Submit or Track your Manuscript LOG-IN

Muhammad Arif1, Fazal Jalal1, Mohammad Tariq Jan1, Dost Muhammad2

... legumes produced taller plants and high number of grains ear-1. Nitrogen application increased plant height, number of grains ear-1, thousand grains weight, grain and biological yield. It is concluded that integration of biochar and legumes could be a useful strategy for enhancing the overall farm profitability and productivity of cereal-based systems by providing increased yields from this additional ‘summer gap’ crop.

...

Hayat Badshah1*, Farman Ullah1, Abid Farid2, Ahmad-U-Rahman Saljoqi1, Sajjad Ahmad3

...idae), on different host plants. Such studies would identify the best host plant for its efficient rearing. The present study investigated some basic life table parameters i.e. female life span, adult female weight, longevity and reproductive potential of P. solenopsis on okra (Abelmoschus esculentus Linn.), brinjal (Solanum melongena Linn.), potato (Solanum tuberosum Linn.), China rose (Hibiscus rosa-sinensis Linn) and tomato (Lycopersicon esculentum Mill.). ...

Muhammad Nawaz Kandhro*, Habib-Ur-Rehman Memon, Muhammad Ali Ansari, Ahmed Naqi Shah

...between two rows of crop plants was pulverized with the help of local tool spade. The statistical analysis of data showed that interculturing, Dual Gold, and sorghum and sunflower water extracts caused significant reduction of weeds and increased seedcotton yield as compared to weedy check. The combined application of sorghum @ 15 L ha-1+ Dual Gold @ 1.25 L ha-1 resulted in weeds mortality upto 66.6%, produced seedcotton yield of 3961.4 kg ...

Luca Vitale

...d productivity; however, plants are able, to some extent, to cope with limiting environmental conditions by means of different mechanisms that contribute to their adaptive success in different habitats.

...

Claudia Kohl*, Andreas Nitsche, Andreas Kurth

Email: kohlc@rki.de

...ude all the fish, ducks, plants, fungi, bacteria and everything else that belongs to the lake. If we apply this approach to clinical samples we can identify the community of etiological pathogens, without any knowledge on the targets in advance. However, clinical specimens usually comprise an overwhelming amount of host nucleic acids, which by far exceeds the number of pathogen nucleic acids in the sample. Subsequently, it is necessary to either decrease the a...

Mudasir Irfan Dar*, Fareed Ahmad Khan and Farha Rehman

E-mail | irfanmudasir@gmail.com

...gated. Forty-day-old pot plants were exposed to different concentrations of the insecticide, ranging from 0 to 40 grams active ingredient per hectare (g.a.i ha-1) through foliar spray. Analyses were done at days 3, 7, and 15 after treatment. Lipid peroxidation rates and contents of proline, ascorbate (ASC), glutathione (GLU), antioxidative enzymes; superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX) and glutathione reductase (GR) were assess...

 Nagina Zeb, Muhammad Sajid, Abdul Mateen Khattak and Imtiaz Hussain

...of maleic hydrazide, the plants grown under control treatment took minimum days (112.9) to flowering, maximum plant height (47.06 cm) and number of leaves (57.89) plant-1. Maximum fresh flower weight (47.85 g) and dry flower weight (5.80 g) was observed with 1500 ppm maleic hydrazide. The interaction between “potassium” and “maleic hydrazide” showed significant effects for some of the growth parameters. It can be concluded that potassiu...

Ali Mohammadi, Mohammad Hossein Ebrahimi

... available and applied implants, none of them was evaluated by motion analysis system. It has been shown that severity of pain and overall function of knee joint were improved following the use of this implant. Although it has been mentioned that KineSpring knee implant is an effective method to relieve pain and improve function in Knee OA, there are incomplete evidences to support this claim. Therefore, it is recommended to perform high-re...

Rongfei Lu1, 2, Zhiyang Liu1, Peng Fang1, Guangyi Chen1, Feng Sun1, Yongjian Fan1, Yijun Zhou1, Tong Zhou1*

Khalid Ali1*, Amanullah Jan2

...g, DAS) and parts (whole plants incorporation and stubbles incorporation) under varying nitrogen levels (0, 75 and 100 kg ha-1) on physiology, yield and economic returns of Canola (Brassica napus L. cv. Bulbul-98). The experiments were laid out in randomized complete block design with split plot arrangement having three replications. Findings of the experiment revealed that guar as previously green manuring crop considerably increased leaf area index (LAI) 4.4...

Murad Ali Khan and Mohammad Akmal 

...rows spaced at 70 cm and plants spaced within the rows at 20 cm and (b) 90 x 15.5 cm with rows spaced at 90 cm and plants spaced within rows at 15.5 cm. It is important to mention here that 70 cm is the recommended row spacing used for sunflower crop in the region. Experiments were conducted in randomized complete block design, replicated four times. Results showed no significant changes in yield traits i.e. plant density (m...

 Muhammad Nawaz Kandhro, Qamaruddin Jogi, Mahmooda Buriro, Aijaz Ahmed Soomro, Ghulam Mustafa Laghari and Ali Nawaz Khaskheli

 

...lelopathic properties of plants is thought to be an effective and environment-friendly approach for weed management. A pot experiment to evaluate the allelopathic potential of leaves of Eucalyptus camaldulensis (L.) against Convolvulus arvensis (L.) and Cyperus rotundus (L.) was undertaken during summer 2011. The study was conducted at Department of Agronomy, Sindh Agriculture University, Tandojam, Pakistan. The experiment was laid out in three replicated comp...

Sayeda Sarah and Muhammad Ibrar

...he soil of control (RP0) plants, which decreases progressively with increasing fertility level. Less number of spores and percent root colonization was found at high RP level (RP100) in all hybrids. Higher P doses declined the sporulation and colonization. There was total seven AMF species that were observed and recorded. The dominant genus was Acaulospora which was followed by Glomus, Sclerocystis and Gigaspora. The average AMF spore density ranged from 56-26...

Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek

...and giving vigour to the plants. In laboratory experiment, L. muscarium was the most effective against nematode eggs (95.6%) and second stage juveniles (J2) (95.8%) infection. In greenhouse experiment, similar trend was found. L. muscarium proved to be more effective against M. hapla whereas S. rugosoannulata and C. rosea showed better results among other tested fungi in experiments. Moreover, plant growth parameters were als...

Manzoor Hussain*, Miloslav Zouhar and Pavel Rysanek

... of L. muscarium treated plants was documented minimum as compared to that of control but slightly higher compared to that of treated with nematicides. More interestingly, plant growth parameters including shoot and root were tremendously improved in L. muscarium treated plants than that of other treatments.

...

Felwa A. Thagfan1, Mohamed A. Dkhil1,2* and Saleh Al-Quraishy1

...one of the commonly used plants in Islamic countries.The root extracts of S. persica has been tested for its anticoccidial activity against Eimeria paillata induced infection in mice jejunum. Three different doses, 300, 600 and 900 mg/kg were used after infection of mice with sporulated oocysts. A dose of 300 mg/kg reduced the number of oocyst output in mice faeces by about 56.8 % and also improved the body weight. In addition, the root extract d...

Safdar A. Wahocho, Tanveer F. Miano, Noor U.N. Memon and Niaz A. Wahocho

... RCBD design. The zinnia plants were grown under four photoperiodic treatments which included T1=Natural photoperiod (Control), T2=4 hours daylight (8 am -12 noon), T3=6 hours daylight (8 am – 2 pm) and T4=8 hours daylight (8 am – 4 pm). The results revealed significant (P<0.05) photoperiodic effect on all the growth and quality traits of Zinnia. The Zinnia grown under 8 hours daylight (8 am – 4 pm) with 38.29 cm plant height, 6.61 side b...

Ai Ming Zhou1,2, Guang Wen Liang2, Ling Zeng2, Yong Yue Lu2 and Yi Juan Xu2*

...oraging activity both on plants and the ground. Ant diversity in fire ant-infested plots was significantly reduced compared with in fire ant-free plots. Compared with in the no-ant plots, the colony growth rate of mealybug significantly increased, and the parasitism of mealybug was obviously decreased, both in fire ant-infested plots and in fire ant-free plots. Colony growth rate of mealybug in fire ant-infested plots was greater than fire ant-free plots. Thes...

Sadiq Hussain, Muhammad Sharif, Sarmad Khan, Fazli Wahid, Hina Nihar, Wiqar Ahmad, Imran Khan, Nadeem Haider and Tabassum Yaseen

Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

...igher in the non-treated plants than those that were treated. The root quality of the fungus-treated plants was significantly improved. All fungi conclusively proved to be effective against H. schachtii and need to be further investigated at the molecular level.

...

Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

.../Pi) was observed in the plants treated with L. muscarium compared to the control. However, all chemical nematicides were also effective in reducing the nematode infestation significantly (P=0.05) in soil compared to the control, but there was no significant difference (P=0.05) among them. Plant growth was significantly (P=0.05) improved in the plants treated with L. muscarium.

...

Zafar Waheed, Khalid Usman, Iftikhar Ali

...wheat + Rumex dentatus 0 plants m-2 (T1), wheat + Rumex dentatus 05 plants m-2 (T2), wheat + Rumex dentatus 10 plants m-2 (T3), wheat + Rumex dentatus 15 plants m-2 (T4), wheat + Rumex dentatus 20 plants m-2 (T5), wheat + Rumex dentatus 25 plants m-2 (T6), and wheat + Rumex dentatus ...

Iram Liaqat1*, Najma Arshad2, Muhammad Arshad3, Safdar Ali Mirza4, Nazish Mazhar Ali1 and Ammara Shoukat1

Sidra-Tul-Muntaha1, Muhammad Sagheer1*, Mansoor-ul-Hasan1 and Shahbaz Talib Sahi2

Zamarud Shah, Safdar Hussain Shah, Asad Jan and Gul Shad Ali

...egulating heat stress in plants. Tobacco (Nicotiana benthamiana) was transformed with heat shock transcription factor HsfA1d by transfecting leaf discs with Agrobacterium strain GV3101 carrying CaMV35S-YFP::HsfA1d construct. After PCR and confocal-based confirmation, HsfA1d overexpression lines (OX1, OX2 and OX3) were evaluated for their response to heat stress. Overexpression lines on average showed 33.26% less electrolyte leakage after induction of heat str...
Eman Mahmoud El-Diasty1,Madeha Abd El-Halim Ibrahimand Ghada Kamal El Khalafawy2,*
...m two poultry processing plants represented broiler carcasses swabs and worker (hand swabs and nail scrapings). Phenotype-based methods for identifying yeast especially Candida species are often difficult, time-consuming and not enough to identify most yeast species. . Molecular biological techniques provide a useful alternative approach. Concerning with genotypic identification, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was...
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
... M. incognita. Eggplants inoculated with nematodes only served as control. Each treatment was replicated tenfold. Data were recorded after one week interval up to five weeks to record different developmental stages of M. incognita. After each harvest, neemex in combination with G. mosseae proved the most effective as the development of nematode was adversely affected. Developing juveniles and adults were less in number in the combined trea...
Fazal Said1,Mian Inayatullah2 and Hussain Ali3*
...ng due to less number of plants with blooms and less availability of pollens and nectar on flowers. Maximum seed production as well as oil contents was obtained from sunflower plots kept under natural conditions, where bee visitors had access to sunflower blossoms. In contrast, sunflower plots covered with insect-proof bags gave minimum seed production and oil contents, which most probably was because of bee visitors denied to forage on flowers of the crop. Re...
Waqar Islam*1, 2, Madiha Zaynab3, Muhammad Qasim2 and Zujian Wu1,2
...le natural resistance in plants against viral threats. The review aims to explain the molecular mechanisms involved in triggering the antiviral resistance in plants. Antiviral RNA silencing, R-gene mediated resistance and host factor related recessive resistance are categorized as most beneficial plant defense approaches used by plants. The review also briefly explains about introgression ...
Zafar Iqbal1* and Muhammad Khurshid2 
...icotiana benthamiana plants inoculated with ToLCNDV. To immunocapture the ToLCNDV, two antisera raised against Tomato yellow leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. However, immunocapture of ToLCNDV could only be achieved by using the TYLCV-CP antisera followed by PCR detection by using specific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae)...

Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1

...aughter slab (processing plants) in Nigeria. The relatively high prevalence rate documented in this study may be attributed to the generally poor infrastructure, lack of well-equipped poultry slaughter houses, lack or inadequate water supply at these markets which hampers the ability of handlers to maintain good sanitary and hygiene conditions of the carcass, environment and themselves. Data collected could be valuable for instituting effective intervention st...

 Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*

...as a result rotten woody plants. The larval beetles characteristically feed in the phloem as well as later in the xylem. The females select living hosts for oviposition and thus destroy the vigour of the trees. However, at the early stage of intestation, detection of Anoplophora glabripennis and exposure will help to eliminate the pest in addition to prevent its establishment. Plantation with different tree species, the cultivation of fast-growing timbe...

Habib Ullah Khan1*, Saleem Ullah1, Hamid Ullah Shah1, Muhammad Arif2

...ve good or bad effect on plants grown in those soils.

...
Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6
...oram, India and infected plants showed declined symptoms and poor fruit yield. Infested plants displayed stunting and yellowing and thick-root symptoms. The association of the root knot nematode species was identified based on observations on morphology of different life stages, beta-esterase phenotype and amplification of rDNA and partial sequence homology of ITS-1and ITS-2. Host differential tests confirmed the race 2 of <...

Sanaullah Jalil*, Asim Hayat, Abid Majeed, Syed Haider Abbas, Muhammad Noman, Muhammad Imran Kasana and Muhammad Mazhar Hussain

... the utilization of P by plants. This research was conducted during wheat cropping season of year 2010 and 2011 and it consisted of determination of the residual effect of six treatments (T0 = control without rock phosphate & farmyard manure, T1= rock phosphate @150 kg P2O5 per hectare, T2 = FYM @5 tons per hectare, T3 = RP @100 kg P2O5 per hectare+ FYM @5 tons per hectare, E0 = without effective microbes and E1= EM-Biozote @ 50 l ha-1) on yield parametrs ...

Waqas Ahmed Dogar2, Arshad Ali Khan3*, Saeed Ahmed2, Sudheer Tariq2, Mukhtar Ahmad2, Muhammad Imran2, Muhammad Noman2 and Nadeem Khan1 

...s observed from the same plants. T2 (11 x 11ft) was close plantation and had more total number of flowers per plant (441.58) and fruit length (58.243 mm), but yield was less due to more fruit drop % (74.165). While, T3 (22 x 22ft) exhibited the poorest results. V2 (Musambi) showed best results for most parameters. Overall situation indicated that plants planted at 11 x 22ft (T1) showed better results as compared to

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
... rot disease and promote plants growth as the length and weight of root and shoot in pot trials on tomato plants. Keywords: Antagonistic fungi, root knot nematode, wilt fungus, bio-management
 

 

...

K.N. Ahmed and M.R. Hasan

Sudden outbreak of mealy bug and armoured scale causing severe damage to economic crops in Bangladesh
... of different ornamental plants in Rajshahi and Dhaka, Bangladesh. It is a polyphagous pest damaging coffee, sweet potato, jute, groundnut, tomato, citrus, cotton, guava etc. causing enormous damage to them. The female lays about 300-400 eggs which hatch in few hours. The life cycle is completed in about 40 days. The small and big black ants tend F. virgata and they keep other insects including hymenopteran parasites away from the mealy bug. The cottony cushio...

S. K. Dutta, S. Roy Chowdhuri, D. Pandit and A. K. Bajpai

Rot diseases of muga host, Som (Persea bombycina) in Assam, India
...ecifically the pollarded plants) were generally infected with rot disease when it grows older. Phellinus contigus (under Polyporaceae), a white rot fungus, causes heart rot disease and Biscogniauxia mediterranea (= Hypoxylon mediterranea) (under Xylariaceae) causes canker rot disease of Som plant. A survey was conducted to study the infection of rotting pathogens on Som plants at Regional Muga Research Station (RMRS), Boko, ...

Debjani Chowdhury, P. C. Paul and B. Dasgupta

Management of leaf spot of Centella asiatica (Thankuni) caused by Alternaria sp. and target leaf spot of Rauvolfia serpentina (Sarpagandha) caused by Corynespora cassicola
...weight and dry weight of plants.

...

K.N. Ahmed , M.A. Al-Helal, N-E-P. Khanom, S. Bulbul

Control strategies of papaya mealybug, Paracoccus marginatus Williams & Willink infesting vegetable crops in Bangladesh
...er cent. Generally young plants die due to heavy infestation and colony formation of the mealybug. P. marginatus is a polyphagous pest attacking several agricultural, horticultural crops, ornamental plants and weeds of economic value. The papaya mealybug feeds on the sap of the plants by inserting its stylets into the epidermis of the leaf as well as into the fruit and stem. In doing so, i...

M. S. A. Mamun and M. Ahmed

Integrated pest management in tea: prospects and future strategies in Bangladesh
... are associated with tea plants. Among them 25 species of insects, 4 species of mites and 10 species of nematodes are recorded from Bangladesh. Enormous crop loss was incurred due to the attack of these pests and largely responsible for the declining productivity of tea. Extensive use of chemical pesticides began only a few decades ago with tremendous immediate economic gains but its abuses were not foreseen or ignored. As a consequence there arose the develop...

Nilesh Suresh Gole and Bijan Kumar Das

Biology of Dichromia sagitta (Fabricius) (Noctuidae: Lepidoptera), a serious pest of Indian ipecac, Tylophora indica

Sitansu Pan and Amrita Das

Control of cowpea (Vigna sinensis) root and collar rot (Rhizoctonia solani) with some organic formulations of Trichoderma harzianum under field condition
...ion vigour of the cowpea plants, basal girth, number of branches & pod number, pod vigour of the bio primed seeds over other treatment combinations. Soil application of Trichoderma in vermicompost +20% neem cakes gave better disease control over the others.

...

P.S. Ajith, K.K. Lakshmesha, S. Mahadev Murthy and N. Lakshmidevi

Botanicals for control of anthracnose of bell peppers
...ed that all the selected plants have potential to inhibit the radial mycelial growth of C. capsici in-vitro. The plant extract from C. aromaticus at 50% concentration showed 42% radial mycelial growth inhibition in poisoned food technique, whereas 15% increased seed germination and 26% reduced disease incidence is recoded when compared to untreated control. In pot experiments, there is an increase in height and weight of the plants

M. A. Al-Helal, K. N. Ahmed, N-E-P. Khanom, and S. Bulbul 

Observations on papaya mealybug, Paracoccus marginatus Williams & Willink (Hemiptera : Pseudococcidae) damag-ing some crops in Bangladesh
...egetables and ornamental plants of economic importance in Bangladesh perspectives.
 

 

...

A. Sajeena and T. Marimuthu

Efficacy, stability and persistence of Ganosol, a Ganoderma based fungicide against plant pathogens
... in Ganosol 10EC sprayed plants and were absent in control. The formulation was tested to have good emulsion stability. The antifungal activity of the formulation persisted up to seven days after spraying the formulation on rice plants. The formulation retained its 100% antifungal efficacy up to three months of storage. Surprisingly, spraying cowpea plants with the formulation as simultane...

S. Patra, V.W. Dhote, SK F. Alam, B.C. Das, M.L. Chatterjee and A. Samanta

Population dynamics of major insect pests and their natural enemies on cabbage under new alluvial zone of West Bengal
...m randomly selected five plants /plot. Peak population of diamond back moth (DBM) was recorded on 1st March and 23rd February with13.60 and 14.33 larvae /plant during 2011-12 and 2012-13 respectively. Cabbage aphid reached its peak on 9th February (14.17 aphids/inch2 leaf) and 16th February (11.03 aphids/inch2 leaf) of 2011-12 and 2012-13, respectively. Highest parasitized larvae of diamond back moth by Cotesia plutellae were found on 15th and 8th March with 1...

Anil Sehajpal, Saroj Arora and Parminder Kaur 

 

Evaluation of plant extracts against Rhizoctonia solani causing sheath blight of rice
...fusion method. Out of 44 plants tested, 36 plant extracts showed varied degree of antimicrobial effect at different concentrations against the pathogen whereas 8 plant extracts, viz. Abrus precatorious, Acacia auriculiformis, Bougainvillea glabra, Convolvulus arvensis, Hibiscus rosa-sinensis, Morus alba, Thevatia peruviana, and Withania somnifera did not exert any effect. Among all the plant extracts, A. sativum exhibited strong fungitoxicity even at the lowes...

Dhananjoy Mandal

Eco-friendly management of mealybug and wilt in pineapple
... of percentage of wilted plants and mealy bug population, T3 was the best and T2 ranked second. Percent of wilted plants in T1, T2 and T3 were 11.88, 4.19, 2.62; mean mealy bug population/plant were 9.33, 5.29, 4.20, and yields were 32.5 tha-1, 38.7 tha-1, 41.6 tha-1, respectively. Benefit: Cost ratio was highest in T3 (1.30) followed by T2 (1.24) and T1 (1.09).
 

 

...

S. Pal and I. Sarkar

Pests infesting ornamental plants in hilly region of West Bengal
...ing different ornamental plants viz. Myzus persicae on Carnation, gerbera and Anthurium; Macrosiphoniella sanborni on Chrysanthemum; Aphis gossypii on China rose. Other sucking pests infesting ornamentals included Bemisia tabaci on Gerbera, leafhopper on Gladiolus and scale insect (unspecified) on Anthurium. Amongst the thysanopteran pests Taeniothrips simplex was very much serious on Gladiolus and another species of thrips (unspecified) was found infesting Ca...
P.P. Ghosh*, C. Ghosh, B. Mahato, A. Chakraborty, S.K. Bhattacharya and M.K. Bhattacharjya
... destruction of diseased plants (farmers’ practice). Results indicated all the management approaches under study performed significantly superior to farmers’ practice in terms of reduction in disease severity (32.8-43.6%), yield increase (20.9% - 26.8%) and benefit-cost ratio. Integrated approach was the best approach followed by prophylactic and curative soil disinfestations. Thus, for the present micro-level situation vascular bacterial wilt mala...

Gadeeyya G and Ratna Kumar P.K.

...dy was conducted on weed plants for the primary investigation of natural enemies which may became promising biocontrol agents. A total of 7 weed plants include Commelina benghalensis, Cyperus rotundus, Crotalaria verrucosa, Digera muricata, Sida cordifolia, Ipomoea pestigridis and Trianthema portulacastrum were selected for in vitro studies. Fungal isolates namely Ascochyta cypericola, Bipolaris s...
Azhar Abbas Khan1,*, Arif Muhammad Khan2 and Muhammad Afzal3
...hemicals released by the plants in response to herbivorous attack influences third trophic level and natural enemies use these substances to locate their prey. Twelve-arm olfactory apparatus was used to evaluate the response of C. septempunctata toward aphids and different host plants of aphids. Different horticultural plants and field crops were used singly or in combination with p...
Ayesha Ilyas1, Hafiz Azhar Ali Khan2,* and Abdul Qadir1,*
...tracts of six indigenous plants viz., amaltas (Cassia fistula), datura (Datura alba), neem (Azadirachta indica), niazboo (Ocimum basilicum), yellow kaner (Thevetia peruviana) and safeda (Eucalyptus camaldulensis) against the peach fruit fly, Bactrocera zonata (Saunders), at 2% concentration in a free choice bioassays. Acetone, chloroform, petroleum ether and ethanol were used for extraction from leaves. A...
Adnan Yousaf1,Jia Wu1, Qaiser Shakeel2, Yasir Iftikhar3, Muhammad Irfan Ullah4, Uzma Tahira5,Mustansar Mubeen1 and Wubei Dong1,*
...i>. Two week old chilies plants were inoculated with M. incognita, S. rolfsii separately and in combination as well. At harvesting, roots of C-302 contained significantly fewer galls (30) and egg-masses (51) compared to the other fourteen cultivars. Seven cultivars including C-33, Gola Peshawari, 11-2010, 18-2010, 15-2010, 27-2010 and C-68 had 10 root galling and egg-masses indices (from a scale of 0-10). Hence, present study shows that none of the avai...

Sadia*, Abdur Rab, Sayyed Hamad Ahmad Shah, Irfan Ullah, Farida Bibi and Islam Zeb

...5.5cm3) were recorded in plants deblossomed in September treated with 50 ppm of GA3. While maximum fruit density (1.13gcm-3) was recorded in the month of July fruits treated with 10 ppm of GA3. While maximum fruit drop (11.69%), titratable acidity (0.59%), with minimum number of new shoots (16.3), number of new flowers (65.3), fruit weight (53.3g), and fruit volume (48.1cm3) were recorded in plants which were not deblossomed...
Saleem Khan1, Amir Hamza2, Farhadullah Khan3, M. Subhan4, Aziz Khan1, Irfan Ali Shah1, Shakirullah Khan Shakir3*
... using cotton as a model plants, the present study was designed. For this purpose, dry seeds of four cotton genotypes (Gomal-93, Bt-131, Bt-121 and Bt-CIM-602) were exposed to gamma rays with 10, 15, 20 and 25 Kilo Radium (KR) doses sourced from 60Co. The irradiated seed samples were assumed treated seeds while non-irradiated seeds of each genotype were used as control. Field experiment was conducted in randomized complete block design (RCBD) in thr...

Abdur Rab1*, Muhammad Sajid1, Naveed Ahmad1, Khalid Nawab2, Syed Ghias Ali3

...gated by exposing tomato plants to 0, 75 and 150 mM salinity; and foliar application of 0.0, 0.25, 0.50, 0.75, 1.0, 1.25% calcium solutions. Salinity stress increased leaf Na+ and Na+/ K+, fruit firmness and blossom end rot (BER) incidence but significantly decreased the leaf K+ and Ca content of the fruit and yield. The foliar calcium application decreased the Na+ accumulation, Na+/ K+ ratio and BER incidence as well as increased the leaf K+ and Ca content of...
Nargis Bano and Khalid Mahmood Qureshi*
...otect several species of plants against environmental stresses by initiating different processes that are involved in the mechanism of stress tolerance. SA is part of an extremely complex signal transduction network’s part and it works differently in different systems. Drought stress is a major restraint for crop production in arid and semi arid states such as Pakistan. In this study experiments were conducted against the responses of strawberry plant to...

 Zabih Ullah*, H. Rahman and Niaz Muhammad

...y desirable as it allows plants to escape various biotic and abiotic stresses. It also makes multiple cropping possible as the land becomes available for next crop. Keeping the importance of early maturity of maize crop in view, the present study was conducted to evaluate different maize hybrids for maturity and related traits in the geographical location of Khyber Pakhtunkhwa. The experiment was conducted at The University of Agriculture, Peshawar during the ...
Liana Mihaela Fericean1* and Mihaela Corneanu2
...use direct damage to the plants by extracting the sap, and indirectly it is a vector to 16 plant viruses. The study presents data referring to the external morphological characteristics, to the biometrical measurements and to the life cycle of Aphis nasturtii. The researches have been carried out for a period of four years on the potato and for a period of two years on the orchards from Romania. At the Aphis nasturtii species the smallest length ...

Arshad Iqbal1*, Iftikhar Hussain Khalil1, Syed Mehar Ali Shah1 and Muhammad Sharif Kakar

... the performance of crop plants by knowing the magnitude of heritability. An experiment was conducted using a set of spring wheat genotypes to estimate heritability for various plant traits during crop season 2014-15 at the University of Agriculture, Peshawar. The randomized complete block design with three replications was used in the experiment. Data were recorded on yield and some other important plant traits like days to heading (days), days to maturity (d...
Ayesha Aihetasham1,*, Muhammad Saeed Akhtar1, Maryam Umer1, Khalid Zamir Rasib2 and Muhammad Imran Din3
...er. Extracts of both the plants were found repellent to this termite. LT50 values of O. basilicum and F. vulgare against Heterotermes indicola were 60.91 and 115.9 h, respectively.
...
Mahreen Yahya, Noor Abid Saeed*, Sajid Nadeem, Muhammad Hamed and Sajid Shokat 
...ually with the growth of plants. Three aphid species were recorded i.e., Rhopalosiphum padi (L.), Schizaphis graminum (R.) and Sitobion avenae (F.). Mean seasonal aphid population (no. of aphids/tiller) on wheat plants during the whole season was the highest in NW-1-8183-8 and NW-3-3341-7 and the lowest in Faisalabad-08. However, grain yield was the highest in Galaxy-13 and the lowest was in Lasan...
Muhammad Qaisar Nawaz
...t (132.00 cm), number of plants (91.33 m-2), number of tillers (146.00 m-2), number of leaves tillers-1 (5.66), total dry matter (17.70 t ha-1) and fodder yield (60.90 t ha-1) showed that nitrogen application @ 150 % N of recommended dose with drill sowing proved to be the most cost effective technique for fodder oat production in salt affected soil as compared to other treatments.
...

Muhammad Anas1, Abdul Jabbar1, Muhammad Aqeel Sarwar2*, Raza Ullah1, Muhammad Khubaib Abuzar3, Ijaz Ahmad4 and Sohail Latif5 

...uded viz. Four sunflower plants m-2 + 30 mungbean m-2, 6 sunflower plants m-2 + 30 mungbean plants m-2, 8 sunflower plants m-2 + 30 mungbean plants m-2, 4 plants m-2 of sunflower alone, 6 plants m-2 of sunflower alone, 8 pl...

Imtiaz Ahmed, Muhammad Abbas Khan, Noorullah Khan, Naveed Ahmed, Abdul Waheed, Fazal Yazdan Saleem, Sajjad Khan and Sohail Aslam 

...b (12.5); whereas taller plants (54 cm) and maximum bulb yield of 12.85 t ha-1 was recorded in those plots planted with 10 cm spacings. While the highest unite price of Rs. 300 kg-1 (Rs. 3.315 m ha-1) was received from those garlic which were obtained from 20 cm spacing as against the lowest market price of Rs. 225 kg-1 (Rs. 2.891 m ha-1) received from those garlic obtained from10 spacing. To achieve high market price, good quality garlic production and free f...

Riaz Alam* and Muhammad Sajid 

..., 30 and September 14 in plants of olive cultivars Frontoio, Manzanilla, Ottobratica, Pendolino and Picual. Significant variations were recorded among olive cultivars regarding asexual propagation through air-layerage. The daughter saplings of cultivar Manzanilla took less number of days (47.94) to root appearance, produced more rooting percentage (38.89%), number of roots (4.31), root length (4.61 cm) and root weight (1.77g) with more number of re-sprouts (3....
Temel Gokturk1, Elif Tozlu2,* and Recep Kotan2
...auses harm in almost all plants that grow along the Eastern Black Sea coast. The chemicals used to control this pest are prohibited in this region due to tea cultivation. For this reason, new strategies are needed to control this pest. With the awareness on the negative effects of the chemicals used in the control against pests and with the increasing awareness on environmental issues, alternative methods were sought in the past; and in this context, studies w...
Hayat Badshah1, Farman Ullah1, Paul-André Calatayud2, Hidayat Ullah3 and Bashir Ahmad1
... to the locality and the plants on which P. solenopsis is feeding. In this context, this experiment investigated under field and laboratory conditions the influence of the host plant of P. solenopsis on the parasitism success and the female fitness of A. bambawalei, Five plant species, commonly found to be host of P. solenopsis, were tested: hibiscus, potato, okra, eggplant and tomato. Under no choice test conditions, the res...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...s urticae, on tomato plants, was tested under greenhouse and laboratory conditions. A sharp reduction in the population of T. urticae was obtained after one week of applying Huwa-San TR50 at a rate of 4000 ppm. This resulted in mortalities of 82.10 and 78.60% under greenhouse and laboratory conditions, respectively. The side effects of Huwa-San TR50 on predatory mite, Neosiulus cucumeris, were also tested to gain successful implementation of ...

Ayesha Aihetasham1*, Khalid Zamir Rasib2, Syeda Rida Hasan1, Imran Bodlah3

...racts of three medicinal plants viz., Carica papaya (paw paw), Helianthus annus (Sunflower) and Bougainvillea glabra (Paper flower) against Heterotermes indicola. The leaf extract of C. papaya caused highest mortality i.e. 100% of 10%, 5% and 3% concentration. Bougainvillea glabra and H. annus caused 100% mortality at 10% and 5% concentration while 96.4% mortality on 3% concentration after exposure period of 10 hours. B. glabra extracts also caused 100% mortal...

Muhammad Zahid1*, Muhammad Ather Javed Khan2, Muhammad Idrees3 and Ahmad Kamran Khan4 

...wers adopted thinning of plants, 91.3% knew pest scouting, 87.3% used pesticides after pest scouting while 74% farmers used pesticides both at morning and evening. It was concluded that integrated pest management project enhanced the skills of farmers and resulted in higher yields of quality cotton through reduction of pesticides sprays 

...

Aqsa Waqar1, Sahir Hameed Khattak2, Sania Begum2*, Tayyaba Rehman1, Rabia1, Armghan Shehzad2, Wajya Ajmal2, Syeda Shahdana Zia2, Iqra Siddiqi2 and Ghulam Muhammad Ali2* 

... - 100%, due to infected plants and shriveled grain. These problems can be overcome by knowledge about the disease, identifying resistance lines and subsequently develop resistant varieties with an aim to shorten the disease cycle. One of the quickest ways in this direction is the designing molecular markers for non-race-specific resistance genes. Use of molecular markers is efficient tool for screening diversity of rust genes in wheat germplasm and can facili...
Sumaira Zareen1, Syeda Sadaf Zahra2, Ayeza Mehmood3, Muhammad Asadullah4* and Aish Muhammad5

 

...ments from healthy grown plants were used as explants and cultured on standard Murashige and Skoog (MS) medium supplemented with different concentrations and combinations of benzyl amino purine (BAP) or kinetin for shoot induction and Indole acetic acid (IAA) for primary shoot and Indole Butyric acid (IBA) for root proliferation. Best shoot proliferation (4.48 per explant) was observed in MS medium containing 0.2/0.4 mg/L BA...

Ata-ul-Mohsin*, Ehsan-ul-Haq** and Muhammad Naeemullah*

...parasitoid was higher on plants with high phosphorus than those treated with high calcium concentrations.

...

 Muhammad Asim, Muhammad Asif, Muhammad Munir* and Muhammad Aslam**

...culated and uninoculated plants of soybean [Glycine max (L.) Merr.] from the time of inoculation to root-nodule initiation (192 hours after inoculation). 3H-ABA was applied to the leaves of two soybean cultivars: cv. Williams-82 and its hypernodulating mutant, NODI-3. There was a significant difference in the percent uptake of 3H-ABA between the two varieties both in inoculated and uninoculated plants. A marked difference in...

 Naheed Akhtar, Muhammad Ashfaque, Waseem Ahmad Gillani*, Ata-ul-Mohsin**, Afzala Tashfeen and Irshad Begum*

... know the effect of host plants on the fecundity of R. padi. Two varieties Wafaq-2007 and Diamond were the least preferred for fecundity and one line V00125 was highly preferred for fecundity.

...

 Badaruddin Khokhar*, Imtiaz Hussain** and Zafar Khokhar*

...V–7004, had taller plants in comparison with cultivars NARC–9 and V–7004 however, wheat grain yield was not affected significantly among different cultivars.

...

 Sumia Bint Zaman, Sidra Majeed and Shahid Ahmad*

...feed crops and fuel-wood plants.

...

 Ahmed Aziz Kurd, Amanullah, Saifullah Khan, Basharat Hussain Shah and Munir Ahmed Khetran*

Tariq Mahmood, M. Sudheer Tariq, Khalid Mahmood Khokar, Hidayatullah and Syed Ijaz Hussain*

...rop with no mortality of plants. Highest mortality of plants due to foliage eating by red pumpkin beetle was observed in control where no permethrin was applied. None of the plant extracts tested in this study as dust alone or mixed with dung ash was effective in controlling red pumpkin beetle attack. Permethrin dust (0.5%) alone and ash + permethrin dust (2000: 1 a.i w/w) gave a significantly higher yield of 18.07 and 18.63...

 Hidayatullah, T. Mahmood, M. Farooq, M. A. Khokhar and S.I. Hussain*

* Corresponding author: hidayatu2003@yahoo.uk.co.uk

PLANT GROWTH REGULATORS AFFECTING SEX EXPRESSION OF BOTTLE GOURD (LAGENARIA SICERARIA MOLINA) PLANTS
...enaria siceraria Molina) plants cv. Faisalabad Round was investigated under field conditions in National Agricultural Research Centre, Islamabad. Plants sprayed with distilled water were considered as control. Among all foliar agents, the response of -l GA3 3 and MH was found better. Exogenous application with 30 µmol l GA maximally increased the pistillate flower production as compared to control. Moreover, the treatm...

 Khalid Mahmood Qureshi, Fakhar ul Hassan, Qamar ul Hassan, Usman Shaukat Qureshi, Saman Chughtai and Adnan Saleem*

IMPACT OF CULTIVATION SYSTEMS ON GROWTH AND YIELD OF STRAWBERRY (FRAGARIA ANANASSA) CV. CHANDLER
..., Rawalpindi. The runner plants of the strawberry (Fragaria ananassa) cv. Chandler were collected from Swat (Mingora.) Different cultivation systems were adapted i.e., standard growing media in polyethylene bags (T ), soil less media (T ), high tunnel (T ), green house (T ), 1 2 3 4 including open field condition on ridges (T ) by keeping plant to plant 5 distance of 30 cm and row to row distance of 60 cm. The study was conducted to evaluate the effects and su...

 Habib Iqbal Javed, Ashiq Saleem, Javed Fateh, Mozammil Hussain, Naheed Akhtar and Shamim-ul-Sibtain Shah*

DEVELOPMENT OF RESISTANT MAIZE GERMPLASM
...on the basis of survived plants, a total of 250 accessions including 150 exotic out of 350 and 100 indigenous out of 900 were selected. During autumn 1999, out of 250 accessions (progenies) 35 exotic and 10 indigenous could survive under artificial infestation. Under natural infestation, 100 progenies performed little better. The best plants among these progenies were advanced by self pollination. A total of 400 self pollina...

 Muhammad Tariq*, Raja Muhammad Omer**, Muhammad Ashraf Mian*, Obaid Ur Rehman***, Amjad Tahir Virk and Kazim Abbass**

PROMOTING CERTIFIED SEED AVAILABILITY OF WHEAT (TRITICUM AESTIVUM L) THROUGH PUBLIC-PRIVATE PARTNERSHIP AND ITS IMPACT ON YIELD IN RAINFED AREAS
... stand which enabled the plants to withstand abiotic stress especially drought during the crop season. The seed multiplication of crop varieties of rainfed areas can be done in irrigated areas to ensure the quality of seed and its availability in rainfed areas, which ultimately will increase the income of the farming community of the area.

...

 Arshad Ali, Imdad Ali Mahmood, Muhammad Salim, Muhammad Arshadullah* and Abdul Rasool Naseem**

GROWTH AND YIELD OF DIFFERENT BRASSICA GENOTYPES UNDER SALINE SODIC CONDITIONS
...andomly (average of five plants per replication) at the time of crop maturity. Ionic concentration in plant tissues and oil content in seeds were also determined. Comparatively more number of branches and pods per plant were produced by cultivar Dunkled closely followed by BARD-I while maximum seed yield (241.7 and -1 235.1 kg ha ) was obtained from Dunkled and Sultan Raya, respectively which was statistically at par. However, BRS-II and Rainbow showed signifi...

 Muhammad Arshadullah, Syed Ishtiaq Hyder, Arshad Ali and Imdad Ali Mahmood*

CUMULATIVE EFFECT OF SULFUR AND CALCIUM ON WHEAT GROWTH AND YIELD UNDER SALINE-SODIC SOILS
...+ + receiving CaSO4 help plants to attain more Ca , K and S to avoid Na uptake.

...

 Rabeea Tariq*, Khalid Mahmood Qureshi*, Imran Hassan*, Muhammad Rasheed* and Usman Shaukat Qureshi*

EFFECT OF PLANTING DENSITY AND GROWING MEDIA ON GROWTH AND YIELD OF STRAWBERRY
...oss. Results showed that plants grown at low planting distance on all growth media showed more pronounced results as compared to high planting distance. Plants grown in peat moss at both planting densities moderately increased the plant height, canopy size, leaf area, number of fruits, fruit size, fruit weight and titratable acidity. A significant increase in fresh and dry weight of leaves, number of leaves, fruit yield in t...

 Asghar Ali*, Muhammad Tahir**, Shahid Riaz Malik* and Muhammad Hanif Munawwar*

EVALUATION OF PRE AND POST-EMERGENCE HERBICIDES FOR WEED MANAGEMENT IN LENTIL (LENS CULINARIS MEDIK.)
...causing injury to lentil plants.

...

 Muhammad Ali*, Ghulam Mustafa Sajid**, M. Faisal Anwar Malik*** and Kalimullah****

ESTABLISHMENT OF IN VITRO CULTURE OF GRAPES
...culture from shoot tip explants (meristemetic tissue) of grapes was investigated through tissue culture technique. These explants were collected from gene bank of Institute of Agricultural Biotechnology and Genetic Resources (IABGR), National Agricultural Research Centre (NARC), Islamabad, Pakistan. Fifteen accessions of grapes were surface sterilized and tested on 75% MS media for germination and initial growth parameters. ...

 Aniqa Iram*, Javed Khan**, Nadeem Aslam**, Ehsan-ul-Haq**, Habib Iqbal Javed**, Muhammad Irfan*, Awais Rasool*, Muhammad Ishaque Mastoi** and Sumera Aslam* 

EFFICACY OF PLANT DERIVED OILS AND EXTRACTS AGAINST WHITEFLY, BEMISIA TABACI (GENNADIUS) ON SESAME CROP
...ed on more than 600 host plants worldwide. Different methods are being used for its control. The present experiment was conducted to determine the effect of some plant extracts of mint (Mentha spp.) and geranium (Pelargonium graveolens) and soybean oil (Glycine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data were recorded 24h before and 24h, 48h, 72h and 168h after application of each ...

 Hassnain Shah*, Nadeem Akmal*, Waqas Farooq*, Muhammad Azeem Khan* and Shahid Munir**

SHIFT FROM SITE DEVELOPMENT TO SKILL DEVELOPMENT: A CASE STUDY OF WATER HARVESTING THROUGH MICRO CATCHMENTS
...r conservation for fruit plants but also cost effective, water, labor and resource saving along with farmer friendly under rainfed condition with scare supplemental water availability. The cost of adoption of technology including labor charges for its preparation and maintenance was recovered from irrigation cost saved from single rainfall at the demonstration site. One of the important implications drawn in this regard was the need of a shift from site develo...

 Nosheen Zahra*, Ghulam Sarwar* and Sher Muhammad**

COMPARISON OF GYPSUM AND POTASSIUM SILICATE FOR RECLAMATION OF SALINE SODIC SOIL
... in all the pots i.e., 3 plants per pot. Necessary N, P and K fertilizers were applied at the recommended rate. After crop harvest, soil samples were taken for analysis of pH, electrical conductivity (EC), sodium adsorption ratio (SAR) and exchangeable sodium percentage (ESP) of soil. All the amendments when used alone or in combination with each other improved the chemical parameters of soil. All levels of gypsum (100%, 75% and 50% G.R) proved effective in lo...

 Ibrar Ali*, Abdul Mateen Khattak*, Muhammad Ali* and Kalim Ullah**

PERFORMANCE OF DIFFERENT TOMATO CULTIVARS UNDER ORGANIC AND INORGANIC REGIMES
... t ha ) were recorded in plants provided with organic conditions Roma cultivar performed better than other cultivars under the agro climatic condition of Peshawar followed by cultivar Rio Grande. Therefore, organic tomato production, and these two cultivars are recommended to be grown in Peshawar area. 

...

 Quratulain*, Muhammad Aslam**, Muhammad Khalid Rafique*, Mian Atiq Ahmad* and Rashid Mahmood***

POPULATION DYNAMICS OF ROSE APHID MACROSIPHUM ROSAE L. ON DIFFERENT CULTIVARS OF ROSA INDICA L. IN PAKISTAN
...earch field area on rose plants for rose aphid populations during 2008-09. Data were recorded on weekly basis. Nymphs, winged and wingless adults were counted from leaves (upper, middle and lower leaves), buds and flowers by visual observation from tagged plants. Aphid populations start to develop in November and its population decline with decline in temperature in December. While its population started rising again at the ...

 Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**

EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...igher in fully irrigated plants as compared to water stress ones. Fertilizer treatments had no considerable effect on phenolic compounds.

...

 Raja Zoq-ul-Arfeen*, Aamir Saleem*, Sarwat Naz Mirza*, Muhammad Akmal**, Hafiz Muhammad Tayyab* and Obaid Afzal***

BIODIVERSITY AND PHYTOSOCIOLOGICAL STUDIES OF UPSTREAM AND DOWNSTREAM RIPARIAN AREAS OF PAKISTAN: SPECIAL REFERENCE TO TAUNSA WILDLIFE SANCTUARY AND KETI SHAH FORESTS
...e sanctuary. Total 14259 plants/individuals were recorded, which belong to 54 plant species with 18 different families. In Taunsa pre-monsoon survey, total 30 plant species were found with 4476 plants from 16 different families. In Taunsa post-monsoon survey total 3348 individuals were recorded from 20 plant species and 9 families. Similarly, in Keti Shah forest, total 3975 individual were recorded from 22 species and 11 fam...

 Imran*, Shaheeda Naveed**, Asad Ali Khan* and Inayat Khattak* 

IMPACT OF PHOSPHORUS LEVELS AND SEED RATES ON GROWTH AND YIELD OF LATE SOWN MAIZE ON HIGH ELEVATION IN SWAT, PAKISTAN
...s (P) is required by the plants relatively in large quantity and is the second most important crop nutrient that increases productivity of maize (Zea mays L.). An experiment on effect of different P O levels and seed rates on growth and yield of late sown maize cv. 2 5 Baber on high elevation during kharif season, was conducted at Farmer Field School, Swat, Pakistan during summer 2012. The experiment was laid out in randomized complete block design having thre...

 Anwar Hussain* and Muhammad Rahman**

ROLE OF TRAININGS ON FARMERS' PROFITABILITY OF MEDICINAL AND AROMATIC PLANTS IN MOUNTAINOUS AREAS OF DISTRICT SWAT, KHYBER PUKHTUNKHWA
...n medicinal and aromatic plants (MAPs) in mountainous areas of district Swat. A convenient sample of 100 respondents, engaged in MAPs in Chail Valley Madyan was taken. Information about revenue from MAPs, marketing, prices and quantities was collected through a structured questionnaire. The respondents were given training under Swiss Development Cooperation Project at the time of collection, harvesting, cleaning, drying, packing and marketing of MAPs. The over...

 Azhar Usman Ali*, Ghulam Sarwar*, Muhammad Aftab* and Sher Muhammad**

EFFECT OF SOIL AND FOLIAR APPLIED COPPER ON GROWTH AND YIELD OF WHEAT (TRITICUM AESTIVUM L.)
...ni-2000) were sown and 3 plants were maintained in each pot after germination. Foliar application of copper was done at booting and tillering stage. At maturity, data regarding different yield components were noted and wheat plants were harvested. Grain yield and total biomass was also recorded. Soil samples were collected from all pots and analyzed for copper concentration by using wet digestion method. Results of the exper...

 Muhammad Mudasar Aslam ⃰, Muhammad Jamil**, Ijaz Malook**, Amana Khatoon*, Ali Rehman*, Abdur Rahim***, Pirzada Khan*, Shakir Ullah Khan Shakir*, Shahid Irfan*, Faizan Ullah****, Khair Ul Bashar**, Mahideen Afridi** and Shafiq Ur Rehman*

PHYTOTOXIC EFFECTS OF CALOTROPIS PROCERA, TAMARIX APHYLLA AND PEGANUM HARMALA ON PLANT GROWTH OF WHEAT AND MUSTARD
...ytotoxic effects of many plants are known on growth of different useful crops. This research study was designed to find out phytotoxic effects of Calotropis procera, Tamarix aphylla and Peganum harmala on seed germination and seedling length of wheat and mustard. Results showed that seed germination of wheat was significantly decreased by 5%, 10%, 15%, 20% and 25% while mustard seeds were resistant and were affected by higher dilutions (15%, 20% and 25%) of al...

 Muhammad Farrukh Saleem*, Munir Ahmad*, Shakeel Ahmad Anjum*, Muhammad Aown Sammar Raza** and Abdul Shakoor*

EFFECT OF TOPPING UNDER DIFFERENT NITROGEN LEVELS ON EARLINESS AND YIELD OF COTTON
...s showed that 90 cm tall plants -1 produced maximum seed cotton yield when supplied with 150 kg N ha ; 120 cm tall -1 plants gave maximum seed cotton with 200 kg N ha while 150 cm tall cotton plants -1 needed 250 kg N ha for highest seed cotton production. In conclusion, cotton growth can be manipulated successfully for better performance by topping provided N dose is monitored.

...

 Tasawar Sultana*, Farah Deeba* and S.M. Saqlan Naqvi*

HIGH-THROUGHPUT AGROBACTERIUM-MEDIATED TRANSFORMATION OF MEDICAGO TRUNCATULA IN COMPARISON TO TWO EXPRESSION VECTORS
.... truncatula transformed plants expressing OsRGLP1 were obtained through GATEWAY technology using pGOsRGLP1 (pH7WG2.0::OsRGLP1). The transformation efficiency of this vector was compared with expression vector from pCAMBIA series over-expressing same gene (pCOsRGLP1). A lower number of explants generated hygromycin resistant plantlet for instance, 18.3 with pGOsRGLP1 vector as compared to 35.5% with pCOsRGLP1 vector. Transfo...

Muhammad Zahid Kiani*, Tariq Sultan**, Arshad Ali**, Ghulam Qadir*** Imdad Ali Mahmood**, Tauseef Tabassam**, Muhammad Arshad Ullah** and Nasir Abbas* 

EFFECT OF PGPR STRAINS ON SUNFLOWER GROWTH AND NUTRIENT CONTENTS UNDER SALINITY STRESS
...ter six weeks of sowing, plants were harvested and data regarding root length, plant height, root dry weight and shoot dry weight were recorded. The plant growth improved significantly with PGPR strain under salt stress. The root length, plant height, root and shoot weight increased up to 40%, 40%, 167% and 255%, -1 respectively over un-inoculated at 12 dS m salinity level. Whereas an increase of 38%, 54%, 109%, and 117% in root length, plant height, root weig...

 Syed Waqar Shah* and Muhammad Ather Rafi*

PIERID (LEPIDOPTERA: PIERIDAE) PESTS AND THEIR NEW CRUCIFERS HOSTS IN POTHWAR REGION OF PAKISTAN
...n-cultivated cruciferous plants, the known cultivated hosts such as , , ,, var. and were attacked by , and . Among above reported Pieridae species is reported for the first time however, is also a new record from districts Rawalpindi and Chakwal and from Jhelum, Rawalpindi and Chakwal. However, the non-cultivated host plants in the region were , , and . Among noncultivated hosts was the new host for . C. was found common hos...

Mehwish Kiran*, Muhammad Saleem Jilani*, Kashif Waseem*
and Muhammad Sohail**

EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON GROWTH AND YIELD OF RADISH ( L)
...ere found in NPK treated plants followed by PM, GM, SS, PrM and FYM, respectively.

...

 Arshia Naeem*, Maria Anjum*, Mariam Rehman*, Zahid Mahmood** and Muhammad Asif Kamran**

AN INTEGRATED INFORMATION SYSTEM TO FACILITATE FARMERS IN WHEAT, SUGARCANE AND OTHER CROP DISEASES IDENTIFICATION
...ize yield losses in crop plants. An integrated application to facilitate farmers to communicate their crop related issues directly to agriculture scientists is proposed. This 'AXPERT Platform' consists of web application that provides user centered interface to farmers and a desktop application that facilitates agricultural scientists to identify crop diseases. A case study was developed from Faisalabad region where information about crops, their soil conditio...

 

Shakir Ullah*, Aish Muhammad*, Iqbal Hussian*, Hafeez-Ur-Rahman**, Muhammad Zeeshan Hyder***, Muhammad Din**** and Nizamud Din

MORPHOLOGICAL VARIATIONS IN APRICOT CULTIVARS GROWN IN GILGIT BALTISTAN PAKISTAN

 

ROLE OF HONEY BEES FORAGING ACTIVITIES IN INCREASED FRUIT SETTING AND PRODUCTION OF APPLES APIS MELLIFERA MALUS DOMESTICA

...eight gain in pollinated plants compared to non-pollinated plants. Maximum number of fruits per panicle were 5.33±0.51(Mean±SE) whereas the highest fruit weight 170±2.65g (Mean±SE) was recorded in plants provided with augmentation of honey bees along with natural pollination. The lowest fruit weight of 80±3.05g (Mean±SE) and the minimum 0.33±...

 Asif ullah Khan*, Faizan Ullah*, Sultan Mehmood*, Muhammad Irshad* and Farhat Ullah Khan**

ALLELOPATHIC EFFECTS OF JATROPHA CURCAS L. LEAF AQUEOUS EXTRACT ON EARLY SEEDLING GROWTH OF L. PARTHENIUM HYSTEROPHORUS
...on of not only with crop plants but also with weed species before its introduction into agroforestry systems. During present investigation, allelopathic potential of leaf aqueous extract was investigated on seed germination and seedling development of L. Extracts were applied at 25%, 20%, 15%, 10% and 5% as seed soaking for 8 hours prior to sowing. Phenolics compounds were found in aqueous extracts and were higher in 25% extract (52.72 mg gallic acid eq. / gm ...
Muhammad Sharif1*, Shahzada Sohail Ijaz2, Muhammad Ansar3, Ijaz Ahmad4 and Syed Abdul Sadiq5
...ically same under CT (83 plants m-2, 6.02 Mg ha-1, 3.32 Mg ha-1, respectively), MT (83 plants m-2, 5.90Mg ha-1, 3.26 Mg ha-1, respectively) and RT(72 plants m-2, 5.92 Mg ha-1,3.20Mg ha-1, respectively)tillage systemswith retention of crop residues,whilesignificantly lower values were recorded...
Muhammad Zameer Kayani1,*, Tariq Mukhtar2 and Muhammad Arshad Hussain3
... the other hand, ages of plants at inoculation had negative correlations with reductions in these parameters at each inoculum density. The production of galls was found to be positively correlated with the inoculum densities and plant ages. However, rate of nematode build up decreased with an increase in inoculum density and appeared to be negatively correlated with inoculum densities and, on the contrary, was found to be positively correlated with plant ages....
Mubashar Hussain, Muhammad Faheem Malik, Sehreen Siddique, Muhammad Umar, Tamkeen Zainab, Fatima Zafar
...ent pests and their host plants.
...

Nadia Mubarik1, Aqib Iqbal1*, Iqbal Munir1 and Muhammad Arif2 

... foliar application, the plants were regularly irrigated upto one week and water stress was imposed by withholding water from half of the pots for 20 days. Data were recorded on the relative water content (RWC), proline, sugar content and transcripts abundance of Lhcb2 gene in the selected leaves. Application of CaCl2 increased the RWC, proline and sugar content as well as the Lhcb2 expression in the leaves under both irrigation conditions; however, the effect...

Zakirullah Jan1, Shamsher Ali1*, Tariq Sultan2, Muhammad Jamal Khan1, Zahir Shah1 and Farmanullah Khan1 

...on with large numbers of plants and microbial mats. In this regard, a pot experiment was carried out with the aim to assess the impact of different strains of cyanobacteria on rice crop growth and nutrients uptake under saline soil condition at National Agricultural Research Center (NARC), Islamabad Pakistan during summer 2016. A total of 18 experimental pots were induced with salinity of 7.0 dS m-1 and arranged in Completely Randomized Design (CRD) with three...
Ghulam Muhae-ud-Din1,4, Anam Moosa1, Umer Farooq Ghummen1, Muhammad Jabran1, Amjad Abbas1, Muhammad Naveed2, Abdul Jabbar1 and Muhammad Amjad Ali1,3,*
...ts a huge number of crop plants. It also infects the ornamental plants resulting in a serious growth-limiting factor in ornamentals. In this study, the response of ten ornamental plants to M. incognita was assessed in pot experiments. All the ornamental plant species showed varying degree of infection of M. incognita. Rhapis excels and Ophiopogan japonicas were ...

Muhammad Suhaib1*, Ijaz Ahmad2, Masooma Munir3, Badar-Uz-Zaman1, Bushra Atta4 and Muhammad Khubaib Abuzar5 

...mical parameters of crop plants however lower level of salicylic acid 0.25 mM was found more efficient then the higher level of salicylic acid. Salicylic acid induced improvement is significant regardless of stress environment or normal growth conditions.
 

...

Safdar Ali1*, Obaidullah Shafique1, Tariq Mahmood2, Muhammad Amir Hanif1, Ijaz Ahmed3 and Bashir Ahmad Khan

...s by DNA transfer in the plants or nanoparticle-mediated gene. Biofuel production from biomass is estimated to speed up using nanotechnology. Researchers and manufacturers have to demonstrate that the application of nanotechnologies have no harmful effect on the atmosphere against the anomaly based only on small amounts of toxicological research and concerns about the safety of nanomaterials.

...

Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4  

...ile the distance between plants to plant was 30 cm. The seed was sown in the first week of August. The following parameters were studied in the experiment i.e. days to flower initiation, days to flower completion, plant height, days to maturity, stem diameter, head diameter, number of leaves, 1000 seed weight and seed yield per hectare. Quality parameters were consisted upon oil content (%), protein content (%), and fatty acid profile. The results showed that ...

Ghufran ul Haq1*, Muhammad Arif2, Asad Ali2 and Mian Inayatullah3 

...eflies inoculated tomato plants. Transmission properties of the virus were determined by inoculation of tomato plants of susceptible cultivar, Roma-VF, by whiteflies, determining the minimum time required for acquisition and inoculation of the virus, latency period and the persistence capacity. The highest incidence of 9.47 percent of TYLCV was recorded in Mohmand Agency, followed by Malakand Agency with 8.2 percent, Shabqad...

Fayaz Ahmad1*, Noorullah Khan1, Farrukh Siyar Hamid1, Qamar uz Zaman1, Shamsul Islam1, Muhammad Abbas Khan1 and Sair Sarwar

...replications. Mature tea plants (26 year old) of Qi-men variety were deeply pruned (30 cm from the ground level by completely defoliating the bushes) on five different dates i.e., November, December, 2012, January, February and March, 2013 having one month interval. Application of potash fertilizer @ 90,120 and 150 kg ha-1 was also compared with control for studying its role in the recovery and growth of deeply pruned tea. The earliest shoot sprouting (April, ...

Shamsher Ali1*, Sarmad Khan1, Muhammad Jamal Khan2, Naveed ullah4, Muhammad Rashid3 and Wiqar Ahmad1 

Abdul Basit1, Muhammad Zeeshan Majeed1,4*, Sohail Ahmed2, Gohar Ali2 and Muhammad Javaid

...estation on bitter gourd plants and compared it with reduced-risk insecticide formulations of spinosad. Refractive sheets of red, orange, yellow, green, blue, black and white were installed in M. charantia beds at three different angles (30º, 60º and 90º). Results revealed that control treatment exhibited significantly higher fruit fly infestation (60%) with minimum marketable fruit yield (374g/bed) than all other treatments. Among treatments, y...

Muhammad Fiaz1*, Muhammad Afzal1 and Muhammad Zeeshan Majeed1,2 

...c insect pests of citrus plants and a putative vector of Huanglongbing worldwide. Treatments were comprised of label-recommended (FD) and its half (HD) dose rates of spirotetramat and I. fumosorosea formulations. Both treatments were applied either alone or in binary combinations. There was a significant reduction in psyllid population for all treatment combinations as compared to control (F8, 107 = 70.36; P-value = 0.001 for 2016 and F8, 107 = 63.58; P-value ...

Abdur Rehman and Zahir Shah 

...lant and root growths of plants. These results suggested that application of both Mo and Fe is necessary for pea crop enhanced nodulation, N2 fixation, yield, nutrient uptake and for improved soil fertility 

...
Qudsia Yousafi1,*, Muhammad Afzal2, Muhammad Aslam3 and Allah Ditta Abid4
...twenty randomly selected plants. The percent fruit infestation in all three treatments was lower than control except on June 15 when infestation in control and in plots having light traps was not significantly different. Seasonal means for fruit infestation reduced fruit infestation by 16.1, 9.6 and 19.5 percent in T1, T2 and T3, respectively as compared to control.
...

Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2 

... sprayed-glucose treated plants showed increasing trends in grain yield under drought. Physio-chemical attributes were also modulated by exogenously applied carbohydrates. Nitrate reductase activity and total soluble proteins were increased with increase in sugar treatments under drought. Osmotic and water potentials were reduced under drought but foliar glucose sprays of 10 mM and 50 mM applied at reproductive phase significantly reversed the adverse effects ...

Ali Sher1*, Khalid Naveed1, Gulzar Ahmad2, Ayub Khan1, Muhammad Saeed1 and Shah Masaud1 

...roving N availability to plants improve biomass production and also increase the shoot Fe content and accumulation of Zn in wheat plants. Experiments were conducted at the Cereal Crop Research Institute (CCRI) Pirsabak, Noweshera, Khyber Pakhtunkhwa, Pakistan during 2014-15 and 2015-16 to study the response of wheat to N, Zn and Fe application. Treatments included three levels of N (90, 120 and 150 kg ha-1), three concentrat...

Ashraf Khan1*, Suliman Shah2, Maid Zaman3 and Komal Habib2

...ortality was observed in plants treated with combination of Nitenpyram + Chlorfenapyr (99.20 and 99.89 %) followed by Flubendiamide (89.83 and 99.39 %) and Imidacloprid (89.31 and 98.77 %) after spray 1 and 2, respectively. Least effective insecticide was proved to be Melathion with 39.79 and 65.43 percent reduction in citrus psyllidspopulation except untreated plants with 9.27 and 15.94 percent decrease after first and seco...

Abdur Rehman1* and Shad Khan Khalil2 

...uce drought tolerance in plants. Field trials were conducted at Agricultural Research Institute Tarnab, Peshawar-Pakistan to study the effects of moisture stress and foliar application of chemicals at different growth stages on canola growth and phenology during 2015-16 and 2016-17. The experiment comprised of four moisture levels (optimum water, 10%, 20% and 30% reduced irrigation water), three chemicals (salicylic acid 0.5mM, potassium nitrate KNO3 1% and me...

Shamsher Ali1, Zakir Ullah Jan1*, Zahir Shah2, Muhammad Jamal Khan2, Farmanullah Khan2, Inayat ur Rahman3 and Shah Fahad3 

... 20000 kg ha-1. The Azam plants were taller than hybrid. The treatment (T5) significantly yielded more grain (6806 kg ha-1) and (5106 Kg ha-1) from hybrid (CS-200) and a local maize Azam cultivar, respectively. Similarly, stover yield of hybrid (10378 Kg ha-1) and Azam (7708 Kg ha-1) were more in T5 than the other treatments. So, it is concluded that the combined application of farmyard manure and balanced inorganic fertilizer (Nitrogen + Phosphorus) gave sign...

Sabahat Noor*1, Shaukat Ali1, Hafeez-ur-Rahman1, Farhatullah2 and Ghulam Muhammad Ali1 

...rmed and non-transformed plants. It was observed that under drought and salt stresses, proline contents, sugar contents, chlorophyll contents and relative water contents (RWC) were significantly higher in transgenic plants as compared to non-transgenic plants. From obtained results it is concluded that, increase level of RWC, proline, sugar and chlorophyll in transgenic

Umair Riaz1*, Muhammad Ali Kharal2, Ghulam Murtaza3, Qamar uz Zaman4, Sana Javaid4, Hina Ahmed Malik3, Humera Aziz3 and Zafar Abbas1 

...anic compounds that help plants to cope with stress conditions by reducing the intensity of stress through enhancing antioxidants activities, detoxifying toxic ions, regulating the uptake of nutrients and by mediating the transport and distribution of different hormones. Caffeic acid is actively involved in plant physiology and mechanisms of stress tolerance primarily utilized by plants for the synthesis of lignin which ulti...
Ghazunfar Rashid1, Muhammad Avais1, Syed Saleem Ahmad1, Muhammad Hassan Mushtaq2, Rais Ahmed3,*, Mahboob Ali1, Muhammad Naveed-ul-Haque4, Mehtab Ahmad5Mumtaz Ali Khan1 and Naimat Ullah Khan6
...rent parts of the fodder plants were estimated qualitatively through the Diphenylamine Filed Test (DFT) and quantitatively by spectrophotometry. The nitrate levels were highest in Jowar, followed by Jai, Shaljam, Makai, Bajra and Sarson. The concentrations were lower in the afternoon in the leaves and in mature crops as compared to stem parts, immature plants, and in samples collected from plants
Sajid Ali Khan1, Mazhar Hussain Ranjha1, Azhar Abbas Khan2,*, Muhammad Sagheer1, Amjad Abbas1 and Zeshan Hassan2
... two different medicinal plants (Dhatura alba and Calotropis procera) against two different strains of T. granarium. Plant extracts were obtained by Rotary Shaker apparatus by using acetone as solvent. Four different concentrations 5%, 10%, 15% and 20% were prepared by diluting in acetone. The data regarding mortality, growth regulation and repellency of T. granarium was observed. Repellency of plant extracts was tested using area p...

Syed Atif Hasan Naqvi1*, Ummad-ud-Din Umar1, Ammarah Hasnain2, Ateeq ur Rehman1 and Rashida Perveen1 

...agronomic traits of rice plants. The reduction of disease in all the trials along with healthy crop stand in glass house and field indicated that these decoctions might play an important role in biological management strategies for the control of BLB of rice. The present research may provide an avenue for the formulation of new bactericides for future uses. 

...

 *Muhammad Waseem1, Dost Mohammad Baloch1, Ghulam Khaliq1,
M. Rashid1, Qurban Ali2 and Mustajab A. Khan3

INTENSIFICATION IN BAMBOO (Bambusa bambos L.) TRAITS IN RESPONSE TO ORGANIC AND CHEMICAL NITROGEN ALONG THE COAST OF ARABIAN SEA
...mboo (Bambusa bambos L.) plants were grown with four fertilizer sources i.e. S = Control (0) kg N ha-1, S = urea (120 kg N ha-1), S = Farm Yard Manure (FYM 1% N), S = 0 1 2 3 Combination {50% N from urea (the recommended dose) + 50% N from Farm Yard Manure (FYM)}. A recommended dose of nitrogen was used as chemical source and applied at the rate of 120 kg N ha-1. Significant differences were reported for studied traits in response to treatments. The results in...

 Muhammad Akram and Faheem Aftab

THIDIAZURON INDUCES IN VITRO BUD BREAK AND SHOOT DEVELOPMENT FROM NODAL EXPLANTS OF ORTHOTROPIC SHOOTS OF MAIDENHAIR TREE (GINKGO BILOBA L.)
...e cut to prepare nodal explants (5-10 mm long), surface sterilized and inoculated on MS (Murashig and Skoog, 1962) medium supplemented with different concentration (0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1,2,3,4 or 5uM) of TDZ for 24 days. Highest bud break (100%) was obtained at 0.005 uM TDZ after 14 days of initial culture. The same cultures were further maintained and subsequently obtained with 20.6 mm shoot length and 7.2 average number of leaves for another ...

Farah Deeba, Hafiz Abdullah Shakir, Muhammad Irfan, Javed Iqbal Qazi*

Chitinase production in organisms: a review
...life (bacteria to higher plants and animals) as one of the most durable, richest biopolymers distributed widely in nature both in the terrestrial and marine environments. Chitinase are chitin degradable enzyme have control of phytopathogens, physiological functions and degradation of chitinous waste. Interest in chitin wastes utilization is increasing day by day because of its natural resistance against degradation. The review focused on different sources of n...

Shaukat Ali1,*, Sundas Nasreen1, Sobia Safeer1, Saiqa Andleeb1, Mubashir Ejaz1, Saira Bano2, Hafiz Abdullah Shakir3

Medicinal plants as therapeutic agents for cancer treatment
... cancer.

...

 Zubair Ahmed#, Muhammad Farhanullah Khan, Habiballah Rana*

Toxicological effects of Haloxylon recurvum Bunge ex Boiss (Khar Boti) whole plant extract and novel insecticide chlorantraniliprole against maize weevil, Sitophilus zeamais Motschulsky
...nsecticides derived from plants have increased popularity in
stored products protection due to ecological concerns and insect resistance to
chemical insecticides. In these regards, a study were carried out to evaluate
toxicity of crude methanol extract of whole plant of Haloxylon recurvum (Khar boti)
and a novel insecticide chlorantraniliprole. A serial concentration of extract i.e.,
1.2%, 2.4%, 3.6%, 4.8%, 6.0% and insectici...

 Hafiz Muhammad Tahir1*, Zafar Iqbal Khan2, Saira Batool2, Kafeel Ahmad2, Salma Begum2

Residual effect of lambda-cyhalothrin on abundance of insect pollinators in marigold field patch
...secticide treated
plants for one hour. The mortality rate of honey bees in the control and insecticide
exposed group was compared. Overall, a significant decline in plant pollinators was
observed after application of lambda-cyhalothrin on the patch of marigold plants.
Lambda-cyhalothrin caused significant mortality (15/20=75%) in honey bees in
semi-field experiment. It is concluded that lam...

 Zafar Iqbal1, Muhammad Farooq Nasir1, Imran Bodlah1*, Rahmatullah Qureshi2, Ayesha Aihetasham3

Notes on three morphs of Bulaea lichatschovii (Hummel) (Coleoptera: Coccinellidae) from Northern Pakistan
...s species
on many plants. In this study, three morphs of B. lichatschovii are reported during
2015-2017 from different localities of Northern Pakistan (Gilgit-Baltistan and Azad
Jammu and Kashmir). Three food plants of the coccinellid are, Krascheninnikovia
ceratoides, Artemisia vulgaris and A. maritima, are documented. Notes on
diagnostics of the species are given with illustrations and ne...

 Muhammad Khalil Ahmad Khan1*, Muhammad Zafar2, Munazza Perveen3, Munir Ahmad3, Asia Iqbal4, Asmatullah3

Efficacy of malathion and carbosulfan against crop invadedaphid types Aphis craccivora (Koch) and Aphis gossypii (glover) on bean and brinjal plants
...ared on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathion with LC50 as 20.11 μg cm-2 for A. craccivora and 25.28 μg cm-2 for
A. gossypii while carbosulfan was found to be least toxic with LC50 as 312.80 μg
cm-2 for A. craccivora and 322.25 μg cm-2 for A. goss...
Muhammad Muddassir Ali1,2 and İbrahim Hakkı Ciğerci1,*
... the world. Many endemic plants all over the world have magical therapeutic potential. These could be explored further for medicinal purposes and hence can be preserved for their proper propagation. Thermposis turcica is endemic to Turkey. It’s general anti-oxidant and anti-cancerous activities are explored, but no study has been observed on liver cancerous cell line in term of its genotoxicty. So, genotoxic evaluation was carried out for the alco...

Ali Zohaib1*, Saima Yousaf1,2, Shakeel Ahmad Anjum1, Tahira Tabassum1, Tasawer Abbas3, Wardah Muzaffar1 and Wasiq Ikram2 

...4V4 produced the tallest plants. In conclusion, seed inoculation of soybean improved the growth, allometric traits and dry matter yield of soybean, and could be employed for the betterment of crop productivity. 

...
Mirza Imran Shahzad1, Hina Ashraf2,*, Muhammad Arshad3, Sabeeha Parveen4, Amna Aslam4, Nargis Naz4, Zahid Kamran1, Sumbul Gohar Khalid5, Sajid Hameed1, Muhammad Ashfaq6 and Muhammad Mukhtar7

 

...even selected Cholistani plants against New Castle Disease Virus (NDV)-LaSota strain. All of these plants were reported for their different pharmacological activities but their antiviral potentials were not known before. The methanolic extracts were made and concentrated by rotary evaporator and finally dissolved in distilled water before taking their antiviral trials in 7-11 days old chicken embryonated eggs. The viral load...

Muhammad Salman Wazir and Mohammad Akmal 

... in maturity with taller plants at the split N application of NAT2 and NS3 as compared to the NS1. Likewise, better traits of wheat plant and hence the yield including grain wet gluten content were reported for the treatment NS3 as sole wheat crop, followed by the intercropped with fababean. Among the intercropping, IC-I with fababean showed better future scope of wheat crop production under the changing climate to produce higher production per unit area with ...

Muhammad Tahir Amin, Khalid Usman*, Muhammad Waqas Imam Malik and Nishter Ali

...7th day) produced taller plants (139 cm) and more sympodial branches (18.3) compared to less frequent irrigations (10-19th day). However, 19th day irrigation interval significantly improved seed cotton yield and fiber quality traits (fiber length, fiber strength, micronaire, and fiber uniformity). Likewise, phosphorus at 150 kg ha-1 significantly improved seed cotton yield (3794 kg ha-1) and ginning out turn (39.1%) compared to other phosphorus levels. In conc...

Nighat Seema1*, Muhammad Hamayun1, Husan Ara1 and Raham Sheer Khan

...culously with their host plants and may be more capable to solubilize nutrients from soil and provide it to their hosts. In current study, endophytic fungi inoculation significantly affected the soil properties such as soil texture, organic matters, EC and pH with or without 8% PEG induced drought stress. Upon inoculation of different endophytic fungi with or without drought stress, the trend in pH values of soil remain variable (7.61~7.96) compared with the p...

Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6 

...ent availability to crop plants. A field experiment was carried out to determine the effect of seed inoculation with PGPRs on yield and quality of different genotypes of soybean. Seed inoculation treatments [control (no treatment), nitrogen fixing bacteria (Rhizobium japonicum) and phosphorus solubilizer (Pseudomonas fluorescens)] were applied to three different cultivars of soybean (EBR4V4, Freedom and Swat-84). The results showed that seed inoculation with R...

Salman Ali*, Inamullah, Muhammad Arif, Mehran Ali, Muhammad Owais Iqbal, Fazal Munsif and Arsalan Khan 

...of maize crop and taller plants with higher number of grains ear-1, 1000-grain weight, biological and grain yield, and harvest index were observed in plots irrigated five times. Likewise, 75 kg K ha-1 application resulted in higher biological (plant height and biological yield) and grain yield (grains ear-1, thousand grains weight, grain yield and harvest index) components of maize. Increase in K levels beyond 75kg ha-1 showed a slight decrease in yield. It is...
Shamesa Maryam1, Ajaz Ahmad Sandhu1, Imran Bodlah2*, Muhammad Asif Aziz2, Ayesha Aihetasham3

 

...ted from twenty two host plants at six different localities of Gujranwala area of Punjab province, Pakistan. Total 12 species namely; Aphis craccivora, Aphis fabae, Aphis gossypii, Aphis nerii, Rhopalosiphum padi, Lipaphis erysimi, Macrosiphum euphorbiae, Myzus persicae, Pentalonia nigronervosa, Sitobion avenae, Greenidea (Trichosiphumpsidii and Cinara (Cupressobium) t...

Muhammad Naveed Afzal1, Muhammad Tariq1*, Muhammad Ahmad1, Khuram Mubeen2, Muhammad Ayaz Khan3, Muhamamd Umer Afzal4 and Shakeel Ahmad

...densities (8.88 and 4.44 plants m-2) were assigned to main plot and four nitrogen rates (0, 50,100 and 150 kg N ha-1) were kept in sub plots with three replications. The PD was maintained by altering the within plant spaces keeping the row spaces (75 cm) constant. The results indicated that significant PD X N interaction was observed for plant biomass components i.e. the high PD (8.88 plants m-2) with 0-N produced 16.80%, 25...

 Saira Zaheer1, Abrar Hussain1*, Aqsa Khalil1, Muhammad Mansha1, Muhammad Lateef2

...ines and local medicinal plants are being explored to control the parasitic worms. The aim of this study was to evaluate the anthelmintic potential of two local plantsAlbizia lebbeck L. and Camellia sinensis L against H. contortus using Adult Motility Assay (AMA). Crude Ethanolic Extracts (CEE)of dried leaves of A. lebbeck L. and whole plant of C. sinensis L. were prepared by ...

Ummad-ud-Din Umar1, Syed Burhan-ud-Din2, Muhammad Fahad Khan1, Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Muhammad Asif Zulfiqar3, Azhar Ali Khan3 and Naila Ilyas1

...e resistance in mungbean plants by triggering the SA pathway. Induced resistance was assessed by evaluating the appearance of symptoms and detection of virus titter through ELISA. Different concentrations of SA and BTH were exogenously applied to activate the inherent resistance of mungbean by the production of defense associated compounds. All treatments were supportive in suppressing plant infection as compared to infected control, but the most promising out...

Muhammad Aslam Rajput1,3, Imtiaz Ahmed Khan2, Rehana Naz Syed3 and Abdul Mubeen Lodhi3* 

...se development. Diseased plants produced profuse tillers, but of no use as emerging tillers were very weak. Significant positive correlations were found among the disease incidence and other traits as well as between numbers of whips and tillers. 

...

Shakeel Ahmad Anjum1, Muhammad Mohsin Raza2, Sami Ullah1, 3*, Malik Muhammad Yousaf2, Ahmad Mujtaba1, Mumtaz Hussain2, Muhammad Jahangir Shah2, Bashir Ahmad2 and Ijaz Ahmad4 

...), plant population (7.2 plants m-2) and stem diameter (1.58 cm), cob length (19.1 cm), biological yield (19.5 t ha-1) and harvest index (37.0%), while lowest grain yield (3.08 t ha-1), number of grains per cob (319), 1000 grain weight (204 g), plant height (174 cm), plant population (6.2 plants m-2), stem diameter (1.28 cm), cob length (14.9 cm), biological yield (12.1 t ha-1) and harvest index (30.5%) were obtained from th...

Sabi-Ur-Rehman1, Anwar Khalid2, Qazi Najam Us Saqib3, Farooq Ahmad1, Shaheed-Ur-Rehman4, Neelam Zaman3, Ayeza Mehmood5 and Abdul Samad6*  

...biotic drugs resistance, plants provide source for discovery of new antimicrobial drugs. This study was carried out, include in-vitro antibacterial and antifungal screening of aqueous methanolic extracts as well as crude saponins isolated from leaves and roots of Sarcococca saligna, using disc diffusion method. The tested bacterial strains include, B. subtilis, E. coli, S. aureus, P. fluorescens and fungal strains were Aspergillus. niger, A. flavus, and D. tur...

 Syed Turab Raza1,*, Zhu Bo1,*, Zulfiqar Ali2 and Tang Jia Liang3

... to recover nutrients of plants such as NPK (nitrogen, phosphorus, calcium). A vermicomposting system using the earthworm species (Eisenia fetida) and treating it with cattle dung, pig manure and biochar with crop (wheat straw and rapeseed) waste was established in upland areas of China. It was monitored for two months. Four treatments (T1 to T4) were prepared using crop residues i.e. wheat straw, rapeseed and cow manure in different concentratio...

Khadim Hussain Wagan1*, Muhammad Ibrahim Khaskheli2, Jamal-U-Ddin Hajano1 and Abdul Ghani Lanjar2 

...(46.67%) was recorded in plants inoculated with MPS16 isolate followed by MPS17 (43.33%) and MPS12 (43.0%). Similarly, length of necrotic lesions was also significantly higher in MPS16 (6.67 cm) followed by MPS17 (6.33 cm), MPS12 (6.30 cm), MPS15 (6.17 cm) and MPS 13 (6.07 cm). The predicted isolate (MPS16) was aligned with different species and observed that MPS16 belongs to M. phaseolina isolate. The sequence showed high identity with sequences with Macropho...

 Abdul Khaliq1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Akhlaq Ahmad2 and Yasir Iftikhar3

...0% concentrations of all plants but E. Camaldulensis (5%) was least effective against all insects after control. Resurgence response in F1 generation in each experiment showed high multiplication rate at low concentrations and vice-versa also suppressed against N. tabacum and C. procera. Hence, developing PH3 resistance can be managed with bio-pesticides up to extant and need more work to make it applicable in field.<...

Saqib Bashir* and Bashir Ahmad 

...g N ha-1 produced taller plants with height of 104.4 and 104.0 cm, heavier grains with 52.0 and 50.8 g weight per thousand grains, higher biological yield 11986 and 11859 kg ha-1 and optimum grain yield 4161 and 4147 kg ha-1. Results indicated that the integration of 90 days older pigeon pea green manuring with 90 kg nitrogen ha-1 can be the best recipe for better and sustainable wheat production. 

...
Ahmed Ali Samejo* and Riffat Sultana*
...ctive pest to the useful plants. Morphology and morphometry of immatures of desert locust in relation to gaining of body length and weight at each consecutive stage was carried out for the purpose of investigating the role of immatures in destruction of plants in Thar Desert, Sindh. Hatchlings of solitarious S.gregaria were light green at the time of emergence, but turned over to black with yellow strips after two hou...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
...in microbes, animals and plants. The asparaginase of bacterial origin has been extensively applied in the treatment of childhood lymphomas and leukaemia. However, the glutaminase activity of enzyme can cause serious side-effects triggering a search for highly specific and more stable enzyme. In the present study the gene consisting of 972bp coding for 323 amino acids was PCR amplified from Geobacillus thermodenitrificans DSM-465 was PCR amplified and re...
Ashfaque Ahmed Nahiyoon1,*, Shahina Fayyaz2 and Nasira Kazi2
...s associated with cotton plants in Sindh. During 2017–2018 extensive surveys were conducted at the time of cropping and at harvesting and soil root samples were collected from different fields in the cotton producing regions of five districts of Sindh viz., Sanghar, Mirpurkhas, Umerkot, Mityari and Tando Allahyar. The analysis of samples resulted in the identification of one new species of soil nematode viz., Acrobeloides gossypii n....
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...c enzymes, widespread in plants, fungi and microorganism, gain commercial importance for improving the yield and nutraceutical properties of juice processing industry, degumming of fibre plants and maximum oil recovery. These enzymes break down complex polysaccharide polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin was purified by salting out with ammo...
Bushra Siddique1,*, Muhammad Tariq1, Muhammad Naeem1 and Muhammad Ali2
...fferent cues released by plants to increase the efficiency of foraging. Aphid endoparasitoid, Diaeretiella rapae (McIntosh) (Hymenoptera: Braconidae) have an ability to locate itshosts by responding to odours from aphid hostplants or by visual searching.The treatments with different combinations of plant extracts and semiochemicals were used for natural enemypreference experiment. The experiment was conducted with sev...

Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2 

...ial diets and ornamental plants on parasitoid performance. Among artificial diets tested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the fiel...
Faraz Akrim1,2, Tariq Mahmood1,*, Muhammad Sajid Nadeem3, Siddiqa Qasim1, Shaista Andleeb1 and Hira Fatima1
...ic prey contributed 19%, plants 14%, grits 2%, and anthropogenic matter (plastic bags, and threads) 5%. In comparison, 17 dietary items were recorded in the diet of small Indian mongoose, including 10 wild, 1 (one) domestic and 6 plant species. Consumption of wild prey was 60%, domestic prey 17% plant matter 11%, grits 2% and anthropogenic matter ~10%. Dietary niche breadth of Indian grey mongoose was found broad (0.83) during autumn season but narrow (0.36) d...
Shamsudin Bojang1, Idris Abd Ghani2, Jugah Kadir1, Adamu Saidu Paiko1, Yasir Iftikhar3 and Muhammad Kamran3,4,*
...age the greens and other plants in other part of the world then the probability for the specie to adapt to other hosts other than the family of poaceae under Malaysian climate should not be discounted. Therefore, screening and restriction of movement of planting materials be observed critically.
...
Lichao Feng1,2, Shaoqing Zhang4, Dianyuan Chen2, Sina Adl3 and Donghui Wu1,4*
...ed to different types of plants associated with their farmland habitat, as follows: mixed pollen and nectar of flowers (Erigeron annuus, Trifolium repens, Heteropappus hispidus, Potentilla chinensis, Hibiscus trionum), or leaves of grasses (Poa annua, Echinochloa crusgalli), or maize leaves (Songyu 419, a hybrid variety) as food sources to feed the adult of A. fuscicollis. The larvae were reared...

Muhammad Yasin1, Romana Shahzadi1, Muhammad Riaz2, Mahideen Afridi2, Wajya Ajmal3, Obaid Ur Rehman2, Nazia Rehman3, Ghulam Muhammad Ali1,3, Muhammad Ramzan Khan1,2,3* 

...developing genome edited plants to prevent yield losses in canola in future. 

...

Kamran Aziz1*, Aamir Saleem1 and Arshad Mahmood Malik2 

...ir role to decompose the plants parts such as roots, shoots, leaves and other parts. The present study was conducted to estimate the decomposition rate, litter fall production and elemental composition of Cedrus deodara and Pinus wallichiana in the study area Dungagali, Taohidabad, Kuzagali and Khanspur situated around the Ayubia National Park. The research was carried from September, 2016 to August, 2017. Litter bag technique was used to estimate the decompos...

Abdul A. Mirani1,2*, Chee H. Teo2, Adel A. Abul-Soad3, Ghulam S. Markhand1, Tahira Jatt1, Ameer A. Mirbahar1,4, Najamuddin Solangi

...lm (Phoenix dactylifera) plants derived from immature inflorescences. In this study, three to four years old field grown tissue cultured date palm plants of cvs. Kashuwari and Gulistan derived from in vitro subculture 1-10 (block I) and 11-25 (block II) in multiplication stage were screened for type and nature of phenotypic abnormalities. Six phenotypic abnormalities were detected: 1) dwarfism, 2) excessive vegetative growth...

Muhammad Affan Khan* and Abdur Rab 

...Star were grown at three plants spacing i.e. 20, 30 and 40 cm and were evaluated for growth and seed production. Variety Arka Anamika had the maximum plant height (136.8 cm), number of branches per plant (1.42), number of pods per plant (26.33), number of seeds per pod (60.67), seed weight per pod (3.87 g) and seed yield (4.54 t ha-1). The plant spacing of 20 cm resulted in the maximum plant height (136.92 cm) but minimum values for all other attributes. 40 cm...
Tariq Mukhtar1,* and Muhammad Arshad Hussain2 
...It is concluded that the plants of moderately resistant cultivar Sanam suffered less damage and suppressed nematode infections at all inoculum levels and therefore, recommended for cultivation in root-knot nematode infested fields to abate yield losses and repress the nematode from further multiplication. 
...

Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2 

Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah

...culated and uninoculated plants were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry weight of plants was increased at 0-50mM NaCl and decreased at 100-300mM NaCI concentration. Inoculation effectively increased the dry weights of plants at salinity levels of 0-50 mM NaCI as compared to uninoculated

Ammara Saeed* and Noor-ul-Amin 

...rowth and development of plants. A Randomize Complete Block Design experiment was laid with split plot arrangement at Ornamental Horticulture Nursery, Department of Horticulture, The University of Agriculture Peshawar during 2014 and 2015. Cut flower rose cultivars were tested with treatments of 3 levels of phosphorus (30, 60 and 90 kg ha-1) and potassium (20, 40 and 60 kg ha-1) each as well as combined. Results showed that when plants...
Asad Abdullah, Muhammad Irfan Ullah*, Abu Bakar Muhammad Raza, Muhammad Arshad and Muhammad Afzal
...ure. Suitability of host plants is critical for the efficient management of this economically important insect pest. We studied the effect of various host plants on the growth, development and fecundity of S. litura. The larvae of S. litura were offered leaves of cabbage, alfalfa, sesbania and, maize in comparison to artificial diet under laboratory conditions (32±05 oC; 65±05 RH). Thel...

Muhammad Usman Ghazanfar, Muhammad Imran Hamid, Mubashar Raza, Waqas Raza*, Misbah Iqbal Qamar 

...es promote growth of the plants and commercially used as bio-fungicide against soil borne plant pathogens. The present study was conducted with the aim to determine the efficacy of Trichoderma species using dual culture and pot assays against Phytophthora infestans (late blight) and Fusarium oxysporum (wilt) of tomato on different compost including carbon rich compost, nitrogen rich compost and nutrient enriched compost. The species of Trichoderma includes T. ...
Muhammad Tariq Adnan Khan*, Tariq Mukhtar and Muhammad Saeed
...gths and weights. As the plants of moderately resistant cultivar Brinjal Jamak suffered less damage and suppressed nematode infection considerably and therefore, recommended for cultivation in root-knot nematode infested fields to abate yield losses and repress the nematode from further multiplication. 
...

Muhammad Amin1,2*, Khalid Mahmood2 and Imran Bodlah3 

...ird-finding, 11 new host plants and 71 new locality records in Pakistan. Aphis gossypii and Aphis craccivora were found infesting 8 tree species in 8 genera and 6 in 6 genera respectively. Rosaceae with 5 species in 4 genera carrying 9 aphid species in 5 genera was the most aphid-prone family. Systematics, host range, distribution of the related aphids and catalogue of host plant-tree species in the studied area from Pakistan are given herewith. 

...

Muhammad Arshad1, Muhammad Irfan Ullah1*, Muhammad Afzal1, Mian Anjum Murtaza2, Ejaz Ahraf3, Zahoor Hussain4, Syed Muhammad Ali Zahid1 and Maryam Riaz1 

...t pests attacking citrus plants in Pakistan. The study was conducted to quantify the leaf area damage of eight citrus cultivars caused by mining activity of CLM during summer 2016. The total leaf area and mine area per leaf were calculated by the image analysis method using Sigma Scan Pro 5.0 software. The results of the present study showed that CLM generated larger mines; 1.64 cm2 on Grapefruit, 1.44 cm2 on Kinnow and 1.40 cm2 on Succari compared to other fi...

Masood Ahmad* and Abdur Rab 

...h demand for its quality plants especially cut flowers. Gladiolus is commercially propagated by corms. The quality and health of corm is one of the important factors that affect the production and quality of gladiolus florets and spikes as well as corm production. Keeping in view, the significant role of calcium in plants and its potential effects on vegetative attributes and quality production of gladiolus corms, an experim...

Muhammad Zeeshan Manzoor1*, Ghulam Sarwar1, Mukkram Ali Tahir1, Noor-Us-Sabah1, Ayesha Zafar1 and Sher Muhammad2 

...>The general response of plants to soil and water salinity depends upon climate, soil characteristics, topography and management strategies. Water, even may be saline, is becoming more precious natural resource. Hence, there should be more crops and jobs per drop while conserving the quality of present terrestrial and groundwater. Saline water has been used for production of fodder and forages in many countries. Managing soil and water salinity under prevailin...
Manzoor Hussain*, Marie Maňasová, Miloslav Zouhar and Pavel Ryšánek
...ion were observed in the plants treated with Lecanicillium muscarium and both chemicals. Lecanicillium muscarium treatments alone or with nematodes had significant (P = 0.01) positive effects on plant shoot and root growth among all other treatments in the experiment. After L. muscarium and the chemicals (Vydate and Basamid), Stropharia rugosoannulata ranked second in reducing the nematode numbers of gall...
Qudsia Yousafi1*, Muhammad Aslam2 andShahzad Saleem1
...eaves per plant and four plants per plot and averaged per leaf. Numbers of ladybeetles were recorded from the whole plant by sampling three plants per plot. Seasonal mean number of aphids per leaf was at the maximum on the variety Black Beauty and lowest on Nirala, during the 2013-14 growing season. During the 2014-15season the maximum number of aphids per leaf was recorded on the variety Round Black and lowest on Nirala. Wh...
Tahsin Razzaq*, Muhammad Fareed Khan and Shahid Iqbal Awan
...to impact of NCLB. Maize plants were artificially inoculated at four to six leaf stages. Thirty genotypes were screened in first field trail in June 2016. Genotypes had significant differences for NCLB severity and reactions and were classified into resistant, susceptible and moderate categories on the basis of 0-5 disease severity scale. The percent disease incidence ranged from 20-60% and area under disease progressive curve (AUDPC) 22-362dsu (Development st...

Muhammad Khuram Razzaq1,2*, Saeed Rauf1, Mohsin Khurshid3, Shahid Iqbal1,4, Javaid Akhter Bhat2, Ayaz Farzand5, Adeel Riaz1,6, Guangnan Xing2 and Junyi Gai

 

...the substantial stage in plants and fertile pollen are important for proficient plant reproduction. Abiotic stresses reduce the photosynthates production, thus genotypes also reduce the reserve mobilization for tapetum cells which induce the significant reduction in pollen fertility. Therefore, pollen fertility index can be exploited to discriminate resistant and susceptible genotypes under abiotic stresses. High heritability in the segregating generation warr...

Muhammad Irfan Ullah1*, Muhammad Arshad1, Muhammad Imran Khan1, Muhammad Afzal1, Azhar Abbas Khan2, Syed Muhammad Ali Zahid1, Muhammad Saqib1, Asad Abdullah1, Saba Kousar1 and Maryam Riaz1 

... modifies the ability of plants to resist against insect feeding is an interesting and important component in an integrated pest management program. In the present study, water stress was applied to field grown cotton with two Bacillus thuringiensis transgenes (CIM-602 and CIM-599) and one non-transgenic genotype (CIM-554) for the performance of H. armigera feeding The difference in leaf injury, relative consumption and growth rate of H. armigera was detected ...

Mazhar Habib1, Aamir Saleem1, Arshad Mahmood Malik2*, Sarfraz Ahmed3 and Sameera Arshad4 

...cally, proportion of its plants with vegetative stage declined. This decline of plants with vegetative stage can cause distraction to livestock depending on the species for grazing purposes. It is suggested that two month clipping stage should be applied on Blue panic grass to get sustained grass vigor and optimum herbage yield. 

...

Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2 

...functions to protect the plants against different forms of stresses. In this study, the feedback-insensitive serine acetyltransferase (SAT); a rate-limiting enzyme for Cys biosynthesis from tobacco i.e. NtSAT4 was successfully cloned into three types of overexpression constructs i.e. pBinAR_NtSAT4 (targeted to cytosol), pBinAR-TKTP_NtSAT4 (targeted to plastids) and pBinAR-SHMT_NtSAT4 (targeted to mitochondria). For stable transformation of B. napus floral-dip ...

Tanveer Ahmad1*, Muhammad Mujtaba Rafiq1, Waqas Ahmed Dogar2, Abid Mahmood Alvi3, Qumer Iqbal4, Muhammad Azam5 and Arshad Ali Khan6 

...tica L.). Healthy phalsa plants were fertilized with P2O5 @ 50g, 100g and 150g plant-1. Data were recorded on number of fruit bush-1, yield bush-1 (kg), single fruit weight (g), fruit diameter (cm), number of fruiting nodes, length of new shoot (cm), number of sprouted shoots cane-1 and leaf area (cm2). Treatments were applied under Randomized Complete Block Design (RCBD) in triplicates and means were compared by Tukey’s HSD test. Association of the biol...

Muhammad Abdul Qayyum1*, Farhat Bashir2, Muhammad Mudassar Maqbool3, Anser Ali3, Saqib Bashir1 and Qaiser Abbas4 

...ered a severe threat for plants seed germination because it has highest concentration of soluble salts. This study aims to examine the effect of NaCl salt at 100 mM and 200 mM concentrations on linseed (Linum usitatissimum L.) germination, plant growth, nutrients and soluble salts uptake. The results revealed that tested four linseed genotypes showed an overall germination rate of 86-94% at 100 mM NaCl (T2) and 78-84% at 200 mM NaCl (T3) and seedling survival ...

Sibgha Noreen*, Sumrina Faiz, Muhammad Salim Akhter, Kausar Hussain Shah 

...These molecules help the plants to regulate osmotic adjustment and to enhance abiotic stress tolerance in plants. This study was aimed to examine mitigation effects of different osmoprotectants (salicylic acid, ascorbic acid, proline and their admixture) @ 200 mgL-1 on sunflower (Helianthus annuus L.) grown under saline environment (150 mM NaCl). The results showed that salinity stress (150 mM) resulted into significant decr...

Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh* 

...) and internode (100%) explants was observed in cv. Desiree using Agrobacterium strain GV2260, while the highest gene transfer efficiency rate for leaf and internode explants in S. chacoense M6 were obtained with AGL1. The highest callus formation for both cv. Desiree and S. chacoense M6 was obtained on cv. Desiree leaf explants, transformed via the Agrobacterium strain GV2260. The lowest ...

Manzoor1*, Ahmad Khan1, Amir Sohail2, Shahzad Ali1, Fawad Ali Shah3, Junaid Iqbal3, Muhammad Owais Khan4 and Sultan Nawaz4 

...ters excluding number of plants at harvest. Full irrigation (10 irrigations) had significantly more plant height (189.25 cm), 1000 grain weight (211.25 g), leaf area (425.95 cm2), number of leaves (16.23), grain yield (3352.75 kg), biological yield (10726.08 kg) and shelling percentage (47.78). Whereas one irrigation missing at six leaves stages produced maximum Harvest index (33.99 %). In case of planting methods, ridge planting had significantly higher plant...

Hassnain1, Abdul Basit1*, Mehboob Alam1, Imran Ahmad1, Izhar Ullah1, Noor Alam2, Inayat Ullah3, Muhammad Areeb Khalid1, Muhammad Shair4 and Noor ul Ain1 

...ys) were given to tomato plants from 15 days after transplantation. Results showed that various application of chitosan and water stress interval had a significant (P< 0.01) effect on almost all studied parameter. Tomato plants treated with 6 days water stress interval had maximum average plant height (82.69 cm), average number of leaves (104.02), leaf area (81.47 cm2), chlorophyll content (71.31 SPAD), relative wate...

Noorullah Khan1*, Farrukh Siyar Hamid1, Fayaz Ahmad1, Sabaz Ali Khan2, Imtiaz Ahmed1, Muhammad Abbas Khan1, Shamsul Islam1, Abdul Waheed1, Basharat Hussain Shah1 and Hussain Shah

...5.5 cm) were recorded in plants treated with 3000 ppm IBA. Contrarily the longest roots of 50.7 cm were observed with IBA concentration of 5000 ppm. Correlation analysis revealed that SSR % and growth of kiwi seedlings are strongly associated with NFARP as we found strong correlation (P<0.001) among NFARP, SSR% and plant height. In addition, the main root length also showed moderate correlation (P<0.05) with plant height but it was not correlated with SS...
Umer Iqbal1,* and Tariq Mukhtar2
...mination and survival of plants. Doses also had a significant effect on the germination and plant survival. Maximum germination and survival were recorded where the seeds were treated with a concentration of 150 ppm and minimum was recorded in case of 50 ppm concentration. With a decrease in the concentration, the germination and survival decreased significantly showing a direct relationship between concentrations and plant survival. Benomyl at 150 ppm concent...

Ghulam Murtaza1*, Ghulam Sarwar1, Noor-Us-Sabah1, Mukkram Ali Tahir1, Fakhar Mujeeb2, Sher Muhammad3, Muhammad Zeeshan Manzoor1 and Ayesha Zafar1  

...uch as height of sorghum plants, diameter of stem, number of plants/ m2, total biomass of fresh plants were noted. Among all the treatments, T7 (T1 + organic matter @ 10 Mg ha-1) performed the best which produced the highest values of growth parameters. However, the treatment T3 (water of EC 3.0 dS m-1) proved inferior to all others with respect to height of sorghum <...

Muhammad Qaisar Nawaz*, Khalil Ahmed, Ghulam Qadir, Muhammad Rizwan, Muhammad Faisal Nawaz and Muhammad Sarfraz 

...nt/m-2, number of leaves/plants, root length, bulb diameter, forage yield and total bulb yield. Results revealed that all the studied parameters were significantly improved with nitrogen application @ 80 and 100 kg ha-1 in ridge sowing. However, 80 kg N ha-1 in ridge sowing documented maximum economic benefit as compared to other treatments and is suggested as most cost-effective technique for turnip production under moderately salt-affected soils. 

...

Saleha Ashfaq1, Manzoor Hussain1, Nazish Bibi2, Jan Alam1, Muhammad Junaid2 and Sabi-Ur-Rehman3*

....) C.C. a narrow endemic plants of northern areas of Pakistan. The antimicrobial potential of H. gilesii extracts in different solvents was assessed using agar well diffusion method against bacterial and fungal strains, while cytotoxic activity was studied in the methanolic extract using brine shrimp’s lethality assay. All the extracts showed significant biological activity against Gram positive, Gram negative bacteria and selected fungal strains. Aceton...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

...sing levels of NaCI. The plants treated with 50 mM NaCI had maximum amount of protein contents as compared to those at 0mM NaCI level. Varieties CM91 and CM2000 had higher protein contents than CM44 and CM98. At I/50 level of salinity the total protein contents were found more than inoculated control at 0mM NaCI. From this study, it is concluded that PGPRs can play an important role to mitigate the salt stress at different concentrations for better crop yield....

Mohammad Aquil Siddiqui1*, Muhammad Tahir Khan1, Ghulam Shah Nizamani1, Shafquat Yasmeen1, Imtiaz Ahmed Khan1, Abdullah Khatri1 and Nighat Seema Soomro2 

...genetic structure of the plants as an indispensable tool for crop improvement. This field study was initiated to evaluate three potential mutant lines of lentil against their parent (M-85) and two check varieties (NIA-Masoor-05 and NIA-Masoor-16). The pooled data of the crop, after two years of evaluation, indicated the earliest maturity in the mutant AEL-40/30 (92.0 days). Plant height was observed to be low in all the studied mutant lines (AEL-40/30, AEL-13/...
Muhammad Irfan Ullah1*, Muhammad Arshad1, Sajjad Ali2, Asad Abdullah1, Samina Khalid3, Hafiz Muhammad Aatif4, Syed Muhammad Ali Zahid1, Muhammad Afzal1 and Jaima Molina-Ochoa5
...ment.

...

Muhammad Rasheed*, Tayyaba Naseer, Asma Hassan, Fayaz ul Hassan, Rifat Hayat, Ghulam Jilani, Samman Gul Vaseer and Muhammad Bilal Ali 

...s on the roots of legume plants. To ensure an optimum rhizobial population in the rhizosphere is necessary that improves the nodulation, N2 fixation and growth of legume crops. The experiment was conducted to access the effect of isolated bacteria from nodules on growth and nodulation of the lentil cultivars. Different cultivars were used in this experiment; Markaz 2009, Masoor 2009 and NIA 2005 treatments were used viz BS0 (control), (Pseudomonas stutzeri), B...

Amna Qazi1, Ghulam Shah Nizamani2*, Muhammad Tahir Khan2, Shafquat Yasmeen2, Shahla Karim Baloch1, Muharram Ali1, Imtiaz Ahmed Khan2, Sagheer Ahmad3, Muhammad Rashid Nizamani4 and Mohammad Aquil Siddiqui

... vegetatively propagated plants through in vitro culture. This study was conducted to establish the optimal concentrations of plant growth regulators and sucrose for micropropagation of sugarcane. Sugarcane is cultivated through cane sets and therefore, multiplication of any new genotype through traditional practices requires interminable period of time. Eight sugarcane genotypes viz. NIA-2004, SPF-234, NIA-2012, BL4, AEC92-1208, Thatta-10, Gulabi-95 and ...
Sumaira Akram1, Sajid Aleem Khan1*, Nazir Javed1 and Saeed Ahmad2
...of eggs were observed in plants treated with in aloe vera extract. Protective and curative treatment with plant extracts, biocontrol agents and chemicals suppressed the disease and enhanced plant height and root weight. All treatments evaluated in this study exhibited suppression of MG. Therefore, these treatments can be used in combination against MG infestation on wheat.
...

Muhammad Zamin1*, Abdullah Khan1, Ibadullah Jan1, Fazli Rabbi2, Shahen Shah3, Rashid Ali1, Kaleem Ullah1 and Muhammad Amin4 

...lications. There were 10 plants in each replication. The highest number of florets per spike (11.42) were obtained at treatment combination of nitrogen and potash (100N +200K kg/ha) where other parameters of plant height, number of leaves, leaf length and spike length were at par with their respective maximum results. However, the lengthiest spike (88.10cm) was produced at 100kg/ha nitrogen. Similarly, the application of nitrogen at the rate of 200 kg/ha produ...

Pushpa1, Nighat Seema Soomro1, Shahla Karim Baloch2, Mehmooda Buriro1, Aijaz Ahmed Soomro1, Muhammad Tahir Khan3, Qamar Uddin Jogi1*, Muhammad Nawaz Kandhro1 and Farheen Deeba Soomro1 

...ions. The powder of weed plants produced significantly (p<0.05) harmful outcomes on all growth parameters of wheat varieties as compared to the control treatment. The maximum seed germination (82.16a %), shoot length (27.70 cm), root length (14.90 cm), shoot fresh weight (2.19 g), root fresh weight (1.16 g), shoot dry weight (0.54 g), root dry weight (0.27 g), and seed vigor index (3483.5) were recorded in variety Amber under the control (where no allelopat...

Ahmad Naeem Shahzad1, Muhammad Kamran Qureshi2, Samee Ullah1, Muhammad Latif3, Shakeel Ahmad1 and Syed Asad Hussain Bukhari1* 

... a possible strategy for plants to survive under adverse environmental conditions. The current study emphasizes the ameliorative role of trehalose, in mitigating the detrimental effects of salt stress, in cotton plants. Three concentrations of trehalose (0, 5 and 50 mM) were applied to plant foliage, subjected to varying levels (0, 11 and 17 dSm-1) of salinity. Salt stress disturbed the sodium and potassium concentrations in...
Muhammad Sarmad, Syed Muhammad Zaka* and Syed Muhammad Tahir Abbas Shah
... stems and seeds of host plants. Being a serious pest of many important crops, the present work will study on biology and bionomics of O. laetus on three different hosts Gossypium hirsutum, Abelmoschus esculentus and Helianthus annuus. Shorter nymphal duration was observed on Gossypium hirsutum 20.00±0.14 days as compared to Abelmoschus esculentus 21.00±0.26 days and Helianthus annuus

Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad

...t combinations on tomato plants. This research study was performed at Agricultural Research Institute, Tarnab, Peshawar-Pakistan. Different biochemical tests were conducted to confirm stem rot pathogen. Boron was applied at the rates of 1.97, 2.96 and 3.95 g seedbed-1. Plant extracts were neem (Azadirachta indica) and ghwaraskay (Dodonaea viscosa). Morphological traits such as plant height, maximum number of fruits plant-1 and yield were observed and severity ...

Muhammad Safdar Hussain1*, Muhammad Farrakh Nawaz2, Muhammad Ayyoub Tanvir2 and Noor-E-Hira

...ation, drought-resistant plants should be sorted out. The objective of this study was to explore the growth behavior of Eucalyptus camaldulensis (recommended for waterlogged areas) and Tamarix aphylla (recommended for arid regions) under water stress. Therefore, a pot experiment was carried out with three treatments: Well-watered, 25% and 50 % drought to achieve said objective. It was found that drought negatively affected plant growth. The mean heights of E. ...

Aqsa Ahmad1, Iftikhar Ahmad1* and Malik Fiaz Hussain Ferdosi

...riment I) indicated that plants grown in these soilless compositions died before flowering, while those grown in silt (control) performed best. While in experiment II, the highest quality plants were grown in 50% CC + 40% RH +10% PM. Quality was defined as plants with shortest production time (days), tallest plant height (cm), optimal leaf chlorophyll content (SPAD), highest leaf area (cm2...
Sajjad Ali1,*, M. Irfan Ullah2, Asif Sajjad1, Muhammad Zeeshan Majeed2, M. Aslam Farooqi1, M. Shahid Rizwan3, Qaiser Shakeel4, Sohail Akhter1,Muhammad Raheel4 and Muhammad Arshad2
...ters with different host plants in terms of their physicomorphic attributes has been the subject of great interest with point of their integrated pest management. Helicoverpa armigera (Noctuidae; Lepidoptera) -being highly polyphagous- is the pest of many crops and exhibits high fecundity and migrating efficiency. The present study aimed to evaluate its physicomorphic responses towards different host plants. The highe...

Anila Latif, Zaheer Abbas, Farhatullah and Ghulam Muhammad Ali* 

...alkaloid and produced by plants of family Berberidaceae. Berberine Bridge Enzyme (BBE) gene involved in the synthesis of berberine was isolated from Berberis lyceum and over expressed in Arabidopsis thaliana. The integration of the BBE gene in transgenic lines was confirmed through PCR while the expression was confirmed by Reverse Transcriptase PCR. Whole plant bioassay confirmed 100% mortality in DBM within 72 hours. The present investigation concludes that t...

Muhammad Usman Ghazanfar1, Waqas Raza1*, Waqas Wakil2,3, Imtiaz Hussain4 and Misbah Iqbal Qamar

...stify;">Pre-treatment of plants with chemical elicitors can induce systemic resistance against plant pathogens and insect herbivores. The plan of the study was to study induction of defense responses and protective effects against Phytophthora infestans (Mont.) de Bary and sucking insect pests of potato (Solanum tuberosum L.) with application of salicylic acid (SA) and β-aminobutyric acid (BABA). Concentration of SA and BABA (2, 4 and 5 mM) were applied t...

Abid Khan*, Mukhtar Alam and Yousaf Jamal 

...igher LAI (0.99), taller plants (89 cm), higher CGR (8.76 g m-2 day-1), delayed maturity (171 days) and more chlorophyll a and b (1.95 and 0.64 µg ml-1) were achieved while using NS6 as compared to other nitrogen sources. Significantly more leaves and leaf area tiller-1 (5.2 and 34.3 cm2), higher LAI (1.18), taller plants (93.8 cm), higher CGR (10.27 g m-2 day-1) and greater chlorophyll a and b (2.30 and 0.75 µg ...

Muhammad Medrar Hussain*, Asad Jan* and Sayyar Khan Kazi 

...se rice calli transgenic plants were regenerated and established in greenhouse. For the evaluation of OsTZF8 gene role in drought stress tolerance, two weeks old rice seedling were subjected to drought stress. OsTZF8-OX transgenic indica line A and B displayed 69% and 64% survival rates respectively compared to 33% of control. These results confirmed that due to overexpression of OsTZF8 gene, transgenic line A and B displayed considerable level of drought stre...

Gulnaz Parveen1*, Salma Gul2, Muhammad Ather Rafi3, Ashfaq Ali Khattak4 and Hikmatullah Jan

...ced the growth of tomato plants. Infection % of all test fungi included Fusarium solani, Fusarium oxysporum, Macrophomina phaseolina and Rhizoctonia solani was significantly controlled by leaf powder (LP) and shoot powder (ShP) when applied alone and with combination. While combinations of 3% LP + 3% ShP, 3% LP + 5% ShP, 5% LP + 1% ShP, 5% LP + 3% ShP, 5% LP + 5% ShP completely controlled the infection of Macrophomina phaseolina. Similarly combination of 5% LP...

Samman Gul Vaseer1, Muhammad Rasheed1*, Muhammad Ansar1, Yamin Bibi2, Saqlain Shah1, Asma Hassan1, Lubna Ayub Durani1, Muhmmad Asif3 and Zuhair Husnain

...in the nodules of legume plants. However, the variable reports for Cobalt (Co) effects on plant growth and crop yields urged to research and verify if the Co is an essential component particularly for leguminous crops. A greenhouse study was

Ayesha Zafar1, Ghulam Sarwar1*, Muhammad Sarfraz2, Muhammad Zeeshan Manzoor1, Sher Muhammad3 and Ghulam Murtaza

...culture in Pakistan. The plants in saline environment are negatively affected due to several issues like low osmotic potential, specific ion effect, and nutritional imbalance. The fertilizer behavior in salt stress conditions is quite different as compared to the normal soils. Linseed is an important oil seed crop. Its 50 % yield reduction occurs at ECe 5.9 dSm-1 and ESP value of 25-30. A field experiment was conducted on saline sodic soils to determine fertil...

Wajiha Anum1*, Liaquat Ali1, Umair Riaz2*, Abid Ali1, Nadia Manzoor3, Laal Hussain Akhter4, Asad Ur Rahman5, Naeem Maan6 and Ijaz Ahmad

...of metabolic function in plants. However, it is not readily available to the crop because of its immobile nature. In order to ensure its efficient uptake by crop, an experiment was conducted to appraise the effect of various P placement methods and fertilizer rates on wheat. The fertilizer treatments were F1=150-00-60 NPK kilogram/hectare, F2=150-30-60 NPK kilogram/hectare, F3=150-60-60 NPK kilogram/hectare, F4=150-90-60 NPK kilogram/hectare, F5=150-120-60 NPK...
Fehmina Ashraf1*, Muhammad Irfan2, Hafiz Abdullah Shakir1, Shaukat Ali3, Muhammad Khan1
...ous species of bacteria, plants and in different genera of fungi. Laccases have been purified by various methods. It involves in di-oxygen to water reduction and 1e- oxidation of phenolic and its allied parts. Laccases are mostly used in different industries like food, paper and pulp, pharmaceutical and textile etc. Both laccases and mediators have been used in different process like delignification of pulp. Laccases from bacterial species are used in dye deco...

Zubair Aslam and Ali Ahmad* 

...maize hybrid P30B74. The plants were harvested 45 days after sowing and the evaluation was done on the basis of various morphological (root length, shoot length, root fresh weight, shoot fresh weight, root dry weight, shoot dry weight, number of leaf, leaf length, stem girth) and physiological parameters (relative water contents (RWC), chlorophyll contents and membrane stability index (MSI)). The obtained results indicated that vermi-fertilizers and chemical f...

Hafiz Abdul Ghafoor1*, Muhammad Afzal1, Muhammad Luqman2, Muhammad Arshad Javed2, Syed Wasim Hasan3 and Muhammad Zeeshan Majeed

...) as compared to control plants. Results of 2nd experiment also clearly demonstrated a significant impact of different treatments on the mealybug infestation (F12, 103 = 58.75, P < 0.001; HSD at α = 0.05) as compared to control. At both 3 and 7 days post-treatment, maximum reduction of mealybug infestation was recorded in plots treated with spirotetramat (87.75±3.91%) and lambda-cyhalothrin (85.52±4.42%) in combination with EPF followed ...

Jawad Ali Jan1, Ghulam Nabi1, Maqsood Khan1,2*, Shehzad Ahmad1, Peer Sikandar Shah1, Saddam Hussain1 and Sehrish

... are applied to the crop plants in different farms to improve its production and nutritional value. This experiment was conducted at Agriculture Research Institute (ARI) Tarnab, Peshawar during summer 2016. Two factors i.e. Chilli varieties (Magma and High fly) and humic acid levels (0, 25, 50, 75 and 100 g L-1) were applied in the field during experiment. The results of the experiment showed that High fly variety took minimum days to produce flowering (33 day...

Javed Iqbal1, Ali Zohaib1*, Muzzammil Hussain1, Adnan Bashir1, Muhammad Hamza2, Wardah Muzaffer3, Muhammad Tahir Latif1 and Naeem Faisal1 

... improved the emergence (plants per m2), number of productive tillers per m2 and grain yield (3-7%) of all wheat varieties although productive tillers per plant, number of grains per spike and 1000-grain weight was decreased. Faislabad-08 performed better regarding grain yield and related components among all varieties. Seed rate and varieties did not interact significantly for studied traits. Correlation analysis revealed that grain yield was positively corre...

A. S. M. El-Nuby1† , S. A. Montasser2 and I. A. El-Khadrawy

Control of root-knot nematodes using wild plants colonized Sinai, Egypt
...RKN). The selected seven plants viz., Artemisia judaica, A. monosperma, Bassia muricata, Cornulaca monacantha, Salsola kali and Zygophyllum album with different dilutions (25%, 50%, 75% &100%). The potent nematicidal efficacy observed in the extract of A. judaica followed by A. monosperma. In vivo trial post inoculation treatments were effective than pre one, the maximum reduction in nematode population was recorded by A. judaica (87.0%) followed by A. mon...

 M. M. A Youssef and W. M. A. El-Nagdi †

Effect of some temperature changes on the population density of some plant parasitic nematode species
...e parasitic nematodes on plants viz., date palm and olive in both soil and roots was investigated. These nematodes were negatively correlated with the prevailing average soil temperature during four seasons (autumn= 20°C; spring= 22°C; summer= 27°C and winter= 14°C).

...

Rashid Nawaz*1, Iftikhar Hussain1, Sikandar Bilal Khattak1 

KEY PERFORMANCE INDICATORS IDENTIFICATION AND PRIORITIZATION FOR ENVIRONMENTAL SUSTAINABILITY IN THE CEMENT MANUFACTURING INDUSTRY IN PAKISTAN USING ANALYTICAL HIERARCHY PROCESS
...senting
24 cement plants were analyzed using Analytical Hierarchy Process (AHP). The proposed KPIs are supposed to
assist the decision makers in achieving environmental sustainability. Among the 11 KPIs identified, the KPI “Total
amount of Emissions in Metric tons of CO2 equivalent per year” was identified as having the highest impact on
environmental sustainability.

...

Razaullah1*, Iftikhar Hussain1 

A TWO-WAREHOUSE SUPPLY CHAIN NETWORK DESIGN AND OPTIMIZATION WITH CROSS-ROUTE COSTS AND BUDGET, MAXIMUM FLOW AND CAPACITY CONSTRAINTS
...oduction capacity of the plants, stocking capacity of owned and rented
warehouses and traffic factors on the supply routes in the mathematical model further broadened the problem. A case
study is solved to analyze how the model performs with the changing network characteristics. 

...

Nazish Huma Khan1, Mohammad Nafees1, Adila Bashir1, Farooq Ahmad1 

STUDY OF POLLUTION LAOD IN PAPER MILL EFFLUENTS AND ITS RECYCLING BY SUNDRY PLANTS AT HAYATABAD INDUSTRIAL ESTATE, PESHAWAR
... via recycling of sundry plants. For this
purpose a detail study was conducted at paper mills and sundry plants at Hayatabad Industrial Estate. The plants
were examined for operation and sampled for waste water. Total 7 waste water samples were collected from selected
points of Paper mills, Industrial drain and Sundry plants. Samples...

Inamullah Khan1*, Amjad Usman2  and Rahamdad Khan2

The Mortality Rate of Pupae and Adult of Fruit Fly Bactrocera cucurbitae Coquillett (Diptera: Tephritidae) Affected by Different Submerging Time and Soil Types under the Laboratory Treatment
...gation of fruit fly host plants standing in clay loam or silt clay loam soil texture may help in controlling the overwintering pupae in the orchards.

...

Sajjad Haydar*, Zunaira Asif*, A. A. Bhatti**, Obaidullah Nadeem***, Ghulam Hussain*, Nadeem Abbas*

EFFICIENCY OF WASTEWATER TREATMENT PLANT IN THE PUNJAB TANNERY SECTOR: A CASE STUDY OF DADA TANNERY
...div>wastewater treatment plants to address the issue. This study aims to evaluate the performance of wastewater
treatment plant (WWTP) of a local tanning industry. Raw wastewater showed high concentration of organic matter
and Chromium. Phosphorous concentration was found deficient for satisfactory biological treatment. WWTP showed
overall removal efficiency of 88.81, 84.54 and 62.31% for total suspended solids (TSS), five d...

Shahida Nasreen Zakir*, Samina Siddiqui**, Nasreen Ghaffar*

MAJOR ELEMENTS CONCENTRATIONS IN CALCAREOUS SOILS
... hence is unavailable to plants. Calcareous soil has more than 15% of CaCO3 at pH ranged from 7.5 to 8.4. Iron was also found to be low in calcareous soils. Such soils are required an improved nutrient management in such a manner that soil contact of P, K and Fe can be minimized.
...
Naeem Ejaz*, Daulat Khan**, Usman Ali Naeem*, Muhammad Ali Shamim*, Muhammad Fiaz Tahir*, Faisal Shabbir*, Jawad Hussain*
DETERIORATION OF ORDINARY PORTLAND CEMENT AND FLY-ASH BASED GEO-POLYMER CONCRETES DUE TO SULFATE ATTACK UNDER THE ACTION OF SULFURIC ACID AND WASTEWATER
...and wastewater treatment plants has been a major problem but this issue has not been resolved satisfactorily yet. Generally, deterioration happens due to sulfuric acid reaction with treatment units and sewer materials. Geo-polymer binders especially fly ash (FA) is an acid resistant and can be used as a substitute binder for sewer construction. This research work highlights the laboratory results of fly ash based geo-polymer concrete and ef...

Shahid Ali1, Habib Akbar2, Shamsher Ali3*, Adnan Nasim1, Muhammad Ismail1, Nur Ul Haq1 and Muhammad Usman4

Effect of Planting Sources, Cane Portions and Setts Placement Methods on Sugarcane Yield Attributing Traits
... also found that tallest plants with maximum biological yield were recorded in canes top portion with triple setts placement methods. Minimum results were observed for all the traits when bottom portion from trenched planting source was planted at single setts. Study suggests that planting fresh cane top portions with double and triple setts placement methods are better than trenched planting for cane yield and yield attributing traits.

...

Muhammad Riaz1*, Naureen Akhtar1, Salik Nawaz Khan1, Muhammad Shakeel1,2 and Ateeq Tahir1

Neocosmospora rubicola: An Unrecorded Pathogen from Pakistan Causing Potato Stem Rot
...rubicola infected potato plants were necrotic stem lesions near the collar region. Causal organism was isolated from the infected tissues, purified and identified on the basis of morphological characters, nucleotide sequences of internal transcribed spacer region (ITS) and partial beta tubulin gene. Phylogenetic analysis was also conducted to determine the phylogenetic relationship of this species with other reported species of this genus. Pathogenic potential...

Saba Iqbal1*, Muhammad Luqman1, Hafiz Muhammad Nasrullah1, Asmat Ullah1 and Hafiz Muhammad Akram2

Response of Cotton to Application of Organic and Inorganic Source of Nutrients in Semi-Arid Climate
...tment resulted in taller plants (121 cm), more number of sympodial branches (19.9), more number of bolls per plant (26), higher boll weight (3.6 g), higher seed cotton yield (1792 kg ha-1) and benefit cost ratio (BCR) (1.8:1) followed by the treatment where 30 kg urea ha-1 was applied in combination with 8 t ha-1 slurry. In conclusion, combined application of urea and FYM @ 30 kg ha-1 and 8 t ha-1, respectively could be the economical approach to attain the hi...

Sikander Hiyat1, Nazim Hussain1, Muhammad Ishaq Asif Rehmani2*, Muhammad Nasir Abbas2, Smana Raza3, Javed Shabbir Dar4 and Tauqeer Ahmad Yasir5 

...ts, widely spaced cotton plants (RS3, 75 cm) without application of mepiquat chloride produced maximum seed cotton yield as compared to all other spacing levels. Ultra-narrow row spacing (RS1, 25 cm) Combination of narrow row spacing (RS2, 50 cm) and mepiquat chloride application slightly higher seed cotton yield. Ultra-narrow row spacing must carefully use to exploit in the cotton production system was appeared to be a viable alternative approach for successf...

Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu

...ght stress analysis. All plants were grown in pots under greenhouse conditions, and were subjected to 20-day drought stress by withholding irrigation, followed by re-watering for 5 days. The changes in leaf water content (LWC), electrolyte leakage (EL), concentrations of photosynthetic pigments, protein, soluble sugar, hydrogen peroxide (H2O2), malondialdehyde (MDA), ascorbate (AsA) and reduced glutathione (GSH), activities of superoxide dismutase (SOD) and pe...

Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood

... tarits of horticultural plants. A field trial was carried out in 2018-19 aiming at the evaluation of impacts of new commercial products “Quantis” and “Acevit-C” on growth, yield and antioxidative behaviour of bottle gourd cv. Aakash F1. Three level of Quantis (6 ml, 8 ml, 10 ml) and Acevit-C (100 ppm, 150 ppm and 200 ppm) were applied as foliar treatment following RCBD design. Results showed that impact of foliar application of both Qu...

Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1

Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...the uses of these native plants were recorded such type of study was concluded for the first time in the selected area of Dir (Upper). In view of the fact that these plant species are scarcely distributed, hence struggle should be made to protect them. The key objective of the present study was to file the taxonomic knowledge and the local and medicinal uses of the root juice of Desmodium elegans DC, combined with the bark juice of Bauhinia malabarica for the ...
Muhammad Rizwan1*, Bilal Atta1, Ana Maria Marino de Remes Lenicov2, Roxana Mariani2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Misbah Rizwan4, Muhammad Sabar1, Ch. Muhammad Rafique1, Muhammad Afzal5
...nthoppers and their host plants were studied in the “Kallar” tract of the Punjab, Pakistan (an important growing area of the world for producing Basmati rice). Planthoppers are considered the most important pests of rice. Delphacidae and Cixiidae are families of planthoppers with the most harmful species. Delphacids are primarily vector of the viruses, whereas Cixiids are vectors of phytoplasmas, mycoplasmas and prokaryotes-like associated to ...

Muhammad Ismail1, Tufail Ahmad2, Shamsher Ali2*, Shahid Ali1, Nur Ul Haq1 and Naveedullah3

Heavy Metals (Pb and Ni) Pollution as Affected by the Brick Kilns Emissions
...etal content of soil and plants around the brick kiln chimneys was studied in 2009-2010. The research was carried out on Peshawar Ring Road’s south direction between chimneys of bricks preparation that were named A and B with distance of 300 m. The kilns were positioned such that Southern direction of chimney of A was north for the chimney B. A total of 36 (18+18) soil and wheat leaf samples were collected in four directions. Samples were collected at va...
Safina Naz1, Syed Atif Hasan Naqvi2*, Bushra Siddique3, Muhammad Asif Zulfiqar4 and Abdur Rehman5 
 
Exogenous Application of Selected Antioxidants and Phyto Development Directors Influenced the Development, Output and Biochemical Attributes of Tomato (Lycopersicum esculentum Mill.)
... to significantly taller plants and greater leaf area while, shorter plants and lower leaf area was recorded in control. Greater leaf number per plant was obtained with application of GA3(100 ppm). This was followed by salicylic acid (200 ppm). Leaf number was significantly lesser in the plants grown in control. Significantly greater fruit count /plant, length of fruit including sole fruit...
Tabassum Yaseen1*, Shehzad Ahmad1, Khushnood Ur Rehman2, Fayaz Asad1, Abdul Waheed1, Rani Gul3, Hussain Gulab4 and Naveed Akhtar2
Arbuscular Mycorrhizal Fungal Spore Density and Root Colonization in Weeds of Carrot field at Charsadda, Pakistan
...biotic associations with plants through roots. It forms the multi colonization systems with the roots and provide benefits to the host plants. The present study was conducted to evaluate the occurrence and distributions of Arbuscular mycorrhizal fungi in the rhizospheric soil of major weeds of District Charsadda. In the present study roots and rhizospheric soil of 15 weeds species belonging to 12 families were collected from...

Mohammad Javad Golmohammadi1, Hamid Reza Mohammaddoust Chamanabad1*, Bijan Yaghoubi2 and Mostafa Oveisi3

GIS Applications in Surveying and Mapping of Rice Weeds in Guilan Province, Iran
...ant species with 9 and 8 plants/m2, respectively. Echinochloa crussgalli and C. difformis with a density of 5 plants/m2. Weeds were non-uniformly distributed in various families including Cyperaceae, Poaceae, Lythraceae, Polygonaceae, Asteraceae, and Salviniaceae that accounted for 36 species (54.5 percent). Accurate and specific weed maps are the key to achieving all the benefits of weed management. When in an area the dist...

Shahid Nadeem1*, Taj Naseeb Khan1, Mushtaq Ahmad1, Adnan Younis2 and Iram Fatima3

Influence of Plant Growth Regulators by Foliar Application on Vegetative and Floral physiognomies of Gladiolus
...osition among ornamental plants due to its captivating spikes, with plane ruffle and deeply crinkled sepals, and it mainly used as cut flower and greatly demanded in floral markets. In order to achieve the maximum outcomes for the purchaser or community, a comprehensive study was conducted on gladiolus to enhance its vegetative and floral characteristics with the foliar application of growth hormones i.e. gibberellic acid (GA3) and salicylic acid (SA). The res...

Tahseen Ullah* and Noor ul Amin

In Vitro Antibacterial Activity of Medicinal Plant Extracts
...vities of four medicinal plants, Silybum marianum, Berberus lycium, Peganum harmala and Curcuma longa and standard antibiotic tetracycline was carried out in the biosafety level 3 Microbiology Lab, Faculty of Life Sciences, University of Bradford, Bradford, UK. Two different concentrations (low, 5 mg/ml and high extracts, 300 mg/ml) of these plants were evaluate against two different bacterial strains i.e. Bacillus subtilis ...

Shaiza Rasool1, Iftikhar Ahmad1*, Khurram Ziaf1, Irfan Afzal2, Muhammad A.S. Khan1, Muhammad Aashir Sajjad1 and Muhammad Zain Ali1

Seed Conditioning Effects on Germination Performance, Seedling Vigor and Flower Production of Zinnia elegans
...TW) produced the tallest plants (104 cm) with longer internodes and the largest canopy diameter (42.4 cm). Using MLE along with MTW produced greater plant fresh weight (137 g), more flowers (27.5), and larger flower diameter (9.7 cm) similar to the results of using MTW alone. In summary, seeds primed with MLE in combination with untreated water or MTW resulted in improved plant growth and yield characteristics and may be recommended to commercial growers of zi...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...izes. Tallest (43.08 cm) plants, maximum number of leaves plant-1 (22.17), florets spike-1 (22.79) and number of bulblets produced plant-1 (22.03) were found in soil amended with humic acid. However, the least days (85.22) to flowering were observed in planting medium amended with potting soil and largest bulblets (2.14cm) were found in compost amended sandy soil. As far as the effect of bulb size is concerned, maximum days to flowering (97.44), plant height (...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...izes. Tallest (43.08 cm) plants, maximum number of leaves plant-1 (22.17), florets spike-1 (22.79) and number of bulblets produced plant-1 (22.03) were found in soil amended with humic acid. However, the least days (85.22) to flowering were observed in planting medium amended with potting soil and largest bulblets (2.14cm) were found in compost amended sandy soil. As far as the effect of bulb size is concerned, maximum days to flowering (97.44), plant height (...
Sri Nuryani Hidayah Utami*, Andin Muhammad Abduh, Eko Hanudin and Benito Heru Purwanto
Study on the NPK Uptake and Growth of Rice under Two different Cropping Systems with different Doses of Organic Fertilizer in the Imogiri Subdistrict, Yogyakarta Province, Indonesia
...xt-align: justify;">Rice plants are commonly cultivated in a grid system with a plant spacing of 25 cm x 25 cm. The modification of spacing to increase nutrient uptake by providing plant free area (PFA) for better air circulation and sunlight distribution needs to be further studied. This study examined the differences in NPK uptake and rice growth in organic farming using the grid system and the cropping system with longitudinal rows given space in between. T...

Malik Abdul Rehman1, Shafqat Ali1, Muhammad Babar Shahzad Afzal1, Muhammad Nawaz Khan1 and Mujahid Ali2*

Efficacy of Chemicals and Botanical Extracts to Control Citrus Canker on Kinnow in Sargodha Region
... bearing trees of Kinnow plants. There were nine treatments, control (no chemical was applied), Neemsol @ 5 ml, copper oxychloride @ 3 g, streptomycin sulphate @ 1 g, potassium acetyl benzoic acid @ 10 ml, difenoconazole @ 0.5 ml, extracts of Acacia nilotica @ 10 ml, Datura alba @ 10 ml, and Allium cepa @ 10 ml. These treatments were used by mixing in 10-liter water. The foliar spray was applied four times a year, i.e. March-April and August-September. The res...

Muhammad Imran1,2*, Shahbaz Talib Sahi1, Muhammad Atiq1 and Amer Rasul3

Brown Leaf Spot: An Exacerbated Embryonic Disease of Rice: A Review
...es the defense system of plants and reduces the disease. The plants which are scarce nutrients are more prone to disease as compared to nutrient deficient. The pathogen damage is compensating by a specific nutrient that reduces the disease through tolerance. Good management practices are those which include all possible combinations of cultural, biological, chemical, induce resistance, nutrient management, natural byproducts...
Abida Parveen1, Sajid Aleem Khan1, Nazir Javed1, Anam Moosa1*, Khushboo Javaid1, Hina Safdar1 and Asma Safdar2
...ignificantly enhanced in plants treated with MO extracts, SK and their combinations compared to MI treated control plants. The total number of infective juveniles/g root and soil, galls, egg masses, females were highest in MI treated plants while lowest in plants treated with a combination of MI + SK + aqueous MO + ethanolic MO after 60 days of inoculati...

Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4

Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...cument host and non-host plants in cultivated fields of Bagh district, Azad Jammu and Kashmir. Total of 111 vegetable fields from 82 locations of study areas was surveyed during summer 2013, 2014, 2016 and 2017. Okra, Eggplant, tomato, cucumber, chilies, beans and cucurbits were found most frequently cultivated vegetables in the area. RKN was found on 80 fields, with 68 out of 82 surveyed locations with 72% field incidence. Okra was found with highest field in...
Ammara Gull-E-Fareen1, 3, Imran Bodlah1*, Muhammad Tariq Rasheed1, Yasir Niaz2, Muhammad Adnan Bodlah2, Muhammad Asif4 and Nasir M. Khokhar5
...h aphids on various host plants in Pothwar. For this purpose, seven ant species were selected, identified as Camponotus compressus (Fabricius, 1787), Formica fusca Linnaeus, 1758, Formica clara Forel, 1886, Lepisiota frauenfeldi (Mayr, 1855), Myrmica aimonissabaudiae Menozzi, 1939, Tapinoma melanocephalum (Fabricius, 1793) and Tetraponera allaborans (Walker, 1859). A lot of surveys were conducted during 2015-17 ...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
...egration of antagonistic plants with the antagonistic fungi may be useful for the better control of plant parasitic nematodes.
...
Amir Aziz1*, Mukkram Ali Tahir1, Noor-us-Sabah1, Ghulam Sarwar1 and Sher Muhammad2
Effect of Rice and Wheat Straw and K-Silicate Application on Maize Growth
...ortant for the growth of plants particularly under stress. Silicon is considered as quasiessential element for plant growth. The benefits of silicate fertilization are often correlated with the amount of silicon uptake by plants. In order to evaluate the growth and yield behavior of maize crop in response to different source of Si (straw and potassium silicate), a pot experiment was conducted at College of Agriculture, Unive...
Zulekha Zameer, Samreen Mohsin, Ammarah Hasnain, Asma Maqbool* and Kauser Abdulla Malik
Influence of Explant Sources on in vitro Callogenesis and Regeneration in Maize (Zea mays L.)
... efficiency of various explants sources for maize tissue culture, especially the immature embryos. However, the manipulation of immature embryos as explants is hampered due to its unavailability throughout the year and low regeneration response. The present study is aimed to investigate the effect of various explants sources for callogenesis and regeneration in maize (Pioner 3025). The mai...

Malik Abdul Rehman1*, Hafiz Muhammad Ehsan2, Tehseen Ashraf2, Zulfiqar Ali Gurmani3, Sajjad Khan3 and Mujahid Ali2

Effect of Growing Media on Plant Growth of Rough Lemon (Citrus jambhiri Lush.) and Poncirus (Citrus trifoliata)
...oncirus rootstocks. Five plants per treatment were growing in black polythene bags filled with the required media using a Completely Randomized Design with three replications. Data of stem length stem diameter, number of leaves, leaf area, and survival percentage was recorded. Chemical analysis of leaf was done by taking samples from treatments were analyzed for determination of N, P, K. Results indicated that stem length, stem diameter, number of leaves, leaf...

Muhammad Yaseen1*, Muhammad Luqman1*, Zahoor Hussain2, Usman Saleem3, Asif Nawaz1, Tahir Munir Butt4 and Muhammad Umer Mehmood1

Assessment of Knowledge Level and Information Sources of Vegetable Growers regarding Tunnel Farming in District Sargodha
...ery and distance between plants and rows of plants were also answered quite satisfactorily. Farmers do not know how to overcome the increasing attack of insects, pests, and diseases in tunnel farming. Some areas were identified, which require the attention of responsible authorities for the relevant knowledge.

...
Taqiur Rahman1, Tabassum Yaseen1*, Ali Mujtaba Shah2, Samiullah3, Ghulam Jelani3, Gul Nawaz1,Qudratullah Kalwar2
...fy the leading medicinal plants used by local communities for the treatment of animals and document the threatened herbal knowledge from the elder formers (R1, R2 and R4) this study labels the ethno veterinary practices in different villages of District Shangla, where the documentation process is carried out through semi-structured questionnaires in 2017 (R1) where about seventy plant species belonging to different families of spermatophytes have been collecte...
Muhammad Ramzan, Unsar Naeem-Ullah*, Mudssar Ali and Hasan Riaz
...ok like branches of host plants. The male and female mean longevity was 6.0 ± 1.171 and 11.4 ± 1.70 days. Pale reddish brown lines were present on the dorsal side of female forewings. Female forewings were broader than male wings with dark reddish brown thorax, head and abdomen. Adult hind wings were grayish with reddish brown outer margins. The biological and morphological information of Trilocha varians described in current paper will le...

Agustine Christela Melviana1, Rizkita Rachmi Esyanti1*, Roy Hendroko Setyobudi2, Maizirwan Mel3, Praptiningsih Gamawati Adinurani4 and Juris Burlakovs5

Gene Expression Related to Steviol Glycoside Synthesis Produced in Stevia rebaudiana (Bert.) Shoot Culture Induced with High Far-Red LED Light in TIS RITA® Bioreactor System
...he propagation of Stevia plants using in vivo methods, an alternative technique of propagation using in vitro methods is needed. The micropropagation method with the RITA® (Recipient for Automated Temporary Immersion System) is used in the production of a large amount of stevia biomass in approximately a short period. The forming of flowers is one of the limiting factors interfering with the metabolite production, as the content of steviol glycoside will d...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...ene resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transproteins toxic to different plant parasitic nematodes can be expressed into tissues and cells feed upon by nematodes. Transgenic products wi...

Zubia Rahim1, Gulnaz Parveen1*, Salma Gul2 and Khushnood-ur-Rehman3

Ameliorating Effects of Salt Stress (KCl, NaCl) on Growth and Germination Parameters of Pearl Millet (Pennisetum americanum)
Arifa Khan1*, Arsalan Bashir1, Shazia Erum2, Jabar Zaman Khan Khatak1 and Aish Muhammad3
Effects of 6-Benzylaminopurine and Indole-3-acetic Acid on Growth and Root Development of Banana Explants in Micropropagation
...ot induction of banana explants micro-propagated in vitro. Explants were obtained from young suckers of 8818-william, Pisang and Brazilian varieties. The explants were cultured in vitro containing MS media and different BAP and IAA combinations. The results showed banana varieties exhibited differences for the shoot and root development and also for the number of shoots and leaves. Wialliu...

Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman

Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
...cts in mills, processing plants and storage facilities where these products are stored. The residual efficacy of spinosad was assessed by exposing the Oryzeaphilus surinamensis, Tribolium castaneum and Trogoderma granarium to the treated commodities (wheat, maize, rice and oats) at concentrations of 0.25, 0.50 and 1 mg Kg-1 under laboratory conditions maintained at 28 ± 2oC, 65 ± 5% RH and continuous darkness. Seven bioassays were conducted by re...
Yonghua Liu*, Xianhua Li, Xiongfei Yan and Gang Li
...the effect of the 4 host plants Armeniaca vulgaris (apricot), Malus pumila (apple), Prunus salicina (plum), and Amygdalus persica (peach) on the growth, development, survival, reproduction, and life table parameters of A. fimbriana were studied. Different host plants had significant effects on the growth, development, and reproduction of A. fimbriana. The overall developmental durati...
Adeen Kiran1, Umar Farooq Gohar1*, Ayesha Farooq1, Malik Muhammad Asif2 and Hamid Mukhtar1
Redressal of Antibiotic Resistance using Plant Extracts
...hytochemicals present in plants and its ability to kill these pathogens and microbial inability to develop resistance against these pathogens. Therefore, the trend has been shifting from using synthetic or semi-synthetic antibiotics to the use of medicinal plants which are the part and parcel of traditional medicines. Thus, this review article explains the different mechanisms adopted by microbial life to develop resistance ...

Sajid Ali1, Abdul Basit1,3*, Abdul Mateen Khattak1, Syed Tanveer Shah1, Izhar Ullah2, Noor Alam Khan3, Imran Ahmad1, Kamran Rauf1, Salman Khan1, Irfan Ullah1 and Intizar Ahmad1

Managing the Growth and Flower Production of Zinnia (Zinnia elegans) through Benzyle Amino Purine (BAP) Application and Pinching
...lysis showed that zinnia plants treated with 100mg.L-1 and pinched at 6 leaves stage recorded maximum days to flowering, flower persistency, branches, leaves and flowers plant-1 and stem thickness. While in case of untreated and un-pinched plants maximum flower diameter, fresh and dry flower weight, and height of plant were reported. Hence, it is concluded form the research study that BAP application (@100 mg.L-1) reduced he...

Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3 and Waqas Raza1*

Influence of Resistance Inducers on Nitrogen, Phosphorus and Potassium Contents of Susceptible Chickpea Cultivars after Inoculation with Ascochyta rabiei
...f the disease. Normally, plants are stressed by different environmental confines may be weakened and susceptible to disease and these include nutrient scarce plants. Tissue contents of potassium, nitrogen, and phosphorus of above parts of the ground of plant in three cultivars of chickpea (‘C-44’, Bittle-98’ and ‘Pb-91’) after treatment with Bion® (acibenzolar-S-methyl), salicylic acid (SA),...

Hafiz Muhammad Wasim1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Sher Muhammad3, Usman Saleem4, Muhammad Zeeshan Manzoor1, Ayesha Zafar1, Imran Shehzad1, Aneela Riaz5 and Aamer Sattar2

Impact of NaCl Toxicity on Yield and Yield Components of Rice (Oryza sativa) Grown in Aridisol
... free can be absorbed by plants. A pot study was performed to assess the poisonous impact of NaCl salinity on rice growth parameters. Selection of soil with customary characteristics was done. Various levels of salinity; < 4, 4, 6, 8, 10, 12 and 14 dS m-1 were established using NaCl salt. Soil was left for appropriate period for accomplishment of salinity. Completely randomized design (CRD) was used for layout of the experiment. Transplantation of seedlings...

Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3

Application of Nanotechnology for Insect Pests Management: A Review
...ory” comprising of plants, algae, fungi, yeast, etc. which are consists of wide array of biomolecules. There is various size and shapes of nanoparticles to be synthesized by using the naturally occurring biomolecules. These biomolecules acting as a driving force for the designing of greener, safe and environmentally benign protocols for the synthesis of nanoparticles. Insect pests are main density dependent factors that deteriorate the quality and produc...

Muhammad Umair Hassan1, Muhammad Aamer1, Muhammad Nawaz2, Abdul Rehman3, Talha Aslam3, Ubaid Afzal4, Bilal Ahmad Shahzad3, Muhammad Ahsin Ayub5, Faryal Ahmed1, Ma Qiaoying1, Su Qitao1 and Huang Guoqin1*

Agronomic Bio-Fortification of Wheat to Combat Zinc Deficiency in Developing Countries
...ny irregularties in both plants and humans. The Zn deficiency considerably reduced the plant growth, tillers production, chlorophyll synthesis, and crop yield. Moreover, in the case of humans’ Zn deficiency causes blindness, lower intelligence quotient (IQ) levels, weaker immune system, and impaired physical and mental development. Wheat crop play a chief role in daily food requirement and calories need in developing countries, however, inherently wheat ...
Faiza Altaf1, Shamim Gul1,2*, Tasawar Ali Chandio3, Gul Bano Rehman1, Attiq-ur-Rehman Kakar4, Sami Ullah4, Naqeebullah Khan4, Umbreen Shaheen5, Muhammad Naeem Shahwani6, Muhammad Ajmal7 and Misbah Manzoor8
 
 
....8% - 1166.6%) of tomato plants (as only tomato plants were analyzed for WUE). Furthermore, these amendments reduced concentration of heavy metals in plants of both crops. As compared to contaminated control treatment, amendment of biochar-poultry manure mixtures increased the concentration of soluble mineral phosphorus by 288% - 914% in soil. Our study suggests that amendment of wood-deri...
Javeria Afzal, Muhammad Abid, Faisal Hussain* and Alia Abbas
... activities of different plants viz., Amaranthus viridis, Chenopodium album, Solanum nigrum, Carica papaya and Euphorbia hirta have been evaluated against root-knot nematodes. Plants were collected from different areas of Karachi. Aqueous extracts (2, 6 and 10%) of these five plant species were made for the experiment. All selected plant species inhibited egg hatching and caused larval mort...
Wali Muhammad1*, Humayun Javed1, Munir Ahmad1 and Tariq Mukhtar2
...e infestation on brinjal plants sown at different times was at par at both the locations and was found slightly higher at farmer field. The maximum average fruit infestation (52.8 %) was observed at URF Koont on early sown crop (1st of March) while the minimum (46.3 %) was observed on crop sown on 20th of March. At Rawat, the maximum mature infestation (54.5%) was observed on late sown crop (30th of April) while the minimum mat...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
 
...ght stress of two weeks, plants were subjected to morphological, biochemical and physiological investigations. Drought stress reduced the biomass and enhanced the root length in all three wheat varieties. However, growth reduction due to drought stress was relatively lower in variety F23. While the shoot length of all three wheat varieties was decreased because of drought stress, whereas the root/shoot ratio was increased. The root length was higher in variety...

Saleem Maseeh Bhatti1*, Aslam Khan Gadehi1, Inayatullah Rajpar1, Muhammad Nawaz Kandhro2, Mukesh Kumar Soothar1 and Zohaib Ur Rehman Bughio1

 

 

...m-1). Spinach plants were irrigated with defined EC levels at 80% field capacity of a clay loam, non-saline soil. Results indicated that the growth and yield parameters of spinach genotypes were constantly decreased with an increase in EC levels of irrigation water. The plants irrigated with EC 6.0 and 8.0 dS m-1 had less fresh weight of leaves (> 30%) than the plants<...

Ahmad Ur Rahman Saljoqi, Muhammad Salim* and Iftikhar Ahmad 

 

...ree times. A total of 30 plants in each treatment were selected randomly for the data collection at 1, 2, 3, 6, 9 and 12 days intervals. Peak population of thrips (51.27 plant-1) was noticed during the last week of April. Results regarding different treatments showed that Emamectin was effective exhibiting minimum mean number of T. tabaci (nymphs 1.74 plant-1 and adults 1.31 plant-1) as compared to the rest of treatments...
Sana Khan1*, Faiza Aman1, Muhammad Ismaeel2, Zafar Ali2, Mehboob Alam1, Sadeed Iqbal1 and Taimur Khan3
 
...ers of randomly selected plants in each treatment and replication. Results showed that phosphorus levels significantly affected all growth parameters. Maximum absolute growth rate (3.31cm day-1), leaflets plant-1 (102.61), pods plant-1 (16.43), pod length (9.53 cm), root weight (4.67 g), nodules plant-1 (19.97), 100 seeds weight (40.66 g) and yield ha-1 (5.71 tons) were recorded in
Saba Shabeer1, Riffat Tahira2 and Atif Jamal3*
 
...genic species can attack plants at different stages causing considerable damage amounting to millions of rupees. One of the plant pathogenic fungi is Fusarium spp. Fusarium species are very well-known soil-inhabiting fungi that cause many economically important diseases of crops.Many species are included in the Fusarium genus, which are not only pathogenic to plants but also cause different dis...
Kartika Noerwijati1*, Sholihin Sholihin1, Tinuk Sri Wahyuni1, Rohmad Budiono2, Nguyen Van Minh3, Roy Hendroko Setyobudi4, Zane Vincēviča-Gaile5 and Lulu Husna6
 
 
...ecause the F1 plants’ ability to form tubers was not optimal, and there were even plants that only produce roots. However, there were F1 plants which had higher tuber yields than the average yield of the check varieties. The harvest index in F1 population ranged from 0.25 to 0.96 with an average of 0.75. The analysis cluster based on fresh tuber yield...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
... leaflets in numbers per plants with a range of 131.33 to 176.67 cm, 60 to 105, 41.5 to 60.0, 50.66 to 77.167 and 7.607 to 15.33, 30.33 to 82.0, respectively were significantly affected (P<0.05) by the interaction of selenium application in irrigation and foliar spray in relation to season. The effect was also significant (P<0.05) on some minerals like Cu, Mn, Zinc, Mg and Se that ranged from 0.2080 to 0.3150, 0.1260 to 0.2520, 0.2012 to 0.2970 and 18.04...

Muhammad Ihtisham1, Noor Amjad2, Muhammad Nauman3, Asghar Ali3, Khawar Riaz3, Muhammad Sajid3, Muhammad Owais Shahid*3 

 

...) and winter survival of plants (93.03%). It was concluded from the results that scarification durations of 90 and 135 min and sowing on 4th-14th April were the most effective in improving the germination, growth attributes and winter survival of Sophora.

...
Asima Batool1, Ghulam Abbas2*, Zuhair Hasnain3, Nasira Perveen4 and Muhammad Naeem Akhtar5
...inated maize seedlings / plants were placed in the glass fitted canopies, where canopy temperature was found 7-10°C higher than ambient temperature along with light reflection was enough for optimum photosynthesis. The plants were raised under heat stress environment for 15 days and harvested. Data regarding seedling parameters
Javaria Sherani1,2*, Muhammad Saleem Jilani1, Tanveer Ahmad2, Sohail Kamaran3, Abdul Manan2, Tehseen Ali Jilani2 and Mateen Sajid2
 
...that Dehli White grafted plants produced maximum yield kg/plant (60.33, 71.43, 78.00 ) followed by Mehmud Wali, Karela and Suffen scion grafts. Suffen grafted plants produced better quality fruits in terms of total soluble solids (TSS) (14.67, 15.45, 16.56 Brix0), pH and Ascorbate content followed by Karela, Mehmud Wali and Dehli White scion graft. Based on findings of the experiment, it could be recommended that Mahmud Wali...
Umair Riaz1*, Shazia Iqbal2, Muhammad Irfan Sohail2, Tayyaba Samreen2, Muhammad Ashraf1, Fatima Akmal2, Ayesha Siddiqui3, Ijaz Ahmad4, Muhammad Naveed5, Naveed Iqbal Khan5 and Rao Masood Akhter6
...e medicinal and aromatic plants (MAPs) are current hot topic in the industries for their products. MAPs used in various items like pharmaceutical industry, health care items, cosmetics, organic food items etc. MAPs are gaining global admire and most of the pharmaceutical companies filing patents on medicinal plants and their derivatives and about 40% newly approved drugs during last two decades are formulated from natural or...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
 

...re decreased in chickpea plants affected with wilt disease. Leaves of three resistant and susceptible (un-inoculated and inoculated) chickpea lines/varieties were tested to find out their ionic status (N, P, K, Ca, Mg, Na, Zn, Fe and Cu). The un-inoculated and inoculated plants of resistant and susceptible groups exhibited significant variation (
Hafiz Imran Iqbal1*, Zahir Ahmad Zahir2, Obaidur Rehman1, Rizwan Khalid1*, Abdul Waheed1, Raja Abad Raza1, Shahid Saleem1, Muhammad Rashid1, Sarosh Tariq Alvi1 and Asia Munir1
 

...y increase the growth of plants. An experiment in pot was conducted to assess the effect of combined use of rhizobia and plant growth promoting rhizobacteria (PGPR) (containing 1-aminocyclopropane-1-carboxylate (ACC) deaminase) on the growth and yield of maize under salt affected conditions. In pots three levels of salinity were developed i.e. 1.2 (original), 6 and 12dSm1 by sodium chloride (NaCl) salt. The inoculants being used for maize seeds incl...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
 

...at govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA) before lethal-temperature stress (50 °C) were assesse...
Praptiningsih Gamawati Adinurani1,*, Sri Rahayu1, Endang Dwi Purbajanti2, Devi Dwi Siskawardani3, Karina Stankeviča4 and Roy Hendroko Setyobudi5
...-height: normal;">Peanut plants use nitrogen sources from the atmosphere with the help of Rhizobium bacteria. Rhizobium was requiring P elements for root nodules formation. This study aims to determine the effects of the application of mycorrhizae at different levels that play an essential role in increasing P elemental uptake and rhizobia inoculants to improve N element fixation and root nodule formation. Rhizobia inoculant applications were allotted to main ...
Shehzadi Saima1, Maqsoda Perveen2, Muhammad Nawaz1, Khalid M. Ahmad1,* and Haider Sultan1
...evelopment and growth of plants. Therefore, the present study was planned to test the effects of potassium on Gladiolus by different treatment methods, and to find out which method is more promising. The corms of Gladiolus hybrid cv. yellow stone was used for plantation. Experiment was carried out in complete randomized design (CRD) with four replications and three fertilizer treatments (control, 2g/pot with side dressing, 2g/pot with foliar spray). Results re...
Uzma Ayaz1,* and Muhammad Fareed Khan2
 

...y randomly selecting ten plants per plot data was recorded for various traits i.e. germination percentage, flower initiation days, full flowering days, full development days, total leaves per plant, chlorophyll content (mg/cm-2), height of plant (cm), disk length (cm), thickness of stem (mm), 1000-achene’s weight (g), fresh achene’s weight (g), dry achene’s weight (g) and achene’s yield (kg/ha). This experimental study...

Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2

...tical drought stage. The plants were exposed to normal irrigation, application of bio stimulants like 2µM ABA, 10 mM SA, 15% MLE and 10% MBLE were applied at grain filling stage but skipping irrigation. Maximum growth related parameters were observed by applying full irrigation. Comparing the bio stimulants application, the application of ABA significantly increased the plants population (95.55 m-2), plant height, till...

Muhammad Usman Ghazanfar1, Waqas Wakil2, Shahbaz Talib Sahi3, Waqas Raza1* and Mahmood Ahmad Randhawa4

... than induced unstressed plants. The increase was more evident in case of Bion treatment as compared to all other treatments with SA and KOH. Similar trend was shown by plant extracts where in neem extract induced higher amino acid contents. The cultivar C-44 responds efficiently as compared with other two cultivars. The results of the current study showed that amino acids play significant role in resistance and susceptibility of chickpea cultivars against A. ...
Khaliq Dad1, Muhammad Nawaz2*, Rumsha Hassan2, Kainat Javed2, Asma Shaheen2, Fengliang Zhao3, Muhammad Imran4, Syed Tansir Hussain Shah4, Muhammad Faraz Anwar5 and Muhammad Aurangzaib6
 
...growth and physiology of plants. The experiment was conducted to study the impacts of biochar on the growth and physiology of tomato grown in Cd contaminated soil and activity of biochar in the contaminated soil. In this study different treatments of Cd were applied in the presence of certain portion of biochar. The order of treatments was 0 mg Cd as control with biochar (12%), low Cd (10mg), high Cd (15mg), low cadmium + biochar (10mg+12%) and high cadmium + ...

Saleem Maseeh Bhatti1*, Muhammad Aslam Panhwar1, Zohaib ur Rehman Bughio1, Muhammad Saleem Sarki1, Allah Wadhayo Gandahi1, and Niaz Ahmed Wahocho2

...nd sprayed to strawberry plants before flower initiation. A continual increase in number of leaves, number and weight of berries, fresh weight of strawberry plants, and Zn concentration in strawberry fruit was observed as a function of foliar application of zinc. Plants sprayed with 66 and 99 mg Zn L-1 had significantly more number of leaves (27.4 ± 1.14 and 29.9 ± 1.36) and ...

Ali Ahmad1*, Zubair Aslam1, Korkmaz Bellitürk2, Naeem Iqbal3, Muhammad Idrees3, Muhammad Nawaz4, Muhammad Yasir Nawaz5, Muhammad Kashif Munir6, Ahmad Kamal1, Ehsan Ullah1, Muhammad Ahsan Jamil1, Yousuf Akram1, Tanveer Abbas1 and Muhammad Mohsin Aziz1

...dies about the impact on plants of vermicasts prepared from aquatic weeds and agriculture wastes.

...

Muhammad Junaid*, Musharaf Ahmad and Saifullah

...ximum (89.72%) number of plants survived for 1% amendments concentration. Significantly high number (87.22) of plants survived for green manure as compared to FYM with 78.47. C2 amended was found to be best with lowest (1.19) disease ratings. Significantly higher (i.e. 1.75 and 1.89) disease was observed for C1 and C3 amended soils. FYM was better as it produced significantly less (1.14) disease as compared to green manure w...
Celalettin Gözüaçık1, Ecevit Eyduran2 and Mohammad Masood Tariq3*
...the infected 675 alfalfa plants were evaluated with the objective to predict height of eggs laid by the alfalfa weevil at the plant stem from plant height, number of eggs per cluster, number of egg clusters at the plant stem, and location as potential predictors. In the prediction of height of eggs, CHAID (Chi-square Automatic Interaction Detection) and MARS (Multivariate Adaptive Regression Splines) algorithms were implemented for describing egg laying behavi...

Bushra Baig and Saeeda Yousaf*

...pesticide from these two plants could be utilized for their efficacy against various pests of okra and potato. Keeping the environmentally friendly nature of these biopesticide, compared to synthetic pesticides, it is recommended that more research be directed for assessment of more active compounds that could act as potential candidates for biopesticide. The objective of the study was to find the bioactive compounds in plant extracts of Neem and Black pepper ...

Fayaz Ahmad, Noorullah Khan, Farrukh Siyar Hamid, Abdul Waheed, M. Abbas Khan, Imtiaz Ahmad, Shamsul Islam, Basharat Hussain Shah, Sohail Aslam and Qamar uz Zaman

...hree replication and 100 plants per replication.  Data were recorded on plant height (PH), number of branches per plant (NBP), number of leaves per plant (NLP), stem diameter (SD), main root length (MRL), root diameter (RD), number of lateral roots per plant (NLRP), dry shoot weight (DRW) and dry root weight (DRW). The highest plant height (78.66 cm) was produced by clone BP2-2, followed by Clones BP1-4, BP1-3, BP3-1 and BP2-5 with plant height of 70.46, ...

Muhammad Nawaz1*, Muhammad Dawood1, Kainat Javaid1, Muhammad Imran2, Fengliang Zhao3, Shahzadi Saima4 and Syed Tansir Hussain Shah2

...ere may adversely affect plants and ultimately cause serious negative consequences on the development, growth and maturity of crops. In this regard, this study was conducted to examine the possible health effect of fluoride pollution in the form of sodium fluoride on the growth and physiological parameters of cotton plant. The cotton plants were grown in the pots. Six different concentrations of fluoride (3mg/L to 15mg/L) al...

Qaiser Shakeel1*, Rabia Tahir Bajwa1­, Yasir Iftikhar2, Mustansar Mubeen2, Muhammad Luqman3, Waqas Ashraf1 and Ifrah Rashid4

...de extracts of different plants and fungicides were performed for determination of antifungal activity against Penicillium digitatum, a plant pathogenic fungi responsible for ginger soft rot. Petri dish were used to conduct bioassay through poisoned food technique with triplicates. The crude extract of all the plants showed a better inhibitory effects on the pathogen’s (P. digitatum) mycelial growth rather than fungici...

Imtiaz Ahmed*, Naveed Ahmed, Abdul Waheed, Muhammad Abbass Khan, Noorullah Khan and Fayyaz Ahmed

...lications. There were 45 plants in each replication. The treatments comprises of two growing methods i.e. vertical growing method and horizontal method which was assigned to the main-plot and two direction of sowings i.e. east to west and north to south which were allotted to the sub-plot. The results of the experiments revealed significant variation among studied parameters. In case of growing methods, maximum vine length (4.55 m), number of leaves vine-1 (41...

Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sher Muhammad3, Muhammad Latif4, Ayesha Zafar1, Imran Shehzad1, Sarfraz Hussain5, Aneela Riaz6 and Abid Niaz2

...ation in shoots of maize plants. The same trend of improvement was noted for maximum nitrogen (3.16%), phosphorus (0.92%) and potassium (2.88%) concentration in roots of maize plants.

...

Saba Aleem1*, Iram Sharif2, Mehvish Tahir3, Muhammad Najeebullah3, Ali Nawaz1, Muhammad Imran Khan1, Amina Batool1 and Waheed Arshad1 

...e was experienced by the plants during the curd development stage. Heat tolerance ability of the genotypes was assessed by their ability to curd induction and development at high temperature and also based on different physiological traits. Heat susceptible genotypes showed lengthened curd induction stage. Further, decrease in chlorophyll and osmoprotectants contents was also seen in heat susceptible genotypes. TSX-C40 was identified as most susceptible genoty...

Muhammad Fiyyaz1, Ghulam Sarwar1*, Noor-Us-Sabah1, Mukkram Ali Tahir1, Muhammad Aftab2, Muhammad Zeeshan Manzoor1, Sarfraz Hussain3, Ayesha Zafar1, Imran Shehzad1 and Aneela Riaz4

... before harvesting maize plants. Laboratory analysis for collected soil samples was carried out. Data were statistically analyzed. Results indicated that treatment (T8) produce maximum plant height (115.0 cm), biomass (64.34 g) and root length (27.083 cm) of maize. Organic matter content (1.78 %), phosphorus (16.67 ppm) and potassium (213.0 ppm) concentration in soil was also increased in this treatment.

...

Allah Bakhsh1, Attiq Akhtar1*, Fiaz Hussain1 and Shabbir Ahmed2

... of light and air in the plants, as a result of leaf removal, decreases the occurrence and severity of bunch rot to less than 5%.This method is extremely useful for maintaining grape quality and quantity without the use of chemicals to combat disease. As a result, this strategy is both environmentally and health-friendly. In Pakistan, we consider using leaf removal therapy to treat grape bunch rot disease because it is the least expensive.

...
Suman Bhattarai1*, Subodh Raj Pandey2, Jaya Prakash Dutta3, Meghnath Timalsena4 and Rajendra Bam5
...maintenance of flowering plants (p=0.057) have significant effect on honeybee productivity. Labour cost and migration cost had positive coefficient and significant relation at 1% level of significance with gross return whereas expenses on baiting materials had positive coefficient and significant relation at 5% level of significance with the gross return. Thirty-six percentage of total visit for foraging of honeybees was contributed by East Chitwan. The overal...

Mukkram Ali Tahir1, Noor-Us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Abdul Moeez1, Humaira Ramzan1, Mudassar Hafeez1, Muhammad Zeeshan Manzoor1, Aneela Riaz3, Sher Muhammad4 and Muhammad Latif4

...a essential nutrient for plants; although it has shown to be beneficial for plant development. Crop production is seriously affected by salinity worldwide. This research was performed in the research zone of Department of Soil and Environmental Sciences during the summer, 2018 in College of Agriculture, University of Sargodha, Sargodha, Pakistan. In the present study growth response of rice under normal and saline soil conditions was checked using Randomized C...

Qudsia Nazir1, Muhammad Aftab1*, Ghulam Sarwar2, Aneela Riaz3, Sarfraz Hussain1, Ifra Saleem1, Amina Kalsom1, Noor-Us-Sabah2, Mukkram Ali Tahir2, Ateeq-ur-Rehman4 and Muhammad Arif1

...nt not only for animals, plants but for humans as well. Its importance cannot ignore for the plants to improve overall quality and yield. The overall physiology, quality and biochemical parameters also enhanced with optimum application of Zn. By keeping in mind, the facts, it was hypothesized that the use of ZnO (a cheap source of Zn) impregnated urea for rice may enhance grains (paddy) yield. Three types of urea were prepar...

Muhammad Rafique1, Inam Ul Haq1*, Humara Umar2, Muhammad Jan2 and Muhammad Azhar Iqbal2

...er of true to type olive plants for sustainability of olive sector in the country. 

...

Muhammad Ahsan1*, Aneela Ramzan1, Muhammad Nafees1, Adnan Younis2, Muhammad Amin1, Gulzar Akhtar3, Khansa Saleem1 and Azka Sabeeh1

...er (T0). There were four plants in each treatment with three replications which were arranged according to completely randomized design (CRD) under room temperature. The results showed that maximum fresh weight (g) was obtained in T4 (acetic acid), flower head diameter (mm) and flower color was ideal under T3 (salicylic acid). Maximum dry weight (g), highest flower freshness on 1st and 3rd day, minimum petal discoloration which leads to productive market accep...

Khan Tamoor1*, Hafsa1 and Hanif Maryam2

...our indigenous medicinal plants viz., Ferula oopoda, Zataria multiflora, Achillea santolina and Nepeta cateria against Meloidogyne incognita at banana orchards of District Lasbela, Balochistan, Pakistan. Crude extracts, essential oils and fixed oil of these selected plants were tested separately. The crude extracts of Z. multiflora and F. oopoda showed higher mortality as compared to A. santolina and N. cateria. The results ...

Weenghar Ali Chandio1, Tajnees Pirzada1*, Abdul Majid2 and Farzana Rashid3 

...d effects of HA on other plants.

...

Hussan Ara Begum1, Muhammad Hamayun1, Noor Shad1, Waqar Khan3, Jawad Ahmad1, Muhammad Ezaz Hasan Khan2, David Aaron Jones2 and Kishwar Ali2*

...g economically important plants. The current study assesses the effects of UV radiation on germination, growth, chlorophyll content and fresh and dry weight of Brassica rapa L. and Eruca sativa L. Some seeds of Brassica rapa L. and Eruca sativa L. were placed in petri plates, and were exposed to UV light for 30, 60 and 120 mins daily. The source of UV light was a UV box having a UV Tube. The UV exposure on the seeds reduced the germination percentage in both s...
Muhammad Ramzan1*, Unsar Naeem-Ullah2, Muhammad Umair Sial2, Naeem Iqbal2 and Shafqat Saeed2
...ae) are a large group of plants grown for landscape and medicinal purposes in various regions and also known for absorbing various toxic pollutants from the environment. Several insect pests like thrips, whiteflies, mealy bugs and caterpillars attack on these plants. Among them, leaf eating caterpillar, Trilocha varians (Lepidoptera: Bombycidae) is serious insect pest for these precious plant species in various countries. Th...

Sami Ul Haq1, Abid Hussain1*, Umair Riaz2, Muhammad Baqir Hussain1, Adnan Fareed1, Nabeel Ahmad Ikram3 and Fahim Nawaz3

...yield (80%) of sunflower plants grown in soil fertilized with 75 kg S kg ha-1 plus Compost (750 kg ha-1). The application of Compost is one of the effective strategies to enhance the availability of nutrients, including S, to obtain high quality and product in sunflower. It can be suggested that the finding of current research can be utilized to as a good strategy for enhancing the productivity of sunflower.

...

Ahmed A. Kheder

...ion including strawberry plants. SLRSV was detected and characterized using serological (DAS-ELISA), biological and molecular diagnostic techniques. Virus incidence was performed in different locations in five governorates during 2018-2020. Forty-one samples out of 693(5.94%) reacted positively to SLRSV. Specifically, the percentages of infection were 7.3, 6.7, 5.4, 5.16 and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia governorate...

Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*

...ediately weighed, and 10 plants were subsampled from each sample for morphological evaluation. Ten plants were weighed and separated into stem and leaves portion, subsequently weighed and analysed for dry matter (DM) content. The remaining samples were air dried, ground and analysed for chemical composition and in vitro digestibility (IVDMD) and in vitro gas production (IVGP). The results revealed large variability (P < 0...

Ain-ul-Abad Syed1*, Zaheer Ahmed Khan1, Shakeel Hussain Chattha1, Irfan Ahmed Shaikh2, Mian Noor Hussain Asghar Ali1, Zohaib ur Rehman Bughio3, Shahzad Hussain Dahri2 and Ghous Bakhsh Buriro4

...ght was used to meet the plants’ light requirements. The stock solution (a combination of water and nutrients) was used to feed the transplanted plants during hydroponic cultivation. On average, relative to water use under geoponic agriculture, the hydroponic model’s productivity was 97.42 percent. The growth efficiency of the hydroponic spinach crop was much higher than that of geoponic cultivation. On average, ...
Mandour, A. M. 1, Abdel Maksoud, H. M. 2, Amal, A. Khalil 3 and Mohga, A. El-Tahlawey 4
...naturally infected maize plants at El-Monfia. These samples were checked
for virus presence using Indirect ELISA. A number of cultural practices were
evaluated as control measures against MDMV to minimize the virus
infection in maize crop.
...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef* 
...>
BBTV in infected plants and banana aphid (P.nigronervosa) using specific primer
of DNA-1 for BBTV. The results showed that amplified PCR product with the
expected size 476 bp for both infected banana and aphid. PCR was used to detect
component 6 of BBTV-DNA using specific primer at expected size 813 bp.The
isolated component was cloned into PCR™-4-TOPO vector (3.956~kb) and were
transfor...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
...ed faba
bean plants exhibiting blotchy mottle,vein-clearing and deformation. BBMV was able
to infect limited host range ten out of thirty three tested plant species, and
cultivarsbelonging to six different families. It was transmitted mechanically and not
transmitted by seeds or aphids. The isolated virus was inactivated by 10 min exposure
to 95°C, but not at 97°C, at a dilution of 10ˉ3,and a...

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

...tic hibiscus
plants. Samples of hibiscusleaves were collected from El Giza, Alexandria, Qlubia,El-
Fayom, and El-Mansouragovernoratesand analyzed for phytoplasma infection.The
collected hibiscus plants showed characteristic symptoms for Phytoplasma associated
witches‟-Broom disease, which is characterized by excessive axillary branching,
abnormally small leaves, a...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

...Agro-inoculation. Tomato plants were transferred into regeneration medium and genetically transformed with the HSV-2gD-PB21 binary vector through Agrobacterium co cultivation. Agro-inoculated tomato plants were tested for the HSV-2gD insertion and transcription using both PCR and RT-PCR and the results were successful in getting insert-containing tomatoes against HSV-2gD. Specific expression of the introduced antigen constru...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H.
M. Mazyad1
...btained from common bean plants were collected from
Qaliobeya governorate, Egypt, and tested for Squash Leaf Curl Virus (SLCV) infection by
PCR using both degenerate and specific oligonucleotide primers. SLCV (bean isolate) was
transmitted from naturally infected common bean onto twenty two species and varieties
belonging to six different families i.e. Moraceae, Solanaeae, Cucurbitaceae,
Leguminoceae,...

Samah A. Mokbel, Ahmed K. El-Attar

...thy
hibiscus plants, the in vitro-infected hibiscus explants were exposed to gamma
radiation at different doses - 5 gray (Gy), 10Gy, 15Gy, 20Gy and 25 Gy- emitted
from cobalt 60 (60Co) for 30 minute. All applied doses resulted in phytoplasma-free
hibiscus plantlets with different survival activity. The presence of phytoplasma 16Sr
DNA was examined using PCR detectio...

Hanaa H. A. Gomaa1; Entsar A. A. Nassar2; K. A. El-Dougdoug3

...ert. These are important plants used for treatment of various liver diseases. All the studied genetic parameters showed variations among milk thistle and parent varieties (plant height, main branch, total branches, head flower, fruit yield per plant). Concentration and yield amount of seven detected silymarin compounds using HPLC showed wide variations among varieties. They ranged from 9.2 to 34.78 mg/g fruits or 450.25 to 1250.25 mg/plant. The silymarin produ...

Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed

...the OYDV infecting onion plants in
Egypt and to obtain OYDV-free plants from infected onions through tissue culture
techniques. To achieve our aim, the virus has been isolated from naturally infected onion
plants grown in five Egyptian Governorates, Gharbia, Qalyobia, Giza, Fayoum and Beni-
Suef then mechanically transmitted onto healthy onio...

K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2

... isolate-infected pepper plants confirmed by DAS-ELISA and isolated on
Chenopodium amaranticolor L. where gave chlorotic local lesions. Eleven potato cultivars
(Solanum tuberosum) mechanically inoculated with PVY isolate under greenhouse condition
were divided to three categories, resistant (Diamond, Execusa, Hermes and Valor), tolerant
(Sisi, Lady Balfor, Nikola, Ditta and Lady Rosetta), susceptible (Anabel and ...

Om-Hashem M. El-Banna1, Maisa A.E. Awad2, M.S. Abbas3, Hoda M. A. Waziri2 and Huda S. A. Darwish2

...n the tissues of healthy plants, indicating the effect of the virus of these tissues.
...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
... common bean
plants grown in Egypt. Symptomatic leaf samples were collected from bean fields
cultivated in different governorates and tested by PCR using Geminivirus degenerate
primers and Squash Leaf Curl Virus (SLCV) specific primers. All bean varieties grown in
surveyed governorates were found susceptible to Geminivirus infection and the dominant
Geminivirus affecting bean fields was SLCV. Percenta...
M. A. S. El-kady1; A. B. Badr2; Ahmed K. El-Attar1, Hoda M. A. Waziri1 and Kh. E. A. Saker1
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2
...of BSV.
...

A. B. Badr1 ; M. A. S. El-kady2; and Kh. E. A. Saker2

...racters of infected bean plants. The thickness of
leaflet blades, palisade and spongy tissues were increased than the healthy plants. In
contrast the thickness of upper and lower epidermis layers were reduced. Also the
thickness of midrib zone was slightly reduced. Moreover, vascular tissues lost their
normal shape and arrangement as xylem arms. The most interesting finding, le...

Rehab A. Dawood1; Entsar A. Nassar2; and K.A. El-Dougdoug 3

...ted from infected potato plants using osmotic potential (Osmotherapy) applied 50 , 60 and 70 gl -1 sucrose at 210C with 73 , 89 and 92 % respectively . In addition to production of microubers in vitro under osmotic potential 8.8 (50 gl-1); 8.2 (60 gl-1) and 6.2 (70 gl -1) number per 5 plantlets at 170C . All PVY results were confirmed with DAS – ELISA.

...

Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³

...rally infected faba bean plants growing in the experimental fields of Giza Agricultural Research Station showing mottle and distortion of leaves. The identity of the virus was confirmed biologically, serologically and by light and electron microscopy. It was found that BBMV reacted systemically with 12 species belonging to Fabaceae and locally with 2 species belonging to Chenopodiace. It was transmitted mechanically and by Sitona lineate. It was detected serol...

Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4

...ight and yield of squash plants.

...

Aly M. Abdel-Salam

... (Saccharum officinarum) plants in Giza and Assiut
governorates showing leaf symptoms of pronounced flecks or freckles and vein
banding which turn later to chlorotic and necrotic strips. Polymerase chain reaction
(PCR) utilizing degenerate primers for badnaviruses for the reverse trancriptase,
RT/RNase genome regions of ORF III detected the virus in infected sugarcane leaves
and in its vector Sacchari...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...m symptomless strawberry plants and identified with a specific antiserum (Loewe Biochemica GmbH) using Double Antibody Sandwich ELISA (DAS-ELISA). Virus survey was carried out during 2013 - 2014 in different locations on commercial strawberry fields. The percentages of infection were 3.7, 4.5, 15.7 and 20% in El-Behera, El-Kalubeia, El-Ismalia and El-Menofia respectively. SLRSV was transmitted either by Xiphinema americanumas nematode vector or mechanically fr...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
...eased
tomato plants (Solanum lycopersycum L.), and to identify and classify the phytoplasma
involved. A detection of infected tomato plants, which showed symptoms of big bud,
witches'-broom and phyllody, in all regions of the screened governorates, reacted
positively when assayed by nested polymerase chain reactions (PCR) using universal
phytoplasma-specific primer ...
M. A. Kararah1, Om-Hashem M. El-Banna1, Salwa N. Zein2 and Abd-Elrehiem, A.F.3 
...ected
cowpea plants, showing mosaic and choloratic ring spot symptoms, which
had been grown in the experimental fields of Giza Agricultural Research
Experimental Station (A.R.E.S) in 2008. Identification studies based on host
range, symptomatology and seed transmission through cowpea and different
hosts belong to Fabaceae.The results indicated that the host range of the
virus was expanded ...

Maryam Yousaf1, Salman Ahmad1*, Romana Anjum2 and Muhammad Zeeshan Majeed3

...nching method. Untreated plants served as control. First disease symptoms appeared after seven days of inoculation and seedlings became wilted within 30 days post inoculation. Stems from wilted as well as control seedlings were cross sectioned to observe the histopathological modifications. Wilted cross sections represented the cell wall disintegration and disruption of the tissues along with the blockage in xylem and phloem vessels due to the tylone productio...

Megahed, A.A.1; Kh. A.El-Dougdoug2 and B.A. Othman2

...ally infected sugar beet plants showing distincted for one or more viruses were collected from 73 fields in season 2009/2010, while from 76 field, the total of examined plants were 451 through the second season (2010/2011), upon external symptoms. All samples were distributed in 8 symptomatic groups in the forms of: vein clearing, mottling, mosaic, blisters, leaf curling, stunting, yellowing and necrosis. Depending on the ex...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...s isolated from cucurbit plants growing in Eastern Province area in Saudi Arabia and characterized using reverse transcription-polymerase chain reaction (RT-PCR). The nucleotide sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the i...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

... naturally infected rose plants collected from different rose farms in Taif, KSA exhibiting a wide range of foliar disease symptoms including necrotic spots, wavy lines, oak leaf pattern, leaf deformation, reduction in number and diameter of flowers , color breaking and necrotic spots on flower petals .The virus was biologically purified from single local lesion formed on Chenopodium quinoa. The isolated virus was identified on the basis of symptomatology, tra...

Badr, A. B. 1, Abou-zeid, A. A2. and Al-Naggar, A. M1.

...um tuberosum L.cv. cara) plants during the winter season at 2011 to investigation the abnormalities changes of potato leaflets and tubers infected with Potato virus Y. Anatomical features of terminal leaflets i.e. mean of thickness both, midrib zone, leaflet blade, upper epidermal layer, palisade and spongy tissues, length and width of protoxylem and metaxylem vessels were reduced. However, lower epidermal layer was increased. Stomatal characters i.e. number o...
Eman A. Ahmed1, Osama Y. shalaby2, Emad F. Dwidar2, Samah A. Mokbel1 and Ahmed K. El-Attar1
...that infection of tomato plants with phytoplasma led to an increase in stem diameter by 10.23% as well as greatly increase in measurements of the other stem components while the diameter of pith was decreased by 38.46%. This infection was led to an increase in the diameter of petiole by 109.2% and also the other components of flower petiole. At the same time, tomato leaves were greatly affected as a result of the infection with phytoplasma. The thickness of le...

Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3

...aturally infected tomato plants collected from Taif governorate, Saudia Arabia for the first time. Observed symptoms circumvented mosaic, curling, bronzing and/or purpling, chlorosis and necrotic spot on the leaves. Disease symptoms of infected fruits produced from inoculated healthy tomato seedling showing discoloration, faint concentric rings, necrotic and chlorotic spot on mature tomato fruits. The virus was biologically purified from a single local lesion ...

Ramy A. Qabel1; Tarek F. El-Arabi2; Adel A. Shoukry1; Hassan H. Elsebaay1; Abdel-Aziz F. El-Hamahmy1

...ul symbiosis with legume plants is governed by many factors. The foremost factor that could affect the rhizobia is bacteriophage infection. In this context, this study aimed to investigate the abundance of rhizobiophages in Egypt. Rhizobiophages were isolated from the rhizosphere of different legume plants. While no temperate phages were detected, two groups of phages were determined based on their virulence. Highly virulent...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...ctively in particular in plants treated with algal filtrates by mixed with virus inoculum immediately before inoculation. Spraying plants with the algal filtrates 24 hrs. before inoculation produced a higher inhibitory effect against BYMV than that obtained by spraying 24 hrs. after inoculation. The same trend of inhibition effect that was detected with algal biomass was lower than with filtrates. The indirect ELISA was carr...

Salama M. El-Saghir1, 2

...rus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence o...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...dicator (Vollka marina ) plants. The Phytoplasma was
transmitted from naturally infected Lemon (Citrus limon) to healthy periwinkle (Catharanthus roseus)
by dodder (Cuscuta reflexa Roxb) and Lemon (Vollka marina) plants by eye bud grafting.
Cytopathological detection referred to Diene's stain was used to differentiate the phloem tissues of leaf
petiole sections from infected tr...

Maha A. El-Abhar1, Moustafa A. Elkady1, Khaled M. Ghanem2, Hussieny A. Bosila3

...ange among weed and crop plants which produces a variety of symptoms. It can cause problems in potato
in some regions where vectors easily move into potato fields from reservoir host, particularly if a tuber
necrosis-causing strain is involved.
Objective: : The purpose of this study is to characterize biologically and serologically AMV infecting
potato (Solanum tuberosum L.) in Egypt. Moreover, the study describe...

Mohsen M. Elsharkawy1, Salem H. Homayed1, Mohamed M. Elsawy2 and Amr A. Khedr1

...asion of CMV in cucumber plants.
Methods: The fan was operated two times per day (8:00 am and 18:00 pm, each time for 30 min).
Moreover, cucumber plants were treated with cell free filtrate (CF) of GF 19-1 at 1 day before virus
inoculation.
Results: The wind velocity (2.6 m/s) resulted in decreased virus severity and titer compared with the
control. However, the pot...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...ptomatic infected potato plants during growing seasons for
the cultivated commercial local tuber seeds using Double Antibody Sandwich-Enzyme Linked
Immuno-Sorbent Assay (DAS-ELISA). The PVM was mechanically isolated on potato cv. Diamant.
Host range was carried out by mechanical inoculation of PVM on a set of different plant species.
Electron Microscopy was used to examine the virus morphology. The cytopathic eff...

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

... of aromatic and medical plants. In March 2016, several symptoms of leaf
necrosis, bright yellow mosaic and malformation of leaves suggested viral infection of AMV on
basil plants grown in Beni Suef governorate.
Objectives: The present study aimed to characterize the virus at the molecular level and
described the ultrastructural changes or other histopathological alterations in...

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

...al commercial ornamental plants, leads to serious economic losses all over the world. During
2017-2018, gazania showing phyllody, yellowing, proliferation, virescence and little leaf symptoms
was observed Giza, Egypt.
Objective: The current work aims the detection and molecular identification of phytoplasma infecting
Gazania in Egypt.
Methods: Phytoplasma disease was detected and isolated from natural...

Ahmed M. Soliman

...he largest host range of plants.
Aim: The present study was conducted to identify four Saudi CMV isolates (cucumber, tomato, pepper and watermelon) using biological, serological and molecular assays.
Methods: Survey of some vegetable crops exhibiting mosaic, yellowing, blisters, shoestring leaf, mottling and stunting in different regions of Al-Ahsaa at Eastern Province in Saudi Arabia was conducted during the spring of 2016 and 2017. Th...

Mohsen M. Elsharkawy1, Sara E. Hanbal2, Samir A. Sidaros1, Mohamed M. Elsawy2, Ali H. Hamed2

...ion of BYMV in faba bean plants.
Methods: Faba bean plants were treated with PGPF isolates at 2 days prior to BYMV inoculation. Disease severity and virus titer were estimated at 1, 2 and 3 weeks after virus inoculation. The transcription profile related to defense genes was evaluated at 1, 2 and 3 weeks after BYMV inoculation by quantitative real-time PCR analysis.
Results: Treatments with PGPF resul...

Shimaa A. Khalaf1 , Mohsen M. Elsharkawy2, Samir A. Sidaros2, Shawky A. El Kewey2, Ayman F. Omar2, Ali Hamed1

...re evaluated in cucumber plants treated with barley grain (BGI) or culture filtrate (CF) of GU23-3 under greenhouse conditions. Additionally, the expression levels of defense genes were assessed by reverse transcription PCR (RT-PCR) analysis.
Results: Both of virus severity and titer were significantly reduced in treated plants in comparison with the control. All growth characters and yield of cucumber
Huda S. Darwish 1, Om-hashem M. El-Banna2, Mohamed S. Abbas3, Hoda M. Waziri 1, Maisa A. Awad1
...rapevine and pelargonium plants and detected
using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA). Host range study
was carried out using mechanical inoculation into fourteen different diagnostic host plant species and
cultivars belonging to 6 families. Tomato seeds were treated with four different concentration of
NaN3and EMS (1.0, 2.0, 3.0 and 4.0 mM) and (0.3%, 0.4%, 0.5%and 0.6%) respe...

Tahsin S. Shoala1, Ahmed K. El-Attar2, Ahmed I. Abd El Maksoud3

...Methods: Infected potato plants (Solanum tuberosum L. var. slany) were externally sterilized
and cultured in Murashige and Skoog media (MS media). Four weeks later, potato plants were
tested for PLRV using RT-PCR technique, and all of the plants were PLRV positive. MS
media were prepared, autoclaved, and active natural materials (Glycyrrhizic acid ammoni...

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

...n to occur in sugar beet plants in Egypt and may
produce severe damage to infected plants. However, studies on the effect of the CMV on the cellular
and internal structures of sugar beet leaves were rare.
Methods: The CMV was isolated from sugar beet samples collected during November 2018 from the
Fayoum governorate, exhibited symptoms of mosaic and leaf malformation. Detection...

Gulnaz Ismaylova

...tribution, phenology and plants affected by the pest. Both nymphs and adults of O.japonica cause serious damage to plants. When the females lay their eggs, it files the sprouts by the ovipositor and let them dry. Wintering is carried out in the egg phase. Nymphs begin to hatch from overwintered eggs in early May. The eggs of O. japonica were also photographed under a JCM-6000 electron microscope and given dimensions. It turn...

Muhammad Rafique1, Muhammad Azhar Iqbal2, Inam Ul Haq1*, Muhammad Ramzan Anser2, Humara Umar2 and Muhammad Ashraf Sumrah2

...ns. The demand for local plants is increasing and no scientific study has been previously carried out to standardize propagation technology concerning optimization of light intensity under greenhouse conditions. The current study was conducted at Izhar farms (Pvt.) Ltd. under the collaboration with Barani Agricultural Research Institute (BARI) Chakwal to find out the appropriate light intensity for successful olive propagation under greenhouse conditions. The ...

Ahmed Ali Moryani1, Nasir Rajput1*, Muhammad Naeem1, Atta Hussain Shah1 and Hidayatullah Soomro2

...a mixture of all 3 herbs/plants at 2ml/L; mixed with distilled water and another with citric acid. The dressing percentage was observed significantly (P < 0.05) higher in compound II supplementary group F and lowest in control group A. Whereas, the fat pad percentage recorded significantly (P < 0.05) lowest in the compound II supplementary group F and highest in control group A. The relative weight of organs; liver, pancreas, spleen, heart, duodenum, jej...

Haroon Ur Rashid1*, Nazia Tahir2, Muhammad Zamin3, Naveed Shehzad4, Aman Ullah2, Bibi Zainub5 and Farooq Azam6

...and various allelopathic plants [Sorghum {Sorghum bicolor (L.) Conard Moench.}, Sunflower (Helianthus annuus L.) and Parthenium (Parthenium hysterophorus L.)] residues as surface mulches and their water extracts integrated @ 15L each +atrazine @ 0.125 kg a.i ha-1(1/4th of the recommended dose) was assigned to sub plots (Factor B). Data were recorded and analyzed for dry biomass (g) of total weeds 60 DAS, leaf area (cm2), leaf area Index (%) and Stover yield (K...
Pengfei Liu*, Xuexue Qin and Fei Shang
...t preference for nesting plants between the two species. However, the nest predation rate and breeding success were not different significantly. Our study suggested that the space segregation of nesting site contribute to the extensive stable coexistence of these two species.
...

Fahrauk Faramayuda1,2*, Totik Sri Mariani3, Elfahmi1,4 and Sukrasno1

...d that in vitro cultured plants contain the same secondary metabolites as the wild type. This study aims to identify the chemical content of two varieties of O. aristatus resulting from in vitro culture. The five-month-old variety of O. aristatus purple and white purple and wild type was extracted using two solvents with different polarity levels, namely ethanol and ethyl acetate. The concentrated extract was identified for its chemical content using gradient ...

Muhammad Madni Afzal1*, Shahbaz Talib Sahi1, Amer Habib1, Waqas Ashraf2, Muhammad Ahmad Zeshan3, Muhammad Raheel2 and Qaiser Shakeel2

...xperiments. Three desert plants i.e. Gossypium thurberi, Calotropis procera and Suaeda fruticose were used at 50 ppm, 100 ppm and 150 ppm concentrations. Maximum basal rot disease reduction (78.6%) was recorded at 150 ppm concentration of wild cotton (G. thurberi) under in-vitro conditions. Whereas, wild cotton also gave the highest disease reduction under greenhouse (62.93%) and field conditions (52.56%) as compared with other two plant extracts and control. ...

Gulzar Ullah* and Gohar Ayub

...(48.87%) was observed in plants treated with 20 hours heat pretreatment duration as compared to other heat pretreatment durations and control. Concerning tomato varieties, number of flower clusters plant-1 (16.99), fruit set percentage (68.25%), number of flowers cluster-1 (7.91), chlorophyll content (48.06 SPAD), leaf relative water content (80.68%), Putrescine concentration (190.25 nmol/g), spermidine concentration (152.57 nmol/g), yield (21.00 t ha-1) and l...

Muzamil Farooque Jamali1, Fayaz Ali Jamali1, Tanveer Fatima Miano1, Zulfiqar Ali Abbasi2, Sohail Ahmed Otho3, Khalid Hussain Talpur4, Niaz Ahmed Wahocho1 and Muhammad Iqbal Jakhro5*

...rieties of marigold. The plants irrigated with canal water (control) having EC of 0.7 dSm-1 showed better results for both seed and flowering related traits. The plants treated with canal water showed better seed germination (82.56 %), seed germination index (2.04), plant height (21.31 cm), branches/plant (45.61), leaves/plant (201.67), flowers/plant (8.56), diameter of flower (7.95 cm), fresh root biomass (0.821 g) and dry ...
Arshad Khan1, Mohammad Ihsan1, Ali Hazrat1*, Mohammad Nisar1, Muhammad Laiq1, Maryam Bibi1, Nasir Ali2, Ulfat Naz1, Muhammad Zakria1, Nausheen Nazir3, Adam Khan4 and Muhammad Asif Nawaz5
...he most important annual plants globally. The current study was conducted to evaluate Celtis australis genotypes through morphological and biochemical characterizations. A total of 80 genotypes were collected from different regions of district Dir and Swat, Khyber Pakhtunkhwa Pakistan, and were characterized for 11 phenotypic traits (4 qualitative and 7 quantitative). A significant diversity was found for leaf length with the range of 4 to 15 cm, leaf width 1 ...

Muhammad Irfan Ullah1*, Muhammad Arshad1, Abu Bakar Muhammad Raza1, Nimra Altaf1, Muhammad Afzal2

...ecorded higher on citrus plants after application of this insecticide compared to others. Our findings indicate that imidacloprid can be considered the best insecticide for managing CLM and ACP population in an integrated approach. 
 
Novelty Statement | The present study will be helpful in the selection of effective insecticide for the management of two major insect pests of citrus orchards. ...

Kawa A. Ali1*, Sazar S. Noraldeen2 and Arshad A. Yaseen2, 3

...ta for tomato and pepper plants where higher levels with atLEAF instrument comparing to SPAD chlorophyll meter. Higher chlorophyll levels were recorded in open field plants comparing to lath and plastic houses plants. Chlorophyll a content was related to carotenoid levels in both destruction methods. There was positive correlation between SPAD and atLEAF. Nondestructive methods could be us...

Khaliq Dad1, Muhammad Nawaz2*, Muhamamd Ibrahim3, Fengliang Zhao4, Rumsha Hassan2, Humaira Nawaz5, Muhammad Usman Saleem6, Kinat Javed2, Ayesha Komal2 and Hajra Naz2

...aken up from the soil to plants and finally becomes the part of human body which warrants serious health concerns. Cadmium causes mild to severe effects on plants, animals and environmental health. Humans are exposed to cadmium through food, water intake, inhalation (cigarette) and dermal contact which then produces heart disease, kidney failure, lung cancer, orthopedic disease, nervous system failure, low immunity level, me...
Yanhong Hu* and Linkai Cui
...lized glands of animals, plants as well as other organisms via well-characterized biosynthetic pathways. Fatty acyl alcohols are the key components for synthesis of wax. A fatty acyl-CoA reductase (FAR) is often essential in this biosynthetic pathway. The subcellular localization of FARs is crucial for understanding the process of synthesis and transport of wax to the surface of body. In this study, we characterized the subcellular localization of EpFAR from t...

Muhammad Aftab1*, Aneela Riaz2, Ghulam Sarwar3, Muhammad Arif1, Qudsia Nazir1, Ifra Saleem1, Sarfraz Hussain1, Abid Ali4, Abid Niaz1, Fakhar Mujeeb4, Khalid Mahmood5 and Sarfraz Nawaz6

...ried out to evaluate the plants tolerance under combined stress of B and salt. In combined stresses of (B and Salt) causes oxidative stress in plants due to increase in production of the reactive oxygen species (ROS) including hydroxyl radicals (OH-), hydrogen peroxide (H2O2) and superoxide (O2-). However, on their side, efficient antioxidant defense system developed in plants, which havin...

Ayesha Gul1, Mohammad Sayyar Khan1*, Mazhar Ullah1 and Iqbal Munir3

...cer of osmotic stress in plants. In the present research, PEG stress was applied to sugarcane calli of CP-77/400 and the physiological and biochemical responses of the stressed and the control calli were measured. The calli were grown on MS media and were then transferred to different PEG concentrations (0%, 2.5%, 5% and 7.5%). Data was taken after 30 and 60 days of treatment. Relative growth of call showed significant decrease after 30 and 60 days. Control ha...

Huda Bilal1, Hasnain Raza2*, Kaynat Ahmed2, Iqra Tariq2, Qurat-ul-Ain2, Sana Sarfaraz1, Sanaullah1, Maryam Maqsood3 and Ali Raza3

... that is affecting land (plants, soil, microbes, animals, and arthropods) and aquatic biodiversity (waterbodies, phytoplankton, coral reefs, and fishes) drastically.

...

Muhammad Nauman1, Iftikhar Ali3, Nazir Ahmad1,2*, Fazli Ahad1 and Touheed Iqbal4

...useful variation in crop plants has been a major thrust of early farmers since the dawn of agriculture. This study aimed to estimate genetic variability, heritability, and genetic advance for quality characters in Brassica carinata L. A total of 22 genotypes comprised of six parental lines and their 16 bulked F2 populations were evaluated in a randomized complete block design with three replications at The University of Agriculture Peshawar during 2013-14. Dat...
Nagarathinam Arunkumar*, Jainullabudeen Gulsar Banu, Nagarajan Gopalakrishnan and Arkalgud Hiriyannaiah Prakash

 

...s and in waste treatment plants proved their importance. In this study, 23 wax-degrading bacterial strains isolated from four mealybug species infesting cotton were screened for lipase production. On the basis of the 16S rRNA gene sequences, lipase-positive strains were classified into six genera, namely, Pseudoxanthomonas, Acinetobacter, Klebsiella, Providencia, Enterobacter, and Serratia. Acinetobacter lwoffii...

Mukhtar Iderawumi Abdulraheem1*, Muhammad Ihtisham2*, Abiodun Yusuff Moshood3, Nawab Khan4, Muhammad Owais Shahid5, Shafiq Hussain6, Kumail Abbas6 and Fawad Zaman7

...led that all of the okra plants tested were susceptible to virus infections regardless of treatment. Those who had a treatment combination of three weedings and polythene mulching, on the other hand, had the lowest incidence and severity of viral infection, while those who received no weeding and no mulching had the highest. At the 7th week after planting, the treatment combination of thrice weeding with polythene mulching had the lowest viral incidence of 18....
Dia Mamadou1,2*, Meissa Beyah1, Sow Amadou Harouna1, Ba Samba Alassane1, Bouzouma Moustapha1, Braham Cheikh Baye1 and Beibou Ely1
...or at lobster production plants of this species at the time of their sorting and packaging. A total of 31770 individuals were measured and weighed; their level of maturity and moulting state were noted. This deep-sea species, reproduces all year round with a period of intense reproduction between August and December. The size of the smallest mature female mature female encountered during this period of experimentation (February 2015 to June 2018) is 213.5 mm T...
Muhammad Zohaib1, Muhammad Sajjad Ansari1*, Bushra Allah Rakha2* and Ali Akhter2
...l and other positions of plants were recorded as 17%, 10% and 25%, respectively. The preferred height for nest construction was recorded 1-2m (58%) followed by 2-3m (17%), 0-1m (16%), 3-4m (7%) and 4-5m (1%). The bulbul prefers to make nests on northern white cedar (Thuja occidentalis; 32%) followed by guava (Psidium guajava; 19%), mango (Mangifera indica; 9%), white mulberry (Moris alba; 9%), sweat orange (Citrus X sinensis;...
Madiha Nawaz and Shoaib Freed


...st of cotton, ornamental plants and many other crops due to its polyphagous nature. A study was conducted to check the efficacy of different local isolates of entomopathogenic fungi on 2nd nymphal instar of P. solenopsis under laboratory conditions by immersion method. Three entomopathogenic fungi; Beauveria bassiana (isolates Bb-01, Bb-08), Metarhizium anisopliae (isolates Ma-11.1, Ma-2.1) and Isaria fumosorosea (isolate...

Salma Javed1* and Daniyal Siddiq2

... nematode populations in plants in treated containers compared to untreated plants (control) with values increasing as time and concentration increased. During sixty days of treatment, no significant effect was recorded in plant height and shoot weight for extracts and concentration. Extracts of S. cumini may have potential for controlling M. javanica on tomato.

...

Ilker Kepenekci1, F. Dolunay Erdoğuş2 and Adnan Tülek3*

...serious pests of several plants worldwide including straw berry. So far, no record of any plant parasitic nematode (PPN) exists detailing the species found in strawberry growing areas of Kyrgyzstan. This research aimed to provide a faunistic and taxonomic record of PPNs from soil and plant samples collected from strawberry orchards in 10 different locations in Tokmok area of northern Kyrgyzstan during the summer of 2016. PPNs were identified according to morph...

Mohammed Abdel-Mageed Abdel-Aziz Abdel-Mageed1, Eman Alsayed Hammad2*, Nashaat Abdel-Aziz Mahmoud1 and Anas Farag El-Mesalamy1

...n 500 ppm applied to the plants as foliar sprays alone, foliar sprays with chelates and soil drenches were tested against root-knot nematode M. javanica infecting tomato plants cv. Strain-B under greenhouse conditions. Almost tested materials have significantly reduced nematode parameters compared to Oxamyl 24% L. and the untreated plants (check). The degree of nematode reduction varied ac...

Mahmoud M.A.Youssef and Wafaa M. A. El-Nagdi

...nita on roots of several plants were reduced gradually by increasing gamma irradiation doses. When tomato plants infected by root-knot nematode, Meloidogyne incognita were exposed to combined elevated atmospheric CO2 concentration (+100 ppm) and higher temperature (+2oC), tomato shoot dry weight and nematode control were increased compared to prevailing conditions.

...

Thomby Paul, Sreekanta Biswas, Sabiha Zarin Tasnim Bristi, Debashish Sarker, Saroj Kumar Yadav and Bhajan Chandra Das*

...onfirm the position of implants. On 30th day of post-surgical observation, mediolateral radiograph revealed migration of implants but callus formation was observed between the fracture ends of olecranon in order that the implants were removed. On 45th day of clinical observation, the dog showed good weight-bearing in right forelimb and walked normally.

...

Muhammad Junaid Yousaf 1, Farhad Ali2*and Fawad Ali2

... leakage, similar to the plants aerially treated with 2% NaCl while plants treated with 0.2%. 0.6% and 1.2% salt concentrations had high chlorophyll content and low electrolytic leakage, receptively. Seedlings exposed to a 2% salt stress had the highest RWC and low WL, followed by 1.2% and 0.6% while 0.2% and control plants performed similarly. In conclusion, few seedlings survived under s...

Mohamed S. Khalil

... javanica in roots of eggplants. Milbemectin (Milbeknock 1% EC) was applied at 0.1% (1 ml/l) and 0.5% (5 ml/l) in compared with the non-fumigant nematicide fenamiphos (40% EC). Results revealed that all tested doses of milbemectin suppressed galls (ranged from 50.59 to 75.50%, of both experiment) and egg masses (ranged from 66.67 to 87.01%, of both experiment) significantly, while fenamiphos recorded moderate reductions. Also, the measured plant indices were a...

Atef El-Sagheer1*, Anas El-Mesalamy1, Abdel-Monem Anany2 and Nashaat Mahmoud1

...avanica infecting squash plants under greenhouse conditions. Data indicated that treatment with P. guilliermondii filtrate (1012) caused best percentage of nematode reduction (71.46%). Followed by S. roseus at (1012) (42.95 %), then in third treatment with C. albidus (103) by (40.50 %). On the other hand, all tested treatments decreased the negative effects of nematodes and enhanced growth characters of squash plants. The hi...

Oluwatoyin Adenike Fabiyi

...th response of sugarcane plants increased significantly (p=0.05) with the highest concentration (75 mg) of furfural. A reduction in nematode population in soil of treated plants was remarked. The results indicated that furfural could be practically applied in the management of nematode pests of sugarcane, while safe guarding the environment from pollution.

...

Syeda Shazia Bokhari, Aisha Waheed Qurashi*, Roheela Yasmeen*, Fouzia Yasmeen, Nabeela Nayab, Uzma Rafi

... promoting the growth of plants and soil fertility traits.
...

Samreen Khan*, Salma Javed, Tabassum Ara Khanum, Nasira Kazi

...ental flowers, medicinal plants and other commercially important trees from different four sites of district Lakki Marwat and subsequently assessed the presence of EPNs using last instar larva of greater wax moth Galleria mellonella L. as baited host. After completion of requisite process, resultantly the corresponding recovery rate of EPNs was found 10.9% which includes only genus Steinernema comprising two isolates of S. balochiense (24%), two isolates of S....
Muhammad Rizwan1*, Bilal Atta1, Misbah Rizwan2, Arshed Makhdoom Sabir1, Muhammad Tahir3, Muhammad Sabar1, Muddassar Ali1 and Muhammad Yasir Ali4
... increased in Si treated plants by 3rd instar larvae of C. medinalis. Results also showed that enhanced Si level in rice plants reduces food quality and increases plant resistance to the C. medinalis in rice variety. This study concluded that Si fertilizers may play an effective role in C. medinalis management for rice crop protection.
...
Muhammad Taqi1, Shazia Erum2, Shamaila Rasheed2, Sadar Uddin Siddiqui2 and Shakeel Ahmad Jatoi2*
...on Caralluma tuberculata plants resulting in the disappearance of its wild populations in different mountainous regions in Pakistan. A proficient way for large-scale and fast propagation of C. tuberculata through in-vitro organogenesis was carried out at in-vitro lab, Bio-resources Conservation Institute, NARC, Islamabad, Pakistan. Nodal-tips as explants were grown on MS salts enriched with diverse plant growth regulators in...

Vahid Mollasadeghi1,2* and Samaneh Elyasi1,2

...on the leaves of tobacco plants compared to PVY on the leaves of Agria. PVY-infected leaves were more curled and paler than healthy leaves of cultivars Agria. The results of analysis of variance of the evaluated traits showed that the effect of PVY virus treatment was significant on chlorophyll a, b, leaf area and stem length at 1% and 5%, respectively. In addition, the effect of Pars Humic seven on chlorophyll a, b, leaf area and stem length was significant a...

Zahoor Hussain1,2, Yasir Iftikhar3, Mustansar Mubeen3, Muhammad Zia Saleem3, Muhammad Umer Naseer3, Muhammad Luqman4, Raheel Anwar5, Faheem Khadija6 and Aqleem Abbas7

...ied on selected diseased plants in combination. Afterward, different vegetative, physiological, and biochemical parameters of citrus greening infected fruit include fruit diameter, fruit weight, flavedo thickness, total soluble solids, ascorbic acids, juice percentages, TSS/TA ratio, total soluble solids, and titratable acidity were statistically analyzed. The application of Zinc sulphate (0.75 g/L) combined with Manganese sulphate (0.75 g/L) had significantly...
Stefan Pratama Chandra1, Yoanes Maria Vianney1, Theresia Liliani Christie2, Merlyn Wongso2, Melisa Widjaja2, Deok-Chun Yang3, Se Chan Kang4, Manar Fayiz Mousa Atoum5,6 and Johan Sukweenadhi1*
...e of the most well-known plants in traditional medicine that contains bioactive compounds called ginsenosides. It is widely used as raw material in many pharmaceutical industries in Indonesia. However, to supply for this purpose, they still rely on imports. PT. Kalbe Farma (through its subsidiary, PT. Bintang Toedjoe), University of Surabaya (Ubaya), and Hanbang-Bio Laboratory (holding company of Kyung Hee University) established the Kalbe Ubaya Hanbang-Bio La...

Niamat Ullah Khan1*, Umbreen Shahzad2, Azhar Abbas Khan2, Sami Ullah2, Muhammad Arshad Farooq2, Muhammad Kashan2 and Shitab Khan2

...ght (114.8cm), bolls per plants (18.9), bolls weight (2.42g), seed cotton yield (1812 kg ha-1) and lint percentage (36.72%) than conventional tillage. Likewise, frequent irrigation interval of 10 days produced taller plants compared to less frequent irrigations (20-25 days). Irrigation at 20 days interval improved seed cotton yield (48.7%) and lint %age (21.1%). Interaction effects (tillage x irrigation) revealed that reduce...

Imran Ali Chandio1, Muhammad Nawaz Kandhro1*, Qamaruddin Jogi1, Ghulam Murtaza Jamro2 and Siraj Ahmed Channa3

...nutrient deficiencies of plants. A field study was conducted in Tandojam for two consecutive years in autumn 2018 and 2019. The experiment was replicated thrice in randomized complete block design. Different doses of nitrogen as broadcasting and fertigation (0, 75, 100, 125 kg N ha-1 in two and three equal splits given at sowing time, 1st, 2nd and 3rd irrigations, respectively) were applied to two sunflower genotypes (HO-1 and Hysun-39). Data analysis revealed...

Muhammad Iqbal Jakhro1*, Nadeem Sadiq1, Javed Ahmed Abro1, Amanullah1, Fateh Muhammad2, Maqbool Ahmed3, Syed Ishtiaq Ahmed Shah3 and Qasid Hussain4

...ties. One-year old Olive plants were applied with organic and inorganic mineral fertilizer application for six months. The results showed that in comparison to control, plants fertilized with T2 (N 50g/plant), T3 (P 25g/plant), T4 (K 25g/plant), T5 (NPK 50:25:25/plant), T6 (Biochar 2:2) and T7 (FYM 2:2) had significant results. The studied parameters which was height of plant, leaves per plant, branches per

Ali Zohaib*, Muzzammil Hussain, Iftikhar Ahmad and Adnan Bashir

...vely increased number of plants per tray and per hill after transplanting while decreased the root length and root/shoot ratio of rice. Plant height was not affected significantly by seeding rate. Highest increase in number of productive tillers (8%), 1000-grain weight (8%), total dry biomass (14-17%) and grain yield (10-16%) was caused by 90 g seed per tray, as compared to 110 g seed per tray. Order of grain yield produced by different seeding rates was 90 &g...

Mirza Gul1*, Muhammad Zahid1, Ikram Ilahi2, Hazrat Ali2*, Fida Hussain3 and Muhammad Anwar Sajad3

...xtracts of two medicinal plants, Artemisia scoparia and Anisomeles indica against larvae, pupae and adults of Culex quinquefasciatus. The study also evaluated the predatory effects of the diving beetle, Agabus cybister, against various instar larvae of Cx. quinquefasciatus. Bioassay of whole-plant extracts was performed following WHO methods, with slight modifications. LC50 values for A. scoparia and A. indica against early fourth instar larvae were 360.4 and ...

Hera Gul Mohmmand1, Rozina Gul1, Hamayoon Khan2, Sheraz Ahmed1*, Laila Fayyaz1, Ajmalud Din1 and Imtiaz Ali1

...d on mean data, chickpea plants with P application produced more seed number plant-1 (60.9), pods plant-1 (57.3) and seed yield (557.2 kg ha-1). Higher seed yields were produced by genotypes NDC-4-20-1 (1004 kg ha-1) and NKC-5-S-15 (851 kg ha-1). Seed yield had significantly negative phenotypic correlation with plant height. Similarly at genotypic level, it was significantly correlated with seed number pod-1 while negatively with 100-seed weight. Among the tes...
Dyah Roeswitawati1*, Iva Kristova1, Muhidin Muhidin1, Otto Endarto2, Manar Fayiz Mousa Atoum3,4, Irum Iqrar5,6 and Luqman Ali Shah7
 

Ahmad-Ur-Rahman Saljoqi1, Sumayya Amin1, Muhammad Salim1*, Taufiq Nawaz2 and Farida Anjum3

....46g) were recorded from plants after 7 and 10 days, respectively. Significantly highest ascorbic acid concentration (9.68 mg/100g) was recorded on day 10 while lowest (9.19 mg/100g) was recorded on 3rd day post treatment. Similarly, highest percent concentration of pesticide residue (0.080%) was recorded on day 1 while lowest (0.0624%) was recorded on 10th day of post treatment. Results showed that Imidacloprid is significantly better against tomato fruit wor...

Javed Khan1, Abdul Majid1, Mohammad Nisar2*, Ali Hazrat2, Nausheen Nazir3, Muhammad Zahoor3, Mohammad Ihsan2, Azhar Hussain Shah1, Muhamad Ajmal Khan4 and Muhammad Yahya1

...ative and most important plants in District Dir Lower, Khyber Pakhtunkhwa, Pakistan, mostly used for medicinal purposes. In the present study, total 50 genotypes of Alnus nitida were collected from Dir lower and evaluated for morphological traits (leaf, petiole, nut, and catkin size). A significant level of variations was observed in the size of the leaf (10.22%), petiole (24.84%), catkin (9.19%), and nut (3.08%). There is a significant correlation between pet...

Zein Ahmad Baihaqi1,2, Irkham Widiyono3*, Bambang Suwignyo4, Amado A. Angeles5 

... metabolite compounds in plants. These studies are interesting to be continued and explored in an effort to reduce methane production through in vitro and in vivo, because it is proven that there are many types of biological or agro-industrial waste in the world different contents, structures and benefits. This review of the last 5 years related to the utilization of tannin active compounds showed the effect on the reduction of methane production. Condensed ta...
Muhammad Faisal Riaz1, Abu Bakar Muhammad Raza1*, Muhammad Zeeshan Majeed1 and Talha Nazir2
...ultural and agricultural plants. This study determined the prevailing diversity of aphids on different economically important plantations in district Sargodha. From November to April 2018-2019 and 2019-2020, about 51,000 apterous adult aphid specimens were collected from various plantations from all six tehsils of district Sargodha and were identified up to species level. Richness and relative abundance of different aphid species were determined by calculating...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Sher Shah Souri1, Bibi Amina3, Wajia Noor4, Abidullah1 and Muhammad Adil1

...rate 90 kg ha-1 produced plants taller (81 cm), nodules plant-1 (22), protein (22.35 %), carbohydrates (61.11 %) and seed N content (3.60 %). Considering Mo x P, interactive effect was found significant for pods plant-1, protein, carbohydrates and seed N content of mungbean crop. On the basis of experimental consequences, it is clinched that mungbean crop with application of molybdenum and phosphorus at rate of 1.5 and 60 kg ha-1 boosted yield and yield attrib...

Hussain Ali1, Shahid Sattar Khan1, Fazal Maula2, Said Hussain Shah3* and Misbah Uddin1

...a incertulas) infest the plants from seedling to maturity, which is one of the key pests that infest the rice crop at regular intervals. It is pivotal to find out management strategies for this pest for higher production of rice. Research experiments were conducted to investigate the impact of different rice varieties and synthetic insecticides on the population density of rice stem borer. Experiments were conducted in randomized complete block design (RCBD) r...
Abdul Jabbar1, Muhammad Tariq1*, Asim Gulzar1, Tariq Mukhtar2 and Tayyaba Zainab3
...ects of extracts of four plants i.e. Azadirachta indica, Zingiber officinale, Syzygium aromaticum and Datura stramonium and their green synthesized silver nanoparticles (AgNPs) were evaluated against 3rd and 4th instar larvae of C. pipiens. The green synthesized AgNPs of these plants were characterized by UV-Multiskaner. LC20 and LC50 values were calculated through Probit and Logit analysis (POLO) software. All the plant ext...

Muhammad Tahir Jan1, Sarfraz Ali Shad2, Mushtaq Ahmad Saleem3 and Muhammad Binyameen2,*

...cotton plant. Out of 240 plants inspected, E. vittella females laid 204 and 194 eggs on 40.9% and 36.9%of the plants in 2011 and 2012, respectively. Spearman Rank Correlation showed that a significant and positive relationship (association) existed between the number of infested plants or plant parts and number of eggs laid. In every week, an average of 6.1±1.2

Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1

...Solanum lycopersicum L.) plants and these were liberated to healthy plants for transmission of viruses. It was evident from the results that the whiteflies were incapable to acquire and transmit chickpea chlorotic dwarf virus (CpCDV)-a mastrevirus and mastrebegomo chimeric virus (MCV) from the symptomatic tobacco and tomato plants to healthy plants. Whit...

Doaa Sh. Mohamed1, Nema S. Shaban2 , Mai M. Labib3, Olfat Shehata4 

...l compounds derived from plants have medicinal and antioxidant properties. The purpose of the current investigation was to investigate if almond oil could protect male mice against doxorubicin-induced cardiotoxicity. The experimental mice were divided into three groups; control group: received 0.9 percent saline, doxorubicin group: Mice were intraperitoneal injected with doxorubicin (5 mg/kg) ithree times over a period of two weeks (dose every five days) and a...
Afsheen Noman Saddar1, Anila Naz Soomro2*, Sadaf Tabasum Qureshi1, Syeda Saleha Hassaney1 and Mukhtiar Ahmed Mahar2
...lity enhancing medicinal plants viz root of sweet flag, seed of radish, root of land-calotrops, leaves of peppermint and flower of red cabbage through brine shrimp toxicity assay. Brine shrimp eggs hatching was optimized by applying three temperature levels (25°C, 27°C and 29°C), three salinities (10 ppt, 30 ppt and 35 ppt), two food demands (0.8 g and 1.6 g) and two levels of shrimp egg (1 g/l and 1.5 g/l). Five concentrations (1200, 2500, 5000, 1...

Muhammad Rizwan, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad

...phs and adults on citrus plants. Results showed that the average population of mealybug nymphs (9.92 individuals per branch) and adults (14.55 individuals per branch) was higher in Bhalwal as compared to Kotmomin and Sargodha. The maximum population of nymphs (31.93 individuals per branch) was observed during April and the adult population was maximum (34.86 individuals per branch) during May. The nymphs and adults were remained lower in January and February. ...

Hosny Kesba1, Ashraf Suloma2, Samy Sayed3*, Abdullah Abdel-Rahman1 and Shaimaa Diab1

...n the production of many plants and is a major problem in organic systems. This study was carried out to examine the influence of irrigation with different effluent water sources, including semi-intensive tilapia pond (STP), intensive tilapia biofloc (ITB) systems, and well water (WW), on the reproduction of Meloidogyne incognita infecting eggplants7 or 45 days after planting in sandy loam or sandy soils. Each irrigation sou...

Saima Naz1*, Ahmad Manan Mustafa Chatha2, Sajjad Ali2 and Muhammad Irfan Ullah3

...s with other insects and plants. Exposure of toxic level of heavy metals can cause DNA damage, learning, sensory disability and memory deficit. Major portion of insects have malformed growth and mortality rate affected by heavy metals, mainly with the exposure of pesticides. On the other hand, pesticides not only alter the behavior, growth and developmental physiology, gut microbiota, but also cause mitochondrial abnormalities. The use of different antibiotics...

Muhammad Tahir Latif1*, Muzzammil Hussain1, Ayesha Latif2, Majid Hamid Bajwa1, Iftikhar Ahmad1, Ali Zohaib1, Naeem Faisal1 and Muhammad Hamza3

...oper fixation of nursery plants in the soil etc. The study results projected mechanically transplanting area (ha) for riding type MT as well as for walk after type MT respectively as 64.78 and 28 annually. Accordingly, there would be 36.15 (000 ha) mechanically transplanted area (5.41%) of province Punjab, Pakistan annually after completion of the Govt. prevailing project on rice.

...

Dali Wang1,2, Yujing Zhu1,2, Wancai Xia1,2, Mei Zhao1,2,3, Chan Yang1,2 and Dayong Li1,2*

...her shrubs or herbaceous plants. Gnaphalium hypoleucum had the highest importance value of the herbs (27.48%), while Leycesteria formosa had the highest importance value of the shrubs (17.33%). The Shannon-Wiener diversity index was significantly higher in the lower section and the Bray-Curtis distance was significantly lower, suggesting vegetation recovery has progressed faster on the lower end of the debris field. The speed of restoration within the landslid...

Shuhuan Li1*, Yongheng Bo2, Youzhi Li3 and Xiuzhen Yang2

...nergic drug from natural plants, and has been widely used in the clinical applications of animals and humans. However, in livestock production, excessive or improper use of atropine will lead to atropine residues in meat. When people eat animal meat from these sources, it will pose a potential threat to human health. Thus, in production practice, atropine residues in meat are usually determined quantitatively. In this study, high performance liquid chromatogra...

Eman Alsayed Hammad1* and Mahmoud Mohamed Hassanin Hasanin2

...rium oxysporum on coleus plants, Coleus forskohlii in vitro and greenhouse conditions. Nanoemulsions of thyme (droplets size was in the range of 25.4–32.9 nm) and spearmint (droplets size was in the range of 5.91–9.77 nm) at concentrations 4000 and 5000ppm separately, recorded the best results in vitro investigations, completely prevented F. oxysporum growth at all concentrations, and increased M. javanica mortality by 100%, in comparison to the no...

I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2,  I Gede Mahardika1,  I Gusti  Nyoman Gde Bidura1

...ts. In some areas, these plants commonly being used as an alternative feed for ruminant, particularly during the dry season, but the study of its effect was limited. This study aims to determine the effect of additional Hibiscus leaf flour (HLF) in the concentrate on protein balance, blood metabolic profile, and body composition of Etawah crossbreed goats. A total of 20 goats with an average initial body weight of 18.22 ± 3.09 kg were used in the study ...
Asmaa Khamis1, Osama Abdalla1, Mohamed Hashem2, Noha Abdelnaeim1*
...go major (PM) are herbal plants that are supposed to have hepatoprotective properties. This study aimed to compare the effects of both medicinal plant extracts on rats intoxicated with carbon tetrachloride (CCl4). A total of 60 male albino rats were equally distributed in six groups. The first group received purified water and was kept as a control. The second and third groups were given oral PN and PM (500 mg/kg/day) for 31 days, respectively. The fourth grou...

Iram Liaqat1*, Umaima Bibi2, Muhammad Arshad3 and Najma Arshad2*

...cted medically principal plants; Hyssopus officinalis, Origanum vulgare, Thymus vulgaris, Glycyrrhiza glabra, Cordia latifolia and Zizyphus jujuba. Antioxidant activity was determined by total phenolic content determination, Pyrogallol method, 2,2-diphenyl-1-picrylhydrazyl (DPPH), hydroxyl radical scavenging assay, and free-radical-scavenging assay. Results revealed that O. vulgare and T. vulgaris possess high free radical scavenging capability and significant...

Abdul Qadoos1, Muhammad Bakhtiar2*, Wajiha Seerat3, Asma Bibi4, Sohail Rahman1, Muhammad Noman Khan5, Ghulam Yaseen6, Mamoona Munir7 and Sadiqullah Khan8

...tiller m-2 (304), taller plants (95.40 cm), maximum spike length (10.72 cm), more grain spike-1(49), greater 1000-grains weight (42 g), greater biomass (10719 kg ha-1), maximum grain yield (4148 kg ha-1) and highest economical yield (38%). Regarding Zn levels Plots treated with Zn @ 16 kg ha-1 produce more plants m-2 (295), taller plants (93.5 cm), maximum spike length (10.57cm), more grai...

Oluwatoyin Adenike Fabiyi

...growth of treated tomato plants. Fruit weight per plant and number of fruits per plant increased notably as opposed to the untreated tomato plants. Nematode population in root and soil of treated tomato plants also reduced significantly. Terpenes, esters, aldehydes, phenols and ketones were identified as the major constituents of the fractions with partial characterization. The reduction i...

Farzana Begum* and Gohar Ayub

... in seeds harvested from plants sown on March 30 as compared to seeds harvested from late sown plants on May 9. Highest hard seed (23.69 %) was recorded in seeds collected from late sown plants on May 9 as compared to other sowing dates. As for as harvesting stages are concerned, maximum seed weight pod-1(3.57 g), 1000 seed weight (61.33 g), seed yield (1.67 t ha-1), germination (81.21 %) ...

Mohamed E. El-Speiy1, Tarek A. Sadak1, Mohamed A. Abd-Elaal1, Ayman M. Khalifah2, Amr S. Morsy2*

...owing rabbits, Medicinal plants, Synergistic effect
...
Ch. Muhammad Rafiq1, Muhammad Rizwan1*, Bilal Atta1, Arshed Makhdoom Sabir1, Misbah Rizwan2, Muhammad Arshad3, Muhammad Zeeshan3, Hamza Latif3, Usama Bin Khalid1, Shawaiz Iqbal1
...with a uniform number of plants in each plot had less incidence of N. lugens as compared to narrow spaced (0 and 30 cm) geometries. More number of N. lugens nymphs (80.0-95.0 number/plant) were recorded with less spaced planting geometry as compared to higher spaced planting geometry (27.0-29.5 numbers/plant) during both years. With different planting geometry, no significant difference was recorded in the agronomic parameters except yield and 1000 grain weigh...

Atta Ullah*, Nasrullah Khan, Ataur Rahman and Rafi Ullah 

... gathered randomly about plants’ medicinal and folk uses in the park. One hundred and sixteen plants species belonging to 99 genera and 50 families were recorded and identified with the help of available literature. Of these, monocots were represented by 17 species under 15 genera and 5 families, while dicots were represented by 99 species belonging to 84 genera and 45 families. The results reflect that 24% of

Abdul Ghaffar*, Niaz Hussain, Muhammad Nadeem, Khalid Hussain, Muhammad Aslam, Mudassar Khaliq, Muhammad Irshad, Zubeda Parveen and Muhammad Younas

... that secondary branches/plants expressed the highest direct positive effect (0.872) grain yield followed by the pods per plant (0.623). Analysis of correlation coefficient also confirmed the highest significant contribution of secondary branches per plant (91.57%) followed by pods (78.12%) and each plant’s primary branches (64%). It was proved from the current experiment that Plants with secondary branches as well as ...

Tooba Ather1, Muhammad Rafiq Shahid2*, Muhammad Ahsin Ayub3, Javed Iqbal2, Muhammad Asim Bhutta2, Muhammad Akram2, Naveeda Anjum4, Muhammad Rizwan6, Hafeezur Rehman5 and Umar Farooq5

...eed on diversity of host plants. Different concentrations of Pyriproxyfen and Buprofezin are Insect Growth Regulator (IGR) were bio-assayed against 3rd instar of CMBat Integrated Pest Management Laboratory, Department of Entomology, University of Agriculture, Faisalabad, during 2016. The results revealed that mortality of 3rd instar of P. solenopsis increased with increase in concentration of Pyriproxyfen and Buprofezin at three days of post application interv...

Umair Faheem1*, Qurban Ali2, Mussurat Hussain1, Abrar Ahmad3, Tamsila Nazir2, Ghayour Ahmad3, Idrees Ahmad3, Madiha Mobeen4, Hammad Hussnain3 and Nadia Hussain Ahmad3

...ous insect pests. Cotton plants shows genetic resistance or tolerance against these insect pests. In the current experiment six varieties of cotton i.e. CIM-496, CIM-534, NIAB-111, MNH-786 and Bt-121 were sown in the field under sprayed and un-sprayed condition to check the genetic resistance or tolerance against these insect pests and to also check the population of the parasitoids. It was observed that MNH-786 and Bt-121 were the most resistant or tolerant v...

Syed Wajahat Husain Jaafry1* and Amber Fatima2

...is well established that plants can communicate with each other under different stressful conditions through (signals, cues, and rhizosphere interactions). Numerous studies have been conducted to find how plants respond to different neighbors at various points of genetic affiliation. Contrasting results and lack of molecular evidence in species recognition studies have made this topic more curious and complex. Some plant spe...

Khaliq Dad1, Fenliang Zhao2, Rumsha Hassan3, Kainat Javed3, Humaira Nawaz4, Muhammad Usman Saleem5, Tahreem Fatima6 and Muhamad Nawaz3*

...which are transported to plants as well as animals through food chain and severely affect the ecosystem by causing acute or chronic disorders in the people of all ages. Similarly these pesticides cause serious threats to the aquatic ecosystem after their release by comprising different toxic substances, heavy metals and contaminants. This review paper has focused on the toxic nature of different pesticides, impacts and their possible refinement strategies from...

Hakan Kececi1*, Yasin Ozturk2, M. Bahaeddin Dortbudak3, Seda Yakut4, Gurdal Dagoglu5 and Merve Ozturk1

...lebur, potentially toxic plants is found abundantly in meadows and pastures. One of the most significant ingredients that causes toxicity is atractyloside (ATR). In this study, the concentration of ATR in cocklebur seeds was determined as 4 mg/g seed. The study involved 54 rats which were divided into a total of 9 groups including one control group. A single dose of cocklebur seed extract was provided by gavage after being concentrated by 2 ml for each animal ...

Iqtidar Hussain1*, Shakeel Ahmad Jatoi2, Muhammad Jawad Nazir1, Ehtesham Ul Haq1, Faheem Abbas1 and Muhammad Saqib Raza Shah1

...lelopathy from perennial plants (trees) surrounding our crops in the field is our focus in agroforestry. To quantify its severity, the phytotoxic impact of popular (Populus deltoides L.) leaves aqueous extract was determined in cultivated oat (Avena sativa L.), maize (Zea mays L.), rice (Oryza sativa L.), pearl millet (Pennisetum glaucumL.), bread wheat (Triticum aestivum L.) and sorghum [Sorghum bicolor (L) Moench. Response of aqueous leaves extract was asses...

Ghulam Qadir1, Khalil Ahmed1*, Muhammad Ashfaq Anjum1, Quais Muhammad Affan2, Muhammad Zaighum Mushtaq3, Muhammad Amjad Qureshi4, Amar Iqbal Saqib1, Hafeezullah Rafa1, Abdul Wakeel1, Ghulam Shabir1, Muhammad Rizwan1, Muhammad Qaisar Nawaz1 and Muhammad Faisal Nawaz1

...ening of available local plants which can grow or survive under salt stress and have considerable economic importance to the farming community. Therefore, a three-years pot experiment was executed to explore the salinity tolerance of medicinal plants i.e., Podeena (Mentha spicata), Hina (Lawsonia inermis), Qulfa (portulace oleracea), Methi (Trigonella foenumgraceum), Dill (Anethum graveolens) and Kalwanji (nigella sativa), u...

Ghalib Ayaz Kachelo1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Shahbaz Talib Sahi1, Nasir Ahmad Khan1, Akhtar Hameed2, Noor Muhammad1 and Muhammad Saqib Mushtaq1

...d their combination. The plants treated with tilt + moringa was found effective as compared to alone applications. tilt + moringa showed minimum disease incidence (15%) followed by Tilt (18.33%) and moringa (32.33%) as compared to control. While under the field conditions same combination of Tilt + moringa expressed minimum disease incidence (18%) followed by tilt (20.83%) and moringa (34.50%). By these findings it is recommended to farmers that, Alternaria le...

Tertia Delia Nova1*, Yulia Yelita2, Rizky Machicula1

...ntally friendly. Aquatic plants belong to the duckweed family which can be found in swamps, lakes, and rice fields. This feed is classified as an unconventional feed that can be used as an alternative feed ingredient for fibrous protein sources. In addition, it contains several minerals, xanthophyll pigments and -carotene which are important nutrients for ducks. However, the practical use of this plant has not been fully studied. This experimental study used a...

Shou-Dong Zhang1,2,3, Dao-Xin Liu1,2, Dan Mou1, Tong-Zuo Zhang2, Jian-Ping Su2 and Jiu-Xiang Xie1*

...ms were analyzed and 103 plants were used in the analyses. Kruskal-Wallis tests revealed statistically significant deviations (from the mean) in Ei values among the four taste groups (χ2 = 199.033, df =3, p = 0.000). Pairwise Mann-Whitney U tests showed that, at the p = 0.05 or higher significance level, the Ei values of the four taste groups could be ranked as: sweet > bitter = other-taste > tasteless. Using bootstrapping analyses, we detected ten s...

Oluwatoyin Adenike Fabiyi

... evaluation of medicinal plants as probable sources of nematicides. A study was conducted in the screenhouse to evaluate the nematicidal potential of Tridax procumbens and Sida acuta (weeds) on root knot nematodes Meloidogyne incognita infesting lettuce and carrots. T. procubmens and S. acuta was applied as soil amendment (400, 600 & 800g) and organic solvent crude extracts (40, 60, 80g/kg soil) in M. incognita infested lettuce and carrot

Muhammad Shafiq1, Tehseen Ashraf2*, Sehrish Mushtaq1, Naveeda Anjum3, Muhammad Asim4, Muhammad Aqeel Feroze3, Malik Abdul Rehman4 and Marja Aziz3

...ypocotyl and cotyledon explants was established. The study was conducted to observe the effect of genotypes, culture conditions and growth regulators on plant regeneration of chili pepper genotypes (Seedex Pepper (SP), Loungi, Tatapuri, and Sanam) grown in Pakistan including. For both hypocotyl and cotyledon explants, SP was found to be the most sensitive among the tested genotypes tested. Maximum mean callus induction rate ...

Hafiz Kashif Ali1, Iftikhar Ahmad1, Mujahid Ali2*, Zahoor Hussain3, Muhammad Ather Nadeem4, Malik Abdul Rehman5, Barkat Ali6, Muhammad Iftikhar7

...highest stem length when plants were sprayed once at 1 ppm Isabion. Among cultivars, ‘Iron Rose’, produced highest leaf area (42.8 cm2) with 3 ppm Isabion application, when sprayed only one time. Among the number of sprays, plants sprayed three times with Isabion produced the thickest stem diameter followed by 2 and 1 sprays. ‘Cheerful White’ had maximum leaf total chlorophyll contents, followed by &l...

Habib Ullah Habib1, Malik Muhammad Akram2, Mujahid Ali1*, Tahir Mehmood3, Muhammad Manzoor4, Maqsood Ahmad3, Hasseb Ahsan1, Muhammad Mazhar Iqbal3, Malik Abdul Rehman5, Muhammad Mohsan1 and Ahsan Mohyo ud Din6 

...hrough Crop Watt. Kinnow plants showed significant results regarding plant canopy, plant height, the average weight of fruits, the weight of large size fruits, the weight of medium size, the weight of small size fruits, number of fruits per plant, number of small fruits per plant, number of medium-size fruits per plant, and number of large size fruits per plant. The maximum number of medium-size fruits (15%) was observed at 15% water depletion level with a 50%...

Dhiya Altememy1, Mohammad Darvishi2*, Samira Shokri3, Saber Abbaszadeh4 

.../mm on day 21. Medicinal plants Origanum vulgare and Hypericum perforatum, especially their active ingredients hypericin and carvacrol, reduce wound microbial load and inflammation and ultimately repair wounds in diabetic rats due to antimicrobial and anti-inflammatory activities. They can therefore be used as an effective remedy for healing wound infections in diabetics.

Keywords | Nanoparticle, Herbal plants, Diabe...

Kokab Nazim1*, Asghari Bano1 and Ghulam Jellani2

...ter transplanting tomato plants were divided into controlled and chilling stressed. Chilling stressed set was placed in open field to apply stress while control treatment was kept in polytunnel. All the genotypes showed significant variability in cold tolerance during two growing seasons. A significant reduction in plant height, setting %age and fruits per plant was observed in sensitive genotypes. Antioxidant enzyme essay showed enhanced production of Superox...

Asma Hassan*, Zuhair Hasnain, Muhmmad Asadullah, Syed Saqlain Hussain and Muhammad Abbas Anees

Shabana Ehsan1*, Aneela Riaz2, Muhammad Amjad Qureshi1, Abid Ali1, Ifra Saleem3, Muhammad Aftab3, Khalid Mehmood4, Fakhar Mujeeb1, Muhammad Asif Ali1, Hina Javed1, Fraza Ijaz1, Anwar-ul-Haq5, Khaliq-ur-Rehman3 and M. Usman Saleem

... Fe-limiting conditions, plants and plant growth-promoting rhizobacterial (PGPR) have a siderophore production mechanism. Inoculation with seed soaking of such siderophore-producing bacteria can be a cost-effective biofortification technique. The current study includes the collection of rhizobacterial isolates from wheat, maize, sorghum, millet, and maize rhizosphere soil of Rawalpindi and Sargodha divisions. The screening of bacterial isolates for siderophore...

Ahmad Nadeem1,2 and Rubina Arshad1,2,*

... MLPA6 mutant inoculated plants as compared to control whereas maximum increase in 100 seed weight (43.1%) and plant weight (90%) was attained in consortium treated plants over control. In desi variety, MLPA6 mutant also manifested significant increase in root length (53%), pod number (43.5%), seed number (50%), 100 seed weight (24%) and plant weight (67.9%) than control. These eco-friendly plant probiotics offer great poten...
Azra Kalhoro1, Abdul Aziz Mirani2, Fozia Khan Siyal1, Tahira Jatt2*, Abdul Razak Mahar1, Sadia Iram3 and Muhammad Abbas Bhutto4
...cated and accumulated in plants and subsequently transferred to human body through the food chain, yet it has become the most commonly used water source for irrigating vegetable crops in peri-urban or urban areas of several countries including in Pakistan. Karachi, the metropolitan city of Pakistan, is the largest industrial and financial hub of the country with an estimated 16 Million population of multilingual, multi-cultural and multi-religious peoples. The...

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

...bserved in leaves of fig plants. To evaluate the presence of Fig latent virus (FLV -1) in fig plants. One hundreds fig trees were collected with virus-like symptoms and symptomless fig trees. The virus was detected by DAS-ELISA. Infected fig leaves were mechanically inoculated on Chenopodium amaranticolor L. and reinoculated on Ch. amaranticolar L. and Nicotiana glutinosa for virus propagation. Fresh wood cuttings (4-6 nodes...

Hasnain Raza1*, Tanveer-ul-Haq1, Muhammad Imran1, Nabeel Ahmad Ikram2 and Muhammad Bilal Shoukat1

...ake wastewater treatment plants for the elimination of hazardous contaminants.

...

Samina Kausar1, Rana Badar Aziz2, Muhammad Waseem3, Muhammad Ahmad3, Hamza Shafiq4, Muhammad Asim5, Usama Zia6, Sobia Afzal7, Wanpeng Xi8*, Mansoor Hameed1* and Muhammad Usman Shoukat9

...ynthetic organisms e.g., plants, bacteria, and algae, while carotenoids also be synthesized in some non-photosynthetic fungi or bacteria. The color gamut of carotenoids is from colorless to yellow, orange to red color, with variations reflected in many vegetables, fruits and flowers. They are categorized into two types: (1) xanthophylls and (2) carotenes. For instance, lycopene is found in tomatoes and watermelon, beta carotene in sweet carrots and potatoes, l...

Ishtiaq Ahmad1*, Muhammad Nafees1, Maryam2, Irfan Ashraf3, Ambreen Maqsood4 and Muhammad Saqib5 

... collected from mulberry plants growing at the experimental area, The Islamia University of Bahawalpur, Pakistan. Analysis of variance showed significant effect of drying methods on fruit quality of mulberry (p ≤ 0.05). There was significant difference (p ≤ 0.05) in fresh and dry fruit weight, fruit width and area, and Cu contents of both the species in spectrophotometer. Reduction in fruit weight, fruit area and moisture percentage were significantly hi...

Mahmut Islamoglu

... are many pests of wheat plants, Sunn pest Eurygaster integriceps Put. (Heteroptera; Scutelleridae) is the most important pest in Turkey and West Asian countries. In our country, it causes important economic losses in wheat with the epidemics it has made from time to time. E. integriceps spends most of its life in overwintering sites. It is thought that knowing the wintering characteristics of Sunn pest will provide important advantages in the fight against th...

Muhammad A. Ahmad1, Shabbir Hussain2*, Humera A. Awan3, Muhammad Riaz4 and Muhammad Saeed1

... justify;">The growth of plants and their productivity can be improved by the use of plant growth regulators (PGRs). The PGRs have pronounced effects on the yield, biochemistry, physiology and plant morphology of wheat crop. Current studies were performed to investigate the effect of PGRs on the yield of wheat crop in Sayban International, Lahore (Pakistan). The field experiments were performed to evaluate the effects of numerous concentrations of three PGRs (...

Rezqita Putri Pitaloka1, Kartiawati Alipin1, Mas Rizky A.A Syamsunarno2, Gemilang Lara Utama3, Ramdan Panigoro2, Ratu Safitri1* 

...can be done with natural plants. Sappan wood (Caesalpinia sappan L.) contains active compounds, such as brazilin and flavonoid with the ability to chelate Fe. This study aims to determine the effect of sappan wood ethanol extract (SWEE) as an adjuvant and substitute for iron chelator. The adjuvant test group was given 60 mg/kg BW iron dextran (ID), 75 mg/kg BW deferiprone (DFP), and 50 to 200 mg/kg BW SWEE, while the substitute group was administered with 60 m...

Nosheen Jehajo*, Nasreen Memon, Mansoor Ali Shah and Naheed Shah

...seeds of neem and castor plants can be used to manage the stored grain pest up to the tolerable limits in integrated pest management. Moreover, the present study suggests further work on the efficacy of some other local plant extractions as an alternative to chemical pesticides.

...
Humaira Gul1*, Muhammad Junaid Yousaf1*, Fawad Ali1, Mamoona Rauf1, Farhad Ali2 and Iqthedar Ali3
.... During the experiment, plants were grown in eleven sets of soil combinations texture wise with varying ratio of sand and clay along their chemical properties. Different growth parameters based on physiological functioning and biochemical aspects were observed for various physical and chemical properties of soil provided to plants for growth optimization.. Barley flourished only well in sandy soil. The number of leaves, bra...

Emtiaz Ibrahim Ghoniem, Gaber Mamdouh Abdelgalil, Amira Farouk Gad* and El-Sayed Hassan Eshra

 
...ricultural pest for many plants. Copper sulfate (CuSO4) is extensively used for controlling a number of molluscs in many areas. In this study, CuSO4 toxicity indices against T. pisana after 24, 48 and 72 h using the topical application technique were estimated. Additionally, in vivo evaluation of acetylcholinesterase (AChE), alkaline phosphatase (ALP), aspartate aminotransferase (AST) and alanine aminotransferase (ALT) activities in T. pisana intoxicated with ...

Shama Sadaf1*, Komal Hassan1, Ayesha Saeed1 and Zeeshan Ahmad2 

...rma and Litchi chinensis plants and applied on 100% cotton. Before and after applying antimicrobial finish mechanical property was checked. The antimicrobial finish was applied by pad dry cure method and finish was fixed by using of poly urethane binder. The presence of microorganisms was checked by ASTEM E2149 shake flask method before and after applying antimicrobial finish and after successive 25 washes. The results were analyzed through MANOVA. The fabric ...
Shahrokh Mojarradgandoukmolla* and Hasan Akan
...e oldest known medicinal plants in the world which is used in the treatment of many diseases due to its various effective compounds. Trigonella strangulata, Trigonella filipes and Trigonella uncinata are three widely used species and folk medicine that grow well in the northern suburbs of Iraq. Therefore, the present study was designed to evaluate and identify the effective compounds of these species and to investigate their physiological ...

Monis Hussain Shah1*, Rizwan Rafique2,6, Munawar Almas1, Muhammad Usman3, Sadia Yasin4 and Sajida Bibi5

...urseries stocks of fruit plants should be certified, the small land holders should be supported by the government incentives for specific fruit production. Research according to the modern steps regarding plant protection measures, introduction of exotic varieties and use of Biotechnological tools for crop improvement should be adopted for better yield and production.

...

Sumaria Maqsood1*, Muhammad Ali 2, Amna Shoaib3, Shahbaz Ahmad2 and Noor-ul-Ain2

...hreatening pests of many plants including tomatoes. In vitro, mass-rearing of S. litura is essential to attain a large number of insects with good quality for bio-ecological studies and biological control programs. In the current study, a modified diet was formulated and assessed against two diets used for mass rearing of S. litura, and tomato fruits were taken as a natural diet. Results revealed that development attributes based on mass rearing of S. litura o...

Zaheer Ahmed Lashari1, Muhammad Saleem Sarki1, Saleem Maseeh Bhatti1, Muhammad Sachal Khokhar1 and Zohaib ur Rehman Bughio2*

...fertilizer that enriches plants and soil. The present research was undertaken to prepare composts utilizing organic wastes and to testify their impacts on onion cultivation. Three dissimilar composts with variable recipes viz. banana plants + poultry manure (Compost 1), banana plants + goat manure (Compost 2) and banana plants + cattle manure (Compost 3)...

Saima Rubab1,3*, Ghazala H Rizwani2, Arjumand Iqbal Durrani3, Iram Liaqat4*, Urooj Zafar5, Mahjabeen6, Farah Batool7, Noor-E- Seher3, Naveera Younas3 and Ayesha Sadiqa8

...of traditional medicinal plants have been used for thousands of years in different region of the globe for the treatment of various diseases. In developing countries, traditional medicines are used as source of primary health care. Keeping in view the importance of Camellia sinensis L., present investigation was aimed to evaluate the phytochemical and pharmacological potential of different morphological parts of C. sinensis L. Successive extractions of all pla...

Samiya Rehman*, Eman Mustafa, Ali Ahmad Faiz, Maheen Kanwal, Farkhanda Yasmin and Arooj Fatima

Huma Abbas1*, Nazir Javed1, Muhammad Kamran2, Sajid Aleem Khan1, Abdul Jabbar1, Akhtar Hameed1, Hira Abbas3, Azhar Iqbal2 and Ehetisham-ul-Haq2
...o (Solanum lycopersicum) plants. Tomato seedlings were transplanted in sterilized soil amended with Cartap, Virtako, Cure and Azadirachtin at their recommended doses and inoculated with 500 freshly hatched juveniles (J2s) of M. incognita. Data were recorded after 7, 14, 21 and 28 days to check the invasion and development stages. All the treatments significantly reduced invasion and subsequent development of M. incognita in roots. Different application methods...

Oluwatoyin Adenike Fabiyi1*, Mariam Temitope Baker2 and Gabriel Ademola Olatunji2

...al activities. Medicinal plants are rich source of acid esters, hence Alstonia boonei (Apocynaceae) leaves were extracted cold in ethyl acetate. This yielded crude extract that was subjected to column chromatography (silica gel 100-120 mesh grade), which afforded fractions that were analysed with GCMS and FTIR for constituent identification. The result shows octanoic acid; hexanoic acid methyl ester; ethyl octanoate; 9, 12-octadecadienoic acid methyl ester; do...

M. M. A. Youssef† and W. M. A. El-Nagdi

...ots i.e., when number of plants in the same pot increased (1-4 plants/pot), a higher number of nematode juveniles in plant roots occurred. Thus, plant density, such as 4 plants if produced it promoted the number of the hatched juveniles, galls and egg-masses in roots as compared to the plant densities of 1, 2 and 3/pot. However, number of juveniles in soil decreased with increasing plant d...

A. Ghasemzadeh1, S. Jamali1†, M. Esfahani2 and H. Pedramfar1

...l, the nematode-stressed plants under both light and dark conditions, amount of minimum and maximum fluorescence (F0 and Fm) and the difference between them (FV), rate of non-photochemical quenching, photochemical quenching and descriptive parameter of non-chemical quenching increased, while the efficiency rate of photosystem II under both conditions trended to a downward with increasing nematode levels. The correlation between nematode levels and various samp...

S. Miheret1, A. Seid2† and N. Hailu3

... with other antagonistic plants. Further research is needed to evaluate the effectiveness of the antagonistic plants in the management of root-knot nematodes under farmer’s field conditions.

...

A.H. Choshali1, S. Rezaee2, S. Jamali3, H. Reza3, Zamanizadeh4 and F. Rejali5

...ere studied. Mycorrhizal plants which pre-colonized for 7 weeks inoculated with 1500 J2 per 1 kg soil. The quantitative activity of chitinase and ß 1, 3 glucanase enzymes was assessed on 2, 4, 6 and 8th days after M. incognita inoculation based on split- plot in time design. Also the results showed that AMF pre-inoculation caused a significant decrease in RKN pathogenicity factors (number of galls, eggs, egg sacs and J2) in both tolerant and susceptible ...

Hira Anwar1, Muhammad Jabran1,3, Anam Moosa2, Usman Arshad2, Abdul Haseeb1, Abdul Jabbar1, Muhammad Burhan4, Amjad Abbas1, Muhammad Naveed5 and Muhammad Amjad Ali1*

...the different changes in plants.

...

Muhammad Shahid Nadeem*, Jalaluddin Azam Khan and Firoz Anwar

...nisms including animals, plants, fungi and microbes. The enzyme has a clinical applications in the diagnosis of many diseases. In the present study we have produced a recombinant of ALT from Pyrococcus abyssi in BL21 (DE3) strain of E. coli. The recombinant enzyme was purified by anion exchange chromatography, it displayed a 45kDa band on SDS-PAGE, with 58.1% final recovery, 15.3 fold purification and 139 U/mg specific activity. Maximum enzyme activity was fou...

M. Israr1, F. Shahina2† and K. Nasira2

...urnip (Brassica rapa L.) plants collected from Mianwali, Punjab, Pakistan. Aphelenchoides turnipi n. sp. belongs to the Group 2 of Aphelenchoides species sensu Shahina with one or sometimes two mucronate structures in female tail terminus and is characterized by small body size (0.29-0.38 mm); two lateral incisures in the lateral field; small stylet with minute basal swellings (stylet: 7-9 μm); vulva at 67-69 percent of body, tail short with pointed mucro (...

I. K.A. Ibrahim1, Z.A. Handoo2† and A. B. A. Basyony1

...ated with different crop plants: Heterodera avenae on wheat, H.
daverti and H. trifolii on Egyptian clover, H. leuceilyma on Bermuda grass, H. lespedezae on lentil, H. goldeni on
qasabagrass, H. schachtii on cabbage and sugar beet, H. zeae on corn and wheat and Globodera rostochiensis on
potato. The cyst nematodes H. leuceilyma and G. rostochiensis are new records of the country and H. lespedezae on
lentil is a n...

M. A. Radwan†, M. M. Abu-Elamayem, S. A. A. Farrag and N. S. Ahmed

...cting tomato
plants was investigated under greenhouse conditions. The results showed that all tested organic acids as well as the
application methods significantly reduced tomato root galls and 2nd stage juvenile numbers in soil compared with
control. Except DNSA and AA, foliar application of tested organic acids was more effective in reducing nematode
galls than soil drench application. Foliar application of ASA...

H. Ravindra1, N. Adivappar2, M. Sehgal3 D. M. Soumya4 and H. B. Narasimhamurthy4

...n. Coriander
plants also exhibited poor growth showing stunting and chlorosis due to severe infestation. This is the first report of
root-knot nematode from Karnataka.
...
M. M. A. Youssef† and W. M. A. El-Nagdi
... were higher on dry bean plants replacing
cutting sugar beet than those on dry bean plants replacing uprooted sugar beet within the most periods. In contrast,
plant growth parameters were higher for dry bean plants replacing uprooted sugar beet than parameters for plants
replacing cutting sugar beet.
...

I. K. A. Ibrahim1 and Z. A. Handoo2

...zosphere of the surveyed plants. Twenty-three genera of phytoparasitic nematodes were detected in the
collected soil and root samples. In soil samples from Alexandria governorate, the sugar beet cyst nematode
(Heterodera schachtii) was very common on sugar beet while the root-knot nematodes Meloidogyne incognita and
M. javanica were very common on guava, olive trees and sugar beet. Helicotylenchu...

I. K. A. Ibrahim1, M. A. EL-Saedy2, S. F. A. Awd-Allah3 and Z. A. Handoo4,

.... goldeni as compared to plants inoculated with M.
incognita concurrently or a week beforehand. When H. daverti or H. zeae were inoculated one week after
inoculation with M. incognita on rice cultivars Giza 178 or Sakha 101, respectively, the final population of these
cyst nematodes increased. Treatments with M. incognita alone or one week before inoculations with the tested
cyst nematodes induced a significant

A. A. Galal1,2, S. F. Abou-Elwafa1,3, F. J. Kopisch-Obuch1 and C. Jung1

...tocol for testing barley plants against root lesion nematode (RLN) had
been standerdized. The plants were grown in 150 cm³ instead of 20 cm³ tubes and we increased the inoculum size
from 400 to 1000 nematodes/plant in combination with a nutrient solution better adapted to the barley crop. Six
barley accessions were tested with Pratylenchus neglectus and Pratylenchus penetrans. Te...

K. Taimoor1† and F. Shahina2

...s medicinal and aromatic plants viz., Perovskia abrotanoides, Valeriana wallichii, Artemisia
vulgaris, Peganum harmala, Saphora alopecuroides, Artemisia absinthium, Carum copticum, Berberis
balochistanica, Matricaria lasiocarpa, Ephedra procera, Centratherum anthelminticum, Zatoria multiflora,
Lallemantia royaleana, Mentha spicata, Withania coagulans, Achillea santolina, Ferula oopoda, Nepeta cateria,
Teucrium st...
A.W. Aseffa1, F. F. Addisu2, G. N. Roge3, L. T. Hadis4, T. B. Abera5, M. G. Gero6 and B. H. Meressa1†

I.K.A. Ibrahim1 and Z. A. Handoo2

...matode infection on rice plants.

...

S. Anwar1, K. Wieczorek1 and E. Inselsbacher2

.... schachtii infection in plants.

...

A. S. A. Saad1, M. B. Al-Kadi1, A. A. A. Deeabes2 and A. M. El-Kholy2

...ncognita) affecting okra plants in vitro as well as in vivo conditions. Five concentrations of all chemicals were prepared. Data of in vitro studies showed a marked nematicidal and nematode hatching inhibitory activity against root-knot nematode (M. incognita). However, the nematicidal activity differed between treatments as compared to control. Fosthiazate was found as the most toxic compound against J2 of M. incognita after 24 and 48 hour exposure time as we...

M. Israr†1, F. Shahina1 and M. Habib2

...ted and un-infected host plants. Data indicates that highest reproduction rate and root-knot index was observed in vegetable plants infected with root-knot nematodes after three months as compared to un-infected (control). The physiological parameters as well as biochemical contents showed significant difference in different growth criteria and amount of nutrients between infected host plants<...

Farwa Batool1*, Riaz ur Rehman1, Samia Ikram2 and Maham Zahara3

...strate source in nursery plants production. The present research is focusing on the utilization of agriculture waste with different proportions for better foliage plant growth and development. Different combinations of silt, sand, leaf compost, FYM, peat moss, sawdust and garden soil were used as (SGS) for the growth and quality of three selected foliage plants (A. commutatum, D. deremensis and A. elatiors). The plant respon...

C. Azhagumurugan† and M.K. Rajan

... The control and treated plants
were analyzed for various growth characteristics such as, root and shoot length, fresh and dry weight of root and
shoot, leaf area, root gall index and chlorophyll content after 65 days. These growth characteristics found decreased
with increasing inoculum levels of egg-masses and increased with increasing concentrations of leaf extract
treatment and fresh and dry weight of root an...

A.M. Korayem, M.M.M. Mohamed† and S.M. EL-Ashry1

...udied on common dry bean plants under natural
infestation in the field at two different seasons of planting. In the first season, bean was grown in Autumn, 2012
while, the second season in early Spring, 2013. For the first season, the relation between nematode initial population
density and bean yield was significantly negative (r = -0.6). A significant reduction in bean yield (P = 0.05) was
obtained when nematod...

R.R. Arain, R.N. Syed, A.Q. Rajput, M.A. Khanzada1, N.A. Rajput and A.M. Lodhi1

...en of tomato
plants. The artificial inoculation of M. incognita developed a large number of galls and suppressed the tomato
plant growth significantly. Three different concentrations of neem extract, furadan and Trichoderma harzianum
were evaluated to control the M. incognita. All concentrations proved effective in reducing the disease
development in nematode inoculated tomato plants
C. Azhagumurugan and M.K. Rajan
...control and experimental plants were analyzed for various biochemical constituents such as,
carbohydrate, protein, amino acid, lipid, proline and phenol content after 65 days of treatment. Carbohydrate and
protein were found decreased with increasing inoculum levels of egg-masses and increased with increasing
concentrations of leaf extract treatment and lipid, amino acid, proline and phenol content found increased with
...

S.A. Khan†, M. Abid and F. Hussain1

...tack nearly all types of plants. In
this study 32 seaweeds were evaluated to determine nematicidal activity against Meloidogyne javanica (egg
hatching and larval mortality tests) in vitro. Results revealed that seaweed biochemical potential in two different
solvents viz., water and methanol @ ratios 2.5, 5 and 10%. It is observed that Sargasssum tenerrimum, Padina
tetrastromatica and Melanothamnus afaqhusainii sh...

W.M.A. El-Nagdi and M.M.A. Youssef†

...cowpea, maize and sesame plants
replacing sugar beet for controlling root-knot nematode, Meloidogyne incognita resulted that sugar beet-Hybrid
maize and sugar beet-sesame cropping sequences proved most effective against root-knot nematode as they reduced
nematode parameters as indicated by the number of galls, egg-masses and hatched juveniles on roots. Consequently,
they lowered rates...

N. Hajra

... soil components treated plants. Higher proline concentrations
reflected in leaves of treated plants as compared with mycorrhizal treated plants. The decrease in shoot length,
number of leaves and leaf area were observed in non mycorrhizal and plant treated with other biotic and
abiotic stresses. Higher amount of proline was produced in non mycorrhizal a...

I. Kepenekci

...found associated with 66 plants from 48 different
localities of the country.
...

M.A.M. El-Saedy, A.A. Mokbel*† and S.E. Hammad**

...cognita infecting tomato plants under laboratory,
greenhouse and field conditions. Treatments with essential oils of arugula, camphor, castor, garlic, nigella, onion
and sesame resulted in 48.0-92.7% reduction in numbers of root galls/root under laboratory conditions. Similarly,
application of these oils resulted in great reductions of 59.2-92.8% and 47.4-89.6% in numbers of root galls and

A.W. Amin† and A.W. Mona*

...s indicate that cucumber plants grafted onto Ercola hybrid 6001, C. maxima x C. moshata (Ercola
6001) and Bh had highly significant less root galling, number of females and egg-masses than non-grafted and
infested one. The reduction in number of galls ranged between Rugby 10G (47%) grafted onto Bh (98.3%) and
Rugby 10G (30.2%) grafted onto Ercola 6001 (84.5%), respectively in two seasons followed by grafted onto Ercola
...

A.E. Ismail† and A.M. Kheir*

...ngest than on the oldest plants.
...

F. Shahina†, K.A. Tabassum and M.A. Habib*

...e number of bollworms on plants before and 24 hrs after
EPN spray @ 1000 and 2000 juveniles/ml water were assessed for mortality percentage. All four species of insects,
viz., Helicoverpa armigera, Earias insulana, E. vitella and Pectinophora gossypiella were found susceptible to
infective juveniles of the four EPN species; S. pakistanense was the most virulent EPN species. There is a dire need
to focus further r...

A.A. Mokbel

...he rhizosphere of peanut plants.
Meloidogyne arenaria was the most common nematode in all collected soil samples followed by Tylenchorhynchus
spp., Helicotylenchus spp., M. javanica and Pratylenchus penetrans. All tested peanut cultivars were resistant to M.
incognita race 2 and moderately resistant to M. javanica. Whereas, peanut cvs. Balady, Ismailia 1 and Giza 6 were
found highly s...

A.A. Anter, A.W. Amin†, A.H. Ashoub* and A.S. El-Nuby*

...gyne incognita in tomato plants cv.
Castel Rock was investigated under greenhouse conditions. All inducers were applied as soil dren ch to
tomato plants grown in 25 cm-diam. earthen pots. Three days-before nematode inoculation time treatment
maximized the efficacy of tested chemicals in reducing nematode galls, egg-masses and eggs numbers
followed by synchronized addition with ...

A.W. Amin†, A.A. Anter, A.H. Ashoub* and A.S. El-Nuby*

...elevated in bacteriazied plants as compared
nematode infected plant as well as total phenol content. Results revealed that crude culture suspension of bacteria
was more effective for reducing nematode population followed by cell-free culture filtrates, bacterial live cells and
bacterial dead cells, sequentially. It was concluded that bacteria has induced tomato resistance or bio-control effects
against M. incogni...

W.M.A. El-Nagdi†, M.M.A. Youssef and M.G. Dawood*

...ge compared to untreated plants significantly (p ≤ 0.05). Lower concentration of the tested materials caused
higher percentages reduction the mentioned nematode criteria. Vice versa, increase in length of shoots, dry and fresh
weights of shoots and roots occurred by higher concentration of each material followed by those occurred by
moderate and lower ones. The percentages of total soluble carbohydrates, proteins, phenoli...

Najam-ul-Sehar Afshan1*, Javeria Majeed1, Abdul Rehman Niazi1, Saima Khanum2, Maria Riaz1, Muhammad Fiaz2 and Shaila Anjum

...ed in Pakistan. Infected plants were collected from districts Mansehra and Abbottabad of Khyber Pakhtunkhwa, and district Lahore of Punjab, Pakistan, during phytopathogenic surveys in 2015–2020. The causal fungus was observed and identified on the basis of morpho-anatomical and molecular analyses. This is the first report of powdery mildew infection caused by Erysiphe necator var. necator from Punjab and Khyber Pakhtunkhwa provinces of Pakistan.

...

Kalsoom1, Nasir Shah2, Muhammad Ibrahim3*, Tahira Bibi1, Kazim Ali4 and Zahir Shah2

... salt in MS media, while plants of all the tested varieties were dead at concentrations more than 50 mM of NaCl in in vitro condition (75, 100 mM). Variation was observed in the level of tolerance to salinity in these potato varieties. Increasing NaCl (mM) level reduced the overall plant growth, number of shoots, number of nodes and leaves, root and shoot lengths (cm), fresh as well as dry root and shoot weights (g). In contrast, proline, Na+ and K+ (mg g-1 FW...

Saima Mumtaz1,3*, M. Imran Kasana1, Riaz Alam1, Noorullah Khan1, Muhammad Noman1, Sanjeela Sabahat1 and Hussain Shah2

...survival rate of layered plants, more requirement of mother stock and labor intensive method. To address these issues an alternative technique has been employed for quick multiplication of litchi. In the present study we have investigated the influence of various levels of Indole Butyric Acid (IBA) on four Litchi cultivars (Gola, Surahi, China and Bedana) for root induction, its development and success rate of survival in hardwood cuttings. Six treatments of I...

Tariq Mahmood1*, Mamoona Wali Muhammad2, Sami Ullah1, Bilal Ahmad3, Zarmina Aslam4, Naveed Ahmad Khan5, Muhammad Shahzaib Tariq6, Muhammad Ali Raza6, Rana Usama Iqbal7 and Samia Zain8

...advantageous not only to plants and insect colonies but also to humans. Honey bees helps preserve ecosystems as they offer pollination to many wild flowering plants. These pollinators are now under attack from a variety of sources. Pesticides, habitat degradation, genetic diversity loss, inclusion of genetically modified crops, and parasites are among the main threats to these pollinators. As a result of their decrease, ther...

Muhammad Adeel Qureshi1*, Raza Ahmad2, Bilal Ahmed1, Tanzim Ullah Khan1 and Muhammad Yasin3

...ts. All the internodal explants placed on CIM1 produced 100% callus while CIM2 produced 70% callus. No callus was observed from leaves on CIM1 and CIM2. After callus induction, four different types of media were used for plant regeneration, having different concentrations of cytokinin (BAP and Zeatin) i.e. RZ1.5, RZ2, RB1 and RB2. The most efficient regeneration media was RZ2, having Zeatin 2mg/lit showed early and maximum shoot formation. On average, 05 shoot...

Syed Shah Mohioudin Gillani1, Muhammad Naveed Tahir1, Adeel Anwar1*, Syed Ijaz Ul Haq2, Muhammad Awais3, Mujahid Iqbal4, Javed Iqbal5, Hina Ahmed Malik3, Syed Muhammad Zaigham Abbas Naqvi6, Raza Ullah7 and Muhammad Abdullah Khan1

...orophyll pigmentation in plants is a supreme factor to assess the health of plants and ultimately leads to crop yield estimation. The present experiment evaluated the capacity of high-resolution satellite imagery to estimate wheat chlorophyll content coupled with ground-based information for accurately monitoring crop chlorophyll status under rainfed conditions. Images with zero clouds from LANDSAT 8 and ground data collecti...

Muhammad Afzal1,3*, Shafqat Saeed1, Hasan Riaz1, Muhammad Ishtiaq1, M. Habib ur Rahman2

...Pakistan. Alternate host plants belonged to vegetables, weeds, and mixed farming practices helped the evolution of new viral and whitefly species. The CLCuD develops resistant cultivars against CLCuV and screening of new host resistance forms. Applications of DNA markers to induce resistance into the cultivars and editing of genome are some of the good practices contributing to suppress this disease. The study is helpful in understanding population dynamics of...

B. K. Goswami, C. Bhattacharya, R. Paul and T. A. Khan

...b(255, 255, 255);"> plants. Among the tested treatments, Trichoderma viride

A.E. Ismail and M. M. Mohamed

...s compared to un-amended plants. All rates of Ch M treatment gave best results in protecting sugar beet plants and diminishing the nematode population densities in various stages. But, SM treatment with their rates ranked statistically in the second category. However, the three levels of CM treatment achieved the third category in managing the nematode. All treatments significantly improved infected sugar beet growth includi...

B. Archana and R. Saxena

...ous extract of medicinal plants viz., Amaranthus spinosus,Chenopodium album, Catharanthus roseus, Solanum nigrum and Ocimum sanctum were investigated for their nematicidal activity against second stage juvenile of Meloidogyne incognita by in vitro technique. Aqueous extract of all plant roots exhibited nematicidal activity. LC50 values calculated as 1024 ppm for C. roseus, 1867 ppm for S. nigrum, 1968 ppm for A. spinosus, 3428 ppm for C. album and 962 ppm for ...

Mohamed S. Abbas1*, Adel E.M. Mahmoud2, Hemat S. Mohamed3, Adam Cieślak4 and Małgorzata Szumacher-Strabel4

... effect of dietary forge plants (grasses, legumes and forbs) contents and concentration on ruminal fermentation, pH, ammonia (NH3), total gas production (TGP), methane and volatile fatty acids (VFA) concentration. Twenty-six wild palatable forage plants were identified and analyzed for pH, NH3, TGP, methane and VFA. The results indicated that in grasses the highest pH and NH3 concentration was found in Aeluropus lagopoides, ...

Rehman Shabbir1, Ghulam Sarwar1, Noor us-Sabah1, Mukkaram Ali Tahir1, Muhammad Luqman*2, Muhammad Fahad Ullah3, Muhammad Zeeshan Manzoor1 and Imran Shahzad1

...ies and growth of tomato plants. The physiochemical parameters of the soil such as pH, EC, organic matter, heavy metals and physiological parameters of the tomato plants were observed. Most of the soil parameters were proved higher with the irrigation of the industrial wastewater effluents than the soil irrigated with canal water. The tomato plants were grown at the different ratios of ind...

Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*

...in the feed derived from plants.

...

Rahmat Ullah Khan1*, Karim Gabol1, Asif Sadam2, Waheed Ali Panhwar3, Hamidullah4 and Abdul Rahim1

...or on the branch fork of plants. The nests were mainly constructed using local dry grasses (48%) followed by crop leaves (35%), plastic string (10%), and unidentified materials (7%). The average outer diameter of the nest 12.00±1.1 cm, inner diameter 9.13±2.3 cm and inner cup depth was 4.99±2.1 cm. This bird has one brood per season. Overall breeding cycle lasted for 90 days. The shape of the eggs was oblong and white pinkish, with darker ...
SYED ZULFIQAR ALI ABIDI, HAFIZ ABDULLAH SHAKIR, SYED SHAHID ALI, & JAVED IQBAL QAZI*
... potential. Total thirty plants were collected on the basis of their availability and abundance around the year from different locations of Punjab, Pakistan. The aqueous and alcoholic extract of fresh and dried parts of each plant were used for qualitative estimation of thirteen metabolites (alkaloids, carbohydrate, cardiac glycoside, flavonoid, phenol, phlobatannine, free amino acids, saponins, tannins, terpenoids, quinine, oxalic acid and steroids). Twenty o...
SAEED AHMED*1, ZIA-UR-RAHMAN1, SALMA KHALID2, TARIQ KHAN1, ARSHAD IQBAL3
& ZAMARUD SHAH4
...inking water. Filtration plants, proper chlorination and awareness program should be carried out for safe drinking water.
 
Key Words: Drinking water, Microbial contamination, waste management.
...
 
 SADAF SARFRAZ1*, SAFDAR AMEER1, REENA AMBREEN1, SHOMAILA SIKANDAR 2, SHAISTA NAWAZ3 AND YASIR SALEEM
...ally occurring medicinal plants, Cinnamaldehyde, owing to its acid generation, acid tolerance and virulence gene expression has gained a considerable attention. Keeping in view its beneficial aspects, the present study has been conducted to investigate the contents and compare the nutritional and antimicrobial activities of Cinnamon collected from various regions of Asia. In this study, antimicrobial activity of cinn...

Arief1, Roni Pazla2*, Rizqan1, Novirman Jamarun2 

...

Tithonia diversifolia plants and cassava leaves have the potential to be used as a substitute for field grass. Palm kernel cake is a waste of the palm oil processing industry and can be used as a concentrated alternative. This study aims to determine the impact of giving Tithonia diversifolia plants, cassava leaves, and palm concentrates on the milk production and quality (fat and lactose), intake, and digestibility of Et...

Muhammad Ramzan1*, Unsar Naeem-Ullah2, Shafia Saba2, Madiha Mobeen Khan3, Umair Faheem4, Asad-ur-Rehman3, Naeem Arshad Maan3 and Waseem Hassan5

...lected from the infested plants grown in lawns of Muhammad Nawaz Shareef University of Agriculture, Multan, Pakistan, and were brought to the lab for rearing and identification. After emergence of moths, specimens were killed and identified using available taxonomic keys under stereomicroscope. After identification, it was revealed that the insect under study was identified as T. varians. After going through the relevant literature, it was found that this spec...
Heavy metals (HMs) are harmful and lethal at negligible levels and non-biodegradable in the typical ecosystem and constitutes animal, human and environmental hazards. They are divided into toxic metals like Lead, Cadmium, Arsenic, etc. and essential elements like copper, zinc, manganese, iron, nickel and chromium. Additionally, could be categorized into two groups based on the natural and anthropogenic sources releasing origins. Population and industrial expansion led to food contamination with HMs. Poisonous metals can be transferred from irrigation water to agricultural soils, agricultural operations, air pollution, animal feed, and packaging materials. Toxic metals are non-biodegradable, non-thermos degradable, and exceedingly stable in the ecosystem; as a result, they quickly build in various foods. Metal pollution of many foods, including agricultural commodities, and animal protein sources such as fish, milk, meat, and eggs, poses a hazard to food safety and security. Toxic metal pollution of irrigation water, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazardous HMs pathway into the food chain and the human body. Metal nanoparticles are employed in beneficial applications, although they are associated with specific hazards.
 
Keywords | Food contamination, Heavy metals, Nanoparticles, Pollution sources, Remedy, Soil contamination
...ter, agricultural soils, plants, and animals result in their integration into the food chain, posing a health hazard to humans. Most metals are harmful to animals and humans and accumulate in several organs like the skeleton, hepatic tissue, spleen, and renal tissues. Metals have a deleterious impact on the production of plants and animals. As a result, several remediation strategies have become necessary to limit the hazard...
Riaz Muhammad1*, Aamer Sharif2 and Muftooh ur Rehman Siddiqi³
...arious micro hydro-power plants because of its low head, cost-effectiveness, environmentally friendly and minimal installation and setup time. In the present study, the performance of single-stage gravitational water vortex turbine assembled in a conical basin with curved blade has been analyzed at different head and flow rate to investigate the performance parameters such as vortex formation, vortex height and rotational speed. In addition to that, the influe...
Muhammad Arabi Awan1, Hafiz Husnain Nawaz2*, Naeem Akhtar2 and Azmat Ali Awan3
...ion on a 10 cm branch in plants treated with CHLORPYRIPHOS 50% EC and THIAMETHOXAM 25 WG was significantly different from that of the control and Detergent, but not from either of the other two treatments. The control group had the highest olive psyllid population, which was measured at 22.08 total individuals. These results suggest that treatment with detergent was the most effective at reducing the population of olive psyllids, while CHLORPYRIPHOS 50% EC and...

A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1

... YN isolated from potato plants cultivated at Monofyia Governorate. RNA was extracted from virus-infected tissues of D. metel leaves by the use of degenerate primers through polymerase chain reaction (PCR). Large-scale amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolati...

Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2

...m and Physalis peruviana plants. Total nucleic acids were reverse transcribed using Retrotool reverse transcriptase enzyme and the PCR reactions were performed for 30 min in a capillary thermal cycler.  RFLP analysis of the PCR products was performed using Msel restriction enzyme. The results showed a dimorphic restriction digestion profile that "as suitable for identifying the two isolates. The method described here is rapid. reliable and highly rec...

E. K. Allam1; Kh. A. El-Dougdoug1; M. A. Amer2; A. A. Abou-Zaid2; and S. M. Amin2

...) was detected in potato plants grown in Egypt using return-polyacrylamide gel electrophoresis (R-PAGE) and molecular techniques. The method involved the extraction of circular nucleic acids followed by electrophoretic analysis of the extracts on 5% polyacrylamide gel. A reverse transcription-polymerase Chain reaction (RT-PCR) assay was used for the isolation and identification of PSTVd cDNA from infected plant materials using a specific primer to PSTVd. A maj...

A. S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik2; Nashwa M. A. Abd El Mohsen1; and H. M. Abdelmaksoud1

...fy;">The infected potato plants showed aucuba symptom characteristic to this virus (brilliant and extensive yellow mottle on lower and middle leaves reaches their tips, brown patches and sunken brown areas were frequently observed on the tubers surface) were used as a virus source. Isolation and identification of the virus was performed through studying biological, serological, and molecular characters. Electron microscopy helped for illustration Of Morphology...

S.A. El-Kewey1; R.A. Omar1; S.A. Sidaros2 and Samaa Abd El-Khalik3

...erity symptoms on garlic plants of both cultivars. The electron microscope preparations of crude sap extracted from naturally infected garlic plants and negatively stained with 2% PTA showed flexuous rod-shaped particles 657-714 nm long. Biological relationships between the virus and insect vectors were studied.

...

 Salwa N. Zeinl and Hanaa S. Zawam2

... was transmitted to bait plants grown in soil containing Xiphinema spp. nematodes, The virus was identified according to host range, mode of transmission, particle morphology, serological tests, and SDS-Polyacrylamide gels. Purification of ACLSV was performed using bentonite/polyethylene glycol. Electron micrograph of purified virus preparation revealed flexuous filamentous virus particles of 700 nm length and 12 nm wide. The average yield was 1.14-1.7mg/100 g...

Bismillah Khan1*, Muhammad Mehran Anjum1,2*, Maaz Ullah1, Izharullah1, Aftab Ahmad3 and Jawad Akbar1

...gher weeds density (79.6 plants m-2), (64.0 plants m-2) and (39.6 plants m-2) 30, 60 and 90 DAS, respectively. Similarly, local check PS-15 produced higher weeds fresh weight (219.6 g m-2), (253.7 g m-2) and (303.0 g m-2) 30, 60 and 90 DAS, respectively. Moreover, weeds dry weight was recorded higher (61.3 g m-2), (88.6 g m-2) and (111.6 g m-2) 30, 60 and 90 DAS in local cultivar PS-15, re...
Saiwa N. Zein
...eedlings and tested host plants. Host range of the virus studied was restricted in Chenopodiceae. Cucurbitaceae. Ebenaceae. Leguminosae and Solanaceae. The identity of the virus to TRV was confirmed by mode of transmission. particle morphology and serological typing. Examination or the purified virus preparation 1» electron microscopy revealed rod-purify the Egyptian isolate of TRV. The yield of the virus was 2.6-5.7 mg/ 100 g tissue of Nicotiona rustica...

Adel B. Salama and Reham M. Sabry*

...ontrol). Petal harvested plants produced a significantly much more harvestable total flower yield of 297-350 per plant than control with 48-51 flower/plant. Further, petal harvesting has significant effect on the flowers number and it increased 6-7 folds; hence possibly improve the compensation ability of plants to set new buds. Petal harvesting had positive significant effects on plant fresh and dry weights, seed yield but ...

Najamuddin Solangi1*, Mushtaque Ahmed Jatoi1, Adel Ahmed Abul-Soad2, Abdul Aziz Mirani1, Muhammad Aslam Solangi3 and Ghulam Sarwar Markhand1

...ngi and Ajwa. Spikelet explants of spathes (avg. 17, 28, 32 cm) excised at different intervals were used as initial explants. Results revealed that sterilization of spathes with 50% sodium hypochlorite (NaOCl) solution resulted in significantly highest survival, lowest mortality and contamination in spikelet explants. The spikelet explants obtained from ...

Muhammad Asim Bhutta1,2*, Amna Bibi2, Nadia Hussain Ahmad2, Sadia Kanwal2, Zarmeena Amjad1, Hafeez ur Rehman3, Umar Farooq3, Muhammad Nouman Khalid4 and Syeda Fiza Nayab5

Rahma Boukarine*, Leila Hamdi and Kamel Khelili

...have been extracted from plants and fruits, especially antioxidants which aid protect against oxidative stress. This study was conducted on Albino Wistar rats to investigate the antioxidant effect of Eruca sativa on the hepatic and renal profile damaged by xylene. Seventy rats were divided into seven equal groups and treated by gavage for 30 days as follows: Control group (C), group (CO), positive control group (RE) was received 350 mg / Kg bw of Eruca sativa ...

Anwar ul Haq1, Maqsooda Parveen2, Shehzadi Saima3* and Khalid Masood Ahmad1*

...ping losses of these pot plants. Optimum concentration of appropriate auxins is used to promote effective rooting. Completely randomized design (CRD) is adopted and it consisted of five treatments including control and different concentration of both auxins viz. 1-Naphthalene acetic acid (50 mg/L,100 mg/L) and Indole-3-acetic acid (100 mg/L, 200 mg/L) on tip cuttings of chrysanthemum. In this experiment, 15 pots of 9-inch diameter were used which were filled w...

Hassan Raza1, Muhammad Kashif Afzal2, Muhammad Luqman1*, Tahir Munir Butt3, Muhammad Yaseen1 and Muhammad Umer Mehmood1

...ist with a minimum of 50 plants was collected from the Department of Agriculture (Extension). A total sample size of 310 farmers was selected through a purposive sampling procedure by using Morgan and Krejcie table as the total population (Olive growers in the targeted research areas) is 1500. Data were collected through a face to face interviews with the help of an interview schedule. The SPSS (Statistical Package for Social Sciences) and MS. Office software ...

Sahar Ezeldien1,2, Foromo Dramou2, Fatma M. Yousseff3*, Alexander A. Nikishov2, Sergy B Seleznev2

...e most popular medicinal plants known for its antibacterial, anti-inflammatory, and antioxidant properties. This study was conducted to determine the effect of chamomile aqueous extract on the productivity, egg quality, and serum biochemical parameters of laying Japanese quail. A total of 42 Japanese quail were separated into two groups of 21 birds each, with three replicates per group (7 birds) at random; the control group without any additives and the supple...

Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Summer, Ali Haidar Gormani, Saira Nawaz and Ayesha Muzamil

...ferent parts of mulberry plants. Mulberry leaves possess different physiological and biological potentials. Inflammation is the most common factor involved in various chronic diseases. This research study was conducted to evaluate anti-inflammatory and analgesic potentials of hot water extracts of mulberry leaves (mulberry tea) of two species i.e., Morus alba and Morus nigra. Mice were fed orally with mulberry leaves extract (200mg/kg, 100mg/kg and 50mg/kg) mi...

Imtiaz Khan1*, Bashir Ahmad1, Ahmad ur Rahman Saljoqi1, Shah Alam Khan1, Javed Khan3 and Muhammad Azim Khan2

...eters having 3 rows and 5plants/row in randomized complete block design (RCBD) with three replications. The data was recorded from Mar-Nov from fresh and ratoon crops of the year 2020 and 2021, respectively. The leaves (top, middle, and bottom) of five plants in each subplot was observed randomly for data collection every fortnight in all replications. The total mean population of Pyrilla perpusilla (eggs cluster and nymphs/...

Sarwat Yousuf1, Shaista Emad2 , Mohammad Misbah ur Rehman3, Zehra Batool4, Sara Qadeer5, Yousra Sarfaraz1, Sheeza Sheikh1, Sana Sadaf6 and Tahira Perveen1,*

...e therapeutic potency of plants has been known for ages and the ability to divulge their biological activity is an area of great interest. Citrus lemon is traditionally used as an antioxidant, antibacterial and anti-inflammatory agent. This study intended to determine the potential role of lemon peel oil in neurobehavioral function and oxidative stress. Rats were treated with lemon peel oil at a dose of 0.7, 1.4, 2.1, 2.7, 3.5 g/kg for 14 days. Results showed ...

Amina Rahat1, Zahin Anjum1*, Sehlina Zehra2, Fatima Umal Baneen3 and Rabia Chishti1

...are present in medicinal plants. These bioactive chemicals serve as a foundation for the creation of antibiotics that are utilized to cure infectious illnesses. Allium sativum is being used traditionally since ages for many purposes. It is extensively used in numerous dishes throughout the world and due to its aromatic nature, as a fragrance and Plantago ovata is traditionally used for many therapeutic purposes; laxative anti-acidic stabliser, stomach soothing...

Monis Hussain Shah1*, Riaz Ur Rehman2, Riaz Ali Shah1, Farwa Batool3, Rizwan Rafique4, Muhammad Usman5, Sajida Bibi6, Sadia Yasin7 and Samida Qamar8

.... The performance of the plants during 2017-18 were judged by observing the bulb germination percentage, leaf width (cm), leaf length (cm), scape length (cm), flower size (mm), primary color of the flower, secondary color of flower, no. of large, medium and small size of bulbs and number of bulbs harvested. The bulbs were harvested and stored at 5±2oC (In Refrigerator). The morphological attributes of plants were obse...

Altaf Ur Rahman1, Muhammad Ajmal Khan2*, Ali Hazrat3, Awais Farid4, Muhammad Yahya3* and Inam Ullah5

...terial strains. Numerous plants act as a source of novel compounds that could be used to develop new drugs. Therefore, the current study was aimed to investigate the methanolic extract of Corylus jacquemontii for phytochemical, antibacterial, antioxidant potential. The methanolic fraction of C. jacquemontii was evaluated for quantitative phytochemical constituents. The antibacterial efficacy was investigated via well diffusion method by using a concentration o...

Shujaullah Khan1, Zahid Hussain1*, Haroon Khan1 and Omer Suha Uslu2

...ts. However, the tallest plants and the highest number of grains spike-1 were observed in hand weeding. The highest thousand-grain-weight, biological yield and grain yield were recorded in the hand weeding treatments. However, the results of hand weeding treatments were statistically at par with the treatments of artificial intelligence (robotic weeding). The artificial intelligence got the highest CBR followed by the broad-spectrum herbicide and hand weeding....

Ahmed El-Sayed Ismail 

...lings than on the oldest plants. Studies on the effect of N, P and/ or K fertilizers applied to Giza 2 corn on the behaviour of H. zeae revealed that the nematode population greatly varied according to the fertilizer type and level. When N, P, or K were used separately, the fertilized plants sustained the lowest nematode final population and rate of build-up as compared with those of the control plan...

Farooq Jan1*, Abdur Rauf1, Ikramullah Khan1, Muhammad Yasin2, Muhammad Qayash3, Hazrat Wali1, Muhammad Luqman1, Fayaz Asad4 and Muhammad Khalid5

...ng RotoRod sampler. Many plants pollen are allergenic that cause different types of allergenic diseases globally. Pakistan also faces the problem of pollen allergy caused by various plants pollen. Among these allergenic pollen producing plants are Broussonetia papyrifera, Alternanthera pungens, Cannabis sativa, Eucalyptus globulus and Taraxacum officinales pollen grains are dominant. These...

Zia Gul1, Muhammad Sajid1, Muhammad Noman Khan1*, Faheem ul Haq1, Zohra Nawaz1, Muhammad Bakhtiar2, Sajid Siddique1, Komal Aslam3 and Muhammad Irshad1

...(80.8) was recorded when plants were irrigated at 15 days interval. While regarding organic manures, the maximum number of leaves (11.0) plant-1, plant height (41.6cm), leaf length (39.5 cm), leaf area (247.8cm2) leaf breadth (4.7 cm), leaf thickness (3.5 cm) leaf weight (207.3 g), number of suckers (4.1) plant-1, amount of gel (174.7 g) leaf-1 and survival percentage (71.5) was recorded in plants fertilized with poultry man...

Akbar Hayat1*, Muhammad Asim1*, Tehseen Ashraf2, Ehsan-Ul-Haque1, Rabia Zulifqar2, Maryam Nasir3, Ahmed Raza1, Fahim Khadija1, Sohaib Afzal1 and Shafqat Ali1

... of healthy and vigorous plants in the nursery. The trial was designed with seven treatment combinations of growing substrates that was five times repeated for each treatment in Completely Randomized Design (CRD). The rough lemon rootstock was tested for growth with all different types of media as T1 = Soil + silt + sand (2:1:1), T2 = Rice husk + sand + soil (2:1:1), T3 = Bagass + sand + soil (2:1:1), T4 = Wheat straw + sand + soil (2:1:1), T5 = Rice husk + sa...

Afifatul H.A. Adilah1, Junun Sartohadi2* and Suci Handayani1

...ia. Coconut and Mahogany plants have been cultivated as intercrops in most dry-land agricultural fields by many people for different purposes of income generation. The differences in canopy characteristics between the two plants significantly affect the production of runoff. Field evidence is needed to support it as a suitable plant for soil and water conservation efforts. The study was conducted using a field survey method ...

Deny Anjelus Iyai1*, Ambo Ako2, Sitti Nurani Siradjuddin2, Budiman Nohong2 

...to find out the types of plants that can be a source of natural food for livestock both inside and outside the oil palm land. The study area was purposively selected from 9 districts (subdistricts) as many as 4 districts (44.44%). Withdrawal of grass clippings is done using a quadrant measuring 1 x 1 m2. Quadrant laying is done diagonally in a land area of ​​100 m2. Dominance Index, Species abundance using Shannon-Weiner Diversity Index, Similarity index, ...

Zaib Ullah1*, Sajid Mahmood2,3, Zafar Iqbal4, Fakhar-i-Abbas5, Naveed Akhtar1 and Abdul Majid Khan6*

...hese 1213 dig marks, 186 plants uprooting and two setting places. An average of 49.95 signs/km2 was recorded; this is a very high encounter rate. According to BBC (British Broadcasting Corporation) Science and Nature, the home range size of Asiatic black bears is 10 to 20 km2, so we concluded that more than 24 black bear were present in both valleys.

...

Bushra Allah Rakha1*, Farah Qayyum1, Muhammad Sajjad Ansari2, Ali Akhter1, Komal Shakeel1, Javeria Batool1, Faryal Akhtar1 and Sehrish Hina1

...nd other position of the plants 16.25%. Preferable height for nest construction by white-cheeked bulbul was 1-2m (60%) followed by 2-3m (23.7%) and 0-1m (16.25%). Outer diameter of nest was recorded (16.0 ± 4.22cm) while inner diameter was (10.8 ± 2.95cm). The preferred plant species used by white-cheeked bulbul for nest construction was garanda (Carrisa opaca; 58.7%) followed by sanatha (Dodonaea viscosa; 26.25%), panch phuli (Lantana camera; 6....

Mehran Ali* and Inamullah

..., make it unavailable to plants. Inoculation of arbuscular mycorrhizal (AM) fungi could be helpful in the sustainable management of immobile P in soil. However, their use in releasing P from alternative sources in alkaline calcareous soils have been little investigated. To explore the influence of AM fungi and P management on wheat productivity, two years of field experiments were carried out at Agronomy Research Farm, The University of Agriculture Peshawar du...

Tahir Abbas Khan1*, Imran Ashraf1*, Athar Mahmood1, Muhammad Ilyas2, Sardar Alam Cheema1, Muhammad Mahmood Iqbal3 and Muhammad Umair Hassan1

...s nutrient necessary for plants growth and development. Similarly, cultivars also differed significantly in terms of growth, yield and P utilization. Therefore, present study was performed to assess P efficient maize genotypes on the basis of growth and yield. The study was comprised different maize genotypes; CS-2Y10, KSC-SB 9663, FH-949, 30Y87, NT-6621 and DK-6789 and of diverse P levels; control (No P), 40 and 80 kg P ha-1. The maximum root length (RL), sho...

Rahamdad Khan1, Saad Muhammad2, Muhammad Haroon3, Saad Jan1 and Syed Majid Rasheed1*

...h development and allows plants to work properly. Therefore, the aim of this study was to determine the effect of light duration on the growth performance of Parthenium hysterophorus and Cannabis sativa. The results showed that under reduced light duration (2 hours), plant growth performance (i.e., biomass, plant height, leaf area, and number of branches) was all reduced. In addition, with increasing light duration (9 hours), both species grew faster and recor...

Fatimah A. Al-Saeed 

...fect humans, animals and plants. Cadmium (Cd) is a heavy metal known as a toxic factor to humans, animals and plants. Saudi Arabia is enriched with medicinal plants whose therapeutic effects are not sufficiently known and not exploited properly. Medicinal plants play an important role in treatment of human health problems since past decades until now. Th...

Fariha Qahar and Muhammad Sayyar Khan*

...cation of xenobiotics in plants. The genetic manipulation of GSH biosynthesis-related genes is considered a prime strategy to achieve higher in planta GSH contents. In this study, stably transformed Brassica napus lines harboring the feedback-insensitive isoform of Serine acetyltransferase (SAT), a rate-limiting enzyme for cysteine (Cys), and GSH biosynthesis, were subjected to H2O2, metolachlor, and atrazine-induced oxidative stress. The overexpression of the...
Jaffar Hussain*, Zeenat M. Ali and Syed Farman Ali Shah
...ficial photosynthesis in plants to produce the raw material for biodiesel production The fourth generation was not available on commercial scale. The biodiesel produced by esterification (one step) and Transesterification process (two step). The catalysts used were homogenous, heterogenous and enzymatic. The homogenous were alkaline and acidic. The alkaline catalyst undergoes saponification reaction when free fatty acid concentration was high. The acidic catal...

SHEHLA AKBAR*, SAIQA ISHTIAQ*, KHALID HUSSAIN, ANS MUNIR & SAIRA REHMAN

...opriateness of medicinal plants or their extracts orally taken by the
marginal communities. Primary and secondary metabolites of Misopates
orontium (L.) belongs to Plantaginaceae family were screened out and
tested for therapeutic values through in-vitro biological assays.
Quantitative analysis was done on powder of Misopates orontium by
using standard methods for estimating the primary and secondary<...
IRAM MUJAHID IQBAL1*, ASAD SHABBIR1, 2, KANZA SHABBIR1, MAHAM NAVEED1, FAREIHA UROOJ1,
AQSA BUTT1, RAEES KHAN3, NIDHAN SINGH4 & FIRDAUS-E-BAREEN1
...The living collection of plants in botanical gardens and academic
institutions play an important role in scientific research, education, and
conservation. The University of the Punjab (PU) is one of the oldest and
largest seat of higher education learning in Pakistan with its two main
academic campuses located in the city of Lahore. Besides several oncampus
plantations, PU has a dedicated botanical ga...

ZAHOOR AHMAD SAJID1* & SHEZA AYAZ KHILJI2

...ign having ten replicate plants for each salt (NaCl) treatment. Initially the plants were raised by irrigating with tap water and then after their establishment, with NaCl (50, 100 and 200 mM) containing water. Various growth and biochemical characteristics were found to be adversely affected by saline treatments i.e., root length, shoot length, fresh weight, dry weight, amount of protein and antioxidant enzymes. The higher ...

Orooba Mohammed Saeed Ibrahim1*, Rawaa Saladdin Jumaa2, Nibras Zeyad Yahya1 

...treat diseases today was plants. This study aims to ascertain the antibacterial activities of fruit Citrus aurantium and Citrus limonum juice on isolated Staphylococcus aureus, Sterptococcus pneumoniae and Klebsiella pneumonia. The antibacterial activity of fruit juice extract on bacterial strain was determined using macro-broth dilution, agar well diffusion methods and time kill curve. Results revealed that the used juice extracts were variously bacteriostat...

Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Farooq Bhatti, Muhammad Summer and Ali Haidar Gormani

...lign: justify;">Mulberry plants belonging to the Morus genus are widely planted across Asia. Almost all parts of these economically and medically important plants including fruits, root bark, stem and leaves are of equal importance in terms of uses but their leaves are the most excessively used part. Traditionally leaves have been used in different folk remedies, dietary supplements and herbal medicine. Commercially these ar...

Slamet Widodo1*, Mohammad Ikhsan Shiddieqy1, Teguh Wahyono2, Yeni Widiawati1, Zultinur Muttaqin1

...asses a diverse range of plants, each possessing its own characteristic physical and biological traits that contribute to its individual ability to adapt, grow, and produce. While some generalizations can be made, it is vital to recognize the quality differences between various plant species and even different cultivated varieties. This   study was conducted to evaluate the relationship between nutrient content, digestibility, and gas production of s...
.... The infected indicator plants featured severe mosaic on Lentil cv. Giza51, mottling on cv.Giza9, mild mottle on cv. Giza 4, yellow mild mottling on cv.  Giza370. Seed transmission tests of PMoV confirmed of the virus transmission through Lentil seeds. Peanut Mottle Virus was detected in the testas, cotyledons and embryo dissected from seeds of each Lentil cultivates. Electron microscopy of PMoV showed virus particles a...

Muhammad Raza Salik1, Muhammad Babar Shahzad Afzal1,2*, Ayesha Komal3, Muhammad Nawaz Khan1, Muhammad Ihsan Ullah4, Faheem Altaf5, Akbar Hayat1 and Hira Tariq1

...n the second year (2013) plants of T1 yielded fruits of significantly less weight. Significantly less number of seeds/fruit was found in plants grown at a distance of 10` × 10` as compared to others. Plants grown at 22` × 22` distance yielded more fruits as compared to others with less spacing. Chemical characteristics of Citrus reticulata such as juice percentage, TSS, acidity...

Aishat Adetola Anifowose*, Nkechi Betsy Izuogu and Benoit Katchitche Sossou

...gher (P=0.05) in treated plants than in control plants. Galling was most severe in negative control plants with poor yield. Even so, the yellow jersey variety was more susceptible to Meloidogyne incognita infection. However, the combination of EM and compost manure had significantly higher performance than the other treatments, especially on the Boniato variety. The implications of EM comb...

Hafiz Nawaz1*, Kashaf Nawaz2, Attiq ur Rehman1, Muhammad Bashir3, Mussera Hira2 and Mariyam Nawaz4

... viral disease. Infected plants have uneven yellow-green spots. Diseased plants develop late and produce few flowers and pods. MYMD causes 85% of economic losses. Begomovirus is a Begomovirus. DNA-A and DNA-B make up its single-stranded genome. The virus’s virulence and symptoms need both components. The sequencing of both components showed considerable variation between old-world and new-world viruses. Cultural practi...

Zain Ali1, Amjed Ali1, Bilal Ahmad Khan1*, Muhammad Ather Nadeem1, Muhammad Asif1, Adnan Ashraf1, Muhammad Ehsan Safdar1, Iram Inayat2, Aneela Nijabat3 and Rameez Hussain3,4

...unflower heads and maize plants have better combination for the silage production and the quality parameters like pH, moisture content, protein content, fat content and ash contents. The moisture contents of both the samples and combined silage had not much difference among them, but the protein content, fat content and the pH of the combined silage had remarkable difference among them. The Syngenta-8711 + sunflower and Monsanto-6142 + sunflower varieties were...

Hafiza Mehwish Iqbal1, Salman Khurshid1*, Saqib Arif1, Qurrat-ul-Ain Akbar1, Saba Iqbal2, Shahid Yousaf3, Kainat Qureshi1, Abdul Karim Khan5, Abdul Ahad6, Aqeel Ahmed Siddique4 and Neelofar Hamid7

.... basilicum and S. asoca plants have21 and 22mm MIZD. Methanol 20%has maximum antioxidant activity in O. basilicum whereas, in S. asoca and M. koenigii 20% aqueous showed maximum activity. Total phenolic content (TPC) 80%methanol exhibited high value in O. basilicum and S. asoca and aqueous 0% has a high TPC content in M. koenigii. The study of medicinal plants is an important area of research in modern medical science for b...

Waheed Ali Panhwar1*, Mehtab Ali Mahar2 and Abdul Manan Shaikh3

...defoliator of cultivated plants and plants of barren areas. Survey was conducted to collect beetle fauna from different localities of Sindh Province. 46 specimens were captured and sorted out into Genus Melolontha Fabricius, 1775 of subfamily Melolonthinae with two species i-e: Melolontha indica Hope, 1831 and Melolontha furcicauda Ancey, 1881. In addition to this, M. indica constructed as a new regional record for Pakistan ...

Muhammad Ayub1*, Syed Arif Husain Rizvi2, Ishtiaq Hussain3, Musa Ali Hashmi4, Iqbal Hussain5, Shahid Hussain1, Zakir Hussain1 and Rehmat Kabir6 

Amna Ali Mohammed Makoof Zabanoot, Al Wafaa Ahmed Suhail Qatan, Amal Salim Mahad Hubais, Khadijah Hamid Musallam Bait Said and Selvaraju Sivamani*

...wed better growth with 4 plants, and length of the stem, root, and plant as 14.2, 2.1 and 16.3 cm, respectively. Thus, it is be concluded that rejected lime could be a potential soil conditioner for plant growth.

...

Agha Mushtaque Ahmed1*, Ali Zachi Abdul Qadeer Alhilifi2, Fahad Nazir Khoso1, Muhammad Ibrahim Kubar1, Tehniyat Naz Shah3 and Touseef Ahmed1

... polyphagous nature. The plants on which it feeds possess variable chemical and physical properties which may influence its biology particularly for growth and reproduction. This study evaluated the growth and fecundity of S. frugiperda on artificial diets. The FAW larvae were reared on two distinct composed artificial diets (bean D1 and chickpea flour D2) and one natural diet D3 (fresh and healthy maize leaves). In both artificial diets, only the flours were ...

Jinwen Liu, Hong Li, Jinhua Zhang, Jianping Li and Xiujuan Yan*

...crease of grubs, whereas plants regulated population change through interaction with above- and below-ground herbivores, thus reducing the survival rate of above- and below-ground insect herbivores. In naturally occurring populations, behavior of leaf-feeding were influenced by root-feeders, causing multitude interactions at the same time. In conclusion, it is suggested that there may be a mutual inhibition between different aboveground and below-ground herbiv...

Anas M. S. Al-Haj Afandi*, Ahmed H. F. AL-Bayati 

...partial degradation of implants in the site of implantation as well as, thinning of white fibrous connective tissue over the sheet. depending on the clinical and macroscopical outcomes, it can be concluded that bovine tunica vaginalis sheets were better than caprine acellular dermal matrixes for repairing of large ventro-lateral abdominal wall hernia in bucks. 

...

Khansa Jamil1, Muhammad Ramzan Khan1, Asad Jan2 and Ghulam Muhammad Ali1

...ign: justify;">Medicinal plants have played a vital role in drug production. Herbal medicines have proved to be safe to use. Crude extract of Caralluma tuberculata stem was used to examine its antibacterial activity and phytochemical screening. Antibacterial assay was carried out by well diffusion method. A maximum number of compounds were eluted by methanolic extract by thin-layer chromatography and a total of 70 compounds were identified by GC-MS analysis. T...

Nusirat Aderinsola Sadiku1, Oluwatoyin Adenike Fabiyi2* and Tesleem Taye  Bello

...). Two weeks old lettuce plants were inoculated with 1,000 juveniles of Meloidogyne incognita. BPL was applied at three concentrations of 100, 200 and 400 mg/ml. Results revealed that nematode infected lettuce plants treated with BPL recorded significantly higher (P< 0.05) mean number of leaves, plant height and yield compared to the untreated control. In addition, BPL at 400 mg/ml had substantially higher nematicidal eff...

Farhana Umer1, Muhammad Sheryar2 and Sangam Khalil3*

...rgy transfers from power plants generation to substations then to consumers and its own environment is tremendous. Among various hazards, the overhead wires associated with power lines are the most fatal hazard to birds. The power lines and poles have caused fatal risks for birds and have affected their habitats significantly. Dangerous types of power poles in the middle voltage lines which have small distances between the lines and short insulators cause shor...
Qingsen Ran1,2, Manjing Li3, Jiayin Han3, Lifang Wang3, Han Wang3,4, Shaobo Liu5* and Yanping Wang1*
...compounds from medicinal plants exhibit anti-glycation effects. Therefore, it is of potential significant to find biomarkers based on glycolysis-related genes in predicting the prognosis of colon cancer (CC), a common invasive gastrointestinal tumor. In this study, clinical and gene data were collected to identify glycolytic genes that significantly associated with overall survival (OS) rate of CC patients through gene set enrichment analysis (GSEA) and Cox re...
Hanaa H.A. Gomaa1*, Dalia Y.A. Amin1, Mona A. Ismail1, Basma Hamdy2, Khaled A. El-Dougdoug3
...o virus infection in fig plants. The fig (Ficus carica L.) cv. sultani) plants were grafted by infectious blind eye from Fig latent virus (FLV) infected plants. Infected and healthy plants were foliar sprayed with nanochitosan (ChNPs), biomagic (BM) or combination (ChNPs and BM). Microtome and ultrathin sections were carried out on healthy ...

Abdul Aleem Memon1*, Inayatullah Rajpar2, Ghulam Murtaza Jamro2, Javaid Ahmed Shah3

... potassium (K) uptake by plants possibly due to K-fixation and variation in cation ratios. Soils in country are thought to be well supplied with K, little or no K fertilizer is applied to majority of the crops, including sunflower. However, recent studies have shown that the sunflower is becoming more responsive and exhibiting superior growth and yield with the addition of K. To determine the impact of K fertilizer sources on the growth and development of sunf...

Rana Mahmood Ahmad*, Orooba Mohammed Maeed  Ibrahim

...attention to using these plants as anti-inflammatory. This study was designed to highlight and compare the effects of Syzygium aromaticum extracts oil and Piroxicam on inflammation circumstances. Extraction of clove bud with petroleum ether revealed a bright yellow extract with a typical clove oil smell and bud. The gas chromatography-mass spectrophotometer (GC-MS) method revealed the presence of sixteen distinct elements, making up 100% of all known compounds...
El-Dougdoug. K.A.1, Mervat, M. Fath Alah2, Reham A. Hassen3,Rehab A . Dawoud2
...to induced SAR in potato plants using bacterial and fungal contaminants in tissue culture against Potato virus Y. These biotic inducers were Pseudomonas sp., Bacillus sp., Xanthomonas sp. as well as Trichoderma, Aspergillus and Fusarium as contaminants microbial of potato micropropagative in vitro. The occurrence of induced resistance and increased potato plantlets were found by MS medium treated with culture filtrates based on reduction of PVY infection, dise...
Mohga A. El-Tahlawey1, Samah. A. Mokbel1, A.M. Mandour1,and H. A. Mohamed2
...v. Giza 51. The infected plants feature severe mosaic on lentil cv. Giza51. mottling on cv. Giza9. mild mottle on cv. Giza4, yellow mild mottling on cv. Giza370, Seed transmission tests Of PMoV confirmed of the virus transmission through Lentil seeds. Pe...

El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.

... Egypt. Different potato plants were collected from an experimental station in Giza Governorate, Egypt and were tested using RT-PCR. PVY was amplified using primers represented portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was ...

El-Bramawyl , M . A. S. A. and El-Beshehy2, E. K. F.'

...nd susceptible faba bean plants were investigated under artificial infection by BYMV in the green house during two successive seasons (2008/09 and 2009/010). Faba bean population's plants were evaluated for the resistance to BYMV using a four-class scale of increasing susceptibility to the BYMV disease, which took into a account the infected main percentage and disease severity for the faba bean population's

Elbeshehy, E. K.F. and Sallaml, A.A.A.

...urally infected cucumber plants Cucumis sativus L. grown in various garden and greenhouses of Ismailia Governorate, Egypt exhibiting systemic mosaic, blistering, fruit malformation and stunted plant growth and identified by biological, serological and molecular analysis. The isolated virus gave positive reaction with CMV antiserum but not with antibodies of WW and SqMV using DAS-ELISA. CMV was able to infect different host plant species including squash, pumpk...

El-Dougdoug2, Kh.A; Ghalyl, M.F. and Tahal , M.A.

...n and in 2nd experiment, plants treated with CF showed variable visible viral symptom9compared with the broth media treated control 15 days post inoculation and remained symptom less throughout the study period. Such five Streptomyces species identified were able to produce an antiviral component in the culture filtrate, non phytotoxic and effective in local as well as systematically control of CMV infection.

...

Mahdyl , A.M.M.; Hafezl , M.A.; EL-Dougdoug2, Kh. A.; Fawzyl , R.N. and Shahwanl , Eman S.M.•

...nd non-inoculated tomato plants. Identify of CMV was confirmed by some differential hosts and dot blot immunoassay (DBIA) using polyclonal antibody specific CMV. Water extracts of Mirabilis jalapa, Clerodendrum inerme and Kombucha as antiviral to control the virus infection and detection systemic acquired resistance (SAR) Were Studied. SAR was detected by determination of salicylic acid (SA) resulted induction of protein related to biotic inducers, virus conce...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...ymptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antiserum for the isolated virus had a titer 1\1024. 600 bp DNA fragments from the coat protein gene (CP) of TMV—Ch—EG was amplified with Rt-PCR technique. Phylogenetic analysis of the TMV-Ch-EG/CP- gene showed 89% nucleotide sequence homolo...

Aboud*, K. A; Gomaa**, Hanaa H. A.; El—Taholowy***, Mohage, A. and El - Sugher**, S.

... because infected banana plants produce no fruit. -The tissue culture approach was used to permit the recovery of BBTV-free plantlets, genetic stability followed by chemotherapy and early screening to facilitate the efficient production of virus-free plantlets. Results demonstrated that application of 10,20,30,40 mg/L thiouracil in vitro gave an 85,72,35,20  survival and 60, 83, 91 and 95.5% BBTV-free plantlets ,respectively. Furthermore, the obtained vir...

Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.

...PCR from infected garlic plants, such fragnent were not obtained from healthylooking plants and/or virus-free seedlings of shoot-tips. The amplified products of OYDV was cloned into pGEM@-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared with corresponding viral nucleotide sequences reported in GenBank. The ...

Eisa*, Nawal A.; Abd El-Ghafar **, N. Y. Abd EL-Mageed*, M.H.; Mohamed* , F.G. and Hasan*, Eman O.

El-Dougdoug, Kh.A.; Rezk , A.A.; Dawoud, Rehab A. and Sofy, A.R.

...m infected Chrysanthemum plants. It is a member of Pospiviroidae. In order to study the structure of CSVd-EG, it was reverse transcribed in total RNA from infected leaves and then amplified by polymerase chain reaction (PCR) using Pospiviroid-CCR specific primers. Purified gel RT-PCR product (⁓199) was cloned into the PCR Il TOPOvector then it was sequenced. Partial sequence 199 bp of CSVdEG is almost identical to that of the prototype 199 bp Canada and USA ...

Nasr-Eldin1 , M. A.; El-Dougdoug2, K. A.; Othman2, B. Ahmedi , Sabah A, and Abdcl-Azizl , S. Il.

...iroid-infected grapevine plants than dot-blot hybridization, the number Of HSVd-infected grapevine plants were 10 plants, PSTVd were 10 plants and the CEVd was detected with high incidence level in grapevine, where 12 out of 100 grapevine trees analyzed were infected. The frequency of HSVd, CEVd and PSTVd naturally infected grapevine trees recorded diffe...

Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.

... from infected faba bean plants. The UV absorption spectrum had a maximum at 260 nm and a minimum at 240m. The ratios of Amax /A min and A 260/A 280 were 1.48 and 1.71, respectively. The yield of purified BBTMV preparation was about 1.57 mg/Kg infected leaves. Production of specific antiserum against BBTMV was obtained by rabbit immunization using three different methods of injections. The titer Ofthe prepared antiserum as determined by indirect ELISA with dil...

El.-Kadyl, M.A.S; Badr2, A.B.; zein3, Saiwa N. and Khalifa4, M.A.A.

...ection in pepper treated plants: Actellic application gave superior results (46.7%) in decreasing the infection percentage followed by either Sumithion or K.Z. oil (55.0%), whereas Potassium Soap spray gave infection percentage of 60.0% followed by Bio-fly (61.7%). Moreover Supper Royal treatment gave the lower effect in the percentage of virus infected plants (63.3%). Although, actellic treatment produced a higher yield as ...

Ahmed, AmalA.; Zein, Salwa N. and Khatab, Eman A. H.

...aturally infected celery plants showing mosaic symptoms suspected to be caused by viral infection, also, it was isolated from other hosts. The isolated virus was biologically purified from single local lesions formed on Chenopodium amaranticolor. CeMV was identified by its host range, symptom expression, modes of transmission and particle morphology.  CeMV able to infect only 20 plant species and varieties from 22 tested by mechanical inoculation. The vir...

Zein Salwa N; Abd El-khalik, Samaa; Khatab  , Eman A.A.H and Azzam4,Clara R.

...rally infected sunflower plants growing in Giza Res. Station, showing systemic mosaic and spots. Purified TMV-S migrated as a single zone in density gradient column. Ultraviolet absorbance ofTMV-S was typical of nucleoprotein with minimum and maximum at 247 and 260 nm respectively. The ratios of A260/280 and Amax/min were 1.2 and 1.1 respectively. Electron microscopy of purified virus showed the presence of rod shape particles with a size 300 nm. Titer of the ...

Ahmed*, Amal A.; Khatab*, Eman A.H. ; Dawood*, Rehab A. and Ismeil*, Amira .M.

...irus affecting carnation plants .The two viruses were detected serologically by DAS-ELISA using specific antibodies . Shoots from plants infected with ( CLV & CarVMV ) which maintained in green house were used for tip culture . Murashige and Skoog medium (MS ) supplemented with (0.2 mg/L BA ) and (Img/l BA and 0.5 mg/L kinetin ) were used for proliferation and micropropagation of the infected shoot clumps respectively. T...

*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'

...uberosum, L. cv. Spunta) plants, showing bright yellow blotching or mottling «Calico» and aucuba symptoms suspected to be due to virus infection. Leaf samples were collected from different localities in Minufyia Governorate, Egypt. AMV was readily mechanically inoculated by sap extracted from infected potato leaves to host plants (bioassay). The identity of AMV isolate was confirmed by sequence analysis of their ...

Ahmed, Amal A. and Fath-Allah, Mervat M.

...rieties out of 24 tested plants by either grafting or mechanical inoculation, and PPV was able to infect only 19 plant species and varieties. CMV and PPV can be transmitted by Aphis gossypii and Myzus persicae from cucumber to cucumber and woody plants. The best time for leaf sampling was to detect the viruses, in diseased apricot tree by sap inoculation or ELISA, in April, followed by May and June. Double infection by PPV a...

El-Sayed • l , Eman H; Mahfouze , Sherin A.; Shaltout ,A. D.; El-Dougdoug3 ,Kh. A. and Sayed1 , R. A.

...gative effects on banana plants. The chemical mutagens such as create mutations in the genome of plants. Selection of plant mutants is based on morphological and ISSR-PCR markers. The DNA based marker is reliable and reproducible for mutant selection for BBTV and BMV resistance banana plants used in the study. Explants from shoot apical meristem were cul...

Karl Maramorosch

... be detected in diseased plants. The inadequate characterization of viruses delayed the discovery of the pathogens of yellows-type diseases by forty years. In 1967 Japanese plant pathologists and entomologists announced the discovery of mycoplasma-resembling pathogens in diseased plants and insect vectors and the temporary recovery of diseased plants treated with tetracycline antibiotics. ...
Mazharul A. M. 1, Md. S. Sarwar ,M. Nurullah 2, Keshab K. Adhikary I and M. Rahmatullah 1 
 
...sh to identify medicinal plants used for the treatment of the above diseases. It was observed that six plants Nyctanthes arbortristis, Swertia chirata, Vitex negundo, Andrographis paniculata, Clerodendrum viscosum and Tinospora cordifolia were used for treatment of viral fevers. Stemona tuberosa was used in case of measles. Moringa oleifera and Azadirachta indica were used to treat chicken pox. Three

S.A. Sidaros, S.A. El-Kewey , Hala A. Amin;Eman A.H. Khatab ,  A.A. Emeran l , Samaa Abd El-Khalilk and M.A.S. El-Kady

...rus isolated from pepper plants grown in Egypt has been characterized. Pepper mild mottle Tobamovirus (PMMoV) was isolated from naturally infected pepper plants grown in Kafr El-sheikh Governorate. RT-PCR using a specific non:åegenerate primer pair for the PMMoV coat protein gene (PMM-F and PMM-R) revealed 470 bp amplified product. Dot blot hybridization was used to establish the authenticity and specificity to the RT-...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2 
...-ELISA), woody indicator plants, differential hosts, peroxidase isozymes and activity, total RNA content and reserves transcriptionpolymerase chain reaction (RT-PCR). The severe isolate (ARC) gave the highest OD. value (2.204) in ELISA, followed by the mild isolate (TB) (1.958) and the last latent isolate (N) (1.669). These isolates differed also in incubation period, intensity of symptoms and response to sensitivity of woody indicator

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

...o (Solanum tuberosum L.) plants is very important due to their effect on potato yield and degeneration of seed tubers. This study aimed to eliminate potato virus Y (PVY) by tissue culture technique using different therapies, such as thermo-, chemo- and electrotherapies. Potato plants cv. Diamond cultivated at Faculty of Agriculture farm, Sohag University were tested by direct antigen coatingenzyme linked immunosorbent assay ...

Sahar, A. Youssef t ; M.M.A. Al-Dhaher 2 and A.A. Shalaby 

... two viruses. Virus free plants were produced within six months using meristem tip culture. Woody plant medium supplied with benzylamino purine (BAP) (1.5 mg/L) for shoot proliferation, and Indol butyric acid (IBA) (0.05 mg/L) for plants rooting. Before acclimatization, the plantlets were submitted to DAS-ELISA and RT-PCR in order to evaluate virus eradication. GFLV- and GLRaV-l-free plants

*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,

... from infected carnation plants and identified by host-range, serological detection and maintained on Carnation (Dianthus caryophyllus L.) and / or Gompherena globosa. Morphological studies of CarVMV were conducted by light and electron microscopy. Light and electron microscopy revealed amorphous cytoplasmic inclusions in infected leaf cells. In some cases, however, inclusions have a characteristic shape, spindle, circular or sledge-like. Pinwheel inclusions c...

* Amal Abou El-Ela, A.

...fy the causal virus, the plants were tested by enzyme-linked immunosorbent assay using antibodies against different Ilarviruses i.e., Apple mosaic virus (ApMV), Prunus necrotic ring virus (PNRSV), Rose mosaic virus (RNIV) and Tobacco streak virus (TSV) Preliminary results revealed the presence of PNRSV in tested rose shrubs. The isolated virus was biologically purified from single local lesions formed on cucumber cotyledon. Identification of this virus was bas...

S. A. Sidaros*, S. A. EL-Kewey*, Eman A. H. khattab**, M. M. ELsharkawy* 

...rom faba bean and cowpea plants, respectively using two different methods. The UV absorption spectrum had maxima and minima at 260 and245 nm, respectively for the two viruses. The absorbance ratios of A and A260/280 of the combined lower bands of purified BBSV preparations were 1.19 and 1.62, respectively. Infected faba bean plants yielded up to 0.48 mg/100g tissue. The corresponding data for CABMV were 1.20&1.22 and its...

S.Y.M. Mahmoud1 and M. Hashem2

...VV coat protein and bait plants test, respectively. The results confirmed the presence of BNYVV in 46 out of 184 and 24 out of 50 root and soil samples, respectively. The virus was found with percentage of 65% in root samples collected from Kafr EI-Sheikh. The transmission experiments indicated that BNYVV was mechanically transmitted to Chenopodium amaranticolor, C. quinoa, Beta Vulgaris cvs. Pleno. Tripl and Gloria. D. macrocarpa and B. maritema inducing chlo...

Amal Abo El-Ela Ahmed; Eman A.H. Khatab; and M.S. Shafie

...an Garden for ornamental plants, Giza Governorate and it was found to be widely spread in rose fields. The virus was transmitted mechanically and by grafting (chipbudding) but not by aphids. It was successfully purified from infected N tabacum L. cv. White Burley leaves. Only one band of purified virus preparation was observed 3.5 cm below the meniscus of the density gradient. Infectivity test of the viral zone was found positive. The absorption spectrum of th...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...ct the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other published sequences of the Same virus shows 79.4% - 84% homology.

...

A-New-Whitefly-Transmitted-Geminivirus

...re collected from tomato plants grown at different locations in Egypt. The collected plants were subjected to biological analysis, the viral causal agent vector of the two types of symptoms was found to be Bemisia tabaci (Gennadius). Based on diagnostic host species and back inoculation assay two different types of symptoms were found. The first consists of identical Tomato yellow leaf curl virus (TYLCV) symptoms such as sev...

M.A. Abo-EInasr l, Kh.A. EL-Dougdougl, M.H. El-Kattan2 and L.A. Salem2

...d be induced in cucumber plants using different concentrations of seven nutrient chemicals against Zucchini yellow mosaic Potyvirus (ZYMV). These chemicals were. Potassium sulfate, Magnesium sulfate, Ammonium sulfate, Chelated iron, Chelated zinc, Chelated manganese, and salicylic acid. SAR was determined via disease severity. virus concentration and some biochemical changes i.e., the high level of endogenous salicylic acid, proteins related to inducers and ac...

E.F. Mohamed1 and I.M. Sabra2

...to is grown ToMV affects plants and yields. Virus was isolated and identified on the base of symptomatology on tomato plants, host range, diagnostic hosts, physical ptoperties, mode of transmission, and ELISA detection. ToMV had a longevity in vitro (LIV) of 90 days at room temperature. dilution end point (DEP) Of 10-6 and thermal inactivation point (TIP) of 90oC. ToMV was easily transmitted by sap. The obtained results reve...

E.F. Mohamedl and A.A. Owayss2

...rally infected faba bean plants in Fayoum Governorate. The virus was identified as Faba bean mottle Virus (BBMV) according to symptomatology on Faba bean plants, host range, diagnostic hosts, virus stability and ELISA detection. The host range of the isolate was restricted to Fabaceae. BBMV lost infectivity after 10 min at 95 on dilution of 10-3 and after 21 days storage at room temperature. BBMV was easily transmitted by sa...

S.A. Sidaros1; R.A. Omar; S.A. El-Kewey l and Samaa Abd El-Khalik2

...elimination and survival plants was 3 mm long whereas 5 mm long produced highest survival plants without virus elimination and I mm long failed to produce survival plants in two of the tested three cultivars. The suitable medium was MS + 0.5 mg/L BA that produced 33.3% survival plantlets whereas MS + 0.1 mg/L NAA + 0.5 mg/L BA and MS + 0.1 mg/L NAA produced 16.6 and 6.6% survival plantlets...

M. Osman1, Kh. El-Dougdoug2, E. T. Abd El-Salam3, R.M. Taha4 and R.M. El-Hamidl

... (CMV) infected cucumber plants was detected by DAS-ELISA and confinned by inoculation of Chenopodium amaranticolor. CMV-isolate was propagated on squash plants var. Eskandarani. After 15 days. systemic symptoms appeared in the newly formed leaves in the form of vein banding, severe mosaic, yellowing, malformation, and leaves wilting. Histopathological studies of CMV-infected squash leaves showed changes such as compact meso...

Hanaa H.A.Gomaa1, A. F. Moustafal, Kh.A.El-Dougdoug2, A.A. Abou-Zeid3 and S. Y.M. Mahmoud4

...the metabolism of potato plants. It was found that detectable decrease or dry matter, total nitrogen, tuber Starch, number of starch granules, and total protein. The nucleic acid content of infected plants increased than healthy ones. The investigated hydrolytic enzymes of amylase and protease were reduced in infected potato plants while the level of polyphenol oxidase and peroxidase was i...

B. A. Othman; Kh. A. El-Dougdoug; M. H. Abdel Ghaffar and T. F. El-Arabi

...trogen content of clover plants. While Barseem IP2 (mutant) was not affected by phages since the growth characters and nitrogen content of clover plants were increased. 

...

Xiaojun Li

...ive pest on Brassicaceae plants family around the world. The present study investigated the feeding selection behavior of diamondback moth larvae with an approach to the acetone extract effects of Salvia Miltiorrhiza Bunge (SMB). It was found that acetone extracts of Salviami ltiorrhiza Bunge (SIB) represented by cryptotanshinone and dihydrotanshinone had lethal effect on diamondback moth larvae, and the correlation coefficient was 0.972. Through further antif...

Shakir Ullah1* and Lubna Shakir

...composition of medicinal plants. Euphorbia helioscopia, (sun spurge or madwoman’s milk) (Euphorbiaceae) is a wild medicinal plant that grows nearly in all phytogeographical zones of Bajaur. The plant location, age, and their interactions had a significant influence on the phytochemical composition of E. helioscopia. The plant location had the highest effect on the marginal means of compounds (81.517) while the age influenced a variation by a marginal eff...

Julieta M Lopez-Martinez and Imran Ahmad*

...entral America. Amaranth plants are well adaptable in different climatic conditions, and easy to grow. Amaranth grains have several beneficial features such as high-quality protein, high content of fiber and micronutrients such as iron and calcium. Furthermore, amaranth seeds are a good source of phytochemical compounds with health-promoting effects such as squalene, phytosterols, and polyphenols. Amaranth seeds have gained popularity in recent years due to th...

Alveena Izhar1*, Basit Ullah2, Rabia Asghar1, Aqeel Ahmad1 and Hassam Bin Mujahid1

...g (32) were noted in the plants supplied with phosphorus at the rate of 100 kg ha-1, while the minimum were observed in the control plots. Steckling size also affected the growth and yield parameters of radish crop. Maximum plant height (68 cm), number of pods plant-1 (183), pod length (7.4 cm), pod diameter (3.54 mm), seed pod-1 (7), 1000 seed weight (21.9 g), seed yield plot-1 (23.2 g), seed yield (153.4 kg ha-1) and seed germination viability (90.0) with le...

Nasir Shah1,4, Muhammad Ibrahim1*, Zarnosh Habib2, Kalsoom3 and Zahir Shah4

...r 15 days. All the three plants exhibited insect repelling potential but these had no significant difference from each other, while A. indica showing nonsignificant but most promising results. Similarly, there was no significant combine effect of plants extracts and its various concentrations. However, various doses of plant extracts showed significant difference in reducing the number of oviposition, pupae developed, flies ...
Yongtao Xu1, Dandan Wang1, Xiaolong Hu1, Minling Li1, Ming Tang1, Wuhua Liu2, Jianwen Zhan2 and Weiwei Zhang1*
...ndicated that the forage plants of sika deer belong to 82 families, and 110 genera. An alpha diversity analysis showed that there was no significant difference (p > 0.05). The NMDS analysis found considerable overlap at the three sampling sites, and the niche breadths of SS (Fir forests), MP (The nursery base), and NJS (Nie Jiashan) were 9.593, 9.426, and 9.419, respectively. High-throughput sequencing and metabarcoding trnL could provide higher taxonomic r...

Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2

...rials, respectively. The plants of Noor-2019 are 60-65cm tall, semi-erect, and medium in canopy spread. Its grains are light brown, ram-headed, medium in size with a 100-seed weight of 25 g. Adoption of this cultivar across different climatic regions of Punjab, and other provinces could contribute in attaining self-sufficiency in local chickpea production as well as plummeting import bill.

...

Muhammad Usman1*, Muhammad Uzair Khalid2, Muhammad Hasnain3*, Muhammad Tauseef4, Ali Raza4, Muhammad Akram4, Muhammad Shahid4, Abrar Ahmad4, Muhammad Shoaib Ismail1, Rabia Afzal2, Atta-Ulla2 and Muhammad Hussnain Babar3

...ses metabolic actions in plants. Healthy seedling germination will increase the yield of the crop. Moreover, it was concluded that osmo-priming is best for farmers to reduce the negative effects of zero tillage and by time of bed sowing, and then it will produce maximum results. Further, it will helpful for the farmers to enhance their income.

...

Muhammad Akram1, Anirban Mandal2*, Mehwish Iqbal3, Arindam Mukherjee4, Ritika Bandyopadhyay5, Surendar Rangasamy6, Rida Zainab1, Muhammad Talha Khalil1, Pragnesh Parmar7 and Umme Laila1

...ivity exists in numerous plants, for instance, rutin, a flavonoid glycoside generally found in a range of botanicals, is efficient against herpes simplex virus type 1 (HSV-1), herpes simplex virus type 2 (HSV-2), and influenza A virus. Ascorbic acid, beta carotene and lots of phenolics play active parts in decreasing inflammation, postponing aging, and averting certain kinds of carcinomas. There are some phenolic compounds such as tannins, flavonoids, vitamins...

M. Imran Kasana, Rashid Iqbal Khan*, Noor Ullah Khan, M. Noman, Shahid Ali, Saima Mumtaz, Shamaila Rasheed and M. Qamar-Uz-Zaman

...gh-quality, true to type plants. The current study was planned to evaluate four different grafting techniques (Cleft, Tongue, Patch and T-budding) in ten different cultivars of avocado. The outcomes suggested that Cleft grafting was most suitable one among all other evaluated techniques. The highest survival rate (27.40%) was recorded in cleft grafting. Moreover, vegetative characters, i.e., no. of leaves and leaf area, no. of internodes and internodal length,...

Zaryab Murad1*, Sobia Bibi1, Shehr e Yar Ahmad1, Mohsin Ali Khan1, Rimsha Sadaf2, Mauz ul Haq1, Umair Manan1 and Muhammad Younas2

... selected and 10 healthy plants were transplanted into each pot. After successful and possible growth five most perfect and healthy plants were kept for experimental work. All the pots were kept in standing water condition and the pots were irrigated on the visual requirement of the water. From the experimental results, its depicted that rice yield and biological yield was increased from control to 4% BC application (4.9 and...

ZARYAB KHALID SIAL & FARAH KHAN

...dable life from infected plants of Potatoes. The present study was aimed to confirm the presence and identification of potato spindle tuber viroid (PSTVd) on potato plants in Pakistan. RNA was extracted and purified using optimized Trizol reagent and RNeasy Miniplant Kit. The RNA obtained was converted into cDNA on the same day and amplified. The identification of PSTVd was carried out by Sequencing and BLAST. The advanced o...
ZAFAR IQBAL KHAN1*, KAFEEL AHMAD1, KHALID NAWAZ2, MUHAMMAD NADEEM3, ASMA ASHFAQ1,
BABAR MUNIR1, HAFSA MEMOONA3, MADIHA SANA3, FARZANA SHAHEEN1, NAUNAIN MEHMOOD4, HIRA MUQADAS4, MAHPARA SHEZADI5, IJAZ RASOOL NOORKA6, HUMAYUN BASHIR1,
MUDASRA MUNIR1, ILKER UGULU7 & YUNUS DOGAN7
...biochemical processes in plants. Any of these metals, at high concentrations in soil, can cause severe damage to physiological and biochemical activities of plants. Scarcity of fresh water in agricultural area enforced farmers to use industrial effluent and domestic wastewater for irrigation purpose. Ramzan sugar mill industry located at Chiniot discharges high amount of effluent which is used by farmers for irrigation purpo...

HIRA MUBEEN1, 2*, AMMARA NASEEM1, AMMARA MASOOD2, SHAHID RAZA3 & NAUREEN NAEEM3

...ession level of genes in plants. The expression of genes is regulated by certain regulatory elements including, Cis-acting regulatory elements (CRE), transcription factors (TFs) and promoters. Cis-acting elements are actually specific class of DNA binding proteins that act at particular site of DNA. Promoters are part of DNA fragment essential for transcriptional regulation of genes with certain transcription factors. These transcription factors could be usefu...

AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2

...iochemical attributes of plants was analyzed by launching a petri dish and pot experiment. The analysis spread out in a totally block design (randomized) with ten replicates for each salt (0 and 120 mM NaCl) and SA (0, 0.1, 0.5 and 1mM) treatment. The commercially available cultivar (cv. Faisal) of maize was planted in earthen pots for 15 days. After fifteen days of growth, seedlings were irrigated with saline water (120 mM NaCl) and SA was applied for 60 days...

ARIFA ZEREEN & ALMAS JAHAN

...en planted as ornamental plants at the green belts. With the passage of time the exotic plant species also called Invasive Alien Species (IAS) is going to be a serious threat to local ecosystems. This research work was planned to determine the harmful and significant effects of exotic plants on local flora. Fourteen species of exotic and invasive plants viz., Eucalyptus camaldulensis Dehnh...

Adriana Beatriz Sánchez-Urdaneta1,2*, Gisela del Carmen Rivero-Maldonado2, Cecilia Beatriz Peña-Valdivia3 and Dianelis del Carmen Sánchez-Urdaneta4

 

 

...on of the Opuntia plants to certain extreme environments. This is because a thicker cuticle, epidermis, collenchyma, and parenchyma in these plants can improve survival and growth in arid conditions. At the same time, these characteristics can optimize the efficient use of water, while providing greater protection of the inner tissues. All of the above has applicability for the selection and cultivation of promising g...

MUBEEN RIAZ1, KIRAN ZAHID1, SUMAIRA ASLAM CHOHAN1, MUHAMMAD ASHFAQ*2, MUHAMMAD ALI2, RIFFAT SIDDIQUE1, NUDRAT ANEES1 & FARAH KHAN1

...rolled and NaCl stressed plants, the extracted DNAs were subjected to RAPD markers, using PCR amplification. For this purpose a total of seven primers viz, OPH_01_F, OPH_01_R, OPH_01_RC, OPI_05_R, OPI_05_RC, OPG_10 and OPC_06 were used. PCR amplification was followed by gel electrophoresis (1.2% agarose gel) and visualized by UV light, which revealed the presence of monomorphic and polymorphic bands in the amplified products. During this analysis, two primers ...

SEHRISH MUSHTAQ1, MUHAMMAD SHAFIQ1, MUHAMMAD ASHFAQ*1 FAIZA KHAN1, SOHAIB AFZAAL1, UMMAD HUSSAIN1, MUBASSHIR HUSSAIN1, RASHID MUKHTAR BALAL2 & MUHAMMAD SALEEM HAIDER1

...tes are colonized inside plants and have antagonistic potential for fungal pathogens. These endophytes should be further explored for disease control. Ongoing study in this area will help to the innovate biological control of plant pathogenic fungi.

...

ABRAR HUSSAIN1, AQSA KHALIL1, SAIRA ZAHEER1, MUHAMMAD LATEEF2 & MUHAMMAD MANSHA1

...In this connection local plants/ their parts are being used to explore their anthelmintic potential. The aim of the present study was to determine the anthelmintic activity of Tribulus terrestris L. and Ziziphus mauritiana Lam. Whole plant of Tribulus terrestris L. and leaves of Ziziphus mauritiana Lam. were used. The plant materials were dried, ground firmly, macerated in ethanol and then the crude ethanolic extract (CEE) was prepared. Adult motility assay (A...

ALIA NASEEM, *SUMERA IQBAL & KHAJISTA JABEEN

...Cr treated and untreated plants. In comparative analysis compost appeared as more beneficial for okra than farmyard manure. Overall, the application of compost at 5 percent was found to be effective in improving yield characters, chlorophyll and sugar contents of Cr affected okra plants.

...

Olaolu Fadeyi1,2, Oluwatoyin Fabiyi3*, Tesleem Bello4 and Gabriel Olatunji5

...ots and soil of the Okro plants. This resulted in increased fruit weight and the number of fruits per plant.

...

Bela Putra1*, Budi Prasetya2

...totalling 700 seeds. The plants were grown in acidic soil with a pH of approximately 4.5–5. After two months of growth, the plants were harvested, and various parameters were analyzed. The results of the research indicated that the application of a 15 Gy dosage significantly enhanced the absorption of P (p<0.01), N (p<0.01), and Ca (p<0.01) in the plant. Additionally, gamma irradiation at a 25 Gy dosage demons...

Habibeh Jabbari

...cultivars and other host plants. High incidence of this nematode revealed by soil and root samples in the vegetable growing farmlands in Tabriz, Iran. Different populations of H. cruciferae were collected from the region and characterized based on morphological, morphometric and molecular features, four out of those populations isolated from the rhizosphere and roots of four different cabbage cultivars were subjected to further studies. All the populations sho...

Mehwish Zafar1, Muhammad Shahzad1*, Muhammad Zubair Akram2, Quratulain3, Mehak Shehzad4 and Samreen Nazeer5*

... salts hampers growth of plants and its yield of biomass by impacting major physiological mechanisms i.e., ionic, oxidative and osmotic stress. One possible and climate resilient strategy is to introduce new crops that can bear high level salinity and allow irrigation with saline water. Quinoa has great potential to grow under saline conditions having outstanding nutritious value. Pot based complete block design was conducted in COMSATS University Abbottabad, ...

Tianhoun Denté Fidèle1,2*, Meda Nãg-Tiéro Roland2, Zabré Geneviève3, Koama Benjamin2, Kaboré Adama1, Tamboura H. Hamidou1, Bélem Adrien Marie Gaston4 

... on the use of medicinal plants. Thus, the present study was carried out to assay total phenolics and evaluate the in vitro anthelmintic efficacy of aqueous and hydroacetone extracts of Combretum micranthum leaves on the parasite Haemonchus contortus. Following phytochemical assay, five increasing concentrations (0.6; 1.2; 2.4; 4.8 and 9.6 mg/ml) of the two extracts were prepared and tested for egg hatching and larval development in the presence of positive (A...

Nadia Kèmi Assana Chabi1, Gildas Codjo Tchemadon1,2*, Olaïgbé Lydie Hounkpatin3, Paul Kouété Jimmy4 and Leonard Antoine Chaffara Afouda1

...ing stage of sweetpotato plants. They observe the presence of aphids or whiteflies in their fields at 53.3% (AEZ II); 65.0% (AEZ VI) and 75.6% (AEZ VIII). Moreover, 100% (AEZ II); 92.5% (AEZ VI) and 93.0% (AEZ VIII), of farmers do not apply any management strategy for sweetpotato viral diseases. However, 5.0% (AEZ VI) and 7.0% (AEZ VIII) of them use chemical insecticides and 2.5% (AEZ VI), ash to control these diseases. To limit the impacts of these diseases a...

Muhammad Adnan1*, Muhammad Nauman Khan2,3, Barkat Ullah2, Faisal Zaman2, Alevcan Kaplan4, Hubert O. Dossou-Yovo5, Sajid Ali Khan Bangash6, Sana Wahab7, Mehreen Ghazal8 and Muhammad Hassan Sarfraz9

... first domesticated crop plants and is the most widely grown crop in the world, both in terms of cultivated area and yield, and wheat is known to be consumed by about two-thirds of the world’s population. The study was carried out to investigate the elemental and proximate composition of wheat against boron induced stress. Greenhouse experiments were conducted in October 2019 under natural light conditions to assess the chemical status of

Ali Hassan1, Javaria Ashraf1*, Salman Wahid1, Kamran Alyas1, Samaria Nisar1, Sadia Kanwal2, Nadia Hussain Ahmad2, Amna Bibi2 and Rameen Nawaz3

...ybrids in different crop plants. In cotton, heterosis of morphological and yield related traits using line × tester design is very important to identify best performing parents in future cotton breeding program. Therefore, in this study five lines (MNH-1020, MNH-1035, FH-152, CIM-632 and BS-20) were crossed with three testers (CEMB-100, RH-662 and NIAB-5) using line × tester crossing design, which resulted 15 F1 hybrids. The analysis of variance fo...

Iqra Munir*, Farrah Iftikhar, Hira Fatima, Sunbal Khalil Chaudhari and Roha Ramash

...ign: justify;">Medicinal plants serve as a natural source of herbal medicine employed in treating numerous diseases within local communities across various countries. They also constitute the raw ingredient for the pharmaceutical industry. This study was conducted during year 2020-2021 to gather the native indigenous knowledge about therapeutic uses of medicinal plants in Mandi Bahauddin, District Gujrat, Punjab, Pakistan. E...

Shahzad Aslam1*, Amjad Rashid Kayani2, Muhammad Irfan Ashraf3, Muhammad Azhar Jameel2 and Kiran Sahar4

...osition consisted of 83% plants diet, 14% provisioned food items and 03% scavenging on garbage bins. To study food resource preference, the monkeys were classified into five age/sex classes: Adult males, adult females, sub adults, juveniles and infants. Analysis of food resources preference of five age/ sex classes of rhesus monkeys revealed that it mainly varied due to nutritional requirements and physiological conditions of monkeys. Rhesus monkeys preferred ...

Philip O. Akporhuarho1, Ufuoma Godstime Sorhue1*, Adimabua Mike Moemeka2, Onyinye Stella Onwumere-Idolor3, Jonathan Ujomu1, Emmanuel Abadah1, Jennfer Aaron1

... Meat quality, Medicinal plants
...

Bushra AL-Khaqani, Amira Mohammed*  

...ch is present in several plants, red wine, and grapes, has been researched for its potential anti-inflammatory, and antioxidant qualities, and to induce relaxation of airway smooth muscle. The current study investigated whether Resveratrol (RES) could lessen allergic asthma that ovalbumin (OVA) causes in rats. Current results revealed that RES improved significantly (P<0.05) allergic asthma attenuation by decreasing the number of infiltrated mononuclear cel...
Gilmar Jesús Cañarte-Cañarte1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1 and Fernando David Sánchez-Mora1*
...spacing between rows and plants on the growth, development, and production of the cotton variety BRS-336. Twelve plant densities were used: 55 556, 37 037, 27 778, 50 000, 33 333, 25 000, 45 455, 30 303, 22 727, 41 667, 27 778 and 20 833 pl ha-1, with single row planting arrangements. A randomized complete block design, in factorial arrangement (A x B), with four replications was used. The variables recorded were daily height increase (cm/day) in bu...
Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Gilmar Jesús Cañarte-Cañarte1 and Fernando David Sánchez-Mora1* 
...reduce the height of the plants, contributing to the good structure of the plant, efficiently using its nutritional resources. When the growth regulator was applied at a single time, that is at 50 DAS, the best average yield of raw cotton was obtained (4,642 kg ha-1). Meanwhile, the most efficient dose was that of 300 mL of MC, with which the highest yield (4,613 kg ha-1) of raw cotton was obtained. 
...
Julio Adolfo Corzo-Bacallao1*, Carlos Alfredo Salas-Macías1, Osvaldo Fonseca-Rodríguez2,3, Felipe R. Garcés-Fiallos1, Erika Isabel Alcívar-Muñoz1 and Henry Fabricio Baque-Loor1 
 
...otal Branches) of coffee plants showed higher values in S2 compared to S1 and S3. These results are related to the higher photosynthetic activity associated with the higher intensity of incident solar radiation, although the relationship is not linear. In our results, flowering and fruiting were not affected by the level of shade, nor were their precursors, such as nodes per productive branch and productive nodes per productive branch. On the other hand, coffe...

Huma Naz1*, Sajid Abdullah2, Tanveer Ahmed3*, Khalid Abbas2, Syed Qaswar Ali Shah1, Muhammad Rizwan1, Fareeha Latif4, Adnan Ahmad Qazi1, Muhammad Adeel Hassan5

...ops as well as the fruit plants. However, terrestrial and aquatic biodiversity is directly affected by overuse of insecticides. Present study was conducted to find out the genotoxic effect of insecticides on DNA damage and nuclear anomalies in RBCs of Labeo rohita after exposure to chlorpyrifos+endosulfan (CPF+END) by using Comet and Micronucleus Assay. Twenty fingerlings of L. rohita was kept in LC50 concentration of CPF+END, (1.95±0.02 μgL-1 for 96...
Mona Adel El-Wakeel1*, Salah El-Din Abd El-Ghany Ahmed, Sanaa Abd El Rahman Mohamed
and Nadia Khalil Messiha
...yield of Capsicum annuum plants
and both associated weeds: Phalaris minor (grassy weed) and Malva parviflora (broad-leaf
weed). PLP was mixed with in the soil surface at successive rates (15, 30, 45 and 60 g pot-
1). In the corresponding treatments PLP at the same sequenced rates were mixed with the
soil then sprayed with acetic acid 5% immediately. Moreover, sole spraying of acetic acid
5% treatment ...

Mona Adel El-Wakeel1 and Ibrahim Mohamed El-Metwally1

... response of common bean plants.
Two successive pot experiments were conducted with twelve treatments. The first four
treatments were applied by incorporating of orange peels powder with the soil surface at
successive rates (10, 20, 30 and 40 g/pot) one week pre-sowing of common bean. In
the other corresponding four treatments, the orange peels powder was incorporated with

Felix O. Takim*1, Gideon Z. Nayan2, Oluwafemi O. Osatuyi1and Israel O. Olayiwola1

...ulations(maize at 53,333 plants/ha + 33,333 plants/ha of sweet potato, maize at 53,333 plants/ha + 66,666 plants/ha of sweet potato and maize at 53,333 plants/ha +99,999plants/ha of sweet potato), sole maize at 53,333 plants/ha and sole sweet potat...

Syed Awais Hussain Shah1*and Rizwan Ali2 2

...with five species. These plants are utilized by habitants from centuries as Ethnomedicine against various diseases like cough, cold, malaria, fever, stomach disorders, mouth and throat sour etc. This research provides a lot of Ethnomedicinal knowledge which depicts men’s interaction with plants.

...

Hussain Shah1, Hamida Bibi2, Ali Hazrat1and Khan Sher3

...anical uses of medicinal plants were documented in tehsil Utman Khel
district Bajaur Khyber Pakhtunkhwa Pakistan. 76 plant species belong to 47 families of
herbs, shrubs, mushrooms, trees and vegetables were recorded for their medicinal use.
These include 74 plants (96%) of angiosperms, 1 (1%) of gymnosperms, 2 (2%) of fungi
and 1 (1%) of Pteridophytes. Asteraceae was a dominan...
Tabassum yaseen1*, Muzamil shah1, Khushnood Ur Rehman2 Ali Mujtaba Shah3, Gul
Nawaz1,Rani Gul4
...ity in
weeds plants of soil selected from the Tehsil Tangi. The spore density was observed in all
weeds plants in the host growth stage. The maximum arbuscular Mycorrhizal Fungi (AMF)
spore density was found in the Chenopodium album (93.00±74.02) and Scandix iberica
(89.00±92.08) at the vegetative stage. The Glomus species is dominant in the rhizospheric
Muhammad Bilal Niaz1, Abdul Ghaffar1, Khuram Mubeen1, Mahmood Alam Khan1
and Wazir Ahmed2
...ced the height of cotton plants by
26.51%, crop growth rate in terms of biomass by 28.44%, total dry matter 28.46% and
seed cotton yield by 45% as compared to weed free treatment for whole season. The
increase in yield in horse purslane free crop for whole season (23.45%), horse purslane free
crop for 30 DAS (14.27%), horse purslane free crop for 60 DAS (18.07%), horse purslane
and other weeds free cr...
Luqman1, Zahid Hussain1, Mohammad Ilyas2, Azmat Ali Awan3, Javed Rahman 2,
Mazhar Ali2 and Tamana Bakht4
...fresh biomass, number of plants ha-1 and fruit
weight. The results showed significant effect for all the parameters during both years. Weed
biomass was the highest (2971 and 3595 kg ha-1, respectively) in weedy control treatments,
and lowermost in the hand weeded treatments (68 and 83 kg ha-1) in 2012 and 2013,
respectively. Moreover, the effect of the mulching treatments and the herbicidal treatments
Fawad Khan1, Zahir Muhammad1, Khushdil Khan2 , Shabir Ahmad2, Muhammad Jamil Khan3, Tamana Bakht4 And Asif Kamal2
...study. Among the studied plants, most of the
species belong to the Asteraceae family. For morphological studies of pollen through light
microscope (LM) and scanning electron microscope (SEM), the samples were prepared via
acetalization process. We done the fieldwork for the collection of weed plants and also
performed the experimental work i.e. SEM and LM for the pollen morphol...

Khalid Ali1, Asif Tanveer1, Naila Farooq2, Tasawer Abbas3*, Ghulam Sarwar2, Muhammad Ather Nadeem4, Ishtiaq Hassan3, Muhammad Mansoor Javaid4, Anees-ul-Hussnain Shah5, Bilal Ahmad Khan4 , Ali Raza6

...d under stress than crop plants.

...

Shazia Shafique1, Sobiya Shafique1 and Sonia Sahar1

...ds biocontrol using such plants against the phytopathogens in a vast range. The study can be extended to isolate and purify the compounds and its production on commercial scale to manage these pathogens in field conditions.

...

Amir Ehsan1*, Muhammad Ehsan Safdar1, Amjed Ali1

...ded 0, 22, 44, 66 and 88 plants m-2 densities of each of Echinochloa colona and Digera arvensis laid out in randomized complete block design. Augmented densities of E. colona (0, 22, 44, 66 and 88 weed plants m-2) enhanced its plant dry biomass up to 348 and 353%; and relative competitive index maximally to 80 and 77% in years 2015 and 2016, respectively. While the corresponding increases in plant dry weight and relative com...
Muhammad Ather Nadeem1 , Bilal Ahmad Khan*1, Saima Anwar2, Ahsan Aziz1, Rizwan Maqbool3, Muhammad Kashif Sohail4, Muhammad Ehsan Safdar1, Muhammad Mansoor Javaid1, Muhammad Mohsin Amin1, Muhammad Kashif Iqbal1, Amir Aziz4
...
Aqueous extracts of plants are used to control weeds being inexpensive and
environment friendly. Present study was undertaken to investigate the effect of aqueous
extracts of Sonchus oleraceus L. on the red rice (Oryza punctata Kotschy ex Steud.)
emergence and initial seedling growth. Treatments included in the study were aqueous
extract of leaves, stem and fruit of Sonchus oleraceus at varying concentration...
Farrukh Avais1, Anser Ali1, Hamza Javed2, Muhammad Saleem3, Tehreem Tahir4,
Muhammad Rafiq5,*
...rom selected
plants (Garlic and Peppermint) to explore their tyrosinase inhibition activity. Tyrosinase is
a key enzyme of melanogenesis which determines the mammalian skin, hair and eye
colour. Hyper-pigmentation leads to various skin disorders like melasma, sunspots, age
spots and freckles. Moreover, abnormal skin pigmentation is a serious aesthetic concern
which leads to psychosocial problems. Thus...
Barkatullah1, Sumayya Noreen1.Khushnood Ur Rehman1, Zahid Ali Butt2, Tabassum
Yaseen3, Kamran Akbar3, and Salma Noreen3
...m different parts of the plants, which include bark, fruit, leaves,
mulching, and rainwater. In all applications the growth of plumules and radicles of three
test species was retarded. It was determined that the allelopathic effect of extracts is
directly related to the duration of soaking i.e. 48 h extracts were more effective than 24 h.
among all parts the highest activity was shown by leaves followed by fruit,...
Naeema Khatoon Khaskheli1 , Muzafar Hussain Sirohi11, 2,*, Ameer Ahmed
Mirbahar1, Abdul Razak Mahar1, Mumtaz Ali Saand1, Mirza Hussain3
...iv>Weeds are the noxious plants that stunt growth and yield of many crops. This study
recorded the community composition of weeds in maize crops grown at District Khairpur,
Sindh, Pakistan. The weeds were collected from the maize crop at three different localities
using the quadrat method (60 quadrats/site). The species were identified and herbarium
samples were preserved in Herbarium, Shah Abdul Latif University...
Haseeb Ahmad1*, Muhammad Shafi1, Waqas Liaqat1, Muhammad Faheem Jan1,
Shahzad Ahmad2 and Muhammad Farooq3
...tavator produced tallest plants
(221.22 cm) with maximum grain rows ear-1 (16) and shelling percentage (78.14%).
Among weed control methods, hoeing 15, 30 and 45 days after sowing showed maximum
plant height (226.41 cm), grain rows ear-1 (16), and shelling percentage (79.11%). All weed
control methods showed significant reduction in weeds m-2, weeds fresh
...
Kamran Ahmed Pathan1 , Waheed Ali Panhwar1,*, Abdul Manan Shaikh1, Safdar Ali
Ujan1, Javed Ahmed Ujan1, Khadim Hussain Memon1, Irfan Ahmed Pathan1 and
Shabana Mangi1
...e association of various plants with the
species is provided for the first time. This study will be a baseline for the future research
associated with longhorn beetles.
...

*Arshad Javaid1, Syeda Fakehha Naqvi1 and Iqra Haider Khan1

...div>identified. The weed plants were collected from Jehlem, Pakistan. Its roots were dried,
powdered and extracted in methanol. After evaporation of the solvent, the remaining
extract was mixed in water and partitioned with n-hexane, chloroform and finally with ethyl
acetate. The last fraction was analyzed through GC-MS that indicated the presence of 15
compounds. These included the three major compounds namely o...

Khushdil Khan1, Mushtaq Ahmad1, Muhammad Zafar1, Khafsa Malik2, Shazia Sultana1, Shabir Ahmad1, Fawad Khan3, Asif kamal1, Kalim Ullah3

...ferent weedy bee foraged plants belong to 10 various families from Southern Khyber Pakhtunkhwa were collected, identified, and studied using light microscopy (LM). The plants were Asphodelus tenuifolius, Euphorbia helioscopia, Parthenium hysterophorus, Rhazya stricta, Datura innoxia, Eruca sativa, Convolvulus arvensis, Anagallis arvensis, Galium aparine, and Anethum graveolens. Slides for light microscopic studies were prepa...

Iqtidar Hussain1, Ejaz Ahmed Khan1, Jawad Nazir and Ehtesham-ul-Haq1

...l growth of neighbouring plants is called allelopathy. The significance of study was checked allelopathic phytochemical potential of white cedar vern. Bakain (Melia azedarachL.) leaves on wheat.Leaveslitter was used to examine the allelopathic effects of M.azedarach at five concentrations (100, 200, 300, 400 g, control). The studied parameters were germination percentage (%), Speed of germination, plant height (cm), root length (cm), Shoot length (cm), coleopt...

Muhammad Ather Nadeem1, Bilal Ahmad Khan1* Sadia Afzal2, Rizwan Maqbool3, Hasnain Waheed1, Aneela Nijabat4, Muhammad Ikram5, Amir Aziz6, Muhammad Adnan1, Qaisar Mehmood7, Hasnain Umer3

...ify;">Weeds are unwanted plants in crop that can be controlled by different methods among them use of aqueous extracts of crops is an imperative method. In this method allelochemicals present in crop plant help in suppressing or inhibiting weeds. Therefore, this study was planned to investigate the allopathic potential of aqueous extract of winter crop Papaver somniferum (opium) on summer weed Echinochloa cruss-galli (barnyard grass. The experiment comprised o...

Mushtaq A.Alabodi1*, Imad Majeed Almeeni2 

...fficiency of melatonin implants as a single subcutaneous dose to suppress or delay the estrus cycle in queens. Ten domesticated non-pregnant cats of known origin aged between 1-3 years were used. The cats were divided randomly into two groups. The first group (G1, n=5) was left without treatment and served as control group, and the second group (G2, n=5) was administered 18 mg melatonin implants as a single-dose subcutaneous...

Zia Ur Rahman1*, Naveed Ahmad1, Adnan Ahmad2, Hammad Ud Din1 and Fazli Amin1

Amir Afzal1*, Sairah Syed1, Hafiz Husnain Nawaz2, Ruqeah Mustafa1, Marjan Aziz1, Madeeha Khan1, Azra Khan3, Uzma Javed1, Attiq Ur Rehman4, Rubab Altaf 5 and Qamar Shakil6

...gainst differential host plants, and molecular techniques such as PCR and DNA sequencing are discussed as effective tools for tracking Pst populations, identifying new introductions and monitoring their evolution over time. A combination of traditional and molecular techniques has generated valuable data for understanding populations virulence of Pst.

...
Mohammad Islam, Habib Ahmad, Abdur Rashid, Abdur Razzaq, Naveed Akhtar , Ikarmullah Khan
NAVEED AKHTAR,Maqsood Anwar,WISAL MUHAMMAD KHAN,Amjad Siddique,MUHAMMAD SALEEM KHAN,SAMIN JAN
Muhammad Alam Zeb,Adeela Haroon,SULTAN MEHMOOD,MANZOOR ULLAH,REHMAN ULLAH KHAN,SAAD ULLAH KHAN,ASIM MUHAMMAD,IHSAN ULLAH,Saira Abbas
Siraj Ahmad[1], Asghar Ali , Hanifa Beg , Altaf Ahmad Dasti , Zabta Khan Shinwari
KASHIF ALI,Muhammad Shuaib,SAJJAD ALI,Tanweer Kumar,SHARIFULLAH,IKRAMULLAH KHAN
Muhammad Nabeel,Ali Ahsan Bajwa,Sehrish Sadia,Wahaj Nafees,SHAHIDA KHALID
NAVEED AKHTAR,WAHEED MURAD,IKRAMULLAH KHAN,SAMIN JAN,HABIB UL HASSAN,AKASH TARIQ
Syed Rehmat Ullah Shah, Muhammad Qasim , Ijaz Ahmad Khan , Syed Azmat Ullah Shah
SULTAN MEHMOOD,MANZOOR ULLAH,SAAD ULLAH KHAN,IHSAN ULLAH,ASIM MUHAMMAD,REHMAN ULLAH KHAN
MUHAMMAD SALEEM KHAN,IQBAL MUNIR,SYED ZAHIR SHAH,NAVEED AKHTAR,Haroon Khan,WISAL MUHAMMAD KHAN
Amna Ali,MUHAMMAD SALEEM HAIDER,UZMA BASHIR,NAUREEN AKHTER
Inamullah,SAFDAR SHAH,SHAHIDA BIBI,ABDUL MAJID,SAJJAD ZAHEER,HABIBULLAH,Zahid Hussain,ALAM ZEB
Shad Ali Khan, Lajbar Khan, Iqbal Hussain, Khan Bahadar Marwat , Naveed Akhtar
Arshad Iqba,INAMULLAH KHAN,FAZL E RABBI,SIRAJ UD DIN,SAMIN JAN
Irum Mukhtar , Ibatsam Khokhar , Sobia Mushtaq,Muhammad Azam Khan , Mir Ajab Khan , Mazhar Hussain
Kee-In Lee,In-Taek Hwang,Soo-Jin Cho,Ha-Young Song,No-Joong Park,Hee-Kyung Lim,Dal-Rye Kim
Shahida Naveed , Madeeha , Inayatullah Khattak and Khan Bahadar Marwat

Zeinab A. El-Moaty1,2*, Hoda Ahmed1,3, Wafaa Sorour4,5 and Tarfa H. Alsheddi6

...en highly significant in plants and insects collected from the cement site. Mg level was the same in plants and insects collected from the two inspected sites. The concentrations of different MHs were higher in beetles than soil and plant. Only, the concentration of Zn in plant (163.59 µg/g) was higher than that recorded in soil (1.67 µg/g) and insect (80.99 µg/g). The concentration of Mg, Cu, Fe, Pb, Cd an...

Roshan Ara1, Muhammad Ali Khanzada1, Amir Khan Korai1*, Abdul Mubeen Lodhi, Anam Mehwish Khanzada1, Khalid Hussain Qureshi1, Shakal Khan Korai2*

...ita) infection on chilli plants and evaluated the efficacy of various chemical nematicides in controlling the infection. Infected plants exhibited symptoms such as pale green to yellow discolouration, stunted growth, and the development of knots on roots containing egg masses and female nematodes. Pathogenicity tests on “Ghotki” chilli plants revealed a direct correlation betwe...
Manahil Wahab1 and Anwar Ali2
...e normal spacing between plants on the boundaries of field is 2-3 feet whereas in case of compact plantations it is 3x3 or 4x4 feet. About 48% of the respondents procured saplings from private nurseries whereas 42% of the farmers produce planting stock in their own nurseries. Majority (82%) of the respondents reported that trees have negative effects on agricultural crops which results in loss of agricultural crop in the range of 20-50%. On the average the los...
Muhammad Rayyan1, Basheer Ahmad1, Anwar Ali1, Nowsherwan Zarif1*, Saif Ullah1 Khan and Salman Ahmad1
...onomic return, while 15% plants for shelterbelt purposes. Whereas, results further revealed that 12.5% farmers planted trees for land stabilization. In addition to that 57.5% of households gets benefits from agroforestry in the form of cash and fuel wood 10% in the form of fuel wood. From the survey it is also revealed that 45% of farmers are directly benefited from fuel wood from farmland, while 32.5% of farmers relied for fire wood on their land as well as f...
Khush Bakht Arooj1, Muhammad Salman2 and Naveed Ahmed3
...d income, pollination of plants to increase crop yield, maintains biodiversity and to protect the environment. The current status of apiculture in district Bannu is evaluated in the study as it is also a famous area for honey production in Khyber Pakhtunkhwa. In this study the primary data was collected through well-designed questionnaire and the study was carried out in different villages of Tehsil and District Bannu. A general survey was also conducted to kn...
Sanam Zarif Satti1, Tanvir Ahmad Quereshi2, Mehwish Zarif3 and Iftikhar Ahmad4
...ent. ...
Ch. Muhammad Muslim1, Hassan Sher2, Junaid Khan2, Shahid Hussain2, Ashfaq Ali2 and Atif Majeed3
... 40 herbaceous medicinal plants belonging to 33 different angiosperm families used by local people to cure different ailments. Lamiaceae was represented by maximum number of 6 species followed by Apiaceae and Solancaceae represented by 4 species each. Alliaceae was represented by 3 species while Amaranthaceae, Asterceae, Brassicaceae, Fabaceae and Pllygonaceae were represented by 2 species each. All other families were represented by 1 species each. Documented...
Ahmed Zamir, Muhammad Waqas Khan and Saeed Anwar Wazir
... to variety of medicinal plants and has been called as the floral emporium of medicinal plants. It has about 6000 species of wild plants, among them almost 4000-6000 are considered to carry or of medicinal importance. During the ethno botanical elaboration of Leepa valley 106 plant species of 55 families were recorded. Among them 93 are considered to carry great medicinal values. Residents...
Ashar Farooq1; Farid Shah2; Saifullah Zahri2 and Samiullah Jaffar2
...d. Leaves of intercepted plants were removed at a distance of 5 meters. The cover and height of the same plants was also measured. Quadrat method was used to measure the number of individuals per unit area of Seriphidium at both sites. For measuring the concentration of Fe+, the plant samples were dried, digested and analyzed on AAS (Atomic Absorption Spectrometer). It has been concluded that there was non-significant...
Saif-ur-Rehman Saif Abbasi & Saeed Akbar
...on in shape of medicinal plants, wood for making their farm implements i.e. wooden plough, spade, blade etc. and domestic goods of daily usage i.e. charpoy, stool, baskets, furniture etc. The use of cheep and easily available forest vegetation, based on indigenous knowledge, has reduced household expenses on one hand but has also put tremendous pressure on forest vegetation on the other hand. There is need to create awareness on sustainable forest resource man...
Syed Said Badshah Bukhari, Muhammad Yousaf Khan Syed Zakir Hussain Shah and Khalid Jan
...carbons in thermal power plants is reducing the oxygen four times the weight of hydrocarbon used in the power plants and is therefore detrimental to the very existence of life on this planet.

The arrangements proposed in this study will not only regulate the flow of water for agriculture but power generation on cheaper rates will be ensured. The additional water storage of 40 million Acre feet will be sufficient fo...

Ch. Muhammad Muslim and Sohail Sikander
...esearch on the medicinal plants was started by the researchers in the last century in order to allocate different valuable alternative resources to the increasing demands of population especially to those communities totally dependable on forests and other non-renewable natural resources. Linum usitatisimum is a renowned medicinal herb of the world of herbaceous plants because of its multipurpose uses in different dis...
Ch. Muhammad Muslim and Sohail Sikander
...egeneration of medicinal plants is adversely affected by a number of climatic and edaphic factors (earthquake). Drug plants occurring at higher elevations acquire perennial nature due to short growing season of 4 to 6 months and hence require a prolong growth periods of 6 to 10 years depending upon plant species concerned. Disturbance in the regeneration pattern is also affected by heavy grazing and intensive felling of tree...
Muhammad Shabir Mughal and Muhammad Muslim
...l, aromatic and economic plants growing in the area and evaluation of future prospects of endemic tree species including medicinal and economic plants that need in-situ conservation of sustainable utilization having market potential and income generation activities for rural communities. The area falls under scrub forests and subtropical Chir pine forests. Inhabitants are holding small land and cultivating maize and millet c...
Rahim Muhammad Akmal Syed1, Hasnain Shahida2, Mamoona Wali Muhammad3 and Jabeen Farkhanda4
...rent suitable species of plants. The results of the soil analysis of various agro ecological zones and the consequent recommendation of the associated suitable species, aids the agrofarmers to pick out the best possible option.

Key words: Soil Analysis, Agro-ecological Zones, Farm Plantations, Soil Texture and Organic Matter, Nitrogen and Phosphorous.

...
Ch. Muhammad Muslim1, Yahya Karamat2, Muhammad Shabbir Mughal3 and Imtiaz Hussain4
...esearch on the medicinal plants was started by the researchers in the last century in order to allocate different valuable alternative resources to the increasing demands of population especially to those communities totally dependable on forests and other non renewable natural resources. Nigella sativa is a renowned medicinal herb of the world of herbaceous plants because of its multipurpose uses in different disease...
Muhammad Afzal, Aqeela Mobeen Akhtar and M. Mahboob-ur-Rahman
...he Earth's surface where plants developed in relative isolation over long periods of time and are separated from one another by geologic features, such as oceans, broad deserts or high mountain ranges, that formed barriers to plant migration. Forest Ecozones are characterized by the evolutionary history of the plants they contain. These are divisions of the Earth's surface based on plant life form or the adaptation of
Muhammad Shabir Mughal, Asif Raza Wazir and Ch. Muhammad Muslim
...s. A number of medicinal plants like Berberis lycium, Thymus serpylum, Salvia sp., Solanum suratense were also found in the area. The data reveals that due to ever-increasing human and livestock population, the area is under heavy biotic pressure resulted deforestation and soil degradation. Recommendation for the improvement of vegetation in the area was made of soil, unemployment and poor lively hood. The respective Forest Department may manage ...
Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...d reproductive growth of plants, and depending habitat characteristics. In addition to biologists and ecologists, this study provides guidelines to policy makers for adaptation of mitigation measures.

Key words: Climate change, temperature, rainfall, evaporation, wind

...
Shakeel Haider Zaidi, Ch. Muhammad Muslim, Muhammad Shabbir Mughal and Imtiaz Hussain
Tanvir Hussain
.../embryos with stem) as explants in different culture media i.e. Murashige & Skooge (MS) medium, Gamborgs B5-salt (B5)and Basal nutrient medium (BNM) alone and in combination with Auxins and Cytokinins. It was found that only the axillary buds gave good response to all media. For callus initiation, same ex-plants and media (alone and in combination with callus initiators) were tried but callus formation was not observed. Asep...
Md Golam Moula
...Considering the types of plants, survival rate, diameter and height growth, E. agallocha, H. fomes and X. mekongensis are found highly promising for underplanting in the western coastal belt of Bangladesh....
Sarfraz Ahmad, Sarwat N. Mirza and Muhammad Islam
... and production of range plants in Balochistan. Salsola vermiculata a Mediterranean perennial shrub was evaluated under natural rainfall regimes to assess its potential of germination and establishment under drill and broadcast seeding treatments for range improvement in highland Balochistan. Seeds of S. vermiculata germinated in both treatments with higher germination percentage in drill seeding. Apparently, no differences were observed for seed...
Majid Azizi and Mohammad Modarres
... to feed paper producing plants. The decision-making is examined within the framework of benefits, opportunities, costs, and risks (BOCR). A hierarchy is used to prioritize the BOCR themselves are prioritized using the Analytic Hierarchy Process (AHP) ratings approach. A control hierarchy is then created and prioritized using the Analytic Network Process (ANP) to evaluate the control criteria of the system. There are a total of 19 control criteria in the syste...
Majid Azizi
...ishment of Wood industry plants.

Keywords: Wood industry, TOPSIS, Analytical Hierarchy Process, Location, Priority

...
Muhammad Afzal, Aqeela Mobeen Akhter and Masood Amjad
...rue to type Shisham tube plants can be produced vegetatively through the application of rooting hormones, which are fit for field planting with in a period of 4 months. NAA with a concentration of 100 mg/l among the other rooting hormones proved to be more economical for production of these true to type tube plants. These tube plants showed promising growth in the field with more than 80% ...
Muhammad Afzal and Aqeela Mobeen Akhter
...pots and 85% survival of plants in soil was recorded....
Sardar M. Rafique and Ghulam Ali Bajwa
...on, training of mulberry plants should be carried out before the autumn rearing to get young nutritious leaves.

Key words: Silkworm, Bombyx mori, Rearing, Efficiency, Mulberry leaf.

...
Bashir Ahmed Wani1, Shakeel Haider Zaidi2, Hakim Shah3 and Muhammad Muslim4
... Herbal drugs, Medicinal plants.

...
Chaudhry Abdul Rashid1, Raja Muhammad Omer2, Chaudhry Muhammad Faisal2, Waqar Ahmed3, Zahid Ali4
...camaldulensis) Eight plants of E camaldulensis were replicated thrice in each treatment with a spacing of 2m x 3m. Plant height (m) and diametre at breast height (DBH) (cm) were measured annually from 1992 to 1998 Soil samples were analysed for pH, organic matter (OM) %, P, K, total soluble salts (TSS) % and soil saturation % Results indicated that the growth of E camaldulensis was highest in combination with Leuceana leucocephala and ...
Hassan Sher, Midrarullah, A. U. Khan, Z. U. Khan, Farrukh Hussain and Siraj Ahmad
...A study of the medicinal plants of Udigram, District Swat was conducted during spring and summer 2003. The study revealed 78 species under 37 genera belonging to 47 families, of which 68 plant were dicotyledons, 6 monocotyledons, 1 gymnosperm, 2 pteriodophytes and 1 fungus. The largest family was Lamiaceae (9 species) followed by Asteraceae, Poaceae (each with 5 species), and Rosaceae (4 species). The family Apiaceae, Asclepidaceae, Brassicaceae, Caryophylacea...
Sarfaraz Hussain Bangash
...o: Functions of boron in plants The exact and specific function of boron in plant vegetative life is not understood as yet. However, investigations have shown that it causes death of the terminal growing point, breakdown of the conducting tissues and results in the brittleness of stem and petiole which finally causes brown coloration and cessation of roots and height-growth (Bangash & Gardiner, 1985). Boron deficiency causes increase in total sugar and starch ...
Md. Aktar Hossain , Mohammad Kamaluddin and M. Serajuddoula
...ct of etiolation of stockplants on rooting ability to cuttings of Guava (Psidium guajava Linn.). Fifteen months old sun grown containerized stockplants of guava were etiolated in a darkroom. Cuttings from the etiolated and control stockplants were tested for rooting ability. The study revealed that the cuttings of the stockplants etiolated or cont...
Aman Ullah Bhatti, Shamsher Ali and Farmanullah Khan
...d K. The total number of plants were 410 in agro-forestry field and were about 5 years old Data collected on soil properties were statistically analyzed. In the field of agro-forestry, the percent co-efficient of variation (% CV) for EC (1:5) and P were 57.4 and 35.2 for surface soil and 49.8 and 72.7% for sub soil, respectively. Based on critical level for soil P. all the soil samples in both the depths were deficient, except one sample which was medium in su...
Bashir Ahmad Wani, Shakeel Haider Zaidi, Muhammad Shabir Mughal and Hakim Shah
...s....
Muhammad Ibrar Shinwari, Maryum Ibrar Shinwari and Mir Ajab Khan
... as marketable medicinal plants collected by the inhabitants, drug dealers and herbalists for their socioeconomic value. Among the species sold in the local market, 3 species i.e., Asparagus adscendens Roxb., Berberis lyceum Royle. and Viola canescens Wall, ex Roxb. found vulnerable to harvesting....
Muhammad Afzal, Muhammad Mushtaque, Aqeela Mubeen Akhtar, Nighat Chughtai and Shaheena Ramzan
...ugh multiplication of ex-plants produced from aseptically raised germinates of the species. In the basal media (MS + 5 micro molar BAP), ex-plants started differentiating shoot buds at high frequency. These aseptically developed plantlets were shifted to earthen pots for rooting without applying any root-promoting hormone. These plantlets showed a good growth response in earthen pots and attained one-meter height within a pe...
G.A. Bajwa and H. Gul
...us defoliator of nursery plants being environmentally safe for this purpose seed of A. indica, bark of C. fistula and leaves & tender shoots of C. procera were used The reduction in larval body weight in treated larvae was 74 19% to 78.92% over control in case of C. procera and the mixture after 12 and 6 days of treatment, respectively Mean larval period was extended upto 22 days in the mixture treatment while it was 11.5 days in co...
Muhammad Naqash, Anwar Ali, Ahmad Hussain, Mamoona Wali Muhammad, Ahmad Zamir, Ikram Ul Haq
...le the average number of plants regenerated per hectare is estimated to be 136, some of which were coming out of natural regeneration besides plantations. The average survival rate was 92.36% in Mingora and Matta Forest Subdivisions and Kabal and Fatehpur Ranges. In Mingora and Matta Subdivisions the survival rate was 92.08% and 94.65% while in Kabal and Fatehpur the survival rate was 89.20 and 93.50 %. Majority of plants (...
Siraj-ud-Din and Abdul Waheed Baloch
...n survival and growth of plants as compared to conventional planting methods. Within the various water conservation techniques contour trenches and earthen moistures are more economical and are able to keep the period happy and vigorous for a longer period of time. Biological treatment to sand dune stabilization is the only permanent and everlasting solution to this problem.
...
Anwar Ali, Muhmmad Ayaz, Saz Muhammad
...f Kaghan. There were 332 plants per ha in the forest area. Reserved forests have significantly higher number of regeneration than Guzara Forests. It was astonishing to know that the highest number of regeneration was recorded for Fir which was 43%, followed by Kail as 27%, deodar 14%, Spruce 12% and Taxus wallichiana as 4%. The study recommends adoption of assisted natural regeneration techniques and opening of canopy for improvement of stand structure...
Sanam Zarif Satti, Tanvir Ahmad Qureshi, Iftikhar Ahmad and Sumara Zarif
.......
Sarfaraz Hussain Bangash
...ity of these elements to plants. Amongst the micro-nutrient elements, boron is perhaps the most important and plays a very important role in soil-plant relationship. It has a marked effect on crop growth, both from the standpoint of plant nutrition if it is deficient in soil, and of toxicity if it is present in excess. Boron is the 25th element in order to abundance on the earths surface, and 12th in order of abundance in plants
Muhammad Rafique and Muhammad Afzal
...ensis tubed nursery plants for transplanting in the field. Six different age groups of seedling were planted for this purpose. Results revealed that seedlings of three months old or less are not suitable for out-planting due to their high mortality rate. Seedlings of four and a half to six months are best for transplanting in the field....
Jehan Zeb, M. Aslam, Shahid Ahmad, Aamir Kabir and Taj Ali Khan
Muhammad Ibrar Shinwari and Mir Ajab Khan
...ve always used medicinal plants for various ailments and have for a long time been dependent on surrounding plant resources for their food, shelter, fodder, health care and other cultural purposes. However, encroaching industrialization and the accompanying changes in their life styles are responsible for the decline in the local practice of uses of these plants before the information is lost. About 100 informants were inte...
Mian Muhammad Shafiq
...ely and 11% low (5% for plants, 4% for mammals, none for birds, 10% for reptiles for fish) but the blending of elements from different origins has ensured a diverse and interesting flora and fauna....
Muhammad Rafique Sardar
...ses the existing forests plants preparation, important characteristics and objectives of forestry projects and evaluation processes. The paper suggests that forestry activities must be integrated with rural development. It further suggests that the importance of Planning, Monitoring and Evaluation (PME) of forestry projects must be recognized and evaluation must be made an integral part of the plans....
Ghulam Akbar, Muhammad Arshad and Taj Naseeb Khan
...ervations confirmed that plants emerging from seed were morphologically more vigorous than those arising from root stumps. Thus seeding method if synchronized with suitable soil moisture can prove more effective in terms of DMY in desert areas like Cholistan....
Mohammad Noor and Bashir Hussain Shah
...i, were compared. Twenty plants of each of the five fodder tree species were planted in each of 6 replications on RCB design. Survival, growth and airdried biomass data were collected in January, 1994 on each tree species, and analyzed statistically. Acacia modesta, Prosopis cineraria and Acaica albida had substantially higher survival percent than Acacia tortilis and Acacia victoriae. Acacia albida and Acacia tortilis
A. U. Khan, S. Siddique and F. Naz
...f exposure dosage on the plants, alongwith plant physiology and the energy and chemical balance in the plant micro-environment created on the road determine to what extent pollution can be absorved or emitted by these trees....
Abdul Khaliq Chaudhry, Sahibzada Muhammad Hafeez and Muhammad Jahangir Ghauri
...ensis potted nursery plants and its effect on the out-planting success. Survival percentage and height and diameter growth of seedlings at nursery as well as field phase were found non-significant. Economy in irrigation water and use of labour for irrigation without affecting the growth of plants was also worked out....
Muhammad Hafeez, Liaqat Hussain Jafri and Mohammad Rafiq
...lands by planting tubed plants is preferable....
Hanif Gul
.... All the dying and dead plants were found infested by termites while healthy plants were safe from termite infestation. Chemical control trials with chlorinated hydrocarbon insecticides afforded protection for more than 20 years while trials with pyrethroids are in progress and have shown efficacy for the last seven years....
Mohammad Hafeez and Muhammad Rafique
...and make it available to plants in their tender age. An experiment was laid out at Maujghar in Cholistan to study the effectiveness of such a chemical 'alkasorb' for its water retaining capacity and its ultimate effect on the survival and growth of tree species....
Ghulam Ali Bajwa and Hanif Gul
...percent dry matter. Five plants per treatment were selected at random, then data were converted on per plant basis. Plant height was the only parameter which significantly increased in response to Temik, while others were non-significant. Temik 10g at the dose of 3.2 g/plot increased 32.13 percent plant height over control....
K. M. Siddiqui
... and graceful group of plants and are of multiple utility. About 14 million hectares of the earth surface is covered by bamboo forests with 80 percent of their total area falling in Asia. They are well represented in all continents except Europe and their distribution extend from 15° North latitude in Japan to 47° South latitude in South Argentina in the areas of Tropic of Cancer and Tropic of Capricon. The altitudinal range is from just a...
Zakaullah
...hat most of the infected plants had already died while the remaining exhibited blisters, swellings and girdling of stem, death of small shoots, needles turnings to reddish brown, resin exudation and eventually leading to the death of entire plant. The dead wood was found attacked by the borers (insects)....
Mohammad Arif Chaudhry
...nology of three-year-old plants of 5 Paulownia species namely P. australis, P. elongata, P. fortunei, P.tomentosa and P. forgesii indicated that flower bud production occurred in the month of August in the first four species . P. forgesii did not produced any flower buds. The blooming took place in first week of March before foliation. P. elongata flowered earliest of the species in the first followed by P. fortunei in...
Sahibazada M. Hafeez
...ed from CSIRO Australia, plants raised in the nursery and then out planted in the field trial during September, 1990. Three years survival and growth data have been analysed and better performing salt tolerant species have been identified. ...
K. M. Siddiqui and Muhammad Tahir Laeeq
...for which 1309.4 million plants will be raised. On the basis of these targets, 992,710 kg seeds of various tree species would be required during this period....
Mohammad Saleem and C. A. Call
... were implemented when plants were 32 weeks old; and consisted of: equally clipping (3-cm stubble height) plants in monoculture and mixture zero, one, two or three times at 4-week intervals (32, 36. and 40 weeks after emergence), and clipping (3-cm stubble height) one species in mixture zero, one, two or three times at 4-week intervals (32, 36 and 40 weeks after emergence) without clipping the associated species. The final...
M. Ismail Chaudhry and Ghulam Ali Bajwa
...rent parts of four drug plants Azadirachata indica, Dhatoora alba, Melia azedarach and Calotropis procera were used to determine their efficacy against Plecoptera reflexa larvae, an important defoliator of shisham plantations. In case of A. indica and M. azedarach seed powder was used for making 10% water extract and for D. alba and C. procera leaves, branches and stem were boiled in water for making 15%...
Raza-ul-Haq
...th-old and 12-month-old plants in polythene tubes gave best survival rate under shade in all three cover condition. Under similar condition the survival rate was comparatively low for the seeding planted directly in forest soil due to root competition. For older plants (24-month-old) both shade and root competition are less important. Height growth of young seedling (3-24 month old) is not significantly affected by sh...
Hanif Gul and M. Ismail Chaudhry
...in improving vitality of plants by reducing moisture loss through transpiration thereby decreasing plant mortality. Further, almost all dying and dead plants were infested by termites at Kharian while only 30% of dead plants were infested at D. I. Khan showing that termites are not the cause of mortality of plants....
Shakeel Haider Zaidi and Anwar Ahmad Khan
...9 to 1992) at Medicinal plants farm, Peshawar. The plant has successfully adapted to the climatic condition of Peshawar giving the highest yield when planted at 60*30 cm spacing. It can be easily cultivated under irrigated conditions at Peshawar and has good potential for supplementing the farmer's income even on marginal lands....
Hanif Gul and M. Ismail Chaudhry
...eplications keeping five plants in each treatment. A total of 243 plants were found dead at D. I. Khan during the period of experiment out of which termite damage was recorded on 27 plants only. At Peshawar mortality of plants was less than that at D. I. Khan. A total of 175 plants died over a period of a year and...
Mohammad Noor
...ge number of established plants of the ecotypes from India (269), Australia (426) USA (235) and Pakistan (229) was significantly hider than those of other ecotypes. The ecotype from Pakistan (390) produced minimum air-dried for age and had minimum number of established plants....
Pazir Gul and Muhammad Farooq
...rably well with oil from plants grown in colder climate but less unsaturated than Russian oil. It was also observed that the oil was of fair standard and could be used in place of oil from other Ricinus spp....
Anwar Ahmad Khan and Shakeel Haider Zaidi
M. Bashir Khan
... of control) was in the plants fed with both ammonium and nitrate. The highest increase (34.7% of control) in the alkaloid concentration was in the plants fed with only ammonium.The increase in the Putrescine level. ODC and ADC activities was higher in the plants fed with only ammonium of both ammonium and nitrate as compared to those plants fed w...
S. M. Rafique
...ttings and whole nursery plants were planted in it at a spacing of 2.7 x 2.7 meters (9 x 9 feet). Irrigation was applied as and when required from an open sewerage drain. All necessary cultural operation were carried out according to the plan of operations. Ten years old tree crop in may, 1992 consisted of only 536 trees because there were numerous gaps in it. Amongst these, 11 trees were defective (top broken per dry and partially rotten from ground upwards)....
Editor
...promotion of medicinal plants was held on 6th and 7th March, 1991 at the Pakistan Forest Institute, Peshawar, organized at the initiative of Mr. Amir Gulistan Janjua, Governor, NWFP. The objectives of the Workshop were to bring together research scientists, pharmaceutical industrialists, traders, professional foresters, farmers,'attibas' and personals engaged in the manufacturer of medicines used in the traditional system, to initiate dis...
Mirza Hakim Khan Dr.
...sed ample number of food plants, shelter and spring water for the animal. Improvement of this habitat is, therefore, essential for the protection of the animal against biotic interference....
S. H. Iqbal and Firdaus-e-Bareen
...ronds of ferns and other plants in the rock crevices start senescing. The fine rhizoids of mosses and liverworts were observed penetrating the decaying aerial portions of Adiantum capillus-veneris L., making them heavily VA mycorrhizal. Vesicular and arbuscular infections were observed in thestem and fronds of Adiantum....
Shakeel Haider Zaidi and Anwar Ahmad Khan
...owth performance of the plants were under-taken in its natural habitat. Results are presented in this paper....
Mir Baz Khan
...ce where mulberry trees plants are found in .abundance. The following sericulture centres have been established over the years in the province....
M. Iqbal Ahmad and I. A. Hafiz
...d 50% after sprouting of plants in spring and 50% after 20 days of leaf plucking, increased mulberry leaf yield by more then 100%. The PFI-1 early sprouting variety was selected and distributed among all forest departments of provinces and AJ&K for further propagation and raising of plantations. Pollarding at 30 to 70 height cm from ground level was suitable in mulberry plantations on agriculture flat land and 70 cm to 170 cm height in irrigated forest...
M. Khan and M. Kleine
...ng growth. About a10,000 plants per hectare, which are more than 20 cm tall, and sufficient to constitute future stands of desirable densities, are the result of two years of protection from fire and biotic factors. Strong indications could be found for a substantial reduction of the regeneration period which would lead to an increased productivity of these forests. ...
S.A. Khan and A. R. Beg
...rest Institute, (PF1-B), plants collected from three localities in Chitral District were identified as Buxus microphylla Sieb. and Zucc. The plant was referred to Mr. I. C. Hedge of Edinburgh for confirmation who named it B. wallichiana Baill.var. microphylla Hook.f. The taxon represents a new record for Pakistan and is reported....
M. B. Bhatti, M. I. Sultani, M. Aslam and Ehtesham Ali Syed
... differed significantly, plants being taller under closer spacing, the variations in per-plant fresh weight were found insignificant....
Jehandar Shah and Zakaullah
...ticultural and medicinal plants....
Mahmood Iqbal Sheikh
...uantity of water for the plants. Acacia tortilis and A.victoria turned out to be the most outstanding exotic species and P. cineraria and T. undulate which are local to our deserts but never tried before gave very indicative results. These species should be propagated on a large scale for bringing back the desert vegetation for fuel, fodder and food....
Mohammad Bashir Khan, Pazir Gul, Muhammad Farooq and F. W. Khan
...ous products of the said plants....
Mahmood Iqbal Sheikh
... conditions affected the plants adversely. Some studies on spacing were laid out in the country in 1969 but the treatments were not properly replicated and distributed. To find a possible answer to these questions this PL-480 study was started in Change Manga irrigated plantation in February, 1976....
Qutabuddin Marwat and Naseer Ahmad Khan
..., including 15 medicinal plants and 11 grasses....
F. O. C. Nwonwu
...t and 50% fine sand. The plants were watered daily for four weeks and the height gains by plants measured. At the end of 4 week watering was stopped and two plants from mixes A and B were selected and observed for the length of survival without watering. Results showed that height gains due to weeks of watering and soil mix are both significant at the 1% level with LSD (0.01) of 6.9 cm and...
Zakaullah, Jehan Ara and Abdul Jabbar
...timber species, orchard plants, condiments, medicinal herbs and weeds. However, earlier workers (Ahmad 1956, 1956, 1978; Spaudling 1961; Sadiq and Shah 1986) have significantly contributed to the records of fungi and their hosts occurring in different regions of the country. The present article describes the fungi comprising 3 Classes: Ascomycetes, Basidiomycetes and Fungi Imperfect with information on habitat, locality and date of collection etc. Five ...
Qaisar Ali, Mohammad Yousaf Wazir and Mirza Hakim Khan
...ctylifera and fodder plants like Diplachne fusca and Juncus maritimus can be tried successfully in the area for land reclamation and range management....
Raja Walayat Hussain and M. I. Sheikh
... and one year old entire plants were transplanted at the above spacing in RCB design with four replications. First thinning was done in the crop in autumn of 1980 but it was rather on conservative side. The crop gave a congested appearance on visit in September 1984. Therefore second thinning was done giving a release to the left over plants to put up better growth....
Laskar M. Rehman and M. I. Sheikh
...d growth of a variety of plants and animals. Due to over exploitation and very little input for their perpetuation this erstwhile resource is fast disappearing. The present paper summarizes the mangroves of Pakistan, the area and distribution, flora and funa, management, utilization, and causes of degradation. Suggestions have also been made to improve the situation....
M.I. Sheikh
...eplications. Twenty five plants of each species were planted in a replication in each depth of planting at 2 x 2 metres spacing. The plants were planted at two depths i.e. 30 cm and 18 cm in the pits of 0.5 meter diameter...
M. I. Sheikh
...lterbelts. 9-month old plants of Eucalyptus camaldulensis in polythene tubes were planted in 3 rows comprising one belt, 2 m row to row and one m plant to plant distance, staggering plants in adjoining rows. In all 4 such belts spaced at 181 to 196 m and 630 in length were planted. The farmer has been planting wheat, cotton, maize and some other crops in-between the shelterbelts. The farm is canal irrigated. H...
M. I.Sultani, Akhtar Ali, M. S. Khan and M. A. A. Qureshi
...e....
Mahmood Iqbal Sheikh
... in February, 1978. 120 plants of each species were planted in 16 subplots at a spacing of 4 x 4 m. In each subplot, 30 plants were planted, 480 plants in all. Planting was done in a randomised complete block design in 4 replications. ...
M.I. Sheikh
...r, 2-year and 6-year old plants of some of the clones which are represented in the populetum and other experiments, established on the premises of Pakistan Forest Institute, Peshawar. Trees of P. euratnericana cv. 1-214, aged 10 years, were measured from Changa Manga plantation as old trees of this clone were not available in the Peshawar area. ...
Wali-ur-Rehman and M. Ismail Chaudhry
...rage....
M. Kamaluddin and M. K. Bhuiyan
...ndition. The survival of plants was 96%. At the age of 5 years the plants attained an average height of 11,54 m with an average diameter (dbh) of 11.64 cm. The yield of fuel wood including bark and branches was 139,1 t/ha 12% moisture content. The results show a good prospect in raising fuel wood plantation of the province in rural waste and marginal land on a rotation of 5 years....
Mohammad Noor
...he number of established plants among themselves except Festuca elatior (Kenwell) which had significantly more number of established plants as compared with other ecotypes/species. ...
Anjum Amin
... survey of ten medicinal plants was conducted in Leepa Valley of Jhelum Valley Forest Division in Azad Kashmir, during the year1978-79 to ascertain the productivity of medicinal plants available in the area. It was found that medicinal plants are available not only in considerable quantities for commercial exploitation but also it is imperative to initiate concerted efforts both by ...
Zakaullah, Mohammad Irfanul Haque and Khial Badshah
...tus was parasitizing the plants in the higher range and L. longiflorus in the lower range. They were found attacking 32 timber and fruit plant species some of which had been reported earlier L. longiflorus was more prevalent particularly on old trees of Acacia modesta, while L. pulverulenrus had comparatively low incidence. Only four host species were found commonly attacked by both parasites. For the rest of 28 species they were ho...
Salahuddin Ahmad
...he multifarious uses of plants, the one rather less appreciated and even neglected aspect is that the plants are the sole source of nectar and pollen for the bees and bee-keeping industry .We talk and dream no stalically about a land overflowing with milk and honey but practically do nothing to realise our ambition. Generally it does not pay to raise plants specially for the bees but we c...
M. I. Shiekh and S. H. Bangash
...n height and diameter of plants were recorded from 1978-82. The results did not reveal any significant differences in plant height and diameter. However, the nutrient uptake by the leaves of treated plants during the first vegetative growth period increased significantly....
Yasin J. Nasir
...sted as uncommon or rare plants for the area. The maximum numbers of uncommon or rare plants are to be found in the Poaceae (27), followed by Papilionaceae (10) and Orchidaceae (8). Information including the locality, the vernacular name and flowering period, where ever possible, are given for each taxon....
M.I. Sheikh
...e trees and 1 - year old plants of the following 15 clones transported from Pakistan Forest Institute, Peshawar were planted at a spacing of 4.5 x 4.5 m in 0.5 m deep pits. ...
Mohammad Shariq Khan, Altaf Ahmad and Anwar Ahmad Khan
... N0). Ephedra plants are a good remedy for curing bronchial asthma, cold, cough, urticaria, renal colic, itching, typhoid, hey fever and body pains. It can also be used as a tanning material for curing goats and lamb skins. This natural resource is exploited on large scale to the tune of 2.2 million kg. per annum for the manufacture of ephedrine which is exported to different countries of the world and is also used in the medicines prepared by the p...
Mahmood Iqbal Sheikh and Fazle Subhan
...method. Planting of Chir plants in polythene tubes was started in early seventies and it has now been adopted as the standard practice for artificial regeneration in all Chir pine areas of the country....
M.I. Sheikh, Bashir Hussain Shah and Abdul Aleem
...fect on the survival of plants. However, out of the lour treatments, plastic aprons were significantly effective in improving the growth rate of both the species; stone pitching and grass mulch had rather negative effect on growth. ...
M.I. Sheikh and Sultan Maqsood Khan
...erage height of survived plants. The irrigation frequencies had a differential effect on the biomass production of leucaenea and the height of trees but not on their survival percentage. Leucaenea leucocephala, had a much more survival, height and biomass than all other species. Robinia did not do well under low or no irrigation and Tecoma did as good without irrigation as with irrigation. Leucaenea and Tecoma can grow witho...
M.I. Sheikh and Abdul Aleem
...e growth of 16 year old plants and hence resistance to the disease but none of the three treatments had any effect on the younger plants. ...
M.I. Sheikh and Sultan Maqsood Khan
... conservation, medicinal plants, sericulture, wildlife and outdoor are also described. ...
M.I. Sheikh
... 1977. One year old tube plants of bamboo were planted at 2 x 2, 3 x 3 and 6x6 m spacing, replicated 3 times using 180, 84 and 24 plants in all the treatments respectively. In the first three years of the study, inter-cropping was done with maize, barseem and wheat. Afterwards it was not possible to do agriculture due to increase in the size of the bamboo clumps except in the 6x6 m spacing where it was continued for one more...
M.I. Sheikh
...f poplars. One year old plants of P. euramericana CV-I-214 were grown for four years with and without agricultural crops. In the control plots no agricultural crop was grown but nevertheless, soil cultivation was done.

2. In another study, weeds were allowed to grow in one set of plots while the second set was regularly ploughed. The average height and diameter after three years Were 5.85 m, 4.3 cm for the control plots, these were 7.71 and 5.6...

M.I. R. Khan
... late sixties to provide plants and seedlings for the plantation and afforestation projects which were started about the same time on the initiative and under the directives of H.H. Sheikh Zayed bin Sultan Al Nahyan, the Ruler of Abu Dhabi. Since then, with the expansion of plantation, agricultural and landscaping projects, the raising of various types of nursuries has made considerable progress both in the public and the private sectors. More recently, indo...
M.I. Sheikh
...he size and shape of the plants of mulberry and the number of branches is controlled and the size and quality of the leaves remains consistent and it is possible to estimate the annual quantity of leaf crop from a given area....
M.I. Sheikh and S. H. Bangash
...indication for the older plants. Higher dose of the fertilizers is recommended for future trials. ...
M. N. Malik and M.I. Sheikh
...icultural crops and tree plants. This menace of land was realized even long before the creation of Pakistan, and full-fledged Department of Land Reclamation was established to counter-check the malady; nevertheless, it attained alarming proportion and threatened the very basis of economy of Pakistan. Of course, vast physical outlays in the form of SCARP have been the outcome of very serious deliberations, even involving the expertise at international level; al...
M.I. Sheikh, B. H. Shah and A. Aleem
...at in deep planting 64% plants of all species survived and in shallow planting 54%. In both depths maximum survival was of A. tortilis being 75% followed by 58% of T.undulata and 44% of A.aneura. In deep planting the average height of plants was 76 cm and in shallow planting it was 60 cm. A. tortilis showed better rate of growth as the average height gained by the p...
Mahmood Iqbal Sheikh
...an old bed. One year old plants of 3 species viz. Acacia victoriae, Acacia aneura (Australia) and A. tortilis (Sudan) were planted in August 1979. One hand watering was given at the time of planting. 16 plants of each species were planted in one plot at 2 x 2 m, in 5 replications; 80 plants each of the three species, 240 plants in all. The ...
Mahmood Iqbal Sheikh and Raza-ul-Haq
...shawar on 13-2-1978. 120 plants of each species were planted in 16 sub-plots at a spacing of 4 x 4 m. In each sub-plot a randomised complete block design, replicated 4 times....
Malik Mohammad Khan
...of the most fast growing plants. It has 1250 kinds ranging from the small-sized bamboo to the very thick one generally being used for shuttering in the multi-storeyed buildings. Its quick growth, lightness in weight and flexibility are the few prominent characteristics that make the bamboo sticks unique in their nature....
Mahmood Iqbal Sheikh
...ent No. 55. One year old plants were planted at 5 x 5 m spacing. Their performance was evaluated in 1981 and the ten clones were found to be the best amongst all clones....
Adil Al-Kinany
...s exchange level of transplants was found to be of the same magnitude in different treatments....
Sarfaraz Hussain Bangash and Mahmood Iqbal Sheikh
...One year old healthy plants of Pinus roxburghii (Bazkhan Seed source) grown in polythene tubes (7.5 x 18 cm) filled with 50:50 sand-soil mixture, were arranged for this study. Initial height of plants was recorded. The fertilizers were added in a water solution, 50 ml to each tube, on 1-5-1979:...
Mahmood Iqbal Sheikh
...tudies one year old tube plants were used. Planting was done just after rain....
Hanif Gul and M. Ismail Chaudhry
...sa attacking nursery plants. Baylucid gave 75% and 100% mortality in 0.05% and 0.1% concentration respectively, 72 hours after treatments while Barestan gave 70% and 80% mortality in 0.1% and concentrations as against a natural mortality of 23% to 33%. Nogas and Sodium Chloride were less effective....
G. M. Khattak and M. I. Sheikh
....3 m spacing with entire plants of poplar and Eucalyptus and root-shoot cuttings of shisham and semal.

On 22-10-1979 the area was irrigated to prepare it for wheat sowing. On 5-11-1979 Pavan variety of wheat was sown in drills 45 cm apart between the lines of trees. The drill next to the line of trees was 80 cm away from it. Seed rate was 135 kg/ha. Urea was applied on 4-12-1979 at the rate of 230 kg/ha. Two irrigations of 10 cm depth each were giv...

Mahmood Iqbal Sheikh
...raight stemmed healthy plants for getting seed and clonal material for large scale propagation...
G. M. Baloch and M. A. Ghani
...ffect a wide variety of plants, some economically important. Loranthus spp. infest about 274 hosts which include citrus, limes, tea. rubber, fruit, forage, park and many other broad-leaved trees (Mushtaque and Baloch, 1979). The dwarf mistletoes, Arceuthobium spp., attack coniferous forest trees (e.g., pines, fir, spruce, junipers, larch) while Viscuni spp. infest deciduous trees in parks, boulevard plantings, natural forests and orchards ...
Khial Badshah and Zakaullah
...sariosis) in basil. The plants in the nursery were found severely attacked by a species of Fusarium causing longitudinal stripes on the stem and chlorotic spots on leaves which wilt and fall prematuiely. The pathogen was found to invade the plants through injured roots. Plant debris, infected young transplanting mateiial and seeds served as source of infection. The pathogen proved specific to Ocimum
Mahmood Iqbal Sheikh
...poration or seepage, the plants are supplied with a quantity just sufficient for their survival and growth....
Wali-ur-Rehman and M. Ismail Chaudhry
...in each height groups of plants. Terracur gave 100%mortality of nymphs in 10-20 days only in the smaller plants. Disyston rated 3rd by giving 96%mortality of nymphs only in highest dose and smaller plants. Disyston other insecticides other insecticides showed no effect against the pest. In check all nymphs survived but 1-6%adults were found dead after a month. ...
Mahmood Iqbal Sheikh
...a nutritious fodder. The plants in the first instance were raised in Silvicultural Research Nursery, Lahore and planted in different climatic zones in the country. The sites include Bhurban in Murree hills, Islamabad, Peshawar, Changa Manga etc. The plant seems to have responded well to its new environment with luxuriant growth producing abundant seed and good natural regeneration at favourable site (deep sandy loam, 1000 mm rain or irrigation)....
Munawar Ashfaq and Anwar Ahmad Khan
...ddish brown rhizome. The plants occur in the hilly areas of Swat, Dir, Hazara, Kaghan, Murree Hills, Chitral, Kurram Agency and Azad Kashmir....
Mahmood Iqbal Sheikh
... increasing demand for plants of chinar, an effort has been made to raise the plants from seed. The fruit which ripens in December is a globose head 2.5 to 7.5 cm in diameter, consisting of numerous one seeded achenes densely covered at the base with long fine hair. Nursery has been raised at two different localities Peshawar and Abbottabad....
K. M. Siddiqui
...eeding because most crop plants are raised for their seed and heavy and regular seed production is taken for granted. Most trees however, are not grown for their seed, and many trees that otherwise have desirable characteristics, seed only occasionally or not at all. Then fore, a tree breeder is concerned with seed production. Considerable research is underway in almost all countries on the stimulation of flowering and fruiting of trees (Wright, 1976...
Mohammad Noor
...ference in the number of plants of species established did not show any significance. ...
Mahmood Iqbal Sheikh and M. Ismail Chaudhry
...r by importing grafted plants from France, Italy, Spain and Turkey or by budding or top working on the indigenous wild olive (Olea cuspidata). The history of these attempts carried out in the Punjab, Azad Kashmir and N.W.F.P. has been well documented by Chopra (1), Khan (3) and Chaudhry (2). Khairimurat Plantation: Of all the work done, the most productive effort has so far been the Khairimurat plantation, a 20 hectare piece of land 56 km south wes...
Islam Mahmud Khan, Gulzar Ahmad Khan and Shoukat Islam
...e also conducted. ...
Anwar Ahmad Khan, Munawar Sultana and Shakeel Haider Zaidi
...a higher total number of plants. At Dungagali July planting gave significantly higher sprouts on 25th August, 1977 as compared to November planting. Indole acetic acid treatment did not significantly increase sprouting....
Musarrat Nasreen Ali and Anwar Ahmad Khan
... and violet berries. The plants are distributed throughout the hilly areas of Pakistan, from Baluchistan to Dir, Chitral, Gilgit, Hazara, Murree and Azad Kashmir at an elevation of 900-3,000 metres (4)....
Raja Walayat Hussain
...ex relationships between plants and their environment and for the simulation of biological and economic situations. In forest management it finds its use in financial control of forest operations, for estimating and controlling forest production, for allocation of resources and for planning and control of new planting programs. In information management it finds its application in maintaining upto- date records of long range experiments and files of employees...
Ashiq Ahmad and M. Ismail Chaudhry
...ts and bark of succulent plants, agricultural crops and perennial grasses. Trees are debarked, young plants and shisham stumps are uprooted. They breed twice a year and usually give birth to tow young ones who live initially in mother's milk switching to tender barks 2-3 months later. ...
Islam Mahmud Khan, Shaukat Islam and Qaisar Ali
...es from 31% to 0% in the plants growing in the similar environmental conditions. The point of attachment and the T.S. of the gynophores and ovary are given. The probable mode of inheritance is also discussed. ...
Mohammad Shahid and Abdul Qayyum
...tar and pollen yielding plants for honey-bees. A detailed list of 122 such plants both wild and cultivated, their scientific names, time of blossom and their distribution in the Province has been prepared. Of the 122 bee-foraging plants, the shisham (Dalbergia sissoo), phulai (Acacia modesta), bhaikar (Adhatoda vasica), apple (Malus sylvestris ), loquat (...
Abdul Aleem
... Feeding habits and food plants preferred by the animal were observed and the results of the analysis for nutritional contents of food plants have been reported. ...
Islam Mahmood Khan Dr.
...eny of the X-ray treated plants a haploid was discovered which was then made diploid by treating it with colchicines. The pollen mother cells in the auto diploid petunia showed a remarkable shape with continuous cytoplasm and without partition walls. The chromosomes were scattered in lots of different sizes. These pollen grains resembled the synocytes described by Levan 1914. ...
Anwar Ahmad Khan and Altaf Ahmad
...>Importance of medicinal plants and their use as a remedy of certain diseases was known to human beings from times immemorial. Knowledge of medicinal plants lead to its logical conclusion, that is, gradual evolution of science of Taxonomy. In the present age because of synthetic products some of the medicinal plants have lost their old value but still a considerable number of drugs menti...
Miss Munawar Sultana and Anwar Ahmad Khan
... with a fetid smell. The plants are commonly distributed in Karachi, Sind, North Waziristan, Khyber and Kurram Agencies, Dir, Chitral, Swat, Lower Hazara, Rawalpindi and Jhelum district upto an elevation of 1200 meters (3).
The plant is much valued for its powerful expectorant and anti-spasmodic properties. Leaves are used in asthma, chronic bronchitis and all kinds of coughs. The powdered leaves are used in malarial fevers, dysentery and diarrhoea. ...
M.I. Sheikh, Abdul Aleem and Mohammad Hafiz
...nsignificant survival of plants.
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type of plastic was mere durable....
Mohammad Hafeez
...nsignificant survival of plants.
2. Better rate of growth with aprons.
3. Significant effect on height by the material and colour of aprons.
4. Light resistant type plastic was more durable. ...
Abdul Aziz Khan and M. N. Malik
...i>Dalbergia sissoo) plants are well acclimatized to the climatic and edaphic conditions generally prevailing in the plains of West Pakistan, where they normally exhibit vigorous growth and, comparatively, do not require much care after germination....
M. Hafeez and M. I. Sheikh
...ttings as well as entire plants exposing them to a number of treatments such as time of planting, different rooting media, frequency of irrigation and position of cutting on the plant etc. and using clones like P. deltoids 63/51, 90/60, 69/55 and 18/62, P. euramericana CV-I-214 being the control. Indications in both the cases were that supported by adequate winter rains or artificial irrigation and an efficient planting schedule,...
Mohammad Amin Siddiqi
...sub-continent. These two plants belong to a very small genus Emex australis with only two species, of the family Polygonaceae. One of the species is Entex australis and the other is Emex spinosus. The first one is native of Cape of Good Hope, South Africa and the second one comes from N. Africa and the Mediterranean coastal regions. It is a strange coincidence that both the species have been found growing not far from each other. E. aus...
Zaka-Ullah
...phytotic form on nursery plants. Absence of large scale and compact plantations of Willows seemed to be a limiting factor in the appearance of few other pathogens in epiphytotic forms. No bacterial or virus disease was observed....

Abdul Aleem Memon1*, Inayatullah Rajpar2, Ghulam Murtaza Jamro2, Javaid Ahmed Shah3 and Saima Kalsoom Babar2

...or field-grown sunflower plants. Among interaction of Kfs x Kft, seed and oil yields were obtained to be highest in T3 when NoP>SoP>MoP were sprayed with 0.67% spray each at LDS, IES and FS stage. It can be concluded that under the calcareous conditions of Sindh, foliar application of 2% K (2 or 3 equal splits at LDS, IES and FS) through NoP, SoP, and MoP sources increase the growth, seed and oil content of sunflower.

...

Rafiullah1, Said Sajjad Ali Shah1*, Muhammad Ilyas Khan2, Anwar Ali3, Imtiaz Ali Shah1 and  Sohaib ul Hassan4

... feeding of indigoferous plants by camels.

...

Mohammad Umar* and Gohar Ayub

...rs of broccoli. Broccoli plants irrigated early in the morning resulted in early curd formation (66.8), maximum plant height (45.21cm), leaves plant-1 (15.84), leaf weight (11.00 g), primary curd weight (340.94 g), secondary curd weight (189.50 g), primary curd diameter (8.60), secondary curd diameter (7.56cm), curds plant-1 (8.73), yield (8.03 t ha-1) and survival (92.67 %) than rest of the treatments. As for as irrigation level is concerned, irrigation at 35...
Javairia Mehboob1, Syeda Hafsa Ali1*, Fahima Ashraf Kasi1, Syeda Ayesha Ali2, Safa
Farooqi3, Muneeza Arbab4,
...at the three
plants have versatile biochemical molecules responsible for wide range of AgNP and its
activity against bacterial and fungal strains. Studies on combined use of AgNPs with other
antimicrobial agents may solve the problem of toxicity and possible risk of drug resistance.
...

Maqsood Anwar, Shah Khalid and Naveed Akhtar1*

...d that a variety of weed plants
infest wheat crop in the study area that may cause a loss to crop yield. For acquiring better
yield, it is necessary to take the appropriate chemical, mechanical and biological
measurements for weed control.
...
Muhammad Naeem Korejo1*, Muhammad Nawaz Kandhro1, Aijaz Ahmed Soomro1 and Niaz
Ahmed Wahocho2
...mbination of
plants extracts and herbicides at reduced doses controlled weeds efficiently and optimum
enhancement in seed yield of mungbean was noticed at three irrigations.
...
Rizwan Maqbool1, Bilal Ahmad Khan*2, Sumbal Parvez3, Muhammad Ather Nadeem2,
Muhammad Mughees Ud Din4, Jamshaid Qamar2, Muhammad Waqas1, Muhammad Mohsin
Amin2, Burhan Khalid1
Abdul Basit1, Ayesha Zahid1, Syed Tanveer Shah1, Inayat Ullah2, Sana Ullah3*, Muhammad
Kashif Nawaz4, Muhammad Areeb Khalid1, Izhar Ullah5, Fawad Ali1, Shaukat Ali1
...study revealed that okra plants
sown on the ridges recorded maximum germination percentage (96.9%), fruit weight
(22.41g), pod length (14.44 cm), seed pod-1 (48), 100 seed weight (6.41 g), seed yield
(102.2 kg ha-1) and fresh yield (0.165 tons ha-1). Data regarding number of picking intervals
showed that maximum germination percentage (92.7%), fruit weight (20.97 g), pod length
(12.25 cm), seed yield ...

Abdul Basit1 and 2Sana Ullah*

...s i.e. identification of plants, total area of nurseries, soil type, irrigation system,
weeding, fertilizer application, propagation method, propagation time, transplanting time,
field situation and finally problems of the nurseries were studied. All the agricultural and
horticultural practices were not fully applied and practiced in proper recommended way. Out
of the total studied parameters, irrigation system t...

Rizwan Maqbool1, Bilal Ahmad Khan2*, Muhammad Ather Nadeem2, Sumbal Parvez3, Muhammad Mohsin Amin2, Jamshahid Qamar2, Azhar Hassan1, Muhammd Alam Elahi1, Jamshed Haider1, Muhammad Irfan4 and Memuna Ghafoor Shahid5

...xt-align: justify;">Crop plants release biochemicals into surrounding environment that help in obtaining maximum yield of crop by acting as bioherbicide at high concentration and plant growth hormone at low concentration. Therefore, this study was planned at the Department of Agronomy in Weed Science Laboratory, University of Agriculture Faisalabad during Winter season of 2018 to evaluate the hermetic effects of Cinnamomum verum (Dalchini) on vegetable crop ra...

Zara Naeem1, Khajista Jabeen1*, Muhammad Khalid Saeed2, Sumera Iqbal1

...of various infections in plants and their post-harvest produce that pose a serious threat to humans and animals. In the current study, the objective was to examine the in vitro efficacy of different concentrations of methanolic leaf extract of Sorghum halepense (L.) Pers. against target pathogenic mycotoxin producing fungal species (Trichoderma viride Pers., Trichoderma harzianum Rifai. and Cladosporium cladosporioides (Fresen.) G.A. de Vries. For this purpose...

Siti Fatonah*, Herman and Dewi Yuni Safitri

...itratus are fast-growing plants, easy to find and contain various secondary metabolites. Therefore, these two types of plants can be used as an alternative bioherbicide for weed control. This study aims to determine the effect of aqueous extracts from fresh leaves of C. citratus, M. bracteata and a mixture of both on the germination and growth of Paspalum conjugatum and Borreria alata weeds.Treatments consisted of extracts o...

Hafiz Ishtiaq Ahmad1, Jinlong Zhang1, Fuxun Luo1, Owais Iqbal2 and Yuying Wang1*

...olid culture medium. The plants were subjected to various LED spectra for a duration of 14 hours each day and continuous subsequent 100 days. The experiment was completely randomized design with nine treatments and each treatment have ten replications. The SPSS statistics software was used to analyses experimental data. In addition, the result of the current study revealed that the plant height, leaf length, leaf width and root number were significantly increa...

Muti Ul Hannan1, Wazir Ahmed1, Muhammad Naeem Akhtar2*, Muhammad Baqir Hussain1 and Khuram Mubeen1

...ffects of heat stress on plants. Based on past studies, the objective of the study was to integrate pre-tested compost, SA, Zn-Fe-B consortia and foliar K with conventional fertilizers for ameliorating detrimental effects of heat stress on morphological and fiber characteristics of cotton. During study, salicylic acid based Fe, Zn, B consortia (S-N consortia), foliar potassium (K) and compost were used in different combinations along with conventionally used f...
Nazish Huma Khan1*, Mohammad Nafees2, Tooba Saeed3, Sarzamin Khan1, Hazrat Hussain4, Adila Bashir2 and Nida Naz1
...ucture projects of power plants, dams, and highways. For such developmental activities, the role of the crushing unit is tremendous in providing the basic raw material for infrastructure. The literature revealed that the majority of stone-crushing units are operating illegally as 567 units have been declared hazardous to health and safety in the Peshawar region. Due to the lack of safety measures, workers involved in stone crushers were exposed to significant ...

Saddam Hussain1, Muhammad Asrar2*, Usama Saleem2, Dilbar Hussain3, Muhammad Sohail Qadir3, Muhammad Saleem3, Rashid Ali2, Zeeshan Javed2 and Mubshar Saleem4

...nd above-ground parts of plants. They bite and chew on tubers, young and old leaves, stems, lower branches of the plants, and peanut seeds. Termite infestation is a considerable problem in the livelihood of the farmers of Pakistan. Termite swarming is a major problem and revenue constraint in the area, destroying crops in the field and store. Forests and orchards are rarely termites free, particularly when conditions are fav...
Cristian Mendoza1*, Adriana Celi-Soto2, Ernesto Cañarte3 and George Cedeño-García2
...ferent parts of oil palm plants on controlling root borer (S. valida) in the interspecific oil palm hybrid OxG. The study was conducted at the Palesema plantation, situated in Mataje Parish, San Lorenzo Canton, Esmeraldas Province, Ecuador, located at 1°17’18” N and 78°50’13” E and 100 m above sea level. 10-year plants from the OxG Coari x La Mé hybrid were used in the study. Par...

Shoaib Zawar1, Muhammad Waqas Yonas1,2*, Muhammad Mujahid Akbar1 and Abeer Ahmad1

...s due to its ability for plants to maintain optimum density per unit area, reduced intraspecific competition, and enhanced grain formation, leading to higher grain yield (5562.38 kg ha-1 in 2020-21 and 5220.22 kg ha-1 in 2021-22). Adapting an appropriate sowing method is crucial to maximize wheat production which has been proved in the augmented furrow method over a broadcast and/or the usual drill sowing methods. The relatively better performance of augmented...

Wadood Shah* and Sanam Zarif Satti

...and growth, responses of plants to various levels of drought stress as well as their ability to regulate and alleviate the negative consequences of low water availability. Meeting the world’s population’s continual increase in food consumption is hampered significantly by drought stress. Plants adjust their cellular osmotic potential and water potential in response to stressors, by increasing root length, closing...

Noorullah Khan1, Shahid Ali1, Azher Zeb2, M. Noman1, M. Imran Kasana1, Rashid Iqbal Khan1*, Saima Mumtaz1, Shumaila Rasheed1, M. Muneer3 and M. Qamar-Uz-Zaman1

...three replication and 10 plants per replication. Data were recorded on plant survival rate (PSR %), bud sprouting rate (BSR %), shoot length (SL cm), shoot diameter (SD cm) and number of leaves per plant (NLP). The outcomes exhibited that peach scion cvs., “Coronet” and Early Maria Delizia exhibited the maximum plant survival rate (97.67 and 97.33%) and maximum bud sprouting rate (96.0 and 97.0), respectively. On the contrary, the highest shoot len...

Muhammad Wasif Gulzar*1, Riffat Maqsood1, Hussain Abbas1, Musharraf Manzoor1, Muhammad Suleman1, Hassaan Ahmad Bajwa2, Ali Hamza2, Shaher Yar1, Muhammad Zain1, Abdul Wadood1 and Noman Aslam3

...aterials can be found in plants, soil, water, air, food, and feed. Through the food chain, their residues build in humans and animals after entering plants and animal products.They destroy useful species in the ecosystem and put our lives and health in peril. This review highlights the current standing of the impact of insecticides on viral diseases in man and animals. We observed that in addition to their surroundings, peop...

Asad Ali, Anwar Ali, Muhammad Farooq and Basheer Ahmad* 

...tare was estimated at 75 plants in pits and trenches at the plantation, with a composition of 70% Prosopis juliflora, 19% Zizyphus nummularia, and 7% Phoenix. The study identified established regeneration, while unestablished regeneration (below 9 inches) was not observed. The data showed an average survival rate of 93% in both subdivisions (Teri and Karak) of the Kohat forest division, with Karak Forest Subdivision recording a 92% survival rate and Teri Fores...

Nask Jawher Ahmed and Kawa A. Ali*

...ith better adaptation of plants exhibiting drought at flowering and seed development in the plant life cycle.

...

Aysha Fatima1, Safdar Ali1, Saira Azmat2, Luqman Amrao1, Muhammad Usman Ghani3*, Yasir Iftikhar4, Muhammad Ahmad Zeshan4*, Adeel Ahmad5 and Humaira Kalsoom6

... management purpose. The plants were treated with zinc sulphate (ZnSO4), copper sulphate (CuSO4), manganese sulphate (MnSO4) and boric acid were used in different combinations i.e., T1 (ZnSO4+CuSO4), T2 (MnSO4+CuSO4), T3 (boric acid+CuSO4) and T4 (ZnSO4+MnSO4+CuSO4+BA). The combination of ZnSO4+MnSO4+CuSO4+BA showed minimum disease severity (5.85%) and disease incidence (23.15%) as compared to control (28.59%). The outcomes of present study would be the way fo...

Efi Rokana1, Iin Rohmatul Fatimah1, Brilian Desca Dianingtyas1, Niswatin Hasanah2, Wulandari3, Zein Ahmad Baihaqi1,3* 

...rs: elephant grass, corn plants, and rice straw. Employing a completely randomized design (CRD) with three treatments and nine replications, the research examined dry matter intake, body weight gain, feed efficiency, and income over feed cost (IOFC). Results indicated that feeding with different types of forage did not significantly impact dry matter intake (P>0.05) but significantly affected body weight gain, feed conversion, feed efficiency (P<0.05), a...
Iswahyudi Iswahyudi1,2, Wahyu Widodo1*, Warkoyo Warkoyo1, Roy Hendroko Setyobudi3, Damat Damat1
Dyah Roeswitawati1, Shazma Anwar4, Thontowi Djauhari Nur Subchi1, Irma Rahmaita Utarid5,  Marchel Putra Garfansa2, Mohammad Shoimus Sholeh2, Ida Ekawati6, Rusli Tonda7,  Wahyu Alvina Mujianti2, Dody Sukma RA8, Sri Utami Lestari8 and Choirul Anam9
...act global attention. On plants, MPs have detrimental effects such as interfering with nutrient absorption, slowing germination and roots development. Of all the stages of growth, seeding has an important role in the crop yields obtained. The examined the impact of three polymer MPs (1 % w w–1) on paddy seeding and control as a comparison with four repetitions by using soil culture experiment for 20 d. Plant height, leaf length, root length, f...

Arba Aleem, Norrizah Jaafar Sidik*, Wan Razarinah Wan, Abdul Razak and Norfatimah Mohamed Yunus

...oot exudates secreted by plants roots can attract beneficial microbes that help plants by boosting nutrient intake and improving plant growth. Sustainable agriculture and ecosystem management potentially benefit from an understanding of the mechanisms and purposes of root exudates under biotic and abiotic conditions. Harnessing the potential of plant-microbe interactions enables the infrastructure development for more effect...

Murad Muhammad1,2,3*, Shahid Ullah1, Nimrah Ameen4, Abdul Wahab3,5, Abdul Basit6, Muqadas Batool7, Muhammad Nazim2,3 and Haroon Khan

...htunkhwa. Many medicinal plants grow wild or as weeds worldwide, including in Pakistan. The Dir Upper district boasts a diverse weed flora with significant medicinal value for daily use. Surveys using semi-structured open-ended questionnaires were carried out in distant villages of the Larjam subdivisions, specifically interviewing 120 local respondents (85 males, including herbalists and pansiris, and 35 women) regarding the naturally occurring medicinal weed...

Marriyam Batool1*, Ahmed Zia2, Shabir Ahmed1, Imran Bodlah3, Waheed Ali Panhwar4, Muhammad Ashfaque5, Falak Naz6 and Muhammad Muneer5

...ltivated as well as wild plants grown at variable altitudes of the valley. A total of 398 individuals were collected from 26 host plants of which, 23 species and 13 genera are reported for the first time for this valley. Within the recorded fauna, Macrosiphum euphorbiae was found to be abundant with 103 individuals followed by Myzus persicae and Aphis craccivora, respectively. Impact of altitudinal variations over the distri...

Daniel Offiong Etim1*, Etim Johnson Umana1, Idorenyin Asukwo Udo2, Ndarake Eden Ini-Ibehe1

...trol. Two weeks old okra plants were inoculated with 5,000 larvae of M. incognita and one gram of S. rolfsii (3 Sclerotia g-3) in a heat sterilized soil. The obtained results showed highly susceptibility of okra to M. incognita and S. rolfsii infection without neem cake and Trichoderma species infestation. Amendment of soil with neem cake at 4.00t/ha in combination with T. viride significantly (P≤0.05) reduced root galling, nematode population and nematode ...

Marwa M. El-Deriny1,2*, Rania H. Wahdan1, Marwa S. Fouad3 and Dina S.S. Ibrahim1,2*

...ct various horticultural plants, including eggplants (Solanum melongena, L) and cause destructive loss in crop yield production. The purpose of this study was to evaluate the impact of individual or concomitant treatments with Trichoderma viride and some plant growth promoting rhizobacteria (PGPR) on root knot nematode in eggplant.In greenhouse, a standard microbial fertilizer (NPK) and four microbial isolates involved Pseud...

Malik Muhammad Yousaf1*, Abou Bakar Siddique1*, M. Jahangir Shah1, Mumtaz Hussain1, Bashir Ahmad1, M. Bilal Zafar1, Maryam Hayat1, Shamsa Rasool1, Zainulabdeen1, Muhammad Mohsin Raza3, Malik Ibrar Yousaf2 and Usman Majeed1

...nal and modern medicinal plants due to its pharmacological properties and placed in leading medicinal crop in worldwide. Research plot was located at Bahawalpur divisions at different location under (Pakistan Agriculture Research Council PARC), Arid Zone Research Institute in two crop seasons 2022-2023. Five different germplasm were used for the study 21213, 21474, 20617, 21260 and 21988. The study was carried out to calculate the effects of chemical plant fer...

Noor Rahmawati*, Dea Indriani Astuti and Pingkan Aditiwati

...ic exchange between host plants and endophytes, endophytic fungi can produce the same secondary metabolites as their host plants. Numerous research on the bioactive elements of secondary metabolites from endophytic microorganisms, particularly endophytic fungi, have been undertaken on plants that are able to produce secondary metabolites with unique properties. When tested using the DPPH r...

Gunel Arzuman Ramazanova1, Gulnara Fakhreddin Abbasova2*, Khalsa Ibrahim Nasibova3 and Sait Engindeniz4

... order to infect healthy plants, samples infected with blister smut disease collected from the maize cultivated areas of the Garadagli village and brought to the Plant Diseases Diagnostics of Azerbaijan State Agrarian University, transferred to artificial nutrient medium and multiplied. In the study, the intensity of spread of the disease, disease severity index and yield losses were determined according to years and varieties. In addition, income losses cause...

Masoumeh Hosseynikhah 

...mulation of potassium by plants. In addition, plant weight, 100 seed weight, relative water content, chlorophyll content and photosynthesis were also affected by different levels of NaCl. However, the external application of silicon and potassium nitrate decreased sodium absorption, increased potassium, and as a result improved plant weight, 100-seed weight, seed yield, cob length, and photosynthesis rate. This study showed that the use of a salt-tolerant cult...

Junaid Khan* and Muhammad Sajid

...ustify;">The guava fruit plants produce heavy fruit yield during summer season but these plants then produce very little fruit yield during winter season due to low carbohydrates. To increase guava fruit production during winter season, this experiment ‘effect of nitrogen doses (0, 75, 150 and 225 kg ha-1) and timing (September, October and November) on fruit quality of guava in winter’ was conducted at farmer fi...

Muhammad Iqbal1*, Saba Iqbal1, Asmat Ullah2, Arbab Jahangeer1, Naveed Akhtar3, Tahira Tabassum3, Ali Zohaib3, Naveed Ramzan3

...ered in the root zone of plants causing ionic and osmotic disproportion. However, by way of a superior field-management opportunity, buildup of soluble salts in rhizosphere can be managed by applying soil mulching which reduces water evaporation from soil hence limits upward movement of salts. Moreover, it also reserves soil moisture, increases utilizing efficiencies of nutrient and water hence improves crop yield. Critical research gaps exist in understanding...
Shruti Yadav1,2*, Kamana Singh2, Pratap Adinath Divekar3 and Suhas Gorakh Karkute1,3*
...ingle copy insertions in plants of six independent transgenic events. Cry2Aa gene was highly expressed in transgenic plants and its protein level was as high as 30.94 µg/g in fresh leaves and 20.57µg/g in fruits. Insect bioassay showed the BSFB larval mortality between 90% to 100%. Altogether it was observed that expression of the Cry2Aa protein in the shoots and fruit of transgenic brinjal lead to high BSFB larv...

Sairah Syed1, Rafia Urooj Saman1, Ayesha Manzoor1, Muhammad Arsalan1, Abdul Latif1*, Madeeha Khan1, Rehmat Ullah2, Muhamad Bilal2, Rizwan Latif3, Ejaz Ahmad4, Muhammad Amjad1, Muhammad Aslam5, Sair Sarwar6, Sabir Hussain Shah7 and Amaima Masood8

... the growth and yield of plants are well studied. However, studies related to its utilization and effect in combination with reduced chemical fertilizers on plant growth are still limited. Therefore, this experiment was conducted to evaluate the effect of varying levels of VC (0 and 2.5 tons/ha) and NPK (60:80:60 kg/ha or RDF, 75% RDF, 50% RDF, 25% RDF) fertilizers on the growth and yield of spinach, peas, and radish. In a Randomly Complete Block Design (RCBD)...

Catur Suci Purwati1, Chusnul Hanim2*, Lies Mira Yusiati2, Budi Prasetyo Widyobroto3

...te derived from cinnamon plants. This research aimed to investigate effect of cinnamon powder on protein balance, and blood profile of etawah crossbreed goats. A total of 15 goats with an average initial body weight of 15 - 23 kg and age 8 - 12 months, were used in the study with completely randomised design (CRD) consisting of three treatments and six replications. The three treatments tested were as follows: A: without adding cinnamon powder (0 g/kg feed DM)...

Yusra Karim1, Munawar Saleem Ahmad1, Javed Khan2, Imtiaz Khan3*, Said Hussain Shah2, Syeda Anika Shamsher4, Imran Qazi5, Habib-Ur-Rehman Kakar6 and Wajih Ullah7 

...to contain the vegetable plants in a small field. B. thuringiensis with active CRY1F was cultivated in Luria-Bertani (LB) media under controlled laboratory conditions. The goal was to maximize colony growth for the preparation of spore/crystal mixtures at various concentrations. The larvae of S. litura and H. armigera   were reared in a laboratory under control. Following tests, the LC50 (96-hours) of the CRY1F protein-crystal mixture against lepidop...

Bilal Ahmed Qazi, Nowsherwan Zarif, Anwar Ali*, Faizan Ahmed, Asim Karim and Ali Nawaz 

... of soil moisture to the plants for a longer period to enhance survival and growth. Various water harvesting techniques such as mud plaster, conservation contour trenches, V-shaped micro-catchments, hillside ditches, roaded catchments, water spreading, and individual basins were investigated to determine their efficiency and effectiveness. Deep planting and plastic mulching were extensively used for this purpose. Several multipurpose tree species were recommen...

Muhammad Shahid Hassan1, Nargis Naz2, Hassan Raza Javeed1*, Sabahat Zafar1, Laraib Kanwal1, Seerat Mariyum1, Areej Fatima1, Areeba Bashir1 and Muhammad Imran Atta3

...Weeds compete with wheat plants for essential resources (nutrients, light, space, and gases) and ultimately reduce yield. The current study was conducted during 2021 – 2022 in the wheat fields of three tehsils of district Layyah to investigate the weed biodiversity. Weeds biodiversity data was recorded by a random quadrate sampling method using the quadrate of 5 m2. Phyto-sociological attributes such as density, frequency, cover, relative density, relati...

Muhammad Ehsan Safdar1*, Muhammad Sikander Hayyat, Muhammad Zeshan Maajid, Mubashar Nadeem and Amjed Ali

...C. arvensis density of 8 plants per m2. Whereas number of grain spike-1 and 1000-grain weight of wheat were prone to substantial reduction at and above 4 and 12 C. arvensis plants m-2, respectively. Losses of grain yield of wheat ranged between 10 to 28% under the influence of C. arvensis density between 8 to 20 plants per m2. Economic threshold of C. arvensis as estimated by prediction mo...

Fasih Ullah Haider1,2, Sardar Alam Cheema1and Muhammad Farooq1,3

...ion. Cover crops are the plants grown inn field in such a way that these plants give soil cover despite it may be incorporated in field or not and also facilities weed suppression, control soil erosion, improve soil fertility and also manage diseases and pests present in that field. Cover crops normally comprise of legumes and grasses. Cover crops lead to be one of the better options that reduce the dose of herbicides and th...

Umm-e-Kulsoom1, Saima Hashim2, Fazli Wahid3, Haseena Gulzar4 and Tamana Bakht5

... of these species (donor plants) were collected and stored. After drying, the plant materials were grinded. The powder of each species and each part were soaked separately at 100 g per liter and 150 g per liter to get two different aqueous extracts. The objectives of the studies were to investigate the allelopathic effect of extracts of different parts of donor species on weed seed germination and growth of potato. Weed seed germination test was conducted in p...

Iqtidar Hussain1*, Mohammad Safdar Baloch, Ejaz Ahmad Khan and Asghar Ali Khan

...xtracts of ten different plants viz., neem (Azadirachta indica L.), eucalyptus (Eucalyptus camaldulensis L.), tobacco (Nicotiana tobacum L.), Indian lilac (Melia azadirach L.), acacia (Acacia nilotica L.), poplar (Populous deltoids L.), sunflower (Helianthus annuus L.), jaman (Syzygium cumini L.) and karir (Capparis decidua L.) were used in this study along with distilled water (control). Tobacco and sunflower extracts were prepared by grinding the mature harv...

Gul Hassan, Anees Amin, Haroon ur Rashid, Naqib Ullah Khan and Hussain Ali1

...olled environment. Fresh plants of Parthenium and berseem were collected before flowering stage, chopped into about 1 cm pieces, dried and then incorporated into soil 30 days before planting. The treatments included NPK at recommended dose alone and NPK + 1, 2, 3 and 4% dried parthenium (w/w of soil). For comparison, treatments like dried berseem 2% (w/w) and untreated (0 NPK and 0 Parthenium or berseem); were also employed. The experiments were replicated fou...

Muhammad Farooq* and Sanam Zarif

...eign species of vascular plants that are found in Pakistan. These include high-impact invaders such as Broussonetia papyrifera, Prosopis juliflora, Parthenium hysterophorus, and Lantana camara. In Pakistan, invasive plants have significant negative effects on ecosystems and local flora displacement. For instance, the allelopathic effects of Eucalyptus camaldulensis have adversely affected the growth of grass and bushes in th...

Saima Maher1*, Salma javed2*, Gul mina1, Rizwana Salam1, Farah Mukhttar1, Noureen Khan3 and Fakhra Batool3 

... Six Pakistani medicinal plants, from which five different extracts methanol, ethanol, ethyl acetate, hexane, and chloroform were prepared from various plant. Preliminary phytochemical analysis of these extracts revealed the existence of main phytochemical constitutes, including alkaloids, glycosides, flavonoids, tannins and phenolic compounds. These compounds were found to contribute to the observed anti-nematicidal activity of the plant extracts. The study c...

Mehak Muhammad Ashfaq1*, Aqsa Naeem Chawla1, Muhammad Umaid Ali1 and Adnan Ahmed Bhutto2

...gated chemicals found in plants that comprise the group of polyphenols, which also include epicatechin, catechin, and procyanidin. Based on a ground-breaking study, eating foods high in flavonoids is linked to a lower risk of cancer, cardiovascular disease (CVD), and other neurological conditions, including Alzheimer’s, Parkinson’s, and others. Nevertheless, due to research constraints and confounding variables such as study design, population size...

Aasma Rasheed1, Dilbar Hussain2, Usama Saleem1, Saddam Hussain3, Zeeshan Javed1, Mashal Shahzadi1, Muhammad Sohail Qadir2, Muhammad Saleem2, Abdul Ghaffar2, Mawra Rafique4, Ayesha Ikram5, Saad Rasheed1 and  Muhammad Asrar1*

...cotton, sunflower, fruit plants, and vegetables. C. septempunctata is the free living predatory specie of sucking insect pests such as aphids, mealybugs, and whiteflies and consume many preys during its lifetime. C. septempunctata larvae and adults are both active predators. The present study regarding toxicity of new chemistry insecticides against C. septempunctata was conducted under laboratory conditions. The toxic potential of six synthetic insecticides Em...
Mohammad Moneruzzaman Khandaker1*,Nuratiqah Emran1, Nurul Elyni Mat Shaari1, Arba Aleem2, Zanariah Mohd Nor1 and Ali Majrashi3
...ch is easily absorbed by plants. The metal makes living organisms susceptible to its acute and chronic toxicity through plant food. Similarly, Cd hinders the growth of plants by causing the loss of chlorophyll, which in turn negatively impacts the activities of photosynthesis. Therefore, this current study aims to evaluate the effects of Cd on the germination behaviour, morphology, growth and development of Pak Choi

Ngele Blessing Alfred, Agba Mary-Ibenreh Ogaboh*, Bassey Rosemary Anietie and Egeh Ajah Egwu

...h and dry weights of the plants decreased significantly (P≤0.05) as detergent concentration increased, with fresh and dry weights at 0 g/l being 1.68g and 0.69g, respectively, and at 5g/l being 0.50g and 0.69g, respectively. Seedlings irrigated with 5 g/l detergent solution showed higher peroxidase and polyphenol oxidase activities (1714.14 µmol product/L/min and 40.43 µmol product/L/min, respectively), while catalase activity decreased with hig...

Kouakou Yadom Yao François-Regis*, Kra Kouamé Daniel and Atta Diallo Hortense

...cidal efficacy of castor plants was usually assessed using leaves, regardless of maturity or plant phenology. Under these conditions, the efficacy of each leaf type is unknown. This study aimed to identify the maturity level of castor leaves that exhibit the highest nematicidal activity against okra root-knot nematodes. Aqueous extracts of five types of castor leaves were prepared. These were immature (ILV) and mature (MLV) leaves from vegetative

Estrelle Anne Tacbas1, Neil Pep Dave Sumaya2 and Nanette Hope Sumaya1,3*

...e crude extracts of both plants delayed the development of L4 for almost 48 hours. Thus, the results suggest that the extracts of A. heterophyllus and A. camansi can be a potential alternative for anthelmintic treatment or with further research, can be utilized as a natural source and active ingredient for a bio-based antihelmintic pharmaceutical drug.

...

Muhammad Jan1*, Muhammad Ashraf Sumrah2, Muhammad Azhar Iqbal1, Inam-ul-Haq1, Attiq Ur Rehman1, Javeria Sherani3, Muhammad Imran3 and Rizwan Latif4

... than 5.00 million olive plants had been planted over an area of 40450 hectares in the area of Balochistan, Khyber Pakhtunkhwa (KPK), Punjab, Azad Jammu Kashmir (AJK) and Gilgit Balistan (GB). This is only possible due to availability of certified olive plants in a bulk quantity. Center of Excellence for Olive Research and Training (CEFORT) is playing a pivot role in this regard as a source for availability of certified

Bingzhao Yan1, Guiping Chen2, Lulu Ding1, Ruxue Huang1, Wenjing Yu1 and Jicang Wang1*

...istributed in fruits and plants, belongs to the class of flavonoids and is thought to have health benefits and protect many tissues from heavy metals. This experiment aimed to explore the effect of Que on Cd-induced PERK-CHOP apoptosis pathway in rat testis. A total of 24 8-week-old Sprague–Dawley rats were divided into four groups: control group, CdCl2 group, CdCl2+Que group, and Que group. The control group was gavaged daily with distilled water and 0....

Pangesti Nugrahani1*, Hery Purnobasuki2, Arif Nur Muhammad Ansori3, Jatuporn Anuchai4 and Anugerah Dany Priyanto5,6

... root growth in banana explants. 6-benzyl amino purine (BAP), a form of cytokinin, plays a significant role in stimulating cell division and differentiation. This study aimed to assess the impact of BAP on various growth parameters, including shoot initiation, root initiation, leaf initiation, shoot and root length, plantlet weight, root number, leaf number, and shoot number. The study followed a completely randomized design with one factor, namely the composi...

Aytan Ilham Zeynalova1*, Fariz Shahin Alakbarov1, Dunya Ali Isayeva1 and Sait Engindeniz2

Shahid Ali Khan1*, Farooq Ahmad1, Muhammad Zubair Akram2, Yan Tongyu3, Fatima Urooj1, Kamran Ahmad1, Saeed Ullah4, Sharmeen Zulfiqar5, Tahira Batool6, Aqsa Sarwar1, Yaqoob Sultan7 and Samreen Nazeer8*

... the Anthophyta class of plants. it consists of 340 genera and 9000 species and is cosmopolitan distributed throughout the world. The habits of plants are annuals, perennial herbs, shrubs, and trees. The identifying characteristic feature of plants in this family is the formation of milky latex, because of their succulent nature; they can tolerate or resist water deficit conditions. Differ...

Elkhan Rajaf Allahverdiyev1*, Azer Agazade Khalilov2, Araz Mustafa Gasimov2, Zahid Gurban Khalilov2, Parvana Bahlul Bayramova2, Kamala Fatiaga Abilova2 and Sait Engindeniz3

...rowth and development of plants sown in intercrops. The height of the mixed sowing sorghum plant increased to 245-255 cm, and the height of the pea plant increased to 100-110 cm in the variant with 10 t/ha+N70P125K90 of mineral and organic-mineral fertilizers. The researches prove that in the variant applied with organic-mineral fertilizers at the rate of 10 t/ha+N70P125K90, along with the growth and development of plants, g...
Nur Amira Idayu Romzi1, Aina Zahirah Mohd Suhaili1, Norhayati Ngah1,2 and Mohd Fahmi Abu Bakar1*
... crude proteins in maize plants. This study focuses on the determination of the crude protein production from different amounts of nitrogen composition in the fertilizers. A total of sixty maize seeds (GWG 888) were planted at Universiti Sultan Zainal Abidin (UniSZA) Kampus Besut Farm. Four different fertilizer treatments were used for the plant species, including control, NovaTec, foliar, and urea. The data for morphological and physiological characteristics,...
Nur Anis Hashim1, Nor Hasima Mahmod1*, Abubakar Abdullahi Lema2, Lee-Hoon Ho3 and Mohammad Moneruzzaman Khandaker1
...x roselle from different plants. Calyx samples were labeled as fresh calyx (FC), air-dried (AD), oven-dried (OD), and freeze-dried (FD) according to treatments. Four extracting solvents, which were methanol, ethanol, aqueous, and hexane, were evaluated for their efficiency in extracting antioxidant components from the differently treated roselle calyx, and these extracts were used to determine antioxidant activities and contents by assessing DPPH scavenging ac...

Salim Saifullah1* and Achyut Adhikari2

...onoid found in Artemisia plants, has been shown to possess various biological effects including anti-oxidant, anti-inflammatory, anti-cancer, and anti-apoptotic properties. In this study, nepetin as yellowish powder was isolated from A. vulgaris extract through column chromatography. Structure of the compound was elucidated through various spectroscopic techniques such as Mass and NMR (1D and 2D).

...

Aimen Raza1, Muhammad Muzamil Ijaz1,2*, Adnan Younis1, Nasir Ahmad Khan3, Ahsan Akram1, M. Abdul Salam khan2 and M. Nadeem4

...rovides nutrients to the plants. The goal of this study was to use plant-based substrates as growing mediums for ponytail palm production. The research was conducted at Lalazar Nursery, Gardening Wing Estate Management, University of Agriculture, Faisalabad. There were eight treatments and each treatment was replicated three times, with three plants each. Different plant-based materials, including leaf compost, coco peat, an...
Anum Razzaq*, Tariq Mahmood, Ammara Saman, Ammara Baig, Nadeem Munawar and Muhammad Farooq
...eding on wheat-groundnut plants and grains as the crops approached maturity, wild flora (viz: herbs, grasses, seeds and tubers) invariably amongst crop stages and seasons. During spring season, wheat was the most frequently consumed cereal. But during winter, as groundnut crop approached towards maturity/harvested, gerbils consumed mainly nuts and grains, while in autumn and summer (non-crop periods), the rat species switched its diet to wild flora, and consum...

Shahid Ali Khan1*, Farooq Ahmad1, Fatima Urooj1, Shabana Ehsan2, Yan Tongyu3, Tahira Batool4, Aqsa Bibi1, Muhammad Bilal1, Amrat Eman1, Javeria Tariq1, Ansa Asghar1, Yang Yan5, Asima Shabbir2 and Samreen Nazeer6*

... the Anthophyta class of plants and has 340 genera and 9000 species and is found in many parts of the world. Plants of this family exhibit various habits, including annuals, perennial herbs, shrubs, and trees. The distinguishing trait of plants in this family is the production of milky latex due to their succulent nature, enabling them to withstand or withstand water scarcity conditions. V...
Khaled A. El-Dougdoug1, Wael S. El-Araby2* and Rehab A. Dawoud3
...al;">The viromes of land plants are enormous and diverse, and they are dominated by RNA viruses. However, reverse-transcription and single-stranded (ss) DNA viruses also make significant contributions to the viromes of land plants. In this article, we present a thorough taxonomy of viruses that was recently adopted and is based on phylogenomic investigations. This taxonomy is then applied to the plant virome. We continue our...

Muhammad Umair Khan1*, Abdur Rehman1, Mansoor Ali Khan1, Abdur Rahman Khan1, Sajid Ali1 and Zeeshan Ahmad2

...se of fibers of non-wood plants in paper production is also linked to a number of issues, such as collection, transportation, challenges of chemical recovery, alteration of morphological properties and slow water retention. The main consumers of non-wood fibers, small mills, usually have poor pollution control systems. Non-wood materials are now a more viable option as raw materials for papermaking due to a number of considerations. Several pulping methods can...

Wan Nurfarzana Wan Mohamad Zani1, Norrizah Jaafar Sidik1*, Asmah Awal2, Nurul Izzati Osman3, Lyena Watty Zuraine Ahmad1 and Mohd Khairi Nordin4

... cm. Subsequently, the explants underwent rooting in both semi-solid and liquid MS media, supplemented with various IBA concentrations over a 5-week period, with rooting observed solely in the cultures in liquid media. The rooted plantlets were 100% survived when acclimatized in a greenhouse using a mixture of soil, sand and compost.

...

Ahmed Shamkhi Jabbar1* and Saadoon Murad2

...of P. solenopsis on host plants can cause significant economic losses and damage. The effectiveness of commercially available chemical insecticides and biopesticides against cotton mealybugs was evaluated under lab and field conditions by using the secreted toxins of symbiotic bacteria Xenorahbdus nematophlia, Blaiser® as a biopesticide, and chemical pesticide Sivanto®. Our results indicate that the efficacy of secreted toxins by symbiotic bacteria X. ...

Jumiati Asis1, Nur Aainaa Hasbullah1, Mohamadu Boyie Jalloh1, Noor Khairani Mohamad Basri1, Palanivell Perumal2, Peter Mojiun2 and Mohd. Rashid Mohd. Rakib1* 

...Ganoderma-inoculated plants. It was found that T4RH, T8R, and mixed Trichoderma treatments have significantly lower disease incidence, disease severity index, area under disease progress curve, and percentage of necrotic primary roots as compared to the positive control. The disease reduction was up to 57.70% and 43.86% when plants were treated with T4RH and T8R, respectively. Additionally, the Trichoderma ...
José J. Cedeño-Díaz1, Caridad A. Torres-García1, Marina García1, Freddy Zambrano-Gavilanes1, Naga Raju Maddela2* and Felipe R. Garcés-Fiallos3*
...t on seedlings and adult plants of INIAP H-603 maize under semi- controlled and field conditions at the Pacific coastal Ecuador. Unfertilized and urea-fertilized plants were used as controls in both environments. Under the greenhouse conditions, different phytometric characteristics were evaluated at 21 days after sowing (DAS). In the field conditions, the incidence (%) and severity (%) of Curvularia leaf spot (Curvularia...
Rukayat Omolara Folarin1,2, Nurhadirah Hairil1, Nurafiqah Anis Ismail1, Putri Athirah Zamrifana1, Lina Nadhirah Abdullah1, Muhammad Afiq Zabhin1, Ariff Imran Alkaf1, Farrah Izzuanie Zainudin1, Hanisah Basir1, Asmad Kari1, Enike Dwi Kusumawati3, I Wayan Karyasa4 and Connie Fay Komilus1*
...und. It involves growing plants without soil in water or a nutrient-rich solution in a greenhouse. All parts of the hydroponic fodder (leaves, stems, roots, and grain) are fed to livestock by the farmers. This experiment aimed to identify the effect of goat manure liquid fertilizer on growth performance, production yield and proximate composition of all four parts of wheatgrass, including the appropriate day of harvesting. This study used a complete randomised...

Sherine Abbas1, Heba M.A. Abdelrazek2*, Eman M. Abouelhassan3, Nayrouz A. Attia4, Haneen M. Abdelnabi4, Seif El-Eslam E. Salah4, Abdelrahman M. Zaki4, Mohamed A. Abo- Zaid4, Nadia A. El-Fahla5

...most important medicinal plants. This research intended to explore the immunological potential of dietary neem leaves extract prenatal exposure on male Wistar albino rats’ offspring. In this experiment, 18 adult female and 6 male Wistar rats were used. All experimental animals were kept in the same environment which was suitable, away from stresses and of adequate hygiene was provided. They were alienated into two groups. Control and treated with neem le...

Mohamed E. Enany1, Ahmed M. Hamouda2, Reem M. Khashaba3*

...compounds from medicinal plants had many advantages such as fewer side effects, better patient tolerance, less expensive, acceptance due to long history of use, being renewable in nature and also higher plants represent a potentiall source of novel antibiotic prototypes.
 
Keywords: Decimal assay for additivity, Antimicrobial, Amoxicillin, Doxycycline, Turkey poults
...

Bakht Zada1, Ahmed Zia2, Sardar Azhar Mehmood1, Abdur Rehman3*, Toheed Iqbal4*, Kiran Shahjeer5 and Shabir Ahmed1

...nomic descriptions, host plants, and global distribution for each of the identified species. 

...

Muhammad Usman Saleem*, Tahir Hussain Awan, Bilal Atta, Arshed Makhdoom Sabir and Muhammad Ijaz

...illers/m²), tallest plants (148.50 cm), longest panicles (28.93 cm) and highest 1000-grain weight (23.21 g). Moreover, the NP + CAN combination also achieved the highest paddy yield per acre (1922.30 kg), demonstrating its superior effectiveness compared to other treatments. The DAP + Urea treatment also performed well, showing significant improvements in these traits compared to the control. Conversely, the control treatment exhibited the lowest values a...

Qasim H.A. Aljboori* and Saadoon Murad Saadoon

... species can infect rice plants and affect its growth, in addition to producing various mycotoxins that are dangerous to humans and animals. Therefore, a study was conducted to evaluate the effectiveness of four levels of agricultural sulphur (0,100,200 and 300 g/m2)and the fungicide Benomyl (100 ppm) against F. solani fungus infecting three varieties of rice (Anbar33,Yasmeen and Mishkhab2) grown in Iraq. The study results showed that sulphur reduced the F. so...

Sarhad Journal of Agriculture

September

Vol.40, Iss. 3, Pages 680-1101

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe