Submit or Track your Manuscript LOG-IN

Lei Chen, Ling Zhu, Zhi-Wen Xu, Wan-Zhu Guo

 

Molecular Genetics of Aichivirus C (Porcine Kobuvirus) in China
...de a brief summary about molecular and epidemiology characterizations of Chinese Aichivirus C strains. Mutiple Aichivirus C strains and Aichivirus C variants are circulating in China. Recombination events were also observed in Chinese Aichivirus C strains. More further studies are needed to clarify the evolutionary features and pathogenicity of Aichivirus C.

 

...

Aradhana Chopra1, Ravi Shukla2 and Tarun Kumar Sharma2,3*

...elivery, bio-imaging and molecular therapy. In this review we have summarized recent advancements and applications of aptamers in biology.

...

Maureen McKeague1, Maria C. DeRosa2*

...anded nucleic acid-based molecular recognition elements, are generated through an in vitro evolution process called SELEX. The selection of aptamers with optimal specificity and high affinity remains a challenge, leading to the recent emergence of elegant new approaches and tools for SELEX. In this commentary, we discuss recent advancements in the selection of aptamers.

...

Nicola J. Stonehouse

...n therefore be useful as molecular tools and also as novel therapeutic agents. This commentary describes RNA aptamers selected to bind to the RNA-dependent-RNA polymerase of foot-and-mouth disease virus. The aptamers are able to inhibit the function of the enzyme both in vitro and in the context of a sub-genomic replicon and highlight the future potential of this technology in many aspects of virus research as well as in diagnostics and therapeutics.

...

Simon Mwangi Kihu1*, George Chege Gitao1, Lily Caroline Bebora1, Njenga Munene John1, Gidraph Gachunga Wairire2, Ndichu Maingi1, Raphael Githaiga Wahome1, Davis Njuguna Karanja1, Julius Otieno Oyugi3, Ernest Lutomia3

Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4

...his study was to perform molecular typing of PPRV strains that caused outbreak in Tandahimba district in 2011. A total of 17 (sheep=0, goats=17) out of 27 (sheep=3, goats=24) were positive for PPRV N gene. The nucleotide sequence and phylogenetic analysis clus- tered the PPRV from Tandahimba into lineages II and IV. The results give evidence of at least two separate introductions of PPRV into Southern Tanzania, underlining the transboundary nature of the disea...

Chun-Yi Lin1, Meng-Ling Wu2, Tang-Long Shen1, Hsin-Hung Yeh3, Ting-Hsuan Hung1*

 

...of citrus. Two multiplex molecular detection methods provide the understanding of the genetic diversities among viroid isolates and quantify viroids in citrus host. Our field survey can help clarify citrus-viroid relationships and develop proper prevention strategies in the near future.

 

...

Hai-Bo Wang, Qiu-Hua Mo, Ze Yang*

...mplification (NASBA) and molecular beacon technique. Recently there have been two major progresses in the field, in which RT-NASBA technique was applied for the detection of diarrhoea related viruses. This mini review overviewed the basic principle of RT-NASBA and discussed the significance of these new findings.

...

Ummara Waheed Khan, Raza Ahmed, Irum Shahzadi and Mohmmad Maroof Shah

Email | mmshah@ciit.net.pk

...g edge. The discovery of molecular genetics and biotechnological techniques, such as genome mapping, tissue culture, genetic transformation and in vitro regeneration offered new dimensions of research to improve important crop species including wheat. The tissue culture by itself has increased the crop improvement potential to develop new cultivars with desirable traits through somaclonal and gametoclonal selection. While successful tissue ...

Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4

...body tissue samples. The molecular characterization revealed clustering of the PPRV within lineage IV with significant substitutions in the nucleoprotein (NP) gene. Genetic variations within NP gene, and possibly in other proteins which are essentially mediating protective immunity, may explain the extreme infectious nature of the virus and its host-specific pathogenesis. Moreover, understanding the nature of such circulating field viruses is essential to unde...

Christopher U Orji1*, Ignatius O Onyeocha2, Steven S Shaida3, Peter M Dede4, Bitrus Yakubu5, Elijah E Ella6 and Pam D Luka5

 Mukhtiar Ahmed, Jana Pickova, Taufiq Ahmad, Muhammad Liaquat, Abid Farid, Muhammad Jahangir

...dation occurs by several molecular mechanisms such as generation of reactive oxygen precursors and free radicals. Oxidation affects many interactions among food constituents, leading to both desirable and undesirable products. Food lipids are the foods components that are most susceptible to oxidation, therefore oxidation reactions are one of the major sources of deterioration that occurs during manufacturing, storage, distribution and final preparation of foo...

Neha Singh and Anjana Pandey

... is possible to know the molecular profile of the cellular surface. Whole CELL SELEX is very useful in the field of diagnostics and targeted therapy and the aptamers generated can be utilized to differentiate cancerous cells from normal cells or even different types of cancerous cells, detect live pathogenic organisms, and to discover novel disease biomarkers to facilitate early detection of the disease and for therapeutic purposes.

...

 John G. Bruno and Jeffery C. Sivils

... proteins of the correct molecular weights for intact outer membrane proteins (OMPs), intimins and SLT-2. Some bands on the aptamer Western blots were shared between the “Big 6” non-O157 Shiga toxin-producing E. coli (STEC), E. coli O157 and related Gram negative bacteria. However, unrelated Gram positive bacteria exhibited very few, if any, bands in common with those identified on the E. coli Western aptamer blots, thus attesting to the specificit...

Hassan Tarik Atmaca

... on different aspects of molecular biology of the virus and to consolidate national and international strengths to eradicate the disease from the planet. This Editorial highlights recent research articles and reviews that have provided up-to-date and current research trends in the field to further facilitate disease eradication campaigns. 

...

Usman Ijaz1, Muhammad Sajid Tahir2, Khalid Abdul Majeed3*, Shahid Iqbal4, Iffat Huma5, S. Firyal6, Ijaz Ahmed7, Shahid Chohan8 and Aamir Riaz Khan9 

Paul I. Ankeli, Mashood A. Raji, Haruna M. Kazeem, Moses O. Odugbo, Nendir J. Umaru, Idowu O. Fagbamila, Livinus T. Ikpa, Obinna O. Nwankiti, Issa A. Muraina, Pam D. Luka and Nicholas D. Nwankpa

...ort of the isolation and molecular identification of Mmm from the ear canal of cattle in Nigeria. It is recommended that samples from the ear canal be considered when Mmm isolation is intended so as to improve the chance of recovery. 

...

Iqra Mahmood1, Asif Nadeem1*, Masroor Ellahi Babar2, Muhammad Muddassir Ali1, Maryam Javed1, Aisha Siddiqa1, Tanveer Hussain2 and Muhammad Tariq Pervez2

...led understanding of the molecular mechanisms underlying the host immune response to the infectious agents is necessary. Identification of the genes, and their variants, involved in innate immune responses is essential for the understanding of this inflammatory disease and to identify potential genetic markers for resistance to mastitis. This article presents a systematic integration of complex biological interactions of 226 mammary gland genes to uncover unde...

Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

...ther investigated at the molecular level.

...

Pan-pan Guo1, Wei Liu2, Yan Li2, Rui-yu Ma2, Wang Zaigui1*, Kai Zhan2*, Jun-ying Li2 and Sheng-nan Liu2 

...onsidered as a potential molecular marker for the selection of production performance-related phenotypes in local chicken breeds need to be further verified.

...

Ali Raza Awan*, Sehrish Firyal, Muhammad Tayyab, Lala Rukh, M. Zia ul Haq, Shagufta Saeed and Muhammad Wasim

...eport that lays bare the molecular classification of Pakistani wild Rose-ringed Parakeet at sub-specie level using novel Cytb gene polymorphism.

...

Süleyman Kök1*, Sertaç Atalay1, Hasan Semih Eken2 and Mustafa Savaşçi3

...ication of gene specific molecular markers in genotyping and genetic identification is of essential significance for preserving genetic diversity. The aim of this study was to reveal the genotype profile of indigenous types for TGC breed. In order to characterize TGC population, two polymorphic loci in cattle Calpain gene (CAPN1) and one polymorphic locus in Calpastatin gene CAST were studied. In order to sort the allele variants (G/C), PCR products, the ones ...

Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2

...nfluenza viruses and its molecular detections in asymptomatic commercial layers from Faisalabad district of Punjab, Pakistan. Overall 120 blood samples, 24 tissue samples from each organ (trachea, lung and intestine) were collected from the 12 commercial layer flocks selected randomly at the age of 35-50 weeks without any direct clinical manifestation of avian influenza. Serum collected from 120 birds was tested for antibodies against H9N2 by using Haemaggluti...

Jixue Hou1,2, Xueling Chen3, Jing Wang4, Hongwei Zhang2, Yu Xi2, Jie Xia2, Xinyu Peng2,* and Xiangwei Wu2,5*

...y be used to explore the molecular mechanism of post-angioplasty restenosis with lowest costing.

...

Fukuan Du1,2, Yan Li2, Zhixin Wen1, Ruguo Chen1 and Pao Xu2*

...enetic markers are ideal molecular markers for the following investigating genetic diversity, constructing genetic maps, and marker assisted selection.

...

Bahattin Cak1, Orhan Yilmaz1, Siddik Keskin2, Tahir Bayril3 and Mohammad Masood Tariq4*

...rth to 150 days. The Monomolecular, Gompertz, Richards and Three Parameter Logistic models were used. The best model was determined by considering the root mean square error, R2 % and asymptotic correlation coefficient criteria. We concluded that the Gompertz and Richards models were favourable for singletons and that the Richards model was favorable for determining twin Colored Mohair goat growth characteristics. Birth type should be considered in subsequent ...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahimand Ghada Kamal El Khalafawy2,*
Lingtong Ye1, Chao Cao1,2, Bin Tang1,2, Tuo Yao1, Ruixuan Wang1 and Jiangyong Wang1*
... combines morphology and molecular analysis of the mitochondrial cytochrome c oxidase subunit 1 (COI) gene. Adult P. websteri exhibit a high degree of morphological plasticity in the palp pigmentation pattern, the shape of the anterior edge of the prostomium, the shape of the major spines on chaetiger 5, and the shape of the pygidium. The COI gene sequence demonstrated that the intraspecific distance of P. websteri was 0.33%, whereas the interspe...
Sameera Akhtar1*, Muhammad Akram Muneer1, Khushi Muhammad1, Muhammad Yasin Tipu1, Muhammad Anees2, Imran Rashid1, Raza-ur-Rehman3 and Irshad Hussain1
...Pakistan; however, their molecular characterization is largely inadequate and requires continuous evaluation. In this study, sequencing and molecular analysis of fusion (F) and hemagglutinin (HN) genes of NDV strain isolated from an outbreak in a peacock flock was undertaken. Proteolytic cleavage site of F0 showed a cleavage motif (112RRQKR↓F117), representative of a velogenic serotype. ...
Jehangir Khan1,2*, Inamullah Khan3, Ijaz Ali2, Aqib Iqbal2 and Muhammad Salman4
...utbreaks since 2005, the molecular epidemiology in mosquito (dengue vectors) is limited. Here, we investigated the vertical transmission of dengue virus (DENV) in the Aedes mosquitoes and its (DENV) transmission through other factors mainly tyres trade. DENV was detected in Aedes aegypti (57%) and Aedes albopictus (43%) adults (n=1050) and larvae (n=550). The samples were collected from four (Shuba Bazaar, Tarnab Farm, Wazir Bagh and Hayat...
Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*
...no acids. The calculated molecular weight of crucian carp Wap65 protein (CcWap65) is 50.8kDa, containing a signal peptide cleavage site between amino acids 18 and 19. The CcWap65 is a hydrophilic protein and no trans-membrane topological proteins. The SMART analysis revealed that CcWap65 contains three hemopexin-like repeats (E-value < 0.05). The crucian carp Wap65 was mainly expressed in liver, with limited expression observed in intestine, skeletal...
Faiz Muhammad,1, 2,*, Zhang Zhi-Feng,1, Shao Ming-Yu1 and Muhammad Shafi3
... acids with an estimated molecular mass of 17.6 kDa. The LvCypA has four β- strands. Tissue distribution of the LvCypA after real time analysis revealed that expression is in order of muscle, gill, lymphoid organ and hepatopancrease. 
...
Waqar Islam*1, 2, Madiha Zaynab3, Muhammad Qasim2 and Zujian Wu1,2
...view aims to explain the molecular mechanisms involved in triggering the antiviral resistance in plants. Antiviral RNA silencing, R-gene mediated resistance and host factor related recessive resistance are categorized as most beneficial plant defense approaches used by plants. The review also briefly explains about introgression of durable resistance to generate virus resistant cultivars for economically important crops through molecul...
Mirza Imran Shahzad1,*, Anna Iqbal2, Farrah Ali1, Nuzhat Sial3, Muhammad Ashfaq4, Abul Hasanat5 and Azra Khanum6
Shahzad Ali1,*, Heinrich Neubauer2, Falk Melzer2, Iahtasham Khan1, Shamim Akhter3,Tariq Jamil2 and Sajid Umar3
Muhammad Shahid1, Iram Amin1,*, Samia Afzal1, Zareen Fatima1, Sadia Zahid1, Usman Ashraf1 and Muhammad Idrees2
...a comprehensive study at molecular level to determine the main causative serotype of 2013 DENV outbreak in Pakistan. Overall 703 serologically positive suspected patients from different major health centers of Pakistan were registered in present study of which 214 were females and 489 were male. Overall weighted prevalence of PCR positivity was 38% (268). Of the total 268 PCR positive subjects, 0.74%, 56.71%, 15.67% were positive for serotype 1, 2 and 3 respec...

Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*

...lation and compared with molecular identification of Mycoplasma infections. A total of 96 tissue samples from trachea, air sacs, lungs and oral swabs along with blood from each bird were collected and initially subjected to isolation of Mycoplasma spp. using brain heart infusion broth supplemented with horse serum. The blood was used for serum plate agglutination assay. Thereafter, the samples were subjected to genomic DNA extraction to detect Mycoplasma spp. ...
Tianzhu Chao, Huiqiang Cai, Yuxun Zhou, Kai Li* and Junhua Xiao
...ies. We investigated the molecular phylogenetics of Chinese house mice based on 466 DNA sequences from mitochondrial D-loop fragments. Our analyses revealed that Mus musculus musculus and M. m. castaneus are older colonized subspecies with broad distributions in East China, while M. m. domestics is a newly arrived subspecies currently restricted to Shanghai, indicating the elevated risk in this cosmopolitan cities. Phylogenetic analysis in...
Jun Gao1,2, Liang-Liang Yue3, Xianhuan Jiang1, Liju Ni4, Muhammad Aqeel Ashraf5, Yuxun Zhou,1 Kai Li1,* and Junhua Xiao1,*
...period. According to our molecular clock analysis, the main clades of M. fortis divergence and separated time at around 0.77±0.64 million years ago (Mya) located in the Penultimate Glaciation. Divergences within the three clades taken place during the interglacial period between the Penultimate Glaciation and the Last Glaciation. Bayesian skyline plot indicates the effective population size of M. fortis had been experiencing a downward tre...
Xiang Nong1,2,3,*, Yao-jun Yang1,2, Guang-you Yang3, Feng-zheng Chen2, Mei Tang1,2 and Gang Wang2
...arch on the insecticidal molecular mechanism of stigmasterol to lay the foundation for the development of stigmasterol as nontoxic and pollution-free pesticides that can be introduced into the environment.
...
Urooj Fatima1, Arslan Mehboob2, Muhammad Abid3, Muti-ur-rehman Khan4 and Tahir Yaqub4*

 

... pioneer research on the molecular characterization of CPVs in dogs would establish foundations to carry out effective control strategies in future.
...
Neenish Rana, Nosheen Ehsan, Awais Ihsan and Farrukh Jamil*
...e previously regarded as molecular fossils, non-functional by-products of genome evolution. However, it has been indicated by several lines of evidences that some pseudogenes are active. Using current data of NCBI we have retrieved 65 pseudogenes from the genome sequence of human pathogenic bacteria Helicobacter pylori (H. pylori) strain 26695. Computational analysis of the genome showed 6 transcriptionally active pseudogenes that can produce sta...

Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty

Recent advances in geminivirus detection and future perspectives
...) and finally the use of molecular (nucleic acid-based) techniques have revolutionized the diagnosis of plant viruses. While the technologies available to virologists have obviously become more diverse and improved, the challenges have also changed greatly.Detection of plant viruses is becoming more critical as globalization of trade,particularly in horticultural commodities increase. The potential effects of climate change have further aggravated the movement...

Shams Ur Rehman, Muhammad Arif and Abdul Mateen 

 

Soil-borne viruses in major potato growing areas of Pakistan
...%. It was concluded that molecular studies will be required to deter-mine variability among the prevalent isolates of PMTV and TRV.

 

...

A. K. Ganguly and Uma Rao

Decades of researches in biochemical and molecular nematology at IARI
...ield of biochemistry and molecular biology of plant parasitic nematodes during the early seventies of last century. The main research areas were biochemical mechanism of resistance against phytonematodes and diagnostics of economically important plant parasitic nematodes. Specific isozymes have been identified for differentiating the important root knot nematodes species of India belonging to the genus Meloiodogyne. Further, molecular<...
Sadia Munir1a, Asif Nadeem1a*, Maryam Javed1, Masroor Ellahi Babar2, Tanveer Hussain2, Wasim Shehzad1, Rajput Zahid Iqbal3 and Sidra Manzoor1 
...creening of this gene at molecular level in Sahiwal cattle of Pakistan. No work has been reported on this gene in Sahiwal cattle. In this study, a new set of single nucleotide polymorphisms (SNPs) were reported. Heterozygosity, allelic and genotypic frequencies of identified variants were also determined. Chi2 test was performed to evaluate the Hardy-Weinberg Equilibrium of each polymorphic site. Two loci were found to be in HWE. These identified al...

Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1 

...xclusively on the use of molecular tools. In this study, we analysed the G-protein-coupled chemokine receptor (GPCR) genes of two LSDV isolates from Ixodid (hard) ticks (Amblyomma hebraeum) in Egypt. Multiple alignments of the nucleotide sequences revealed that both isolates had nine nucleotide mutations in comparison with the local reference strain, LSDV-Egypt/89 Ismalia. Compared with the GPCR sequences of SPV and GPV strains, 21 nucleotide insertion and 12 ...
Wenqiao Hui1, Jishun Tang1, Dejian Zhu1, Qian Ban2* and Sheng Chen1*
... fecundity. However, the molecular mechanism of puberty onset has not been well understood. It has been demonstrated leptin act as a critical metabolic cue linking adipose and the onset of puberty. In the present study, we first assessed the morphological changes in adipose tissue at pre-puberty and puberty onset stages of goats, and then determined the role of leptin to activate signaling pathways which modulate the expression of hypothalamic genes involved i...
Sidra Manzoor1,Asif Nadeem1,*, Masroor Ellahi Babar2, Wasim Shehzad1, Abu Saeed Hashmi1, Muhammad Imran1, Tanveer Hussain2, Abdul Wajid1 and Maryam Javed1
Madiha Hashmi1, Abid Hussain1, Shafiq ur Rehman1, Farida Ahmed2, Shahbaz Aslam3,Nadeem Afzal4 and Zaigham Abbas1,*
Saba Irshad1,*, Ayesha Ashfaq1, Ammara Muazzam1 and Abida Yasmeen2
...cuma longa L. with a molecular weight of 17.3 KDa might be useful to treat patients as a considerably cheap herbal drug which can be prescribed to poor people efficiently at an affordable cost.
...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and  Kui Chen2,*
Ghulam Abbas1,Asif Nadeem1,*, Masroor Ellahi Babar2, Tanveer Hussain2, Muhammad Sajid Tahir3, Wasim Shehzad1, Rajput Zahid Iqbal3, Muhammad Tayyab1 and Maryam Javed1
...least studied species at molecular level in Pakistan. The present study was planned to investigate its molecular phylogeny and diversity analysisusing mitochondrial cytochrome b, cytochrome c and d-loop region. Samples werecollected from different localities. After DNA extraction and quantification, amplification of gene was done by polymerase chain reaction. PCR products were sequenced bi-directionally,...

Muhammad Abid1*, Tahir Yaqub2, Arslan Mehboob3 and Muhammad Zubair Shabbir4

... through serological and molecular assays. The sequence analysis of NA genes shown 99% homology with the H9N2 AIV recently isolated from Pakistan and their phylogenetic analysis revealed that all the isolates belonged to the G- lineage. Amino acid analysis of NA stalk regions of these isolates illustrated no insertion, deletion and substitutions compared to A/DK/HK/Y280/97 lineage and human isolates (A/HK/1073/99 and A/HK/1074/99). Several amino acid substitut...
Rais Ahmed1,*, Khushi Muhammad1, Masood Rabbani1 and Muhammad Sarwar Khan2
... are required to explore molecular diversity of the pathogens together with sero-conversion in animals and humans.
...
Fareeda Tasneem1, Farah Rauf Shakoori1 and Abdul Rauf Shakoori2,*

 

...aramecium species, a molecular phylogenetic analysis was performed on the basis of H4 gene sequences. A phylogenetic tree was constructed using the aligned sequences of our study with 22 entries of closely related species from GenBank Data. Highly polymorphic sites were observed in FT8 strain sequence as compared to other species. Analysis of H4 gene sequences in our study showed they are closely related and behaved as a good substitute for phylogenetic an...
Mehran Kausar1,2, Naveed Ashraf3, Farzana Hayat4, Asraf Hussain Hashmi1, Saima Siddiqi1,* and Mariam Anees2
...ncing provided a precise molecular diagnosis. Theidentification of the same variant in CTSK as identified in other families from Pakistan suggests that it is common due to a founder effect.
...
Lu Liu1, Sher Khan Panhwar2, Tianxiang Gao3, Zhiqiang Han3, Chunhou Li4, Dianrong Sun4 and Na Song1,*
...lidity of the species by molecular methods, we sequenced a fragment of the cytochrome oxidase subunit I (COI) gene of mitochondrial DNA of Liza affinis and Liza klunzingeri from coastal waters of China and Pakistan, respectively. Sequences of L. carinata were obtained from GenBank. A neighbor-joining tree showed the specimens to form a strong monophyletic group. The mean within-species genetic distances for L. affinis, L. carinat...
Fang Wang, Yong-Fang Jia, Po Wang, Qi-Yan Du and Zhong-Jie Chang*

 

.... In order to reveal the molecular mechanism by which LET caused sex reversal, juvenile carp (120dph) were exposed to 0, 5, 25, 125, and 625μg/L LET for 15 days, and the expression profiles of seven gonad differentiation related genes (Cyp19A, Cyp19B, Arα, ERα, Dax, Foxl2, Dmrt1) and gonad histological changes were examined. The results showed that LET could inhibit oocyte growth in female and promote the development of testes in males. For the ...

Rabia Tahir1*, Khushi Muhammad1, Masood Rabbani1, Muti-u-Rehman Khan2, Farah Khan1, Hassan Bin Aslam1 and Arslan Mehboob

...idences are lacking. The molecular mechanism and establishment of latent infections warrant future investigations to elucidate these discrepancies.

...
Rabia Arif*, Shahar Bano, Muhammad Ishfaq and Muhammad Saleem
...hypervariable regions as molecular markers, we show a sequence analysis of (V3, V4 and V9) hyper-variable regions of the small sub unit (SSU) of different natural strains of the Pyrenomycete, Sordaria fimicola, to examine genetic diversity. Strains were taken from two contrasting environments (Natural and Harsh) from the south facing and north facing slopes of Evolution Canyon, Israel. Sequenced amplicons were introduced to the NCBI database as a query ...
Saba Manzoor1,*, Ali Raza Awan1, Abdul Wajid1, Sehrish Firyal1, Muhammad Tayyab1, Muhammad Mansha2, Asim Khalid Mahmood3, Abu Saeed Hashmi1 and Muhammad Wasim1,*
...in order to identify the molecular targets for proper cure of this ailment.
...
Rehana Shahida1, Tasnim Farasat1, Shagufta Naz1,* and Shahjahan2
...sulin resistance and the molecular mechanisms involved in the interaction of atherosclerosis and hyperglycemia within the context of chosen pro atherogenic parameters including plasma glucose level, serum levels of insulin, IL-6, and TNF-α. Serum level of thrombomodulin was assessed as a measure of vascular damage. Different demographic parameters as age, BMI, waist /hip ratio, B.P., personal history and socioeconomic status were recorded. Fasting glucos...
Xue-yang Wang1, Shang-zhi Zhang1, Ming-hui Liu2, Dong Yu1, Yan Ma1, Dong-qiong Fei1, Hai-zhong Yu1 and Jia-ping Xu1,*
...ino acid residues with a molecular weight of approximately 71.2 kDa. BmARM-like mRNA showed highest expression in hemolymph, significantly high expression levels in 4th instar, moth, and egg, stable high expression levels in the early embryonic development, relatively high expression levels in the 1st day and 5th day of the pupa stage, and highest expression levels in the molting stage. What’s more, BmARM-like prot...
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
Amtul Jamil Sami1,*, Madeeha Khalid1, Rehman Shehzad1, Sana Mughal1 and A.R. Shakoori2 
...homogeneity and showed a molecular weight of about 30 kD. Purified placental lactogen was administered to male albino mice for up to eight weeks for growth promoting activity. Increased mammary growth was observed in test female non lactating mice, as compared to controls when placental lactogen was applied. Increase weight gain for visceral tissues like kidney, liver, muscle and lungs was also observed, as compared to control subjects. It was also recorded th...
Pei-feng Yin1,2,Xiu-xiu Li1,Qi-wei Zeng3, Cheng-chen Shen1, Le Gao1 andJian-zhang Ton2,*
...ermore, to elucidate the molecular resistance mechanism of fruit mulberry “Da10” i.e., popcorn disease, Two-dimensional electrophoresis (2-DE), matrix-assisted laser desorption/ ionisation time-of-flight tandem mass spectrometry (MALDI-TOF-TOF MS) and bioinformatics technique were used for characterize the differential expressed proteins. Almost 78 patho-stress responsive proteins which expression level more than 1.5-fold were identified, wh...
Guang-Xin E1, Yong-Ju Zhao1, Yue-Hui Ma2, Ming-Xing Chu2, Jia-Hua Zhang1, Zhong-Quan Zhao1, Hui-Jiang Gao2, Huai-Zhi Jiang3, Di Liu4, Li Liu5, Yan-Bin Zhu6, Wang-Dui Basang6, Luo-Bu Danjiu7, Tian-Wu An8, Xiao-Lin Luo8, Shi-Cheng He7 and Yong-Fu Huang1,*
...ibute to research on the molecular mechanisms of dominant follicle selection in goats. In this study, 90276370 and 115579236 clear reads in dominant and nondominant follicles of goat were generated through Illumina paired-end sequencing, and their mapping rate was 84.99% and 84.47%, respectively. A total of 12577 differentially expressed genes (DEGs) were identified, including 6009 upregulated and 6568 downregulated genes in dominant follicles compared with no...

H.I. Hosein1, Sherin Reda Rouby1*, Ahmed Menshawy1 and Ahmed E. AbdAl-Ghany2 

...cal, bacteriological and molecular basis. A total of 141 cows from brucella infected farms under quarantine of the veterinary authorities were employed. Serological examination using BPAT, RBT and CFT in 141 cows revealed 109 (77. 3), 105 (74.47) and 104 (73.76) seropositive respectively. Relative sensitivity, relative specificity, positive predictive value and negative predictive value of BPAT, RBT and CFT were estimated as, (98.04%, 76.92%, 91.74% and 93.75%...
Hafiz Muhammad Ishaq1, Muhammad Shahzad2, Xiaokang Wu3, Chaofeng Ma4 and Jiru Xu1,*
...ignificant change in the molecular characterization of gut microbiota.
...
Bian Xunguang1,2, Li Jiancheng1, Xu Chu1 and Yang Li2,3,4,*
... was consistent with the molecular expression of AR mRNA, the positive reaction in the infundibulum, isthmus and uterus is more intense, followed by the magnum, the vaginal reaction is weak. Positive responses in the sections were mainly focused on luminal epithelium, glands and vascular epithelial cells. This study revealed the molecular expression of AR and the distribution of intracellular proteins in the oviduct of the h...
Amjad Khan1,*, Muhammad Hassan Mushtaq1, Mansur ud Din Ahmad1, Jawad Nazir1, Zahida Fatima2, Asghar Khan3 and Shahid Hussain Farooqi3
...uous surveillance at the molecular level to identify circulating strains for control and prevention of future outbreaks.
...
Yunjun Yan, Zhenming Lü, Tianming Wang, Yongjiu Chen, Jingwen Yang, Baoying Guo, Lihua Jiang, Changwen Wu and Liqin Liu*
...i>. More morphologic and molecular evidences should be involved to resolve the taxonomic status of O. dollfusi in future’s studies.
...
Muhammad Abubakar,1,2,* Aamer Bin Zahur,1,3 Khalid Naeem1,3, Muhammad Azeem Khan1,3 and Subhan Qureshi
...ons in the country using molecular tools. A total of eighty-four (n = 84) PPR outbreaks were investigated during the study (2010 to 2013). The highest number of outbreaks was reported from Punjab province (n = 38) followed by Sindh (n = 21) and Khyber Pakhtunkhwa (KPK, n = 10). In 48 out of 84 outbreaks, disease occurred in goats only while 18 outbreaks affected sheep only and the remaining occurred in mixed herds. A total of 6221 animals were affected in thes...

Aqsa Waqar1, Sahir Hameed Khattak2, Sania Begum2*, Tayyaba Rehman1, Rabia1, Armghan Shehzad2, Wajya Ajmal2, Syeda Shahdana Zia2, Iqra Siddiqi2 and Ghulam Muhammad Ali2* 

...rection is the designing molecular markers for non-race-specific resistance genes. Use of molecular markers is efficient tool for screening diversity of rust genes in wheat germplasm and can facilitate the integration of multiple genes into wheat by pyramiding and transformation. This review discusses information regarding rust disease and resistance in wheat to tackle the disease through resistance breeding. 

...
Bashir Ahmad1, Muhammad Idrees1,*, Kafeel Ahmad1, Dawood Ahmad2, Sajid Ali3 and Shumaila Bashir4
...le information about the molecular characteristics of Mycobacterium tuberculosis (M. tuberculosis) strains predominant in the province. Therefore, this study was planned to study the genetic diversity in the M. tuberculosis isolates isolated from clinical samples. In the current study total 794 patients were tested for suspected tuberculosis by fluorescence microscopy and GeneXpert system during the study period (2015-2016) at the Provincial TB R...
Yanjie Guo1, Weini Wu1, Hongmei Wang2, Xiao Guo2 and Yongping Xu2,*
... the IMG, which provides molecular evidence for the study of immune and neuro-modulation in the female reproductive system.
...

Iracema Nunes de Barros1,2, Luciane Dubina Pinto3, Rosely Bianca dos Santos Kuroda1, Sheila Oliveira de Souza Silva1, Leonardo José Richtzenhain1,2, Cláudio Wageck Canal3 and Paulo Eduardo Brandão1,2* 

...mited information on the molecular diversity of CCoV in many parts of the world. In this study, canine fecal samples from diverse States of Brazil were screened by PCRs for CCoV and positive samples were subjected to partial sequencing for the membrane (M), spike (S), nucleocapsid (N) and non-structural protein 3b genes. Out of the samples collected, 40.17% were positive for CCoV; 57.45% of CCoV-infected animals showed enteritis and most of these (76%) were yo...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...as designed to undertake molecular characterization of an Infectious bronchitis virus (IBV) recovered from a suspected case of avian infectious bronchitis from commercial poultry. Initially the isolated IB-virus was characterized by RFLP using enzymes Alu I, Hae III, BstYI and XcmI. On the basis of its distinct RFLP pattern from other known IBV vaccine strains, the isolate was named as KU145467_NARC/786_Pakistan_2013 (also named as Pak-786) was subjected to Sp...
Haixia Liu, Yuwei Ye, Yang Li, Xiaolin Liu, Dongmei Xiong* and Lixin Wang
...t some loci. Analysis of molecular variance (AMOVA) revealed that relatively little (11.02%) genetic diversity came from individual among population. In contrast, the majority of diversity (88.98%) occurred among individual within a population. Results from Nei’s genetic distance indicated that the YX and TB populations were grouped in one cluster, which was clustered with the ZZ population, the LX population was grouped in a separated cluster. Low genet...

 Tasawar Sultana*, Farah Deeba* and S.M. Saqlan Naqvi*

HIGH-THROUGHPUT AGROBACTERIUM-MEDIATED TRANSFORMATION OF MEDICAGO TRUNCATULA IN COMPARISON TO TWO EXPRESSION VECTORS
...a model legume plant for molecular analysis resulted in the development of efficient Agrobacterium-mediated transformation protocols. In current study, M. truncatula transformed plants expressing OsRGLP1 were obtained through GATEWAY technology using pGOsRGLP1 (pH7WG2.0::OsRGLP1). The transformation efficiency of this vector was compared with expression vector from pCAMBIA series over-expressing same gene (pCOsRGLP1). A lower number of explants generated hygro...
Yanling Xia1,2, Heping Li2, Yuntao Liang2, Jichen Zhao2, Binshan Lu2 and Di Liu1,*
...amino acids. The deduced molecular mass and isoelectric point of Vps26A protein were 38.2 kDa and 6.13, respectively. Glutamic acid had the largest proportion (10.4%) in the primary structure. Homologous sequence alignment and phylogenetic tree analysis indicated that theVps26A protein of sika deer was highly similar to that of Bos taurus. Expression analysis by real-time quantitative RT-PCR revealed that Vps26A gene had a higher expression level...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
...ys, both serological and molecular, have been developed and are applied for estimating the current status of the disease. This review article focuses on the development of different molecular diagnostic assays from conventional reverse transcriptase polymerase chain reaction to real time reverse transcriptase polymerase chain reaction and reverse transcriptase loop mediated isothermal amplification over the last decade. Thes...
Basit Zeshan1,2,*, Mushtaq A. Saleem2,Javed Iqbal Wattoo2, Mohd Mokhtar Arshad1 and Maizan Mohamed1
...in E. coli with a molecular weight of 38kDa determined through SDS-PAGE and confirmed by Western blotting. The recombinant truncated protein was then purified from the culture media. The immunogenicity of the protein was studied in an animal experiment on mice, in which mice were injected subcutaneously. These findings suggest that the truncated Sf200 expressed in the pET-32a (+) prokaryotic vector can be used as antigen to detect antib...
Wei Dang1, Ning Xu1, Wen Zhang1, Jing Gao2, Handong Fan1 and Hongliang Lu 1,*
...shock proteins and other molecular chaperones play specific physiological roles in such thermal adaptation. Here, we analyzed heat shock protein 70 (Hsp70) expression in six lizard species to investigate the variation in Hsp70 response contributing to thermal adaptation. At first, we collected three lizard species of the genus Takydromus from different geographical locations. We found that either the constitutive expression pattern in different organs o...
Jun-Ying Liu, He-He Liu*, Jie Kou, Yang-Mei Zhao, Ji-Wen Wang, Liang Li and Xiao-Hui Du
..., and the downstream molecular response in the immune system may contribute more to the TLR4 signaling cascade.
...

Osama Elshazly1, AbdelSatar Arafa1, Mohammed A. Rohaim2, Ismaeil M. Reda2 and Hussein A. Hussein2*

...as well as antigenic and molecular detection methods. Full-length hemagglutinin (HA) sequences of six representative H5N1 isolates were analysed to study their genetic evolution followed by estimation of their evolutionary rates among different virus clusters. This analysis revealed a high evolution rate for clade 2.2.1.2. Additionally, analysis of selection pressures in the HA gene revealed a positive selection pressure. Deduced amino acid analysis revealed c...
Jiji Li*, Tianyang Zu, Xiangli Dong, Xiao Yang, Wei Liu and Changwen Wu
... the gene expression and molecular characteristics of three members of the CC family of chemokines: 1) dual chemokine ligand CCL17; 2) homeostatic chemokines ligand CCL21; and 3) CCL24 in response to bacterial challenge in large yellow croaker (Larimichthys crocea). The results revealed that the immunological effect of CCLs in the croaker is weaker than that of other fish, and revealed the infectivity of the large yellow croaker. Thus, these findings co...

Sher Nawab Khan* and Ghulam Hassan 

...prerequisite for further molecular and biochemical study to explore resistance pathway. These lines could be used as a source of aphids resistance in future wheat breeding program 

...

Baharullah Khattak1*, Saifullah2, Shaukat Hussain2, Musharraf Ahmad2, Asad Ali2, Mohammad Junaid2, Ijaz Ahmad Khan3, Taj Ali Khan1 and Mubbashir Hussain1 

...isolates, was studied at molecular level by randomly amplified polymorphic DNA procedure. A selected set of three random primers was used for this purpose, which resulted in 113 bands on gel for the 15 isolates of T. harzianum. The analysis of the bi-variate data, using Unweighted Paired Groups Method Averages, divided the indigenous isolates of Trichoderma, into four well-defined clusters. These results clearly revealed that there were considerable genetic di...
Ayesha Munir, Hafiz Muhammad Umer, Anjum Nasim Sabri and Imran Sajid*
...erization along with the molecular identification by 16S rRNA gene sequencing confirmed that caries isolates are pathogenic S. mutans and soil isolates belong to the genus Streptomyces. The antibiotic resistance profile of S. mutans illustrated resistance to optochin. The antimicrobial screening of Streptomyces against S. mutans showed that these strain are the prolific producers of active agents to inhibit the growth of cari...
Farah Rauf Shakoori1,*, Anum Feroz1, Ayesha Gondal1,Sahar Akram2 and Tanzeela Riaz3
...rate metabolism and macromolecular concentrations of 4th and 6th instar larvae of a stored product pest, Trogoderma granarium. The LC50 values of λ-cyhalothrin for 4th and 6th instar larvae of Lahore population was 15.93 and 13.76ppm respectively, while 19.07 and 16.21ppm were for the 4th and 6th instar larvae of Gujranwala population, respectively. The resistance ratio ...
Musrrat Fatima, Muhammad Saad Khan, Hamid Rashid, Asim Mehmood, Sumaira Kanwal, Muhammad Asif Rasheed and Farrukh Jamil*
Abdul Wajid1,*, Asma Basharat2, Muhammad Akbar Shahid3, Sidra Tul Muntaha1, Abdul Basit4, Tanveer Hussain5, Muhammad Farooq Tahir6, Muhammad Azhar7, Masroor Ellahi Babar1 and Shafqat Fatima Rehmani2
Amna Waseem, Sikander Ali* and Syeda Wajiha Khalid
...tion method at 40 %. The molecular weight of the enzyme was found to be 33 kDa. The results showed that the enzyme produced from mutant strain gave significantly higher (p≤0.05) lipase activity than the wild-type. From the results presented in the study, it was observed that maximum lipase activity could effectively be achieved after EMS and MMS-induced mutagenesis of filamentous fungus culture used.
...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
...or the first time on the molecular identification of Mccp and Mmc, and on predominance of Mccp as etiological agent of CCPP in sheep and goats of Northern Pakistan. The results have implications in the epidemiology and vaccine strategy against CCPP infection in small ruminants in the Northern region of Pakistan and therefore, a comprehensive country wide surveillance should further investigate the overall prevalence of members of MM cluster in suspected cases ...
Rafa Almeer1,*, A. Alqarni1,2, S. Alqattan3, S. Abdi4,*, S. Alarifi1, Z.Hassan5 and A. Semlali6
...quired to understand the molecular mechanism of honey as an anticancer agent.
...

G. Venkatesan* and Amit Kumar  

...e infection using latest molecular diagnostics and effective vaccine along with anti-viral therapeutics. This short commentary deals with current knowledge and opportunities on ORFV and future challenges as control perspectives in India. 

...
Riaz Aziz Minhas1,*, Muhammad Nasim Khan1, Muhammad Siddique Awan1, Basharat Ahmad1, Syda Shaista Bibi1, Mohsin Hanif1 and Afsar Mian2
...E / primer) of different molecular weights (126-3342 bp), of which, 96 were population specific. Polymorphism was (37.71±5.29%; mean ± SE), with the highest in Muzaffarabad population (54.29%), followed by Poonch (43.67%) and Neelum (36.73%). Values of Shannon’s (I: 0.129-0.200) and Nei’s genetic diversity (He: 0.082-0.117) indices were low. Total heterozygosity (Ht: 0.144±0.007), genetic diversity within population (Hs: 0.096&...

 

Syed Aun Muhammad1, Muhammad Soaib Said2, Shams Ur Rehman2, Muhammad Dawood2, Muneer Ahmed Qazi3 and Nighat Fatima2,*
...thein B) to the NMD-1 by molecular docking. A computational ligand-target docking approach was used to analyze structural complexes of enzyme target with diaportheins. Auto Grid model showed the most energetically favorable binding mode of natural compounds to beta-lactamase. Docked energies for diaporthein A and B were -8.02 and -8.41 kcal/mol, respectively. These outcomes revealed that these ligands could be potential drugs to treat infectious diseases.
Farah Rauf Shakoori1,*, Tanzeela Riaz2, Uzma Ramzan1, Anum Feroz1 and Abdul Rauf Shakoori2,3,*
...rate metabolism and macromolecular concentrations of 4th and 6th instar larvae of a stored grain pest, Trogoderma granarium. The LC50 values of esfenvalerate for 4th and 6th instar larvae of Phosphine and deltamethrin-susceptible population was 34.29 and 28.05ppm, respectively, while 39.30 and 32.67ppm were for the 4th and 6th instar larvae of Phosphine and deltamethrin-toleran...
Jam Nazeer Ahmad1,2,*, Rashid Mushtaq1, Samina Jam Nazeer Ahmad1,2, Sumaira Maqsood3, Ishita Ahuja4 and Atle M. Bones4
...chnique was used for the molecular detection of NPV gene from native NPV diseased insect. Multiple sequence alignment and phylogenetic analysis were performed to compare SlNPV- FSD15 based on Lef-8 with other Lef-8genes sequences clearly showed that our SlNPV-FSD15 isolate belongs to Spodoptera litura associated NPVs. The biological activities of this NPV isolates were investigated under laboratory condition. The highest mortality o...
Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
...onal microbiological and molecular methods. The agar disc diffusion method was used to evaluate the antibiotic susceptibility. Virulence-associated genes were detected using PCR while association analysis was used to test the likelihood of strains carrying combinations of genes involved in toxin production and/or host immune evasion. Highest resistance was observed against beta-lactam group followed by cephalosporin, lincosamide, tetracycline, macrolides and a...
Binbin Shan, Yan Liu, Changping Yang, Shengnan Liu and Dianrong Sun*
...cellular components, and molecular functions. Moreover, 18,621 unigenes were mapped 25 different clusters of eukaryotic proteins. In addition, a total of 17,671 unigenes were classified into 311 KEGG pathways. Finally, we predicted the coding sequences of 13,072 unigenes and obtained 9,222 SSRs in the present study. The whole transcriptome is an important foundation for future genomic research on the P. penicillatus and can provide comprehensivel...
Rida Zainab1, Sana Elahi1, Afshan Kaleem2,*, Daniel C. Hoessli3, Mehwish Iqtedar2, Roheena Abdullah2, Faiza Saleem2, Shanza Khan1, Anusha Ijaz1, Shagufta Naz2 and Abdul R. Shakoori4,5,*
Lamiaa Elsayed Mokhtar Deef
...ment. The biometrics and molecular markers were used to confirm the identification of A. albiventris at the species level. In the current work 757 bp and 668 bp were identified as regions of the mitochondrial cytochrome b (Cyt b) and mitochondrial 12S rRNA genes, sequences of both genes were placed in the GenBank publication database (Accession numbers are KF783143 and KJ193305) and (Accession numbers are M95109, KF783175, AC175224 and AC160876) of Cyt ...

Yasir Ali1*, Muhammad Aslam Khan1, Muhammad Atiq1 and Muhammad Hussain2

... species using different molecular approaches. This review provides a detailed discussion of the different aspects for controlling three rust diseases caused by P. recondita Rob. exdesm f. sp. tritici , P. striiformis West. f. sp. tritici, P. graminis Pers. f. sp. tritici and the importance of race specific and non-specific rust resistance genes in in global wheat varieties. This knowledge will help as basis for plant pathologist, plant breeders and genetics t...
Muhammad Zahid1, Aneela ZameerDurrani1, Muhammad Ijaz1, KhushiMuhammad1,Muhammad Usman1,*, Muhammad Husnain1 and Nadeem Kamal2

 

Shaukat Ali1,*, Sundas Nasreen1, Sobia Safeer1, Saiqa Andleeb1, Mubashir Ejaz1, Saira Bano2, Hafiz Abdullah Shakir3

Medicinal plants as therapeutic agents for cancer treatment
...ned in the number of new molecular entities from the
medicinal industry, unique anticancer agents are being required from traditional medicines. According to recently
published data, this article reports a detailed review of ethnomedicinally important anticancerous medicinal plants. It
will provide a new way to explore the therapeutic value of plants and characterization of biologically active
compounds from them that may lead towar...
Haniya Mazhar1, Naaz Abbas2, Tehseen Zamir3, Zahid Hussain1, Syed Shahid Ali4*
...logical, biochemical and molecular characterization. Best medium for lipase production was olive oil and mustard oil cake and the best carbon sources were fructose and maltose whereas yeast extract was found to be the best nitrogen source, showing 55U/mL enzyme activity. The best inoculum size for the growth of this strain was 4-5%. Optimum pH was 8 and best temperature was 40oC for the reported strain. Addition of divalent Mg2+ and Ca

Saman Fatima* and Shazia Iram 

...fied. Both classical and molecular method was used for identification of pathogens. Under classical approach the infected sections from the skin of kinnow was utilized to grow fungal colonies on generalized media, i.e. potato dextrose agar, from which six fungal colonies were also isolated and studied further. Under molecular approach direct DNA was isolated from the infected skin of sampled fruits by using CTAB method. The ...
Aiguo Zhou1,3,4, Shaolin Xie1,4, Zhenlu Wang1, Lanfen Fan1, Yanfeng Chen2, QiaoYe1, Fang Zeng1 and Jixing Zou1,*

 

...ut not subspecies at the molecular level. Moreover, take Lateolabrax maculates and Epinephelus coioides as outgroups, molecular phylogenetic tree showed that all the haploids gather together as a branch and crossing each other. These indicated that the white type Channa argus should be regard as an albino of biocolor type.
...
Rahila Huma1,2, Tariq Mahmud1,*, Rubina Munir2, Sana Javaid Awan3,Kiran Iftikhar4 and Mufakkira-Tul-Islam5
Zhiwen Zou, Jianfei Xi, Fen Chen, Rui Xu, Tianrong Xin and Bin Xia*
...relationship and provide molecular evidence for the evolution, but also provide a better way to identify phytoseiid species in citrus.
...
Jam Nazeer Ahmad1,2,*, Muhammad Jafir1, Muhammad Wajid Javed1, Sumaira Maqsood3 and Samina J.N. Ahmad1,2,*
...s is the first report of molecular identification and DNA barcoding of Oxycarenus hyalinipennis infesting cotton from Pakistan. DCB is becoming alarming pest, so, this study will be highly helpful to observe DCB correct identification for management.
...

Rafiullah1*, Abdur Rahman2, Khalid Khan1, Anwar Ali1, Arifullah Khan2, Abdul Sajid3 and Naimatullah Khan3 

Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...siological, biochemical, molecular and genetic characteristics of the plants. As the information about the relationship between physico-morphic characteristics of commercially grown okra cultivars and resistance or susceptibility to Helicoverpa armigera is lacking, therefore, in the present study relationship between physico-morphic characteristics and resistance or susceptibility of okra cultivars to H. armigera was evaluated. The heights and st...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
...ty of two species at the molecular level, complete mitochondrial genomes of the two species were first determined. The genomes were 16,546 bp (P. orientalis) and 16,545 bp (P. vittatus) in size, respectively, which both consisted of a typical structure of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and one noncoding control region. Genomic composition, organization and gene order were similar to that obtained in most ve...
Aisha Khalid1, Muhammad Tayyab1,*, Abdual Rauf Shakoori2, Abu Saeed Hashmi1, Tahir Yaqub3, Ali Raza Awan1, Muhammad Wasim1, Sehrish Firyal1, Zaheer Hussain4 and Munir Ahmad5
...E analysis confirmed the molecular weight of recombinant protein as 39 kDa. The protein was found thermostable which retained more than 70% residual activity with an incubation of 1.67h at 90 °C in the presence of cobalt. Presence of ionic and non-ionic detergents showed an inhibitory effect on the enzyme activity. Kinetic studies of recombinant protein demonstrated the km and Vmax values of 0.22 mg/mL and 2500 µmo...
Liyan Zhang1,2, Zhidong Zhou1,3, Haiping Li1,2, Yanlong Qiao4, 5 and Yueping Zhang1,3,*
...populations. Analysis of molecular variance (AMOVA) and Fst analysis showed that genetic variation was mainly derived from within populations, and genetic divergence was very weak among populations. The complex hydrologic environment of the Taiwan Strait and its adjacent waters did not block gene flow among different populations, which indicates relatively high genetic homogeneity; thus, the populations should belong to the same fishery manag...
Doğukan Ölmez1 and Gonca Alak2,*
...rpose. Protein profiles, molecular size and distribution changes of the obtained hydrolysates were calculated using SDS-PAGE and lipid profiles were calculated using high performance thin layer chromatography (HPTLC) method. As a result of the analyses, it was observed that there were 9 protein bands in the muscle and 7 protein bands in the visceral organs, and the volume increases were observed in protein amounts in the hydrolysates depending on time. In addi...
Luo Lei1, Xingxing Deng1, Dengyue Yuan2, Zonglin Zheng1, Chengke Zhu1, Hui Luo1, Baohai Li3, Hua Ye1,* and Chaowei Zhou1,3,*
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
... and Kasur districts for molecular based confirmation of B. abortus in both sheep and goats. Brucellosis in sheep and goats is caused by B. ovis and B. melitensis, respectively but B. abortus (causative agent of bovine) may cross the species barrier to infect the small ruminants which may complicate the control measures of brucellosis because most of the control programs rely on serological screening of brucellosis rather than
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...y in silico analysis and molecular docking of variants with GTP. MutationTaster was used for functional analysis of genetic variants and three-dimensional structure of mutant proteins were built by Swiss-Model and were further subjected to structural alignment and stability studies by I-Mutant Suite and DUET server. Both variants were predicted as ‘disease causing’ and protein stability analysis revealed p.G138V to be more destabilizing variant tha...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
..., the enzyme exhibited a molecular weight of about 36 KDa. Its specific activity was 1650 U per mg of protein with about 5% glutaminase activity and no activity against D-asparagine. Optimal enzyme activity was found at 75°C and pH 9. The KM value of 5.9mM was found for L-asparagine. In silico studies have shown that the enzyme exists as a homotetramer. Molecular docking studies have revealed that Gly19...
Sumreen Hayat1,6, Muhammad Hussnain Siddique2, Bilal Aslam1, Habibullah Nadeem2, Asma Ashraf3, Muhammad Saqalein1, Mohsin Khurshid4, Naveed Shahzad5 and Saima Muzammil1,*
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
... as a protein with 47kDa molecular weight by SDS-PAGE. The optimum pH of purified polygalacturonase activity was found to be 4.5 and stable within pH range 3.5-5.5. Temperature dependent studies revealed temperature optimum of enzyme to be 40°C and stable up to 60°C. Among substrates, polygalacturonic acid was established as the best substrate for polygalacturonase showing its specificity in the hydrolysis of polysaccharide galacturonate chain. The pre...
Emel Banu Buyukunal1,*, Rojan Ibrahim Albazaz1 and Mehmet Ali Bal2,3
...yzed by conventional and molecular methods for E. coli isolation in this study. Subsequently, antimicrobial susceptibility profiles of E. coli isolates (n=71) were determined against thirteen agents; amoxicillin-clavulanic acid, piperacillin-tazobactam, ceftazidime, cefotaxime, ceftriaxone, cefpodoxime, aztreonam, ciprofloxacin, amikacin, ertapenem, imipenem, meropenem, trimethoprim-sulfamethoxazole by disk diffusion method. Double-disk synergy t...

Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4 

...etection approaches with molecular diagnostic tool. The method relies on periodically thermo cycling heating and cooling of DNA in presence of certain chemical reagents. In order to detect and differentiate parapox infections from those induced by pox virus. A new parapox specific and sensitive PCR assay based on amplification of B2L gene was applied against conserved gene of Orf virus. Crusted scraps and biopsies from different portion of skin and blood were ...
Shengjie Zhou1,2, Pengfei Wang1,2, Chao Zhao1,2, Mingjun Fu3, Jian G. Qin4, Lihua Qiu1, Zhenhua Ma1, 4,* and Maoshang Lin1
...o acids with a predicted molecular weight of 14.06 kDa and a theoretical isoelectric point of 8.73. The results of qRT-PCR showed that the highest tissue expression of L-FABP gene was observed in fish liver on 18 DPH. Along with the ontogeny of fish larvae, the expression of L-FABP gene was low at hatching, and quickly increased with the increase of fish age from 0 DPH to 4 DPH, and reached the highest level on 12 DPH. The highest expression of <...
Sun Hong1, Zhang Yifeng1, Wang Baishi2, Li Yangwei1, Xu Wenbo1, Mao Runkun1 and Wang Zhenglong1,*
...nary, physiological, and molecular basis of hypoxia-hypercapnia inmandarin voles.
...
Hayat Zada1, Ahmad-Ur-Rahman Saljoqi1,*, Ijaz Ali2, Bashir Ahmad1, Abdul Waheed Khan2 and Shabeer Ahmad2
...se results revealed that molecular variations among the population of C. pomonella might be attributed to the climatic conditions, geographical location and pest control programs.
...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and  Cheng-Kai Zhai1, *
...in rats and the possible molecular mechanisms, 40 male Sprague-Dawley rats were randomly assigned to four different diets, including reference chow diet (RCD), high fat and cholesterol diet (HFCD), city diet (CD) and compound whole-grain diet (CWD). Serum lipid profiles and glucose level were examined after 8 weeks. The molecular mechanisms underlined the effects of CWD on lipid metabolism were investigated by western blot a...
Songhao Zhang1, Yiwen Gong1, Jian Xu1, Mou Hu2, Peng Xu3 and Yanliang Jiang1,2,4,*
...2. Understanding the molecular mechanisms underlying the biological characteristics of purse red carp will advance our knowledge of the genetic differentiation between different common carp varieties caused by domestication, and accelerate the molecular selection of fish species with consumer-favored skin color and body shape.
...

Amany Adel, Wesam Mady*, Zienab Mosad, Fatema Amer, Asmaa Shaaban, Dalia Said, Marwa Ali Abdel Maged, Abdel-Satar Arafa, Mohamed Kamal Morsi, Mohamed Khalifa Hassan 

Hala Mohamed Nabil Tolba1, Naglaa Fathy Saeed Awad1*, Gamelat Kotb Farag Kotb2, Amany Adel3 

Amany Adel, Wesam Mady*, Zienab Mosaad, Fatma Amer, Asmaa Shaaban, Dalia Said, Marwa Ali, Abdel-Satar Arafa, Mohamed Kamal Morsi and Mohamed Khalifa Hassan  

Jie Zhang1,2,*, Baradi Waryani3,4 and Qihai Zhou2,*
...he genetic diversity and molecular invasive mechanism are urgently needed for both native and invasive populations. Present investigation details 12 polymorphic microsatellite loci and 12 to 26 alleles per locus denoted. Whereas, d expected and observed heterozygosity values ranged from 0.902 to 0.972 and 0.750 to 0.958, respectively. Moreover, the polymorphic information content (PIC) values ranged from 0.869 to 0.949. The cross-species amplification and appl...

Wesam Mady*, Nahed Yehia, Mohammed Hassan Elhussieny, Azhar Gaber Shalaby, Moataz Mohamed El Sayed, Neveen Rabie Bakry, Asmaa Shaaban, Abdel Satar Arafa, Afaf Abdel Baset Mahmoud and Wafaa Mohammed Hassan 

... study the Situation and molecular characterization of HPAIV (H5N8) in backyard poultry production sector in Egypt. In this study, a total of 7505 samples of tracheal swabs representing 1180 backyard poultry flocks were collected based on the surveillance conducted by the GOVS (General Organization for Veterinary Services), Egypt during the period from May 2017 to August 2018. 11 positive cases were confirmed in seven governorates with a prevalence rate of 0.9...
Tian-Yi Zhao1, Zi-Qing Liu2, Bo Yang1, Qiao Gao1, Hong-Yu Zhang1, Pei-Yu He1, Ming-Hua Duan1* and Yu-Li Yan1*
...we want to elucidate the molecular mechanism underlying the effects of APs in the recovery of anemia. Red blood cell count and hemoglobin level in peripheral blood were measured using a fully automatic blood cell counter. Flow cytometry was performed to detect the changes in red blood cell counts and number of T cells in peripheral blood and the spleen. Western blotting was performed to detect Stat5, Bcl-2, and Cyclin D1 protein expression in peripheral blood....
Yan-Bin Zhu1, Wang-Dui Basang1, Zhan-Dui Pingcuo1, Yang-Ji Cidan1, Sang Luo1, Dun-Zhu Luosang1, Yang-La Dawa1 and Guang-Xin E2,3,* 
...nowledge about different molecular genetic markers. Therefore, unexpectedly, our study indicated that the diversity of some of the populations was decreased, leaving us to improve and refine our conversional strategy. In addition, this resulted in a greater understanding of human yak phylogenetic differentiation as well as providing data support for understanding the evolution and migration of yak population in future studies.
...
Jam Nazeer Ahmad1*, Taiba Sharif3, Samina J.N. Ahmad2, Sumaira Maqsood4 and Fariha Zafar3 
...s is the first report of molecular identification and characterization of Tephritid fruit flies infesting fruits in Punjab, Pakistan. 
...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

Huma Sattar1, Sehrish Firyal1,*, Ali Raza Awan1, Habib-Ur -Rehman2, Muhammad Sajid Hasni3 and Amjad Islam Aqib4*
.... Identification of molecular marker sequences that are directly related to immunity against mastitis might be helpful for animal selection trait and prevention of this disease. The aim of the present study was to assess the effect of polymorphism in bovine tumor necrosis factor alpha (TNF-α) gene on immune function and its role in mastitis susceptibility in Pakistani Sahiwal cows. In this study, a total of 150 Sahiwal cows were selected suff...
Lin Qi, Lu Li, Danyang Chen, Mingxiao Liu, Yan Wu and Wei Hu*
...m-negative bacteria. The molecular mass and purity of this polypeptide was determined by ultra-performance liquid chromatography (UPLC) and Bruker micOTOF OllQ TOF mass spectrometry, respectively. The full amino-acid sequence of the monomericpeptide was analyzed by sequential Edman degradation using a protein/peptide sequencer. The antibacterial activity of the protein monomer in antlerplate was studied by disc diffusion method, and the antibacterial ring diam...
Shanshan Cai1, Tianxiang Gao2, Binlun Yan3, Aiyi Zhu1 and Xiumei Zhang1,2,*
...que advantages will make molecular markers as novel and highly-efficient approaches for assessment of stock enhancement.
...
Zhijun Zhong1, Rui Tu1, Xichun Wang2, Yi Geng1, Qicheng Xiao1, Yinan Tian1, Bin Wei1, Jiaming Dan1, Ya Wang1 and Guangneng Peng1,*
...onducted a comprehensive molecular, pathological, and immunohistochemical analysis to detect this pathogen in pet dogs. Molecular methods, combining three types of PCR assays, identified two strains isolated from two pet dogs as Brucella canis. Histopathological changes revealed extensive inflammation and necrosis in the liver, lung, spleen, kidney, testicle, and lymph nodes, among which changes in the spleen were the...
Zahra Eftekhar1, Morteza Naderi2,*, Mohammad Kaboli3, Hamid R. Rezaei4 and Nematollah Khorasani3
...ond to those of previous molecular and niche analyses. Our research also confirms an ideal capability of morphological approaches in species evolutionary assessments.
...
Beenish Zahid*1,2,7, Javed Iqbal Qazi2, Amir Zohaib2, Asim Aslam3, Raheela Akhter3, Haleema Sadia4, Qurat ul Ain5, Razia Sultana6, Irfan Irshad3 and Sobia Alyas7

Sibgha Noreen*, Sumrina Faiz, Muhammad Salim Akhter, Kausar Hussain Shah 

...compounds which have low molecular weight. These molecules help the plants to regulate osmotic adjustment and to enhance abiotic stress tolerance in plants. This study was aimed to examine mitigation effects of different osmoprotectants (salicylic acid, ascorbic acid, proline and their admixture) @ 200 mgL-1 on sunflower (Helianthus annuus L.) grown under saline environment (150 mM NaCl). The results showed that salinity stress (150 mM) resulted into significa...
Naila Riaz1, Hafiz Muhammad Tahir2, Muhammad Khalid Mukhtar1, Ali Hassan2, Shaukat Ali2, Shafaat Yar Khan1
...m yield. The approximate molecular weights of these selected venom fractions were determined by SDS Gel electrophoresis. The molecular weight of venom fractions of H. tamulus and A. finitimus used in the study were 36kDa and54kDa, respectively. The doses of venom fractions used during the study ranged from 10-30µg/ml. Both venom fractions significantly inhibited the activity of AChE. However, 30µg/m...
Shahid Sherzada1,2,4,*, Muhammad Naeem Khan4, Masroor Ellahi Babar2, Muhammad Idrees3, Abdul Wajid2, Muhammad Nauman Sharif3, Muhammad Shahzad Iqbal3, Iram Amin3 and Muhammad Shahid3
.../i> gene is an efficient molecular technique for the exact identification of typical fish species.
...
Syed Maaz Nadeem1*, Muti ur Rehman Khan1, Asim Aslam1, Ali Ahmad Sheikh1, Arfan Ahmad1* and Muhammad Anees2
...Pakistan; however, their molecular characterization is largely inadequate and requires continuous evaluation. In this study, sequencing and molecular analysis of specific regions overlapping VP1-VP2 and VP2-VP3 genes of CAV strain from outbreaks in broiler flock (n=45) were undertaken in the Punjab Province of Pakistan. The phylogenetic analysis clustered study strains of CAV in group II similar to those reported previously ...
Jam Nazeer Ahmad1,2*,Mujahid Manzoor1, Zubair Aslamand  Samina Jam Nazeer Ahmad1, 2
Honghua Wang1,2, Summia Perveen1,2, Shucheng Shao1,2, Kun Wang1,2 and Fei Yin1,2,*
...ified with a theoretical molecular weight of 11.53–610.90 kDa and an isoelectric point of 4.13–11.77. A total of 63.07% or 50.09% proteins were annotated by Kyoto Encyclopaedia of Genes and Genomes (KEGG) or Gene Ontology (GO) terms, respectively. These results highlight that mass material is transported and catabolised and growth- and death-related proteins are highly expressed, including a number of vesicle-mediated transport, cytoskeletal and ex...

Naglaa M. Hagag1*, Mervat E. Hamdy1, Mary A. Sargious1, Sara M. Elnomrosy1, Nahed A. Ahmed1, Ayman A. Hamed1, Ahmed R. Habashi1, Essam I. Ibrahiem1, Mahmoud A. Abdel-Hakim2 and Momtaz A. Shahein

Ahsan Anjum1, Asim Aslam1, Raheela Akhtar1, Tahir Yaqub2,  Muti-ur-Rehman Khan1, Rizwana Sultan3, Saba Usman1Aneela Zameer Durrani4 and Muhammad Usman4*
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
... goat MC1R protein has a molecular mass of 34.65 ku, an isoelectric point of 8.70, which is weakly alkaline, and contains seven transmembrane domains typical of cell membrane receptor proteins. Sequencing analysis of the black, brown and white different color MC1R genes of Nubian goats revealed that there are three SNPs in the gene sequence, which are 219, 712 and 1160, respectively. The C/T mutation did not cause amino acid mutations; base A/G mutations occur...

Anand Kushwaha, Amit Kumar, Aparna Madhavan, Durga Goswami, Golmei Poulinlu and Gnanavel Venkatesan* 

...al diagnostics including molecular tools are available, recombinant protein based diagnostic assays namely ELISA is safer and robust to handle large sample size and also to minimize labor/time. However, the genus Capripoxvirus encodes putative 147 proteins in their genome, among which some of them are reported as potential immunogenic candidate genes. Selection and use of such candidate immunogenic proteins from an array of genes located at different structure...

Hamoudi Naoual1, Alloui Nadir2*, Barberis Abdelhak2 and Boudaoud Amine2 

Muhammad Ilyas1, Sardar Ali Khan1, Shahid Iqbal Awan1, Shafiq-ur-Rehman1, Waqar Ahmed1, Muhammad Riaz Khan2, Raja Mohib Muazzam Naz2, Muhammad Mohib Ullah Khan3 and Sumaira Hafeez1* 

Tian-Yi Zhao1, Zi-Qing Liu2, Shu-Fei Ma3, Bo-Yang1, Fan-Fan Guo1 and Ming-Hua Duan1*

 

...s diseases. However, the molecular mechanisms of biatractylolide in preventing and protecting Alzheimer’s disease (AD) remained elusive. This study was conducted to observe the effect of biatractylolide on the pathological changes of amyloid beta protein (Aβ)-induced AD. In vitro assays (MTT and flow cytometry) were applied to detect the effect of biatractylolide on PC12 cell proliferation, growth inhibition rate and apoptosis. In order to assess th...
Sana Aslam1, Wayne Thomas Shier2 and Imran Sajid1*
...ds has been exhausted so molecular characterization of actinomycetes from less explored habitats may be an alternate solution to this challenge. The aim of this study was to explore the actinobacterial diversity of the saline lake, situated in the salt range, Punjab, Pakistan and to screen them for antagonistic activities against multi drug resistant pathogens and to characterize the bioactive metabolites produced by them. A total of seventy strains of actinom...
Kanwal Nisa1, Sadaf Ashraf1, Masood Ahmed Siddiqui1*,Naila Taj1Habib-Ur-Rehman1, Arifa Bano1 and Naeem Rashid2
...e enzyme had an apparent molecular weight of 240 kDa and was a dimer of heterotetramers (αβɣδ)2 with molecular masses of 44, 36, 20 and 12 kDa, respectively. Both of the activities were oxygen sensitive. The apparent Km values for POR reaction towards pyruvate and CoASH were 0.49 µM and 115 µM, respectively, while for PDC reaction values these values were µM 0....
Abdurakhim Kuchboev1, Mehmonjon Egamberdiev2, Rokhatoy Karimova1, Oybek Amirov1 and Mitsuhiko Asakawa3,*
...i> sp. is described with molecular evidences in gastropod intermediate hosts from Fergana Valley, Uzbekistan. Larvae of D. dendriticum were detected in 28 (10.7%) out of 262 Xceropicta candacharica, and 8 (9.7%) of 82 Angiomphalia gereliana. Brachylaima sp. larvae were found in 3 (1.6%) of 95 Pseudonapaeus sogdiana. The total number of larvae per snail varied from 8 to 110 individuals. Alignment of the first four sequences of...
Jun Yan Bai*, Hong Deng Fan, Shuai Yang, Xue Yan Fu, Heng Cao, Xiao Hong Wu, You Zhi Pang and Kun Peng Shi
...ion period. To recognize molecular markers of egg quality of quail, SNP in control regions of cytogenin gene (MyoG) 5’ in China yellow quail, Beijing white quail, Korean quail detected by PCR-SSCP method in this study. Moreover, correlations of control regions of MyoG 5’ with egg quality of quail were analyzed. Results demonstrated that: In egg quail group, six genotypes were detected in Locus A in the control region of MyoG 5’, including AA,...
Mubashra Salim1, Omeira Ibrahim1, Hugo Vilhena2,3,4, Carla Maia5, André Pereira5, Maria Shahzeen1, Shabana Kalsoom1, Asim K. Mahmood6 and Furhan Iqbal1*
...udy was designed for the molecular detection of Mycoplasma haemofelis and Candidatus Mycoplasma haemominutum in feline blood samples collected from various pet clinics in Pakistan, by Polymerase Chain Reaction (PCR), using 16S rDNA as the target sequence. Clinical and epidemiological data was collected in all animals included in the study. M. haemofelis and C. Mycoplasma haemominutum DNA was detected by PCR respectively in 6.8% (10/...
Meriem Msaad Guerfali1,*, Heitham Hamden1, Salma Fadhl1, Wafa Djobbi1, Lotfi Sillini1, Wafa Marzouki1 and Mohammed Ammar2
...d should be confirmed by molecular analyses for malathion. On the other hand, spinosad LC50 were 127.95 ppm and 22 ppm for field and laboratory population, respectively. Resistance phenomenon is suspected, a rotation of insecticides with different modes of action is desirable in insect resistance management programs.

...
Muhammad Rizwan Ashraf1, Asif Nadeem1,2, Eric Nelson Smith3, Maryam Javed1, Utpal Smart3, Tahir Yaqub4, Abu Saeed Hashmi1 and Panupong Thammachoti3
.... More morphological and molecular studies are required to raise both the subspecies to separate species.
...

Arfan Ahmed Gilal1*, Lubna Bashir1, Muhammad Faheem2, Asad Rajput1, Junaid Ahmed Soomro1, Saifullah Kunbhar1, Abdul Samad Mirwani1, Tanzeela-ul-Zahra1, Ghulam Sarwar Mastoi3 and Jam Ghulam Mustafa Sahito

...ry wide study along with molecular identification of FAW should be conducted to confirm its presence in corn growing areas of Pakistan. This could be helpful to restrict its further spread with proper management. 

...
Maria Khalid1, Tanveer Hussain1*, Zahid Farooq2, Kamran Abbas1 and Masroor Ellahi Babar1  
...family, however a scarce molecular data is reported that urged us to investigate its genetic diversity and phylogeny using mitochondrial DNA, Cyt-b and Cox1 genes. A total of 749bp of Cox1 and 472 bp of Cyt-b complete coding regions of both genes were amplified by PCR followed by sequencing. The sequences were aligned and edited using Bio-Edit software and single nucleotide polymorphisms (SNPs) were identified. The boot strapped Nei...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...conclusion, confirmatory molecular characterization of the viral genome remains controversial and further studies are needed in this respect.
...
Sikander Ali* and S. Wajiha Khalid
...rude enzyme extract. The molecular weight of enzyme was found to be 86 kDa, as determined by SDS poly-acrylamide gel electrophoresis. 
...

Jie Yang

...us tumours; however, the molecular functions of miR-16 in papillary thyroid cancer remained largely elusive. In order to investigate the regulation of miR-16, human papillary thyroid carcinoma cells are transfected with miR-16 mimics or inhibitors. Targeting miR-16 and using dual-luciferase reporter assay, qRT-PCR and Western blot, the mRNA and protein expression were detected, respectively. Cellular apoptosis were examined by flow cytometry and Western b...
Hui-Ying Chen1,2*, Ping-Chuan Yin1,2, Ya-Nan Lu1,2, Hai-Yun Li1,2*and Yang Shan3
... However, the underlying molecular mechanisms of aspirin in the prevention of cancer are yet to be fully elucidated. In the current study, the GSE115660 microarray dataset was downloaded from the Gene Expression Omnibus database to identify key genes in aspirin-damaged yeast cells following redox injury. Differentially expressed genes (DEGs) were subsequently identified and functionally enriched for analysis. Additionally, a protein-protein interaction network...
Yue Qin Song, Hui Zhong Sun* and Jun Feng Dong
... the key elements in the molecular recognition and discrimination of odorants. On the basis of female and male antennal transcriptomes of Yemma signatus adults, a total of 66 candidate Y. signatus olfactory receptor genes (YsigORs), including one olfactory co-receptor (Orco), were identified in this study. All the sequences were further validated by cloning and sequencing. Tissue expression profiles of all YsigOR genes in the antennae of females ...
Mahvish Rajput1, Abdullah G. Arijo1, Muhammad Bachal Bhutto1Rehana Shahnawaz Buriro2, Javaid Ali Gadahi1, Muhammad Naeem3 and Zubair Ahmed Laghari1*
...abad, Pakistan and their molecular characterization with analysis of their evolutionary relationship. A total of 200 rumens from slaughtered sheep were examined and out of 200 sheep, a total of 75 (37.5%) were positive for rumen fluke infection. The results indicate that sheep were infected with the morphologically identical species indicating the only species infecting rumen. Further, it was found that the infection was prevalent in all months sampled but the...
Murtala Muhammad, Ting Zhang, Siyu Gong, Jing Bai, Jiansong Ju, Baohua Zhao* and Dong Liu*
...ogical, biochemical, and molecular techniques. Virulence and pathogenesis of the disease were determined by intraperitoneal injection of the etiological agent to the healthy A. sinensis. Physiological and 16s rRNA molecular analysis identified Streptococcus iniae as the causative agent of the disease outbreak. The bacteria has a unique biochemical profile compared with most of the previously isolated strai...
Majeeda Rasheed1*, Tanveer Akhtar1, Nadia Mukhtar2, Muhammad Furqan Shahid2, Muhammad Imran3, Saima Yaqub2
...tcomes and elucidate the molecular epidemiology of prevalent strains in the said geographical locations for better disease control and management interventions. 

Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5* 

...ify;">Here we report the molecular characterization, antigenic disparities and the phylogenetic analysis of unusual human rotavirus VP4 genotype detected in Moroccan children fully vaccinated with Rotarix™. After RNA virus extraction, the rotavirus VP7 and VP4 genes were amplified. The DNA was purified, sequenced and genotypes were determined using the RotaC online classification tool. A phylogenetic tree was constructed using the Maximum Likelihood meth...

Joseph Anejo-Okopi1*, Ocheme Julius Okojokwu1 and Onyemocho Audu2 

...y to use and inexpensive molecular methods for accurate diagnosis. The sub-Saharan Africa HCV genotypes distribution are diverse, but genotype I is the most common. This review highlights the need for more robust surveillance studies with introduction of opt-in testing at all clinics for better epidemiology the HCV disease burden more accurately.  

...

Pravin Mishra1, Md. Muket Mahmud2, Md. Ahosanul Haque Shahid2, Alamgir Hasan2, Vivek Kumar Yadav3 and Moinul Hasan1* 

... was studied and further molecular detection confirms the presence of methicillin-resistant Staphylococcus aureus from the outer part of the wound but not from the inner part. The study helps and aware the veterinarians, health-workers, and general people regarding the situation of antibiotic resistance. As maggot helps in the reduction of bacteria, this can be used as medical therapy in the case of a different wound. 

...

Kajol, A. H. Bhat, Aasha and A. K. Chaubey

Biochemical and molecular characterization of Photorhabdus akhurstii associated with Heterorhabditis indica from Meerut, India
... morpho-taxometrical and molecular analyses. The present populations were identical to the original description; however, the size of the 3rd stages was longer than the topotype populations. Analysis of ITS-rDNA sequences showed 1 nucleotide base pair difference in aligned data with type description, however, no nucleotide base pair difference was seen in the D2D3 domain. The associated bacterial symbiont of the DH3 strain was identified as Photorhabdus akhurs...

M. Rizwan Gul*

COMPARISON OF THE OF MECHANICAL AND WEAR BEHAVIOURS OF DIFFERNT TYPES OF POLYETHYLENES AND THE EFFECT OF RADIATION CROSS-LINKING ON THESE BEHAVIOURS
...y (HDPE), and ultra-high molecular weight (UHMWPE) were studied. Cross-linking was carried out by high energy electron beam at room temperature, with radiation dose ranging from 0-600 kGy. The results show that the stress-strain curve of UHMWPE in unirradiated state is marked by extensive strain hardening resulting in excellent wear resistance. Unirradaited HDPE show extensive yielding and high strain to failure, with dry abrasive wear properties comparable to...

Muhammad Imran Ahmad*, Nan Zhang**, Megan Jobson**, Muhammad Younas*, Kamran Ghani***

DELUMPING PROCEDURE FOR PREDICTION OF DISTRIBUTION OF PRODUCTS IN DISTILLATION USING A SHORT-CUT MODEL
...dology helps retain molecular information of composition of petroleum fractions and may help extend the premise of molecular components-based modeling to separation processes such as distillation.
...
Dibyendu Biswas1*, Shib Shankar Saha2, Shankar Biswas3 and Md. Abu Sayeed4
Outbreak of Lumpy Skin Disease of Cattle in South-West Part of Bangladesh and its Clinical Management
...ation of risk factor and molecular characteristics of this disease in Bangladesh.

...
Jam Nazeer Ahmad1,*, Samina J.N. Ahmad1,2,*, Mubashir Ahmad Malik1, Abid Ali1, Muhammad Ali3, Ejaz Ahmad1, Muhammad Tahir2 and Muhammad Ashraf2
...rphological features and molecular characters were observed using digital camera and PCR technique, respectively. For molecular identification, DNA was extracted through CTAB method and polymerase chain reaction was performed using mitochondrial cytochrome oxidase I (COI) gene based primers. Gel electrophoresis of the PCR products of desert locustsindicated a 710bp amplified DNA fragment on 1.5% agarose gel. DNA sequence ana...

Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3

Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
Sehrish Firyal1,*, Ali Raza Awan1, Muhammad Umair Latif1, Muhammad Tayyab1, Muhammad Wasim1, Shagufta Saeed1 and Imaad Rashid2

 

...is. These are bi-allelic molecular markers, easy to interpret and uniformly distributed within genomes. In this study cytochrome b (Cytb) gene based SNPs analysis was employed to genetically characterize the Pakistani domestic breed Lathy pigeon. Cytb haplotype for local domestic breed was developed. Homology analysis of Cytb gene revealed Columbia livia as closest homologue of Pakistani Lathy pigeon with five novel SNPs. Phylogenet...
Aatif Amin1,*, Zakia Latif2, Arslan Sarwar1, Basit Zeshan1 and Mushtaq A. Saleem1
Hong Hu1, 2, Li Qian1, Yuanlang Wang1, Chaodong Wu1, Xiaodong Zhang1, Yueyun Ding 1*, Li Wang1, Xudong Wu1, Wei Zhang1, Dengtao Li1, Jian Ding1, Min Yang1 and Zongjun Yin1*
...ork aimed to explore the molecular mechanisms and candidate genes associated with fat metabolism in Anqingliubai (obese) and Yorkshire (lean) pigs. The transcriptome profiling of backfat between Anqingliubai and Yorkshire pigs was carried out by RNA-sequencing technology. The sum of clean reads were 288.3 and 365.3 million which was obtained from the RNA sequencing data in the Anqingliubai and Yorkshire pigs, respectively. Most reads were located in exonic reg...

 Majid Shahi Bajestani1, Esmat Mahdikhani Moghadam2*, Reza Aghnoum3 and Hamid Rohani2

Study of Plant Parasitic Nematodes and Description of New Record (Rotylenchus alius) Associated with Barley (Hordium vulgare L.) in Khorasan Razavi Province, Northeast Iran
...etailed investigation at molecular level. Molecular traits on Meloidogyne arenaria species done by partial 18s ribosomal DNA primer and sequence results verified the morphometric studies and showed 99 percent resemblance to AB905316 sequence from Japan. In addition, scanning electron microscope (SEM) assay on infected roots by Meloidogyne arenaria showed that this species has been able to create gall in barley root and disru...

Kecheng Zhu1,2,3, Peiying He1, Baosuo Liu1,2,3, Huayang Guo1,2,3, Nan Zhang1,2,3, Liang Guo1,2,3, Shigui Jiang1,2,3 and Dianchang Zhang1,2,3,* 

...s. In the present study, molecular cloning, bioinformatic analysis and transcriptional analysis of Acanthopagrus latus myomaker (Almyomaker) were performed. The open reading frame (ORF) sequence of Almyomaker is 858 bp, which encodes a polypeptide of 285 amino acids. Moreover, phylogenetic and gene structure analysis indicates that Almyomaker is highly conserved among vertebrates. The tissue distribution pattern shows that Almyomaker

Fan Sigang1, Guo Yihui1* and Xu Youhou2

...na. Investigation on the molecular regulatory mechanisms of gonadal maturation in scallop is critical in the aquacultural industry. Here, gonads in maturing stage were obtained from noble scallops and sequenced using an Illumina high-throughput sequencer, producing 6.68 and 6.70 Gb of data for the ovary and testis, respectively. Reproduction-related genes, including vasa, nanos, and vitellogenin, and sex-determining genes, such as FoxL2, Dmrt, and sox9, were d...
Gautam Patra1*, Ana Sahara2, Sonjoy Kumar Borthakur1, Parthasarathi Behera3, Subhamoy Ghosh1, Apurba Debbarma4 and Seikh Sahanawaz Alam5
...ch, 2018 to identify and molecularly characterize Plasmodium relictum based on cyt b gene in various species of wild birds (Upupa epops, Passer domesticus, Pycnonotus cafer, Bubulcus ibis). The birds were captured by netting system. After blood was collected from wing veins, birds were released from the cages. Blood samples were examined after staining with Giemsa stain. The positive samples were used for amplification...
Faryal Saad1,3, Zia Ur Rahman2, Aamir Khan3, Rabia Noushin4, Irfan Ullah5, Farman Ullah Dawar3,Shahid Naiz Khan3, Rafiqe Hussain6, Kenza Javed2Abid ur Rehman7, Amna Fayaz3, Zohra Saifullah3 and Kalim Ullah3*
...s the seroprevalence and molecular detection of CMV infection among pregnant women of districts Lakki Marwat and Bannu of Khyber Pakhtunkhwa. A total of 188 blood samples were randomly collected from pregnant women of both districts and were examined through Enzyme-Linked Immunosorrbent Assay (ELISA) and Polymerase Chain Reaction (PCR) for CMV. Out of total 88 samples, 73.40% were positive for CMV through ELISA and 57.44% were positive for CMV through PCR resp...

 Amna Arshad Bajwa1, Saher Islam1, Muhmmad Imran1, Karman Ashraf2, Arman Khan1, Muhammad Farhan Khan3, Imran Rashid2, Muhammad Yasir Zahoor1Waseem Ahmad Khan4 and Wasim Shehzad1*

...ogy. Therefore, a simple molecular technique, that is precise with non-invasive sampling approaches such as faeces, would be valuable. In the present study a set of molecular markers was developed exploiting the AMLx/y gene to assess gender of Punjab urial population in Kala Bagh, using faecal samples as the DNA source. In our study, among 92 urial samples, 54 (58.69%) were identified as female samples, 34 (36.95%) were reco...

Agustine Christela Melviana1, Rizkita Rachmi Esyanti1*, Roy Hendroko Setyobudi2, Maizirwan Mel3, Praptiningsih Gamawati Adinurani4 and Juris Burlakovs5

Gene Expression Related to Steviol Glycoside Synthesis Produced in Stevia rebaudiana (Bert.) Shoot Culture Induced with High Far-Red LED Light in TIS RITA® Bioreactor System
...nts, particularly at the molecular level. This research was therefore performed in the TIS RITA® bioreactor system to evaluate the effect of far-red LED induction towards biomass growth, multigene expression related to steviol glycosides, and its derivatives, and also the metabolites produced in S. rebaudiana plant. The result showed that the increment of biomass and gene expressions (ent-KO, ent-KS, ent-KAH13, UGT85C2, UGT74G1, and UGT76G1) in high far-re...

Muhammad Iqbal1, Muhammad Ehetisham ul Haq1*, Muhammad Kamran1, Muhammad Idrees1, Shahid Nazir2, Ihsan Ullah3, Sumera Naz1, Shaukat Ali1 and Muhammad Zafar Iqbal2

Morpho-Molecular Characterization of Xanthomonas Axonopodis Pv. Citri Associated with Kinnow (Mandarin) and its Management
...ized morphologically and molecularly. The relative efficacy of commercially available antibiotics against the pathogen was evaluated in the lab and in field conditions. A systematic survey of randomly ten localities/sampling sites was conducted for a reliable estimation of citrus canker disease in District Sargodha of Punjab Province. Nine sampling sites showed 90 % the presence of Xanthomonas axonopodis pv. citri and only one site was free of citrus canker di...

Sidra Shehzadi, Sher Bahadar Khan*, Umar Sadique and Saqib Nawaz

Isolation and Molecular Identification of Clostridium perfringens Type D in Goats in District Peshawar
... for isolation  and molecular identification of new strains of C. perfringens Type D for effective diagnosis, treatment and vaccination. A total of 100 fecal samples  were collected aseptically from four different zones of district Peshawar during the period of February, 2019 to April, 2019. C. perfringens  Type D was confirmed through bacterial culturing, Gram staining, biochemical tests and polymerase chain reaction (PCR) . Results revealed th...
Saima Yaqub1, Tahir Yaqub1*, Muhammad Zubair Shabbir2, Asif Nadeem3Aziz-Ul-Rahman1, Muhammad Furqan Shahid1, Zarfishan Tahir4 and Nadia Mukhtar4
Ehsan Kashani1, Hamid Reza Rezaei2*, Morteza Naderi3 and Nematolah Khorasani4

 

...ied to investigate their molecular peculiarities in central steppes and deserts of Iran. Mitochondrial evidence indicates rapid population expansion and bottleneck event for both species during the past. Phylogenetic analysis successfully grouped the specimens in two distinct clades without any common haplotypes. Long-eared specimens grouped in two distinct phylogenetic groups which belong to two different geographic areas while for P. hypomelas ...
Wentao Wang1,2, Xu Lin3, Jianshu Zhuo3, Dongjie Zhang2, Xiuqin Yang3* and Di Liu1, 2*
...ranscripts in pigs using molecular biology technique for the first time. The CDS of the canonical transcripts (named V1) of porcine E2F3b is 1023 bp in length, and showed 93.35% and 90.62% identities with the homologues from human and mouse, respectively. The splicing variants were produced by exon skipping, alternative 5’ and 3’ splice sites alone or in combination. Minigene analysis showed that the splicing of porcine E2F3b is complicated. E2F3b ...
Zhen-Yang Wu1, Li Li1, Yu-Hua Fu2, Sheng Wang3, Qing-Ming An1, Xiao-Hui Tang4, Xiao-Yong Du3,5,* and Fei Zhou6,*
...rstanding of the complex molecular mechanisms of coat color in Tibetan sheep and provide a foundation for future studies.
...
Jun Yan Bai*, Kun Peng Shi, Xiao Ning Lu, Xiao Hong Wu, Xue Yan Fu, Heng Cao, Hong Deng Fan, Meng Ke Chen and Yong Kang Ma
...ze: small;">To recognize molecular markers of slaughter performance of quail, SNP in control regions of cytogenin gene (MyoG) 5’ in French giant quail, and Savimit quailwas detected by PCR-SSCP method in this study. Moreover, correlations of control regions of MyoG 5’ with slaughter performance of quail were analyzed. Results demonstrated that: In meat quail, three genotypes (AA, BB and AB) were detected at locus A in the control regi...
Sana Mehmood1, Hafiz Muhammad Tahir1*, Muhammad Summer1, Sher Muhammad Sherawat2, Shaukat Ali1*, Sajida Naseem3
...d to correct taxon after molecular identification. To describe the species diversity and richness in numerical structure, diversity indices (Shannon’s and Simpson’s) and evenness indices (Margalf’s index, Chao 1) were applied. No overlap was found between inter-specific and intra-specific divergence values. Neighbor joining tree clearly separated the species into different clusters. Present study concluded that although morphological identifi...

Shishir Sharma* and Laxmi Prasad Joshi

Current Insights on Stemphylium Blight of Lentil with its Management Strategies
...of the lentil yield. The molecular study for the recognition and delineation of species is inevitable as high complexity is seen due to environmental concerns and contrasting morphological characteristics among species. The frequency and intensity of this disease depends on environmental and climatic factors that are mainly favored by high humidity, temperature greater than 220c, and cloudiness. The pathogen mainly persists in crop debris and occasionally in s...
Ashara Sajid1, Muhammad Usman Ghazanfar1, Saeed Rauf 2, Zahoor Hussain3, Salman Ahmad1 and Yasir Iftikhar1,*
...udy not only detects the molecular detection of CGD in already identified samples through the iodo-starch test but also provides reliability for quick indexing of disease in the aforesaid field. Moreover, molecular detection also revealed the (standardization) of primers used in previous and current studies. Characteristic symptoms combined with molecular detection would be useful to formu...

 Shuanping Zhao, Lei Xu, Hai Jin and Yutang Jia*

...ene could be utilized as molecular markers for future assisted selection in cattle breeding program.
...
Mashal Malik and Mudassar Nawaz Khan*
 
...ed for morphological and molecular variations. In order to analyze genetic variations, Single sequence repeat (SSR) markers were used. The line B20G16 showed the highest morphological growth parameters of plant height, total number of leaves, leaf width, leaf length and leaf weight, while line B29G11 revealed the lowest. The maximum plant height (128.03 cm) was found for line B20G16. A maximum number of 48 leaves with leaf width of 2.34 cm, leaf length ...
Muhammad Qayash Khan1,2, Muhammad Zubair Anjum2, Muhammad Adnan3, Abbas Khan1, Hafsa Zahid1, Javed Nawab4, Sher Zaman Safi5Muhammad Ishaq Ali Shah6, Atif Kamil7 and Abid Ali1*
... the present study was a molecular characterization of fish species of economic importance belonging to the genus Schizothorax, Tor and Mystus collected from various rivers of Khyber Pakhtunkhwa, Pakistan. The samples were morphologically identified, its mitochondrial DNA was extracted and subjected to molecular characterization by amplifying and sequencing the mitochondrial cytochrome c oxidase 1 (CO1) ...
Rao Muhammad Ramiz1, Arfan Ahmad2*, Aamir Ghafoor2, Muhammad Avais3, Qurat-ul-Ain1 and Muhammad Zahid Iqbal3
...gical investigations and molecular characterization respectively. In this study, animals of group A (32.5%) showed significantly greater seropositivity (P<0.05) against BLV than group B (16%). Furthermore, exotic breeds of cattle showed significantly greater seropositivity (18.75%) compared to the local breeds of cattle (5.5%). Nested PCR on each of the 10% seropositive and negative samples confirmed BLV infection in three seropositive exotic animals (30%)....
Nosheen Basharat1, Usman Waheed2,3*, Muhammad Arshad1, Noor e Saba4, Iram Masood1, Akhlaaq Wazeer1, Ahmad Farooq1, Sadaf Moneeba1Abdul Rauf5 and Hasan Abbas Zaheer2,3

 

... conducted to assess the molecular epidemiology of TTV in healthy blood donors and find its relationship with hepatitis B and hepatitis C seropositivity. The study was conducted at the Department of Pathology and Transfusion Medicine, Shaheed Zulfiqar Ali Medical University, Islamabad, from November 2016 to June 2017. Total 282 samples were selected after routine blood screening of Hepatitis B and C, of which 75 were HCV positive (asymptomatic), 75 were HBV po...
Eman Khalifa1*, Riad Khalil2 and Haitham Elaadli3
...d to bacteriological and molecular examination for M. bovis followed by their antibiogram profile. Seven (7%) isolates were identified as M. bovis from totally examined 100 milk samplesand isolated M. bovis showed resistance to ciprofloxacin; gentamycin and sulphamethoxazole-trimethoprim while were intermediate sensitive to both of erythromycin and norfloxacin but on the contrary were sensitive to amikacin; cefotaxime; clindamycin and stre...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
 

...ublethal-temperature are molecular chaperons that positively regulate plant growth and development that govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA

Saad A. Moussa1, Ahmed F. Afify1*, Suzan Salah2 and Ayman Hamed3

...ed for the antigenic and molecular characterization of betacoronavirus 1 (bovine coronavirus) BCoV in newborn gastroenteritis calves in the Delta Region, Menofia Province, Egypt, also for isolation and identification of the local circulating BCoV strain for further diagnosis or vaccination. In cattle, Betacoronavirus 1 bovine coronavirus (BCoV) is primarily involved in enteric infections which leads to serious complication which may be fatal in young calves up...
Sara Sultan Alomran1, Muhammad Nasir Khan Khattak1,2, Amir Ali Khan1,2*, Sallam Hasan Abdallah2, Abeer Maher Fayyad1 and Khalid Bajou1,2
...ize: medium;">Unraveling molecular mechanisms that govern adipocyte formation will lead to a greater understanding of obesity and subsequent treatment. In the current study, we assessed the effects of miR-22-3p, a non-coding RNA, on adipocyte differentiation from telomerase-transformed Mesenchymal Stromal Cells (iMSC3). The transfection of iMSC3 with miR-22-3p suppressed adipocyte differentiation as evident by reduction in lipid content and number of lipid dro...
Hesham Saeed1*, Manal Abdel-Fattah1, Ahmad Eldoksh1, Farid S. Ataya2 and Manal Shalaby3
...o acids with a predicted molecular weight of 21 kDa. Basic local alignment search tool (BLAST) sequence analysis revealed that C. dromedarius IFNα gene shares high sequence identity with IFNα genes of other species, including C. ferus, Vicugna pacos, and Homo sapiens. Expression of C. dromedarius IFNα cDNA in Escherichia coli revealed a fusion protein with a weight of 22.5 kDa after induction of expre...
Abdul Muhaimin Wahab1, Basit Zeshan2,*, Naveed Ahmed2, Muhammad Afzal2 and Muhammad Naveed2
Aiguo Zhou1,2, Di Sun1,2,Shulin Liu 1,2, Yongyong Feng1,2, Yue Zhang3
Yanfeng Chen4, Shaolin Xie1,2* and Jixing Zou1,2*

 

...ne of the most effective molecular markers in the study of identification for fish species, which has a fast evolutionary rate. And thus, in the present study, investigation of genetic comparison was performed based on the complete sequences of mtDNA control region for “Bicolor” and “White” types of northern snakehead (Channa argus) due to an uncertain classification of them. The results showed that the genetic distance for the i...
Saqib Nawaz1, Sher Bahadar Khan1*, Umar Sadique1, Muhammad Israr2
Mumtaz Ali Khan3, Hameed Ullah Khan4, Muhammad Irshad5, Ihsan Ali1 and Haq Aman Ullah1
...cally, biochemically and molecularly confirmed through Gram staining, gelatin liquefaction test (GLT) and polymerase chain reaction (PCR), respectively. Out of total, 85 (31.3%) were positive for C. perfringens type D on PCR. The results revealed 6-34% prevalence of C. perfringens type D in different regions. Similarly, significantly (P˂0.001) higher prevalence was observed in lambs (54%) as compared to
Xuhai Wang1,2, Xin Li1, Fangyuan Yuan1, Chaocheng Li1, Bin Jia1* and Song Jiang1*
...all;">To study the early molecular immunity of Echinococcus granulosus infection in livestock, especially in sheep, the immunohistochemistry, in-situ hybridization was used to study the relationship and the distribution between miR-216b and IL2RB in the intestine tissue of kazakh sheep with resistant and non-resistant MHC haplotypes after oral infection with E. granulosus eggs. The results demonstrated that miR-216b negatively regulated IL2RB in ...

Muhamamd Rizwan1*, Muhammad Arshad2, Muhammad Kashif3, Aneela Zameer Durrani4, Asghar Abbas5, Tanveer Ahmad6, Muhammad Nadeem7 , Kinza Khan8

.... CRISPR Cas system is a molecular mechanism of prokaryotic microorganism. It acts as bacterial natural adaptive immune system against phages, plasmids and foreign genomic elements. Mostly prokaryotes uses their CRIPR Cas system to enhance the integrity of their cell membrane that inhibit the permeability of antimicrobials from host body into the bacterial cells. CRISPR Cas system also help bacteria to evade from the host immune system by suppressing the activ...
Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2, Muhammad Azmat Ullah Khan3, Muhammad Naveed1 and Abdul Rauf Shakoori4
... the Gag-Pol proteins by molecular modeling approaches. Mutational analysis in our study revealed S61A, S61M, S61Y, S61G, S61Q and M90L as the most hypervirulent mutations. This induces a selection pressure and a rate of increased virulency on Gag-Pol cleavage sites. These results significantly highlight the fact that the identified SNPs possibly contribute towards a positive selection pressure contributing to the identification of novel mutations like S61A, S...

Kiran Shahjeer1*, Gauhar Rehman1, Khurshaid Khan1 and Toheed Iqbal2

... by modern techniques of molecular identification.

...
Maria Qibtia1, Muhammad Wasim1, Farzana Chowdhary1, Muhammad Tayyab1, Sehrish Faryal1, Ahmed Mansouri2, Zeeshan Ahmad2, Muhammad Hamid3 and Ali Raza Awan1,*
...36/0.67). In this study, molecular identification and screening in LNP subjects provide the mutational variants of the LCT-gene in the region of Pakistan. This is a major step in clinical management and accurate genetic counseling of the pre-symptomatic diagnosis of LNP. Among the six novel mutations found, mutation XI was found in all of the LNP subjects and was absent in the lactose persistent group. This study, for the first time, focuses on
Shuang Yang1,2, Huiting Zhao3, Xuewen Zhang2, Kai Xu1, Lina Guo1, Yali Du1 and Yusuo Jiang1,*
...ne studies. However, the molecular mechanism of chemoreception in G. mellonella pertaining to sex pheromone recognition has not been elucidated. In this study, transcriptome sequencing was conducted on the antennae of male and female greater wax moths to assess the differential expression patterns of chemosensory genes and better understand the underlying olfactory mechanism. In the results, a total of 121 chemosensory gene transcripts were identified, ...

Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1 

...ochemical (SDS PAGE) and molecular markers. The present work was conducted on the basis of morphological and biochemical characterization in order to estimate the genetic diversity among the barley landraces; to explore significant variation which can be used in breeding programs. For this purpose, 40 barley landraces were collected from Dir Lower and Swat, districts of KP, Pakistan. A total of 18 traits were recorded, 10 qualitative characters including spike...
Sana Ilyas1, Muhammad Hidayat Rasool1,*, Muhammad Javed Arshed2, Muhammad Usman Qamar1 and Bilal Aslam1
...ere further subjected to molecular characterization for the presence of ESBL and carbapenemase-producing genes using PCR. Of 392 samples, 219 ESBL positive E. coli were recovered and among these 156/213 (73.2%), 42/63 (66.6%) and 21/27 (77.7%) were from poultry, environmental water, and urine samples, respectively. The PCR results revealed that71.2% of blaCTX-M, 67.5% blaCTX-M -1 and 62.2% blaTEM pro...

Ahmed A. Kheder

...S-ELISA), biological and molecular diagnostic techniques. Virus incidence was performed in different locations in five governorates during 2018-2020. Forty-one samples out of 693(5.94%) reacted positively to SLRSV. Specifically, the percentages of infection were 7.3, 6.7, 5.4, 5.16 and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia governorates respectively. SLRSV was mechanically transmitted from infected strawberry plants onto ten...

El-Habbaa, A.S.

...ay (IFA) and
molecular detection of viral DNA using PCR. Positive results were showed in 36 of
samples (28/30 of sheep samples and 8/10 of goat samples)upon isolation on ECE by the
3rd passage and 22 of samples (17/28 of sheep isolates and 5/8 of goat isolates) using
AGIDT and indirect-IFA. PCR detection showed positive results with 30 /40 of samples
before isolation (23/30 and 7/10 of sheep and goat ...
Ala’audin Hakami,1AusamaA Yousif,2* Mohamed Zaki,3 Mahmoud Ismail,4,5 Ahmed Al-Ali,5 Abdu-Rahman Al-Ankari5 
...iv>identify its possible molecular origins. Total DNA was extracted from
feather and blood samples from randomly selected 19 clinically-suspect
and 153 apparently-normal birds collected from 10 locally-bred and
imported Psittaciformes. Specimens were collected between 2008 and
2010. A replicase-associated protein (Rep) gene-specific PCR was used to
amplify a 603 bp region of the viral genome. PBFDV wa...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef* 

Maha I. El Zaafarany1, WafaaM. Badawy2, Eman M. El Salakh3

...>...
Nader M. Sobhy,1 Sunil K. Mor,2 Mohammed E.M. Mohammed,1
Iman M. Bastawecy,3 Hiam M. Fakhry,4 and Sagar M. Goyal2
...nic variation. Therefore molecular study of FMDV is pre-requisite for amplification of FMDV specific genomic fragment and also copying specific serotypes O, A and SAT2 nucleotide sequence. In this work FMDV serotype O, A and SAT2 were isolated from cattle clinical samples (foot lesions). RNA extracted from clinical samples was subjected to reverse transcriptase polymerase chain reaction( Rt. PCR) nucleotide of FMDV ID and 3D genes were determined using standar...

Ebtisam, A. Abouel yazeed1; Yanni, M.I.1 and Hanan A. Fahmy2

...chnique (FAT) as well as molecular method as real-time quantitative reverse transcriptase PCR (RT-qPCR) from samples collected during neonatal diarrhea. Six out of forty tested samples were found positive for rotavirus (15%) infection using ELISA test. Successful isolation of the rotavirus on MDBK cell line from two samples from the positive ELISA samples. The beginning of characteristic cytopathic effects (CPE) were observed from the 3rd passages as clumping,...

Hanaa A. Ahmed1 and Eman M. AboHatab2

...re confirmed positive by molecular methods. Eleven out of twenty one nodular samples were positive by (IFAT) in CAM, which prove that PCR and Real Time PCR are much sensitive and rapid diagnostic tool of LSD reflecting their importance in controlling the rapid spread of disease in Egypt.

...

Yanni, M. I1; Hanaa A. Ahmed2; Lamyaa, A. Ahmed1; Hanan, A. Fahmy3 and Ibrahim, E.M.4 Aggour, M. G.3

...izootological study on a molecular basis is needed.

...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...exandria) Serotyping and molecular characterization by polymerase chain reaction PCR for (31) samples as FMD Serotype O , (2) Serotype A and (3) serotype SAT2 the samples collected from outbreaks in period November 2013 –July 2014 the season Autumn and winter for forming an Epidemiological map for 10 governorates of the circulating strains during this period
...

El-Bagoury, G.F., El-Nahas, E.M., El-Habbaa, A.S.

...nce techniques, and then molecularly identified using reverse transcription polymerase chain reaction (RT-PCR). Both cattle and buffalo isolates behaved the same pattern for serological and molecular identification in correlation with BEFV Webster reference strain and showed an amplicon size 473 bp for G2 gene. In conclusion, BEFV field strains from cattle and buffaloes seem like but further molecula...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

... primers.PCR product was molecularly cloned in t E.coli cells using PCR2.1/TOPO/ TA cloning vector. HSV-2gD fragment was liberated from 1 μg recombinant plasmid by using the restriction endonuclease EcoRI. HSV-2gD was successfully sub-cloned into binary plant expression vector PBI-121. HSV-2gD subunit-containing binary vector PBI 121 were transformed into Agrobacterium tumifaciens LBA 4404 strain for Agro-inoculation. Tomato plants were transferred into reg...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1

Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed

.../div>
identify and molecularly characterize the isolate of the OYDV infecting onion plants in
Egypt and to obtain OYDV-free plants from infected onions through tissue culture
techniques. To achieve our aim, the virus has been isolated from naturally infected onion
plants grown in five Egyptian Governorates, Gharbia, Qalyobia, Giza, Fayoum and Beni-
Suef then mechanically transmitted onto healthy onion plant...
M. A. S. El-kady1; A. B. Badr2; Ahmed K. El-Attar1, Hoda M. A. Waziri1 and Kh. E. A. Saker1

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...ological (DAS-ELISA) and molecular assays. Reverse transcription polymerase chain reaction (RT-PCR) was used to amplify 497 bp fragment using PCR primers specific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
... from 200 to 600 nm. The molecular characterization was performed for
three different samples representing the different symptoms of phytoplasma through
cloning and direct sequencing. The DNA sequencing, phylogenetic analysis and the
multiple alignments for the sequences of the Egyptian clones with each other and with the
other sequences of phytoplasma strains on GenBank showed that we may have two
di...

Sherif .M. Ibrahim*, Abd El-Razek. B. Abd El-Razek*. Hanan. M. El-Zahed Amal. A. Fatouh* and Ayatollah. I. Ibrahim*

... based on biological and molecular basis. Vaccinal and isolated strains were propagated on the chorioallentioc membrane of specific pathogen free (SPF) embroynated chicken egg (ECE) showing the characteristic pock lesions for each strain with titers reached 4.5 and 3.5 log10 EID50/ml at 5th passage for FPV and PPV isolates, respectively. The isolated strains were further identified using the specific hyper-immune sera for each virus by virus neutrization test ...

Sahar Abd El Rahman1; Mohamed Eladl2 and Mohamed M. El-Diasty3

...the viral antigens, then molecular characterization of its genome. Infection by the bovine ephemeral fever virus (BEFV) was noticed in Dakahlyia governorates during the summer season of 2015. Twelve samples of buffy coats were collected from dairy farms suspected from clinical investigations to be infected by bovine ephemeral fever virus. The virus was isolated intracerebrally in suckling mice then successfully identified by indirect immunofluorescence techniq...

Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1

...focuses on isolation and molecular characterization of EHV-1 of the local isolate Egypt/VSVRI/Zahraa/2014 using the glycoprotein D of EVH-1 due to its role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins based on sequence analysis and multiple alignment revealed single nucleotide substitution at the base pair number 121 fr...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...y, serological tests and molecular technique. The virus was identified serologically by direct ELISA, dot and tissue blotting immune-binding assay using authentic and induced antiserum for PNRSV.RT-PCR with specific PNRSV primer was used to confirm the obtained results. No amplified product was obtained from healthy control. The partial RNA3 movement protein product from PNRSV infected rose directly cloned using the TA cloning system. Nucleotide sequencing rev...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

...n this study showed that molecular techniques could be used for rapid evaluation of PPR vaccine including RT-PCR for identity testing and for detection of BVDV as adventitious contaminant and PCR assay for detection of bacterial contaminants as mycoplasma.

...

Lamya A. F. Ateya1, Said A. Ahmed 2, Mansour H. Ayman3, Khamees K. Ashraf 4, Heba A. Abdel-Hady 5

...f bands at the predicted molecular size (1926bp). Neutralizing antibodies against LSDV were (55) out of total 100 serum samples by serum neutralization test. Conclusion: Selection and processing of clinical specimens, viral isolation and PCR assay applied, for LSDV are much sensitive and rapid diagnostic tool of LSD reflecting their importance in controlling the rapid spread of disease in Egypt.

...

Aly M. Abdel-Salam

...ally, serologically, and molecularly one Crinivirus viz. Cucurbit yellow stunting disorder virus (CYSDV) and one Ipomovirus viz. Cucumber vein yellowing virus (CVYV) from infected cucurbits. Further, the study is concerned with illustrating the adverse effect of mixed infection with these viruses on diagnosis and breeding for virus resistance in cucurbits. Methods: CYSDV was isolated through Bemisia tabaci insects; whereas, CVYV was isolated through mechanical...

Salama M. El-Saghir1, 2

...c antiserum for PVS and, molecularly using specific primers for PVS.
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).<...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and Mohammed A. Shalaby2

...bjective: To use of some molecular techniques as conventional reverse transcriptase polymerase
chain reaction (RT-PCR) and real time RT-PCR in identity test of PPR vaccine.
Methods: Four batches of PPR vaccines that produced in Egypt by Veterinary Serum and Vaccines
Research Institute (VSVRI) were collected and tested for identification of PPRV by conventional RTPCR
using two primer sets targeting F-gene and N-ge...
Muhammad G. Khodary1, Ayman H. El-Deeb2, Mohamed M. Emara2, Othman E. Othman1, Hussein A. Hussein2

Lamiaa M. Omar, Mohamed A. Abdrabo, Dali M. Omar, Nermeen A. Marden

...iv>
in (ECE) or by molecular assay for detection AI virus specific nucleic acids such as (rRT-PCR).
Methods: Titration of the HPAI virus for infection of SPF chicken. The tracheal swabs were collected
from diseased chicken for virus isolation and quantification by ECE inoculation and rRT-PCR.
Results: the titer of original HPAI virus was 1010.3 EID50/ml. The AI titers after experimental
infection of chicken...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...y (TEM). Phytoplasma was molecularly
detected in symptomatic samples using the specific primers of their 16S-23S rRNA gene by PCR.
Results: The Phytoplasma was isolated on indicator (Vollka marina) plants. It was transmitted on
Lemon (Citrus limon) by grafting and on periwinkle by dodder. It was detected in the sieve tubes and
parenchyma cells of leaf midribs tissues using Diene's stain and TEM. Infection of Lemo...
Ashraf S. Khameis, lamya F. Atteya, Ayman H. Mansour, Heba A. Abdelhady, Ashraf A.
Saad
...pplied for isolation and molecular identification of Sheep pox
virus from clinically affected sheep in El Menofiya governorate, Egypt during 2016. Additionally, the
isolated agent was identified using electron microscopy (EM).
Methods: Thirty five skin lesions of nodular and crusted scab samples were collected from clinically
infected SPV sheep and were prepared and isolated on chorioallantoic membrane of 9-11 da...

Dina A. Abdulrahman1, Ayman H. EL-Deeb2, Momtaz A. Shaheen1 & Hussein A. Hussein2

... for
routine molecular characterization of the circulating FMDV strains to ensure the rapid detection of any
new or mutant strains and update the used vaccine accordingly.
Methods: Twelve epithelial samples were collected from cattle showing signs suspecting of FMD.
The samples were tested by real time RT-PCR using universal primers for detection of all seven
serotypes of FMDV. The positive-resulted s...

Shimaa M. Mansour, Reham M. ElBakrey, Ahmed Orabi, Haytham Ali, Amal A. Eid

...
Aim: Clinical and molecular investigation of avian reovirus infection in broiler chickens with
availability of Vertical Transmission
Methods: Herein, 18 chickens derived from 4 broiler flocks within Sharkia Province, Egypt suffering
from different degrees of lameness and/or stunting were clinically and molecularly examined for the
presence of ARV.
Results: By...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
...t study was conducted to molecular characterize the exonic regions of β-casein gene and to explore the status of A1/A2 β-casein type in Cholistani cattle breed of Pakistan. Blood samples of Cholistani Cattle were collected from Government Livestock Farm, Jugait Peer, Bahawalpur. Genomic DNA was extracted from whole blood by organic method. PCR primers were designed and optimized according to respective melting temperatures. PRALINE tool, MEGA 6.0 and...

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

Nagwa K. Meselhy1, Mohamed A. Abo El-khair1, Basem M. Ahmed2, Sherif A. El-Soally3,
Abdelhamid M. Fares1, Mohamed A. Nayel1 and Hussein A. Hussein2
...s: In the present study, molecular characterization of circulating EHV-1 viruses among horses
of equestrian clubs in Egypt was carried out. Sixty-two samples of whole blood with anticoagulant
were collected and screened for EHV-1 using nested PCR that amplify the conserved fragment of
glycoprotein B gene (ORF 33), followed by sequencing and phylogenetic analysis.
Results: The study revealed that 19% of our sample...

Hanaa A. Elsamadony1, Laila A. Tantawy1, Sabry E. Omar2 and Heba A. Abd Alah1

Samira M. Bolis1, Magda Mahmoud2, Salah E. Gumma3, Naser E. Bilal1 and
Isam ElKhidir4

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

...cterize the virus at the molecular level and
described the ultrastructural changes or other histopathological alterations in basil cells
following infection by AMV.
Methods: Studies were conducted to elucidate the etiology of the disease. The diagnostic tools
used were the transmission electron microscope for rapid diagnosis, host reactions, serological
double-antibody sandwich (DAS)-ELISA, reverse tr...
Riham H. Bassam, Hussein A. Hussein, Mohamed M. Amer, Basem M. Ahmed and Ahmed A. El-Sanousi
...t study is to detect the molecular characterize IBV in samples
collected from Lebanese flocks geographically distributed in 7 Governorates.
Methods: Blood sera, tracheal swabs and tissue organs were collected from 60 poultry flocks from
different ages, different type of raising which were housed in different Governorates in Lebanon
including, broilers, layer hens of breeders, backyard chickens and ducks for seros...

Riham H. Bassam, Hussein A. Hussein, Mohamed M. Amer and Ahmed A. El-Sanousi

Aml S. El-Saadany1, Ayman H. El-Deeb2 and Hussien A. Hussien2

...ent study the aim was to molecular characterize IBDV field strains detected in flocks
located in 4 governorates. Also, a phylogenetic analysis based on the sequence of the hyper variable
region of VP2 gene was carried out.
Methods: Forty field bursa samples were collected from different localities. IBDV was detected using
RT-PCR. Sequence analysis of the variable region of VP2 gene purified from the PCR product.<...

Mohamed F. ElKersh1, Fatma M. Abdalla2, Gamilat K. Farg2, Soad A. Nasef3, Ahmed A. Ali2

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

...k aims the detection and molecular identification of phytoplasma infecting
Gazania in Egypt.
Methods: Phytoplasma disease was detected and isolated from naturally infected gazania plants during
surveys in flower nurseries and open filed in Giza governorate, it was transmitted from naturally
infected Gazania to healthy periwinkle and other ornamental plants by dodder (Cuscuta reflexa ), and
the leaf ho...

Ahmed M. Soliman

...logical, serological and molecular assays.
Methods: Survey of some vegetable crops exhibiting mosaic, yellowing, blisters, shoestring leaf, mottling and stunting in different regions of Al-Ahsaa at Eastern Province in Saudi Arabia was conducted during the spring of 2016 and 2017. The viral isolates were biologically isolated by single chlorotic local lesion on Chenopodium amaranticolor and propagated in healthy Nicotiana benthamiana. Enzyme linked ...
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...duction mutagens by ISSR molecular method.
Methods: ToRSV was isolated from infected tomato, grapevine and pelargonium plants and detected
using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA). Host range study
was carried out using mechanical inoculation into fourteen different diagnostic host plant species and
cultivars belonging to 6 families. Tomato seeds were treated with four differen...

Mohamed M. Mashaly1, Ayman H. El-Deeb2, Momtaz A. Shahein1, Hussein A. Hussein2

...btained LSDV isolate was molecularly identified and deposited to the GenBank accession
number of MN271728. In addition, a comparative study of LSDV growth curves of two permissible
continuous cell lines (MDBK and Vero). The growth curve of LSDV was determined by inoculating
both cultures, harvesting at intervals up to 24 hours and titrating the virus culture. To confirm LSDV
accumulated in cell cultures,
Bingjie Zhou1, Hitesh Bhagavanbhai Mangukiya1, Siva Bharath Merugu1, Fakhar-un-Nisa Yunus1, Yuchen Fan1, Zhenghua Wu1,* and Dawei Li1,2,*
...tracellular function and molecular mechanism.
...
Aamer Abbas1, Jabbar Khan1*, Mir Abid Hassan2, Asif Qayyum3 and Hamed Shafiq4
...sessment of clinical and molecular attributes was done using standard protocols. Healthy women were used as negative controls. This study revealed significant concentrations of Zn, Cd, Cr, Pb, Cu. Except Zn and Pb, the other 3 metals were found below the permissible limit set by WHO. Interestingly, the infertile males having maximum age limit of above 47 years and highest marriage ages during the present study showed comparatively higher concentrations of all ...
Guan-bao Ning1, Sheng Niu1, Yue-jian Li1,2, Xiao-xiao Lu1,3, Shi-xiong Yang1,  Ali-Raza Jahejo1, Ding Zhang1, Wei-fang Hao4, Wen-wei Gao1, Yu-jun Zhao1, Jian-hui Li1, Fang Yan1, Rong-kun Gao1, Yu-hai Bi1,5, Wen-xia Tian1* and Ling-xia Han6*
...ay help to elucidate the molecular mechanism of chicken erythrocytes relate to immune responses in MDV infection.
...
Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
... collected from dogs and molecular detection methods were used to identify the tick species and CME by amplification of the cytochrome oxidase subunit I and disulfide oxidoreductase gene, respectively. The results indicated that 1.29% of the serum samples were positive for E. canis, and 5.50% of dogs were infested with ticks. The Wenzhou samples of R. sanguineus exhibited a high homology (99.7%–99.8%) and these parasites showed a 99.1%&ndas...
Nianhong Huang, Yan Wu, Yuanyuan Li* and Jinhong Zhao*
...ecies. Morphological and molecular analysis of Hepatozoon sp. establishes a basis for identification of the genera Hepatozoon, increasing protection and prevention of parasitic diseases of snakes.
...
Tanzeela Riaz1, Farah Rauf Shakoori2*, Syed Shahid Ali2 and Mushtaq Ahmad Saleem1
...rate metabolism and macromolecular concentrations in two larval instars (4th and 6th) of the khapra beetle, Trogoderma granarium, at different exposure periods (24-120 h) was determined. Two populations of khapra beetle used in this research possessed different levels of susceptibility to phosphine. Based on LC50 one population was termed as a susceptible population (never exposed to phosphine previously) while the other...
Ewa Czerniawska-Piątkowska1, Iwona Szatkowska1, Daniel Zaborski2*, Wilhelm Grzesiak2, Sara Tabor-Osińska1, Małgorzata Wasielewska1Witold S. Proskura1, Wojciech Kruszyński3 and Edward Pawlina3
...equired to elucidate the molecular basis of the relationships observed in the present research.
...
Iram Liaqat1,*, Safdar Ali Mirza2, Sumera Sajjad3, Shaukat Ali1,*, Muhammad Faiz Qamar4 and Ikram Ul Haq5
...tionarily conserved macromolecular assembly and known architecture making it an ideal drug target. The knowledge obtained will help to elucidate mechanism and design principles necessary to understand protein secretion systems.
...
Jia Li and Hong Yang*
...anthracene (BaA), a high molecular weight polycyclic aromatic hydrocarbons (PAH) was increased via a combination of alkyl polyglucosides and alkaline treatment during the waste activated sludge (WAS) anaerobic fermentation. During the experimental study, the biodegradation efficiency of BaA was enhanced from 12.2% in the control to 25.6% at pH 10 and 46.7% at pH 10 and alkyl polyglucosides (APG) reactors. APG and alkaline treatment increased the BaA deposition...

Muhammad Aftab1*, Aneela Riaz2, Ghulam Sarwar3, Muhammad Arif1, Qudsia Nazir1, Ifra Saleem1, Sarfraz Hussain1, Abid Ali4, Abid Niaz1, Fakhar Mujeeb4, Khalid Mahmood5 and Sarfraz Nawaz6

...ants, which having lower molecular weight of antioxidants. It also reduces (ROS) enzymatic activities including catalase (CAT), peroxidase (POD) and superoxide dismutase (SOD). Under combined stress conditions agronomic, bio-chemical, quality and over all yield reduces, which is an alarming situation for agriculture sector. To assess the K effect on bio-chemical and agronomic characteristics of selected cotton crop varieties, a lysimeter study was carried out ...
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
...y is the first report on molecular characterization of E. tenella in Pakistan highlighting the pathological potential and distribution of E. tenella.
...
Jia Liu1, Zhen Wang1, Zifan Ning1, Ali Mujtaba Shah2,3,Qing Zhu1, Yan Wang1, Huadong Yin1, Zhichao Zhang1, Lu Zhang1, Yaofu Tian1, Diyan Li1,Gang Shu2,4, Lin Ye1 and Xiaoling Zhao1,*
... however, the underlying molecular mechanisms responsible for the differences in post-hatch muscle development are unclear. Here, we report on the identification of several candidate genes that may modulate myofiber growth and thus explain some of the differences in the skeletal muscle phenotype of FG and SG chickens. We collected pectoralis major (PM) and gastrocnemius muscles (GM) on d 1, 7, 28, 49, and 70 post-hatch, and measured the weights of the muscles,...
Shoaib ur Rehman1, Jabbar Khan2*, Raaza Malja Khan3, Maimoona Azam4 and Zeeshan Mutahir5

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

...ly, biochemically and at molecular level. Bacteria after isolation were labelled as EPF1 while by molecular confirmation this bacterial strain was named as Exigoubacterium auranticum. Optimum bacterial growth response was recorded at pH 7.0, temperature 37oC, LB media and shaking 160 rpm conditions. Cell surface characteristics of E. auranticum (EPF1) was determined in terms of bacterial cell surface hydrophobicity and auto-...
Iqra Mobeen1*, Rabia Arif1*,Maimoona Ilyas1, Siu Fai Lee2 and Muhammad Saleem1
...on and abundant class of molecular markers present in the genome of many organisms. The current study represents the first attempt to investigate the natural variations in the RK-MTases genes; Ribosomal N-lysine methyltransferase1 (RKM1) and Ribosomal N-lysine methyltransferase4 (RKM4) in Sordaria fimicola using SNP markers. A total seven SNPs in the RKM1 gene and nine in RKM4 gene were identified. A subset of SNPs wer...
Sadaf Ashraf1, Masood Ahmed Siddiqui1*, Kanwal Nisa1, Samar Ali1 and Naeem Rashid2
...acids with a theoretical molecular mass of 58 kDa. The amino acid sequence contained the four conserved regions that are a characteristic of GH13 family members. Recombinant Pcal_0222 was purified to apparent homogeneity using cation exchange and gel filtration column chromatographies. Purified Pcal_0222 exhibited optimal α-amylase activity at 85°C and pH 5.5. The activity was not dependent on any metal ion. The hyperthermophilic nature and metal ion...

Adel M. Abdelrahman1, Sahar R. Mohamed1, Soliman M. Soliman2, Sherif Marouf3* 

Eman H. Mahrous1, Mohamed. W. Abd Al -Azeem2, Faisal A. Wasel1, Waleed Younis2* 

...isolated from rabbits by molecular techniques. To establish this goal, lungs, liver, and heart (50 for each organ) were collected from 50 diseased rabbits (suffering from respiratory signs) from backyard rabbits at different localities in Sohag governorate, Egypt. All samples were submitted for PCR test and other conventional methods of identification. Recovery of P. multocida isolates of diseased rabbits from lung, liver, and heart were 23 (46%), 11 (22%), 13...

Stephen Chijioke Emencheta1, Chinelo Charity Eze1, Anthony Amaechi Attama2, Damian Ejike Agbo1 and Ebele Benedette Onuigbo1*

...stewaters is a promising molecular tool in combating the global antimicrobial resistance threat.

...

Asad Ullah1*, Umar Sadique2, Ibadullah Jan2, Imad Khan1, Raheela Taj3, Mumtaz Ali Khan4, Salah-ud-din4, Naimat Ullah Khan1

...osis; to investigate the molecular prevalence of bTB. Overall, 390 no of sputum samples collected as of 800-participants comprised of TB patients (100), livestock(L/S) farm employees(200), abattoir employees(174), butchers(294), veterinarian(10) and veterinary assistants(22). Two out of 100 TB patients (2/100), 3 out of 200 livestock farm workers (3/200) and 3 out of 23 abattoir workers (3/23) were found positive for the presence of M bovis through PCR techniq...
Ardi Prasetio1*, Christina Maria Sri Lestari2, Sutaryo Sutaryo2, Manar Fayiz Mousa Atoum3,4Muhammad Zahoor5, Asma Nisar6 and Muhannad Illayan Massadeh7

Altaf Hussain1*, Muhammad Saad Ashraf3, Asim Shamim1, Mohsin Nawaz1, Arslan Mehboob2 and Urooj Fatima2

Mustafa Ozan Atasoy

...ter understanding of the molecular insights of viral diseases. These have spurred the development of safer and efficient vector vaccines, which convey immunogenic genes of interest obtained from vitally important diseases. Herpesvirus of turkeys (HVT) has long been considered a versatile tool owing to its non-pathogenic characteristic, relatively higher transgenic capacity, and enabling the DIVA strategy. Numerous bivalent and multivalent HVT constructs have b...

Jiao Ma*

...tem cells with different molecular phenotypes and differentiation potentials have been discovered and studied. Increased proliferation and differentiation of these cells in areas of cardiac ischemia is a significant factor in the repair and enhancement of heart injury. This role of endogenic cardiac stem cells can be regulated by factors. Numerous causes, such as paracrine and autocrine factors, extracellular matrixes and genetic factors. In general, it is wel...
Johar Hussian1, Faiz Muhammad2, Shafqat Fatimah Rehmani3, Aqeel Ahmad4, Nazir Ahmad Lone4, Moomal Bughio5, Syed Khurram Freed1 and Shakeel Ahmed Khan4*
...y rapid diagnosis either molecular or serological test. However, the later test is inexpensive such as heamagglutination inhibition test (HI), but IBV fail to give Heamagglutination (HA) reaction without pretreatment. Therefore, we designed this study for preparation of IBV antigen by treating with different enzymes for HA reaction. IBV local isolates were characterized by SDS-PAGE and RT-PCR. The indigenous isolate HA antigens were treated with different prot...

Aly M. Ghetas1*, Dalia M. Sedeek1, Hanaa S. Fedawy1, M.A. Bosila1, Hoda M. Mekky1, Kh. M. Elbayoumi1, 3, Mohamed M. Amer2 

...ungi, immunosuppression, molecular identification, Histopathology.  

...

Lin Huang1, Ling Mai2, Keyan Zhong1 and Xinjun Chen3*

...i sequence alignment and molecular evolutionary tree of SeFABP were predicted and analyzed. On this basis, SeFABP was whole-genome synthesized and cloned into prokaryotic expression vector. The recombinant plasmid pET-30a(+)-SeFABP was constructed, then transformed into E. coli BL21 (DE3) and induced by IPTG. The purified SeFABP was obtained by Ni-IDA resins affinity chromatography, and were finally confirmed by SDS-PAGE and Western blot. The results showed th...

Lanjie Li1, Jingjing Zhang2, Ruiyan Zhang2, Ning Zhang2, Zixiang Wei2, Guiqin Liu1,*, Riaz Hussain Pasha3, Muhammad Akram Khan4 and Saif-Ur-Rehman5

...ntioxidant activity, and molecular weight distribution of oligopeptides in hydrolysates were studied. The optimum enzymatic hydrolysis conditions were identified at 5.96 pH, 0.7% enzyme-substrate ratio, 55ºC temperature and 3 h time. Under these optimum conditions, DH of 25.4%, PR of 95% was obtained. Moreover, hydrolysates were rich in oligopeptides, especially di- and tri-peptides and demonstrated good antioxidant activities. These results introduce a n...

Nour El-Hoda Khayrat Hammad1*, Yousef Y. El-Seady3, Azza E. Hassan1, Sara T. Elazab2, Magdy S. Amer2 

...tes and epididymis. On a molecular basis, mRNA expression of CYP17A1 and LHR genes were significantly reduced in testicular tissues of FCZ group while aromatase gene was elevated. The administration of LIN oil after FCZ treatment markedly improved the aforementioned alterations caused by FCZ. So linseed oil is capable to ameliorate the fluconazole induced fertility disorders.

Keywords | Male fertility, Antifungal, Medicinal plant, Testosterone hormone,...

Alexander Tsybulsky1*, Tatyana Tabakaeva1, Anna Klimovich2, Michail Shchelkanov1, Eduard Kostetsky1, Maksim Aliev1, Anton Degtyarenko3 

...tem (IFN) in particular, molecular guard factors for cell genome integrity evaluation (p53, etc.). Methods. In domestic cats with a previously established diagnosis of «FeLV-infection and chronic leukaemia» (n = 10) and healthy control cats (n = 6), we examined the following: 1) Haematological parameters of the blood; 2) Biochemical blood indicators of the physiological characteristics of the kidneys and liver, whose disorders are most critical in ...

Ghassan Zahid1, Sania Begum2, Sikandar Almani3, Sahir Hameed Khattak2, Rajesh Kumar Soothar4 and Shakeel Ahmed Soomro4*

.../Lr34) respectively. The molecular markers screening results indicated that the primer Sr2/Lr27 was present in almost all of the double haploids and genotypes except the Nesser and Tukuru varieties. The Yr29/Lr46 gene complex was present in all double haploids and genotypes except for Nesser, Opata-85, inqilab-91 and Tukuru. the gene complex Yr18/Lr34 was present in eight double haploids, and only one genotype showed its presence, however the rest of the genot...

Neda Amani1, Mehrdad Shariati1, Rahim Ahmadi2,3*, Mokhtar Mokhtari1 and Saeed Khatamsaz1

...nt studies, however, the molecular pathway is unclear. This study aimed to investigate the effects of testosterone enanthate on expression level of iNOS, MMP9 and caspase-3, -8 and -9 in human colon (HCT) and gastric (AGS) cancer cells. Cell lines were divided into untreated (control) group and groups exposed to 0.001, 0.01, 0.1, 1 and 10 mg/ml of testosterone enanthate. The cytotoxic effect of testosterone enanthate was measured using MTT assay method. iNOS, ...

Saydat Saad1, Doaa Abdel-Fattah1, Tarek Khamis2, Aya El-Sobky1* 

... introduce new tools for molecular and cellular biology, biotechnology, veterinary physiology, animal genetics, and reproduction. Nano-propolis is beneficial to veterinary medicine in different aspects by varying the size of propolis using various techniques, nano-propolis can be more effective without compromising its qualities. Propolis has numerous benefits, including anti-inflammatory, antioxidant, anticancer, and antifungal properties. Low bioavailability...

Mohammed H. Galhoum1, Hamza M. Eed2, Essam S. Soliman1* 

...l identifications versus molecular detection. A prospective study was designed to last for six months from March 2021 to the end of August 2021. A total number of 126 chicken samples (100 samples from five broiler chicken farms and 26 samples from two slaughterhouses) were collected from the Ismailia governorate. Each sample was composed of liver, intestine, and breast and thigh muscles. The study revealed a total prevalence of 35.7% (45 positives out of 126 s...

G. Basana Gowda*, N.B. Patil, M. Sahu, S.R. Prabhukarthikeyan, S. Raghu, G.P. Pandi, T. Adak, C.K. Swain, S. Pokhare, S.D. Mohapatra and P.C. Rath 

... through biochemical and molecular techniques. Among nine isolates of bacteria from resistant and susceptible populations, six isolates belonged to gram positive bacteria and three belonged to gram-negative. The 16S rRNA gene sequences displayed 96 to 100 per cent homology to other 16S rRNA gene of strains within the National Centre for Biotechnological information (NCBI), Genbank. Among different bacteria strains, two, Bacillus subtilis and Staphylococcus sap...

Doaa Sh. Mohamed1, Nema S. Shaban2 , Mai M. Labib3, Olfat Shehata4 

...ities were elucidated by molecular docking studies. Treatment with almond oil attenuated lipid peroxidation, improved superoxide dismutase (SOD) activities that are associated with doxorubicin administration. Also almond oil considerably modulated the gene expression of toll like receptor 4 (TLR4) and lowers the serum levels of both nuclear factor κB (NF-κB) and tumor necrosis factor α (TNF-α). The elevated levels of Creatine Kinase - M...
Ghada Mohamed Safwat1*, Mohamed Ahmed Kandiel1, Omayma A.R. Abozaid2, Mahmoud Mohamed Arafa3, Sahar Omar Mohamed4

Sharjeel Saif1, Asghar Ali Kamboh1*, Ghulam Mustafa Solangi2, Rehana Burriro3, Hasina Baloch1, Atta Muhammad Memon2  

...r, further studies using molecular tools are warranted to validate these findings.

Keywords | Dairy buffalo, M. bovis, Mastitis, Mycoplasma, Survey 

...
Aly M. Ghetas1*, Dalia M. Sedeek1, Hanaa S. Fedawy1, M.A. Bosila1, Asmaa M. Maatouq1, Hoda M. Mekky1, Kh. M. Elbayoumi1,2, Mohamed M. Amer3
...r study was performed to molecularly identify infectious bursal disease (IBD) virus (IBDV) from naturally infected native chickens. Thus, bursa specimens were collected from two IBD vaccinated native broiler chicken flocks showing clinical signs, mortality and lesions of IBD in this study. The collected bursae showed pathological changes related to those of IBD infection. Furthermore, the isolates were molecularly characteri...

Asli Salcioglu

...ify;">In this study, the molecular identification of the three Mediterranean Spicara species was investigated by using the 16S rRNA gene for confirmation of the taxonomic status and also identify incorrectly classified sequences on the GenBank database. The results of the haplotype network and phylogenetic trees show three distinct Spicara haplotypes/haplogroups, corresponding to three different species. Additionally, the number of mutations and high values of...

Yaruq Jabeen1, Nida Ansari1, Haroon Rasheed1, Muhammad Asif Rasheed1,*, Muhammad Awais2, Muhammad Ibrahim1, Sumaira Kanwal1, Aqsa Khalid3, Manzoor Ahmad Zahid4 and Farrukh Jamil1,*

... have been developed for molecular dockings such as LeDock, rDock, AutoDock Vina, AutoDock, UCSF DOCK, GOLD, Glide, Surflex-Dock, LigandFit and MOE-Dock. Among these, AutoDock Vina has been widely used by academia for molecular docking. This tool performs docking of a ligand into a protein by seven steps. For docking analysis of several ligands, AutoDock Vina is a time-consuming tool. In order to make AutoDock Vina more effi...

Hamdy Abdala Elnagar*, Wael Mohamed Wafa, Moataz Ibrahim Badwy, Abdelaziz Mustafa Sakr 

...owed the presence of the molecular weight of proteins of 71, 52 and 31 kDa in BP and SP; 63, 33, and 19 kDa-proteins in SP, and 28 - 30 kDa-proteins in BP is in association with bull fertility (high semen quality). Also, 48, 18 and 16 kDa-proteins were present in the BP and SP of low fertile bulls. Proteins with 16, 30, 34, 35, 36, 37, 63, 64, 175, and 316 kDa were observed in the BP of bull calves. Proteins of BP and SP are related to bull fertility. Determin...

Samah Samir, Amal Awad*, Gamal Younis 

... based on phenotypic and molecular characterization. The frequency of edw1, cds1, qseC and pvsA genes were 75%, 70%, 42.5% and 2.5% respectively. E. tarda isolates displayed high resistance to ampicillin, amoxicillin, clindamycin, cefuroxime, penicillin, and amikacin, while, it is more sensitive to ciprofloxacin. Multi antimicrobial resistance (MAR) was observed in 100% of the tested isolates. In addition, 33 isolates (82.5%) were positive for biofilm producti...

Pan Ziyi1, Ambreen Iqbal1, Gao Zhen1, Liu Juan1, Fang Xibi2, Jiang Ping1* and Zhao Zhihui1

...hisms might be used as a molecular marker for marker-assisted selection in beef cattle breeding.

...

Hua Liu, Wei Hou, Li Peng, Changjun Peng, Yansen Cai and Jing Li*

...sidered to be preferable molecular markers for genetic population analysis. SNP markers that are suitable for non-invasive samples are important to wild population investigations in endangered species. Based on the whole genome sequences of Macaca thibetana, we successfully developed 26 SNP loci that were sensitive to non-invasive samples, then based on which, genetic diversity and population structure of three populations of M. thibetana were estimated. Our r...

Muhammad Zahid Iqbal1, Aneela Zameer Durrani1, Jawaria Ali Khan1, Nisar Ahmad2, Muhammad Usman1,*, Abdul Jabbar1, Saba Usman3, Ahsan Anjum3, Muhammad Husnain1, Nadeem Raza1 and Anwar-ul-Haq4

...study provides the first molecular evidence of coxiellosis in bovines from Pakistan.

...

Abida Shehzadi*, Muhammad Shafique and Ahmad Ali Shahid

Stephen Chijioke Emencheta1, Anthony Amaechi Attama2, Ezinwanne Nneoma Ezeibe1, Adaora Angela Agubata1 and Ebele Benedette Onuigbo1*

...stewaters is a promising molecular tool for E. coli tracking in the environment.

...

Aml M. Ragab1*, Maha R. Basyoni1, Enas A.I. Khoris2, Nadia A. Abd Elghany3 

...us. It was identified by molecular methods based on sequencing of genes, the potential of the groEL gene as a phylogenetic marker, and identified (hbl ,(nhe), (cytK), and (ces) enterotoxigenic genes. B. cereus isolates were analyzed for antibiotic susceptibility. A lab trial was conducted for two weeks using 60 Tilapia fish were divided into three equal groups, (1): kept as control negative, (2): infected intraperitoneally with (0.1ml) 8×107 (CFU/ ml/ fi...
Mubasshir Sohail*, Qadeer Ahmed Soomro, Raza Muhammad, Muhammad Usman Asif and Imran Rauf
...ctivities with different molecular weights. SDS-PAGE showed the presence of endoglucanase activities with molecular weight of 57 kDa.

...

Zaniar A. Abas1, Mohammed Omer Baba Sheikh2,5*, Hardi N. Aziz3, Omed I. Abid4 

...The current study on the molecular characterization of CPV-2 will provide foundations to carry out effective control strategies in the future.

Keywords | VP2 gene, Molecular genotyping, Phylogenetic analysis, Viral evolution. 

...

Nour H. Abdel-Hamid1*, Walid Elmonir2, Eman I. M. Beleta1, Rania I. Ismail1, Momtaz Shahein1, Mahmoud E. R. Hamdy1 

... the bacteriological and molecular techniques (AMOS-PCR) as Brucella (B) melitensis biovar 3 (n=24) and B. abortus bv1 (n=5). The ERIC and RAPD primers (ERIC2 and Operon 18/ RAPD4) used in this study created polymorphic band patterns in all Brucella isolates and the reference strains. ERIC-PCR and RAPD-PCR Dendrograms clustered the B. melitensis isolates into two clusters and three clusters composed of 16 and 13 genotypes with genetic similarity percentages of...

Ghassan Zahid1, 2*, Sara Iftikhar3, Muhammad Umer Farooq4 and Shakeel Ahmed Soomro5

...tors the use of advanced molecular markers is a handy option for the improvement of the fruit germplasm in Pakistan. Additionally, they also have diverse applications in the area of genetic diversity, varietal identification studies, hybrid detection, disease diagnostics and sex differentiation by administering the powerful diagnostic polymorphism detection tools at specific loci and the genome level. This review focuses on exploring the application, recent ad...

Zahra Jamilah Sabrina1, Adrian Pearl Gunawan2, Beryl Reinaldo Chandra2, Ilham Pangestu Harwoko3, Johannes Marulitua Nainggolan4,Widi Nugroho1* 

...wed that micro-CHA has a molecular formula of Ca10(PO4)3(CO3)5(OH) and a crystallinity level of 89.97%. Nano-CHA has agglomerate sizes of 82.68 – 153.00 nm. Emery’s score in the nano-CHA+PRP group was highest amongst all groups (P<0.05). Emery’s score in the micro-CHA+PRP group was higher than that in the micro-CHA and control groups (P<0.05). Emery’s scores in the control and micro-CHA groups were similar (P>0.05). This study ...
Mudassar Jehan1, Masroor Ahmed Bajwa2, Mohammad Masood Tariq2, Asim Faraz3*, Abdul Samaad2, Jameel Ahmad1 and Yousaf Hassan Barozai2

Sri Melia1*, Indri Juliyarsi1, Yulianti Fitri Kurnia1, Evy Rossi2, Hurriya Alzahra3

Amreen Zahra1*, Mushtaq A. Saleem2, Hasnain Javed3, Muhammad Azmat Ullah Khan4 and Abdul Rauf Shakoori4
...dwide. Therefore, a deep molecular insight unveiling the genetic characteristics of the prevailing strains is the need of the hour for successful disease control interventions in endemic countries like Pakistan. Here we present, a detailed molecular and computational analysis of the major genetic constituents, Gag-Pol region of HIV-1 for the very first time in Punjab-Pakistan including three regions of outbreak i.e. Kot Imra...
Basel A. Abokhadra, Samah M. Mosad, Sahar Abd El Rahman*
...e. In the present study, molecular screening of 60 nasal swabs, collected from clinically suspected animals, was established by polymerase chain reaction (PCR) targeting glycoprotein B (gB) gene. Six PCR positive samples were isolated on chorioallantoic membranes (CAMs) of 11 days old Embryonated Chicken Eggs (ECEs) for three blind passages. The CAMs showed thickening and congestion at 1st passage and typical pock lesions appeared at 3rd passage. Indirect immu...

A. El-Shemy1*, Hoda M. Mekky2, M. A. Bosila2, A. M. Allam1, Kh. M. Elbayoumi2, M. M. Amer3 

Limei Yuan1, Kong Yang1* and Dechun Jiang2*

...udy, we investigated the molecular phylogenetic status of R. laoshan and Z. yinggelingensis using mitochondrial DNA (12S rRNA, tRNAVal, 16S rRNA and Cyt b) fragments and nuclear DNA (RAG-1, RHOD, TYR) fragments. Our results revealed that Rhacophorus laoshan is closely related to R. verrucopus, R. orlovi and R. calcaneus, and Zhangixalus yinggelingensis should indeed be placed under Zhangixalus. This research clarified the phylogenetic positions of two species ...

Abdullah Channo1*, Asmatullah Kaka1, Qudratullah Kalwar2, Imdadullah Jamali3, Ghulam Jelani2, Muhammad Bakhsh4, Ghulam Nabi Dahri5 and Jai Parkash Goil6

...c pituitary dysfunction, molecular alteration in growing follicle are important components. COD has been diagnosed by animal behavioral changes, nymphomania, anestrus, repeat breeding, pelvic ligament relaxation, tails head elevation, determination of progesterone level in plasma and milk by using kits of progesterone assay, and to confirm the diagnosis of COD, mostly trans rectal palpation and trans rectal ultrasonography methods have been used. COD should be...

Mostafa El-Sebelgy1*, Hanafy Madbouly2, Sabry Tamam2, Nagwa Ata1, Kawther Zaher1

 

...as a trial to expose the molecular identity of the encountered BTV virus and consequently justifying the PCR negativity encountered before. Therefore, the proteomic approach was utilized. The virus was isolated on SPF-ECE and concentrated using PEG-6000. The concentrate was analyzed using liquid chromatography with tandem mass spectrometry (LC-MS/MS) using a technique called untargeted (label-free) shotgun proteomic analysis. The resultant peptides were used a...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...ting results and lack of molecular evidence in species recognition studies have made this topic more curious and complex. Some plant species compete more vibrantly for below-ground resources when an encounter with neighboring unrelated conspecifics as compared to related conspecifics (kin recognition). Some species increase competition when interacting with related and unrelated conspecifics (niche partitioning); some species do not show any change in the abov...
Gamilat A. Elsaid1, Weam Mohamed Baher1*, Eman Shukry1, Abeer E. Abd El. Ghafar2, Marwa Shalaby1
...ity, Egypt. In addition, molecular confirmation, and detection of shiga toxin coding genes (stx1, and stx2) in the recovered E. coli isolates was done using PCR. Moreover, the inhibitory effects of potassium sorbate (KS) and Bifidobacterium animalis subsp. lactis on the growth of E. coli O26 were screened. The estimated MPN of coliforms and E. coli in kareish cheese collected from grocery stores were 3.44 ± 0.12 and 2.22 ± 0.14. These values were...

Xiaoguang Su1,*, Yanjun Gao2, Yanling Wang1 and Yaohui Ma2

...g the miR-128-3p / EPHB2 molecular axis.

...
Fei Wang1, Xiaofen Hu1, Feng Wen2, Xiaoen Tang3, Shanshan Yang1, Shengwei Zhong1, Zuohong Zhou1, Xu Yuan1 and Yong Li1,*
... correlation between its molecular bioinformatics characteristics and biological function. After the desired RNA was extracted from the intestine of Wahui pigeons, the complete CDS of vasoactive intestinal peptide was obtained by PCR amplification and sequencing, in addition, a variety of bioinformatics analysis was performed to evaluate its structural characteristics. CDS of vasoactive intestinal peptide, encoding 132 amino acids, is 399 bp long in Wahui pige...

Ehab A. Fouad1*, Khaled A. Abd El-Razik2 , Eman H. Abdel-Rahman3

...here were two bands with molecular weights of 73 and 64 KDa, compared to ten bands with molecular weights ranging from 209 to 24 KDa. The isolated fraction showed diagnostic properties of S. aureus mastitis using indirect ELISA with 100% sensitivity and 95 % specificity. The fraction validity lasted for more than one year of storage at -20 ºC. The current study introduces effective way for S. aureus mastitis diagnosis t...

Omnia Mohamed Khattab1*, Hala Kamel Abdelmegeed2, Mohamed Mahmoud Mashaly1, Mervat Hamdy1*, Naglaa Hagag1, Ayman Hamed3, Hanan Aly Fahmy3, Essam Ibrahim4, Momtaz Abdelhady Shahein2, Elsayyad Mohamed Ahmed2

...k in mares using various molecular detection techniques were done using the tentative diagnosis by rt-PCR. The presence of 16 liver and spleen samples out of 20 (80%) from aborted fetuses were positive for EHV-4, but all were negative for EHV-1. Virus isolation trial for EHV-4 were done, eleven samples out of 20 (55%) on the CAM of ECE were positive. The virus glycoprotein B (gB) fragment (580pb) was amplified in selected isolates using the nested PCR (n-PCR),...

Muhammad Akram1*, Muhammad Imtiaz Shafiq2, Amber Malik3, Farmanullah Khan4, Munir Ahmad Bhinder5 and Muhammad Sajjad6

...tudy was to evaluate the molecular role of GST genotypic polymorphism involved in the development of CVD. For this case-control study, a total of 504 participants including 261 CVD patients and 243 healthy individuals were enrolled after taking informed consent. The analysis of the three allelic variants GSTM1, GSTT1, and GSTP1 was carried out through PCR-based amplification. Amplification of GSTM1 and GSTT1 was performed using the specific primers designed by...

Gawhara Ahmed-Abdelmonem1*, Zeinab Aboezz2, Ahmed Habashi1, Saad Sharawi2 

... So, this study aimed at molecular characterization of serotype A FMDV that has been involved in the latest FMD outbreaks in Egypt. Thirty-six samples (26 blood and 10 oral epithelial tissue samples) were obtained from suspected cattle in three Egyptian governorates during 2019-2020. The samples were screened for FMDV by means of real‑time RT‑PCR that showed nearly 86% (n=31) of the examined samples to be FMDV positive. Virus isolation was carried out on t...

Xiangli Dong1,2, Shilin Mikhail Borisovich2, Jiji Li1,*, Jianyu He1, Zeqin Fu1, Yingying Ye1, Julia N. Lukina3, Olga V. Apalikova4 and Jianshe Zhang1

...generates some essential molecular biology tools for the study of L. crocea MRC1 and MRC2 protein structure and function. These tools will enable us to better understand the biological functions of MRC1 and MRC2 in defending against pathogenic bacteria challenge and the innate immune response in the large yellow croaker. These findings also provide a foundation for the preparation of a Vibrio vaccine.

...

Xiaoli Yao1, Xiaofang Yue2, Yue Yang3 and Guobin Zhang3,*

...serve the effects of low-molecular-weight heparin calcium (LMWHC) combined with argatroban on the treatment, vascular endothelial function, inflammatory factors and neurological function in patient with acute cerebral infarction. A total of 80 patients with acute cerebral infarction were randomly divided into 2 groups each of 40 cases, regardless of gender, aged from 55-75 years, who underwent treatment in hospital from January 2018 to December 2020. Each grou...

Xiaoli Yao1, Xiaofang Yue2, Yue Yang3 and Guobin Zhang3,*

...serve the effects of low-molecular-weight heparin calcium (LMWHC) combined with argatroban on the treatment, vascular endothelial function, inflammatory factors and neurological function in patient with acute cerebral infarction. A total of 80 patients with acute cerebral infarction were randomly divided into 2 groups each of 40 cases, regardless of gender, aged from 55-75 years, who underwent treatment in hospital from January 2018 to December 2020. Each grou...

Hanan Saad El-Samahy, Amani Abd El-Naby Hafez, Mohamed Talat Ragab, Disouky Mohamed Mourad*  

...cessary to apply further molecular studies on these pathogens to control and avoid their spread in turkey and other poultry flocks.

Keywords | Bacteria, Multiplex PCR, Sinusitis, Turkey  

...

Alexander Tsybulsky1*, Eduard Kostetsky1, Anton Degtyarenko2, Michail Shchelkanov1,2,3 

...ates an imbalance in the molecular censor systems that protect the health of the cellular genome. Evaluation of the expression levels of this spectrum of genes, especially the gadd45g and ifnλ1 genes, may be useful as an additional criterion for the differential diagnosis of benign and malignant breast diseases in cats.

Keywords | Breast cancer, Mastopathy, Interferon genes, Tumour-suppressor genes, Expression 

...

Heba S.S. Salem1, Hend M. Megahed2, Marwa M. Sarhan2, Maha M. El Alem3, Gehan N. Alagmy3* 

...onal culture methods and molecular confirmation using PCR. All tested S. aureus isolates were positive for virulence-associated genes (nuc, icaA, and Hlg). In an experimental trial, a total of 75 healthy rabbits were divided equally into five groups (n =15/each group). The first group served as a negative control, the second group was injected intra-articulately with S. aureus, did not receive any treatment, and served as a positive control group, the third g...

Amna Sulaman1, Qurat-ul-Ain Ijaz1, Muhammad Shafi2 and Faiz Muhammad1*

...s research validated its molecular identification as T. pyrum. The neighbor-joining results revealed that it clustered with the same species of family Turbinellidae except for the individual of the same species from India’s west coast. Individuals of this species have demonstrated less genetic difference. The present findings will be beneficial for taxonomists and future researchers of the region. 
 

Shomaila Sikandar1*, Imran Afzal1 and Sadaf Sarfraz2

...ignificance of these low molecular weight compounds lies in the fact that they are the contributors of severe health issues in livestock and humans. Every year mycotoxins infect different crops and animal feedstock by accumulating in the food and feed crops in the field and during transportation, which leads to the huge economic losses. Presently about 300 types of mycotoxins have been identified, while, aflatoxins, fuminisons, ochratoxins, trichothecenes and ...

Sohail Nadeem1, Muhammad Aziz2*, Ayesha Mohy ud Din1 and Tayyaba Jamil1

Muhammad Ismail1, Jabbar Khan1*, Zahid Rauf2, Khalid Khan3 and Muhammad Rafi1

...fy;">It was attempted to molecularly characterize breast cancer patients of district Bannu, KP, Pakistan for any possible polymorphism in the estrogen receptor (ESR1) gene. Blood samples in this regard were collected from clinically diagnosed eighteen breast cancer patients, all possessing invasive ductal carcinoma. DNA was amplified through PCR for 2 different sequences of ESR1 gene. Twelve normal individuals of different ages were also characterized. Amplifi...

Aulia Nurul Saputri, I Komang Gede Wiryawan, Dilla Mareistia Fassah*, Dewi Apri Astuti 

...tudy was to identify the molecular characteristics of LAB isolated from the digestive tract of black soldier fly (BSF) larvae on different substrates as probiotic candidates. The LAB from the digestive tract of BSF larvae in chicken manure and palm kernel meal substrates was isolated and taxonomically identified using the 16S rRNA sequence homology and molecular identification. The LAB isolates were also tested for antimicro...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

...d for more comprehensive molecular surveys to estimate its prevalence in wider geographical areas and additional animal species as well as human population.

...

Ahmad Nadeem1,2 and Rubina Arshad1,2,*

...g, biochemical tests and molecular characterization. The co-culturing of LAB isolates with fungal cultures (in vitro) showed that among seven LAB isolates, only three possessed antifungal activity. One promising wild type isolate (LPA6) was subjected to gamma irradiation for mutation induction. Seeds of two chickpea varieties were inoculated with LAB isolates in four treatments comprising of T1 (wild type LPA6), T2 (mutant MLPA6), T3 (wild type LPA6 + mutant M...

Lobna M.A. Salem, Nashwa O. Khalifa, Marwa O. Abd El-Halim* 

...ade possible by advanced molecular techniques. Our study aimed to estimate the prevalence of Fascioliasis and identify the phenotypic features of Fasciola that infecting sheep, cattle, buffaloes, goats, and camels in Qualyobia, Egypt. The genetic identity of Fasciola species was examined by the analysis of forward and reverse sequences of the ITS2 of the rDNA gene that amplified in 300bp. Out of 286 slaughtered animals {88 sheep, 26 goats, 68 cattle, 25 buffal...

Jie Yang1, Wenjun Zhou2, Qi Zhang2, Lei Chu2, Zhenshi Chen1, Xiajun Zhang2, Weidong Wu3*, Shaoru Zhang1* and Lihui Wang1*

...dy was to understand the molecular characteristics of clinical isolates of N. gonorrhoeae and their resistance to azithromycin (AZM) in Danyang, China. Firstly, the clinical isolates of N. gonorrhoeae from January 2016 to December 2020 were collected by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS). Secondly, the drug sensitivity of all clinical isolates was analyzed. Thirdly, polymerase chain reaction (PCR) and DN...

Syeda Batool Zehra1, Abdullah G. Arijo2, Aly Khan3, Nasira Khatoon1* and Samina Waheed1

...ased on two key factors: molecular analysis and statistical analysis. When traditional morphological techniques used with, molecular biology technologies it has proven to be effective in distinguishing closely related species. Statistical analysis is used to determine the intensity of infection in relation to age and gender. This study will focus on children who are suspected of being afflicted with pinworms. The presence of...

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

Saydat Saad Abd El-Megeed1, Walaa Yehia El-Sayed1*, Tarek Khamis2 

...and some biochemical and molecular parameters were determined. The results revealed that ZnO NPs in combination with Empagliflozin suggestively declined the blood glucose levels, lipid profile, and liver and kidney functions. A reduction was recorded in malondialdehyde (MDA), as well as improved catalase (CAT), glutathione peroxidase (GPx), and superoxide dismutase (SOD). A reduction was found in the gene expression in the hepatic homogenate of Patched 1, hedg...

Samaa M Galal1, Sally Ibrahim2, Karima Mahmoud2, Ola Adel1, Aya A. Shokry3, El-Belely MS1, Ismail Sayed Taha1* 

...oes. Hence, the study of molecular control of the CL in Egyptian buffaloes let us to know the mechanisms of this regulation. We aimed to (1) figure out the expression profile of apoptotic genes (TNFα- BAX - CASP3 - FASLG - AGTR2 - and NOS2) mRNAs during early, mid, and late stages of CL and (2) clarify the accompanied changes in progesterone (P4), nitric oxide (NO) concentrations and histological evaluation through different stages of CL in buffaloes. Fo...

Muhammad Tariq Navid1,2*, Mian Muhammad Awais2*, Muhammad Irfan Anwar2 and Masood Akhtar2

...r H9 gene through direct molecular detection. The cultivated oro-pharyngeal and cloacal swab samples were not found positive upon re-confirmation from allantoic fluid through RT-PCR by using same specific set of primers. This study concludes that asymptomatic backyard poultry birds can carry AI viruses and act as potential reservoirs that might be responsible for recurrent episodes of AI outbreaks in a region. The viral shedding through oral and/or cloacal rou...

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

Aslı Çilingir Yeltekin

...a may reflect one of the molecular pathways that play a role in tebuconazole toxicity.

...

Samina Kausar1, Rana Badar Aziz2, Muhammad Waseem3, Muhammad Ahmad3, Hamza Shafiq4, Muhammad Asim5, Usama Zia6, Sobia Afzal7, Wanpeng Xi8*, Mansoor Hameed1* and Muhammad Usman Shoukat9

...f organic, chemical, and molecular or genetic regulation. Carotenoid metabolism and its regulatory network is not only increasing plant “defense” but also enhance the quality of plants. In this overview article, we summarize the results of current research studies on carotenoid metabolism, knowledge about genetic information, and enzymes that are involved in carotenoid metabolism and regulation, underlying carotenoid accumulation, and factors that ...

Hams M.A. Mohamed1*, Katreen K.G.2, M.W. Abd Al-Azeem1, Faysal A. Wasel2, Ahmed M. Abd-Eldayem3 

...teria monocytogenes were molecularly confirmed, while the remaining five were subjected to 16S rRNA sequence analysis and identified as L. innocua (three isolates) and L. welshimeri (two isolates). The antibiotic susceptibility profiling revealed multidrug resistance of L. monocytogenes strains against several antimicrobials in addition, they harbored antibiotic resistance genes, including. ampC, aad6, tetM each present in 100% of our isolates and mefA (37.5%)...

Jinzhao He1, Pengfei Feng2, Junqi Qin2, Yun Teng1, Xu Luo2*, Zigui Chen1*, Huawei Ma2* and Dayan Zhou1

... investigate the genetic molecular mechanism of body color differentiation and variation of red tilapia, selecting the main genes related to the variation and cultivating the pure and stable red tilapia variety. The effects of different temperature treatments on body color and survival of Guam red tilapia, pearl white red tilapia and Florida red tilapia were compared. Besides, comparative transcriptome analysis was used to screen the candidate genes linked to ...

He-Cai Zhang, Tian-Ge Hu, Chang-Ying Shi, Guang-Wen Chen* and De-Zeng Liu

...hic pattern. Analysis of molecular variance (AMOVA) suggested that the genetic differentiation of D. japonica in Taihang Mountains was very great (FST=0.405, P<0.01). This significant genetic variation mainly occurred within populations (59.52%), followed by 36.54% deriving from among populations. As for demographic analysis, positive Tajima’s D and Fu’s Fs values (0.250 and 1.657, respectively) were found in concatenated Cytb/ITS-1 sequences as...

Rahman Ullah1*, Muhammad Junaid2, Nabila Gulzar2, Rahat Ullah Khan3, Baseer Ahmad4, Ambrina Tariq5, Aamir Iqbal6, Mushtaq Ahmed7 and Mirwaise Khan8*

... was carried out for the molecular characterization (identification) ETEC (Enterotoxigenic Escherichia coli) strains in both raw and pasteurized milk available in the market of District Kasur, Punjab (31.0896° N, 74.1240° E). A total of 65 samples of milk including 5 pasteurized milk samples from various sources were analyzed through scientific polymerase chain reaction (PCR) method including other microbiological laboratory techniques (Total plate cou...

Abdurakhim E. Kuchboev1*, Mehmonjon Kh. Egamberdiyev2 

...erent morphotypes. After molecular genetics and morphological analyzes, these land molluscs belonged to 8 different species: Angiomphallia regeliana, Pseudonapaeus albiplicatus, P.maydanica, P. sogdiana, Psedonopaeus sp., Xeropicta candacharica, Deroceras reticulatum and Candaharia levanderi. The infection rate of Pulmonata snails by protostrongilids larvae was 28.2% and that of slugs - 6.8%. In addition, the first informs of P. maydanica, C. levanderi and D. ...
Chunlan Shan1, Chaoying Liu1, Qin Lu1, Guowen Fu2, Syed Aftab Hussain Shah3, Rana Waseem Akhtar4, Ru Zhao2, Libo Gao2, Chang Liu2, Shushu Miao2, Hongdan Wang2 and Hong Gao2*

 

...tiary structures of high molecular weight proteins (HMWPs), encoded by five structural genes, were predicted using bioinformatics tools. These proteins had differences in random curls, α-helix and slight amount of β-sheet. After validation, 10 iron deficient isolates expressed the ferritin HMWPs similar to those of Yersinia. Later on, Kunming mice were infected with E. coli HPI+ and HPI- strains, respectively for the histopathology examination. The ...

Ghulam Akbar1*, Muhammad Anjum Zia1, Amer Jamil1 and Faiz Ahmad Joyia2

...bular chain with 47000 D molecular weight. The fibrinolytic drug is comparatively cheap as compared to all other fibrinolytic drugs. It is the drug of choice in all low income nations and developing countries. The mortality rate with cardiovascular diseases is 85% in less developed countries and 75% prevalence is in women. The wild and mutant strains of Streptococcus mutans were used for this trace element optimization study. There are some salts like KH2PO4, ...

Nauman Zaheer Ghumman, Muhammad Ijaz*, Arslan Ahmed, Muhammad Umar Javed, Iqra Muzammil and Ahmed Raza

...ults revealed an overall molecular prevalence of 28.70% for S. aureus among which MRSA-associated mastitis was found 47.62% prevalent. The SDS-PAGE analysis depicted the presence of a 78KDa protein band specific for PBP2a protein in MRSA. The comparative risk factor analysis showed significant variation among risk factors associated with S. aureus and MRSA-induced mastitis. The phylogenetic analysis of MRSA mecA gene showed a high resemblance of the study isol...

Dzulhelmi Muhammad Nasir1,*, Suriyanti Su2, Van Lun Low3, Zulqarnain Mohamed1 and Norma-Rashid Yusoff1

...owever, in this study, a molecular approach was utilized to produce a more precise and accurate result in an effort to identify, delineate and verify the species. Mitochondria-encoded cytochrome oxidase I (COI) and nuclear-encoded 18S rRNA (18S) genes) were adopted to establish DNA bacodes for 17 species of tetragnathid spiders (Araneae, Tetragnathidae) in Malaysia. Generally, the molecular data of tetragnathid spiders was c...

Aqsa Javaid, Masoom Yasinzai* and Khunsa Saeed Kiyani

...sing Sephadex G-50). The molecular weight of extracellular phytase from B. subtilis KT004404 estimated by SDS-PAGE was 30 kDa. The Km and Vmax of B. subtilis KT004404 phytase were 0.175 mM and 250 U/mL (phytase activity) respectively. The optimum temperature for partially purified extracellular phytase was 40°C, and the optimum pH range for extracellular phytase activity was pH 6.5-7.0. The extracellular enzyme activity was not significantly affected by Cu...

J. Salma, K. Nasira, M. Saima and F. Shahina†

... and T. karachiense were molecularly identified on the basis of 18S
ribosomal gene with accession numbers KY497017, KY979964 and KY979968, respectively.
...

K. A. Tabassum,† J. Salma and H. Sagir

...e="text-align: justify;">molecular characteristics with brief study of S. cholashanense and S. feltiae. S. affine Pak. G.S.356 deposited in
NCBI with accession number MF150033; S. cholashanense Pak.G.S.350 and Pak. G.S.355 with accession
numbers MF125282 and MF0339642, respectively; S. feltiae Pak. G.S. 354, 357, 358 deposited with accession
numbers MF150034, MF158314 and MF144570, respectively.
...

K. A. Tabassum, F. Shahina†, K. Nasira and Y. I. Erum

...y both morphological and molecular
means from different agro-climatic regions of Sindh, Punjab and Azad Jammu & Kashmir, Pakistan. All species
belong to insectivora group on the basis of leptoderan bursa, crochet needle-shaped spicules, normal rectum, lateral
field with six separate lines and had unique ribosomal DNA-ITS, sequence. A compendium of the genus Oscheius
(of both insectivora and dolichura groups) ...

Y. I. Erum and F. Shahina†

...ations were conducted at molecular level, to estimate genetic diversity among wheat germplasm (20 cultivars/lines) in
relation to their response against cereal cyst nematodes Heterodera avenae, through Random Amplified Polymorphic DNA
(RAPD) technique. A total of 589 bands were generated using 14 primers with an average of 28.8 bands/genotype. Maximum
percentage of polymorphic loci was 92.86% for genotype TJ-83. Inferences h...

S. Ahmed†, Q. Liu and H. Jian

...lates were identified on molecular basis using 16S rDNA, physiologically and biochemically and grouped as plant growth promoting bacteria (PGPB). In the green house experiments identified isolates; B.cereus XZ 24-2-1, B. cereus XZ-33-3, B. weihenstephansis MH-58-60-01, B. thuringiensis MH 032-003 and a nematicide (Avermectin) were used as seed coating. All four Bacillus isolates significantly reduced nematode infection of wheat roots when juveniles were used a...

F. Shahina† and G. Mehreen

...de sequences using three molecular makers viz; ITS-1, 5.8S and ITS-2 rDNA (seventy nine); D2-D3 and
28S (LSU) sequences of rDNA region (fifteen) and 12S rDNA mitochondrial gene (twenty nine) to investigate the
genetic diversity. Phylogenetic trees were constructed using two different methods maximum parsimony (MP) and
Bayesian inference (BI) in which most of them form highly to moderately supported clades.
...

Yuejing Yang1,2, Mengbin Xiang1,2, Zhengshi Zhang3, Minrui Zhou1, Bingjie Hu1, Tingsen Jing1, Zhe Li1, Fenglin Liu1, Hui Luo1, Qinglu Li1* and Hua Ye1*

...to acquire some reliable molecular genetic markers for growth traits, correlation analysis between 31 SNP markers and growth traits in S. prenanti was analyzed using 164 samples with the same growth conditions. Principal component analysis showed that the body weight accounted for 94.50% of the variance, the eigenvalue was greater than 1, and the accumulative variance was more than 85%. So, the body weight was the first principal component of the growth traits...

Najam-ul-Sehar Afshan1*, Javeria Majeed1, Abdul Rehman Niazi1, Saima Khanum2, Maria Riaz1, Muhammad Fiaz2 and Shaila Anjum

...of morpho-anatomical and molecular analyses. This is the first report of powdery mildew infection caused by Erysiphe necator var. necator from Punjab and Khyber Pakhtunkhwa provinces of Pakistan.

...

Salman Hussain1, Basit Zeshan2*, Rabiya Arshad1, Saba Kabir1 and Naveed Ahmed3

...dy was conducted for the molecular detection of the mecA, mecC, and nuc gene among MRSA and to investigate biofilm formation among the methicillin-resistant Staphylococcus aureus (MRSA) clinical isolates. A total of 208 different samples were collected and processed for phenotypic and genotypic identification of MRSA. All MRSA isolates were subjected to antibiotics sensitivity, cefoxitin disk diffusion test, and vancomycin minimum inhibitory concentration (MIC...
Safika1*, Ni Luh Putu Ika Mayasari1, Juliadi Ramadhan2
...ed and biochemically and molecularly identified. The Kirby-Bauer disk diffusion method was used to test positive isolates, followed by PCR method to discover the resistance coding genes. The results showed that ampicillin showed 76.0% resistance to Klebsiella pneumoniae, followed by oxytetracycline (72.0%) and tetracycline (68.0%), enrofloxacin (52.0%), and gentamicin (44.0%). All Klebsiella pneumoniae isolates carried the blaTEM gene, 57.20 % contained the te...

Ghada A. Ibrahim1*, Mohamed Sayed Helal1, Nahed Abd Elhafeeze Kamoura2, Mohamed Samir3,4, Amira Mohamed Mazid5, Mohamed F.M. Farag6

JAVERIA NEHAL1, ARIF MUHAMMAD KHAN1, AZHAR ABBAS KHAN*2, MUHAMMAD MUBIN3, HAFIZ MUHAMMAD TAHIR4 & JAVED IQBAL5

Jameel Ahmed1,2*, Mohammad Masood Tariq1, Nadeem Rashid1, Asim Faraz3*, 
Majed Rafeeq1, Irfan Shehzad Sheikh1, Mudassar Jahan1,2, Abdul Fatih1,2
Masroor Ahmad Bajwa1, Ifrah Jameel1, Muhammad Ali1 and Saira Iftikhar4
...tic analysis using ovine molecular markers where fifteen sheep SSR genetic markers were employed for describing multiple-allelomorphism. The average observed number of alleles (Na), effective number of alleles (Ne) and Shannon’s Information Index were 2.07 ± 0.79, 1.86 ± 0.69 and 0.54 ± 0.29, respectively. Heterozygosity was described by the average, observed and expected heterozygosities whose values were found to be 0.56 ± 0...

Chenchen Liu1,2, Tong Wang1, Muhammad Khan3*, Xiaolin Cui2 and Yongming Li1,2*

... colonogenic assays. The molecular mechanism associated with induction of apoptosis includes ROS generation, G2/M phase arrest and inhibition of aerobic glycolysis. Inhibition of glycolysis was found to be linked with down-regulation of lactate dehydrogenase A (LDHA) and glucose transporter-1 (GLUT1). Finally, ALT effectively suppressed growth and induced apoptosis in cisplatin resistant A2780/CR cells. Taken together, our findings suggest that ALT could be de...

Omnia M. Khattab1, Morcos I. Yanni2, Hala K. Abdelmegeed2, Mahmoud Eliwa1, Naglaa M. Hagag1, Sara M. Elnomrosy1

Abubakar Sadiq Muhammad1,2, Latiffah Hassan1, Saleha Abdul Aziz1, Zunita Zakaria1, Hassan Ismail Musa1, 2*, Maswati Mat Amin3 

... farm environments, were molecularly characterized by multilocus sequence typing (MLST) and analyzed against the environmental physicochemical properties from 33 livestock farms in four selected states of Negeri Sembilan, Pahang, Perak, and Selangor in Peninsular Malaysia. Multinomial logistic regression analysis found a significant association between soil water content and ST (sequence type) 84 (OR = 0.833, 95% CI: 0.708 to 0.980; p=0.027) when compared to S...
M. A. Abou El- Nasr1, Kh. A. Dougdoug1, Hayam S. Abdelkader2, and Rehab A.
Dawoud2

A.Y. Ahmad1, M. A. Amer2, T. A. Mostafa1, F. M. Abo El-Abbas1, and M. El-Hammady1

... of their biological and molecular characters were studied using several techniques. Many different symptotypes were appeared on Chenopodium amaranticolar. Ch quinoa. Datura metal and Nicotiana tabacum cvs. Samsun and White Barley as a result of mechanical inoculation. All isolates reacted positively with monoclonal antibody specific to Potato virus Y group N. Reverse transcription-polymerase chain reaction (RT-PCR). hemi-nested and nested-RT-PCR were used to ...

E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2

.... Both immunological and molecular detection methods provide tools assisting in the understanding of the epidemiology and diversity of nepoviruses as well as to facilitate resistance breeding, cultivar selection, and development of control strategies.

...

Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2

E. K. Allam1; Kh. A. El-Dougdoug1; M. A. Amer2; A. A. Abou-Zaid2; and S. M. Amin2

...trophoresis (R-PAGE) and molecular techniques. The method involved the extraction of circular nucleic acids followed by electrophoretic analysis of the extracts on 5% polyacrylamide gel. A reverse transcription-polymerase Chain reaction (RT-PCR) assay was used for the isolation and identification of PSTVd cDNA from infected plant materials using a specific primer to PSTVd. A major cDNA product of approximately 360 bp was successfully hybridized with digoxigeni...

Sahar. A. Shoman1 and B. A. Othman2

...ll be helpful in further molecular characterization of this strain.

...

A. S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik2; Nashwa M. A. Abd El Mohsen1; and H. M. Abdelmaksoud1

...ogical, serological, and molecular characters. Electron microscopy helped for illustration Of Morphology of virus particles as well as alteration in cell organelles. The virus systematically infects most Of Solanaceae plants. but become diverse to different hosts as it induced local lesions and top necrosis on Capsicum annuum L. cvs. California Wonder & Godion as well as Lycopersicon esculentum Mill. cvs. Streen B and Casel Rock. Solanum tuherosum L cv. Ca...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...logical. serological and molecular characterization. Data of the use of Sorghum bicolor vars. Rio and Atlas show successful detection of 7 SCMV strains (A, B. D. E. H. l. and M). The indirect-enzyme-linked immunosorbent assay (I-ELISA) detection Of SCMV strains showed the presence or five strains. i.e., SCMV-A. SCMV-B. SCMV-D, SrMV-H and SrMV-I. The electron microscopy of SCMV-E-infected sorghum plant cells proved the presence or the cytoplasmic inclusions cha...
Zhao Fulin1,2, Liang Chen2, Tao Lin1, Jiang Yanting3, Ouyang Yina3, Hong Qionghua3* and Chu Mingxing1*
... C loci were suitable as molecular markers for litter size in YS, and g. 64266710G> C locus was suitable as a selection marker for litter weight at weaning.

...

Wuritunashun*, Burenbatu, Narenqiqige, Jiuguniang, Eerdunduleng, Shuanglian Wang, Cuiqin Gong, Hashengaowa, Huizhi Jin, Baiwurihan and Chunhaizi

...eins and protein-related molecular pathways that are responsible for the efficacy of Zhenbao pill in the management of HSP.

...

Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5

...cle provides overview of molecular mechanisms involved in photoinhibition and its protective elements.

...

Faiza Siddique1, Muhammad Shahzad Ahmed1, Rana Arsalan Javaid1, Alvina Hanif1, Maria Rabnawaz1, Muhammad Arshad2, Irum Raza3 and Abid Majeed1*

Khitam J. Yahya*, Mohammed T. S. Al-Zubaidi 

...ty and specificity using molecular analysis and sequences. A total of 100 fecal samples were collected from quails in various parts of Baghdad/ Iraq from January to September, and they were then tested for the presence of Cryptosporidium spp. using molecular methods (PCR), followed by DNA sequencing. The overall infection rate was 37% (37/100) of the samples were Cryptosporidium-positive by using PCR. Three of five quails wh...

Fakhra Nazir1*, Sahar Fazal1 and Fakhar-i-Abbas2

...fective tool for species molecular identification and their phylogenetic analysis during this study which may help in identification and biogeographic studies of birds in future.

...

Ying Liu1,2, Ji-Yong Fang2, Na Zheng3 and Hai-Long Wu1*

...hrough morphological and molecular characterization of S. schmackeri sp. nov., we generated new data on the Seuratascaris genus, providing a crucial scientific basis for future studies on the genus. 

...

Yufang Liu1,2, Guiling Cao3, Yujing Xie3 and Mingxing Chu1*

...justify;">To explore the molecular mechanism of the puberty effects on the reproduction of goats, goats at different growth stages from two breeds (Jining Grey (JG) goats and Liaoning Cashmere (LC) goats) were divided into three groups with three replicates (juvenile stage (JG 30d vs. LC 30d, AO group), puberty (JG 90d vs. LC 180d, BO group) and the same age control of puberty (JG 90d vs. LC 90d, EO group). Ovary tissues were taken from goats on 30 days, 90 da...

Muhammad Aijaz1, Nasir Mahmood2, Ghulam Mujtaba3 and Imran Riaz Malik1*

...thy subjects (n=100) for molecular analysis of the human IL-10 gene mutation at the -1082 (G/A) position. Extraction of genomic DNA was done from patients and healthy subjects. An allele-specific polymerase chain reaction determined polymorphism at a position (-1082 G/A). PCR products were analyzed by agarose gel electrophoresis to detect polymorphism. Further analysis was done by sequencing the PCR products from some randomly selected samples. Urban locality,...

Altaf Ur Rahman1, Muhammad Ajmal Khan2*, Ali Hazrat3, Awais Farid4, Muhammad Yahya3* and Inam Ullah5

...er for mode of action on molecular basis.

...
Umer Farooq1,2, Nimra Murtaza2, Abubakar Siddique1, Bilal Saleem1, Obaid Ur Rehman1, Nageen Zahra1, Muhammad Uzair1, Muhammad Naeem Riaz1,3* and Muhammad Ramzan Khan1*
...her exploration into the molecular processes associated with these variances.

...

Supawadee Piratae1*, Noraphat Khiewkham2, Nattawut Maungmungkun2, Chanakan Tippornwong2, Tossapol Seerintra2, Sirikanda Thanasuwan3, Luyen Thi Phung4 

Farha Deba1, Rubina Nelofer2 and Muhammad Irfan1*

...FD7 were verified by the molecular identification investigation using 16S rRNA sequence technology respectively. Out of these seven isolates, the Bacillus cereus FD2 strain produced the most keratinase (298U/mL), and was selected for more research. The Bacillus cereus showed the highest keratinase activity at neutral pH 7.0, with 1% inoculum size, 1% substrate and after 72h of the incubation period. This current study revealed that these isolates have ability ...

Dajun Su1, Tao Deng2* and Mingshui Xie2

...y was to investigate the molecular mechanism of lncRNALOXL1-AS1 regulating the proliferation and apoptosis of ovarian cancer cells by targeting miR-761. Ovarian cancer cells SKOV-3 and normal ovarian cells FTE187 were divided into groups according to the experimental procedures, and were transfected negative, respectively. The expressions of lncRNALOXL1-AS1 and miR-761 in ovarian cancer cells were measured by qRT-PCR (quantitative real-time PCR). LncRNALOXL1-A...

Jie Wang1, Di Fang1, Jianqing Zhao1, Fei Huang2, Bo Liu2, Weikun Tao2, Baoshan Cui2 and Qinghua Gao1,2,3*

...ition categories. As for molecular functional categories, DEGs were significantly enriched in cellular process “,” biological regulation “and metabolic process” during biological processes. Moreover, KEGG analysis showed that the most abundant pathways were oxidative phosphorylation and Wnt signaling pathway”,”MAPK signaling pathway “,” Regulation of actin cytoskeleton “and VEGF signaling pathway”. To...

Nadia Jabeen1, Abdul Mubeen Lodhi1*, Rehana Naz Syed1, Muhammad Ali Khanzada2 and Alia Gul3

...cal characteristics. For molecular characterization, DNA extraction was performed from the samples using a kit , and PCR amplification  was done using ITS4 and ITS1F  primers designed from the conserved regions as described in the previous studies. The amplified PCR products were sequenced from Macrogen Korea, via worldwide scientific Pakistan. Phylogenetic analysis of the obtained sequences was done based on the maximum similarity method using Mega ...

Abeedha Tu-Allah Khan and Abdul Rauf Shakoori*

...ent understanding of its molecular mechanisms is continually increasing, the identification and consequently the roles of transcription factors (TFs) in the respective molecular events under neuroinflammatory conditions in distinct brain regions is still lacking. To address the said gap in knowledge, first we have identified the TFs specific to IL-1β a key player in mediating inflammatory process using online databases....

Lili Zhao1, Fan Zhao1 and Yaping Jin2*

... formation. However, the molecular mechanism of trophoblast cell proliferation, invasion and hormone secretion remains elusive. In this study, we explored the role of GRP78 in the functionalities of goat trophoblast cells (GTCs). The Grp78 gene was efficiently knockout by using the CRISPR/Cas9 system, which resulted in altered morphology and function of GTCs. The cell shape showed a subrounded configuration, and the cell size also significantly increased. Furt...

Reza Esmaealzade Dizaji1, Arasb Dabbagh Moghaddam1*, Arash Ghalyanchi Langeroudi2, Mohamad Foad Heydari3, Seyyed Javad Hosseini Shokouh4 and Ana Shirzad Shahrivar5

...ess’ sub-streaming molecular route for re-epithelialization. Model (deep second-degree thermal wound), PRP, and PRP/BNF groups were each randomly assigned a set of animals. Wounds were monitored daily for many days following therapy to see how they were healing. H&E staining and qRT-PCR were used to examine the pathological alterations in wound tissues and to determine mRNA expression of inflammatory and pro-inflammatory cytokines. We found that the ...

Azza M. El-Kattawy1, Tarek Abou Zed1, Randa Megahed1 and Mohammed El-Magd2*

...veil the biochemical and molecular changes that accompany the application of Sim as anti-arthritic in a mouse model of pristane-induced arthritis. Female Swiss albino mice (20-30g) were randomly divided into 5 groups (n= 10/group): control, Sim control, pristane-induced arthritis, Sim co-treated, and Sim post-treated group. Sim treatment significantly 1) downregulated the expression of immunomodulatory genes [interferon gamma (IFNγ) and lactoferrin (LF)]...

Nasir Ali1,2,6, Muhammad Ilyas2,3, Nazia Akbar1,2*, Gohar Rahman2, Shakirullah Khan4, Mujaddad Ur Rehman6, Abdul Samad5, Habib Ahmad1,2 and Bibi Nazia Murtaza7*

Samia Afzal1*, Jahanzaib Ahmad1, Iram Amin1, Liaqat Ali2, Muhammad Shahid1, Mohsin Ahmad Khan1 and  Muhammad Idrees1

...sses the serological and molecular markers of HBV infections; for example, Hepatitis B envelope antigen (HBeAg), inhibition and reduction of HBV DNA titer during HDV infections. Very few studies described the clampdown of HBV-related markers during HDV replication and the current study is the only report from Pakistani perspective. The objective of this study is to find the interference of HDV in HBV replication, both in HBV chronic active and inactive state p...
Burarah Arooj1, Zeeshan Mutahir1, Moazzam Ali1, Mohsina Akhter2, Malik Siddique Mahmood1, Arslan Hamid3 and Mahjabeen Saleem1*
...and docking analysis and molecular dynamic simulation indicated that the interactions of amino acids Asn 204, Glu 277, Leu 278, Asp 312, Glu 314, Gln 372, Tyr 374, Trp 463, Trp 467 from GH18 catalytic domain with (NAG)2 molecule are involved in the enzyme catalytic mechanism. This is the first time a thermostable chitinase from Paenibacillus sp. Y412MC10 has been cloned, expressed heterologously, and purified.

...

Mamona Jabeen1, Sumra Naz1, Hina Amjad1, Khalid Abbas1*, Sajid Abdullah1, Muhammad Anjum Zia2, Taqwa Safdar1 and Muhammad Sarfraz Ahmed1

...water fish species using molecular markers is important for their management regarding the evaluation of the potential genetic effects induced by anthropogenic interventions. The genetic variability among five natural populations of Channa marulius was studied by using five microsatellite loci in a total of 150 individuals. The C. marulius population exhibited a moderate level of heterozygosity. The mean value of observed heterozygosity ranged between 0.700 &n...

Mahmoud Abdelhady Metwally1*, Mona Abdelftah Ali1, Farouk Abdelmohdy1, Mohamed Kassab1, Tarek Kamal Abouzed2 and Khalil Fathy Abou-Easa1

...described the underlying molecular mechanisms involved. We isolated BMMSCs and identified them using flowcytometry and culture characteristics, then prepared BMMSCs-CM. HepG2 cells were treated with various concentrations of BMMSCs-CM for up to 72 h. The methylthiazolyldiphenyl-tetrazolium (MTT) assay showed decreased proliferation, while flowcytometry showed increased apoptosis and cell cycle arrest in the G0/G1 phase with inhibition of entry into the S phase...

Saad Tahir, Nadeem Ahmed*, Mohsin Ahmad Khan, Muhammad Akram, Rabia Abbas and Kausar Malik

... with 40% yeild having a molecular weight of almost 111kDa. The purified fusion protein (HSA-SK) was also verified via western blotting by using anti-streptokinase antibodies. Clot lysis assay was used to estimate the biological activity of HSA-SK. For half-life estimation, proteolytic and thermal stability of HSA-SK was also checked.

...

Olabode, H.O.K1, Mailafia, S1, Martha Echioda-Ogbole1*, Ameh, J.A1, Amadi, K.I1 and Meseko C.A

... need to conduct further molecular studies to establish the circulating viral field strains for comparism with empirical vaccine strains and create more public enlightenments and awareness campaign about the disease burden and possible zoonotic impact.

...

Muhammad Haseeb Malik2, Muhammad Moaeen-ud-Din1*, Ghazal Kaukab Raja2 and Feroza Hamid Wattoo2

...gned to develop standard molecular markers for Sahiwal to ascertain their purity for breeding purpose. In this study 50 and 48 unrelated males were sampled for each Sahiwal and Crossbred cattle respectively. Candidate molecular markers present in Sahiwal but absent in Crossbred and vice versa were detected using amplified fragment length polymorphism method. Eleven markers were developed that were converted to single nucleot...

Di Zhou1, Qingmeng Long1*, Rong Yang1, Xiaoshan Tan1, Jun Li1, Mingyan Tang1, Zhonghai Zhao3, Ye Ao2, Zhinan Zhou1 and Changxue Chen1

...ponent processes and for molecular function, the genes were related to protein binding, catalytic activity and cell proliferation. Moreover, these DEGs were enriched in the categories of signal transduction, reproductive system, endocrine system and cancer-related pathways and linked the cGMP-PKG, cAMP, TGFβ and mTOR signaling pathways to reproductive performance. We verified these results using qRT-PCR for 9 up-regulated (AMH, CYP19A1, FOXL2, FSHR, GATA4...
Muhammad Abdul Mannan1,2, Sharmin Chowdhury2, Md Abul Hashem3,4 and Md. Hazzaz Bin Kabir1,5*
...the understanding of the molecular epidemiology of Haemonchus contortus in sheep and goat carcasses in the Chattogram Metropolitan area in Bangladesh. A sample of 400 abomasa (150 from sheep and 250 from goats) was collected from five different slaughterhouses in the Chattogram Metropolitan area and analyzed using morphological and microscopic methods. The Polymerase Chain Reaction (PCR) was then employed to amplify the sec internal transcribed spacer (ITS-2) ...

Zhipeng Song1,2, Jialiang Xin1,3, Xiaoli Wei1,2, Abula Zulipiya1,3, Kadier Kedireya1,2 and Xinmin Mao1,3*

Muhammad Fiaz Qamar1*, Tahir Hussain1, Iram Liaqat2, Madiha Kiran1 and Abdur Rahman Ansari1

...res confirmation through molecular assays. 

...

Ihab G. AL-Shemmari1*, Ali Hussein Fadhil1, Mohammed Assad S. Alkabi1, Eman Jawad Jabber2 

...s using a combination of molecular techniques and culture yielded the highest reliable results, suggesting that this method might be employed as a rapid regular screening test. 

...

Jyotsana Shakkarpude1*, Aditya Mishra2, Deepika D. Caesar2, R.K. Sharma3, Anand Kumar Jain2, Sanju Mandal2, Rajesh Kumar Vandre4, Danveer S. Yadav5, Bhavna Ahirwar6 and C.P. Solanki6

...actions. Betaine acts as molecular chaperone, as it repairs heat shock proteins. The present study was aimed to investigate the effect of dietary betaine on heat and metabolic stress during lactation in Murrah buffaloes (Bubalus bubalis). For this purpose, a total of 18 postpartum Murrah buffaloes were randomly divided into control, low betaine and high betaine groups supplemented with betaine @ 50 g/animal/day and 100 g/animal/day respectively from day 5 post...
Ummul Firmani1,3, Rahmi Nurdiani2, Arning Wilujeng Ekawati2 and Happy Nursyam2*
...the bacterial wells. The molecular identification found that the bacterial species was B. paramycoides B2.1. These results suggested that Bacillus paramycoides B2.1, which is found in the digestive tract of milkfish, can be used as a probiotic candidate for fish feed indicated by several probiotic tests that have been carried out.

...

Nguyen Thi Thu Hien1, Dong Huu Rin2, Nguyen Xuan Hoa1, Le Viet Tuan Khanh2, Phung Thang Long1*, Dinh Thi Bich Lan1

...ed a fusion protein with molecular weight of approximately 20 kDa. Moreover, the antibodies against M. hyopneumoniae in sera taken from pigs that were immunized with the PEP inactivated vaccine (HYOGEN®) strong detected the recombinant M. hyopneumoniae P36 protein by ELISA, demonstrating that expressed recombinant P36 protein has the antigenicity and is specific for M. hyopneumoniae. In summary, we have successfully cloned the gene (432 bp) encoding the M....

Hayder M. Watban1,2, Nabeel M.H. Al-Maaly2

...cteria were subjected to molecular detection using conventional PCR and sequencing. The finding showed that Klebsiella pneumoniae were 31 out of 74(41.89%) from total 100 camels that slaughter in the abattoir. This study indicates that Klebsiella pneumoniae reported higher infection rate as it is the predominant bacteria isolated from pneumonic camels which slaughter in Al-Muthanna abattoir.
 
Keywords | Camels, Klebsiella pneumoni...

Waqas Ahmad*, Muhammad Naeem

...dy successfully reported molecular identification and genetic diversity of N. notopterus. Moreover, low genetic diversity reported in Chenab is matter of concern for fish resource managers and need to take constructive steps for its conservation.
 
Novelty Statement | DNA barcode base molecular identification and genetic diversity of N. notopterus evaluated from Satlu...

Abdul Kabir1*, Anees Ur Rahman2, Inzamam Ali Shah2, Ibad ur Rahman2 

...r improved surveillance, molecular characterization, and vaccine development for buffalopox.
 

...

Muhammad Nauman Arif1, Muhammad Mansha1* and Tanveer Hussain2

...t there are insufficient molecular data, provoking us to explore its genetic variation and phylogenetic analysis using ATPase 6/8 genes of mitochondrial DNA. The blood samples from hog deer were collected and DNA was extracted by using in-house organic methods. PCR was used to amplify a total of 880 bp of overlapping genes, which were then sequenced. Bioedit software was used to align, and edit the sequences, and single nucleotide polymorphisms (SNPs) were eva...

Hafsa Saeed, Soumble Zulfiqar, Abeedha Tu-Allah Khan and Abdul Rauf Shakoori*

...e. This study focused on molecular characterization of ZntR, a transcriptional regulator of znt operon. The minimum inhibitory concentration of zinc, lead and cadmium were 10, 10 and 4 mM, respectively against K. pneumoniae KW. The strain also exhibited metal uptake and storage ability. Having amplified and cloned zntR gene, expressed and purified ZntR protein showed binding with zntA promoter. Increased transcripts of zntR in the presence of metal ions reveal...

Khansa Jamil1, Muhammad Ramzan Khan1, Asad Jan2 and Ghulam Muhammad Ali1

...pounds were subjected to molecular docking from which all targeted compounds received scores ranging from (−3.5 to −5.9) kcal/mol with targeted protein. Hence the study revealed that bioactive compounds derived from the Caralluma tuberculata plant pose highly antibacterial activity and might be used to synthesize the antibacterial drug.

...

Abida Mushtaque1, Ali Ahmad Sheikh1, Aamir Ghafoor1*, Wasim Shehzad2 and Nadeem Ahmad3

...fied rOmpH protein had a molecular weight of 36 kDa and concentration around 0.973 mg/mL. The BALB/c mice group injected with 100 ng of purified rOmpH exhibited significant protection (80%) when challenged with LD50 of P. multocida B:2. From the obtained results it is evident that rOmpH can be used as subunit vaccine against P. multocida B:2 and the purified rOmpH can also be further used to develop diagnostic test i.e., ELISA to screen and assess the immune r...
Muhammad Javed Iqbal1, Farah Rauf Shakoori1*, Bushra Muneer2 and Abdul Rauf Shakoori3
...% respectively. Further, molecular subtyping was done on the bases of cellular expression of hormone receptors by IHC and found 80% Luminal A, 12.5% Luminal B, 5% HER2 enriched and 2.5% Basal-like. Screening of mutations in PIK3CA, AKT1, MTOR and PTEN genes was carried out and analyzed by Next Generation Sequencing (NGS) using the Whole Exome Sequencing (WES) to explore possible mutations in PIK3CA, AKT1, MTOR and PTEN genes. The results revealed that there we...
Mahmoud M. Bayoumi
...ges over conventional or molecular-based vaccine types. The mRNA vaccine only encodes the target viral protein, with no infection hazard or even nucleic acid integration. Furthermore, mRNA vaccines can stimulate both specific cellular and humoral immunity in a short time scale to combat a life-threatening or emerging viral disease. This review will comprehensively cover the recent advances in mRNA vaccine production, the delivery methods, and the essential com...
Akram A. Salama1, Moustafa A. Zaghloul2*, Ahmed A. Zaghawa1, Mohamed A. Nayel1, Ahmed M. Elsafey1, Mohamed F. Azooz2, Hanem S. Harb1 and Walid S. Mousa1

Milena Vlahovic*, Dragana Matic, Marija Mrdakovic, Larisa Ilijin, Anja Grcic, Aleksandra Filipovic, Jelica Lazarevic and Vesna Peric-Mataruga

...ition to biochemical and molecular research, PMM can be used for studying the cadmium effects to gain a better insight into the state of the organism under stress conditions.

...

Taidong Wang1, Xiaowei Huang1, Jian Huang2, Guangfu Lv3 and Zhe Lin1*

...sing DAVID database, and molecular docking verification was performed on the core targets after topology analysis. Subsequently, 24 rats were randomly divided into control group, model group, wild high-dose group and wild low-dose group, 6 rats in each group. Results of in vivo experiments showed that high-dose group (P<0.01) and low-dose group (P<0.01) significantly decreased body temperature in rats; high-dose group significantly decreased TNF-α,...
Yi Zhao1,2,3, Lei Luo1,2, Liqi Tan4, Jianhua Huang1,2, Dongliang Liu1,2,5, Shigui Jiang1,2 and Lishi Yang1,2*
...emperature stress at the molecular level, and benefit to develop the strategy to defend the damage in the crayfish aquaculture caused by the temperature neither in the different regions nor in the different season.

...
Muhammad Fiaz Qamar1*, Tahir Hussain1, Iram Liaqat2, Madiha Kiran1, Abdur Rahman Ansari3, Faiza Yasmeen1 and Tahira Batool3
...ion by means of advanced molecular techniques. 
...
Annum Razzaq1*, Zia Ullah2, Arooj Naseer1 and Abdul Nasir Khalid1
...mical details. Moreover, molecular techniques have been used to amplify its ITS region of nrDNA and sequenced for phylogenetic analyses. This genus is a new record for Pakistan.
...

Elkalamawyl, I.M.; Elhddadl, S.; Swelim2, M.A.; Hamdy2, S.M. and Fahmy3, Hanan A.•

Yousifl ,3 , Ausama A. and Al-Naeem , Abdelmohsen A.

...inability to monitor the molecular epidemiology of the virus in the environment. It also reduces our capability to evaluate vaccine-based control strategies. OPV continues to persist in nature and re-emerge. We were able to isolate a CMLV from an outbreak in the Eastern Provence of KSA in 2009. The infection produced mild clinical signs in adults and camel calves. We were able to confirm that the isolate was indeed CMLV using PCR and partial sequencing of the ...
Hagag, N.M.*•, Arafa, A.*; Shalaby, M. A. ** El-Sanousi, A. A. **and Aly, M. M. 
... poultry. Application of molecular methods such as Reverse Transcriptase polymerase chain reaction (RT-PCR) and Real time RT-PCR (RRT-PCR) as a rapid, specific and sensitive detection methods currently used in national and reference laboratories worldwide. In this study a comparison of the specificity and sensitivity between 2 different formats of conventional RT-PCR (one and two steps) and 3 different formats of RRTPCR (one step using TaqMan probe, two steps ...

Omarl , Dalia M.; El-Ibiaryl , Elham A.; Sadik2, Atef S.; Abdel-Ghaffar2, Mamdouh. H. and Othman2, Badawy A.

El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...logical, serological and molecular analysis. The isolated virus gave positive reaction with CMV antiserum but not with antibodies of WW and SqMV using DAS-ELISA. CMV was able to infect different host plant species including squash, pumpkin, pepper, bean, Chenopodium amaranticolor and cowpea showing foliar symptoms of mosaic, deformations and necrotic and chlorotic ring spots, that resemble those induced by CMV. SDS-PAGE test showed various distinguishable sole...

Nasr-Eldin1 , M. A.; El-Dougdoug2, K. A.; Othman2, B. Ahmedi , Sabah A, and Abdcl-Azizl , S. Il.

... biological indexing and molecular methods. In the present study, direct tissue-printing and dot-blot on the membranes, procedures has been applied on a large scale for an initial screening of HSVd, CEVd and PSTVd in Egypt. The results showed that the tissue print assays allowed clear discrimination between healthy and viroid-infected grapevine plants than dot-blot hybridization, the number Of HSVd-infected grapevine plants were 10 plants, PSTVd were 10 plants...

El Sayed l , Yasmein A.; Ghareeb2 , A.; El-Dougdoug3, K. A. and Bekheetl , H. K.

SHARAW11'2*S S. S. A.; AL-HOFUFY2, A. N. and AL-BLOW12, M. H.

...e been described for the molecular detection of camel pox virus (CPV). This study reports the development of a Real-time polymerase chain reaction (RT-PCR) for detection of CPV using SYBR green I chemistry. A total of 15 specimens from camels suspected of being infected with CPV were collected from Riyadh Province during 2009 and submitted for virological investigation at the Central Veterinary Diagnostic Lab. (CVDL), Riyadh, Ministry of Agriculture; KSA. In s...

*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'

Madbouly, H.M; Orkhan, M.H**; Nagwa El-khoty

...ypt. These isolates were molecularly characterized and compared with those H5Nl strains isolated during January 2007 from the same locality. The strains isolated from infected chicken during 2006 were closely related to A/ty/Turkey/l/05 strain which had been isolated from turkeys in Turkey 2005 and to MVietnam/1194/04 strain isolated from human cases of Al H5Nl and induced higher case fatality in human in Viet Nam.   phylogenetic analysis of haemaggl...

Arafa, A.; Kanawaty, Z.; Abdclwhab. E. M.; Hassan, M.K.; and Aly M.M.

Hassanein, S.A.*; Ibrahim, A.K**; Mervat, M.M.* and   Nahed,K.A.*

...s can be applied for the molecular epidemiology of BHV -l.

...

JEHAN A. M. GAFER.' HUSSEIN, H.A. and REDA I.M.

...logical, serological and molecular assay.

...

Eman, Abo Hatab*; Hussein, HA.; El-Sabagh IM. and Saber, MS.

...ployed and confirmed the molecular characterization Of the isolates viruses with the correct and expected bands. The RT-PCR specific band of VP7 gene of two selected isolates was eluted from the agarose gel and sequenced using VP7 specific primers sequence. The obtained sequence was analyzed using computer software (BLAST) which revealed that both isolates had Maximum identity to the GIO serotype of group A bovine rotaviruses ranging from 90-93%. This is the f...

Mayada A. Abd Elgalell; B.A Othman2; Th. Radwan, 1 and Amal S.M. Abo-Sinna3

...he nucleic acid DNA with molecular weight of 2223 bp and 2559 bp for PPI and PP2 respectively.

...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

...e coat protein gene as a molecular procedure for diagnosis. Electron microscopy of purified preparation of PRMV showed presence of isometric particles 28 nm in diameter. Ultrathin section for electron microscopy examination of infected peach leaves shows virus particles in vacuoles. Tubules structure scattered in the cytoplasm or associated with plasmodesmata was shown. Extensive severe degeneration of chloroplast and mitochondria structure as well as developm...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...ts using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other published sequences of the Same virus shows 79.4% - 84% homology.

...

A-New-Whitefly-Transmitted-Geminivirus

...genetic diversity at the molecular level for the two isolates showed that the coat protein and the replicase genes of putative TYMV-QaIubia are not identical to TYLCV resembled genes, at least at the flanking regions of each gene. According to the results obtained from the PCR products and indicator host plants, it can be concluded that they are two different Geminiviruses. Based on host range and symptomatology, the TYMV-QaIubia appeared to cause infections o...

Seham A. El-Zeedy1, Dalia A. Abd El-Moaty1, H. A. Hussein2 and M. A. Shalaby2

A. A. El-Kholy1, S. Vilcek2 and A. M. Daoud1

...nt study offers a useful molecular epizootiological tool to group local BVDVs in a herd-specific manner at a geographic region to recognize new virus introduction and thus to improve local vaccines and diagnostic assays for effective control policies.

...

Nahed A. Mohamed l, H. A. Hussein2, Fathia M. Mohamed1 and M. A. Shalaby2

...or further antigenic and molecular characterization using virus neutralization test and different formats Of PCR assays. The results revealed that the isolated BVDV field strains (3 from Cairo designated as Cairo/10/99: Cairo/12/99 and Cairo/13/99 and 2 from Suez designated as Suez/60/99 and Suez/68/99) were of BVDV type I.

...

Ausama A. Yousif1,3, Sandy M. Watkins1, Lyle J. Braunl, David J. Hurley2 and Christopher C. L. Chase1

 

...001). BVDV type-specific molecular beacons were used to estimate the effect of the presence of two BVDV RNA genotypes on the RNA relative replication efficiency of each genotype by comparing Ct values obtained from the samne reaction tube in a real-time RT-PCR. This was done in bovine and ovine cultured cells following simultaneous- or superinfection with different biotypes and genotypes of BVDV. The noncytopathic BVDV-2 890 blocked superinfection with the cyt...

Rana Mohammed Ibrahim1*, Haider Mohammed Ali Al-Rubaie2

Zhengfei Wang1*, Chenchen Shen1,2, Yiping Zhang1, Dan Tang1,3, Yaqi Luo1, Yaotong Zhai1, Yayun Guan1, Yue Wang1 and Xinyu Wang1

...lucidations of olfactory molecular mechanism in Procambarus clarkii, and provided further insight for a better understanding of olfaction molecular mechanism in crustaceans.

...

Faisal Alzahani1* and Mohammed Abu El-Magd2*

...t the precise epigenetic molecular mechanisms for the combined therapy are still unclear. This study aimed to investigate the epigenetic mechanism of CAPE and/or CNPs on human HepG2 cells. The results revealed a significantly higher cytotoxic effect for CAPE on HepG2 cells than CNPs. The combined therapy with CAPE and CNPs exhibited significantly higher expression of the apoptotic Bax gene and lower expression of the antiapoptotic Bcl2 gene than treatment with...
Zeynep Karapinar1* and Mehmet Özkan Timurkan2
...of infection, to perform molecular characterization of the virus at the VP2 gene level, and to investigate genomic differences. FPLV DNA was detected in 7 (36.84%) of the stool samples collected from 19 cats with diarrhea and vomiting symptoms. Genotyping and phylogenetic analysis of the positive samples were performed. It was observed that five of the FPLV positive samples obtained were in the G3, one sample was in the G1, and one sample was in the CPV-2b gro...

Sarah G. Yousef1*, Ahmed Shehta2, Hend M. El Damaty1 and Hussein A. Elsheikh3

...dy was conducted for the molecular investigation of MAP in cattle reared for small-scale dairy production in Sharkia Governorate, Egypt. Seventy-five fecal samples were collected from diarrheic and healthy dairy cows that came into contact with diarrheic ones for molecular screening. Clinically, 32 of 75 examined cattle showed variable degrees of body weight loss and diarrhea. The PCR targeting the insertion sequence IS900 g...

Lingang Dai1,2,3, Xiang Chen1,2,3, Jiajin Huang1,2,3, Jiali Xu1,2,3, Meimei Xiao1,2,3, Jiajing Chen1,2,3 and Yong Ruan1,2,3*

...d be used as a potential molecular breeding marker for research.

...

Tinda Afriani1*, Jaswandi1, Yurnalis1, Putri Oktavially1, I Made Merdana2 

...thod employed involved a molecular analysis of growth hormone in the exon 5 gene using Polymerase Chain Reaction (PCR), alongside a qualitative analysis of the characteristics exhibited by the FH and Pesisir cattle crosses. The identification results regarding the diversity of the GH gene found 14 point mutations, including six transversions, namely, C>G 1343 bp, T>G 1376 bp, C>A 1438 bp, G>C 1570 bp, A>C 1720 bp, and G>A 1744 bp. Additionall...

Siqiang Li1,2, Tiantian Wang1, Peng Sun1, Airong Gao1, Xin Gong1, Yuanhong Xu2, Baogen Wang2, Jun Wu1* and Bo Liu1*

...tructed via conventional molecular cloning methods, and expressed in a 5-liter fermentation tank. The target protein was purified in three-step purification and identified by peptide mass of fingerprint. The enzymatic activity and optimal reaction conditions of MDS I were detected using DNA sequencer-assisted fluorophore-assisted carbohydrate electrophoresis. We obtained MDS I with a purity exceeding 90% in gram scales, which was capable of digesting α-1...

Kadhim Kh. K. Al-Khayat1*, Athmar K. A. Al-Azawi2

...d on morphologically and molecular detection by using NAD1 and COX1 genes and conventional PCR during the period from 1/ March / until 31/ May/ 2022 in Baghdad city, Iraq. Rabbits were humanely euthanized and abdomen opened longitudinally to looking for any cyst may be founded grossly in the peritoneal cavity or on the visceral organs, all cysts were examined for their structures scolex, membrane and the size measurements. The fluid was collected from each cys...

Babi Kyi Soe1*, Toe Win Naing2, Su Lai Yee Mon1, Nay Chi Nway3, Hiroshi Sato4

...sing both microscopy and molecular techniques. A total of 59 samples were collected from Mingaladon township, Yangon region, and the presence of infection was assessed using a Giemsa-stained thin blood smear and PCR of 16S rRNA gene amplification. Both microscopic and PCR-positive samples were further analyzed for hematobiochemical alteration. As a results, Anaplasma spp. was detected in 3.38% (2/59) of sampled animals. Hematology results revealed severe anemi...
Sijie Jian1,2,3,4, Wei Sun1,3, Jia Chao1,2, Na Rong1,4, Xiang Liu1,2,3,4* and Chen Chen1,2,3,4*
...ish. Slp was obtained by molecular cloning, expression and purification, and the expression conditions were optimized. In mice immunized with Slp, the immune-related factors of LZM and AKP were enhanced (p < 0.05), and a specific antiserum titer (1: 3200) was obtained that had immune recognition effects for A. hydrophila and P. fluorescens. Passive immunization of Carassius auratus with Slp mouse serum and challenging with bacteria showed a passive protecti...

Lijuan Liu1, Jinghang Chen2*, Min Wang3 and Wei Li4

...ology combined with macromolecular compounds can extend drug pulmonary residence; mannose modification or acid-sensitive bond linkage can achieve drug release in alveolar macrophages; and personalized modified prodrugs can achieve drug release in alveolar macrophages. It is possible to produce physicochemical qualities suited for inhalation administration while reducing medication toxicity. Overall, using prodrug technology may be able to meet the different ne...

Feri Eko Hermanto1, Yuli Frita Nuningtyas1, Filoza Marwi1, Fajar Shodiq Permata2, Agus Susilo1, Muhammad Halim Natsir1*

MUHAMMAD ASLAM1*, ZAHRA NOREEN2, AMINA ASGHAR1, ABRAR HUSSAIN2, RASHAD MEHMOOD3, MUHAMMAD USMAN KHAN4, KAYNAT SALEEM5, MUHAMMAD TAHIR HUSSAIN6* & ASMA CHAUDHARY7

...d,p) basis set. Frontier molecular orbital analysis has been executed at B3LYP/6-311+G(d,p) level of theory. The global reactivity parameters were explored using the energy of frontier molecular orbitals. Natural bond orbital analysis has been carried out at B3LYP/6-311+G(d,p) level of theory to discover hyper conjugative interaction and stability of the title molecule. Moreover, the product showed the reverse urease inhibit...

HIRA MUBEEN1, 2*, AMMARA NASEEM1, AMMARA MASOOD2, SHAHID RAZA3 & NAUREEN NAEEM3

...gulation is an important molecular process for monitoring overall expression level of genes in plants. The expression of genes is regulated by certain regulatory elements including, Cis-acting regulatory elements (CRE), transcription factors (TFs) and promoters. Cis-acting elements are actually specific class of DNA binding proteins that act at particular site of DNA. Promoters are part of DNA fragment essential for transcriptional regulation of genes with cer...

*SHAJAHAN BAIG1, MUSHTAQ AHMAD SALEEM1, MUHAMMAD AZMAT ULLAH KHAN1 ZEESHAN NADEEM2, SUFIAN AHMED2, MEMUNA GHAFOOR SHAHID3 & TANZEEM AKBAR CHEEMA3

FOZIA HUMAYUN1, ZARRIEN AYUB2, MUHAMMAD SAMEE HAIDER3 & SYED ABID ALI1*

...f the shell and used for molecular identification and biochemical analysis (Amino acid profiling). Macro/micro morphology of the shells was also studied by scanning electron microscopy and energy dispersive X-ray spectrometry. The analysis of nutritional status of the three Siphonaria sp. revealed quite similar profiles among the three Siphonaria sp with the presence of nine essential and nine non-essential amino acids. Our results successfully established the...

MARIAM ZAHEER*1, SYED SHAHID IMRAN BUKHARI2, MUDDA

... or homopolymeric. Their molecular weights vary from 10 to 1000 kDa. Exopolysaccharides have multifarious applications in different fields of life. These EPSs are used as anticoagulant, immunomodulator, emulsifiers, anticancer and bioflocculants. They are widely used in food industry and bioremediation. This review article describes sources, synthesis, fermentation, extraction and applications of exopolysaccharides.

...

MUHAMMAD NAEEM RAZA1, KALSOOM SUGHRA1* & NADIA ZEESHAN1

... cases were subjected to molecular genotyping on Real Time PCR (Applied Biosystems, Step One software). Results show 2750 out of 3540 (77.6%) suspected patients were positive for HCV-RNA. Female have higher percentage (57.78%) than male (42.22%) with highest viral load observed at age group 15 to 30 years. The genotype 3a (83.33%) was dominant to other circulating genotypes as 2b (13.33%) and mixed 3a/2b (3.33%). The highest prevalence of HCV infection was not...

SHEIKH AJAZ RASOOL1, MUHAMMAD SALMAN RASOOL2 & MUNAZZA AJAZ3

...acteria have evolved the molecular genetical basis (and other parameters) for acquiring the resistance. For the containment and eradication of globally evolving MDR bacteria, it is crucial to understand and implement certain strategies/agents such as, probiotics, CRISPRs, bacteriophages, nanotechnology and phytochemicals.

...

Ngoc Tan Nguyen1*, Thi Tuong Vi Trang1, Thi Thuy Tien Nguyen2, Tuan Thanh Hoang2, Duc Thoa Nguyen2

...fficient can be used for molecular-aided selection to improve egg production in native chickens, requiring more in-depth study.
 
Keywords | Dual-purpose chicken, Egg production, Polymorphism, Prolactin gene, Promoter regression
...

Anisa Mushtaq1, Murtaz ul Hasan1*, Asim Shamim2, Muhammad Ali Abdullah Shah1, Muhmamad Arif Zafar3, Abdul Asim Farooq4, Aayesha Riaz1, Muhammad Kamran1 and Saif ur Rehman

...sed on morphological and molecular identification of ixodid ticks, using morphological keys and an internal transcribed spacer (ITS-2) Deoxyribonucleic acid (DNA). Moreover, the presence of Babesia and Theileria species was also investigated in ticks using 18S rRNA gene. Identification of ticks collected from 384 cattle and 384 buffaloes screened revealed three tick genera and six tick species: Rhipicephalus microplus, Rhipicephalus decoloratus, Rhipicephalus ...

Habibeh Jabbari

...ogical, morphometric and molecular features, four out of those populations isolated from the rhizosphere and roots of four different cabbage cultivars were subjected to further studies. All the populations showed same range of morphometric and morphological characters fitted thoroughly with the identity of H. cruciferae. Different primers for amplification of ITS1-5.8S-ITS2, D2-D3 rDNA and hsp 90 genes, showed similarity between the nematode populations. ITS-R...
Samia S. Alkhalil1, Faisal Al-Sarraj2, Abeer S. Aloufi3, Zuhair M. Mohammedsaleh4, Mamdoh S. Moawadh4, Fayez M. Saleh5, Majid Al-Zahrani6, Waheeb Aggad7, Youssef S. Alghamdi8, Mutaib M. Mashraqi9, Saleh Alshamrani9 and 
Mona H. Soliman10,11*

Zhenkun Zhao1,2, Ziniu Alimo2, Xinyue Zhao2, Haifen Qin1, Buddhi Dayananda3, Lichun Jiang1,2* and Wei Chen4*

...y should focus on adding molecular markers and taxa samples and use both effectively to reconstruct a better resolution for disputed species.

...

Ahmed Kareem Kadhim Al-Wasmee1, Waddah Salam Hassone2, Hawraa Talib Al-Janabi3, Hamed AH Al-Jabory1

Mir Manzar Ud Din1*, Naveed Ahmad1, Muhammad Salman1, Fazli Amin1 and Saeed Ud Din

...rties. We delve into the molecular composition of silk protein, the mechanisms of silk synthesis, and the factors that influence its physical and mechanical properties. Furthermore, we explore the potential applications of silk protein in various fields, such as biomedicine, textiles, and materials science. This research paper aims to deepen our understanding of the biochemistry of silk protein and highlight its significance in diverse domains.

...

Amir Afzal1*, Sairah Syed1, Hafiz Husnain Nawaz2, Ruqeah Mustafa1, Marjan Aziz1, Madeeha Khan1, Azra Khan3, Uzma Javed1, Attiq Ur Rehman4, Rubab Altaf 5 and Qamar Shakil6

...rential host plants, and molecular techniques such as PCR and DNA sequencing are discussed as effective tools for tracking Pst populations, identifying new introductions and monitoring their evolution over time. A combination of traditional and molecular techniques has generated valuable data for understanding populations virulence of Pst.

...
Sangita Shrestha , Glenn C. Graham , Donald S. Loch , Stephen W. Adkins

Safdar Abbas1, Jawaria Ali Khan1*, Syed Saleem Ahmed1 and Aftab Ahmed Anjum2

...tudy is to look into the molecular occurrence, haemato-biochemical changes, and risk factors associated with the occurrence of BCoV infection in cattle calves at different dairy farms and small households in the district of Jhelum, Pakistan. From July 2020 to June 2021, 200 faecal samples were collected from newborn cattle calves exhibiting symptoms of diarrhoea and dysentery. S&C Biotech Bovine Coronavirus Antigen Rapid Test Kits were used to screen sampl...

Hanan Yousif Jasim1*, Rasha Munther Othman2, Wasan Moaed Shaker3

Pavana Jyothi Vanjavaka1, Mouradam Veerasami2, Mohana Subramanian Bhaskaran2*, Vijay A.K.B. Gundi1*

...hogenicity. In contrast, molecular characterization has become an essential tool in comprehending the evolution of viruses. For studying the molecular level changes, 28 field isolates were collected from various regions in India and subjected to PCR for amplification, with sequencing of a partial region of the VP2 gene. Among these isolates, 27 samples were positive for CPV, of which one was CPV 2b while the remaining were C...

Zhenyu Chang1,3, Qingqing Xiao1,2, Yourong Ye1,2, Mujahid Iqbal4, Mengqi Duan1,2, Yangzom Chamba1,2* and Peng Shang1,2*

..., biochemistry, 16S rRNA molecular biology and acid and bile salt tolerance tests. The results showed that, screened strain is Lactobacillus Roy’s F1. Tibetan pig source Roy’s Lactobacillus F1 showed the ability to grow maximum when the inoculation was 1%, the temperature 37 ℃ and pH = 7. This strain depicted a strong tolerance for artificial gastric and intestinal juice. Roy’s Lactobacillus F1 can inhibit the growth of Staphylococcus aureu...

Zhiwen Xu

...were used to explore the molecular mechanisms by which Snail/Slug promoted OSCC cell proliferation by regulating YAP. The activation of the Snail/Slug pathway promoted the progression of OSCC. The Snail/Slug regulated the OSCC process via targeting YAP. Inhibition of the Snail/Slug pathway, however, reversed the effect of YAP on OSCC. These findings suggest that the Snail/Slug pathway promoted OSCC progression by targeting YAP.

...

Rumisha Raza1*, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Muhammad Tayyab1, Aftab Ahmed Anjum2, Muhammad Muddassir Ali1 and Sehrish Firyal1*

...ridae and Falconidae, at molecular level using mitochondrial ND2 gene. The partial sequence of ND2 gene was submitted to GenBank. The novel SNPs were investigated which serves as marker for identification of Pakistani raptorial species. Two sub species of falcons are also characterized at genetic level for the first time. The study represented the first report on genetic data of raptorial species of the Pakistan. This strategy can be used to identify other spe...
Qurat-ul-Ain Ijaz1, Amna Sulaman1, Dost Muhammad Baloch2, Muhammad Shafi2, Faiz Muhammad1* and Shahnaz Rashid1
...cteristics. Therefore, a molecular based identification approach was used to confirm the variety of gastropod species commonly found on the coast during low tide at rocky shores. In the present investigation, nine species of gastropods were identified using the foresaid modern technique such as (Thalessa savignyi, Purpura persica, Turbo sparverius, Lunella coronata, Cellana karachiensis, Nerita albicilla, Nerita tristis, Ischnochiton australis, Astralium tento...

Sardorbek N. Turgunov, Oybek O. Amirov*, Erkinjon B. Shakarboev, Abdurakhim E. Kuchboev

... on the morphometric and molecular characteristics of the nematode Parascaris equorum collected from horses of the Fergana Valley, Uzbekistan. The total length of the male Parascaris equorum nematode was 175.5±3.86 mm, and that of the female was 293.7±4.83 mm. For molecular genetic studies from the collected samples, genomic DNA was extracted using the head of male of P. equorum species. QIAamp DNA Mini Kit rea...

Iwona Szatkowska1, Jan Udała2, Daniel Zaborski3*, Ewa Czerniawska-Piątkowska1, Wilhelm Grzesiak3, Małgorzata Wasielewska1 and Jerzy Wójcik4

...s aspects, including the molecular reason, are still controversial and require further detailed research.

...

Noor Rahmawati*, Dea Indriani Astuti and Pingkan Aditiwati

...as carried out using ITS molecular analysis. Thirty strains of endophytic fungus were taken from twigs and leaves. Based on the early TLC examination, a number of endophytic fungus showed the presence of compounds with antioxidant function. Endophytic fungi crude extracts have been shown to be able to inhibit DPPH radicals by up to 86 percent by A26 and A19 and by 80 percent by B3 in spectrophotometric studies on cultures with antioxidant activity. This is the...
...gically, to characterize molecularly C. pseudotuberculosis from the external nodes of lymph of sheep and goats, and to determine multiple drug resistance of C. pseudotuberculosis in sheep and goats in Halal Food Industries, Modjo, Ethiopia. A total of 450 animals (100 sheep and 350 goats) were examined during antemortem and postmortem inspections. Bacteriological isolation and identification of the collected lymph nodes were performed and then confirmed by PCR...
Nan Jiang1,2, Chaochao Luo3, Mingying Shao4, Ziping Zheng4, Qudrat Ullah6, Muhammad Zahoor Khan5,6*, Guangming Sun2, Dun-Zhu Luosang2, Rubina Mushtaq7, Yulin Ma5 and Wang-Dui Basang1,2*
...t in dairy cows, but the molecular mechanisms responsible for milk fat synthesis in yaks are still unclear. This study examined the regulatory mechanism of milk fat synthesis in yak mammary epithelial cells (YMECs) by investigating the role of Ribosomal protein L8 (RPL8) in the mTORC1-SREBP1 signaling pathways. The results showed that over-expression or inhibition of RPL8 had a significant effect on triglyceride (TG) secretion, which also affected the sterol r...
Hend E.M. Elsheikh1*, Mamdouh F. El-Mekkawi1, A.A. Abou-Zaid1 and 
Amal M. Abd El Raof2
...d on viral isolation and molecular detection. The required data were collected using a pre-structured questionnaire during fieldwork. This study examined 575 cattle from 25 herds during the LSD outbreak from June 2020 to May 2022. Approximately 185 of 575 cows showed typical LSDV clinical signs that varied from mild to serious. Diseased animals had fever, anorexia, and decrease milk yield, as well as superficial lymph nodes expansion, the sudden appearance of ...
Abdul Majeed Saim1, Arshad Javid1, Misbah Sarwar2­, Muhammad Hafeez-ur-Rehman3 and Ali Hussain4*
...otypic, biochemical, and molecular characterization of ABR genes by PCR. E. coli colonies appeared circular and dark purple on EMB agar media plates while S. enterica colonies were small, circular, and red on SS agar media plates. E. coli and S. enterica isolates were found resistant to amoxicillin, ciprofloxacin, and sulfamethoxazole, while sensitive against doxycycline, gentamycin, and tetracycline. E. coli isolates showed positive results in catalase, indol...

Israa M. Essa*, Ghazi Y. Azzal, Alaa Tariq Abdulwahid

...sra province (Iraq) with molecular testing and phylogenetic analysis of obtained flukes in the National Center For Biotechnology Information (NCBI). The findings showed that 8.03% of livers were infected with Fasciola spp., in which, juvenile flukes were observed significantly (79.31%) when compared to adults (20.69%). Based on morphology, all adult flukes were diagnosed as Fasciola. Accordingly, positive rate, risk and Odd ratio of fasciolosis were reported s...

Roy Sukbir Singh1, Jekson Martiar Siahaan2,3*, Endy Juli Anto4, Syafruddin Ilyas5, Putri Eyanoer6, Hendrika Andriani7,8

...silico analysis involved molecular docking simulations to evaluate the interactions of Aloe vera compounds with inflammatory mediators such as TNF-α and COX-2. Furthermore, this study also employed a laboratory design with a post-test randomized controlled group. The study included 30 male white rats divided into six groups. Prior to the study, the rats were induced with a high-fat diet (HFD) for 14 days. The groups consisted of a normal group receiving ...

Dalia M.A. Elmasry1*, Dalia M. El-Husseini1, Asmaa A. Eissa1, Zakaria R. Elkanawati2, Momtaz A. Shahein3, Amany Adel4

Haifen Qin1,2, Yujia Liu1, Yujie Zhang1, Jingfeng Liu1, Zhenkun Zhao1,2 and Lichun Jiang1,2*

...status and reveal insect molecular evolution. In this study, the mitochondrial genome (mitogenome) of Anoplophora horsfieldi (Coleoptera: Chrysomelidae) was determined using high-throughput sequencing. The size of circular mitogenome is 15,796 bp and it includes a typical structure of 13 protein-coding genes (PCGs), two ribosomal RNA genes (rRNAs), 22 transfer RNA genes (tRNAs) and an adenine + thymine (A+T)-rich region. The base composition of the major stran...

Emad M. Gad1, Haidy G. Abdel-Rahman2, Mohy Eldin Abd-El-Fattah1, Merna M. Kamal1, Ahmed Shaker Eltahan3, Amina A. Dessouki3*

Ashraf Samir Hakim1*, Doaa Diab Khalaf1, Engy Farahat1, Mohammed Darwish Mohammed1, Wahid Hussein El-Dabae1, Khaled Abd El-Hamid Abd El‑Razik2, Amany Nabil Dapgh3, Ehab Ali Fouad4, Hussein Ahmed Abuelhag1

...ction via phenotypic and molecular methods. Besides that, the study determined their multidrug resistance patterns, particularly the existence of the gene responsible for carbapenem resistance. A cross-sectional study performed on one hundred and ninety two urine samples owned to urinary infected humans, dogs and cats were obtained from Egyptian laboratories in Great Cairo governorates. The samples were cultured onto the suitable media; the presumptive E. coli...

Muhammad Al-Maruf1, Mahfuzul Islam2, Md. Rashedul Islam3, Syidul Islam1, Md. Sirazul Islam4, Md. Roknuzzaman Khan1, Md. Khairul Islam1, Md. Akib Zabed1, K. B. M. Saiful Islam1*

...dard bacteriological and molecular techniques were followed to isolate and identify Campylobacter spp. Data related to the poultry farm management practices were collected by using a designed questionnaire to predict the potential risk factors at the farm level. The prevalence of Campylobacter spp. was 24.00% irrespective of the farm locations. In the districts of Munshiganj, Narayanganj, and Narsindi, the prevalence of Campylobacter spp. colonization was foun...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
... done by biochemical and molecular (Polymerase chain reaction) testing methods. Phylogenetic tree analysis was also performed for genetic identification of the species. in vitro antibiotic disc diffusion method of those selected isolates was performed against 20 most common human therapeutic antibiotics. The isolates were found to be highly resistant against most of the available antibiotics leaving behind very less choice of selection for treatment. The resul...

Hussein Jabar Jasim*, Naer Abdulbari Madlool Alkaabawi, Ali Naser Kathem  

Rongrong Wang1,2, Da Ji1,2, Junjie Yao1,2*, Wenzheng Zhang1,2, Xianjun Zhou1,2, Xin Su1,2 and Tianquan Bai3

...espectively. Analysis of molecular variance (AMOVA) showed that inter- and intrapopulation variation accounted for 41.63039% and 58.36961%, respectively, of the total variation, and the genetic variation coefficient (Fst) was 0.05268. The gene flow (Nm) values between the three C. sowerbyi populations were <1. The results of neutrality, Fu’s Fs and Tajima’s D tests did not show significant negative values. The overall nucleotide diversity of the...

Sana Eijaz, Asmat Salim* and Mohammad Anwar Waqar

...vailable regarding their molecular mechanism of action. In this study, we used a new combination of the aforementioned herbs and Trigonella foenum graceum as a separate treatment. We investigated their effect on the blood glucose level, body weight, expression of some of the insulin signaling genes in skeletal muscle and adipose tissue including insulin receptor (INSR), insulin receptor substrate-1 (IRS-1), protein tyrosine phosphatase-1B (PTP-1B), phosphoinos...

Nguyen Ba Trung1,2*, Pham Thi Kim Phuong1,2

...gole cattle by utilizing molecular markers. We examined the nucleotide sequences of mitochondrial DNA and the SRY gene on the Y chromosome, as well as conducted genotyping of the NCAPG, DGAT1, and RNF212 genes in the Ongole cattle population. The sequence investigation of the mitochondrial DNA revealed that the cattle possess the Bos indicus type I1 haplotype, suggesting relatively high genetic diversity in the maternal lineage. The sequence analysis of the SR...

Muhammad Tahir1, Muhammad Saqib1, Shahbaz ul Haq2, Shahrood Ahmed Siddiqui3,4, Khurram Ashfaq1, Urfa Bin Tahir5, Mughees Aizaz Alvi1*, Shujaat Hussain6, Talha Javaid1, Raheela Taj7, Muneeb Islam8, Imad Khan9, Asad Ullah9* and Shakirullah Khan10

...re studies are needed to molecularly characterize T. gondii variants.

...

Samah Abou Asa1, Omnia Tag2 and Walid Elmonir2*

...t study aimed to utilize molecular and histopathological techniques to detect encysted metacercariae (EMC) of Heterophyids in mullet (n= 50) and tilapia (n= 50) fish and describe their pathological effect on fish meat quality. Also, knowledge, attitude and practices (KAPs) related to fish-borne parasitic zoonoses among 100 residents in Kafrelsheikh Governorate were also investigated. The overall prevalence of EMC infection in examined fish was 32% (32/100): 44...

Bushra Sial1, Arif Muhammad Khan1, Mohsan Raza1,6*, Azhar Abbas Khan2, Sayyad Ali Raza Bukhari1, Muhammad Kashif Hanif3, Sher Khan Panhwar4, Muhammad Ashfaq5

...-align: justify;">Recent molecular approaches have revolutionized the world of species classification and identification. In this study, we delved into the fascinating domain of DNA barcoding precisely for rare marine species and delineated species population genetic variability, genetic differences, and phylogenetic relationships between families/genera. 542 COI sequences from experimental species and an online database were considered for phylogenetic and Fs...

Amal Mahmood Alwan1*, Thekra Atta Ibrahim1, Ghalib Idrees Atiya Ali2 

... in understanding future molecular mechanisms of diseases. 

...

Wirokartiko Satyawardana1,4, Umi Cahyaningsih2*, Fadjar Satrija2, Safika Safika3, Arifin Budiman Nugraha2

Thaer W. Enad*, Khalefa A. Mansour

... This article presents a molecular and epidemiological investigation of FMD serotype SAT2 in Iraq buffalo. The study involved 102 buffaloes from two provinces, Wassit and Dhi-Qar. Clinical examination within the herd revealed classic FMD signs, including salivation, oral and nasal mucosal erosions/ulcerations lesions and laminas of affected animals. The proportions of older animals were more likely to show infection (p > 0.05), but there was no significant ...

Nguyen Ba Trung1,2*, Pham Thi Kim Phuong1,2

...Vang cattle by utilizing molecular markers. We investigated the nucleotide sequences of mitochondrial DNA and the SRY gene on the Y chromosome, as well as performed genotyping of the DGAT1, NCAPG, and RNF212 genes related to economically important traits such as milk yield, carcass weight, and fertility within the Vang cattle population. The analysis of the mitochondrial DNA sequences indicated that the Vang cattle carry the Bos indicus type I1 haplotype, whic...

Yasser Asaad Hameed Al-Shareef, Firas Hussain Kadim Abawi*

..., clinical, genetics and molecular biological approaches identified velogenic strains of NDV in poultry which breach the immunity induced by the currently applied vaccines, warranting future monitoring to better device control strategies in poultry. 

...

Walid Elmonir1*, Ahmed Abdel-Fattah Tayel2, Suzan Abdelbaky Kotb1 and Wael Fawzy El-Tras2

...amples by microscopy and molecular analysis. In total, 9% (18/200) of agricultural produce samples had Toxoplasma oocysts. T. gondii was detected in 14% of carrots, 12% of radishes, 4% of lettuces, and 6% of strawberries. There was no significant difference in prevalence of T. gondii between different fresh produce type (P value= 0.1 – 0.6). T. gondii was not detected in any fish samples. Two agriculture produce (1 carrot and 1 strawberry) samples were m...

Karar Ali Abdulkhuder* and Abdul Kareem Salman Alyassari 

...ceptibility patterns and molecular characteristics of Staphylococcus aureus strains isolated from eye infections. For this purpose, a total of 20 Staphylococcus aureus isolates were obtained from eye infection samples and then were subjected to antibiotic susceptibility testing using standard methods. Additionally, a subset of isolates demonstrating high resistance was selected for molecular analysis to detect the presence o...

Qasim Jawad Amer, Wissam Ahmed Sabah Al-Janabi* 

...valuate the potential of molecular methods as a reliable alternative to traditional techniques for accurate and rapid diagnosis of T. evansi in camel populations. For this purpose, this study was designed to collect seventy-five blood samples (n=75) from camels of different ages of both sexes (male and female) from different areas of northern and southern Babylon.Each blood sample was placed in a special anticoagulant tube (EDTA), with a label containing the n...

Baraa Qasim Mohammed1, Asmaa Hamoody Abdullah1, Ahmed Raheem Rayshan2* 

...s and disease associated molecular marker which can guide future design of improved treatments. 

...
Abrar ul Haq1, Shusheng Yin2, Amara Maryam1, Muhammad Khan1*, Hafiz Abdullah Shakir1, Muhammad Akhtar Ali3, Muhammad Irfan4, Muhammad Faisal Maqbool1 and Yongming Li2*

Bibigul Sansyzbayeva1, Sholpan Adylkanova1, Toleukhan Sadykulov1 and Koray Kırıkçı2*

...e could potentially be a molecular marker for the Saryarka breed to increase lamb production and be integrated into the current selection program for the breed. 

...

Ahmed E. Orbano1, Mohsen El Dimerdash1, Mohamed Abaza2, Ali Zanaty3, Mohamed Rady3, Mohamed H. Nemr3, Wael K. Elfeil1*

...rategies, and continuous molecular surveillance to control respiratory diseases in Egyptian poultry.
 
Keywords: Respiratory viral infection, Broilers, ILT, Mixed infection
...

Khalid Nabieh1, Wael K. Elfeil2*, Ahmed Ali1, Ali Zanaty3, Magdy F. Elkady1

...urrently circulated. The molecular analysis must be performed regularly to track the IBDV strains and their evolution, in addition, to assessing the effectiveness of vaccines.
 
Keywords: Phylogenetic analysis, Strains, Infectious bursal disease, VP1, VP2, Chicken
...

Mohsin Raza1, Zeshan Hussain2, Fazil Abbas2, Muhammad Atiq Ashraf3, Hadj Henni Imene4 and Talha Riaz5

...with a focus on emerging molecular diagnostic tools. While traditional methods such as biological indexing, serological testing, and electron microscopy remain crucial for epidemiological research, molecular techniques provide a promising approach to producing virus-free seed potatoes. Implementing robust viral detection strategies will significantly contribute to sustainable agriculture, improve potato health monitoring, an...

Ma Huadan1,2,3, Sher Zaman Safi3*, Huang Junjie4*, Wei Hua5, Guo Xingrong6 and Ikram Shah Bin Ismail3

...f VECs and its potential molecular mechanism, aiming to provide a conceptual basis for the potential of using MEG3 as a clinical diagnostic, prognostic, and targeted therapeutic approach for vascular-related diseases.

...

Hakeem Jawad Kadhim1, Abbas Kamil Shlaga1*, Safaa Hussein Ali2 

...cal tests as well as the molecular approach should always be considered in endemic regions.  

...

Trang Nguyen Phan*, Loc Bao Nguyen, Thi Anh Ngoc Tong

...se strains. Furthermore, molecular identification at the species level by 16 S rRNA sequencing revealed that selected LAB isolates belonged to the species Pediococcus pentosaceus, Limosilactobacillus fermentum, Lactiplantibacillus plantarum, Weissella confusa, and Weissella paramesenteroides. The differences in LAB species found in meat versus vegetables-fermented foods reflect these bacteria’s adaptability and ecological variation. These data are antici...

Suhad I.J. Al-Asady1*, Mohammad H. Al-Hasnawy2

...r, no epidemiological or molecular data regarding Cryptosporidium species infection in dogs is available in Iraq. Therefore, the current study aimed to detect and identify Cryptosporidium species infecting dogs using microscopy and molecular techniques. For the microscopic examination, feces samples of 100 dogs were examined from September 2023 to March 2024 by the flotation technique based on the modified Ziehl–Neelse...

Mohammed Jawad Kadhim*, Qasim Jawad Amer

....5%). In conclusion, the molecular approaches employed in the present investigation shown a remarkable degree of sensitivity and specificity.
 
Keywords | Entamoeba histolytica, Cattle, PCR, Babylon, Human and Diarrhea
...

Aiman Mohammed Baqir Al-Dhalimy*, Alaa Kamil Mahmood

...dogs with EDTA tubes for molecular assay, and without anticoagulant tubes for serological tests. Polymerase Chain Reaction (PCR) and Enzyme-linked immunosorbent assay (ELISA) tests were used to identify CAV-1. Specific primers targeting the E3 gene were employed for the diagnosis of canine adenovirus type 1 (CAV-1). The PCR results indicated the presence of canine adenovirus type 1 (CAV-1) in 9 out of the 200 animals tested, with the remaining 191 animals test...

Mohammed A. Hamad1*, Murtadha Abdule Mahdi Al-Mudhafar2, Alaa Fayeq Habeeb3, Firas R. Jameel1, Ismael Raheem Al-Muhana2, Najemaddin A. Hamad5

...ecting the virus using a molecular technique. In this study, fifty-two (n=52) nasal swabs were collected from male and females in young cattle by using viral transport media from the period between October 2022 and April 2023 and were utilized by time PCR (RT-PCR). Thus, the virus was identified by employing this technique, which is a more precise and sensitive method of detection. The system utilized for nucleic acid extraction was RT-PCR compatible, and succ...

Mohammed A. Al-Saadi1*, Yahia I. Khudhair1, Muthanna Hadi Hussain1, Monyer Abdulamier Abd Alfatlawi2, Mourad Ben Said3

...es information about the molecular characteristics of SPV after the genetic analysis of the important genes of this virus. This gives us ideas to develop better diagnostic tools and control measures and help to decrease the effect of this infection on sheep populations. These findings continue to emphasize the importance of doing a continuous genetic monitoring of SPV on field, that will help us to keep the animal health status, in addition to controlling outb...

Afshan Akbar1, Saliha Afzal2*, Najam Ul Sehar Afshan2, Muhammad Fiaz1 and Abdul Nasir Khalid2

...rysiphe diffusa based on molecular and morpho-anatomical analyses. This is the first report of Erysiphe diffusa on Lespedeza tomentosa from Pakistan. 

...

Sahir Odhano1*, Michael S Rosenberg2, Noor Us Saher3, Guan Yang Zhang4 and Mustafa Kamal5

...onomic, biochemical, and molecular redescription of the genus Ocypode (Family Ocypodidae) from two localities of the Karachi, Sindh coast (Sandspit and Sonari) and one locality of Miani Hor, Balochistan (Sonmiani). The species belonging to the genus Ocypode are commonly known as ghost crabs. Previously, there was no such research conducted on biochemical and molecular studies. Polyacrylamide gel electrophoresis was used for ...

Junrong Yang1, Ning Zhang1*, Muhammad Akram Khan2, Qingpeng Wang1*, Zhengping Wang1*, Quiqin Liu3, Lanjie Li3, Jun Han1, Abdul Asim Farooq4, Aayesha Riaz5 and Ruiyan Zhang1

...udy, we investigated the molecular mechanism underlying the effects of KD on cell cycle and autophagy in colon tumor-bearing mice. Our results showed that compared with the SD group, KD treatment upregulated the expressions of autophagy-related proteins LC3-II and Beclin-1 while downregulated the expression of p62 protein in CT26+ tumor-bearing mice. In parallel, the expressions of CDK4-Cyclin D1 and CDK2-Cyclin E proteins were decreased, while the expression ...

Donghao Zhang1, Lingqian Yin1, Zhongzhen Lin1, Chaowu Yang2, Chunlin Yu1,2, Zengrong Zhang2, Mohan Qiu2* and Yiping Liu1*

... further research on the molecular mechanism of autosomal influence on feather development is of great significance for chicken production and early sex identification. Here, genotyping-by-sequencing (GBS) technology was used to develop genome-wide single nucleotide polymorphisms (SNPs) markers for early-feathering (EF) and late-feathering (LF) phenotypes in Daheng broilers. A total of 11626 high-quality SNPs were identified, and the different positions and nu...

Tawoos Mohammed Kamel Ahmed1*, Khalid Mahmood Yosif1, Sameerah Faydhallah Mohammed2 

...a single band at a given molecular weight: 232 bp, 1250 bp, 1500 bp, and 791 bp for the 16SrRNA of the marker used for E. coli, Klebsiella spp., P.mirabilis, and Staphylococcus spp. Regarding biodegradation, none of the examined microorganisms could break down trimethoprim, and it was clear that the drug exhibited a solid resistance to biodegradation . Although TMP is light-sensitive, the abiotic control demonstrated that during the experimentation period, pho...
Nan Jiang1,2, Chaochao Luo3, Mingying Shao4, Ziping Zheng4, Shakeeb Ullah5, Qudrat Ullah6, Guangming Sun2, Dun-Zhu Luosang2, Rubina Mushtaq7, Yulin Ma8, Muhammad Kamal Shah5, Saima Naz9, Muhammad Zahoor Khan5,8* and Wang-Dui Basang1,2*
...tic improvement. Various molecular markers, such as single nucleotide polymorphisms (SNPs), microsatellites, and candidate genes, can aid in the identification of economically important traits in yaks. The availability of high-throughput genotyping technologies and advanced statistical models further support the efficient implementation of MAS in yak breeding programs.

...

Yifan Wang1,2, Liangyu Hu2, Numan Ullah2 and Mengzhi Wang2,3*

... reviews advances in the molecular regulatory mechanism whereby Arg regulates casein synthesis and mammary development, focusing on novel mechanisms, including transcription factors, microRNA and metabolic enzymes. Our aim is to highlight fundamental information that can aid in the improvement of approaches to enhance milk protein quality.

...
 Nadeem Raza1, Aneela Zameer Durrani1, Muhammad Hassan Saleem1,  Ali Ahmed Sheikh2, Muhammad Usman1*, Quratulain Mujahid3,  Muhammad Zahid Iqbal1, Muhammad Rizwan4 and Muhammad Husnain Ali Alvi1
...ical identification, and molecular characterization by using polymerase chain reaction targeting 16S rRNA gene and phylogenetic analysis. Hyalomma dromedarii and Rhipicephalus were found to be 76% (152/200) and 24% (48/200), respectively. Molecular study showed the 10.5% (21/200) prevalence of B. burgdorferi sensu lato in ticks. Phylogeny showed that our isolates branched with isolates from tick (...

Wilmienthe Marlene Mesang Nalley1*, Thomas Mata Hine1, Aloysius Marawali1, Solvi Mariana Makandolu1, Maria Marsefar Raja Kota1, Athhar Manabi Diansyah2, Annisa Rahmi3, Abdullah Baharun3

...n the semen plasma, with molecular weights (MW) of 10-15 kDa, 75-100 kDa, and 250 kDa, and in sperm, with MWs of 10-15 kDa, 50 kDa, and 75 kDa. The pearson’s correlation showed a strong positive correlation (p < 0.05) was found between sperm motility and MWSP, and between sperm viability and MWSP, particularly in ID5 and ID6. These findings suggest that the variation in sperm quality across Landrace boars is associated with the presence of critical pr...

Zainab Temitope Salami1, Oladele Oluyinka Opaleye1,2*, Olusola Ojurongbe1,2, Adekunle Olugbenga Olowe1,2 and Titilayo Adenike Olayinka1,2

Dina Al-Shinawy1*, Reda E.M. Moghaieb2, Sara B. Awaly2, Gihan El-Moghazy1 and Dalia S. Ahmed2

...t both morphological and molecular levels, focusing on their toxigenic potential and genetic diversity. Out of the samples tested, six were confirmed as Aspergillus flavus using internal transcribed spacer (ITS) specific primers, accounting for approximately 12 % of the total detected microorganisms. Morphological and molecular analyses revealed that all strains exhibited 97-100 % similarity with a reference strain and were ...

Hend A. Hamedo, Ahmed E.M. Shokr, Omnia T. Abd-Elsalam and Naglaa Elshafey*

...d octadecanoic acid. The molecular docking study displayed high potential of the extracted PHA ingredients as drugs used against liver hepatocellular carcinoma (HCC); with binding affinity ranging between -4.0 to -6.5 kcal/ mol. This is in addition to the prediction of a synergistic effect of PHAs ingredients and sorafenib drug against HCC, showing a promising binding affinity ranging from 20.2 to 23.2 kcal/ mol. Our findings indicate that Paracoccus onubensis...

Sayed S. Sohrab

Volume 2, Issue 6 November and December 2018 Pages 114-121

Hongmei Dai1, Shixiong Xu1, Zhipeng Liu1, Hailong Huo2, Fuhua Yang1, Xia Zhang3* and Jinlong Huo1,4*

...GO terms, including four molecular functions (MF), three cellular components (CC), and two biological processes (BP). Furthermore, the ceRNA network analysis showed that BMI CDK16 was primarily regulated by six miRNAs including ssc-miR-21-3p, ssc-miR-296-3p, ssc-miR-296-5p, ssc-miR-370, ssc-miR-490 and ssc-miR-532-3p. Overall, our findings revealed the crucial role of CDK16 in BMI spermatogenesis, representing a promising candidate for further investigation.

 Yahaya, S.M.1*; Mardiyya, A.Y.1; Sakina, S.B.1; Hayatu, L.W.1

Novel Research in Microbiology Journal (2019), 3(1): 204-214

Laxmi, D.1*; Gayathri, C.1

Novel Research in Microbiology Journal (2019), 3(1): 252-257
...ted to morphological and molecular characterization, finally identified as Oceanobacillus oncorhynchi and Pseudomonas stutzeri, respectively. Among both isolates, DM27 specifically showed maximum growth and degradation activity of hydrocarbons (i.e. diesel and naphthalene). This hydrocarbon degrading ability was assayed by using 2, 6-dichlorophenol-indophenol (DCPIP) as an indicator. Our overall results demonstrated the potentiality of both halophilic bacteria...

 Seham Abdel-Shafi1*; Ghaly Mohamed Farouk1; Mohamed Taha1; Khalid El-Dougdoug2

Novel Research in Microbiology Journal (2019), 3(2): 297-313
...dentified by biological, molecular and serological assays. The aims of this study were to predict the antigenic determinants (epitopes) of the isolated PVY using immunoinformatics; to prepare antibodies then apply them for PVY screening in potato plants in the field, as well as comparison with antibodies against coat protein. The amino acid sequence of PVY isolate was expected by DNAStar protean system; in which four parameters for epitope prediction including...

 

Muhammad Junaid1*; Ayesha Bibi2; Musharaf Ahmad3; Muhammad Ali4; Yousaf Noor5

Novel Research in Microbiology Journal (2019), 3(2): 314-325
... colony characteristics, molecular tools; and to investigate the ability of this pathogen to cause Bacterial wilt (BW) disease, when being inoculated into tomato plant using different inoculation methods. For this purpose, a total of 74 locations covering all over the KP were visited for the presence of tomato plants with BW disease, caused by R. solanacearum. The bacterial pathogen was isolated from diseased plant tissues by growing it on the selective 2,3,5-...

 Waithaka, P.N.1*; Mwaura, F.B.1; Wagacha, J.M.1; Gathuru, E.M.2; Githaiga, B.M.2

Novel Research in Microbiology Journal (2019), 3(3): 351-365

 

Ahmed Ali1*; Ahmed I. Abd El-Mawgoud2; Al-Hussien M. Dahshan1; Azza A. EL-Sawah1; Soad A. Nasef3

Novel Research in Microbiology Journal (2019), 3(4): 415-427
...PEC can be considered as molecular markers of pathogenicity. Although of their current limitations, some vaccine trials showed promising results as good alternative to control colibacillosis in poultry.

...

 

Dalia G. Aseel1*; Mahmoud H. Abd El-Aziz2; Sanaa A. Riad3; Azaa Makhlouf3; Gaber I. Fegla4; Elsayed E. Hafez1

Novel Research in Microbiology Journal (2019), 3(4): 453-463
...tissues, and a band with molecular size 336 bp was obtained using Reverse transcription-Polymerase chain reaction (RT-PCR). The DNA sequence of the Egyptian PLRV-Banha -MP gene was deposited in GenBank under an accession number of KR002119. Moreover, sequence analysis revealed that the Egyptian PLRV isolate was closely related to a New Zealand isolate of PLRV (GU002341), with identity of 100%. Transmission electron microscope (TEM) examination of PLRV showed i...

 Dalia Gamil Aseel1*; Mahmoud Hamdy Abd El-Aziz2; E. E. Hafez1

Novel Research in Microbiology Journal (2019), 3(6): 493-501
...ypt using biological and molecular tools.

...

 

Sohila A. Abd Elmohsen1*; Samah A. Mohmed1; Ghadir E. Daigham2; Essam M. Hoballah3; Nagwa M. Sidkey2

 

Novel Research in Microbiology Journal (2019), 3(6): 546-557
...hich was identified by a molecular assay as Aspergillus tubingensis F20, and was assigned an Accession number of (MK226258.1) using the NCBI GenBank database. The factors affecting mono-dispersed production of SiO2 NPs such as; reaction times, incubation temperatures, hydrogen ion concentrations (pH) and salt concentrations were optimized. It is revealed that 10-3 M precursor salt concentration, 72 h of reaction time at pH 3, and an incubation temperature 28&d...

 

Ahmed El Taweel1*; Ahmed Kandeil1; Ahmed Barakat2; Omar El Faroq2; Ghazi Kayali3; Mohamed Ahmed Ali1

Novel Research in Microbiology Journal (2020), 4(1): 666-674
...es in Egypt. Despite the molecular and serological evidences of the existence human astroviruses in several regions of Egypt, attempts to isolate these viruses have been largely unsuccessful. The aims of the current study were to isolate and make full genome sequencing of two human Astroviruses genotype 1 and 4, from infected children in Cairo, Egypt. Currently, we report the isolation and full-genome sequencing of two human isolates based on our novel designe...

Qingqing Liu1,2, Zhilong Tian1, Chunhuan Ren2, Zijun Zhang2 and Mingxing Chu1*

...sheep, searching for new molecular markers for litter size trait in sheep. Sequenom Mass ARRAY® SNP technology was used to detect polymorphisms at these loci of ESR1, PGR and CYP19A1 genes in seven sheep breeds including polytocous sheep (Small-tailed Han sheep (STH), Hu sheep and Cele Black sheep) and monotocous sheep (Tan sheep, Sunite sheep, Suffolk sheep and Tibetan sheep), then the association between the loci and litter size in STH sheep was analyzed...

Anugrah Masih; Aditi Singh*

...
their complicated molecular structure and resistance to antibiotics. Biofilms of bacteria that
form on the medical equipment pose a risk to patients and facilitate the transmission of
infection. Progress has been made in eliminating bacterial biofilms by combining
bacteriophage with antibiotics for a synergistic impact and employing the phage-lysin
efficiently. The aim of this study was to explore the pote...

Noha Mostafa Mahmoud*

...ing mass spectrometry or molecular next generation
sequencing. Culturomics of the human gut microbiota can be used as a bactriotherapy for the
inflammatory bowel diseases and the respiratory illnesses like COVID-19, and as an
immunomodulatory agent for cancer therapy. Furthermore, culturomics is a big store for
discovering new antibacterial agents and resistance genes. The aim of this review was to
hi...
Debasmita Dubey1; Gopal Krishna Purohit2; Shakti Rath3*; Sushree Swagatika Subhadarshini4; Rajashree
Panigrahi5
...tanding this infection's molecular processes. The hosts defence
mechanisms and their dysregulation, such as the innate immune response and the genetic
susceptibility factors, play a crucial role in determining the susceptibility to VVC. Candidahost
interactions in the vaginal environment, including the adhesion mechanisms and the tissue
invasion, have been extensively investigated, revealing the intricate strateg...

Mahmoud Abou-Alhmd Soliman

...isolate was confirmed by molecular identification through detection of coronatine
production and 16S rDNA analysis. The obtained nucleotide sequence was deposited at
GenBank with accession no. OQ117369.1 and designed as P. syringae pv. tomato strain Pst1-
MAS. The tomato plants only produced the typical bacterial speck symptoms among the tested
solanaceous and cruciferous plants. The tested tomato plants exhibite...

Ramesh Bhandari*; Fenyong Sun; Qiuhui Pan

Novel Research in Microbiology Journal (2020), 4(3): 746-765
...d genomes, epidemiology, molecular immunopathogenesis, and diagnostic approaches of the SARS-CoV-2 coronavirus. Moreover, we discuss the current approaches, progress in vaccine development, and the antiviral therapies to cope with COVID-19 infection. Thus, the information and data gathered on coronavirus will be helpful in understanding all the aspects on SARS-CoV-2 virus, impact.

...

Bikash Chandra Behera1; Bijay Kumar Sethi1; Sonali Mohapatra2; Hrudayanath Thatoi3; Rashmi Ranjan Mishra1*

Novel Research in Microbiology Journal (2021), 5(3): 1241-1255
...fied morphologically and molecularly as Trichoderma longibrachiatum (Accession no. MF144551) and by Penicillium rubidurum (Accession no. MF144561). Submerged fermentation was carried out using different agro industrial substrates to quantify for protease production, where the supernatants obtained were used for alkaline protease estimation. Among the different tested substrates, soybean powder and wheat bran were the most suitable substrates for maximum protea...

Shrikant Verma1; Mohammad Abbas1,2*; Sushma Verma1; Aliya Abbas Rizvi1; Almas Khan1; Syed Tasleem Raza3; Farzana Mahdi1

Novel Research in Microbiology Journal (2021), 5(4): 1313-1324
... based on the particular molecular interpretation of the patient. Precision medication (PM) represents a new way of thinking about infection detection; prevention and treatment. The use of PM grounds in an emerging COVID virulent disease is becoming more prominent. Various discoveries revealed that severe acute respiratory disorder COVID-2 (SARS CoV-2) is accountable for the Coronavirus disease -2019 (COVID-19), which caused slew of procedures to restrict vira...

 

Sunday Zeal Bala1*; Abdullahi Nasiru1; Madinat Hassan2; Priscilla Kini3; Paul Isaac Ojodale4; Yusuf Muhammed5

Novel Research in Microbiology Journal (2021), 5(5): 1351-1370
... discussion on the basic molecular mechanisms of these vaccines; with particular focus on the in vivo responses toward these vaccines recorded by the vaccinated individuals.

...

 

Samuel Adedayo Fasiku1*; Sherifah Monilola Wakil2

Novel Research in Microbiology Journal (2021), 5(6): 1480-1493
...s were fermented using 2 molecularly-identified S. cerevisiae strains. The highest RS contents (16.79 mg/ g) were recorded when MS was pre-degraded by PO for 21 d compared to Lentinus squarrosulus (16.55 mg/ g), and with the consortium of the two fungal cultures (16.36 mg/ g). However, MS pretreated with NaOH and Pleurotus ostreatus gave better yield of RS (17.38 mg/ g), than treatment with Pleurotus ostreatus (16.79 mg/ g) alone. The sugar profiles of the NaO...

Simiat O. Jimoh1*; Khadijat O. Adefaye1; Lateefah A. Arowolo2; Ramot B. Badmos-Oladapo1

Novel Research in Microbiology Journal (2022), 6(2): 1530-1542
...mes activities and their molecular weights were determined using Gas chromatography (GC). Moreover, the size exclusion chromatography revealed the presence of several enzymes, including chitin deacetylase; chitooligosaccharide deacetylase, chitinase and chitosanase; in addition to chitooligosaccharides derivatives such as; chitohexose, chitopentose, chitotetrose, chitotriose, chitobiose and chitosan with varying concentrations. Based on the results obtained in...

 

Salwa Mahmoud Masoud1; Rehab Mahmoud Abd El-Baky1,2; Sherine A. Aly3; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(2): 1543-1556
...ynergy assays, while the molecular studies were carried out using the conventional polymerase chain reaction (PCR). High prevalence of ESBLs producers (61.6 %) was detected, whereas ESBLs and MBLs production was significantly associated with high multiple antimicrobial resistance index (MARI). The bla-TEM was the most prevalent genotype (94.6 %), while the prevalence of bla-NDM and bla-IMP was 45.9 % and 40.5 %, respectively. Imipenem and amikacin were the mos...

 

Soumya Nigam1; Urvashi Vijay2*; Bhumandeep Kour3

Novel Research in Microbiology Journal (2022), 6(3): 1601-1613
... (RT-PCR) assays are the molecular tests of choice for the diagnosis of COVID-19. The remaining direct tests include GeneXpert and TrueNAT assays. In the indirect testing's; antigen-antibody-based techniques are recommended for surveillance of the disease, which may help to formulate the control measures. These tests not only help in assessing the disease severity, but also they benefit in evaluating the prognosis and management strategies.

...

 

Beatrice O. Ojiego1*; Obianuju P. Ilo1; Fatima Dantanko1; Shauibu A. Abdullahi2; Ibrahim M. K. Gadzama2; Paul Bolorunduro2; Elijah Ella3; Gideon I Ogu4

Novel Research in Microbiology Journal (2022), 6(5): 1713-1724

 

Fatma Ahmed Abdel Aziz1; Gamal Fadl Mahmoud Gad1; Ahmed Mohamed Kamal El Shafei2; Reham Ali Ibrahem1*

Novel Research in Microbiology Journal (2022), 6(5): 1725-1741

 

Shrouk E.E. Farg1; Shafik D. Ibrahim2; Samir Mahgoub3*; Atef S. Sadik1; Mamdouh H. Abdel-Ghaffar1

Novel Research in Microbiology Journal (2024), 8(2): 2370-2392
...hy plants based on three molecular tools. When sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS- PAGE) analysis was used to determine the genetic variability of four cucurbits infected with ZYMV compared to the healthy ones, a total of 15 storable protein bands were recorded. The experimental results showed that DNA polymorphisms included 38 polymorphic DNA fragments that were generated using the five inter simple sequence repeat (ISSR-PCR) used ...

 

Sherin P. Mekhail1; Marwa S. Fouad2*

Novel Research in Microbiology Journal (2024), 8(2): 2393-2413
...fected barely leaves and molecularly identified. The identified isolate was deposited in GenBank with an accession number of OR827023. In vitro dual culture assay showed a decrease in D. graminea radial growth with a growth inhibition percentage of 77.8 %. T. harzianum culture filtrate (TCF) (30×106 spore/ ml) was efficiently applied in the greenhouse causing a significant reduction in final disease severity (FDS %) by 77 %, compared to the positive cont...

 

Mohammed Ajdig1,2; Bahia Rached2,3; Ahlam Mbarki1,2; Taha Chouati2,4; Chouhra Talbi1; Elmostafa El Fahime2,4; Marouane Melloul1,2*

Novel Research in Microbiology Journal (2024), 8(3): 2414-2434
...B. licheniformis through molecular typing, helping for the development of clearly-identified PGPR isolates to be used as biofertilizers. A total of 15 rhizobacteria were isolated from the olive rhizosphere soils. These bacterial isolates exhibited various proprieties in terms of abiotic stress tolerance, biofilm formation under stress conditions, and enzyme activities (i.e., lipases, cellulases, and proteases). In addition, several PGP traits such as phosphate...

 

Simiat O. Jimoh1*; Faizah R. Adebowale2; Kifayat O. Asafa-Adedimeji2, Ramat B. Badmos-Oladapo2; Taiwo A. Sorunke1

Novel Research in Microbiology Journal (2024), 8(3): 2452-2468
... 43 ng and 600 bp, 33 ng molecular weights of the fast DNA marker; justified the synthesis of different alginate products. Azotobacter alginate synthesis using a low-cost substrate (i.e., corn cobs) and completely non-pathogenic bacteria (Azotobacter vinelandii DT1) may be desirable compared to the pathogenicity risks and poor jellying qualities linked to Pseudomonas alginate biosynthesis, its expensive production costs, and the adverse environmental effects o...

 

Hend M. Radwan; Nagwan G. El Menofy*; Sahar M.R. Radwan

Novel Research in Microbiology Journal (2024), 8(4): 2510-2525
...hanisms. The most common molecular approaches for assessing AMR in water include quantitative polymerase chain reaction (PCR) and whole genome sequencing (WGS). Metagenomic WGS sequencing provides more extensive genomic data and taxonomic classification than quantitative PCR, as it makes sequencing for the entire genome of microorganisms. The objectives of this review were to demonstrate the primary mechanisms through which bacteria develop resistance to antim...

 

Souad Oirdi Zahir1,2; Mounia El Khadir2,3; Dafr-Allah Benajah1,4; Sidi Adil Ibrahimi1,4; Laila Chbani5; Mohamed El Abkari1,4; Bahia Bennani1,2*

Novel Research in Microbiology Journal (2024), 8(4): 2542-2554
...ghly sensitive and cheap molecular technique to detect H. pylori clarithromycin resistant strains. For that, plasmids of H. pylori 23S rRNA region harboring A2143G point mutation were constructed and used to develop polymerase chain reaction coupled with a high-resolution melting technique (PCR-HRM). Then, this method was applied on 233 gastric H. pylori positive samples. The obtained results showed that the developed PCR-HRM technique allowed specific identif...

Aml Ghanem1,2; Ahmed A. Al-Karmalawy3,4; Noha E. Morsy5; Mahmoud Elsabahy6; Ahmed M. Rayan2,7*

Novel Research in Microbiology Journal (2024), 8(6): 2750-2771
... using morphological and molecular identification techniques. Chemical characterization of dichloromethane fraction (DCM) of Alternaria alternata was conducted using Liquid Chromatography-Mass Spectrometry (LC-MS). The biological screenings revealed anticancer potential of the fungal secondary metabolites, while DCM extract showed strong antimicrobial activity against Escherichia coli and Pseudomonas aeruginosa compared to gentamycin. These findings imply that...
Hayam Albalawi1,2, Muhammad Shahid Nadeem1*, Hisham N. Altayeb1
Saima Iftikhar3, Mariam A. Al-Ghamdi1,4,5, Jalaluddin Azam Khan1 and Ahmed Osman1

Ahmed Hamzah Mosa*, Hamed A. H. Aljabory, Ali Hamid. M. H. Rabeea, Lina Shaheed Waheed

Wisam Naser Kadhim* and Qassim Gawad Ameer

...e Sarcocystis hominis by molecular diagnosis in slaughtered cattle. It is the most important species between humans and animals, causing diseases in humans. This is also determined the Sarcocystis heydorni which is zoonosis disease, and S. cruzi S. hirsute. With the use of (120 slaughtered cattle meat (esophagus) samples and 10 samples from imported meat were compared. In addition, the effect of some certain factors i.e. (age, gender, and months) was undertake...
Muhammad Azhar1, Muhammad Hassan Saleem1*, Muhammad Ijaz1, Ayesha Safdar2 and Kamran Ashraf3

Saed A. Althobaiti1, Safa H. Qahl2, Layaly Elsigar1, Lobna M.A. Gurafi1, Zeinab Kanani1, Mohamed Mohamed Soliman3* and Omaima Nasir

...chemical indices and the molecular levels.

...

Nusrat Jahan Lily1*, Kazi Abdus Sobur2, Minhaz Zabin Saif Mim3, Anika Thasin Bithi4, Hamja Hasanat5, Tabassum Mounita5, Foysal Ahammad6,7, Abdus Samad7,8 and Palash Bose2

...further analyzed through molecular docking and extensive 200-nanosecond molecular dynamics simulations to evaluate binding affinity, stability, and interaction with the ZIKV protease structure (PDB ID: 5LC0). Among the tested ligands, PubChem CID: 56649692 showed the most favorable binding affinity at -5.321 kcal/mol, surpassing other compounds, including the control ligand. Molecular dyna...

Burhan Khalid1, Muhammad Umer Javed2, Muhammad Atiq Ashraf3, Hafiza Zara Saeed4, Musrat Shaheen5, Talha Riaz6*, Rabiya Riaz7 and Shumaila Nawaz3

...focus on elucidating the molecular interactions between microbial biostimulants and plant hosts, paving the way for innovative approaches to combat viral diseases in agriculture. Microbial biostimulants provide a viable and efficient way to increase plant resistance to viral infections, encouraging healthier crops and lowering the need for chemical pesticides, all supporting environmental sustainability and global food security. 

...

Zaid Khalid Alani1*, Saaba Muhsen Farhan2, Shahad Abdullah Shwan3, Atheer Kareem Kadhim4

... serological testing and molecular analysis. Additionally, 100 serum samples from small ruminants (sheep and goats) were collected from slaughterhouses during the same study period. The prevalence rate in women varied by age categories, with significant differences (p ≤ 0.01): 32.7% in 18–25-year-olds, 21.8% in 25–35-year-olds, and 10.9% in 35–40-year-olds. The B1 gene was detected in both pregnant women and small ruminants using nested PC...

Journal of Animal Health and Production

December

Vol. 12, Iss. 4, Pages 258-653

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe