Lei Chen, Ling Zhu, Zhi-Wen Xu, Wan-Zhu Guo

 

Molecular Genetics of Aichivirus C (Porcine Kobuvirus) in China
...m China. Due to the high detection rate in the severe diarrhea in China, Aichivirus C is thought to be a potential pathogeny of pig diarrhea. The review represented the discovery of Aichivirus C in China, and made a brief summary about molecular and epidemiology characterizations of Chinese Aichivirus C strains. Mutiple Aichivirus C strains and Aichivirus C variants are circulating in China. Recombination events were also observed in Chinese Aichivirus C strai...

Chun-Yi Lin1, Meng-Ling Wu2, Tang-Long Shen1, Hsin-Hung Yeh3, Ting-Hsuan Hung1*

 

... Two multiplex molecular detection methods provide the understanding of the genetic diversities among viroid isolates and quantify viroids in citrus host. Our field survey can help clarify citrus-viroid relationships and develop proper prevention strategies in the near future.

 

...

Hai-Bo Wang, Qiu-Hua Mo, Ze Yang*

...ique was applied for the detection of diarrhoea related viruses. This mini review overviewed the basic principle of RT-NASBA and discussed the significance of these new findings.

...

Oladipo Elijah Kolawole*, Oloke Julius Kola, Awoyelu Elukunbi Hilda, Olasunmibo Oluwatobi Gabriel, Ogunyale Tolulope Temitope

E-mail | koladipo2k3@ yahoo.co.uk

Shumaila Manzoor1, Afshan Ahmed1 and Muhammad Abubakar2*

...V) structural antibodies detection in terms of their sensitivity and specificity. These methods were performed by using set of sera collected from cattle with foot-and-mouth disease vaccination. The pattern of antibody titers in animals of different age groups was observed as less than 1 year, 1-2 years and more than 2 years for both ELISA and SNT. The peak immune response measured by SNT was 2.8log10 whereas ELISA detected serum...

Tomas Jinnerot1*, Karin Malm1, Erik Eriksson1 and Jonas Johansson Wensman2

E-mail | Tomas.Jinnerot@sva.se

...c real-time PCR for detection of B. bronchiseptica in samples from dogs with respiratory signs. A genome comparison program was used to select a suitable target DNA sequence. A PCR targeting the bfrZ gene was developed which showed no cross-reactivity in silico or when tested with a panel of bacterial isolates. The limit of detection was determined to 4x103 bacteria per m...

Claudia Kohl*, Andreas Nitsche, Andreas Kurth

Email: kohlc@rki.de

...leic acids, to allow for detection via metagenomic NGS. This minireview is revising our developed TUViD-VM protocol and selected other approaches regarding their suitability in metagenomics. We provide an overview on the difficulties, challenges and opportunities that developed alongside metagenomic virus discovery. The field of metagenomics from clinical specimens promises the identification of novel, yet unknown, infectious diseases and etiologies.

...

Rongfei Lu1, 2, Zhiyang Liu1, Peng Fang1, Guangyi Chen1, Feng Sun1, Yongjian Fan1, Yijun Zhou1, Tong Zhou1*

...e current field of virus detection and disease dynamics.  The validity and the reliability of generated data can be enhanced significantly appropriate measures. As a standard for the relative expression of target genes, the selection of reference genes is crucial. This review describes the history of the RT-qPCR technology, emphasizes the importance of reference genes and enumerates several algorithms to screen reference genes to normalize the RT-qPCR dat...

John G. Bruno1*, Chien-Chung Chao2,3, Zhiwen Zhang3, Wei-Mei Ching2,3, Taylor Phillips1, Allison Edge1, Jeffery C. Sivils1

...se ratio of > 4.0 for detection of ~ 1,000, R. typhi cells. Titration experiments conducted in buffer revealed a limit of detection between 100 and 1,000 R. typhi cells per ml. The Rt-18R aptamer detected only one band at ~ 84 kD in R. typhi lysates on aptamer Western blots. While the homogeneous Rt-18R fluorescent sandwich aptamer-magnetic bead assay did not cross-react with comparable concentrations...

Moustafa Kardjadj1, Pam Dachung Luka2

.... However, the increased detection of the virus in the light of rinderpest eradication and the lack of awareness of the disease in areas where the virus has been detected for the first time in recent years given the educational status of farmers contributed to this emergence.

...

Ahmed Zein Mahmoud1, Muaz Abdellatif 2, 3*, Luai Shazali1

... subjected to antibodies detection using c-ELISA. Out of examined animals, 83 (62.9%) goats and 70 (33.2%) sheep were detected positive against PPRV antibodies, whereas camels appeared to be seronegative. Based upon the seasonal variations in the antibodies detection, environment appeared to be a significant factor on the level of antibodies in the tested small ruminants population. Taken together, results indicate the serop...

Neha Singh and Anjana Pandey

...kers to facilitate early detection of the disease and for therapeutic purposes.

...

Atul Sharma, Aruna Chandra Singh, Gautam Bacher, Sunil Bhand

...sensing applications for detection of specific target molecules. In the present review, we concentrate on the recent advances in the development of aptasensors for antibiotics residue analysis based on electrochemical signal generation. Aptamers possesses the strong potential as receptors for the development of biosensors for antibiotics detection; therefore, a specially designed aptamer specific to an antibiotic may be suit...

John Gachohi, Simon Karanja, Salome Wanyoike, Nduhiu Gitahi, Salome Bukachi, Kenneth Ngure

... water samples. Antibody detection in animal and human serum samples will utilize Microscopic Agglutination Test (MAT). Study outcomes will include (i) geo-referencing of adverse environmental attributes that support Leptospira growth, (ii) animal and human seasonal public health burden of Leptospirosis, (iii) seasonal variation in the distribution of Leptospira determinants in a slum setting, and (iv) a simulation model based on an ecological metapopulation f...

Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2

...iruses and its molecular detections in asymptomatic commercial layers from Faisalabad district of Punjab, Pakistan. Overall 120 blood samples, 24 tissue samples from each organ (trachea, lung and intestine) were collected from the 12 commercial layer flocks selected randomly at the age of 35-50 weeks without any direct clinical manifestation of avian influenza. Serum collected from 120 birds was tested for antibodies against H9N2 by using Haemagglutination Inh...

Oladipo Elijah Kolawole, Oloke Julius Kola and Awoyelu Hilda Elukunbi

Shazia Irfan1*, Asima Rani1, Muhammad Arshad2 and Razia Bashir1

Kiran Afshan1*, Sarwat Jahan1 and Mazhar Qayyum2
...nt assay (ELISA) for the detection of IgG against fascioliasis in sera of small ruminants. The result of current study indicated diagnostic accuracy of test 95.6%, while sensitivity and specificity of this assay for small ruminants was 97.83% (95% CI: 92.35% to 99.67%) and 93.75% (95% CI: 87.54% to 97.44%) respectively. In field this test indicated significant (p<0.05) values for sheep as compared to goat indicating high risk of infection in sheep. The curr...
Farkhanda Manzoor1, Iram Amin2,*, Muhammad Shahid2,Samia Afzal2,Hania Ramzan1, Tahir Rehman Samiullah2 and Muhammad Idrees3
...tested by nested PCR for detection of dengue virus. Out of total 50 pools of Aedes aegypti larvae, DV-2 was the most prevalent serotype. DENV-1 was not found in any pool. While all pools of Aedes albopictus were negative for dengue virus. Our study showed that the main cause of spreading of dengue virus was Aedes aegypti. Serotype DENV-2 was dominant in the field collected larvae of Aedes aegypti in Lahore and Sheikhupura, Pakistan....
Zafar Iqbal1* and Muhammad Khurshid2 
...otential to expedite the detection of plant viruses from plant species containing various forms of PCR amplification inhibitors. In current study, IC-PCR was used for the detection of Tomato leaf curl New Delhi virus (ToLCNDV) from plant extracts of Nicotiana benthamiana plants inoculated with ToLCNDV. To immunocapture the ToLCNDV, two antisera raised against Tomato yellow leaf curl virus-coat protein (TYLCV-CP...

Idowu Fagbamila1*, Adaobi Okeke2, Micheal Dashen2, Patricia Lar2, Sati Ngulukun1, Benshak Audu1, David Ehizibolo1, Paul Ankeli1, Pam Luka1, Maryam Muhammad1

 Saqib Ali1, Suliman Ali1, Lina1, Wen Zhou1, Muhammad Irfan Waris1, Ashfaq Ali2 and Man Qun Wang1,*

...ly stage of intestation, detection of Anoplophora glabripennis and exposure will help to eliminate the pest in addition to prevent its establishment. Plantation with different tree species, the cultivation of fast-growing timber forest, the plantation of trap trees, sanitation, removal of the damaged trees and exact placement of insecticide saturated sticks into larval sites can reduce the spread of ALB in the regions of China. The ecological, in additi...
Muhammad Shahid1, Iram Amin1,*, Samia Afzal1, Zareen Fatima1, Sadia Zahid1, Usman Ashraf1 and Muhammad Idrees2

John G. Bruno

...gens to enable sensitive detection of rickettsia exposure in humans who have seroconverted. Such anti-idiotypic aptamer antigens might also serve as rickettsial vaccines, if fully developed. The top five highest affinity R. rickettsii and top five R. typhi anti-Fab aptamers as assessed by enzyme-linked aptamer sorbent assay (ELASA) screening were shown to specifically bind their cognate antibodies when captured by their Fc tails on the surface of Protein A-con...

Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

...vaccination for antibody detection by HI test. All immunized chickens shown high HI antibody titers (9Log2) two weeks post-booster dose. The chickens were then challenged using homogenous AI H9N2 strain. During the course of infections, oropharyngeal and cloacal swabs were collected from all chickens at 3, 5 and 7 days post-challenge (p.c.) for virus titration in eggs. Data indicated that all chickens vaccinated with pCA-Egy-H9 were fully protected without cli...

Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*

Matiyar Rahaman Khan1,*, Sabyasachi Pal2, Ghule Tushar Manohar2, Somnath Bhattacharyya3, Amit Singh4, Prahlad Sarkar5 and Samuel Lalliansanga6

Nirbhay Kushwaha, Achuit K Singh, Brotati Chattopadhyay and Supriya Chakraborty

Recent advances in geminivirus detection and future perspectives
...ext-align: justify;">The detection and identification of viruses has been a challenge since the advent of the discipline of plant virology over a century ago.Agreat variety of methods have been developed that permit differentiation of viral pathogens.These methods, initially based solely on identifying the distinct biological characteristics of different viruses, were soon supplemented with methods based on light or electron microscopy and serology and subsequ...

Bijan Kumar Das

Incidence of Aleurocanthus spp. (Aleyrodidae: Hemiptera) on betelvine (Piper betle L.) and their interaction with host plants
Muhammad Ashfaq,1 Shamim Akhtar,2 Saleem Akhtar2,* and Mariyam Masood2
...inae). Traditionally the detection of hyperparasitoid is done by host-rearing, but that is time-consuming when working with field populations at larger scale. The current study used morphology and DNA sequences from mitochondrial (cytochrome oxidase I) and nuclear (internal transcribed spacer I) genes to identify the hyperparasitoid Promuscidea unfasciativentris. The successful PCR-based detection of hyperparasitism i...
Muhammad Aslam Farooqi1,*, Mansoor-ul-Hasan2, Sohail Akhtar1Muhammad Arshad2, Muhammad Naveed Aslam3 and Muhammad Rafay4
...ography with ultraviolet detection (HPLC-UV) was used to determine residues of commonly used agricultural insecticides (imidacloprid, thiametoxam, profenofos, endosulfan, spinosad and deltamethrin) in multi-floral raw honey of Apis dorsata F. collected from the cotton belt area of Punjab, Pakistan. The residues of these insecticides were extracted using ethyl acetate. Honey samples were spiked at 0.1 and 0.01 mg/kg. The mean recoveries of these insectic...

Rabia Tahir1*, Khushi Muhammad1, Masood Rabbani1, Muti-u-Rehman Khan2, Farah Khan1, Hassan Bin Aslam1 and Arslan Mehboob

...owever, based on genetic detection such evidences are lacking. The molecular mechanism and establishment of latent infections warrant future investigations to elucidate these discrepancies.

...
Carolina A. Bonin1,2, Eric A. Lewallen2,3, Andre J. van Wijnen3, Marta Jussara Cremer4 and Paulo C. Simões-Lopes5*
...s socialization. The detection of these key areas should facilitate both local and broad-scale efforts to preserve critical habitats for this population of dolphins, and by extension may help inform management plans for ecologically vulnerable S. guianensis populations in other parts of their distribution.
...
İbrahim Aytekin1,*, Ecevit Eyduran2, Koksal Karadas3, Rifat Akşahan4 and İsmail Keskin1
...es and especially in the detection of ideal fattening period for each breed under the condition.
...
Tahira Kamal1*, Saeed-Ul-Hassan Khan2, Amir Bin Zahoor3, Khalid Naeem3, Muhammad Naeem Riaz1, Siddra Tayyab Akhtar4, Ghulam Muhammad Ali1*
... are developed for rapid detection of FMD but these are expensive and time consuming. Elisa, cell culture, Reverse Transcriptase (RT-PCR) and real time PCR need specific high quality equipments in lab. Whereas Lamp PCR is simple and accurate test for the rapid diagnosis of FMD. This study has been done initially with FMD known serotypes (O, A, Asia1) already in use at animal health.Viral RNAs were extracted using R Neasy Minikit (Qiagen) according to instructi...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
Nilgün Paksoy1, Hikmet Dinç2 and Serap Kılıç Altun3,*
...ples were lower than the detection limit of 1 mg L-1.
...

Osama Elshazly1, AbdelSatar Arafa1, Mohammed A. Rohaim2, Ismaeil M. Reda2 and Hussein A. Hussein2*

... antigenic and molecular detection methods. Full-length hemagglutinin (HA) sequences of six representative H5N1 isolates were analysed to study their genetic evolution followed by estimation of their evolutionary rates among different virus clusters. This analysis revealed a high evolution rate for clade 2.2.1.2. Additionally, analysis of selection pressures in the HA gene revealed a positive selection pressure. Deduced amino acid analysis revealed characteris...
Niamatullah Kakar, Farhat Abbas, Muhammad Shafee and Tauseef Asmat*
...th. Precisely and timely detection of Mycobacterium tuberculosis is prerequisite for the successful treatment of TB. Aim of this study was to evaluate the prevalence of tuberculosis along with associated risk factors in Quetta Jail, Pakistan. In this cross-sectional study, 186 sputum samples were collected randomly from jail inmates. Sputum was processed for smear microscopy and culture inoculation for the detection
Jia-kui Li1,2,*, Kun Li2, Zhao-qing Han2, Hui Zhang2, Xiao-qiang Wang2, Hou-qiang Luo2, Yan-fang Lan2 and Gang Qiu1,2
...
...
Muhammad Asim Khan1,*, Shahid Niaz Khan1, Sanaullah Khan2, Abdul Jabbar Khan3, Muhammad Adnan4, Nawab Ali5 and Ijaz Ali6
...ed by microscopy for the detection of malarial parasites. In the Southern districts, the overall incidence of Plasmodium slides positivity was 52.47% of which 91.07% were identified as Plasmodium vivax and 6.23% as P. falciparum and 2.69 was 43.62%, of which Plasmodium vivax were 91.2%, Plasmodium falciparum were 6.09% and 2.68% were identified as mixed infections. Malaria was most prevalent in the age group 11 - 20 years (61...
Ali Zaman1,*, Abdul Haleem1, Sajjad Ur Rahman2, Adnan Amin3 Asma Saeed1, Sana Ullah4 and Naimat Ullah4
...inhibition (HI) test for detection of H5 antibodies. Highest sero-prevalence of Avian Influenza (H5) was recorded in district Abbottabad 36.15% (47/130) followed by Dera Ismail Khan 33.08% (43/130), Tank 26.92% (35/130), Peshawar 21.54% (28/130) and Mansehra 16.92% (22/130). Statistical analysis confirmed a significant (P<0.05) difference of sero-prevalence between the districts. There was a significant (P<0.05) association of occurrence of...
Xi-wen Chen1,2, Qian Wang1,3, Miao Yin1, Zhong-hui Pu1,2, Ai-wei Guo3, Lian Li 1,3, Wen-tao Luo1,3 and Xiong-qing Wang1,*
...apid and practical early detection assay is required. This study established a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay to detect PRRSV. Four primers were designed targeting the ORF5 gene of PRRSV were designed. Reverse transcription and amplification of the viral RNA using AMV reverse transcriptase was optimal at a constant temperature of 65 °C. The output of the RT-LAMP assay was visualized using 1% agarose gel electro...
Nasreen Ishaq1, Arif Rasheed Malik2, Zameer Ahmad1, Saad Ehsan Ullah3
...k has been conducted for detection of different methods of identification to establish a baseline of identity e.g. dental data, fingerprinting, DNA analysis, anthropometry, identification of sex, assessment of age, determination of height and blood groups identification. Among these, DNA analysis and dental data provide easiest identifications, however, these techniques are expensive and not readily available necessitating additional techniques for identificat...
Muhammad Kashif Munir1*, Sana Rehman1, Rizwan Iqbal1, Muhammad Saqib Saeed2, Muhammad Aasim1
...ging global issue. Rapid detection of such type of tuberculosis is necessary for timely control of the disease. GeneXpert test has already been implemented by World Health Organization to diagnose the infection on urgent basis.
Objectives: This study was designed to apply GeneXpert MTB/RIF assays for the detection of rifampicin resistant tuberculosis and validation of assays by comparing with conventional ...
Sahar Naz1, Farhan Rasheed2, Muhammad Saeed3*, Shagufta Iram4 and Ambereen Anwar Imran5
...r processed for MβL detection by EDTA method, zone size of Carbapenem disc only and Carbapenem disc impregnated with EDTA was compared ( >7 mm increase MβL positive, 0-5 mm increase MβL-negative).
Results: Out of total 12126 samples, 35.9% (n=4361) were culture positive and only 40.5% (n=1770) were Gram negative rods. Of these 9.6% (n=170) were Carbapenem-resistant isolates with 47% (n=80) MβL producers. Briefly 51.7% ...
Matiyar Rahaman Khan1,*, Sabayasachi Pal2, Amit Singh2, Ashok Dhananjaybhai Patel3, Bhagubhai Ambaram Patel3Tushar Manohar Ghule2 and Victor Phani1
...in Gujarat of India. The detection of M. indica and its diagnostic symptoms on some hosts (citrus and Bt-cotton) was recorded and the nematode species was authentically identified as Meloidogyne indica Whitehead, 1968 which was first time described on citrus from Delhi, India. The species is further characterized based on detailed morphological, morphometric descriptions and beta-esterase phenotyping. The present study elucidated information on <...
Muhammad Sarfraz*, Shahida Hasnain
...t pAmpC β-lactamase detection accurately and support physicians to prescribe the appropriate antibiotics.
...

Mohammed Zaki Fathy* 

...after administration for detection the hematological changes. Results showed that the onset, duration and total recovery times of anesthesia were 7.33±3.05 min and 3.33±1.53 min, 26.33±3.51 min and 45±3.00 min and 64±4.58 min and 86.67±6.11 min in G1 and G2 respectively. In G1, presence of a significant decrease in RBCs, PCV and Hb values and apnea was recorded. However, non-significant hematological changes were re...
Jam Nazeer Ahmad1,2,*, Rashid Mushtaq1, Samina Jam Nazeer Ahmad1,2, Sumaira Maqsood3, Ishita Ahuja4 and Atle M. Bones4
...s used for the molecular detection of NPV gene from native NPV diseased insect. Multiple sequence alignment and phylogenetic analysis were performed to compare SlNPV- FSD15 based on Lef-8 with other Lef-8genes sequences clearly showed that our SlNPV-FSD15 isolate belongs to Spodoptera litura associated NPVs. The biological activities of this NPV isolates were investigated under laboratory condition. The highest mortality of S. li...
Imran Taj1,*, Ferhat Abbas1, Zafar Ahmad1, Mohammad Kamran Taj1, Deedar Ahmad2, Zahoor Ahmed2, Ghulam Mohammad2, Ajaz-ul-Haq1, Farooq Shahzad1 and Sabiha Azam3
Şehriban Çek Yalnız 1,* and Erdal Yilmaz2
...ovulatory follicles. The detection of karyorhexis, characteristic of apoptotic cells may provide a better understanding in atresia mechanism. It seems that apoptosis has a major role in the elimination of POF and atretic oocytes in the ovaries of C. gariepinus.
...
Asad Ullah1, Umar Sadique Khattak2, Sultan Ayaz1, Muhammad Subhan Qureshi2, Imad Khan1, Ibad Ullah Jan2, Irfan Khattak1, Raheela Taj3, Sahar Nigar4,    Naimat Ullah Khan1,Mumtaz Ali Khan5 and Muhammad Luqman Sohail6,*
...berculin test (CCIT) for detection of Mycobacterium bovis infection. Data regarding socio-demographic status, risk factors and farming practices were gathered through a pre-form questionnaire. Results revealed that prevalence of bovine tuberculosis was 5.88%. Statistical analysis revealed significant association of age (OR= 3.267; CI = 1.686-6.331) and herd size (OR = 2.600; CI = 1.421-4.760) with CCIT positivity. Similarly, induction of new animals int...
Ejaz Mahmood Ahmad Qureshi1,*, Amtul Bari Tabinda2, Seemal Vehra3 and Atif Yaqub4
...n a mosquito population, detection of the viruses in adult mosquitoes was used to calculate Minimum Infection Rate (MIR). Average MIR was highest being 3.52 and 2.94 in late rainy season in 2011 and 2012, respectively, while it was highest (3.06) in early post rainy season in 2013. Results also revealed significant correlation coefficient ‘r’ and coefficient ofdetermination r2 of MIR with air temperature in all seasons, strongest in earl...
Shagufta Nighat1, Muhammad Sajid Nadeem1,*, Syed Israr Shah1, Amber Khalid1, Tariq Mahmood2, Ayesha Aihetasham3 and Muhammad Asif4

Ummad-ud-Din Umar1, Syed Burhan-ud-Din2, Muhammad Fahad Khan1, Ateeq ur Rehman1, Syed Atif Hasan Naqvi1*, Muhammad Asif Zulfiqar3, Azhar Ali Khan3 and Naila Ilyas1

...pearance of symptoms and detection of virus titter through ELISA. Different concentrations of SA and BTH were exogenously applied to activate the inherent resistance of mungbean by the production of defense associated compounds. All treatments were supportive in suppressing plant infection as compared to infected control, but the most promising outcome of treatments was observed when SA and BTH were applied at the concentration of 5mM and 150mg/L respectively....
Muhammad Hidayat Rasool1,*, Muhammad Zaheer1, Muhammad Farooque Hassan2, Muhammad Shafique1 and Muhammad Usman Qamar1
...olates were subjected to detection of Metallo-beta-lactamase production by Double Disc Diffusion test (DDDT) and Modified Hodge’s test. In 152 specimens, different species identified in order of their frequency were; Klebsiella pneumoniae (59; 38.8%), Pseudomonas aeruginosa (46; 30.3%), Escherichia coli (36; 23.7%), Klebsiella oxytoca (4; 2.6%), Serratia marcescens (3; 2%), Enterobacter agglomerans (2; 1.3%) and ...
Sumreen Hayat1,6, Muhammad Hussnain Siddique2, Bilal Aslam1, Habibullah Nadeem2, Asma Ashraf3, Muhammad Saqalein1, Mohsin Khurshid4, Naveed Shahzad5 and Saima Muzammil1,*
...y test (DDST). Molecular detection for the presence of bla-SHV and bla-TEM was carried out by polymerase chain reaction (PCR). Of 392 blood and urine samples, 120 were found positive for microbial growth. Antibiotic susceptibility testing of K. pneumoniae isolates illustrated high resistance to ceftazidime (95.6%). Phenotypically,52.17% of K. pneumoniae isolates were found to be ESBL producers as observed by double disc synergy test...

 Ping Zhang1,2, Yabin Pu1, Yu Zhang2, Jia Chen2, Kunfu Wang3, Qian Li3, Yujiao Sun3, Yuehui Ma1, Shuqing Jiao2,* and Weijun Guan1,*

...ofluorescence and RT-PCR detection, and CD45 was negative expressed. MDSCs were successfully induced into Adipocytes, osteoblasts, chondrocytes, myoblasts and neuron-like cells under the optimized inducing medium. To conclude, in vitro high purity MDSCs have multiple differentiation potential, and can play an important role in muscle tissue repair, and provide seed cells for tissue engineering research and clinical applications.

...
Emel Banu Buyukunal1,*, Rojan Ibrahim Albazaz1 and Mehmet Ali Bal2,3
...) was also performed for detection of Extended Spectrum β-Lactamase (ESBL)-producing organisms. As a result, majority of poultry isolates was susceptible to most of the tested antibiotics and highest resistance rates were detected for ciprofloxacin (2.8%) followed by ertapenem, imipenem, meropenem with equal resistance rates of 1.4% with CLSI interpretative criteria. However, analyzing of the same data according to EUCAST interpretative criteria resulted ...

Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4 

...rize a precise and rapid detection approaches with molecular diagnostic tool. The method relies on periodically thermo cycling heating and cooling of DNA in presence of certain chemical reagents. In order to detect and differentiate parapox infections from those induced by pox virus. A new parapox specific and sensitive PCR assay based on amplification of B2L gene was applied against conserved gene of Orf virus. Crusted scraps and biopsies from different porti...

Hala Mohamed Nabil Tolba1, Naglaa Fathy Saeed Awad1*, Gamelat Kotb Farag Kotb2, Amany Adel3 

...ere subjected for direct detection of a 620 bp hypervariable region in the VP2 gene using Reverse transcriptase polymerase chain reaction (RT-PCR). The nucleotide and deduced amino acid sequences for VP2 hypervariable region of selected five IBDV field isolates were determined and compared to well characterized reference and vaccine strains worldwide. The IBD virus was detected in 9 out of 16 (56.25 %) investigated chicken flocks. Sequence analysis revealed th...
Xuefeng Cao1, Guangneng Peng1, Xiaobin Gu1, Changliang He1, Guizhou Yue2, Jun Shi3,* and Zhijun Zhong1,*
...sting showed the minimum detection limits of real-time (RT)-PCR were 7.44×101 copies·μL-1 (CPV) and 4.20×101 copies·μL-1 (CDV). DARPM detection of CPV with DNA showed a minimum detectable of 1.53×101copies μL-1, while the minimum detectable amount from the virus culture supernatant was 6.70×101 copies μL-1. The...
Shujjah Haider1,*, Ayesha Maqbool1, Tariq Pervez1, Saima Parveen1, Arfan Ahmad2, Zahid Iqbal3, Javed Iqbal3, Shahid Mehmood3, Amanullah Khan4 and Sajid Umar5
...nsitive and specific for detection of MG antibodies in serum samples as compared to RPA/SPA test. This evidence emphasizes the need of more systemic approaches for the investigation ofMG distribution and prevalence in otherparts of Pakistan in order to design effective control strategies. 
...
Nida Zia1, *, Ayesha Maqbool2, Muhammad Safdar3, Umm-I-Habiba1, Altaf Mehmood4, Muhammad Usman5, Zahid Iqbal6, Javed Iqbal6, Shahid Mehmood6, Amanullah Khan7 and Sajid Umar8
Kun Wang1,2, Yinglin Cui2, Xu Zhao2 and Changjiang Hu1*
...inistered via enema. The detection of neuronal apoptosis was measured by TUNEL assay. Using immunofluorescence, the expression of claudin-5, ZO-1 and VE-cadherin was detected. The expression of DNA methyltransferase 3b (DNMT3b) and Matrix metalloproteinase-9 (MMP-9) was evaluated by western blot. And microRNA-29b was identified using quantitative real-time PCR. 3). Compared with the Model group, the group treated with XN had a significantly reduced number of d...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

Rais Ahmed1,2,*, Muhammad Khalid Mansoor1,2, Iftikhar Hussain1, Muhammad Saqib3, Muhammad Hammad Hussain4, Amjad Islam Aqib5, Haleema Sadia6, Javed Muhammad7, Asma Irshad8, Kashif Prince5, Muhammad Zain Saleem9 and Abdul Whab Manzoor10
...ilable ELISA kit for the detection of antibodies against Mycobacterium avium subsp. paratuberculosis (MAP). Data were analyzed using chi square for ELISA and odds ratio for finding association of species, gender, body weight, age and body condition score (BCS) with prevalence of antibodies against MAP. Seropositivity against MAP was significantly (P<0.05) detected. Male and female animals were equally susceptible to the disease (OR: 0.908, 95%...

Adewumi Moses Olubusuyi1, Ogunsakin Temitope Rachael1, Ogunrombi Sefiu Babatunde1, Ojeamiren Iduda1, Olawole Alaba Samuel1, Faleye Temitope Oluwasegun Cephas1,2* and Adeniji Johnson Adekunle1,3 

Zhijun Zhong1, Rui Tu1, Xichun Wang2, Yi Geng1, Qicheng Xiao1, Yinan Tian1, Bin Wei1, Jiaming Dan1, Ya Wang1 and Guangneng Peng1,*
...results demonstrated the detection of B. canis antigens in the lesions of all examined tissues. Strong positive staining was primarily found in the spleen, liver, and testicle. In conclusion, this study was the first to report the isolation of two B. canis strains from pet dogs in Sichuan province, southwestern China, and to further evaluate B. canis antigen location in tissues. Our study will contribute to the understanding of B. canis...
Beenish Zahid*1,2,7, Javed Iqbal Qazi2, Amir Zohaib2, Asim Aslam3, Raheela Akhter3, Haleema Sadia4, Qurat ul Ain5, Razia Sultana6, Irfan Irshad3 and Sobia Alyas7

Mahnoor Pervez and Farkhanda Manzoor* 

...used for fast and simple detection of pesticide residues of commonly used pesticides (imidacloprid, deltamethrin, chlorpyrifos, fipronil, thiamethoxam, carbaryl, profenophos and bifenthrin). Among a total of 100 pollen samples, 47% were found to be positive. The most frequently found residues were imidacloprid (11%), thiamethoxam (7%) and carbaryl (6%). Among all 100 nectar samples, 36% samples were positive and most abundant pesticides in nectar were imidaclo...
Umm-i-Habiba1,*, Ayesha Maqbool2, Muhammad Safdar3, Nida Zia1Altaf Mehmood4, Muhammad Usman5, Mehwish Sharif6, Amanullah Khan7 and Sajid Umar8

Asim Munawar1,2*, Farooq Ahmad1, Aqsa Arshad1, Muhammad Ishaque Mastoi3 and Chengjuan Liang4 

Ahsan Anjum1, Asim Aslam1, Raheela Akhtar1, Tahir Yaqub2,  Muti-ur-Rehman Khan1, Rizwana Sultan3, Saba Usman1Aneela Zameer Durrani4 and Muhammad Usman4*
...ng samples were used for detection of CBPP through PCR targeting 16S ribosomal RNA. Furthermore, lungs, liver, kidney and lymph node were collected for histopathological examination. Of the 560 samples, 49 (8.25%) were found positive for CBPP. Maximum pathological lesions (50-75% of surface area) were seen in 34.69 percent lung samples, chronic type pleurisy in 97.96 percent, maximum aggregate pathological lesion score in 65.31%, while 48.98% lung samples had ...

Hamoudi Naoual1, Alloui Nadir2*, Barberis Abdelhak2 and Boudaoud Amine2 

...owing the first official detection of the H9N2 subtype circulation in broiler flocks in Eastern Algeria, a preliminary descriptive study is conducted to identify and enumerate in wetland areas, migratory bird species, known to carry the AIV. The Anatidae population peaked in January 2017 with a total of 8064 birds. The 6 frequent species observed are: Mallard (Anas platyrhynchos), Eurasian teal (Anas crecca), Gadwall (Anas strepera), Eurasian wigeon (Anas pene...
Nahed H. Ghoneim, Maha A. Sabry, Zeinab S. Ahmed and Esraa A. Elshafiee*
.../i> (36.4 %) through the detection of the Map A and Ceu E genes, respectively. The antibiotic resistance of the Campylobacter isolates was determined via the disc diffusion method and was observed most frequently to nalidixic acid (81.8 %), tetracycline (72.7 %), ciprofloxacin (54.5 %), and erythromycin (54.5 %), while low resistance to ceftriaxone (18.2 %) was detected. Among the 11 Campylobacter isolates, 9 isolates were multidrug...
Abdul Kabir¹, Amjad Hussian Mirani¹, Jam Kashif1, Shumaila Manzoor2, Abdullah Iqbal3*, Ihsan Ullah Khan4 and Muhammad Abubakar2
...ears. Results of antigen detections showed that the outbreaks were going in study population and confirmed positive for PPRV by IcELISA and RT-PCR (N-gene). The study revealed a comparison of PPRV occurrence in the different production system of small ruminants and on-going disease outbreaks in the target area.
...
Mubashra Salim1, Omeira Ibrahim1, Hugo Vilhena2,3,4, Carla Maia5, André Pereira5, Maria Shahzeen1, Shabana Kalsoom1, Asim K. Mahmood6 and Furhan Iqbal1*
...signed for the molecular detection of Mycoplasma haemofelis and Candidatus Mycoplasma haemominutum in feline blood samples collected from various pet clinics in Pakistan, by Polymerase Chain Reaction (PCR), using 16S rDNA as the target sequence. Clinical and epidemiological data was collected in all animals included in the study. M. haemofelis and C. Mycoplasma haemominutum DNA was detected by PCR respectively in 6.8% (10/148) and i...
Bo Gao1,2, Fengmei Yang3, Wei Chen2, Xiaojia Song4, Xiaobo Liu5 and Dongmin Li1*
...nant tumor patients. The detection of MDR1 expression combined with tumor markers can improve the sensitivity and specificity of predicting postoperative recurrence (especially breast cancer and PEOC).
...
Yan-Guo Han, Jia-Yuan Wu, Ri-Su Na, Wei-Jiang Si, Yu-Qin Han, Yan Zeng, Yong-Ju Zhao and Yong-Fu Huang*
...ary immunisation for the detection of kisspeptin antibodies and testosterone by indirect enzyme-linked immunosorbent assay. Scrotal circumference was detected from week 0 to week 14 after primary immunisation, and the testes were weighed at week 14 after primary immunisation after slaughter. The concentrations of 4-methyloctanoic acid and 4-methylnonanoic acid in waist subcutaneous adipose tissue were detected using gas chromatography. Immunisation of oral and...

Adewumi Olubusuyi Moses1,2*, Faleye Temitope Oluwasegun Cephas,1,3, Ope-Ewe Oludayo Oluwaseyi1, Ibitoye Ibipeju Henrietta1, Arowosaye Abiola Opeyemi1, Adelowo Oluwatosin Deji1 and Adeniji Johnson Adekunle1,2,4 

...cell culture with direct detection from clinical sample might impact our ability to detect non-polio EV Species C (NPESC) members in stool samples. In all, 20% (8/40) of all the samples screened had NPESCs and 50% (8/16) of the EVs detected were NPESCs. However, the RD cell line missed all NPESCs. Hence, RD cell line alone should not be used for EV isolation if the desire is to also isolate NPESC.  

...

Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan

...vine tuberculosis (bTB); detection of Mycobacterium bovis (M. bovis) infection in lactating indigenous cattle/buffaloes raised on different commercial dairy farms and exposing the hazards linked with milk-born tuberculosis infection in the area where unpasteurized milk is normally used in the central zone of Khyber Pakhtunkhwa (KP), Pakistan. A total of 1225 cattle and 1175 buffaloes of more than one year were studied for the prevalence of bovine tuberculosis....
Sana Khan1, Raheela Taj1, Noor Rehman2, Asad Ullah3, Imad Khan3 and Sadeeq ur Rahman3,*
...> followed by phenotypic detection of β-lactamases and antimicrobial susceptibility profile. Our results indicated that a total of 130(4.40%;130/2950) samples were positive for C. freundii comprised of urine 58.46%, pus 33.85% and wounds 7.69%, respectively. More samples from females (n=70) than males (n=60) with majority (43.08%) from age group 21-40 years were found positive for C. freundii. Of the 130 isolates, 28 (21.53%) w...
Dil Afroza Khanom1, Amirun Nesa1, Muhammad Abu Sayed Jewel1, Muhammad Ayenuddin Haque1, Alok Kumar Paul1, Sonia Iqbal2, Usman Atique2,3*, Lubna Alam4
...ls presence and loads by detection after wet digestion of samples. The results displayed the hierarchy of average levels of the targeted metals in G. chapra in declining order of Zn (14.37) > Cu (12.63) >Mn (1.39) > Cr (0.64) >Pb (0.38) > Cd (0.03 mg/kg) whereas, Zn (11.89) > Cu (11.18) >Mn (1.69) > Cr (0.52) >Pb (0.19) > Cd (0.01 mg/kg) in E. vacha. The t-test indicated significant differences ...

Pravin Mishra1, Md. Muket Mahmud2, Md. Ahosanul Haque Shahid2, Alamgir Hasan2, Vivek Kumar Yadav3 and Moinul Hasan1* 

...ed and further molecular detection confirms the presence of methicillin-resistant Staphylococcus aureus from the outer part of the wound but not from the inner part. The study helps and aware the veterinarians, health-workers, and general people regarding the situation of antibiotic resistance. As maggot helps in the reduction of bacteria, this can be used as medical therapy in the case of a different wound. 

...

Sahib Khan1, Muneeza Wahid2, Muhammad Abeer Irfan1, Muhammad Naeem3, Asma Gul4, Muhammad Haseeb Zafar2

ROW LEVEL IMAGE FORGERY DETECTION TECHNIQUE USING EMBEDDED DIGITAL SIGNATURES
... justify;">Image forgery detection is one of the most important issues in today’s modern world. It has become very easy to change the contents of digital images with image editing tools and software. This paper is presenting a new technique to detect any changes made in digital images. This technique ensures the integrity of digital image at row level and using embedded digital signatures. Using message digest 5 algorithm, digital signature is generated ...

Waqas, A. Imtiaz1, Yousaf Khan1, Syed Waqar Shah2 

COST VERSUS RELIABILITY ANALYSIS OF NEW TREE-BASED HYBRID PROTECTION ARCHITECTURE FOR OPTICAL CODE DIVISION MULTIPLE ACCESS SYSTEM
...be able to provide fault detection and restoration at both feeder and the distribution level. This paper
focuses on design and analysis of a novel tree-based hybrid protection architecture for OCDMA system in order to
make it economical and reliable for deployment at the access domain. It is observed that the proposed protection
architecture provides desirable (5 nines) connection availability along with minimum cost as compared to existin...

Muneeb Abrar1, Shabbir Majeed Chaudhry2 

DESIGN OF A LOW NOISE, LOW POWER AND SPURIOUS FREE PHASE FREQUENCY DETECTOR AND CHARGE PUMP FOR PHASE-LOCKED LOOPS
...ansistors for
the detection process, which reduces the chip area and power consumption of the PLL block. It also minimizes the
dead zone and eliminates the reset path to reduce the delay. The output is passed through a buffer to suppress the
distortion and to reduce the overall output noise. Phase noise has been reduced to -156 (dBc/Hz) at 1 MHz offset
frequency. A simple current mirror based charge pump circuit is presented next. T...

Shaukat Ali*, Shah Khusro*, Laiq Hasan**, Asif Ali Khan**

A SURVEY OF MOBILE PHONES CONTEXT-AWARENESS USING SENSING COMPUTING RESEARCH
...automatic road condition detection and traffic monitoring, social networking, environmental pollution monitoring, and healthcare monitoring etc. This paper presents a comprehensive survey of research efforts contributed by researchers, organizations, and academia emphasizing on using mobile phones sensing capabilities for developing effective context-aware applications. The readily available knowledge is organized and classified effectively to g...

Parakriti Gupta1, Kapil Goyal2 and Mini Pritam Singh3*

Hepatitis E Virus and Zoonosis
...gnosis is established by detection of HEV antigen or anti-HEV IgM in acute sera. However, the detection of HEV RNA is important to establish the diagnosis in immunosuppressed patients. In transplant patients, decrease in immunosuppression is usually done, however ribavirin therapy has also shown a definitive role. There is upcoming literature on the role of sofosbuvir also in these groups of patients. Since the virus has onl...

Syeda Farzana Bibi* and Siraj-ud-Din

Fluorescence Analysis, Extractive Values and Cytotoxic Screening of Crataeva adansonii DC Leaf and Bark through Brine Shrimp Larvae Assay
...ill be supportive in the detection of adulteration and drug quality control.
...
Fei Wang1, Xianlai Zhang1, Youbao Zhong2, Xiaoen Tang3, Xiaofen Hu1
ShanShan Yang1, Shengwei Zhong1, Zuohong Zhou1, Jin Liu1, Xu Yuan1 
and Yong Li1*
...t of immunohistochemical detection. It is indicated VIP probably participate in the functional regulation of pigeon intestine as a key role and mediate the neuroendocrine and mucosal immune system as an information molecule due to the high expression of VIP. It will provide the basis for clarifying the biological function of VIP in pigeons.
...
Aribah Naz1*, Uzma Badar1,Afsheen Arif2*, Zaid Qureshi1, Sondas Saeed1,Erum Shoeb1, Maqsood Ali Ansari1 and Obaid Yusuf Khan1
...nity and low pH. Ease of detection is one of the prominent features of these glowing organisms to be the center of attention of many researchers and scientists. The focus of the study is to characterize and identify local Gram negative luminescent bacterial strain isolated from gut of Nemipterus japonicus commonly known as Japanese threadfin bream fish.Isolation, temperature optimization for growth and luminescence, growth curve, MTC for heavy metals an...

Ummad ud Din Umar1, Syed Atif Hasan Naqvi1*, Ishfaq Ahmed1, Ateeq ur Rehman1, Muhammad Asif Zulfiqar2, Sibghat Ullah3, Shah Pasand4, Zehri Khan3 and Abdur Rehman5

Prevalence and Serological Detection of Spiroplasma citri, a Cause of Citrus Stubborn Disease in Southern Punjab, Pakistan
...ng the serological based detection methods by conducting a comprehensive survey in various districts of Southern Punjab. The results of the survey and serology of CSD showed that this destructive disease which causes symptoms mostly similar to citrus greening is present in all areas of South Punjab. Layyah, and Multan showed maximum incidence of CSD with “11.66” and “5.66%” respectively while least incidence was observed in District Bha...
Muhammad Zahid Mengal1, Hamida Ali2, Raheela Asmat3, Muhammad Naeem1,4, Ferhat Abbas1, Abdul Samad1, Mohammad Zahid Mustafa1, Jannat Raza2 and Tauseef M. Asmat1*
...iagnosis by simultaneous detection of Mycobacterium tuberculosis and resistance to RIF (rifampicin), a surrogate marker for multidrug-resistant TB in less than two hours. The RIF-resistance pattern in Balochistan, Pakistan, is not documented. This study was aimed to detect RIF-resistant TB and mutations in RNA polymerase beta (rpoB) gene of M. tuberculosis within 81-bp RRDR in Quetta, Pakistan using GeneXpert® MTB/RIF assay....

Christian Marco Hadi Nugroho1 and Jeanne Adiwinata Pawitan2,3,4*

Production of Antibody for Direct Fluorescence Antibody Assay against Avian Influenza H9N2
...ted some methods for the detection of H9N2 infection including the immunofluorescence method that is commonly known as the direct fluorescent antibody (DFA) assay. This method is a combination of immunology and bio-imaging. This DFA assay is rapid and sensitive, but specificity is influenced by antibody production methods. Therefore, the aim of this review was to describe various antibody production methods, which might be used in developing DFA assay to diagn...

Joseph Anejo-Okopi1*, Dorcas Yilger Gotom1, Noble Allison Chiehiura1, Julius Ocheme Okojokwu1, David Ochola Amanyi2, John Otumala Egbere1, Joshua Adetunji1, Otobo Innocent Ujah3 and Onyemocho Audu4

The Seroprevalence of Zika Virus Infection among HIV Positive and HIV Negative Pregnant Women in Jos, Nigeria
Sher Bahadar Khan1, Mumtaz Ali Khan2,*, Hameed Ullah Khan3, Sher Ali Khan4, Shah Fahad5, Faheem Ahmad Khan6, Irshad Ahmad7, Nighat Nawaz8, Sidra Bibi9 and Muhammad Muneeb10
...usion method followed by detection of their respective antimicrobial resistant genes. Overall prevalence of Campylobacter jejuni was 14% being higher in Peshawar division (21%) followed by Bannu division (16%), Malakand division (13%) and Hazara division (8%). Over all highest antibiotic resistance was found against AMX (93%) followed by LIN (88%), AMP (86%), TET (82%), SXT (75), CHL (68%), CLR (65%), STR (50%), GEN (44%), OFX (27%), CIP (25%), LFX (13%...

Syeda Farzana Bibi* and Siraj ud Din

Unraveling the Bioherbicidal Potential, Elemental Analysis and Nutritional Evaluation of Crataeva adansonii Dc Leaf and Bark
...ill be supportive in the detection of adulteration and quality control. Due to the herbicidal potential, it can be used in the agricultural industry. For future studies, it is suggested to understand the mode of action of its active compounds through future studies.

...
Muhammad Aamir Naseer1, Amjad Islam Aqib2*, Ambreen Ashar3Muhammad Ijaz Saleem1, Muhammad Shoaib4Muhammad Fakhar-e-Alam Kulyar1, Khurram Ashfaq1, Zeeshan Ahmad Bhutta1 and Shagufta Nighat5
...farms and put to biofilm detection and antibiogram. Based on collected data with statistical inferences, the study found 61.60% of S. aureus from subclinical samples, while 72.73% of S. aureus were positive for biofilm with uniform hike in samples from cattle (77.55% bpSA) and buffalo (70.48% bpSA). Udder condition/consistency, teat dip, teat abnormality, tick infestation, body condition, mastitis knowledge, treatment approach, and therape...
Faryal Saad1,3, Zia Ur Rahman2, Aamir Khan3, Rabia Noushin4, Irfan Ullah5, Farman Ullah Dawar3,Shahid Naiz Khan3, Rafiqe Hussain6, Kenza Javed2Abid ur Rehman7, Amna Fayaz3, Zohra Saifullah3 and Kalim Ullah3*
...prevalence and molecular detection of CMV infection among pregnant women of districts Lakki Marwat and Bannu of Khyber Pakhtunkhwa. A total of 188 blood samples were randomly collected from pregnant women of both districts and were examined through Enzyme-Linked Immunosorrbent Assay (ELISA) and Polymerase Chain Reaction (PCR) for CMV. Out of total 88 samples, 73.40% were positive for CMV through ELISA and 57.44% were positive for CMV through PCR respectively.<...
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
...ant coated tubes for the detection of Theileria piroplasms. DNA was extracted from collected samples and subjected to PCR amplification to determine ovine and caprine theileriosis. Through a questionnaire, the data regarding animals as well as herds characteristics were gathered to define the risk factors favors the spread of Theileria spp. infection. 24% and 8.5% Theileria infection identified through PCR and microscopic examination during present investigati...
Ahmad Sadiq1, Muzafar Shah2*, Habib Ullah1, Irfan Ali1, Amir Alam3
Navid Jalil1 and Muhammad Khan3
...moglobin (HbA1c) for the detection of lipid profile and CVD. In recent study 108 (56 males and 52 female) type 2 diabetes (T2DM) subjects were diagnosed at Hayatabad Medical Complex (HMC) Peshawar and private diabetic clinic “Khattak Medical Centre” (KMC), Dabgari Garden Peshawar, Khyber Pakhtunkhwa, Pakistan. The normal or control group consists of twenty (9 females and 11 males) people having no history of diabetes mellitus, hypertension and card...
Oluwatobi Emmanuel Olaniyi1,2*, Chukwudiemeka Onwuka Martins2, Mohamed Zakaria2
...unter rate and effective detection radius of PPI and AP between PIW and PW. Both wetlands had low site occupancy, an unevenly distributed and non-significantly relative abundance (p>0.05) of PPI and AP. PW recorded the higher estimates of site occupancy, naïve occupancy and detection probability by PPI and AP. The findings implied that PW is more abundant in PPI and AP as compared to PIW. Also, it ascertained ...
Ashara Sajid1, Muhammad Usman Ghazanfar1, Saeed Rauf 2, Zahoor Hussain3, Salman Ahmad1 and Yasir Iftikhar1,*
...ly detects the molecular detection of CGD in already identified samples through the iodo-starch test but also provides reliability for quick indexing of disease in the aforesaid field. Moreover, molecular detection also revealed the (standardization) of primers used in previous and current studies. Characteristic symptoms combined with molecular detection would be useful to formulate the m...
Nasir Rashid1,2*, Javaid Iqbal1,2, Umar Shahbaz Khan1,2, Mohsin Islam Tiwana1,2 and Amir Hamza1,2
Abdul Hafeez1*, Akhtar Nawaz Khan2 and Zahid Ullah3
...olders for early disease detection.
...
Humza Sami1, Mahnoor Sagheer1, Muhammad Amir Altaf1, Javaid Iqbal2 and Muhammad Zubair1,*
 
...ging, especially for the detection of breast cancer at early stages. 
...
Kamal Al-Samawi1, Mohamed Al-Hassan2, Hussein Migdadi3,4*, Megahed Ammar5 and Salem Alghamdi3
...i>) mRNA levels in early detection of pregnancy in Aardi goats compared to progesterone and ultrasound (US) were evaluated. Female goats were synchronized using the ovsynch protocol level in combination with natural mating (NM). Blood samples were collected at 1, 7, 15, 23, 35, and 60 days post NM. Levels of ISG15 and ISG17 mRNAs were assayed using real-time PCR, and serum progesterone (P4) concentrations were assayed using an ELISA kit...
Eman Khalifa1*, Riad Khalil2 and Haitham Elaadli3
... used for prevention and detection of tuberculous mastitis in buffaloes’ farms. The general public health should also be intensely warned from consuming raw or unpasteurized milk. All these prophylactic measures will eventually lead to a positive impact on public health.
...

Joseph Anejo-Okopi1*, Jennifer Ifeoma Okpara1, James Mogoret Dabol1, Joshua Adetunji1, David Adeniyi2, David O. Amanyi3, Otobo I. Ujah4, Veronica David1, Patience Omaiye5 and Onyemocho Audu6

...tients for HDV for early detection to avert subsequent development of end stage liver disease. Furthermore, larger studies are needed to gain better understanding of the HDV infection among chronic hepatitis B patients in endemic regions and other high-risk populations.

...
Fuhua Zhang, Yishuang Yu and Shibao Wu*
...vely, after B-ultrasound detection; pangolin MJ-X4 did not give birth to a cub. This study showed that B-ultrasound can accurately diagnose pregnancy in Sunda pangolins and detect the developmental status of their embryos and fetuses. As a method of pregnancy diagnosis, B-ultrasound is not only easy to operate, safe, and noninvasive, but also very intuitive and efficient compared with hormone detection methods. Efficient

 Ramadan, F. Abbas1;H.M.Salem1; M.H. Belal2, and A. M. M. Abd-Alla3*

...ory colony, leads to the detection and isolation of this virus from
Egypt. Injection of filtrate induced SGH symptom in 60% injected flies.
The salivary gland symptom was similar to the previously reported
symptoms of the MdSGHV. Examination of the SGH suspension with
Electron microscopy revealed the presence of rod-shape virus particles
with 500-700 nm in length and 50-70...

Ahmed F. Afify1, Mohamed A. Shalaby2, Ahmed A. El-Sanousi2 and Amal S. Gaber1

...%.
Molecular detection of EAV genome was performed only on 8 selected semen and
EDTA-blood samples which were giving highly distinct positive reaction in the
indirect ELISA. All samples were found negative to the presence of EAV genome by
real time RT-PCR. Trials of isolation on different types of cell cultures were done on
the 4 described semen samples; RK-13, VERO-1008, BHK-21 AND MDBK cell lines

El-Habbaa, A.S.

...cken eggs (ECE), antigen detection using agar gel
immune-diffusion test (AGIDT) and indirect-Immunofluorescence assay (IFA) and
molecular detection of viral DNA using PCR. Positive results were showed in 36 of
samples (28/30 of sheep samples and 8/10 of goat samples)upon isolation on ECE by the
3rd passage and 22 of samples (17/28 of sheep isolates and 5/8 of goat isolates) usi...
Mansour, L. L.*; Othman, B. A. **; Abd-EL Ghaffar, M. H. **; Eman, M. Marai** and Sahar, A. Youssef* 

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

...es‟ stain was used for detection of
witches‟ broom infection midribs of the symptomatichibiscus plant. The phloem of
infected tissues showed scattered area stained bright blue. Molecular detection utilizing
nested and direct PCR as well as DNA sequencing was used for the diagnosis of the
witches‟ Broom infection. Total DNA was isolated from leaf tissues of infected hibisc...

D. N. Abd-elshafy1, 2 and M. M. Bahgat2, 3

...efinitely facilitate the detection of the virus both in clinical or environmental samples using cell culture techniques.

...

Enas K. Abo-Elmagd,Kouka S. Abd El-Wahab,Azza H. El- Salakawy

...ICA) as a rapid test for detection of RV antigen in stool specimens collected from Egyptian infants and young children with ELISA, and nested reverse transcription polymerase chain reaction (RT-PCR). Furthermore, to study the frequency of RV infection in Egyptian infants and young children during the summer season 2012 and the effect of certain risk factors including age and gender on the extent and impact of RV infection. The study included 73 infants and you...

Ebtisam, A. Abouel yazeed1; Yanni, M.I.1 and Hanan A. Fahmy2

...some farms in Egypt. The detection was done by ELISA and indirect fluorescent antibody technique (FAT) as well as molecular method as real-time quantitative reverse transcriptase PCR (RT-qPCR) from samples collected during neonatal diarrhea. Six out of forty tested samples were found positive for rotavirus (15%) infection using ELISA test. Successful isolation of the rotavirus on MDBK cell line from two samples from the positive ELISA samples. The beginning of...

Hanaa A. Ahmed1 and Eman M. AboHatab2

...e method for LSD antigen detection. nodules were subjected directly to PCR and Real time PCR for rapid and specific detection of LSDV, sixteen out of the twenty one nodular samples were confirmed positive by molecular methods. Eleven out of twenty one nodular samples were positive by (IFAT) in CAM, which prove that PCR and Real Time PCR are much sensitive and rapid diagnostic tool of LSD reflecting their importance in contro...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...it used for FMDV antigen detection for the epithelial suspension from 42 field samples collected from various geographic locations 10 governorates are ( El-Sharkia,Giza, Port Said, Assuit, Suize, Kafre El-Shake, Qina, Al-Gahrbia, Domiatte and Alexandria) Serotyping and molecular characterization by polymerase chain reaction PCR for (31) samples as FMD Serotype O , (2) Serotype A and (3) serotype SAT2 the samples collected from outbreaks in period November 2013...

Nashwa M. Helmy1 and Ahmed S. A.2

...nd as a consequence, the detection of these
antibodies is not serotype restricted. The current study aimed on detection of early NSPs
in apparently healthy cattle, and detects FMDV by real-time RT-PCR and Indirect
sandwich ELISA in suspected samples. The serum samples were collected from Sharkia
and Fayoum governorates (30 and 40 sera respectively) submitted to laboratory
...

Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc

...nd HI, respectively. The detection of both H5 and H9 antibodies in (4) samples indicated that co-infection may occur, while (10) samples were only containing H9 antibodies and (1) sample was H5 positive by HI test. The AIV positive samples were detected in (9) species belongs to (5) orders and (7) families. The Anseriformes and Charadriiformes orders had the most frequently sero-positive species to AIV. In conclusion, the presence of H5 and H9 subtypes provide...

Allam A. Megahed1; Hoda M.A. Waziri2; Khaled A. El-Dougdoug3; Badawi A. Othman3; Sirag M. Lashin1; Mohamed D. Hassanin1 and Mahmoud A. Ibrahim4

...an isolates specific for detection of sugar beet viral infections as a good replacement of foreign ones.

...

Samah A. Mokbel, Ahmed K. El-Attar

...A was examined using PCR detection before and after treatments. The different
treatments of radiation resulted in different survival rates and phytotoxic effects
including leaf yellowing and lack of growth. The 5Gy dose was proved to be best
effective dose for controlling the phytoplasma without affecting the in vitro growth
and survival rate, while the higher doses leaded to strongly reducing the survived
...

Samah A. Mokbel1, Ashraf A. Abd El-Mohsen2

...onstrated by serological detection were used as a source for virus-free minitubers production. This achived by subjecting tubers directly to thermotherapy treatment at 36ºC, 37ºC or 38ºC for three weeks which resulting in 50%, 70% or 80% of PLRV-free tubers and 0%, 16.6% or 33.3% of PVX-free tubers respectively. Moreover, no effects on the survival rate of tubers were detected. High percentage (93.1% or 76%) of PLRV- or PVX-free plantlets was ac...
Aly M. Abdel-Salam1, Rehab A. Dawoud2, Amira M.E.Aly2, and Salama M. El-Saghir2

Mohamed I. Azzam1, Safaa M. Ezzat1, K. A. El-Dougdoug2, Badawi A. Othman2

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...cular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis.

...

Elharony, S.B.1,3, SaharA.Youssef2 and Richard F. Lee3

...iv>
and virus like detection and identification. The method provides a
pure preparation of un-degraded RNA and DNA in high yield and
can be completed within 2 h. It is particularly useful for processing
large number of samples and for isolation of RNA and DNA from
small quantities of tissues. The method does not require expensive
and environmentally hazardous reagents and equipment. It can be
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
...
involved. A detection of infected tomato plants, which showed symptoms of big bud,
witches'-broom and phyllody, in all regions of the screened governorates, reacted
positively when assayed by nested polymerase chain reactions (PCR) using universal
phytoplasma-specific primer pairs P1/P7 and R16F2n/R16R2. Similar assays were used
to detect phytoplasma interactions with experimentally host plant. Diene...

Magdy, Mariam1 ; Abou ElHassan D.G. 2 ; and Salem, S.A.H 3

...of vaccinated animals by detection of antibodies
against serotypes of FMDV (A),(O) and (SAT-2) by (SNT) as well as by analysis of negative
Non Structural Protein sera by solid phase competitive ELISA for differentiation between natural
infected and vaccinated animals by detection of Non-Structral protein of FMDV by priocheck
test. Five hundred sera were collected from vaccinate...
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...asmid for optimizing the detection of the virus from field samples by PCR using 2 sets of primers one of them includes the whole length of the gene about 1209 bp while the nested one from the start ATG is 1000 bp ,seven out of nine samples have been reported positive by the 2 sets of primers, then the specific band at the expected size of the whole length of EHV-1 (EHV-1gD) gene of the local isolate was sent for sequence analysis, multiple alignment revealed s...

Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

...d to sterility tests for detection of bovine viral diarrhea virus as possible extraneous virus contaminant using RT-PCR and detection of mycoplasma as possible bacterial contaminant using PCR technique. All of the four batches were positive when tested using specific primers and they were free from BVDV or mycoplasma contamination. Results in this study showed that molecular techniques could be used for rapid evaluation of P...

Ola Youssef 1; EL-Deeb A.H.2 Nassif S.A.1 and Ahmed A. El-Sanousi 2.

... significant for H5 gene detection and titration using polyclonal H5 serum. The HVT titer in CEF
was 3045, 3200, 3400, 3750 & 4000 PFU/dose for batch A, B, C, D, and E respectively. The selected
batches safety was satisfactory by 10 fold field doses injection in SPF chicks. The challenge test results
revealed 80% protection for A, B and C batches while D and E batches gave 90% protection. The
shedding of chal...

Salama M. El-Saghir1, 2

...ere used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the pr...

Salama M. El-Saghir1, 2

... primers for phytoplasma detection, P1/P7, in the first step.
The PCR products were re‐amplified with nested‐PCR to verify phytoplasma incidence using the
nested primers R16F2/R2.
Results: DAS-ELISA confirmed the presence of PNRSV in the tested peach trees. For phytoplasma
incidence, the universal primers P1/P7 amplified one fragment of about 1800 bp in length. Nested PCR
amplified amplicons of 1,...

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

... and amino acid sequence detection. Results: NDV Giza 2014 isolate and NDV Qualubiya 2014 were characterized as velogenic and lentogenic strains, respectively using Mean Death Time (MDT), Intracerebral Pathogenicity Index (ICPI) and studying amino acid motif of the F protein cleavage site. Phylogeny put NDV Giza 2014 in a separate branch independent from other Egyptian isolates, however it is more related to Lasota (genotype II) and Clone 30 vaccinal strains, ...
Muhammad G. Khodary1, Ayman H. El-Deeb2, Mohamed M. Emara2, Othman E. Othman1, Hussein A. Hussein2
...n reaction (rRT-PCR) for detection of
FMDV. The highly viral loaded FMDV positive samples were typed by conventional reverse
transcriptase polymerase chain reaction (RT-PCR). Sequencing and phylogenetic analysis of 6
representative samples were performed.
Results: Testing of 80 collected samples of Oropharyngeal, oral epithelial tissue and/or vesicular
fluids by real time Reverse transcriptase polymer...

Naglaa F.S. Awad1, Gamelat K.F. Kotb2

...egions) revealed neither detection of recombination points nor sites
under positive selection.
Conclusion: The obtained results indicate that non-hemagglutinating RHDVa G6 variant viruses are
currently circulating in Sharkia with the ability to infect both young and adult rabbits that may be due
to inadequate application of vaccine and not due to vaccine mismatch. We recommend broad
application of cur...

Lamiaa M. Omar, Mohamed A. Abdrabo, Dali M. Omar, Nermeen A. Marden

...r by molecular assay for detection AI virus specific nucleic acids such as (rRT-PCR).
Methods: Titration of the HPAI virus for infection of SPF chicken. The tracheal swabs were collected
from diseased chicken for virus isolation and quantification by ECE inoculation and rRT-PCR.
Results: the titer of original HPAI virus was 1010.3 EID50/ml. The AI titers after experimental
infection of chicken and viral re-isolat...
Rasha M. Mahrous1,4, Ahmed K. El-Attar2, Ahlam A. AlWatban1, Sohair I. EL-Afifi3,
Nagwa M. Aref1,3
...>
Cytopathological detection referred to Diene's stain was used to differentiate the phloem tissues of leaf
petiole sections from infected trees. The phytoplasma was detected in the sieve tubes and parenchyma
cells of leaf midribs by Transmission Electron Microscopy (TEM). Phytoplasma was molecularly
detected in symptomatic samples using the specific primers of their 16S-23S rRNA gene by PCR.
Results: The P...

Ahmed A. Azab, Wesam H. Mady, Ali Zanaty, Mahmoud Samir

...nd was confirmed for IBV detection by Reverse Transcriptase Real
time PCR (RRT-PCR) using IB specific primers. Comparison of different isolation methods was done
by generating a standard curve by real time PCR.
Results: The results revealed that the propagated virus in CEK showed the highest virus titer (5.952 x
106 and 3.245 x 106) than Vero cell line (7.184 x 101 and 2.14 x 103) and ECE (7.536 x 103 and 5.444 x...
Ashraf S. Khameis, lamya F. Atteya, Ayman H. Mansour, Heba A. Abdelhady, Ashraf A.
Saad

Dina A. Abdulrahman1, Ayman H. EL-Deeb2, Momtaz A. Shaheen1 & Hussein A. Hussein2

...ains to ensure the rapid detection of any
new or mutant strains and update the used vaccine accordingly.
Methods: Twelve epithelial samples were collected from cattle showing signs suspecting of FMD.
The samples were tested by real time RT-PCR using universal primers for detection of all seven
serotypes of FMDV. The positive-resulted samples were then tested using conventional ...

Shimaa M. Mansour, Reham M. ElBakrey, Ahmed Orabi, Haytham Ali, Amal A. Eid

...tions. Further molecular detection of ARV within the 18
clinically affected samples (n=18) by RT-PCR using a specific primer set targeting a conserved
sequence within ARV- sigma C protein revealed 7/18 positive samples. All positive samples (7/18)
were successfully isolated on specific pathogen free embryonated chicken eggs (SPF-ECE). Additional
RT-PCR testing and re-isolation of ARV from ECEs of a breeder flock ...
Dalia M. Omar1, Nermeen A. Marden1, Lamiaa M. Gaafar1, Elham A. El-ebiary1, Khalid El-Dougdoug2, Badawi Othman2, Abd Elsattar Arafa3, Hussein A. Hussein4
...t study was designed for detection, isolation, identification and characterization
of Avian influenza viruses (AIV) circulating among poultry in 2016 to determine its suitability to be
used in vaccine quality control in Egypt.
Methods: The newly isolated virus was identified and subtyped antigenically by serological test as
Haemagglutination inhibition (HI) using standard AI antisera for H5 antigen and geneticall...

Nermeen A. Marden1, Lamiaa M. Gaafar1, Hussein A. Hussein2

...d was done by the direct detection of the viral content and viral identity using
the rRT-PCR technique from final product of these inactivated vaccines.
Results: The data of this study showed that sufficient HA antigen content and similar HA sequences
with the field HPAI challenge viruses are needed to produce a consistent and high protection percent,
but, they are not enough to assess the vaccine efficacy.
...
Sahar Mubashar*, Tariq Mukhtar and Nasir Ahmad Khan
...methods are used for the detection of the virus such as nucleic acid and immunological methods but RT-PCR is considered as the most reliable. Some antiviral drugs have shown to be effective against the virus like Favilavir, Remdesivir, Chloroquine, hydroxy-chloroquine, Tocilizumab etc. but further clinical studies are required to confirm their efficacy. In Pakistan, blood plasma therapy is in high demand but involves the risk of transmission of blood borne pat...

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

...iv>
Then Molecular detection of LSDV with PCR using G-protein-coupled chemokine receptor (G-PCR)
gene primer revealed positive result for LSDV, So classical Isolation of LSDV was started by
inoculation of nodules on Chorioallantoic membrane (CAM) 9-11 day old SPF eggs, then adaptation
on Madin-Derby bovine kidney cell line ( MDBK ); confirmation of LSD isolated virus was done by
using Electron microscopy (E...
Nagwa K. Meselhy1, Mohamed A. Abo El-khair1, Basem M. Ahmed2, Sherif A. El-Soally3,
Abdelhamid M. Fares1, Mohamed A. Nayel1 and Hussein A. Hussein2
...priate technique for the detection of EHV-1 present in blood
of a latently, or silently infected horses. The application of this nested PCR is considered to be a rapid
diagnostic tool for use in veterinary laboratories. Thus it will enhance the detection and
characterization of the circulating EHV-1 in Egypt. Control strategy for EHV-1 viruses in vaccinated
and non-vaccinated a...
Othman N. O. Mansour 1, Naglaa Hagag 2, Momtaz A. Shahein 1, Sayed S. Hassan 1 Ahmed
A. EL-Sanousi 3 and Mohamed A. Shalaby3
...ttoirs were negative for detection of MERS-CoV. All 98 nasal swabs and
serum samples which collected from local breeds of camel's farms were negative for MERS-CoV or its
specific antibodies. Phylogenetic analysis of coronavirus ORF1a partial sequences in some positive
nasal swab samples of imported breeds (with accession number on gen bank; MH184776, MH184776
and MH184777) confirmed presence of different branch o...

Ayman S. El-Habbaa1 and Mervat E. Radwan2

...e: To investigate strain detection and genetic analysis of BEF virus among suspected cattle in
August 2017, Qualyubia, Egypt.
Methods: Partial sequence was generated after detection by reverse transcription-polymerase chain
reaction (RT-PCR) and subsequent gel purification of the amplified products of G gene of BEF virus.
Results: BEF virus was circulating in this region. Seque...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...
potato tissues, and detection of PVM in commercial potato seed tubers using RT-PCR.
Methods: The PVM was detected in symptomatic infected potato plants during growing seasons for
the cultivated commercial local tuber seeds using Double Antibody Sandwich-Enzyme Linked
Immuno-Sorbent Assay (DAS-ELISA). The PVM was mechanically isolated on potato cv. Diamant.
Host range was carried out by mechanical inoculation...
Samira M. Bolis1, Magda Mahmoud2, Salah E. Gumma3, Naser E. Bilal1 and
Isam ElKhidir4

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

...he current work aims the detection and molecular identification of phytoplasma infecting
Gazania in Egypt.
Methods: Phytoplasma disease was detected and isolated from naturally infected gazania plants during
surveys in flower nurseries and open filed in Giza governorate, it was transmitted from naturally
infected Gazania to healthy periwinkle and other ornamental plants by dodder (Cuscuta reflexa ), and

Wesley D. Nafarnda, Japhet H. Baraya, Olatunde H. Olabode, Malang K. Simon

...>
Result: Antibody detection showed seroconversion in chickens 28day post vaccination and post
booster vaccination with significant (P<0.05) antibody titer increase from 1:16 - 1:1024 and mean
GMT 2.87 - 5.09 amongst 61.5 - 87.0% tested chickens. Questionnaire further showed V4
thermostable ND vaccination had significant effect on morbidity, mortality, hatchability, culling and
ultimately the flock produ...
Ahmed A. ElWakil1, Ausama A. Yousif2 , Adel A. Fayed3, Ibrahim M. elsabagh2, Mahmoud
El Gamal2, Omnia H. Refaei3
...y in ticks uses targeted detection of the viral
DNA polymerase mRNA and metagenomics analysis using MinIon technology.
Methods: A total of 34 adult female ticks were collected from three LSD clinically disease cattle that
were previously vaccinated using the Egyptian sheep pox (SPPV) vaccine, apparently healthy cattle in
contact with the diseased cattle, and one healthy animal located in a previously infected zon...

Ljupco Angelovski*, Zagorka Popova, Katerina Blagoevska, Sandra Mojsova, Marija Ratkova Manovska, Mirko Prodanov, Dean Jankuloski, Pavle Sekulovski

Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
... from dogs and molecular detection methods were used to identify the tick species and CME by amplification of the cytochrome oxidase subunit I and disulfide oxidoreductase gene, respectively. The results indicated that 1.29% of the serum samples were positive for E. canis, and 5.50% of dogs were infested with ticks. The Wenzhou samples of R. sanguineus exhibited a high homology (99.7%–99.8%) and these parasites showed a 99.1%–100% hom...
Mona Kadry, Sara Mohamed Nader*, Esraa A. Elshafiee and Zeinab S. Ahmed
...e to carbapenemases. The detection of ESBL and carbapenemase- producing salmonellae from chicken in Egypt is confirmed and represents a major public health problem.
...

Asim Faraz1*, Abdul Waheed1, Nasir Ali Tauqir2 and Muhammad Shahid Nabeel3 

...vior and may be used for detection of rutting and non-rutting males.

...
Amjed Ali1, Muhammad Tayyab1,*, Sehrish Firyal1, Abu Saeed Hashmi2, Asif Nadeem3, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1
...or antibiotic resistance detection in bacteria. This project was an initial step for the production of β-lactamase for clinical diagnostics in Pakistan. The current work deals with the optimization of conditions for higher level production of recombinant β-lactamase from Bacillus subtilis R5. Supplementation of LB medium with various carbon sources including wheat bran, rice bran and molasses could increase the enzyme production from 25 to 43....
Congfen Zhang1,Yingxiao Liu2, Linfeng He2, Fengjun Shi2, Weitang Yao2 and Xuegang Luo2,*
... used as a biomarker for detection of heavy metal contamination.
...

Mst. Deloara Begum1, Md. Muniruzzaman1, Md. Salauddin2* and Md. Mostafizer Rahman1

Wei Luo 1,2,3, Yongtao Jin 1,2,3, Xuqing Li 1,2,3 and Ke Liu 1,2,3*
...he mask generated in the detection of the MASK R-CNN, following which the information of both the population number and the distribution of all kinds of large herbivores can be estimated. According to the data of domestic herbivores on hand provided by the General grassland station of Qinghai province, the difference percentage of Tibetan sheep, yak, and horse is 7.5%, 8.1%, and 18.7%, respectively.
...

Adel M. Abdelrahman1, Sahar R. Mohamed1, Soliman M. Soliman2, Sherif Marouf3* 

... respectively. Molecular detection of ESBLs encoding genes in P. aeruginosa recorded that blaTEM genes blaSHV and blaCTXM genes were detected in percentages of 64.7%, 47.0 % and 29.4%, respectively. Finally, ESBL P. aeruginosa showing multidrug antimicrobial resistance that detected by mexR gene.

Keywords | Camels, P. aeruginosa, ESBL, Antibiotic resistance, Virulence genes 

...

Eman H. Mahrous1, Mohamed. W. Abd Al -Azeem2, Faisal A. Wasel1, Waleed Younis2* 

Asad Ullah1*, Umar Sadique2, Ibadullah Jan2, Imad Khan1, Raheela Taj3, Mumtaz Ali Khan4, Salah-ud-din4, Naimat Ullah Khan1

Ardi Prasetio1*, Christina Maria Sri Lestari2, Sutaryo Sutaryo2, Manar Fayiz Mousa Atoum3,4Muhammad Zahoor5, Asma Nisar6 and Muhannad Illayan Massadeh7
...ation by blood parameter detection. Thus, this study investigated the BSLF substitution effect on rabbit blood traits. This study was performed using 28 wk old weaned male New Zealand White rabbits (1300 g ± 130 g) that were randomly divided into control group (T0) and treatment group (T1, T2, T3), which respectively substituted 0 %, 10 %, 20 %, and 30 % SBM with BSFL. Blood samples were collected from the right ear marginal vein. The result showed an i...
Tabinda Urooj1,*, Bushra Wasim1, Shamim Mushtaq2, Syed Nudrat Nawaid Shah1, Lubna Faisal3, Moazzam Ali2, Nabeela Rasheed1 and Syed Faizan Ali Rizvi4
...ge IV). Therefore, early detection will not only cure the breast cancer patients but also prevent them undergoing painful circumstances.
...

Aly M. Ghetas1*, Dalia M. Sedeek1, Hanaa S. Fedawy1, M.A. Bosila1, Hoda M. Mekky1, Kh. M. Elbayoumi1, 3, Mohamed M. Amer2 

Ghassan Zahid1, Sania Begum2, Sikandar Almani3, Sahir Hameed Khattak2, Rajesh Kumar Soothar4 and Shakeel Ahmed Soomro4*

...and Sr2/Lr27. Therefore, detection of slow rusting gene complex in these varieties with the assistance of molecular markers can be utilized for slow-rust resistance. Furthermore, the selected markers can be used as a primary choice for detecting rust resistance genes specifically in the wheat breeding population.
...

Noura El-Shahat Attia1*, Abd El-Khalek Ramadan El-Sheikh1, Mohamed Omia Siam2 

...light microscope for the detection of fungal spores or mites. Blood samples were taken for hematological analysis, along with taking serum samples for biochemical analysis. Rectal temperature, heart, and respiration rates were not significantly differed between the two groups. Packed cell volume (PCV), total erythrothetic count (TEC), white blood cells (WBCs), serum glucose, total proteins and serum Zn were significantly decreased. Moreover, while copper (Cu) ...

Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Kaiser Latif Cheema2, Abdul Ghaffar3, Imtiaz Ali4, Muhammad Jahanzaib Khalid2 and Zeshan Ali5

...ilable genetic stock for detection of most diverse and high yielding genotypes is a pre requisite for a successful crop breeding program. For this purpose, a research experiment comprising of sixty-eight elite chickpea germplasm genotypes along with two commercial varieties were sown under tri-replicate randomized complete block design during the winter season of 2020-21. D2 statistics, principle component analysis and cluster analysis were employed to detect ...

Mohammed H. Galhoum1, Hamza M. Eed2, Essam S. Soliman1* 

...cations versus molecular detection. A prospective study was designed to last for six months from March 2021 to the end of August 2021. A total number of 126 chicken samples (100 samples from five broiler chicken farms and 26 samples from two slaughterhouses) were collected from the Ismailia governorate. Each sample was composed of liver, intestine, and breast and thigh muscles. The study revealed a total prevalence of 35.7% (45 positives out of 126 samples). S...

Nargis Sardar1*, Maria Binte Sarfraz2, Sufian Rasheed3 , AKM Rezwan Sardar4 , Fahamida Zaman5, Arsalan Rasheed6,7* 

...uman blood plasma in the detection of Vitamin D from diverse samples, including Vitamin D production in nature. Among the most commonly used electrochemical biosensors for vitamin D detection are Ab-25OHD/SPE/ FMTAD, CYP27B1/GCE, SiO2/GO/Ni(OH)2/GCE, BSA/Ab-VD2/CD-CH/ITO, BSA/Anti VD/Fe3O4 PANnFs/ITO, BSA/Ab-VD/Asp-Gd2O3NRs/ITO, 25OHD Antibody, 25OHD, 25OHD Antibody, IoT Enabled Enzyme Embossed Biosensor, Au-Pt NPs/APTES/FTO...

Hong Liu and Rui Xu*

...best sensitivity for the detection of fetal kidneys in patients with pregnancy-induced hypertension. It is concluded that 3D-CPA ultrasonography could be used to quantitatively analyze fetal kidneys with gestational hypertension in pregnancy, providing a quantitative basis for prenatal diagnosis of fetal renal blood perfusion in patients with gestational hypertension. It could also be used to detect risk pregnancy in early pregnancy.

...
Alshimaa A. Hassanien1*, Asmaa Osama Tolba2, Asmaa A. A. Hussein3, Walaa M. Elsherif4
... were used for S. aureus detection in 150 meat products (50 grilled chickens, 50 grilled beef kofta, and 50 cooked beef meat) as well as 92 food handlers. 23S rRNA gene sequencing was done. Disk diffusion method was used for antimicrobial resistance detection, while the impact of casein and α-lactalbumin was evaluated by well diffusion method. Results indicated that 53 (35.5%) and 35 (38.04%) of meat products and food ...

Hazel Tamakan* and Huban Gocmen

...th VITEK 2 and mecA gene detection was performed by PCR. A total of 100 samples including 50 cats and 50 dogs were examined from 6 veterinary clinics. S. pseudintermedius (4%) and S. aureus (8%) were isolated in cat samples; S. pseudintermedius (56%) S. aureus (6%) and S. schleiferi (2%) were isolated in dog samples, and 3 MRSP strains were identified. Methicillin resistance of these isolates was found to be statistically significant (χ²= 90.013, p<...

Sonali Menamvar1,2,3, Kirubakaran Vinod Kumar1, Veeregowda Muniveerappa Belamaranahally2, Yella Narasimha Reddy3, Rathnamma Doddamane2, Shrikrishna Isloor2, Ramesh Poojari Thimmaiah2, Gurrappanaidu Govindaraj1, Bibek Ranjan Shome1, Vinayagamurthy Balamurugan1* 

...(n=56) were examined for detection of leptospiral antibodies using the Microscopic Agglutination Test (MAT), the gold standard serological test. The Chi-square and odds ratio analyses were employed to identify the important risk factors for leptospirosis in dairy farms. The study revealed that the seroprevalence of bovine leptospirosis at an individual animal and farm level was 39.8% and 75%, respectively, associated with age (p=0.041) and the health status of...

Mohamed Saeed M. Hassan¹, Hitham Abdel-Saeed1*, Kawkab Abd El Aziz Ahmed2, Ossama Mohamed Abdou1 

...plied on all animals for detection of the definitive common causes of anemia. Results revealed four main definitive causes of anemia included parvoviral infection (sub-group 1): 20 cases (36% of diseased cases), ectoparasitic infestation (sub-group 2): 18 cases (32%), malnutrition (sub-group 3): 7 cases (12%) and hepatic or renal diseases (sub-group 4): 10 cases (18%). The most recorded clinical manifestations in diseased dogs were pale mucous membranes, tachy...

Amal Hamad1, Ashraf M. Abu-Seida2*, Faisal A. Torad2, Nahed S. Thabet3, Shabaan M. Gadallah1

...avioral effects with the detection of changes in vital signs and blood values following injection of Nalbuphine HCl, Fentanyl citrate, Tramadol HCl and Meloxicam in dogs. Forty clinically healthy mongrel dogs were randomly divided into 4 groups (10 dogs each) according to the analgesic agent used. Doses of 0.5mg/kg Nalbuphine HCl, 5μg/kg Fentanyl citrate, 2mg/kg Tramadol HCl and 0.2mg/kg Meloxicam were given IV in groups A, B, C and D, respectively. The zer...

Amira M. Nowier1, Hassan R. Darwish2, Sherif I. Ramadan3, Nadia A. Abo El-Maaty2 and Othman E. Othman2*

Nahla Hamada Magd Khalil1*, Ihab Mahmoud Helal2, El-Desoky Hassan Ibrahim Dorrah1, Soad Ahmed Soliman Ismail3 

...amples were analyzed for detection of organochlorine pesticide residues (OCP) by gas chromatography. The results revealed presence of different types of OCP residues (Dichlorodiphenyltrichloroethane (DDT), dichlorodiphenyldichloroethane (DDD), chlorodiphenyldichloroethylene (DDE), Alderin, Dieldrin, Heptachlor, Heptachlor epoxide, Alpha hexachlorocyclohexanes (αHCH), Gamma hexachlorocyclohexanes (γHCH), Endosulfan and Gamma chlordane (γ-chlor...

Muhammad Ali Raza1*, Aneela Zameer Durrani1, Muhammad Hassan Saleem1, Kamran Ashraf2, Muhammad Muddassir Ali3, Kumayl Hassan Akhtar4 and Nazia Rubab5

...man) milk in Lahore. Kit detection and HPLC methods were used to identify ABs residues. The samples were collected from Lahore. Raw milk of buffalo and cow collected from the open market have shown 23.5% as the highest positive and UHT milk as the lowest positive 8.5%. Thus, it is an indispensable question to be further explored prospectively. 
 
Novelty Statement | The det...

Basanta Kumar Adhikari1*, Deepak Subedi1*, Sumit Jyoti1, Krishna Kaphle2, Chet Narayan Kharel3, Doj Raj Khanal4

...irst-ever report of sero-detection of CCPP antibodies in the goat population of Nepal. This article confirms the presence of CCPP in Nepal and the potential circulation of the pathogen to other parts of the country warranting the concerned authorities and farmers to be vigilant for keeping this disease at bay.

...

Shuhuan Li1*, Yongheng Bo2, Youzhi Li3 and Xiuzhen Yang2

... 0.5 to 5.0 mg/kg, and a detection limit of 0.25 mg/kg, providing an effective and reliable method for the detection of atropine residues in beef. 
...

Muhammad Shaheen1* and Abdullah2

...e the method for outlier detection on the basis of the threshold value. The threshold value of the outlier named as clus_span is computed by taking distance of each point from each other point and dividing it by the total number of points. All the points of a dataset that do not qualify the value of the minimum threshold are considered as outliers. New K Means with this add-in is tested on benchmark dataset for identification of outliers and compared with the ...

Sher Bahadar Khan1,*, Mumtaz Ali Khan2, Irshad Ahmad3, Faheem Ahmad Khan4, Hamayun Khan1 and Sher Ali Khan5

...usion method followed by detection of their respective antimicrobial resistant genes through PCR. Among them, the highest prevalence of Staph. aureus was found in Peshawar-Mardan division (30%), followed by Malakand (28.5%), Bannu-Dera Ismail khan division (25%) and Hazara division (16%). Over all the high resistance was found against Lin (96.25%) followed by AMX (82.5%), TET (63.75%), AMP (58.75%), SXT (50%), CHL (48.7%), CLR (36.25%), STR (25%), GEN (17.5%),...

Ghassan Zahid1, 2*, Sara Iftikhar3, Muhammad Umer Farooq4 and Shakeel Ahmed Soomro5

...fication studies, hybrid detection, disease diagnostics and sex differentiation by administering the powerful diagnostic polymorphism detection tools at specific loci and the genome level. This review focuses on exploring the application, recent advancements and future implications of DNA-based molecular markers with the context of their role in the genetic improvement of fruit germplasm that is widely grown in Pakistan like...

Abdelrahman A. Abdelrahman1, Salama A. S. Shany1, Kareem E. Hassan1, Mansy A. A. Dardeer2, Ali A.1*, Magdy F. El-Kady1* 

...8%). An rRT-PCR used for detection of AIV-H9N2 and IBV showed high prevalence for IBV (88.2%) and AIV-H9N2 (52.9%), the highest rates of co-infection were MG-H9N2-IBV, Mycoplasma other than MG/MS, and H9-IBV with rates of (17.6%), (14.7%), and (13.2%) respectively, While for single infection were IBV (14.7%) and H9N2 (7.4%). The highest mortality rate was (30%) of co-infection with MG, IBV, and H9N2. The current study highlights the role of co-infection betw...
Mohammad Belal Shaker1, Waleed Rizk El-Ghareeb2,3*, Marwa Magdy Seliem4, Wageh Sobhy Darwish3, Bassam Abdulla Alhawas2, Ahmed E. Tharwat3
Noha M El-Motaily1, Ossama M Abdou1, Heba S Farag1, Kawkab A Ahmed2, Mahmoud Saber1*
...ical alterations. Beside detection of the antioxidant trace elements (Zn, Cu, Se) levels in dogs suffering from demodicosis. Results showed significant decrease in the value of (PCV) and (TEC). Affected dogs also showed leukocytosis associated with lymphocytosis. Hypothyroidism demonstrated by reduced levels of free T4 and significant decrease in antioxidant trace elements level (Zn, Cu, Se).
 
Keywords | Antioxidant trace elements...

Hend K. Sorour, Mohammed A. M. Saleh, Azhar G. Shalaby* 

...reast) were subjected to detection of colistin residues by HPLC (High-performance liquid chromatography). In this research, we used polymerase chain reaction (PCR) for the detection of the mcr-1 gene, and phylogeny was performed on three isolates to detect mcr-1 gene mutations and relationships. The percentage of isolated E. coli was 25.5%. All isolates showed resistance to colistin in disc-diffusion assay, while in MIC (min...

Asim Faraz1, Muhammad Yaqoob2, Nasir Ali Tauqir3, Hafiz Muhammad Ishaq1, Ayman Balla Mustafa4, Amir Ismail5, Muhammad Arslan Akbar6, Abdul Waheed1* and Muhammad Shahid Nabeel7

...rkers of early pregnancy detection in female dromedary camel. 
 
Novelty Statement | The study has significant values as it talks about the hormonal levels related to early pregnancy diagnosis in lactating Marecha she-camels, a contribution towards modern approaches in research of camel reproduction. As the Marecha camel is the main breed of Pakistan, playing very important role in rural economy of...
Sara Mohamed Hemeda1, R.H. Sayed2, Hani Hassan1, Sheima A.E.2, Hassan Aboul-Ella3, R. Soliman3*
...s been developed for the detection of β-lactams antibiotic residues in dairy milk. The developed LFK is based on a competitive immunochromatographic format using anti-antibiotic-specific polyclonal antibodies. Specific artificially induced active acquired polyclonal antibodies production were performed in female New Zealand rabbits against the following β-lactam antibiotics; Amoxicillin (AMX)- Keyhole Limpet Hemocyanin (KLH) and Penicillin-G (Pen G)-...
Zeinab R. Aboezz1*, Ayman S. El-Habbaa1, Rania S. El-Mohamady2, Samia A. Elnagar2, Ehab M. El-Nahas1
...20-2ncp.While Npro based detection was not succeeded to detect our HoBi-like Pestivirus in original samples or even in viral isolate despite their ability to amplify the BVDV RNA of reference strain (NDAL). Precisely, this study provides the first evidence of HoBi-like pestivirus infection in Egypt, raising prospective threat to Egyptian cattle industry.
 
Keywords | HoBi-like Pestivirus, Cattle, Phylogenetic analysis, 5`UTR
...

Xinjun Zhang1,2, Pengyong Wang1,2, Huimin Ju1,2, Yanhong Wang1,2, Yang Yang1,2* and Guoqiang Zhu1,2*

...iroN, and focA, with the detection rates of 71.4, 57.1 and 57.1% respectively; while papG allele I, papG allele I’, papG allele II, papG allele III, cdtI, sat, sfaS, iha and sat were not detected. Most of the isolated UPEC strains have a strong virulence on T24 cells and could induce strong immune response. Taking these data together, canine UPEC strain may not be a canine specific pathogen, but has a certain potential for zoonosis.

...
Gamilat A. Elsaid1, Weam Mohamed Baher1*, Eman Shukry1, Abeer E. Abd El. Ghafar2, Marwa Shalaby1
...ecular confirmation, and detection of shiga toxin coding genes (stx1, and stx2) in the recovered E. coli isolates was done using PCR. Moreover, the inhibitory effects of potassium sorbate (KS) and Bifidobacterium animalis subsp. lactis on the growth of E. coli O26 were screened. The estimated MPN of coliforms and E. coli in kareish cheese collected from grocery stores were 3.44 ± 0.12 and 2.22 ± 0.14. These values were 4.61 ± 0.11 and 3.60...

Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*

.... gondii) to improve the detection of toxoplasmosis in pet cats. Escherichia coli BL21 (DE3) was transformed with a prokaryotic expression vector, pET-21a-SAG2, which was constructed and induced to express a recombinant protein (SAG2), identified using SDS-PAGE and Western blot analysis. The purified protein was then used as a coating antigen to establish an indirect ELISA method for detecting the T. gondii antibody in pet cats, whose reaction conditions were ...

Shujaat Hussain1*, Muhammad Saqib1, Khurram Ashfaq1 and Zia ud Din Sindhu2

... blood variables for the detection of coxiellosis in camels additional investigations are obligatory.

...

Omnia Mohamed Khattab1*, Hala Kamel Abdelmegeed2, Mohamed Mahmoud Mashaly1, Mervat Hamdy1*, Naglaa Hagag1, Ayman Hamed3, Hanan Aly Fahmy3, Essam Ibrahim4, Momtaz Abdelhady Shahein2, Elsayyad Mohamed Ahmed2

... using various molecular detection techniques were done using the tentative diagnosis by rt-PCR. The presence of 16 liver and spleen samples out of 20 (80%) from aborted fetuses were positive for EHV-4, but all were negative for EHV-1. Virus isolation trial for EHV-4 were done, eleven samples out of 20 (55%) on the CAM of ECE were positive. The virus glycoprotein B (gB) fragment (580pb) was amplified in selected isolates using the nested PCR (n-PCR), sanger se...

Agus Mulyono

...ims to determine the sex detection process of Java sparrow through color and texture analysis of Java sparrow beak image with classification method using ANFIS and determine the level of accuracy. In this study there are 3 stages, namely preprocessing, learning stages and testing stages. The results of the Java sparrow sex detection accuracy through texture and color analysis of beak images using the ANFIS method are 90%. Th...

Gawhara Ahmed-Abdelmonem1*, Zeinab Aboezz2, Ahmed Habashi1, Saad Sharawi2 

Zahra Naz1,2, Fouzia Ismat1, Muhammad Saleem2, Mazhar Iqbal1, Aamir Shehzad1 and Moazur Rahman1,2*
...tic antigen for reliable detection of NDV infection in chickens. In the present study, we have devised a strategy for extraction and solubilization of the NDV M protein from Escherichia coli in a single step using a non-ionic detergent, lauryl-dimethylamine oxide (LDAO), enabling the purification of the detergent-solubilized M protein in a soluble form through affinity chromatography without compromising the structural integrity of the protein. Using the purif...

Hanan Saad El-Samahy, Amani Abd El-Naby Hafez, Mohamed Talat Ragab, Disouky Mohamed Mourad*  

Qi Zhuo, Yuanchun Yao, Meisongzhu Yang*, Jinhua Chen and Miao Tian

...ssion in cell lines; MTT detection of cell proliferation; wound healing test and transwell assay were used to evaluate the ability of breast cancer cells to metastasize and invade; colony formation test was conducted to detect the effect of HDAC8 on the cells. We found that the expression of miR-216b-5p protein in breast cancer group was lower than that in healthy control group (P<0.05); the expression of HDAC8 protein in the group was higher than that in h...

Veasna Chem1 †, Hong-Seok Mun1,2 †, Keiven Mark B. Ampode1, Shad Mahfuz1, Il-Byung Chung1, Muhammad Ammar Dilawar1,3, Chul-Ju Yang1,3,* 

... new technology for heat detection in gilts.

Keywords | Temperature, Proestrus, Estrus, Thermal camera 

...

Shomaila Sikandar1*, Imran Afzal1 and Sadaf Sarfraz2

...rch for early mycotoxins detection methods and making regularity bodies to contain the spread of mycotoxins. This review summarizes the occurrence and toxicity of five major types of mycotoxins associated with food and feed and their importance in human nutrition and animal health.
...

Muhammad Usman1*, Aneela Zameer Durrani1, Nasir Mehmood2, Muhammad Hassan Saleem1 and Mamoona Chaudhry3

...traction was followed by detection of 16S rRNA signature gene using B. burgdorferi s.l. specific primers through conventional PCR. We found that 4.3% dogs and 8.9% tick pools were positive for B. burgdorferi s.l. Rhipicephalus sanguineus (86.5%) was the most abundant tick species. 57.1% I. gibbosus and 8.4% R. sanguineus pools tested positive for B. burgdorferi s.l. Phylogenetically, our sequences clustered with B. burgdorferi sensu stricto, B. bavariensis, B....

Abhishek Pandit1, Suman Poudel2, Manish Gautam3* and Shambhu Shah4

...n, requirements for heat detection, number of hormone injections, number of cattle handled, and injection time. Increased labor and upfront cost of hormone treatment, standard degree of supervision, and decent handling facilities are some of the drawbacks of this technique. Successful estrus synchronization necessitates optimum nutrition, a good body condition score, the best semen quality, general health, and an efficient estrus detec...

Pharaoh C. Sianangama1*, Brian Tembo2, Sylvia J. Harrison1, Rubaijaniza Abigaba1,3 

...an be used for pregnancy detection, preferably towards month-end after insemination, in dairy cattle with seed germination parameter being sufficient to get reliable results.

Keywords | Dairy cattle, Maize, Pregnancy detection, Punyakoti test, Seed  

...

Jie Yang1, Wenjun Zhou2, Qi Zhang2, Lei Chu2, Zhenshi Chen1, Xiajun Zhang2, Weidong Wu3*, Shaoru Zhang1* and Lihui Wang1*

...spectively. The mutation detection of AZM-R related gene showed that there were single (A) nucleotide deletion mutation in mtrR promoter region, G45D mutation in mtrR coding region, G70 mutation in rplD and A2047G mutation in 23s rRNA allele, but no mutation was found in rplV. A total of 8 different STs were identified in 5 AZM-R strains, of which two ST1866 isolates showed a high level of AZM-R. The clinical isolates of N. gonorrhoeae in Danyang have high gen...

Muhammad Said1, Amjad Hussain Mirani1, Abdul Kabir*1,2, Muhammad Haris Raza Farhan3, Abdul Latif Bhutto1, Ghulam Shabbir Barham1, Khaleeq Ur Rahman Bhutto4, Muhammad Uzair1, Maaz Khan1 

...plex methods of mastitis detection, as identification of the etiological agents are vital to preventing mastitis in dairy cows.

Keywords | Mastitis, Diagnosis, Bovine Mastitis, Immunoassays, Diagnostic Techniques, Chronic Mastitis 

...

Syeda Batool Zehra1, Abdullah G. Arijo2, Aly Khan3, Nasira Khatoon1* and Samina Waheed1

...osis via PCR for pinworm detection has been performed. The findings in this research were based on two key factors: molecular analysis and statistical analysis. When traditional morphological techniques used with, molecular biology technologies it has proven to be effective in distinguishing closely related species. Statistical analysis is used to determine the intensity of infection in relation to age and gender. This study will focus on children who are susp...

Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2

Muhammad Tariq Navid1,2*, Mian Muhammad Awais2*, Muhammad Irfan Anwar2 and Masood Akhtar2

...chicken eggs. The direct detection through RT-PCR confirmed H9 gene from cloacal swab samples in 6.9% of the seropositive sample while we could not confirm any of the oro-pharyngeal samples for H9 gene through direct molecular detection. The cultivated oro-pharyngeal and cloacal swab samples were not found positive upon re-confirmation from allantoic fluid through RT-PCR by using same specific set of primers. This study conc...

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

Abdullah Iqbal1, Muhammad Abubakar2, Shumaila Manzoor3, Muhammad Kamran Ameen4 and Rani Faryal1*
 
...ivac vaccine. Antibodies detection was done using competitive ELISA from serum samples. Antigen shedding by vaccinated animals via nasal and fecal route was checked by the haemagglutination test and RT-PCR. All group 2 bucks, developed humoral protection against PPR within the 1st week. Only, 50 percent bucks of group 1 developed humoral protection against PPR after one week of vaccination. The mean percent inhibition value of competition-ELISA of group 2 was ...

Ayma Aftab, Samia Afzal* and Muhammad Idrees

...at has also been used in detection of corona virus. This case study emphasizes the importance of HRCT for early and confirm diagnosis of COVID-19 whereas RT-PCR results can vary. This process may show negative results and is time consuming.

...
Emel Hulya Yukseloglu1, Fatma Cavus Yonar1*, Omer Karatas1, Gulten Rayimoglu1, Faruk Asicioglu1, Elif Canpolat1, Onur Ozturk2 and Itir Erkan3
...y, specificity, limit of detection, dynamic range, limit of quantification, stochastic threshold study, reproducibility and repeatability, mixture and contamination study parameters. Validation parameters and population genetics data were calculated by using Arlequin v 3.5.2.2 version. According to our results, SE33 (PM=0.014) locus showed the greatest power of discrimination and TPOX (PM=0.132) has the least power of discrimination power in Turkish population...

Farah Naz1*, Asad Umair2 and Ghazala Noureen3

...the pandemic, like early detection, isolation of confirmed cases, and social distancing, were build and implemented on the assumption that COVID-19 is simply a health emergency that demands solutions from the life science alone. They failed to take into account structural inequalities present in societies that affect the ability of an individual to cope with this medical condition and follow the recommended strategies. As Geoffrey Rose (1992) concluded his sem...

Marwa S. Khattab1*, Ahmed H. Osman1, Huda O. AbuBakr2, Rehab A. Azouz3, Asmaa A. Azouz4, Heba S. Farag5 

... an insulated icebox for detection of the presence of ivermectin residues using the high-performance liquid chromatography (HPLC) technique. Skin histopathology and immunohistochemistry of collagen were performed. Results: Ivermectin was detected in 36 samples, out of them 15 contained high ivermectin levels (100 ppb). Chlorpyrifos, piperonyl butoxide, and acetamiprid were below the limit of quantification in 3 samples only. Histopathology of tick-infested ski...

Umar M. Bello1*, Samuel A. Ojo1, Abdurrahman Ghaji1, Ambrose A. Voh (Jr)2, Muazu N. Bappah3, Casmir O. Igbokwe4  

...unct tool during oestrus detection and for predicting time of ovulation in this breed; and furthermore, either of diurnal temperature rhythms, MRT or MVT can be used, in combination with other diagnostic tools, as a potential on-farm indicator of oestrous stage in Nigerian indigenous breeds of Red Sokoto does.

Keywords | Exfoliative vaginal cytology, Oestrus cycle, Red Sokoto does, Rectal temperature, Vaginal temperature 

...

Barbosa Carla1*, Gregori Fabio2, Thomazelli Luciano1, Oliveira Amanda1, Araújo Jansen1, Ometto Tatiana1, Marcatti Roberta3, Nardi Marcelo3, Paludo Danielle4, Utecht Nathalia1 and Edison Durigon1

...mplexity, studies on the detection and genetic characterization of these viruses are scarce, especially in South American wild birds. Thus, this paper aims to detect and discuss the diversity of these agents in birds at migratory stopping and wintering sites, along Brazilian Segment of the Atlantic Flyway. Therefore, 738 avian samples from different regions of Brazil were subjected to a RT-Nested-PCR protocol, with primers targeting RdRp region. Positive sampl...

I. K.A. Ibrahim1, Z.A. Handoo2† and A. B. A. Basyony1

...s were collected for the detection of cyst nematodes. The results showed
the prevalence of nine cyst nematode species associated with different crop plants: Heterodera avenae on wheat, H.
daverti and H. trifolii on Egyptian clover, H. leuceilyma on Bermuda grass, H. lespedezae on lentil, H. goldeni on
qasabagrass, H. schachtii on cabbage and sugar beet, H. zeae on corn and wheat and Globodera rostochiensis on
pot...

Salman Hussain1, Basit Zeshan2*, Rabiya Arshad1, Saba Kabir1 and Naveed Ahmed3

...ducted for the molecular detection of the mecA, mecC, and nuc gene among MRSA and to investigate biofilm formation among the methicillin-resistant Staphylococcus aureus (MRSA) clinical isolates. A total of 208 different samples were collected and processed for phenotypic and genotypic identification of MRSA. All MRSA isolates were subjected to antibiotics sensitivity, cefoxitin disk diffusion test, and vancomycin minimum inhibitory concentration (MIC) E-test. ...
Rafik Soliman1, Neven Waheeb2, Essam Nasr2, Mahmoud El-Hariri1, Heidy Abo-Elyazeed1, Hassan Aboul-Ella1*
...ay be unreliable for the detection of tuberculosis-infected cattle. 
 
Keywords | Bovine tuberculosis, tuberculin skin test, lateral flow kits for antibody detection, ELISA, Rapid diagnostics, dairy industry, Human health hazards, Granulomatous diseases
...

Eman S Ramadan, Mohamed E Ali, Mohamed A Elkhiat 

...iR-122) for liver injury detection involved in feline infectious peritonitis (FIP). Twelve cats were enrolled in this study. Cats were admitted to small animal hospital, Faculty of veterinary medicine, Cairo University. Cats were classified into six apparently healthy cats as a control group and six clinically diseased cats. All cats were exposed to clinical examination, abdominal ultrasonography, serum biochemical analysis as well as rapid feline infectious p...

Kamilla Gadzhimuradovna Alieva1, Patimat Mitkhatovna Daniyalova1, Svetlana Aleksandrovna Shemyakova2*, Kerim Khasanovich Bolatchiev2, Ismail Anatolyevich Bittirov3 

JAVERIA NEHAL1, ARIF MUHAMMAD KHAN1, AZHAR ABBAS KHAN*2, MUHAMMAD MUBIN3, HAFIZ MUHAMMAD TAHIR4 & JAVED IQBAL5

...ventional method for the detection of Xanthomonas axonopodis has been based on biochemical tests. A rapid and sensitive method for identification and detection of Xanthomonas axonopodis is required for management of citrus canker. PCR-based diagnostic test is appropriate for monitoring pathogen in a very short time compared to laborious, non-specific and expensive protocols. ELISA, Nested PCR has been used for many years in ...

Ahmed Abdel-Rady3*, Mohamed Karmi2, Menna_allah Youssef1, Aml M. Abdel-Ra’ouf1, Bahaaa Madkour1 

...eileriosis especially in detection of blood and lymph smears negative cases.
 

...

Hanaa M. Abdelkhalek1, Hanan E. Nagib1, Randa S. Elias1, Saad S. Mansour1, Walid S. Mousa2*

...tis origin. In addition, detection of some virulence and antibiotics resistance genes. Two hundred buffaloes were examined and sixty mastitis milk samples were collected from clinical cases from the period from October 2021 until March 2022. The acute mastitis sings were assessed according to cardinal signs of inflammation and milk abnormalities. Out of two hundred buffaloes, sixty (30%) were diagnosed as clinical mastitis according to inflammatory signs and t...

Omnia M. Khattab1, Morcos I. Yanni2, Hala K. Abdelmegeed2, Mahmoud Eliwa1, Naglaa M. Hagag1, Sara M. Elnomrosy1

Hala A. Amin1; A. Barakat2; A.A. Abou Zeid1

...ivity in the serological detection of CTV. This antiserum could be used at dilution or 1: 10.000 at the detection stage in an indirect ELISA (IDAS-ELISA) and was efficient for trapping the virus in standard ELISA. These polyclonal antibodies reacted with a wide range of CTV isolates from different Egyptian geographic sources, and or different biological properties.

...

E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2

... limiting factor for the detection of GFLV in infected vines. Both immunological and molecular detection methods provide tools assisting in the understanding of the epidemiology and diversity of nepoviruses as well as to facilitate resistance breeding, cultivar selection, and development of control strategies.

...

Hayam S. Abdelkader1; Gamalat M. Allam1; T. A. Moustafa2; and M. El-Hanunady2

...o amounts sufficient for detection and cytopathological analysis. Electron micrograph of the virus showed that it is quasi-spherical and its diameter ranges from 80 to 100 nm. The virus caused thickening of the cell wall and changes in the chloroplast structure. Virus identification was confirmed by Dot blot immunoassays. RT-PCR assays using primers complementary to the nucleocapsid protein gene (NPs) were used to detect two isolates of TSWV from Lycopersicum ...

Om-Hashem M. El Banaa l, A.A. Abou Zeid2, Fawzia I. Moursy3 and Azza, G. Farag

...echnique was applied for detection of S. citri Saglio et al in which the Spiroplasma was captured with the specific polyclonal antibodies on a solid-phase. Specific primers based on the sequence of the Morocco strains of S. citri Saglio (R8A2HP and G113) were used. Two pairs of primers SC. SC’ and SC8. SC9 were used. PCR fragment of correct size 330bp was amplified with primers SC. SC expressing spiralin gene and 760bp was amplified with primers SC8, SC9...

Sahar. A. Shoman1 and B. A. Othman2

...sensitive method for the detection or Tobacco mosaic virus- Egyptian strain (TMV-E). Total RNA extract of infected plant and RNA of purified TMV particles were subjected in this method with four degenerate and undegenerate primers. The primer pairs generated two specific PCR fragments of 3428 base pair (bp) and 3836 bp of the whole TMV genome. The intensity of these RT-PCR amplified products was estimated, and it indicated relatively to the amount of the virus...

M.A.S. El-Kady1, Om-Hashem M. El-Banna 2, E.A Salama2, Salwa N. Zein1

...pared antiserum was used detection of BSMV by serological methods i.e., Enzyme-linked immunosorbent assay (ELISA), Dot-blot and tissues-blot immunobinding assays (DBIA and TBIA). The presence of the virus was confirmed in mature seed parts and non-seed parts of the different five barley cultivars tested.

...

 Salwa N. Zeinl and Hanaa S. Zawam2

...d antiserum was used for detection Of ACLSV using ELISA dot immunobinding assay (DIBA). The presence of the virus was checked in blossom parts. (Petioles, stigma, and flower cup).

...

Pengliang Xie1, Lufang Zheng2*, Mingxia Dong3, Huaiqiang Zhang1 and Fang Chen1

...ol group (P<0.05). In detection of protein expression levels of sVEGFR-1 and sVEGFR-2 in patients with different severity levels, diffuse macular edema group had higher protein expression levels of sVEGFR-1 and sVEGFR-2 than the localized macular edema group (P<0.05), and cystoid macular edema group had higher protein expression levels of sVEGFR-1 and sVEGFR-2 than diffuse macular edema group (P<0.05). In the case of more severe macular edema, the sVE...
Saiwa N. Zein
...d antiserum was used for detection of T RV using dot-blot immunobinding assay (DBIA). This is the first report for isolation of Tobacco rattle virus Tohrarirus (T R V) from D.Kaki under the Egyptian conditions.
...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...nd Atlas show successful detection of 7 SCMV strains (A, B. D. E. H. l. and M). The indirect-enzyme-linked immunosorbent assay (I-ELISA) detection Of SCMV strains showed the presence or five strains. i.e., SCMV-A. SCMV-B. SCMV-D, SrMV-H and SrMV-I. The electron microscopy of SCMV-E-infected sorghum plant cells proved the presence or the cytoplasmic inclusions characterized to the potyviruses. The virus was purified and an an...
Balquees Kanwal1*, Syeda Saba Shah1, Syed Waqas Hassan2 and Farzana Shaheen3
...157:H7 strain of STEC by detection of Stx-1 and Stx-2 genes in 160 chicken meat samples, which are randomly collected from different regions of Northern Punjab, Pakistan. Isolation of pathogen from meat samples were performed with the use of International Organization for standardization based microbiological techniques, while chain reaction technique (PCR) was used for detection and characterization of Stx-1 and Stx-2 genes...

Natalia Shchur1,2*, Olha Chechet1, Tetiana Mazur2, Oleksandr Martyniuk2, Olga Gorbatiuk1, Halyna Buchkovska1, Iryna Musiets1, Diana Ordynska1, Olena Finkova3, Larisa Moskalenko3, Tetiana Ponomaryova-Gerasimyuk3, Maksym Lusta3, Vitalii Nedosekov2 

...iological method for the detection of Campylobacter according to the scheme of accumulation, isolation, isolation and identification according to DSTU ISO 10272-1:2007. As a result, 33 isolates of Campylobacter spp. were isolated, which is 1.6% of the total number of the researched samples. The most common phenotypes of antimicrobial resistance of the selected isolates were: Cip / Tet / Ery - 14 isolates from poultry, which accounted for 42.42%.  Tet...

Pawinee Kingkan1, Thanathip Supcharoenkul1, Chaowit Rakangthong1, Chaiyapoom Bunchasak1, Komwit Surachat2,3, Wiriya Loongyai1* 

...tinal morphology, E coli detection, cecal bacterial composition, and the incidence of diarrhea in nursery pigs for 6 weeks. A total of 800 pigs (Large White × Landrace × Duroc) were randomly allocated to two treatments: a basal diet supplemented with a mixture of amoxicillin and colistin (Amox-Co) and a basal diet supplemented with amoxicillin and 1 g/kg of a bacteriophage cocktail (Amox-Phage). Each treatment consisted of eight replicate pens, wit...

Suleman Irfan1*, Masood Rabbani1, Ali Ahmad Sheikh1, Sehrish Firyal2 and Arfat Yousaf Shaheen1

...rm Count, and Salmonella detection. The mean log values of total viable counts of meat samples of traditional poultry shops, super markets and processed meat were 5.70, 4.65 and 3.60, respectively and significant (p < 0.05) results were obtained. The mean log values of total coliform counts in meat samples were 2.7, 2.31 and 2.11, respectively. E. coli was predominant 73% in coliform count of all samples. Salmonella was found in 3.75% of samples in which re...

Yajuan Zheng, Qiuping Mo, Hongchao Tang, Qinghui Zheng and Dandan Guan*

...nalyzed by the transwell detection. Construct LGR5-knockdown, LGR5-overexpressing and LGR5-ΔC-overexpressing (lack of C-terminal tail) human colon cancer LoVo cell lines. The mechanism of the reaction between LGR5 and IQGAP1 was examined by immunoprecipitation. Expression of LGR5 and phosphorylation ratio of IQGAP1 showed opposite trends in breast cancer and normal body. Viability, migration and invasion ability of breast cancer cells were all affected b...

Skenndri Safae1*, Charrat Nadia2, Jmiai Mehdi3, Nassik Saadia1 

... geared toward pathogens detection. The microscopic lesions found on most of the farms of the P group on day 35 indicated the ongoing of a regenerative process, contrarily to the farms of the D and G groups, in which the guts still underwent inflammation on day 35. Coccidiosis infection was heavily widespread on birds at day 35. Differences between the farm in D and P groups weren’t striking as the disease was detected on the intestinal portions of almos...

Mehwish Malik1*, Zanib Sadia2, Muhammad Sajid3, Hammidullah1, Yasir Amin1, Zubair Ali1 and Sohail Ahmad1

...ed for ESBL E. coli. The detection of ESBL E. coli is done through DDST and CDT. It was noted that out of 210 samples 08 samples were found negative (no growth of any bacteria found) and 20 samples were shown growth other than E. coli suggesting a total prevalence of E. coli as 86.6 %. The prevalence of ESBLs in cecum of broilers in the present study is 53% of the total samples tested which is 61% of total positive samples. This current situation of prevalence...

Yakun Ge

...n fluorescence intensity detection. Cell proliferation was detected by MTT method. Combined treatment promoted the production of ROS. The cell viability of the combined treatment group was lower than that of the control group at 24h, 48hs and 72h (P<0.05). Compared with the control group, the expression level of E-cadherin mRNA in the combined treatment group increased (P<0.05), and the expression levels of N-cadherin and vimentin decreased (P<0.05). ...

Irtaza Hussain1, Muti ur Rehman Khan1*, Asim Aslam1, Masood Rabbani2 and Ahsan Anjum1

...h day post-infection for detection of antibodies, and essential information related to potential risk factors was collected through a questionnaire from fourteen districts of Punjab, Pakistan. Serologically positive samples were processed through PCR for confirmation using scab samples by identifying the GIF/IL-2 gene. This study found an overall 13.2% seroprevalence of contagious ecthyma infection, indicating a higher percentage in goats (14.6%) than in sheep...

Ijaz Ahmad1,5*, Haihong Hao1, Pascal Sanders2, Zafar Iqbal3, Saeed Ahmed4, Farhan Anwar Khan5, Zahir Shah5, Muhammad Ibrahim6 and Lingli Huang1

...ation (LOQ) and limit of detection (LOD) were 0.04 and 0.01 µg/mL. The recovery of cefquinome from plasma was 73.4%, 78.33%, and 77% for low, medium and high concentration samples. The intraday and inter day relative standard deviation were less than 15%. The Cefquinome were found to be stable for more than 3 month at -70oC (degree symbol) and more than 24 h at 4oC. The present method has been applied successfully for the pharmacokinetics study in cattle...

Xu Yun-Ming1*, Sun Zhi-Yuan1, Yang Jian-Bo1, Bian Rong-Rong2, Ren Hong-Lin3, Zhong Si-Yuan1, Cai Yu-Hong1, Peng Jing1 and Bao Hua-Xia1

...esult by LAMP assay. The detection limit of B. cereus genomic DNA(gDNA) by LAMP was 0.755 pg/μL which was 100 times more sensitive than conventional PCR assay. The CFU limit of LAMP assay was 14×103 CFU/mL. The artificial polluted samples (chicken meat) can be detected by LAMP, when at least 45 min must be needed to enrich bacteria. Visual dye hydroxynaphthol (HNB) successfully used in LAMP assay was established for detection<...
Akram Ali Baloch1*, Adeel Ahmad2, Kaleem U. Kakar3, Sara Naudhani1, Samiullah Khan1, Agha Muhammad Raza3, Imrana Niaz Sultan1, Humaira Zahid4, Saadullah3 and Shakeela Daud1*

Rimsha Ijaz, Rida Zahra, Naseer Ali Shah*, Haroon Ahmed, Nazish Bostan and Sadia Sattar

...d by HCV, having precise detection methods that allow for early diagnosis and care for better outcomes is critical.

...

Liyun Chang*, Yazi Li, Yumei Cai and Chenghui Li

...multiplex PCR method for detection of the aforementioned three pathogens. The results show that the amplified fragments of interest were 280 bp, 151 bp, and 111 bp for BVDV, BRV, and BCV, respectively. The method had no cross-reaction to Escherichia coli, Salmonella, and infectious bovine rhinotracheitis virus. Moreover, it detected the minimum limit of 1.19 × 103 copies/μL for BVDV, 3.89 × 102 copies/μL for BRV, and 3.74 × 102 copies/&...

SADAF IFTIKHAR1, SAMAN SHAHID2*, MUHAMMAD UMAR HASSAN1 & UBAID ULLAH3

...ive trio for an earliest detection of COVID-19-associated coagulopathy (CAC). Regular monitoring of these biomarkers can prompt early detection and timely management of CAC.

...

Ferry Lismanto Syaiful1*, Jaswandi Jaswandi2, Mangku Mundana2, Ilham Ilham2, Novirman Jamarun1, Efrizal Efrizal3

...ign: justify;">Pregnancy detection is the most essential aspect after insemination, this can increase reproductive efficiency and buffalo birth. This study is aimed is evaluating the use of mung bean seeds on multiple dosages in the growing seeds tests for the accuracy, sensitivity, and phases of local buffalo pregnancy, and detecting buffalo pregnancy quickly, massively, and cheaper. The object of this study was 40 local buffalo post-AI with the criteria of B...

Hayder M. Watban1,2, Nabeel M.H. Al-Maaly2

...e subjected to molecular detection using conventional PCR and sequencing. The finding showed that Klebsiella pneumoniae were 31 out of 74(41.89%) from total 100 camels that slaughter in the abattoir. This study indicates that Klebsiella pneumoniae reported higher infection rate as it is the predominant bacteria isolated from pneumonic camels which slaughter in Al-Muthanna abattoir.
 
Keywords | Camels, Klebsiella pneumoniae, pneumo...

Kristina Morkūnienė*, Rūta Insodaitė, Laimutis Kučinskas, Renata Bižienė 

Arslan Muhammad Ali Khan1, Rao Zahid Abbas1*, Zia ud Din Sindhu1, Muhammad Shahid Mahmood2

...ography-flame ionization detection (GC-FID) was performed to identify the chemical components of A. subulatum essential oil. The acaricidal and repellent activities of the A. subulatum essential oil against Hyalomma spp. were observed via adult immersion test (AIT), the larval immersion test (LIT), egg hatchability test (EHT), and the tick repellency assay. GC-FID provided that the main compounds of A. subulatum essential oil were monoterpenoids (limonene and ...
Iko-Ojo Charity Ikwe Agada, James Agbo Ameh, Olatunde H. Olabode and Martha Echioda-Ogbole*
... SNAP parvovirus antigen detection kit (IDEXX Laboratories, United State). Other disease conditions include helminthiasis 25 (12.7%), canine babesiosis 3 (1.5%), while 37 (18.78%) cases were recorded as canine distemper and other bacterial enteric diseases. Monthly distribution of CPE cases in this study showed significant difference (p<0.05) characterized by high prevalence in the dry season with peak of infections in the month of January. Breed dispositio...

Lijiao Wang1, Haibin Chen2*, Hongyan Yu1, Zexian Fu3 and Jianjun Zhao2*

...et for this disease. The detection of the EPAS-1 gene has an auxiliary diagnostic value for lymph node metastasis in RCC.

...
Kanwal Nisa1, Sadia Roshan1, Shazia Shamas1,2*, Raheela Atta Mustafa3, Shamaila Irum1, Kalsoom Sughra4 and Memoona Iqbal1 
...y prove feasible for the detection of prostate cancer in aged males. Testosterone replacement therapy may prove to be effective in retrieving the complications induced by prostate cancer. 
...

Khalid Alhudaib

...esult demonstrates first detection of PNRSV in Saudi Arabia.

...

Elkalamawyl, I.M.; Elhddadl, S.; Swelim2, M.A.; Hamdy2, S.M. and Fahmy3, Hanan A.•

...says can be achieved for detection of HBV in clinical specimens. Control of these EBV mutants, which will require new drugs, vaccines, and treatment strategies, will become the next major challenge on the path to eventual elimination of HBV infection. Keywords: HBsAg, PCR, Sequencing, Phylogenetic.

...

Ibrahim l , Madiha Salah and Ikuta 2, Kazuyoshi

... on the rise, rapid H5N1 detection in infected poultry is essential for controlling spread to human. To test the performance of two rapid influenza tests for the detection in naturally infected birds, clinical specimens from different species and organs of sick and dead birds collected during 2007 and 2009 in Egypt were tested using virus culture in embryonating chicken eggs and RT-PCR as references. Influenza rapid tests ef...
Hassanein, Suzan A.; Abd El-Wahab, Wafaa; Eweis, Moustafa and Mahmoud, Mervat M.
...he samples were used for detection of FMD antibodies to 3ABC non-structural proteins using commercial ELISA kit (Priocheck). The overall percentage of positive was 38.9 %. The higher percentage of positive detected in Behaira (48%), then Mounofya (45.3%) while Kafer El-sheikh was the lowest (23.7%). The positive results of detection of antibodies against non structured proteins of FMDV indicate that these samples come from n...

El-Kenawy, A. A. and El-Tholoth, M. S.

...d for rapid and specific detection of LSDV nucleic acid in crude skin and internal organs samples. Also, LSDV could be detected in CAMs of ECEs  using PCR at first day post-inoculation (PI) and by IF and IP at second day post-inoculation before appearance of characteristic pock lesions on CAM.

...
Hagag, N.M.*•, Arafa, A.*; Shalaby, M. A. ** El-Sanousi, A. A. **and Aly, M. M. 
..., specific and sensitive detection methods currently used in national and reference laboratories worldwide. In this study a comparison of the specificity and sensitivity between 2 different formats of conventional RT-PCR (one and two steps) and 3 different formats of RRTPCR (one step using TaqMan probe, two steps using TaqMan probe and two steps using hybridization probe) were performed and compared as a diagnostic tool for H5N1 virus ...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...ISA was established, for detection of the antibody response to FMDV NSP 3ABC using commercial ELISA kit (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330) from Kafr ElSheikh Governorates during 2009 from cattle and buffaloes. The higher percentage of positive was detected in Sharkia (31.7%) while Kafr Elsheikh was (27.3%). The positive result of detection of antibodies against non structured prot...

Omarl , Dalia M.; El-Ibiaryl , Elham A.; Sadik2, Atef S.; Abdel-Ghaffar2, Mamdouh. H. and Othman2, Badawy A.

...t study was designed for detection and isolation of Avian Influenza Viruses (AIV) circulating among poultry since their first detection in 2006. Tracheal and cloacal swabs were taken from the freshly dead birds. Till now (2010) the tested swab samples were inoculated into the allantoic cavity of 911-day-old SPF embryonated chicken eggs (ECE) for virus isolation. The allantoic fluids (AF) of the inoculated ECE were examined f...

Abd El-Razakl, A.G. and AboElkhair2, M.

...s RT-PCR-based viral IBD detection in bursa of Fabricius at day post challenge.

...

Mahdyl , A.M.M.; Hafezl , M.A.; EL-Dougdoug2, Kh. A.; Fawzyl , R.N. and Shahwanl , Eman S.M.•

... the virus infection and detection systemic acquired resistance (SAR) Were Studied. SAR was detected by determination of salicylic acid (SA) resulted induction of protein related to biotic inducers, virus concentration and disease severity (DS). The obtained results from quantification of total SA in induced tomato plants (after 7 days of spraying inducers) showed high level of SA with kombucha &eatment followed by C. inerme and M. jalapa, while mixed (M. ...

Aboud*, K. A; Gomaa**, Hanaa H. A.; El—Taholowy***, Mohage, A. and El - Sugher**, S.

...e subjected to DAS-ELISA detection. Tissue culture-derived genetic stability banana plants and virus tested plants were screened by RAPD- PCR. Only two RAPD primers (among 10 tested) were chosen as producing polymorphic DNA bands differentiating the investigated micropropagated plants. Based on DNA markers, the genetic stability between micropropagated plants were estimated. The morphological variations were recorded in shoots of micropropagated clones more th...

Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.

...od of identification and detection by RT-PCR of OYDV was established. This study also aimed to obtain OYDV-free plants from infected garlic plants using cloves subjected to electrotherapy, thermotherapy, chemotherapy or meristematic dissection followed by in vitro culture. A combination treatment with electro- and chemotherapy (15 mA/10 min + 20 mg 1-1 virazol) was found to more effective on viral elimination and survival of explants. ELISA tests showed that 8...

Eisa*, Nawal A.; Abd El-Ghafar **, N. Y. Abd EL-Mageed*, M.H.; Mohamed* , F.G. and Hasan*, Eman O.

El-Dougdougi, Kh. A.; Dawoud2, Rehab A.; Rezk2, A.A. and Sofy3, A.R.*

...rge scale for an initial detection of CEVd, HSVd and PLMVd in fruit trees in Egypt. CEVd was detected mainly in sweet orange trees and occasionally in grapevine and mango. 'Ihe principal characteristics of the disease on sweet orange trees. It was incidence with 15.4, 4.5 and 1.5% respectively. HSVd was detected mainly in sweet orange trees and occasionally in apple, apricot, mandarin, grapevine, mango, peach, pear and plum trees with 25.2, 2.2, 7.2, 10.5, 12....

Nasr-Eldin1 , M. A.; El-Dougdoug2, K. A.; Othman2, B. Ahmedi , Sabah A, and Abdcl-Azizl , S. Il.

... hybridization in viroid detection. HSVd was isolated on Cucumis sativus L. cv. Alpha plants which showed specific symptoms severe mosaic, vein clearing, rugosity and yellowing spots. CEVd was isolated on Gynura aurantiaca plants which showed specific symptoms mild mosaic and mottling and Lycopersicon esculantum L. cv. Castle rock reacted with PSTVd producing leaf curl and epinasty.  
...

Abo Elmagd l , Enas K.; Abdel-Wahab l , Kouka S.; Alrasheedy l , Zeinab E. and Khalifa2, Ahmed S.

...V) including HCV antigen detection in peripheral blood mononuclear cell (PBMNC) lysates, antibodies to HCV core, NS3, NS4 and NS5 epitopes by enzyme linked immunoassay (ELISA) in mothers and their infants using serum samples for both mothers and infants plus saliva for infants, in addition to detection of serum HCV- RNA (viremia) by reverse transcription polymerase chain reaction (RT-PCR). Also detec...

Abo-Elmagdl , Enas K;El-Mougy2, Hala M. T. and Abd El-Salam 3, Manal

...(BN) as a rapid test for detection of RSV antigen in nasal wash specimens collected from Egyptian infants and young children with the detection of RSV-RNA by reverse transcription polymerase chain reaction (RT-PCR). Furthermore, to study the frequency of RSV infection in Egyptian infants and young children during the winter season 2009/2010 and the effect of certain risk factors including age and gender on the extent and imp...

SHARAW11'2*S S. S. A.; AL-HOFUFY2, A. N. and AL-BLOW12, M. H.

...cribed for the molecular detection of camel pox virus (CPV). This study reports the development of a Real-time polymerase chain reaction (RT-PCR) for detection of CPV using SYBR green I chemistry. A total of 15 specimens from camels suspected of being infected with CPV were collected from Riyadh Province during 2009 and submitted for virological investigation at the Central Veterinary Diagnostic Lab. (CVDL), Riyadh, Ministry...

Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.

...out to be used for ELISA detection. The concentrations of IgG and IgG conjugated with alkaline phosphatase were 1.0 mg/ml and 1:1000 respectively. Antiserum produced specific to BBTMV was used for virus detection by using different serological diagnostic methods. The percentages of virus detection in leaves, stems were higher than that in roots; on the other hand the percentages Of virus <...

*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'

...od of identification and detection by RT-PCR of AMV was established.

...

Karl Maramorosch

...eous announcement of the detection of phytoplasmas in a leafhopper vector by Japanese entomologists was not mentioned by Tokyo plant pathologists. Attempts to culture the fastidious phytoplasmas failed, while spiroplasmas have been cultured and properly characterized and classified. Several careers were made by  phytoplasma and spiroplasma researchers, but some were destroyed by erroneous reports and one tragically ended through political involvement. The...

El-Tabakh, SAA l ; Abdel Wahab, KSE; Badr, AF   and Helal, IG  

...CV infection showed that detection of HCV-RNA in SF was intermittent but' detection of new native protein as well as glycopeptides was consistent.  
...
Arafa, A ; El-Kanawaty, Z; Hassan, M.K; Anwar, H.K  and  Mona M.Aly 
 
...osis was based on direct detection of viral RNA by real time PCR. Two positive cases from turkey and Grocer duck were processed for viral isolation and characterization. The level of antibodies was detected in vaccinated birds by HI test and the results were discussed to evaluate the role of vaccination in controlling the disease in these valuable zoo birds.

...

Ahmed Abd El Samie Hassan Ali

...ations for isolation and detection of its antigens on MDBK cells using outgrowth ELISA and immunofluorescence as well as measurement of BVDV antibodies by serum neutralization test. Virus antigen detection was reported on days 5 & 7 while the antibodies were initially detected on day.

...

El-Tarabili M. M., El-Shahidy M. S., Rifaat M. M., Kania S. A. and Abdelwahab Shahira A.

Sahar A. Youssef I and A. A. Shalaby 

...ped for the simultaneous detection and discrimination among five RNA viruses namely ,4pple cholorotic leaf spot virus (ACLSV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Plum pox virus (PPV) and Tomato ringspot virus
(ToRSV) which considered the most economically damaging viruses of stone fruit trees in Egypt and worldwide. Five compatible primer sets for one•step RT-PCR amplification  us...

*Amal Abou El-Ela A., M. A. Amer and Eman A. H. Khatab,

... host-range, serological detection and maintained on Carnation (Dianthus caryophyllus L.) and / or Gompherena globosa. Morphological studies of CarVMV were conducted by light and electron microscopy. Light and electron microscopy revealed amorphous cytoplasmic inclusions in infected leaf cells. In some cases, however, inclusions have a characteristic shape, spindle, circular or sledge-like. Pinwheel inclusions characteristic of Potyvirus which include CarVMV w...

* Amal Abou El-Ela, A.

...ation was useful for the detection of PNRSV in herbaceous and woody plant tissues. In successful attempt to eliminate the virus from infected dormant rose cuttings by heat therapy resulted in 29.6% virus elemination of (PNRSV).
 
...

Manal A. El-Shazly1, A. s. 2 Abdel Wahab and Salwa N. Zein3

...bsp; were used for virus detection using different serological diagnostic methods such as indirect ELISA and dot-blot immunoassay (DBIA) on nitrocellulose membranes.

...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

... be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other published sequences of the Same virus shows 79.4% - 84% homology.

...

E.F. Mohamed1 and I.M. Sabra2

... transmission, and ELISA detection. ToMV had a longevity in vitro (LIV) of 90 days at room temperature. dilution end point (DEP) Of 10-6 and thermal inactivation point (TIP) of 90oC. ToMV was easily transmitted by sap. The obtained results revealed that ToMV was not transmitted by any insects used in this study. The identification of ToMV was confirmed serologically using ELISA technique. The effectiveness of gibberellic acid (GA) and indole acetic acid (IAA) ...

E.F. Mohamedl and A.A. Owayss2

...irus stability and ELISA detection. The host range of the isolate was restricted to Fabaceae. BBMV lost infectivity after 10 min at 95 on dilution of 10-3 and after 21 days storage at room temperature. BBMV was easily transmitted by sap. ELISA was used efficiently to detect BBMV in leaves of infected Faba bean plants. The present study was carried out to determine the effect or propolis on BBMV. In vitro experiment, propolis reduced the occurrence of mosaic sy...

M.R. Abd-El Wahab l, H.A. Hussein2, T.M. Asfourl and M.A. Shalaby2

S. A. Khalil1; M. El-Sayed2; M. M. El-Fayomy2; H. Y. Hassan3 and A. Zaghawa3

...lly and confirmed by the detection of BEFV antigen by Immunoperoxidase staining. The aim of the present study was to determine the efficiency of transfer of BEFV antibodies from naturally infected cows to newborn calves through colostrum. According to the level of serum neutralizing antibodies (SNA), the cows were allotted into three groups. In the first group (n=9). the mean SNA in naturally infected cows was 46.2. which gave a mean titer neutralizing antibod...

N. A. Sherif, Lamiaa M. Omar, S. M. Shafei and Elham A. El-Ebiary.

...be used successfully for detection of antigens and antibodies

...

Rana Mohammed Ibrahim1*, Haider Mohammed Ali Al-Rubaie2

Nurhashunatil Mar’ah1, Safika Safika2*, Agustin Indrawati2

...e (50%). Gene resistance detection found that water samples encoded blaTEM gene (100%), Udder rinses water encoded blaTEM (80%), blaSHV (20%), blaCTX-M (20%) and udder swab samples detected the presence of blaTEM genes (40%). K. pneumoniae virulence factor genes: mrkD detected in all isolates (100%), entb and wabG were found in all water sources, milker hand, and udder swabs samples (100%) except samples from udder rinses water that encoded gene virulence fact...

Nurlan Akhmetsadykov1*, Tanatar Kydyrov2, Moldir Akhmetzhanova1, Gulnazi Akhmetova3, Maxat Berdikulov4 

...gical properties for the detection and diagnosis of trypanosomosis. To create a recombinant antigen, bioinformatic analysis of the primary structure of T. evansi GM6 antigen from several regions was carried out. The protein sequence was reverse translated to the nucleotide sequence, after which the gene was synthesized using solid-phase method. The gene fragment, encoding the GM6 protein, was inserted or cloned into the pET28 expression vector after synthesis....

Tarek Refaay, E.A. Elshafiee, Hayam A. Mansour and Maha A. Sabry*

 

...rate. In conclusion, the detection of pathogenic MDR E. coli O157:H7 in food samples, food handlers and food equipment in some touristic cities in Egypt poses a serious risk to public health. Therefore, it is recommended to focus on identifying practices which increase the risk of food contamination, and on implementing measures to improve the sanitary conditions in the food outlets in touristic cities.

...

Sarah G. Yousef1*, Ahmed Shehta2, Hend M. El Damaty1 and Hussein A. Elsheikh3

...ecular technique for MAP detection in small dairy cattle farms.

...
Asad Ullah1, Hayat Ullah2, Muhammad Lateef3, Imrana Niaz Sultan4, Afrasiab Khan Tareen4 and Muhammad Waseem Khan4,5*
...-income countries. Early detection of disease coupled with other parameters help in treatment and reducing disease transmission. The current study was conducted to assess the sensitivity and specificity of the GeneXpert MTB/RIF (Cepheid Sunnyvale, CA, United States) in comparison to conventional techniques used for the diagnosis of TB. Our study is one of the first ones from Pakistan investigating and assessing the performance of GeneXpert. We recruited eight ...

Salema Lafta Hassan1*, Taghred Jabbar Humadai1, Sabrin Ibraheem Mohsin

...); Immunoglobulin G(IgG) detection using a chemical immunosorbent assay test. the outcomes of PHA test revealed that Folcord inhibited humoral immune response, with a considerable rise in antibody titer in the third and second groups, but decreased serum antibody levels in the first group. Furthermore, the (IgG) titer in serum is measured using the Enzyme linked immunosorbent assay (ELISA) method. G1 revealed a significant decrease (P≤0.05) in the first gro...

Kadhim Kh. K. Al-Khayat1*, Athmar K. A. Al-Azawi2

...ologically and molecular detection by using NAD1 and COX1 genes and conventional PCR during the period from 1/ March / until 31/ May/ 2022 in Baghdad city, Iraq. Rabbits were humanely euthanized and abdomen opened longitudinally to looking for any cyst may be founded grossly in the peritoneal cavity or on the visceral organs, all cysts were examined for their structures scolex, membrane and the size measurements. The fluid was collected from each cyst for meas...
Aatif Masood Ahmad Khan1, Masood Rabbani1*, Arfan Ahmad1, Muhammad Wasim2 and Sohail Raza1
...dentification, and rapid detection of Avibacterium paragallinarum, the causal agent of Infectious Coryza (IC), from layer chickens in various farms in Pakistan. A total of 46 isolates were obtained from a total of 244 clinical samples from 122 sick and moribund or dead layer chickens showing signs of IC like slight swelling of infra orbital sinuses and nostril mucus membranes. Two sampling sites were chosen, squeezing the nostrils for live birds and infra orbi...
Nusrat Bano1, Muhammad Tayyab1*, Bushra Muneer2, Sehrish Firyal1, Abu Saeed Hashmi3, Muhammad Wasim1 and Ali Raza Awan1
... the quick diagnosis and detection of dengue stage for the proper treatment of infection. This cross-sectional study was conducted at Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Lahore and Jinnah Hospital Lahore (JHL) from January to December 2013. Total 345 clinically suspected patients reporting to JHL were serologically diagnosed for dengue specific antigen and antibodies. In this study 20 patients of febrile i...

Pakistan Journal of Zoology

February

Pakistan J. Zool., Vol. 56, Iss. 1, pp. 01-501

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe