Submit or Track your Manuscript LOG-IN

Shumaila Manzoor1, Afshan Ahmed1 and Muhammad Abubakar2*

...y of two techniques i.e. serum neutralization test (SNT) and solid-phase competitive ELISA (SPCE) for foot and mouth disease virus (FMDV) structural antibodies detection in terms of their sensitivity and specificity. These methods were performed by using set of sera collected from cattle with foot-and-mouth disease vaccination. The pattern of antibody titers in animals of different age groups was observed as less than 1 year, 1-2 years...

John G. Bruno1*, Chien-Chung Chao2,3, Zhiwen Zhang3, Wei-Mei Ching2,3, Taylor Phillips1, Allison Edge1, Jeffery C. Sivils1

...">< 100% human serum or a tick homogenate, the fluorescent aptamer assay maintained sensitive detection of Rickettsia typhi cells. 

...

Anna-Maria Andersson*, Ann-Kristin Nyman, Per Wallgren

...imation of antibodies in serum and dried blood samples collected from mink, a VP2 ELISA (enzyme-linked immunosorbent assay) system was recently evaluated. However, such estimations of disease progression are commonly based on single sampling occasions and it is essential to know if estimated antibody levels vary over a period of weeks or months. Therefore, the aim of this study was to evaluate the short term stability and the long term ...

Muhammad Mushtaq, Umer Sadique, Naila Chand, Iftikhar Ahmed, Said Sajjad Ali Shah, Ijaz Ahmad, Imran Ullah and Muqadar Shah

...lysis. Lipid profile and serum glucose was significantly improved. Lipid profile and serum glucose was significantly reduced in all treated groups. Mean cholesterol was (157.66 mg/dl), triglyceride (65.64 mg/dl), HDL (58.88 mg/dl) while no alteration in LDL contents. Significantly effect of water based infusion was notice on mean serum glucose (73.83 mg/dl) Observation of the study indicat...

Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1

John Gachohi, Simon Karanja, Salome Wanyoike, Nduhiu Gitahi, Salome Bukachi, Kenneth Ngure

...tion in animal and human serum samples will utilize Microscopic Agglutination Test (MAT). Study outcomes will include (i) geo-referencing of adverse environmental attributes that support Leptospira growth, (ii) animal and human seasonal public health burden of Leptospirosis, (iii) seasonal variation in the distribution of Leptospira determinants in a slum setting, and (iv) a simulation model based on an ecological metapopulation framework to track Leptospira b...

Tasnim Farasat*, Saima Sharif, Farkhanda Manzoor, Muneeza Zafar and Shagufta Naz

...e, cholesterol level and serum insulin were significantly higher (p< 0.05) in proliferative group of diabetic retinopathy, while triglyceride level, HbA1c (%), and low density lipoprotein (LDL) were non-significantly higher (p> 0.05) in diabetic retinopathy groups. To conclude high prevalence of diabetic retinopathy was observed among newly diagnosed diabetic patients.

...

Abdul Sattar Baloch1*, Abdul Rasheed1,2, Rahmatullah Rind1, Jam Kashif Sahito1, Rehana Buriro1, Muhammad Faisal Ayoob1 and Parkash Dewani1

...engal Plate Test (RBPT), serum agglutination test (SAT) and competitive-ELISA (c-ELISA) were used as screening tests, and overall seroprevalence of brucellosis was found to be as 21%, 21% and 13% by RBPT, SAT and c-ELISA tests, respectively. Seroprevalence was higher in females (26%) than in males (16%) by RBPT and SAT tests, and also in camels less than 9 years of age (13.33%). Milk samples were collected to detect the antibodies against the disease, however,...

Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2

Rongrong Li1, Kun Li2, Xiaoqiang Wang2, Houqiang Luo2, Gang Qiu2, Hui zhang2, Yanfang Lan2 and Jiakui Li2,3*

...ibet, China. A total 454 serum samples were collected from Tibetan pigs in Nyingchi in 2014 and 2015. Each sample was assayed for T. gondii antibodies by a commercial enzyme-linked immunosorbent assay kits and an indirect hemagglutination test. The results showed that seroprevalence in Tibetan pigs were 25.6% by ELISA. On gender basis, the prevalence was found 25.1% in males and 27.8% in females. By the method of IHA, the seroprevalence in Tibetan pigs were 21...

Hussain Ahmad1, Inamullah1, Ijaz Ali2, Tauseef Ahmad3, Muhammad Tufail4, Kabir Ahmad5 and Bibi Nazia Murtaza3,6*

Asmaa Hamid1,* and Samia Kalsoom2

...were monitored for total serum cholesterol. It was found that both Bengal gram and chickpea had a significant effect on lowering glucose level and total cholesterol of these experimental animals. Bengal gram however, proved to have a significantly (p<0.05) greater effect on lowering of these parameters.

...

Shazia Irfan1*, Asima Rani1, Muhammad Arshad2 and Razia Bashir1

...lification strategy. The serum samples were analyzed for determination of metals and minerals through Atomic absorption spectrophotometer (AA 6600 Shimadzu). The statistical analysis indicated that non-significant association existed between SOD1 (rs2070424) gene polymorphism and RA (p>0.05). Results of HWE estimation indicate that allele frequencies were not deviant from HWE in RA group. The results of present study indicates that Pb and Cr concentration d...

Aziz-ul-Rahman, Farooq Yousaf, Naveed Anwar and Muhammad Abubakar

...Pakistan. A total of 965 serum samples were collected from sheep and goat’s farms from January to December 2015 with no history of vaccination. Haemagglutination inhibition (HI) test was performed using PPRV antigen to determine antibody titres level. The overall prevalence of antibodies to PPRV in goats and sheep were 66.22% (521 samples) and 65.76% (444 samples), respectively. Sero-prevalence of anti-PPRV antibodies was found higher in adults (69.14% w...
Wan-Long Zhu1 and Guang Yang2,*
... body mass, food intake, serum leptin levels and hypothalamic neuropeptide neuropeptide Y (NPY), Agouti related peptide (AgRP), pro-opiomelanocortin (POMC), cocaine and amphetamine regulated transcript (CART) expressions were measured. The results showed that short photoperiod reduced body mass and body fat mass, and increased food intake. But serum leptin levels showed no significant differences between short photoperiod gr...

Pam D Luka, Frank N Mwiine, Bitrus Yakubu, Joseph Erume, Ricardo Pérez-Sánchez, Hermann Unger and David Shamaki

... cycle in Nigeria, 3,288 serum samples were collected from domestic pigs from 10 states and analysed for anti-tick antibodies using the recombinant TSGP1 indirect ELISA. Of the samples analysed, 13.4% (442/3,288) showed moderate to high reactivity, suggestive of domestic pigs’ exposure to tick-bite. Antibody reactivity’s were found in eight of the 10 states studied and all the states have favourable climatic conditions for soft ticks’ surviva...
Muhammad Luqman Sohail1,*, Muhammad Sarwar Khan1, Muhammad Ijaz1, Muhammad Avais1, Muhammad Yasir Zahoor2, Omer Naseer1 and Muhammad Usman Saleem3
...he study. Blood profile, serum biochemistry and mineral profile were analyzed at day 0, 7 and 21 of infection. Results showed significant decrease (P<0.05) in red blood cells (RBC), packed cell volume (PCV), hemoglobin (Hb), mean corpuscular hemoglobin concentration (MCHC) and platelets while total leucocytes count (TLC), neutrophils, eosinophils, basophils, lymphocytes, monocytes, red cell distribution width (RDW) and mean corpuscular volume (MCV) were inc...
Shazia Ali, Hizb Ullah and Sarwat Jahan*
...uced (P<0.001), while serum ferritin were significantly increased (P<0.001) in all four thalassemic groups on comparison with control. Kisspeptin levels were significantly reduced in ≤13 years female (P<0.001). While significantly high levels were observed in >13 years of male (P<0.01). T3 levels were significantly increased in both thalassemic groups of female (P<0.01). While T4 levels were significantly reduced in &...
K.N. ArulJothi1, M. Abinaya1, B. Suruthi Abirami1, Melvin George2, S. Elangovan3 and A. Devi1*
...rs5888 polymorphism with serum lipid levels and CVD risk in an Indian population. A total of 412 samples which included 148 myocardial infarction survivors, 162 Normolipidemic healthy controls and 102 patients with hypercholesterolemia in a   Indian Tamilian population were included in the study. Genotyping of SCARB1 genetic polymorphisms was done by PCR-RFLP combined with gel electrophoresis. The genotype distribution in the population was found t...
Hui Zhang2, Yajing Wang2, Kun Li2, Mujeeb Ur Rehman2, Fazul Nabi2, Rui Gui2, Yanfang Lan2 and Houqiang Luo1,2
...province, a total of 732 serum samples were analyzed through enzyme-linked immuno sorbent assay (ELISA) in 2015 and 2016. The diagnosis of avian leukosis virus subgroup A (ALV-A) infection was confirmed by necropsy, histopathological examinations and PCR analysis. The results showed, 20 chickens as positive for ALV-A (2.73%, 95% CI 1.7-4.2) and these chickens were found to be positive for ALV-A with the further distribution of 2.91% (95% CI 1.0-6.7), 3.70% (95...
Akbar Ali1,*, Khalil Mohamed2 and Fawzia Toulah3

 

...and IgM were detected in serum by ELISA method. Toxoplasma gondii DNA was detected using PCR. Most women were in the 20-29 years age group (48%), followed by 30-39 years (33%) and >40 years (14%). Overall prevalence of Toxoplasma gondii IgG was seen in 12%, with significantly more in women with age more than 30 years as compared to those with age less than 30 years (19% vs 8%; p=0.038). The percentage of IgG seroprevalence was higher in...
Shahzad Ali1,*, Heinrich Neubauer2, Falk Melzer2, Iahtasham Khan1, Shamim Akhter3,Tariq Jamil2 and Sajid Umar3
... Pakistan. A total of399 serum samples from indeginous and exotic cattle were tested for brucellosis by RBPT, SAT and multiplex real-time PCR for Brucella sp., Brucella abortus and Brucella melitensis. A total of 20 (5.01%) samples were found seropositive by RBPT and 19 (4.76%) by SAT, however real-time PCR showed 13 (3.25%) samples positive for both Brucella (sp.) and Brucella abortus. None of the seropositive samples were f...
Tausif Ahmad1, Iahtasham Khan2, Saddaf Razzaq1, Saeed-ul-Hassan Khan1,* and Raheela Akhtar3
...Pakistan. A total of 120 serum samples were randomly collected from buffaloes and cattle (60 per species) at Civil Veterinary Hospitals, animal markets and peri-urban livestock holdings in Rawalpindi and Islamabad. Serum samples were initially screened by the Rose Bengal Plate Test (RBPT). RBPT positive samples were subjected to a B. abortus specific indirect enzyme-linked immunosorbent assay (i-ELISA).

Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*

... supplemented with horse serum. The blood was used for serum plate agglutination assay. Thereafter, the samples were subjected to genomic DNA extraction to detect Mycoplasma spp. using multiplex-PCR. Isolation and identification data showed that a total of 58/96 samples (60.41%) were positive for Mycoplasma infections whereas a total of 61/96 blood samples were also found positive using serum<...
Mustafa Cengiz1*, Jama Hussein Ali2, H. Mehtap Kutlu2, Djanan Vejselova2 and Adnan Ayhanci3
...of biochemistry markers (serum alanine transaminase (ALT), aspartate transaminase (AST) and alkaline phosphatase (ALP)). In contrast, in the groups given D-GaIN and EA, a decrease in the damage of the liver tissue, a significant decrease activated Bax and caspase-3-positive hepatocytes, while increase in the number of Bcl-2 positive hepatocytes, a decrease in the biochemistry markers levels were found. Group 4, given EA before D-GaIN, showed better results whe...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...ic field IBDV caused the serum biochemical changes by damaging the liver and kidney tissues with histopathological effect on lymphoid organs of chicken.
...
Hai-Ji Zhang1, Di Zhang2, Dong-Min Hou1 and Wan-Long Zhu1,*
...RMR), organs morphology, serum leptin levels and food intake were measured in the present study. The results showed that food deprivation decreased body mass and body fat mass. After refeeding, body mass can not be returned to the control value on refeeding 12 h, and it returned to control level on refeeding 7 days, but body fat mass can not be restored to the control level on refeeding 7 days. RMR and mass of liver decreased significantly in fasting groups, w...
Viram Kumar1,*, Moolchand Malhi1, Saeed Ahmed Soomro1, Toufique Ahmed Qureshi2, Muhammad Nawaz Sanjrani3 and Khushal Das Malhi1
...y, the hematological and serum biochemical parameters were determined to establish the reference values in the wild Indian blue peafowl (Pavo cristatus) of Thar (desert) region in the Sindh province of Pakistan. A total of 60 blood samples were collected from peafowl (30 males and 30 female) in months of March and April, 2015. The gender difference showed that RBC, MCV and MCH concentrations were significantly higher (P < 0.05) and the
Mutassim M. Abdelrahman1*,Ibrahim Alhidary1, Abdullah H. Alyemni2, Rifat U. Khan3, Abdel Raouf S. Bello4, Mohamed Y. Al-Saiady2 and Ramzi A. Amran1
Madiha Hashmi1, Abid Hussain1, Shafiq ur Rehman1, Farida Ahmed2, Shahbaz Aslam3,Nadeem Afzal4 and Zaigham Abbas1,*
...ent assay (ELISA) in all serum samples. This study indicated that the frequency of both alleles HLA-DRB1*11and HLA-DRB1*12 in aero allergy patients is less as compared to healthy controls. HLA-DRB1*11 demonstrated significant association with aeroallergens and could have a protective role for allergy while HLA-DRB1*12 did not show any association with aeroallergen sensitization.
...
Farah Ashfaq* and Tasnim Farasat
...mine the relationship of serum resistin with metabolic markers in obese Pakistani subjects. Anthropometric parameters including age, body mass index (BMI), waist circumference, waist-hip ratio (WHR), diastolic and systolic blood pressure, lipid profile and fasting glucose, serum resistin and insulin of three hundred over weight, obese males and females, 17 to 30 years and 100 comparable control subjects were included.
Shabana1,*, Farah Ehsan1 and Shahida Hasnain1,2
...t its effect by changing serum fasting plasma glucose, total cholesterol and LDLC levels.
...
Ambreen Butt1, Uzma Malik2, Khadija Waheed3, Amna Khanum3, Samar Firdous4, Sara Ejaz5 and Fawad Randhawa2, Tania Shakoori6*
...
Research shows that serum Vitamin B12 levels are reduced in diabetes including gestational diabetes. We sought to compare serum cobalamin between pregnant females diagnosed with gestational diabetes mellitus (GDM) and healthy controls and to propose a cut off value for serum B12 levels as a predictive biomarker for GDM. Study design was Quantitative cross-sectional study. This study w...
Zia-ur-Rehaman1, Naila Chand1, Sarzamin Khan1 and Rifat Ullah Khan2,*
... from day 21 to 42. Mean serum antibody titer against Newcastle disease (ND) and serum paraoxonase (PON1) were significantly higher (P< 0.05) in TN zone, while serum malondialdehyde (MDA) was significantly (P< 0.05) higher in HAT zone. No significant differences were recorded in serum antibody titer against ND, PON1 and MDA among different broiler ...
Rehana Shahida1, Tasnim Farasat1, Shagufta Naz1,* and Shahjahan2
...ng plasma glucose level, serum levels of insulin, IL-6, and TNF-α. Serum level of thrombomodulin was assessed as a measure of vascular damage. Different demographic parameters as age, BMI, waist /hip ratio, B.P., personal history and socioeconomic status were recorded. Fasting glucose and HbA1c was done by chemistry analyzer. Fasting serum insulin, IL-6, TNF-α and thrombomoduli...
Jiandong Wu, Miao Ye and Zaigui Wang*
... reducing the content of serum total cholesterol (TC), triglycerides (TG), and low-density lipoprotein-cholesterol (LDL-C) and increasing the concentration of high-density lipoprotein-cholesterol (HDL-C).
...
Tahira Perveen1,*, Shaista Emad1, Saara Ahmad2, Zehra Batool1, Sarwat Yousuf1, Sheeza Sheikh1, Sara Qadeer1 and Saida Haider1

Irfan1* , Arshad Javid2 , Muhammad Altaf3 , Muhammad Shahbaz3 , and Khalid Javed Iqbal4 

...an";">Variations in serum biochemical profile with increase in age were analyzed in turkeys (Meleagris gallopavo). Genderwise variations and effect of rearing systems i.e. free range, semi-intensive and confinements were also assessed from 1st to 6th month of age. Total sixty (n = 60) experimental birds were divided in to three groups i.e., poults having age 4-8 weeks (10 &...
Muhammad Iqbal Anjum*, Shahbaz Javaid and Mukhtar Ahmad Nadeem
... and 7.11 mg/dL in blood serum and 32.61, 31.36 and 32.83% and 16.57, 15.92 and 16.60% in tibia bone of chicks fed rations I, II and III, respectively. The total feed cost per unit weight gain of broilers fed R-III diet was numerically 14% and 9% less than the broilers fed R-II and R-I, respectively. Results suggested that exogenous microbial phytase supplementation to rations having low DCP had positive effects on weight gain, feed: gain ratio and economic ef...
Rabia Qurashi, Qurat ul Ane Gillani* and Furhan Iqbal*
 
...ys, on hematological and serum biochemical profile of 6 week old male albino mice. Blood samples from male albino mice (CGP55845 treated N = 14 and saline treated N = 16) were collected directly by cardiac puncture and used for estimation of hematological and some serum biochemical parameters. The hematological parameters did not show any significant variation between the two groups. From amongst ser...
Faiza Hassan1, Mubshara Saadia1,*, Muhammad Sher1, Mian Anjum Murtaza2, Muhammad Arshad3,Asam Riaz4 and Mahmood Ahmad Khan5
...extracts (150 mg/kg) and serum samples were collected from overnight fasted diabetic rats on day 15 to observe thepercent changes in blood glucose levels and lipid profile. Garlic extracts have shown the significant (p<0.001) hypoglycemic activity with no considerable effect on mean body weight of rats (ns, p>0.05) as compared to diabetic rats. The AGE treatment has significantly reduced the blood glucose level (56%), however, the EGE treatment was found...
Muhammad Usman Saleem1, Saima Masood1,*, Hafsa Zaneb1, Aneela Zameer Durrani2, Asim Aslam3, Kamran Ashraf4, Habib-ur-Rehman5, Muti-ur-Rehman3 and Muhammad Shabir Shaheen6
...al microarchitecture and serum biochemistry in Hubbard chicks. A total of 128 one day-old chicks were divided equally in four different groups with each group having 4 replicates. The number of birds per group were 32 whereas the number of birds per replicate were 8.The first group was kept as control (CONT) whereas, the second (MOSG) and third (OABG) groups were given MOS (2g / kg of feed) and OAB (3g / kg of feed), respectively. The fourth group (MOS+OAB) wa...

Attia Anwar1, Sajida Malik2*, Zobia Usman1 and Sadia Chiragh3 

...enzymes, renal function, serum uric acid and blood cell counts of Sprague-Dawley rats. For this purpose, twenty Sprague-Dawley rats were divided in two groups. Group A (n=10) was given distilled water and Group B (n=10) was supplemented berberine hydrochloride with dose of 75 mg/kg body weight/day. 24 weeks post-treatment, blood samples were collected by cardiac puncture from both groups and tested for Hb (%), WBC, RBC and platelet counts, SGPT, alkaline phosp...
Kashif Prince1,*, M. Sarwar Khan1, Muhammad Ijaz1, Aftab Ahmad Anjum2, Muhammad Asad Ali2, Jawaria Ali Khan1, Nisar Ahmad3,Rais Ahmed2, Aamerzish Mushtaq4, Sajid Umar4 and Yung-Fu Chang5
...esigned to determine the serum selenium status in association of its risk factors in cattle and buffaloes of district Kasur, Punjab. Selenium status was evaluated by Atomic Absorptions Spectrophotometery (AAS) with respect to sex of animals, geographical area, age of animals, herd size, stage of animals, production level and concentrate feeding. Selenium deficiency was also evaluated as a risk factor of mastitis and repeat breeding. About 48.43% cattle and 72....

Abida Sajid* and Aqsam Sajid 

...ncy Anemia is defined as serum ferritin level less than 12 micro gram per ml and on Red Blood Cell indices, i.e. decrease in MCV, MCH and MCHC, and Microcytic Hypochromic cells in Peripheral Smear. Megaloblastic anemia was labeled when Macrocytic Hypochromic cells seen. Obstetric outcome in terms of Preterm delivery defined as delivery at <37 weeks of gestation (36 +6 weeks) and birth weight <2500g mand a need for operative delivery. Patients fulfilling ...

Muhammad Athar Khan1, Muhammad Zahid Latif2*, Syed Amir Gilani3 and Ifrah Bukhari4 

...council as controls. The serum sample of each subject was tested against each of the five antigens against the serovars. A total of 250 subjects were included in the study. Out of these, 125 subjects were exposed to the rice paddy water where as 125 were not exposed to rice paddy water. The cumulative seropositivity among the exposed is (83.2%) as compared to (42%) among the non exposed to rice paddy field water. The calculated cumulative odds ratio is 6.7 whi...

Sana Qanber Abbasi1*, Ejaz Ahmed2 and Rabia Sattar1 

...een found between rising serum pro BNP levels and Cardiovascular pathologies especially those involving left ventricular dysfunction which may depict a probable association between migraine and CVD. To compare the levels of serum pro Brain natriuretic peptide (pro BNP) between migraineurs and hypertensive migraineurs. It was a cross sectional comparative study in which serumpro BNP levels ...
Promy Virk
...d groups. The results on serum ALT, creatinine levels and blood urea also showed a comparable ameliorative effect of both the bulk Trigonella seed extract (TBN) and the green nanocomposite (TN), being more efficacious than metformin. Thus, the green synthesis and application of the Au/Ag nanoparticles offer a novel approach in nanomedicine for diabetes management.
...
Muhammad Kashif Maan1, Muhammad Arif Khan1, Shehla Gul Bokhari1, Muhammad Ijaz2, Hamid Akbar1, Sajid Umar 3 and Muhammad Luqman Sohail4,*
...terectomy.
...
Shireen Ihsan Izzaddeen1 and Ali Kaygısız2,*
...;0.05). The calf’s serum total cholesterol, glucose, AST, GGT, creatinine, phosphor, calcium, insulin, total T3, total T4, albumin, GH and globulin concentrations did not differ between the groups (P>0.05). Essential laurel oil containing whole milk, on the other hand, lowered serum triglyceride concentration (P<0.05). Altogether these results suggested that the consumption of laurel essential oil (600 mg/day) co...
Lili Zhang, Yuanxiao Wang, Yili Kong, Hussain Ahmad, Rui Yan, Li Dong, Jingfei Zhang and Tian Wang*
...and 160 days of age, the serum urea nitrogen levels of the IUGR pigs were significantly higher than the NBW pigs (P<0.05). The serum insulin levels of the IUGR pigs were significantly lower (P<0.05) than the NBW pigs at 28 and 66 days of age. The serum leptin level was significantly higher (P<0.05) in the IUGR pigs at 28 days of age while it decreased significantly (P<0.05) at ...

Ikramullah Khan1,2*, Muhammad Subhan Qureshi2, Sohail Akhtar2, Ijaz Ali3 and Ghufran Ullah4 

...rs determined from blood serum were glucose, cortisol and Heat shock protein-70 (HSP-70). Thermal stress increased all physiological parameterssignificantly (P < 0.001). Holstein Frisian manifested maximumincrease in RT, RR and PR (3.33, 209.50 and 59.41%) than crossbred (0.59, 40.22 and 22.0%), Sahiwal (0.78, 42.54 and 34.31%) and Achai (0.78, 39.22 and 33.85%) respectively (P < 0.001).Thermal stress increased biochemical changes significantly (P < 0...
Ambreen Asghar, Tasleem Akhtar, Nadeem Sheikh*
...aluate the variations in serum protein level induced by fat rich diet. For this purpose, two groups of Wister rats were fed with diets carrying difference in percentage of fats. Protein profiling of treated groups indicated a marked increase in serum protein (related to iron metabolism and immune response) level compared to low fat-fed rats. Additionally, a decreased level of serum protein...
Naimat Ullah1,3,*, Aneela Zameer Durrani1, Muhammad Avais1, Nisar Ahmad2, Sana Ullah3, Muhammad Shuaib Khan3, Khalid Mehmood5, Mumtaz Ali Khan1 and Ikramul Haq1
...lanine aminotransferase, serum creatinine, urea whereas decrease in glucose level in diseased animals. The current study concluded that paying close attention to animal feeding, housing and keeping may reduce the occurrence of theileriosis in sheep.
...
Jun-Ying Liu, He-He Liu*, Jie Kou, Yang-Mei Zhao, Ji-Wen Wang, Liang Li and Xiao-Hui Du
...leukin-12 (IL-12) in the serum of ducks at 1 day and 7 days after LPS injection (P<0.05). However, there were no apparent changes in organ index or the relative expression of TLR4 and IgM (P>0.05). Furthermore, correlation analysis showed a positive relationship between the mRNA expression of TLR4 and concentrations of TNF-α and IL-12. These results revealed that although there were no significant effects of LPS injection on
Lotta Wahldén1, 3, Ulf Emanuelson1, Torsten Møller2 and Jonas Johansson Wensman1*
...servation. In total, 146 serum samples from 47 individuals were analyzed. Serum neutralization test was used to determine presence of CDV antibodies, and an indirect IgG ELISA was used to detect CPV antibodies. Neutralizing antibodies was induced after CDV vaccination and persisted up to 3.9 years. Most animals had high IgG antibody titers to CPV prior to vaccination and vaccination did not result in increased titers. A decl...
Amna Kausar1,2, Sana Anwar1, Naila Siddique2, Safia Ahmed1 and Javid Iqbal Dasti1,*
... out of 507 samples, 479 serum samples were scrutinized by enzyme linked immunosorbent essay (ELISA). Sero-prevalence of AIV among different species of wild birds was as follows; peacock (n=35; 14%), duck (n=5; 2%), migratory water fowl (n=3; 1%), pheasant (n=2; 0.8%), grey leg goose (n=1; 0.4%), turkey (n=1; 0.4%), eagle (n=1; 0.4%) and crane (n=1; 0.4%), for domesticated bird species sero-prevalence was; broiler (n= 152; 60%), rural poultry (n=14; 6%), domes...
Fazul Nabi1,2, Hui Zhang1, Muhammad Kashif Iqbal1 , Mujeeb ur Rehman1, Muhammad Shahzad3, Khalid Mehmood1,3 and Jiakui Li1,* 
... (AST) activities in the serum along with decrease in level of antioxidant enzymes and significantly increase in the MDA contents in TD afflicted chickens compared to control group. The SM administration to TD affected birds significantly ameliorated lameness, stimulated ALP level with a decrease in ALT and AST contents, increase in antioxidant parameter and decrease in MDA contents significantly (P<0.05). SM treatment of TD-afflicted birds prevented lamene...
Jia-kui Li1,2,*, Kun Li2, Zhao-qing Han2, Hui Zhang2, Xiao-qiang Wang2, Hou-qiang Luo2, Yan-fang Lan2 and Gang Qiu1,2
... China. Totally, 516 yak serum samples were randomly got during 2012 to 2014. BVDV was found highly prevalent among the adult yaks (51.1%; 95% CI: 46.5-55.6) and calves (60.5%; 95% CI: 43.4-76.0), respectively. The prevalence of BVDV infection in 2012 to 2014 was 45.3% (95% CI: 38.6%-52.1%); 56.0% (95% CI: 49.7-62.2) and 60.5% (95% CI: 43.4-76.0), respectively with a significant difference in the three years (P<0.05). The current result reveal a growing pre...
Mingming Ning1,2, Yanjie Zheng1, Yuanyuan Dun1, Weijun Guan2 and Xiuxia Li1,*
...ng proportion of chicken serum and some growth factors. CAFSCs can be transferred to 34 passages nowadays. Surface marker Oct4, CD105, nanog, CD73 and SSEA-4 on CAFSCs are detected positive with immunofluorescence histochemistry, Gene CD44, CD29, CD73 and SH2 are detected positive with RT-PCR. We carry karyotype analysis out and find that chromosome is 2n=78 and shows normal. CAFSCs in mid period of subculture propagate fastest from cell cycle examination on F...
Tayfun Karataş
...vation for 8 days on the serum metabolites and antioxidant enzymes, thiobarbituric acid reacting substance levels, endogenous reserves in liver and muscle tissues of rainbow trout (Oncorhynchus mykiss). Eight-days of fasting caused a significant decrease in glucose, total protein, triglyceride, cholesterol, high-density lipoprotein and low-density lipoprotein levels as well as protein and lipid reserves in liver and muscle tissue of fish (p<0.05). Th...
Muhammad Shahid Saeed1, Adeela Shahid2, Samia Jawed3, Muhammad Akram4, Irshad Hussain Qureshi5 
...s taken to determine the serum magnesium levels. All patients were given Salbutamol inhalation and intravenous (I/V) Hydrocortisone. The study group was given 2gm of MgS04 intravenously in 20 minutes in a burette and Placebo group was given placebo (0.9% normal saline). Salbutamol inhalation was given at regular intervals and Spirometry was performed to determine lung functions.
Results: The two groups (study group and placebo-tre...
Fangxiao Dong1,2, Xuan Luo1,2, Delu Yuan1,2, Aixin Liang1,2* and Liguo Yang1,2*
...ced significantly higher serum GH and PRL concentration in comparison with T2 and control groups (p < 0.05). Expectantly, mice in T1 group also showed significantly higher average weight gain and offspring weaning weight than that in T2 and control groups, respectively (p < 0.05). Overall, these results suggested that novel somatostatin plasmid fused to tPA signal peptide obtained stronger immunogenicity, and better potentials of pro...
Farhat Ijaz1, Rana Khurram Aftab2*, Samia Jawed3
...atients. TNF-α and serum insulin levels were determined using ELISA. Insulin resistance was calculated using HOMA-IR. Comparison between groups was performed using independent sample t-test. The P value ≤ 0.05 was considered statistically significant.
Results: Mean HOMA-IR and TNF-α values were significantly (p-value <0.01) higher in obese diabetics (17.13+8.77) and (10.96+4.69), respectively when compared to non-obese Type...
Muhammad Anwar Iqbal1, Habib Rehman2, Ali Hussain3,*, Faiza Jabeen4, Ijaz Ahmad2, Kamran Ashraf5, Muhammad Irshad Arshad6 and Omaima Khan7
... visceral organ weights, serum mineral levels and caecal concentrations of E. coli and Clostridium spp. in Japanese quail (Coturnix coturnix japonica). Japanese quail (one-day old; n = 1320) were taken and randomly separated into four groups (n = 320), having 8 replicates (n = 40) in each group. Corn-based poultry feed (basal diet) was given to control group birds (Group A) and the same feed mixed with three different concentrations of MOS...
Bo Wu1, Hui Zhang2, Kun Li2, Khalid Mehmood2,7, Yan Zhao1, Bin Jiang1, Chengjun Xue3, Muhammad Tariq Javed6, Fazul Nabi2, Zhaoqing Han5,* and Houqiang Luo4,*
...Zhejiang. A total of 368 serum samples were collected from June to July in 2016. Out of these samples, 23 (6.79%, 95% CI 4.4-9.9) pigs were found positive for FMD antibodies with the further distribution of 9.09% (95% CI 4.6–15.7), 6.90% (95% CI 2.6–14.4), 5.49%, (95% CI 1.8-12.4) and 4.35% (95% CI 0.9-12.2) from Wenzhou, Lishui, Jinhua and Ningbo counties, respectively. For the first time, we investigated the seroprevalence and the immunization sc...
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
...h and mobility of bovine serum albumin (BSA) was different in all milk species.
...
Shoukat Ara1, Sheikh Adil2,*and Manzoor Ahmad Khan3
... cristata on growth, serum biochemistry and laying performance layer chicken, a study was conducted on 240 key stone golden layer chicks which were randomly assigned into five groups having three replicates of 16 each. Birds in control (T1) group were fed the basal diet, where as other groups the groundnut cake was replaced with 5 (T2), 10 (T3), 15 (T4) and 20% (T5) Azolla. The results revealed ...
Wajid Ali1,*, Asma Karim1, Muhammad Irfan2, Hafiz Abdullah Shakir3*, Ghulam Mustafa4, Zeeshan Shafique1, Ijaz Anwar1
...changes were observed in serum biochemistry and histology. Serum glucose and cholesterol were increased while total protein was decreased. Histopathological result reveled that gills of experimental fish was damage severely resulting Necrosis, Damaged nuclei , rupturing of epithelial cells, Mucous cells and severe lamellar fusion. It was concluded that, deltamethrine is highly toxic for non-target aquatic organisms like silv...
Xiaojie Ding, Xiling Sun, Zuien Wang, Qiusheng Zheng, Xiaofei Yu, Wenjin Hao, Kejun Wang, Wenjuan Xu and Zhengping Dong*
... testing the contents of serum level of tumour necrosis factor-α (TNF-a), interleukin-6 (IL-6), lipopolysaccharide (LPS) as well as colonic mucosal tissue TLR4/9 and NF-kB. We got the following results: (1) The rat IBS-D model was successfully prepared; (2) Wumei Pill could reduce the contents of serum TNF-α, IL-6 and LPS in rats(P<0.05), and alleviate the inflammatory reaction and accumulation of bacterial en...
Qudrat Ullah1,*, Huma Jamil1, Zafar Iqbal Qureshi1, Muhammad Saqib2 and Heinrich Neubauer3
...ii antibodies in the serum. Serological analysis revealed overall flock-level sero-prevalence of 92.3% which varied from 88.88% in sheep and 100% in goat, while individual level sero-prevalence was 15.6% in sheep and 15.0% in goats, the difference being non-significant. A significant (P<0.05) association was found between seropositivity against C. burnetii and variables like livestock farm, type of farming, region (locality of farm), prese...

Bata Shalangwa Ishaku1*, Maimadu Abdullahi1, Dakwang Nalong1, Rengkat Jonah1 and Olabode Mayowa

...eria. Five hundred (500) serum samples comprising of 300 pigs, 100 each of sheep and goats were collected and analyzed for Toxoplasma gondii antibodies (IgG) using latex agglutination test (LAT). Serum samples with LAT titer >10 IU/ml were considered positive. The study showed that 176 of the 500 samples analyzed were positive for Toxoplasma gondii antibodies (IgG) giving an overall prevalence of 35.2%. There was statisti...

Muhammad Babar Khawar, Nadeem Sheikh*

Effect of paper industry leachate on various serological indices and serum proteins of wistar rats
...e variations in level of serum aspartate aminotransferases (AST) (P<0.0001), cholesterol (P<0.0001) and High density lipoproteins (HDL) (P<0.0001) while a significant negative change in triglycerides (P=0.0002) and creatinine (P=0.0370) level in both experimental groups. Alanine aminotransferases (ALT) level showed a significant increment in Group 1 and a decrement in Group 2 compared to control group (P<0.0001). SDS page analysis revealed an overa...

 Tahir Abbas*1, Khawaja Raees Ahmad2, Asmatullah3, Khalid Pervaiz Lone4, Muhammad Ali Kanwal2, Sadia Suleman2

Reno-hepatic protective effects of Jambul against chromium induced anomalies in mice

Riffat Mehboob1*, Sami Ullah Mumtaz2, Zoya Manzoor3, Sajid Abaidullah2, Fridoon Jawad Ahmad1

Deranged biochemical and hematological profile of septicemia patients in Mayo hospital, Lahore
...ish the possible role of serum biomarkers of liver, kidney and blood in the diagnosis of septicemia. 101 confirmed patients of septicemia from a tertiary care hospital in Lahore were included. Liver and renal function tests were performed for all patients. Patients were divided into 3 age groups on the basis of age: 30-50, 51-70 and 71-90 years. In Liver function Tests, ALT (37.62%), AST (50.49%) and ALP (99%) were elevated, Bilirubin was normal in majority of...

Nasir Raza Zaidi1, Mian Waheed Ahmad1, Mahesh Gautam1, Riffat Mehboob2*

Risk factors for multiple sclerosis in Pakistani population- A crosssectional study
... had low level of
serum vitamin D and 30% of the patients had positive family history. Current study shows viral infections, smoking,
and hypovitaminosis D as frequently associated with MS.

...

Muddasir Hassan Abbasi1, 2, Noor Fatima1, Syed Shahid Imran Bukhari1, Asma Rashid khan3, Nadeem Sheikh2*

Variations in proteins and transaminases following experimental induction of Bisphenol A in mice
..., as noted by changes in serum proteins and transaminases. Therefore,
further investigation of its toxicity is necessary in order to consider it safe.

...

 Muhammad Babar Khawar1, Muddasir Hassan Abbasi1, 2, Sana Fatima3, Khawaja Abdul Mujeeb2, Nadeem Sheikh1

Alterations in proteins and transaminases activity induced by thioacetamide in albino rats
...te changes in tissue and serum total proteins and
albumin along with urea, uric acid and serum transaminases activity after 12 and 24h of TAA administration in albino
rats. Rats were randomly divided into three groups (n=3) namely control group, 12h group and 24h group. Each
experimental group (12h and 24h) was administered 300 mg/ kg TAA intraperitoneally (i.p) while control received
same volume ...

Nabila Roohi, Mehjabeen, Samina Ashraf*

Effects of cigarette smoking on serum proteins profile in male active and passive smokers
...als with the analysis of serum total proteins and fractions
(albumin, total globulins, gamma globulins and non-gamma globulins) of active and
passive smokers. Blood samples of 180 cigarette smokers were collected from
different locations of Lahore and 60 healthy non-smokers from University of the
Punjab, Quaid-e-Azam campus Lahore, in terms of comparable age, height, weight
and socioeconomic set up. S...

 Anber Naqvi1*#, Abdul Qadir1, Adeel Mahmood2, Mehvish Mumtaz3, Iqra Aslam1, Gan Zhang4

Assessment of polychlorinated biphenyls (PCBs) in maternal blood serum from selected districts of Punjab, Pakistan
...he PCB residues in blood serum of
mothers residing in five districts of Punjab Province, Pakistan. The mean
concentration of Σ34 PCB congeners was recorded 232.3 ng/g l.w. PCB homologs
profile showed highest levels of Tetra-CBs (53%) followed by Penta-CBs (23%)
and Hexa-CBs(11%), respectively. Spatial distribution of PCB homolog reflected
the higher prevalence of lower chlorinated PCBs in urban population descending
Hina Abrar1,2, S.N.H. Naqvi1,*, Muhammad Rashid Ahmed3, Asma Basharat Ali3 and Hina Yasin1,2
A.M. Abdul Azeem, A.N. El Shahat* and Ashraf M. Mounir
...significant reduction in serum activities of liver enzymes, level of hepatic and testicular lipid peroxidation and plasma levels of caspase 3 associated with significant increase in the levels of luteinizing hormone, follicle stimulating hormone and testosterone in addition to marked improvement in the level of total antioxidant capacity and glutathione content and the activity of superoxide dismutase activity and catalase activity of the liver and testes of l...
Muhammad Ijaz1, Shahid Hussain Farooqi1, Rahmatullah2, Amjad Islam Aqib1, Sadaqat Ali3,*, Awais Ghaffar1, Ahmad Ali1 and Sehrish Saleem1
...n hematocrit and various serum biochemical parameters (serum electrolytes, trace and ultra-trace elements) in foals. A total of 105 diarrheic foals (n = 35 horse foals, n = 35 donkey foals, and n = 35 mule foals) were selected regardless of their etiologies. Additionally, 12 healthy foals (n = 4 horse foals, n = 4 donkey foals, and n = 4 mule foals) as control animals were selected for this study. Packed cell volume (PCV) an...
Muhammad Amir Iqbal1, Nabila Roohi1*, Ahmad Qureshy2

 

...re used to determine the serum levels of FT4, FT3, TSH, Creatinine, AST and ALT. Prominent reduction (P<0.001) of creatinine was observed in overt hyperthyroid state, when compared with controls. However, significant (P<0.05) improvement was noticed in it in post treatment group. Pronounced elevation (P<0.001) of ALT was observed in overt state when compared with controls. Subclinical subjects also manifested...
Yan-Guo Han1, Xiao-Li Peng1, Kai Li1, Yu-He-Tian Zhao1, Xun-Ping Jiang2, Guang-Xin E1, Yong-Ju Zhao1, Jun-Hua Ye3, Li Xu3, Qin-Tao Zhao3 and Yong-Fu Huang1,*
...higher anti-SS antibody, serum growth hormone and IGF-1 concentrations and average body weight than those in the control group (P < 0.05). Immunisation with ptCS/2SS-asd promoted the growth of rams similar to the effect of the simple co-injection of CpG and SS DNA vaccine. Thus, the fusion type of CpG adjuvant is an effective, simple, and low-cost method in enhancing the effect of SS DNA vaccine and the growth of ram lambs.
...
Tamoor Azeem1,*, M. Yasin Tipu1, Asim Aslam1, Sajjad Ahmed2, Salman Ahmed Abid1, Abdullah Iqbal3, Naeem Akhtar4, Muhammad Saleem4, Aamerzish Mushtaq4 and Sajid Umar4
...lues. On the other hand, serum analysis revealed increase in ALT, AST, ALP and GGT while decrease in total protein and albumin (p>0.05).
...
Muhammad Huzaifa Mehmood1, Muhammad Ahmad Iqbal2, Muhammad Daood1, Muhammad Rizwan Tariq3*, Khubaib Ali3
...eat while improvement in serum lipid profile was observed by 4% supplementation of oat seeds. It was also observed that fat percentage in meat was also reduced by oat seed supplementation.
...
Zhen-li Li1,2, Hui-fang Zhou2,*, Bo-ru Zhou2, Bei Liu2, Xiao-fei Jiang2 and Jian-ya Xu2

 

... intervention. Then, the serum follicle-stimulating hormone (FSH) and luteinizing hormone (LH) levels were detected by ELISA, FSHβ and LHβ expression levels in the pituitary were determined by qPCR, and GnRHR expression levels were assessed by qPCR and western blot analysis. Simultaneously, transcription factors, such as c-Jun, Elk-1, Egr-1, Nur77, CREB, and transduction molecules in PKC-MAPK, Ca2+-CAM, and cAMP-PKA signaling pathways, such as PKC, p...
Jian Wang1,*, Zhi Liu2, Sheng Xu2, Mei-Fen Hu2, Xiao-Rui Liu1 and Wen-Jie Cai1
...e expression of CXCL8 in serum and its mRNA in neutrophils of the patients with chronic renal failure (CRF). It was used to dynamically observe of Hemodialysis on the concentration of the CXCL8 in serum and the levels of CXCL8 mRNA in neutrophils were respectively measured by ELISA and PCR. The house keeping gene encoding glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the internal reference, the ratio of lgcDNA/lgGAPDH ...
Wen Chao Liu1,2, Kwan Sik Yun3 and In Ho Kim2,*
...n tended to increase the serum HDL cholesterol levels (quadratic, P=0.074). Furthermore, the relative weight of bursa of Fabricius was increased by supplementation with 1,3-DAG (quadratic, P<0.05). In conclusion, dietary supplementation of different levels of 1,3-DAG in broilers diets could improve the growth performance, modify blood lipid profile and promote the development of bursa of Fabricius. 
...
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
...ve or negative effect on serum total protein (TP), albumin (Alb), triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) (P<0.05 or P<0.01). The g.247075G>A mutation was significantly association with these measured serum biochemical indexes except for LDL-C. Significant additive effects were detected for all detected
Osman Ergene1,*, Isfendiyar Darbaz1, Serkan Sayiner2 and Selim Aslan1
...In the PAG-Milk and PSPB-serum tests, there was a difference (P <0.05) in terms of blood values between the 32nd day and the 40th day when EM was detected. Statistically significant differences in PAG-Serum test (P <0.001) and PSPB test (P <0.01) was obtained between animals that were pregnant on the 40th day and animals that had EM on the 40th day according to TRUS observations. Sensitivity and specifici...
Yang Liu1, Jing-xin Mao2, Xiao-dong Wei2, Man Yi2, Xiao-long Zhang2, Ke Zheng3, Xian-xin Chen4, Guo-Ze Wang5 and Bing-bo Chen1,*
...ad significant increased serum levels of IgA, IgG, IgM and IL-2 compared with the control group (P<0.05); the Lactobacillus BFA group had obviously increased levels of IgA, IgG and IL-2 than the control group (P<0.05). It proves that the BFA has a positive effect on improving the health indicators and nutritional status, blood physiology and biochemistry, weight gain of rats, which can effectively promote the growth of animals and raise feed reward. It r...
Iqra Bano1,*, Moolchand Malhi2, Pershotam Khatri3, Saeed Ahmed Soomro2, Hira Sajjad4, Ambreen Leghari5, Muhammad Awais2, Safia Kandhro6 and Shakeel Ahmed Lakho5 and Munaza Soomro7
...rent in both groups. The serum glutathione peroxidase (GPx) activity as well the testicular GPx activity was significantly increased in SY as compared to C. Furthermore, the serum T-SOD activity was significantly elevated in SY as compared to C. Moreover, the T-SOD activity in testicular tissues was also significantly increased in SY as compared to C. The results revealed that the SY supplementation has positive effects on g...
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
...n this study 960 and 471 serum samples of goats and sheep were collected, respectively. After screening with Rose Bengal test (RBT), all seropositive samples were subjected to real-time PCR assay. RBT confirmed the seroprevalences of 19.32% ± 0.289 and 12.29% ± 0.0105 brucellosis in sheep and goats, respectively and real-time PCR confirmed the B. abortus in 74 samples (62.71% ± 0.044) out of 118 seropositive samples in goats while 6...
Fazal Abbas1, Muhammad Ijaz1,*, Zunaira Akhtar1, Khalid Mehmood2, Muhammad Zeeshan Hyder3 and Umair Iqbal4
...ificant correlation with serum electrolytes and trace elements.

...
Fan Yi1,2, Xiaobin Yang1, Shigen Ye1, Hua Li1 and Ruijun Li1,*
...pheral leukocytes count, serum lysozyme activity, phagocytic rate, phagocytic index, respiratory burst activity of head kidney cells, compared with the basal feed group (P<0.05 or P<0.01). The challenge test results also showed that the 0.5% and 1% HCT feeding had higher immune protection against Edwarsiella tarda infection; and the relative protection ratios were 60% and 50%, respectively. It was also obtained that interval feeding ...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
...s on growth performance, serum biochemical parameters, digestive enzymes activity and antioxidant status of largemouth bass (Micropterus salmoides) reared in an in-pond raceway system (IPRS). Fish (initial average body weight: 35.68±2.12g) were randomly allotted to in-pond raceways (26.2m×5m×2.5m) stocked at two stocking densities (68 and 114 fish/m3, respectively). Fish were fed twice daily (08:00 and 17:00), and the daily...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and  Cheng-Kai Zhai1, *
... increasing, increase in serum triacylglycerol, total cholesterol, glucose and the decrease in high density lipoprotein cholesterol. However, CWD can improve blood lipid and blood sugar levels, and at the same time improve obesity and fat accumulation in rats. CWD significantly augmented the relative level of peroxisome proliferators-activated receptor γ (PPARγ) and suppressed the sterol regulatory element-binding protein 1c (SREBP-1c...
Yan-Guo Han1,2, Jun-Hua Ye1, Qin-Tao Zhao1, Yong-Jie Huang2, Kai Li2, Yong-Fu Huang2 and Li Xu1,*
... in T2 and C groups, and serum PRL levels in T1 group was significantly higher than that in control group. Body weight of offsping rats in T1 group were significantly higher than that in control group at weeks 2 and 4 after birth, and body weight of offsping in T2 group were significantly higher than that in control group only at week 4. Oral SS-14 DNA vaccine fused tPA signal peptide and CpG adjuvant and delivered by attenuated Salmone...

Shaikh Abdul Lateef, Zhou Lin, Wu Jian, Junjie Qian, Jonathan Hartanto Tan and Zheng Shusen*
 

...fied into infectious and serum hepatitis. The pattern of disease progression manifests liver inflammation, chronic hepatitis and hepatocellular carcinoma. In this article, we present a comprehensive review characterizing the viral architecture, life cycle, infectivity mechanisms, immune escape strategies, disease epidemiology and preventive measures associated with HBV. The current antiviral therapeutics are not providing adequate protection against HBV. It is...
Shujjah Haider1,*, Ayesha Maqbool1, Tariq Pervez1, Saima Parveen1, Arfan Ahmad2, Zahid Iqbal3, Javed Iqbal3, Shahid Mehmood3, Amanullah Khan4 and Sajid Umar5
...tion of MG antibodies in serum samples as compared to RPA/SPA test. This evidence emphasizes the need of more systemic approaches for the investigation ofMG distribution and prevalence in otherparts of Pakistan in order to design effective control strategies. 
...
Qudrat Ullah1,8,*, Huma Jamil1, Laeeq Akbar Lodhi1, Zafar Iqbal Qureshi1, Shakeeb Ullah1, Tariq Jamil2, Iahtasham Khan3, Shahbaz Bashir4, Qudratullah5, Inamullah Wazir6M. Abdus Sallam1 and Muhammad Zubair7
...nfection. A total of 384 serum samples were collected from cross bred dairy cattle at three different private farms located in Gujranwala, Pakistan. The samples were analysed by Rose Bengal Plate Test (RBPT) and by indirect-Enzyme Linked Immunosorbent Assay (iELISA). The overall seroprevalence was found to be 28.90 and 27.86% by RBPT and iELISA, respectively. Previous history of animal reproductive disorders was found to be significantly associated (P=0.005...
Ali Mujtab Shah1,2,3, Muhammad Naeem2, Muhammad Giasuddin Shah2, Muhammad Haaroon2, Quanhui Peng1 and Zhisheng Wang1,*
...is study showed that the serum IgG levels and body weight gain were significantly (p < 0.05) different among the groups, the greater levels were observed in ST (15.74±0.29 mg/ml) as compared to NF (11.52±0.72 mg/ml) and NS (10.36±0.36 mg/ml) during the experiment period. Whereas; withers height, heart girth and body length were found non-significant (p > 0.05) among the groups. The morbidity rate of calves fed different levels of col...

Chukwuemeka Calistus Okolo1*, Ikenna Onyema Ezeh2, Chinelo Nnenna Uju3 and Nwakaego Ernestina Nweze1 

...oups A and B had similar serum alanine and aspartate aminotransferases, blood urea nitrogen, and serum creatinine levels as group D. The serum malondialdehyde and catalase levels were similar in groups A--D. Therefore, treatment with the probiotics, while enhancing clearance of trypanosomes did not improve the antioxidative and clinical outcome of the infection. 

...
Nouf Alharbi*, Mai Elobeid and Promy Virk
...MDA) levels in liver and serum, and histopathological evaluation of liver and kidney. Results showed that low dose of quercetin was significantly (p≤0.05) more effective than the high dose. Low dose was more efficacious in reducing Cd accumulation in the tissues, reversing the effects of Cd toxicity on blood profile, and on the CAT and SOD activity in the liver and decreased the MDA levels in both serum and liver. Thus, t...
Gul Afshan1,2,*, Soumble Zulfiqar2, Sumaira Mehboob2, Muhammad Tahir Javed Khan1 and Abdul Rauf Shakoori2,*
...ein bound with the human serum almost three times more efficiently than the positive control. For raising antibodies against the antigenic protein HCV3a E2, the purified protein E2 was injected subcutaneously into the rabbit (Oryctolagus cuniculus). The antibodies titer in rabbit after immunization in 100% pure serum sample was 0.736 which was 15 times more than that of pre immune control sera (0.049). It is co...
Yue Ren1, Peng-Fei Liu2, Wan-Long Zhu1,*,Hao Zhang1 and Jin-Hong Cai1
...esis (NST), food intake, serum leptin levels and hypothalamic neuropeptide Y (NPY), agouti aelated peptide (AgRP), pro-opiomelanocortin (POMC), cocaine and amphetamine regulated transcript (CART) expressions were measured. The results showed that body mass and serum leptin levels were lower significantly in winter than that of in summer in five areas. But thermogenic characteristics and food intake were higher significantly ...
Shad Mahfuz1,2, Shuyuan Wang1, Mo Chen1, Fei Zao1, Dong Zhen1
Zhongjun Liu4 and Hui Song1,3*
...ormance, egg quality and serum metabolic profile during the early phase of production.A total of 105 ISA Brown 18 wk old laying hens were grouped into 5 treatments with 7 replications of 3 hens each. Dietary treatments included a basal diet as control; antibiotic (0.05% flavomycin); 2% FVW; 4% FVW; and 6% FVW for 8 wk. Data were subjected to one-way analysis of variance using SPSS software followed by Duncan’s test probability of p<0.05. During...
Lin Sun1, Xiaofang Bu2, Jian Wang1*, Xiaorui Liu1 and Zhanyi Kong2
...ntration of the CXCL8 in serum and the level of CXCL8 mRNA in PBMCs of forty-eight children were dynamically measured by ELISA and PCR. The ratio of lgcDNA/lgGAPDH was regarded as the extreme level of CXCL8 mRNA. The serum level of CXCL8 and expression of CXCL8 mRNA in PBMCs in MPP children were (298.917±51.860) pg/mL and (1.848±0.525) lgcDNA/lgGAPDH. There were significant differences between the trial groups ...
Mo Chen1, Shad Mahfuz1, 2, Yan Cui1, Liying Jia1, Zhongjun Liu3 and Hui Song1, 4*
...ntioxidant properties of serum and egg yolk in ISA Brown layer hens fed with mushroom (Flammulina velutipes) stembase (FVS). A total 150 hens of 30 wk old were grouped into 5 equal treatments with 5 replications of 6 hens each. Dietary treatments included basal diet as a control group; control diet including antibiotic (0.05% flavomycin) as an antibiotic group; 2% FVS fed group; 4% FVS fed group and 6%FVS fed group. The experimental duration was total 63 days,...
Muhammad Furqan Shahid1*, Tahir Yaqub1, Muhammad Yasin Tipu2, Asim Aslam2, Saima Yaqub1, Aziz-ul-Rahman3, Muzaffar Ali1
... Cross reactivity of antiserum response toH9N2 was compared among reference isolates when challenged in broilers, Partridge origin anti-H9N2 antibodies showed varied hemagglutination inhibition results (4log2 to 15log2) when cross reacted with different antigens, suggesting H9N2 viruses are circulating with different antigenic characteristics. Sero-biochemical analysis of blood collected at 7th DPI revealed an increase in aspar...
Hafiz Muhammad Arsalan1, Maria Altaf1, Zeemal Seemab Amin1, Muhammad Khalil Ahmad Khan2, Anum Shahzadi1, Hina Mudasser1, Iqra Maqsood1, Nazia Gulshan1, Saira Naseem3
...5 ml Blood was drawn and serum was separated. Anti-Oxidant Biomarkers, Serum micronutrients, serum Electrolyte balance was measured through spectrophotometric procedure. Serum MDA level jump high in patients (14.19) as compared to normal subjects (3.26). Serum Glutathione declined in disease persons (0.56) from healthy...
Haq Aman Ullah1,*, Aneela Zameer Durrani2, Muhammad Ijaz2, Aqeel Javeed3, Muqadder Shah1 and Ikramul Haq1
...ence to udder health and serum parameters of lactating goats. Thirty two lactating Beetal goats of 3-4 y age, weighing 40.91±0.285, were randomly selected, and equally divided into four groups. Group A was kept as control while animals of groups B, C, and D were individually fed daily with 30µg, 40µg and 50µg of AFB1, respectively, through naturally contaminated cotton seed cake for a 10 days period. Milk samples were tested for aflato...
Saman Muhsin Abdulkareem* and Nadir Mustafa Nanakali
...ve stress biomarkers and serum liver enzymes (p<0.05). While, pre and post treatment of QCT (20 mg/kg/day) had protective effects on hepatotoxicity induced by TCDD and could significantly decrease these factors (p<0.05). Furthermore, there is no difference between the pre and post treatment of QCT (p>0.05). In addition to, the results showed that prolonged exposure to TCDD causes mutation in CYP1A1 gene and increases the expression of this gene...
Zekeriya Demir1 and Hatice Kaya2*
...ncreased Mg value in the serum parameters. However, the other serum parameters were not affected by the treatment. In conclusion, supplementation of bee pollen during the study period improved the feed conversion ratio and decreased serum cholesterol and lipid contents. In addition, according to economic analysis, the net income for hen fed 1.5% BP addition dietincreased by about 0.62% com...
Hu Liu1,2, Qifang Yu1,2, Xiaopeng Tang1,2, Chengkun Fang1,2, Sijia Chen1,2 and Rejun Fang1,2,*
...oncentration in eggs and serum antioxidant capacity in laying hens. Seven-hundred and twenty 21-week-old healthy Roman laying hens with a similar laying rate were randomly divided into 5 groups with 6 replicates of 24 hens. The experiment was designed by 2 × 2 factorial arrangement with two sources of Se and two levels of Se. The hens in control group were fed a basal diet without adding exogenous selenium source, and the hens in other four groups were f...
Kadry A. El-Bakry1, Lamiaa E.M. Deef1*, Lotfy Z. Habbak1 and Samia S. El-Naeli2
... significantly increases serum level of malondialdehyde (MDA) but decrease the activity of superoxide dismutase (SOD) enzyme. On the other hand, in patuilin injected rats and treated with ginger, the activity of ALT, AST and SOD were improved and level of MDA was decreased significantly. The liver and kidney tissues showed markers of improvement after treatment the patulin rats with ginger. In conclusion, treatment with ginger can protect liver and kidney form...
Sameh S. Tawfik, Ahmed A. Elkady* and Ehab T. Mohamed
...limited the elevation in serum tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) levels when compared to irradiated rat group. The histopathological-findings of renal tissues in the irradiated-group, showed nephrotoxicity; the renal cortex showed massive necrotic changes, the convoluted tubules showed distinctive pattern of ischemic renal injury and the cuboidal epithelium cells of proximal and distal renal ...
Monica Paula Marin1, Elena Narcisa Pogurschi1*, Iuliana Marin2 and Carmen Georgeta Nicolae1
...ficant increase in blood serum calcium during the last week of precalving period, as well as in the calving and postcalving periods, having as consequence fewer recorded milk fever cases. The results obtained can convince the farmers to use volcanic tuff as a food additive in the feeding of dairy cows during the precalving, postcalving and lactation periods, in parallel with ensuring the selenium requirements, because the natural zeolite can improve the reprod...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
Yan-Guo Han, Yu-Qing Han, Jia-Yuan Wu, Jia Guo, Ri-Su Na, Yan Zeng, Guang-Xin E, Yong-Ju Zhao and Yong-Fu Huang*
...e in maternal animals on serum related hormones in offspring. In this study, ten ewes with two newborn lambs were randomly divided into SS DNA vaccine group (Group T) and empty vector group (Group C), and these vaccines were given orally into the ewes at weeks 0, 3 and 6 of the research. Blood samples of ewes or offspring lambs were collected at week 6 or 9 of lactation, respectively. Serum SS, prolactin (PRL), growth hormon...
Abdüssamet Aydın1 and Ş. Canan Bölükbaşı2*
...ion peroxidas (GSHPx) in serum. Sixty Lohman LSL white layers, 40 weeks of age, kept in individual cages were assigned randomly to five treatment groups, each group included 12 hens. The hens received one of five diets with 0, 32.5, 65 or 130 mg/kg pennyroyal extract and 50 mg/kg BHA, respectively. Experiment lasted for 60 days. At the end of the experiment, the supplementation of pennyroyal extract did not affect feed intake, rates of albumen, yolk and shell ...
Mingsan Miao*, Hui Zhao, Jiaojiao Jia, Xiaoyan Fang and Yanyan Miao
...mical indicators such as serum NSE in the brain tissue. To investigate the impact of total phenolic acid on the biochemical parameters in the repeated cerebral ischemia-reperfusion mice, the mouse model of cerebral ischemia repeated reperfusion was successfully replicated. The doses of total phenolic acid of D. canes have significantly reduced the levels of IL-6 and TNF-α in brain tissue and decreased the level of NSE in the seru...
Abdul Kabir¹, Amjad Hussian Mirani¹, Jam Kashif1, Shumaila Manzoor2, Abdullah Iqbal3*, Ihsan Ullah Khan4 and Muhammad Abubakar2
...era, KPK. A total of 246 serum samples were randomly collected from three age groups (<1 year, 1-2 year and >2 years) of sheep and goats. Competitive ELISA was performed to evaluate sero-prevalence of PPR in goats and sheep. The swab and tissue samples were collected from the surrounding areas from suspected sheep and goats to confirm the PPRV. Out of total 246 sera, 144 (58.54%) samples were found seropositive for PPRV. PPR was more prevalent in sheep (...
Fatima Hashim Abbas1,2* and Alaa Tareq Shakir Al-Hassnawi1
...OS) were measured in the serum of all studied groups. MDA levels were significantly higher (p≤0.05) in aborted women with T. gondii compared to negative control. MDA levels were also significantly higher (p≤0.05) among aborted women with Cytomegalo virus compared to negative and positive control groups. All aborted women had significantly higher levels of TAC levels (p≤0.05) compared to the control groups. However, catalase activity and ROS lev...
Ahsan Numan1,4, Khadija Irfan Khawaja2, Abdul Basit Qureshi3Muhammad Shahbaz Yousaf4, Imtiaz Rabbani4, Hafsa Zaneb5 and Habib Rehman4*
...determination of various serum biochemical determinants. Prevalence of DSP was found to be 31.48% when 2,290 diabetes mellitus Type-2 subjects were screened. The patients with DSP were older (p < 0.05), had longer duration of DMT2 (p<0.01), elevated systolic blood pressure (p<0.05), blood sugar (p < 0.05), HbA1c (p<0.001), cholesterol (p<0.01), LDL (p<0.001), triglycerides (p<0.05) and more obese (p<0.01) when compared wit...
Ahmet Ozer Sehirli1,2, Serkan Sayiner3*, Ayliz Velioglu-Ogunc4, Nedime Serakinci5, Emel Eksioglu-Demiralp6, Berrak Yegen7, Feriha Ercan8 andGoksel Sener2
...me, creatinine, and both serum and urinary electrolyte levels were measured. In addition, the apoptosis rate of white blood cells was analysed from plasma samples. Tissue samples from the brain, heart, aorta and kidneys were used for analysis of the collagen content besides tissue luminol, lucigenin, malondialdehyde (MDA) and glutathione (GSH) levels. A significant difference was determined between the CRF group and the control group with regard to heart rate,...

Saima Sharif*, Farkhanda Manzoor, Tasnim Farasat, Shaugfta Naz and Raheela Tabasum 

...stimation was done using serum creatinine and blood urea along with eGFR calculation by MDRD equation. Kidney dysfunction was defined as eGFR of <60 ml/min/1.73m2. Statistical analysis was donedone by using SPSS. The serum creatinine of ischemic stroke patients was found to be 2.41 mg/dl compared to 0.93mg/dl in controls. The blood urea in ischemic stroke group was 67.3 mg/dl in contrast to 34.6 mg/dl in controls. The eGF...
Gong Ga1,2 and SuoLang Sizhu2,*
... In this study, 173 serum samples of Tibetan swine were tested for anti-HEV IgM and IgG antibodies by the ELISA. HEV RNA were measured in feces (n=173), serum (n=173) and tissue ((including liver, spleen, kidney and intestine, n=21) by nested RT-PCR and qRT-PCR. HEV antigens were detected in tissues by immunohistochemistry analysis. Overall, we found that that eight serum samples (4.6...
Xuhui Zhang1, Zhiyuan Sun2, Jinfeng Cai1, Guibin Wang1, Zunling Zhu1, Linguo Zhao3 and Fuliang Cao1,*
... the FR3 diet. Moreover, serum glutathione (GSH) and α-tocopherol (α-TOH) contents in the FR groups were increased, while, levels of total cholesterol (TC), malondialdehyde (MDA) in serum and hepatic reactive oxygen species (ROS) in FR groups were significantly decreased compared with the control or NF group at 42 d of age. Furthermore, serum total superoxide dismutase (T-...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...y included 500 suspected serum samples. All clinical specimens were tested for IgM and IgG specific antibodies against Chikungunya virus using a commercial ELISA kit. Twenty seven (5.4%) and thirty five (7%) samples were IgM and IgG positive, respectively. All antibody positive samples and a subset of negative samples (195) were further subjected to PCR for confirmatory purposes. Two different sets of primers were used for the identification of the viral genom...
Ke Zhang1, Shuai Liu2, Qiu Chen1, Yu Wang1, Li Liu1, Bingjie Li1, Kai Ma1, Xiaoya Wei1, Aijun Li3 and Junyan Li2*
...(WB) with artificial antiserum. A total of 105 Haemaphysalis longicornis (H. longicornis) ticks were selected to prepare protein samples. Some of them were used for 2-DE, and the others were used to immunize mice to collect tick antiserum for WB. Then, 2-DE followed by WB and MALDI-TOF was carried out to screen and identify tick antigens. We identified 19 protein spots representing 12 ORFs: 4 from ticks and 8 f...
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...S), body weight (BW) and serum health biomarkers in Beetal goats during the transition period. Twenty-four Beetal goats were randomly allotted to three groups YSC0, YSC5 and YSC10 and were fed a basal diet supplemented with 0g, 5g or 10g yeast day/animal, respectively for 4 weeks before and -4 weeks after kidding. When compared with the non-supplemented goats, dietary yeast improved (P<0.05) DMI during transition period however, BCS (P = 0.81) and BW (P = 0...

H. Liu1, X.P. Tang1, R.J. Fang1,*, F.Yi2, C. Zhang2, R.Q. Yang1, F. Sun1 and S.Y. Zhou1 

...n growth performance and serum Cu-Zn SOD activity in piglets. A total of 288 (144 castrated males and 144 females) healthy post-weaned at 23-day-old piglets (Duroc × Landrace × Yorkshire) with an average body weight of (8.79±1.15) kg were randomly divided into 6 groups with 8 replicates in each group, and 6 piglets (3 castrated males and 3 females) per replicate. Control group was fed a basal diet, experimental groups were fed diets suppleme...
Khayyam1*, Muhammad Zahid1, Naiz Ali2 and Qadeem Khan3
... patients. Prolactin and serum gonadotropin showed fluctuations in Hashimoto’s thyroiditis patients but in Grave’s disease patients only the gonadotropins showed abnormal values while prolactin was in the normal range. The study suggests that autoimmune thyroid diseases effect the pituitary-hypothalamic axis which needs to be further investigated to find the mechanism underlying it.
...
Mian Adnan Kakakhel1, Faryal Gohar1, Zahid Anwar2, Raza Ullah1, Muhammad Attaullah3, Shahbaz Ahmad4, Aamir Khan5, Kalimullah5*
... Peshawar, Pakistan. The serum samples were analyzed for IgG and IgM by using enzyme-linked immunosorbent assay (ELISA), and statistical analysis carried out. Out of these tested samples, 20% were positive for both IgG and IgM against T. gondii. The positive prevalence of T. gondii was 11.11% in male dogs and 42.85% in female dogs. Further details of results are given in below in main data. T...
Majeeda Rasheed1*, Tanveer Akhtar1, Nadia Mukhtar2, Muhammad Furqan Shahid2, Muhammad Imran3, Saima Yaqub2
Magbolah Salem Helal Alzahrani
...demonstrated decrease in serum lipoprotein HDL, LDL, VLDL fraction levels, indicating liver damage. Rats given CCl4 and fed on 5% M. chamomilla showed the most significant increase in organ weight as compared to all levels of treatment suggesting that M. chamomilla can reduce liver damage. Rats given CCl4 then fed on a combination of all levels of M. chamomilla showed a decrease of AST, ALT and ALP enzyme levels in th...
Mumtaz Ali Khan1, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Kashif Prince1*, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4Asad Ullah5, Naimat Ullah4, Muhammad Shoaib2 and Said Sajjad Ali Shah2
...ets, packet cell volume, serum creatinine, bilirubin, liver enzymes, total, glucose and urea in blood significantly (P<0.05) increased. Fluctuations in mean erythrocyte counts (RBC), hemoglobin, PCV and total bilirubin were beyond the limits while others were within normal ranges in sheep infected with Clostridium perfringens type A. The total bilirubin, Liver enzymes, creatinine level, glucose and urea levels in blood were abnormal while others were...

Muhammad Shakeel1*, Mudussar Nawaz1, Zahid Naseer1, Muhammad Fiaz1, Asghar Khan1, Muhammad Imran Khan1, Awais Ur Rehman1, Ahmad Yar Qamar2 and Ali Raza3

Caprine and Ovine Serological Evidence of Brucellosis in Five Districts of Punjab, Pakistan
...akistan. A total of 1239 serum samples were collected from male (n=73) and female (n=1166) different sheep (n = 865; Pak-Karakal, Thalli, Lohi, Kajli and non-descript type) and goat (n = 374; Teddy, Beetal and non-descript type) breeds of variable age groups (0 months to 4years). All the serum samples were analyzed using Rose Bengal Plate Test (RBPT) and seropositive samples were further submitted to

Amit Sharma1* and Pankaj Sood2

Sonographic Assessment of Ovarian Follicular Dynamics during Breeding and Non-Breeding Season in Gaddi Goats
...ing both the seasons for serum progesterone (P4) estimations. Follicular growth was characterized by presence of three to five numbers of follicular waves in both seasons. Significantly higher (P<0.01) number of follicular waves (4.0±0.21 versus 3.18±0.12), number of follicles at wave emergence during second (2.85±0.26 versus 1.77±0.14; P<0.01) and third wave (2.57±0.2 versus 2.0±0.16; P<0.05), along with shor...

Zahir Shah1*, Saima Munawar1, Ihsan Ullah2, Taif Shah3, Haq Aman Ullah1, Saqib Nawaz1, Farhan Anwar Khan1 and Manoj Kumar Shah4

Combined Physico-chemical and Analgesic Effects of Electroacupuncture Plus Clonidine in Goats
...r, a significantly lower serum glucose concentration was noted in EA plus 10µg/kg of clonidine treated goats at 15-60 min than those treated with clonidine alone. Creatinine, blood urea nitrogen, alanine/aspartate aminotransferase activities, and hematological variables for differently treated groups were insignificant. In conclusion, EA combined with a low dose of 10µg/kg of clonidine provided better analgesia in experimental animals.

...
Muhammad Tahir Khan1, Shahid Mehmood2*, Athar Mahmud2Khalid Javed3 and Jibran Hussain2

 

...fferences (P>0.05) in serum biochemical indices, and immune-related parameters among the diets. The experimental group fed compost at 10% showed the lowest (P=0.0001) feed cost per kg weight gain compared to control group. These results indicate that it is possible to feed diets containing up to 10% compost to growing meat quails without compromising growth performance, carcass characteristics, serum biochemical indices, ...

Joseph Anejo-Okopi1*, Dorcas Yilger Gotom1, Noble Allison Chiehiura1, Julius Ocheme Okojokwu1, David Ochola Amanyi2, John Otumala Egbere1, Joshua Adetunji1, Otobo Innocent Ujah3 and Onyemocho Audu4

The Seroprevalence of Zika Virus Infection among HIV Positive and HIV Negative Pregnant Women in Jos, Nigeria
...us IgG (ZV-IgG) in human serum. A total of 90 pregnant women was recruited, and the overall seroprevalence was (14.4%) for Zika virus (20.0% HIV positive and 8.9% negative) IgG antibodies. A significant association was found with age category among the HIV negative pregnant women p=0.012, and in the history of blood transfusion among the HIV positive participants, p=0.013. No association with educational level, employment, marital and resident, gestational tri...
Rida Younas1*, Tamseela Mumtaz1, Nabeela Roohi2 and Muhammad Amir Iqbal3
...sion of IL-6 and IL-8 in serum samples were evaluated by Enzyme-linked immunosorbent assay. Correlation between serum inflammatory cytokines (IL-6 and IL-8) level and post predicted FEV1%, FVC% and FEV1/FVC was analyzed. Results of serum IL-6 and IL-8 showed significant difference among control and GOLD stages II, III and IV (both P< 0.05). The level of IL-6 was highest in GOLD stage II...
Yasir Sharif1, Saba Irshad1*, Ammara Muazzam1, Muhammad Hamza Tariq1, Ambreen Kanwal1, Sana Rasheed1, Mabel Baxter Dalrymple2 and Anam Tariq1
...ount (CBC), blood group, serum ferritin level and liver function tests were performed. Secondary complications were assessed by physical examination of pallor, splenomegaly, ascites, and hepatomegaly. The average±SD values of patients’ CBCs and liver enzymes were: red blood cells 3.07x 1012±0.769x 1012/L, white blood cells 8.89x 109±2.849x 109/L, hemoglobin 8.01± 1.027 g/dL, platelet...
Mehwish Saleem Khan
Evaluation of Changes in Zinc Levels in Patients Suffering from Cancer
...this study zinc level in serum of cancer patients was observed. For this purpose, the blood of 50 cancer patients was taken from MAYO HOSPITAL Lahore. The patients are suffering from different type of cancers such as, breast cancer, lung cancer, uterus cancer, oral cavity cancer, esophageal cancer, urinary bladder cancer, blood cancer and brain tumor. In addition to serum zinc level of cancer patients many other parameters w...

Md. Gulam Rabbany Rassel1, Kazi Afsana Homayra Orchy1, Md. Moshiur Rahman Khan1, Marzia Rahman2 and Md. Mahmudul Alam1*

Hematological and Serum Biochemical Indices in Calves with Navel Ill
...es in haematological and serum biochemical attributes in calves affected with navel ill. Peripheral blood was collected from affected and healthy calves, and serum was separated for biochemical evaluation. In term of haematological profile, Hb and TEC were decreased whereas PCV and TLC were elevated compared to healthy calves. Some leading enzymes such as ALT, AST, ALP, LDH, CK were elevated in affected calves than their hea...
Jin-Juan Wan, Mei-Fang Shen*, Hui Xue, Hong-Yan Liu, Mei-Qin Zhang, Xi-He Zhu and Chong-Hua Wang

 

...i><0.05). The highest serum lysozyme (LZM), lowest catalase (CAT) and malondialdehyde (MDA) were observed in crayfish fed 3 times/day. However, there were no significant differences in cortisol, glucose (Glu), and superoxide dismutase (SOD) among all groups (P>0.05). The cumulative mortality in F3 was significantly lower than that of the other groups at d4 after challenge (P<0.05). In conclusion, both low and high feeding frequencies cou...
Xuya Zhou1, Ying Liu1, Deqin Xu1, Jie Bao1, Yaru Cao2 and Yong Jin3*
...c peptide (BNP) in blood serum of diabetes complicating arthritis rats. Blood pressure was measured by a noninvasive caudal artery blood pressure meter. Western blot analysis showed that unification of two drugs caused protein expression levels of COX-2 to reduce obviously and increased protein expression levels of CYP4A1. Immunohistochemistry showed the increased expression of CYP4A1. Elisa indicated that the decreased production of PGE-2 and the increased pr...

Yuan Xing, Congming Tan, Yan Luo and Wenjun Liu* 

...evels in the asthma mice serum. Inflammatory cells in the mice BALF are significantly reduced in a dose-dependent manner through quercetin. Quercetin (P<0.05) significantly reduced the level of TNF-α, IL-1β, IL-4 and IL-5 cytokines and increased the level of IFN-π in allergic asthma mice caused by OVA. In contrast, there was no significant effect in the body weight of mice treated with quercetin. Based on the result, we may infer that querceti...
Muhammad Shafiq1,2,*,Rajwali Khan1, Ilyas Ali3, Sadeeq Ur Rahman4, Saif Ullah3Shah Jan Mohammad2, Mohammad Jan2 and Jinhu Huang2
...le breed type on (a) cow serum IgG and serum total protein concentration (b) colostrum immunoglobulin level and (c) their respective calves’ serum immunoglobulin and serum total protein concentration. Three breeds of cattle were observed: Jersey, Holstein Friesian (HF) and local Pakistani cow breed Achai. To assess s...
Somia Shehzadi1, Sana Javaid Awan2, Maryam Javed1*, Asif Nadeem1 and Tahir Yaqub3
...ty of ATFs. Fetal bovine serum (FBS) is used extensively in cell culture but being expensive and scarce in availability, its alternatives are needed. This study proposed autologous equine serum (AES) and adult bovine serum (ABS) to be evaluated as alternative to FBS. ATFs were cultured in DMEM-HG and supplemented with 10% FBS, 10% AES and 10% ABS. At passage 4, each group showed same morph...
Rabia Riaz1, Khushi Muhammad1*, Masood Rabbani1, Muhammad Amjad Iqbal2, Aamir Riaz Khan2, Sadia Sarfaraz1, Mudassar Naseer3 and Khalid Majeed1
Huan Yang1, Tingting Li1, Huimin Zhao1,2, Xiaoyuan Zhang1, Huiyan Xu1, Yangqing Lu1, Xingwei Liang1, Shengsheng Lu1, Xiaogan Yang1*and Kehuan Lu1*
... medium (SSCM), which is serum-free. SSCs began to proliferate on the second day and quickly formed grape-like clusters that were consistent with the morphological features of SSCs. These cells were identified as positive by immunofluorescence staining. This study successfully isolated, enriched and identified buffalo SSCs and established an effective platform to explore the mechanisms of proliferation and differentiation of buffalo SSCs.
...
Kamal Al-Samawi1, Mohamed Al-Hassan2, Hussein Migdadi3,4*, Megahed Ammar5 and Salem Alghamdi3
...using real-time PCR, and serum progesterone (P4) concentrations were assayed using an ELISA kit. Pregnancy detection was performed by US on 23, 35, and 60 days post NM. Serum P4 concentration was significantly higher in pregnant than non-pregnant goats at 15, 23, 35, and 60 days post NM. Relative expression of mRNA of ISG15 and ISG17 was significantly higher in pregnant goats at 7, 15, and 35 days post N...
Ying Liu1, Shankun Liu1, Hui Wang2 and Weihua Su2,*
...The blood glucose level, serum, lipids, antioxidant, cytokines and C-peptide was recorded. GDM group rats showed the lower weight of pregnant rats, fetal and placental weight as compared to other group rats. Caffeic acid treated group rats exhibited the modulated level of blood glucose level, lipid profile and antioxidant parameters at dose dependent manner. Caffeic acid significantly (P<0.001) enhanced the level of insulin, hepatic glycogen as compared to ...
Nosheen Basharat1, Usman Waheed2,3*, Muhammad Arshad1, Noor e Saba4, Iram Masood1, Akhlaaq Wazeer1, Ahmad Farooq1, Sadaf Moneeba1Abdul Rauf5 and Hasan Abbas Zaheer2,3

 

...iscovered in 1997 in the serum of a Japanese patient. TTV is a non-enveloped small virus of 3.8 kb containing a circular single-stranded negative-sense DNA genome. TTV represents the first circovirus-like virus found in humans. The study was conducted to assess the molecular epidemiology of TTV in healthy blood donors and find its relationship with hepatitis B and hepatitis C seropositivity. The study was conducted at the Department of Pathology and Transfusio...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
... using NDV reference antiserum, As well as realtime polymerase chain reaction by using standardized NDV specific primers and finally eight viruses were selected for further sequencing for the partial fusion protein, The eight NDVs isolates of velogenic genotype VII and contain the unique cleavage site motif 112RRQKRF117 with high relation to very virulent NDV Chinese strain Chicken /China/SDWF07/2011 strain with nucleotide identity percentage (99.3% -100%). Th...
Hagar E. Mohammed1, Ranwa A. Elrayess2 and Heba N. Gad El-Hak2*
...indices and a decline in serum testosterone levels which may have a bad impact on male infertility, on the other side, treatment the rats with the combined extract of different doses of A. monosperma or M. piperita attenuated the deleterious damage to the testes, the sperm index and the sex hormones. This study indicated that the traditional use of these two herbs as a mixture has no effects on male reproductive health.
...

Ali Zaman1, Nabila Roohi1 and Muhammad Irfan2*

...al signs, hematology and serum biochemistry in Nili Ravi buffaloes under subtropics is lacking. This study was designed to fulfill this gap by analyzing the effects of exposure to the bacterial culture of Pasturella multocida (P. multocida) type B:2 and its immunogens, i.e., lipopolysaccharide (LPS) and outer membrane protein (OMP) on Nili Ravi buffaloes. Prepubertal Nili Ravi female buffaloes (N=18) of 10-12 months age in good health condition were divided in...

Mehwish Saleem1*, Maria Tahir1, Maryam Ilyas2 and Aqsa Malik2

... purpose was to evaluate serum calcium level in patient’s blood. Blood samples were collected from cancer patients from MAYO hospital LHR during the time period April 2018 to May 2018. Some cancer patients have increased calcium level in blood. Cancer is more prevalent in males (n=17) 57% than females (n=13)43%. The most frequent cancer type among males is blood 41cancer (n=5) 36%, lung cancer (n=3)   22% and oral cancer (n=3)22%. In females br...
Aneeqa Saleem1, Muhammad Islam1, Hamid Saeed1* and Mehwish Iqtedar2
...utcome measures included serum creatinine, uric acid and BUN levels. Significant differences exist with regards to primary and secondary metabolites between both peel and pulp extractives. After 21 days of treatment in mice, only chloroform (CHL) extractives of peel and pulp demonstrated significant improvements in serum creatinine (Peel: N; 1±0.44, PC; 1.4±0.62, CHL; 0.43±0.18, p<0.05, ...
Xiujun Yao1, Haofeng Wang 2, Ligong Zhang3, Jingzhang Wu4 and Lijun Wang1*
... urine protein quantity, serum levels of IL-6, IFN-γ, and TNF-α ,kidney ROS and MDA levels, relative content of TGF-β1 and CTGF in TGP group were lower than that in model group (P <0.05); serum levels of IL-2 and CTLA-4,SOD levels in TGP group were higher than that in model group (P <0.05).These results indicated that TGP could reduce urinary protein quantity, inhibit inflammatory response, and reduce ...
Chaman Ara1*, Asmatullah1, Saima Hanif1, Shagufta Andleeb2, Beenish Zahid3 and Madeeha Arshad4
.... Blood was collected in serum separating tubes through intracardiac puncture for biochemical analysis. Morphometric observations revealed significant decrease (P≤0.001) in body weight of mice in Al treated groups as compared to control but organs weight increased contrary to the body weight. Significant increase (P≤0.01-P≤0.001) was recorded in total alanine transaminase (ALT), aspartate transaminase (AST), alkaline phosphatase (ALP) in liver and ure...

Saddar Faheem1,2, Hameeda Kalhoro1, Naeem Tariq Narejo1*, Muhammad Hanif Chandio3, Memon Samina4, Shahnaz Rashid5 and Ghulam Abbas5*

...tological variations and serum biochemical constituents of Labeo rohita from Kotri Barrage near Jamshoro, Sindh, Pakistan. Fish samples (100 specimens for each sex) were collected during two seasons i.e., summer: March to May, 2017 and winter: November, 2017 to January, 2018. Haematological characteristics of the fish specimens were considered season and sex wise separately. Results showed that erythrocytes (2.09 × 106 to 2.26 × 106), leucocytes (1...
Majed Rafeeq1,*, Nadeem Rashid1, Muhammad Masood Tariq1, Irfan Shahzad Sheikh1, Muhammad Zahid Mustafa1, Muhammad Shafee1, Khalid Mehmood1, Rana Muhammad Bilal2 and Tauseef Asmat1
... parameters, hematology, serum biochemistry, immune response (ND and SRBC), intestinal histo-morphology, bacterial enumeration and cecal volatile fatty acids (VFAs) were measured. There were significant improvements in weight gain (WG), feed conversion ratio (FCR) and average daily gain (ADG) in the treatment groups supplemented with extract (P<0.05) compared to control. Similarly, intestinal histo-morphic parameters and ileal bacterial count were significa...

Ahmed F. Afify1, Mohamed A. Shalaby2, Ahmed A. El-Sanousi2 and Amal S. Gaber1

...se breeds, including 540 serum samples, among these, 4 EDTAblood
and 4 semen samples. Serologically, indirect ELISA was performed on 540
serum samples. 130 samples were clearly strong positive at a percentage of 24%.
Molecular detection of EAV genome was performed only on 8 selected semen and
EDTA-blood samples which were giving highly distinct positive reaction in the
<...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
...ained only with BBMV antiserum.The BBMV induced amorphous cytoplasmic
inclusion bodies in infected cells .The Susceptibilityof some faba bean cultivars and
genotype was also studied forvirus infection.The effectiveness of extracts from garlic
cloves (GE) and onion (OE) as an antiviral against BBMV infection in vivo has been
evaluated. The percentage of virus inhibition induced by GE and OE varied according
...

Yasser F. Elnaker 1, Mohamed El-Tholoth 2, Sahar Saber 3, Amira A- Elsaid4, Mohamed A. Saad 3, Emad E. Younis 5

...nofluorescence test. The serum antibody titers were determined by serum neutralization test (SNT) and Enzyme linked immunosorbant assay (ELISA) in calves and also their dams. The results confirmed infection of calves with lumpy skin disease virus (LSDV) and showed that calves older than 3 months old age and those out of first calf heifers are more susceptible for infection. Some calves even with insufficient amount of matern...

1Mona A. El-Manzalawy, 2Abeer A. Boseila , 3Hanan M. El Zahed

...une response detected by serum neutralization test (SNT). This vaccinated group of sheep was the highest while the group of sheep vaccinated with RVF vaccine adjuvanted with Alum gel only show the least antibody titer. The group of sheep, which was vaccinated with RVF, inactivated PMO without gel vaccine show intermediate level of antibodies. Moreover, the values of ED50 of the developed vaccines as well as the Alum vaccine alone were not exceed 0.02 which lie...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...his study 161 out of 376 serum samples in percentage 42.8% were positive for FMD non structure proteins( NSP) antibodies which indicated the natural infection. ELISA kit used for FMDV antigen detection for the epithelial suspension from 42 field samples collected from various geographic locations 10 governorates are ( El-Sharkia,Giza, Port Said, Assuit, Suize, Kafre El-Shake, Qina, Al-Gahrbia, Domiatte and Alexandria) Serotyping and molecular characterization ...

Nashwa M. Helmy1 and Ahmed S. A.2

...n suspected samples. The serum samples were collected from Sharkia
and Fayoum governorates (30 and 40 sera respectively) submitted to laboratory
examination by Priochek for NSPs (3ABC) 32 out of 70 were positive (12 sera samples
from Sharkia and 20 sera samples from Fayoum), while 22 out of 70 were positive by
real time RT-PCR (10 sera samples from Sharkia and 12 sera samples from Fayoum).
Definitive ...

Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed

...specific
antiserum and confirmed by Reverse Transcriptase-Polymerase Chain Reaction (RTPCR)
using virus-specific primers. The molecular characterization for the Egyptian
isolate has been performed through cloning and sequencing for the OYDV CP gene
which amplified by RT-PCR then cloned and sequenced in the TOPO cloning vector. The
CP gene sequence has been submitted to the GenBank and compared to othe...

Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2

...A using the specific antiserum. Anatomical and ultrastructure changes in leaf tissues of both Tomato and Grapevine artificially infected with Tomato ringspot virus were studied by light and electron microscopy. By light microscopy viral infection resulted in the presence of amorphous inclusion bodies in the cytoplasm of infected leaves.Phloem tissues were also affected by infection. Investigations of leaf tissues of both tomato and grapevine by Transmission El...
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2
.../div>
specific antiserum for BSV. IC-PCR indicated the episomal presence of BSV in
Williams and Pradica banana varieties. In addition, IC-PCR analysis on vitroplants
collected from tissue cultures (TC) showed the significant role of TC in spreading out
of BSV. PCR amplicons for the reverse transcriptase and RNaseH motifs of ORF III
for four BSV isolates were cloned, sequenced and submitted to GenBank. The f...

Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³

... using BBMV specific antiserum. Light microscopy of epidermal strips of faba bean infected-leaves revealed amorphous cytoplasmic inclusions (X-bodies). The UV absorption spectrum of the purified virus had a maximum at 260 nm and a minimum at 245 nm. The ratios of Amax/Amin and A260/280 were 1.39 and 1.57, respectively. Yield of the purified BBMV preparation was about 2.5 mg/100g of infected tissue. Electron micrograph of purified virus preparation revealed iso...

Aly M. Abdel-Salam

.../div>
Egyptian antiserum of BSV captured SCBV antigens in leaves and insect vectors in
Immunocapture (IC) PCR analysis. The present study represents the first record of
SCBV presence in Egypt.
...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...fied with a specific antiserum (Loewe Biochemica GmbH) using Double Antibody Sandwich ELISA (DAS-ELISA). Virus survey was carried out during 2013 - 2014 in different locations on commercial strawberry fields. The percentages of infection were 3.7, 4.5, 15.7 and 20% in El-Behera, El-Kalubeia, El-Ismalia and El-Menofia respectively. SLRSV was transmitted either by Xiphinema americanumas nematode vector or mechanically from infected strawberry plants onto 16 host...

Aly M. Abdel-Salam1 and Samah A. Mokbel2

... sap and an Egyptian antiserum for NRSV. Purified preparation
from infected leaves, using the electro-elution technique yielded nucleoprotein which
had Amax and Amin at 260 and 240 nm respectively. Electron microscopy examination
showed spherical virions with ca. 26 nm in diameter.
...
M. A. Kararah1, Om-Hashem M. El-Banna1, Salwa N. Zein2 and Abd-Elrehiem, A.F.3 
...lly purified for its antiserum production. The absorption
spectrum of the purified virus had a min at 245 nm and a max at 260 nm. The
ratios of A260/280, A280/260 and Amax/min were 1.16, 0.85, and 1.04,
respectively. Yield of PMV was 1.7 mg/100g of infected leaves. Electron
micrographs of the partially purified virus preparation revealed the presence
of filamentous flexuous virus particles about 700- ...

Sadiq Haladu1*, Taiwo Oladoye Akande2 and Mudassir Nasir3

... taken were analyzed for serum components, haematological indices and lipid profiles. The results of plasma lipid profile showed that diet 4 (78.76 mg/dl) is significantly low in HDL compared to other dietary treatments. Egg total cholesterol showed significant reduction in diet 5 (254.65 mg/dl) observed when compared to the control diet (314.56 mg/dl). The result of serum analysis also showed significant difference in all t...

Safaa M. Mohammed*, Shahira A. Abdelwahab**,Fetaih,H⃰ ⃰ ,Neveen,R⃰ ,Abdel satar ,A⃰ and Mohamed S. Elshahidy**

...alities .75% of examined serum reacted positive to TKPV .All TKPV isolates were amplified using specific P4b primers and visualized by gel electrophoresis at 578bp.

...
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...s have been reacted with serum collected from aborted and infected mares revealed band at the expected site using anti equine IgG labeled horse radish peroxidase, concluding that the expressed envelope glycoprotein D of EHV-1 (EHV-1gD) could be used as a good candidate for manufacturing of diagnostic Antigen for detection of the circulating antibody either in vaccinated or latent infected horses.

...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

... by bleeding and the antiserum was obtained. IgG was purified and conjugated to alkaline phosphatase. The conjugated antiserum was evaluated by indirect enzyme-linked immunosorbent assay (ELISA). The conjugated antisera that prepared in this study were succeeded to detect the virus in infected plants.

...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...uthentic and induced antiserum for PNRSV.RT-PCR with specific PNRSV primer was used to confirm the obtained results. No amplified product was obtained from healthy control. The partial RNA3 movement protein product from PNRSV infected rose directly cloned using the TA cloning system. Nucleotide sequencing revealed the clones to be portion of PNRSV genome. These results indicate that the virus in rose is an isolate of PNRSV from Taif, KSA.

...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

Serageldeen Sultan1, Nabila Osman2

...in Egypt. A total of 510 serum samples were collected from broiler breeder (n=191), layer breeder (n=235) and commercial broiler chickens (n=84) from different farm flocks (24 flocks) in Egypt. These samples were examined for the presence of avian HEV antibody using enzyme linked immuno-sorbent assay (ELISA). The results revealed that the occurrence of avian HEV was 15.7% (80/510) and 66.7% (16/24) of the examined flocks. HEV antibody prevalence increased as a...

Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3

...IA) using an induced antiserum for TSWV. All the five tested tomato cultivars were found to be susceptible when mechanical inoculated under greenhouse conditions. Wide variations of symptoms were found between cultivars. Super strain and super merman were found to be more susceptible than any other cultivar tested which showing 90% infection. Basil essential oil and ethanolic extract of Plantago major leaves was used as antiviral to reduce the infection with T...

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...e against LSDV and (100) serum samples were drawn from cattle 4 weeks post vaccination with local attenuated sheep pox virus vaccine located in Sharkia and Fayoum governorates. Methods: Lumpy skin disease virus (LSDV) was isolated from skin biopsies collected from clinically infected cattle. The virus was isolated on MDBK cell line and identified by agar gel precipitation test (AGPT) and indirect fluorescent antibody technique (IFAT) using specific hyper immun...

Lamya A. F. Ateya1, Said A. Ahmed 2, Mansour H. Ayman3, Khamees K. Ashraf 4, Heba A. Abdel-Hady 5

...ng specific hyper immune serum against Lumpy Skin Disease Virus. Further identifications were carried out by polymerase chain reaction (PCR). Results: 15 samples were +ve for LSDV by conventional PCR.The results showed that 11/23 biopsies were positive by IFAT. Molecular identification of LSD virus by using RT-PCR, revealed positive for amplification of bands at the predicted molecular size (1926bp). Neutralizing antibodies against LSDV were (55) out of total ...

Lamya A. F. Ateya1 , Said. A .Ahmed2, Khamees K.S. Ashraf3, Heba A. Abdel-Hady4

...overnorate. Methods: 220 serum samples were tested for FMD NSP by 3ABC Trapping ELISA.20 serum samples were used as control (no vaccination),100 serum samples collected from animals received local vaccine and 100 serum samples from animals received imported vaccine. Results: 34/220(15.5%) were +ve and 186/220(84.5%)were –ve for FMD NSP test preinoc...

Ola Youssef 1; EL-Deeb A.H.2 Nassif S.A.1 and Ahmed A. El-Sanousi 2.

...tion using polyclonal H5 serum. The HVT titer in CEF
was 3045, 3200, 3400, 3750 & 4000 PFU/dose for batch A, B, C, D, and E respectively. The selected
batches safety was satisfactory by 10 fold field doses injection in SPF chicks. The challenge test results
revealed 80% protection for A, B and C batches while D and E batches gave 90% protection. The
shedding of challenge virus was significantly low with mean ...

Salama M. El-Saghir1, 2

...div>
authentic antiserum for PVS and, molecularly using specific primers for PVS.
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
a...

Salama M. El-Saghir1, 2

...v>using an authentic antiserum for PNRSV. The incidence of phytoplasma as a second pathogen in the
trees was PCR tested using the universal primers for phytoplasma detection, P1/P7, in the first step.
The PCR products were re‐amplified with nested‐PCR to verify phytoplasma incidence using the
nested primers R16F2/R2.
Results: DAS-ELISA confirmed the presence of PNRSV in the tested peach trees. For phytoplasma...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and Mohammed A. Shalaby2

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

...entification was done by serum neutralization test ( SNT ) using reference antisera which confirm
presence of LSDV . By nucleotide sequences and genetic characterization was conducted on (G-PCR)
gene segment of these isolates.
Results: 93 samples were positive for LSDV by using conventional PCR direct from nodular lesion, 4
positive samples were inoculated on CAM showed characteristic pock lesion, formerly after ...
Othman N. O. Mansour 1, Naglaa Hagag 2, Momtaz A. Shahein 1, Sayed S. Hassan 1 Ahmed
A. EL-Sanousi 3 and Mohamed A. Shalaby3
...al swabs and
serum samples were collected from local breeds presented in some camel farms. All nasal swabs tested
using real time RT-PCR while serum samples were tested using indirect ELISA technique.
Results: From 1500 nasal swabs of imported camel breeds collected in Birqash veterinary quarantine,
ten samples (0.66%) were positive for MERS-CoV by real time RT-PCR. Out of 195 ...

Rana A. Rabiea1, Mohamed Fawzy2, Mohamed H. Khodeir3 and MokhtarM. EL-Tarabili2

...on inhibition test (HI), serum neutralization test (SNT), and
indirect ELISA.
Results: There was detectable TRT antibody titers by SNT in the first week post vaccination as 4 log2
in group-1 and 2 log2 in group-3. Both groups showed peak SNT titer (256 log2) of TRT virus by the
third-week post administration of the second dose and remain stable up to 24 weeks post vaccination.
Follow up avian influenz...
Soad, E. Elsayed 1, Mohammed A. Shalaby2, Ausama A. Yousef2, Abu bakr A. Agor1,
Sherouk E. Aly1
...unological evaluation by serum neutralization test showed enhanced immunogenicity of
developed formula when compared to the conventional one. Challenge test revealed high protection
levels that reached 90% of the Guinea pig vaccinated by nano emulsion.
Conclusion: Our findings suggest that we aimed to enhance immunity through nano emulsion of
Montanide ISA 206 is well achieved.
...
Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
...icated that 1.29% of the serum samples were positive for E. canis, and 5.50% of dogs were infested with ticks. The Wenzhou samples of R. sanguineus exhibited a high homology (99.7%–99.8%) and these parasites showed a 99.1%–100% homology to previously reported isolates. The E. canis derived from R. sanguineus in the current study showed a similarity of 98.7%–99.7% to previously published isolates. Our results indica...
Chao-Qun Shi1, Hong-Ying Lin1, Jin-Qing Zheng1, Fan Yang1, Kwame Ayisi Lartey1, Dan-Ju Kang1, Hwa-Chian Robert Wang2, Ravi Gooneratne3*and Jin-Jun Chen1*

Asim Faraz1*, Abdul Waheed1, Nasir Ali Tauqir2 and Muhammad Shahid Nabeel3 

...ent of the importance of serum bio-gram which has pronounced effect on sexual behavior and may be used for detection of rutting and non-rutting males.

...
Tian Tian, Lili Luo*, Haiyan Wang and Lei Wang
...tively. After treatment, serum β- human chorionic gonadotropin and progesterone levels in the successful group decreased more significantly as compared with that before treatment, p<0.05. When the levels of β-human chorionic gonadotropin and progesterone were increased, the success rate of methotrexate combined with mifepristone tablets showed a decreasing trend, p<0.05. When the maximum diameter value of pelvic effusion was increased, the succ...
Rizwana Sultan1, Asim Aslam1, Muhammad Yasin Tipu1, Habib ur Rehman2, Saba Usman1, Ahsan Anjum1,*, Muhammad Saeed Imran1, Muhammad Usman3 and Muhammad Zahid Iqbal3
...followed by haematology, serum biochemistry, and histopathology. Species specific PCR based on polymorphic site of the ITS1 gene was developed and used to identify the organism. Haematological examination of the blood demonstrated a decrease in total erythrocytes, packed cell volume, haemoglobin concentration, and red blood cell indices. Differential leukocyte analysis revealed leukocytosis, heterophilia, eosinophilia, monocytosis, and lymphocytosis.
Gong Xue-na1, Jia Ting2, Zhang Di2 and Zhu Wanlong1*
...RMR), activity behavior, serum leptin levels, hypothalamic neuropeptide expressions and body compositions were measured. The results showed that regions and HF diet affected body mass, food intake and RMR significantly, HF diet increased body mass in E. miletus, while regions had significant effect on activity behavior, but HF diet had not affect activity behavior. Regions and HF diet also showed remarkable effects on leptin and hypothalamus Neur...
Muhammad Zahid1, Aneela Zameer Durrani1, Muhammad Ijaz1, Khushi Muhammad2,Muhammad Usman1,*, Muhammad Husnain1 and Nadeem Kamal3
...rsquo; hematological and serum biochemical parameters were analyzed and compared with altered values in different conditions. These physiological biomarkers were evaluated at short intervals and processed for total MCV, MCH, MCHC, and lymphocytic and leukocyte count, most importantly. It was recorded that there was significant increase in number of WBCs and neutrophils, but a significant decrease was noticed in number of lymphocytes. While the
Zhiyuan Sun1, 3, Xuhui Zhang2,*, Xian Li3, Yanping Huang3, Shiyan Sui3, Weifeng Liu3, Guochao Ni3, Xiaozhou Xu1, Jianbo Yang1, Xue Lian1 and Hui Jia1
...pectively) and increased serum tumor necrosis factor alpha (TNF-α) concentration (P <0.01), but ACTH treatment has no significant effect on them. Neither ACTH nor LPS treatment had any significant effect on levels of pulmonary SOD, CAT and MDA secretion, as well as expression of IL-6, TNF-α, IL-10, COX-2 and TLR4 mRNAs (P >0.05). Pulmonary cortisol level was inhibited by LPS (P =0.034), with a similar trend of inhibition ...
Rajesh Kumar Oad1, Nasir Rajput1, Imdad Hussain laghari1, Hidayatullah Soomro1, Muhammad Azhar Memon2, Abdul Sattar Baloch5, Qudratullah Kalwar3,  Mashhood Ahmed1, Zubair Ahmed Soomro2 and Waseem Ali Vistro4*
...in group A (31.63 %) and serum cholesterol in group F (83.07 mg/100ml). Above findings suggest that 0.75% lysine in broiler ration is better for growth, as well as to achieve maximum net return of the farmers.
...
Syed Shahid Imran Bukhari1*, Nusrat Jahan2, Muhammad Khalil Ahmed Khan3, Mariam Zaheer1, Sabir Javed1
...ificantly decline in the serum biochemical parameters viz. total cholesterol, triacylglycerols and glucose in Group 3 in comparison to Group 1 (p<0.05). An overall statistically significant decline in serum values of studied parameters was noted compared to the corresponding control values. High dose (400mg/kg) was effective in reducing blood sugar random and fasting blood glucose level (58.00±6.35 and 66.00±...

Khlood G. Abdelkhalek*, Aly B. A. Badawy, Mohamed Fathi, Elshymaa A. Abdelnaby 

...), testosterone (T), and serum nitric oxide metabolites (NOMs) were measured in 5 Baladi bucks weighting (13–15 kg; with a body condition score of 3.5 ± 0.01) from 4-months- to 10-months-old in relation to testicular hemodynamics. Testicular morphometry, scrotal circumference, Doppler examinations, image analysis, and blood sampling were performed on a weekly basis. Results showed that FSH level was elevated (P<0.05) firstly from 5-months to 6....
Amr N. El-Shahat1, Refaat G. Hamza1,*, Ashraf M. Mounir1 and Madeha N. Al-Seeni2
...ntents, concentration of serum urea, creatinine and uric acid, glucose level, activity of some liver enzymes and liver and kidney TBARS levels with remarkable increases in level of HDL-C, insulin and showing elevation in GSH level and SOD and CAT activities of the liver and kidney of gamma-irradiated treated rats compared to irradiated group.It was suggested that the biochemical and antioxidant amelioration observed ...

Wassan Mhammed Husain1*, Zainab Sattar Ali2 

...en by heart puncture for serum collection. In comparison to all other groups, the current results reveal a significant (p≤0. 05) decrease in testosterone, somatic testicular index, and sperm quality in the G3 group, nevertheless, there was a significant (P<0.05) increase in LH, FSH, sperm abnormalities percent, and dead sperm percent in the G3 group. The capacity of Phitofert ® to restore all passive effects of CCL4 and increase epididymal sperm qual...

Yan Jiang1,2, Xia Tao3,4 and Hongxia Chen5,6*

...MN) and its influence on serum levels of nephrin and B-cell activation factor belonging to the TNF family (BAFF). For this purpose, a prospective randomized controlled study method was designed for this study. 92 patients with IMN in our hospital from December 2015 to December 2017 were divided into study group (n=46) and control group (n=46) based on a computer-generated random number table. On the basis of conventional treatment, the control group was given ...

Arkan B. Mohammed*, Ammar S. Abdulwahid, Samah M. Raouf 

...were found to have lower serum cholesterol concentration than those of the control. Supplementing a laying hen’s diet with thyme significantly increased glutathione, while, decreased the malondialdehyde, AST and ALT activity in comparison to the control. Therefore, it can be concluded that thyme additives can be used in laying hens diet to improve egg production, egg quality, antioxidant and biochemical parameters in a dose-dependent manner.

&nbs...

Elfadil Elfadul Babiker1, Khalid Ahmed Abdoun2*, Fahad AL Juhaimi1, Kashif Ghafoor1, Riyadh Salih Aljumaah2 and Ahmed Abrahim Al-Haidary2
..., and cholesterol in the serum of ewes and goats fed on alfalfa hay-based diet (AHD) supplemented with 25% Moringa oleifera (MOD) or Moringa peregrine (MPD) leaves. Thirty ewes (2 years old and 50-60 kg BW) and 30 goats (2 years old and 35-40 kg BW) were randomly allocated to 3 experimental groups, consisting of 10 ewes and 10 goats each. The 3 experimental groups of either ewes or goats were fed on one of the experimental diets (AHD, MOD, or MPD) for 6 weeks....

A.M. Abdul Azeem, Ashraf M. Mounir and Amr N. El-Shahat*

...sticular malondialdehyde serum level and the activity of xanthine oxidase were elevated (P < 0.05) with obvious reduction in the concentration of insulin, total thyroid hormones triiodothyronin and thyroxine, leutinizing hormone, testosterone and testicular antioxidant parameters (glutathione content , the activity of xanthine dehydrogenase, superoxide dismutase and catalase) in the group of alloxan (150 mg/kg B.WT)-administrated rats as compared to control...

Chunjie Song1, Shangquan Gan2 and Xiaoyun Shen1,3*

..., and the blood routine, serum biochemical parameter, serum immune and antioxidant indices were measured. The results showed that the P. przewalskii were sensitive reaction, increased appetite, and no diarrhea in the modified Yujin powder group. The healing rates were 75%, 85%, and 60% in low-dose group, high-dose group, gentamicin sulfate group, respectively. The effects of modified Yujin powder was better than gentamicin s...

Zheng Tan*, Li Li, Yuxin Song, Meirong Tian and Fan Jia

... control. The changes in serum endothelin, brain natriuretic peptide and high sensitive c-reactive protein in patients with CHD were observed and analyzed. The levels of serum endothelin, brain natriuretic peptide and high-sensitivity c-reactive protein were significantly higher in AMI group compared to UAP group, SAP group and the control group, p<0.05. The level of indicators in the UAP group was higher than that in the...

Yuan Zhang1, Qingyue Han1, Peiquan Du1, Yi Lu1, Lianmei Hu1, Sadaqat Ali2, Khalid Mehmood2, Sajid Hameed2, Zhaoxin Tang1, Hui Zhang1* and Ying Li1*

 

Yuan Zhang1, Qingyue Han1, Peiquan Du1, Yi Lu1, Lianmei Hu1, Sadaqat Ali2, Khalid Mehmood2, Sajid Hameed2, Zhaoxin Tang1, Hui Zhang1* and Ying Li1*

 

Altaf Mahmood1*, Muhammad Athar Khan2, Saima Parveen3, Tanveer Hussain4 and Ayesha Azad5

... haematological and some serum biochemical alterations were explored in six months old commercially raised eight female rabbits after oral administration of gossypol. Cotton seed cake with 0.25% free gossypol concentration was daily given to each rabbit at the rate of 4 grams per kg live weight for entire experiment period of 60 days. Analysis of fortnightly collected blood specimens revealed significantly (p <0.05) decreased hematocrit, total red blood cel...

Juliet N. Ozioko1, Obinna V. Ayogu2, Benjamin O. Ezema1, Dilibe C. Uramah3 and Kingsley O. Omeje*,1

...ificant changes in their serum activity. Similarly, superoxide dismutase and catalase showed no significant increase after the period of study.

...

Fujun Miao1, Chunlan Shan2, Wei Yang3, Hao Wang3, Shuxiang Geng1 and Delu Ning1*

... The results showed that serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in the ethanol + walnut oil (ETH + WO) and ETH + silymarin positive group (PC) groups significantly decreased, and the lesions of ethanol-induced liver injury were relieved compared with the ethanol (ETH) group. Walnut oil significantly increased the activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) in the liver of ALD. Walnut oil exert...

Nour El-Hoda Khayrat Hammad1*, Yousef Y. El-Seady3, Azza E. Hassan1, Sara T. Elazab2, Magdy S. Amer2 

... significant decrease in serum testosterone hormonal levels and spermatozoa (viability and motility) which accompanied by some histopathological damage in testes and epididymis. On a molecular basis, mRNA expression of CYP17A1 and LHR genes were significantly reduced in testicular tissues of FCZ group while aromatase gene was elevated. The administration of LIN oil after FCZ treatment markedly improved the aforementioned alterations caused by FCZ. So linseed o...

Noura El-Shahat Attia1*, Abd El-Khalek Ramadan El-Sheikh1, Mohamed Omia Siam2 

...lysis, along with taking serum samples for biochemical analysis. Rectal temperature, heart, and respiration rates were not significantly differed between the two groups. Packed cell volume (PCV), total erythrothetic count (TEC), white blood cells (WBCs), serum glucose, total proteins and serum Zn were significantly decreased. Moreover, while copper (Cu) and iron (Fe) were significantly inc...

Hong Yin*, Dan Yang, Ji-Jie Liu, Jing-Wei Ding and Dan-Dan Cui

... mice were collected for serum and tissue samples. Histopathological studies showed the tissue protective role of β-CM-7 in aged mice. The treatment of β-CM-7 in aged mice significantly increased the triglyceride (TG) level with decreasing high density lipoprotein (HDL) level in serum. The superoxide dismutase (SOD), glutathione peroxidase (GPx) activities and malondialdehyde (MDA) level were significantly increase...

A.H. Alqhtani1, A.S. Alharthi1, N.J. Siddiqi2, S. Zargar2 and A.M. Abudabos1*

...romoters. However, total serum protein, gamma glutamyl transferase (GGT) and alkaline phosphatase (ALP) showed no significant differences between the groups. Thus, it can be concluded that probiotic, prebiotic and symbiotic in feed may cause some degree of liver damage as indicated by the release of AST and ALT in the serum.

...

Doaa Sh. Mohamed1, Nema S. Shaban2 , Mai M. Labib3, Olfat Shehata4 

... 4 (TLR4) and lowers the serum levels of both nuclear factor κB (NF-κB) and tumor necrosis factor α (TNF-α). The elevated levels of Creatine Kinase - MB (CK-MB), Lactate Dehydrogenase (LDH), and Troponin-1 induced by doxorubicin injection were neutralized by almond oil supplementation. Almond oil ameliorated all the histological alterations caused by doxorubicin. The administration of almond oil with doxorubicin modulated the doxorubici...

Kanakuntla Sandhyarani*, Dhoppalapudi Madhuri, Yadala Ravikumar 

...line phosphatases (ALP), serum total proteins, serum albumin and glutathione stimulating hormone (GSH). Grossly, chalky white deposits of urate crystals on the serosal surface of pericardium, liver, intestines, air sacs, kidneys and ureters. Microscopically, tissue sections show urate crystal deposition in parenchyma of the organs along with infiltration of inflammatory cells. Incorporation of low protein diets, jaggery mixe...
Ghada Mohamed Safwat1*, Mohamed Ahmed Kandiel1, Omayma A.R. Abozaid2, Mahmoud Mohamed Arafa3, Sahar Omar Mohamed4
...idants concentrations in serum and/or egg yolk and on gene expression of fatty acid synthase and acetyl CoA carboxylase in laying hens. The experiment was applied on 42 Commercial Mandarah strain laying hens which divided equally into control and olive cake (7%) group.Addition of olive cake (7%) led to a significant increase in serum and egg yolk HDL-C and a significant decrease in TAG, cholesterol, LDL-C and VLDL concentrat...

Jie He* and Ren Yang

...vitexin group, levels of serum ALT, AST and LDH in propofol + vitexin group were reduced (P < 0.05), apoptosis index was reduced (P < 0.05), Bcl-2 protein expression was increased (P < 0.05), Bax protein and caspase-3 protein expression was decreased (P < 0.05). In conclusion, propofol and vitexin could up-regulate expression of Bcl-2 protein, down-regulate expression of Bax and caspase-3 protein, inhibit cell apoptosis, reduce liver damage indexes...

Ali Raza1, Muhammad Sharif1*, Fawwad Ahmad1, Asghar Ali Kamboh2, Muhammad Saeed3, Muhammad Ashraf1 and Asad Ullah Hayder1

Sonali Menamvar1,2,3, Kirubakaran Vinod Kumar1, Veeregowda Muniveerappa Belamaranahally2, Yella Narasimha Reddy3, Rathnamma Doddamane2, Shrikrishna Isloor2, Ramesh Poojari Thimmaiah2, Gurrappanaidu Govindaraj1, Bibek Ranjan Shome1, Vinayagamurthy Balamurugan1* 

... risk factors along with serum samples from eight non-vaccinated dairy herds. The collected serum samples (n=56) were examined for detection of leptospiral antibodies using the Microscopic Agglutination Test (MAT), the gold standard serological test. The Chi-square and odds ratio analyses were employed to identify the important risk factors for leptospirosis in dairy farms. The study revealed that the seroprevalence of bovin...

Rafiqul Islam1, Nasrin Sultana1*, Md. Abu Hadi Noor Ali Khan2 

...ermining how DEX affects serum biochemistry (cholesterol and triglycerides), morphology, and morphometry of broiler hearts. Eighty one-day-old chicks (DOCs) were randomly categorized into four groups i.e., one control group and three trial groups (i.e., E1, E2, and E3). The control group was given commercial broiler feed and the trial groups were given commercial broiler feed containing DEX at the rate of 3, 5, and 7 mg/kg respectively for 28 days. On days 7, ...

Mohamed Saeed M. Hassan¹, Hitham Abdel-Saeed1*, Kawkab Abd El Aziz Ahmed2, Ossama Mohamed Abdou1 

Heba El-Zahar*, Zeinab Abd El-Rahman, Abbas El-Naggar 

...ed a significant rise in serum activity of aspartate aminotransferase (p<0.05), and blood urea nitrogen, blood creatinine, lipase and alkaline phosphatase (p<0.01) in IBD dogs. The mean values of IBD-related biomarkers (CRP, haptoglobin, and fecal calprotectin concentrations) increased significantly (p<0.05 or p<0.01) compared to controls. CRP, haptoglobin concentrations, and fecal calprotectin were found to have a strong positive correlation. Furt...

Mohamed Abd El-Fattah Abo-Farw1, Maged Ahmed Aboul-Omran1, Abdel-Khalek El-Sayed Abdel-Khalek2* 

... significantly decreased serum concentration of progesterone (P4), estrogen (E2), thyroxin (T4), zinc (Zn), and selenium (Se) by about 24.05, 13.80, 5.36, 2.50, and 3.44%, respectively, while triiodothyronine (T3) concentration showed non-significant decrease by about 3.77%. Mastitis incidence at early postpartum in lactating Egyptian buffaloes delayed the resumption of estrous and ovarian activity and decreased pregnancy rate, antioxidant status, thyroid and ...

Sana Shakoor, Tahir Rehman Samiullah, Naila Shahid, Abdul Qayyum Rao*, Aneela Yasmeen, Sana Tahir, Ayesha Latif, Saira Azam, Ahmad Ali Shahid and Tayyab Husnain

...d produced antibodies in serum was detected by immunodot blotting assay. The appearance of the dot on spotted position confirmed the specificity of anti-HA antibodies. The titer of antibody produced in immunogenic mice was determined through ELISA. The highest geometric mean titer of HA-specific serum IgG, which was greater as compared to the control.

...

Amal Hamad1, Ashraf M. Abu-Seida2*, Faisal A. Torad2, Nahed S. Thabet3, Shabaan M. Gadallah1

...ital signs, hemogram and serum biochemistry. Statistical analysis was carried out by paired samples t-test. Unlike Nalbuphine HCl, Fentanyl citrate and Tramadol HCl, Meloxicam induced better analgesia, no significant changes in total leukocytes, neutrophil, eosinophil, lymphocyte and monocyte counts, serum levels of total protein (TP), albumin, urea, creatinine, creatinine clearance and serum<...

Muhammad F Tajol Ariffin1, Chai M Hian1, Muhammad Z Sukiman1, Mohd F Ghazali1, Siti M Zainal Ariffin2* 

...). The haptoglobin (Hp), serum amyloid A (SAA) and α1-acid glycoprotein (AGP) levels in serum and milk were measured at pre-and post-infection (6, 24, 48 and 72 h) using the ELISA method. The SCC was determined by the direct microscopic method. Results revealed a time-dependent change of Hp, SAA and AGP in the infected group compared to the control. The APP levels in the milk were significantly higher (p<0.05) than ...

Asmaa S. Mohammed*, Ahmed F. Abou-Elnaga, Ahmed I. Ateya, Mohammed M. Fouda, Ragab A. Darwish, Usama A. Abou-Ismail 

...eproductive performance, serum vitamin D levels, cortisol levels and expression pattern of follicle stimulating hormone receptor (FSHR) and estrogen receptor alpha (ER-α) genes in female rabbits. A total of 84 Nulliparous Blanc de Bouscat does were randomly allocated into one of four experimental groups (non-UVB, 12-h UVB, 8-h UVB and 4-h UVB) according to the duration of exposure to UVB radiation (n = 21 for each group). Behavioural patterns of rab...

Alaa Jaheen*, Noha Salem, Mohamed El-sherif 

...rofile and estimation of serum concentration of total antioxidant capacity (TAC), malondialdehyde (MDA), C-reactive protein (CRP), serum zinc, copper concentrations, total protein, albumin, globulin values, triglycerides, and cholesterol concentrations. The most consistent hematological alteration was elevated eosinophils in eczema-affected horses. The oxidant-antioxidant status showed a significant increase in malondialdehy...

Ibrahim Samir Abd El-Hamid1*, Wafaa Adel Abd Fouda1, Hesham Attia Shedeed1, Safaa Ali Mostafa1, Ahmed Mohamed Elbaz2, Salah Abo Bakr2, Baliegh Hamdy Mosa1, Ali Saber Morsy1, Amal Mohamed Hasan1, Khamis Refaay Emam3 

El-Kholy KH1*, Tag El-Din H1, Seham NE Seleem1, Eman Hussein2 AM El-Shhat2 

...rmore, concentrations of serum total protein and their fractions (albumin and globulin) and all lipid profile were insignificant affects by in-ovo different SV solutions, times of eggs dipping and their interaction. The best values of body weight gain, feed conversion ratio and performance index were recorded in that group dipping eggs at 0.05% SV followed by groups dipping at 0.15 or 0.10 % SV throughout the experimental period. According to the results, it c...

Basanta Kumar Adhikari1*, Deepak Subedi1*, Sumit Jyoti1, Krishna Kaphle2, Chet Narayan Kharel3, Doj Raj Khanal4

...epal. A total of 89 goat serum samples were tested by using a competitive enzyme-linked immunosorbent assay (c-ELISA) for the presence of antibodies against Mycoplasma capricolum capripneumoniae. Out of the total serum sample tested, 3 were seropositive for CCPP giving an overall apparent seroprevalence of 3.37% and true seroprevalence of 3.4%. Significantly higher seroprevalence (p<0.05) was observed among goats with a h...
De Hu, Jia Wang, Huan Wang, Xiang-Yang Leng, Tian-Yi Zhao* and Shu-Min Wang*
...nd interleukin (IL-6) in serum were measured through ELISA, and the contents of NLRP3, ASC, caspase-1 and IL-1β in gastric tissue were detected by Western blot. The results showed that FP of C. lilacina could effectively prevent the stress gastric ulcer induced by WIRS in mice by reducing the expression level of NLRP3/ASC/caspase-1.

...
Yuechen Li1, Yumo Li1, Xuefeng Zhuang1, Guangfu Lv2, Xiaowei Huang1, Zhe Lin1, Yuchen Wang1* and He Lin1*
..., IL-1 and IL-2 level in serum. In addition, OR significantly improved the protein expressions of Nrf2, HO-1 and NOQ1 in the brain tissues of aging mice, which was detected by western blotting. In conclusion, OR treatment improved behavioral disorders and brain damage in the aging mice, suggesting that OR has the potential to be a new anti-aging drug candidate.

...

Hamidur Rahman1*, Asghar Ali Kamboh1, Nazar Ali Korejo2, Atta Muhammad Memon3, Rashid Ali Korejo3, Manzoor Ahmed Chandio1 

...Pakistan. A total of 100 serum samples, 50 each from male and female camels were collected from district Sibi, Pakistan and analyzed by competitive enzyme linked immunosorbent assay (cELISA), and rose Bengal plate test (RBPT). The overall seroprevalence of brucellosis in camels was observed as 13% and 17% by RBPT and cELISA respectively. The higher prevalence (p < 0.05) found in females (16% and 22%) as compared to males (10% and 12%) by RBPT and cELISA res...

Barirah Rehman Talpur1, Zaheer Ahmed Nizamani1*, Imdad Hussain Leghari2, Mansoor Tariq1, Aisha Rehman3, Shahnawaz Kumbhar1 

... (p<0.05) increase in serum Alanine aminotransferase (GPT), Alkaline phosphatase (ALP), Gamma glutamyl transferase (γGT), uric acid and creatinine levels and significant (p<0.05) decrease of serum calcium levels were noted in all treatment groups of both species as compared to control. In rabbits and broilers, necropsy findings included mild inflammation and discoloration of liver along with nephritis. While in b...
Mohamed Lebdah1, Sahar Abd El Rahman2*, Ahmed Attia3, Reham Karam2, Naglaa Fathy Saeed Awad1, Mohamed Ibrahim El Bagoury1
... disease virus (NDV) antiserum. The NDV field isolates were confirmed by reverse transcription polymerase chain reaction (RT-PCR) and partial sequencing targeting F gene of amplicon size (362) bp containing the region 112RRQKRF117 motif, which is the determinant part of virus virulence. The sequenced isolate was grouped in class II genotype VII.1.1 with small distance from NDV strains in chickens and turkeys which is alarming for the potential transmission of ...

Asaad A. Fares1*, Mohamed M. Ghanem2, Yasein M. Abd El-Raof2, Hossam M. El-Attar2, Ameer A. Megahed2, Heba M. El-Khaiat2

...l the sudden decrease in serum Ca before and immediately after parturition, which is caused by rapid transport of large amounts of Ca into the mammary gland related to colostrgenesis. Blood and mid-stream urine samples were collected from 24 cows fed on DCAD ration and 24 cows fed on non DCAD ration daily starting 24h before calving (-1day), the day of parturition (0day), one day after parturition (+1), and second day after parturition (+ 2). Feeding DCAD rati...

Asim Faraz1, Muhammad Yaqoob2, Nasir Ali Tauqir3, Hafiz Muhammad Ishaq1, Ayman Balla Mustafa4, Amir Ismail5, Muhammad Arslan Akbar6, Abdul Waheed1* and Muhammad Shahid Nabeel7

...t 5000 rpm for five min; serum was collected and stored at – 18°C for laboratory analysis. Commercially available ELISA kits were used to measure serum progesterone and estradiol levels. Progesterone and estradiol levels were found significantly high (P<0.05) with the value of 3.46±0.25 ng/ml at day 14th and 4.45±0.34 ng/ml at day 21st in G2 (Pregnant animals), while in non-pregnant group

Mohamed A. Hussein1, Bahgat A. Abd El-Rehman2, Kareem A. Eldin2, Mohamed Fouad Mansour1* 

...tected between groups in serum kidney function enzymes. Cytokine profile including IL-2 was markedly increased from 1st day after inoculation and elevated moderately till arrived to the peak at the 5th, 7th and 10th days post-vaccination in groups vaccinated with Ch-NPsV, AlP-NPsV and AlHV respectively. The results IFN-γ mRNA expression level was consistent with the results of cytokine profile including IL-2. Neutralizing antibody was increased from the ...

Nkana Kontchiachou J. Gwladys1, Kouamo Justin2, Vemo Bertin Narcisse3*, Mweugang Ngouopo Nathalie4, Wang-Baa Temoa Christophe1, Awantu Christian Funwi1, Semi Yam Alphonsius1, Kenne Noubissie Christèle5, Tendonkeng Fernand5

...e the haematological and serum biochemical response of guinea pigs to green anise (Pimpinella anisum) powder ration supplementation. To achieve this aim, 60 adult female guinea pigs, weighing of 450 ± 50 g were randomly distributed to three experimental groups (20 females per group). Experimental rations consisted of incorporating green anise powder in the basic ration (control) at 0.5% (GA0.5) and 0.75% (GA0.75) of feed. These female guinea pigs were f...

Xing Lu1, Mahmoud A.O. Dawood2, Fan Wu1, Hua Wen1, Wei Liu1, Juan Tian1, Ming Jiang1, Li-Juan Yu1, Xiang Li3, Ning Xu3 and Hong-Wei Liang1*

...itine (P < 0.05). The serum biochemical indices analysis revealed that dietary L-carnitine at 400 mg kg-1 had markedly reduced triglyceride (TG) concentration (P < 0.05). The elevated expression of hepatic igf1 gene at the transcriptional level was positively correlated with dietary L-carnitine levels on the growth performance of Chinese soft-shelled turtle. Furthermore, dietary L-carnitine supplementation significantly up-regulated the mRNA levels of su...
Zeinab R. Aboezz1*, Ayman S. El-Habbaa1, Rania S. El-Mohamady2, Samia A. Elnagar2, Ehab M. El-Nahas1

Xiaowei Huang1, Jinji Wang1, Zhun Yu2, Minghua Duan1* and Zhe Lin1*

...synthase (NOS) and NO in serum, the contents of malondialdehyde (MDA) and superoxide dismutase (SOD) in kidney of each group were detected with ELISA after 24 h of irradiation, and the protein expression levels of TGF-β1, phosphorylated (p-)Smad2, p-Smad2, p-Smad1, p-Smad5 and BMP7 in kidney were detected by western blotting. In the results, compared with the model group, NOS, NO and MDA contents were decreased in the middle and high dose groups while SOD...

Xiaojing Liu and Zhongxin Li*

...oup, 24 h urine protein, serum creatinine (Scr), blood urea nitrogen (BUN), blood uric acid (UA), alanine aminotransferase (ALT) and aspartate aminotransferase (AST) significantly reduced in rats treated with TSG (20 mg/kg) (P<0.05), blood total protein (TP) and albumin (ALB) significantly increased (P<0.05), VEGF expression significantly reduced (P<0.05) and MMP-9 expression significantly increased (P <0.05). The present study results showed that ...

Hamdy Abdala Elnagar1, Wael Mohamed Wafa1*, Abdel-Khalek El-Sayed Abdel-Khalek2

...rtum days of all groups, serum P4 and E2 concentrations were in association with conception rate. In conclusion, the dual treatment of lactating cows on day 15 postpartum with 0.6 NAC/kg (orally for 7 days) plus 1% NAC (IU infusion for 3 days) may improve the reproductive efficiency, health performance, antioxidant enzymes, and inflammatory reaction during the postpartum period.
 
Keywords | Antioxidant, Cows, Cytokines, N-acetyl-c...

Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*

..., 0.6 μg·mL-1; serum dilution, 1:200; 60-min serum action time, 1:2000 working dilution of the enzyme-labeled secondary antibody; and 5% skimmed milk used as a blocking solution. No cross-reactivity was observed with the positive serum of Eperythrozoon, Trichinella spiralis (T. spiralis) and Hydatid cysts. The coefficients of the inter- and intraassay variations in the repeatabil...
Muhammad Kashif Iqbal1*, Khalid Mehmood2,4, Shakeel Ahmed3, Fazul Nabi4, Muhammad Arif Rizwan1, Muhammad Kaleem1, Mushtaq Ahmed1, Abdul Waheed1 and Jiakui Li5
...nzymes (SOD; GSH-Px) and serum biomarkers and the protective effects of the medicine was assessed through these values. Results showed that VEGF mRNA levels were significantly (P<0.05) up-regulated; however, the Flk-1 receptor levels were down-regulated in TD-affected birds significantly (P< 0.05) as compared with the control group. Furthermore, thiram induction also increased the levels of AST, ALT and MDA contents in liver, whereas decreased the antiox...

Mohammed A. Almujtaba1, Turky Omar Asar2, Salma Naqvi3, Vikas Kumar4, Fahad A. Al-Abbasi1, Abdulbasit I. Al-Sieni1 and Firoz Anwar1*

...logical changes. Altered serum levels of the biomarkers were restored on treatment with Zamzam water. Histopathological studies are in agreement with cardioprotective influence of Zamzam in cardiac dysfunction. Research findings endorse the cardioprotective potential of Zamzam in doxorubicin induced cardiac remodeling. We attributed this effect to the presence of zinc in alkaline medium of Zamzam.

...

Zhaojun Wang1, Yang Zhou2 and Xinghua Song3*

...ven. The patients’ serum interleukin-1β (IL-β), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) levels were detected using ELISA method before treatment and 3 months after treatment; incidence of adverse prognostic reactions was compared between the two groups. After treatment, the observation group had 34 markedly effective cases and 21 effective cases, with total effective rate of treatment at 91.67%. The figure was signi...

Shujaat Hussain1*, Muhammad Saqib1, Khurram Ashfaq1 and Zia ud Din Sindhu2

...ces in hematological and serum biochemical variables of infected and healthy camels. Moreover, to set a reference line of blood variables for the detection of coxiellosis in camels additional investigations are obligatory.

...

Hakan Kececi1*, Yasin Ozturk2, M. Bahaeddin Dortbudak3, Seda Yakut4, Gurdal Dagoglu5 and Merve Ozturk1

.... Both hematological and serum biochemical values (Ca, P, TBIL, ALT, AST, ALP, Urea, and Creatinine) were within the physiological limits in all groups. Consequently, in light of the obtained data, it was observed that the rats were not exposed to any toxic effect even when they consumed a stomach full of cocklebur fruit at once.

...

Jiacheng Du and Yuping Cao*

...oup, n=110) according to serum AMH levels; and group C (successful group, n= 88) and group D (failure group, n=112) according to whether they completed clinical pregnancy. These groups were used to compare the differences in sex hormone, pregnancy outcomes, and ROC curve analysis of serum AMH levels in the predictive value of IVF-ET clinical pregnancy in PCOS patients. Subjects in Group A showed significantly lower FSH, LH, ...
Zahra Naz1,2, Fouzia Ismat1, Muhammad Saleem2, Mazhar Iqbal1, Aamir Shehzad1 and Moazur Rahman1,2*
...V antibodies in multiple serum samples collected from different poultry farms of district Faisalabad, Pakistan. The data presented here reveal that the recombinant detergent-solubilized M protein is an active, promising diagnostic antigen and can be exploited in an indirect ELISA for rapid and reliable detection of anti-NDV antibodies in chickens. Owing to the conserved nature of the M protein and the ease of extraction and solubilization in a single step usin...

Xiaoli Yao1, Xiaofang Yue2, Yue Yang3 and Guobin Zhang3,*

...ical deficit (NIHSS) and serum neurological function, endothelial injury and inflammatory marker levels, and the clinical efficacy after treatment of 14 days were compared between groups. After treatment of 14 days, the vascular endothelial function (NO, ET-1, FMD) and inflammatory factors (hs-CRP, TNF-α, IL-6, MMP-9, Lp-PLA2) in the patients of the treatment group were significantly higher than the control group. NIHSS and serum...

Xiaoli Yao1, Xiaofang Yue2, Yue Yang3 and Guobin Zhang3,*

...ical deficit (NIHSS) and serum neurological function, endothelial injury and inflammatory marker levels, and the clinical efficacy after treatment of 14 days were compared between groups. After treatment of 14 days, the vascular endothelial function (NO, ET-1, FMD) and inflammatory factors (hs-CRP, TNF-α, IL-6, MMP-9, Lp-PLA2) in the patients of the treatment group were significantly higher than the control group. NIHSS and serum...

Hazem E. M. Hassanien1*, Awad M. M. Mahmoud2, Elsayed M. Abdel-Raouf1, Nabil M. Eweedah1 and Midhat. N. Nassif3

...0 mEq/kg DCAD. Prepartum serum tCa, iCa, hydroxyproline (OH-PRO) was highest for -180 DCAD compared with both -100 and 0.0 DCAD. Parathyroid hormone was highest for 0.0 DCAD compared with -100, -180 DCAD. After calving there is a significant effect of tCa and iCa of prepartum treatment and we didn’t obtain any effect due to interaction between prepartum x postpartum treatment. Feeding an acidogenic diet improved Ca postpartum status.

...
Muhammad Sajid Hamid Akash1*, Hina Sharif1, Kanwal Rehman2, Sumbal Rasheed1 and Shagufta Kamal3
...ng with ATO. We measured serum levels of glycemic index biomarkers and carbohydrate metabolizing enzymes. Simultaneously, we also measured arsenic concentration in liver using HG-AAS technique. ATO exposed rats showed a significant elevation in serum glucose, reduction in serum insulin, rise in insulin resistance and alteration of carbohydrate metabolizing biomarkers when compared with une...
Mutassim M. Abdelrahman1, Ibrahim Alhidary1, Mohsen Alobre1, Riyadh S. Aljumaah1 and Rifat Ullah Khan2*
...red to the TMR. However, serum iron (Fe) content was significantly (P<0.05) higher in TMR fed group alone. From the findings of the present study, we concluded that AS supplementation improved rumen color, however, fecal H2S production was increased which needed to be further investigated.

...

Abdulkhaliq A. Al-Janabi1*, Mohammad S. Alsalami1, Arkan B. Mohammed1, Abdulkhaliq A.R. Al-Douri2 

...e blood cells, including serum cholesterol, triglycerides, low-density lipoproteins and the aspartate aminotransferase (AST) and alanine transaminase (ALT), were significantly decreased in both Omega-3 treated groups compared to the control. In conclusion, the supplement with Omega-3 (150 and 300 µl) induced the growth rate, and liver enzymes, and reduced their lipid profiles, suggesting it would be a beneficial dietary supplement for rabbits.

Ke...

Lei Xu1, Qin Yang2 and XiaoYan Zhang3,*

...he level of sclerosin in serum of patients after peritoneal dialysis (PD) and to analyze the underlying clinical factors, a total of 94 patients who were subjected to the peritoneal dialysis for over three months in the Nephrology Department of XXX Hospital between January 2019 and January 2020 were enrolled into the experiment group (n = 94). Simultaneously, 94 healthy subjects who received the physical examination were enrolled into the control group. Prior ...

Huajun Lin, Wei Qu and Zhuxian Yu*

...), TGF-β1 levels in serum and cognitive function were compared between the two groups. The total effective rate of treatment in the combination group was 93.75%, which was significantly higher than 62.50% in the control group (P<0.05); after treatment, the serum CTGF and TGF-β1 levels in both groups were higher than before treatment. The serum CTGF and TGF in the combination g...

N. Wachida1*, P. M. Dawuda2,1, I. U. Ate3,1, P. I. Rekwot4, 2 

...LISA). Blood samples for serum were collected for oestradiol and luteinizing hormones. Follicular diameters at 42 hr were longer (P<0.05) in hot dry season (8.088±0.52 mm) than in raining seasons (8.618±0.9 mm) and cold dry season (6.338± 0.68 mm). At 72 hr follicular diameters were longer (P<0.05) in hot dry season (17.006±1.41 mm) than cold dry (12.898±1.22 mm) and raining seasons (12.075±0.82 mm). Time to pea...

Mai A Fadel1*, Ahmed M Elmahdy1, Jihan Mostafa Badr2, Mohammed AM Saleh3, Mona A.A. AbdelRahman3 

...xacin and amoxicillin in serum and different tissues of chickens. The pharmacokinetics and pharmacodynamics indices of both antibiotics were calculated and statistically analyzed. Aspartate aminotransferase, alanine aminotransferase, urea, and creatinine serum level were also estimated. From our findings, we concluded that the usage of a half-dose combination of enrofloxacin and amoxicillin is safer and more efficient in the...

Nurdan Urvaylioglu1*, Ogunc Meral1, Serkan Sayiner2, Ulvi Reha Fidanci1 and Arif Altintas1

...s and healthy cows. Milk serum haptoglobin (Hp) and amyloid A levels were not determined statistically different between groups (p> 0.05). No correlation was found between CMT scores, SCC values, Hp and milk amyloid A levels in milk serum. There were no significant differences in Hp, MAA levels and SCC in the milk of clinically healthy cows and cows with clinical and subclinical mastitis (p> 0.05). As a result, Hp and ...

Dhiya Altememy1, Mohammad Darvishi2*, Samira Shokri3, Saber Abbaszadeh4 

... 1 mm, respectively. The serum level of TNFα in the Tio2 N.P. synthesis by Hypericum perforatum decreased from 62 ± 1 pg/mm on day 0 to 10 ± 1 pg/mm on day 21. Medicinal plants Origanum vulgare and Hypericum perforatum, especially their active ingredients hypericin and carvacrol, reduce wound microbial load and inflammation and ultimately repair wounds in diabetic rats due to antimicrobial and anti-inflammatory activities. They can therefor...

Sonia Kanwal1, Muhammad Naeem1*, Zaib Un Nisa1, Rabia Farhat1 and Zia Ur Rehman2

...ll production stages and serum has been preserved at -20 0C and used to evaluate the differences in vitamin E, vitamin C, Triiodothyronine (T3), Thyroxine (T4) and Cortisol. The statistical analysis was done by two way ANOVA and Duncan Multiple Range Test (DMRT). T3 and T4 showed significantly different results  during various stages of lactation in Lohi sheep and Beetal goats. However, Vitamin E, Vitamin C and Cortisol did not reveal significantly differ...

Midrar Ullah1, Nail Chand2, Abdul Kabir3, Muhammad Rasheed4, Hubdar Ali Kaleri5, Saqib Kakar5, Mubarak Ali4, Deepesh Kumar6, Asad Ali Shah1, Amir Shahb1, Muhammad Amir Khan1, Raza Ali Mangi7, Abdul Wahid Solangi5, Rameez Kaleri5,8*

...ed in Giblets weight and serum triiodothyronine T3, T4 and TSH of both control and irradiated groups. It has been concluded from the present study that irradiated feed can be used at the place of antibiotics with 5KGy level to decrease the mortality % for achieving maximum body weight, body growth and better FCR with less public health problems.

...

Hayrettin Çayiroglu1*, Füsun Coskun1, Hüseyin Çayan1, Ayse Gül Filik2 and Ahmet Sahin1

... were not affected while serum triglyceride level and prolactin hormone level increased by fenugreek seed supplementation (P<0.05). Fenugreek seed supplementation did not affect milk organoleptic properties such as smell, taste and appearance. To conclude, fenugreek seed in lactating goats can be used as natural supplement to increase milk yield since fenugreek seed had no effect on sensory properties of milk.

...

Jiahua Peng1,2, Shiyao Hua3* and Qian Wu4

...e fasting blood glucose, serum insulin and insulin sensitive index changes were analyzed. The RT-PCR method was used to detect ovarian tissue TNF alpha and the level of IL-6 gene expression; Western blot was used to detect the changes in the expression levels of IKKβ and NF-κB protein expression. The results of fasting blood glucose and serum insulin test showed that DHEA could significantly reduce fasting blood g...

Samaa M Galal1, Sally Ibrahim2, Karima Mahmoud2, Ola Adel1, Aya A. Shokry3, El-Belely MS1, Ismail Sayed Taha1* 

...les were obtained for P4 serum levels estimation. Results showed a significant rise of TNFα mRNA during late stage of CL and increase the expression of CASP3, FASLG and AGTR2 mRNAs during mid-stage of CL. Furthermore, NOS2 mRNA was raised during early stage of CL. Surprisingly, NO in CL homogenate was raised through early and late stages of CL. Additionally, P4 increased in mid-stage of CL. Taken together, the fine tuning between apoptotic genes (TNF&alp...

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

...ct Peshawar. Analyses of serum samples by iELISA revealed the presence of antibodies against MAP in 9% sheep and 5% goats. Ziehl Nielsen (ZN) staining exhibited acid-fast bacilli (AFB) in 31% sheep and 23% goat’s fecal impression smears. Gross pathology in intestinal samples (thickness, corrugation) was observed in 30% sheep and 22% goats, while MLN exhibited gross lesions (hemorrhages, edematous swelling) in 35% sheep and 27% goats. Histopathological le...

Saleh M. Albarrak1*, Fahad S. Aldahmashi1,2, Abdulrhman A. Alrubayan1,2, Abdel Kader A. Zaki1,3 

...and quantify ASAs in the serum and seminal plasma of 29 infertile dromedary male camels, which were of two different breeds (Waddah & Majaheem) and three different ages (> 3 to ≤5, ≥5 to ≤7, and >7 years). ASAs were detected in ≥ 80% of the examined animals with considerable individual variation within each group. The serum and seminal plasma ASAs indexes (%) were significantly elevated in the >7 yea...
Abdullah Iqbal1, Muhammad Abubakar2, Shumaila Manzoor3, Muhammad Kamran Ameen4 and Rani Faryal1*
 
...g competitive ELISA from serum samples. Antigen shedding by vaccinated animals via nasal and fecal route was checked by the haemagglutination test and RT-PCR. All group 2 bucks, developed humoral protection against PPR within the 1st week. Only, 50 percent bucks of group 1 developed humoral protection against PPR after one week of vaccination. The mean percent inhibition value of competition-ELISA of group 2 was half the mean percent inhibition values of group...

Ayma Aftab, Samia Afzal* and Muhammad Idrees

...od count (CBC), D-dimer, serum ferritin, eosinophil sedimentation rate (ESR) test, tuberculosis test, real time PCR and high-resolution computed tomography (HRCT) were done to rule out the cause of flu like symptoms. HRCT reveals a haze area in the right perihilar region adjacent to medial part of horizontal fissure on the 3rd day of manifestation of symptoms. Radiological studies showed early consolidation of COVID-19 whereas RT-PCR showed negative results. C...

Iqra Qazi1, Sohail Raza1*, Masood Rabbani1 and Muhammad Avais2

...ple collection time. The serum samples were processed by indirect ELISA to detect antibodies against BoHV-1. The overall sero-prevalence was 68.40%. Post pubertal animals (>3yrs) contributing more to disease occurrence. High sero-positivity was observed in buffalo (73.12%) as compared to cattle (60%) moreover, the sero-prevalence is higher in animals of greater size herds. Parity status is in agreement of strong correlation with BoHV-1 infection. Evidently,...

Shahid Iqbal1,2, Zulha Javed1, Mushtaq Hussain Zahid3, Qurat ul Ane Gillani4 and Furhan Iqbal1,*

...ical components of blood serum of male albino mice. The extracts were administrated orally (100 mg/ ml solvent/ Kg body weight) for 15 days and it was observed that the complete blood count (CBC) remained unaffected while cholesterol (P = 0.03) and triglyceride (P = 0.008) levels in serum were significantly elevated in P. pinnata leaf extract treated mice. Mice treated with E. camaldulensis leaf extract had significantly red...

Qingyue Han1, Ying Li1, Jichang Deng1, Kunxuan Huang1, Yanyang Yang1, Quanwei Li1, Zhuowei Zhang1, Na Qiao1, Yanju Ji2, Khalid Mehmood3, Sarfaraz Ali Fazlani4, Hui Zhang1 and Zhaoxin Tang1*

...min D [25(OH)D] level in serum is currently considered the best indicator of vitamin D supply to the body from cutaneous synthesis and nutritional intake. Few reports are available regarding the effects of vitamin D and its metabolites on heart development in swine. The effect of 25(OH)D3 and Ca2+ supplementation in diets on heart development in neonatal piglets during pregnancy were examined in this study. Total 40 sows of 7 gestational age with good health a...

Sugiharto Sugiharto*, Ikania Agusetyaningsih, Endang Widiastuti, Hanny Indrat Wahyuni, Turrini Yudiarti, Tri Agus Sartono 

...omplete blood counts and serum biochemical parameters, serum creatinine concentration was higher (P < 0.05) in HSD and HSD-P than in CONT and HSD-PC. In conclusion, germinated papaya seeds or a mixture of germinated papaya seeds and chitosan improved broiler production performance and kidney health while alleviating muscle protein catabolism in high-density pens from days 15 to 28.

Keywords | Broiler, Chitosan, Ge...

Amber Khalid1*, Farah Ashfaq1, Shahzadi Farah1, Amna Akbar1, Farkhanda Manzoor1, Muhammad Babar Khawar2, Saira Riaz3 and Safina Ashfaq3

...taken and lipid Profile, serum creatinine and Serum albumin analysis was done by using automated chemistry analyzer. Results concluded that the experimental subjects have shown a significant difference (P<0.00) in HDL level as compared to control subjects. Result of t test has shown significant increase (P<0.00) in total cholesterol and triglycerides level. Results have shown that there is highly significant correlatio...

Reda Hassan*, Bahaa Abou-shehema, Sherif Zayed, Micheal Gorgy, Shama Morsy, El-Sayed Abu El-Hassan, Mahmoud El-Gbaly, Hanaa Basuony, Ebtehal Hassan 

...bumin values in broilers serum compared with ngative control. Aflatoxins supplementation significantly (P<0.05) increased malondialdehyde values in liver and significantly (P<0.05) diminished the reduced glutathione (GSH), glutathione S- transferase (GST). In addition to, dissemination of aflatoxin residue in broilers liver was detected. Nevertheless, dietary addition of HSCAS and SC, in separate and combined forms, alleviated the above-mentioned alterat...

Ibrahim El-Ratel1*, Mostafa El-Moghazy2, Amira El-Gaml2, Ibrahim Abu El-Naser2 

...All PEE levels increased serum follicle-stimulating hormone, luteinizing hormone, testosterone, immunoglobulin, and antibody titer, while reduced lysozyme. All PEE levels improved antioxidants capacity, while reduced malondialdehyde in blood serum and in seminal plasma. Advanced motility, membrane integrity, livability and sperm viability were improved, but sperm abnormality, apoptosis and necrosis were reduced in cryopreser...

Rezqita Putri Pitaloka1, Kartiawati Alipin1, Mas Rizky A.A Syamsunarno2, Gemilang Lara Utama3, Ramdan Panigoro2, Ratu Safitri1* 

...clude iron levels in the serum, liver, heart, spleen, kidney, and brain. The results showed that the effective dose was the combination of 75 mg/kg BW DFP and 50 mg/kg BW SWEE as an adjuvant, while 200mg/kg BW SWEE can be used as a substitute for chelators, especially in the heart. The decrease in serum and organ iron levels due to the combination of DFP and SWEE showed their ability to act as an adjuvant and substitute for ...

Chanathip Thammakarn1*, Sawanya Umphonphison1, Paitoon Kaewhom2, Kanokrat Srikijkasemwat1 

...2018-2021. A total 2,002 serum samples were collected from 16 farms located in 10 provinces and tested by Enzyme-Linked Immunosorbent Assay. Among total serum samples, 914 samples were further tested by polymerase chain reaction (PCR) to detect ORF2 gene. The results revealed that 81.17% of pigs had low positive level antibody against PCV2, while 10.29% had high positive titer. On the other hand 8.54% of pig had no antibody...

Doaa H. Assar1, Rasha A. Al Wakeel2, Mahmoud M. El-Maghraby3, Mohammed M. El-Badawy3, Adel A. El-Badawy3, Wael M. Nagy3, Mustafa S. Atta2, Abdel-Khalek E. Abdel Khalek4* 

...e decreased MDA in blood serum of their lambs. Allicin dietary supplementation (1.2 g/kg) pre-May breeding season enhanced the productivity and general health of crossbred ewes and their lambs. Allicin exerts these positive impacts via its ability as a scavenger of free radicals by enhancing the endogenous antioxidant enzyme activities, metabolism, immunity, and reproduction.

Keywords | Allicin, Antioxidative enzymes, Healthy status, Immunity, milk, La...

Adrial Adrial1*, Rudy Priyanto2, Salundik Salundik2, Ahmad Yani2, Luki Abdullah3 

...peat soil, forage, blood serum and their impact on reproductive performance of beef cows. This study was carried out at peatlands of Pulang Pisau district, Central Kalimantan Province through observation method supported by laboratory analysis. Reproductive performance data were obtained through direct interviews and recording cards. Soil and forage samples were taken from the main forage source locations. A total of 138 blood samples were taken through the ju...

Hanaa H.A. Gomaa1*, Shimaa A.S. Hasan1, Nashwa Harb1, Amal H.A. Gomaa2 and Maha Anani3

...tudy was conducted on 94 serum samples of pregnant women in Ismailia City. The presence of herpes simplex virus type 1 and 2 antibodies (IgG and IgM) and viremia were evaluated by commercial ELISA and real-time polymerase chain reaction (RT-PCR) techniques. Our findings revealed a very high frequency of HSV-1 and 2 infections among the studied pregnant women with percentages of 74.5% and 98.9%, respectively. Upon the interpretation of the HSV serological profi...

Nadia A Eltablawy1, Ibrahim El Tantawy El Sayed2, Hamed Mohamed Abdel Barry2, Marwa A. Ibrahim3*, Maha Nageib Ahmed Serag ElDein2 

... significantly increased serum AST, LDH, CK-MB activities, Troponin1, iron accumulation, and oxidative stress as evidenced by the increased MDA, and NO in association with significant reduction of GSH content in cardiac tissue. Furthermore, mRNA expression of iNOS was significantly upregulated and eNOS and Top 2 ß mRNA expression levels were downregulated. The pre and concomitant administration of TME with DOX as well as the post-administration of TME at...

Lulu Ding, Ke Wang, Ruxue Huang, Wenjing Yu, Bingzhao Yan, Mengli Jiang and Jicang Wang*

..., and hematocrit(HCT) of serum were significantly reduced after Cd exposure for 4 weeks. Cd increased the expression of GSH and MDA and decreased the activities of CAT and T-SOD. Furthermore, in the Cd-treated rats, the glomerulus contracted, the renal tubular structure was damaged, the epithelial cells were disordered and degenerated, and a large area of lesions occurred. However, treatment with Nar slowed down the occurrence of oxidative stress induced by Cd...

Ayesha Bakhtiar1, Sardar Azhar Mehmood2, Abdul Rauf Bhatti3*, Shabir Ahmad2, Naqash Khalid2, Javed Iqbal5, Azra Nadeem4 and Waqas Ahmad1

...and 35 of the study, the serum HI antibody response to these four immunisations was assessed. As evidence of its strong efficacy, Group C, which had received the Lasota (vaccine-2) vaccination, displayed high antibody titers throughout the experiment. In terms of geometric mean titers, there was a significant difference (p 0.05) between the groups. On days 7, 14, 21, and 35 of the experiment, data on other performance indicators, including as feed intake, wate...
Ulvi Fitri Handayani1, Wizna2, Irfan Suliansyah3, Yose Rizal2, Maria Endo Mahata2*
...o lipid profile of blood serum consist of cholesterol total, triglycerides, LDL (Low Density Lipoprotein), and HDL (High Density Lipoprotein). Two hundred laying hens of the Lohman Brown were healthy, had no physical defects, weighed 1600-1800 g, and produced 82% at the age of 32weeks at the beginning of the treatment. They were randomly housed in cages (one bird per cage, ten cages per replicate) and subjected to one of five experimental diets. This experimen...
Rafik Soliman1, Neven Waheeb2, Essam Nasr2, Mahmoud El-Hariri1, Heidy Abo-Elyazeed1, Hassan Aboul-Ella1*
...solation. Using ELISA on serum samples collected prior to skin testing from the positive tuberculin reactors, only 26 cases (37.7%) were positive. The IQRT Anigen lateral flow kit showed only 21 positive cases, 43.8% of 48 bacteriologically identified cases, and 30.44% out of the 69 tuberculin-positive cases. The Ubio quick VET kit has detected zero% of bovine tuberculosis-positive cattle. Using bovine tuberculosis rapid kits alone may be unreliable for the de...

Eman S Ramadan, Mohamed E Ali, Mohamed A Elkhiat 

...dominal ultrasonography, serum biochemical analysis as well as rapid feline infectious peritonitis (FIP) test and Rivalta test for the diseased cats. On basis of these results, six cats diagnosed with feline infectious peritonitis (effusive form) involving liver injury. Serum microRNA-122 was estimated by real-time polymerase chain reaction in all cats. Effusive form of FIP with liver injury was manifested by abdominal diste...

Bashir Ahmad1*, Ali Muhammad Yousafzai2, Waqar Ali1, Ikram Ilahi1, Farman Ullah3, Saeed Ahmad1, Ayaz Ali Khan1, Umair Ahmad2 and Hafsa Maria2

...nd several liver related serum parameters in paracetamol-intoxicated rabbits. Moreover, the amount of (DPPH) free radicals that garlic aqueous extract scavenged at various doses was used to determine its antioxidant capacity. There were five groups each of which contains eight rabbits as experimental animals. These groups were, group A (control animals), group B (intoxicated animals), group C (Animals treated with standard drug), group D and group E (extract w...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Mohammad A. Al-Mahaish4, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel5
...le concentrations in the serum were significantly (p < 0.05) improved by increasing the level of MWM into broiler diets up to 6%. In contrast, some traits of carcass composition and meat quality as well as physiological parameters deteriorated when adding higher levels of the MWM (8-10%) to the diets, compared to the control. Economically, there was a linear and quadratic (p < 0.05) decrease in the protein cost of the diet and a linear increase in birds&...
Chalothon Amporn1, Somchit Guntaprom1*, Sarawut Duongmawong1, Wilasinee Srisanyong1, Sirikanda Thanasuwan1, Phalita Koonnadilokpot1, Dechawut Bunyaluk2, Juggrid Jugsumrit3, Jakrit Yaeram4, Chompunut Lumsangkul5
...itional 10% fetal bovine serum, streptomycin (100 μg/ml), penicillin (100 U/ml), 25 μg/ml FSH, 2 IU/ml hCG, 0.2 mM sodium pyruvate, 1 μg/ml 17-β-Estradiol, and either 0, 100, or 200 μM/ml cysteine where 0 served as the control. IVF-TALP medium was used to fertilize the mature oocytes which subsequently underwent culturing in a simple culture medium (KSOM). The results showed that percentage of matured oocytes, fertilized oocytes, 8-16 cells de...
Lovita Adriani1*, Chitra Kumalasari1, Endang Sujana2, Ronny Lesmana3
...hematological values and serum biochemistry. The research was carried out from March until April, 2022 at the Layer Farm Sukarapi Village, Universitas Padjadjaran, Indonesia. A total of 40 laying hens 90 weeks were randomly allocated to four treatments and five replications, with experimental Completely Randomized Design (CRD).  The treatments were, T0: probiotic powder free-control diet. T1: ration and 2 % powder probiotic, T2: ration and 3% powder probi...

M.M. Mikailov1*, O. Yu. Chernykh2, E.A. Yanikova1, G.A. Nurlygayanova3, O.D. Sklyarov4 

...gnostic studies of blood serum from cattle for brucellosis from farms with different epizootic situations, carried out in 2019 . The diagnostic efficacy of the indirect hemagglutination reaction (RNGA) was studied in comparison with the enzyme-linked immunosorbent assay (ELISA), agglutination reaction (RA), complement fixation reaction (CSC), rose-bengal test (RBP) and immunodiffusion reaction with O-PS antigen (RID with O -PS antigen). The specificity of thes...

Hussein Jabar Jasim1*, Amer Murhum Al-Amery2

...ificant increases in the serum total bilirubin, creatinine, and active serum enzymes ALT, AST, ALP, and GGT. In contrast, the serum total albumin showed a significant decrease in infected buffaloes. Moreover, the results of the gross pathological examination revealed that cirrhosis and paleness of the liver with multiple abscesses appearing as pale necrotic areas, as well as thickness and ...

Muhammad Shahid1*, Muhammad Idrees1, Afza Rasul2, Iram Amin1 and Samia Afzal1

...trols were included. The serum of CHC patients was analyzed for HCV viral load and genotype. The liver function test, lipid profile, sugar levels, and complete blood count values were assessed in the laboratory. Receiver operating characteristics were used to find the biomarkers of infection. Logistic regression analysis revealed that liver enzymes (ALT, AST, ALP, γGT, albumin), blood cell count (globulin, platelets, MCHC RBC, WBC, monocytes% and lymphoc...

Lihang Wang, Qiling Chen, Tingsheng Lu, Shudan Yao, Xingwei Pu and Chunshan Luo*

...sequently harvest of the serum and the spinal cord tissues was behind euthanasia of rats. Detection of biochemical indicators, observation of cell apoptosis, and determination of Bax, Bcl-2, p38 MAPK and Smad2 were clarified. We found that MH and MH+MPS could effectively reduce apoptotic cells, dramatically minify TNF-α, IL-6, IL-8, MDA and Bax contents (P < 0.01) and elevate GSH-Px and Bcl-2 level (P < 0.01). Additionally, the P38AMPK/Smad2 pathwa...

Abdirahman Barre*, Karanja D Njuguna, Bebora Lilly Caroline and George Chege Gitao

...he jugular and screening serum for attendance of Brucella antibodies using Rose Bengal Plate Test (RBPT), serum agglutination test, competitive- enzyme linked immune sorbent assay and double agar gel immunodiffusion test. The selected camels were followed into the slaughterhouse and pathological changes were identified grossly and microscopically based on alteration in organ and/tissue structure. The three main clinical sign...

Subramaniyam Suresh, Saravanakumar Marimuthu*, Prashanth D’Souza 

...rate (BHB) (mmol/L), and serum cholesterol & triglycerides (mg/dL), and liver marker enzymes (IU/L) viz. aspartate aminotransferase (AST), alanine transaminase (ALT), and gamma-glutamyl transferase (GGT). Results revealed that 4% FCM was numerically improved on week 1 (0.11), week 2 (0.46), week 3 (0.56), and week 4 (0.54) as compared to baseline in PTF supplemented group. Milk fat (%) was also significantly (p < 0.001) improved on weeks 2, 3 & 4 as...

Chun Ik Lim, Hyeon Kwon Kim, Kang Nyeong Heo, Are Sun You, Hyo Jun Choo* 

...arding blood parameters, serum concentration of albumin (ALB) was significantly (P < 0.05) higher in the group fed diets supplemented with FGP than in the CON group fed a basal diet. FGP supplementation quadratically (P < 0.05) increased serum total protein (TP) level. Aspartate amino transferase (AST), cholesterol (CHOL), and triglyceride (TG) concentrations were significantly (P < 0.05) decreased in the FGP2.0 gro...

Caiping Duan

...raphy in each group, the serum nitric oxide (NO), endothelin-1 (ET-1) and cardiac troponin (cTnT) contents in different treatment groups were detected by enzyme-linked immunosorbent assay. Coronary blood samples were obtained during coronary angiography. Expressions of interleukin-1β (IL-1β), interleukin-6 (IL-6) and tumor necrosis factor-α (TNF -α) were detected by Western blotting (WB). The protein contents of B-cell lymphoma factor 2 (...

Jianli Xiong1,2,*, Hongtao Ren2, Guanglu Li2, Xiaochan Gao2, Yong Huang2 and Shiyang Gao2

...rmance, immune function, serum biochemical parameters, and antioxidant capacity of growing swan geese (Anser cygnoid). 240 four-week-old healthy swan geese were randomly divided into five groups (n = 48 each). Each group was subdivided into six replicates, with eight geese per replicate. Geese received basal diets, supplemented with either 0 (control), 10, 20, 40, or 80 IU/kg VE. All geese were treated for 12 weeks. The results showed that VE supplementation h...

Yang Hu, Jingxin Ding, Beilei Xu, Xiangming Sun, Guoyu Li, Hui Song, Zheng Zong and Wenlan Li*

...ministered with TGs, and serum fingerprints of blood samples collected at 10 different times were established by UPLC-Q-TOF-MS analysis. The estrogen-like activity of TGs was evaluated by determining the proliferation rate of Michigan Cancer Foundation-7 cells. The spectrum-effect relationship was analyzed by serum fingerprint of TGs to characterize the activity in vivo and identify the active compounds of TGs. In the result...

Ghulam Mustafa Solangi4, Zaheer Ahmed Nizamani1*, Mansoor Tariq1, Zubair Ahmed Leghari2, Asghar Ali Kamboh3, Barirah Rehman Talpur1 

...province, a total of 800 serum samples from four districts of Sindh (Thatta, Tharparkar, Jamshoro and Larkana) representing four agro-ecological zones of Sindh were examined by using c-ELISA. The overall seroprevalence of CCPP in goat population was found to be 18.0%. The prevalence of CCPP varied significantly (p<0.001) in the four districts. It was found highest in Tharparkar (24.5%) followed by Larkana (19.0%) Jamshoro (15.5%) and Thatta (13.0%). Sex-wis...

Doaa H. Assar1, Rasha A. Al-Wakeel2, Zizy I. Elbialy3, Mahmoud M. El-Maghraby4, Helmy K. Zaghlool5, Adel A. El-Badawy4, Abdel-Khalek E. Abdel-Khalek6*

... packed cell volume, and serum total protein, high-density lipoproteins, testosterone, and thyroid hormones (T3 and T4), and significantly decreased activity of aspartate and alanine transaminases (AST and ALT), triglycerides, cholesterol, low-density lipoproteins (LDL), very-LDL, and urea. Semen variables including semen volume, and percentages of sperm motility, livability, and abnormality as well as concentration and output of sperm cells were significantly...

Fathin Faahimaah Abdul Hamid1, Mohd Farhan Hanif Reduan1*, Jasni Sabri1 , Faez Firdaus Jesse Abdullah2,Mohammed Naji Odhah1, Nur Athirah Binti Abdul Manaf1, Mohd Jefri Norsidin2 , Siti Nor Che Yahya1, Intan Noor Aina Kamaruzaman1, Nur Zul Izzati Mohd Rajdi1 

...of the hematological and serum biochemistry changes is critical to determine the effectiveness of the treatment approach in reducing the severity of infection. Healthy goats (n=20) were equally divided into 5 groups: Mannheimia haemolytica 107 concentration was inoculated intranasally to all goats except goats of Group 1 which served as the negative control, Group 2 was the positive control, Group 3 goats treated with oxytetracycline, Group 4 goats were treate...

Anhar Ibrahim Elhanafy*, Amr Mohamed Mousa, Amaal Mohamed Kamal 

...proved RBCs count, WBCs, serum total protein, albumin and globulin concentrations, as compared to control. Upon treatment, a significant decline in aspartate aminotransferase, alanine aminotransferase, serum total bilirubin, direct bilirubin and in direct bilirubin, serum creatinine, urea content, serum total cholesterol, triglycerides, and low-density...

A. A- E. Abo-Elkhier1, K. S. E. Abdel-Wahab2, M. A. Ali3, M. A-H. El-Sayed4, N.A-K. Saleh5 and A. A. Atef6

...e aborted women and cord serum of infant of anti-HEV IgG and IgM positive full term delivered women were tested for REV Ag and HEV RNA. Among 120 aborted women. 2.5 (3/120) of them were positive result with anti-HEV IgM. Anti-HEV IgG, HEV RNA and HEV Ag. also 11.7 % (14/120) of them gave positive result with anti-HEV IgG. HEV RNA and HEV Ag. and 5.8 % (7/120) or them were positive for anti-HEV IgG only. Also 13 of 120 (10.83 %) full term delivered women were a...

Om-Hashem M. EI-Banna1, M. A. S El-Kady2, E. A Salama1 and Salwa N. Zein2

... with the monoclonal antiserum raised against the coat protein of ND18 stain and the two coat proteins were indistinguishable in their sizes.

...

Hala A. Amin1; A. Barakat2; A.A. Abou Zeid1

.... coli cell culture. Antiserum obtained from rabbits after injection with the BBP-rCTV-CP fusion protein showed comparable reactivity in the serological detection of CTV. This antiserum could be used at dilution or 1: 10.000 at the detection stage in an indirect ELISA (IDAS-ELISA) and was efficient for trapping the virus in standard ELISA. These polyclonal antibodies reacted with a wide range of CTV isolates from different E...

M.A.S. El-Kady1, Om-Hashem M. El-Banna 2, E.A Salama2, Salwa N. Zein1

...1:1000. The prepared antiserum was used detection of BSMV by serological methods i.e., Enzyme-linked immunosorbent assay (ELISA), Dot-blot and tissues-blot immunobinding assays (DBIA and TBIA). The presence of the virus was confirmed in mature seed parts and non-seed parts of the different five barley cultivars tested.

...

 Salwa N. Zeinl and Hanaa S. Zawam2

...: 1000. The prepared antiserum was used for detection Of ACLSV using ELISA dot immunobinding assay (DIBA). The presence of the virus was checked in blossom parts. (Petioles, stigma, and flower cup).

...

Fang Chen

...ed with 10% fetal bovine serum, 100 µg/ml streptomycin and 100 U/ml penicillin and kept in humid air containing 5% CO2 at 37°C. The cell assay was performed when the cells were in the logarithmic growth phase. In the cultured H69/apatinib, the IC50 of apatinib was greater than 30nM, while it was about 13μM in H69 parental cells (P<0.05), indicating that the anti-apatinib SCLC cells were successfully constructed in vitro. The expression of miR-4...
Saiwa N. Zein
...: 1000. The prepared antiserum was used for detection of T RV using dot-blot immunobinding assay (DBIA). This is the first report for isolation of Tobacco rattle virus Tohrarirus (T R V) from D.Kaki under the Egyptian conditions.
...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
... was purified and an antiserum containing polyclonal antibodies specific to SCMVE strain was raised. Western blot immunoassay (WBIA) successfully used to study the specificity of the produced antiserum to SCMV-E strain. On the level of the molecular studies of SCMV•E strain. a single protein band "ith a size of about 35-37 KDa was obtained after SDS-PAGE analysis of the purified virus preparation. The SCMV-E-RNA wa...

Rafik Soliman1*, Rafik H. Sayed2, Hanan Mahmoud3, Heidy Abo El-Yazeed1, Marsell Saad1, Shaimaa Abdelall Elsaady2, Khalid Sh3 

...nificantly higher in the serum and milk whey of immunized cows as compared to the non-immunized cows (P<0.01). The highest ELISA titers against E. coli (O111), S. aureus, Str. agalactiae and Str. dysgalactiae were recorded 4 weeks post immunization in the serum and milk whey of immunized cows as compared to the non-immunized group. In cows suffering from subclinical mastitis the vaccination and /or antibiotic treatment in...

Saad Zaghlou El-Damrawy1, Reda Ali Hassan2*, Ahmed Maher Bakhaty1, Adel M. Nasr2, El-Sayed A. Abu El-Hassan2  

...ght, haematological, and serum biochemical responses of broiler chicks. Six nutritional treatment groups with equal numbers of birds each were created. In a randomized complete block design experiment, each group contained 100 birds in five repetitions and was assigned to one of the six feeding regimens. Experimental groups included: (1) Negative control (NC) with the basal diet, (2) NC + 600 mg/kg diet of silymarin, (3) NC + 400 mg/kg diet of choline, (4) Pos...

Wuritunashun*, Burenbatu, Narenqiqige, Jiuguniang, Eerdunduleng, Shuanglian Wang, Cuiqin Gong, Hashengaowa, Huizhi Jin, Baiwurihan and Chunhaizi

...pill on the differential serum protein expression of HSP patients. Out of 14 significantly differentially expressed proteins, four proteins immunoglobulin lambda variable 3-27, immunoglobulin kappa variable 3-11, neural cell adhesion molecule L1-like protein, and immunoglobulin heavy variable 3-33 were upregulated, whereas 10 proteins i.e., protein Z-dependent protease inhibitor, C4b-binding protein alpha chain, heparin cofactor 2, complement C4-A, complement ...

Xiaowei Huang1, Chao Ma1, He Lin1, Yuchen Wang1, Yan Xu1, Guangfu Lv2* and Zhe Lin1*

...corticosterone (CORT) in serum were detected. Hematoxylin and Eosin (H&E) staining was used to observe the hippocampal histomorphological changes. The protein levels of glucocorticoid receptor (GR), mineralocorticoid receptor (MR), brain-derived neurotrophic factor (BDNF), trosine kinase B (TrkB) and cyclic adenosine monophosphatec response element binding protein (CREB) in hippocampus were detected by western blotting. The results showed that, OR could si...

Sahar Ezeldien1,2, Foromo Dramou2, Fatma M. Yousseff3*, Alexander A. Nikishov2, Sergy B Seleznev2

...tivity, egg quality, and serum biochemical parameters of laying Japanese quail. A total of 42 Japanese quail were separated into two groups of 21 birds each, with three replicates per group (7 birds) at random; the control group without any additives and the supplemented group with chamomile aqueous extract (3ml/L) in the drinking water from 2 weeks to 13 week at the end of expermint. The total phenols, flavonoids, , and antioxidant potential of chamomile extr...

Nawfal Hammadi Jasim1, Yasmeen Jassim Mohammed2 , Jala Amir Salman Alahmed1, Majdy Faisal Majeed3* 

...atio of ALT in the blood serum significantly increased in groups 1 and 2 of MPH-treated rats, meanwhile, the ratio of AST remained unchanged significantly in Group 1. In the liver, MDA and GSH-PX rates were significantly increased (P≤0.05) in 1 and 2 groups compared to the 3 groups (the control), while SOD level significantly rises only in Group 2, also did not appear MPO values any Significant alteration throughout the experiment. While, the histology al...

Meltem Kızıl1*, Ali Rişvanlı2, Murat Abay3, Tarık Şafak4, Mehmet Akif Kılınç5, Öznur Yılmaz6, Burak Fatih Yüksel1 and İbrahim Şeker1

...umbilical cord and blood serum of cows and calves depending on the mode of delivery.

...

Zahra Abdulameer Al-Zayadi1, Hana Kadum Shanan1, Al Salihi Karima Akool2

...o revealed variations in serum liver enzyme values between treatment groups. The values of ALT, AST, and ALP (U/L) evaluation in control groups were ˃ 29.01±1.8, 87.55±2.9 and ˃ 98.12±8.8, respectively. In conclusion, this study investigated that the ethanolic extract of Sc-RE has an anticancer effect that reduces the proliferation of cancer cells caused by the carcinogenic substance. 
 
Keywords | Antic...

Munir Ahmad1, Abdul Ghaffar1, Riaz Hussain2* and Rifat Ullah Khan3*

...The final results on the serum biochemical parameters showed significantly (p < .05) higher concentrations of liver biochemical profile, biomarkers of kidneys, triglyceride, glucose, and cholesterol in fish treated with pesticide. Histopathological examination showed renal tubular degeneration, widening of Bowman’s space and necrosis in kidneys. Different histopathological lesions in liver of treated test specimens including edema, hemorrhages, atroph...

Aditya Chowdhury Avi1,4*, Md Tariqul Islam1,4, Md Saiful Bari2,4, Rebeka Sultana Swapna Khandoker3, Goutam Buddha Das1 

... FO supplementation. The serum HDL level was increased, whereas cholesterol, LDL, and triglyceride levels were significantly decreased with increasing levels of FO in the broiler diets. It was concluded that supplying 2% or 3% would be effective in both increasing market weight and improving the profit of commercial broiler farming.  

...

You-Ming Teng, Wen-Zhou Liu and Li Yang*

...FFA and Ang II levels in serum. Moreover, pioglitazone inhibited the expression of HIF-1α protein and simultaneously enhanced the expressions of PPAR-α, CPT-1 as well as PDK-4 mRNA and proteins. So we infer that pioglitazone could improve hypertension-induced cardiac hypertrophy and redress abnormal myocardial glucolipid metabolism in rats by down-regulating the protein expression of myocardial HIF-1α and increasing the protein expressions of...
Muhammad Rizwan1, Hamid Akbar1*, Aftab Ahmad Anjum1, Muhammad Arif Khan1, Aneela Zameer Durrani2, Muhammad Abid Hayat3, Anjum Masood4, Muhammad Talha Sajjad1 and Nadeem Raza2
...atelets, lymphocytes) in serum of dairy cows before and after the surgical correction of left displacement abomasum. Twenty-six cows were divided into two groups as control (Group-A) and treatment (Group-B), each of 13 cows. Left displacement abomasum was confirmed by clinical assessment and ultrasonography, and then was surgically treated through Dirksen technique. Blood samples of both groups were collected on days 0, 7, 14, 21, and 28. Levels of various oxi...

Dalia M. Amin1*, Noha Mohammed Halloull1, Walaa E. Omar2, Basma A. Ibrahim2, Nahla M. Ibrahim1 

... blood urea nitrogen and serum creatinine levels as well as significant pathological alterations as tubular injury and infltration of infammatory cells. Elevated TGF1, pERK1/2, and pSTAT3 levels were also present. Bcl-2 levels were down while p53 levels were up. All of the detected adenine-induced biochemical and histological alterations were reduced by erlotinib and Garcinia cambogia. Conclusions: we concluded that oral administration of erlotinib and garcini...

Samin Ullah1, Huma Rizwana1, Abdul Kabir1,2*, Atique Ahmed Behan1, Muhammad Naeem1, Ghulam Shabbir Barham1, Abdul Hafeez Bukero1, Anees ur Rahman1, Naseeb Ullah1 and Shafiq ur Rahman Shah1

...daily feed intake, total serum protein, and serum antibody IgG levels of group C were also higher than those of groups B and A. The study also found that two calves in group A, one calf in group B, and one calf in group C had health issues such as diarrhea and pneumonia. The findings suggest that providing 4 liters of colostrum to crossbred Holstein Friesian calves within 30 minutes of birth can improve their immunity and he...

Zaki Al-Hasawi1* and Reda Hassanine2

... biochemical parameters, serum liver enzymes (ALT, AST, ALP, GGT), serum glucose, triglycerides and urea were significantly higher than those in uncontaminated fishes from the unpolluted site, but mean level of serum total protein was significantly lower. Only, significant correlations were found between mean levels of blood biochemical parameters and mean concentrations of Zn, Cd and Pb i...

Zaki Al-Hasawi1* and Reda Hassanine2

... biochemical parameters, serum liver enzymes (ALT, AST, ALP, GGT), serum glucose, triglycerides and urea were significantly higher than those in uncontaminated fishes from the unpolluted site, but mean level of serum total protein was significantly lower. Only, significant correlations were found between mean levels of blood biochemical parameters and mean concentrations of Zn, Cd and Pb i...

M.A.M.M. Shehab-El-Deen1,2*, S.A. Al-Dobaib1 and K.A. Al-Sobayil1

...els of NEFAs for 24 h in serum-free maturation media. Obtained zygotes were cultured in synthetic oviduct fluid with 5% FCS for eight days. Blastocyst stages from each treatment group were assessed and evaluated for their quality by determining the ACR by means of TUNEL staining. The presence of palmitic or stearic acid at high concentrations during oocyte maturation increased ACR, whereas oleic acid had no significant effects. The results of the present study...

Kazi Afsana Homayra Orchy1, Mst. Antora Akter1, Nelema Yesmin1, Md. Moshiur Rahman Khan1, Marzia Rahman2, Md. Mahmudul Alam1* 

...nd kidney functions, the serum levels of liver enzymes (ALT, AST and ALP) and kidney function biomarkers (creatinine, BUN) showed a significant increase in burn patients of the saline-treated control animals, whereas, the animals treated with hPRP exhibited the normal range of these functional biomarkers. On the basis of morphology, histopathology, and biochemical analysis, it can be concluded that PRP, irrelevant of source improves and accelerates the burn wo...

Lianci He1, Dingxi Bai2, Chenxi Wu2, Yizhu Zhong2, Shi Chen2, Xinru Bao2, Jing Gao2*, Chaoming Hou2*

... cyclooxygenase-2 in the serum were measured. Compared with the CON group, the CFS group had decreased weight and decreased activity and mobility (P < 0.05). Compared with the CFS group, the three SXC groups and the FLU group all had varying levels of increased body weight, horizontal motion, vertical motion and fatigue time (P < 0.05). The SXC downregulated the mRNA and/or protein expression of IL-1β, TNF-α, TAK1, TAB, IKKα and NF-&kapp...
Xiangjie Zhao1, Zheshi Kuang2, Jiyuan Yang2, Muhammad Bilal1 and Rongling Yang1*
...e, immune organ indices, serum biochemical parameters, and meat quality of Lingnan yellow broiler chickens. Lingnan yellow broilers were randomly categorized into 4 groups. The control group was fed with basal diet containing 3% fishmeal, and the treatment group 1, 2, and 3 were fed basal diet with 30%, 60%, and 100% fishmeal substituted with fermented silkworm pupae (FSP), respectively. Broilers were fed the treatment diets in phase 1 (1-21 d) and phase 2 (22...

Yakun Ge

...ed with 10% fetal bovine serum, 50μunits/mL penicillin and 50μg/mL streptomycin, maintained at 37°C and 5% CO2 in a humid incubator environment. Quantitative analysis of ROS was performed using flow cytometry and median fluorescence intensity detection. Cell proliferation was detected by MTT method. Combined treatment promoted the production of ROS. The cell viability of the combined treatment group was lower than that of the control group at 24h, 48...

Jing Hu1,2,3 and Zhenhua Ma1,2,3*

...dneys and the changes of serum indicators of hybrid grouper (Epinephelus lanceolatus ♂ × Epinephelus fuscoguttatus ♀) in 96 h. The results showed that the survival rate of each group was 100%, and no abnormal behavior was observed in juvenile fish. The damage performance in gill generally deepened over time. Lamellar fusion and curling of secondary lamellae also deepened from C group to T3 group. The proportion of interrenal tissue and hematopoietic ...
Tehreem Fatima1, Jabbar Khan1,*, Hamid Shafiq2, Dost Muhammad3, Muhammad Rafi1 and Shoaib ur Rehman1
...ion of blood sample. For serum collection, blood samples were centrifuged at 1000xg for 15 minutes. Quantitative measurement of Hsp70 protein was done using sandwich ELISA technique. The maximum serum Hsp70 level observed was 42ng/ml and minimum serum Hsp70 value was 13ng/ml, with median value of 28ng/ml. In control group, maximum concentration observed was 38ng/ml while the minimum

Khalid M. Al-Syaad1,2

...ne and urea in the blood serum and lipid peroxidation product (TBARS). While decreased (P<0.001) the total antioxidant capacity (TAC) and number of spermatozoa compared with control group. The histological examination of the kidney revealed alterations induced by CC, including atrophy, tubular necrosis, enlargement of the glomeruli, dilatation and congestion of the glomerular capillaries (G) and the blood vessels around the renal tubules, atrophy in some re...

Hafiz Muhammad Arsalan1, Amina Arif1 and Muhammad Khalil Ahmad Khan2*

... profile, lipid profile, serum electrolytes were evaluated in CML and control groups. Our study reported that no significant difference in biochemical profile among treated with Nilotinib or Imatinib tretated groups while in comparision to control group, a marked difference was observed. Antioxidant biomarkers i.e. MDA, SOD and CAT were augmented in control group as compared to CML treated groups. Decreased GSH level was reporetd in the CML group while increas...
Chen Gu1,2, Ze-Dong Xu1, Lin Chen1, Ming-Hui Gu1, Sheng-Mei Yang1, Ai-Qing Wang1, Bao-Fa Yin1* and Wan-Hong Wei1,2,3*
...by the highest levels of serum adrenocorticotropic hormone (ACTH), serum corticosterone (CORT), and hypothalamic c-fos mRNA, compared to RO and DW offspring. When exposed to rabbit odor, male RO offspring showed more alerting behaviors than females, while male CO offspring showed more exploring behaviors than females. CO offspring exposed to rabbit odor exhibited higher levels of serum ACT...

Irtaza Hussain1, Muti ur Rehman Khan1*, Asim Aslam1, Masood Rabbani2 and Ahsan Anjum1

...imals. For this purpose, serum samples from 350 goats and 91 sheep were collected on the 20th day post-infection for detection of antibodies, and essential information related to potential risk factors was collected through a questionnaire from fourteen districts of Punjab, Pakistan. Serologically positive samples were processed through PCR for confirmation using scab samples by identifying the GIF/IL-2 gene. This study found an overall 13.2% seroprevalence of...

Ijaz Ahmad1,5*, Haihong Hao1, Pascal Sanders2, Zafar Iqbal3, Saeed Ahmed4, Farhan Anwar Khan5, Zahir Shah5, Muhammad Ibrahim6 and Lingli Huang1

...istration, the mean peak serum Concentrations (Cmax) was found 2.95μg/mL and achieved after (Tmax) 1.50h. The elimination half-life (tl/2(el)) was 2.03±0.06h. The Mean Residence Time (MRT) was 2.58±0.05h and the area under curve from zero time to infinity (AUC0-∞) were 9.67±0.72μg/mL/h. The newly proposed method was shown to be simple, rapid, economical and sensitive compared to the previously reported method, and thereafter ap...

Imbang Dwi Rahayu1, Ali Mahmud1*, Wahyu Widodo1, Adi Sutanto1, Apriliana Devi Anggraini1, Devi Dwi Siskawardani2, Wisnu Nurcahyo3, Tri Untari3

Xiaowei Huang, Yajie Wang, Jia Zhou, Junxiu Liu, Zhe Lin and Ruili Li*

...O, SOD, GSH-Px levels in serum were significantly increased. The levels of TNF-α, IL-6, MDA, LDH in serum were significantly decreased. The protein expression levels of TLR4 and Nuclear factor-κB (NF-κB) p65 in kidney were significantly decreased. HandE staining on renal showed that SBG groups had a certain protective effect on renal injury, especially the high-dose group. In conclusion, SBG may improve hem...

Abdullah Alsrhani1*, Aisha Farhana1, Shahid Hussain2 and Muhammad Ikram Ullah1

...t study was to determine serum concentrations of thyroid hormones, serum thyroid antibodies, and serum 25(OH)-D and underscore the association of vitamin D with thyroid function in HT. A cross-sectional study comprising 150 subjects, including 80 HT cases and 70 healthy controls was carried out. The serum thyroid hormone concentrations (FT4, TSH),

Saad Tahir, Nadeem Ahmed*, Mohsin Ahmad Khan, Muhammad Akram, Rabia Abbas and Kausar Malik

Zeyad Kamal Imari 

...osphatase) levels in the serum (p=0.027; p<0.0001 and p=0.0006 respectively). The ash, calcium and phosphorus content of tibia were showed non-linear responses (p<0.0001) when the dietary calcium reduced from 1.4% to 0.4%. Lower calcium in the diet non-linearly increases (p<0.05) dressing percentage and relative weight of the breast and leg. The results also showed that predicted dietary calcium requirements for dressing percentage and relative weight...
Yafang Wang1,2,3, Fugui Jiang2,3, Haijian Cheng2,3, Yifan Liu2,3, Chen Wei2,3, Ce Liu2,3 and Enliang Song1,2,3*

H.A. El-Nagar1, A.M. El-Hais2, M.S. Mandouh2, W.M. Wafa1*, A.H. ABD El-Aziz, K.A. Attia4 

...xidant capacity in blood serum, and RBCs, WBCs, Hb, and PCV increased (P<0.05) in treated than in the control calves, being the highest with the combination treatment. Urea-N and creatinine concentrations, and AST and ALT activities decreased (P<0.05) in treated compared with the control calves, with the lowest values for the combination treatment. The treated calves were heavier with higher weight gains than the control one, being the highest with the c...

Salma Jameel Askar 

... G1 while clotting time, serum uric acid, blood urea nitrogen levels, and liver enzyme functions all increased significantly. Rats in G3 had significantly higher RBCs, platelets, PCV%, and Hb concentrations, while clotting time, serum uric acid, and blood urea nitrogen levels, and liver enzyme functions were all significantly reduced in comparison to G2. Liver section of G2 showed increased Kupffer cell proliferation, enlarg...

Wafaa AL. Bnyean1,2 ,Zainab A.H. AL-Mousawi1* 

...ificantly (P<0.05) in serum cortisol, ACTH, CRH hormones, and (11β-HSD) enzyme concentration, while was a significant reduction in serum MDA level in the therapeutic and protective group compared with the positive control group. Our results concluded that glycyrrhizic acid improves the alteration caused by hydrocortisone of hypothalamus pituitary adrenal axis hormones and reduces the free radicals.  

...

Bilal Ahmed Shah1, Muhammad Avais1*, Jawaria Ali Khan1, Masood Rabbani2, Aftab Ahmad Anjum2, Muhammad Asad Ali2, Muhammad Awais1, Sohail Ahmad3 and Shahan Azeem2*

Mohamed I. El-Katcha1, Mosaad A. Soltan1, Seham M. El-Kassas2*, Mahmoud M. Arafa3, El-Sayed R. Kawarei 3, Karima M. El-Naggar1*
...ic and CuO-NPs increased serum Cu levels, MDA and SOD activities while reduced serum glutathione peroxidase activity compared with CuO (P < 0.05). Moreover, serum lipid profile was significantly altered as triglycerides concentration was increased while total cholesterol was reduced in birds received organic and CuO-NPs. So, the organic or Nano forms of Cu could be used as safe alternat...

Shaker B. Al Suwaiegh 

... growth performances and serum biochemistry of goats in arid subtropics. Twenty-four goats average 29.70 ± 1.17 kg body weight (BW) were randomly distributed over four groups. The goats were fed four diets composed of 50.0% concentrates and 50.0% forages. The four diets formulated according to replacement of alfalfa hay with giant reed were control alfalfa hay diet (T1; 50.0% alfalfa hay) and giant reed rations (T2 20.0% alfalfa hay and 30.0% giant reed...

Nusrat Habiullah1*, Shah Nawaz Kumbar1, Fahmida Parveen Samo1, Shamusuddin Bughio2, Asghar Ali Kamboh3, Burirah Rehman Talpur1 

...unction with decrease in serum GGT, creatinine and uric acid and albumin increase; thus selenium might be adapted for strategies against the toxicological effects of lead in avian species.  

...

Muhammad Umar Farooq1, Kashif Ishaq1*, Muhammad Imran Khan1, Muhammad Farooq Iqbal1, Tanveer Ahmad1, Jamil Akbar1, Asim Fraz2, Sara Naeem1 and Aansa Latif1

Shafi Muhammad1, Bibi Nazia Murtaza2, Aftab Ahmad1, Muhammad Shafiq3, Nurul Kabir4 and Hamid Ali1*

...no data available on the serum profiling of IL-17A in HCV patients from Pakistan. Thus, we investigated the relationship between serum levels of IL-17A and age in chronic and fibrotic HCVpatients by ELISA and evaluated different markers that are invloved in the progression of CLDs towards HCC by performing histopathology and immunohistochemistry (IHC) techniques in liver tissues in HCV patients from the southern districts of...

Al-Moataz Bellah Mahfouz Shaarawy1, Wael Mohamed Wafa1*, Ashraf Ali Mehany1, Reda Abdel Samee Ahmed Rezk2, Shereen Kamal Genena1, Mohamed Hamada El-Sawy1 

...tivity of AST and ALT in serum were significantly increased (P<0.05, 0.01 and 0.001), while TSH, T3, T4, total protein, glucose, cholesterol, Ca, P, Na, and K, ALP activity, and milk yield significantly decreased (P<0.05, 0.01 and 0.001) in summer than in spring in Friesian and crossbred cows. In summer season, Friesian cows showed significant increase (P<0.05, 0.01 and 0.001) in RR, PR, creatinine, K, ALT and AST, while T3, T4, glucose and milk yield...

Wisit Ketpanyapong1, Kulisara Marupanthorn2*

...ion on blood parameters, serum antioxidant status, and sperm quality in 24 Duroc boars at 1.0-1.5 years. The boars were randomly divided into four groups of three replicates each and their feed was supplemented with MOLE at concentrations of 0, 10, 50, and 250 mg/kg body weight (BW). Supplementing Duroc boras with MOLE increased leukocyte, erythrocyte, and hemoglobin levels, and significantly influenced serum antioxidant con...

Retno Setyaningsih1, Sri Murtini2*, I Wayan Teguh Wibawan2, Surachmi Setiyaningsih2, Ekowati Handharyani3

... RHDV antibody in rabbit serums without clinical symptoms in some rabbit farms. The presence of antibodies to RHDV in rabbits without vaccination indicates exposure to the virus. Thus, this study aims to investigate the presence of RHDV antigen in asymptomatic seroconverted RHDV rabbits in West Bandung District, West Java Province, Indonesia also to see the relevance of seroconversion within rabbit’s profile. Liver, intestines, and faeces were collected ...

Afshan1, Asad Ullah2*, Imad Khan2, Rafiq Ullah1, Tahira Tayyab1, Fatima Syed3, Raheela Taj3, Shumaila Gul4, Faiza Khan5, Ibad Ullah Jan6, Syed Weqas Ali7 and Assad Ullah8 

...ive stress. In the blood serum the catalase and Malondialdehyde (MDA) both shows significant (P≤0.05). In conclusion I assume that 0.3mg/kg of selenium supplementation in redox status and thyroid hormone show better results in comparison to the control group.

...

Sajida Batool1, Mubeen Akhtar1, Shafaat Yar Khan1,2*

...sinophils percentage and serum level of luteinizing hormone, follicle stimulating hormone and interleukin-3 in both groups. Two tailed, independent t-test and Pearson co-relation was applied to analyze hematological and biochemical parameters while anthropometric parameters like weight and height were compared as percentages. Results of current study showed that body mass index was significantly (P<0.05) elevated in PCOS patients when compared with BMI of c...

Ahmed H. El-Anwar, Eid A. Mabrouk, Khaled M. Ali, Nermeen A. Helmy, Rehab M. Reda* 

... the growth trials, some serum biochemical parameters, and testicular functions in growing V-line male rabbits. A total of 45 V-line were randomly separated into 3 equal groups; the first group (acted as control) was fed on a plain ration, and the two other groups (second and third groups) were nourished for 3 months on a plain diet supplemented with 60 mg ZnO/ kg and 60 mg n-ZnO/ kg, respectively. Growth performances; body weight (BW), body weight gain (BWG)...

Rana Mahmood Ahmad*, Orooba M.S. Ibrahim 

...llected specifically for serum collection. In the present investigation, the administration of SaZnONPs to infected rats yielded noteworthy reductions in the levels of the pro-inflammatory cytokine TNF-α. SaZnONPs demonstrated an elevation in the levels of the anti-inflammatory cytokine IL-10, which is known to play a crucial role in safeguarding tissues against damage caused by inflammation. These results led us to hypothesize that SaZnONPs therapy spee...

Ying Chen1, Chao-Zheng Li2, Zhun Yu3, Jia Zhou4, Yan Xu4, Zhe Lin4, He Lin4* and Xiao-Wei Huang4*

...MB (CK-MB) isoenzymes in serum, and superoxide dismutase (SOD), malondialdehyde (MDA), glutathione peroxidase (GSH-Px) and catalase (CAT) in myocardial tissue were detected by ELISA. Hematoxylin and eosin (HandE) staining was used to detect the histological changes of rat myocardium. Western blotting (WB) was used to detect the protein expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1), and NADH quinone oxidoreduct...
Xiao-Wei Huang1,2, Mei-Li Liu1, Jin-Ji Wang1, Yue-Xin Liu3, Zhe Lin1, Chun-Shu Rong4* and Ji-Xiang Ren4*
...e growth factor (NGF) in serum were detected using ELISA. The protein expression levels of phosphoinositide 3-kinase (PI3K), protein kinase B (Akt) and mammalian target of rapamycin (mTOR) in the hippocampus were detected through western blotting. In the results, VAP contained 17 kinds of AA, including 7 essential AA, with a content of 394.08 g/kg, the total AA content was 831.55 g/kg. In the OFT, the PIR, VAPH and VAPL groups showed significant decreases in s...

Taidong Wang1, Xiaowei Huang1, Jian Huang2, Guangfu Lv3 and Zhe Lin1*

...body temperature, reduce serum TNF-α, IL-1β and IL-6 levels, reduce the hypothalamus COX2, caspase3 and Bax protein expression levels and improve BCL2 protein expression levels, play an antipyretic effect.

...

Abroo Fatima Qazi* and Din Muhammad Shaikh

...lucose level and rise in serum insulin as compared to positive control group (P < 0.001). At the same time, they showed significantly increased expression of insulin gene along with transcription factor PDX1 in group A (P < 0.001). It was concluded that the effect of appropriate dosage of O3FAs on the transactivation of insulin gene by expressing PDX1 can be a new therapeutic strategy in managing T2DM in future.

...

Rana Mahmood Ahmad*, Orooba Mohammed Maeed  Ibrahim

...tory cytokine (IL-10) in serum. According to the results, we can conclude that the clove oil produced using the petroleum ether have the potential to be used as an excellent anti-inflammatory agent with less side effect. Because medicinal plant extracts are non-toxic, safe, and have no harmful side effects, available in abundance, researchers have turned their attention to using these plants as anti- inflammation.
 

Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2 

...to a substantial drop in serum TAC-O, an increase in MDA, GGT, PC, and ROS concentration, and attenuation of silica’s oxidative stress status, CP NPs (T3) or SiO2 NPs (T2) administered orally to female rats for four weeks constitutes a case of oxidative stress. The study revealed the protective role of CP NPs against the negative impact of SiO2 NPs. The T3 group that got CP alone saw higher results; CP NPs can be thought of as an antioxidant component.&n...

Hemeida, A. A., Osman, M., El-Shahat, Mohamed, Hashem, Medhat H., Mahmoud, Amal and Dahi, Hosni

...lpha fetoprotein (AFP) , serum Albumin , serum creatinine , Serum TSH, Hemoglobin (Hb),White blood cells count (WBCs) and Platelets count . Hematological disorders and ALT elevation were common side effects of treatment. The side effects were increased within group B than that of group A. Three random hepatitis C virus (HCV) samples from group B were studied for the diversity and sequence ...
Hassanein, Suzan A.; Abd El-Wahab, Wafaa; Eweis, Moustafa and Mahmoud, Mervat M.
...world. In this study 465 serum samples were collected from 3 Nile delta governorates (Behaira, Mounofya and Kafer El-Sheikh) during 2009. The samples were used for detection of FMD antibodies to 3ABC non-structural proteins using commercial ELISA kit (Priocheck). The overall percentage of positive was 38.9 %. The higher percentage of positive detected in Behaira (48%), then Mounofya (45.3%) while Kafer El-sheikh was the lowest (23.7%). The positive results of ...

El-Kenawy, A. A. and El-Tholoth, M. S.

... liver (3)). Hyperimmune serum was prepared against reference LSDV (Ismailyia88 strain). Immunofluorescence (IF), immunoperoxidase (IP) techniques and polymerase chain reaction (PCR) were used in our study. Chorioallantoic membranes (CAMs) of embryonated chicken eggs (ECEs) were inoculated with Known previously isolated and identified LSDV of 104 8 EID5d0.1 ml for virus follow up in these CAMs by using IF and IP techniques and PCR. The results indicate that IF...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...it (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330) from Kafr ElSheikh Governorates during 2009 from cattle and buffaloes. The higher percentage of positive was detected in Sharkia (31.7%) while Kafr Elsheikh was (27.3%). The positive result of detection of antibodies against non structured proteins of FMDV indicates that these samples come from natural infected animals. The further work is required to evaluate the performance of...

Madboulyl , H. M.; Tamami , S.M.; Abd Elmoneml , A.S.; Husseinl , A.S. and Arafa2, A.M.

...ey for APV antibodies in serum and egg yolk samples collected from non-vaccinated flocks (608 serum samples were obtained from broiler chickens from El-Fayoum, Beni suef and Giza, 40 turkey poults serum samples from Al Behira and El Monofia, 278 chicken egg yolk samples from El-Monofia, Dommiat, Alexandria and Al Behira and 675 turkey egg yolk samples from El-Fayoum and Beni suef Governora...

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...ve reaction with CMV antiserum but not with antibodies of WW and SqMV using DAS-ELISA. CMV was able to infect different host plant species including squash, pumpkin, pepper, bean, Chenopodium amaranticolor and cowpea showing foliar symptoms of mosaic, deformations and necrotic and chlorotic ring spots, that resemble those induced by CMV. SDS-PAGE test showed various distinguishable sole novel protein bands in four cucumber cultivars infected with CMV but not i...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...ltinosa. The induced antiserum for the isolated virus had a titer 1\1024. 600 bp DNA fragments from the coat protein gene (CP) of TMV—Ch—EG was amplified with Rt-PCR technique. Phylogenetic analysis of the TMV-Ch-EG/CP- gene showed 89% nucleotide sequence homology with other published strains of TMV in GenBank and 81% amino acid sequence homology. Tissue culture approach was used to pemit the recovery of TMV-Ch-free micropropagated shoots via appli...

Abo Elmagd l , Enas K.; Abdel-Wahab l , Kouka S.; Alrasheedy l , Zeinab E. and Khalifa2, Ahmed S.

... and their infants using serum samples for both mothers and infants plus saliva for infants, in addition to detection of serum HCV- RNA (viremia) by reverse transcription polymerase chain reaction (RT-PCR). Also detection of antiHIV IgG class antibodies in mothers' sera. The study sample included 61 pairs of 20-40 years old Egyptian mothers and their infants whose ages ranged from one day t012 months. All the deliveries were...

Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.

...oduction of specific antiserum against BBTMV was obtained by rabbit immunization using three different methods of injections. The titer Ofthe prepared antiserum as determined by indirect ELISA with dilution of tissues 1/5 was 1/1024. Purification of the immunogamaglobulin G and conjugate of IgG with alkaline phosphatase were carried out to be used for ELISA detection. The concentrations of IgG and IgG conjugated with alkalin...

El.-Kadyl, M.A.S; Badr2, A.B.; zein3, Saiwa N. and Khalifa4, M.A.A.

...t quantities for its antiserum production. The absorption spectrum of the purified virus had a min at 245nm and a max at 260 nm. The A260/280, A280/260 and Amax/min ratios were 1.30, 0.76 and 1.29, respectively. The estimated yield of the purified virus was 3.35 mg/100 g leaf tissues. Electron micrographs of the purified virus preparation revealed the presence of filamentous flexuous virus particles about 730-745nm long. Antiserum

Ahmed, AmalA.; Zein, Salwa N. and Khatab, Eman A. H.

...ly with the specific antiserum for the CeMV using double antibodies sandwich—enzyme linked immunosorbent assay (DAS-ELISA). It was successfully purified from infected N. tabacum L. var. White Burley leaves and virus particles had filamentous flexuous shape. Only one band of purified virus preparation was observed 1.5 cm bellow the meniscus of the density — gradient column. Infectivity test of the viral zone was found positive. The absorption spectr...

El-Tabakh, SAA l ; Abdel Wahab, KSE; Badr, AF   and Helal, IG  

...C virus (HCV) in viremic serum was used for experimental infection of a human hepatoma cell line (HepG2) at a multiplicity of infection (MOL) of one genome copy per 103 cells. Stock HepG2 cell cultures were grown in Dulbecco modified minimum essential medium (DMMM) as growth medium with 10% fetal calf serum and antibiotic mixture (IOOU penicillin and 100 mgm streptomycin/ml) and subcultured at 3-4 days. HepG2 cells were main...

Hussein, HA; sultan, HA. Al Deeb AH and AA. El-Sanousi

... the present study, 9922 serum samples were collected from vaccinated chickens including some broiler breeders and commercial layers from the period Of December 2006 to February 2008 and tested for the immune response to the multiple vaccination with different H5Nl and H5N2 avian influenza vaccines (Reassortant H5N1 and 6 types of H5N2 vaccines) by hemaggtutination inhibition (HI) test using heterologous H5 antigen which represent non of the vaccine antigens. ...

Ahmed Abd El Samie Hassan Ali

...nt of BVDV antibodies by serum neutralization test. Virus antigen detection was reported on days 5 & 7 while the antibodies were initially detected on day.

...

El-Sabagh, I.M.; Hussein, H.A.; Amer, H.M.; El-Sanousi, A.A.; Reda,I.M. and M.A. Shalaby

...ity with hyperimmune antiserum to BRV when tested by immunoflurescence assay. Using solid phase ELISA, the VP7 expressed protein was detected intracellulary and extracellulary at 48 and 96 hours post-inoculation using polyclonal antibodies against BRV, respectively. The VP7 expressed protein was not detected in Coomassie blue stained SDSPAGE but produced a detectable band in Western blot assay. The reactivity of the VP7 expressed protein with BRV-specific hype...

Attyat, M. Kotb; Abeer, E. Mansour; Naglaa, I. Aly; Zeinab, T.Salama and Azab, A. Mohamed

... vaccinated control. The serum neutralizing antibody titer expressed in log10 of FMD (strain O and strain A) in calves vaccinated with bivalent FMD vaccine only were increased from (0.9 log10 and 0.9 log10) consequently at the first week post vaccination (WPV) till it reached (2.7 log10 and 2.85 log10) for type O and type A respectively by the week. These titers were reduced to (l .2 log10 — 1.35 log10) by the 16th WPV. The FMD neutralizing antibody tite...
Eman, M. M. Soliman*; Taha, M. M.*;El-Sanousi A,;Shalaby M. S. Wasscl , Youscf Adel*
...determined by using both serum neutralization test (SNT) and enzyme-linked immunosorbent assay (ELISA) on sera collected weekly up to 7 weeks post vaccination, where the antibody titer elevated from I st WPV till reach the protective level at 5th WPV. Effective doses in mice has been calculated in mice by inoculation of 5 groups of mice (10 each) with 2 doses of five fold diluted vaccine; inoculated mice have been challenged I/P with virulent RVF virus 10...

Abdel Razek,B.Omar*and Magda M.Sayed**

...n: justify;">Hyperimmune serum against lumpy skin disease virus(LSDV) was prepared by inoculation of the virus in successive doses into susceptible two calves with complete and incomplete Freund’s adjuvant. Identity tests were applied by agar gel precipitation test (AGPT) and indirect fluorescent antibody technique (IFAT). Serum neutralization test (SNT) and ELISA tests were applied for titration and evaluation of the ...

Abou zead, A.A., Ali, A.A.H.*and Abd El Hkeem M.M.

...d. Serosurvey of 80 serum samples revealed 5 (6.25%) positive for the presence of IBDV precipitating antibodies. 3 out 12 pooled bursae (25%) were positive to the presence of IBDV precipitinogen. Trials for virus isolation on the CAM of chicken embryos revealed the isolation of 3 IBD viruses from diseased quails. Isolated IBDV viruses '.vere examined by electron microscopy. The disease was reproduced in quails to record the course, the clinical findings, ...

S. A. Sidaros*, S. A. EL-Kewey*, Eman A. H. khattab**, M. M. ELsharkawy* 

... leaves. The maximum antiserum titer against either BBSV or CABMV was I :512. The dilution end point of BBSV in faba bean sap was I :320 using indirect ELISA, whereas it was 1:280 for CABMV. Both of BBSV and CABMV were detected in stems and all flower parts (sepals, petals, pistils and anthers) in intact seeds and all seed parts (seed coats, cotyledons and embryos) of immature seeds obtained from infected faba been and cowpea plants. Both of the viruses were n...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

...ture. Using specific antiserum. PRMV was detected in the tissues of infected trees by DAS- ELISA, TBIA and DBIA. RT-PCR was used to amplify fragment of PRMV cDNA using specific primers designed to amplify 200bp of the coat protein gene as a molecular procedure for diagnosis. Electron microscopy of purified preparation of PRMV showed presence of isometric particles 28 nm in diameter. Ultrathin section for electron microscopy examination of infected peach leaves...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...fied with a specific antiserum (Sanofi comp) using Double Antibody Sandwich ELISA (DAS-ELISA) and Dot Immunobinding Assay (DIBA). Survey was carried out during 2001 to 2003 in different locations on commercial peach orchards. Percentages of infection were 6.3, 6.7, 12.3 and 10.9 in Menofia (Khatatba) . EL-Behira (EL-Nobaria North Sinai (Rafah) and Dakahlia (Metghamr), respectively. ACLSV was transmitted mechanically from peach trees those showing less vigorous...

A-New-Whitefly-Transmitted-Geminivirus

...ed-geminivirus (WTG) antiserum [immunogenic oligopeptides coat protein (Cp-3)]. Based on the previous results, the isolated virus TYMV is confirmed to be a whitefly transmitted geminivirus belonging to genus Begomovirus or the Geminiviridae family. 

...

M. E. Shawky and A. M. Daoud

...ere compared to those of serum neutralization test (SNT) and 3CD ELISA Kit. Sensitivities of the ELISA Kit and 3CD ELISA were 94% and 91%, respectively. Rapid confirmation of the presence of FMDV antibodies through the developed ELISA Kit may have a significant impact on initiating emergency control of FMD outbreaks. 

...

M.R. Abd-El Wahab l, H.A. Hussein2, T.M. Asfourl and M.A. Shalaby2

...esting 356 camel sera by serum neutralization test revealed negative for the presence of serum neutralizing antibodies to BVDV. Using RT-PCR assay based on primers located at the non-translated region of BVDV genome to detect BVDV RNA in some buffy coat samples, collected from the cohoused camels in the area where dead camels were found (BVDV-positive). revealed positive results. However. genotyping of such positive samples ...

S. A. Khalil1; M. El-Sayed2; M. M. El-Fayomy2; H. Y. Hassan3 and A. Zaghawa3

...ccording to the level of serum neutralizing antibodies (SNA), the cows were allotted into three groups. In the first group (n=9). the mean SNA in naturally infected cows was 46.2. which gave a mean titer neutralizing antibodies (NA) of 28.4 in their colostrums. Calves fed on these colostrums had a mean SNA of 12.2. 6.9 and 2 after one week, one month, and 2 months, respectively. In the second group (n = 7) the mean SNA in naturally intucted cows was 12.6. whic...

Musaad A. Al-Dubaib

...;">In the present study, serum samples obtained from Holstein cattle, native cattle, sheep, goats, and camels in Al-Qassim, and surrounding regions were tested for bovine leukemia virus (BLV) antibodies for different animal species. Agar gel immunodiffusion was carried out using commercial diagnostic reagents. All samples of herds having positive cases with immunodiffusion were tested by ELISA. Positive cases were recorded among samples of the Holstein cattle ...

Arwa H. El -Naggar, Nirmeen G. Shafiek, and M. S. Wassel.

...: justify;">Hyper immune serum against bovine Rota was prepared in guinea pigs through its inoculation with complete and incomplete Freund's adjuvant and without adjuvant in successive doses into susceptible guinea pigs. Serum neutralization (SNT), ELISA and indirect fluorescent assay (IFA) tests were used to evaluate the hyper immune serum Before conjugation with fluorescent. The antibody...

Maria Kikelomo Adegun1*, Femi Godwin Ekundayo1, David Daisi Ajayi2 

...growth, haematology, and serum biochemical indicators of West African Dwarf (WAD) ram lambs, a study was designed that included cassava peels ensiled with urea (UTCP) and graded amounts of Gliricidia sepium fodder (GSF). Sixteen yearling WAD rams with an average weight of 12±1 kg was randomly assigned into four treatments (T1, T2, T3, and T4) in a ten-week trial. The rams assigned to T2, T3, and T4 were fed 90% UTCP+10% GSF, 80% UTCP+20% GSF, and 70% UT...

Estabraq Hayder Khayoon, Ammar Ahmed Abdulwahid*  

...tal antioxidant in blood serum and behavioral differences like Acrylamide greatly decreased the struggling and ascending time in the swimming test, dramatically lengthens the time needed to turn an animal’s head 180 degrees during a negative geotaxis test and decreased locomotors activity in the Y maze test. Curcumin’s anti-apoptotic, anti-inflammatory, and antioxidant properties have not been thoroughly examined in neurotoxicity given on by Acr...
Geeta Moolchandani1, Jaiperkash Moolchandani2*, Nasima Iqbal3
Syed Mohsin Turab4, Muhammad Kashif5 and Lubna Farooq6
...maternal age. Lowest the serum pH level, highest was the frequency of HIE risk factors. Prolonged 2nd stage of labor was significantly associated with lower neonatal weight, overall, very low and very high birth weight neonates were having higher frequency of HIE risk. To conclude the risk factors like insufficient antenatal care, high rates of maternal anemia, other maternal comorbid like history of hypertension, complications of delivery process and its mana...

Mathew O. Ayoola1*, Kayode Sasona1, Oluwakamisi F Akinmoladun2, Tolulope O. Faniyi3, Abel O. Oguntunji1, Tunde E. Lawal1

...cal parameters. Measured serum biochemical indices of rabbits were not significantly (p>0.05) affected by treatments. Rabbit carcass weight (kg) and dressing-out percentage (%) were significantly (p<0.05) affected by the main and interactive effect of housing with feeding systems. Overall, H3 and F3 had the best growth performance, carcass characteristics and physiological response (p<0.05) as compared to other treatment groups. The interaction effect...

Salema Lafta Hassan1*, Taghred Jabbar Humadai1, Sabrin Ibraheem Mohsin

...r immunization for work, serum samples were taken for passive hemagglutination test (PHA); Immunoglobulin G(IgG) detection using a chemical immunosorbent assay test. the outcomes of PHA test revealed that Folcord inhibited humoral immune response, with a considerable rise in antibody titer in the third and second groups, but decreased serum antibody levels in the first group. Furthermore, the (IgG) titer in

Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*

...asting insulin (FINS) in serum (all P < 0.05); levels of plasma fibrinogen (Fb) and D-dimers (D-D) in serum of patients in the hyperglycemia group were much higher than those in the hypoglycemia group, while serum plasma prothrombin time (PT) and activated partial thromboplastin time (APTT) were much shorter than those in the hypoglycemia group (all P < 0.05). Thrombus precursor prot...

Qing Cao1, Wei Jiao2, Huihui Lu1, Jing Zhang2, Meiling Ren3, Yan Xu1* and Shuyang Hu1*

...asting insulin (FINS) in serum (all P < 0.05); levels of plasma fibrinogen (Fb) and D-dimers (D-D) in serum of patients in the hyperglycemia group were much higher than those in the hypoglycemia group, while serum plasma prothrombin time (PT) and activated partial thromboplastin time (APTT) were much shorter than those in the hypoglycemia group (all P < 0.05). Thrombus precursor prot...

Xiangmei Chen, Burie Bao* and Mo Degema

...dramatically reduced the serum HbALc and GLUC3 content in hyperglycaemic rats. Dry CPP had a down-regulating effect on the levels of SGLT2 and GLUT2 protein, SGLT2 mRNA and GLUT2 mRNA in the kidneys of hyperglycaemic rats. However, there was no meaningful difference between the metformin group and the high- and medium-dose camel placenta groups. To conclude camel placenta has a notable hypoglycaemic effect on diabetic rats induced by STZ with a high-fat and hi...

Rehana Shahida1, Shagufta Naz1*, Tasnim Farasat1, Saima Sharif1, Shah Jahan2 and Farkhanda Manzoor1

...ke plasma glucose level, serum levels of insulin, thrombomodulin and IL-6 were measured by ELISA. The serum level of thrombomodulin was assessed as a measure of vascular damage. This study showed significantly elevated serum concentration of IL-6 and altered lipid profile in diabetes individual when compared with the control subjects. IL-6 and thrombomodulin was progressively higher in dia...

Irfan Ullah1, Asad Ullah2*, Tahira Tayyeb1, Rafiq Ullah1, Muhammad Hanif1, Faiza Khan3, Imad Khan2, Raheela Taj4, Fatima Syed4, Shumaila Gul5, Muhammad Sadeeq6, Muneeb Islam7, Arsalan Khan8 and Khudija Ghani9

... minutes at 1000 rpm for serum analysis and anticoagulant added tube for whole blood. The serum was stored at -20°C until further analysis. Biochemical parameters were measured through commercial kits. The result of the current study showed that the values of Alanine transaminase (ALT), Aspartate aminotransferase (AST) and Alkaline phosphatase (ALP) were higher significantly (P≤0.05) in negative control group (B) as c...

Moazama Batool1*, Saima Naz2*, Ghulam Abbas3, Ahmad Manan Mustafa Chatha4, Mamoona Mahmood1, Asma Aziz1 and Fatima Yasmin2

Zahid I. Mohammed

...eduction (P< 0.05) of serum total lipids in growing kids of the groups (2, 3 and 4) at the end of the experiment. Also, the kids were fed 10 grams of Spirulina supplement had the lowest serum cholesterol concentration as compared to the control and other groups. kids which were fed diets with Spirulina showed significantly (P<0.05) higher HDL-C concentrations in blood serum. Treatmen...

Tayfun Karatas1*, Betul Apaydın Yıldırım2 and Serkan Yıldırım3

... aminotransferase (AST), serum alanine aminotransferase (ALT) and malondialdehyde (MDA) levels, and reduction in superoxide dismutase (SOD), catalase (CAT) activities, glutathione (GSH), total immunoglobulin (T. Ig), and white blood cell (WBC) levels. Moreover, CMN exposure led to degeneration, steatosis, and necrosis in liver hepatocytes as well as hyperemia and inflammation in the liver and caused degeneration, desquamation, necrosis and adhesion in the gill...
Sijie Jian1,2,3,4, Wei Sun1,3, Jia Chao1,2, Na Rong1,4, Xiang Liu1,2,3,4* and Chen Chen1,2,3,4*
...sis showed that anti-Slp serum might provide cross-protection to resist bacterial infection in fish. Slp was obtained by molecular cloning, expression and purification, and the expression conditions were optimized. In mice immunized with Slp, the immune-related factors of LZM and AKP were enhanced (p < 0.05), and a specific antiserum titer (1: 3200) was obtained that had immune recognition effects for A. hydrophila and P....
Nusrat Bano1, Muhammad Tayyab1*, Bushra Muneer2, Sehrish Firyal1, Abu Saeed Hashmi3, Muhammad Wasim1 and Ali Raza Awan1
...ine levels and decreased serum levels of albumin, cholesterol, sodium, potassium and calcium were commonly associated with severe form of disease.

...

Shamsa Jabeen and Javed Iqbal Qazi*

...tions. Their increase in serum concentration have been used as indicators for muscle damage. The aim of the current study was to determine the effect of Lactobacillus rhamnosus administration on CK and LDH levels in the serum of mice following extensor digitorium longus (EDL) muscle grafting. Blood from the intact control as well as experimental and EDL muscle grafted mice was secured on day 3, 5, 7 and 14 post-transplantati...

Waseem Abbas1, Dildar Hussain Kalhoro1*, Hasina Baloch1,  Muhammad Abubakar3, Muhammad Saleem Kalhoro1, Neluma Wali2, Mazhar Hussain Mangi1, Azhar Ali Laghari4, Shahid Hussain Abro1, Rani Wagan1 and Mehkar Hussain5

...iments were conducted on serum of yak, zo and cow from Gilgit and Nagar districts of Gilgit Baltistan Pakistan. Seroprevalence and risk factors of brucellosis were recorded during this study. Confirmation of Brucella abortus in serum was carried out using Rose Bengal plate test (RBPT) and indirect enzyme linked immunosorbent assay (I-ELISA). Seroprevalence at district Gilgit was recorded 6.66% in cows and 6.66% in yak while ...

KAFEEL AHMAD1, NIMRA ARSHAD1, ZAFAR IQBAL KHAN1, KINZA WAJID1, HUMAYUN BASHIR1, IJAZ RASOOL NOORKA2, MAHPARA SHEHZADI3, HAFSA MEMONA4, MADIHA SANA4, KHALID NAWAZ5, MUDASRA MUNIR1, IFRA SALEEM MALIK1, TASAWAR ABBAS6, ABRAR HUSSAIN7, MUHAMMAD SHER8, MUHAMMAD FAHAD ULLAH6, MUHAMMAD AKRAM QAZI9, MUHAMMAD NADEEM10, MUHAMMAD RIZWAN QURESHI10

...entrifuged and the blood serum was separated which was then digested using acids. The atomic absorption spectrophotometer was then used to analyze the heavy metals in the digested samples. The results were analyzed statistically. Two-way ANOVA was used to find out variance and correlation in all samples. The nickel concentration found in the samples of soil, forage and blood was highest in the samples collected from site II (Chak 50 SB). The bio concentration ...

NAILA MALKANI*, IRFAN ISHAQUE, KHALID SHAHBAZ, RIZWAN ULLAH KHAN, ARIFA SHABBIR & ATIF YAQUB

... difference was noted in serum creatinine and urea values between the two groups. Histology of liver and kidney tissues revealed signs of chronic damage in the wild captured fish as characterized by lymphocyte infiltration and altered morphology of functional units. It is concluded from findings of the present study that farm-raised Labeo rohita were healthier and safer to consume compared to the wild-caught fish.

...

ZAHRA NASEEM1, MUHAMMAD AMIR IQBAL1, SHAAF AHMAD2 & NABILA ROOHI1*

HAFIZ MUHAMMAD ARSALAN1,2*, SUMMARA TABASSUM1, MUHAMMAD SHERAZ YASIN3, FAROOQ SALEEM4, ZEEMAL SEEMAB AMIN1, MUNIB ASHFAQ1, UMAR FAROOQ GOHAR5 & RASHIDA BASHIR6

...itamin C and Vitamin E), serum glucose level and Advance glycation end products (AGE’s) were estimated. The results showed that levels of the Malondialdehyde (0.087, 0.151 and 0.104 respectively), Advance glycation end products (0.026, 0.053, 0.025) and Nitric oxide (0.07, 0.438, 0.190) were found decreased while level of the GSH (0.184, 0.188, 0.207), CAT (0.087, 0.031, 0.091) and vitamin A (0.196, 0.136, 0.178), E (0.199, 0.140, 0.179) and C (0.163, 0....

Huda K. Khassaf1*, Zainab A.H. Al-Mousawi1, Sawsan A. Ali2, Anwar Nather Seiwan3

...ALA had higher levels of serum thyroxin T4, Free T3, and Free T4 than rats that did not get alA (p≤0.05). As well as decreased total bilirubin, Na+, and Ca+2 levels and increased K+ and Cl- levels (p≤0.05). Furthermore, ALA is an effective therapeutic medication that improves the histological characteristics of the thyroid gland noticeably. The results of this study indicated that supplementing with ALA improved blood thyroid profiles more than SAL did, ...

Youfang Li1, Xu Li2, Shaik Althaf Hussain3, Jayasimha Rayalu Daddam4 and Zhigang Chen5*

...re removed for urine and serum biochemical analysis, tissue anti-oxidant, miR-21 as well as morphological examination. We found that administration of Sodium oxalate induced induced oxidative stress, alteration in the serum as well as urinary biochemical alterations as well as spiked expression of miR-21. The alterations were reversed in all the treatment group especially EGCG and EGCG-Quercetin. The reversal potentials of c...

Dilruba Akter Mir1, Md. Sahidul Islam¹*, Mosammat Mahamuda Khatun1, Sharmin Zaman1, Bidyut Matubber², Nazmin Sultana Runa3, Zannatul Ferdous3, Tithe Saha3, Md. Anwar Jahid4  

...g period, a total of 419 serum samples (227 layers and 192 broilers) were randomly collected from apparently healthy, sick and recovered birds. The haemagglutination inhibition (HI) test was used to analyze the chicken sera samples for determination of the titer of the antibodies against NDV. The test results showed that the overall seroprevalence was 13.84% (n = 58/419). Layer chickens (17.62%) were more prevalent for ND than broilers (9.38%). However, a chi-...

Dilruba Akter Mir1, Md. Sahidul Islam¹*, Mosammat Mahamuda Khatun1, Sharmin Zaman1, Bidyut Matubber², Nazmin Sultana Runa3, Zannatul Ferdous3, Tithe Saha3, Md. Anwar Jahid4  

...g period, a total of 419 serum samples (227 layers and 192 broilers) were randomly collected from apparently healthy, sick and recovered birds. The haemagglutination inhibition (HI) test was used to analyze the chicken sera samples for determination of the titer of the antibodies against NDV. The test results showed that the overall seroprevalence was 13.84% (n = 58/419). Layer chickens (17.62%) were more prevalent for ND than broilers (9.38%). However, a chi-...
Muhammad Atif Raza1, Muhammad Tariq Javed2, Muhammad Fiaz1*, Muhammad Shakeel3, Muhammad Shahbaz Ul Haq2, Amna Kanwal2, Syeda Maryam Hussain1 and Muhammad Zubair Siddiqi4
... terms of immunological, serum biochemistry and lipid profile parameters. Broiler chicks (Age = 1 d and n = 90) were kept under uniform management conditions. Chicks were divided randomly into six groups on day ten of their age with 15 replicates in each; control negative (CN), control positive (CP) and four treatments (T1, T2, T3 and T4). Wheras challenge infection of Salmonella gallinarum was given on nineteen days of age to all experimental birds except of ...

Muhammad Shuaib1*, Abdul Hafeez1, Woo Kyun Kim2, Aamir Khan3 and Abubakar Sufyan4

...consistency, hematology, serum biochemistry, and intestinal morphometrics during peak egg production periods. A total of 160, 28-weeks old golden misri (brown) laying hens were distributed in the following groups. A basal diet of the corn-soybean meal was formulated as a control group and a soybean meal in the basal diet was replaced with 3%SH, 6%SH, and 9% SH respectively. The results of the feces proximate analysis showed significantly higher crude protein d...

Abeer Alahmari1,2*

...ed by markedly increased serum creatinine, urea, and uric acid levels along with histological changes, including shrunken glomeruli, necrosis, inflammatory cell infiltration, congestion, and edema. They also exhibited significantly elevated lipid peroxidation and oxidant radicals with decreased antioxidant parameters in renal tissue. In contrast, AME alone did not cause renal injury, and it was able to notably improve the toxic impacts of ethanol in the kidney...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

Fika Yuliza Purba1,4*, Andi Magfira Satya Apada1, Andi Ariyandy2, Irwan Ismail1,4, Subaedy Yusuf3,4

...d to Groups B and C. The serum concentration of albumin in Group A was significantly higher than in other groups, and the serum concentration of aspartate aminotransferase in Group D was higher than in the other groups. The serum concentrations of creatinine and blood urea nitrogen in Group A were significantly higher than in Groups C and D. In conclusion, hematological and biochemical pro...

Umair Ahmad1*, Asad Sultan1, Sarzamin Khan1 and Muhammad Tahir2

...on significantly lowered serum cholesterol (TG and LDL) while HDL was raised in GPP2 compared to the N-CON group showing a positive effect on lipid profile. Protein digestibility and AME were improved in the GPP2 group compared to N-CON. Gut health was improved in terms of better integrity, villus height, crypt depth, and villus surface area by birds in the GPP2 group. These findings demonstrated that adverse effects associated with using a high level of local...

Dio Fico Felsidan Diatmono1, Seraphina Kumala1, Pradita Iustitia Sitaresmi2, Stefani Winda Paramita1, Megawati Andi1, Yustina Yuni Suranindyah3, Diah Tri Widayati1*

...inal smear. The obtained serum from whole blood was immediately for total protein, cholesterol, glucose, and blood urea nitrogen (BUN) levels assay. The spectrophotometry method used for biochemical data using specifics enzymatic were used. Feed samples were analysed using proximate method to determine dry matter (DM), crude protein (CP), and total digestible nutrient (TDN) intake. The data results were analysed using Independent Sample T-Test and the correlat...

Hayder S. Rwayyih*, Tahani S.S. Al-Azawi

...in CPK, CRP and troponin serum level. Moreover, there is an increase in heart index (0.45% and 0.41%) as compared with none supplemented intact and ovariectomized groups (0.43% and 0.35%) respectively. The histological sections of the heart from the supplemented groups show no clear lesions with normal spindle shape cardiac muscle and intercalated disc with normal aorta and epithelial cells. From the other hand, the ovariectomized non- supplemented rabbits sho...

Minh Thi Le Bui1, Thanh Minh Le2, Thuan Khanh Nguyen1*

...The HI test measured the serum antibody level against the Newcastle disease virus. The results showed that A. fistulosum L. powder supplementation (10 g/kg) in the basal diet increased the antibody titer against, while chlortetracycline (10 mg/kg) in the basal diet had a low antibody titer against ND virus in chickens on 49 days of age. Feed intake and feed conversion ratio were similar among the five treatments. Weight gain was significantly different among t...

Muhammad Adnan Khalid1, Syed Makhdoom Hussain1*, Shafaqat Ali2,3*, Abdullah Ijaz Hussain4, Muhammad Asrar1, Nisar Ahamd5, Majid Hussain6 and Muhammad Zubair-ul-Hassan Arsalan7

...ls, body composition and serum antioxidant status of C. mrigala fingerlings except parthenium biochar. This study indicates that biochar could be used as supplement in fish diets to improve mineral status, carcass composition, and antioxidant activity. 
 
Novelty Statement | Our results show efficacy of various sources of biochar on the mineral status, body composition and antioxidant activity of f...

Saira Jabeen1, Muhammad Avais1*, Jawaria Ali Khan1, Kamran Ashraf2, Aftab Ahmad Anjum3

Shangmei Peng1 and Changhe Yu2*

... (4.90%, P>0.05). The serum creatinine, uric acid and urea nitrogen in the contrast-enhanced CT group decreased, while cystatin C and eGFR increased after the examination, with statistical significance (P<0.05). But there was no significant difference in creatinine, urea, urea nitrogen, cystatin C and eGFR between the two groups at the same time point (P>0.05). The incidence of eGFR 5 patients in the two groups was higher than that in other stages, an...

Md. Khayrul Basher1, Sumon Sarkar2,3, Md. Samiul Haque1, Sourav Sarker4, Md. Rashedul Islam1*

... result also showed that serum RBS, ALT (SGPT), Alkaline phosphatase, Total cholesterol, Triglyceride, and Uric acid levels were significantly (p<0.01) higher in the NaAsO2 exposed group. Arsenic exposure also led to a significant (p<0.02) decrease in the organ-to-body weight ratio in the spleen and slight discoloration and consistency of the liver and lung than the control group. It’s interesting to note that co-administration of sodium selenite m...

Liyun Chang1*, Yumei Cai1, Chenghui Li1 and Jianhua Qin2*

...as amplified by PCR, the serum IgG antibody was detected by routine ELISA, peripheral blood lymphocyte proliferation response was evaluated by cell proliferation assay. The results showed that a target band of 583 bp was obtained by PCR in DNA vaccine PLGA microspheres group at 7th, 14th, 21st, 28th, 35th day post-injection. No 3-1E gene target band was found in the control group and the naked plasmid DNA vaccine group. It indicated that plasmid pcDNA3-1E exis...

Haoneng Guo1,2, Shuangshuang Xiao3, Wenfang Lou1,2, Rifat Ullah Khan4, Juanjuan Wu1,2, Bo Huang2, Sifa Dai2,3* and Guanhong Li1*

... from the perspective of serum biochemical indicators. A total of 192 healthy 1-day-old broilers with no significant difference in weight, were randomly divided into four groups, each group with four replicates and 12 broilers per replicate. Group Ⅰ was a control group, the broilers were fed the basal diet, and the broilers in Group II, III, IV were fed a basal diet supplemented with 1.0% and 1.5%, respectively 2.0% Gln. The broilers were kept at 25±2...

Aya A. Saber1, Mohamed Fawzy2*, MokhtarM. EL-Tarabili2, Eman K. El Sayed2

...se was evaluated by beta serum neutralization test (SNT) and ELISA. BEF antibody titers were detected by SNT in the 1st-week post first vaccination as 6 (by detecting the endpoint of the serum that inhibit completely 100 TCID50) in the group 1 and 5.2 in a group 3. Group 1 and 3 SNT showed elevated antibody titers that reached the peak (128) at the 4th-week post-second vaccination and the 3rd-month post-second vaccination re...

Marah Salim Hameed1, Raad Mahmood Hussein Al Zubaidi2, Ali Ibrahim Ali Al-Ezzy3*

...) days for separation of serum. Serum cholesterol, triglyceride, total serum protein, albumin and globulin, total serum cortisol, total serum bilirubin, liver enzymes (ALT, AST, and ALP) were determined. Significant variation was reported in serum cholesterol between ethanolic extrac...

I Ketut Puja1*, I Nyoman Sulabda2, Ni Nyoman Trinayani3, Ni Wayan Patmawati3, Made Rahayu Kusumadewi3, Putu Bulan Sasmita Dewi3, I Wayan Sukernayasa4, Anak Agung Gede Oka Dharmayudha5, Putu Devi Jayanti5, I Wayan Nico Fajar Gunawan5 

Fatima Aziz Mahdi Al-Badry

... blood was collected and serum obtained in purpose of chemical examinations were included functions of kidney as (urea and creatinine) and liver enzymes (ALT, AST and ALP). After that, all rats were dissected then kidney and liver were eradicated for histopathological examinations. The results indicated to puma administration led to significant increase (P≤0.05) in urea and creatinine concentrations with significant decrease (P≤0.05) in ALT, AST and ALP ...

Dunia Tahseen Nema Al-Aridhi 

...nd lab results including serum acid levels and estimated glomerular filtration rate (eGFR) were gathered at the beginning. The participants were monitored for changes in these factors over time. The study consisted of 342 individuals. A reciprocal association was identified between eGFR and levels of uric acid. (p<0.001). The receiver operating characteristic curve (ROC) showed that serum uric acid predicted renal functio...
Naveed Hussain1*, Muhammad Arif Khan1, Asim Khalid Mahmood2, Muhammad Yasin Tipu3, Mamoona Chaudhry4, Hamad Bin Rashid1, Haroon Akbar5 and Abdul Aziz6
... parameters, hematology, serum analysis, bone biomarkers, mechanical assessment, radiographic evaluation and histomorphometry. We concluded that Bone-BMA combination showed best results in fracture healing and bone remodeling while Bone-PRP combination was below par than Bone-BMA but was superior to Bone-DFS combination. More clinical research may be required before widespread use of these regimens. Furthermore, it is paramount that veterinary orthopedic surge...

Farhatul-Ain Arshad1, Asia Bibi1*, Amna Mushtaq1, Rubaida Mehmood2 and Nahid Kausar1

...e in BMI, lipid profile (serum level of HDL, LDL, CHOL/HDL, HDL/LDL and LDL/HDL ratios) and endocrine profile (estradiol and insulin levels) between obese cases and obese controls. We have also observed a significantly lowerserum HDL, estradiol,  levels and HDL/LDL ratio compared to control groups. While CHOL level was significantly higher in obese cases than obese controls, the serum...

Ayoola Mathew Oluwaseyi1*, Aderemi Foluke Abimbola1, Alikwe Philip2 , Tumgbulu Samuel2, Eniufuoma Augustina2 

... feed additive. Measured serum total protein of the groups on ECLM were significantly (p<0.05) higher, while serum cholesterol were significantly (p<0.05) lower than those on control group. Birds on 1% and 2% ECLM inclusion had the best dressed weight which was significantly (p<0.05) higher than those on control. ECLM inclusion as feed additive increased populations of beneficial bacteria such as Lactobacillus spp. ...

Yaowu Zhan, Dandan Su*, Jinxiu Bai, Fang Li and Yulian Dong

...ical predictive value of serum amyloid A and C reactive protein in children with acute upper respiratory tract infection. A total of 324 children with acute upper respiratory tract infection (ARTI) who were treated in our hospital from October 2020 to April 2022 were selected as the research subjects. The variation of C-reactive protein concentration was tested by sphericity hypothesis, and the Greenhouse-Geisser method was used for in-depth analysis. The Rece...

Komal Hingoro1, Muhammad Saleem Chang1,2* and Ghulam Sarwar Gachal1

...antly highest and lowest serum levels of glucose were examined in Kachuga smithii and Pangshura tecta, protein in the species of Pangshura tecta and kachuga smithii, cholesterol in Nilssonia hurum and Chitra indica, urea in A. gangeticus and Chitra Indica, triglycerides in Nilssonia hurum and Chitra indica and uric acid in Pangshura tecta and Lissemys punctata, respectively. Finally, no significant (p< 0.5) differences were identified in the hematological a...

Mohammed Mijbas Mohammed Alomari1, Nawar Jasim Alsalih2*, Samir Sabaa Raheem2, Mohenned Alsaadawi2, Ali Mosa Rashid Al-Yasari3

...α-amylase in blood serum, erythrocytes, leukocytes, T- and B-lymphocytes, O-cells, and T-helpers. From this study concluded the treating sick dogs, positive changes occurred, which are characterized by an improvement in the general clinical condition , normalization of the concentration of hemoglobin in the blood, total protein, albumin, urea, creatinine, total bilirubin, circulating immune complexes, the activity of alanine, aspartic aminotransferases, ...

Hind A.Norii1, Adel M.Hassen ALZobidy2* 

...OS. Also, an increase in serum LH was observed in the PCO group and decreased in estrogen and progesterone was noticed. Additionally, an increased in the hormone testosterone and prolactin was noticed in the group of PCO. The ameliorative effect of extract of VAC was clearly observed at doses of 150 and 250 mg/kg bw on the release of estrogen and progesterone. Taken together, our findings illustrate that Vitex agnus-castus alcoholic extract impact the physiol...

Muhammad Shuaib1*, Abdul Hafeez1, Naila Chand1 and Muhammad Tahir2

... other hematological and serum biochemistry parameters were not affected and were in the normal range. It is concluded that the replacement of soybean meal in the diet of laying hens by 3% SH in combination with enzyme (β-Mannanase) at the level of 20mg/kg feed has a positive effect on the overall performance of laying hens during the early peak egg production period.

...

Yugang Meng1*, Xiting Yan2 and Haiying Liang3

...erellin on the levels of serum vascular endothelial growth factor (VEGF), anti-endometrial antibody (EMAb) and sex hormone in patients with endometriosis. Participants in the study, 92 patients with endometriosis admitted from June 2016 to May 2017 to our hospital, randomly were divided into control group and study group (46 cases in each group). The control group was given routine treatment such as medroxyprogesterone acetate tablet, and the study group was g...

Abdul Ghaffar1*, Kashfa Akram1, Habiba Jamil1, Riaz Hussain2, Ghulam Abbas3, Fozia Afzal4, Ahrar Khan5,6, Rabia Tahir7, Muhammad Ahmad Chishti1 and Shahnaz Rashid3

...atine phosphokinase, and serum minerals were notably reduced in exposed workers compared to unexposed counterparts. Prolonged pesticide exposure induces oxidative stress, evidenced by elevated production of free radicals and alterations in antioxidant defense enzymes. Comet assay analysis detected DNA damage in pesticide-exposed workers, correlated with increased age and duration of exposure. In conclusion, pesticides elicit oxidative stress and lead to hemato...

Tahani Ahmad Al-Matrafi1, Zuhair M. Mohammedsaleh2, Mamdoh S. Moawadh2, Waheeb S. Aggad3, Rawabi Mohamed almuhimed4, Zamzam Alhuwaymil5, Aishah E Albalawi6, Ifat Alsharif7, Hailah M. Almohaimeed8, Fatima S. Alaryani9 and Mona H. Soliman10,11*

...d total protein in blood serums), hepatic antioxidants (SOD, CAT, GSH, and GPx in liver homogenate), and inflammatory markers (IL-6, TNF-α, COX2), along with other liver biomarkers. Histopathological alterations in the liver were evaluated using Hematoxylin and Eosin staining. The leaf extracts effectively restored liver function indicators and hepatic antioxidants to normal levels, demonstrating a significant improvement compared to the elevated levels ...

Yibo Yan, Zhaohui Ding, Nanxin Liang, Kai Zhang, Lei Yue, Wengang Li* and Xianyi Song*

...oduction performance and serum metabolizes in weaned piglets. A total of 40 28-day-old weaned piglets (Duroc × Landrace × Yorkshire; half female and half castrated male) with 10 ± 0.30 kg of IBW were randomly assigned to 4 group (1 female and 1 castrated male/pen and 5 replicates/group). Piglets were consumed a basal diet, or the basal diet supplemented with 0.5%, 1.0%, and 2.0% SBP for 30 d, respectively. The results showed that the ADG, AD...
Nguyen Van Vui1*, Duong Hoang Oanh2, Nguyen Thi Kim Quyen1, Nguyen Thuy Linh1, Kim Nang1, Nhan Hoai Phong1
...ed between treatments in serum HDL and LDL levels. HDL levels increased and LDL levels decreased in the Spirulina supplemented groups as the concentration increased. Notably, the antioxidant capacity of the egg yolk increased with higher Spirulina concentrations (P<0.05). It was concluded that the addition of Spirulina to the drinking water of laying hens enhanced egg yolk color, increased the yolk’s antioxidant capacity, and improved

Desak Putu Mas Ari Candrawati*, I Gede Mahardika, I Gusti Nyoman Gde Bidura, Ni Wayan Siti

...d reduced cholesterol in serum by 24.79% compared to the control. Administration of 0.6% PPS significantly (P<0.05) reduced low-density lipoprotein (LDL) levels, while 0.2% PPS (P<0.05) reduced total cholesterol. Coliform and E.coli bacteria populations in broilers intestines had no significantly different effect (P>0.05) between treatments. This showed that the addition of 0.2% PPS to commercial rations could increase feed efficiency and reduce total...

Uzma Zafar1*, Zaima Ali1, Ambreen Tauseef2 and Saba Khaliq3

... syndrome and to compare serum adiponectin levels in its polymorphic genotypes. It was an observational study conducted at University of Health Sciences, Lahore. Study approval was granted by institutional Review/Ethical Board. Informed consent was taken from all the participants. The venous blood sample was taken after an overnight fast of 8-10 h. Blood was secured for DNA analysis and biochemical tests. Adiponectin rs266729(-11377 C>G) and rs1501299(+276G...

YP Arios1,2*, J Pamungkas3, IWT Wibawan3, D Iskandriati4, CS Tan5, SPH Rahman5

... total of 12 sera (8 cat serum and 4 dog serum), based on the results of the Surrogate Virus Neutralization Test analysis, formed antibody titers against SARS-CoV-2 in as many as four individuals (33.33%). The existence of protected antibody titers in dogs and cats can provide initial information for further studies.
 
Keywords | Antibody titer, COVID-19, Dogs and cats, SVNT
...

Ahmed J. Jaafer1*, Alaa K. Jassim1, Nidhal A. Hashim2 

... for 15 minutes, and the serum was stored at a temperature of -20 Celsius until use. Fasting glucose levels were measured using a spectrophotometer, and HBA1c and insulin levels were measured using Cobas e411. Lipid profile, their levels were measured using spectrophotometer. The results showed a significant increase in cholesterol levels in the case group compared to the control group with a normal body mass index. While cholesterol and LDL levels increased i...

Mohammed Haider Asker1*, Yahya Fawzi Hashim2, Huda Hamid Mohsen3

...s with no differences in serum CRP levels (0. 24 ± 0. 003 mg/dL), the animals in G4 showed aortic subintimal vacuolation points towards a modulatory effect also observed with CoQ10. These results clearly conclude that CoQ10 can ameliorate all the drug-induced side effects in the cardiac muscles and also points the directions for the future research on the potential benefits of CoQ10 in clinical settings.
 
Keywords | Coenzym...

Rawya Sh. Mohammed*, Baraa N. Al-Okaily 

... from anesthetized rats; serum was analyzed to assess levels of FSH, estrogen, TGF-β, and NF-κB. Additionally, ovarian tissue was extracted to measure levels of malondialdehyde (MDA) and superoxide dismutase (SOD) concentrations, and to estimate ovarian gene expression of PTEN. The findings indicated a notable decrease in tissue SOD, serum FSH, and estrogen levels, along with an elevation in tissue MDA,

Abdul Ghaffar1*, Ayesha Maqsood1, Riaz Hussain2, Ghulam Abbas3, Rabia Tahir4, Habiba Jamil1, Fozia Afzal5, Ahrar Khan6,7, Muhammad Ahmad Chishti1, Shahnaz Rashid3, Aliya Noreen8, Kashfa Akram1 and Maria Niaz1

...d in both EDTA tubes and serum vials. The purpose was to study the hematological, biochemical, and genotoxic potential in rural inhabitants exposed to pesticides. Samples were collected across different age groups and compared with those from 100 unexposed individuals. Demographic characteristics of the pesticide-exposed workers in the district were also observed. Hematological and biochemical parameters, including WBCs, RBCs, hemoglobin, HCT, MCHC, MCH, lymph...

Al-Moataz Bellah Mahfouz Shaarawy1, Mahmoud Yassin Mohamed1*, Mahmoud Sayed Sayah2,1, Ashraf Ali Mehany1, Ezzat Arafa Ahmed El-Beltagi1, Shimaa M. Ali1

...ighest concentrations of serum proteins, glucose, and lipid profiles. The 2nd group came next, and 1st group registered the lowest concentrations. In conclusion, data on GH and LP levels from birth to weaning could be a useful early-life selection tool for selecting high-performing individuals and predicting improved animal performance in the distant future throughout different ages (from 105 d to 540 d of age).
 
Keywords | Friesi...
Hussein Ali Naji1, Saad Hashim Al-Husseiny2, Zainab Abdul Hussein Saud3 and Wesssam Monther Mohammed Saleh1*
...gust 2021. In a total 78 serum samples of cattle aged from 2-5 years were analyzed with competitive enzyme – linked immunosorbent assay for Schmalleneberg virus. All the suspected animals suffered from many recurrent non-specific clinical signs such as dropping of milk production 78 (100%), loss of appetite 70 (89.74%), still birth 46 (58.97%), abortion 28 (35.89%) and malformation 4 (5.12%). The results of competitive ELISA technique indicated the 66 (8...

Emad M. Gad1, Haidy G. Abdel-Rahman2, Mohy Eldin Abd-El-Fattah1, Merna M. Kamal1, Ahmed Shaker Eltahan3, Amina A. Dessouki3*

...ted considerable rise in serum glucose, urea, creatinine, KIM-1, β2-MG, TNF-α, and TGβ1 levels compared to control rats, while treated diabetic ones manifested significant decrease in these measures in contrast to the untreated diabetic rats. Also, renal tissue IL-6, NF-κB and NADPH oxidase manifested significant (P≤0.05) increase in untreated diabetic rats, while treated groups revealed significant decline in comparison to the untreat...

Aya Salah Eldin Mohamed1*, Gamal E. Shams1, Gihan G. Moustafa2, Reda M. Abd El-Aziz3

..., malondialdehyde (MDA), serum hormonal and sperm parameters, and histopathology of testes were measured. The obtained results were exposed to one-way analysis of variance followed by post hoc Tukey’s test to assess the statistical significance of data between different groups. The results revealed that oral treatment with citalopram for 60 days ensued significant (p<0.001) upsurges in the levels of luteinizing hormone (LH), and follicle-stimulating h...

Tamadhur H. Hussein, Layth H. Merzah, Tahreer M. Al-Thuwaini* 

Sana Eijaz, Asmat Salim* and Mohammad Anwar Waqar

...so restored the level of serum adiponectin and leptin. Our data suggests that the antidiabetic activity of these herbs may be due to the action on insulin signaling genes and adipokines level along with the normalization of blood glucose and body weight. These herbs may offer a safe and economic strategy and has nutritional significance for the cure and prevention of type 2 diabetes.

...

Hina Abrar1*, Hina Yasin1, Hira Naeem2, Rabia Bushra1, Shaukat Mahmood2 and Kaneez Fatima3

...sely, the lower level of serum ALT, ALP, γGT and BRB were found when administered PRL with PHY (p<0.005). Prominent change in hepatic cells structure and diameter of nucleus were observed (p<0.05). Severe hepatic damage reflected by necrosis, hemorrhage and dilation of sinusoids, inflammation with dilation and congestion of portal vein were obvious in PHY treated group. Combination treatment of PHY with PRL showed normal liver function and identica...

Efi Rokana1*, Zein Ahmad Baihaqi1,2, Khoirul Wafa1, Kalvin Putra Wahyudatama1, Ferdian Ginanjar1, Rini Mastuti3, Amiril Mukmin1, Miarsono Sigit4 

...lyzed for hematology and serum chemistry in a laboratory. The results did not show significant differences in productivity parameters (feed consumption, average daily gain, feed conversion, and income over feed cost) between control and beer waste fed groups. Health parameters, including hematology (hemoglobin, erythrocytes, leukocytes) and blood chemical parameters (total protein, blood urea nitrogen, creatinine), remained within normal ranges in all beer was...

Layth H. Merzah, Tamadhur H. Hussein, Tahreer m. Al-Thuwaini*

Aamir Khan Awan1, Nighat Sultana1*, Rahmat Ali Khan2, Rifhat Sultana3
Umm-e-Kalsoom1, Fayaz Ahmed Sahibzada4, Rifat Ullah Khan5, Naimat Ullah Khan6, Nazir Ahmad Khan7, Syed Haider Zaman8, Mir Sadiq Shah9 and Assar Ali Shah10*
... aminotransferase, urea, serum creatinine and total proteins were significantly (P<0.05) decreased in response to oral dosing of three varieties of P. granatum peel methanolic and aqueous extracts which were comparable to healthy control. Moreover, the aqueous extracts and wild P. grantaum were more effective than methanolic extracts and other species against hyperglycemia and biochemical profiles of treated rats. It was concluded that the extracts of peels...

Abd El-Alim F. Abd El-Alim1, Abdelhakeem El-Murr2*, Tahsein Hasan1

...respectively. Meanwhile, serum protein and hematological parameters enhanced in T1, T2 and T3 in comparing with positive control. The glucose and cortisol levels were 84.67 ± 2.97 mg/dL and 9.16 ± 0.89 ng/mL in positive control and significantly reduced in SME treated groups T1 (79.36 ± 2.65 mg/dL and 7.56 ± 0.85 ng/mL), T2 (78.89 ± 2.16 mg/dL and 5.79 ± 0.93 ng/mL) and T3(77.28 ± 3.11 mg/dL and 4.87 ± 0....

Adham Omar Mohamad Sallam1*, Ashraf Abd El-Hakem Ahmed El-Komy1, Enas Abdulrahman Hasan Farag2, Samar Saber Ibrahim3

...d the elevated levels of serum alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, urea, and creatinine caused by Meloxicam toxicity. Additionally, oxidative stress markers such as malondialdehyde (MDA) were significantly reduced, while antioxidant enzymes like superoxide dismutase (SOD) and catalase (CAT) showed marked improvement in the GSE-treated groups (p ≤ 0.05). Histological and immunohistochemical analysis confirmed these fin...

Dalia Hamid Mansour1, Mohamed Elshabrawy Ghanem2, Marwa Hassan3, Yousry Ibrahim4, Ibrahim M. Hegab5*

...rcass and organs weight, serum chemistry including albumin, total protein, alanine transaminase, aspartate aminotransferase, alkaline Phosphatase, gamma-glutamyl transferase, urea and creatinine as well as examining the histological alterations in internal and lymphoid organs and bacteriological analysis of cecal bacterial count. One hundred and five chicks were divided into 3 groups, Group A, in which chicks (n=35) was vaccinated and taken Biocid® for the...
Wenfang Lou1,2, Wenhao Wu1, Haoneng Guo1,2, Shuangshuang Xiao3
Rifat Ullah Khan4, Xianhua Zhang 1, Guanhong Li2 and Sifa Dai 1*
...e peroxidase (GSH-PX) in serum and jejunum, GSH-Px in duodenum of group II, the CAT and GSH-Px activities in ileum of group III, the GSH-PX and total antioxidant capacity (T-AOC) activities in jejunum in group IV were increased (P < 0.05). The malonic dialdehyde (MDA) content in serum was decreased (P < 0.05). On day 14, the jejunum CAT and superoxide dismutase (SOD) activities in group II were increased (P < 0.05),...

Manar Mousa Alhussein*, Eman Faisal Albghdady

...estosterone and estrogen serum concentrations using competitive ELISA kits. The scrotum was dissected, the epididymis detached from the testis, and the weight and length were taken, then divided into three divisions (caput, corpus, and cauda) for histopathological study. HandE staining was used to detect general structures and histopathological changes. Special stains are used to detect collagen fibers, and mucopolysaccharide. The treated group (G2) shows a si...

Y. Eid1, S. Abo El-Sood1, A. Fawzi1, W.A. Morsy2* and H. Mehany3

...ondialdehyde contents of serum, meat, and liver were significantly decreased with increasing fish oil levels in diets. It may be concluded that the inclusion of fish oil up to 1% of growing rabbits’ diet enhanced the growth performance and improved their physiological status without any harmful effects on liver and kidney functions, under Egyptian environmental conditions.

...

Thaer W. Enad*, Khalefa A. Mansour

... test, which was used on serum samples for antibody detection. Genetic analysis revealed a close genetic relationship between the Iraqi SAT2 isolates and the Egyptian strains, suggesting a possible transmission route. This study outlines an increased risk of disease from SAT2 form and significant biosecurity challenges to Iraqi livestock, indicating requirements for focused at-risk surveillance and control efforts.
 
Keywords | Buf...

Moh Sofi’ul Anam1, Ali Agus1, Budi Prasetyo Widyobroto1, Gunawan2, Andriyani Astuti1*

...nd centrifuged to obtain serum. The serum was then used to assess blood biochemistry parameters and T-AOC with an automatic biochemical analyzer and a commercial kit. The findings showed no significant changes in the levels of AST, ALT, total protein, glucose, BUN, triglycerides, cholesterol, HDL, LDL, or creatinine (P>0.05) due to supplementation. However, the SUP group showed a significant increase in WBC (41.50%), lymp...

Heni Suryani1, Sri Novianti2*, Fatati2, Jul Andayani2, Saitul Fakhri2, Muhammad Ambar Islahudin3

...for 48 hours in a 120 ml serum bottle. Gas production was measured at intervals of 2, 4, 6, 8, 10, 12, 16, 20, 24, 36, and 48 hours. Rumen fluid was also collected to calculate the population of protozoa at 4, 24 and 48 hours. After incubation, the residue was used for determining dry matter and organic matter degradability (DMD/OMD), while the supernatant was analyzed for pH, VFA, NH3, and protozoa concentration. Data were analyzed using ANOVA, Differences be...

Nguyen Phi Bang1,2*, Nguyen Thi Hanh Chi1,2, Ngo Thuy Bao Tran1,2, Nguyen Thi Bich Hanh1,2, Nguyen Ba Trung1,2, Le Thi Thuy Hang1,2

...nce of antibodies in the serum and compare factors related to the dogs’ natural characteristics (age, gender) and other factors, such as dog management, regional characteristics, and vaccination timing. The study assessed the effectiveness of rabies vaccination in dogs by analyzing data from owners, health records, and serum samples. ELISA tests measured antibody levels, and statistical analysis, including chi-square a...

Mariam Ismail Ali1*, Rania Helmi Abdou1, Mary Ayad Sargious2, Omnia Mohamed Khattab2, Kawthar Abdelwahed Elhady1

... significant increase in serum creatinine, urea, and histopathological lesions in the kidney of cd-treated rats. Bee venom showed nephroprotective effects, decreasing serum creatinine and urea by 16.9% and73.4% respectively and also improving histopathologic lesions in the kidney. Also, the neuroprotective effect of bee venom appeared in the improvement of the histopathological lesions in the brain.
 
...
Chang Guoliang1,2*, Pan Zhengjun1,2, Zhu Chuankun1,2, Zhao Haitao1,2
Yan Zhang3, Summaya Rajput4 and Laghari M. Younis4*
...) in the hepatopancreas, serum and muscle were determined. The maximum final weight gain rate (WGR) and standard growth rate (SGR) observed with Diet# 4, showed average increases of 52.51±7.91 and 0.70±0.086 g, respectively. This result suggests that the SGR and WGR of prawns fed a diet containing 0% SO were higher than those of the other experimental groups. Furthermore, the survival rate also increased by decreasing the SO level in the feed con...

Kai Wang, Weifeng Xu, Pengyuan Dai and Chunmei Li*

...ignificant change in the serum malondialdehyde (MDA), hydrogen peroxide (H2O2), superoxide dismutase (T-SOD), alanine aminotransferase (ALT) and aspartate aminotransferase (AST). Meanwhile, the mRNA expression of HO-1 and NQO1 in liver tissue was also not significantly different. These results indicate that PNP may damage liver tissue through oxidative stress. Arg may improve growth performance and attenuate PNP-induced liver inflammation in healthy animals, b...

Sherine Abbas1, Hadeer M. Shosha2, Hala M. Ebaid2, Heba Nageh Gad El-Hak2, Heba M. A. Abdelrazek3*

...ical parameters of blood serum (ALT, AST, albumin, total protein urea, uric acid and creatinine), as well as in the histopathological changes and immunohistochemical expression of tumor necrosis factor (TNF) in liver and caspase-3 in kidney tissues were observed when the pregnant rats exposed to CO especially the high dose that were significantly altered than the low dose CO. These findings suggested that a higher dose treatment of CO to the mother can lead to...

Sherine Abbas1, Heba M.A. Abdelrazek2*, Eman M. Abouelhassan3, Nayrouz A. Attia4, Haneen M. Abdelnabi4, Seif El-Eslam E. Salah4, Abdelrahman M. Zaki4, Mohamed A. Abo- Zaid4, Nadia A. El-Fahla5

...ion (P<0.05), reduced serum TAC levels statistically (P<0.05), and affected DNA and lymphoid tissues evidenced by increased (P<0.05) immunohistochemical expression of IL-6, NFKB and TNF-α in addition to induced spleen and thymus histopathological alterations. The study concluded that methanolic neem leaves extract has a cytotoxic effect that affects the histo-architecture of lymphoid organs, promoted inflammatory markers and the mononuclear cell...

Bassant Mahmoud Emam1, Jehan Abd Elrazek Hassanen1, Abeer Gaffer Ali Hassan3, Azza Mahmoud Abdullah1, Hadeer Said Aboelnaga2, Amina Ali Dessouki2*

El-Sayed I. Hassanein1, Abdallah E. Metwally1, Hossam Eldin M. Abd Elbaky1*, Walaa Fathy Saad Eldin2

...iochemical parameters of serum, total antioxidant capacity, intestinal morphology, mortality percentage, and estimates of economic efficiency. Over the course of the five-week trial period, 150 (Ross 308) one-day-old chicks were separated into five groups, each consisting of three replicates (10 chicks/replicate). The chicks were fed five different experimental diets with varying quantities of oil (0% oil, 1 (SBO and 1% LO), 2% LO, and 3% LO, respectively). Fo...

N. M. Abed 

...had significantly higher serum levels. Our investigation concludes that propolis has a significant impact in safeguarding against hypothyroidism and gonadotoxicity generated by NiCl2 and/or CCl4.
 

...

Jaafar Haider Abd Alrudah1, Nada Fadhil Abbas2*, Farah Ali Hadi1, Haider Tuma Kaab3 

...es in the pigeons’ serum. Candida albicans was isolated from birds infected with Candidiasis using CHROMagar Candida and diagnosed microscopically to detect the presence of pseudohyphae and true hyphae. Many microscopic examinations, such as germ tube tests, were performed to accurately diagnose the species of Candida. The identification was confirmed using PCR targeting the ITS gene region. Live attenuated antigen was prepared using sonicater devic...

Muhammad Waqas1*, Razia Bashir1, Khadija Munir1 and Muhammad Arshad2

...e performed, focusing on serum creatinine and urea levels to provide a nuanced understanding of renal function. The findings revealed a higher prevalence of beta-thalassemia in the 11-20 years age group, emphasizing the critical role of adolescence and early adulthood in the manifestation of this genetic disorder. Family history emerged as a significant factor, with patients having positive family histories showing a higher prevalence. Caste-based analysis hig...

Abdul Ghaffar1*, Maria Niaz1, Ghulam Abbas2, Riaz Hussain3, Fozia Afzal4, Habiba Jamil1, Ahrar Khan5,6, Rabia Tahir7, Muhammad Ahmad Chishti1, Shahnaz Rashid3, Shahzad Ali Gill8, Aliya Noreen9, Ayesha Maqsood1 and Kashfa Akram1

...matological analyzer and serum collected in this study was use for different biochemical tests. Hematological parameters including HGB, RBCs count, hematocrit, MCV, MCHC, monocytes, lymphocytes, neutrophils and eosinophils vary in different diseases in the exposed and unexposed workers. The percentages of occurrence of certain diseases were high in exposed group than the unexposed groups. Biochemical parameters ALT, AST, LDH, CPK, ALP, Creatinine, urea, lipid ...

Jian Bai1, Xiyuan Dong1, Longjie Gu2, Jianhua Wang3 and Chen Gong3*

...to assess the effects of serum Immunoglobulin G (IgG) on secreted norepinephrine (NE) amounts and norepinephrine transporter (NET) expression in sympathetic neurons. The purified serum IgG from the patient group Control, CP/CPPS+ED, CP/CPPS and ED was administered to cultured superior cervical sympathetic ganglions from nude mice, and secreted NE was quantitated by radioimmunoassay. Quantitative real-time PCR and Western blo...
Qurat-ul-Ain1*, A. Ahmad2, Farhat Nazir Awan3, M. Rabbani1 and M. Hassan Mushtaq4
... Punjab, a total of 1000 serum samples from 100 dairy herds were collected and the sero-prevalence was estimated using an Ab capture ELISA assay. Inactivated BVDV vaccine was also prepared using local isolate (MK084980) and tested for induction of humoral immune response in comparison with commercial vaccine in experimental cattle calves. Calves of group A (n=5) and B (n=5) were vaccinated with self-prepared and commercial vaccines respectively followed by boo...

Ozdan Akram Ghareeb1*, Goljameen Midhat Abdulla1, Sanaz Sheikhzadeh2

...g that, each rat’s serum was taken for the required biochemical assays, and its liver was removed to assess oxidative stress markers. Comparing treated versus untreated rats, the results showed that AS exposure significantly raised malondialdehyde levels in liver tissue while clearly inhibiting the level of total antioxidants. Furthermore, a time-dependent significant increase in serological concentrations of hepatic enzymes and pro-inflammatory cytokine...

Dheyab D. Radhi1*, Rasheed H.A. Al-Aidi2, Ali Ahmed Khalaf 3

...ST, and glucose in blood serum was also observed.
 
Keywords | Iraqi sheep, L-carnitine, Sperm quality, Sexual ability
...

Maryam Ali Mohammed, Ahlam A. Al-Rikaby*

...ermined by measuring the serum zinc level after 24 hrs from 1,10 phenanthroline injected. After treatment ,animals were distributed into four groups, 1st group healthy rats acted as negative control treated with physiological saline solution(1ml), 2nd group carried zinc deficiency as positive control treated with physiological saline solution, 3rd group zinc deficiency rats were treated with zinc sulfate 20mg/kg dissolved by physiological saline solution; 4th ...

Hasan Muwafaq Ali*, Raed Hussain Salih Rabee

...y was performed in blood serum to determine immunity. First-day of measurements, ELISA titer was similar across research groups. Significant changes were seen 30 days post-intervention, with MEVAC leading (883.17 ± 173.94). At 50 days post-intervention, MEVAC group had the highest level (2767.33 ± 445.10). At 70 days post-intervention, MEVAC group had the highest level (3269.00 ± 244.67). At each time point assessed, the MEVAC group had th...

Svetoslav Farafonov1, Olha Yaremko2, Mykola Verkholiuk2, Lesja Muzyka2, Bohdan Gutyj2, Oleh Marenkov3, Vadym Lykhach4, Tetiana Nemova4, Olena Khmelova5, Roman Mylostyvyi5*

...levels in hair and blood serum in animals. The experiment was conducted on 3-year-old cows of the Ukrainian beef breed raised in the same biogeochemical region. The methodology included determining trace elements in hair samples taken from various body areas and in blood serum using electrothermal atomic absorption spectroscopy (ET-AAS). The study revealed significant differences in the concentration of trace elements in hai...

Muhammad Mudasir Mushtaq1, Safdar Hassan1, Muhammad Sharif1*, Arfan Asghar2, Fawwad Ahmad1, Muhammad Khalid Bashir3, Muhammad Ashraf1, Mukarram Bashir1, Tahreem Fatima4, Muzammal Mushtaq5 

...s, antioxidant activity, serum minerals, and bone mineralization in layers. A total of 160 white commercial laying hens, aged 37 weeks, were distributed into four treatment groups with 5 replicates and 8 hens per replicate. The experimental duration was 8 weeks. The basal diet was supplemented with 0, 0.125, 0.250, and 0.375% humic acid. Blood samples were collected from the wing vein at the beginning and end of the trial. Blood parameters (CBC, LDL, HDL, AST,...

Journal of Animal Health and Production

November

Vol. 12, Sp. Iss. 1

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe