis showed that recessive AA genotype of this polymorphism signif...

Frah R Kbyeh1*, Ahmed N. Abedsalih2 

...tes by using  Polymerase chain reaction  (PCR). The presented study, all rabbits, forty-eighth adult female rabbit aged (6-8 weeks) and weighing between (1500 and 2000) gm., was randomly divided into six equal groups(8/each) groups injection 0.1 ml in 1 x 109 CFU Escherichia coli 0157: H7 by urinary catheterization route excepting in negative control and all groups resulted in a significant increase in urea creatinine, sodium, Potassium, chlorid...
Hyun-Su Hwang1, Jae-Kang Lee2, Tae-Kyung Eom2, Seung-Hun Son3, Dong-Ho Lee2, Hyeongyu Ko2 and Shin-Jae Rhim2*
...its (Parus major), and Eurasian nuthatches (Sitta europaea). In addition, the type of food, temperature, and metabolic energy requirement affected food utilization in marsh tits and great tits. In our study, some evidence was found that wintering birds in temperate zones prefer high-energy food items. Limited food availability during winter affects social hierarchies.

...

Khanitta Pengmeesri1,2* Thassawan Somchan1 , Doungnapa Promket1,3 

...by the 10th week, in contrast to purebreds taking 12 weeks. This study aims to examine carcass composition, meat quality, and muscle fiber in crossbred and purebred native chickens after a 4-week freeze at market weight. The research involves 100 purebred Thai native chickens (Yellow-whited tail, YWN) and 100 three-breed crosses (25% egg line, 25% meat line, 50% Yellow-whited tail native chicken, CBN), raised under identical open-house conditions for 10 and 12...

Sara H. Zughayyar*, Amer H. Gyad 

...rosopis farcta L. In contrast to loperamide, all groups intestinal contents varied significantly (P≤0.05) in volume and weight. Histopathological examinations of the duodenum corroborated the antidiarrheal efficacy of the extract. In contrast to the positive control group, which showed significant edema and inflammatory cell infiltration, rats treated with the Prosopis farcta L. fruit extract exhibited varying degrees of ...

Zakia Panhwar1, Arfan Ahmed Gilal1*, Lubna Bashir Rajput1, Jamal-U-Ddin Hajano2, Shafique Ahmed Memon3, Naimatullah Koondhar4, Muhammad Ibrahim Kubar1

...trus sinensis L.), lemongrass (Cymbopogon citratus Stapf.), eucalyptus (Eucalyptus globulus Labill.) and peppermint (Mentha piperita L.) were evaluated against C. maculatus adults. Each oil was applied at 0.1, 0.5, and 1.0ml doses on the filter paper. A long glass cylinder divided into three (A, B, and C) sections, supplied with 20g cowpea seeds at ends was used in the study. Ten freshly emerged male and female C. maculatus adults were released separately in t...

Muhammad Ali Raza1*, Aneela Zameer Durrani2, Muhammad Muddassir Ali3, Tariq Usman4, Bilques Bano5, Nazia Rubab6, Syed Tasadak Mehdi7, Muhammad Wasim Iqbal8, Kumayl Hassan Akhtar9, Hira Hameed10

Shu-Zhi Qin, Wen-Pei Ling, Mei-Fang Yin, Chun-Yu Luo and Cheng-Guo Zhao*

...of aspartate aminotransferase (AST) and lactate dehydrogenase (LDH) were measured by colorimetry; Apoptosis rate and reactive oxygen species (ROS) content were measured by flow cytometry; the expression of Bcl-2, Caspase-3, p38 MAPK, ERK1/2 and JNK proteins were determined by WB technique. The results showed that, compared with control group, LDH, AST content, ROS level, apoptosis rate, Caspase-3, p38 MAPK, ERK1/2, JNK protein expression in H/R group were sign...

Nguyen Huu Van1*, Nguyen Thi Mui1, Dinh Van Dung1, Van Ngoc Phong1, Tran Ngoc Long1, Le Tran Hoan1, Le Duc Thao1, Vo Thi Minh Tam1, Ngo Mau Dung1, Bui Van Loi1, Nguyen Xuan Ba1, Ton Nu Minh Thi2, Nishino Naoki2

...) (ad libitum access to grass feeding); 0.75% (control plus 0.75% of concentrate); 1.5% (control plus 1.5% of concentrate); 2.25% (control plus 2.25% of concentrate) and 3.0% (control plus 3.0% of concentrate) as a percentage of live weight on dry matter basis. Fifteen lambs (three of each treatment) were slaughtered at the end of the experiment (90th day). The results indicated that dry matter intake (%DM/kgLW) and daily gain weight (DGW) of the animals incre...

Wei Wan1, Xiao-Li Wang1, Shu-Juan Wang2, Qin Si2 and Li-Qing Duan1*

...noids on acetylcholinesterase (AChE) and glutathione S-transferase (GST) activities in P. sinica were assessed in vitro. Correlation between numbers of synergistic or antagonistic binary mixtures and AChE or GST activities was analyzed. The results showed that 2-ethylimidazole had the strongest acute toxicity against P. sinica adult, with a median lethal concentration (LC50) value of 0.52 g/L. Among the 66 binary mixtures, 1...

Hualong Jiang1, Tao Li2,3*, Jing Xiang3, Hanqing Yang3 and Maolin He3

...l responses to marine infrastructure construction.

...
Riffat Sultana1*, Mohan Lal1, Samiullah Soomro1, Santosh Kumar2 and Ahmed Ali Samejo1
...pecimens of band-winged grasshoppers were collected. These samples were sorted out into 07 genera and 11 species. Morphological and morphometry account of each species with illustration ecology and global distribution was given. Taxonomic keys have been generated at generic and species level.

...
Akram A. Salama1, Moustafa A. Zaghloul2*, Ahmed A. Zaghawa1, Mohamed A. Nayel1, Ahmed M. Elsafey1, Mohamed F. Azooz2, Hanem S. Harb1 and Walid S. Mousa1
...Using the standard polymerase chain reaction (PCR) and specific primers designed from the EEV gene, tissue samples from skin nodules (N = 40) and blood samples (N = 60) were collected from diseased animals. Sequencing and a phylogenetic tree construction were done on the amplified byproducts of samples from blood and nodules on cattle skin. By PCR technique, 55 samples out of 100 (55/100; 55%) were positive for LSDV. A representative sample was sequenced and h...

Milena Vlahovic*, Dragana Matic, Marija Mrdakovic, Larisa Ilijin, Anja Grcic, Aleksandra Filipovic, Jelica Lazarevic and Vesna Peric-Mataruga

...g Cd/g dry food). In contrast to chronic treatment, egg masses respond more uniformly by reducing PMM during the short-term effect of cadmium. Finally, we can conclude that, as an addition to biochemical and molecular research, PMM can be used for studying the cadmium effects to gain a better insight into the state of the organism under stress conditions.

...

Usama Mahalel1, Barakat M. Alrashdi1, Ibrahim Abdel-Farid1, Sabry El-Naggar2, Mohamed Hassan3, Hassan Elgebaly1 and Diaa Massoud1,4*

...s; aspartate aminotransferase (AST) and alanine aminotransferase (ALT), reduction in the cholesterol content, and altered the architecture of the hepatic cells. Animals treated with M. forsskalii extract at a low dose after CCl4 administration enhanced the liver functions as evidenced by histological examination and liver enzymes analysis. Immunohistochemical investigation showed that the administration of M. forsskalii extr...
Muhammad Fiaz Qamar1*, Tahir Hussain1, Iram Liaqat2, Madiha Kiran1, Abdur Rahman Ansari3, Faiza Yasmeen1 and Tahira Batool3
... the prevalence of gut parasites in domestic pigeons through routine laboratory methods in district Jhang. Fresh fecal samples (n = 1800) of pigeons were gathered in plastic bags from district Jhang home fanciers and local retailers. Smearing, sedimentation, and flotation procedures were among the various parasitological methods used to analyze all of the samples that were gathered. Herein, the prevalence of coccidiosis was ...

Asma Sadia Authoy2, Aneek Chanda2, Aparna Datta3, Md Shohel Al Faruk4, Towhida Kamal1* 

... the prevalence of ectoparasites among companion animals in the Dhaka Metropolitan area from January 2022 to August 2022. Data were gathered from Teaching and Training Pet Hospital and Research Center (TTPHRC), focusing on dogs and cats exhibiting skin lesions. A cross-sectional study was conducted, utilizing comprehensive questionnaires based on various risk factors such as age, sex, breed, vaccination history, deworming, etc. A total of 174 case sheets of do...
Budi Utomo1*, Amaq Fadholly2,3, Endang Tri Margawati2, Alek Ibrahim2, Ristaqul Husna Belgania1, Muhammad Fajar Amrullah1, Rimayanti1 and Hermin Ratnani1
... between Limousin and Madrasin cattle based on the sex determining region-Y (SRY) gene. SRY gene is used in the analysis of genetic diversity for sex determination based on the paternal pathway (Y chromosome). The DNA samples used for this study were 10 frozen straw of Limousin cattle and 10 samples of Madrasin cattle. The method used in this research was a descriptive analysis by duplex polymeras
Sudhan Chandran1*, GB Sreekanth2, Geetanjali Deshmukhe1 and  Ashok Kumar Jaiswar1
...orth-Western part of Maharashtra, India using dol nets. The dol net fishing took place from August, 2019 to July, 2020 in monthly intervals, using dol nets of equipped with mesh size of 280 mm at mouth part and 20 mm at cod end part of the dol net. The dol nets fabricated with nylon multifilament were operated from 6 to 25 m depth for 3–6 h each time deployed in 15 fishing trials. The total length and total weight of the combined sex group was recorded b...
Annum Razzaq1*, Zia Ullah2, Arooj Naseer1 and Abdul Nasir Khalid1
.../i> belongs to the mycoparasitic class of fungi and mostly infects fruiting bodies of Russula and Lactarius. During a survey for the collection of macrofungi from forests of sub-himalayas, Bhurban, Punjab, Pakistan, a unique fungus Asterophora lycoperdoides found growing on a decaying Russula species. Previously, no species of Asterophora has been described so far from Pakistan. Descriptions and illustrations are made using m...

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

...nd gamma-glutamyl transferase concentration(GGT). The results indicated that 200 mg/kg of SiO2 - NPs orally for 4 weeks contributed to a substantial drop in serum TAC-O, an increase in MDA, GGT, PC, and ROS concentration, and attenuation of silica’s oxidative stress status, CP NPs (T3) or SiO2 NPs (T2) administered orally to female rats for four weeks constitutes a case of oxidative stress. The study revealed the protective role of CP NPs against the neg...

Maria Endo Mahata1*, Yose Rizal1, Zurmiati1, Sepri Reski1, Indah Fitri Sakinah Limbong2, Dian Saputri2 

...brown seaweed Sargassum crassifolium on broiler performance. The study employed a fully randomized design, incorporating four replacement treatments (0%, 6%, 12%, and 18%) of brown seaweed Sargassum crassifolium within the broiler diet. Each treatment was replicated five times. A total of 100-day-old chicks were used in the experiment and reared under standard conditions. The results showed that inclusion of brown seaweed Sa...

Hemeida, A. A., Osman, M., El-Shahat, Mohamed, Hashem, Medhat H., Mahmoud, Amal and Dahi, Hosni

...erse Transcription Polymerase Chain Reaction (RT-PCR) for HCV. The confirmed patients were received 12 vials of BEG FN- 2a for 12 weeks (1801U/ml weekly) plus ribavirin (1000 mg for 75 Kg or 1200 mg for > 75Kg- Roche) and follow up by RT-PCR. The results showed that 67 patients (72.8%) responded to the treatment (group A), while 25 patients (27.2%) non responders (group B). The two groups were Screened for Serum alanine transaminase (ALT), Serum aspartate t...

Elkalamawyl, I.M.; Elhddadl, S.; Swelim2, M.A.; Hamdy2, S.M. and Fahmy3, Hanan A.•

...ti-HBc (core) IgM. Polymerase chain reaction (PCR) and sequencing were performed to surface antigen region and revealed two genotype D mutants 1--1BV. Aligned with known I-BsAg sequences from GenBank, the mutant variants matched to consensus with eight distinct genotypes (A to H) of hepatitis B virus. Multiple sequence alignment provided a more sensible way of detecting sequence homology and identifying the HBV isolates. From this alignment, certain positions ...

El-Kenawy, A. A. and El-Tholoth, M. S.

...IP) techniques and polymerase chain reaction (PCR) were used in our study. Chorioallantoic membranes (CAMs) of embryonated chicken eggs (ECEs) were inoculated with Known previously isolated and identified LSDV of 104 8 EID5d0.1 ml for virus follow up in these CAMs by using IF and IP techniques and PCR. The results indicate that IF and IP techniques are useful in the quick diagnosis of the disease in naturally infected cattle. PCR could be used for rapid and sp...
Hagag, N.M.*•, Arafa, A.*; Shalaby, M. A. ** El-Sanousi, A. A. **and Aly, M. M. 
...erse Transcriptase polymerase chain reaction (RT-PCR) and Real time RT-PCR (RRT-PCR) as a rapid, specific and sensitive detection methods currently used in national and reference laboratories worldwide. In this study a comparison of the specificity and sensitivity between 2 different formats of conventional RT-PCR (one and two steps) and 3 different formats of RRTPCR (one step using TaqMan probe, two steps using TaqMan probe and two steps using hybridization p...

Eisa*, Nawal A.; Abd El-Ghafar **, N. Y. Abd EL-Mageed*, M.H.; Mohamed* , F.G. and Hasan*, Eman O.

...ify;">Different Phages parasitizing Xanthomonas vesicatoria (the causal agent of the bacterial spot disease of tomato) were isolated from infected leaves of tomato and from tomato rhizosphere soil, using enrichment technique. The phages produced plaques (4-5mm, diameter) with a distinct translucent spreading halo. Presumptive phage particles associated with X vesicatoria were observed by Transmission Electron Microscope (TEM). Particle size and morphology of e...

El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.

... then amplified by polymerase chain reaction (PCR) using Pospiviroid-CCR specific primers. Purified gel RT-PCR product (⁓199) was cloned into the PCR Il TOPOvector then it was sequenced. Partial sequence 199 bp of CSVdEG is almost identical to that of the prototype 199 bp Canada and USA isolates of CSVd with 96% homology. The sequence of CSVd-EG can be arranged into viroid specific rod like structure. CSVd-EG differ from the prototype isolates Canada and USA...

Rabia Anjum

...ment are acetylcholinesterase inhibitors are easily accessible in the market to relief the AD primary symptoms but did not cure it. AD treatment needs a therapeutic approach to minimize its progression. This review focuses on the understanding of disease, hypothesis and treatment of disease to slow its progression. 
 
Novelty Statement | Amidst the challenges posed by the current medications, the n...

Abo Elmagd l , Enas K.; Abdel-Wahab l , Kouka S.; Alrasheedy l , Zeinab E. and Khalifa2, Ahmed S.

...erse transcription polymerase chain reaction (RT-PCR). Also detection of antiHIV IgG class antibodies in mothers' sera. The study sample included 61 pairs of 20-40 years old Egyptian mothers and their infants whose ages ranged from one day t012 months. All the deliveries were vaginal. Neither the infants nor the mothers had a history of high risk exposure to percutaneous virus transmission. Commercial ELISA kits for IgG, IgM, IgA anti-HCV epitopes and RT-PCR k...

Abo-Elmagdl , Enas K;El-Mougy2, Hala M. T. and Abd El-Salam 3, Manal

...erse transcription polymerase chain reaction (RT-PCR). Furthermore, to study the frequency of RSV infection in Egyptian infants and young children during the winter season 2009/2010 and the effect of certain risk factors including age and gender on the extent and impact of RSV infection. The study included 72 infants and young children, their age ranged from one to thirty six months. They were 43 males and 29 females. They were

...

SHARAW11'2*S S. S. A.; AL-HOFUFY2, A. N. and AL-BLOW12, M. H.

...ent of a Real-time polymerase chain reaction (RT-PCR) for detection of CPV using SYBR green I chemistry. A total of 15 specimens from camels suspected of being infected with CPV were collected from Riyadh Province during 2009 and submitted for virological investigation at the Central Veterinary Diagnostic Lab. (CVDL), Riyadh, Ministry of Agriculture; KSA. In solution; detection and identification of CPV was achieved in 10 samples by conventional polyme

Ahmed*, Amal A.; Khatab*, Eman A.H. ; Dawood*, Rehab A. and Ismeil*, Amira .M.

...used for tip culture . Murashige and Skoog medium (MS ) supplemented with (0.2 mg/L BA ) and (Img/l BA and 0.5 mg/L kinetin ) were used for proliferation and micropropagation of the infected shoot clumps respectively. The plantlets were rooted in MS medium supplemented with (1.5 mg/l NAA ) . Plantlets regenerated from meristem measuring 0.1 mm and 0.2 mm yielded (90 and 80 % ) for CLV and (92 and 80 ) for CarVMV virus-free tested plantlets respectively,while l...

El-Tabakh, SAA l ; Abdel Wahab, KSE; Badr, AF   and Helal, IG  

...erse transcription polymerase chain reaction (RT PCR) and viral proteins by polyacrylamide gel electrophoresis (PAGE). HCV infected and control HepG2 cells supernatant fluids (SF) were sampled before complete change with fresh MM at weekly intervals for periods extended to one month after infection. Three SF samples taken 5 days apart after HCV infection showed that detection of HCV-RNA in SF was intermittent but' detection of new native protein as well a...

El-Sabagh, I.M.; Hussein, H.A.; Amer, H.M.; El-Sanousi, A.A.; Reda,I.M. and M.A. Shalaby

...7) of bovine romvirus Nebraska calf diarrhea virus (NCDV) strain in insect cells. The full-length DNA copies of RNA segment 9 (coding for VP7 protein) of NCDV was inserted into a baculovirus transfer vector under the control of the polyhedrin promotor. A recombinant baculovirus carrying the VP7 gene was constucted through homologous recombination between the baculovirus transfer vector carrying the VP7 gene and Autographa californica Nuclear Polyhedrosis Virus...

Sahar A. Youssef I and A. A. Shalaby 

...erse transcription-polymerase chain reaction (m-RTPCR) was developed for the simultaneous detection and discrimination among five RNA viruses namely ,4pple cholorotic leaf spot virus (ACLSV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Plum pox virus (PPV) and Tomato ringspot virus
(ToRSV) which considered the most economically damaging viruses of stone fruit trees in Egypt and worldwide. Five compa...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2 
...erves transcriptionpolymerase chain reaction (RT-PCR). The severe isolate (ARC) gave the highest OD. value (2.204) in ELISA, followed by the mild isolate (TB) (1.958) and the last latent isolate (N) (1.669). These isolates differed also in incubation period, intensity of symptoms and response to sensitivity of woody indicator plants and differential hosts. The CPsV-EG isolates showed differences in isozymes fractions, RF value and intensity  as compared w...

Sahar, A. Youssef t ; M.M.A. Al-Dhaher 2 and A.A. Shalaby 

...ü-anscription-polymerase chain reaction (RT-PCR). The use of tissue culture was investigated as a mean to eliminate the two viruses. Virus free plants were produced within six months using meristem tip culture. Woody plant medium supplied with benzylamino purine (BAP) (1.5 mg/L) for shoot proliferation, and Indol butyric acid (IBA) (0.05 mg/L) for plants rooting. Before acclimatization, the plantlets were submitted to DAS-ELISA and RT-PCR in order to eval...

*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,

... transcription and polymerase chain reaction utilizing degenerate primers derived from conserved regions in the genome of potyviruses was designed to amplify a 335 bp cDNA fragment from infected plant using degenerate oligonucleotide primers specific for detection of Potyvirus group. Amplification of total RNA extracted from infected carnation suggesting the presence of one Potyvirus in the tested carnation plant. Nucleic acid spot hybridization assay also was...

* Amal Abou El-Ela, A.

...erse transcription-polymerase chain reaction (IC-RT-PCR) was used to amplify a 450 bp cDNA fragment from infected rose leaves (Rosa indica L.) using the primers Macl and Mac2 specific to Prunus necrotic ring spot virus (PNRSV) which were designed to amplify of the 3' end of the coat protein gene (RNA-3)- Nucleic acid hybridization was useful for the detection of PNRSV in herbaceous and woody plant tissues. In successful attempt to eliminate the virus from infe...

S.Y.M. Mahmoud1 and M. Hashem2

...smitted by a soilborne parasitic fungus, Polymyxa betae Keskin as a vector and by seed coating with viruliferous cystosori. the thick-walled resting spores of P. betae. as well as by root vortexing in virus inoculum containing carborundum. The virus is not adsorbed to the exterior of the fungal vector but is internalized. Our results indicated that BNYVV is a widespread in sugar beet in Kafr EI-Sheikh Governorate. thus, precaution methods must be taken for red...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

...erse transcription Polymerase Chain Reaction (RT-PCR). Field survey was carried out in commercial peach orchards during 2001-2003 in four different locations using DAS-ELISA. The average percentages of infection in three seasons were 17.5% and 3.1% in El-Dakahlia and El-Behira respectively. Naturally PRMV-infected trees develop chlorotic spots, rosetting, mosaic, chlorotic mottling, leaf deformation and shortening or the internodes (rosette appearance). The vi...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...erse transcription polymerase chain reaction (RT-PCR) procedure was used to amplify fragments using coat protein gene primers (358bp) of the viral coat protein gene. PCR product was used to generate ACLSV-specific probe to detect the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison ...

A-New-Whitefly-Transmitted-Geminivirus

...amily Solanaceae, in contrast to TYLCV. It was indicated that TYMV could be mechanically transmitted to several species of the family Solanaceae with the aid of a special buffer as well as by grafting and whitefly transmission. Electron microscope studies of TYMV showed geminated virus particles with about 18-20 x 30 diameters nm. The molecular weight of the viral capsids was estimated to be 28 KDa for TYMV. Serological analysis also proved that the putative T...

M.E. Shawky and A.M. Daoud.

... justify;">Taq DNA polymerase with different concentrations of other thermostable DNA polymerases with 3' to 5' exonuclease activity (PFU and Vent) was used in the amplification of large fragments (2 Kb, 3 CD genes) of foot and mouth disease virus (FMDV). Such long-distance polymerase chain reaction (LD-PCR) was conducted to reduce mismatch extension rates and improve epidemiological cloni...

A. A. El-Kholy1, S. Vilcek2 and A. M. Daoud1

...erse transcription-polymerase chain reaction (RT-PCR). Whereas virus isolation followed by immunostaining procedure in cell culture confirmed only 6/9 BVDVs that were cytopathogenic. Direct sequencing of the RT-PCR amplicons revealed an extreme nucleotide sequence homology (≥ 98%) among all tested Egyptian isolates versus the local vaccine strain. sequence alignments showed variable identity (74% - 93%) of the Egyptian vaccinal strain versus reference labor...

Maria Kikelomo Adegun1*, Femi Godwin Ekundayo1, David Daisi Ajayi2 

...s, aspartate aminotransferase, and alkaline phosphatase. In all these except alkaline phosphatase, the animals fed 30% GSF and 70% UTCP (T4) fared better than the animals on other treatments. Therefore, when the grasses in tropical regions dry up during the prolonged dry season, sheep can survive on urea-treated cassava peels and Gliricidia sepium fodder. 

...

Anak Agung Ayu Sri Trisnadewi*, I Gusti Lanang Oka Cakra

... straw and use elephant grass as the main source of fiber for ruminants. The research aimed to obtain a ration formulation through the use of elephant grass silage, corn straw silage, and concentrate for etawa crossbreed goats. The experiment used a randomized block design (RBD) with four treatments and each treatment was repeated four times, so there were 16 experimental units. The four treatments were: A = silage with 0% c...

Rana Mohammed Ibrahim1*, Haider Mohammed Ali Al-Rubaie2

... by Leucocytozoon spp. parasite in broiler chickens by using thin blood smears Nested and quantitative real time (qRT)- Polymerase Chain Reaction methods in Baghdad city between 1/11/ 2021 and 31/3/2022. Fifty jugular venous blood samples (about 5ml) were collected. The total infection rate of Leucocytozoon spp. in the blood smears was 10% (5/50), which divided into males 6% and in females 4%, while by qRT-PCR was 4% (2/50) ...

Sulake Fadhil Al-Zubaidi1*, Ghusoon A.A. Alneamah2, Ali Saleh Mahdi1, Abdulraheem Abduljalil Wali3

...ng on clinical signs, ultrasound, and complete blood count (CBC). Bitches were allocated into four groups: Group I: five bitches received only Aglepristone (Alizin®) given at 10 mg/kg Sc. Group II: four bitches received Aglepristone (Alizin®) was given at 10 mg/kg Sc and PGF2α at 1 mcg/kg B.W. after vaginal discharge appeared and continue until discharge disappeared. Aglepristone was repeated after 24 hours and seven days if needed for groups I a...

Nurhashunatil Mar’ah1, Safika Safika2*, Agustin Indrawati2

...-Bauer method. The Polymerase Chain Reaction (PCR) was used to detect the resistance genes and virulence factors of K. pneumoniae. Samples isolated from water sources showed a resistance profile to cefotaxime (100%), ceftazidime, ampicillin, and amoxicillin (50%). Samples isolated from udder rinses water were resistant to amoxicillin, cefotaxime, ampicillin (100%), and ceftazidime (60%). Samples obtained from milker hand swabs results were resistant to amoxici...

Divanildo Outor-Monteiro1,2,3*, José António Silva2,3,4, José Luís Mourão1,2,3, Victor Pinheiro1,2,3

...WBSF and meat pH. In contrast, 84-day-old rabbits reared in cages displayed reduced digestive organ development, decreased caecal acetic acid and increased butyric acid concentration, compared to their counterparts. When comparing slaughter ages, the 84-day-old rabbits exhibited higher dressing out percentages, lower relative organ weights (liver, kidney, lung and heart), decreased hind part proportions and lower cooking loss values. Furthermore, the hind legs...

Zhengfei Wang1*, Chenchen Shen1,2, Yiping Zhang1, Dan Tang1,3, Yaqi Luo1, Yaotong Zhai1, Yayun Guan1, Yue Wang1 and Xinyu Wang1

...50s, and one carboxylesterase. Our study suggested that ionotropic receptors were the main odorant receptors in Procambarus clarkii. Additionally, the key genes that are responsible for olfactory transduction in Procambarus clarkii were identified in the cAMP-mediated olfactory transduction pathway, including Cyclic nucleotide-gated cation channel beta-1, Adenylyl cyclase III, Calcium/calmodulin-dependent protein kinase II and Na+/Ca2+ exchanger. As a whole, o...

Saddam Hummadi1, Nadia Al-Falahi2* 

...t scar formation, in contrast with wounds area of GII which was nearly closed at periods of day 30th, while the wounds of GI exhibited incomplete closure at the same period. In conclusion, the composite bioscaffold integrates the properties of AgNPs with those of SIS hydrogel, providing a synergistic effect for wound healing improvement and showed the best outcome in healing of infected wound.
 

...

Xiaojun Li

...ost destructive pest on Brassicaceae plants family around the world. The present study investigated the feeding selection behavior of diamondback moth larvae with an approach to the acetone extract effects of Salvia Miltiorrhiza Bunge (SMB). It was found that acetone extracts of Salviami ltiorrhiza Bunge (SIB) represented by cryptotanshinone and dihydrotanshinone had lethal effect on diamondback moth larvae, and the correlation coefficient was 0.972. Through f...

Muhammad Talha Sajjad1, Hamid Akbar1*, Muhammad Arif Khan1, Muhammad Hassan Mushtaq3, Shehla Gul Bokhari1, Muhammad Abid Hayat4 and Ghulam Mustafa2

...d 28 by color Doppler ultrasonography and cytokeratin staining. Wound re-epithelialization and the number of fibroblasts were assessed by cytokeratin staining. All data were statistically analyzed. We observed that PRP-wounds had highly significantly (P<0.01) increased levels of neovascularization on days 14 and 28 than control wounds. PRP-wounds had highly significant (P<0.01) increases in re-epithelialization levels and fibroblast numbers at days 14 an...

Muhammad Wasif Gulzar* and Jawad Hussain

...(viral, bacterial, and parasitic), in contrast to the heavily regulated field of the development of medical devices (which include AI) in human medicine. When introducing such potent technology that might affect the welfare of both humans and animals, we must acknowledge the significance of exercising prudence and accountability. As veterinary experts, it is therefore our responsibility to hold ourselves responsible for guar...

Farid S. Nassar1,2, Osama A. El-Sayed3, Saidi Ouassaf4, Ahmed O. Abbas1,2* 

...VA with a polynomial contrasts test to explore the linear and quadratic trends of the FS increasing levels in broiler diets. The overall amount of feed consumed was unaffected by the FS diets. Still, increasing dietary FS levels enhanced the broilers’ final weights, gains, and feed-to-gain ratios (p < 0.05). As the dietary FS levels increased in broiler diets, weights for the carcass yield, breast, liver, and spleen increased substantially (p <...

Vladimir Vasilievich Shimalov  

...al 36 helminth species parasitize common shrews during three research periods. 

...

Elena Balarezo1*, Jose Luis Flores1 and Brendan Cullen2 

...ed adapted perennial ryegrass DR+HT is the most effective adaptation alternative to counteract the effects of climate change on pasture growth. The combined adapted perennial ryegrass DR+HT and the multiple adaptations FCE+DR+HT are the most effective ways to counteract the effects on overall feed consumption. The best adaptation strategy to combat the decline in milk production is to use the multiple adaptations FCE+DR+HT. ...

Seyed Ahmed Reza Hashemi1, Teymour Aminrad1, Asadullah Ali Muhammad2*, Mastooreh Doustdar3 and Parastoo Mohebi Derakhsh3

... between 53-90 tons. Contrast worth of phosphate showed substantial differences among diverse stations (P<0.05), while further parameters did not show substantial differences between stations (P>0.05). Multi-layer artificial neural network analysis indicated that two parameters, phosphate and nitrate, had the greatest impact on sea cucumber biomass. To implement a maximum sustainable yield method for this fishery in Iran.

...

Tinda Afriani1*, Jaswandi1, Yurnalis1, Putri Oktavially1, I Made Merdana2 

... exon 5 gene using Polymerase Chain Reaction (PCR), alongside a qualitative analysis of the characteristics exhibited by the FH and Pesisir cattle crosses. The identification results regarding the diversity of the GH gene found 14 point mutations, including six transversions, namely, C>G 1343 bp, T>G 1376 bp, C>A 1438 bp, G>C 1570 bp, A>C 1720 bp, and G>A 1744 bp. Additionally, seven transitional mutations were detected, including G>A 1359...

Limbang Kustiawan Nuswantara, Eko Pangestu, Marry Christiyanto, Santoso Dwi Pratomo, Elyza Zahrotul Muhtaromah

...of tofu dregs, elephant grass and concentrate composed of distillers dried grains with soluble (DDGS), corn gluten feed (CGF), coconut cake, soybean meal, wheat bran, molasses, gamal leaf flour, calliandra leaf flour. and indigofera leaf flour and then made in pellets. The experimental design used was a randomized block design (RBD) based on grouping body weights consisting of 4 groups and 4 treatments. The treatment applied was a balance of feed in the form o...

Heni Indrijani*, Asep Anang, Muhammad Farhan Fadilah, Nena Hilmia, Maya Fitriani

... 12 weeks of age. In contrast, the crossbreeding between Sentul Kulawu males and Sentul Debu females, produced by Sentul males, had the highest body weight of 973.62 grams at the same age. The research methodology used to measure the heterosis effect involved comparing the average parent with the average crossbreeding in terms of egg weight, DOC weight, fertility, and hatchability parameters. The results indicated that the crossbreeding between Sentul Debu and...

Kadhim Kh. K. Al-Khayat1*, Athmar K. A. Al-Azawi2

... infection rate of the parasite in local breed rabbits in Baghdad, Iraq.
 
Keywords | Cysticercus pisiformis, local breed rabbits, NAD1 gene, COX1 gene, Iraq
...

Riaz Alam1*, Muhammad Sajid2, Imtiaz Hussain3, Gulzar Ullah1, Hussain Shah3, Muhammad Arshad Farooq3 and Rashid Muhammad4

... (3.04 meq kg-1). In contrast, the extracted oil from ripe stage fruits had a lower phenol (361.67 mg kg-1) as well as elevated FFA (1.50%) and POV (4.43 meq kg-1), Furthermore, there was a significant reduction in carotenoids and chlorophyll content from 3.17 to 1.49 mg L-1 and 4.99 to 2.41 mg L-1, respectively in the extracted oil as fruits progressed from lemon green stage to ripe stage of harvesting. Olive cultivars Frontoio, Manzanilla and Picual are reco...

Tran Trung Tuan1,2, Nguyen Binh Truong1,2

...d on maize and elephant grass increased CP digestibility, nitrogen retention and growth performance.
 
Keywords | Rice wine distillers’ By-product, Digestibility, Rumen, Pre-pregnant, Goat
...
Raza Ali Mangi1,2, Ali Raza Jahejo1,2, Afrasyab Khan1,2, Meng-li Qiao1,2, Muhammad Farhan Qadir1,2, Mazhar Hussain Mangi3,  Shi-xiong Yang1,2, Xin-yu Han1,2, Sheng Niu1,2, Ding Zhang1,2, Ying Wang1,2 and Wen-xia Tian1,2*
...ant glutathione-S-transferase A3 (rGSTA3) protein on HDR and PRRs in the thiram-induced TD chicken. One hundred twenty arbor acres (AA+) broiler chickens of seven-day-old were equally divided into six groups. Group A, B, and C were treated with 0, 20, 50 μg.kg-1 of rGSTA3 protein, respectively. Group D, E and F were treated with 0, 20, 50 μg.kg-1 of rGSTA3 protein + thiram 100 μg.kg-1. The results showed that chicks treated with thiram showed a higher...

Irfan Ullah1, Asad Ullah2*, Tahira Tayyeb1, Rafiq Ullah1, Muhammad Hanif1, Faiza Khan3, Imad Khan2, Raheela Taj4, Fatima Syed4, Shumaila Gul5, Muhammad Sadeeq6, Muneeb Islam7, Arsalan Khan8 and Khudija Ghani9

...), Aspartate aminotransferase (AST) and Alkaline phosphatase (ALP) were higher significantly (P≤0.05) in negative control group (B) as compared to the group C, D and E. The level of uric acid, creatinine and blood urea were significantly higher (P≤0.05) in group A (negative control) (P≤0.05) as compared to the group B (positive control) C, D, and E. The blood cholesterol level and low-density lipoprotein (LDL) in group B (positive control) was signifi...

Moazama Batool1*, Saima Naz2*, Ghulam Abbas3, Ahmad Manan Mustafa Chatha4, Mamoona Mahmood1, Asma Aziz1 and Fatima Yasmin2

...ime, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), glucose and cholesterol were significantly (p < 0.05) increased in the treated groups compared to the control group. In conclusion, the study indicates that exposure to cadmium chloride, even in a low concentration, can cause adverse hematological and biochemical changes in Labeo rohita.

...

Sara Brikat, Mouloud Lamtai*, Miloud Chakit, Laila Ibouzine-Dine, Ilhame Fitah, Oumaima Abouyaala, Abdelhalem Mesfioui, Aboubaker El Hessni

...ts (p < 0.05). In contrast, the administration of HFD + Curc + Los lowered NO levels significantly in rats in comparison with the standard diet-treated rats (p < 0.01). In summary, our results suggest that treatments with Curc and/or Los could serve as possible therapeutic agents for memory impairment and OS provoked by HFD.
 
Keywords | Curcuma longa, Losartan, Memory, High caloric diet, Wistar rats
...

Tayfun Karatas1*, Betul Apaydın Yıldırım2 and Serkan Yıldırım3

...in aspartate aminotransferase (AST), serum alanine aminotransferase (ALT) and malondialdehyde (MDA) levels, and reduction in superoxide dismutase (SOD), catalase (CAT) activities, glutathione (GSH), total immunoglobulin (T. Ig), and white blood cell (WBC) levels. Moreover, CMN exposure led to degeneration, steatosis, and necrosis in liver hepatocytes as well as hyperemia and inflammation in the liver and caused degeneration,...
Sijie Jian1,2,3,4, Wei Sun1,3, Jia Chao1,2, Na Rong1,4, Xiang Liu1,2,3,4* and Chen Chen1,2,3,4*
...assive immunization of Carassius auratus with Slp mouse serum and challenging with bacteria showed a passive protection rate of Slp serum against A. hydrophila infection of 42.5 % (p < 0.05) and a passive cross-protection rate against P. fluorescens of 18.6 %; the immune-related factors of LZM, AKP and ACP and the leukocyte phagocytosis of phagocytic percentage (PP) and phagocytic index (PI) increased (p < 0.05); the inflammation-related genes expressio...

Sudip Kumar Sharma1, Al-Nur Md. Iftekhar Rahman1,2, Mahfuzul Islam1,3*  

...nfections (8.89%), and parasitic infestations (7.78%) (p<0.001). Among them, canine parvovirus (28.89%) and viral fever (18.89%) were more common than other illnesses (p<0.001). Crossbreeds had the highest occurrence of clinical diseases (about 29%), followed by German shepherd breeds (24%), local breeds (20%), Labrador breeds (13%), Pug breeds (9%), and Doberman breeds (5%) (p<0.001). Male dogs had a higher percentage of clinical cases (about 69% vs....
Nusrat Bano1, Muhammad Tayyab1*, Bushra Muneer2, Sehrish Firyal1, Abu Saeed Hashmi3, Muhammad Wasim1 and Ali Raza Awan1
...eeding tendencies (38%), rash (51%) and vomiting (48%). Thrombocytopenia (90%), leukopenia (62.5%), elevated transaminases (ALT 56.5% and AST 70.5%), hyponatremia (51.8%), hypokalemia (40.7%) and hypocalcemia (81.4%) was recorded among dengue patient. It was concluded that bleeding tendencies, retro-orbital pain, rash and vomiting were more frequent in DHF and DSS cases. Thrombocytopenia, leukopenia, deranged hematocrit, rai...

Lijuan Liu1, Jinghang Chen2*, Min Wang3 and Wei Li4

...-align: justify;">In contrast to systemic administration methods such as oral or injection, inhaled medications are directly administered to the respiratory tract to exert a therapeutic impact, which has clear benefits in the treatment of respiratory illnesses. However, existing inhaled medications are difficult to fulfill clinical prescription demands, and the research and development of novel inhaled pharmaceuticals has significant hurdles due to a lack of c...

Faris Sahib Imran1*, Layth Hamzah Merzah2, Mohammed Mohsin Kareem3

...ntrol group had natural grass grazing as the basal diet. The results revealed that weight gain, final weight, fat tail weight, hemoglobin, packed cell volume, glucose, and total protein of the experimental group was significantly (P < 0.05) higher than that of the control group A diet containing C. demersum has the potential as a protein source with a significant (P < 0.05) positive effect on the growth performance and hematological and biochemical param...

Kunlayaphat Wuthijaree1, Pattaraporn Tatsapong1, Sukanya Yung-Rahang2, Prayad Thirawong2, Koonphol Pongmanee2*

...er of gastrointestinal parasites per chicken (worm burden) in Thai indigenous chickens (Gallus gallus domesticus). A total of, 229 chickens (113 males and 116 females) were investigated in 3 selected districts in central Thailand. Chickens were raised under extensive backyard conditions and then slaughtered at ages 12, 14, 16 and 18 weeks. Standard parasitological procedures were used to determine the worm burden in the gast...

Kalsoom Abdulrazaq1*, Bisma Arif1, Rimsha Mehboob2, Asma Mehboob3 

...s, protozoa, and other parasites. These pathogens have the ability to infect both domesticated and wild animals. Zoonoses involve interactions among a minimum of three species: an infectious agent and two host organisms, which can either be humans or animals. They can spread directly through contact with diseased animals, such as rabies, and through bites, or indirectly through exposure to contaminated surroundings and contaminated food. Vectors, such as mosqu...

Oybek A.Abduganiev1, Erkinjon B.Shakarboev2*

...>Keywords | Helminths, Parasites, Predatory fish, Uzbekistan
...

Urip Rosani1*, Iman Hernaman1, Rahmat Hidayat1, Darmawan Hidayat2

...ermine the ability of ultrasonic waves to detect rice husks added to rice bran based on physical properties associated with nutrient content. This research utilizes low-intensity ultrasonic waves of 50 kHz transmitted on rice bran mixed with rice husks with particle sizes passing 30 mesh (<0.595 mm). The purpose of this study was to determine the correlation between ultrasonic parameter...

IRFANA IQBAL1*, PAKEEZA TANWEER1, FARKHANDA MANZOOR1, MUHAMMAD NAUMAN AFTAB2, AFSHAN KALEEM3, ROHEENA ABDULLAH3, ASMA ZAFAR4 & MEHWISH IQTEDAR3

...roperties of Dalbergia, Brassica and Trifolium honey samples against microorganisms isolated from infected burned skin of patients in children hospital, Lahore, Pakistan. The isolated microorganisms were identified as P. aeruginosa, E.coli, K. pneumoniae and S. aureus. The original bacterial inoculum was serially diluted (adjusted to 1.5 X 106 CFU) and spread on the nutrient agar plates. Whattmann filter paper discs were soaked in three different concentration...

AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2

...gested that salt stress drastically reduced length of shoot and root, fresh / dry weight and leaf area and antioxidant enzyme activities while the use of 0.5 mM concentration of SA greatly made good progress in all these growth and biochemical parameters. Production of antioxidant compounds under salt stress is accelerated under the influence of SA. So it causes modifications in antioxidant compounds and hence increases salt tolerance under saline conditions.<...

ARIFA ZEREEN & ALMAS JAHAN

...asing population, the infrastructure such as new residential colonies, roads etc. had to be developed which seriously affected indigenous plant communities. This has caused destruction of local vegetation growing there and exposed land for colonization of invasive and exotic plant species. Besides this many exotic species have been planted as ornamental plants at the green belts. With the passage of time the exotic plant species also called Invasive Alien Spec...

ASMA WAHEED QURESHI1* & SHUMAILA ALAM2

...ustify;">Assessment of parasitic contamination of raw vegetables in District Mardan, Khyber Pakhtunkhwa was carried out by detection of parasitic eggs, cysts and larvae. Seven vegetables including cabbage (Brassica oleracea), lettuce (Lactuca sativa), carrot (Daucus carota), mint (Mentha spicata), chili (Capsicum frutescens), cucumber (Cucumis sativus) and corriander (Coriandrum sativum) w...

MUJIBUR RAHMAN1, MUHAMMAD AYAZ KHAN1*, WISAL SHAH1 & ALIA NAZ1

...b) in roadside soil and Brassica rapa (Shalgham). For that purpose, soil and B. rapa samples were collected from primary, secondary, tertiary roadside fields and control site. The samples were investigated for Cd and Pb presence via atomic absorption spectrometer (PerkinElmer, AAS-PEA-700). The Cd concentrations in soil ranged from 2.55 to 4.35 with mean value 3.31 mg/kg, 3 to 8.85 with mean value 5.41 mg/kg, 3.15 to 5.55 with mean value 4.9 mg/kg and 2.45 to ...

ZEESHAN REHMAN1, RANA ABRAR HUSSAIN1, SHAISTA JABEEN2, SAKHAWAT ALI2, ZAHAR NOREEN1 & IRUM MUKHTAR1*

...tly cultivated/consumed Brassica oleracea. Var. Botyris species in Lahore (LHR), Narowal and Kasur districts of Punjab, Pakistan. The average concentration of elemental Zn in sewage-irrigated samples was the highest (153.4233mg kg−1), followed by Cd2+ (70.47333 mg kg−1) and Pb (65.79667mg kg−1). Results showed higher Pb2+ and Cd2+ level in B. oleracea than daily intake of metals (DIM) standard limits, cultivated on wastewater. Whereas health ...

SEHRISH MUSHTAQ1, MUHAMMAD SHAFIQ1, MUHAMMAD ASHFAQ*1 FAIZA KHAN1, SOHAIB AFZAAL1, UMMAD HUSSAIN1, MUBASSHIR HUSSAIN1, RASHID MUKHTAR BALAL2 & MUHAMMAD SALEEM HAIDER1

...l for inhibition. In contrast remaining isolates Enterobacter cloacae (19.33%), Azomonas agilis (17%) and Kurthia sp. (19%) were less efficient as compared to the others. Bacterial endophytes are colonized inside plants and have antagonistic potential for fungal pathogens. These endophytes should be further explored for disease control. Ongoing study in this area will help to the innovate biological control of plant pathogenic fungi.

...

ABRAR HUSSAIN1, AQSA KHALIL1, SAIRA ZAHEER1, MUHAMMAD LATEEF2 & MUHAMMAD MANSHA1

...ic are used to control parasitic infections but their persistent use develop resistance in parasites. In this connection local plants/ their parts are being used to explore their anthelmintic potential. The aim of the present study was to determine the anthelmintic activity of Tribulus terrestris L. and Ziziphus mauritiana Lam. Whole plant of Tribulus terrestris L. and leaves of Ziziphus mauritiana Lam. were used. The plant ...

LAILA SHAHZAD*1, MUHAMMAD UMER HAYYAT1, NIDA SAJID1, FAIZA SHARIF1, ASMA MANSOOR1, MANAL SHAH1 & NABEEHA LODHI1

...ot city to assess the infrastructural vulnerability to natural disasters and the related level of awareness among community. A household questionnaire based survey was used to determine awareness and resilience of the community. Another methodology named Rapid Visual Screening (RVS) was used to determine the factors that contribute to infrastructure vulnerability to natural disasters. Factors assessed through this methodolog...

ZAHID FAROOQ1, IRFAN BABOO2, MUHAMMAD WAJID3, HAFIZA SADIA4, MUHAM

...rea, Alanine aminotransferase, Aspartate aminotransferase, Creatinine, Total Protein and Albumin were determined. The overall biochemical blood values of Urea 282.06±37.18mg/dL, ALT 13.61±2.597 μL, AST 48.23±28.157 μL, Creatinine 61.04±12.658 mg/dL, Total protein 9.29±1.228 mg/dL and Albumin 2.44±0.108 mg/dL and were recorded. All these parameters between male and female were n...

MUHAMMAD NADEEM1, MUHAMMAD WASEEM MUMTAZ1&MUHAMMAD DANISH1

...nt work describes the ultrasonication assisted extraction followed by comprehensive investigation of antioxidant activity and α-amylase inhibition potential of hydroethanolic leaf extracts of Vitexnegundo. Freeze drying assisted ultrasonicated extraction revealed highest level of total phenolic contents (258.29±2.52 mgGAE/g DE) and total flavonoid content (155.91±1.75 mgRE/g DE) in 60% hydro-ethanolic V. ...

*AMNA SHOAIB, AROOJ SHEZAD, ARSHAD JAVAID, SUNDUS AKHTAR & ZOIA ARSHAD AWAN

...="text-align: justify;">Brassicaceae member i.e. Rhaphinus sativus L. and three species of Trichoderma (T. harzianum, T. viride and T. hamatum) were evaluated for their antifungal effect against Sclerotium rolfsii, the causal agent of collar rot disease in chickpea. In vitro, methanolic leaves extract of R. sativus significantly decreased pathogen biomass by 6-96% and three Trichoderma species also caused significant inhibition in pathogen growth variably betw...

Karima Akool Al-Salihi1*, Luay Jumaah Jihad2, Abbas Najm Aldin Saleh3

...stribution of external parasites particularly ticks, and other diseases such as Theileria, Anaplasmosis, FMD, three-days sickness, contagious ecthyma, sheep pox, clostridium diseases, brucellosis, mastitis, and respiratory diseases. The study also showed reemerging of Crimean Congo hemorrhagic fever and rabies in humans. The participants (187) responded at a rate of 98.1%. The undergraduate students and graduated veterinarian percentages were 79.67% and 20.32%...

Bela Putra1*, Budi Prasetya2

...quality of dwarf napier grass (Pennisetum purpureum cv. Mot) cultivated in acidic soil, with a focus on its macro-mineral content and rumen fluid characteristics. The research findings focus on the impact of gamma radiation solely on macro minerals and rumen fluids, enhancing our insights into innovative approaches for improving livestock nutrition in regions with prevalent acidic soils. The experiment involved the application of various gamma radiation doses ...

Gokarna Gautam1*, Sajan Rokaya1, Bhuminand Devkota1, Saroj Sapkota2

...d through transrectal ultrasonography and measurement of blood progesterone concentration using ELISA. Seasonal breeding and calving patterns were similar at two locations. The highest proportions of buffaloes were bred during autumn (40.8%), followed by winter (29.5%), summer (19.8%) and spring (10%). While comparing the month-wise patterns, the highest and the lowest proportions of breeding were in November and April, respectively. Likewise, the highest prop...

Anisa Mushtaq1, Murtaz ul Hasan1*, Asim Shamim2, Muhammad Ali Abdullah Shah1, Muhmamad Arif Zafar3, Abdul Asim Farooq4, Aayesha Riaz1, Muhammad Kamran1 and Saif ur Rehman

...ous blood sucking ecto-parasites of wide range of animals which serve as vector of different types of pathogens like viruses, bacteria, rickettsia and protozoa and cause mortality in humans and animals. This study was focused on morphological and molecular identification of ixodid ticks, using morphological keys and an internal transcribed spacer (ITS-2) Deoxyribonucleic acid (DNA). Moreover, the presence of Babesia and Theileria species was also investigated ...

Xin Yan Ku1, Phek Jin Kwong1*, Chaiw Yee Teoh1, Mohammad Mijanur Rahman2, Fakar Fariz3

...rages like dwarf Napier grass and Trichanthera gigantea for pre-weaning Boer crossbred kids. Proximate analyses were conducted on the feed ingredients and the newly formulated feed before the feeding trial. Twelve (n=12), single-born Boer x Jamnapari crossbred kids, with an average birth weight of 3.25 kg   and body condition scoring of 3 to 3.5 were randomly divided into two dietary treatment groups (n=6 per group), each containing 3 males and 3 fem...

Nawab Ali1, Akeel Ahmed Memon1, Asmatullah kaka1, Amjad Hussain Mirani2, Muhammad Ibrahim Panhwar3*, Nisar Ahmed Solangi1, Kashif Ali Malik1, Fazul U Rahman1, Moin Akhtar Vistro1 

... and real-time B mode ultrasonography. The results showed that group B had a significantly (P<0.05) higher conception rate (50%) than group A (30%). In conclusion, supplementation of TEY extender with 2 mM selenium improved in-vitro (chilled and frozen-thaw sperm traits) and in-vivo conception rate of Kamohri buck semen. 

...

Tianhoun Denté Fidèle1,2*, Meda Nãg-Tiéro Roland2, Zabré Geneviève3, Koama Benjamin2, Kaboré Adama1, Tamboura H. Hamidou1, Bélem Adrien Marie Gaston4 

...ce of gastrointestinal parasitosis associated with resistance to conventional anthelmintics observed in small ruminants has led to the development of alternative strategies focusing on the use of medicinal plants. Thus, the present study was carried out to assay total phenolics and evaluate the in vitro anthelmintic efficacy of aqueous and hydroacetone extracts of Combretum micranthum leaves on the parasite Haemonchus contor...

Naveed Ahmed* and Amjad Usman

...ile Latreille 1802 from grassland and meadows of coniferous forests of Khyber Pakhtunkhwa Province was conducted. Eight species were recorded, two species (Megachile albifrons, Smith 1853, Megachile pseudodisjuncta, Kumari 2018) are new record to Pakistan, whereas all the eight species are new record to Khyber Pakhtunkhwa Province. Brief description together with illustrations and distributional range of each of these Megachile species is also provided. A diag...
Muhammad Atif Raza1, Muhammad Tariq Javed2, Muhammad Fiaz1*, Muhammad Shakeel3, Muhammad Shahbaz Ul Haq2, Amna Kanwal2, Syeda Maryam Hussain1 and Muhammad Zubair Siddiqi4
... (T1, T2, T3 and T4). Wheras challenge infection of Salmonella gallinarum was given on nineteen days of age to all experimental birds except of those in CN group. On 22nd day, infected birds in T1 were given Florfenicol antibiotic. Whereas infected birds in groups; T2, T3 and T4 were given concentration of nanoparticles zinc oxide and copper oxide at different rate; 25+10, 37.5+15 and 50+20 mg/kg/d, respectively. Collected data were analyzed using complete ran...
Kalaiselvi Natarajan1, Karal Marx Karuppiah1, Sheena K Baby1, Sakthivel Mohammed2, Shanmugam Seerappalli Aran1 and Suresh Eswaran1*

Muhammad Wasif Gulzar*, Riffat Maqsood, Muhammad Zain, Muhammad Suleman, Tayyab Ur Rehman, Sana Asif, Abdul Wadood and Jawad Hussain

...nosis include PCR (Polymerase Chain Reaction), and Mouse Inoculation Test (MIT). In endemic locations, vaccinations with DNA, recombinant vaccines, and live, attenuated, or inactivated viruses can be administered. This study provides comprehensive information on immunization, treatment techniques, pathophysiology, epidemiology, transmission, and relevant preventive and control measures.

...

Abeer Alahmari1,2*

... in renal tissue. In contrast, AME alone did not cause renal injury, and it was able to notably improve the toxic impacts of ethanol in the kidney when administered together. In conclusion, AME provided preservation against ethanol toxicity by scavenging reactive oxygen species (ROS) and relieving oxidative stress as a result of its rich chemical content of furano-sesquiterpenes, which possess powerful antioxidant activities.

...

Yousef Abdal Jalil Fadladdin1, Ateeq Ullah2*, Raheela Nawaz3, Yagoob Garedaghi4, Abbas M.A. Al-Azab5 and Mashael Abdullah Aldamigh6

... safely transported to Parasitology Laboratory, University of Malakand for parasite examination. Each of the samples was processed in direct smear methods and examined under microscope first under low power objectives and then higher power Lense. Evidence of infection was noted by the presence of helminth eggs. Out of 200 samples 65% (n=130) were found to be infected with 2 species of soil transmitted helminths including 27%...

Zuhair Dardona1,2, Adnan Al-Hindi3, Mohamed Hafidi1, Ali Boumezzough1 and Samia Boussaa1,4*

...y;">Toxoplasmosis is a parasitic disease that is transmitted by a variety of routes, including the ingestion of raw or undercooked meat. It infects roughly one-third of the world’s population and is caused by Toxoplasma gondii, an obligate intracellular parasite. The goal of this research is to detect the existence and genotypes of T. gondii in beef and mutton, two of the most widely consumed red meats in Gaza, Palesti...

Gokarna Gautam1*, Hari Adhikari1, Bhuminand Devkota1, Subir Singh2

...ned using transrectal ultrasonography. Estrus expression rate (96.7% vs 68%; P=0.008) and ovulation rate (93.3% vs 76%; P=0.10) were higher in CIDR-synch than in Ovsynch group. Although pregnancy rate from FTAI did not differ between CIDR-synch (33.3%) and Ovsynch group (16%), overall pregnancy rate obtained from FTAI plus natural breeding within one month after FTAI was higher (P=0.04) in CIDR-synch (46.7%) than in Ovsynch group (20%). Pregnancy outcome from ...

Fika Yuliza Purba1,4*, Andi Magfira Satya Apada1, Andi Ariyandy2, Irwan Ismail1,4, Subaedy Yusuf3,4

...the other groups. In contrast, the mean corpuscular volume and mean corpuscular hemoglobin in Group A were significantly higher compared to Groups B and C. The serum concentration of albumin in Group A was significantly higher than in other groups, and the serum concentration of aspartate aminotransferase in Group D was higher than in the other groups. The serum concentrations of creatinine and blood urea nitrogen in Group A...

Shahbaz Hussain1, Asif Ameen2*, Muhammad Ehsan Safdar3, Atif Naeem1, Ahmad Jawad1, Madad Ali1, Muhammad Ather Nadeem3, Ghulam Abbas2, Muhammad Arif2, Muhammad Ahmad Zafar4, Zahid Hassan5

...ble approach to control grassy weed flora and ensure higher paddy yield with higher economic returns when rice is sown under DSR technology. 

...

Shahzad Aslam1*, Amjad Rashid Kayani2, Muhammad Irfan Ashraf3, Muhammad Azhar Jameel2 and Kiran Sahar4

...ch on feeding ecology, parasitology, food preference based on nutritional requirements of Rhesus monkey in MHNP.

...

Elie Brigitte Mawussi1*, Arnaud Koffi Assah2, Essozimna Abalo Kulo1

...st trypanosomiasis and parasites. The mineral supplement was provided by the lick stone. Water was constantly served to the animals. The kids are fed with powdered milk replacing their mother’s milk until weaning to avoid the Caprine Arthritis Encephalitis Virus. They are fed with local fodders after weaning. Were collected through regular controls: litter size, birth weight, type of kidding (single or twin), mother’s parity, age at first kidding, ...

Ahmed Kareem Kadhim Al-Wasmee1, Waddah Salam Hassone2, Hawraa Talib Al-Janabi3, Hamed AH Al-Jabory1

...ck-borne hemoprotozoan parasite that result in a tropical theileriosis in bovine herds and causes significant economic losses in the cattle sector. We estimated and interpreted the frequency of theileriosis in the calf herds in Babylon Province. We carried out the study from July until the end of December 2022 in several regions of Babylon Province. Ninety jugular vein blood samples were collected. The calves ranged from <1 M to ≥4 M and both sexes were ...

Muhammad Ilyas Riaz1, Masood Rabbani1*, Sohail Raza1, Ali Raza Awan2, Aleena Kokab1, and Rida Haroon Durrani1

...108 CFU per mice. In contrast to this, the parent RB51 strain induces splenomegaly and showed higher persistence with significantly higher splenic CFUs in the mice group at 10th and 20th DPI as compared to B. abortus ΔpurD mutant. The histopathological comparison of spleens from both groups also revealed much infiltration of giant macrophages in the B. abortus ΔpurD mice group as compared to the parent RB51 mice group indicating superior immune res...
Yanis Cruz-Quintana1*, Ana María Santana-Piñeros1, Byron Manuel Reyes-Mero1, Leonela Griselda Muñoz-Chumo1 and Lenin Cáceres-Farías1,2 
...e-height: normal;">Ectoparasitic protozoa of the genus Trichodina are considered one of the main pathogens affecting cultured fishes, mainly in small organisms or early ages. However, its incidence and effects on Amazon traditional aquaculture species such as Piaractus brachypomus has been little studied. The objective of the present investigation was to establish the presence of Trichodina heterodentata, its parameters of infection, and a...

Faisal Ali1, Abdul Aziz Khakwani1, Iqtidar Hussain1, Ghazanfar Ullah1, Atiq Ahmad Ali Zai2, Moneeza Abass3, Zuhair Hasnain4* and Sara Zafar5*

...ction between the Sudan grass hybrid and fertilizer increased the crop growth rate (16.43 g day), leaf area index (5.01), net photosynthesis rate (66.07 mole m2 sec’’), green fodder yield (109.99 t ha’’), reducing sugars% (2.47), brix% (13.50), and pol% (8.11). Based on the research results, it has been found that Sudan grass hybrids fertilizer using NPK @ (150:120:100 kg ha’’) attained be...

Muhammad Ayyub, Mitha Khan*, Syed Abdul Malik, Sakhawat Ali, Syed Shamsullah, Mujeeb ur Rehman, Ikhlaq Ahmed, Ameer Uddin, Habibullah Kakar, Mohammad Zahid, Khalil Ahmed, Mana Khan, Mukhtiar Ahmed, Muhammad Rafiq Khetran, Zia ul Haq and Muhammad Azam

Asmit Subba1*, Jash Hang Limbu2 and Laxman Khanal1*

...macrophytes (Eichhornia crassipes, Hydrilla verticillata, and Ceratophyllum submersum). The type locality of the H. nani in Bangladesh and the newly reported locality in Nepal share similar tropical monsoon climates and river connectivity that might have facilitated their dispersal. Further studies are warranted to understand the detailed taxonomy and distribution pattern of H. nani in Nepal. 
 

M.J.Al-Saadi*, Jassim E.Q.Al-Musawi 

...05) lower levels. In contrast, the positive control group showed a significantly (P<0.05) higher cortisol hormone level compared to all other treated and negative control groups. In the histological examination of the liver and small intestine, all treated groups exhibited normal organs without adverse gross or microscopic changes, while the positive control group that exposed to heat stress without mint treatment, showed macroscopic and microscopic deleter...

Shangmei Peng1 and Changhe Yu2*

... the risk factors of contrast-induced acute kidney injury (PC-AKI) in patients examined by computed tomography (CT) with iodine contrast agent. A retrospective analysis was made on 1591 patients (809 cases in contrast-enhanced CT group and 782 cases in plain CT group) who underwent CT examination in Yanbian University hospital from May 2012 to May 2022. Binary logistics regression analysis...

Moazama Batool1*, Syeda Ansa Fatima1, Saima Naz2*, Qurat Ul Ain1, Sheeza Bano1, Ghulam Abbas3 and Ahmad Manan Mustafa Chatha4

... LC50 of bifenthrin for grass carp was determined as 6.5µg/L. Fish were divided into four groups i.e., one control and three experimental groups having eight fish in each group. Control group was not exposed to bifenthrin. Experimental fish were exposed to sublethal (1/3rd of LC50) doses of bifenthrin i.e., 2.16 µg/L for 30 days. Behavioral parameters of C. idella were observed at acute as well as sub-lethal concentrations. It was observed that beh...

Arshad Javaid1* and Iqra Haider Khan

...study aimed to assess a brassicaceous weed Coronopus didymus (L.) Sm. as a
source of potential natural herbicides for management of an alien weed parthenium
(Parthenium hysterophorus L.). Initially, the effect of aqueous leaf, stem, root and flower
extracts (0, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0%) of the weed was checked on germination
and growth of the target weed. Leaf and stem extracts showed the best herb...
Muhammad Usman1, Ghulam Murtaza2, Allah Ditta3, Tamana Bakht3 Muhammad Asif4,
Muhammad Nadir1and Sehar Nawaz5
...ops. This issue is more drastic for cereal crops like wheat which is the staple food
crop of over 2.5 billion population of the world. One the control strategies is to investigate
the distribution pattern of weeds under field conditions. In this regard, a survey study was
conducted to investigate the distribution pattern of weed species in wheat crop during 2016-
18 in district Khanewal, Punjab Pakistan. Thirty-s...

Gulwaiz Akhter1* and Tabreiz Ahmad Khan

...al for the
parasites to disseminate and infest new cultivated fields in absence of farmers’ knowledge of
problem and lack of effective management programmes.
...
Mona Adel El-Wakeel1*, Salah El-Din Abd El-Ghany Ahmed, Sanaa Abd El Rahman Mohamed
and Nadia Khalil Messiha
... weeds: Phalaris minor (grassy weed) and Malva parviflora (broad-leaf
weed). PLP was mixed with in the soil surface at successive rates (15, 30, 45 and 60 g pot-
1). In the corresponding treatments PLP at the same sequenced rates were mixed with the
soil then sprayed with acetic acid 5% immediately. Moreover, sole spraying of acetic acid
5% treatment was sprayed on the soil surface. All treatments were applied be...

Mona Adel El-Wakeel1 and Ibrahim Mohamed El-Metwally1

...v>
against canary grass and cheese weed mallow and the response of common bean plants.
Two successive pot experiments were conducted with twelve treatments. The first four
treatments were applied by incorporating of orange peels powder with the soil surface at
successive rates (10, 20, 30 and 40 g/pot) one week pre-sowing of common bean. In
the other corresponding four treatment...

Farrukh Hussain1, Sajid Aziz1, Gul Hassan2, Khalid Aziz1 and Sapna Raisham1

...ta Poaceae, Asteraceae, Brassicaceae, Cyperaceae, Papilionaceae, Euphorbiaceae and Lamiaceae emerged as the important families. The phytosociological data pointed out the dominance of annuals and therophytes (34 spp.),mesophyllous (50%) and leptophyllous& microohyllous (each 19.64%) species. Of the 8 types of leaves, simple entire leaves were dominant (67.86%).Three closely similar communities: Echinochloa-Salvia-Hypericum, Cynodon-Echinochloa-Eragrostis a...
Muhammad Ehsan Safdar1, Muhammad Ather Nadeem1, Abdul Rehman1, Amjed Ali1,
Nasir Iqbal2, Qaisar Mumtaz1, Amir Javed1
...ays after sowing. In contrast to control, all herbicides have shown significant
decline in weed density (up to 94%) and dry weight (up to 88%); and caused significant
increases in plant height (up to 85%), pod bearing branches (up to 77%), number of
pods per plant (up to 83%), 100-seed weight (up to 37%) and seed yield (up to 160%)
of soybean. Among herbicides, topramezone at 21.5 g a.i ha-1 gave significantly th...

Hussain Shah1, Hamida Bibi2, Ali Hazrat1and Khan Sher3

... follows by
Brassicaceae and Moraceae each one is represented by 4 species. Among angiosperms 73
(63.01%) was herbs, 4 (5.47%) was shrubs and 20 (27.39%) was trees. The local
community is currently using these plants species along with mushrooms for different
diseases and also used as a timber wood, as fodder and as a fuel.
...
Tabassum yaseen1*, Muzamil shah1, Khushnood Ur Rehman2 Ali Mujtaba Shah3, Gul
Nawaz1,Rani Gul4
...;0.58). While absent in Brassica nigra (Brassicaceae).
...
Imtiaz Khan,1 Muhammad Kabir, Muhammad Ishfaq Khan, Haroon Khan, Saima
Hashim and Muhammad Azim Khan
...-72% for broad leaf and grassy weeds
respectively. Consequently the instant results provided 54% increased yield compared to
the untreated treatments. Hence it is concluded that, line sowing in combination with tank
mixed herbicides are more suitable for management of weeds in the wheat field and
increased yield in the agro-climatic conditions of Peshawar-Pakistan.
...

Abdullah1, Syed Mukarram Shah2, Adnan Ali Shah1, Murad Muhammad1, Muhammad Abdussalam1, Khushnood Ur Rehman3 and Haroon Khan4*

...aceae (6 species each), Brassicaceae and Polygonaceae (5 species each), Euphorbiaceae and Solanaceae (4 species each), Chenopodiaceae and Convolvulaceae (3 species each), Apiaceae, Caryophyllaceae, Cyperaceae, Malvaceae and Verbenaceae (2 species each) were the dominant plant families, while the rest of 16 families contributed a single species each. The dominant life form was therophytes (76 species) followed by hemicryptophytes (11 species) and geophytes (8 s...

Muhammad Ather Nadeem1, Bilal Ahmad Khan1* Sadia Afzal2, Rizwan Maqbool3, Hasnain Waheed1, Aneela Nijabat4, Muhammad Ikram5, Amir Aziz6, Muhammad Adnan1, Qaisar Mehmood7, Hasnain Umer3

...a cruss-galli (barnyard grass. The experiment comprised of seven concentrations (0, 0.25, 0.50, 1, 2, 4, and 8%) of different plant parts i.e., leaves, stem and flower of P. somniferumwere. All the tested concentrations and plant parts of P. somniferum significantly reduced mean emergence time, germination index, germination percentage, time to 50% germination as well as well growth of E. cruss-galli weed. However, maximum mean emergence time (9.07 days), time...

Eman Ali Hussein1*, Majdy Faisal Majeed2

...g/kg body weight, In contrast, rats in groups 3 and 4 were given oral gavages of TFG herbal extracts (0.15 g/kg BW) in addition to being kept on an identical experimental protocol to that of the rats in groups 1 and 2, respectively. While group 5’s diabetic rats that received orally gavages 3.5 mg/kg of glucophage XR treatment served as positive controls. Treatment with TFG of groups 3 and 4 recorded significantly (p≥0.05) enhanced of renal functions ...

Suparada Saphaphan, K. Teepalak Rangubhet, Phongthorn Kongmun*

...our treatments, Pangola grass hay (PH), rice straw (RS), MSGBTRS, and 3.5% urea-treated rice straw (UTRS), were mixed thoroughly with the concentrated feed ingredients to make TMR at a ratio of 60:40. Treatments were assigned in a completely randomized design. Results showed that cumulative gas production at 72 h was significantly higher (P<0.05) in the MSGBTRS treatment, while PH exhibited the lowest value (P<0.05). Additionally, in vitro dry matter dig...

Fitrimawati*, James Hellyward

...ogies, facilities and infrastructures, markets, raw material suppliers, business developments strategy, government rules and technological tools development. The number of laborers in the livestock sectors should be a major concern at this time.
 
Keywords | Competitiveness, Commodity, Leading, Livestock
...

Mthi S. 1,2, Ikusika O.O.1*, Washaya S.3, Mpendulo C.T.1, Nowers C.B.2 

.../p>...

Ashar Farooq1*, Farrukh Waheed1 and Asad Abbas Khan2

...tudied. The clipping of grass was made at 2.5 cm above the collar point. Data were statistically analyzed using t-test. Results revealed that forage production in un-grazed site was significantly higher (P<0.01) than the grazed site. The results further revealed that air dried forage production and cover percent of Cenchrus ciliaris and Cynodon dactylon were significantly higher in the un-grazed area. This is attributed to protection from grazing while the ...
MURAD ALI KHAN,MUHAMMAD ADNAN,ZAHID KHAN,KAWSAR ALI,KHALID NAVEED,BUSHRA SHAFI,MUHAMMAD TARIQ,MUHAMMAD ARIF,MUHAMMAD WAQAS
Sara Hidayat,Adnan Shakeel,Mushtaq Ahmad,Muhammad Kashif,Haroon Khan,Muhammad Amin,Ijaz Ahmad,Bakhtiar Gul
L.R. Dangwal,Amandeep Singh,Tajinder Singh
ANBREEN ANJUM,ZAFAR IQBAL KHAN,SHAKIRA HAMID,HINA SHAHZADI,AMEER FAWAD,SHUGUFTA IDREES,ZUNIARA MUBEEN,Muhammad Yousaf
Imtiaz Khan, Gul Hassan, Muhammad Ishfaq Khan , Ijaz Ahmad Khan
Vaqar ul Hassan , Muhammad Saleem, Nusrat Shaffi, Kamal ud Din, Muhammad Qasier , Asfandyar
Khan Bahadar Marwat, Ijaz Ahmad Khan, Zahid Hanif , Muhammad Ishfaq Khan
MUHAMMAD AWAIS,AMEER FAWAD,ANBREEN ANJUM,ZUNIARA MUBEEN,SHAGUFTA PURVEEN,Muhammad Yousaf,KULSOOM GHULAM ALI,HINA SHAHZADI
Eric Koetz,David LucketT,Hanwen Wu,Deirdre Lemerle
MUHAMMAD SADIQ,KHALIQ NOOR,Mohammad Safdar Baloch,INAYAT ULLAH AWAN,Muhammad Aslam,EJAZ AHMAD KHAN,Muhammad Ayaz Khan

 

Chika Bright Ikele1*, Ugwu Venita Uju1, Chioma Faith Ikele2

...onia amygdalina), lemon grass (Cymbopogon citratus) and ocimum leaf (Ocimum gratissimum) to investigate their efficacy against theronts for 24 hours. A 100 µl (480 theronts) were distributed into five groups; 0, 0.01, 0.03, 0.05 and 0.1 g/ml (A-E) (for all plant extracts used) in a 96 micro-wells chambers, with 3 sub-replicates of approximately 160 theronts. Mortality occurred in all groups except in the control group during the exposure period. 24-h the...

Muddasir Khan1, Siraj-Ud-Din1, Muhammad Farooq2* and Sanam Zarif2

... specie. Ranunculaceae, Brassicaceae, Apiaceae, Uriticaceae, Nyctiginaceae, Polygonaceae, Amaranthaceae, Chenopodiaceae, Oleaceae, Verbenaceae and Plantaginaceae were represented by 2 species each. Zygophyllaceae, Rhamnaceae, Mimosaceae, and Asclepiadaceae are represented by 3 species each. Moraceae is represented by 4 species. Euphorbiaceae, Solanaceae, Papilionaceae were represented by 7 species each. Asteraceae and Lamiaceae were represented by 10 and 11 sp...

Majeed Ajafar1, Hashim Hadi Al-Jebory1*, Mohammed Khalil Ibrahim Al-Saeedi2

...tive control (PC).In contrast, the 3rd, 4th, 5th, and 6th egg groups were injected with phospholipids at a concentration of 1, 2, 3, and 4% (0.3 ml/egg), respectively. On the 18th day of embryonic age, the second half of the egg was divided and treated similarly to the first half of the egg. The results showed that injecting at 12 days of embryo age resulted in a significant superiority (P < 0.05) for groups G1, G4, and G5 regarding the hatching rate. The e...
Mubashar Hussain1,2*, Hifza Liaqat1, Muhammad Faheem Malik1
Kiran Aftab1, Moazama Batool3, Razia Iqbal1 and Somia Liaqat1
...mpunctata, Sceliphron madraspatanum, Aedes albopictus, Eristalis tenax, Crambus albellus, Zonitoschema melanarthra, Zonitoschema gibdoana, Camponotus vagus, Polistes carolira, and Episyrphus viridaureus were the main contributing species in the community dissimilarity. Results showed significant differences between Vatala - Deva with higher Shannon value in Vatala (H’ = 4.03) than Deva (H’ = 3.92), Deva-Barmala with higher Shannon index in Barmala ...

Lipigwe Lauya1*, Peace Nkiruka Okeke2, Nanma Tongnan Cosmas1 and Chukwudi Chizorom Ibeh1

... gaps in surveillance infrastructure, health inequality in classifying HIV burdens based on HIV type, and deprived HIV-2 research and policy enforcement could create obscurity in HIV-2 data. Considering the existing circumstances, this article highlights the importance of vigilance, re-evaluation of assumptions, and advocacy for unified efforts to address the multidimensional problems associated with HIV-2 to guarantee the sustained integrity of public health....
Tanvir Hussain1, Said Akhtar2, Khalid Hussain3* and Zahid Rauf4
... species except Salix tetrasperma can be selected for manufacturing of pulp and paper products.

Keywords: Fiber morphology, Hardwoods, Lalkoo-Swat....
Muhammad Umair1, Nowsherwan Zarif1*, Zahid Rauf1, Anwar Ali1, Ghayyas Ahmed1, Basheer Ahmed1, Salman Ahmad1 and Saifullah1
...orestry adoption. In contrast, farmers who are older, less educated, and whose properties are located closer to markets were less likely to plant trees in between and on the border of the fields. Cultivators should be aware of the potential benefits that might be derived from agroforestry systems and should strive toward making the growth of these systems economically and environmentally. Further, in order to ensure sustainable economic development and prospe...
Saddam Rasham1*, Sohaib Ahmed1, Arz Muhammad Umrani1, Sidra Jamil2, Tariq Khan1, Shehr Yar Nasim3, Safi Ullah1, Haseeb Ahmad1 and Asfand Yar Nasim1
...ments in the physical infrastructure.
Keywords: Local Community, Perception, Pressure, Tourism, Azad Jammu & Kashmir.
...
Muhammad Farooq1*, Lal Badshah2 and Sanam Zarif1
....), Lamiaceae (8 spp.), Brassicaceae, Solanacea, Poaceae each with 6 species were the leading families. Mimosaceae (5 spp.) Caryophyllaceae (4 spp.) were the next dominant families. The other families had either 3 or less than 3 species. Biological spectrum of flora indicated that therophytes (34 spp., 36.5%), followed by nanophanerophytes (16 spp., 17 %) were the dominant. Similarly, hemicryptophytes (14 spp., 15%), chamaephytes (11 spp., 11.8%), microphanero...
Ashar Farooq1*, Mohammad Salim2, Muhammad Tahir Khan3, Zahid Rauf1, Ahmed Hussain2 and Muhammad Bilal Zia1
...ecies of Panicum grass subjected to different clipping stages at Range Research Garden, Pakistan Forest Institute, Peshawar. Randomized Complete Block Design with Factorial arrangement having four replications was used for layout of the experiment. Treatment combinations consisted of three species i.e. Panicum antidotale, Panicum coloratum and Panicum maximum and three clipping stages viz. Pre-boot; full flowering and Seed Ripe stage. Fres...
Kaleem Mehmood1, Sultan Muhammad2 and Altaf Hussain3
...e sale of fuel wood and grasses along with opportunities of daily wage labor at the time of planting and other cultural activities. Community Plantations increase forest cover which in turn provides opportunity for wildlife conservation in the area due to habitat....
Ch. Muhammad Muslim1, Hassan Sher2, Junaid Khan2, Shahid Hussain2, Ashfaq Ali2 and Atif Majeed3
...aranthaceae, Asterceae, Brassicaceae, Fabaceae and Pllygonaceae were represented by 2 species each. All other families were represented by 1 species each. Documented plants have defined uses for different purposes in the traditional systems of medicines. Plants species were also classified into five conservation classes out of which 7 were dominant 11 frequent, 9 common, 9 rare while 4 were classified as very rare.

Keyword: Ethnomedicine, medicinal plant...

Asad Abbas Khan1, Amina Batool2, Muhammad Aslam1, Muhammad Ehtesham Asghar3, Abdul Ghafoor1 and Muhammad Arif1
... production of reseeded grasses in scrub rangelands of Kherimurat scrub forest of Barani Livestock Production Research Institute, during summer 2010 to spring 2011. Five grass species included Bothriochloa pertusa (palwan), Pennisetum purpureum (Napier), Cynmbopogan distans (Chita), Cenchrus ciliarus (Dhaman) and Themeda anathera (Loondar) were reseeded by broadcast method during summer, 20...
Asad Abbas Khan1, Amina Batool2, Muhammad Aslam1, Muhammad Ehtesham Asghar3, Abdul Ghafoor1 and Muhammad Arif1
... production of reseeded grasses in scrub rangelands of Kherimurat scrub forest of Barani Livestock Production Research Institute, during summer 2010 to spring 2011. Five grass species included Bothriochloa pertusa (palwan), Pennisetum purpureum (Napier), Cynmbopogan distans (Chita), Cenchrus ciliarus (Dhaman) and Themeda anathera (Loondar) were reseeded by broadcast method during summer, 20...
Zahid Rauf, Tanvir Ahmad Qureshi, Ghayyas Ahmad and Wahiba Iqbal
...yptus spp., Poplar spp. Frash (Tamarix aphylla), Bakain (Melia azedarach), Walnut (Juglans regia), Simal (Bombax ceiba), indigenous and imported Willow (Salix tetrasperma and S. alba) and Mango (Mangifera indica). It is recommended that afforestation/reforestation programs all over the country should ensure a sustainable supply of raw material for the wood based industries.
Mohsen Dehghani
...nomically undeveloped infrastructures in the region have led the local communities on the coastal areas to supply the livestock's fodder from mangrove leaves. Hence, the household incomes rely considerably on these habitats product, while economic evaluation of the harvested fodder reaches $124686 annually. Recognizing the importance of mangrove forests and their role, protection of this resource must be considered seriously.

Key words: Economic Valu...

Mubashir Jamil Khan1, Asad Abbas Khan2, Amir Saleem1, Lateef M. A.1, Muhammad Aslam1, Muhammad Mushtaq2, Abdul Ghaffoor2 Amna Btool1 and Arsalan Ali Khan1
... the nutritive value of grasses in order to optimize their forage use. The research was conducted to determine the seasonal variation in nutritional value of five grass species found in Kherimurat scrub forest and rangelands. General observations of increasing percentage of all nutrients except for dry matter were observed from summer to winter season and then reverse from winter to spring in the major range g
Mian Muhammad Shafiq and Muhammad Saqib
...anus) koklass (Pucrasia macrolopha), Kalij (Lophura leucomelana), western horned Tragopan (Gragopan melanocephalus) and Cheer (Catreus wallichi) are found in Pakistan while four (4) species i.e. Monal, Koklass, Kalij and Western horned Tragopan are found in the study areas of Kaghan valley.

This study was conducted in the Kaghan valley to know the status and conservation of pheasants. A questionnaire was designed and th...

Fazal Baqi Kakakhel
...lands, mountain slopes, grass lands and barren rocks. Chi-square tests showed the species displayed significant habitat selection in relation to the availability. The species showed highly significant habitat and preferred mountain slopes highly significantly. The species preferred northerly aspects and foraged in the morning and evening to reduces stress heat. The findings conformed generally to other studies on the species. ...
Bazmir Khan1, Mazhar Iqbal2 and Anwar Ali3
...e and 1,250 numbers of Eurasian Cranes in autumn, 2010 and 35,688 Demoiselle and 2,652 Eurasian Cranes in spring, 2011. It is suggested that regular seasonal monitoring surveys will be helpful to assess the trends in the population of migratory cranes. Options were also identified for conservation of cranes in Balochistan.

Key words: Population monitoring, awareness, conservation, cranes, River Zhob

...
Mian Muhammad Shafiq and Muhammad Saqib
...anus) koklass (Pucrasia macrolopha), Kalij (Lophura leucomelana) and western horned (Gragopan melanocephalus) are found in Pakistan while four (4) species i.e. Monal, Koklass, Kalij and Western horned Tragopan are found in the study areas of Kaghan valley.

This study was conducted in the Kaghan valley to know about the status and conservation of pheasants. A questionnaire was designed and the villages were selected which were...

Tanveer Haider, Aurangzeb Ashraf, Ambar Masud
..., stood 78%, shrubs and grasses cover, in total 79 vegetative species were found in the area, however 7 remained unidentified forage productivity remained 1160 kg/ha, animal units was almost .03. Pressures and threats to park and particular compartment are directly and indirectly increasing day by day. Major pressures are increasing human population, overgrazing by animals, environmental pollution, like water contamination and forest fires. A thing of concern ...
Muhammad Nawaz Rajpar and Mohamed Zakaria
...n the study area. In contrast, eight waterbird and nine terrestrial bird species were the rarest in the study area. The relative abundance of terrestrial birds and waterbirds was significantly different (i.e. F1, = 6.24, P < 0.05) in the wetland reserve. The results of this study indicated that this wetland reserve is highly attractive habitat for wide array of waterbird and terrestrial bird species.

Keywords: Wetland, Waterbird, Ter...

Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...he rainfall was reduced drastically in spring and late summer seasons. Evaporation and wind increased 1.59 times and 1.40 times, respectively. The results indicated a significant feedback mechanism among temperature, rainfall and evaporation. The temperature showed negative correlation with rainfall (r2 = 0.49) while positive correlation with evaporation (r2 = 0.78). The range of variation and coefficient of variation of temperature, rain...
Tanvir Hussain
...ent culture media i.e. Murashige & Skooge (MS) medium, Gamborgs B5-salt (B5)and Basal nutrient medium (BNM) alone and in combination with Auxins and Cytokinins. It was found that only the axillary buds gave good response to all media. For callus initiation, same ex-plants and media (alone and in combination with callus initiators) were tried but callus formation was not observed. Aseptically grown young plants were then transferred to hydroponic conditions for...
Md Golam Moula
...>Ceriops decandra, Aegiceras corniculatum, Phoenix paludosa, Excoecaria agallocha, Heritiera fomes, Lumnitzera racemosa, Xxlocarpus mekongensis, Cynometra ramiflora and Bruguiera sexangula were tried. The highest survivability was found in A. corniculatum and P. paludosa (87.67%) and lowest in L. racemosa (61.33%). The maximum and minimum diameter after 11 years of planting were found in E. agallocha (10.15 ± 0.73cm)...
Malik Mahboob ur Rehman1, Muhammad Rafiq2, Amjad Ali Ch.3, Tariq Mahmood4, Javaid Ahsan5 and Shahzad Fazal6
...aman) was the principal grass species (85%) in treated areas while Eleucine flagellifera (Chimber) (38.72%) in untreated areas. General grass coverage on the average was 9.7% and 36.75% in un-treated and treated pastures respectively. Carrying capacity based on dry biomass of grasses/herbs was found to be 18 Ac/AU/Yr and 10 Ac/AU/Yr in un-treated and treated areas. Study concluded t...
Muhammad Afzal, Amjad Ali Ch., Javaid Ahsan, Shahzad Fazal and Saima Tabassum
...aman) was the principal grass sp. (47.85%). General grass coverage on average was 57.01% and 30.27% in protected and open pastures respectively. Dry matter yield of protected pastures was 1316 kg/ha while it was only 388 kg/ha from open pastures. Carrying capacity based on herbage biomass for protected and open pastures was found to be 0.40 and 0.12 AU/ha/yr respectively. ...
Amjad Ali Ch., Tariq Mahmood, Shahzad Fazal and Nowsherwan Zarif
...l composition of Buffel grass (Cenchrus ciliaris Linn.), Bluepanic (Panicum antidotale), Pennisetum orientale and Setaria sphacelata. The experiment was laid at Punjab Forestry Research Institute, Faisalabad on sandy loam soil. The experimental design was completely randomized with four replications. Grasses were established by planting tuft splits in 1x3 m plots at 0.3x0.3 m spacing. No fertilize...
Ghayyas Ahmad, Mian Muhammad Shafiq, Muhammad Shabir Mughal and Mahr Muhammad Asif
...ected and managed in contrast to the Guzara forests which suffer from problems related to management issues and local rights in the forest.

...
Ghulam Mustafa Nasir, Noreen Fatima and Kanwar Muhammad Suleman
...ain, White Bakain, and Farash woods the frequency or size of wood rays was found to be higher and the woods may be non-durable. Therefore, chemical treatment of these woods is necessary before utilization as structural timbers for manufacturing of products. In Amaltas, Chinar Ipil Ipil, Bakain, White Bakain and Phulai, the fibers were longer or thick walled and the woods may be stronger or comparatively better in strength properties. Moreover, all the studied ...
Ajiboye, A. A.1, Ebofin, A. O.1, M. O. Atayese,2, M. O. Adedire3, D. A. Agboola1 and M. Kadiri1
...gravel and emery cloth abrasion. The percentage germination in pretreated seeds ranged between 70-100%. The emery cloth treatments gave the best result. The proximate analysis of the seeds including the moisture content, dry matter, fibre content, crude protein content, crude fibre content, ash content and carbohydrate content were estimated. The seeds of P. Africana and D. guineensis contain moisture content (%) of 8.64 and 12.62, dry matter...
Kabir Dihider Shahriar, Mahmood Hossain and Ripon Kumar Debnath
... was dominated by tal (Borassus flabellifer) species.

Key word: Home garden, Community Forestry, Social Forestry

...
Anwar Ali and Hakim Shah
...t users have led to the drastic degradation of the resources. Though forest legislation limits the rights of local people in the forests but still majority (72%) of them have access to forest resources in the area. They fulfill all their requirements from these forests but contribute nothing to the protection and development of the forest resources. The existing forest legislation and forest management have totally failed to achieve their objectives. It is fea...
Amjad Ali Chaudhry, Chaudhry Muhammad Muslim and Muhammad Mushtaque
...lagellifera was the key grass species. 26.37% and 16 88% ground was covered by grasses/herbs and shrubs, respectively while 56.75% was uncovered. Carrying capacity was found to be 1.003 AU/ha/yr and shrubs were the major contributors of forage. The Rakh presented miserable condition of grasses and it is strongly recommended that rotational system to be followed which promotes forage vigour...
Sardar M. Rafique and Ghulam Ali Bajwa
...D and LBWG were reduced drastically during final instar. It is therefore, recommended that for efficient utilization of food silkworm should not be reared above 26±1°C and 75±5% RH.

Key words: Silkworm Bombyx mori. Strains, Food consumption and utilization, ingestibility, ECI, ECD, AD, rearing season Larval body weight.

...
Muhammad Umar Farooq
...uction potential of the grasslands of the country by converting them into the sown pastures Several strategies for improving rangelands and realizing sustainable forage yields, have been discussed in the article....
Hassan Sher, Midrarullah, A. U. Khan, Z. U. Khan, Farrukh Hussain and Siraj Ahmad
...piaceae, Asclepidaceae, Brassicaceae, Caryophylaceae, Euphorbiaceae, Moraceae, Oleaceae, Papilionaceae, Polygonaceae, Scrophulariaceae, Solanaceae, and Uriticeae were represented by two species each. The remaining families have only one species of medicinal importance. These species are used for the curing of various human ailments in traditional system of medicine. The local uses, local method of recipe preparation and their local name and diseases treated we...
S. M. Rafique
...cies. Out of it 18 were grass/grazing species, 2 forb species, 10 shrub species and 6 tree species. The bio-mass production was 752 kg (AD)/ha which was quite low. The study further indicated that range condition was poor to fair and the range trend was downward. The study has recommended application of specialized grazing system like; intensive repeated seasonal grazing to utilize coarse and or less palatable grass species....
Mohammad Zubair Sulemani* Mohammad Safdar Baloch** and Khalid Abdullah**
...>Helianthus annus), brassica (Brassica compestris) and taramira (Eruca sativa). Seed germination of all sevel crops was significantly and negatively affected due to the application of extracts as compared to tap water treatment. Highest adjusted reduction in germination (89.67%) was recorded in Sorghum followed by Taramira (85.36%), while maize was least affected (60%).

Keywords: Allelochemicals, k...

M. Muhammad Rafi
...e management of similar grasslands have been given. ...
Iqtidar Hussain and Adnan Noor Shah
...mbsquaters, Bird�s seed grass, Broad leaved dock and Umbrella milkweed .In addition to the control, 10 ml of dry leaf water extract was applied at intervals of 3 days for each treatment. The data obtained after 20 days showed that the fresh weight and dry weight of each tested weed were significantly reduced compared to the treatment with water (control). Germination, root length (cm), shoot length (cm) and chlorophyll content of the weeds are adversely affect...
G. A. Bajwa and M. N. Ashiq
...-101 and 206-MKD. Viral grasserie resulted overall 16.65 6.95, 5.52 and 1.87 percent mortality in J-101, C-102, 206-MKD and 207-PO, respectively. There was non-significant difference of mortality between 206-MKD and C-102. White muscardine was not found in 5th instar larvae as well as in spinning larvae; however it caused maximum 2.99% mortality in J-101 during pupil stage. Cumulative mortality because of these three diseases was in the array of J-101 (38.59%)...
Mian Muhammad Shafiq
...mon to a large part of Eurasia, and with those with affinities to the Middle East, Western Asia, Central Asia and Tibet. The rate of endemism is relatively and 11% low (5% for plants, 4% for mammals, none for birds, 10% for reptiles for fish) but the blending of elements from different origins has ensured a diverse and interesting flora and fauna....
Muhammad Afzal
... yet are the members of grass family, the Gramineae. They have sometimes been treated as a different family from the Gramineae; however most taxonomists agree to keep them in Gramineae, sub-family Bambusoideae.

The plant has a many jointed cylindrical hollow stems called the culms. The stems are connected to a rhizome network that spreads out horizontally beneath the soil, forming a bush known as clump. The propagation of bamboos by seed is most successfu...

Muhammad Afzal and Muhammad Hafeez
Altaf Hussain
...ances originated from Batrasi, Dadar and Ghoragali are the best in diameter and height growth under local climatic conditions at Pir Sohawa, Islamabad. ...
Sardar Muhammad Rafique
...loristic composition of grass and forbs species had improved manifolds. The vegetation cover percentage, herbage production, species composition, species distribution and number of species had increased under combined effects of protection and fertilizer application. The Poa alpine - Potentilla fragarioides vegetation type was transformed to Poa alpine - Digitaria sanguinalis types. This change had also registered increase in species number from...
Ghulam Akbar, Muhammad Arshad and Taj Naseeb Khan
...lanting methods of five grasses were compared at Arid Zone Research Institute (PARC) farm in Cholistan during monsoon seasons of 1992-94. A seed rate of 250 seeds/m2 was used in case of seeding while for stump planting the plant to plant spacing was kept at 0.5 m. Overall dry matter yield (DMY) than rest of the grasses. Field observations confirmed that plants emerging from seed were morphologically more vi...
Muhammad Iqbal
...luded. The owners of guzaras have the right to collect, free of charge, fuelwood and timber for their domestic and agricultural needs, graze and collect forage for the livestock. Management of these forests, however, rests with the Forest Department, against the management charges at the rate of 20 percent of the net timber sale proceeds....
S. M. Raidh, M. K. Hossain and S. Akhtar
...riculiformis and Chickrassia tabulatris. Five different sizes of polybags were tried for three months time in the nursery. The parameters of seedlings like total height, collar diameter, root length, root diameter, dry weight of root and shoot etc. were measured at the end of the experiment. The finding showed that the polybags of T4 treatment (30.5 x 15 cm size) produced quality seedlings of both the species within three months time and the size may b...
Muhammad Ayaz
... materials like woods, grasses and shrubs, for this use, on the basis of their fiber dimensions. Among all the species investigated softwoods are the best material for pulp and paper, followed by bamboos and other grasses. Most of the hardwoods and shrubby materials yield short fiber. To produce a strong paper from hardwoods and shrubby materials use of a pulp furnish of softwoods and/or bamboos is recommended. In ad...
Bashir Hussain Shah
...on benches with natural grass on slopes and bench terraces. On the risers of bench terraces and conservation benches ipil ipil was planted. In strip cropping Eucalyptus camaldulensis, Acacia modesta and L. leucocephalla were planted in 3 rows at 1 x 1m spacing along the contour. At the outlet of each catchment, detension dams with circular splitter and siltation tanks for monitoring water and sediment yield were constructed. The water and sedimen...
K. M. Siddiqui
...are perennial gigantic grasses which are versatile and graceful group of plants and are of multiple utility. About 14 million hectares of the earth surface is covered by bamboo forests with 80 percent of their total area falling in Asia. They are well represented in all continents except Europe and their distribution extend from 15° North latitude in Japan to 47° South latitude in South Argentina in the areas of Tropic of Cancer and Tropic ...
Ghulam Akbar, Shahid Rafique and Muhammad Asghar
...hree warm-season exotic grass species were raised and evaluated for above ground dry matter biomass in Mastung and Tomagh areas in upland Balochistan. Tall wheatgrass and pubescent wheatgrass exhibited high dry matter biomass in southern upland region (Mastung) both in fall, 1989 and spring 1990. In north-eastern region (Tomagh), weeping lovegrass ...
Mohammad Saleem and C. A. Call
...ponses of the palatable grass Chrysopogon aucheri (Boiss.) Stapf. and the co-occurring unpalatable grass. Chymbopogon jwarancusa (Jones) Schult., under managed and unmanaged conditions on Baluchistan rangelands. Both species were grown in monoculture and in a 50:50 mixture in an 11-month (44-week) greenhouse study. Defoliation treatments were implemented when plants were 32 weeks old; and consisted of: equall...
Javed Afzal, Abdul Sattar Alvi and Sarwat Naz Mirza
...es for fuel. Valuable grasses like Washta/Hadden (Stipa pennata), and Granang/Rangai (Enneapogon persicum) have almost vanished. These were the important palatable perennial grasses representing the climax of range ecosystem in highland Balochistan. Now, these have been replaced by Saba/Kaj (Chrysopogon aucheri), a sub-climax stage in deterioration of the original cover (Johnston and Hussain,...
Adnan Zahoor
...wo million years, have drastically modified the environment. They cleared the large areas of forest, grass land and created new landscapes. Humans started replacing the vegetated landscape with constructed citiescapes. Several physical features of the landscape combine to produce local climate variations. Chief among these are the influence of topography, proximity to the ocean, and urbanization. ...
Mohammad Saleem and C. A. Call
...ess of dominant forage grasses found on arid and semiarid rangelands in Baluchistan. A controlled environment study was conducted to determine differences in leave and tiller development and root development between seedlings of Chrysopogon aucheri (Boiss.) staph, and Cymbopogon jwarancusa (Jones) Schult, at 15, 30, 45, and 60 days after emergence. Chrysopogon aucheri seedlings generally had greater, but not significantly gr...
Wali-ur-Rehman
...ed to a Hymenopterous parasite. 13 of the 24 insect species, identified by the I.I.E. London, belonged to Coleoptera (9 species), Lepidoptera (3 species) and Hymenoptera (1 species). Caryedon serratus among Coleoptera and Hypsipyla robusta and Didia sp. Among Lepidoptera were found the most serious pests infesting seeds of Acacia tortilis (80%), Cedrela toona (97.5%) and Bauhinia variegate (73.5%) respect...
K. M. Siddiqui and Saliheen Khan
...of rainfall) to support grasses, scrub and coniferous forest.

The population of Northern Areas was estimated at 800,000 in 1993. Most people live in small villages and towns in the valleys and lower foothills. Cultivated and orchard land is nearly all irrigated. Recently, Forestry Sector Master Plan used satellite imagery to determine land use in this area (FSMP, 1993). Its data are reproduced below. Since, 4.7 million ha were not classified, so ...

Mohammad Saleem and C. A. Call
...) Stapf. on Baluchistan grasslands may be related to differences in recruitment potential in addition to differences in payability and grazing tolerance. A controlled environment study was designed to investigate the effects of different temperature regimes on germination responses of these two dominant range grasses. Cumulative germination and rate of germination (mean germination time) were evaluated at six altern...
Hanif Gul and M. Ismail Chaudhry
...ds and one Eulophid parasitizing poplar bark borer, Indarbela quadrinotata (Pseuderbelidae, Lepidopteral) larvae and pupae, were recorded. Aeolesthes sarta (Cerambycidae, Coleoptera) grubs were found predated by a mite predator. Entomophathogenic fungus attacking all stages of I. quadrinotata and Elaterid predator of A. sarta, pit borer Apriona cinerea (Lamiidae, Coleoptera) were recorded. Observations on...
Bashir Hussain Shah, Altaf Hussain and Raja M. Omer
...e.g. tree plantations, grass cover and bare soil differed significantly although other physical characteristics were not significantly different....
Bashir Hussain Shah
...effect on the growth of grasses under them as compared to Zizyphus mauritiana, Acacia modesta, Dalbergia sissoo and Albizzia lebbek. The cover percent of the vegetation was lowest (8.25%) under Eucalyptus camaldulensis and highest under Zizyphus mauritiana (83%). The cover percent under Acacea midesta and L.leucocephala was 64, 60, 53, 29, and 16%respectively. The forage production data also showed the same trend...
Mohammad Noor, Mohammad Khan and Gul Nabi
... species composition of grasses, forbs and trees/shrubs were not significantly different in the exclosed and adjacent grazed areas. The higher ( P = 0, 05) forage production and composition of Aristida depressa in the grazed area showed that this species increased under continued grazing. Frequency of grasses, forbs and trees/shrubs was not affected by the exclusion of livestock. The data indicate that direct manipula...
Muhammad Khurshid Swati and Muhammad Afzal Cheema
...lost as smallwood, Pharas, kurf or left as stump on the ground. The outtern volume of trees in logs or in scants primarily depends on parameters such as species, taper, site quality and density of the crop. At present there is no sound basis for accurate assessment of outturn volume in the form of logs and scants a certain forest. As such forest officers do not have the estimates of the outturn from the.marked trees....
*Nasir M. But, **Noor Mohammad, *Sartaj and *M. I. Sultani
...akistan....
P. H. Haydock Wilson and A. R. Beg
...nization by the bladey grass Imperata cylindrica (L.) P. Beauve. a pan-tropical weed. Plots with and without the presence Imperata were sampled over six sites along a single watershed. The number and biomass of Chir pine (Pinus roxburghii Sargent) seedlings of all ages were found to be markedly less in plots where Imperata ground cover exceeds 75%. Over the range of sites, however, other factors of the pine's regenerative ecology a...
Zakaullah
...teria and phanerogamic parasites. Mulberry mosaic virus was found to cause heavy reduction in leaf yield and distortion in the cocoons with inferior silk when silk worms were fed on infected leaves....
K. M. Siddiqui M. Ayaz and A. Jah
...massar and adjoining Guzaras in Siran Forest Division every year at a rate of 1.099 tonnes /ha/annum. Out this 72.2% is woody and 27.8% is non-woody fuel. Woody fuel constitute about 0.62% of the total growing stock and 31% of the annual increment. Therefore, these forests have a limited use other then fuel wood collection heavy collection of fuel wood by the people is a socio-economic condition of the people and gradual substitution of wood fuel with ...
Zakaullah
...ea, S. seriocarpa, S. tetrasperma and a single species of poplar, Populus nigra (Lombardy poplar) were found commonly grown in the area. Nevertheless, a few hybrid poplars (P. X. euramericana) were also noticed around Phander Rest House. Willows are grown for fodder, basket-making, roof construction and for timber; whereas Lombardy poplar is a major timber species. Both the crops are raised vegetatively. A general practice with the lo...
Mohammad Noor
... increase was both for grasses and forbs. The percent cover of grasses and forbs increased 21/2 times inside as compared with that of outside the closure. The grazing capacity due to closure increased 7 times of the grazed area. ...
K. M. Siddiqui
...easing. This called for drastic changes in the aid policy of the donor countries, which could ensure development at grass-root level for individual farmers through development of his own resources. Since, trees provide numerous benefits to the farmers, hence they should be provided assistance to harness the increased benefits. This concept is now gaining ground with growing realization that farming and forestry are in...
Muhammad Farooq, Pazir Gul Khan and F. W. Khan
...tle feed on pilot scale....
Qutabuddin Marwat and Naseer Ahmad Khan
...medicinal plants and 11 grasses....
Zakaullah, Jehan Ara and Abdul Jabbar
...12 fungi were recorded parasitising a dozen new hosts including timber species, orchard plants, condiments, medicinal herbs and weeds. However, earlier workers (Ahmad 1956, 1956, 1978; Spaudling 1961; Sadiq and Shah 1986) have significantly contributed to the records of fungi and their hosts occurring in different regions of the country. The present article describes the fungi comprising 3 Classes: Ascomycetes, Basidiomycetes and Fungi Imperfect with in...
M. I. Shiekh and Sultan Maqsood Khan
...ffect of fertilizers on grass ranges some studies have been conducted at Balakot and Jaba using N, P and K alone or in combinations. The data collected gave encouraging results indicating positive cost benefit ratio. These studies, conducted by Dr. S. M. Khan and his group....
M. I. Shiekh and S. M. Khan
...to reseed the area with grasses such as Cenchrus ciliaris and Panicum antidotale. The selection of these two grasses was based on the fact that both of these are hardy, high yielders, palatable and nutritious. ...
Sultan Maqsood Khan
... stalks, harvesting of grass at boot stage, seeding and planting of desirable adaptable species, soil and water conservation, range suitability classification, crossing local cattle with yak, preventive medication, increasing off takes and extension practices....
M. I. Sultani, Muhammad Banaras Bhatti, Sartaj and Anjum Amin
...different treatments of grass legume mixture during 1982.The green and dry matter yield was found significantly higher in monoculture pure form as compared to the other treatments throughout the growing period. Legume in the pure form as well as in mixture significantly increased the total soil nitrogen in soil. The increase in crude protein contents was associated with the increase of legume in the grass legume mixtur...
Abdur Rashid Tariq and Haji Moosa A. Tayab
... crop of Pioneer Rhodes grass on sprinkler system of irrigation. The irrigation water of these sites was drawn from the subsoil and it contained 3500ppm of dissolved salts. This project went into full production within three months of its initiation. Thereafter this programme was extended further over an area of about 2000 hectares under various agencies. The Forestry Department, besides raising pastures on project scale, also initiated a study to test the ada...
Editor
....S. Aid supports of Honduras Pine in the Caribbean

(ii) Brazilian forestry team win 1984 Marcus Wallenberg Prize for commercial development of cloned Eucalyptus forests...

Zakaullah, Mohammad Irfanul Haque and Khial Badshah
...observed that both the parasites were found growing between 500-1050m above sea level. L.pulverulintus was parasitizing the plants in the higher range and L. longiflorus in the lower range. They were found attacking 32 timber and fruit plant species some of which had been reported earlier L. longiflorus was more prevalent particularly on old trees of Acacia modesta, while L. pulverulenrus had com...
Anjum Amin and Ghulam Akbar
...f transition zone where grassy terraced cliffs are found, which constitute the northern ridge of the Hills. Although most of the best cheer pheasant habitats are mostly disturbed by human activities, yet the habitat along the ridge is ideal and will remain so....
M.I. Sheikh, Bashir Hussain Shah and Abdul Aleem
...n, stone pitching, and grass mulch and without mulch in March, 1981. Observations after one year and two months revealed that the mulches did not have any effect on the survival of plants. However, out of the lour treatments, plastic aprons were significantly effective in improving the growth rate of both the species; stone pitching and grass mulch had rather negative effect on growth. ...
S. Hasan Abbas
.... Griffith and Jagdamba Prasad (1949)....
Sultan Maqsood Khan and Raja Muhammad Zarif
...d control areas. Due to grass seeding the average forage yield had increased from 45 kg/ha a tremendous increase, increasing the carrying capacity of this rangeland from about 23 to only 0.5 hectares/Animal Unit/year. This shows that at present level of livestock management the production of livestock and livestock products can be increased about 40 times by simply seeding these areas with Cenhrus ciliaris. ...
Raja Mohammad Ashfaque and Anjum Amin
...nd flora is occupied by grasses like Digitaria spp., Agrostis gigantea, Agropyron dentatum, Cymbopogon spp., Eleusine compressa, Themeda anathera, Panicum antidotale, Heteropogon spp., Chrysopogon aucheri, Dicanthium annulatum, whereas Trifolium pratense, Taraxicum officinale, Plantago lanceolatus, Fragaria vesca are among the major forbs present. The present study was aimed at to determine the affect of closure on forage pro...
Malik Mohammad Khan
...elongs to the family of grasses and is one of the most fast growing plants. It has 1250 kinds ranging from the small-sized bamboo to the very thick one generally being used for shuttering in the multi-storeyed buildings. Its quick growth, lightness in weight and flexibility are the few prominent characteristics that make the bamboo sticks unique in their nature....
Zakaullah and Khial Badshah
.... The incidence of the parasite was 56%. It was found to increase, generally, with tree size. The infection rating for the stand was 2.7....
Mahmood Iqbal Sheikh, B.H. Shah and A. Aleem
...abilization and natural grass cover proved ineffective in increasing the runoff, as these collected only 7.75 m3, 7.83 m3 , 7.1m3 8.79 m3 and 7.89 m3 water respectively as compared to control which also gave 6.98 m3 runoff. Mud-plaster is also the cheapest treatment as it costs about Rs.4,000 per hectare as compared to the next best treatments, polythene sheet cover and sodium carbonate spray, ...
Sultan Maqsood Khan
... was conducted on short grass prairie near Fort Collins Colorado to determine the effect of depth, slope and micro-relief (ridges and depressions) on belowground biomass. The underground plant biomass was collected to 40cm depth. Fifty percent ( 1004 g/m2 ) of the total collected biomass (2008g/m2) was found in the 0-10cm soil section; 24%(482 g/m2) in the 10-20cm layer; and 26%(522 g/m2) in the 20-40cm depth. The middle slope out-produced (2370g/m2) the upper...
Sultan Maqsood Khan
...oubled total forage and grass production and many times increased the production of desirable species, undesirable species, Chrysopogon aucheri and Cymbopogon martini. However, both nitrogen and phosphorus, when applied separately had no effect on the production of total forage, grass, any palatability class or any important forage species. No fertilizer treatment appreciably affected the forage production of i...
Hanif Gul and M. Ismail Chaudhry
...land snail, Helix asperasa attacking nursery plants. Baylucid gave 75% and 100% mortality in 0.05% and 0.1% concentration respectively, 72 hours after treatments while Barestan gave 70% and 80% mortality in 0.1% and concentrations as against a natural mortality of 23% to 33%. Nogas and Sodium Chloride were less effective....
Q. N. Javeed, Rehana Perveen, Imtiazul Haq and Ihsan Elahi
...edium used was that of Murashige and Skoog's. The effect of auxins, kinetin, coconut milk and casein hydrolysate was studied on induction and further growth of callus. Auxins were NAA (0.05, 0.1, 0.5 and 1.0 mg/1). Cytokinin used was BAP (1.0mg/1). Our results indicated that size of the explant, presence or absence of apical bud, controlled conditions of light and temperature are important factors in callus formation. A successful callus could only be raise...
G. M. Baloch and M. A. Ghani
...tro: The important parasitic weeds in Pakistan include Cusxwza spp. (Convolvulaceae); Loranthus spp. (Loranthaceae); Arceuthobium spp. and Viscuni spp. (Viscaceae); Striga spp. (Scrophulariaceae); and Orobanche spp. (Orobanchaceae). They affect a wide variety of plants, some economically important. Loranthus spp. infest about 274 hosts which include citrus, limes, tea. rubber, fruit, forage, park and man...
Shahida Parveen and Zakaullah
...f cumin.

Mathur and Prasad (1962) recorded powdery mildew (Erysiphe polygoni DC), blight (Alternaria burnsii) and wilt (Fusarium oxysporum f. cumini) diseases on cumin. Of these, wilt was the most serious one causing heavy losses to the crop. The average loss due to the disease was estimated to be 20%....

M. Ismail Chaudhry and Wali-ur-Rehman
.../i> M. Bieb.), a plant parasite. Trichodes sp. Healthy trees in Sasnamana, Ziarat and Chautair were found free from the attack of these borers. Trichodes sp. and Teretrius sp. were recorded as predators and Heterospilus sp. and Agathis sp. as parasites on these borers mostly in Sasnamana area. Fruit berries were heavily infested by fruit moth larvae in all the localities....
Nasim Akhtar, Himayat Husssain Naqvi and Farrukh Hussain
.../i> are important range-grasses found in Pakistan every where upto 1800 meters. Field and laboratory showed that beside toxic root exudates, water extracts continued substances which proved to be inhibitory not only to its own growth but also to other species used in the bioassays. The toxicity in both the cases increased with increasing concentration and soaking time. Cinhrus had more allopathic potentiality than Chrysopogon. The toxicity in both the cases wa...
Mohammad Noor
... was due both forbs and grasses. The percent cover of grasses and forbs also increased. The percent cover of Agrostis gigantea and Potentilla sibbaldia increased significantly inside whereas Poa alpina was more outside the exclosure. The later reacted as increaser in the area open to grazing. Agrostis gigantea and Potentilla sibbaldia reacted as decreasers in the grazed area. The frequency ...
Musarrat Nasreen Ali and Anwar Ahmad Khan
...> Royle locally known as rasaunt belongs to the family Berberidaceae. It is an erect, small rigid spiny shrub, about 1-3.5 metres in height with rough and light greyish bark, yellowish orange branched tap roots and violet berries. The plants are distributed throughout the hilly areas of Pakistan, from Baluchistan to Dir, Chitral, Gilgit, Hazara, Murree and Azad Kashmir at an elevation of 900-3,000 metres (4)....
M. Ismail Chaudhry and Wali-ur-Rehman
...inidae) were recorded parasitizing bagworms in the defoliated area. Gradual increase in parasite population over took pest population in few years and the insect outbreak was controlled by the natural enemies....
Moinuddin Ahmad, Asrar Hussain and Tariq Hussain
...ively propagated in the grass nursery of Botany Department, University of Karachi. Various stage of their life cycle were studied under field and laboratory conditions inflorescence development period, an thesis time, number of sterile and normal florets per inflorescence were determined, and pollen grain fertility, pollen grain germination and viability and seed germination tests were carried out. Mean size, shape and weight of seed and % seed were al...
M. A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
... aerial dicotyledonous parasite on branches or stems and is an important forest pathogen. It is most widely distributed dwarf mistletoe in the northern hemisphere, and among hosts it mainly infects the species of Juniperus (Hawksworth 1972) During British India, Brandis (1906) and Parker (1924) reported it on juniper but its pathological significance was brought up recently by Jamal and Beg (1974) while conducting a survey of the diseases of forest trees. Acco...
S. Maqsood Khan
... yield and frequency of grasses, and frequency of more palatable shrubs was higher in the exclosure than in the open. All the species recorded in the grazed area were also found inside the exclosure, but with lower forage yield and frequency, while some new more palatable species got established inside the protected area....
Ashiq Ahmad and M. Ismail Chaudhry
...ral crops and perennial grasses. Trees are debarked, young plants and shisham stumps are uprooted. They breed twice a year and usually give birth to tow young ones who live initially in mother's milk switching to tender barks 2-3 months later. ...
Zakaullah
... the Mana village. The parasite was extending east-ward. The incidence of infection was 24% for all the study trees within 1.6 km of the ridge. The highest incidence of infection was in trees growing on the ridge. The incidence decreased as the distance from the ridge increased....
S. Maqsood Khan
...due both to increase in grass and forbs. No appreciable difference was found in the frequency of grasses or forbs of desirable, intermediate or undesirable species due to closure....
Mohammad Shahid and Abdul Qayyum
...um spp.),serson (Brassica campestris), maize (Zea mays),dates (Phoenix spp.), citrus fruit (all spp.), ber (Zizphus jujube), guava (Psidium guyava) and shain (Plectranthus rugosus)were recorded as major sources for the production of surplus honey with five major honey-flows in a year at different localities in the Province. Shifting of the bee colonies at appropriate times to different places as determined i...
Naseer Hussain and R. E. Pfadt
... leaves of crested wheatgrass and western wheatgrass. The average C.I. the male grasshoppers fed on crested wheatgrass and western wheatgrass were calculated to be 0.9977 and 1.1094, respectively. Among the females those feeding on crested wheatgrass a C.I. of 1.0006 were recorded co...
Naseer Hussain and R. E. Pfadt
...es of crested wheat grass and western wheatgrass. The average efficiency of Conversion of Ingested Food to Body Substance (E.C.Ia of the male grass-hoppers fed on crested wheatgrass was found to be 8.50 percent compared to J 33% for those fed on western wheatgrass. The highest, 9A2 percent, occurre...
F. H. Shah, M. H. Sedi and B. A. Nadeem
... was up to 502 kg. ...
Bashir Hussain Shah and M. Ismail Chaudhry
...ifteen genera of plant parasitic nematodes belonging to the Order Tylenchida were found in the soil and roots of Eucalyptus saplings in Silvicultural research plots Pakistan Forest Institute, Peshawar, Forest Plantations at Jallo, Chichawatni and Changa Manga, and in Eucalyptus plantation in Watershed Management Project area at Garhi Habibullah, Distt. Hazara. Nine genera of ectoparasitic nematodes and some free living nemat...
Sultan Maqsood Khan
...ntroduction of suitable grass species is important for the production of good quality water and for increasing effective life if the Mangla reservoir by retarding its siltation rate. To find out suitable species for introduction in the Mangla watershed project area (dry sub-tropical) grass introduction trials with 39 cotypes of 14 species are being carried out in collaboration with Watershed Management Project of WAPDA in Mi...
Abdul Aziz Khan
...ith those of the common grasses of Thai, Cholistan and Kala Chitta areas. It has been concluded that since the nutritive components of these forages compare favourably well with those of the common grasses, already supporting large herds of cattle, and since no toxic component exists, these forages, by virtue of their narrow range of nutritive ratio (ratio between proteins and total energy producers )' are...
I. A. Qazi and Raja Walayat Hussain
...bic feet per acre in contrast to their actual average stocking of about 3,200 cubic feet of species....
Mohammad Amin Siddiqi
...her regional or local floras of this sub-continent. These two plants belong to a very small genus Emex australis with only two species, of the family Polygonaceae. One of the species is Entex australis and the other is Emex spinosus. The first one is native of Cape of Good Hope, South Africa and the second one comes from N. Africa and the Mediterranean coastal regions. It is a strange coincidence that both the species have been found growi...

Sundus Oun Ali Al-Zaini1, Mohanad A. Al-Bayati3*, Khazaal Abbas Khazaal2, Salma Talib Salih1

...normal condition. In contrast, fish from the second group were challenged with live Aeromonas hydrophila at a dose of (3×108cfu/fish and 3×107cfu/fish) for 22 days then had been vaccinated single dose. Preliminary findings reveal that fish groups treated with KHV liposomes pharmaceutic vaccine exhibit Relation present survival of 45% protection against KHV infection in bad quality water. Similarly, in fish groups raised in high-quality water, Relat...

Pavana Jyothi Vanjavaka1, Mouradam Veerasami2, Mohana Subramanian Bhaskaran2*, Vijay A.K.B. Gundi1*

...on pathogenicity. In contrast, molecular characterization has become an essential tool in comprehending the evolution of viruses. For studying the molecular level changes, 28 field isolates were collected from various regions in India and subjected to PCR for amplification, with sequencing of a partial region of the VP2 gene. Among these isolates, 27 samples were positive for CPV, of which one was CPV 2b while the remaining were CPV 2a, and one isolate was CPV...

Danh Mo

...ge (50% Wedelia and 50% grass in DM)-to-concentrate (F:C) ratios of 4:0, 3:1, 2:2, and 1:3 (DM basis). The daily consumption of Wedelia by the goat varied considerably (P<0.05) between treatments (38.2-139 g DM, equivalent to 15-50% of the total DM intake), but there was no significant difference (P>0.05) in daily total DM intake (2.63-2.85% of their live weight). As the concentrate level increased, there was a significant (P<0.05) increase in digesti...

Budi Santoso*, Bambang Tjahyono Hariadi, Marlyn Nelce Lekitoo

... palm frond (40%), king grass (30%), cassava (10%), tofu waste (10%), molasses (7%), lactic acid bacteria (LAB) inoculant (3%), and cellulase 0 ml/kg. Treatment B comprised silage A + 3 ml cellulase/kg, while C used silage A + 6 ml cellulase/kg. Furthermore, treatment D consisted of palm frond (50%), king grass (20%), cassava (10%), tofu waste (10%), molasses (7%), LAB inoculant (3%), and cellulase 0 ml/kg. Treatment E used ...

Rafiullah1, Said Sajjad Ali Shah1*, Muhammad Ilyas Khan2, Anwar Ali3, Imtiaz Ali Shah1 and  Sohaib ul Hassan4

...al, hematological, and parasitological studies, while for feed analysis, feed samples (n=20) were collected. Postmortem examination of dead camels revealed extensive hemorrhages in the small intestine and severe congestion of the colon and rectum. Among the hematological parameters, there was a significant reduction in hemoglobin level and hematocrit values and a significant increase in total leukocyte count, whereas all other parameters were in the normal ran...
Luqman1*, Zahid Hussain2, Tamana Bakht3, Miftah-Ud-Din1, Haroon Khan2, Muhammad
Rameez Khan1, Ata Ullah1 and Faraz Ali Shah1, Imtiaz Khan2 and Abdul Majid Khan Dawar2
...ere broad leaves, 8were grasses and 1was sedge.
Moreover, 24 weeds were annuals, while the rest were perennials. A. Among the different
locations of Chitral, the highest weed seed bank was recorded in the soil samples of ARS
Shen Lasht area.. The lowest seed bank was recorded in the soil samples of Garam
Chashma, which was however statistically at par with the rest of the locations studied in
Chitral....
Fawad Khan1, Zahir Muhammad1, Tahseen Ullah1, Khushdil Khan2 , Shabir Ahmad2, Asif Kamal2 and Khafsa Malik2
...followed by
Brassicaceae, Fabaceae, Asteraceae and Solanaceae. Therophytes were dominant class
having 89 species (62.23%) followed by Microphanerophytes with 19 species (13.28%),
Hemicryptophytes with 13 species (9.09%), Chamaephytes 8 species (5.59%),
Geophytes 7 species (4.89%), Nanophanerophytes with 6 species (4.19%) and
Megaphanerophytes with 1 species (0.69%). Leaf size of most plant species was...
Javairia Mehboob1, Syeda Hafsa Ali1*, Fahima Ashraf Kasi1, Syeda Ayesha Ali2, Safa
Farooqi3, Muneeza Arbab4,
...et AgNP. However, in contrast,
Artichoke mediated AgNP showed significant activity against plant fungal strains, followed
by Alkanet AgNP, and finally by Lavender mediated AgNPs. We concluded that the three
plants have versatile biochemical molecules responsible for wide range of AgNP and its
activity against bacterial and fungal strains. Studies on combined use of AgNPs with other
antimicrobial agent...
Muhammad Naeem Korejo1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1 and Niaz
Ahmed Wahocho2
... annuus L.) and bermuda grass (Cynodon dactylon L.) extracts under various
irrigation levels on weed density and yield of mungbean cultivar AEM-96. The experiment
consisted of different weed control practices i.e. weedy check, various levels of sunflower /
bermuda grass extracts, herbicides and hand weeding under three irrigation frequencies (2,
3 and 4). The analysis variance ...
Muhammad Yahya1, Muhammad Ajmal Khan2, Fazle Subhan3, Ali Hazrat1*, Javed Khan5, Aftab
Amin4, Hayat Ullah1 and Tabinda Nowsheen1
...ions peaked in August. Amrasca
Biguttula populations peaked in September 2019. Scirtothrips dorsalis and Helicoverpa
armigera infestations were also observed on the tomato crops and caused significant damage.
The application of Flurofenafire was able to control these infestations. In conclusion the
pesticide Flurofenafire was found effective against a wide range of insect pest of tomato plant.
...

Muhammad Idrees1, Wisal Muhammad Khan1*, Haroon Khan2, Arshad Iqbal1, Nosheen Umar3, Shah Khalid1 and Nisar Ahmad4

...by Rosaceae 16 (6.72%), Brassicaceae 13(5.46%), Solanaceae 11 (4.62%), Papilionaceae 10 (4.20%), Apiaceae, and Poaceae each with 9 (3.78%), Lamiaceae 8 (3.36%), Boraginaceae, Euphorbiaceae and Moraceae each contributed by 7 species (2.94%), Amaranthaceae and Cucurbitaceae each consisted of 6 species (2.52%), Caryophyllaceae and Chenopodiaceae each with 5 (2.10%) while rest of 23 families contributed by 1 species each (0.42%). The largest genera were Euphorbia ...

Muazzam Hashmi1, Braima Pascal Komba1, Muhammad Waqas Alam Chattha2*, Almazea Fatima1, Muhammad Farooq Hyder3

...ciently. In addition, infrastructural facilities like good roads leading to the farms and storage facilities are made available to the florists for suitable marketing.

...

Md. Maniruzzaman1, Md. Kamrul Haque1,3, Md Rokonuzzaman2, Md. Mahmudul Hasan3, Rumana Biswas4, Md. Mustafizur Rahman5, Tahmina Akter Rimi6, Md. Rahat Uz Zaman7*, Md. Alauddin8, Md. Abdul Baki9 and Md. Yeamin Hossain10

...facilities, a lack of infrastructure, and trained personnel are the significant constraints found in the current study. These constraints can be resolved by creating a new marketing channel, enhancing export, minimizing on-season product wastage, processing food and encouraging private investment in the industry. This article recommends a new marketing chain that combines several alternative methods such as food processing, exporting to other countries, and in...

Ali D. Nashmi1*, Jawad K. Hasan1, Manal A. Ibrahim2 

...nhibitor of phosphodiesterase enzymes 3 and 5, dipyridamole is a conventional antiplatelet drug that increases adenosine. The purpose of this study was to investigate whether dipyridamole plays a role as an anti-inflammatory to improve airway inflammation. A total of 24 healthy rats (albino, male), were weighted (150-300 g), were divided into four groups, each group consisting of six rats; Group A rats were given oral distal water and was considered a negative...

Humam T. Hadi1*, Orooba M. S. Ibrahim2 

... characterized by skin abrasions, with the plaque subtype accounting for around 85% of all cases. Green chemistry emerged as a realistic and simple alternative to more difficult chemical synthesis techniques for generating gold nanoparticles. This study evaluated the potential of Syzygium aromaticum gold nanoparticles (SaAuNPs) in treating psoriasis in mice. The study had two parts. The first part involved the extraction of clove oil and the synthesis of SaAu...
Nazish Huma Khan1*, Mohammad Nafees2, Tooba Saeed3, Sarzamin Khan1, Hazrat Hussain4, Adila Bashir2 and Nida Naz1
...tor with an influx of infrastructure projects of power plants, dams, and highways. For such developmental activities, the role of the crushing unit is tremendous in providing the basic raw material for infrastructure. The literature revealed that the majority of stone-crushing units are operating illegally as 567 units have been declared hazardous to health and safety in the Peshawar region. Due to the lack of safety measure...
Sajid Hussain Shah1, Akeel Ahmed Memon1*, Asmatullah Kaka1
Ahmed Nawaz Tunio2, Abdullah Channo1, Qudratullah Kalwar4
Muhammad Ibrahim Panhwar3, Kashif Ali Malak1 and Baban Ali Rahoo1
... were scanned through ultrasound to ensure the normality of reproductive tract. Animals of group A and group B were treated with Ovsynch protocol {GnRH; (Dalmarelin, FATRO) intramuscular at day 0 followed by PGF2α (Dalmazin; FATRO) intramuscular at day 7 and 2nd GnRH intramuscular at day 9} for estrus synchronization while animals of group C was kept as untreated control (intramuscular injection of normal saline as placebo on day 0, 7 and 9). Animals of ...

Ayoola Mathew Oluwaseyi1*, Aderemi Foluke Abimbola1, Alikwe Philip2 , Tumgbulu Samuel2, Eniufuoma Augustina2 

...er hyacinth (Eichhornia crassipes) leaf meal (ECLM) as a feed additive. Treatment diets consisted of a commercial starter and finisher feed with ECLM added at graded levels of 0,1,2,3, and 4g/100kg, T1 with 0g ECLM served as the control. Two hundred and twenty-five Arbor acre-day-old chicks were randomly assigned to the dietary treatments each replicated thrice for eight weeks. Results revealed that average body weight gain, average daily feed intake, and feed...

Baby Nhor K. Ambel1*, Nneka Djen A. Matandog1, Neil Pep Dave N. Sumaya2, Florence Roy P. Salvaña1, Bryan Lloyd P. Bretaña1 and Ma. Teodora N. Cabasan1*

...ed population of plant-parasitic nematodes compared to free-living nematodes. Nematode family Hoplolaimidae was recorded as the most dominant (59.59%-80.49%) across all monocropping durations. Shannon and Simpson’s diversity indices were lowest at 10-15 years of continuous monocropping period, as compared to 2-4 years and 5-9-years. Maturity index (MI, 2.26) was highest at 5-9 years of continuous cultivation while structure index (SI, 68.93), and enrichm...

Xiaowei Zhang*

...tic drugs, apatinib and trastuzumab, on gastric cancer with ascites. 225 patients with gastric cancer and ascites received by the Oncology Department and Gastrointestinal Department of the Central Hospital during October 2019-2021 were selected. They were subsequently assigned into apatinib group, trastuzumab group and combined treatment group. Compared with other treatment groups, the long-term and short-term survival rate ...
Fangmei Zhang1,2, Xiaocen Zhao1,2, Li Qiao1,2, Shibao Guo1,2, Li Zhang1,2
Jian Yin1,2, Zhou Zhou1,2, Chuleui Jung3 and Shubao Geng1,2*

Muhammad Qasim1, Muhammad Zeeshan Majeed1*, Muhammad Arshad1, Umair Abbas1, Mehar Zubair Shehzad1 and Abu Bakar Muhammad Raza1,2

...ural crops and wooden infrastructures worldwide. Coptotermes and Odontotermes were found as the most abundant and damaging genera of subterranean termites in Pakistan. Many conventional synthetic insecticides are being used to combat termite infestations with often unsatisfactory control results. This study assessed the comparative toxicity of some prevailing synthetic insecticides with different modes of action against subterranean termites Coptotermes heimi ...
Guangcan Lin1,2,3, Xingyu Chen1,2,3, Xiaohao Shi1,2,3, Xiaolin Li1,2,3
Anwar Tanwari Kamran4, Zhengxiang Wang1,2,3, Qing Zhu5, Gaodao Liang5* and Lei Pan1,2,3*
...t-align: justify;">Pseudorasbora parva (Temminck and Schlegel, 1842) has a significant potential to spread outside of its current locations and regions, all-continents-spanning invasive range. The invasion of P. parva has threatened the existence of native species. Therefore, evaluation of the condition and fitness of the invasive P. parva population in different regions is necessary. However, no systematic reports of the P. parva length-weight relationships (...

Ying Li, Peng Zhan, Qiang Wang and Dongfeng Chen*

... compartment cartilage abrasion group (n=30) and the lateral compartment cartilage non abrasion group (n=80) according to the lateral compartment cartilage status. The clinical data and laboratory indexes of patients were collected, and the risk factors of cartilage wear in lateral compartment of patients with VKO were analyzed by single factor and multi factor logistic regression. Labor intensity, imaging grade, integrity o...
Zain-ul-Aabdin Abro1*, Naheed Baloch1, Raza Muhammard Memon2 and Niaz Hussain Khuhro2
...ly (P<0.05) maximum parasitization of T. daci (342.00±16.26, 320.00±14.85) respectively in EA-2 (guava) treated blocks at Hyderabad and Larkana. Whereas, minimum parasitization of both parasitoids were observed in the untreated blocks of mango at discrete regions. Furthermore, significantly (P<0.05) reduced number of B. dorsalis (510.00±118.57, 558.40±...

Camilo Romero Núñez1, Galia Sheinberg Waisburd2, Alberto Martin Cordero3, Rafael Heredia Cárdenas1, Laura Miranda Contreras1, Ariadna Flores Ortega4, Linda Guiliana Bautista Gómez5 

...encephalitis, or cause parasite-induced abortion. Because of the risk, they represent measures to control their spread, such as restricting global trade and sporting events. Therefore, the efficacy of fluralaner was evaluated against ticks in horses. Horses were treated with fluralaner 25 mg/kg. Most of the ticks were found on the ears (55.63%), the head (23.23%), and the rest of the body (21.12%). Fluralaner appears to provide effective control of ticks for a...

Camilo Romero Núñez1, Laura Miranda Contreras1, Rafael Heredia Cárdenas1, Ariadna Flores Ortega2*, Linda Guiliana Bautista Gómez3 

...d risk factors for endoparasites, such as helminths like Toxocara, is crucial for implementing effective control programs. The objective of this study was to assess the current prevalence and risk factors for Toxocara spp. in cats. A total of 3695 fecal samples from cats of all ages, genders, breeds, clinical conditions, and origins, representing 31 out of the 32 states of the Mexican Republic, were included. Toxocara presence was assessed using the direct sme...

Shoaib Zawar1, Muhammad Waqas Yonas1,2*, Muhammad Mujahid Akbar1 and Abeer Ahmad1

...er unit area, reduced intraspecific competition, and enhanced grain formation, leading to higher grain yield (5562.38 kg ha-1 in 2020-21 and 5220.22 kg ha-1 in 2021-22). Adapting an appropriate sowing method is crucial to maximize wheat production which has been proved in the augmented furrow method over a broadcast and/or the usual drill sowing methods. The relatively better performance of augmented makes it the preferred choice for enhancing per unit area pr...

Mohammed Mijbas Mohammed Alomari1, Nawar Jasim Alsalih2*, Samir Sabaa Raheem2, Mohenned Alsaadawi2, Ali Mosa Rashid Al-Yasari3

...4 days. Globcan-5 wa, Suprastin, Fosprenil, Gamavit-forte, Levofloxacin, Gordox, Okrestatin, Lactobifadol, Polyoxidonium, Ringer’s solution, rheosorbilact and stabilizol were used as therapy. Firstly, the general clinical, biochemical, and immunological parameters of the blood of sick animals were examined at the time of treatment. The results of A comparative analysis of the recorded was carried out. In the process of treating sick dogs, positive change...

Sardorbek N. Turgunov, Oybek O. Amirov*, Erkinjon B. Shakarboev, Abdurakhim E. Kuchboev

...istics of the nematode Parascaris equorum collected from horses of the Fergana Valley, Uzbekistan. The total length of the male Parascaris equorum nematode was 175.5±3.86 mm, and that of the female was 293.7±4.83 mm. For molecular genetic studies from the collected samples, genomic DNA was extracted using the head of male of P. equorum species. QIAamp DNA Mini Kit reagents (QIAGEN, Germany) were used for genomi...

Hala Harifi*, Mouloud Lamtai*, Siham Ait Salhi, Fatima-Zahra Azzaoui, Omar Akhouayri, Abdelhalem Mesfioui, Leila Bikjdaouene

...tion of the rats. In contrast, the 6 mg/kg dose showed no adverse effects when compared to the 25 mg/kg and 30 mg/kg doses. Additionally, the 40 mg/kg dose proved to be lethal. Weight changes were observed in rats injected with the highest doses of Mn, along with alterations in organ weights. This study led us to conclude that chronic exposure to Mn induces dose-dependent toxic effects, as evidenced by the observed clinical signs of toxicity.
 ...

Tariq Zaman1*, Fawad Khan2, Sajjad Ahmad2*, Alia Mehsud2, Atta Ur Rahman3, Muskaan Zaman2 and Sumaira Noor2

....28%) each, followed by Brassicaceae and Papilionaceae with 4 species (9.52%), Apiaceae and Solanaceae with 3 species (7.14%), Amaranthaceae and Polygonaceae having 2 species (4.76%), while remaining families (Apocynaceae, Asclepiadaceae, Asphodelaceae, Chenopodiaceae, Convolvulaceae, Euphorbiaceae, Fumariaceae, Lamiaceae, Malvaceae, Oxalidaceae, Plantaginaceae and Salvadoraceae) have 1 specie (2.38%) each. Based on plant parts used, leaves were the topmost pa...

Talal Jabal Hussen1, Sattar J.J. Al-Shaeli1*, Baidaa H.R. Al-Mahna2, Hasanain A.J. Gharban3

...ding alanine aminotransferase (ALT), alkaline phosphatase (ALP), aspartate aminotransferase (AST), blood urea nitrogen (BUN), creatinine (Cr), and malondialdehyde (MDA). Whereas, administration estrogen to mice caused significant dropdown the activity of antioxidant markers including catalase (CAT), glutathione peroxidase (GSH-Px) and superoxide dismutase (SOD) compared to control mice. Histologically, tissue sections of liv...

Mahfuza Ferdous1, Sabuj Kanti Nath1 and Mustasim Famous2*

... upon local and natural grasses, whereas 21% produced their own fodder, and 36% supplemented fodder by purchasing. 71% of farms were found feeding raw fodder to the cattle without any kind of processing, and only 29% of farms used chopped fodder before feeding. In feeding concentrate feed, almost 50% of farms mixed the feed ingredients manually, the rest (21%) farms used commercial feed, 29% of farms were found using both commercial and hand-mixing feed. 71% o...

Chinenye Maria-Goretti Ohanu, Chika Bright Ikele*, Okoye, ChukwuEbuka Kingsley, Charity Chidera Eze

.... ELEOG controlled the parasitaemia after the seventh-day post-inoculation but persisted after treatment relative to the standard drug, chloramphenicol’s significant (P=0.05) performance. However, between 72 h and 96 h post-treatment, both the intensity of theronts and trophonts declined to a non-detectable level at a concentration of 500mg/L ELEOG with linear similarity with the standard drug. A positive and strong relationship was observed between pH a...

Md. Asaduzzaman Lovelu1, Md. Amir Hossain2*, Md. Uzzal Hossain1, Tanzila Zafrin Tanvi1, Mahfuza Ferdous3, Nazmin Sultana Runa4, Assrafi Siddika3, Md. Sahidul Islam2 

...d-picking ticks, blood parasites were examined under a stereomicroscope and stained with Giemsa’s stain. Among the investigated cattle, 37.88% had tick infestations: 14% had Rhipicephalus (Boophilus) microplus, 28.01% had Haemaphysalis bispinosa, and 4.13% had mixed infections. Adult cattle older than 2.5 years old (41.05%) had the highest prevalence of tick infestations, while calves younger than a year (33.57%) had the lowest prevalence. Crossbred catt...

Yujun Shuai and Jinhong Zhao*

...onotic disease-causing parasitic nematode belonging to the Anisakidae family. In this study, the nematode samples of A. simplex were collected from rockfish Sebastes sp. From the comparison and analysis of the mitochondrial genome of Anisakis simplex, the results revealed a full-length genome with 13,903 bp, including 12 protein-coding genes, 2 rRNAs and 22 tRNAs. There was no encoding gene of atp8, which was consistent with the genome characteristics of Anisa...

Efi Rokana1, Iin Rohmatul Fatimah1, Brilian Desca Dianingtyas1, Niswatin Hasanah2, Wulandari3, Zein Ahmad Baihaqi1,3* 

...earch factors: elephant grass, corn plants, and rice straw. Employing a completely randomized design (CRD) with three treatments and nine replications, the research examined dry matter intake, body weight gain, feed efficiency, and income over feed cost (IOFC). Results indicated that feeding with different types of forage did not significantly impact dry matter intake (P>0.05) but significantly affected body weight gain, feed conversion, feed efficiency (P&...

Salam N. Aritonang1*, Yulia Yellita1, Dwita Saningtias2, Eka Putri2, Rizqan1 

...l feed comprising field grass, king grass, and 2 kg of withered cassava leaf. The results showed that turmeric flour supplementation significantly increased (P<0.05) erythrocytes (4.8 - 6.51 x 106/mm3), hemoglobin (9.85 - 13.22 g/dl), hematocrit (25.82 - 33.32%), and leukocytes (8.55 - 11.17 x 103/mm3), while maintaining values within normal ranges. Based on the results, supplementation of turmeric flour up to 0.03% (C) w...
Shawky M Aboelhadid1*, Abdel-Azeem S Abdel-Baki2, Khaled M Hassan3
Samar M Ibrahium4, Saleh Al-Quraishy5, Ahmed O Hassan6 and Asmaa A Kamel1
...ivity of acetylcholinesterase enzyme in the house fly larvae 24h post application. In addition, all the treatments induced significant increase in the malondialdehyde activity. In conclusion, nanoemulsion tech and mixing GO+SO increased their insecticidal potency against house fly, C. pipiens and T. castenum. This is a useful method in the integrated pest management. 

...

Arba Aleem, Norrizah Jaafar Sidik*, Wan Razarinah Wan, Abdul Razak and Norfatimah Mohamed Yunus

...eractions enables the infrastructure development for more effective strategies to enhance plant growth and productivity.

...

Marwa M. El-Deriny1,2*, Rania H. Wahdan1, Marwa S. Fouad3 and Dina S.S. Ibrahim1,2*

...a in suppressing plant parasitic nematodes and improving growth yield, encourages the future researches to highpoint the fungal and bacterial interactions with plants as biological control agents for ecological remediation.

...

Maqsood Jan1, Muhammad Zubair Anjum1*, Zahir Muhammad1, Misbah Farooq1, Muhammad Qayash Khan2 and Shamim Akhter1

... on body composition of grass carp (fingerlings). Grass carp is a fresh water fish of edible test and having multiple feed sources. The study was aimed to enhance the production and improve the meat quality of a grass carp in controlled environment. A total of 120 grass carp (fingerlings) were selected and stocked in 12 glass aquaria (n=10 fish in each) ...

Sushan Chowhan1,2*, Md. Moshiur Rahman3, Razia Sultana4,5, Md. Abdur Rouf6, Majharul Islam7 and Sharmin Ara Jannat8

...address problems at the grassroots level, rather than focusing solely on R and D. Emphasizing grassroots solutions can pave the way to a more resilient and self-sufficient agricultural sector.

...

Fatima Kanwal

... were identified. Goose grass (Elusine indica), Lambsquarters (Chenopodium album), and Black nightshade (Solanum nigram) accounted for 87% of the weeds and had densities of 1.82%, 1.82%, and 1.71%, respectively. Species of Amaranthus viridis were found to be 37% prevalent, with the highest density of 10.40%. and was only determined in the Karachi region while Stinging nettle (Urtica dioica) was found to be less common with a 0.07% density and a 60% prevalence....

Muhammad Ihsan Ullah2, Muhammad Hasnain1*, Muhmmad Luqman2, Hammad Hussnain2, Muhammad Tauseef2, Abrar Ahmad2, Muhammad Shahid2, Qaisar Abbas3, Mussurrat Hussain3, Ali Raza2, Muhammad Musadique Ahmad Khan4, Muhammad Kashif Nadeem5, Sajid Nadeem6

...emisia tabaci, jassid, Amrasca biguttula and thrips, Thrips tabaci. About 28% of losses occur in cotton crops every year due to the attack of these insect pests. The major goal of chemical control, which includes using different pesticides is to reduce yield losses in cotton crops. In order to identify an insecticide that could efficiently manage these sucking insect pests of cotton, the toxicity a few selected insecticides in the field have been assessed in c...

Paulus Klau Tahuk*, Gerson Frans Bira, Wolfhardus Vinansius Feka 

...ons consisted of native grass, Gliricidia sepium leaf meal, ground corn, pollard bran, and rice bran. Variables observed included feed intake and digestibility, as well as growth performance metrics such as average daily gain (ADG), conversion rate, and feed efficiency. While there were no significant differences in dry matter (DM) and gross energy (GE) intake among treatments, significant variations (P<0.05) were observed in the intake of organic matter (O...

Barkat Ali Jatoi1*, Amjad Hussain Mirani1, Abdul Latif Bhutto1, Ambreen Laghari2, Abdul Samad Magsi3, Ahmed Sultan Jatoi4, Aneela Sultan Jatoi5, Muhammad Mohsen Rahimoon6, Aarab Khan Lund7, Om Parkash1, Atif Ali Malak8 

.../ml, respectively in contrast to that of Eucalyptus camaldulensis where the zone diameter was 13.00, 9.67, 9.33, 8.33 and 8.33mm at concentration 2.50, 2.00, 1.50, 1.00 and 0.50mg/ml, respectively. The average inhibition zone formed by Moringa oleifera (13.55mm) was noted markedly higher (P<0.05) than that formed by eucalyptus camaldulensis (8.75mm). It could be concluded that the Moringa oleifera plant extract found to be efficient against P. multocida com...

Amaq Fadholly1,2*, Endang Tri Margawati1, Alek Ibrahim1 and Widya Pintaka Bayu Putra1

...ion continued with polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP). The Association of MYF5 genotypes with body weight and body size measurements was analyzed using General Linear Model by SAS 9.4 program. The result showed that MC4R gene with HpyCH41V restriction enzyme was polymorphic with three genotypes of CC, CG and GG with frequencies of 0.18 (9), 0.32 (16) and 0.5 (25), respectively. The MY5 gene also showed three...

Rijanto Hutasoit1,3, Edison Purba2*, Simon Petrus Ginting3, Nevy Diana Hanafi2

...rthogonal polynomial contrast test. In this study, the soil characteristics were analyzed descriptively. The findings showed that there was no significant difference (P > 0.05) between the M2 I. zollingeriana generations in terms of quantity and quality. Numerically, 300 Gy treatment produced the most dry matter production (11.08 t ha-1 y-1). When compared with those that are not irradiated, the impact of radiation can result in an increase in dry matter yi...

Desak Nyoman Dewi Indira Laksmi1*, I. Gusti Ngurah Bagus Trilaksana1, I. Wayan Sukernayasa1, Nyoman Oka Widiarta2, I. Wayan Nico Fajar Gunawan1, I Made Merdana3

...erate intensity). Primiparas had a longer post-partum estrus performance than pluriparas. Furthermore, leptin increases estrogen production, stimulated by FSH and IGF-1, an aromatase stimulator. Estrus with less clear or moderate intensity is related to hormonal patterns, especially the hormone estrogen level, which plays a role in stimulating estrus.
 
Keywords | Appearance time of estrus, Estru...

Waqas Ahmad Shams1*, Gauhar Rehman2, Muhammad Ismail3, Rahmul Kabir4 and Abdul Qahar1

...n the H2O2 assay. In contrast, the ethanolic extract showed superior antioxidant potential in the ferric cyanide (Fe3+) reducing assay compared to ethyl acetate and aqueous extracts. Furthermore, all extracts exhibited antioxidant properties in the nitric oxide (NO) scavenging assay, with the ethanolic extract showing significant dose-dependent activity. Overall, our findings suggest that both aqueous and ethanolic extracts possess substantial antioxidant pote...

Waheed Iqbal* and Muhammad Faheem Malik

... Pieris canidia, Pieris brassicae, Pontia daplidice, Belenois aurota, Colotis etridae, Colias fieldii, Catopsilia crocalae, Catopsilia pomona, Catopsilia pyranthae, Eurema hecabe, Euchrysops cnejus, Danaus chrysippus, Ypthima asterope, Ariadne merione, Junonia orithya and Junonia almana; four Fairly Common (F.C.) species are; Colias eratae, Catopsilia florella, Tarucus theophrastus and Ypthima nareda; three Un-Common (U.C.) ...

Abdul Mannan1*, Naveed Iqbal1, Randhawa1, Abdul Hanan1 and Abdul Qadeer1

...idae) is prominent egg parasitoid utilized for the purpose of borers attack in IPM. This research was carried-out for the purpose of success various issuance of T.chilions in case of sugarcane insect attacks and observe the decay rate of sugarcane borers and such as control issuance by T. chilonis egg cards. The borers’ generation emerges out after 27 days, trichogramma cards T. chillions were installed with the duration after 10, 15, 20, days interval r...

Muhammad Shahid Hassan1, Nargis Naz2, Hassan Raza Javeed1*, Sabahat Zafar1, Laraib Kanwal1, Seerat Mariyum1, Areej Fatima1, Areeba Bashir1 and Muhammad Imran Atta3

...anthaceae (11.11%), and Brassicaceae (11.11%). The dominant weed species in study area were Anagallis arvensis (78.63%), Phalaris minor (6.7%), Melilotus indica (4.22%), Avena futua (3.5%), Chenopodium album (1.51%), Sisymbrium irio (1.05%), Medicago denticulata (0.70%), Sonchus asper (0.54%), Rumex dentatus (0.44%), Cronopus didymus (0.33%) and Fumaria indica (0.31%). Therefore, it is concluded that this study aims to helpful the distribution patterns and imp...
Ayub Khawar1, Noor Khan1*, Khalid Javed Iqbal2, Mahroze Fatima1, Fayyaz Rasool3, Khalid Mahmood Anjum4, Hamda Azmat1, Shahid Sherzada1, Anjum Khalique5, Sadia Nazir1, Sheeza Bano1, Sakhawat Ali6 and Muhammad Asghar1
...nd digestive enzymes of grass carp (Ctenopharyngodon idella). Fish were fed to 3% wet body weight per day with experimental diets having 0% (CTRL), 0.7% (T1), 1.4% (T2) and 2.1% (T3) urea, with each group having two replicate tanks. Fish fed on 2.1% urea treated sugarcane bagasse (T3) showed significantly (P<0.05) higher growth as compared to T2, T1 and CTRL. The feed conversion ratio and specific growth rate were also significantly higher in T3 fish group,...

Mukondwa Olivia1, Rugare Joyful Tatenda1, Mabasa Stanford1 and Mandumbu Ronald2*

...hispidium L.) and goose grass [Eleusine indica (L.) Gaertn)] and by the addition of their plant material to soil under laboratory and glasshouse conditions. A randomized complete block design with three replicates was used and the experiment was repeated twice over time. Results showed that there was a significant (P < 0.01) effect of sorghum and pearl millet cultivars on germination / emergence and dry weight of goose gras

Fasih Ullah Haider1,2, Sardar Alam Cheema1and Muhammad Farooq1,3

...comprise of legumes and grasses. Cover crops lead to be one of the better options that reduce the dose of herbicides and these are harmonious with the objectives of conservation agriculture. Regardless of much importance of cover crops and their worth in agricultural systems, cover crops have certain negative aspects as well. They compete with cash crops for moisture, solar radiation and nutrients which ultimately decrease the return of cash crops. Farmers are...

Shahida Naveed1, Salma2, Inayatullah Khattak3 and Khan Bahadar Marwat4

...47%). Amaranthaceae and Brassicaceae were represented by five (5) species each (8.19 %). Chenopodiaceae was represented by one genus having three (3) species (4.91 %) and Euphorbiaceae was represented by three (3) genera with four (4) species (6.55%). Cucurbitaceae, Caryophyllaceae, Malvaceae, Solanaceae and Zygophyllaceae were represented by two genera and two species each (3.27 %), while Papilionaceae has two genera with three species (4.91%). The remaining ...

Fawad Ali1, 2, Gul Hassan2*, Naveed Akhtar3, Muhammad Jamal Babar3 and Ataullah Jan4

...edominant families were Brassicaeae (5 spp.), Poacea and Fabaceae (4 spp. ea.) followed by Polygonaceae, Asteraceae, Caryophlliceae and Plantaginaceae (2 spp. ea.), while the remaining families were represented by only one species each. Five weed communities were established on the basis of importance value constancy index in the investigated area. Coronopus-Poa-Anagallis appears as the predominant community in Tarnab area while at Azeem Khan Pul, Veronica-Cor...

Zuyang Zhou1, Xi He2, Yufang Liu1, Qiuling Li3, Pingqing Wang2, Yongfu An4, Ran Di1, Yuze Yang5 and Mingxing Chu1*

...ductase (KR) and thioesterase (TE) domains in FASN by using polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP). As a result, two single nucleotide polymorphisms (SNPs) were detected and genotyped in 407 Chinese Holstein cows. The non-synonymous g.16024G>A, g.17924G>A in KR and TE domains respectively resulted in a non-conservative substitution of alanine by threonine. g.17924G>A was associa...
Sohaila Fathi El-Hawary1, Nermeen M.L. Malak2, Reda A. Gomaa3, Hesham Z. Tawfeuk3, Suzan Ismail4, Nady Khairy Elbarbary5*
...%). According to a polymerase chain reaction analysis, most Vibrio isolates had one or more virulence genes. Antibiotic sensitivity tests showed that the isolates were highly resistant to many commonly used antimicrobial drugs in Egypt. These drugs included ampicillin, tetracycline, and sulfamethoxazole. The average MAR score was 0.530 indicating that the isolates have acquired a hereditary resistance that poses a public health hazard to customers. More...

Ibrahim Ali1,2, Hanan Mohamed Fathy Abdien1*, Wael Kamel Elfeil1, Mohsen Mohamed Zaky ElDemerdash1, Mohamed Ali Zain El-Abideen2,3, Walid Hamdy Kilany2,3

...) post-challenge. In contrast, groups receiving intranasal vaccine (G1 and G3) showed unacceptable humeral immune response with protection rates of 45% and 15%, respectively. IMS1313 (G4) provided 0% protection accompanied with substantial increase in IL-6, IL-2, IL-4, and IFN-γ levels post-challenge, indicative of acute infection.  We conclude that the vaccine adjuvant quality plays the corner stoon in initiation, magnitude and longevity of the spe...

Muhammad Farooq* and Sanam Zarif

... affected the growth of grass and bushes in the Malakand highlands. In order to stop invasive species from spreading, many management techniques are used. These consist of chemical control with herbicides such as glyphosate, mechanical removal, and organic pesticides. The use of biological control agents has proven successful in certain situations. 

...

Raad M. Sayed-Lafi*

...="text-align: justify;">Grass carp (Ctenopharyngodon idella) species are among the commercially most valuable. To find patterns and trends in the published research on this subject, we used a bibliometric approach to evaluate the body of literature that has been published in the field of grass carp study over the last ten years (2013–2023). Based on articles retrieved from Scopus, the analysis was carried out; a total ...

Israa M. Essa*, Ghazi Y. Azzal, Alaa Tariq Abdulwahid

... potentially important parasite in field. However, the main limitations of the present study include the low number of examined animals, short period of study, and disapproving of some owners to examine their slaughtered animals. Therefore, it is necessary to develop the suitable parasite control measures (e.g. controlling the snails, judicious annual using of flukecide, frequent examination of fecal samples of field animals...

Ririn Siti Rahmatillah1*, Diky Ramdani1, Iman Hernaman2, Anuraga Jayanegara3, Yulianri Rizki Yanza2

...ADFD (P = 0.032). In contrast, tea extract influenced blood glucose (mg/dl, P < 0.001) and blood urea (mg/dl, P < 0.001) levels. Based on the results, the tea can reduce glucose absorption in the intestines and further affect urea synthesis in the liver.
 
Keywords | Blood profile, Digestibility, Meta-analysis, Performance, Ruminants, Tea leaf products
...

Edy Rianto1, Nadlirotun Luthfi2*, Retno Adiwinarti1, Agung Purnomoadi1

...osition, Feed conversion rasio, Feeding level, Lamb, Live weight gai
...

Dalia M.A. Elmasry1*, Dalia M. El-Husseini1, Asmaa A. Eissa1, Zakaria R. Elkanawati2, Momtaz A. Shahein3, Amany Adel4

...erse transcription polymerase chain reaction (RT-PCR). Then the positive samples have been genetically characterized by partial sequencing of respective genes of each virus. The results illustrated the domination of the DWV-B and LSV-4 viruses’ distribution in Egypt during all seasons with high incidence up to 88% and 82%, respectively. However, the other viruses have been detected with different incidence rate of BQCV, IAPV, SBV were 15%, 23%, 22%, resp...
Mohammad Moneruzzaman Khandaker1*,Nuratiqah Emran1, Nurul Elyni Mat Shaari1, Arba Aleem2, Zanariah Mohd Nor1 and Ali Majrashi3

Kremlin Mark B. Ampode1,2,3*, Ramanathan Solaiyappan1, Baskaralingam Vaseeharan1 

...ly, glutathione S-transferase (GST) activity was significantly elevated in both the gills and liver (P=0.006). Neurotoxicity assessment through acetylcholinesterase (AChE) activity in the brain showed no significant difference (P=0.952). The ZnONPs significantly influenced antioxidant biomarkers (SOD, CAT, and GST), while the mortality rate, average body weight, and neurotoxicity of tilapia were not statistically affected. H...

Zhulmaydin C. Fachrussyah1*, Indra G. Ahmad2, Iin S. Lantu3, Arafik Lamadi2, Wila R. Nento3

...dy is to inventory ectoparasites in catfish (Clarias sp.) cultivated with Biofloc in Gorontalo. This study was carried out from November to December 2023 at Gorontalo State University’s Integrated Laboratory of Maritime Affairs and Fisheries Technology. A total of 40 catfish samples measuring 20-25 cm from cultivation sites using a biofloc system were selected using saturated sampling based on the sustainability of the catfish business (5 years), which i...

Mohamed Ahmed Abaza1, Amany O. Selim2, Mona Abdallah3, Shimaa A.E. Atwa4, Hala El Daous5, Mona Abd-Allah Abd-Elrehim6, Mohamed M.S. Gaballa7, Reda R. Fathy1*

...li), Alanine aminotransferase (ALT), Aspartate aminotransferase (AST)
...

Enany M.E.1, Fadel Hanaa M.2, Abo-Shama U.H.3, Ahmed Mona M.1, Kholief M.E.A.4*

...ected by multiplex polymerase reaction against vacA, cagA, and hrgA and bio-typed based on urease and nitrate reduction testes, finding non-nitrate reductive isolates from apparently healthy felines 20% and, nitrate reductive isolates from clinical felines and normal sheep 40% and 20%, respectively as total virulence genes H. pylori (cagvachrgA) frequency in autumn. Among the highest frequency both of caghrgA 66.6%, positive nitrate biotypes were highly resist...

Estrelle Anne Tacbas1, Neil Pep Dave Sumaya2 and Nanette Hope Sumaya1,3*

...bal medication against parasitic nematodes in determining the anthelmintic potential for the following concentrations of Artocarpus heterophyllus and Artocarpus camansi, 10000 ppm, 7500 ppm, 5000 ppm. The phytochemical results revealed the presence of alkaloids, flavonoids, saponins, steroids, and tannins in both plant crude extracts. Different developmental stages of C. elegans (i.e., 1st to 4th larval stages (L1-L4), young adult (YA) and adult nematodes) wer...

Zulfiqar Ali1, Asad Ullah2*, Shumaila Gul3, Maryam Begum4, Raheela Taj5, Tahira Tayyeb1, Maiz ur Rahman1, Muhammad Owais Khan1, Rafiq Ullah1, Imad Khan2, Ali Gohar2, Shakirullah Khan6, Khudija Ghani7 and Muneeb Islam8

...idae) are obligate ectoparasites of diverse hosts that affect livestock globally and are carriers of several bacterial, viral, and protozoan infections that affect both animals and human. Ticks (Class Arachnida) are ectoparasites of a wide variety of vertebrates, including livestock, and wild animals. Ticks are arachnids of veterinary and medical importance because they can transmit various diseases. Accurate identification ...

Rand K. Abbas1, Zahraa S. Hadi1*, Zainab A. Hussein2, Sajad K. Matooq3

...sess the prevalence of parasitic diseases in domestic hens that acquired from the poultry market between March 2023 and October 2023. In order to analyze blood parameters (Hb, PCV, RBC, and WBC), sixty mature chickens were employed. Blood samples (1 ml) were taken from each chicken’s jugular vein and placed into an ethylene diamine tetraacetic acid test tube. The tube was then gently shaken. The results were obtained using the Cell-Dyn Ruby equipment. Th...

Fitrini1*, Masyhuri2, Dwidjono Hadi Darwanto2, Tri Anggraeni Kusumastuti3

...sbandry institutions, infrastructure and facilities are quite supportive although some of these aspects need improvement from the government. Beef cattle have potential as a leading commodity as evidenced by LQ>1, which means that beef cattle are a commodity that has a comparative advantage that can fulfilling the needs of beef cattle at the district and regency area and even can be sold to other regions but beef cattle do not have a competitive advantage, ...

Md. Gausur Rahman1*, S.M. Harun-Ur-Rashid1, Md. Golam Azam1, Md. Ahsan Habib2, Golapi Rani Devsharma1 

...ce of gastrointestinal parasites in Sonali chicken in Dinajpur during January to June 2024. For this purpose, a total of 200 faecal samples were collected from various commercial Sonali farms and examined by direct smear method and floatation technique. Among the examined birds, 56 Sonali chickens (28.00%) were infected with gastrointestinal parasites including Ascaridia sp., Raillietina sp. and Eimeria sp. Among these pa

Emad M. Gad1, Haidy G. Abdel-Rahman2, Mohy Eldin Abd-El-Fattah1, Merna M. Kamal1, Ahmed Shaker Eltahan3, Amina A. Dessouki3*

...in these measures in contrast to the untreated diabetic rats. Also, renal tissue IL-6, NF-κB and NADPH oxidase manifested significant (P≤0.05) increase in untreated diabetic rats, while treated groups revealed significant decline in comparison to the untreated one. DAPA and mulberry fruit and leaves extracts optimized IL-10 and renin expression in renal tissue. Histopathological picture of kidney, revealed significant (P≤0.05) improvement in rats r...

Ashraf Samir Hakim1*, Doaa Diab Khalaf1, Engy Farahat1, Mohammed Darwish Mohammed1, Wahid Hussein El-Dabae1, Khaled Abd El-Hamid Abd El‑Razik2, Amany Nabil Dapgh3, Ehab Ali Fouad4, Hussein Ahmed Abuelhag1

...identification via polymerase chain reaction revealed existence of species specific ‘yaiO’ (100%), virulence; ‘fimH’ (71.43%), ‘iutA’ (26.98 %) and ‘iss’ (20.63%). The harboring of blaNDM-1gene was presented among 15 E. coli isolates as (23.81%); dog (11), human (3) and one in cat. The obtained data of our study asserted the potential role of companion animals in transmission of zoonotic E. coli serotypes especia...

Eman Mamdouh Qenawy1, Mohamed Abou-Ellail1, Fatma Abdel-Motaal2, Mohammed O. Alshaharni3, Nady Khairy Elbarbary4*

...itive and specific polymerase chain reaction (PCR) technique to identify the various meat species in meat products marketed as 100% beef and sold in Aswan City, Egypt, with distinct microbiological analysis that highlighted the detection of Pseudomonas aeruginosa and Escherichia coli. Ninety samples of meat in total (15 of each minced beef, sausage, burger, shawarma, and hawawshi) were obtained from several markets in Aswan City, Egypt, and exposed to bacteria...

Jaisy Aghniarahim Putritamara*, Tina Sri Purwanti, Budi Hartono, Awang Tri Satria, Izdihar Ratnaduhita Hidayat

...chasing UHT milk. In contrast, safety value negatively impacts consumer attitudes, suggesting that increased safety concerns or exaggerated claims can lead to skepticism and dissatisfaction. Social value does not significantly affect consumer attitudes, implying it may be influenced by individual traits and environmental background. Hedonic value positively influences consumer attitudes, showing that enjoyment and positive emotions associated with UHT milk enh...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...cal and molecular (Polymerase chain reaction) testing methods. Phylogenetic tree analysis was also performed for genetic identification of the species. in vitro antibiotic disc diffusion method of those selected isolates was performed against 20 most common human therapeutic antibiotics. The isolates were found to be highly resistant against most of the available antibiotics leaving behind very less choice of selection for treatment. The results are as follows...

Sabahat Anwar1, Faria Javaid2 and Qurat-ul-Ain2*

...U/ml/min) and filter paperase (10.61±0.15 IU/ml/min) activities observed in pretreated wheat straw, while untreated gave 1.89±0.19 mg/ml, 4.31±0.13 IU/ml/min and 7.88±0.18 IU/ml/min respectively. Seventy percent increase in CMC-ase and 35% increase in FP-ase activities were observed while using alkali pretreated wheat straw as compared to untreated straw. During incubation, pH 7 and 60°C temperature was found optimum for highest...

Hussein Jabar Jasim*, Naer Abdulbari Madlool Alkaabawi, Ali Naser Kathem  

... a lack of research on parasite infections in horses in Iraq, the aims of the current investigate is to assess the clinical manifestations linked with ascariasis in infected horses. Additionally, it seeks to assess the prevalence of ascariasis in horses in Al Muthanna province and evaluate the impact of various risk factors on the infection rate such as age, sex, and seasonality. Moreover, the PCR was used to confirm the presence of P. equorum in the horses. T...

Shiguftah Khalid1, Muhammad Jahanzaib2*, Haris Khurshid2, Rabia Khalid3, Sundas Waqar3, Faiza Siddique3, Fazal Yazdan Saleem Marwat3 and Zahid Akram1

...P-1, APL and HSW. In contrast, LA, LLA, PB, SB, MPP-1 and SP were those characters that were in a strong negative association with pod yield. The association of these characters with pod yield indicated the importance of these traits for selecting high yielding genotypes under the screening process. Path analysis revealed a positive direct effect of leaflet area, pods per plant, shelling percentage, average pod length and hundred seed weight. In cont

Aya Salah Eldin Mohamed1*, Gamal E. Shams1, Gihan G. Moustafa2, Reda M. Abd El-Aziz3

...defective sperms. By contrast, different treatments (G 6-7) restored spermatogenesis by significant improvement in the sperms count and sperm morphology when compared with G2. There are regressive histopathological alterations in the testis of citalopram-treated rats and these lesions were alleviated with administration of ginseng, vitamin D alone or in combination. In conclusion, ginseng and vitamin D could reduce oxidative stress, necrotic and apoptotic alte...

Abdur Rehman*, Muhammad Umair Khan, Zahid Rauf, Saeed Akhtar, Abdur Rahman Khan and Mansoor Khan

...hat are Willow (Salix tetrasperma) and Lachi (Eucalyptus camaldulensis). The excellence of pulp and paper is directly linked to the fiber characteristics such as fiber wall thickness, fiber lumen diameter, and fiber length. Several wood characteristics associated with paper quality will be deduced from the fiber dimensions, encompassing parameters like the wall coverage ratio, aspect ratio, solidity factors, Luce’s shape factors, flexibility coefficient,...

Rongrong Wang1,2, Da Ji1,2, Junjie Yao1,2*, Wenzheng Zhang1,2, Xianjun Zhou1,2, Xin Su1,2 and Tianquan Bai3

...fferentiation status of Craspedacusta sowerbyi Lankester, 1880 in Guizhou Province, genetic diversity and genetic structure analyses of three geographical populations of C. sowerbyi in Guizhou Province were performed using the results of PCR amplification and direct sequencing based on the mitochondrial DNA COI gene. Sixty-two individuals displayed four haplotypes, and the overall haplotype diversity (Hd) and nucleotide diversity (Pi) of the three C. sowerbyi ...

Pangesti Nugrahani1*, Hery Purnobasuki2, Arif Nur Muhammad Ansori3, Jatuporn Anuchai4 and Anugerah Dany Priyanto5,6

...mmonly conducted using Murashiage and Skoog (MS) media supplemented with various types of growth regulators (PGRs). Cytokinin and Auxin are incorporated into MS media to promote shoot and root growth in banana explants. 6-benzyl amino purine (BAP), a form of cytokinin, plays a significant role in stimulating cell division and differentiation. This study aimed to assess the impact of BAP on various growth parameters, including shoot initiation, root initiation,...

Rawya Shakir Mohammed*, Baraa Najim Al-Okaily

...7 μg/kg B.W.), in contrast, both Doxorubicin and CurSeNPs were administered to Group 3 at the same doses. Ovarian tissue specimens have been taken to determine the level of ovarian VEGF mRNA gene expression, as well as for a histological study. The results showed a significant rise in VEGF gene expression levels, as well as the presence of histological alterations in the G1 group characterized by clear congestion of graffiti follicles and necrotic lesions. ...

Hina Abrar1*, Hina Yasin1, Hira Naeem2, Rabia Bushra1, Shaukat Mahmood2 and Kaneez Fatima3

...P), gamma-glutamyltransferase (γ-GT) and bilirubin (BRB) were measured and compared with the normal values. Additionally, histological examination was done through micrometry and scanning electron microscopy (SEM) to estimate the intensity of hepatotoxicity induced by PHY and PHY with PRL. Animals received PHY alone treatment showed a significant elevation of liver enzymes than control and combination. Conversely, the lower level of serum ALT, ALP, &gamm...
Shaiqah Mohd Rus1*, Anika Z.M.R.2, Awis Sukarni Mohmad Sabere3, Mohd. Rushdi Abu Bakar4,5, Farahidah Mohamed4 and Abd Almonem Doolaanea6*
 
 
...er (amplitude) of the ultrasonicator. The droplet size, PdI, and zeta potential of the nanoemulsion were investigated. The zeta potential values for BSO nanoemulsions ranging from -53.83 ± 1.50 to −63.50 ± 0.66 mV. All zeta values were below -30 mV, demonstrating that the nanoemulsions are stable emulsions. Each amplitude and flow rate produced BSO alginate nanoemulsion within the targeted droplet size, which is below 500 nm of the sonicati...
Hend E.M. Elsheikh1*, Mamdouh F. El-Mekkawi1, A.A. Abou-Zaid1 and Amal M. Abd El-Raof2
...EVAC LSD vaccine. In contrast it’s not capable to do the same on Al-Abbasya LSDV vaccine due to unlikely presence of 27 nucleotides that specific for field strain in this type of vaccine.

...
Hend E.M. Elsheikh1*, Mamdouh F. El-Mekkawi1, A.A. Abou-Zaid1 and Amal M. Abd El-Raof2
...EVAC LSD vaccine. In contrast it’s not capable to do the same on Al-Abbasya LSDV vaccine due to unlikely presence of 27 nucleotides that specific for field strain in this type of vaccine.

...

Muhammad Ehsan Maqbool1*, Muhammad Nadeem Mushtaq1, Tamathues2, Khadija Tul Kubra1, Arish Zulfiqar1, Muhammad Shoaib Sarwar1, Zeeshan Yousaf3, Mudassar Yaseen1, Farwa Nosheen3

...era, and Thysanoptera. Amrasca biguttula biguttula (31.38%) was dominant species throughout the study period followed by Aphis gossypii (12.39%), Podagrica sp. (10.98%), Bemisia tabaci (9.45%), Syllepte derogate (8.30%), Mylabris pustulata (7%), Phenacoccus solenopsis (4.17%), Thrips tabaci (3.52%), Dysdercus cingulatus (3.44%), Earias vittella (1.91%), Helicoverpa armigera (1.53%), Liriomyza trifolii (1.37%), Spodoptera litura (0.91%), Ricania speculum (0.84%...

Ehab Hussein1, Edris A.M.1 and Ghada A.K. Kirrella2*

...70g, turmeric 20g, lemongrass 15g, salt 15g, garlic 7g, coriander 2g and cinnamon 2g; commercial marinades were composed of Spices, onion 380g, garlic, salt 60g, sugar 210g, water 30mL and cooking oil 60 mL and then modified marinades that composed of basic marinade 520g and lemon Juice 25mL. Each group was examined for determination of their BaP, BaA, BbF and CHR polycyclic aromatic hydrocarbons (PAH4). The recorded results revealed that the mean values of PA...
Aamir Khan Awan1, Nighat Sultana1*, Rahmat Ali Khan2, Rifhat Sultana3
Umm-e-Kalsoom1, Fayaz Ahmed Sahibzada4, Rifat Ullah Khan5, Naimat Ullah Khan6, Nazir Ahmad Khan7, Syed Haider Zaman8, Mir Sadiq Shah9 and Assar Ali Shah10*
...ase, alanine aminotransferase, urea, serum creatinine and total proteins were significantly (P<0.05) decreased in response to oral dosing of three varieties of P. granatum peel methanolic and aqueous extracts which were comparable to healthy control. Moreover, the aqueous extracts and wild P. grantaum were more effective than methanolic extracts and other species against hyperglycemia and biochemical profiles of treated rats. It was concluded that the extra...

Abd El-Alim F. Abd El-Alim1, Abdelhakeem El-Murr2*, Tahsein Hasan1

...) in alanine aminotransferase (ALT) from 57.36 ± 1.02 to 36.27 ± 1.08 IU/ L, aspartate aminotransferase (AST) from 72.45 ± 1.86 to 72.45 ± 1.86 IU/ L, creatinine from 1.42 ± 0.14 to 0.75 ± 0.06 mg/dL and urea from 38.62 ± 1.12 to 23.69 ± 0.98 mg/dL in positive control and T3, respectively. Meanwhile, serum protein and hematological parameters enhanced in T1, T2 and T3 i...

Shimaa R. Hamam, Reham A. El-shafei, Nani N. Abdelaziz, Magdy S. Amer

...mes glutathione-s-transferase and nitric oxide in the testicles. Testicular GST and NO activities, as well as the level of testosterone and sperm profile, were all significantly reduced while taking ibuprofen. Significant changes were also brought about in the testicular, epididymal, and seminal vesicle histological architectures. Important components of male fertility, such as testosterone, LH, and FSH levels, sperm profile, and testicular GST and NO activiti...

Adham Omar Mohamad Sallam1*, Ashraf Abd El-Hakem Ahmed El-Komy1, Enas Abdulrahman Hasan Farag2, Samar Saber Ibrahim3

...erum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, urea, and creatinine caused by Meloxicam toxicity. Additionally, oxidative stress markers such as malondialdehyde (MDA) were significantly reduced, while antioxidant enzymes like superoxide dismutase (SOD) and catalase (CAT) showed marked improvement in the GSE-treated groups (p ≤ 0.05). Histological and immunohistochemical analysis confirmed...

Ana Mehak1, Muhammad Mohsin1* and Muhammad Ahsan Raza2,3

... (0.718) in CEDA. In contrast, F-M calculated these parameters at 849 t (0.941). Based on the results, it is clear that L. johnii is being overexploited in Sindh, Pakistan. To ensure sustainable harvesting of this fishery resource and long-term economic exploitation, current management measures should be strengthened along with further research.

...
Nor Adila Zulkifli1, Nurul Zaizuliana Rois Anwar1*, Zalilawati Mat Rashid1, Zarinah Zakaria1, Norshazila Shahidan2, Lee-Hoon Ho1 and Faridah Yahya3
...t sensitivity. Hence, ultrasound which is a non- thermal processing was chosen as an alternative method to minimize the quality loss during the processing of Kelulut honey. The purpose of this study was to investigate the effect of ultrasound processing on the quality of Kelulut honey. The ultrasound processing was conducted at five different amplitudes (20, 40, 60, 80, and 100%) and three...

Siew Ing Nguang, Nur Syafiqah Binti Zainal, Ahmad Mukhlis Bin Hafas, Hou Chew Ha, Connie Fay Komilus, and Asmad Kari*

...strong vibration. In contrast, T2 and T3 experienced a greater decline in motility with a weaker vibration. Antibiotics in T2 likely contributed to the higher motility observed in this treatment. In summary, the absence of antibiotics and sugar negatively affected sperm viability and motility. The addition of antibiotic, sugar, and Av in the extender proved crucial for maintaining the viability and motility of cryopreserved tilapia sperm. These research findin...

Dalia Hamid Mansour1, Mohamed Elshabrawy Ghanem2, Marwa Hassan3, Yousry Ibrahim4, Ibrahim M. Hegab5*

...e, aspartate aminotransferase, alkaline Phosphatase, gamma-glutamyl transferase, urea and creatinine as well as examining the histological alterations in internal and lymphoid organs and bacteriological analysis of cecal bacterial count. One hundred and five chicks were divided into 3 groups, Group A, in which chicks (n=35) was vaccinated and taken Biocid® for the entire experimental period (31 days) in both feed and dri...

Nahed Yehia1*, Rania I. Mohamed2

...erse Transcription polymerase chain reaction (RT-PCR) by specific primers detect avian influenza type A and H9 typing. The nine samples selected represent different governorates for sequencing the HA gene. Also, the pathogenicity of the virus was positive experimentally in specific pathogen-free (SPF) chicks. In this research, the prevalence was 45% (18 out of 40 farms) with mild respiratory signs and 15-20% mortality. According to HA gene’s phylogenetic...

Adel Sobhy1, Ahmed El-khamary1, Ahmed M. Rashwan2,3, Ashraf Shamaa4, Mostafa Kassem5, Mohamed M. A. Abumandour6*, Ahmed El-Mansi7, 8 and Ahmed G. Nomir2

...rtant to have a novel ultrasound (US)-guided approach to brachial plexus block since it allows for a better understanding of the surface anatomy and relationships, as well as injury and consequences. This study used three methodologies of approach (anatomical, cadaveric, and live experimental tests) to describe the brachial plexus topography in the donkey, evaluate the US color doppler brachial plexus blockage, and test the analgesic efficacy. We topographical...

Samah Abou Asa1, Omnia Tag2 and Walid Elmonir2*

... related to fish-borne parasitic zoonoses among 100 residents in Kafrelsheikh Governorate were also investigated. The overall prevalence of EMC infection in examined fish was 32% (32/100): 44% (22/50) in mullet and 20% (10/50) in tilapia fish samples. The EMC were 3 times more likely detected in mullet fish compared to tilapia fish (OR= 3.1, P= 0.01). The heterophyids EMC were molecularly confirmed in 32% (16/50) and 18% (9/50) of mullet and tilapia fish sampl...

Mona F. Shousha1*, Aml M. Ragab2 and Salwa M. Helmy1

...at developing countries drastically reduce the overuse of antibiotics in poultry.

...
Anum Razzaq*, Tariq Mahmood, Ammara Saman, Ammara Baig, Nadeem Munawar and Muhammad Farooq
...wild flora (viz: herbs, grasses, seeds and tubers) invariably amongst crop stages and seasons. During spring season, wheat was the most frequently consumed cereal. But during winter, as groundnut crop approached towards maturity/harvested, gerbils consumed mainly nuts and grains, while in autumn and summer (non-crop periods), the rat species switched its diet to wild flora, and consumed most frequently Ziziphus nummularia (Beri) followed by Cynodon dactylon (K...

Bushra Sial1, Arif Muhammad Khan1, Mohsan Raza1,6*, Azhar Abbas Khan2, Sayyad Ali Raza Bukhari1, Muhammad Kashif Hanif3, Sher Khan Panhwar4, Muhammad Ashfaq5

...wan and Pakistan. In contrast, the lowest Fst value of 0.04 manifested minimal genetic differentiation between populations in the USA and Bangladesh. An average genetic distance using the Kimura 2 parameter (K2P) model using BOLD systems revealed 20.17 and 19.87 percent within genus and family respectively. Nevertheless, this study documented the COI sequence of Caesio varilineata and Uranoscopus dollfusi, for the first time. The combined use of taxonomy, DNA ...

Naglaa A. El-Taib1*, Asmaa T. Talayea2, Hanan R. Ghanayem3

...mL, respectively. In contrast, application of 0.1, 0.3-, and 3-mM concentrations of hydrogen peroxide for 30 minutes could not induce E. coli o157 into VBNC state but only significancy (P<0.05) decreased the count of viable cells from 6.93±0.04 (100%) to 6.49±0.03 CFU/ml (93.7%),6.04±0.06 CFU/ml (87.2%), and 4.79±0.01 CFU/ml (69.1%), respectively. Thus, treatment with chlorine was more potent in induction E. coli O157 into VBNC s...

Mustafa Abd El Raouf*, Mostafa Abdelazim, Abdel Basit M. Abd El-Aal, Shebl E. Salem

...re based on clinical, ultrasonographic, haematological and biochemical examinations. Ten apparently healthy calves with the same age were used as a control group. The affected animals were surgically treated with tube cystostomy technique and divided into two groups; Group I (n=10): orally administered ammonium chloride 200mg/kg and Group II (n=10): Local introducing of Walpole’s solution 100mL/animal. The time of resuming normal urination and urine pH i...

Budi Guntoro1*, Nguyen Hoang Qui1,2, Ahmad Romadhoni Surya Putra1, Nguyen Thi Anh Thu1,2 and Nguyen Van Vui2

... to adopt biogas. In contrast, information awareness (B = 0.295, p < 0.001), social influence (B = 0.389, p < 0.001), and perceived cost (B = 0.246, p < 0.001) were positively correlated with biogas adoption. Other variables such as age, gender, experience, education level, production scale, and income did not significantly influence biogas adoption. The study concluded that promoting the willingness to adopt biogas in pig farms requires policy interv...

Adi Tiya Warman1, Panjono1*, Tri Satya Mastuti Widi1, Sigit Bintara1, Bayu Andri Atmoko2, Endang Baliarti3

...than Bali calves. In contrast, 22.11% of respondents chose frozen semen from Bali cattle to purify the Bali cattle breed. Farmers’ decision-making process in choosing bull breeds for AI mating showed a positive correlation with total cows owned (rs = 0.24), cow breed (rs = 0.51), and AI cost (rs = 0.47). Hence, it can be concluded that farmers’ decision-making in choosing frozen semen for beef cattle is influenced significantly by social (total cow...

Mujahid Ali1*, Malik Muhammad Akram2, Emily Silverman3, Asif Iqbal1, Muhammad Mohsan1, Haseeb Ahsan4

...he public and develop infrastructure for better water management because of the increasing water insecurity in agriculture, low water productivity, and emerging climate issues. 

...

Wirokartiko Satyawardana1,4, Umi Cahyaningsih2*, Fadjar Satrija2, Safika Safika3, Arifin Budiman Nugraha2

...reservoir for zoonotic parasites. Therefore, this study aimed to identify blood parasites and rickettsia in stray dogs in DKI Jakarta. It included 50 stray dogs that were statistically representative of the entire population used detect disease sampling technique from various cities across the province, where blood samples were collected and subjected to polymerase chain reaction (PCR) ana...
Maimoona Imran2, Farah Rauf Shakoori2*, Soumble Zulfiqar1
Abeedha Tu-Allah Khan1 and Abdul Rauf Shakoori1*

Eman Wahsh1, Tarek M Ibrahim2, Mirna E. ElAwady3*

...nxiogenic effect. In contrast, treatment with diazepam produced an anxiolytic effect as evident by a significant increase in the number of licks and shocks. The anxiolytic effects of nifedipine and propranolol were evident at the high dose level as measured by increase in licks and shocks.
 
Keywords: Anxiety, Nifedipine, Propranolol, Caffeine
...

Halla H. Ahmed, Aurass Muhi Taha Al-Waeli and Fadia W. Al-Azawi*

...ber 2023. There is a contrast in the groundwater salinity values. The effects of the groundwater salinity in the NDVI indices produce that R2 = 0.86, R2 = 0.85 in inverse relation. The negative effect to the salinity concentration in the wheat health in the ROI. The conclusion of this study is that the disappear of good class in the period (December 2023, and January 2024) respectively for SARw furthermore Poor class disappear in (February, March)/ 2024 respec...

Ahmed Shamkhi Jabbar1* and Saadoon Murad2

...9.178 and 17.788. In contrast, the LC50 values for Blaiser® were 28.118 and 25.907, respectively. The more toxicity increased with the increase in the exposure period compared to the chemical compound Sivanto®. The results confirmed that the use of a free cell suspension of X. nematophlia bacteria gave excellent and promising results in controlling the mealybug P. solenopsis, comparable to and sometimes superior to pesticides of chemical origin.

...

Elfira Kariane Suawa1*,  Juliet R. Roberts2, Greg Parkinson3,  Angelina Novita Tethool1

...variables, scoring of ultrastructural mammillary layer features, completeness of cuticle cover. Body weight at point of lay and mature body weight at 40-45 weeks did not significantly affected egg production, but significantly impacted on egg size eggshell quality and internal egg quality. Cuticle cover (ΔE*ab value), shell breaking strength, deformation, percentage shell and Haugh unit were higher in the light BW group associated with a lower average eg...

Nguyen Thi Hanh Chi1,2, Ho Xuan Nghiep1,2, Tran Trung Tuan1,2, Nguyen Binh Truong1,2*

... libitum fresh elephant grass. The dry matter consumption per body weight showed a tendency towards a decrease in Ma.C.U (3.11%) and Ma.C treatments (3.11%) than in BrR.C.U (3.31%) and BrR.C (3.25%) treatments. Crude protein digestibility (%) of BrR.C.U was similar to Ma.C.U (P>0.05), but it was higher than (P<0.05) BrR.C and Ma.C (78.0, 78.7, 67.4 and 68.2, respectively). Across treatments, nitrogen retention (g/animal/day) differed (P<0.05). Treatme...

Yasser Asaad Hameed Al-Shareef, Firas Hussain Kadim Abawi*

...erse transcriptase-polymerase chain reaction, the presence of the virus was confirmed and mean death time approach was applied to determine the pathotype of isolates (velogenic). Next, we assessed the most important determinant of ND virus pathogenicity by the analysis of the fusion protein cleavage sites, phylogenetic analysis sand compared genomics of NDV isolates to publish sequences. Isolates characterized here showed 90.37% sequence similarity to the Iran...

Kamal Ahmed El-Shazly1, Amira Abd El-Latif1, Nagwa Elhawary2, Asmaa F. Alswaf1, Foad Farrag3, Samy Sayed4, Mohamed El-Sharnouby5 and Mustafa Shukry6*

...of the Eimeria tenella parasite were implanted orally into all but the negative control groups. According to the current findings, G2 demonstrated a significant increase in feed conversion rate, oocysts count, lesion score, mortality rate, count total leucocytic, ALP, ALT, AST, total bilirubin, creatinine, urea, uric acid, and MDA level, the body weight significally reduction, weight gain in the body, feed consumption, hematological parameters, lymphocytes%, c...

 Saranyah Sathiaganeshan1,2, Nur Aina Natasha Yusoff1, Siti Juzailah Zuraimi1, Rukayat Omolara Folarin1,3, Satya Narayana Rao Ramasamy1,4, Asmad Kari1, Enike Dwi Kusumawati⁵, I Wayan Karyasa⁶ and Connie Fay Komilus1*

...effects of organic wheatgrass (Triticum aestivum) fodders on growth performance and meat quality of Japanese quail (Coturnix japonica). This research aims to determine nutrient compositions in organic wheatgrass fodder (OWF) and to evaluate the effect of organic wheatgrass on the growth performance and meat quality of quail. Wheatgrass fodd...

Moh Sofi’ul Anam1, Ali Agus1, Budi Prasetyo Widyobroto1, Gunawan2, Andriyani Astuti1*

...ith a basal diet. In contrast, the treatment group (SUP) received the same basal diet but with added selenium and zinc supplements at dosages of 0.45 mg/kg and 60 mg/kg of dry matter (DM), respectively, based on our previous studies. The selenium and zinc were provided in organic chelated-methionine forms. The experimental feeding lasted for 49 days. Blood samples were drawn from each cow at the trial’s conclusion and placed in tubes containing anticoagu...

Nbaa Mutea Abid AL-Alh1, Nuha Hatem Khalaf1, Nagam Khudhair1*, Ahmed Khalid2

...17 Liver Weight). In contrast a decrease in body and liver Weight is observed among control and Prophylaxis groups (G3, G4 and G5) while no significant difference (p>0.05) in liver and body weights were observed between the groups under study. There was a significant (p<0.001) increase in G2 group ALT, AST and ALP compared a significant decreasing (p<0.001) in prophylactic groups in particular a concentration 5mg/kg or G5 group. Histopathological chan...

Zainab Sadik Chetheer*, Aseel Abdullah Ibraheem

...r treated groups. In contrast, the PTU treated group showed a significant reduction (P< 0.05) in T4 and T3 hormones levels with an increase in TSH levels compared with the other treated groups. The results for body weight, body temperature and thyroglobulin (TG) showed no significant differences between all treated groups.The histopathological changes of Withania somnifera supplement group showed a marked increase in variably-sized thyroid follicles with va...

Baraa Qasim Mohammed1, Asmaa Hamoody Abdullah1, Ahmed Raheem Rayshan2* 

... virulence gene by polymerase chain reaction study, followed by the identification of the exotoxin T, outer membrane protein I, and phenzaine+ M genes. Three (27.27%) of the isolates were P. aeruginosa carrying exoT genes, four (36.36%) P. aeruginosa isolated carried oprl genes, and three (27.27%) isolates of P. aeruginosa carrying phz+M genes. By using traditional PCR, oprl had the highest prevalence of virulence genes with 504 bp fragments, followed by exoT ...

Abeer S. Hafez1, Shereen M. Aly1, Dalia M. A. Elmasry2*, H. A. Hussein3, Marwa A. Abdelmagid4

...hanges decreased. In contrast, the intestine of the PEE group showed more significant improvement than PN group on 21and28 days old with intact villi and few lymphocytic infiltrations. Indeed, using of PN as an additive with vaccine application in chickens will be of add value in term of growth, immune status and organs health.
 
Keywords: Propolis, Nanoemulsion, Growth performance, Immunity, Pathological finding
...

Kai Wang, Weifeng Xu, Pengyuan Dai and Chunmei Li*

...OD), alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Meanwhile, the mRNA expression of HO-1 and NQO1 in liver tissue was also not significantly different. These results indicate that PNP may damage liver tissue through oxidative stress. Arg may improve growth performance and attenuate PNP-induced liver inflammation in healthy animals, but not by reducing oxidative levels.

...

Zuhaib Nishtar1, Wang Fangzong1,  Nan Yang1 and Jamil Afzal2*

...mals and clean energy infrastructure by meticulously planning renewable energy projects and minimising potential habitat interruptions. The study predicts that renewable energy sources including solar, wind, and hydropower will experience rapid growth, leading the China to a greener and more sustainable energy future. At the same time, preventative actions are taken to lessen the impact of habitat loss, protect vital ecosystems, and keep biodiversity from dwin...

Ho-Kyoung Bae, Jae-Kang Lee, Tae-Kyung Eom, Dong-Ho Lee, Hyeongyu Ko, Joo-Hee Kim, Sung-Hyun Ahn and Shin-Jae Rhim*

...t ground cover of rock, grass, and bare land were positively correlated with latrine site selection by the logistic regression models that displayed good predictive performance (a ROC-AUC value ≥ 0.65). The latrines were found at higher elevations, rather than lower to aviod higher temperatures, and we found that Asian badgers tend to make their latrines in deciduous forest. For the conservation of the species and their habitat, these habitat variables shou...
Roshita Ibrahim1*, Mohd Firza Ahmad Fauzi1 and Mohd Nizam Lani2
...ch as aloe vera pieces, grass jelly, fruit jellies, and tapioca balls. These drinks typically sweetened, which contribute to increased calorie intake. This study explores the use of black jelly mushroom (Auricularia auricula-judae) with its gel-like texture in producing healthy drinks, aiming to diversify the market’s range of wholesome beverages. The investigation involves creating a drink with suspended black jelly mushroom pieces and sweetening...
Rukayat Omolara Folarin1,2, Nurhadirah Hairil1, Nurafiqah Anis Ismail1, Putri Athirah Zamrifana1, Lina Nadhirah Abdullah1, Muhammad Afiq Zabhin1, Ariff Imran Alkaf1, Farrah Izzuanie Zainudin1, Hanisah Basir1, Asmad Kari1, Enike Dwi Kusumawati3, I Wayan Karyasa4 and Connie Fay Komilus1*
...ormal;">Hydroponic wheatgrass (Triticum aestivum Linn) production is an alternative to conventional planting, providing a constant supply of green fodder for livestock year-round. It involves growing plants without soil in water or a nutrient-rich solution in a greenhouse. All parts of the hydroponic fodder (leaves, stems, roots, and grain) are fed to livestock by the farmers. This experiment aimed to identify the effect of goat manure liquid fertilizer...
Mat Zin Ain-Auzureen1, Maizan Mohamed1, Tan Li Peng1, Mohd Faizal Ghazali2, Choong Siew Shean1, Kamaruddin Mardhiah3, Najiah Musa4, Nora Faten Afifah Mohamad5, Chai Min Hian2 and Ruhil Hayati Hamdan1*
...p>TM Vibrio. Polymerase chain reaction (PCR) was used to identify the isolates and detect the twelve virulence genes associated with V. alginolyticus. Antibiotic resistance tests were conducted using 17 antibiotics. The difference in index scores between locations was tested using one-way ANOVA, while the index scores between (multidrug resistance index) MARi and multi-virulence gene indexes (MVGi) were compared using the Mann-Whitney test. Total ...

Duaa Jasim Mohammad 

...cted hepatocytes. In contrast, liver of the untreated control group depicted normal histological features. Findings of this study articulate that halothane anesthesia can induce pathology in the liver of male white mice and offer consideration of mice as animal model to investigate useability, practicalities and implication of such anesthetic agents in animal health practices. 

...

Khalid Nabieh1, Wael K. Elfeil2*, Ahmed Ali1, Ali Zanaty3, Magdy F. Elkady1

...erse transcription polymerase chain reaction (RT-PCR). Followed by sequencing of these segments, and a phylogenetic analysis of the strains was performed to evaluate the genetic divergence and IBDV reassortment. The genetic analysis revealed that the variant strains were more frequent (80%) than the classical (15%) and vvIBDV (5%) strains. The VP1 and VP2 phylogenetic analysis revealed three distinct groups: classical, variant, and vvIBDV strains. Furthermore,...

Mohamed E. Enany1, Ahmed M. Hamouda2, Reem M. Khashaba3*

...21% respectively. In contrast, the isolates demonstrated significant sensitivity to Colistin, with a sensitivity rate of 94.73% while were 60.52% and 52.63% for Gentamicin and Trimethoprim-sulfamethoxazole . the antimicrobial activity of five methanolic plant extracts (garlic, cloves, rosemary, Ficus sycomorus and Ziziphus spina-christi,) were examined toward intermediate resistant strains of Escherichia coli, Salmonella typhimurium and Klebsiella pneumoniae. ...

Sanjita Gurau1,2 and Ram L Ray1*

...2022 in Kawasoti, Nawalparasi-East, Nepal. The experiment was conducted in a single factor randomized complete block design with four replications and five treatments: 1: Anna 303, 2: Anna 202, 3: Sunny House, 4: Shlesha, 5: Grey zucchini. The results showed significantly higher plant spreading in Sunny House. The highest number of male flowers plant-1 (29.56) and female flowers plant-1 (13.81) were recorded in Shlesha 1214, while the lowest number of male and...

Hammad Ali, Basheer Ahmad, Asim Karim*, Saifullah and Salman Ahmad 

...luded the building of infrastructure, fuelwood gathering, animal overgrazing, and forest fires. 

...

Rand Kamil Abbas, Zahra Sadoon Hadi*, Ahmad Hassan Sahib 

...n days). The impact of parasites on various blood parameters were investigated and died animals were examined for gross and histological changes. The results revealed that trichomonas had affected the blood picture, decreased Hb and PCV concentrations while dramatically increasing WBC with no discernible effect on RBCs. On the other hand, garlic possessed beneficial effects on blood parameters and bird health. Gross clinical changes include yellowish white cas...

N. M. Abed 

...he control group. In contrast, the CPF-treated group had significantly higher serum levels. Our investigation concludes that propolis has a significant impact in safeguarding against hypothyroidism and gonadotoxicity generated by NiCl2 and/or CCl4.
 

...

Eman Abdelrazik1, Sahar H. Abdel-Baset2*, Abdelghafar M. Abu-Elsaoud3,4 and Shimaa M.A. Mohamed5

... peanut crops is plant-parasitic nematodes, which are the most destructive pathogens that affect peanuts globally. A survey of plant-parasitic nematodes (PPNs) in peanuts was conducted in Ismailia, Egypt. The host suitability of four Egyptian peanut cultivars for Meloidogyne arenaria cultivation under greenhouse conditions was also examined. Additionally, the effects of fulvic acid, compost, and cattle manure, either alone o...

Oluwatoyin Adenike Fabiyi* and Abigail Abosede Olojede 

...align: justify;">Plant parasitic nematodes are salient pests of cabbage plants often controlled with agrochemicals. This procedure is laden with environmental pollution which calls for agro-biocides development in the control of plant parasitic nematodes (PPNs). Screenhouse trials were set up to assess the effectiveness of silver nanoparticles on Meloidogyne incognita populations in cabbage plants using aqueous extracts from...

Rehan Ullah1, Fazli Rahim1, Muhammad Sajid1, Shakir Ullah2*, Shahab Ali2, Lubna Shakir3, Mohammad Sohail4 and Ghani Subhan5

... species. Additionally, Brassicaceae, Cucurbitaceae, Moraceae, Papilionaceae, Ranunculaceae, and Rutaceae were represented by 5 species each, while Euphorbiaceae, Labiatae, Malvaceae, and Rhamnaceae each had 4 species. The leaves of the plants were predominantly used in preparing therapeutic remedies, most commonly administered orally as decoctions. However, traditional collection practices and inadequate post-harvest handling often reduced the quality of thes...

Hakeem Jawad Kadhim1, Abbas Kamil Shlaga1*, Safaa Hussein Ali2 

...uninfected birds. In contrast, inflammatory biomarkers’ gene expression exhibited an increase in their mRNA levels, indicating that the birds were infected with a viral infection and that there is inflammation in the body. In conclusion, the M gene could be used as a marker for identifying NDV in infected birds. Similarly, the NDV infection led to a decrease in antibody titers, which is associated with an increase in the gene expression of inflammatory b...

Hind Abdulzahra Abdulkadhim Alshaibani1*, Abdul Jaleel Aziz Karim Alqaraghli2, Mohammed Azeez Yasir Alzaidi3 

.../p>...

Huda Hameed Kadhim Alabbody 

... of pets reported were parasitic infestation at 25%, tumors and cancerous lesions at 14%, diarrhea and vomiting symptoms at 10% each, the least were dental problems at 2%. Other problems such as obesity, arthritis, ear infections and skin issues were reported. The study recommends more explanation about companion animals including to encourage health practices, arrange breeding, appropriate nutrition and housing. Veterinarians can provide the best advice and a...

Lalu Ahmad Zaenuri*, Rodiah Rodiah

... internal and external parasites. Ten semen samples were collected using an artificial vagina every four days over a period of ten consecutive days. The collected semen was divided into four tubes based on to the treatment extenders: FF0 (0 ml), FF1 (4 ml), FF2 (6 ml), and FF3 (8 ml) of fig fruit filtrate, each added to 100 ml of a Tris-albumin-based extender (v/v). Each tube was then divided into six aliquots according to the assessment frequencies. The sperm...

Muhammad Abdul Basit1, Lionel Kinkpe1,3*, Abdur Rahman1, Boko Michel Orounladji2, Hafiz Qadeer Ahmed3, Muhammad Subbayyal Akram4, Elodie Dimon5, Gadah Albasher6, Syed Muhammad Suhail1  

...ek, p < 0.05). In contrast, Barbari goats showed no significant difference in weight gain across the feeding systems. Moreover, Makhi Cheeni goats recorded the highest BCS under stall-feeding (2.83), whereas grazing led to the lowest BCS (2.37, p < 0.05). Blood analysis indicated lower total cholesterol levels in Makhi Cheeni goats under semi-intensive grazing systems compared to stall-feeding (p < 0.01), pointing to possible dietary insufficiencies. ...

Mohammed Jawad Kadhim*, Qasim Jawad Amer

...The ITS1 region of the parasite’s small subunit rRNA gene was amplified using a PCR. in conjunction with microscopy. The microscopy results revealed the existence of parasite cysts and trophozoites in both human and cattle fecal samples. The PCR results indicated that the genus Entamoeba was detected in 43% (43/100) of the human fecal samples (27 in male and 16 in female). Moreover, the results showed that the high fre...

Aiman Mohammed Baqir Al-Dhalimy*, Alaa Kamil Mahmood

...serological tests. Polymerase Chain Reaction (PCR) and Enzyme-linked immunosorbent assay (ELISA) tests were used to identify CAV-1. Specific primers targeting the E3 gene were employed for the diagnosis of canine adenovirus type 1 (CAV-1). The PCR results indicated the presence of canine adenovirus type 1 (CAV-1) in 9 out of the 200 animals tested, with the remaining 191 animals testing negative for the virus (4.5%) while the infection rate was five out of 200...

Abdulameer Jawad Zayier*

...The development of the parasites was significantly inhibited both in number and viability of promastigote that treated with green AgNPs of Citrullus colocynthis comparing with control. It also caused killing the promastigote on third day after treatment in all concentration of green nanoparticles of plant (0.5, 1, 1.5 and 2) grams and shown best results in lowering viability in two days after treatment , While the alcoholic extract had an greatest significant ...

Mayada Sahib Hassan1*, Hayder Talib Mahdi1, Sajaa R. Al-Saedi1, Ali Farid Shakir1, Ali J. Al-Nuaimi1, Marwa Sabah Majed1, Ridha Adel Fahad1, Karar Ali Kadhim1, Mustafa Ali Noor1, Ameer Hameed Kadhim1, Hussein Ali Mohammed Hadi1, Zainab Amori Oribi2, Mazin Talib Abbas3, Mahdi S. Hassan4 

...rrestris extract, in contrast to lead acetate, which displayed some detrimental effects.
 
Keywords | Lead acetate, Tribulus terrestris, Plant extract, Nephrotoxicity, Antioxidant
...

Oula E. Hadi*, E.H. Altaee

...ed on several groups of grass-fed cows in different locations in Basra/Iraq. Histopathological examination of the kidneys revealed hemangiomatous transformation in cows with U in the kidney. Uranium levels were measured using a sodium iodide device, and samples were taken from the cows’ kidneys, as they are the organs most affected by uranium. It was noted that if low concentrations of uranium were taken, there would be inflammation in the tissues, and a...

Mahyudin Humalanggi1, Mohammad Zubair Hippy2*, Muhammad Mukhtar3, Sutrisno Hadi Purnomo4, Siti Rahmatia Machieu2, Nancy Noviana Lantapon1, Ivana Butolo1

...grated marketing, and infrastructure development.
 
Keywords | Beef cattle, Ecosystem, Food crops, Integration, Technology
...

Quddusi B. Kazmi* and M.A. Kazmi

...copid ostracod species Parasterope sp. of the family Cylindroleberididae Müller; another species- Ancohenia robusta (Brady, 1890) of a myodocopid family Sarsiellidae and Rutiderma sp. of family Rutidermatidae Brady and Norman were also collected; an instar of an indeterminate myodocopid ostracod is added here Additional descriptions of cyprinid Cypridina dentata (Müller,1906), and a diplostracan Penilia avirostris Dana, 1849 of the order Ctenopoda in...

Reski Amalia1, Claude Mona Airin2, Pudji Astuti2*, Agung Budiyanto3 

... risks today. Broccoli (Brassica oleracea var. italica) has been shown to influence various physiological processes, including hormonal modulation. This study aimed to evaluate the effect of broccoli powder on estradiol (E2) levels in male rats. Over a period of 28 days, male rats were orally administered broccoli powder containing indole-3-carbinol (I3C). A total of 25 rats were divided into 5 groups (P1 to P5) and supplemented with either distilled water (ne...

David Kurniawan1,2, Eko Widodo2, Agus Susilo2, Osfar Sjofjan2*

...eeding level, but in contrast, the polyunsaturated fatty acid profile decreased significantly (p<0.05). In conclusion, feeding 5% Se-BSFL is recommended because it does not show a negative impact on carcass characteristics, especially a decrease in slaughter weight and carcass weight and shows the highest carcass percentage. Feeding Se-BSFL also had an impact on the monounsaturated and polyunsaturated fatty acid of broiler duck meat. These results indicate ...
Aatif Masood Ahmad Khan1, Masood Rabbani1*, Arfan Ahmad1, Muhammad Wasim2 and Sohail Raza1
...s old, and birds were intrasinus challenged at 12 weeks old with A. paragallinarum culture. Birds were kept under complete daily observation for 7 days after the challenge. Signs, postmortem lesions, reisolation of the bacteria, protection rate and stability after 3- and 6-months storage were used as criteria for bacterin evaluation. The results showed that montanide oil and alum gel-based vaccines with 109 CFU/0.5 ml/ dose and commercial vaccine A gave the hi...

Misbah Farooq1, Muhammad Zubair Anjum1*, Zahir Muhammad1, Maqsood Jan1, Muhammad Shahbaz Azhar1, Shaina Rasool1 and Muhammad Qayash Khan2

 

...phometric characters of grass carp for 60 days. A total of 120 fish fingerlings of mean weight 2.95±0.27g were randomly distributed into four experimental groups having three replicates (n=10/aquarium) and fed with four experimental diets i.e., D1 (commercial fish feed without probiotics as control), D2, D3 and D4 (commercial fish feed with addition of 2g, 4g and 6g Lactobacillus rhamnosus GG/ kg respectively) @ 5% of their body weight. Growth performan...

Touseeq Haider1, Saeed Gulzar1, Sabeeqa Usman Malik1*, Aamir Saleem1, Zuhair Hasnain2, Nazakat Hussain3, Syed Ali Abbas1, Amir Hussain4 and Qadir Hussain4 

...nd 2g in Setaria anceps grass. However, Chloris gayana slightly performed better than Setaria anceps in all parameters. The results were analyzed using SPSS, Complete Randomized Design (CRD) one-way ANOVA with a probability threshold of 0.05%.

...

Pacifica Chepchumba Bwogo1*, Samuel Mong’are1, Rael Masai1, Dr. Damaris Matoke-Muhia2

...rum is the predominant parasite responsible for approximately 99% of malaria cases in Kenya. Indoor biting by malaria vector plays a significant role in residual malaria transmission; however, the characteristics of the vectors responsible for driving this phenomenon remain unclear. Methods: The present study, investigated the genetically characterized populations and abundance of malaria vectors captured indoors in three chosen endemic sub-counties of Kisii C...

Shajaan Ridha Hasan, Farhan Khaleel Hussein*, Feedan Mohammed Junaid

...nfection rate with the parasite was within the age group 1-10 years, 53.082%, and the lowest infection rate was within the age group. 61-70 years 1.369%. The current study showed the highest infection rate in males, 50.343%, while in females, the infection rate was 49.657%. The current study showed the highest infection rate with the dry ulcer type, 59.590%, and the lowest infection rate with the wet ulcer type, 40.410%. The current study showed that the highe...

Nounagnon Darius Tossavi1,2*, Mariette Sindété3, Nike Fumilayo Aladetohun4, Marie-Line Escande5, Adam Gbankoto3

 
...s due to a myxosporean parasite infecting ABO in Clarias gariepinus. To achieve this goal, a total of 339 C. gariepinus was investigated for myxosporean infection. Fish sex, size and weight were recorded and light and electron microscopes were used to identify the parasite and to enlighten the physiological impacts. The prevalence was accessed as a function of fish size and climatic seasons. Water physicochemical parameters ...

Munib Hussain1, Abdul Razzaq2, Mohammad Qasim1*, Muhammad Jamil3, Abid Hussain4 and Najeeb Ullah5

...is is an important endoparasitic infection of cattle and goats prevalent in hilly and semi-hilly areas of Pakistan and considered as an important disease of economic significance affecting ruminants especially cattle (Hypoderma bovis and Hypoderma lineatum) and goats (Przhevalskiana silenus). The major economic loss incurred by warble fly infection to livestock and leather industry is due to perforation of hide and skin. Therefore, the present study aims to in...

Wasan Abdulmunem Taha1*, Umer Abdullah Ahmed Alelyan1, Raid D. Hashim2, Zainab Nizar Jawad3, Mohammed Khaleel Jameel4, Mohammed Ahmed Mustafa1

...OT), Alanine Aminotransferase (ALT), Alkaline Phospahatases (ALP), Blood glucose, Luteinizing hormone (LH) and Insulin hormone. The research identifies a gap in the current understanding of the specific biochemical effects of PCOS on liver enzyme activity, glucose metabolism and LH disorder. The study aims to fill this gap in providing an exhaustive explanation of relation between PCOS and these biochemical markers. However, further results indicate female PCO...

Muhammad Shahid1*, Aamir Ghafoor1*, Masood Rabbani1, Hassan Mushtaq1 and Mumtaz Ali Khan2

...tality (n=02/10). In contrast, group C was the most protected group showing mild signs and no mortality. Nephro-pathogenic gross lesions were predominant in all groups except group C which had the lowest score. It was concluded that nephro-pathogenic strains are involved in field outbreaks of IB. Further, a vaccination program only with a classical strain could not provide full protection while priming with a classical strain in first week and boosting by a va...

Esam M. Al-Shaebi, Saleh Al-Quraishy, Saleh N. Maodaa, Hossam M.A. Aljawdah and Rewaida Abdel-Gaber* 

...tify;">Eimeria species parasite resistance to drugs has been reported, which infects many animals and leads to great economic losses. Medicinal plants are a promising source of a cure for many diseases. This study aimed to investigate the effect of Allium sativum juice (ASJ) on the sporulation of oocytes and as an anthelminthic effector via in vitro study. Characterization of the plant was done by Fourier-transform infrared spectroscopy (FT-IR) and determinati...
Abdul Majeed Saim1, Arshad Javid1, Misbah Sarwar­2
Muhammad Hafeez-ur-Rehman3 and Ali Hussain4*
...re intracellular avian parasites and have serious impact on captive and wild birds worldwide. These avian parasites cause serious infections which ultimately cause decline in population of both wild and captive birds even can cause their extinction. Environmental changes especially variation in temperature and altitudinal gradient have great impact on distribution of ectoparasites and endo...

Asher Azeem1, Misbah Javed2, Muhammad Riaz ul Haq1, Maria Shahzeen1, Muhammad Asif1, Gul Muhammad1, Khalid Hussain3, Ahmad Ali3, Muhammad Latif4, Noreen Samad2 and Furhan Iqbal1*

...ue of diafenthiuron for grass carp, Ctenopharyngodon idella and to report the effect of various doses such as 0.0038 (T1), 0.05 (T2), 0.5 (T3), 1 (T4), 5 (T5) and 6.67 mg/L (T6) on complete blood count, serum biochemical profile and antioxidant parameters in kidney and liver of this fish following 96 h exposure. An untreated control group was maintained in parallel. Our results indicated that 96 h LC50 value of diafenthiuron for juvenile C. idella was 5.67 mg/...
 Nadeem Raza1, Aneela Zameer Durrani1, Muhammad Hassan Saleem1,  Ali Ahmed Sheikh2, Muhammad Usman1*, Quratulain Mujahid3,  Muhammad Zahid Iqbal1, Muhammad Rizwan4 and Muhammad Husnain Ali Alvi1
...erization by using polymerase chain reaction targeting 16S rRNA gene and phylogenetic analysis. Hyalomma dromedarii and Rhipicephalus were found to be 76% (152/200) and 24% (48/200), respectively. Molecular study showed the 10.5% (21/200) prevalence of B. burgdorferi sensu lato in ticks. Phylogeny showed that our isolates branched with isolates from tick (USA) and camel blood (China) with >80% bootstrap consensus. Risk factors ex...

Mubashar Hussain*, Syeda Nafeesa Kazam, Aqsa Noreen, Suleman Hussain Shah, Uswa Zeb and Aniza Iftikhar

...="text-align: justify;">Grasshoppers are major herbivores that occupy agricultural landscapes across the globe due to their ecological, behavioural, and taxonomic diversification. The periodic assessment of the population of grasshoppers in field crops is crucial in devising and implementing pest management strategies. This study explored croplands to document the diversity of grasshoppers...

Zainab Temitope Salami1, Oladele Oluyinka Opaleye1,2*, Olusola Ojurongbe1,2, Adekunle Olugbenga Olowe1,2 and Titilayo Adenike Olayinka1,2

...DV IgG antibodies. Polymerase chain reaction (PCR) was carried out in the HBsAg positive and HDV seropositive samples. Statistical analysis was done using the SPSS software, descriptive analysis was done for categorical data to obtain prevalence. Statistical significance was determined with the Chi-square test with the level of significance set at P ≤ 0.05. HBsAg, HBeAb and HBcAb markers of HBV infection were detected in 13.9% (n= 25/180), 2.8% (5/180) and ...

Tengku Halimatun Sa’adiah T. Abu Bakar1,2,3*, Norsida Man1, Nolila Mohd Nawi1, Jasmin Arif Shah Shah1 and Munifah Siti Amira Yusuf1

...harvest adoption. In contrast, social influence (β =0.036; t=0.681; p=0.248), and performance expectancy (β=0.048; t=0.771; p=0.220) were found to be insignificant. Special attention should be paid to other factors influencing PHP adoption to support new literature on technology adoption theories or models in future studies. This study is also significant in meeting the National Agrofood Policy 2.0 (2021-2030), drafted by the government to enhance fo...

Sitti Rosmalah1*, Hartati1, Harianti1, Selvi Diliyanti Rizki1, Rustam2, La Ode Muh. Munadi3, Rina Astarika4, La Ode Jabuddin5, Abdul Rizal6, Muh. Obi Kasmin7 and Muhtar Amin

...urces, facilities and infrastructure, and capital. The main obstacles faced include the lack of development policies, low awareness of healthy food, and minimal support for infrastructure and capital. This study can conclude that there are various problems in each agribusiness subsystem, so the model built for the development of dryland rice agribusiness does not run optimally.

...

Shajaan Ridha Hasan*, Feedan Mohammed Junaid, Bayan Mohammed Mahdi, Farhan Khaleel Hussein

...: justify;">Intestinal parasites are widespread pathogens worldwide and are considered one of the most critical pathogens a person may encounter, especially in developing countries that lack the necessary conditions for personal hygiene and health awareness. These parasites can intrude on the digestive system, causing many diseases, including chronic diarrhea, one of the most common diseases in children. It is also essential...

Andi Mushawwir1*, Lovita Adriani1, Ronnie Permana1, Eli Sahara2

...humidity was 89%. In contrast, the sites at medium altitudes, ranging from 750 to 850 meters above sea level, were in Sumedang and South Subang, where the average temperature was 24°C, and the humidity was 65%. The study, which lasted for six months, aimed to assess the effects of heat stress on various stress markers, including malondialdehyde (MDA), cholesterol, total iron binding capacity (TIBC), and carbonic acid (H2CO3) levels. Additionally, it examin...

Gulzar Ullah1*, Riaz Alam1, Gohar Ayub2 and Ibrar Hussain3

...ut to study the role of brassinolide treatments (0, 0.5 ppm, 1 ppm and 1.5 ppm) on growth and development of three tomato varieties (Yaqui, Roma and Rio Grande) at Horticulture Research Farm of Department of Horticulture, The University of Agriculture Peshawar during 2017-18. The experiment was conducted in a randomized complete block design (RCBD) with two factors replicated three times. 24-Epibrassinolide was used as a sou...

Irma1*, Siti Darodjah Rasad2, Nena Hilmia2, Cece Sumantri3

... c.1358G>A from Polymerase Chain Reaction (PCR) based on direct sequencing. This study aimed to analyze the association between GDF9 diversity and the superovulation response in Peranakan Ongole (PO), Belgian Blue (BB), and its crossbreeds (BB x PO). The experiment was conducted using 21 donors from Livestock Embryo Centre (LEC), which were selected for the superovulation based on oestrous synchronization. The normality distribution of data was evaluated us...

Syeda Abiha Zehra Jaffari1, Tuba Abid1, Muhammad Zohaib2, Ghulam Haider3 and Zehra Hashim1*

... paraoxonase and arylesterase enzyme activities and levels of lipid peroxidation marker were assessed to figure out the level of oxidative stress. The odds ratio was calculated using MedCalc® software and gene counting. SPSS® 16.0 was used to perform Chi-square test, independent t-test and Pearson correlation. In our results, we found that genetic variant PON1 55M (172A) was significantly (p<0.001) correlated with an increased risk of breast cancer....

Hongxiao Li1*, Xiying Wu2, Dengxiang Wu1 and Jiangqing Yu1

...h groups were decreased drastically, and the scores in the Exp. group were dramatically lower than those in the Ctrl group (P<0.05). The bacterial clearance rate in the Exp. group was 64%, which was notably superior to 28% in the Ctrl group (P<0.05). The combination of amikacin and PPC/TS can greatly enhance the disease severity in elderly patients with severe drug-resistant PA, control the in vivo inflammatory response, promote the recovery of patients,...

Binod G.C. 1 Nim Raj Sapkota 2 Binod Rayamajhee 2 Jayram Lamichhane 1 Pramod Poudel 1 Sunil Lekhak 3 Shovana Thapa 4 Santosh Khanal 1

Volume 2, Issue 5 September and October 2018 Pages 65-74
... MHT. Furthermore, Polymerase chain reaction (PCR) was carried out among the MHT positive bacteria for detection of blaNDM-1 gene. Genetic analysis of MHT positive isolates showed that 1\2 E. coli and 2\3 K. pneumoniae isolates were New Delhi metallo-β-lactamase producers (NDM-1). Results of this study demonstrated the presence of blaNDM-1 gene among the carbapenemase producing E. coli and K. pneumoniae isolates, and were recorded to be 50% and 66.6%, res...

Abdelhak Rhouma 1 Ibtissem Ben Salem 1 Mahmoud M’Hamdi 2 Naima Boughalleb-M’Hamdi 1

Volume 2, Issue 5 September and October 2018 Pages 85-100
...ment.

...

Sayed S. Sohrab

Volume 2, Issue 6 November and December 2018 Pages 114-121
... was identified by polymerase chain reaction (PCR). The viral components were amplified by Rolling circle amplification (RCA); and digested with BamH1 and ECoRV which released the 2.7 kb fragment. The betasatellites was amplified by using betasatellites specific primers. The fragments were cloned, sequenced, analyzed and submitted to GenBank under the accession numbers (MK122994-full-length) and (MK122995-betasatellites). The full genome had total 2780 nucleot...

Muhammad Junaid Musharaf Ahmad Saifullah A.

Volume 2, Issue 6 November and December 2018 Pages 138-146
...toms. According to Polymerase chain reaction (PCR), the expected 281bp band was amplified from 25 candidates of R. solanacearum isolates, thus genetically confirming them to be 
Abdul Qadeer1,2, Muhammad Avais1*, Abdul Wajid3, Muhammad Zahid Iqbal1, Hanif Ullah4, Asad Khan5, Sajid Ur Rahman2,6, Aqeel Javeed7 and Sher Zaman Safi8,9
...esistance to different parasites, so medicinal plants have attracted attention due to their affordability and beneficial effects. In this study, the activity of Hedera helix extracts was investigated against H. contortus in sheep. In the in-vitro trial, the anthelminthic activity of methanolic and aqueous extracts of Hedera helix was checked on eggs and developed larvae of H. contortus at different doses (0.02, 0.05, 0.1, 0.15 0.2 mg). Aqueous and methanolic e...

Ashar Farooq1*, Mohammad Salim2, Zahid Rauf1, Muhammad Tahir Khan3 and Asad Abbas Khan4

... value of three Panicum grasses at different growth phases. RCBD with factorial arrangement was employed, consisting of four replications. The treatments included three Panicum species: P. antido tale, P. coloratum, and P .maximum, each assessed at different growth phases i.e., pre-boot, full-flowering, and seed-ripe. Fresh grass samples were collected and analyzed for several quality parameters. The samples were oven-dried ...

Arani Chakma1, Yousuf Biswas2, Md. Kamruzzaman Akimul2, Md. Saifur Rahman2, Md. Rezaul Karim3 and Mohammad Enamul Hoque Kayesh2*

...tudy area, followed by parasitic infestations (15.24%, n=293), feline upper respiratory tract disease (13.68%, n=263), and feline panleukopenia (11.19%, n=215). Among surgical cases, neutering was the most prevalent (39.25%, n=305), followed by spaying (31.66%, n=246), soft tissue surgery (11.71%, n=91), and urolithiasis (11.20%, n=87). The results of this study provide a valuable insight into the prevalent clinical diseases and surgical cases in cats, which m...

Kazi Abdus Sobur1*, Shabuj Kumar Pal2, Md. Abdur Rahim3 and Palash Bose1

... farmers provided green grass, tree leaves, and a minimum amount of concentrate feed such as maize, gram, and wheat bran. Goats were allowed to graze on fallow land and around households during the day and were housed at night. Semi-intensive rearing was the predominant system. Around 73.3% of owners did not vaccinate their goats. Peste des Petits Ruminants (PPR) was reported as the major disease, affecting approximately 72.2% of the population. Natural servic...
Habtamu Tedila1*; Addisu Assefa1; Feto Haji
Novel Research in Microbiology Journal (2019), 3(1): 190-203
...en of humans and has a parasexual cycle that appears to be stimulated by environmental stresses. Aspergilli represent the most common pathogenic species especially for Aspergillus flavus and A. fumigatus.

 

Naïma Boughalleb-M’Hamdi1*; Najwa Benfradj1; Ibtissem Ben Salem1; Paloma Abad-Campos2

Novel Research in Microbiology Journal (2019), 3(1): 271-280
...rity coefficient. In contrast; isolates F.s.c.3 (collected from Sfax) and F.s.c.1 (collected from Beja) were similar. Cluster analysis based on UPGMA of the ISSR markers data assembled F.s.c. isolates into two major groups. These results are helpful to develop integrated management and future breeding programs for plant resistance.

...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
...c primers-mediated Polymerase chain reaction (PCR) was carried out. Two specific primers i.e. forward primer: 5'GTCGCCGTCAACTCACTTTCC3', and reverse primer: 5'GTCGCCGTAGCAATGCGGAATCG3', were used for amplification of the 281bp band. Twenty five isolates out of the 29 were genetically confirmed to be R. solanacearum based on their amplified 281bp band.

...

 

Mahmoud Hamdy Abd El-Aziz1*; Hosny Aly Younes2

Novel Research in Microbiology Journal (2019), 3(2): 326-340
...erse transcription polymerase chain reaction (RT-PCR); the size of amplification of the obtained product was approximately 870 bp for CMV isolate; and was assigned accession number of LN606587. The Phylogenetic tree was generated using partial sequence of CMV isolate, with those of other CMV isolates obtained from GenBank. The aims of the current work were; to produce specific polyclonal antiserum against the purified CMV isolated from cowpea plants, and to re...

 Eman Abuheiba1*; Sawsan M. El-Sonbaty2; Nahed Abdel-Samed3; Eman Kandil1

Novel Research in Microbiology Journal (2019), 3(3): 387-395
... the alanine aminotransferase (ALT) activity and total protein compared to DEN group. Results showed that manganese nanoparticles were effective in treatment of HCC induced by diethylnitrosamine (DEN) in rats. So manganese nanoparticles can serve as a good therapeutic agent for the treatment of hepatocellular carcinoma, and deserve further studies in the future.

...

 

Mahmoud H. Abd El-Aziz1*; S.I. Behiry2; H.A. Younes2; Karrar A. Hamza2

Novel Research in Microbiology Journal (2019), 3(4): 440-452
...erse transcription-Polymerase Chain Reaction (RT-PCR), and register these isolates in GenBank.

...

 

Dalia G. Aseel1*; Mahmoud H. Abd El-Aziz2; Sanaa A. Riad3; Azaa Makhlouf3; Gaber I. Fegla4; Elsayed E. Hafez1

Novel Research in Microbiology Journal (2019), 3(4): 453-463
... PLRV. A multiplex Polymerase Chain Reaction (PCR) was carried out using three different sets of primers, specific for both PLRV and Potato virus Y (PVY) isolates. For confirmation; the movement coat protein (MP) gene was isolated from the infected plant tissues, and a band with molecular size 336 bp was obtained using Reverse transcription-Polymerase chain reaction (RT-PCR). The DNA sequence of the Egyptian PLRV-Banha -MP g...

 Dalia Gamil Aseel1*; Mahmoud Hamdy Abd El-Aziz2; E. E. Hafez1

Novel Research in Microbiology Journal (2019), 3(6): 493-501
...erse Transcription-Polymerase Chain Reaction (qReal Time-PCR) assay was carried out on (GFLV) recovered from infected grapevines leaves at Alexandria, Egypt. A 606 bp fragment of the GFLV RNA-2 coat protein (CP) gene was amplified and then sequenced. Results of reactions of diagnostic hosts were observed on Gomphrena globosa

 

Mohamed G. Farahat

Novel Research in Microbiology Journal (2019), 3(6): 511-525
... was the isolation of agarase-producing bacteria for production of agar hydrolysates with special emphasis on their anti-oxidant potential. An agarolytic strain NI125 was isolated from Nelson's Island, Alexandria, Egypt. Based on 16S rRNA analysis and extensive phenotypic characterization, it was identified as Aquimarina agarilytica. Maximum enzyme production was achieved after 24 h incubation at 20°C, and tryptone was recorded to be the best nitrogen sour...

 

Bassma H. Elwakil1; Safaa M. Ali2*; Soad F. Hafez3; Adnan A. Bekhit4; Moustafa Y. El-Naggar5; Zakia A. Olama5

Novel Research in Microbiology Journal (2019), 3(6): 535-545
... MHT positive. The Polymerase Chain Reaction (PCR) technique revealed that TEM, BETA, NDM and IPM genes are found on the bacterial plasmid (100%). However the presence of the β-lactamase genes on the bacterial DNA varied among the different strains. The presence of the resistance genes on the bacterial plasmid may signify the resistance acquired upon the previous exposure of this bacterium to the different antibiotics. The aims of the current work were to...

 

Safaa M. Ali1*; Nadia A. Soliman2

Novel Research in Microbiology Journal (2019), 3(6): 590-597
...d sequence for the Polymerase Chain Reaction (PCR) products. This study establishes an effortless and professional method for cloning of recent cellulase genes through ecological metagenomes. In the outlook, the metagenomic guide approachs may be functional to the elevated selection of novel cellulase from the environment.

...

 

Jonathan D. Hulse

Novel Research in Microbiology Journal (2020), 4(1): 606-612
... agricultural, forests, grasslands, wetlands, and coastal zones. Chaetomium sp. plays an important ecological role as a saprophyte, but also shows strong anti- microbial activities which allow its use as a biological control agent (BCA). Chaetomium sp. has been recorded on the seeds and within the rhizosphere of a variety of genera of the family Cucurbitaceae including; Citrullus, Cucumis, Cucurbita, Lagenaria, and Luffa. Within the genus Cucurbita, Chaetomium...

 

Ram Bahadur Khadka1,2*; Ravin Bhandari2; Rabin Gyawali3; Balram Neupane1; Dhakaraj Pant4

Novel Research in Microbiology Journal (2020), 4(2): 675-687
...id using Real Time Polymerase Chain Reaction (RT-PCR), for early detection and treatments evaluation. In this review, we comprehensively summarized the COVID-19 epidemiology, pathogenesis and diagnosis, using suitable literatures obtained from reliable sources.

...

Mastooreh Doustdar1*, Seyed Ahmed Reza Hashemi2, Asadullah Ali Muhammad3 and Maryam Forouzad1

Shahzadi Sarrah Atique and Ishrat Aziz* 

...ied as the predominant parasites. The prevalence of Ascaridia galli was highest in Grey Parrots (21.4%), followed by Rump Parrots (21.4%), Alexandrine Parrots (14.3%), Sun Conures (10.0%), Indian Ringneck Parrots (10.0%), and Senegal Parrots (8.3%). No Ascaridia galli infections were detected in Cockatiels, Lovebirds, and Australian Budgerigars. The prevalence of Ascaridia platyceri was highest in Grey Parrots (50.0%), followed by Senegal Parrots (41.7%), Rump...
Sherien E. Sobhy1*; Dalia G. Aseel1*; Essam-Eldeen M. Abo-Kassem2; Nasser A. Sewelam2; Khalil M. Saad-
Allah2; Marwa A. Samy1; Elsayed E. Hafez1
... abiotic stress factors drastically limit plant growth and productivity through
changing the physiological, biochemical, and cellular processes. In this study, 100 mM of lead
(Pb) was used as an abiotic stress source, while Fusarium graminearum represented a biotic
one on wheat plant. Compared to the control, Pb treatment and F. graminearum inoculation
led to remarkable reductions in the wheat seedlings leaf area...

Anjana Suresh*; Grasian Immanuel

...ds, and sea
grasses, serve as the primary sources of antifouling substances and exhibit antimicrobial;
antibacterial, and antifouling activity. During the screening of antifouling compounds; these
marine microorganisms displayed antifouling ability against the macro and micro-foulers. This
review aimed to focus on the improvements in the antifouling abilities of the natural products
derived from marin...

Ram Bahadur Khadka1*; Khimdhoj Karki1; Gautam Prasad Chaudhary2; Jitendra Pandey3

...hase and subsequent skin rash. Originating in 1959 following
a monkey outbreak in Copenhagen's research institute; the initial human case was documented
in 1970 in the Democratic Republic of Congo. The virus subsequently dispersed globally;
impacting several nations such as UK, USA, Israel, and Singapore. Thus, in addition to the
healthcare infrastructure, combating monkeypox i...

Abdur Rauf1, Farooq Jan1*, Muhammad Yasin2, Muhammad Qayash3, Muhammad Luqman1, Kashif Hayat4, Fayaz Asad5, Ikramullah Khan1 and Muhammad Khalid6 

...present (cal.yrs.BP). A drastic decrease in the abundance of Conifers coupled with the simultaneous spread of different herb species, belonging to Poaceae, Cyperaceae, and Amaranthaceae families, was found from 500 back till 900 cal. yrs. BP. Further back in the late Holocene period from 900 to 2000 cal. yrs. BP, herbs belonging to Poaceae, Cyperaceae, and Amaranthaceae dominated these mountains with a little cover of Conifers represented by Taxus and Picea. B...

 

Abeer F. Ahmad*; Heba A. Shehta

Novel Research in Microbiology Journal (2020), 4(3): 825-844
...igate the benefits of ultrasonic method of extraction compared to maceration method, on intensifying the phytochemicals, antimicrobial, and cytotoxicity activities of Eruca sativa leaves and sprouts ethanolic extracts. The ultrasonic treatments of E. sativa leaves and sprout, were tested after 10, 20 and 30 min., whereas, maceration treatments of E. sativa leaves and sprout, were considered after 72 h. Results of Gas Chromat...

 

Dhurva Prasad Gauchan1*; Ashok Kumar Bhattarai2; Shishir Pandey1; Sunil Bhandari1

Novel Research in Microbiology Journal (2020), 4(4): 921-938
...revealed promising mycoparasitic activity. Three isolates (MUSH, BIOC and V3F) showed mycelial growth inhibition in the range of 33-77%, compared to the control plate (without isolates). With respect to isolate MUSH, a significantly higher (P< 0.05) dry biomass weight (g) was obtained at pH 7 (0.66 ± 0.05) and pH 6 (0.55 ± 0.05), than at pH 3, pH 4 and pH 5. Similarly, higher biomass significance (P< 0.001) was obtained in yeast mannitol br...

 

Gehendra Adhikari

Novel Research in Microbiology Journal (2020), 4(5): 955-967
...ding the Real-time polymerase chain reaction (RT-PCR), serological diagnosis, imaging technology etc. Up to the 31th August, 2020, there is no specific therapeutics or vaccines to control this viral infection. So, COVID-19 is posing a great threat for the global public health. The aims of this review were to highlight the current status of COVID-19 worldwide, and to give short notes about its possible prevention and treatment.

...

 

Shimaa, A. Abdel Salam1; Raghda, Hager2*

Novel Research in Microbiology Journal (2020), 4(5): 968-978
...tion, conventional Polymerase chain reaction (PCR) was carried out for detection of mcr-1 gene among the colistin GNB resistant isolates. Most of the GNB isolates (60 %) were recovered from blood samples. Klebsiella pneumoniae (K. pneumoniae) was the most common isolated bacterium; that was represented by 24 isolates (68%). Out of the 35 GNB, only five isolates (14.3 %) were resistant to colistin by E-test, with MIC >256 𝜇g/ ml. The mcr-1 gene was detect...

Bijay Kumar Shrestha*; Jenish Shakya; Manita Tumbahangphe; Bidhya Dhungana; Romika Shrestha; Jyoti Limbu

Novel Research in Microbiology Journal (2020), 4(6): 1015-1028
...fatigue. Real time-Polymerase chain reaction (RT- PCR) and Radiological methods such as Computerized Tomography of chest (CT-scan) are the most preferred diagnostic tools. In fact, the CT-scan of chest is considered to be most sensitive, accurate and a rapid diagnostic tool to remove false negative results, and hence stands to be an efficient diagnostic tool for confirming Corona Virus Disease-19 (COVID-19) infection. Therefore, RT-PCR along with CT-scan repor...

 

Hala, R. Ahmed1; Reham, A. Ibrahem1*; Rehab, M. Abd El-Baky1,2; Helal, F. Hetta3; Amr, M. Elsayed4; Nancy, G. F. M. Waly1

Novel Research in Microbiology Journal (2021), 5(1): 1118-1131
...ing; Alanine aminotransferase (ALT), prothrombin activity and platelet count. In addition to assessing if there are any risk factors associated with the population group, sex, age and other factors. About 35 blood samples were collected from hepatitis C patients randomly selected from the outpatient clinic at the Viral Hepatitis Management Center, Minia governorate, Egypt; including males and females of different ages. Viral load was determined using Real-time...

Rasha M. Elnagar

Novel Research in Microbiology Journal (2021), 5(2): 1194-1213
...test and multiplex Polymerase chain reaction (PCR), respectively. Continuous screening of the bacterial antimicrobial susceptibility at local level and rational use of the antibacterial agents; is essential to decrease the emergence and spread of resistant bacterial pathogens.

...

Omnia A. Eltantawy1*; Amany M. Kamal2; Lamyaa E. Allam3; Nadia M. Elsheshtawy2

Novel Research in Microbiology Journal (2021), 5(3): 1227-1240
...ng time consuming. Polymerase chain reaction (PCR) is a rapid diagnostic tool that helps in saving the patients’ life. This study aimed to investigate the feasibility of multiplex PCR in early diagnosis of IE compared to the conventional blood culture, and to evaluate its impact on IE diagnosis in cases of negative blood cultures. The current study was conducted on 30 patients admitted to the Cardiology Department, Faculty of Medicine, Ain Shams Hospital...

Noha M. Mahmoud1*; Samah S. El-Kazzaz1

Novel Research in Microbiology Journal (2021), 5(6): 1415-1430
...reened through the Polymerase chain reaction (PCR) for the existence of mcr-1 and mcr-2 genes. The fecal carriage of Col-R among the studied patients was 16.8 %. About 72 Col-R bacterial isolates were recovered. Col-R Enterobacteriaceae were predominant and were detected in 89.7 % of the bacterial isolates. Using the BMD, Col-R was confirmed and most of the isolates showed low resistance MIC titer (4 μg/ ml; 55.7 %). In addition, mcr-1 gene was the most fre...

 

Salwa Mahmoud Masoud1; Rehab Mahmoud Abd El-Baky1,2; Sherine A. Aly3; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(2): 1543-1556
...g the conventional polymerase chain reaction (PCR). High prevalence of ESBLs producers (61.6 %) was detected, whereas ESBLs and MBLs production was significantly associated with high multiple antimicrobial resistance index (MARI). The bla-TEM was the most prevalent genotype (94.6 %), while the prevalence of bla-NDM and bla-IMP was 45.9 % and 40.5 %, respectively. Imipenem and amikacin were the most effective antibacterial antibiotics. The current results showe...

 

Soumya Nigam1; Urvashi Vijay2*; Bhumandeep Kour3

Novel Research in Microbiology Journal (2022), 6(3): 1601-1613
...t tests, Real-time polymerase chain reaction (RT-PCR) assays are the molecular tests of choice for the diagnosis of COVID-19. The remaining direct tests include GeneXpert and TrueNAT assays. In the indirect testing's; antigen-antibody-based techniques are recommended for surveillance of the disease, which may help to formulate the control measures. These tests not only help in assessing the disease severity, but also they benefit in evaluating the prognosis an...

 

Fatma Ahmed Abdel Aziz1; Gamal Fadl Mahmoud Gad1; Ahmed Mohamed Kamal El Shafei2; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(5): 1725-1741
... were MR-CoNS. The Polymerase chain reaction (PCR) technique was used to explore the presence of several bacterial pathogenicity genes, including MecA, PVL, icaA, icaD, and Hla in the MRSA and in MR- CoNS. Results of the PCR revealed that all MRSA and MR-CoNS had MecA, icaA, and icaD genes, whereas 28.9 % of the MRSA had PVL and Hla. However, no isolate of MR-CoNS recorded the presence of the PVL or HLa genes. This study showed that prevalence of the bacterial...

 

Amira H. El-Ashry1*; Rasha H. El-Mahdy1; Mohammad A. Gaballah2; Rania Talaat3

Novel Research in Microbiology Journal (2022), 6(6): 1768-1782
... using the E-test. Polymerase Chain Reaction (PCR) was used to test the genes for aminoglycoside modifying enzymes (AMEs), PVL, and SCCmec types of CA-MRSA isolates. A total of 29 isolates of CA-MRSA were obtained from the skin lesions of 100 patients, and a high prevalence of gentamicin resistance (79.3 %) was detected among these isolates. The most predominant AME gene among the gentamicin resistant isolates was aac(6′)-Ie-aph(2′)- Ia. However, t...

 

Heba Ahmed Mohamed1*; Gamal Fadl Mahmoud Gad1; Mona Fattouh Mohamed2; Hend Harby Ahmed3; Ameer Effat Elfarash4; Nahed Fathallah Fahmy2

Novel Research in Microbiology Journal (2022), 6(6): 1801-1820
...tional methods and Polymerase Chain Reaction (PCR). Antibiotic sensitivity testing was carried out using the Disk diffusion method, followed by PCR testing of the common carbapenemase-encoding genes, including OXA-51, OXA-58, KPC, GES, IMP, NDM, VIM, SIM, and GIM. Genotyping was performed using the Enterobacterial Repetitive Intergenic Consensus-Polymerase chain reaction (ERIC-PCR). About 85 % of A. baumannii strains were mu...

 

Gehad M. Mohamed1*; Ahmed B. Barakat1; Marwa M. Gado1; Fatma M. Abdallah2

Novel Research in Microbiology Journal (2024), 8(1): 2320-2338
...erse transcriptase-polymerase chain reaction amplification (RT-PCR) of NS5A and NS5B genes, partially sequenced by the Sanger method, and then analyzed phylogenetically to determine their genetic subtypes and RASs. Finally, SVR was gained in all but two patients who were experiencing VR that carried natural NS5A-RASs a...

 

Mohammed Ajdig1,2; Bahia Rached2,3; Ahlam Mbarki1,2; Taha Chouati2,4; Chouhra Talbi1; Elmostafa El Fahime2,4; Marouane Melloul1,2*

Novel Research in Microbiology Journal (2024), 8(3): 2414-2434
...hat rpoB gene (RNA polymerase, subunit beta) had multiple polymorphic sites that were bordered by conserved sequences. Furthermore, the phylogenetic analysis based on rpoB had identified clusters indicating distinct phylogenetic relationships between B. paralicheniformis and B. licheniformis, and successfully differentiated the two species from a pool of 90 strains. The rpoB partial sequence proved to be effective for accurate species discrimination.

...

 

Simiat O. Jimoh1*; Faizah R. Adebowale2; Kifayat O. Asafa-Adedimeji2, Ramat B. Badmos-Oladapo2; Taiwo A. Sorunke1

Novel Research in Microbiology Journal (2024), 8(3): 2452-2468
...3 U/ ml); glycosyltransferase (9.68± 0.53 U/ ml), phosphomannomutase (266.09± 0.16 U/ ml), mannose phosphate isomerase (95.87± 0.51 U/ ml), alginate lyase (24.50± 0.95 U/ ml), and mannuronan epimerase (49.93± 0.82 U/ ml). In this study, the expression of alginate-modifying genes such as alginate lyase and GDP-Mannose dehydrogenase amplicons of Azotobacter...

 

Hend M. Radwan; Nagwan G. El Menofy*; Sahar M.R. Radwan

Novel Research in Microbiology Journal (2024), 8(4): 2510-2525
...clude quantitative polymerase chain reaction (PCR) and whole genome sequencing (WGS). Metagenomic WGS sequencing provides more extensive genomic data and taxonomic classification than quantitative PCR, as it makes sequencing for the entire genome of microorganisms. The objectives of this review were to demonstrate the primary mechanisms through which bacteria develop resistance to antimicrobials in water, and investigate the impact of hospital effluent water o...

 Maria R. Boushra1*; Noha A. Hassuna2; Gamal F.M. Gad1; Reham A. Ibrahem1; Nancy G.F.M. Waly1

Novel Research in Microbiology Journal (2024), 8(4): 2526-2541
...ere detected using polymerase chain reaction (PCR). Antibiotic sensitivity testing was applied on 93 clinical isolates of P. aeruginosa. The highest rate of resistance was recorded against cefepime and ceftazidime (94.6 % each), while 35.5 % of the examined strains exhibited resistance to minimally one of the evaluated aminoglycoside antibiotics. Furthermore, 49.5 % of isolates were multidrug- resistant (MDR). After CCCP addition, 24.2 % of the resistant isola...

 

Souad Oirdi Zahir1,2; Mounia El Khadir2,3; Dafr-Allah Benajah1,4; Sidi Adil Ibrahimi1,4; Laila Chbani5; Mohamed El Abkari1,4; Bahia Bennani1,2*

Novel Research in Microbiology Journal (2024), 8(4): 2542-2554
...nd used to develop polymerase chain reaction coupled with a high-resolution melting technique (PCR-HRM). Then, this method was applied on 233 gastric H. pylori positive samples. The obtained results showed that the developed PCR-HRM technique allowed specific identification of clarithromycin resistant and heteroresistant H. pylori samples, even if the ratio of resistant/ sensitive samples was low. In this series, the detected rate of H. pylori clarithromycin r...

 

Belal Natey1; Ahmed M.M.A. Kasem1; Younes M. Rashad2*; Nageh Fathy Abo-Dahab1

Novel Research in Microbiology Journal (2024), 8(6): 2712-2733
...) has the greatest mycoparasitic level. Moreover, this isolate showed high in vitro inhibitory effect on S. cepivora BYAN1 growth by the production of both volatile and nonvolatile antifungal metabolites, recording inhibition of 74.32 % and 71.68 %, respectively. In the greenhouse experiment, T. afroharzianum B3R12 culture filtrate led to complete reduction in disease severity in the pretreated onion plants. In addition, pretreating onion plants with T. afroha...

Linda Herlina*, Anita Fitriani, Marina Sulistyati, Khansa Nurul Salsabilah, Achmad Firman

...policymakers focus on infrastructure and product distribution support for intensive farming. This research underscores the strategic importance of targeted interventions to improve profitability and productivity, offering a replicable framework for sustainable rural agribusiness development. However, this study is limited by its geographical focus on Indramayu District, which may affect the generalizability of findings to other regions with different environme...

Tesfaye Edjem1,2, Yisehak Kechero2*, Asrat Guja2

...commercial feed, poor infrastructure, and insufficient extension services hindered progress. The findings underscore the need for policies that enhance feed security, infrastructure, and market access while integrating indigenous knowledge with modern techniques. Future research should focus on developing sustainable fattening models and scaling up best practices to improve livelihoods and meet market demands. This study con...
Ahmed Guerfi1, Mohcen Menaa2*, Kaouther Guellati2, Lamia Boutabia1
Salah Telailia1, Moussa Houhamdi3, Rafik Boukhris1 and Mohamed Cherif Maazi2
...ich ecosystems in Souk Ahras region. These complex landscapes are typically considered vulnerable by intensive land use and human activities, which related to: illegal cuttings, overgrazing, and other anthropological impacts. Protecting and helping the rehabilitation of forest areas are essential for sustaining the integrity of these forest habitats. In this study, non-parametric multivariate methods were used to understand how a particular bird species respon...
Gerardo J. Cuenca-Nevárez1,2* and Juan Carlos Menjivar-Flores2,3
...ultivated with tropical grasses. In this investigation the Nm of 35 farms (depth 0.20m) of the North zone of Manabí was analyzed, integrating them with certain physicochemical properties and as reference method of the Nm was worked from the data obtained by the Walkley-Black indicator (WB). The Illinois Soil Nitrogen Test (ISNT) and Direct Steam Distillation (DSD) indicators were strongly correlated with each other (R2 = 0.92), while correlat...

Edy Rianto1*, Vita Restitrisnani1, Sutaryo Sutaryo1, Sri Mawati1, Agung Purnomoadi1, Endang Purbowati1, Retno Adiwinarti1, Muhammad Hesa Karim1, Putty Kinanti Anif Machfiroh1, Niar Ulfa1, Agnes Ragil Mustikasari1, Dwi Wahyu Setiawan1, Farkhan Farkhan1, Marcelinus Dwi Septian1, Nadlirotun Luthfi2

... rate were collected by crass-sectional comparison method. The data obtained were processed by statistical procedures and interpretated descriptively and quantitatively. The results showed that the majority of buffalo farmers were working as crop farmers. They were in productive working age with elementary school educated, having more than 10 years buffalo farming experience. Fifty two percent of the farmers had less than 3 animal units (AU) buffaloes. They sp...

Hamza Iftikhar1, Ranra Jalal2, Mansoor Ali Shah1, Syed Anas Shah Bacha1, Amjid Ali1 and Syed Majid Rasheed1*

...oney bee species. In contrast, the sugar concentration of A. mellifera pollen was higher than that of A. cerana in the Langstroth hive and A. cerana in the traditional mud hive when the three glucose-D standards were used to compare them to each other. Thus, it can be concluded that A. cerana in traditional mud hive shows better foraging performance as compare to A. mellifera and A. cerana in Langstroth hive.

...

Mahfouz M.M. Abd-Elgawad

...ts of ticks in infested grasslands/pastures. Moreover, sophisticated techniques can optimize their efficacy against ticks on the infected animal skins. They use “smart sprayer” to remotely manage ticks on animals, a sprayable gel to protect the nematodes on cowhides from ultraviolet radiation/desiccation, or applying proper oil emulsion of EPNs to prolong their efficacy. Other discussed features to improve EPN efficacy against ticks engage EPN deli...

Merry Muspita Dyah Utami*, Aryanti Candra Dewi, Rosa Tri Hertamawati, Dillenia Jasmine, Nala Wafia, Jini Saputri, Kornelius Hangga Septiyanto

... and whole fruit, in contrast, the ash (36.67%), fiber (37.67%), carbohydrate (72.51%), polyphenols (12.34 mg/g), flavonoid (5.57 mg/g), tannins (243 mg/g), and antioxidant (42.03%) were significantly higher (p≤0.05) than other parts of pomegranate. Pomegranate peel ethanol extract has a higher percentage of volatile compounds 2-furan carboxaldehyde5 (34,34%) and 2-Furancarboxaldehyde (4,82%) as antimicrobial agents and anti-inflammatory, and 4H-pyran-4-one...

Sarah Fajriannisa1, Achadiyani2, Shafia Khairani1,2*

...ed 11 types of wounds: abrasion, chop, gunshot, hematoma, therapeutic, and laceration wounds. The instruments responsible for these wounds included blunt-force objects, sharp-force instruments, and firearms. The most common physical trauma injuries were mechanical in nature, with gunshot wounds caused by air rifles (5/11) and hematoma abrasions from blunt objects (5/11). The most frequently abused parts of the body are the l...

Ikram-ul-Haq1, Muhammad Huzaifa1*, Muhammad Zeeshan Majeed2, Abdul Hannan Afzal1, Iqra Bibi1, Tashfeen Fatima1, Tayyaba Batool1 and Mudassar Nawaz1

... justify;">Cauliflower (Brassica oleracea L.) is one of the major cruciferous crops in Pakistan. It contributes significantly in the food security of country. This study aimed to evaluate different commercially grown cauliflower cultivars including three hybrid and two non-hybrid ones at seedling stage to assess their genetic variability and association of plant characters. The experiment was conducted in pots and 40 days-old healthy seedlings were selected fo...

Israa Kareem Abdulhussein Al-Kanani and Harith Mahmood Azeez Al-Tamimi*

...of the growth regulator Brassinolide at three levels (0, 0.3, and 0.6 mg/L) and the addition of HumZinc to the soil at three different levels (0, 0.5, and 1 g/L) with the purpose of improving the nutritional and mineral seedlings’ contents. The results showed that the Blood variety had all nutritional contents higher than the Navel variety.The treatment with Brassinolide at 0.6 mg/L or the application of HumZinc at 1 g...

Kamal Hachour1,2,3*, Noura Talmat-Chaouchi1,2 and Riadh Moulaï1

...lduck Tadorna tadorna, Eurasian wigeon Mareca penelope and Eurasian teal A. crecca. The species that have adapted and became resident at the Taksebt Dam include: Mallard A. platyrhynchos, Common moorhen Gallinula chloropus and Great crested grebe Podiceps cristatus. The other species use the dam for feeding and/or resting. 

...

Zheng Han1, Junbo Liu2, Jingyao Luan2, Changlong Gao2, Yufeng Tai2, He Liu2, Saipeng Zhang2, Guanqiang Zhai2, Xi Yang1,3, Haitao Wang1,4*

... lines and associated infrastructure are expanding significantly worldwide. Though power lines are often considered to negatively affect bird populations due to electric collision and electrocution, pylons may serve as artificial perches, roosting sites, or nesting locations for various bird species. In this study, we first examined differences in surrounding habitat characteristics of occupied pylons among bird species in Baicheng City, northeastern China. Th...
Muhammad Azhar1, Muhammad Hassan Saleem1*, Muhammad Ijaz1, Ayesha Safdar2 and Kamran Ashraf3
...oological gardens. Hemoparasitic infections particularly theileriosis, transmitted by ticks, are one of the numerous recognized causes of their mortalities. To the best of our knowledge, no research has been done so far on the sero-prevalence and identification of associated risk factors for theileriosis in captive cervid and antelope in our study area. In the current study, the captive endemic species like Axis porcinus, Antelope cervicapra, Gazelle g. bennet...

Alfinira Sekar Rosiyanti1, Muhammad Abrar Zulkarnain2, Lovita Adriani3*, Andi Mushawwir3

...hens on that day. In contrast, egg weight was determined by weighing the number of eggs produced by each experimental unit. The results indicated that the administration of probiotic yogurt did not significantly affect (P>0.05) the feed conversion ratio (FCR), hen-day production (HDP), egg weight, or consumption in laying hens infected with Salmonella typhimurium.
 
Keywords | Probiotics, Yogurt, Laying hens, Salmonella typhimur...

Zaid Khalid Alani1*, Saaba Muhsen Farhan2, Shahad Abdullah Shwan3, Atheer Kareem Kadhim4

...ssential intracellular parasite responsible for causing toxoplasmosis infections in both humans and animals, which can result in a wide range of clinical signs. In this study, a random blood sample of 165 pregnant women was used for serological testing and molecular analysis. Additionally, 100 serum samples from small ruminants (sheep and goats) were collected from slaughterhouses during the same study period. The prevalence rate in women varied by age categor...

Fahrul Ilham1, Sahmin Noholo2, Haris Singgili3, Fahrudin Zain Olilingo4*

...he lack of supporting infrastructure, such as livestock health testing laboratories and transportation for cattle. The difference between beef production and consumption in Gorontalo is 1,054.4 tons. This difference can be used as a local consumption reserve and some can be sent to the IKN (New Capital City). The most effective and sustainable strategy for optimizing the beef supply chain in Gorontalo was a turnaround strategy, which included financing and inv...
Intan Noor Aina Kamaruzaman1*, Siew Zee Ong2, Iman Natasha Sofea Jafri2, Dayangku Umi Aqilah Pengiran-Isa2, Mohamad Sabri Abdul-Rahman3, Mohd Farhan Hanif Reduan2, Thilini Nisansala1, Soon Heng Goh1, Siti Nur Haslina Mamat2, C.W. Salma C.W. Zalati3, Sazaly AbuBakar4 and Shih Keng Loong4*
...ere tested using a polymerase chain reaction (PCR) assay. From the results, thirteen samples (n=13; 26%) were found to be positive for the 16S rRNA gene. DNA sequencing of the positive samples revealed the presence of Leptospira borgpetersenii (n=11) and Leptospira interrogans (n=1), which are known to be pathogenic Leptospira species in cattle and humans. One sample cannot be sequenced due to poor yield and quality. Furthermore, the kidneys that were PCR-posi...

Ruth Dameria Haloho1*, Marsudi1, Siti Nuraliah1, Agus Setiadi2, Edy Rianto2, Nadlirotun Luthfi3, Muh Munadi4

...ty for buffalo based on grass production in West Sulawesi. The data collection method in this study used primary and secondary data. Primary data was carried out by field observations, direct measurements and interviewing respondents. Secondary data was obtained from information from Central Bureau of Statistics. The forage samples were taken from several regencies in West Sulawesi province. Feed samples were analysed proximately to determine nutrient levels i...

Anguara Khatun1*, Ankon Lahiry2, Nusrat Jahan Nishat1, Maksuda Begum3, Bibek Chandra Roy4, Shubash Chandra Das1

...). Aspartate aminotransferase enzyme levels were significantly (P<0.05) higher in the control group but lower in the oregano group. The herbs supplemented groups had a better benefit-cost ratio. It was summarised that the potential use of powder extract of herbs in broiler diet improved growth performance, meat quality and reduced cholesterol and triglyceride levels by maintaining good liver condition. So, this powder of herbs may be used as an alternative ...

Nguyen Hai Quan, Le Duc Thao, Nguyen Van Chao*

...ds | Alanine aminotransferase, Herbal extract, E. coli, Chicken, Salmonella, Hematological indices
...

Dilawar Jan1*, Muhammad Farooq2, Lal Badshah3, Mehboob Khan4, Salim Saifullah2 and Sanam Zarif2

...ies apiece, followed by Brassicaceae, Euphorbiaceae, Fabaceae, and Rosaceae with five each. Less than five species were found in each of the other families. According to life forms, the two most prevalent life forms were Microphanerophytes, with 23 species (17.69%) and Therophytes, with 66 species (50.76%). The remaining living forms were 16 species of Chamaephytes (12.30%), 11 species of Hemicryptophytes (8.46%), 8 species of Nannophanerophytes (6.15%), and 6...

Safa T. Whaeeb1*, Zeid Alsadoon2, Ali Hussein Fadhil3 Hayder M. Mohammed4

...besia bovis (B. bovis) parasites and Bovine Aorta Endothelial Cells (BAECs), while identifying potential molecular and proteomic changes post-invasion. BAECs were cultured for seven days under constant monitoring. Isolated B. bovis parasites were cultivated and subsequently introduced to BAECs. Post-invasion changes were observed using microscopy, qPCR, and RNA sequencing, with additional proteomic analysis of the cells cond...

Maytham Askar Alwan Al-shabbani1, Hawraa Nasser rufaish1, Hassan Hachim Naser2, Murtadha Abbas3*, Hazem Almhanna4

...esia species are blood parasites that commonly cause illness in both juvenile and mature animals. The primary objective of this study was to identify the specific genotypes of Theileria and Babesia species responsible for infections in cattle and sheep. Blood samples were collected from male and female cattle and sheep slaughtered at the Al-Najaf slaughterhouse. Identification of Theileria and Babesia spp. was conducted using conventional PCR, sequencing, and ...

Mashael Alhumaidi Alotaibi*

...ibitory effects of lemongrass leaves extract on the proliferation of MCF7 breast cancer cells and its underlying mechanisms. MCF7 cells were exposed to increasing concentrations of lemongrass leaves extract (0, 50, 100, 200, and 300 μg/mL) for 24 h, and cell viability was assessed using the MTT assay. The results demonstrated a concentration-dependent reduction in the survival of MCF7 cells when treated with lemong

Rini Mastuti1*, Muhammad Fuad2, Yenni Marnita3, Cut Gustiana1, Silvia Anzitha1, Muhammad Jamil1

...ious factors, such as infrastructure, knowledge and information, initial capital, challenges, and risks, as well as psychological and motivational factors. Data was collected through a survey of 100 respondents using a questionnaire. The results show that infrastructure is the most important factor influencing community interest in animal husbandry (0.277), followed by challenges and risks (0.255). Further research is needed...

Hongqi Li1 and Meidong Xu1,2*

...ll proliferation, in contrast, overexpression of TCF3 prominently accelerated ESCC cell proliferation and colony formation. Mechanistically, ACSS2 is a critical nucleocytosolic enzyme that converses acetate to acetyl-CoA, and acts as a TCF3 downstream molecule. TCF3 modulates the aggressiveness of ESCC by regulating the levels of ACSS2. In consistence, ACSS2 knockdown also attenuated ESCC colony-forming capacity and proliferation, while ACSS2 overexpression pr...

Dan Liao1, Mingchao Li2, Zijun Xiong3, Qiuming Ji4, Ying Xia5, Bing Liu6 and Xiu Gui1*

...e medication revealed a drastic increase in blood lithium C/D ratio in the calcium channel blocker (CCB) subgroup. After the treatment, the YMRS score was 7.84±0.82 in the CG and 9.12±0.89 in the HG. The total number of ARs in the HG was superior to the CG, and the occurrence of ARs in both groups was concentrated within 3-15 days, accounting for 48.6% of all ARs. Patients in the HG had higher blood lithium concentrations, slower lithium metaboli...

Haichao Wang1,2, Yi Liu1,2, Jingwen Wu1,2, Wenjing Wang1,2, Hongyi Zhang1,2* and Cunjian Yi3*

...vity of DNA methyltransferase, restore the expression of HOXA5 gene, and inhibit the proliferation and spread of cancer cells.

...

Mimi Jin*, Xiaoye Hu, Lijing Yu, Shuangli Zheng, Huishuang Huang and Fang Chen

...nalysis showed that Snodgrass, penile downward curve, scrotal dysplasia, prolonged operation time, C-reactive protein (CRP), soluble myeloid triggered receptor 1 (sTREM-1), soluble intercellular adhesion molecule-1 (sICAM-1), white blood cell (WBC) and neutrophil / lymphocyte ratio (NLR) at 24 h after operation were the risk factors for postoperative wound infection in children with hypospadias (P<0.05). ROC curve analysis showed that the ROC-AUC predicted ...

Dalal Tareq Al-Ameri1, Khalid J. Al-Hussainawy2 and Hasan Al-Khshemawee3*

...phid species and their parasitoids. The highest density of A. gossypii on a B. officinalis plant was 74.33 adults/ang2, with a significant difference from A. fabae, which reached 22.53 adults/leave. However, the lowest density of the two aphid species was 29.66 and 1.33 adults/leave, respectively. The highest parasitism rate of A. gossypii on B. officinalis and S. macrosperma plants was recorded at 74 and 23.63%, respectivel...
Diego Armando Tuárez García1, Hernán Humberto Chevez Véliz2, Luis Humberto Vásquez Cortez3,5, Kerly Estefanía Alvarado Vásquez4, Jaime Fabián Vera Chang1, Cynthia Yadira Erazo Solorzano1 and Frank Guillermo Intriago Flor6
..., often likened to fresh raspberries, makes it a promising alternative for both local consumption and export. Despite its potential, limited scientific data on Maqueño bananas produced in Ecuador has prompted this study, which aims to characterize their physical and chemical properties. This research was conducted in El Empalme and La Maná, two Ecuadorian towns, to evaluate how geographical location and post-harvest time influence fruit quality. ...

Muhammad Luqman1*, Muhammad Yaseen1, Talha Mohsin Tanvir1, Tahir Munir Butt2, Muhammad Usman1 and Abdus Salam3

...rt the development of infrastructure necessary for maintaining the quality of fresh produce during transportation. Educational programs focusing on digital literacy and online marketing strategies were recommended to help farmers adapt to new technologies. Furthermore, it was advised that continuous monitoring and regular updates of the platform be conducted to address technical issues and enhance user experience.

...

Monira Sultana1, Md. Shohel Al Faruk2*

...mp-nodes were normal. Ultrasound revealed the thickness of the wall of urinary bladder and increase hyper-tonic contents. In X-ray (Figure 4) it was seen distended urinary bladder, ureteral obstruction and vesicoureteral reflux were seen. Biochemical report (Table 2) was shows that increase the level of blood urea nitrogen (39 mg/dl) and serum creatinine (1.9 mg/dl) level. Phosphorus (6.7 mg/dl), total protein (7.9 g/dl), albumin level (3.71 g/dl) remain norma...

Yunzhi Lin1, Jing He1, Xingwei Wu1* and Qian Shi2*

...erse transcription polymerase chain reaction (RT-qPCR) was implemented to determine the expression levels of ALKBH5, Zinc finger E-box binding homeobox 1 (ZEB1), insulin-like growth factor-2 mRNA-binding protein-1 (IGF2BP1) and EMT markers. Transwell, and cholecystokinin (CCK)-8 assays were implemented to examine RPE cell migration and proliferation. RNA immunoprecipitation (RIP) assays, and Luciferase reporter and determine...

Shouyan Cao1, Aili Yan2, Wenhua Zhang3, Fangfang Li1 and Xiaoning Liu4*

...h was amplified by polymerase chain reaction (PCR). Besides, the uterine tissue samples were processed and subjected to immunohistochemistry to monitor the phosphorylation level of ERK1/2, so as to analyze the expression of decidua and villous tissue cells in cytoplasm from group A and B. The results showed that the decidua and villous tissue cells of patients with RSA were almost not expressed in the cytoplasm. Through the χ2 test, the frequency of CC gen...

Duo Yuan, Bin Shi and Yanhua Tu*

... justify;">Shengdi-cogongrass decoction (SCD) is a traditional Chinese medicine formula, mainly composed of raw Rehmannia glutinosa (RG) and lalang grass rhizome (LGR). However, little is known about the molecular pharmacological activity of Shengdi-cogongrass on blood heat psoriasis (BHP). This study aims to explore the clinical and protective efficacy of SCD on interleukin-6 (IL-6) and t...
Adham Ezz El-Regal Mahmoud1, Atef Shoukry Sadik2 and Ahmed Mahdy3*
...ble to Ribavirin. In contrast, Carvacrol and Thymoquinone showed weaker interactions. These findings suggest that Nigellidine and Nigellicine have superior potential as antiviral agents, with stronger and more diverse interactions than Ribavirin, especially in targeting PVX proteins. This study highlights the therapeutic potential of black seed compounds for antiviral drug development and provides a foundation for future experimental validation.
...

Biao Zhong1*, MengMeng Zou1, Jie Zeng1, Juan Bai2, YongJun Deng3, Xin Li4 and YongQin Wang5

...ional chemotherapy with trastuzumab combined with docetaxel (TCD), were enrolled in the study, which was conducted from January 2021 to March 2022. Patients were randomly assigned to receive combination therapy with Pyrotinib and TCD (observation group) or TCD chemotherapy (control group) in a 1:1 ratio. Changes in CEA, CA15-3, and CA125 levels at pre-treatment (T0), after 2 treatment cycles (T1), and after 4 treatment cycles (T2), as well as safety parameters...

Huifen Li*

...14, 46.6 percent), and N-ras (n=3, 10 percent). In 85% of the sample, changes were observed in RB1 or Cycline-D1. The present study provides evidence that changes of P53 gene expression and other protein indicators play an important role in creating HCC. 
...

Haixiao Zhang1, Xilong Yang2, Yinfeng Li3, Binyu Xu4, Juan Du2,5, Ronghua Wu6 and Sangsang Xiong2*

Meixiang Li, Meiyan Liu, Xuehua Sun and Juan Li*

...ed using real-time polymerase chain reaction (RT-PCR). The results showed that the expression level of miR-137 increased significantly in weeks 25, 26, 27 and 28 of pregnancy. This is despite the fact that the expression of this micro RNA did not show a significant change in the 24th week of pregnancy. The amount of miR-137 expression can be used as a biomarker to predict the stages of GDM. An increase in neonatal hyperbilirubinemia can be considered as an imp...

Zhenglei Qiao*, Shuo Liu, Shengze Wang, Ting Li and Yuxin Han

...nomes in the genus Corydoras (Callichthyidae) were determined, specifically C. hastatus and C. cruziensis. Comparative and phylogenetic analyses were conducted using our data and those of 12 other mitochondrial genomes from Corydoras. The nucleotide diversity and genetic distance among the protein-coding genes of the Corydoras mitochondrial genomes showed that the most conserved gene was C...

Pakistan Journal of Zoology

November

Pakistan J. Zool., Vol. 56

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe