Submit or Track your Manuscript LOG-IN

Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1

 

Life Sciences International Journal Issue 7 Volume 1
...R universal primer pairs directly from field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similari...

Sehrish Kanwal, Ali Saeed, Muhammad Munir, Memoona Arshad

 

British Journal of Virology
...R universal primer pairs directly from field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similari...

John Shook

 

Science, Religion and Culture
...o aloof and abstract for direct confrontation over evidence. Theology’s desperate maneuvers for avoiding science and scientific atheology only delay the inevitable. Partner atheologies wielding logic, ethics, and civics await to help theology extinguish the gods.

 

...

Sehrish Kanwal1, Ali Saeed1*, Muhammad Munir2, Memoona Arshad1

British Journal of Virology
...R universal primer pairs directly from field samples including tissues, vesicle and secretion. The direct sequencing and subsequent analysis of amplified PCR products for VP1 gene indicated the circulation of serotype O of FMD in studied areas. Moreover, using serotype-specific primers (SA(F)/SA(R)) which target the VP1 gene, serotype O was confirmed in all representative samples. As high as 98% nucleotide sequences similari...

Reviewed by John Shook, University at Buffalo, USA; Email: jshook@pragmatism.org

Science, Religion and Culture
...tting readers to examine direct answers on all sorts of topics from today’s premier public intellectu- als. Reading the answers about science and religion in this volume is consistently informative and inspi- rational, and frequently revealing in stunning ways. Comparing the answers from the impressive figures in the book takes readers on a journey through truly deep and important issues with honesty and clarity.

...

Derk Pereboom

...entional manipulation is direct and immediate, the agent is not morally responsible. Fischer’s thought is that Plum’s non-responsibility in Case 1 can be accounted for by the conditions on mechanism-ownership, a feature of the compatibilist account of moral responsibility he and Ravizza (1998) developed, which, he correctly points out, I neglect in favor of the reasons-responsiveness component.

...

Mohammed Ali Hussain, Zakiya Ahmed Hassan

...rains row-1 had positive direct effect on grain yield plant-1 and high positive indirect effect through some traits, so that these traits could be used as an index in the selection of high grain yield plant-1.

...

Rick Repetti

...bsp;Engaging Buddhism is directed primarily at a Western philosophical readership, but is of perhaps equal value to Buddhist philosophers insofar as it articulates many of Buddhism’s core philosophical values, to and for Western philosophy, and in a distinctly recognizable Western philosophical voice, but one that does no damage to the often radically different frameworks, methods, and modes of discourse that are d...

Ali Muhammad*, Muhammad Ayub

...e fruit is unable to eat directly because the fruit contain high level of bitter glucoside such as oleourepean. Aim of this research work was to reduce the bitterness level of olive fruit by different treatment such as water, salt and lye solution which were coded as RW1, RW2 and RW3 respectively. During treatment process the bitter glucoside level such as oleourepean leached out from the fruits to the solvents by osmosis process which alters the composit...

Youssef Lhor1*, Mounir Khayli1, Mohamed Bouslikhane2, Mehdi El Harrak3, Ouafaa Fassi Fihri2

Email: y.lhor@yahoo.fr

...igh risk of infection is directly proportional to that of transmission vectors. Moreover, results demonstrate that the life stage “bumper” of the female imicola is the indicator of the infecting activity of C. imicola. Collectively, the distribution patterns and emergence of BT can be predicted by the abundance of the Culicoides species in a specified locality so that control measures
can be implemented well in time to contain...

Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6

...e have for the rst time directly visualized protein-protein interactions between BDV and its host, and thereby con rmed previous data to demonstrate ndings in cell cultures to be applicable also in experimentally and naturally infected animals.

...

Yongfeng Li, Mo Zhou, Xiao Wang, Libao Xie, Hua-Ji Qiu*

...d an excellent option to directly detect viral replication without the use of secondary labeling. This mini-review discusses the applications of reporter CSFV in the study of CSFV biology, including efficiently screening the antivirals against CSFV and viral receptors, conveniently tracking the viral proteins in live cells as well as improving diagnostic methods and vaccines for classical swine fever.

...

Behzad Hussain1, 2, Abdullah Iqbal2, Muhammad Abubakar2*

...rough hard tick bite and direct contact with blood of the infected animal. The occurrence of CCHF outbreak in Pakistan is increased quite significantly near Eid-ul-Adha. Haemorrhages are the major signs of this fatal disease. No treatment of CCHF is available currently but Ribavirin antiviral drug is used to cure this disease. There is currently no commercially available vaccine for this disease. It is recommended that the disease can be controlled by adopting...

 Zafar Khan, Asad Sultan, Rajwali Khan, Sarzamin Khan, Imranullah and Kamran Farid

 

Allah Wadhayo Gandahi, Khalilluah Panhwar, Rabail Gandahi, Muhammad Saleem Sarki and Mahmooda Buriro

...cluded that there was no direct effect of N, P, K, Mg and Fe on the reddening of cotton leaves but B and Zn application decreased number of red leaves. Plant growth improved markedly when essentially needed NPK was applied @ 120-70-40 NPK in combination with Zn and B @ 4 and 1.5 kg ha-1, respectively.

...

Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

...l Pi. Foliage growth was directly related to fungal Pi and inversely to nematode Pi. Our results showed that the higher Pi of L. muscarium was associated with the lower Pf of M. incognita. Foliage growth increased with increased fungus inoculum.

...

Afzaal Ahmad Naseem1*, Maleeha Akram1, Sarwat Jahan2, Kiran Afshan2, Zubaria Iqbal1, Faheem Tahir3, Mazhar Qayyum1 and Syed Shakeel Raza Rizvi1

...ar growth velocity (LGV) directly through stimulation of chondrocytes and osteoblasts. Furthermore, T promotes LGV through augmentation of GH secretion. Nevertheless, age and developmental stage dependent changes in GH and T and LGV and their associations require further investigation. This study examined relationships between GH and LGV, T and LGV and GH and T in 540 normal healthy boys of 1 to 20 years (n=27 boys/age group). The concentrations of GH and T we...

Ecevit Eyduran1, Daniel Zaborski2*, Abdul Waheed3, Senol Celik4, Koksal Karadas5 and Wilhelm Grzesiak2

...an be considered as an indirect selection criterion for future goat breeding studies. 

...

Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2

... 35-50 weeks without any direct clinical manifestation of avian influenza. Serum collected from 120 birds was tested for antibodies against H9N2 by using Haemagglutination Inhibition assay. Calculated geometric mean titers of 5.37 revealed the infectivity of the flock with H9N2 Influenza virus. To investigate the presence of virus in the study population, trachea, lung and intestine tissue samples were processed for RNA isolation and subjected to molecular det...

Rongrong Li1, Kun Li2, Xiaoqiang Wang2, Houqiang Luo2, Gang Qiu2, Hui zhang2, Yanfang Lan2 and Jiakui Li2,3*

...bent assay kits and an indirect hemagglutination test. The results showed that seroprevalence in Tibetan pigs were 25.6% by ELISA. On gender basis, the prevalence was found 25.1% in males and 27.8% in females. By the method of IHA, the seroprevalence in Tibetan pigs were 21.6%, and the prevalence was found 23.1% and 21.4% in males and females, respectively. The results indicates that the Tibetan gigs were exposed to T. gondii in Tibet area, which should arise ...

Xiangxing Zhu1, Junyu Nie1, Shouneng Quan1,2, Huiyan Xu1, Xiaogan Yang1, Yangqing Lu1, Kehuan Lu1 and Shengsheng Lu1*

... regulatory elements for directing specific expression in porcine astrocytes. However, the practical application of hGFAP-DsRed transgenic Guangxi Bama mini-pigs in neuroscience research requires solving the germline transmission problem of the phenotype.

...

Sidra-Tul-Muntaha1, Muhammad Sagheer1*, Mansoor-ul-Hasan1 and Shahbaz Talib Sahi2

... five plant extracts (Azadirachta indica, Melia azadirach, Pegnum hermala, baryosma and Zingiber officinale) and three synthetic pyrethroids (bifenthrin, cypermethrin and deltamethrin) on three geographical populations of Callosobruchus chinensis collected during 2013 from Faisalabad, Multan and Nankana districts of Punjab, Pakistan. Three concentrations of each plant extract (5, 10, 15 and 20%) and synthetic pyrethroids (0...

Pam D Luka, Frank N Mwiine, Bitrus Yakubu, Joseph Erume, Ricardo Pérez-Sánchez, Hermann Unger and David Shamaki

... the recombinant TSGP1 indirect ELISA. Of the samples analysed, 13.4% (442/3,288) showed moderate to high reactivity, suggestive of domestic pigs’ exposure to tick-bite. Antibody reactivity’s were found in eight of the 10 states studied and all the states have favourable climatic conditions for soft ticks’ survival and national parks harbouring wild swine (warthogs) able to maintain the developmental cycle of these ticks. This provides some e...
Sumra Ashraf1, Zain ul Abdin1,*, Saqi Kosar Abbas2,Rao Sohail Ahmad Khan3, Muhammad Tahir1, Sehrish Rasool1, Maryam Anwar1 and Fiaz Hussain1
...d extra-floral nectar. A direct behavioral assay was conducted to investigate the dietary preference and effects of different diets on the fecundity, sex ratio and longevity of B. hebetor. Three different diets [Honey syrup, sugar syrup, date syrup and a control (water)] were used with different solution percentage (25, 50, 75 and 90%). It was observed that honey fed wasp pair produces significantly more number of eggs, adults and also lived significant...
Atta ur Rehman Khan1,2*, Nazir Javed2, Shahbaz Talib Sahi2, Tariq Mukhtar1, Sajid Aleem Khan2 and Waqas Ashraf3
.../i>) and neemex® (Azadirachtin) against invasion and development of Meloidogyne incognita was tested in eggplant roots in greenhouse pot trials. Neemex (5 g, 10 g and 15 g) and G. mosseae (100 g, 150 g and 200 g) were applied as protective treatment. The roots of eggplant were inoculated with 1000 second stage juveniles of M. incognita. Eggplants inoculated with nematodes only served as control. Each treatment was replicated tenfold. D...
Akbar Ali1,*, Khalil Mohamed2 and Fawzia Toulah3

 

...lso higher in women with direct contact to soil (14% vs 5%). Only one sample was PCR positive. The results show that overall prevalence of Toxoplasma gondii infection in young women of Rafha city is low as compared to other regions of Saudi Arabia.
...
Sehrish Rasool1, Zain ul Abdin1,*, Saqi Kosar Abbas2, Sumra Ashraf1, Maryam Anwer1, Atif Manzoor1, Muhammad Tahir1 and Hoor Shaina1
... and development that is directly proportional to the quantity of resources available.
...
Tausif Ahmad1, Iahtasham Khan2, Saddaf Razzaq1, Saeed-ul-Hassan Khan1,* and Raheela Akhtar3
.... abortus specific indirect enzyme-linked immunosorbent assay (i-ELISA). Serum samples that were confirmed to be positive for B. abortus through serology were subjected to an rPCR in order to test its efficacy in detecting Brucella in blood of infected animals. Initially a Brucella genus-specific bcsp31 genomic region based rPCR was used. This was followed by two species-specificrPCRs that detected IS711 genomic region of B. ...
Muhammad Tahirand Memoona Shehzadi*
... oil production there is dire need to grow more sunflower by using the economical and environment friendly techniques. Present study was proposed to evaluate theresponse of spring and autumn sunflower to chemical and bio-fertilizers for yield and quality traits during 2014 at University of Agriculture, Faisalabad, Pakistan. The treatments comprised on the combination of chemical fertilizers (No chemical fertilizer, half recommended dose of fertilizer and full ...
Muhammad Qadir Ahmad¹*, Farheen Ashraf Raza¹, Abdul Qayyum¹, Waqas Malik¹, Rao Wali Muhammad2, Muhammad Asif Saleem1, Amir Hamza2, Ahmad Baksh Mahar3
...tilized to partition the direct and indirect effects of different traits on BW. Path coefficient analysis revealed positive direct effect of NS on BW. Similarly, SI illustrated positive indirect effect on BW via LA. The genotype V-89 was found a best performing genotype with high yield and moderate leaf traits.
...

K.N. Ahmed, S.H.A. Pramanik, M. Khatun A. Nargis M. R. Hasan

Efficacy of plant extracts in the suppression of insect pests and their effect on the yield of sunflower crop under different climatic conditions
...otanicals viz., Neem (Azadirachta indica) seed oil, castor ( Ricinus communis) oil, a mixture of Neem seed oil and sesame oil, leaf extracts of custard apple (Annona squamosa ) and Bara Bishkatali ( Polygonum orienta) were tested against the pest infestation. The treatment of custard apple leaf extract produced the most favourable result in respect of pest control and crop yield. The other treatments also exhibited better results in comparison to control follo...

Palash Mondal1 , Amitava Konar2 and N. Johnson Singh3

Evaluation of insecticidal schedules for the management of insect pests of potato
...ing of chlorpyriphos, azadirachtin and Bt (T) was not as effective as T.

...

B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran

Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
...ucts are used mainly for direct soil application in nurseries/main fields to suppress the soil-borne inoculum. In liquid state fermentation, Trichoderma is grown in inexpensive media like molasses and yeast medium in deep tanks on a commercial scale. Biomass from the liquid fermentation can be made into different formulations like, dusts, granules, pellets, wettable powders. Trichoderma formulations can be applied to the seed either by dry seed treatment or by...

D. Sharmah, K.C. Deka and A.K. Phukan

Field evaluation of efficacy of some botanical dust against rice bug (Leptocorisa oratorius Fabr.)
...fy">Efficacy of neem (Azadirachta indica A.Jass), soap nut (Sapindus trifoliatus L.) and their formulations and Malathion as standard insecticide were evaluated against the rice bug (Leptocorisa oratorius Fabr.) during 2000-2001 on the basis of per cent reduction under field condition. The per cent reduction in number of rice bug adults due to neem seed kernel powder, neem seed kernel powder + multani powder, multani powder, neem leaf powder, neem leaf powder ...

P.S. Ajith, K.K. Lakshmesha, S. Mahadev Murthy and N. Lakshmidevi

Botanicals for control of anthracnose of bell peppers
... Manilkara zapota and Azadirachta indica was studied by poisoned food technique, seed germination and under green house experiments for control of Colletotrichum capsici, fungal pathogen responsible for anthracnose disease in bell peppers (Capsicum frutescence L.). The results showed that all the selected plants have potential to inhibit the radial mycelial growth of C. capsici in-vitro. The plant extract from C. aromaticus at 50% concentration showed 42% radi...

D.K. Hazra, Megha Pant, S.K. Raza and P. K. Patanjali

 

Formulation technology: key parameters for food safety with respect to agrochemicals use in crop protection
...ll applied pesticides is directly involved in the pesticidal mechanism. This implies that most of the applied pesticides find their way as 'residue' in food chains where they undergo concentration and pro-duce potential, long term, adverse health effects. Pesticides in developing countries in Asia and Pacific region are mainly available as dust, wettable powder, emulsifiable concentrates, solutions, etc. These types of formulations are regarded now as ?convent...

T. P. Ghosh, D. Mandal, S. Laha and M. K. Dasgupta 

Dynamics and severity model in managing fungal diseases
...has been developed for indirect assessment in terms of severity as a direct function of yield loss in terms of occurrence or intensity but not yield or yield loss per se. These findings may help in building simple decision rules for management early in the season as soon as the disease appears in one case, and when some intensity has been achieved in all other cases. Where validated this approach may be a useful tool in plan...

Shyam Singh and L.P. Awasthi

Plant products for the management of yellow mosaic disease of mungbean and urdbean
... per cent followed by Azadirachta indica leaf extract by 42.43 and 42.92 percent in mungbean and urdbean, respectively. Maximum plant height (70.90 and 56.20 cm), primary branches (6.36 and 6.38 per plant), secondary branches (13.56 and 10.68 per plant), nodules (27.48 and 37.69 per plant), pods (17.25 and 22.85 per plant), seed yield (4.43 and 3.89 g per plant) were recorded in eight sprays with Clerodendrum aculeatum leaf extract followed by eight sprays wit...
Mousa Keshavarz1*, Maryam Soyuf Jahromi2
...females had more gonads (direct relation, r=0.45) while the lighter males had more gonads (inverse relation, r=-0.52). The males’ total dry weights were < 20 g and > 40 g but females’ were between 10 to 40 g. The total wet weight was > ~2x (females) and > ~7x (males) the total dry weight. The wet gonad weights is ~3x of the dry gonad weight of gonads and the two-thirds of total wet weight is the moisture of gonads. In females, Interquar...
Muhammad Ayaz1,*, Muhammad Athar Abbas2, Pervez3, Noorulain3, Yasir Amin1, Zubair Ali3, Naila Siddique2 and Khalid Naeem2
...n poultry population was directly proportional to temperature, season and elevation.
...
Ayesha Ilyas1, Hafiz Azhar Ali Khan2,* and Abdul Qadir1,*
...a alba), neem (Azadirachta indica), niazboo (Ocimum basilicum), yellow kaner (Thevetia peruviana) and safeda (Eucalyptus camaldulensis) against the peach fruit fly, Bactrocera zonata (Saunders), at 2% concentration in a free choice bioassays. Acetone, chloroform, petroleum ether and ethanol were used for extraction from leaves. Amongst the various treatments applied, the acetone extract of D. alba showed the highes...
Koksal Karadas1* and Ibrahim Hakki Kadırhanogullari2
...census study method in Igdir province of Turkey with the purpose of determining some factors influencing average honey yield (AHY) per beehive in the year 2014. For this purpose, predictive performances of several data mining algorithms (CART, CHAID, Exhaustive CHAID and MARS) and artificial neural network algorithm (Multilayer Perceptron, MLP) were evaluated comparatively. Several factors thought as independent variables in the survey were age of beekeeper (A...
Vladimir Avdalovic1, Marijana Vucinic2, Radmila Resanovic3, Jelena Avdalovic4, Danka Maslic-Strizak5 and Milos Vucicevic3*
... Further research can be directed to the technological improvement of chopped and pelleted straw production or into the improvement of handling with this substrate.
...
Adnan Yousaf1,Jia Wu1, Qaiser Shakeel2, Yasir Iftikhar3, Muhammad Irfan Ullah4, Uzma Tahira5,Mustansar Mubeen1 and Wubei Dong1,*
...It was hypothesized that direct antagonism and defense by bio-product enhance the resistance in chili cultivars. So, T. harzianum is an efficient biological control for integrated management of chili plants under controlled condition cultivation. To explore the nature of resistance response of C-33 to M. incognita and S. rolfsii further research is needed. 
...
Ghulam Abbas1,Asif Nadeem1,*, Masroor Ellahi Babar2, Tanveer Hussain2, Muhammad Sajid Tahir3, Wasim Shehzad1, Rajput Zahid Iqbal3, Muhammad Tayyab1 and Maryam Javed1
...oducts were sequenced bi-directionally, aligned and single nucleotide polymorphisms were identified. Bioinformatics tools were applied for construction of phylogenetic tree and genetic diversity analysis. Lower genetic diversity was observed. The finding of this research is prerequisite for future research.
...

Sania Shaheen1*, Hina Fatima2 and Muhammad Azeem Khan3

... In last some years, the direct seeded rice system is introduced in some of the rice cropping districts of Pakistan. The current research estimate the technical efficiency of conventional and dry rice farmers and also determine the factors which significantly contribute to increase the rice output. Moreover, this study estimated the sources of inefficiency. Data collected from 300 sample rice farmers into the Kharif cycle (2013-14) at five main rice growing di...
Mehran Kausar1,2, Naveed Ashraf3, Farzana Hayat4, Asraf Hussain Hashmi1, Saima Siddiqi1,* and Mariam Anees2
...ubby hands. We performed direct sequencing of CTSK for five members of the family to find out the causative mutation. All coding exons of CTSK gene were amplified and sequenced in the affected and unaffected individuals of a consanguineous Pakistani family consisting of five members, three affected brothers, one unaffected sister and the unaffected mother. We identified a known missense mutation c.136 C>T in the third exon of CTSK chang...
Kadir Karakuş1, Bahat Comba2, Abuzer Taş3, Tunahan Sancak3, Arzu Comba2, Devrim Saripinar Aksu4, Hasan Koyun5 and Mohammad Masood Tariq6,*

Muhammad Amin1*, Khalid Mahmood2, Imran Bodlah3, Muhammad Rahim Khan2 

...a species. Metopolophium dirhodum (Walker) was recorded on new host plant, Rosa species, in Pakistan. Distinguishing characters, morphometric data, biology and distribution of the studied species are provided herewith.  

...
Asad Abdullah1, Muhammad Irfan Ullah1,*, Muhammad Waqar Hassan2,    Samina Khalid3, Yasir Iftikhar4, Muhammad Arshad1 and Jaime Molina-Ochoa5,6
...tion of neem seed, Azadirachta indica extract was applied upon reaching economic threshold levels of B. tabaci and A. biguttula. The insect pest population was recorded 24 hours before and 24h, 72h and 168h after spray. Maximum reduction of 60.20% of B. tabaci on Bt cotton was recorded at 6% NSE while at 2% concentration of NSE after 148 hrs, 39. 16% reduction was observed. While maximum reduction on non-Bt cotton at 6...

Mohsan Ullah Goraya1,2, Liaqat Ali1,2 and Iqra Younis3  

...ratory tract is prone to direct and continuous exposure to viral infection. Respiratory viruses including influenza virus, coronaviruses and herpes viruses are important pathogens that cause significant losses in the poultry industry. However, successful establishment of infection in the respiratory tract switch on the pathogen recognition by innate immune receptors and establish first line of defense against viral infections. When specific cellular receptors ...
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
Liana Mihaela Fericean1* and Mihaela Corneanu2
...an species who can cause direct damage to the plants by extracting the sap, and indirectly it is a vector to 16 plant viruses. The study presents data referring to the external morphological characteristics, to the biometrical measurements and to the life cycle of Aphis nasturtii. The researches have been carried out for a period of four years on the potato and for a period of two years on the orchards from Romania. A...
Tahira*, Muhammad Arshad, Muhammad Ayub Khan and Mubashar Ahmad Khan
... that in both years, the direct effects of pod length and number of pods per plant on grain yield were positive and of high magnitude. Finally, it was concluded that the trait pods per plant can be exploited for the improvement of seed yield in rapeseed.
...
Carolina A. Bonin1,2, Eric A. Lewallen2,3, Andre J. van Wijnen3, Marta Jussara Cremer4 and Paulo C. Simões-Lopes5*
...ich resulted in 260 h of direct observation. Our results revealed feeding as the most frequent activity in the estuary, totaling nearly two thirds of all records. We also identified two sites of Guiana dolphin habitat preference in our study area, where sightings remarkably totalled > 62% of observation records. These sites (especially Guaraqueçaba Bay) were not only important for feeding, but also for S. guianensis socialization. The detectio...
Saba Khalid*, Muhammad Saddique Awan, Riaz Aziz Minhas, Nasra Ashraf, Khawaja Basharat Ahmed, Nuzhat Shafi and Sajid Abassi
...t>ect sighting and indirect evidences were collected from all these sites. Seventy eight bird species were recorded that belonged to 34 families and 11 orders. Passeriformes was the dominant specie. The habitat destruction due to deforestation, agricultural activities, infrastructure and land sliding and disturbances by the increasing human population were major threats to the avian fauna of Rawalakot.
...

Ehtisham Shakeel Khokhar1*, Amir Shakeel1, Muhammad Amir Maqbool1, Muhammad Waheed Anwar1, Zoraiz Tanveer1 and Muhammad Fahad Irfan2 

...e trait can be used as indirect selection criteria in segregating populations.  

...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

...s the local herdsmen can directly suffer a great economic loss.
...

Imran Ali Rajput1*, Tajwer Sultana Syed1, Ghulam Hussain Abro1, Imran Khatri1 and Abdul Mubeen Lodhi2 

...ium), neem (Azadirachtin indica) and datura (Datura stramonium) were used in traditional method. The overall results showed that the sprays at different interval indicated the highest pest population reduction at tobacco (17.45-15.09%) followed by neem (14.58-15.33%) and datura (11.72-7.81%) in both varieties and similar trend was also noted in the second year of the study. The effect of varietal difference of Bt. and non-Bt. cotton va...
Wali Khan1,*, Noor-Un-Nisa2 and Aly Khan3
...6 to December 2008 using direct smear and concentration methods. One hundred and fifteen (11.04%) participants were found infected with one or more than one intestinal protozoans. Forty one (35.6%) of the participants were infected with single parasite and seventy four (64.3%) with multiple infections. Entamoeba histolytica 30.5% (n=77/252), Giardia lamblia 15.0% (n=38/252), Ascaris lumbricoides 17% (n=43/252), Trichuris trichura 11...
Rana Manzoor Ahmad1,2, Abdul Majid Khan1,*, Ghazala Roohi3 and Muhammad Akhtar1
...he feeding deficiency is directly linked to the physiological or environmental stress. In this study occurrence of enamel hypoplasia in giraffids has been observed in species of all time intervals between 18.3-0.6 Ma except the time 11.2-9.0 (late Miocene) that has no giraffids with this dental defect. The comparative percentage for occurrence of enamel hypoplasia in giraffids of these Siwalik deposits is early Miocene-early middle Miocene (29%), middle Miocen...
Muhammad Siraj-ud-Din1,2, Riaz Aziz Minhas1, Usman Ali3,*, Mayoor Khan2, Muhammad Siddique Awan1, Nuzhat Shafi1 and Basharat Ahmad1
...termined on the basis of direct or indirect evidence (e.g. animal sightings, fecal pallets and hairs) in different habitats. Information on food consumption was collected by using scan sampling technique and also collected from local people, hunters and shepherds (n=78). During scan sampling, focused feeding animals were observed with the help of a telescope and spotting scope. Ladakh urial preferred montane dry sub-tropical...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
...ficiency rates when were directly compared with mock-treated fish control. However, there was no statistically supported level of significance was observed for growth rates and feed conversion rates among groups. Improved live weight and protein efficiency rates reflected positively on the survival rate in MOS-fed fish. Interestingly, the whole body and fillet fatty acid composition shown no-correlation between treated and control groups (p>0.05). During th...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...st management. After the direct application of Huwa-San TR50, N. cucumeris could also sustain its population on treated and/or dead T. urticae, under laboratory and greenhouse conditions. Statistically, the difference between laboratory and greenhouse conditions was insignificant (P > 0.5, using F-test Graphpad prism 7). Up to 3000 ppm of Huwa-San TR50 reduced the population of N. cucumeris by 11.83 and 17.66% under greenhouse and labor...
Saleh S. Alhewairini
...f RPW. After exposure to direct spray of oxamyl, adult mortality was 62, 82 and 100% whereas larvae mortality was 72, 77 and 100% after 1, 24 and 48 h, respectively. Alive adult and larvae were completely paralyzed after 24 hours. There was significant difference between 2 treatments, 1 and 24 h, in both adult and larvae. The mortality of both adult and larvae was 100% after 48 hours of exposure to oxamyl. In the field, however, Oxamyl was applied in two diffe...
Rabia Qurashi, Qurat ul Ane Gillani* and Furhan Iqbal*
 
...d N = 16) were collected directly by cardiac puncture and used for estimation of hematological and some serum biochemical parameters. The hematological parameters did not show any significant variation between the two groups. From amongst serum biochemical parameters triglycerides (P = 0.02) in CGP55845 treated mice showed significant increase compared to the control mice. All other studied parameters remained unaffected indicating that CGP55845 can be injecte...
Syed Kashif Nawaz*, Faiza Zubair and Sidra Kanwal
...vergent genes and 5% uni-directional genes. These categories may further be differentiated as coding vs. coding, coding vs. non-coding and mixture of both types on the basis of overlapping gene structure. Our analyses revealed that human genome has various types of overlapping genes. The occurrence of these overlapping genes is not solely dependent on the size of the chromosomes.
...
Tania Ahmed Shakoori1,*, Muhammad Saqib Saeed2, Asif Hanif2, Saima Mukhtar3 and Ayesha Ghauri4 
...OPD). Their frequency is directly related to the prognosis of the disease. The objective of this study was to identify the ‘frequent exacerbator’ phenotype and determine the risk factors for increased frequency of acute exacerbations in local chronic obstructive pulmonary disease (COPD) patients in a cross sectional analytical study design. For this purpose 137 patients were included in the study after obtaining necessary permissions from the ethic...

Muhammad Jamal Nasir*, Anwar Saeed Khan and Said Alam 

Francisco J. Ayala
...force or immanent energy directing the evolutionary process toward the production of specified kinds of organisms. Even if a scientific account of natural history is open to the God question, it will take a theologian to propose an answer. 
...

Aqsa Waqar1, Sahir Hameed Khattak2, Sania Begum2*, Tayyaba Rehman1, Rabia1, Armghan Shehzad2, Wajya Ajmal2, Syeda Shahdana Zia2, Iqra Siddiqi2 and Ghulam Muhammad Ali2* 

...he quickest ways in this direction is the designing molecular markers for non-race-specific resistance genes. Use of molecular markers is efficient tool for screening diversity of rust genes in wheat germplasm and can facilitate the integration of multiple genes into wheat by pyramiding and transformation. This review discusses information regarding rust disease and resistance in wheat to tackle the disease through resistance breeding. 

...
Bruce R. Reichenbach
... one starts from and the direction one goes determines where one ends up. This is no less true in philosophy than elsewhere, and certainly no less true in matters dealing with the relationship between God’s foreknowledge and human free actions. In what follows I will argue that the incompatibilist view that Fischer and others stalwartly defend results from the particular starting point they choose, and that if one adopts a different starting po...
Wali Khan1,*, Noor-Un-Nisa2 and Muhammad Asif Nawaz3
...6 to December 2008 using direct smear and concentration methods. Two hundred and twenty one (21.2%) participants were found infected with one or more than one intestinal tapeworms. Seventy seven (7.39%) of the participants were infected with single parasite and one hundred forty four (13.8%) with multiple infections. Taenia saginata 32.6% (n=146/447), Ascaris lumbricoides 20.3% (n=91/447), Hymenolepis nana 19.7% (n=88/447), Trichuris tr...
Justyna Batkowska1,*, Lukasz Wlazlo2, Kamil Drabik1, Bozena Nowakowicz-Debek2, Karrar I.A. Al-Shammari3 and Magdalena Gryzinska1
...ggshell. Its use did not directly affect the hatching results and chick quality, however, they were similar to control groups, what may confirm possible use of GT juice as an alternative disinfection method.
...

Rahila Nizami1, Muhammad Zahid Latif2*, Intzar Hussain3 and Khalid Rashid

...es dealing with clinical directors and managers. This research was conducted to study the leadership styles among the medical professionals. For this purpose, a cross sectional and non-probability convenient sampling was conducted involving 59 medical professionals of Azra Naheed Medical College, Lahore. The assessment of leadership-style (T-P leadership rating scale) was applied. The age of subjects was 37.42±11.91 years; 29(49.15%) were males and 27(4...

Ata-ul-Mohsin*, Ehsan-ul-Haq** and Muhammad Naeemullah*

...ain aphid, Metopolophium dirhodum (Walker) and its parasitoid Aphidius rhopalosiphi (De Steph.). High calcium and high phosphorus concentrations applied to a partially resistant wheat cultivar “Rapier” did not have a significant effect on the growth and development of the aphid or its parasitoid. However, the mean fecundity of the parasitoid was higher on plants with high phosphorus than those treated with high calcium concentrations.

...

 Z. A. Soomro, M.B. Kumbhar, A.S. Larik*, M. Imran** and S.A. Brohi***

...dditive gene effects and direct selection may be effective. Boll weight and seed index exhibited low genetic advances irrespective to their high heritability estimates, probably due to non-additive gene effects, developing transgressive segregants through hybridization is suggested. However, hybridization system, which exploits both fixable and non-fixable components, simultaneously, could be useful in the genetic improvement of yield and yield components in u...

Aslam Memon, A. M. Khushk* and Umer Farooq**

...present study aimed to indirectly investigate into the potential of saving land and water resources by re-allocating sugarcane area to relatively more productive recommended sugarcane varieties. Secondly, this exercise shall also provide feedback to researchers in sugarcane crop as well as sugar mills for assessing the types of varieties performing better, relative to others. The study document the extent of adoption of recommended sugarcane varieties in Pakis...

 Ahmed Aziz Kurd, Amanullah, Saifullah Khan, Basharat Hussain Shah and Munir Ahmed Khetran*

...he cuttings were planted directly in polyethylene bags without IBA application. Plants were kept in a shade house and humidity was increased manually by hand sprinkling (four times in a day). Highest rooting percentage (60%) was obtained in the cuttings treated with 3000 ppm. The maximum average number of roots per cutting (4.443) and average root length (5.687 cm) were recorded with 4000 ppm IBA treatment. Percentage of rooted cuttings decreased with increase...

 Oguz Bilgin, Kayihan Z. Korkut, Alpay Balkan, and Ismet Baser*

...aracters. The degree and direction of heterosis varied for different characters and for different hybrids. The highest heterosis over mid and better parents (120.14-109.93%) was recorded in hybrid of Kyzyltan91xIDSN209 for grain weight/spike. Maximum limits of heterosis over mid and better parent for spike length, spikelets/spike, grains/spike, spike density, grains/spikelets and spike harvest index were 8.77-8.14 (Svevo//GedxYav), 8.37-7.37 (Svevo//GedxYav), ...
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2

 

... a medicinal plant Azadirachta indica on the CNS enzymes of a stored grain pest, Tribolium castaneum and a socioeconomic insect, Apis mellifera. A comparative study was designed to identify the role of saponins on insect acetylcholinesterase (AChEs). The enzyme activities were tested for the effect of saponins. The AChE activity of T. castaneum was inhibited by the saponins and follows competitive inhibition kinetics. In case of ...

Muhammad Zafarullah Khan1*, Rehmat Ullah1, Asif Nawaz1 and Ejaz Ashraf2 

 Syed Ishtiaq Hyder, Muhammad Arshadullah, Arshad Ali and Imdad Ali Mahmood*

EFFECT OF BORON NUTRITION ON PADDY YIELD UNDER SALINESODIC SOILS
...ic concentration of rice directly sown on raised beds under -1 saline sodic soils (ECe=5.32 dS m , pH=8.52 and SAR=18.87) at Soil Salinity Research Institute, Pindi Bhattian, district Hafizabad, Punjab Pakistan during 2009 and 2010. Treatments were arranged in RCBD with three replications. The crop was harvested at maturity. Data on tillering, -1 plant height, spike length, number of grains spike , 1000-grain weight, straw and paddy yields were recorded. Na, K...

 Sajida Taj*, Muhammad Tariq Iqbal Khan**, Mazher Abbas and Arshed Bashir***

PRICE SPREAD AND MARKETING MARGINS OF CUT ROSE IN PUNJAB, PAKISTAN
...d channel producers were directly linked with retailers. In Channel-I the highest consumer's price of Rs. 444.78 per 100 pieces of cut roses indicated that consumers have to pay more there. The price spread was greater in Channel-I which was Rs. 243.36 per 100 pieces of cut roses. In Channel-II where producers were directly linked with retailers, producer's share was maximized up to 46.86% which increases the marketing effic...

 Ayesha Tahir* and Zafar Altaf**

DETERMINANTS OF INCOME FROM VEGETABLES PRODUCTION: A COMPARATIVE STUDY OF NORMAL AND OFF-SEASON VEGETABLES IN ABBOTTABAD
...sing opportunity in this direction. The study is based on comparison of income obtained from production both in normal and off–season vegetables. Total sample of study was 150 vegetable producers of Abbottabad district. Majority of the sampled farmers were growing tomato and cucumber. There was not much fluctuation in the income among the farmers in normal season but the income from off-season vegetable production was almost double. Most of the farmers w...

 Ali Ahsan Bajwa*, Ehsanullah*, Shakeel Ahmad Anjum*, Wahaj Nafees*, Mohsin Tanveer* and Hafiz Salman Saeed*

IMPACT OF FERTILIZER USE ON WEED MANAGEMENT IN CONSERVATION AGRICULTURE - A REVIEW
... periods and thus have indirect impacts on weed control strategies and management options in conservation crop production.

...

 Samiullah*, Mehmood Shah*, Kalim Ullah**, Rehmat Ullah*** and Ibrarullah****

PROFITABILITY OF WHEAT PRODUCTION IN DERA ISMAIL KHAN
...that profit is under the direct positive influence of price and output of wheat grain whereas cost had negatively affected the wheat profitability. 

...

 Muhammad Sharif*, Muhammad Azam Niazi* and Abdul Jabbar**

SEAFOOD EXPORTS: CHALLENGES AND WAY FORWARD
...uction, seafood exports, direction and future prospects of seafood exports from Pakistan. The production of inland and marine fish was 729,000 t in 2012-13. Not only seafood output in the country is low but dwindling to the disastrous level. Export of seafood has increased from 131,620 t (a value of US$ 315.5 million) in 2011-12 to 136,360 t (a value of US$ 333.13 million) in 2012-13, with an annual increase of 9.5% in term of quantity and 4.5% in term of valu...

 Muhammad Zahid Kiani*, Arshad Ali**, Tariq Sultan** and Muhammad Munir Ahmed***

CHARACTERIZATION OF PLANT GROWTH PROMOTING RHIZOBACTERIA ISOLATED FROM ROOT SYSTEM OF SUNFLOWER (HELIANTHUS ANNUS L) GROWN UNDER SALT AFFECTED AREA OF PAKISTAN
...ing rhizobacteria (PGPR) directly promote plant growth by providing indole-3-acetic acid (IAA), solubilization of inorganic phosphates, nitrogen fixation and siderophores and other organic acid production, whereas indirectly support plant growth by suppressing plant pathogens. The objective of this study was isolation and characterization of bacterial strains from rhizosphere, endosphere and rhizoplane of sunflower. Thirty s...

 Riaz Hussain*, Muhammad Riaz** and Mushtaq A. Saleem***

TOXICITIES OF AZADIRACHTIN AND POLYCHLORINATED PETROLEUM HYDROCARBON AGAINST RESISTANT AND SUSCEPTIBLE STRAINS OF TRIBOLIUM CASTANEUM (COLEOPTERA: TENEBRIONIDAE) ADULTS
...gnated method against azadirachtin (Nimbokil 60 EC) and polychlorinated petroleum hydrocarbon (Tenekil 100 EC). The LC values of these insecticides were worked out as 12830 and 50 9331 ppm for azadirachtin and 5148 and 4047 ppm for Tenekil 100 EC against PAK and FSS-II strains, respectively. The results revealed that polychlorinated petroleum hydrocarbon was more toxic than the azadirachti...

 Syed Asif Imran Shah*, Shah Jehan Khan**, Abdul Aziz Baloch*** ,
Obaid Ullah Sayal**, Kalim Ullah* andShujaat Ali**

COMBINING ABILITY ANALYSIS IN VARIOUS INBRED LINES OF MAIZE (ZEA MAYS L.)
...fic combining ability of direct and reciprocal effects were observed for all attributes. Azam -1 proved good combiner for days to 50% silking and kernel rows ear while -1 Islamabad Gold for kernels ear and grain yield. Islamabad White × Sadaf was the best combiner for grain yield. For reciprocal effects, BS-I × Sahiwal -1 -1 2002 proved good combiner for kernels row and kernels ear while BS-I × Islamabad White for grain yield. Selection in ea...

 Umar Ijaz Ahmed*, Liu Ying**, Muhammad Khalid Bashir***,
Muhammad Amjed Iqbal*, Muhammad Rizwan*, Muhammad Mazhar
Iqbal****, Muhammad Rafi Qamar***** and Aftab Nazeer******

SPATIAL PRICE TRANSMISSION IN PAKISTAN: THE CASE OF WHEAT AND RICE MARKETS
...m except few markets. Unidirectional and bidirectional causality exists between wheat and rice markets. Bad and poor infrastructure is a major impediment to price transmission among the markets. These market imperfections lead to food insecurity in the country. Government should formulate better policies and develop infrastructure towards better and efficient market function. The results of this study will help the policy ma...

 Imdad Ali Mahmood*, Arshad Ali**, Armghan Shahzad**, Muhammad Asif Masud Ghumman***, Muhammad Arshad Ullah**, Tariq Sultan** and Badar-u-Zaman**

CROP RESIDUES AND PHOSPHORUS EFFECT ON YIELD AND ECONOMICS OF DIRECT SEEDED RICE AND WHEAT GROWN UNDER SALINE-SODIC SOIL
...g ) was c 3 conducted on direct seeded rice and wheat for two consecutive years at Soil Salinity Research Institute (SSRI) Farm, Pindi Bhattian, Pakistan to investigate the yield and economics of direct seeded rice and wheat under crop residue incorporation and phosphorus applications. Split plot design (crop residue in main plots and P application in sub plots) was followed with three replications. Biomass yields were colle...

 Hina Fatima** and Bushra Yasmin**

EFFICIENCY AND PRODUCTIVITY ANALYSIS OF PAKISTAN'S FARM SECTOR: A META-ANALYSIS*
...igned to evaluate the misdirected growth policies in farm sector of Pakistan.

...

 Arshia Naeem*, Maria Anjum*, Mariam Rehman*, Zahid Mahmood** and Muhammad Asif Kamran**

AN INTEGRATED INFORMATION SYSTEM TO FACILITATE FARMERS IN WHEAT, SUGARCANE AND OTHER CROP DISEASES IDENTIFICATION
...heir crop related issues directly to agriculture scientists is proposed. This 'AXPERT Platform' consists of web application that provides user centered interface to farmers and a desktop application that facilitates agricultural scientists to identify crop diseases. A case study was developed from Faisalabad region where information about crops, their soil conditions and associated diseases were provided on a web application. An online registration facility wa...

Jesse M. Smith

... should investigate more directly religious leaders’ rhetoric to better understand the relationship between religious and secular spheres.
...
Zheng Quan Jiang1,2, Feng Shan Li3, Jiang Hong Ran1,*, Chen Hao Zhao1, Man Zhang1 and Hua Li4
... nest, grass mound nest, dirt mound nest and floating grass nest. The nest length, nest width, nest height and nest volume among the four types of nests all were significantly different in the order: floating grass nests >dirt mound nests >grass mound nests >natural island nests, indicating that nest size was related to nest type. Among the three kinds of nest-site habitats, there were no significant differences in ...
Abdul Nabi Jatt1,*, Sarfraz Ali Tunio1, Shaista Bano Memon1, Abdul Sattar Qureshi2 and Muhammad Aqeel Bhutto
...enzymes on routine basis directly in bacterial cultures and biological fluids.
...
Grace C. Onyishi, Ifeanyi Oscar N. Aguzie, Christopher D. Nwani*, R.N.N. Obiezue and I.C. Okoye
...erature declined in same direction. Malaria prevalence correlated positively with Anopheles mosquito abundance (r = 0.863, p = 0.012). Mosquito abundance and malaria prevalence strongly correlated negatively with temperature (r = -0.799, p = 0.031 and -0.869, p = 0.011, respectively). The positive correlation between relative humidity and malaria prevalence and mosquito abundance was not significant (p < 0.05). Malaria prevalence in Nigeria is influe...
Grace Chinenye Onyishi, Ifeanyi Oscar Aguzie, Joseph O. Okoro, Christopher Didigwu Nwani*, Ngozi Ezenwaji, Ndubisi Stanley Oluah and Fabian C. Okafor
...ated host morbidity, and direct and indirect cost of such parasitism to human is important, first for human health and welfare, secondly for sustainable snail farming, and finally for maintenance of snail biodiversity.
...

Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1 

...Pakistan and a source of direct and indirect employment in the country. Current study was designed to explore net return and resource use efficiency in sugarcane production in district D.I. Khan, Khyber Pakhtunkhwa. To realize the objectives of the study, primary data was collected from 76 sugarcane growers through a well-designed interview schedule. Debartin formula was used to calculate net return, while a Cobb-Douglas typ...

Amjad Ali1, Rajan Shrestha2, Ghaffar Ali1, Irfan Ullah1 and Salman Khan1 

...Pakistan and a source of direct and indirect employment in the country. Current study was designed to explore net return and resource use efficiency in sugarcane production in district D.I. Khan, Khyber Pakhtunkhwa. To realize the objectives of the study, primary data was collected from 76 sugarcane growers through a well-designed interview schedule. Debartin formula was used to calculate net return, while a Cobb-Douglas typ...
Riyadh S. Aljumaah*, Mohammed A. Alshaikh, Abdulrahman Jarelnabi, Mutassim M. Abdelrahman and Mansour F. Hussein
...as determined using an indirect enzyme linked immunosorbent assay (ELISA). All camels tested were clinically normal. Out of 253 camels of either sex, 117 (21.99%) were found to be serologically positive to specific anti-N.caninum antibodies. Logistic regression analysis and estimation of odds ratio revealed significant association of the sex and location of the camels with N. caninum seropositivity. On the other hand, neither the breed nor age of...
Lotta Wahldén1, 3, Ulf Emanuelson1, Torsten Møller2 and Jonas Johansson Wensman1*
...CDV antibodies, and an indirect IgG ELISA was used to detect CPV antibodies. Neutralizing antibodies was induced after CDV vaccination and persisted up to 3.9 years. Most animals had high IgG antibody titers to CPV prior to vaccination and vaccination did not result in increased titers. A decline in CPV antibody titer with increasing age was observed regardless of immunization status. Our results suggest that vaccination of African wild dogs with a live attenu...

Shahid Ali1* and Salamat Ali2  

...f Pakistan is generating direct and indirect employment and provision of income for millions. This study, therefore, estimated and compared costs and revenues of open shed and environmentally controlled (EC) shed broiler farms in Punjab, Pakistan. Multistage sampling technique was applied for selection of sampled respondents. 120 farmers, 60 farmers of open shed and 60 farmers of EC shed were interviewed during 2014. Dummy v...
Yakup Erdal Erturk1, Adem Aksoy2 and Mohammad Masood Tariq3,*
...n (comprising Erzurum, Igdir, Kars and Agri provinces) of Turkey. For this goal, Multivariate Adaptive Regression Splines (MARS), a-non parametric regression technique, was used to develop a respectable prediction equation that can denote interaction effects of influential predictors in the definition of the influential factors on AFFLW as an output variable for male and female crossbred cattle. Several predictors in the current survey were province (Erzurum, ...
Muhammad Shahbaz Aslam1, Iram Gull1, Zaigham Abbas2,* and Muhammad Amin Athar1
...s as well as through its direct action on target cells. The recombinant expression of some proteins in E. coli produces inclusion bodies which are misfolded proteins. The objective of this study was soluble expression of IFNα2-Tα1fusion protein in E. coli using pET-SUMO vector and determination of its biological activity. SUMO-IFNα2-Tα1 was successfully expressed in soluble form with IPTG induction to final concentration 0...
Huma Naz1,*, Sajid Abdullah2, Sidra Naz3, Sidra Abbas2, Wardah Hassan2, Shakeela Perveen2, Moazama Batool1, Laiba Shafique2
...ations showed strong and direct relationship with, fin movement followed by mucous secretion, hyperactivity and swimming rate for C. mrigala with R2 value of 0.858, 0.853, 0.216 and 0.005, respectively. The Fe+Ni+Pb+Zn mixture exposure at 96 h LC50 concentration caused significant decrease of catalase activity in liver, kidney, gills, muscle and brain of C. mrigala as compared to control. This study suggests that the behavio...
Muhammad Waheed Mushtaq1,*, Jamil Anwar2, Omara Naeem3,Farah Kanwal1 and Waheed-uz-Zaman1
Nausheen Irshad1,*, Imran Yousaf1, Tariq Mahmood2 and Muhammad Saeed Awan1
...ortunistic survey) and indirect observations based on signs of the species were recorded. This was supplemented with information collected through questionnaire survey. Results confirmed the occurrence of leopard at six out of twelve sampling sites surveyed, in the form of evidences including pug marks, cave/ den, and dead bodies (two carcasses and one skin) of the animal. Moreover, three kill records of the animal in a short duration of six months are indicat...
Nadeem Munawar, Iftikhar Hussain and Tariq Mahmood*
...damage to various crops, directly and indirectly, by gnawing, spoilage, contamination and hoarding activities. The current study investigated the occurrence of different rodent species inside the crop fields and at field edges, associated with four major crops (wheat, groundnut, millet and maize) in the Pothwar Plateau. In all four crops, maximum number of rodent burrows was recorded at maturity stages of the crops. The matu...
Qaisar Jamal1, Muhammad Idrees1, Saif Ullah2, Muhammad Adnan1, Farrah Zaidi1, Qaiser Zaman1,3 and Syed Basit Rasheed1,*
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Shehla Gul Bokhari1, Ikramul Haq1,*, Imdad Ullah Khan3, Naimat Ullah4, Naimat Ullah Khan4, Kashif Hussain1 and Azmat Ullah Khan2
...rs were evaluated with indirect haemagglutination test. The results indicated significantly higher (P< 0.05) immune titer in animal group vaccinated with toxoid vaccine prepared from pathogenic isolates and provide best protection against challenge infection.
...

Ghulam Abbas1, Muhammad Jawad Asghar1, Muhammad Rizwan2*, Muhammad Akram1, Jaffar Hussain1 and Fiaz Ahmad1 

...lso showed high positive direct effects on seed yield. Hence,indirect selection for these traits may facilitate for developing high yielding genotypes. The diversity analysis categorized fifty-eight genotypes into four clusters. Clustering pattern did not show any relation to the geographic origin. Cluster-I with three genotypes (Thailand: 2; Sri Lanka: 1) and Cluster-II with seventeen genotypes (Thailand: 12, Pakistan: 3, I...
Abdul Wajid1,*, Asma Basharat2, Muhammad Akbar Shahid3, Sidra Tul Muntaha1, Abdul Basit4, Tanveer Hussain5, Muhammad Farooq Tahir6, Muhammad Azhar7, Masroor Ellahi Babar1 and Shafqat Fatima Rehmani2
...enetic analysis based on direct sequencing of hypervariable region of hexon gene grouped these sequences into two distinct groups, three FAdV isolates were clustered together belonging to fowl adenoviruses C species and serotype FAdV-4. The similar viruses have been commonly isolated since late 1980s from the poultry flocks. In addition, seven genetically related FAdV isolates were from fowl adenovirus type 11 in D species. To our knowledge, this is the first ...

Wasim Javaid1, Farid Asif Shaheen1*, Farah Naz2 and Muhammad Usman Raja2 

...ss against this pest was directly proportional to its concentration as well as exposure time. For effective management of C. chinensis, 1×108 spores/ml of M. anisopliae and B. bassiana is recommended for safer storage of chickpea, pulses and grains. 

...
Mudassar Javed1,Muhammad Zeeshan Majeed1,*, Muhammad Sufyan1, Sajjad Ali2 and Muhammad Afzal1
...ng the botanicals, Azadirachta indica, Citrullus colocynthis and Nicotiana tabacum caused the most significant reduction of okra borers in both years, followed by Curcuma longa and Corymbia citriodora. These synthetic insecticides and botanicals on average reduced okra fruit infestation by 20 to 56% and by 18 to 10%, respectively, and increased okra fruit yield up to 45%. We therefore recommend their integration in biorational IPM p...
Manzoor Hussain*, Miloslav Zouhar and Pavel Ryšánek

 

...attraction intensity was directly proportional to time and based on the nutrients provided by the nematodes. In this experiment, the nematophagous fungi Arthrobotrys oligospora, A. superba, A. musiformis, Dactylella oviparasitica, Clonostachys rosea, Stropharia rugosoannulata, Lecanicillium muscarium, Trichoderma harzianum, T. viride, Pleurotus ostreatus, and Monacrosporium ellipsosporum demonstrated a prominent...

Ghulam Abbas1, Khalid Pervez Akhtar1, Muhammad Ahsan2, Muhammad Jawad Asghar1, Fiaz Ahmad1 and Muhammad Rizwan3* 

... can, therefore, be used directly as varieties to manage the disease after evaluation for acceptable agronomic characteristics, adaptation, and stability in various regions or can be used as a resistant source in further breeding programs 

...
Dan Yü, Chuchu Li, Yü Huang and Zhen Huang*
...s and difenoconazole was directly related to the concentration of each component used in mixtures. Additive effects were observed in all treatments according to the mycelial growth inhibition, Me and Chi-square values. The use of T. hamatum offers a promising and effective co-formulation product or alternative to chemical fungicides in controlling popcorn disease of mulberry.
...

Muhammad Ishfaq1*, Nadeem Akbar1, Imran Khan1, Shakeel Ahmad Anjum1, Usman Zulfiqar1, Muhammad Ahmad1, Mumtaz Ahmad2 and Muhammad Umer Chattha1 

...es along with quality of direct seeded rice. Farmer field-based experiment comprised two soil moisture regimes at the time of sowing: (M1 = Sowing in moist (field capacity) condition, M2= Sowing in dry condition) in main plots, while three different row spacings (S1: broadcasting, (no defined row spacing) S2: 11.25 cm row spacing, S3: 22.50 cm row spacing) were assigned to sub-plots. The experimental results revealed that treatment S3 (22.50 cm row spacing) to...
Gokhan Sahin1, Ecevit Eyduran2,*, Mete Turkoglu3 and Fatma Sahin2
...of migratory birds in Iğdir, Turkey for next studies with the scope of global warming.
...

Ejaz Ashraf1*, Bushra Hassan2, Nadeem Anwar2, Hafiz Khurram Shurjeel3 and Shafique-ur-Rehman

... in the area. There is a dire need to invest in expert knowledge and vocational training opportunities to bring change in the skills level of the respondents in the study area. It is recommended to create job opportunities by boosting up educational and agri-business opportunities based on the needs, skills and by providing required training for economic wellbeing of the respondents 

...

Amar Razzaq1, Abdur Rehman4*, Abdul Hassan Qureshi2, Iqbal Javed3, Raheel Saqib5 and Muhammad Nadeem Iqbal6 

... interventions should be directed at increasing the adoption rates among small farmers. This could be done by spreading awareness among the farmers about the economic benefits offered by HEIs. 

...

Sajad Ali1*, Syed Asghar Ali Shah2, Jaffar Ali3, Muhammad Nadeem Iqbal4, Arshadullah Jadoon5 and Farmanullah

...of peas from the farmers directly from the local market that is Mansehra and Haripur. It is worthwhile to mention that the public sale arrangement was not totally available in the local markets. Furthermore, the 68 percent in district Mansehra while, in the Haripur 46 percent farmers traded the pea’s output in the local markets. The left over peas output in both the selected districts were offered for sale in the regional markets that is Rawalpindi and P...

Fan Shuli1*, Ameer Hussain Jarwar1,3, Xiaoyan Wang2, Long Wang1 and Qifeng Ma

...l to provide it suit for direct used as vegetable cooking oil alternatively of hydrogenating it is also known as ghee in (solid form), devising cotton production more vulnerable to abiotic and biotic menace. 

...
Qudrat Ullah1,*, Huma Jamil1, Zafar Iqbal Qureshi1, Muhammad Saqib2 and Heinrich Neubauer3
...ve livestock farms. An indirect-Enzyme Linked Immunosorbent Assay (iELISA) was used to detect anti-C. burnetii antibodies in the serum. Serological analysis revealed overall flock-level sero-prevalence of 92.3% which varied from 88.88% in sheep and 100% in goat, while individual level sero-prevalence was 15.6% in sheep and 15.0% in goats, the difference being non-significant. A significant (P<0.05) association was found between seropositivity ...

Bushra Qadir1, Muhammad Asim2 and Mohammad Akmal1* 

...red leaves of Bakayn (Azadir achtaindica), Ber (Ziziphus mauritiana) and water (H2O) and planted in pots on the next morning. The experiment was conducted in a completely randomized design at the University of Agriculture Peshawar during winter 2013-14. Periodic growth sampling was taken by harvesting three pots of treatments starting in early spring and thereafter during tHEgrowth to the maximum five samplings to study roots and shoot growth. Averaged across ...

Aneel Salman1, Muhammad Iftikhar ul Husnain1, Inayatullah Jan2*, Muhammad Ashfaq2, Mudassar Rashid1 and Usman Shakoor1 

... to the GDP and supports directly or indirectly about 68 percent of the population for their sustenance. Farmers’ perception about climate change, current adaptation measures, and decision-making process is important for farmers’ successful adaptation strategies. Using data of 205 conventional farmers from three district of Punjab province, this study provides insights into farmers’ perceptions about climat...

Amjad Ali1, Abbas Ullah Jan1, Lal Almas2, Noor Piao Khan1 and Khurran Nawaz Saddozai

... would help farmers to redirect their scarce resource allocation and reduce allocative inefficiency. 

...
Shagufta Naz*, Saima Sharif, Hafsa Badar, Syeda Fareeha Tauheed
...uch type of research was directed to find the prevalence of Macular corneal dystrophy in the families of Lahore. The techniques used for the diagnosis of MCD were visual Acuity test by Snellen chart, phoropter, slit lamp biomicroscopy, topography, keratometer and pachymetry. In this study, 50 patients of MCD were identified among which 40 were males and 10 were females, including 9 cases with family history. Main complaint was drop in visual acuity and loss of...

Asma Sohail1*, Kashif Sarfraz Abbasi1, Maryum Arif2 and Fatima Najam1 

.... extrusion method and indirect diffusion method using Ca-alginate. Pumpkin seed oil macrospheres showed 91.9 % encapsulation efficiency and 63.0 % loading capacity by direct extrusion method. However, indirect or diffusion method showed 43.0 % and 24.7 %. These results showed that direct method of encapsulation was suitable for oils to achieve maximum e...

Muhammad Arshad*, Sabeeta Jan, Sundas Awan, Samra Azam, Shiguftah Khalid and Muahmmad Ayub Khan 

...correlation coefficient, direct and indirect effects of eight characters towards seed yield under field condition. Experiment was conducted according to RCBD design at NARC (National Agricultural Research Centre), Islamabad during year 2015. Data were recorded on Days to flower initiation, Days to flower completion and Days to maturity, 100 seed weight, oil content percentage and Seed Yield. Results of ANOVA revealed that th...
Tariq Mahmood1,*, Ijaz Ahmad1, Faraz Akrim1, Abdul Hamid1, Muhammad Waseem1, Abid Hussain1 and Muhammad Sajid Nadeem2
Tevfik Ceyhan1,*, Osman Samsun2 and Okan Akyol1
... the garfish. Apart from direct fishing control measures aiming to reduce fishing mortality, the establishment of a MLS of 38cm that coincides with the length at first maturity would be also beneficial for the stock. Our results suggest that the garfish stock undergoes high levels of fishing pressure and the adoption of management measures is necessary.

...

Syed Atif Hasan Naqvi1*, Ummad-ud-Din Umar1, Ammarah Hasnain2, Ateeq ur Rehman1 and Rashida Perveen1 

...e of Mentha piperita, Azadirachta indica and Aloe vera either tested individually or in combination of two or more than two decoctions against the bacterium in question. When used individually, M. piperita demonstrated best in vitro, field and glass house experiments followed by the A. indica which also proved its efficacy against the pathogen. The combination of M. piperita, A. indica and C. limon was superior in reducing the BLB of rice. Besides this, all tr...

 *Irum Javed1, Muhammad Asgher2, Sadia Noreen1, Humara Naz Majeed1 and Tanzila Sahar1

SOLID STATE FERMENTATION OF ASPERGILLUS NIGER FOR CITRIC ACID PRODUCTION USING AGRICULTURE RESIDUE AS SUBSTRATE
...strial wastes. It is a bidirectional beneficial process for cost effective manufacturing of citric acid and management of agro-industrial waste products. This project was carried out in order to evaluate the enhanced production of citric acid by Aspergillus niger using agro-industrial wastes. In the first step of study the liquid state fermentation (LSF) and solid state fermentation (SSF) by Aspergillus niger was compared using molasses based medium and the di...

 Saiqa Andleeb* , Shaukat Ali

RNA interference; A tool for treatment of human diseases
.... In recent era, RNAi is directly used in therapy of various infectious and non-infectious diseases. Variety of human diseases like cancer, viral and neuromuscular has been controlled through RNAi. Some vectors and inducible systems are available now to treat numerous disorders. This review paper provides the basis for further development of RNAi technology as a drug therapy against various human disorders.

...

Mohammad Salim1, Arshad Javid2*, Ali Hussain2, Faiz-ur-Rahman3, Hamidullah4 

First provincial record of desert yellow bat Scotoecus pallidus (Dobson, 1876) from Khyber Pakhtunkhwa, Pakistan

 Abbas Ali1, Muhammad Altaf2*, Muhammad Samar Hussain Khan3

Winter survey of birds at Keti Bunder, district Thatha, Pakistan
...ary, 2016),
using direct and indirect methods. During the survey, total of 49 winter season bird species belonging to 33 genera
and 21 families were recorded. A total of 4280 birds were recorded dedicated survey effort from the Keti Bunder.
Dominance (D), Shannon-Wiener diversity Index (H’), Simpson Index (S), Evenness (E) and Margalef (R) were
observed form the study area as; 0.06, 3.23, 0....

 Jhan Zeb, Muhammad Javed

Forecasting percentage contribution of plankton biomass towards increase in fish yield under composite culture conditions
... treatments, showing the direct dependence of fish yield on plankton
productivity. The order of percentage contribution of plankton productivity towards increase in fish yield is T3 ≥ T4>
T1> T6> T7> T5> T2. Regression model developed for T1, T2, T3, T4, T5, T6 and T7 illustrated 63.40, 51.60, 64.50,
64.00, 52.20, 58.70 and 54.00% dependence of increase in fish yield on plankton productivity, respectively.

...

 Muhammad Khalil Ahmad Khan1*, Muhammad Zafar2, Munazza Perveen3, Munir Ahmad3, Asia Iqbal4, Asmatullah3

Efficacy of malathion and carbosulfan against crop invadedaphid types Aphis craccivora (Koch) and Aphis gossypii (glover) on bean and brinjal plants
...p> In this study, indirect application of two important insecticides viz., malathion and
carbosulfan against two important crop infesting aphid species Aphis gossypii
(Glover) and Aphis craccivora (Koch) were reared on brinjal and bean plants
respectively. In the laboratory, the vegetable plant leaves being applied by residual
film technique with tested Aphid population. The most toxic insecticide was found
to be malathi...

Saman Fatima* and Shazia Iram 

...Under molecular approach direct DNA was isolated from the infected skin of sampled fruits by using CTAB method. The pathogens being identified through classical approach includes: Penicillium sp., Aspergillus flavus, Aspergillus niger, Alternaria sp., Lasiodiplodia theobromae, Fusarium sp. After sequencing of DNA the pathogen species identified includes fungal Colletotrichum sp. These pathogens are involved in deterioration the skin of Citrus reticulate. They ...

Amara Amjad Hashmi1,2,*, Maqbool Hussain Sial3, Waqar Akram4 and Maaida Hussain Hashmi5,6

... this study, we try to indirectly quantify the welfare of people in Pakistan through measuring the food insecurity, malnutrition during last decade (2005-14). This study takes lead from earlier studies, in a sense; it covers two food price hike periods (2007 and 2011). So, it is important to understand, how food insecurity status and nutrition are affected by these shocks during this period. Thus, we use nationally representative data called as Household Incom...

Zakiullah1, Muhammad Farid Khan1*, Muhammad Mohibullah3, Muhammad Iqbal2, Irfanullah3, Faheemullah3, Madiha Urooj1 and Uzma Arif1 

...ic combining ability for direct and reciprocal crosses shows highly significant differences for all the studied parameters. PSEV-3 proved best combiner for days to germination and grains moisture % at harvest while Azam for grain yield and biological yield. Sarhad White was the best combiner for grain yield. Reciprocal effects of Jalal x Iqbal exhibited best combination for leaf area and number of grains ear-1 while Pahari × Sarhad White for grain yield....
Syeda Beenish Bukhari1, Sidra Khalid1*, Shahid Bashir1, Riffat Mehboob2, Humaira Waseem2
...f vaccination procedure/ dirty needles. Analysis revealed a significant association between maternal education and barriers to complete vaccination course.
...

Rafiullah1*, Abdur Rahman2, Khalid Khan1, Anwar Ali1, Arifullah Khan2, Abdul Sajid3 and Naimatullah Khan3 

...-time PCR, followed by Indirect ELISA (24.62%) and Microscopy (11.37%). Transect wise high prevalence for Theileria parva was observed in Lakki Marwat with 33.5% for Real-time PCR, significantly different at P<0.05 from Peshawar. Cattle showed 100% more positive results as compared to Buffalo. All the techniques showed highest prevalence of Theileria parva for female population as compared to male population. Age wise prevalence was not significantly differ...
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
... was first identified by direct sequencing approach, and resulted in three genotypes of AA, GA and GG. Association analysis demonstrated that the liver ChREBP mRNA expression level was significantly positive or negative effect on serum total protein (TP), albumin (Alb), triglyceride (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C) and low-density lipoprotein cholesterol (LDL-C) (P<0.05 or P<0.01). The g.247075G>A mutation was...
Saleh S. Alhewairini1,* and Mahmoud M. Al-Azzazy1,2
...ltatum after 24 h of direct exposure (direct spray treatment) whereas in the dipping treatment, the mortality was 60% and 70% for H. dromedarii and H. impeltatum at 14,000 ppm of Huwa-San TR50. Huwa-San TR50 was found to be moderately effective in killing both tick species. Therefore, it can be used to develop a new and safe strategy for controlling ticks, so as to produce dairy and meat products with minim...
Temel Göktürk1,* and Göksel Tozlu2
...e of both pesticides was directly propositional to the death in larvae. Intriguingly, Dipel at the dose rate of 500 g/100 l was the most effective applications for larvae of N. sertifer. While variable impacts were noticed against larvae, both biopesticides were effective against larvae of D. pini and N. sertifer. Taken together, finding of this study propose the use of Pyrethrum and Bacillus thuringiensis biopesticides to co...
Seth Robertson
... interpret and utilize indirect communication with ease and alacrity. In this paper, I introduce and discuss the concept of nunchi with a focus on two main senses in which it is used: as a skill and as a burden. Then, I discuss the relation of nunchi to well-being and flourishing, both in specifically Korean cultural contexts and in social contexts more generally. Finally, I argue that because of nunchi’s close relation to well-being and flourishing, tha...

Salman Anwar1, 2*, Farhan Anwar Khan3 and Atta-ur-Rahman4 

...70% of its population is directly or indirectly associated with this sector. Gilgit-Baltistan is a vast mountainous and remote area in the extreme north of Pakistan.. The inhabitants of this area are mostly engaged in the agricultural sector. Before the construction of KKH, their mode of agriculture system was subsistence and crude techniques were applied due to non-availability of modern machines and techniques. This was be...
Muhammad Arshad1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Yasir Iftikhar2, Samina Khalid3, Zahoor Hussain4, Jaime Molina-Ochoa5,6 and John E. Foster6
...tested botanicals, Azadirachta indica oil showed better results with percent CLM mortality of 35.6%, through topical bioassay and 31.8% through leaf dip bioassay. In the case of A. indica, the LC50 value was also observed lower (1.88±0.37, 1.73±0.29) in LDB and TB, respectively, as compared to other botanicals. So, our study suggested that abamectin gave better management of citrus leafminer larvae. However, higher...

Ihsan Ullah Khan*, Muhammad Arshad, Muhammad Ayub Khan, Muhammad Ashraf, Ashiq Saleem, Sundas Awan, Samra Azam and Shamim Ul Sibtain Shah 

...oration genes gave a new direction to heterosis based sunflower breeding and consequently revolutionized sunflower seed sector. The high impact of heterosis on the yield and other yield contributing traits in the hybrids, as revealed in this study, offers good prospects for the future use of hybrid breeding in sunflower if genetically more diverse germplasm is incorporated in breeding programs. 

...

Shahid Ali1*, Asim Khan1, Aftab Khan1 and Bakhtawar Riaz

...justify;">This study was directed in district Peshawar, Khyber Pakhtunkhwa, Pakistan. This study evaluated technical efficiency of tomato farms and to catch factors if any causing technical inefficiency in tomato production. 90 farmers were selected through multi-stage proportional allocation sampling techniques. Data was collected by using a well-structured interview schedule. Cobb-Douglas production function was employed to assess technical efficiency. Maxim...
Emel Banu Buyukunal1,*, Rojan Ibrahim Albazaz1 and Mehmet Ali Bal2,3
...smission source for both direct and indirect transfer of those bacteria to human. For this reason, 45 cloacal samples comprising from 23 Japanase quails and 22 chickens were analyzed by conventional and molecular methods for E. coli isolation in this study. Subsequently, antimicrobial susceptibility profiles of E. coli isolates (n=71) were determined against thirteen agents; amoxicillin-clavulanic acid, piperac...
Senol Celik
...could be considered as indirect selection criteria for breeding schemes. It could be suggested that the CART, the CHAID, the Exhaustive CHAID and especially MARS algorithms in the prediction of live body weight were significant statistical tools in sophistically describing the studied breed standards for breeding purposes.

 

...
Ailing Huang, Lingyu Meng, Wei Zhang, Junyan Liu, Guangyao Li, Huihua Tan, Wen Lu and Xialin Zheng*
...rend was in the opposite direction for other four pesticides; activity of superoxide dismutase (SOD) was promoted by beta-cypermethrin and chlorpyrifos, and inhibited by abamectin and bisultap; Activity of catalase (CAT) was promoted by beta-cypermethrin, chlorpyrifos and bisultap, inhibited the influence of promotion by thiamethoxam. Results suggested that P. flammans larvae could be effectively controlled by beta-cypermethrin 10 mg/L and abamectin 25 ...
Ghulam Murtaza1*, Razia Sultana2, Muhammad Arshad Malik3, Sibtain Afzal4, Mubashar Hussain5, Shahid Bashir6
...hod such as transcranial direct current stimulation.
...
Zhengfei Wang*, Dan Tang, Xuejia Shi, Huayun Guo, Xiuping Chen, Daizheng Zhang and Boping Tang*
...ositive selection (i.e., directional selection) in vent crabs by at least two methods. A series of putatively selected codons was localized in or close to the important functional regions (protein binding region and helical transmembrane region) in the mitochondrial protein structure.These results help explain why Bythograeidae crabs are capable of living in the hydrothermal vents and suggest that these crabs might have acquired an enhanced capacity for energy...
Hafiz Abdul Ghafoor*, Muhammad Afzal, Muhammad Asam Riaz and Muhammad Zeeshan Majeed
...anical extracts of Azadirachta indica (neem) and Gardenia jasminoides (gardenia) were the most effective with minimum LC50 (20.00 and 42.19%, respectively) and LT50 (47.97 and 71.26 h, respectively) values followed by Nerium indicum (oleander). Moreover, the essential oils of Datura alba (dhatura) and Syzygium aromaticum (clove bud) were the most effective against D. mangiferae with minimum LC

Hala Mohamed Nabil Tolba1, Naglaa Fathy Saeed Awad1*, Gamelat Kotb Farag Kotb2, Amany Adel3 

...mples were subjected for direct detection of a 620 bp hypervariable region in the VP2 gene using Reverse transcriptase polymerase chain reaction (RT-PCR). The nucleotide and deduced amino acid sequences for VP2 hypervariable region of selected five IBDV field isolates were determined and compared to well characterized reference and vaccine strains worldwide. The IBD virus was detected in 9 out of 16 (56.25 %) investigated chicken flocks. Sequence analysis reve...
Farah Bilal*, Abdulmohsen Alhejaily, Shahida Husnain
...one by QMC-PCR following direct sequencing with sangers’ method. Only one sample detected p.E545K mutation at c.1633G>A. Another most common mutation was observed in PIK3CA exon 20 which leads to change A>G at codon 1047. This transition converts amino acid histidine to arginine. Our study concluded p.H1047R most frequent while p.E545K rarely found mutations in PIK3CA gene in NSCLC population. Present study can be proved as road map i...
Xuefeng Cao1, Guangneng Peng1, Xiaobin Gu1, Changliang He1, Guizhou Yue2, Jun Shi3,* and Zhijun Zhong1,*
...action, we established a direct amplification TaqMan real-time (RT)-PCR method (DARPM) to detect CPV and CDV in clinical samples. We compared this new method against real-time PCR/(RT)-PCR and it showed no cross-reactivity with other pathogens. Sensitivity testing showed the minimum detection limits of real-time (RT)-PCR were 7.44×101 copies·μL-1 (CPV) and 4.20×101 copies·μL-1 (CDV). D...

Shaikh Abdul Lateef, Zhou Lin, Wu Jian, Junjie Qian, Jonathan Hartanto Tan and Zheng Shusen*
 

...challenge for mankind is directly involved in the progress of hepatocellular carcinoma (HCC) subsequently affecting 250 million human population. Due to the complex viral genome of HBV, complete recovery from hepatitis is not achieved. Epidemiologically, it has been classified into infectious and serum hepatitis. The pattern of disease progression manifests liver inflammation, chronic hepatitis and hepatocellular carcinoma. In this article, we present a compre...
Gulzhan Аubakirova1,*, Zhanat Adilbekov2, Assylkhan Inirbayev2 and Tanatar Dzhamanbayev1
...ated.
...

Ayub Khan* and Ghaffar Ali 

...ted program, and in this direction the concerned government and non-government organizations can play key role in educating and mobilizing farmers 

...
Arif Jan*, Abdul Rab, Haroon, Rooh Ullah, Tauheed Ullah and Ikram Ullah
Qudrat Ullah1,8,*, Huma Jamil1, Laeeq Akbar Lodhi1, Zafar Iqbal Qureshi1, Shakeeb Ullah1, Tariq Jamil2, Iahtasham Khan3, Shahbaz Bashir4, Qudratullah5, Inamullah Wazir6M. Abdus Sallam1 and Muhammad Zubair7
...ate Test (RBPT) and by indirect-Enzyme Linked Immunosorbent Assay (iELISA). The overall seroprevalence was found to be 28.90 and 27.86% by RBPT and iELISA, respectively. Previous history of animal reproductive disorders was found to be significantly associated (P=0.0056) with seropositivity of the infection. Age, sex, parity, lactation and pregnancy status of the animal were not found significantly associated. Routine herd screening, consumtion of paste...
Khansa Nazir1,*, Tariq Mukhtar1 and Humayun Javed2
...y of juveniles showing a direct relationship between mortality and concentration of nanoparticles. The effect of time on mortality was also found significant. With the increase in time, there was a corresponding increase in mortality and the relationship was found to be directly proportional. Similarly, the maximum hatching inhibition of M. incognita eggs was recorded at a concentration of 100 mg/ml of nanopart...
Muhammad Waheed Mushtaq1,*, Muhammad Waqar Younas2, Jamil Anwar2, Syed Mustansar Abbas3 and Shahid Bashir3
...ying novel concept of unidirectional freezing. To separate the enzymes from their aqueous system, directional freezing was applied horizontally through synthetic enzyme contaminated water samples, called radial freezing. After complete freezing, the samples were collected from various sections of the frozen mass and concentration of enzymes was determined. It was found that more than ~85% mass of enzymes, migrated along with...
Muhammad Saeed1,2,*, Tariq Mukhtar1 and Malik Abdul Rehman3
... at both the orchards. A direct relationship was observed between nematode population and temperature. Maximum nematode and female populations were observed at a temperature ranging between 26°C to 29°C at a soil depth of 30 cm. On the other hand, minimum populations were recorded at a temperature range of 9°C to 12°C. Similar trends were observed at the soil depth of 45 cm. It is concluded from the present study that the management of nematode...

Haidar Ali1, Malik Muhammad Shafi1*, Himayatullah Khan1 and Hamra Haidar

...as interview schedule or direct observations. Random sampling technique was used for selecting a sample size of 195 small farmers. The present study is focused on two selected districts of Peshawar Valley namely Mardan and Peshawar. Analysis showed that there was a significant difference in the off-farm employment among various sizes of farms. Sampled farm households who were operating farm size up to 1 acre (74.88 hours/week) were performing more off-farm emp...

Naveed Afsar* and Muhammad Idrees 

...is affecting agriculture directly. Present research was done to know the farmers perceptions about agricultural extension services in disseminating climate change knowledge in Khyber Pakhtunkhwa. Data was collected from the 400 farmers of the two purposively sampled districts as these two were the highly vulnerable areas from climate change. The major source of climate change information of the majority of farmers was electronic media and the overall regressio...
Huaisheng Zhang1, Pengfei Li2, Huajun Wen2, Guangming Tian1, Hui Chen1, Lu Zhang1 and Jianqiang Zhu1,*
...s in the development and direction of Milu research in China, which should provide a reference for the healthy development and protection of the Milu population.
...
Huma Sattar1, Sehrish Firyal1,*, Ali Raza Awan1, Habib-Ur -Rehman2, Muhammad Sajid Hasni3 and Amjad Islam Aqib4*
...arker sequences that are directly related to immunity against mastitis might be helpful for animal selection trait and prevention of this disease. The aim of the present study was to assess the effect of polymorphism in bovine tumor necrosis factor alpha (TNF-α) gene on immune function and its role in mastitis susceptibility in Pakistani Sahiwal cows. In this study, a total of 150 Sahiwal cows were selected suffering from clinical (n=50), subclini...
Mumtaz Ali Khan1,*, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Ikramul Haq4, Kashif Prince1, Asad Ullah5, Muhammad Shoaib2, Shahid Zaman6, Amjad Islam Aqib7, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4,Imad Khan5, Naimat Ullah4 and Muhammad Shahid8
...ay of vaccination with indirect haemagglutination test (IHA). The results showed significantly higher (P< 0.05) immune titer in vitamin E supplemented animals groups against C. perfringens type D epsilon toxin.
...
Saleh S. Alhewairini
...ratory conditions. After direct spray application of the recommended dose, the adult mortality percentages were 66.67, 73.33 and 100% for acetamiprid and 23.33, 60 and 96.67% for sulfoxaflor after 1, 24, and 48 h, respectively, whereas the larvae mortality percentages were 63.33, 73.33 and 100% for acetamiprid and 46.67, 73.33 and 96.67% for sulfoxaflor after 1, 24, and 48 h, respectively. Moreover, live RPW (larvae and adult) were found to be completely paral...
Nazish Mazhar Ali1, Asma Ashraf 2*, Iram Liaqat2, Bushra Mazhar2, Shaukat Ali2 and Saiqa Andleeb3
...of leaf extract of Azadirachta indica (Neem Plant) was also checked against the pathogenic bacterial isolates. The bacterial pathogens isolated from eye infections were identified as Staphylococcus sp., Streptococcus sp., Neisseria sp., and Bacillus sp. These bacteria commonly caused corneal infections. All the pathogenic bacterial isolates showed sensitivity against all the compounds except Streptococcus sp. (BS1) and it showed resistance...
Riaz Shah1* and Margaret Appleby2
... bioassays. When sprayed directly (contact bioassay), all of tested low-risk pesticides mortality of 85.2-100% to P. persimilis except DE. All of tested low-risk pesticides were moderately harmful to N. fallacis and S. punctillum causing 30.5-83.6% and 34.6-78.6% mortality, respectively. All of the tested low-risk pesticides were harmless to slightly harmful in the residual toxicity bioassay causing 6.8% - 39.4% mortality in all predators ...
Zelle Huma1*, Ahmad-Ur-Rahman Saljoqi1 and Farman Ali2
...ive sample indication is directed that the environment of these districts are appropriate for EPNs presence.
...

Muhammad Shahzad Akbar*, Maria Aslam, Muhammad Rehan Khalid, Shahid Iqbal, Muhammad Luqman and Muhammad Zeeshan Majeed 

...ity response of termites directly proportional to the extract concentration for all treatments. The floral extracts of basil (O. basilicum) and Tecoma (T. stans) exhibited maximum termite mortality (i.e. 55.5 and 50.0%, respectively) with minimum LC50 and LT50 values, followed by the extracts of chrysanthemum (G. segetum) and African marigold (T. erecta). Overall study results suggest that above mentioned floral extracts can be further characterized for potent...

Matiullah Khan1*, Motsim Billah2, Shoaib Ahmad1, Raza Ullah Khan1 and Muhammad Sarwar1 

...asons to investigate the direct and residual effect of phosphorus enriched compost (PEC) prepared by composting poultry litter (PL) with rock phosphate (RP) and inoculating with effective microorganisms (EM) on the wheat during 2010-11. Both experiments were conducted consecutively, in the same lay out of randomized complete block design with three repeats. Various doses of PEC (6, 4, 2 Mg ha-1) were compared with simple poultry-litter compost (PLC) as 8 Mg ha...

Betül Ayça Dönmez, Sarbesh Das Dangol and Allah Bakhsh* 

... diploid potato and to redirect the breeding program away from tetraploids to the diploids. We aimed to develop the protocol for transformation of Solanum chacoense diploid M6 potato using tetraploid S. tuberorsum cv. Desiree as a control using five different Agrobacterium strains harboring pBIN19 binary vector that further contains gusA gene, interrupted by an intronic sequence, under the control of 35S CaMV promoter. After transformation, we analyzed the tra...
Hanif Ullah1, Muhammad Inayat Ullah Khan2, Suleman3, Sawar Khan1,Salma Javed4, Abdul Qadeer1, Mohsin Nawaz1, Sardar Azhar Mehmood4
Shaukat Ali1,*, Sadia Batool2, Fatima Javed Butt2, Sundas Nasreen1, Hafiz Muhammad Tahir1
... paradigm which proposed directions towards probiotics or biotics-cancer treatment strategy. The probiotics are present in the human gut region and acting as a health promoter; as they have antioxidative, immunomodulatory, antipathogenic and anti-cancerous properties. Review based on the futuristic and modern aspects of cancer treatment, we believe that probiotics based cancer treatment would be supportive to overcome the chemotherapeutic and radiological draw...
Javeria Zafar1, Asif Nadeem1*, Maryam Javed1, Fehmeeda Fatima1, Wasim Shehzad1, Ghulam Abbas1, Rajput Zahid Iqbal2 and Muhammad Muddassir Ali1
...product was sequenced bi-directionally using dideoxy chain termination method after mitochondrial ATPase8/6 genes amplification. Polymorphism, Genetic diversity and Phylogenetic analysis were carried out by the MUSCLE, DnaSP and MEGA6 tools. Total of 20 variations at different positions were found in aligned sequence results. Sequence conservation was observed for the ibex population. The overall results showed a close evolutionary relationship among

Ghulam Hussain1, Muhammad Asrar1, Dilbar Hussain2, Khurum Zia3, Abdul Rashid4*, Hina Anwar5, Muhammad Azeem1, Saddam Hussain1 and Sabeen Asghar1 

...extract @ 300ml/acre, Azadirachta indica @ 300ml/acre, Profenofos @600ml/acre., Crown 70WS @125gm/acre, Match 50EC@250ml/acre, Helmat 40EC@600ml/acre and Confidor 20SL@ 250ml/ acre were evaluated on cotton against 3rd instar cotton mealy bug. Data was collected after 3,6,12,24 and 48 hours. Maximum mortality of cotton mealy bug was recorded in Syngenta 50EC (profenofos) are 42%, 62%, 80%, 88%, 94 % while Match 50EC exhibit minimum percentage of mortality is 22...
Qamar Zeb1*, Silvia I. Rondon2, Hayat Badshah,1 and Arsalan Khan1
...pulation pressure, and indirectly influenced the natural population of parasitoids and predators.
...

Waseem Abbas1, Shakeel-ur-Rehman2, Abdul Rashid2, Muhammad Kamran3, Muhammad Atiq2 and Muhammad Ehetisham ul Haq3* 

...r (Bemisia tabaci) and indirectly the disease incidence. Leaves extracts of four plant extracts i.e. Calotropis gigantea, Zingiber officinale, Allium cepa and Azadirachta indica were evaluated at 3 % concentration against eggs hatchability and adult emergence of the whitefly in lab condition. Two consecutive sprays were applied to assess the relative impact of different plant extracts against adult whitefly population and th...
Mubasher Ahmad Malik1, Samina Jam Nazeer Ahmad2, Muhammad Jalal Arif1 and Jam Nazeer Ahmad1,*
...me this problem there is dire need to explore alternative control measures which are safer to the environment and compatible with human health. The present study was conducted to investigate the insecticidal properties of native isolated Plutella xylostella granulovirus (PxGV) and Azadirachta indica (AZA) on mortality and development of P. xylostella under laboratory conditions. Both AZA and PxGV were ap...
Umer Iqbal1,* and Tariq Mukhtar2
...f growth was found to be directly proportional to the concentration. Fungicides also affected significantly the plant survival of green gram and black gram over control. Maximum plant survival was observed where the seeds were treated with Benomyl followed by Carbendazim. However, Copper + Mancozeb and Copper oxychloride treated seeds gave the minimum germination and survival of plants. Doses also had a significant effect on the germination and plant survival....

Farheen Shafique1, Shaukat Ali2,*, Saiqa Andleeb1, Abdul Rauf1,3, Syed Ayaz Kazmi1,3, Sadia Idrees4, Faisal Farooq1,3, Faiq Nawaz Khan3,4, Muhammad Saad-ul-Hassan1,3, Raja Awais Mumtaz1,3, Saba Khalid1, Zaheem Ashraf1, Hafiz Muhammad Tahir2 and Fazal-ur-Rehman5

...ing health concern which directly indicates to pay attention for ensuring 100% safe blood transfusion.
...

Yousaf Ali1, Muhammad Zamin1*, Ibadullah Jan1, Shahen Shah2, Muhammad Mazhar Hussain3, Fazli Rabbi4 and Muhammad Amin

... six tomato genotypes (Nadir, Money Maker, Pakit, Nagina, Roma and Rio grande) with three replications. The results revealed that the combination of compost and mixture has significant effect on shoot height, number of leaves, stem and root length, however stem diameter was significantly affected by compost and non significantly affected by genotypes. As far as the genotypes performance is concerned, genotype money maker showed the best performance for all the...
Ramazan İlgün1*, Nilgün Kuru2, Ferhan Bölükbaş3 and Fatih Mehmet Gür4
...llae and tongue caudally directed lingual papillae. Thus, in this study, the anatomy and histology of the tongue of the guinea fowl tongue were examined in detail using light and scanning electron microscopy, and the similarities and differences between the tongue of the guinea fowl and the tongue of other poultry species were investigated.
...
Gasem Mohammad Abu-Taweel
...oride administration had direct influence on the social behavioural and blood parameters in the mice offsprings.
...
Hong-mei Gao, Wen-long Su, Gui-bin Tao, Han-yang Li, Wen-zheng Cao and Zhi-dong Qiu*
... tested the geniposide indirectly affecting BM accessory cells. We conclude that geniposide maybe will control the erythropoiesis in vivo and reverse the BM microenvironmental signals, and this could provide an idea to attenuate anemia in chemotherapy.
...

Mudassar Rashid1, Zuhair Husnain2, Usman Shakoor1* and Muhammad Iftikhar ul Husnain

...imatic factors that have direct influence on agricultural productivity are: rise in temperature, heavy rainfall, precipitation, floods and drought etc. This paper has empirically examined the effect of climatic variations on cotton productivity in Pakistan. In order to evaluate the climate change, three climatic variables (rainfall, max. temp and min temp) and three non-climatic variables (technology, fertilizer and area) had been used for analysis. Historical...
Veli Sel1, Isa Yilmaz2,* and Mete Yanar3
...lian water buffalos in Igdir. For this purpose, a total of 637 milk samples gathered from 91 animals raised in 54 farms were analyzed and statistically evaluated. The age and education level of the farmers and the effect of the milker on the SCC were found to be significant (P <0.001). SCC value (65.930 ± 2.484 cells/ml) was found to be the lowest when the milker is the person from the household. The udder cleaning before milking was a significant fa...

Reda Mohamed1, 2 

...ed and originated either directly or indirectly according to the species. The right ruminal artery originated either from the splenic, left gastric or celiac arteries. The epiploic branch detached either from the splenic, celiac or right ruminal arteries. The left ruminal artery arose either from the celiac, splenic or left gastric arteries. The reticular artery originated either from the left ruminal, splenic, celiac or lef...
Muhammad Waseem, Tariq Mahmood*, Abid Hussain, Abdul Hamid, Faraz Akrim, Shaista Andleeb and Hira Fatima
...16-2017. A total of 66 indirect signs of Asiatic black bear were recorded with an altitudinal variation of habitat ranging from 1511m to 2570m elevation including 17 dens and 44 scats of the bear from 10 different sampling sites. The sign density of black bear ranged between 17/km² (Paris MRF site) and 1.2/km² (Sharan site). Sign density was high in habitats having thick, dense and broad-leaved forest with steep slopes having the water resource/s. Si...

Ihsanullah Kakr1, Sarwar Khan2, Khalid Khan3* and Sajjad Ahmed

...uring the year 2011. The direct as well as indirect economic losses due to camel Trypanosomiasis based on the prevalence of Trypanosomiasis, mortality rate, abortion and perceptions of the respondents were recorded. The camel dies due to Trypanosomiasis in direct visible losses and invisible losses include reduced fertility, meat loss, low quality of hide, loss of draught power and tractio...
Yan-Guo Han, Jia-Yuan Wu, Ri-Su Na, Wei-Jiang Si, Yu-Qin Han, Yan Zeng, Yong-Ju Zhao and Yong-Fu Huang*
...es and testosterone by indirect enzyme-linked immunosorbent assay. Scrotal circumference was detected from week 0 to week 14 after primary immunisation, and the testes were weighed at week 14 after primary immunisation after slaughter. The concentrations of 4-methyloctanoic acid and 4-methylnonanoic acid in waist subcutaneous adipose tissue were detected using gas chromatography. Immunisation of oral and plasmid-injected KISS1 DNA vaccines induced stron...

Adewumi Olubusuyi Moses1,2*, Faleye Temitope Oluwasegun Cephas,1,3, Ope-Ewe Oludayo Oluwaseyi1, Ibitoye Ibipeju Henrietta1, Arowosaye Abiola Opeyemi1, Adelowo Oluwatosin Deji1 and Adeniji Johnson Adekunle1,2,4 

... MCF-7 cell culture with direct detection from clinical sample might impact our ability to detect non-polio EV Species C (NPESC) members in stool samples. In all, 20% (8/40) of all the samples screened had NPESCs and 50% (8/16) of the EVs detected were NPESCs. However, the RD cell line missed all NPESCs. Hence, RD cell line alone should not be used for EV isolation if the desire is to also isolate NPESC.  

...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...ubset of ten samples was direct sequenced. Sequence analysis showed 94% similarity to Stenotrophomonas maltophilia which is considered to be the second most prevalent bacterial species in mosquitoe’s midgut. This observation may lead  towards the confusion that the outbreak is either of Dengue or Chikunguna virus. In conclusion, confirmatory molecular characterization of the viral genome remains controversial and further studies are needed in...

Jie Yang

...eakpoint cluster 2 was a direct target of miR-16, and the expression was negatively correlated. Moreover, miR-16 promoted apoptosis suppressing breakpoint cluster 2 through phosphorylation of extracellular-regulated kinase. The study validates miR-16 as a tumour suppressor gene in papillary thyroid cancer cells, and revealed a novel mechanism of miR-16-mediated apoptosis through extracellular-regulated kinase pathway.
...

Ahmad-Ur-Rahman Saljoqi1, Muhammad Zubair Khan1, Ayesha Bibi2, Muhammad Shehzad Khan1*, Bashir Ahmad

...t extracts were neem (Azadirachta indica) and ghwaraskay (Dodonaea viscosa). Morphological traits such as plant height, maximum number of fruits plant-1 and yield were observed and severity of disease was investigated for supplement efficacy. The biochemical results obtained were all positive, which confirmed stem rot pathogen as Erwinia carotovora sub spp. chrysanthemi (gram-negative bacteria). Highest plant height (75.3 cm) and maximum number of fruits plant...

Muhammad Usman Saleem, Nadeem Iqbal, Shawaiz Iqbal*, Usama Bin Khalid, Adila Iram, Muhammad Akhter, Tahir Latif and Tahir Hussain Awan 

...nated technology such as direct seeded rice (DSR). About 30% of total water used in rice cultivation is consumed for puddling of soil (land preparation) and transplanting operations. Physical properties of soils are deteriorating due to continued puddling over the decades, resulting in structural breakdown leads to a compacted layer (the plough plate) that acts as a barrier to the infiltration of water and causes temporary waterlogging, which confines the pene...

Bilal Atta1*, Muhammad Rizwan1, Arshed Makhdoom Sabir1, Muhammad Dildar Gogi2, Muhammad Sabar1, Bakhtawar3, Faizan Ali3 and Mehran Sarwar

...er officinale), Neem (Azadirachta indica), Clove (Syzygium aromaticum) and Tobacco (Nicotiana tabacum) was compared against T. castaneum infesting stored wheat. The results have suggested that mortality and repellency in T. castaneum increased as the dose rate of crude plant extracts and exposure interval increased. The maximum mortality (86.67%) was achieved with the highest dose of crude extract of Z. officinale (80mg per 7.5g wheat) at 10 days exposure inte...

Reda Mohamed1, 2* 

...ileocolic vein or as its direct continuation. The middle colic vein arises from either the cranial mesenteric vein, the caudal mesenteric vein or the right colic vein. The left colic and cranial rectal veins are considered branches from the caudal mesenteric vein or as its direct continuations. The sigmoid veins arise from either the left colic vein or the caudal mesenteric vein. 

...

Shah Nawaz Khuhro1*, Irshad Ali Junejo1, Muhammad Haroon Hullio1, Mohammad Farooque Hassan2, Sultan Ahmed Maitlo3 and Mukhtiar Ahmed Shaikh

...ot read, fallow up label direction of registered pesticide and hazardous indications and majority of farmers did not adopt pest scouting practices. Many farmers disposed pesticide containers and bottles on insecure places and not adopted proper storage, handling, protective devices and most of them did not used any other alternate practices as bio pesticides, bio-control enhancement practices to control pest problems. Research result provides the course of act...
Ayesha Iqbal1, Ghulam Sarwar1, Abdul Majid Khan1*, Muhammad Tahir Waseem1, Ayesha Iqbal1, Rana Manzoor Ahmad1,2, Muhammad Ameen1
... extend in ventrolateral directions and continue to grow in lateral direction while in males the upper canines extend out in anterolateral direction and curve dorsally. The estimation of suid’s ages was based on third molar eruption. The fifty-one craniometric and twenty mandibular measurements were carried out on the adult male skull and data derived from analysis of our sample was ...

Naseem Zahra1* and Shajia Jabeen

...hole grain rice which is directly obtained by removing only husk. In Brown rice, the embryo may or may not be left undamaged depending upon the hulling process. Brown rice may become white rice when the bran layer is exposed of in the milling process. In present era where diseases are common and people are in search of nutritious diet containing minerals and essential compounds, brown rice is found to be healthiest and minerals rich food commodity. Due to its ...

Mujahid Khan1*, Mohammad Tufail2, Muhammad Fahad1, Hazi Muhammad Azmathullah3, Muhammad Sagheer Aslam1, Fayaz Ahmad Khan4, Asif Khan5 

EXPERIMENTAL ANALYSIS OF BRIDGE PIER SCOUR PATTERN
...nd its extent in lateral direction for circular and square pier models. For this purpose a number of experiments
were conducted in the physical modeling laboratory of River Engineering and drainage control, USM, Malaysia.
The study shows that the pier scour depth and affected area around pier increase with the increase in pier size.
The study further demonstrates that the square pier models results in greater scour depth and area as compar...

Zeeshan Al Hameed1, Junaid Saleem2*, Syed Sajid Hussain1, Ahsan Abdul Ghani2, Hira Lal2 

STUDY OF INDIGENOUS FLUORSPAR AS METALLURGICAL FLUX
...indigenous Fluorspar can directly be used as a metallurgical
flux without any beneficiation process as it is rich in Fluorite and also contains small amount of other compounds
that are required to be fed as part of slag. Specifically, it contains only trace amount of apatite as compared to
global Fluorspar. The composition of indigenous Fluorspar was compared with standard specifications and a detailed
characterization was carried o...

Zulfiqar Ali Soomro1* 

NOISE CONTROL FILTRATION OF LATERAL AND YAW DYNAMICS FOR RAILWAY VEHICLE WHEELSET ON TRACK
...way vehicle speed in any direction of basic
degree of freedom. In this paper, Brief applicable mathematic is used framed for necessary modeling. The estimation
of perturbations for the movement by wheels and velocity of train in lateral and yaw phases are enumerated.
Here dual bucy kalman estimator is implemented to decrease the influence of the noise caused due improper ratio
of adhesion level upon track. One estimator reduces the ...

Younis Jamal1, Asad Naeem Shah1, Wasif Amin Butt1, Ahmad Naveed1*, Muhammad Usman1 

EXPERIMENTAL INVESTIGATION OF THE EFFECTS OF FUEL INJECTION PARAMETERS ON DIESEL ENGINE PERFORMANCE AND EMISSIONS
...ons. In current study, a direct injection (DI), CI engine was run on a test bench for the performance
and emission analyses using different nozzles and injection timings. During the experiments, two types of nozzles
known as sac and valve covered orifice (VCO) were used with hemispherical cavity and toroidal cavity pistons,
respectively. Besides an already existing set of sac type nozzles, six distinct combinations of nozzles with varying<...

Muhammad Shahzad Khattak*1, Barkatullah1, Ayesha Aziz1, Jamil Ahmad2, Mohammad Sharif3, Mukand Singh Babel4, Muhammad Fahad5

IMPACTS OF CLIMATE CHANGE ON CROP WATER REQUIREMENT UNDER MULTI - REPRESENTATIVE CONCENTRATION PATHWAYS DURING MID-CENTURY: A CASE STUDY OF D. I. KHAN
...is a major problem which directly affects agricultural economy of a region as the crop water
requirements of major crops is increased. This study was conducted to estimate evapotranspiration (ETo) and crop
water requirements (CWR) of wheat and maize crops of the study area during mid (2040-2059) century under emission
scenarios based on Representative Concentration Pathways (RCPs). The methodology employed here involves
the comparis...

Rafiullah Khan1, Waseem ur Rahman1, Misbah Ullah2, Kamran Afaq3, Muhammad Amjad1, Sakhi jan1 

AGE EFFECT ON THE MECHANICAL PROPERTIES OF HIP JOINT BONE: AN EXPERIMENTAL INVESTIGATION
...gitudinal and transverse directions of the collagen’s fibers. Compact tension specimen
was used for the fracture toughness, while for young modulus and tensile strength, rectangular flat specimens were
used. The test procedures were similar to ASTM (American standard for testing and measurements) techniques. The
test result revealed reduction in mechanical properties of hip joint bone with the age. 

...

Bibi Safia Haq1,2, Shahnaz Attaullah3, Abdul Shakoor4, Hidayat Ullah Khan5, Khan Alam5, Kausar Shaheen1 

CHARACTERISTICS AND EFFICACY OF ULTRAFAST LASER PULSES FOR BIOMEDICAL APPLICATIONS
...olymerisation based on a direct write system to build up solid polymeric material for the fabrication
of three dimensional cell scaffolds can be achieved. By tailoring the optical system and making use of a relatively
weak absorption cross-section we have been able to manufacture deep structures in a single pass of the laser light. 

...

Nazish Huma Khan1, Mohammad Nafees1, Adila Bashir1, Farooq Ahmad1 

STUDY OF POLLUTION LAOD IN PAPER MILL EFFLUENTS AND ITS RECYCLING BY SUNDRY PLANTS AT HAYATABAD INDUSTRIAL ESTATE, PESHAWAR
...er manufacturing and its direct discharge into receiving water is an
emerging concern. While the study proved that pollution level of paper mill effluents can be discouraged by recycling
of sundry plants. Therefore it is recommended to enhance the installation of sundry plants in proposed industrial estate. 

...

Faisal Shabbir*, Naeem Ejaz*, Daulat Khan**, Naveed Ahmad*, Jawad Hussain*, Muhammad Fiaz Tahir* 

INVESTIGATION OF USING PAPER INDUSTRY WASTE (HYPO SLUDGE) IN CONCRETE MIX
...acturing
there is dire need of replacing cement with other binders to be used in concrete. This study investigates the utilization of waste paper sludge ash (WPSA) in concrete. WPSA was partly replaced in the ratios of 5, 10, 15 and 20 percent of cement. Specimens were tested for initial setting time, final setting time, mechanical strengths (i.e. compressive and tensile strength) and dry density, and results are compared with ordinary concrete (without...

Sahib Khan*, Abdur Rehman*, Nasir Ahmad**, Muhammad Naeem*** 

THE REDUCTION OF SPECIFIC ABSORPTION RATE AT DIFFERENT FREQUENCIES
...ance. The improvement in directivity & gain has been observed and bandwidth of
about 65% has achieved with Specific absorption rate reduction. 

...

Suhaib*, Shahid Maqsood*, Sikandar Bilal Khattak*, Misbah Ullah*, Rehman Akhtar*, Rashid Nawaz*, Iftikhar Hussain*, Abdul Shakoor**, Khizar Azam** 

SINGLE FACILITY LOCATION SELECTIONPROBLEM FOR A PAKISTAN BASED ICE CREAM COMPANY: A CASE STUDY
...mal facility location is directly proportional to traveling cost between facility and destinations. In
past decade, extensive research has beencarried out in this field. Most of the facility location optimization techniques
provide optimum or near optimumsolution. In this paper, an optimization technique median method is applied to a
real world problem of a multinational ice cream company’s factory located in Lahore, Punjab (province...

Asif Nawaz1*, Muhammad Zafarullah Khan1, Rehmat Ullah1, Arshad Farooq2 and Abdul Hassan2

Assessment of Weed Management Competency of Field Assistants in Khyber Pakhtunkhwa, Pakistan
... weeds and aware about indirect weeds control methods. Moreover, it was found that Field Assistants required highest training needs in familiarity with biological weed control followed by critical threshold level of weeds and critical period of weed competition. Findings of Rank Based Quotient revealed that lack of promotion, training opportunities and incentives or motivation were the top most constraints that respondents faced in building the required compet...

Inamullah Khan1*, Amjad Usman2  and Rahamdad Khan2

The Mortality Rate of Pupae and Adult of Fruit Fly Bactrocera cucurbitae Coquillett (Diptera: Tephritidae) Affected by Different Submerging Time and Soil Types under the Laboratory Treatment
...pal submergence time has direct effect on the rate of emergence and mortality rate of fruit fly pupae in the soil. Intermittent irrigation of fruit fly host plants standing in clay loam or silt clay loam soil texture may help in controlling the overwintering pupae in the orchards.

...

Shaista Naz1*, Noor P. Khan1, Himayatullah Khan1 and Azra2 

Does Women’s Participation in Livestock Management Enhance their Empowerment? An Insight from the Tribal Belt of Pakistan
...ousehold activities were directly related to the power of men due to the DMI value of below 0.50. The average DMI was 0.98 for livestock management activities as compared to 0.42 for household matters which indicate that women were enjoying a high level of decision-making power/empowerment in livestock management as compared to household matters. The study concludes that women’s participation enhances women’s empowerment. However, the provision of ...

Hina Fatima1*, Sania Shaheen2, Lal Khan Almas3 and Sehrish Haroon4

Profit Efficiency among Transplanting and Direct Seeded Rice Producers (Case Study of Certain Rice Growing Areas of Province Punjab, Pakistan)
...ice production (TRP) and direct seeded rice system (DRS) is gaining greater attention in Pakistan. Profit efficiencies of TRP and DRS are estimated with data from farmers belonging to various districts of Punjab. Gujranwala, Hafizabad, Sheikhupura, Jhang and Sialkot are the major rice producing areas of Punjab. The primary data is collected from the above mentioned areas through random sampling. Stochastic Frontier Analysis (SFA) serves as a tool of obtaining ...

 Sikandar Afridi*, Muhammad Irfan Khattak**, Nasim Ullah***, Gulzar Ahmad**, Muhammad Shafi**

PERFORMANCE ENHANCEMENT OF FACE RECOGNITION SYSTEM USING PRINCIPAL COMPONENT ANALYSIS MERGED WITH DISCRETE WAVELET TRANSFORMS
...l features are extracted directly from the image by calculating the Eigenface. The size of the
train database is reduced with the proposed technique which reduces the processing time of the face recognition
without losing the accuracy. Performance of face recognition system is enhanced in terms of low processing time as
shown by comparing the experimental results of conventional PCA and the proposed technique in this paper.<...

 Fcroz Shah*~ Mohammad A. Irfan**, Rizwan Gul*~ Abdul Shakoor*

ALGORITHM DEVELOPMENT AND IMPLEMENTATION FOR NUMERICAL DETECTION OF HOT SPOTS IN CASTING GEOMETRY
...ed circle. Magnitude and direction of averaged values for all the vectors are computed for each iteration. The new point is moved relative to the previous&nb...

Shahid Ali1, Habib Akbar2, Shamsher Ali3*, Adnan Nasim1, Muhammad Ismail1, Nur Ul Haq1 and Muhammad Usman4

Effect of Planting Sources, Cane Portions and Setts Placement Methods on Sugarcane Yield Attributing Traits
... damage) and fresh cane (directly obtained after harvesting of standing crop) stalk segments i.e. upper, middle, lower and 33 % (having upper + middle + lower cane portions in uniform proportion of 33) each mixed portions of cane were allotted to the main plots, whereas sub plots were given to methods of setts placement (single, one and half, double and three setts (sugarcane stem portion with three buds) each 40 cm. Fertilizer was applied as N: 150 P2O5: 100 ...

Usman Ghani*, Naeem Ijaz* and Daulat Khan**

NUMERICAL SIMULATION OF MEANDERING OPEN CHANNEL FLOWS
...It was observed that the direction of secondary currents depends upon flow depth and their strength increases with increasing depth of flow. In compound channel flow cases, the overbank flow velocities are stronger than the inbank flow field. The bed shearing stresses at the apex of the meander were also found to have been under the influence of flow depth and secondary circulations. It was also established that standard - turbulence model ...

 Majid Ashraf, Mohammad Haseeb Zafar, Tariqullah Jan

EFFICIENT ROUTING SCHEME FOR UNIDIRECTIONAL LINKS IN MULTI-HOP NETWORKS
...rk in the presence of unidirectional links. The distinct feature of this routing scheme is the capability to actively provide routing paths even though a large number of unidirectional links are present in the network. The results depict that the routing scheme is able to reduce the delay and routing overhead compared with the already available routing scheme like AODV and AODV-Blacklist. The performance of pr...

 Muhammad Waseem*, Irshad Ahmad**, Muhammad Asif Khan**

DETERMINISTIC SEISMIC HAZARD ANALYSIS AND SELECTION OF TIME HISTORIES FOR DYNAMIC ANALYSIS FOR A SITE IN SWABI
...research activities were directed to define earthquake hazard. However, amongst other problems in those studies, one hard decision is the use of attenuation relationship as no such equation is developed for Pakistan. These studies either do not consider the newly developed New Generation Attenuation (NGA) equations or use a single NGA equation. The purpose of this study is to utilize all NGA equations to define seismic hazard in terms of pe...
Dibyendu Biswas1*, Shib Shankar Saha2, Shankar Biswas3 and Md. Abu Sayeed4
Outbreak of Lumpy Skin Disease of Cattle in South-West Part of Bangladesh and its Clinical Management
...ridae and transmitted by direct contact or through biological vectors such as mosquitoes, flies and ticks. Sporadic cases of LSD have been observed in cattle elsewhere. The aim of the present study was undertaken to evaluate the present scenario of LSD and its clinical management at different house-holds at south-west region of Bangladesh. A structured questionnaire was developed and data were collected from the two upazila (Monirampur and Abhaynagar) at Jesso...

Zakeer Ahmed Khan Abbasi* and Allah Nawaz 

...refore, more efforts, if directed, to enhance climate change awareness through dissemination of authentic and need based information, would significantly help farmers to undertake more relevant, effective and efficient adaptation measures, thereby, contributing in increasing the agriculture yield and reduce losses. However, imprudent projection of climate change adaptation issues without proper awareness about the associated dynamics, complexities and implicat...
Waqar Majeed1, Naureen Rana1, Elmo Borges de Azevedo Koch2* and Shahla Nargis1
... collected by sweep net, direct hand picking, forceps. For each sampling day in each month, 20 sweeps were randomly taken in each block. The insects at rest or on shrubs were manually collected. Overall, 5867 individuals were recorded pertaining to 152 species. Among the arthropods collected from two fields, number of the order Diptera was most diverse followed by those of Coleoptera, Hymenoptera, Hemiptera, Orthoptera, Lepidoptera, Araneae and Neuroptera. The...

Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1

Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
Ashfaque Ahmed Nahiyoon1*, Nasira Kazi2 and Shahina Fayyaz2
...nging to the family Belondiridae are described from Sindh, Pakistan. Amphibelondira sindhicus n. sp., is characterized by having reduced anterior genital branch, more slender body, smaller neck length and expanded part of pharynx, smaller spicule and clavate tail with distinct radial striae. Belondira paraclava Jairajpur, 1964 is reported for the first time from Pakistan duri...
Zengwen Huang1,2, WuReliHazi Hazihan2*, Baheti Bodai2, Kadyken Rizabek3, Nuralieva Ulzhan3, Omarova Karlygash4, Juan Zhang1 and Yaling Gu1*
Huma Abbas1*, Nazir Javed1,Muhammad Kamran2, Sajid Aleem Khan1Hira Abbas3, Ehetisham-ul-Haq2, Abdul Jabbar1, Mehwish Naz1 and Ihsan Ullah4
... effect of bio (Cure, Azadirachtin) and synthetic (Cartap, Virtako) chemicals was evaluated on the induction of systemic activity by using modified split root technique. Efficacy of different application methods; soil drench and root dip was also tested. Results revealed that all the chemicals have more or less systemic effect against M. incognita. Cartap was found to be more effective in reduction of egg masses followed by Virtako in both treated and u...

Muhammad Ismail1, Tufail Ahmad2, Shamsher Ali2*, Shahid Ali1, Nur Ul Haq1 and Naveedullah3

Heavy Metals (Pb and Ni) Pollution as Affected by the Brick Kilns Emissions
... Ring Road’s south direction between chimneys of bricks preparation that were named A and B with distance of 300 m. The kilns were positioned such that Southern direction of chimney of A was north for the chimney B. A total of 36 (18+18) soil and wheat leaf samples were collected in four directions. Samples were collected at varying distances (100, 200,300 meters) from chimneys. Simi...

Kanwar Muhammad Raheel Mehboob1, Rashid Iqbal2*, Muhammad Israr3,4, Jaweria Shamshad5, Umair Riaz6, Muhammad Habib-ur-Rahman7,8, Fawad Ali9, Arif Nawaz10, Maliha Sarfraz11, Abdul Waheed12, Muhammad Tahir Khan13 and Muhammad Aslam2

 

Assessment of the Consequences of Heat Changes on Cotton Cultivars Growth, Phenology and Yield at Different Sowing Regimes
...nation, a field test was directed to evaluate the phenology, relative development, ideal sowing time, comparative growth just as yield execution of three cultivars of Bacillus thuringiensis Cotton (Bt. Cotton) at different sowing systems during summer 2015 at cotton research station Regional Agriculture Research Institute Bahawalpur (RARI) Pakistan. The test was directed in an irregular complete block design (RCBD) with a sp...
Safina Naz1, Syed Atif Hasan Naqvi2*, Bushra Siddique3, Muhammad Asif Zulfiqar4 and Abdur Rehman5 
 
Exogenous Application of Selected Antioxidants and Phyto Development Directors Influenced the Development, Output and Biochemical Attributes of Tomato (Lycopersicum esculentum Mill.)
...acy of phyto development director i.e. N.A.A.GA3, 2, 4-Dichlorophenoxyacetic acid and antioxidants i.e. Ascorbic acid and 2-hydroxybenzoic acid on development, fruit bearing, output along with biochemical attributes of Lycopersicum esculentum fruits during 2014 and 2015. Foliar spray of GA3(100 ppm) and 2-hydroxybenzoic acid (200 parts/million and 100 parts/million) give rise to significantly taller plants and greater leaf area while, shorter plants and lower ...

Abdiaziz Idiris Mohamud1, Yonis Abukar Mohamed2, Osman Sheikh Ali Jama3, Pravin Mishra4* and Mohamed Idiris Mohamed5 

Prevalence and Major Pathogens Associated with Clinical and Subclinical Mastitis in Dairy Camel (Camelus dromedarius) in Benadir Region of Somalia
...tating camels in the Benadir Region of Somalia and also to recognize the associated microorganisms as causal agents of mastitis. The prevalence of this study was measured by using California mastitis test (CMT). Milk samples were collected from the Deyniile District, Benadir Region of Somalia. The overall prevalence of mastitis was 16.66% (7.93% on the quarter basis), the prevalence of clinical and subclinical mastitis was f...

Md. Aminul Islam1*, A.N.M. Aminoor Rahman2, Mohammad Shah Alam3 and Md. Taimur Islam4

Gastrointestinal Nematodiasis in Quail in Bangladesh
...ecal samples analyzed by direct smear methods and nematodes identified by the presence of characteristic eggs in the feces. Five types of nematode eggs found on different farms. The overall prevalence of gastrointestinal nematodiasis were (17.5%), which could consider relatively higher. The highest rate of infection found for Heterakis gallinarum (7%) and the lowest rate of infection found for Trichuris spp. (1.5%). A significant difference in nematodiasis in ...

Rao Wali Muhammad1, Hafiz Muhammad Wasif Ali2*, Amir Hamza1, Muhammad Qadir Ahmad2, Abdul Qayyum2, Waqas Malik2 and Etrat Noor2

Estimation of Different Genetic Parameters in Various Safflower (Carthamus tinctorius L.) Genotypes under Field Condition
...ed by environment. Thus, direct selection of accessions on basis of studied parameters could lead to genetic improvement of the material and these traits could also be helpful for potential improvement of yield in safflower (Carthamus tinctorius).

...

Yasir Arafat1*, Syeda Nabahat2, Hafiz Ullah3, Afaq Ali Muluk4 and Azra5

An Analysis of Energy Supply and Oil Price Shocks on Agricultural Productivity of Pakistan
...nergy supply and foreign direct investment affect agricultural productivity positively and significantly while oil prices negatively affect the productivity in Pakistan. It is also observed that Pakistan lacks behind in using modern scientific techniques of testing and processing agriculture land and seeds for higher per acre yield which affects farmers directly. Most of the farmers either use electricity or oil to run the t...

Christian Marco Hadi Nugroho1 and Jeanne Adiwinata Pawitan2,3,4*

Production of Antibody for Direct Fluorescence Antibody Assay against Avian Influenza H9N2
...is commonly known as the direct fluorescent antibody (DFA) assay. This method is a combination of immunology and bio-imaging. This DFA assay is rapid and sensitive, but specificity is influenced by antibody production methods. Therefore, the aim of this review was to describe various antibody production methods, which might be used in developing DFA assay to diagnose H9N2 infection in humans or chickens, and we discussed avian influenza H9N2 virus, immunogens,...
Bushra Ismail Khan1, Shamim Akhter1, Sanwal Aslam2* and Rabea Ejaz1
...) bull kept at SPU Qadirabad, District Sahiwal, Pakistan. Qualifying semen ejaculates having motility >60%, volume >5-6ml and concentration >0.5 billion/ ml were diluted 50 × 106 motile sperm ml approximately at 37°C in Tris-citric acid extender supplemented with different concentrations of PVP (0.01, 0.05, 0.1mM). The extender without PVP was kept as control. Semen was stored at 4°C for a period of 2 h and kept at 4°C...

Saeed Ahmad1, Abdul Ghaffar1, Muhammad Habib ur Rahman1,3*, Tanveer-ul-Haq2, Mahmood Alam Khan4 and Arshad Mahmood5

Evaluation of Different Production Systems in Combination with Foliar Sulphur Application for Sunflower (Helianthus annuus L.) under Arid Climatic Conditions of Pakistan
...nursery transplanted and direct seeded) and sulphur foliar spray (0, 50, 100 and 150 ppm) on sunflower in a randomized complete block, with split plots arrangement. Results revealed that tallest plant (175 cm) with maximum number of leaves (32.7) recorded with the application of foliar sulphur spray (150 ppm). Similarly, sunflower produced maximum head diameter (18.0 cm), number of achenes per head (1510), 1000-achene weight (55.7 g) resulted in higher achene ...

Mehnaz Safdar and Urooba Pervaiz*

Constraints in Accessing Agricultural Extension Services by Rural Women: Evidence from Khyber Pakhtunkhwa, Pakistan
... is recommended there is dire need to establish female extension staff. Government should provide basic trainings and subsidized inputs to women in the study area.

...
Wajahat Azeem1,*, Tariq Mukhtar1 and Tooba Hamid2
...ntagonistic plant, Azadirachta indica was tested against M. incognita on tomato. The antagonistic fungus and plant caused significant hatching inhibition and larval mortality of M. incognita. The hatching inhibition and mortality was the maximum at 100% concentrations of both the agents while the minimum inhibition and mortality was obtained at 25% concentration. No statistical difference was observed between T. harzianum and A. ...
Shakeel Ahmed* and Sarwat Jahan
...m anterior pituitary and directly or indirectly play very important role in regulation of HPG axis. In the present study the pathway of stimulatory role of NMS was investigated in the regulation of HPG axis. For this purpose, after NMS administration plasma testosterone (T) and growth hormone (GH) levels were determined in four normally fed and 48 hours fasted adult male rhesus monkeys.Fifty nmol (50 nmol)of NMS was injected...

Shahid Ahmed1,2*, Huiqing Su1, Xuqian Sun1, Peng Feng1, Yongpan Chen1, Liang Yu1, Qian Liu1 and Heng Jian1

Performance of Cereal Varieties against Cereal Cyst Nematode (Heterodera avenae)
...otic stress factors that directly affects the crop physiology from seed germination to crop maturity and limits the cereal production in different agro-ecologies of the world. In China, this pathogen is widespread in more than 20 provinces and infects the major cereal varieties and germplasm being adopted for cereal crop production annually. We tested number of cereal accessions to see the host pathogen interaction; among 15 wheat lines from Zhonnguyuan Sun (C...

Muhammad Javaid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1, Mirza Abdul Qayyum1 and Muhammad Arslan Khan1

Role of Nanotechnology in Crop Protection and Production: A Review
...es food for human beings directly and indirectly. As the world population is increasing, therefore need of the time is to use new technologies in agriculture like nanotechnology for sustainable agriculture production. Nanoparticles have physical, biological and chemical characteristics with size range of 10-9 nanometer in diameter. Nanotechnology will serve as an innovation in agriculture and food industry i.e. nanopesticide...
Ayesha Talib1,2, Khanzadi Nazneen Manzoor1, Wajahat Ali1, Maria Saeed1, Muhammad Asif Gondal1, Malik Badshah3 and Abid Ali Khan1*
...larming pace. There is a dire need to devise novel tactics to deal with these minute yet evolving ever clever microscopic entities. One of the possible ways to fight them is through nanoparticles. Green synthesis is an easy way to synthesize nanoparticles by using biological resources as it is cost effective, eco-friendly and large-scale production possibilities exist. Copper nanoparticles (CuNPs) have been synthesized from the aqueous fruit extracts of Fic...
Mushtaq Ahamd Khan1, Ziaul Islam2, *, Amin Ullah Jan3, Kamran Khan2 and Abdullah Shah3
... strips (CTK, USA) and Indirect Enzyme Linked Immunossorbant Assay (i-ELISA). The study revealed that overall 57.28% sero-prevalence was recorded in women of child bearing age. Highest (56.46%) seroprevalence was recorded in pregnant women as compared to non-pregnant women (43.53%). Highest (57.3%) sero- prevalence was recorded in women having 21-30 years age. Notably, the highest (25%) prevalence was reported in second trimester of pregnancy. Higher (52.6%) i...
Mudussar Nawaz1, Iahtasham Khan2, Muhammad Shakeell*, Arfan Yousaf1, Zahid Naseer1, Munibullah1, Ali Zohaib3, Riaz Hussain4 and Qudrat Ullah5
Muhammad Zeeshan Majeed1*, Muhammad Shahzad Akbar1, Muhammad Afzal1, Muhammad Mustaqeem2, Muhammad Luqman3, Ijaz Asghar4 and Muhammada Asam Riaz1
...e. The extracts of Azadirachta indica (neem) and Nerium indicum (oleander) appeared to be most effective against the termites with minimum LC50 (6.35 and 10.38%, respectively) and LT50 (12.11 and 17.49 h, respectively) values, followed by the extract of Gardenia jasminoides (gardenia). While the extracts of N. indicum (oleander) and Dodonaea viscosa (sanatha) exhibited maximum repellency (up to 78%) of t...
Arshad Mahmood Malik1*, Hafiz Muhammad Tayyab1, Muhammad Arshad Ullah2 and Muhammad Talha Bilal3
Dynamics of Salinity and Land Use in Punjab Province of Pakistan
...cro economy in Pakistan, directly impactingliving standard, migration, health, the crumbling of houses, and harming tocommunication and transport. The study in hand was designed to investigate the impact of salinity on irrigated area, uncultivated area and wheat area in Punjab using panel data of four agriculture census conducted in1980, 1990, 2000 and 2010 in all districts of Punjab. Fixed and random effect model was applied on panel data of Punjab. The area ...
Anjali Khadka1*, Subodh Raj Pandey2, Subarna Sharma Acharya3, Amrit Poudel4 and Sushma Adhikari1
Morphological Evaluation and Multivariate Analysis of Soybean Glycine max (L.) Merrill Genotypes in Western Mid-Hills of Nepal
...maturity had the highest direct positive and negative effect on yield respectively. Though test weight had a significant positive correlation with grain yield, it had a negative direct effect on grain yield. The cluster analysis grouped sixteen genotypes into four clusters among which cluster I was largest with eight genotypes.

...

 Shafii Abdullahi Mohamed1, Abdiaziz Idiris Mohamud2*, Yonis Abukar Mohamed3, Pravin Mishra4 and Osman Sheikh Ali Jama5

Assessment of Knowledge, Attitude, and Practices of Population Towards Brucellosis in Benadir Region, Somalia
...to September 2020 in Benadir region of Somalia, to determine the knowledge, attitude, and practices of population towards Brucellosis. In this study, a total of 120 participants share their knowledge, attitude, and practices towards Brucellosis. Their knowledge regarding causative agent was 37.5% (n=45) and the disease was 45% (n=54), while transmission of animal to human was 43.33% (n=52). The majority of participants would take actions to ensure the animal i...
Abdul Hameed1*, Ihtsham ul Haq Padda2 and Abdul Salam3
Estimating Food Consumption Patterns in Pakistan by Using Ideal Demand System
...od in Pakistan through indirect expenditure and price utility functions, using integrated household economic survey 2015-16 data and the nonlinear quadratic almost ideal demand system. The paper finding shows that demand for most commodity items except for fruit, meat, sugar and other products is less than unit elastic to expenditure elasticity at the country and regional levels. Cross price elasticity assessment demonstrates that the most nutritious food item...

Numan Habib1*, Muftooh Ur Rehman Siddiqi1 and Riaz Muhammad2

Thermal Simulation of Grain During Selective Laser Melting Process in 3D Metal Printing
...d out on a single grain, directly exposed to the laser. The prime goal of this study is to investigate the effect of different process parameters on temperature distribution in grain and capability of the specified laser to melt and fuse above mentioned material powder grain. Three different 2D models of 1µm, 2µm and 3µm grain sizes are modeled and simulated with different scanning speed 60, 100, 140, 180 and 220 mm/sec. Results are demonstra...

Mehreen Ijaz

Effect of Weave Type on Tensile Strength of Cotton Fabrics
...th both in warp and weft directions followed by twill and satin weave. It was due to the less interlacing per unit area of the prepared fabric. Moreover, plain weave helped to create more compact structure that resisted the pressure applied by using tensile tester. It is suggested to use plain interlacing pattern for manufacturing durable structures both for apparel and upholstery industry. This study can help textile manufacturers to alter their construction ...

Muhammad Farooq, Shahid Bashir* and Salman Ilahi Siddiqui

Beam Steerable and Frequency Reconfigurable Antenna Array for 5G Mobile Networks
...ay has increased maximum directivity up to 14 dB and maximum gain up to 13 dB. Furthermore, by incorporating a defected ground structure (DGS), mutual coupling between the two adjacent elements has also been reduced up to 15%. The proposed antenna array can be a prospective candidate for 5G mobile handsets.

...
Sukhpreet Kaur Sidhu*, Gurkirat Singh Sekhon, Randeep Kaur Aulakh and Tejdeep Kaur Kler
...terrestrial bird species directly and indirectly in agricultural habitats.
...
Yasin Altay1, Saim Boztepe2, Ecevit Eyduran3, İsmail Keskin2Mohammad Masood Tariq4*, Farhat Abbas Bukhari4 and Irshad Ali4
...ay be considered as an indirect selection criterion in the characterization of the breed standards of the Karacabey Merino in wool characteristics for breeding goals.
...
Wentao Wang1,2, Xu Lin3, Jianshu Zhuo3, Dongjie Zhang2, Xiuqin Yang3* and Di Liu1, 2*
...aracterized through site-directed mutagenesis analysis, although their existence was predicted by bioinformatic methods. The results increase our knowledge of E2F3b mRNA diversity and provide basis for in-depth functional research.
...
Zhen-Yang Wu1, Li Li1, Yu-Hua Fu2, Sheng Wang3, Qing-Ming An1, Xiao-Hui Tang4, Xiao-Yong Du3,5,* and Fei Zhou6,*
...ch can affect wool price directly. In this study, to investigate the functional roles of genes in Tibetan sheep skin with different coat colors, we sequenced genes from six skin samples using Solexa sequencing. The RNA-Seq analysis generated 63,283,784 and 63,644,062 clean reads in black and white skin, respectively. A total of 60 differentially expressed genes (DEGs) were identified, providing evidence that the different coat color skin changed considerably. ...
Hannan Nasib Hamid1,*, Muhammad Rais1, Muhammad Arif2 and Rubina Noor2
...ies (14 recorded through direct sightings) were recorded which included two species of amphibians and 21 of reptiles (eight snakes, 13 lizards). Species in the sub-tropical broadleaved evergreen forest were more diverse with Common Leopard Gecko, Persian Leaf-toed Gecko, Reticulate Plump-bodied Gecko as notable species while tropical thorn forest had species such as Indian Monitor, Large-scaled Rock Agama and Agror Agama. Common Leopard Gecko was identified as...
Umair Faheem1*, Qaisar Abbas1, Saghir Ahmad2, Ghayour Ahmad2, Abdul Karim2and Mussurat Hussain1
...as found that there is a direct relationship between A. biguttula biguttula population and temperature. While, no significant correlation of A. biguttula biguttula population with the RH except two years (2014 and 2016) where, it has shown positive correlation. RF mostly has significantly positive correlation with A. biguttula biguttula population. During the study duration, it has also been found that A. biguttula biguttula populat...
Abdul Waheed Solangi, Lei Zhang, Yunxia Cheng and Xingfu Jiang*
...nal egg provisioning had direct significances on progeny life history traits, progeny from forced flight females had poorer larval and pupal masses but development time was extended. However, offspring from control females had heavier larval and pupal masses with shortened development time. It is possible that an increased of flight during the pre-oviposition and ovipostion period influence the oviposition trend, egg production and lifespan of the next generat...
Wenyou Huang1, Dan Yü1, Song Huang1,2, Jian Xiao2, Ping Qi2, Anhua Song2* and Zhen Huang1*
...ould potentially be used directly for insect control. 
...
Muneer Abbas1*, Dilbar Hussain2, Muhammad Saleem2, Abdul Ghaffar2Sohail Abbas3, Niaz Hussain1 and Abdul Ghaffar1
...ar. Plant extracts Azadirachta indica and Citrullus colocynthis proved better as they reduced pupal population 14.53 and 10.74, 9.87 and 2.85, 7.20 and 2.27 % in guava, citrus and mango orchards, respectively. Similarly, reduced trend was found in % fruit infestation by 19.41 and 10.29, 15.51 and 10.77, 5.84 and 4.80 % in guava, citrus and mango orchards, respectively after 2nd spray. Maximum % reduction of fruit puncture...
Guofang Wu1,2, Xingxing Xue1, Wenjuan Shen1, Lei Wang1,2*, Yuhong Ma1 and Jiping Zhou1
...breeding industry and is directly related to the livability and growth status of piglets. By applying genetic technology, it may be possible to increase the number of teats and thus enhance production. Previous research has shown that teat number exhibits moderate levels of heritability that could be accelerated by the use of a genetic marker, such as microsatellites. Based on our preliminary sequencing data, the present study describes the use of time-of-flig...

Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Haris Khurshid1, Muzamil Hussain2 and Shahid Ali Khan1

 

 

...nches. A strong positive direct effect was observed between twenty pods length (5.548), shelling percentage (4.630), 100-kernels weight (3.738), and leaflet length (2.950) with dry pods yield, indicating the importance of traits linkage in groundnut genotypes improvement. A weak direct effect was found among morphological traits i.e., number of branches (1.419), plant height (.311), and plant width (1.058). A strong in

Ahmad Ur Rahman Saljoqi, Muhammad Salim* and Iftikhar Ahmad 

 

...xtract @ 5%, neem (Azadirachta indica) seed extract @ 5%, neem oil @ 3%, green lacewing, Chrysoperla carnea @ 3 eggs plant-1,were applied three times. A total of 30 plants in each treatment were selected randomly for the data collection at 1, 2, 3, 6, 9 and 12 days intervals. Peak population of thrips (51.27 plant-1) was noticed during the last week of April. Results regarding different treatments showed that Emamectin was e...
Raheel Saqib1*, Muhammad Luqman2, Saleem Ashraf3, Tahir Munir Butt4, Abdur Rehman5, Imtiaz Hussain6 and Muhammad Umer Mehmood2
 
 
...Directly or indirectly, family farming leads to the food security situation and uplifts people’s living quality. All the rural farm families residing in district Mansehra served as the population for the study. In order to have a representation of the entire population, female respondents from the study area were drawn randomly. A total sample size of the study was 110 respondents (rural female engaged in different farming activities). Data we...
Yongyun Zhang1, 2, Xinyang Fan1, Fangting Zhou1, Weizhen Li3, Yina Ouyang1,4 and Yongwang Miao1*
...tected using PCR product direct sequencing. The CDS for both types of buffalo was the same in length, which contained 645 nucleotides and encoded a peptide composing of 214 residues. A total of 5 single nucleotide polymorphisms (SNPs) was identified in two types of buffalo. Among them, c.516T>C and c.578C>T were observed only in river buffalo, while c.175A>G, c.580T>C and c.609T>G were found only in swamp buffalo. The c.175A>G, c.578C>T an...
Haseeb Khattak1, Imran Ahmad1, Abdul Basit1*, Izhar Ullah1,2, Syed Tanveer Shah1, Humaira Wasila3, Inayat Ullah4, Intizar Ahmad1 and Noman Ahmad1
 
Roland Eric Yessinou1*, Alain Richi Kamga Waladjo2, Nestor Noudeke1, Ignace Dramou3, Justin Adinsi1, Victorien Tamègnon Dougnon4, Elsie Yélognisê Sangnidjo5, Razack Osse5, Alfred Dansou6 and Souaïbou Farougou1
Ibrar Muhammad Khan1, Dezhi Xu1, Zubing Cao1, Hongyu Liu1, Adnan Khan2,  Sajid Ur Rahman3, Jam Zaheer Ahmed4, Muhammad Akmal Raheem5 and Yunhai Zhang1*
...ck of these nutrients is directly related to reproductive performance. Hence, the antioxidants agents(L-cysteine and vitamin E) were added into semen diluent and assessed the freeze-thawed semen quality parameters. The ejaculates were collected from two crossbred groups (Sahiwal × Holstein-Friesian), and (Achai × Jersey) and, split into seven aliquots while extended with three different concentration (5, 7.5 and10 mmol) of L-cysteine ...
Iftikhar Alam1, Atta Ulllah Jan1, Muhammad Ali2 and Muhammad Farooq3*

... These priorities should direct future research activities in the field and be reflected in research policies of the country. We recommend larger research studies also including more diverse experts’ opinion.
...

Aurang Zeb1, Abdur Rab1, Shujaat Ali1,2*, Ijaz Hussain2, Shah Masaud Khan2, Israr Ahmad1, Bilal Pervaiz Khan1, Shakila Umer3 and Muhammad Abbas1

Muhammad Arslan Ibrahim1*, Aneeqa Aleem2, Farkhanda Manzoor2, Shahbaz Ahmad1, Hafiz Muhammad Zahid Anwar1, Talia Aroob2 and Mansoor Ahmad3 

...e present study was also directed to investigate the mortality factors in a lab-based experiment on the life table study of fall armyworm. A sub-lethal dose of 4µl of entomopathogenic NPV suspension containing 4×106 polyhedral inclusion bodies (PIB) was tested as a mortality factor against the late larval instars of S. frugiperda when natural mortality tends to decrease after each successive instar. The single-sex method was adopted in the construc...
Ahmed Saud Alsaqufi1, Sheikh Mustafizur Rahman2,3*, Roshmon Thomas Mathew2, Yousef Ahmed Alkhamis1,2, Md. Moshiur Rahman3,4 and Muhammed Aslam Pathiri2
...operiod and shelter have direct or indirect effects on phenotypic traits expression in different fish species. The present study was, therefore, intended to explore whether these light and shelter could influence some phenotypic traits of African catfish larvae under laboratory condition. Newly hatched larvae were stocked in plastic aquaria (10L) at a rate of 5 individuals/L and reared for one month under four treatments suc...

Frederic Ndihokubwayo and Atakan Koç

... the effects of the body dirtiness score (BDS) and teat end hyperkeratosis score (TEHS) on milk yield and quality in Holstein-Friesian (HF) cows were determined. In the study, a total of 432 cows raised in 9 different dairy cattle farms in Aydın Province, Turkey, were inspected. In addition to measure milk yield (MMY, kg), the milk samples were taken from these cows during the morning milking for the determination of fat content (FC, %), non-fat dry matter co...

Bushra Baig and Saeeda Yousaf*

...ed that more research be directed for assessment of more active compounds that could act as potential candidates for biopesticide. The objective of the study was to find the bioactive compounds in plant extracts of Neem and Black pepper and their effectiveness against reduction in number of whitefly and aphids.

...

Syed Muhammad Aun Naqvi1, Sara Tahir1, Tanveer Ahmed2*, Huma Naz3, Amara Gilani4, Atif Liaqat5

...ut of fish are not eaten directly by humans, but they have significant nutrient contents. The inferences of the present study would be helpful for the fish consumers in selection the best weight category and animal feed formulators. 
 
Novelty Statement | The present study inferences will be helpful in the selection of appropriately sized fish for human consumption. Further, fish visceral organs (n...

Fayaz Ahmad, Noorullah Khan, Farrukh Siyar Hamid, Abdul Waheed, M. Abbas Khan, Imtiaz Ahmad, Shamsul Islam, Basharat Hussain Shah, Sohail Aslam and Qamar uz Zaman

...d which may facilitate indirect selection of one trait for the other trait that is genetically interlinked.

...
Ayse Haligur* and Sema Ozkadif
...ginating from T2 coursed directly via the axillar region of the right side. The left side was not as regular as the right side. In this study, we showed that there were differences between the right and left sides of the plexus brachialis in the red fox.
...

Imtiaz Ahmed*, Naveed Ahmed, Abdul Waheed, Muhammad Abbass Khan, Noorullah Khan and Fayyaz Ahmed

...t of growing methods and direction of sowing on the growth and seed production of ridge guard (Luffa acutangula Roxb)” was conducted at PARC-National Tea and High Value Crops Research Institute, Shinkiari, Mansehra, Pakistan during the months of April-September, 2019. The experiment was laid out in Randomized Complete Block design (RCBD) with split plot arrangement having three replications. There were 45 plants in each replication. The treatments compri...

Muhammad Suhail Ibrahim1*, Asif Ahmad1, Anwaar Ahmed1, Amer Mumtaz2, Muhammad Javaid Asad3, Saqib Jabbar2, Ahmad Mujtaba1 and Muhammad Nadeem4

... last year. Pakistan has dire need of revamping the food safety policy and infrastructure. Food being an important intake is a major source of human exposure. Finally, risk of unsafe communication is required for management and prevention of consumer-based food borne illness, most prevailing illness. We ignore food safety challenges at our peril as potential consequences of a lapse are huge; keeping the food supply safe is a never-ending task.

...

Summara Abbasi* and Khalid Nawab

...f dairy technology has a direct impact on the socio-economic development of rural milk producers as milk production has a significant contribution to sustainable rural livelihoods. For this purpose, the present research was conducted to determine the socio-economic factors that influence the rural milk producers in the adoption of dairy technology. A survey was carried out in district Muzaffarabad of Azad Jammu and Kashmir by selecting 8 villages purposively, ...

Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1 

Nilgun Dogan1,* and Hakan Adanacioglu2
...r outputs and inputs are directed towards reduction of all variables except gross production value.
...

Huma Qamar1, Mariam Hassan1, Muhammad Zubair1*, Adnan Arshad2, Muhammad Qusain Saeed3, Muhammad Umar3, Sundas Shahzad1, Tariq Mahmood1 and Muhammad Aftab1

... yield from a plant. The direct effect of plant’s height on obtained yield was positive and indirect effects through days required for flowering was positive and the indirect negative effects were contributed through branches’ numbers (-5.54) and days required for maturity (12.27). Number of Branches have negative direct effect on the obtaine...

Ahmed A. Kheder

...oduct was confirmed with direct sequences. Phylogenetic analysis results indicated that SLRSV-Eg isolate under study (acc. no. MT648777.1), showed 65.9 – 99.5% nucleotide similarity with available homologous sequences from other crops. Reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of the most promising molecular diagnostic techniques was applied. The amplified products were analyzed using amplification curves a...

Ahmed F. Afify1, Mohamed A. Shalaby2, Ahmed A. El-Sanousi2 and Amal S. Gaber1

...amples. Serologically, indirect ELISA was performed on 540
serum samples. 130 samples were clearly strong positive at a percentage of 24%.
Molecular detection of EAV genome was performed only on 8 selected semen and
EDTA-blood samples which were giving highly distinct positive reaction in the
indirect ELISA. All samples were found negative to the presence of EAV genome by
...

El-Habbaa, A.S.

...usion test (AGIDT) and indirect-Immunofluorescence assay (IFA) and
molecular detection of viral DNA using PCR. Positive results were showed in 36 of
samples (28/30 of sheep samples and 8/10 of goat samples)upon isolation on ECE by the
3rd passage and 22 of samples (17/28 of sheep isolates and 5/8 of goat isolates) using
AGIDT and indirect-IFA. PCR detection showed positive resu...
Mandour, A. M. 1, Abdel Maksoud, H. M. 2, Amal, A. Khalil 3 and Mohga, A. El-Tahlawey 4
...r virus presence using Indirect ELISA. A number of cultural practices were
evaluated as control measures against MDMV to minimize the virus
infection in maize crop.
...
Sallam A.A.A.1, Hoda M.A.Waziri2,E. K .F. Elbeshehy1, SamiaI.Massoud,1 and Abeer M. Abo El-Wafa2.
...BBSV) and (BBMV) using indirect ELISA. Positive reactions was
obtained only with BBMV antiserum.The BBMV induced amorphous cytoplasmic
inclusion bodies in infected cells .The Susceptibilityof some faba bean cultivars and
genotype was also studied forvirus infection.The effectiveness of extracts from garlic
cloves (GE) and onion (OE) as an antiviral against BBMV infection in vivo has been
evaluated. Th...

Mokbel, Samah A.1,Ahmed K. El Attar1; Azza G.Farag2.

...g
nested and direct PCR as well as DNA sequencing was used for the diagnosis of the
witches‟ Broom infection. Total DNA was isolated from leaf tissues of infected hibiscus
plants. Nestedpolymerase chain reaction(PCR) was performed using the universal -
phytoplasma specific primers; P1/P7, R16F2n/R16R2.Witches‟ broom specific primers
SR1/ SR2, at the spacer region (SR), were used for the

Yasser F. Elnaker 1, Mohamed El-Tholoth 2, Sahar Saber 3, Amira A- Elsaid4, Mohamed A. Saad 3, Emad E. Younis 5

...ated virus was done by indirect immunofluorescence test. The serum antibody titers were determined by serum neutralization test (SNT) and Enzyme linked immunosorbant assay (ELISA) in calves and also their dams. The results confirmed infection of calves with lumpy skin disease virus (LSDV) and showed that calves older than 3 months old age and those out of first calf heifers are more susceptible for infection. Some calves even with insufficient amount of matern...

Ebtisam, A. Abouel yazeed1; Yanni, M.I.1 and Hanan A. Fahmy2

... was done by ELISA and indirect fluorescent antibody technique (FAT) as well as molecular method as real-time quantitative reverse transcriptase PCR (RT-qPCR) from samples collected during neonatal diarrhea. Six out of forty tested samples were found positive for rotavirus (15%) infection using ELISA test. Successful isolation of the rotavirus on MDBK cell line from two samples from the positive ELISA samples. The beginning of characteristic cytopathic effects...

Hanaa A. Ahmed1 and Eman M. AboHatab2

...tification of virus by indirect immuno fluorescent antibody technique (IFA) which was considered a rapid and accurate method for LSD antigen detection. nodules were subjected directly to PCR and Real time PCR for rapid and specific detection of LSDV, sixteen out of the twenty one nodular samples were confirmed positive by molecular methods. Eleven out of twenty one nodular samples were positive by (IFAT) in CAM, which prove ...

Yanni, M. I1; Hanaa A. Ahmed2; Lamyaa, A. Ahmed1; Hanan, A. Fahmy3 and Ibrahim, E.M.4 Aggour, M. G.3

...in tissues were sent for direct fluorescent antibody technique and isolation on tissue culture using BHK cells. Direct confirmation was performed by Real time RT- PCR and gene sequencing was performed directly from brain samples. Phylogenetic analysis including sequences from all previous Egyptian isolates and neighboring countries isolates was conducted. The % of nucleotide identities of ...

Afaf. A. Khedr*, Ekram Salama*, A. A. Samy**, Abdella, Y.A.*** and Suzan. K. Tolba***

...narum, and ELISA test, indirect haemagglutination inhibition test and ciliostasis score for infectious Bronchitis virus (IBV). The immune response for the antigenic component of both vaccines show high titre of antibodies, but Montanide ISA-70 adjuvanted vaccine was superior as shown in mean antibody titers against Avibacterium paragallinarum serovar A, B and C and infectious bronchitis. In addition, Montanide ISA-70 is lesser in viscosity that makes it easily...

Nashwa M. Helmy1 and Ahmed S. A.2

...y real-time RT-PCR and Indirect
sandwich ELISA in suspected samples. The serum samples were collected from Sharkia
and Fayoum governorates (30 and 40 sera respectively) submitted to laboratory
examination by Priochek for NSPs (3ABC) 32 out of 70 were positive (12 sera samples
from Sharkia and 20 sera samples from Fayoum), while 22 out of 70 were positive by
real time RT-PCR (10 sera samples from Shark...

Allam A. Megahed1; Hoda M.A. Waziri2; Khaled A. El-Dougdoug3; Badawi A. Othman3; Sirag M. Lashin1; Mohamed D. Hassanin1 and Mahmoud A. Ibrahim4

...:1024, respectively by indirect-enzyem linked immunosorbent assay (I-ELISA) technique. The produced antisera were evaluated and compared with foreign antisera using tissue printing immunoassay (TPIA) and dot blot immunoassay (DBIA). The produced antisera were found more efficiency in development the purplish blue color than the positive reaction when the foreign antisera applied, therefore it should be use produced antisera from Egyptian isolates specific for ...

Samah A. Mokbel1, Ashraf A. Abd El-Mohsen2

...ved by subjecting tubers directly to thermotherapy treatment at 36ºC, 37ºC or 38ºC for three weeks which resulting in 50%, 70% or 80% of PLRV-free tubers and 0%, 16.6% or 33.3% of PVX-free tubers respectively. Moreover, no effects on the survival rate of tubers were detected. High percentage (93.1% or 76%) of PLRV- or PVX-free plantlets was achieved with meristem tip excision (0.1-0.2mm) from thermo-treated tubers at (38ºC) with survival ra...

Ahmed K. El-Attar; Samah A. Mokbel; Ali H. Hamed

...tification was done by indirect ELISA using specific
antiserum and confirmed by Reverse Transcriptase-Polymerase Chain Reaction (RTPCR)
using virus-specific primers. The molecular characterization for the Egyptian
isolate has been performed through cloning and sequencing for the OYDV CP gene
which amplified by RT-PCR then cloned and sequenced in the TOPO cloning vector. The
CP gene sequence has been s...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
...>pJET cloning vector and directly sequenced. The sequence alignment and phylogenetic
analysis showed a relatively high diversity among the three different isolates that the
identity ranged from 89 to 94%.
...

Eman A. H. Kattab1,3, A. H. Ebrahem2 , Om-Hashem M. El-Banna2 and Hanan F. EL-Kammar³

...ected serologically by indirect ELISA using BBMV specific antiserum. Light microscopy of epidermal strips of faba bean infected-leaves revealed amorphous cytoplasmic inclusions (X-bodies). The UV absorption spectrum of the purified virus had a maximum at 260 nm and a minimum at 245 nm. The ratios of Amax/Amin and A260/280 were 1.39 and 1.57, respectively. Yield of the purified BBMV preparation was about 2.5 mg/100g of infected tissue. Electron micrograph of pu...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...ction was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis.

...
Eman A. Ahmed1, Osama Y. Shalaby2, Emad F. Dwidar2, Samah A. Mokbel1, Ahmed K. El-Attar1 
...
cloning and direct sequencing. The DNA sequencing, phylogenetic analysis and the
multiple alignments for the sequences of the Egyptian clones with each other and with the
other sequences of phytoplasma strains on GenBank showed that we may have two
different phytoplasma isolates infecting tomato plants in Egypt.
...

Sahar Abd El Rahman1; Mohamed Eladl2 and Mohamed M. El-Diasty3

...essfully identified by indirect immunofluorescence technique in the brain sections of positively inoculated mice. Reverse transcriptase polymerases chain (RT-PCR) reaction was performed directly on buffy coat samples for molecular identification of the virus showed 470 bp clear band in gel electrophoresis. The sensitivity of the utilized techniques in the identification and diagnosis of bovine ephemeral fever disease reveale...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...serum was evaluated by indirect enzyme-linked immunosorbent assay (ELISA). The conjugated antisera that prepared in this study were succeeded to detect the virus in infected plants.

...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...ntified serologically by direct ELISA, dot and tissue blotting immune-binding assay using authentic and induced antiserum for PNRSV.RT-PCR with specific PNRSV primer was used to confirm the obtained results. No amplified product was obtained from healthy control. The partial RNA3 movement protein product from PNRSV infected rose directly cloned using the TA cloning system. Nucleotide sequencing revealed the clones to be port...

Manal A. El-Shazly1. M. I .Kobeasy2and Sarah H . Altalhi3

...d serological tests by indirect –enzyme linked immunosorbent assay (Indirect- ELISA) and dot blotting immunobinding assay (DBIA) using an induced antiserum for TSWV. All the five tested tomato cultivars were found to be susceptible when mechanical inoculated under greenhouse conditions. Wide variations of symptoms were found between cultivars. Super strain and super merman were found to be more susceptible than any oth...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...an with filtrates. The indirect ELISA was carried out to confirm the identity of the virus isolate and the obtained results of this study. Spraying faba bean plants with either algal filtrates or biomass also increased the plant growth parameters, i.e. plant stem and root length as well as plant fresh and dry weight. Algal proteins were identified by the protein profile pattern using SDS-PAGE method. The contents of alkaloids, phenols and terpenoids in both al...

Rafia Ahsan1, Saif Ullah1, Ijaz Yaseen1, Faisal Sohail Fateh1, Muhammad Fayyaz1, Shahzad Asad1, Atif Jamal1, Muhammad Sufyan2 and Muhammad Zakria1*

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...tation test (AGPT) and indirect fluorescent antibody technique (IFAT) using specific hyper immune serum against LSDV. Further identifications were carried out by polymerase chain reaction (PCR) and clinco-pathological investigation. Results: The results showed that 11/30 biopsies were positive by AGPT, 19/30 by IFAT and 30/30 by PCR. While results of sero-diagnosis showed that 45/100 from apparently healthy non vaccinated cattle and 68/100 from vaccinated catt...

Lamya A. F. Ateya1, Said A. Ahmed 2, Mansour H. Ayman3, Khamees K. Ashraf 4, Heba A. Abdel-Hady 5

...irus was identified by indirect fluorescent antibody technique (IFAT) using specific hyper immune serum against Lumpy Skin Disease Virus. Further identifications were carried out by polymerase chain reaction (PCR). Results: 15 samples were +ve for LSDV by conventional PCR.The results showed that 11/23 biopsies were positive by IFAT. Molecular identification of LSD virus by using RT-PCR, revealed positive for amplification of bands at the predicted molecular si...

Salama M. El-Saghir1, 2

...
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in co...

Naglaa F.S. Awad1, Gamelat K.F. Kotb2

...amples were purified and directly partial sequenced for C-terminal VP60 gene.
Results: Only two samples were positive for partial C-terminal VP60 amplification. The first positive
sample was collected from non-vaccinated young rabbit (45-day old) and designed here as SHAH
2015, whereas the second sample was collected from non-vaccinated adult dam (nine-month old) and
designed as SHMK2016. Hemagglutination analysi...

Dina N. Abd-Elshafy

...ong anti-HAV effect with direct effect on the viral
particles. Supplementing tap water with the extract with continuous shaking every 15 minutes
for 1 hour caused more reduction in the percentage of HAV plaque counts compared to
allowing the supplemented water to rest for without shaking and the same effect was shown
when water was freezed and tested after one and two weeks indicating stability and
ir...

Dina A. Abdulrahman1, Ayman H. EL-Deeb2, Momtaz A. Shaheen1 & Hussein A. Hussein2

...Consequently, there is a dire need for
routine molecular characterization of the circulating FMDV strains to ensure the rapid detection of any
new or mutant strains and update the used vaccine accordingly.
Methods: Twelve epithelial samples were collected from cattle showing signs suspecting of FMD.
The samples were tested by real time RT-PCR using universal primers for detection of all seven
serotype...

Abdou Nagy1, Fatma Abdallah1, Kareem Sweed2, Ahmed Salama3, Mohamed Omar4

.../div>
commercial indirect aMPV ELISA.
Results: Five out of 23 broiler, 6 out of 17 layer, 1 out of 6 Pekin duck and 1 out of 2 Muscovy duck
flocks showed positive results. On the other hand, the results showed significant difference in the net
profits as a measure of economic impact between infected and non-infected flocks in different
provinces.
Conclusion: The results denote that chicken and d...

Nermeen A. Marden1, Lamiaa M. Gaafar1, Hussein A. Hussein2

...o method was done by the direct detection of the viral content and viral identity using
the rRT-PCR technique from final product of these inactivated vaccines.
Results: The data of this study showed that sufficient HA antigen content and similar HA sequences
with the field HPAI challenge viruses are needed to produce a consistent and high protection percent,
but, they are not enough to assess the vaccine efficacy...
Asma Kaouachi1, Mohcen Menaa1*, Abderraouf Chouaib Rebbah2 and Mohamed Cherif Maazi1
...inus halepensis. The direct field observations permitted to note that the summer diet was dominated by the cereals.
...
Sahar Mubashar*, Tariq Mukhtar and Nasir Ahmad Khan
... respiratory droplets or direct contact. Moreover, there have been reports of the mixed infection of coronavirus with other bacteria, fungi and viruses. Various methods are used for the detection of the virus such as nucleic acid and immunological methods but RT-PCR is considered as the most reliable. Some antiviral drugs have shown to be effective against the virus like Favilavir, Remdesivir, Chloroquine, hydroxy-chloroquine, Tocilizumab etc. but further clin...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
...croscopic examination, indirect ELISA and PCR, respectively. Two major surface protein genes (MSP1a and MSP4) sequence were compared with cattle isolates from different origins. Phylogenetic analysis of local isolates showed a close homology with the isolates from Australia, Brazil, Turkey and Japan. It was found that aged, exotic and crossbreed cattle were more susceptible to A. marginale infection in summer season compared to t...

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

...y using conventional PCR direct from nodular lesion, 4
positive samples were inoculated on CAM showed characteristic pock lesion, formerly after passaging
of samples on MDBK cell line revealed characteristic cytopathic effect of LSDV, as well as tissue
culture suspension were positive using conventional PCR . For antigenic identification SNT were
applied. Sequencing of positive sample reveled identity of LSDV by ...
Othman N. O. Mansour 1, Naglaa Hagag 2, Momtaz A. Shahein 1, Sayed S. Hassan 1 Ahmed
A. EL-Sanousi 3 and Mohamed A. Shalaby3
...ples were tested using indirect ELISA technique.
Results: From 1500 nasal swabs of imported camel breeds collected in Birqash veterinary quarantine,
ten samples (0.66%) were positive for MERS-CoV by real time RT-PCR. Out of 195 serum samples
which collected from imported camels in abattoirs of some governorates, 110 samples (56.4%) were
positive for the presence of specific antibodies against MERS-CoV while the n...

Rana A. Rabiea1, Mohamed Fawzy2, Mohamed H. Khodeir3 and MokhtarM. EL-Tarabili2

...(SNT), and
indirect ELISA.
Results: There was detectable TRT antibody titers by SNT in the first week post vaccination as 4 log2
in group-1 and 2 log2 in group-3. Both groups showed peak SNT titer (256 log2) of TRT virus by the
third-week post administration of the second dose and remain stable up to 24 weeks post vaccination.
Follow up avian influenza antibody titers using HI test, peak titer (64 log...

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

... by nested-PCR assay and direct sequenced using specific primer
pairs. Phylogenetic tree was based on obtained sequences data.
Conclusion: The phytoplasma associated with gazania exhibiting phyllody, yellowing, proliferation,
virescence and little leaf symptoms was confirmed by the results of LM and TEM observations and
nested-PCR testing. Based on direct sequence date, phyloge...
Hadeer M. Mossa, Ausama A. Yousif, Emad A. Aboelsoud, Mahmoud El Gamal, Ahmed El-
Sanousi
...>bioinformatics tools to directly represent the genetic content of entire communities of organisms in the
given harvest.
Results: In this study a 3rd generation sequencing (TGS) was applied using a Nanopore technology
(MinION) based on identification of DNA bases by measuring the changes in electrical conductivity
generated as DNA strands pass through a biological pore (nanopore). Its portability, affordability, ...

Md. Abdullah Al Mamun1,2*, Shamima Nasren1,3, Sanjay Singh Rathore1 and Kavalagiriyanahalli Srinivasiah Ramesh1

...of A. japonicus elicited direct effects such as eye opacity, fin rots, scale loss and severe histopathological alterations in catla. 

...

Pukhtoon Yar1*, Salman Khan2, Du Ying1 and Muhammad Israr3

...iculture sector would be directly or indirectly benefited from these projects, currently ongoing under CPEC. Over the last several decades the country’s agriculture sector has severely been affected, and the crisis in energy might be the prime reason responsible for this downfall. In order to achieve the objectives of the study, a comprehensive literature survey has been conducted. Scores of problems have been identifi...
Jehan Dastagir, Muhammad Amir*, Bilal Ur Rehman, Shahid Hameed and Majad Ashraf
.... The work in this paper directly investigates possible attainment of optimized TCP congestion control over wired networks through a proposed modification done to one of the existing TCP protocols. Firstly, the proposed approach looks into various queue limits e.g. Drop Tail and RED. Evidently, a comparison of these two queue limits vividly demonstrates that RED demonstrates a better performance when it comes to attainment of optimized TCP congestion control. ...
Donglai Li1,Mei Han1,Huw Lloyd2, Linyu Jin1, Lei Zhang1, Jiangxia Yin1 and Dongmei Wan1*
...roods. There was also no direct effect of EPP on the reproductive success of breeding adults and the body condition nestlings near fledging. The lack of reliable cues of EP copulations (EPC)s by social mates available for the males, and/or the absence of strictly environmental pressure on males that would favor discrimination may account for a lack of an adjustment in feeding effort. The absence of discrimination between own and EPP chicks in parental care sug...
Pengfei Liu*, Xuexue Qin and Fei Shang
... time. In order to avoid direct competition, closely related bird species that breed alongside each other are expected to use different habitats characteristics for nesting. We looked for possible differences in breeding ecology of two bird species, the plain laughingthrush Garrulax davidi concolor and Elliot,s laughingthrush Trochalopteron elliotii in lianhuashan, try to figure out the mechanisms permit stable coexisting of these two ...

Hina Fatima1*, Bushra Yasmin2 and Lal Khan Almas3

...on pressure, this is the dire need of time to get farmers involved in advanced and intensive farming techniques to attain self-sufficiency in production. This study conducted the efficiency and productivity analysis by applying the parametric and non-parametric techniques to evaluate the optimal utilization of farm resources in multiple cropping system and the efficiency gains from tunnel technology. The data were collected from 150 multiple bitter gourd-capsi...
Arshad Khan1, Mohammad Ihsan1, Ali Hazrat1*, Mohammad Nisar1, Muhammad Laiq1, Maryam Bibi1, Nasir Ali2, Ulfat Naz1, Muhammad Zakria1, Nausheen Nazir3, Adam Khan4 and Muhammad Asif Nawaz5
Tanmoy Mandal1 and Sunil Kr. Ghosh2*
... of imidacloprid with azadiraction was found to be the most effective against leaf miner showing 79.24% mortality with imidacloprid 76.25% and in the mixed formulation imidacloprid+polygonum 73.74 %. It is concluded that lower dose of imidacloprid mixing with azadiractin/polygonam/spilanthes extracts will be environmentally sound and eco-friendly and is recommended for leaf miner control to promote organic farming.
Jun Yan Bai*, Yu Chen, Qi Hang Hu, Zhi Hao Dong, Ying Lei, You Bing Yang, Shu Juan Zhao and You Zhi Pang
...CR products were used to directly sequence the polymorphism of exon 4 of ESR gene in three quail populations (Chinese yellow quail, Korean quail, Beijing white quail) and analyze the association between ESR gene and growth traits of quails. The results show that three genotypes, CC, CT and TT, were detected in exon 4 of ESR1 gene in three quail populations. The highest frequencies of TT gene were 0.409 and 0.617 in China yellow quail and K...

 Yanqiang Zhou1, Lixin Wang1, Chunxiao Hao1, Xiuyun Li2, Shakeel Hussain1, Dongdong Shen1, Zhiwei Peng1, Qi`an Zhai1 and Zhijun Hou1,*

...churis sp., Nematodirus sp., Moniezia sp., E. macusaniensis, another Eimeria sp. and another Strongy-type (different with goats) in alpacas. It was discovered that the infection rate was 45.74%, 38.97%, and 12.09% in blue wildebeest, alpacas and goats, respectively. The hosts have different dominant parasite and diverse prevalence in different season, temperature, and humidity groups. Host specificity is the main reason for the ...

Fahima Khatun1, Abdullah-Al-Maruf2, Md. Mizanur Rahman2, Afroja Yasmin1, Mohammad Ali Zinnah3, Md. Aminul Islam4 and Mohammad Shah Alam5*

...e rectum and examined by direct smear method and helminths identified by the presence of characteristic eggs in the feces. This study was carried out with three age groups: calves (<1 year), young (1-3 years), and adult (>3 years) and three different consecutive seasons (winter, summer, and rainy) during the periods of January 2018 to December 2018. The highest incidence was found in infestation with Fasciola spp. (43.63%) followed by Toxocara spp. (35.7...

Hafiz Muhammad Tahir*, Iram Liaqat*, Junaid Nadeem, Hammad Aamir and Shaukat Ali

...property. Our study used direction application and disk diffusion method to investigate the antibacterial potential of Neoscona mukherji and N. theisi egg and web silk. For disk diffusion method, silk was first degummed to form degummed silk solution’ (DgS), then the degummed silk was dissolved to form the dissolved silk solution (DSS). The DgS and DSS solutions were tested against selected common pathogenic bacteria (Esherichia coli, Salmonella typhimur...

Junaid Ahmad1, Shahzeb Javed2*, Mehmood Khan1, Shadman1, Muhammad Farooq3*, Muhammad Saleem4, Rahila Afzal5, Muhammad Aasim6, Naqeeb Ullah7, Muhammad Noman Khan8, Dawood8 and Naila Ilyas9

...s; they will be the ones directly handling food and will play a key role in helping to maintain a sanitary and clean environment.

...

Amir Muhammad Khan1, Laila Fayyaz2*, Raziuddin2, Sajid Ali1, Israr-ud-Din1, Sheraz Ahmad2, Haidar Ali1 and Ijaz Ahmad2

...important while making indirect selection to improve seed weight and oil content in rapeseed. 

...

Malik Muhammad Shafi, Rabia Habib and Haidar Ali*

..., interview schedule and direct observation was used as a research tools. Through random sampling technique, a sample size of 90 households from 452 farm households were taken. Total consumption expenditures, total income, and land size were the variables which showed significant results. Because their overall p-values indicates significant results at 5% significant value. Results of these variables revealed a positive relationship between household (farmers) ...

Yonis Abukar Mohamed1, Shafii Abdullahi Mohamed1,2, Abdiaziz Idiris Mohamud1,3*, Abdiaziz Ahmed Mohamud1,3, Kassim Abdullahi Jimale1,2 and Said Ali Ibrahim2

...nal (animal-based) and indirect (owner-based) interviews were used to collect the data. A total of 350 randomly selected working donkeys were examined and 350 donkey owners were interviewed. Of these 56.9%, 24.3%, 18.9%, 79.7%, 65.4%, and 38.3%, 8.9% of donkeys were suffering from behavioral problems such as depression, digestive problems, respiratory problems, improper harnessing, ocular, hoof overgrowth and fracture, respectively. Additionally, 40.6% of the ...
Sohail Anjum1, Awais Ahmad1, Farzana Bibi1 and Hazrat Ali2*

Ruqia Bibi1, Najam-un-Nisa1, Sania Komal1, Hafiza Nimra Ghani Qureshi1, Maryam Safdar1, Hafiza Hina Jameel1, Saman Gul1, Sania Saeed1 and Inam Ullah1,2*

...gradation, so there is a dire need to protect avifauna diversity for the proper functioning and stability of an ecosystem.

...

Muhammad Usman Hanif, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad, Muhammad Irfan Ullah

..., Citrus limon L. and Azadirachta indica A. Juss) against the grubs and adults of E. vigintioctopunctata. Three concentrations of each synthetic insecticide (i.e. 2.5, 2 and 1.5%) and botanical extract (i.e. 10, 7.5 and 5%) were bioassayed using standard leaf-dip method. Results revealed that spinosad and 10% A. indica aqueous extract exhibited maximum mean cumulative mortality of hadda beetle grubs (i.e. 84.1 and 73.4%, respectively) and adults (i.e. 67.4 and...

Ayesha Khan1*, Asmatullah2, Urooba Perviaz1, Khalid Nawab1 and Mahmood Iqbal1

.... Organic farming is the dire need of the day; to overcome the excessive use of chemical fertilizers alternative methods are adopted to decrease use of fertilizers. One of the techniques for organic farming is EM-Technology. EM-Technology is used in addition with animal manure and other organic wastes effectively in agriculture. The universe of the study was Malakand division of Khyber Pakhtunkhwa. The EM-Technology using 128 farmers’ data were gathered ...
Monif AlRashidi1*, Sami Saeed M. Hassan2 and Mohammed Shobrak3
... to protect the egg from direct sunlight.
...
Misbah Sarwar1*, Abdul Hamid2 and Iftikhar Hussain2
...r population. There is a dire need of law enforcement to conserve the bird species in the study area.
...
Abdul Sattar*, Hasan Orooj and Muhammad Iqbal Afridi
Abdul Sattar*, Hasan Orooj and Muhammad Iqbal Afridi
Zahid Beg Mirza1,*, Naveed Ali Soomro2 and Farwah Shariff1
...20. Methodology included direct field observations and interviews of local communities. Field Guide to the Birds of Pakistan, by the senior author and other related literature, as well as the use of a high resolution camera helped in the identification of the species. During the surveys, information on the use of non-steroid anti-inflammatory drugs, that is diclofenac and other drugs known to be harmful to vultures, were gathered through interviews. This paper...

Nawab Khan1, Ram L. Ray2, Muhammad Ihtisham3*, Badar Naseem Siddiqui4*, Muhammad Khayyam5, Raheel Anjum6 and Simplice A. Asongu7

... that apple growers need direct or indirect training about the latest technologies and innovations, which helps enhance the adoption rate, apple yield and production, andgrower’s income.
...

Ayesha Muzamil, Hafiz Muhammad Tahir, Shaukat Ali, Iram Liaqat, Aamir Ali, Muhammad Summer

...rulonephritis are linked directly or indirectly to different inflammatory processes. Conventionally, different steroidal and non steroidal drugs i.e., antibiotics are used to treat inflammatory disorders. Theses synthetic drugs have many side effects on the health such as gastrointestinal problems, stomach ulcers, dizziness, liver or kidney problems etc. Cytokines play an important role in the induction and suppression of in...

Arshad Farooq1, Abdul Hassan1, Muhammad Ishaq2, Asif Nawaz3*, Iltaf Ullah4 and Hidayatullah5

...nge as its variation can directly affect the crop productivity. Therefore, knowledge about climate smart agricultural production technology is the main component and knowledge gap is at the crux of yield gap. The current study was carried out in two districts Charsadda and Nowshera of Khyber Pakhtunkhwa province during 2020 with main objectives to measure farmers’ knowledge level in fourteen climate smart recommended agricultural production technologies....

Rehman Shahzad1, Saba Irshad1* and Faisal Amin2

...s study which might be indirectly enhancing the virulence of virus. These findings demonstrated that new mutations are emerging in B2 sub-lineage and there is need for constant surveillance of evolving genome of H9N2 virus prevailing in the country to combat the future challenges of avian influenza out breaks in Pakistan.

...

Kusuma Adhianto*, Satria Ibnu Lenanto, Akhmad Dakhlan, Muhamad Dima Iqbal Hamdani 

...econdary data taken from direct observations in the field and livestock recording data from Sumberejo District. The method used is a survey method, the research sample was determined by purposive sampling. The data were analyzed using the paternal half-sib correlation method. The observed variables included weaning weight and yearling weight. The results of this study showed that the average weaning weight of female Saburai goats in Sumberejo District was 16.4...

Kubilay Ucar1, Görkem Oruk2 and Sait Engindeniz1*

Zane Vincevica-Gaile1, Karina Stankevica1, Maris Klavins1, Roy Hendroko Setyobudi2, Damat Damat3*, Praptiningsih Gawawati Adinurani4, Lili Zalizar5, Muhammad Zul Mazwan6, Juris Burlakovs7
Didiek Hadjar Goenadi8,9, Rista Anggriani3 and Aamir Sohail10
 
 
... soil amendments is also directed by the targets of circular economy and environmental sustainability goals, leading to reducing or abandoning the use of fossil resources and paying attention to waste utilization as secondary raw material. This paper aims to discuss general features of peat-free soil amendments as well as provide efforts into the use of secondary raw materials such as biomass ashes for the elaboration of peat-free soil-improving products. As a...

Abdul Jabbar*, Anees-Ul-Hussnain Shah, Abdul Basit, Ghulam Ahmad, Aftab Ahmad Khan, Suleman Raza, Muhammad Sultan Ali Bazmi, Imtiaz Akram Khan Niazi and Ahmad Hussain

...n of berseem (SB-11) was directed at Fodder Research Institute, Sargodha, Pakistan during 2017-18 and 2018-19. Different sowing methods, broadcast and row spacing of 15cm, 30cm, 45cm, 60cm apart were used. Plant height (cm), number of capsules/m2, number of seeds/capsule, 1000-grains weight (g) and seed yield (kg/ha) parameters were studied. It was observed that sowing methods had a significant outcome on seed yield. The results depicted that broadcast sowing ...

Shuangye Wang1,2, Yunlin Zhao1,2, Zhenggang Xu2,3,*, Junzhi Chen3, Guiyan Yang3, Song Wang2 and Kangkang Jiang2

 

...ze of milu population, indirectly utilizing the habitat.

...

Javed Khan1, Abdul Majid1, Mohammad Nisar2*, Ali Hazrat2, Nausheen Nazir3, Muhammad Zahoor3, Mohammad Ihsan2, Azhar Hussain Shah1, Muhamad Ajmal Khan4 and Muhammad Yahya1

Aasma Younas*, Ijaz Iqbal and Atif Akbar

...r design. This design is directly applied to agriculture, as its give an example of wheat to explain the concept. Crossover Designs have been constructed for different values of treatments, blocks and periods using all possible cyclic shifts. In this article, a computer program has been introduced. This is an era of technology, no one has time to do laborious work by hand. The results suggested some general rules for the construction of such designs. For p &le...

Shoaib Hameed1, Shakeel Ahmad1, Jaffar Ud Din2 and Muhammad Ali Nawaz3*

...urveys, sign surveys and direct sighting, Himalayan brown bear presence was confirmed only in the Yarkhun and Laspur valleys. Ninety-six respondents (59 from Laspur Valley and 37 from Broghil Valley) reported a total of 449 livestock losses (90 heads per year) to carnivore species—grey wolf (Canis lupus), snow leopard (Panthera pardus), Himalayan lynx (Lynx lynx isabellinus)—during the five-year (2005–2009) period, which translated into an ec...
Abdul Jabbar1, Muhammad Tariq1*, Asim Gulzar1, Tariq Mukhtar2 and Tayyaba Zainab3
...s of four plants i.e. Azadirachta indica, Zingiber officinale, Syzygium aromaticum and Datura stramonium and their green synthesized silver nanoparticles (AgNPs) were evaluated against 3rd and 4th instar larvae of C. pipiens. The green synthesized AgNPs of these plants were characterized by UV-Multiskaner. LC20 and LC50 values were calculated through Probit and Logit analysis (POLO) software. All the plant extracts and their green synthesized AgNPs caused the ...

Hassan Ali1, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1* and Muhammad Imran Hamid2

... stramonium (84%) and Azadirachta indica (79%) at 24 h post-exposure. Regarding bioassays with microbial insecticides, maximum mean mortality of larvae (i.e. 42.6 and 46.1%) were exhibited by the highest concentration of Bacillus thuringiensis (18000 CFUs mg-1) and Lecanicillium lecanii (1.0 × 109 conidia g-1) recorded at 5th and 9th day of bioassay, respectively. Based on overall results, the local botanical extracts, particularly peel extract of C. ret...

Tarık Bugra Saruhan and Alptug Sarı*

...>Direct and indirect observation methods were used in field studies. Direct observations were made by one or two-person using point and line observations, as well as using camera traps. In indirect observations, signs such as the jackal’s footprints, scats, etc. were used. As a result of the research, data such as 253 camera trap images of the jackal,

Muhammad F Tajol Ariffin1, Chai M Hian1, Muhammad Z Sukiman1, Mohd F Ghazali1, Siti M Zainal Ariffin2* 

...CC was determined by the direct microscopic method. Results revealed a time-dependent change of Hp, SAA and AGP in the infected group compared to the control. The APP levels in the milk were significantly higher (p<0.05) than those in the serum. A significant good correlation between milk Hp concentration and SCC was observed (rs= 0.73, p<0.05). However, there were no associations between milk SAA and AGP concentrations with SCC respectively. In conclusi...

Abdul Wadood Khan1, Sabahat Subhan1*, Asif Ali Abro2 and Riaz Shahid3 

.... The study recommends a dire need to increase capital stock, skilled labour, and cultivated land to boost and enhance agriculture growth as these are the key factors for the agricultural TFP and economic growth of country’s.
...

Ahmed Abdel-Rady1,2, Walaa Mostafa3* 

...ecal examination through direct smear and flotation techniques were done to determine the presence of the eggs. Out of these, 104 animals were infected with strongyle eggs with (26%) prevalence. Sex, season, and age were the factors that affect the prevalence of trichostrongyle infection in this study. Data analysis reported that there was a significant effect for the season and sex on the trichostrongyle infection level; the highest nematode infection level w...

Doaa Khairy1, Mohamed Ali Osman2 and Fatma Abdel Mohsen Mostafa1*

...eifera Lam), or neem (Azadirachta indica A. Juss) singly or in integration with different parts of canola (Brassica napus L.) extracts to alleviate the deleterious effect of Meloidogyne incognita as well as ameliorate tomato growth in vivo. A mixture of moringa or neem aqueous leaf extracts with different parts of canola viz. leaf, stem and root gave better results than did single ones. Dual application of neem leaf extracts and canola parts extracts exhibited...

Hyun-Ju Cho1, Eun-Jae Lee2 and Shin-Jae Rhim3*

...itat variables had major direct effects on small rodent populations. Investigations of biodiversity in urban areas are necessary and should be considered in urban planning for the conservation of biodiversity.

...

Rana A. Ali1, Abd-Elraheim A. Elshater2, Heba A. Mohammed3*, Mahmoud Elshazly4 

...adays, efforts have been directed and focused on complementary medicine. Aim: Our study was designed to assess the hypoglycemic activity of the laser on diabetic experimental animals. Methods: The present work was carried out on 40 albino rats, and equally divided into 4 groups, (10 rats/group) as following: Group 1, animals served as control. Group 2, animals received STZ. Group3, animals received laser. Group 4, animals received STZ+ laser. After the experim...

Tatyana Mamontova1*, Konstantin Katkov1, Natalia Kizilova2 and Ali-Magomet Aybazov1

...perm, with the value and direction of the daylight gradient having the greatest influence. It is with a negative gradient aimed at reducing the length of daylight that the highest rates of ram sperm are observed.

...

Tatyana Mamontova1*, Konstantin Katkov1, Natalia Kizilova2 and Ali-Magomet Aybazov1

...perm, with the value and direction of the daylight gradient having the greatest influence. It is with a negative gradient aimed at reducing the length of daylight that the highest rates of ram sperm are observed.

...

Tiyyabah Khan1, Hafiz Azhar Ali Khan1*, Muhammad Rizwan Khan1, Muhammad Umer1, Adnan Akhter1 and Waseem Akram2

... and T. castaneum with indirect effect on fungal infection inhibition.

...

Ishrat Younus1,2 and Afshan Siddiq1*

...f the plant but there is dire need to carry out the fractional extraction of crude extract with different solvents based on polarity to identify the active constituents with exact analgesic and antipyretic mechanistic action of Raphanus caudatus as well as clinical trials are required in future for medicinal use of the plant in humans.

...

Huapu Chen1, Zhiyuan Li1, Yaorong Wang1, Wei Yang2,*, Hongjuan Shi1, Shuisheng Li1,3, Chunhua Zhu1 and Guangli Li1,*

...BH had a significant and direct effect on BW. The determination coefficients of traits BL, BT, BH, and HL to BW were 0.163, 0.159, 0.057, and 0.018, respectively with the total value being 0.928. In males, the determination coefficients of six traits to BW were 0.124 (BH), 0.192 (BT), 0.053 (BL), 0.018 (OL), 0.0088 (HL), and 0.0092 (PA), with the total value being 0.855. Moreover, two best-fit linear regression equations were constructed in females and males r...

Riffat Sultana1*, Samiullah Soomro1 and Chuan Ma2

...oint out future research directions.

...

Azra*, Muhammad Awais, Alam Khan and Muhammad Shoaib

...investment because of unidirectional causality. Specification and analytical tests supported reliability of the investment does not affect investment model from key econometric issues. The stability test shows that investment fluctuated during the 1990-2017 periods. OLS and GMM results are comparable. OLS estimation results are reliable since these variables do not suffer from Endogeneity problem.

...

Muhammad Ali Raza1*, Aneela Zameer Durrani1, Muhammad Hassan Saleem1, Kamran Ashraf2, Muhammad Muddassir Ali3, Kumayl Hassan Akhtar4 and Nazia Rubab5

...h (OH) institutions need dire attention of all the stakeholders i.e. legislative, administration, policymaker, corporate sector, professionals for animal welfare and human health, and environmental safety. A survey was conducted through questionnaire distribution among 1000 literate persons who could easily read English i.e. physicians, veterinarians, lawyers, livestock farmers, managers and other literate stakeholders. This survey comprised of a variety of qu...

Md. Taimur Islam1*, Mirza Mienur Meher2, Anas Bin Harun3 and Md. Golam Haider1

 

Md. Serajul Islam1,2, Hongxin Wang1,2,*, Amer Ali Mahdi1, Mohamed Ismael Ahamed2, Zaixiang Lou1 and Fu An Wei3

...e (Chinemys reevesii) by direct QUENCHER procedure. The results showed that the highest ABTS capacity was found in cooked muscle at 10 min (110.133± 4.153 g trolox Eq./kg). On the other hand, DPPH and FRAP capacity were found in cooked muscle at 20 min which were 68.966±0.937 and 37.437±1.027 g trolox Eq./kg, respectively, and raw liver 31.508±1.091 and 58.237±0.919 g trolox Eq./kg, respectively. The total antioxidant capacit...

Noora Hassan Hezam Al-Aqmer1*, Zain Aamir2, Muhammad Farooq Hanif3, Soumble Zulfiqar4, Sibgha Zulfiqar1, Mateen Izhar5 and Abdul Rauf Shakoori4*

... response to hepatitis C directly acting antiviral treatment. This study which is a case control study included 66 hepatitis C patients (genotype 3) who responded to the directly acting antiviral treatment and achieved negative HCV-RNA three months after completing the treatment (sustained virologic response (SVR)) and 66 hepatitis C patients (genotype 3) who did not achieve SVR three months after completing the same treatme...

Jae-Kang Lee, Hyun-Su Hwang, Tae-Kyung Eom, Dong-Ho Lee and Shin-Jae Rhim*

...ulation was influenced indirectly by the negative effect of slope gradient on ground vegetation because ground vegetation serves as food and shelter for A. agrarius. Thus, slope gradient had a negative effect on A. agrarius, but not on A. peninsulae. This study suggests that habitat management, especially in tree-thinned habitats where ground vegetation develops explosively, should be accomplished by considering slope gradient for both creating suitable microh...

Nausheen Irshad1, Maria Akhter1, Tariq Mahmood2*, Faraz Akrim3, Muhammad Rafique Khan1 and Muhammad Sajid Nadeem4

...urrence was confirmed by direct field sightings (live and kill), and indirect signs (pugmarks, burrows, fecal droppings, and reported sightings by local community). During one-year study period (September 2015-August 2016), a total of 28 individuals of the species were sighted in the field including 18 live and 10 dead specimens. In addition, 93 fecal samples of the species were collected and analyzed for investigating its d...

Muhammad Ismail1,*, Abu Bakar Muhammad Raza1, Muhammad Zeeshan Majeed1 and Umair Abbas1 and Riaz Hussain2

...ous extracts of neem (Azadirachta indica A. Juss), garlic (Allium sativum L.), ginger (Zingiber officinale Roscoe) and lime citrus (Citrus aurantifolia (Christm.) Swingle) on the fruits of five citrus cultivars (i.e. bitter orange (Citrus aurantium L.), grapefruit (Citrus paradisi Macfad), lime (Citrus aurantifolia Christm), mandarin (Citrus reticulata Blanco) and sweet orange (Citrus sinensis (L.) Osbeck) against B. dorsalis using choice and no-choice fruit-d...

Tariq Mahmood1*, Shakeela Ismail1, Faraz Akrim2, Muhammad Farooq1, Nadeem Munawar1 and Muhammad Raza Khan1

...bitats and recording its direct and indirect field signs (such as scats, pug marks, prey remains, hairs), while diet composition was investigated by using noninvasive technique of scat analysis. Results showed grey wolf being distributed at an elevation range of 3921 m to 4282 m above sea level (asl) in the park. Scat analysis showed 7 wild and 6 domestic prey species in its diet, with approximately 47 % contribution from li...

Aiman Batool1, Muhammad Sohail Sajid1,2*, Hafiz Muhammad Rizwan3**, Asif Iqbal4, Imaad Rashid5, Ibadullah Jan6, Faiza Bano7, Fiaz Ahmad8, Waqas Ahmad1, Muhammad Nisar Khan1 

...along with ectoparasites directly from the animal rectum, jugular vein and skin, respectively. The examination of gastrointestinal (GI) parasites and haemoparasites was carried out through qualitative and quantitative methods, and Giemsa-stained thin smear, respectively. Morphological identification of ectoparasites was carried out under the stereomicroscope. The overall prevalence of GI parasites, haemoparasites and ectoparasites in the small ruminant populat...

Ghulam Abbas1*, Muhammad Arshad1, Muhammad Saeed2*; Safdar Imran3, Ashgar Ali Kamboh4, Duraid KA Al-Taey5, Muhammad Asad Aslam1, Muhammad Saeed Imran6, Muhammad Ashraf3, Muhammad Asif7, Abdul Jabbar Tanveer8, Razia Abdul Majid Qureshi9, Maria Arshad1, Hussain Ahmed Khan Niazi1, Muhammad Tariq10, Sikandar Abbas1 

...equired to determine the direct effect of OA in multiple stages of poultry health and diseases of infectious nature to determine the appropriate amount of supplementation of OA.

Keywords | Organic acids, Gut health, Natural compounds, Poultry health, Layer production. 

...

Saima Mehar1 and Salma Javed2*

...nents employing bioassay-directed fractionation of both extracts. Concentration of the extract was directly proportional to the mortality of second stage juveniles, the resulted, six withanolides comprising coagulin E, G and J, withaperuvin C and triterpenoid, betulinic acid and the pure isolated bio active constituents also showed the 100% significance mortality with the constant concentration of 1 and 0.5 mg/lagainst the M...
Aiman Al-Mufarji1, Abd El-Nasser Ahmed Mohammed1*, Haitham Al-Masruri2, Rashid Al-Zeidi3
Basel A. Abokhadra, Samah M. Mosad, Sahar Abd El Rahman*
...peared at 3rd passage. Indirect immunofluorescent technique (IFT) was used for confirmation of BoHV-1 presence in CAM; the CAM with clear pock lesions showed yellowish-green fluorescence under the fluorescent microscope. The phylogenetic tree constructed from partial sequencing of gB of our isolate was divided into two clades; clade 1 BoHV-1 (BoHV-1.1 and BoHV-1.2) clade 2 (BoHV-5). Our isolate showed 100% homology to BoHV-1.1 reference strains away from BoHV-...
Makhamadi Abramatov1*, Abdurakhim Kuchboev2, Bakhtiyor Ruziev3 and Khumoyun Sobirov2
...ichostrongylus and Nematodirus predominated the gastrointestinal fauna of ruminants in terms of species composition, P. skrjabini, M. marshalli and O. ostertagi were dominant in terms of the intensity of infection.

...

Abdul Ghaffar*, Niaz Hussain, Muhammad Nadeem, Khalid Hussain, Muhammad Aslam, Mudassar Khaliq, Muhammad Irshad, Zubeda Parveen and Muhammad Younas

...ts expressed the highest direct positive effect (0.872) grain yield followed by the pods per plant (0.623). Analysis of correlation coefficient also confirmed the highest significant contribution of secondary branches per plant (91.57%) followed by pods (78.12%) and each plant’s primary branches (64%). It was proved from the current experiment that Plants with secondary branches as well as pods may be focused on while assessing meaningful selection crite...

Muhammad Jamil1*, Kamran Javed1 and Imran Akhtar2

...s a major pitfall in man directed evolution faced by cotton crop in Pakistan during recent years. Present study was carried out at Cotton Research Station, Vehari during 2019-20. The main purpose was to explore the genetic diversity in the strains under study. Principal component analysis, along with agglomerative hierarchical clustering tools were employed. Twenty-four recently bred upland cotton strains bearing diversified origin were configured in triplicat...

Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*

... aimed to establish an indirect enzyme-linked immunosorbent assay (ELISA) method based on the SAG2 gene of Toxoplasma gondii (T. gondii) to improve the detection of toxoplasmosis in pet cats. Escherichia coli BL21 (DE3) was transformed with a prokaryotic expression vector, pET-21a-SAG2, which was constructed and induced to express a recombinant protein (SAG2), identified using SDS-PAGE and Western blot analysis. The purified protein was then used as a coating ...

Shambel Boki Dabi

...ved oxygen were measured directly on site. A simple test kit was used to evaluate nitrite and ammonia levels. The result revealed a high level of alkalinity (66.3±39. 1mg. L-1) at downstream and lowest concentration (58±40mg.L-1) was found in the middle stream. The upper stream has a high CO2 concentration (14±3.6mg.L-1) while the middle stream has a low CO2 concentration (9.4±0.77mg.L-1). The maximum chloride content (28.7±2...
Fei Wang1, Xiaofen Hu1, Feng Wen2, Xiaoen Tang3, Shanshan Yang1, Shengwei Zhong1, Zuohong Zhou1, Xu Yuan1 and Yong Li1,*
...ity and hydrophilicity indirectly account for its extensive distribution and various functions as expected.

...

Ehab A. Fouad1*, Khaled A. Abd El-Razik2 , Eman H. Abdel-Rahman3

...ureus mastitis through indirect Enzyme Linked Immunosorbent Assay (ELISA). For purification of fraction, bacterial fresh cultures were centrifuged at 3000 rpm / 20 min and were homogenate in phosphate buffer saline and centrifuged at 15000 rpm / 20 min that known as the crude antigen. It entered to affinity column chromatography [Cyanogen Bromide-Sepharose 4B (CNBr-Sepharose 4B)] (Sigma Chemical Co.), obtain the fraction. In brief, IgG of cows S. aureus positi...

Muhammad Haris Raza Farhan1*, Qamar Iqbal1, Tariq Jamil1, Muhammad Fayaz2, Abdul Kabir2,3, Eid Nawaz2, Marjan Ali2, Shumaila Manzoor2 

...agement of animals has a direct effect on the health status of the herd. The unavailability of important nutrients can affect the immune system of the animals increasing their susceptibility to different infections including parasitic infestation. A referral clinical examination was carried out on a small ruminant farm with a mixed population of sheep and goats. History taken from the farm owner revealed the mortality of 8 animals within the duration of 14 day...
Idrissa Sacko1, Madou Dao1, Souleymane Sanogo1,2*, B. Michel Orounladji2, Kaly Diakité1, Diakaridia Traore3, Mamadou D. Coulibaly1, Amadou B. Cisse1
...s (spz) were measured by direct reading and electronic microscopy with a direct image transfer system on screen, respectively. Sperm concentration and total sperm count in ejaculate were determined by microscopy using single chamber Neubauer cell. Results show that ejaculate volume was influenced (p < 0.05) by individual (buck). Besides, individual and period of collection had no impact (p > 0.05) on mass motility. How...
Zahra Naz1,2, Fouzia Ismat1, Muhammad Saleem2, Mazhar Iqbal1, Aamir Shehzad1 and Moazur Rahman1,2*
...diagnostic antigen, an indirect enzyme-linked immunosorbent assay (ELISA) has been developed for the detection of anti-NDV antibodies in multiple serum samples collected from different poultry farms of district Faisalabad, Pakistan. The data presented here reveal that the recombinant detergent-solubilized M protein is an active, promising diagnostic antigen and can be exploited in an indirect ELISA for rapid and reliable det...

Muhammad Rizwan, Abu Bakar Muhammad Raza*, Muhammad Zeeshan Majeed and Muhammad Arshad

...eaf extracts of neem, Azadirachta indica A. Juss (Meliaceae), eucalyptus Eucalyptus camaldulensis Dehnh. (Myrtaceae), datura Datura stramonium L. (Solanaceae), batho Chenopodium album L. (Amaranthaceae) and Indian lemongrass Cymbopogon citratus (DC.) Stapf (Poaceae) were tested against 3rd instar nymphs of mealybug. Results showed that mean mortality was higher (76.67%) after the application of A. indica extract, followed by E. camaldulensis (66.67%) at 72 h p...

Shahbaz Ahmed1, Mubeen Ahmad1, Muhammad Razaq1* and Farhan Mahmood Shah1,2*

...ts of wheat crop causing direct or indirect injury to the crop. The pest is routinely managed through use of insecticides. Insecticides due to their toxic effects are mostly not desired for use on food crops. Thus, alternative approaches such as biological and cultural control are more desirable. This research explores irrigation stress impacts on wheat aphids, predators, and yield characteristics under field conditions. The...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...uggests that there is no direct impact of organic acids on weight gain and FCR of the birds statistically.

...

Sarzamin Khan1, Abdul Jabbar Tanweer2, Rafiullah1, Ibrahimullah1, Ghulam Abbas3*, Jabbar Khan4, Muhammad Saeed Imran5, Asghar Ali Kamboh6 

...gredients has driven the dire need to search for alternative protein and energy sources to be incorporated in poultry feed. Insects may be one of the alternative feed source which can be used as a good quality, low-cost and sustainable ingredients of poultry feed. Therefore, the present experiment was designed to explore the effect of dietary inclusion of mealworm (Tenebrio molitor) scales in diet on production performance, carcass quality and histomorphology ...

Ghalib Ayaz Kachelo1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Shahbaz Talib Sahi1, Nasir Ahmad Khan1, Akhtar Hameed2, Noor Muhammad1 and Muhammad Saqib Mushtaq1

...ivum) (28.087), neem (Azadirachta indica) (29.010) and aloevera (Aloe barbadensis miller) (29.538) mm as compared to control plates, while in chemicals Tilt showed minimum fungal growth (7.982) followed by Score (10.865), Antracol (11.395), Radomil Gold (11.965) and Blue Copper (14.390) mm as compared to control. In the greenhouse, the most effective fungicide and plant extract were applied as tilt and moringa alone and their combination. The plants treated wi...

Hassan Raza1, Muhammad Zeeshan Majeed1*, Muhammad Irfan Majeed2, Mujeeb-Ur-Rehman1 and Muhammad Asam Riaz1

...armers rely primarily on direct applications of liquid insecticides which usually get off the target site resulting in unsatisfactory and short-term termite eradication along with environmental contaminations. This situation necessitates looking for more target-oriented and ecologically safer strategies such as baiting insecticides with some cellulose attractant. In this study, 5% technical grade fipronil was formulated as small beads (3.5 mm) made by a matrix...

Shomaila Sikandar1*, Imran Afzal1 and Sadaf Sarfraz2

...er the food chain either directly or indirectly by contaminating food and feed crops. They can cause infection before and after agricultural crop harvesting. Economically mycotoxins infection leads to loss of feedstock, reduced livestock production, human and animal life threatening diseases and major issues leading to global food security. All these factors demand for extensive research for early mycotoxins detection method...

Dong-Min Hou and Ding-Qi Rao*

...ent shapes and sizes can directly or indirectly affect organisms and pose health risks to animals and humans. Therefore, the size and types of microplastics and their effects on different organs of different types of animals were reviewed in this paper. However, we found that the health risks posed by microplastics to amphibians and reptiles remain unknown. Then, we reviewed the effects of microplastics on amphibians and rep...

Arshad Mahmood Malik1*, Nigah Hussain1 and Nasim Akhter2

...d farming experience has direct relationship with agriculture labour supply. It is therefore suggested that government may focus on fixing minimum ceiling limit on ancestral land transfer and more emphasis will be given on capacity building of farmers for improving agriculture labor supply in rural agriculture labor market.

...
Muhammad Younas1*, Khalid Hussain1, Abdul Ghaffar1, Muhammad Atiq2, Niaz Hussain1, Wasim Abbas3, Muhammad Azeem Khan4, Muhammad Nadeem1, Muhammad Irshad1, Nasir Ahmad Khan2 and Muhammad Zubair5
...ts, Chlorostrobin and Azadirachta indica extract expressed significant reduction in disease severity. It was concluded that out of 50, only eight accessions were resistant which might be grown successfully for higher crop production. Moreover, use of Chlostrobin and extract of Azadirachta  indica may be used for disease management.

...

Reem M. Ramadan1, Fady Sayed Youssef2, Gehad Genidy Mohamed3, Sameh Hamed Ismail4, M.M. El-Bahy1, Shimaa Abdel-Radi1* 

...porulation inhibition is directly related to the increase in C-Oo.Nc concentrations and exposure time. Analyzing the DNA damage in the oocysts exposed to different concentrations using comet assay revealed a significant direct variation (p ≤ .05) between the increase in the dose and the degree of the DNA genotoxic damage as represented by variations in the tail length (μm), percent of DNA in the tail segment, and tail ...

Sidrah Ashfaq1, Muhammad Nadeem1*, Muhammad Yamin1, Talha Afzal1, Muhammad Waqar Akram1, Rabia Anam1 and Ali Mehboob2

...processes in contrast to direct combustion of agricultural waste. Other than controlled burning of biomass, it can be subjected for different purposes like a thermal, synthesis of ethanol, engine running, and for fuel cell applications. An excessive amount of impurities like char, ash, tar, and particulate matter are making these syngas non-feasible for thermal or engine applications. To overcome the above-stated problem, a downdraft gasifier with cyclone sepa...
Ahmed H. Massoud1, Mohamed S. Ahmed2, Moustafa Saad-Allah1, Aly S. Derbalah1, Ashraf Albrakati3* and Ehab Kotb Elmahallawy4*
...ith little risk if label directions were followed, while some are extremely toxic and require special precautions. This study aimed to determine the patho-biochemical toxicity of short-term exposure to repeated low oral doses of malathion, metalaxyl and cymoxanil pesticides on male rats. Results of the present study demonstrated that low doses of malathion, metalaxyl and cymoxanil pesticides was asymptomatic and mostly showed insignificant histopathological ch...

Farheen Shaikh*, Saima Naz and Nadir Ali Birmani

...nic infestation to hosts directly. These parasitic insects are the source of various diseases, like flue, and also serve as a vector of some bacteria and helminthes parasites. Presently only one type of host, guinea fowl Numida meleagris (Linnaeus, 1758) was selected and examined for parasites examination, investigation, identification, population density, means and rate of infestation of from different urban and rural localities of Sindh, Pakistan. There were...

Othman E. Othman1*, Lingjiang Min2, Amira M. Nowier3  

...ed C in CG context is in directionally opposite with fertility trait where this level is lower in HFG than that in LFG. In contrast, the levels of methylated C in contexts CHG and CHH are higher in HFG than those in LFG groups. Despite this small difference in the methylation levels, there are many DMR and DMG were identified in the two groups. One-hundred and seventy fertility-related genes with different frequency in methylation levels were selected for func...

Kokab Nazim1*, Asghari Bano1 and Ghulam Jellani2

...notypes because it shows direct effect of stress on cellular membranes. It is recommended that this method can be employed to shortlist genotypes on cost effective basis.

...

Yêyinou Laura Estelle Loko1*, Joelle Toffa1, Azize Orobiyi1, Gbèblonoudo Anicet Dassou2, Rolande Okpeicha1, Dieudonné Gavoedo1 and Alexandre Dansi2

...ckness showed the higher direct positive effect on soybean susceptibility to C. maculatus indicating that breeding should be done based on this trait to improve soybean seed resistance.

...

Ghulam Qadar* and Khalid Nawab

...ependents on agriculture directly or indirectly. The government of AJandK has started agricultural education program for the students at the school level. The current study was carried out to examine and evaluate agriculture teachers’ competencies levels that are teaching agriculture subject at school level in different parts of the state. For this purpose, 250 agriculture teachers were selected from ten districts of A...

Abdul Latif1, Shahid Sattar1, Fazal Maula2, Imtiaz Khan4*, Asim Iqbal3 and Said Hussain Shah1*

...anicals insecticides (Azadirachta indica, Persicaria hydropiper, Eucalyptus globulus and control (tap water) were assigned in Randomized Complete Block (RCB) Design in three replications. Influence of treatments on mean percent infestation of V. isocrates revealed that lamda-cyhalothrin resulted in lowest mean infestation (3.74±0.36) followed by bifenthrin (3.95±0.32), indoaxarb (4.35±0.28), cypermethrin (4.55±0.28), A. indica (8.00...

Sajida Batool*, Sitara Shameem, Kainat Malik and Aneela Iram

...igate the effect of feed directly exposed to microwaves or in different containers on the histology of the liver and kidney of mice. Forty adult male mice were randomly divided into four groups each of 10: Control group was given normal untreated feed, Direct group was fed on food pellets exposed to microwaves in oven tray directly, Glass group was given feed processed in the microwave ove...

Nurul Isnaini1*, Ervin Kusuma Dewi Reksadinata1, Faizal Andri1, Tri Harsi2, Ida Zahidah Irfan2 

...en quality was evaluated directly. The results showed that the bull age significantly affects semen volume, pH, sperm concentration, total sperm, total motile sperm, and frozen semen production of Aceh cattle (p < 0.05). However, it was found that there was no significant change in the sperm motility, before freezing, post-thawing, and during recovery across age (p > 0.05). Semen volume, total sperm, total motile sperm, and frozen semen production increa...

Hamenya Mpemba1, Fan Yang1, Kirsty J. MacLeod2,3, Dusu Wen1, Yan Liu1,4 and Guangshun Jiang1,*

...prey species via lethal (direct kill) or non-lethal effects (i.e., through predation risk). For example, prey species may move from areas perceived as risky to safer spaces where predation risk is lower, which can have important consequences for investment in foraging, movement, and mating, and for the behaviour and habitat use of other species, such as mesopredators. These changes in prey and mesopredator behaviours are likely mediated by the presence of pred...

Muhammad Tariq Navid1,2*, Mian Muhammad Awais2*, Muhammad Irfan Anwar2 and Masood Akhtar2

...ccination while they are directly connected with migratory carrier birds throughout their life. Keeping in view this study was design. Four Tehsils of district Multan were selected to investigate asymptomatic backyard poultry birds for presence of AIVs. For this purpose, a total of 213 birds were randomly selected and from each bird sera, oro-pharyngeal and cloacal swab samples were collected in sterile containers. About 13.61% of the samples were found seropo...

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

...the presence of MAP by indirect ELISA (iELISA), associated histopathological lesions and PCR in sheep (Ovis aries) and goats (Capra aegagru hircus) in district Peshawar. Serum and fecal samples were collected at random both from commercial farms and abattoirs. Additionally, tissue samples (intestine and mesenteric lymph node (MLN)) were collected at random from sheep and goats at abattoirs of district Peshawar. Analyses of serum samples by iELISA revealed the ...

Akbar Hayat1*, Ehsan Ul Haque1, Marayam Nasir2, Rab Nawaz3, Tariq Mahmood4 and Sohaib Afzaal1

...eir suitability both for direct consumption and value addition. The work spread over two years (2018and19) produced distinctive results for their commercial exploitation. The attributes in analytical work for fruit quality evaluation were fruit size, weight, peel thickness, peel percentage, juice percentage, rag percentage, total soluble solids (TSS), acidity, TSS/acid ratio, number of segments, and number of seeds, maturity period and degree of granularity. T...

Madad Ali1, Muhammad Ahsan1, Muhammad Zubair Akram*2 and Samreen Nazeer3

...ted the highest positive direct effect on grain yield per plant followed by total biomass (r = 1.993) and 100 grains weight (r = 1.194). Among the hybrids understudy, DH-8XDH-6 showed the best performance in Plant height (196.67 cm), Leaves per plant (14), total biomass per plant (440.91 g), cob length (18.169 cm), 1000 grain weight (40.47 g) and grain yield per plant (274.92 g), thus is recommended for further production and research.

...

Iqra Qazi1, Sohail Raza1*, Masood Rabbani1 and Muhammad Avais2

...ples were processed by indirect ELISA to detect antibodies against BoHV-1. The overall sero-prevalence was 68.40%. Post pubertal animals (>3yrs) contributing more to disease occurrence. High sero-positivity was observed in buffalo (73.12%) as compared to cattle (60%) moreover, the sero-prevalence is higher in animals of greater size herds. Parity status is in agreement of strong correlation with BoHV-1 infection. Evidently, positivity rate was higher in ani...

Inam Ul Haq1*, Humara Umar1, Farah Umar2, Naeem Akhtar3 and Muhammad Jan4

...thy saplings, there is a dire need to optimize the protocols for nursery production. In order to attain success in this sector, investigation was carried out to improve the rooting ability of a widely grown olive cv. “Arbequina”. This research aimed to enhance the rooting ability of semi-hardwood cuttings through application of different separate and combined concentrations of indole butyric acid (IBA), urea phosphate (UP) and paclobutrazol (PB). T...

Neni Widaningsih1,2*, Budi Hartono2, Hari Dwi Utami2, Eni Siti Rohaeni3 

...ing channels, namely: 1) direct marketing funnel patterns, 2) one-level marketing funnel pattern, 3) two-tiered hardening funnel pattern, and 4) three-tier marketing funnel pattern. One-level marketing patterns have the highest value of marketing efficiency (Eps= 3.19) compared to two-tier marketing patterns (Eps=7.37) and three-level marketing patterns (Eps= 8.97). The marketing intermediary institutions that get the highest profit share are large traders.

Nosheen Jehajo*, Nasreen Memon, Mansoor Ali Shah and Naheed Shah

...ecticidal efficacy of Azadirachta indica (A. Juss) (neem) and Ricinus cummunis (L.) (castor) seeds oil that effect the various biological parameters of C. maculatus fed on Vigna radiata (mung beans) including mortality, oviposition, and adult emergence using three replication for each treatment. Four concentrations viz; (0.25, 0.50, 0.75 and 1%) each of the oil were prepared to observe the contact toxicity and surface protectant effect. Results showed that as ...

Hafiz Ghulam Muhu-Din Ahmed1*, Aziz Ullah2, Muhammad Asim Bhutta3, Ammara Yasmeen4, Hafeez ur Rehman5 and Umar Farooq5

...luence on yield and have direct or indirect impact on the wheat milling and baking quality. Association of yield and physical traits of grain in 33 spring wheat genotypes were examined under field experimental conditions during the wheat crop season of 2020-21. The experiment was set up in a three-replications through randomized complete block design (RCBD). Analysis of variances revealed that all the studied parameters, lik...

Agha Mushtaque Ahmed1*, Fahad Nazir Khoso1, Ali Zachi Abdulqader Alhilfi2, Sohail Ahmed Otho1, Qurban Ali3, Din Muhammad Soomro1 and Zubair Ahmed Soomro1

...including neem seeds (Azadirachta indica A. Juss), rocket seeds (Erucas sativa Mill.), cotton seeds (Gossypium hirsutum L.) and mustard seeds (Brassica nigra L.). The effect of these oils was recorded on insect mortality, number of adult insects, seed damage (punctured seeds and weight loss of chickpea seeds), seed germination percentage, root length (cm) and seed vigour index. The insect mortality was recorded at different intervals such as 24, 48, 72 hrs and...

Sara Magdy Hashim1, Elshaimaa Ismael2, Mohamed Tarek3, Faten Fathy Mohammed1*, Fatma Amer Abdel Reheem3, Rawhia Esawy Doghaim1 

...f viral antigen revealed direct relation between viral residence in tissue and developed pathology. The present study confirmed that H5N8 HPAI clade 2.3.4.4b, became a predominant strain during the period 2018-2020, causing severe outbreaks in duck farms in Egypt.

Keywords | Avian influenza, HPAI, H5N8, Ducks, Pathology, Egypt. 

...

Shama Sadaf1*, Komal Hassan1, Ayesha Saeed1 and Zeeshan Ahmad2 

...racted from leaves of Azadirachata indica, Butea monosperma and Litchi chinensis plants and applied on 100% cotton. Before and after applying antimicrobial finish mechanical property was checked. The antimicrobial finish was applied by pad dry cure method and finish was fixed by using of poly urethane binder. The presence of microorganisms was checked by ASTEM E2149 shake flask method before and after applying antimicrobial finish and after successive 25 washe...

Hashem Saeed Murad1*, Salah Jassem Amin2, Rawa’a Muhammad Al-Chalabi3, Mahmood Khalaf Wasmi4 and Sundus Salim5

Maha Mostafa1, Sohail Soliman1, Reham I. Mohamed2 and Wael M. El-Sayed1*

...hatase activity. It also directly reduced the concentration of free testosterone and estradiol in both sexes without any apparent effect on LH or FSH hormones. It increased the total cholesterol in males only and elevated the triacylglycerols and glucose levels in both sexes. The administration of testosterone to males, females, or both reduced the fertility index to zero. The mating success was also reduced from 80 to zero when both the males and females were...

Asim Zubair1*, Zohaib Atta Mehdie2, Iffat Batool3, Ghulam Akbar Malik4 and Ayesha Aziz5

.... Changing in climate is directly affecting the livelihoods of Agricultural communities in Pakistan. It has also become the reason of rising temperature and lot of other problems in agriculture sector like food production, quality, and quantity of food is decreasing. Rising temperature effecting yields a lot in sense of production. The worst and biggest effect of climate change is flood. Around 3.4 million hector area of agriculture damaged by flood during 201...

Faisal Khurshid1*, Asad Ullah1 and Sana Manan2

...tion/information enabled direct interaction with agriculture experts in getting required knowledge about innovates (P=0.006). It is concluded from the study that access to information communication technology facilitated its adopters in timely awareness of market information and government subsidies to boost their motivational level and let them persuade a favourable attitude towards agricultural innovations. Awareness raising among farmers for efficient use o...

Adrial Adrial1*, Rudy Priyanto2, Salundik Salundik2, Ahmad Yani2, Luki Abdullah3 

...ta were obtained through direct interviews and recording cards. Soil and forage samples were taken from the main forage source locations. A total of 138 blood samples were taken through the jugular vein from Bali cows and their crossbred cows with different physiological status. Soil and blood serum samples were analyzed in laboratory using Atomic Absorption Spectrophotometry (AAS) method, while forage samples were analyzed according to the Association of Offi...
Huma Abbas1*, Nazir Javed1, Muhammad Kamran2, Sajid Aleem Khan1, Abdul Jabbar1, Akhtar Hameed1, Hira Abbas3, Azhar Iqbal2 and Ehetisham-ul-Haq2
... impact of bio (Cure, Azadirachtin) and synthetic (Cartap, Virtako) chemicals individually and concomitantly with fertilizers on the development of root knot nematode, Meloidogyne incognita and the growth of tomato (Solanum lycopersicum) plants. Tomato seedlings were transplanted in sterilized soil amended with Cartap, Virtako, Cure and Azadirachtin at their recommended doses and inoculated with 500 freshly hatched juveniles...

Shafia Riaz1, Khalid Abbas1*, Tanveer Ahmed1,2*, Huma Naz3, Hina Amjad1 and Shahbaz Ahmad1

...SD), Bhalwal (BHL) and Qadirabad (QBD) assumed as five distinct genotypes were compared for genetic variability in relation to growth performance. Appraisal fish fingerlings were reared in glass aquaria (twenty fish per population) for 60 days under similar environmental conditions. Condition factor (K) and growth parameters (wet weight, fork and total length) were measured fortnightly. The morphometric data were analyzed using SPSS. Genetics characterization ...

S. Feroza1, A. G. Arijo1† and I. R. Zahid2

...ica papaya) and neem (Azadirachta indica) plant seeds on Ascaridia galli infectivity in broiler chicken. A total of eighteen broiler birds were randomly selected that were divided into three groups (A, B and C) with 6 birds in each group. The birds were then artificially infected with Ascaridia galli @ 2000 eggs/bird. Ethanolic extracts of papaya and neem were applied to Group B and C, respectively while Group A was left untreated that served as...

Mutala’liah, S. Indarti † and N. S. Putra

...Malangsari, Getas and Candiroto feilds. Samples of soil and roots were collected and various parameters of soil
abiotic factors (pH, soil moisture, soil temperature, soil texture and organic matter) were obtained from each of the
three fields. Vertical distribution was assessed using two soil sample depths (30 cm and 50 cm). This research
showed that the highest population abundance of Pratylenchus sp. both from soil and roo...

A. Khan†, S.S. Shaukat1, K.A. Khanzada and M.S. Khan2

...arcane bagasse, neem (Azadirachta indica) leaf powder and
marigold (Tagetes erecta) flower powder used alone and in combination with Fertinemakil. Untreated pots were
kept as control. Carbofuran a chemical nematicide was used for comparison. Subsequently after 8 weeks nematode
populations were studied. The results showed that amendments significantly influenced the nematode population

F. Shahina†, K.A. Tabassum and M.A. Habib*

... EPN species. There is a dire need
to focus further research on these EPN isolates to explore and exploit their potential as an alternative to synthetic
pesticides in Pakistan, especially in IPM programmes.
...

A. Tülek, S.S. Ates, K. Akin, H. Surek, R. Kaya and İ. Kepenekci*†

...lilbey, Gala, Tunca and Edirne)
as a sub-plots were evaluated. In nematode-contaminated plots where it was seen that decreases of yield and weight
of 1000 seeds found statistically important at the level 0.01 (P < 0.01). Compared to the control treatment, in
naturally infected treatment cultivars Halilbey, Edirne, Gala and Tunca exhibited 26.7%, 15.8%, 15.6% and 8.1%
yield d...

Aiman Amur1*, Nasreen Memon1, Khalida Unar2 and Roshan Jamali3

... the factors of ecology, directly are indirectly impact on the progress physically and reproductively enhance the growth of Bactrocera dorsalis. These ecological correlations play key role in development of pest.

...

Nuzhat Munawar1, Abrar Hussain1, Imran Sajid2, Zahra Noreen1, Muhammad Aslam3*, Zeeshan Rehman1 and Aamir Ali3,4

...text-align: justify;">Azadirachta indica A Juss. (Neem) is a very valuable therapeutic plant being used as herbal medicine to cure various diseases due to the variety of biologically active compounds present in it. Neem leaves of the plant were collected, dried, powdered, and extracted by using ethyl acetate, chloroform, and acetone as solvents. Qualitative phytochemical analysis showed the presence of active compounds. The antibacterial potential of various p...

Malik Muhammad Yousaf1, Wali Muhammad1, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahamad1, Annum Sattar2, Hera Gull3, Sonia Sumreen4, Malik Waqar Yousaf5, Nazakat Nawaz6 and Nazim Hussain7

...f superior germplasm may direct the quick heritable improvement of the material.

...

Malik Muhammad Yousaf1, Wali Muhammad1, Muhammad Mohsin Raza1*, Mumtaz Hussain1, Muhammad Jahangir Shah1, Bashir Ahamad1, Annum Sattar2, Hera Gull3, Sonia Sumreen4, Malik Waqar Yousaf5, Nazakat Nawaz6 and Nazim Hussain7

...f superior germplasm may direct the quick heritable improvement of the material.

...

Zarema Alimsultanova Magomedova1, Kheda Khalitovna Dadaeva1, Roza Said-Akhmedovna Zakhkieva1, Islam Khasanovich Shakhbiev1*, Boris Kazievich Laipanov2 

...todes of the genus Nematodirus Ransom, 1907. In the lowland zone of the Chechen Republic, 37.50% of soil samples, 23.00% of water samples were contaminated with invasive elements, respectively, in the foothill zone, 41.00% and 26.50% of samples, in the mountainous zone - 29.00% and 15 .00% of soil and water samples. In all climatic zones, on average, 27.83% of soil and water samples were contaminated with eggs of nematodes of the genus Nemato

M.M. Mikailov1*, O. Yu. Chernykh2, E.A. Yanikova1, G.A. Nurlygayanova3, O.D. Sklyarov4 

...nostic efficacy of the indirect hemagglutination reaction (RNGA) was studied in comparison with the enzyme-linked immunosorbent assay (ELISA), agglutination reaction (RA), complement fixation reaction (CSC), rose-bengal test (RBP) and immunodiffusion reaction with O-PS antigen (RID with O -PS antigen). The specificity of these serological tests was confirmed by the negative results of studies of 40 blood serum samples from animals from a safe farm not vaccinat...

Muhammad Afzal1,3*, Shafqat Saeed1, Hasan Riaz1, Muhammad Ishtiaq1, M. Habib ur Rahman2

...ly cryptic species cause direct damage to the crops by feeding and indirectly by transmission of plant viruses that reduce the crop yield and quality. Cotton leaf curl virus (CLCuV) management is difficult due to multiple virulent strains and higher recombination rate that is a serious threat to the cotton crop of the last two decades in Pakistan. Alternate host plants belonged to vegetables, weeds, and mixed farming practic...

Saima Akter1, Md. Rasel Prank1, Shariful Islam1, Sharmin Akter1, Injamamul Hasnine1, Murshed Uddin Ahmed2, Md. Shohel Al Faruk3* 

...d and examined through a direct smear to detect the presence of the egg and oocyst of parasites. The overall prevalence of cattle parasitic infestation (mixed and single) was 80.17% (N=97/121). The overall prevalence of trematode was 49.58%, nematode was 57.86%, and protozoa was 9.1%. The infestation rate of the Strongylys group (45.4%) was dominant followed by Fasciola gigantica (24.79%), Paramphistomum spp. (24.79%), Neoascaris spp. (12.4%) and Eimeria (9.09...

Hidayat Ullah1, Sadia Tabassum1, Sultan Ayaz2, Shumaila Noreen1, Atta Ur Rehman1, Naveed Akhtar3, Muhsin Ali3, Zaib Ullah3* and Sajid Mahmood1,4

...d infestation rate shows direct correlation with temperature but it shows fluctuation with humidity. Current study will be helpful in tick’s controlling strategies, goats and sheep breed selection and future research in this area.

...

Rehman Shabbir1, Ghulam Sarwar1, Noor us-Sabah1, Mukkaram Ali Tahir1, Muhammad Luqman*2, Muhammad Fahad Ullah3, Muhammad Zeeshan Manzoor1 and Imran Shahzad1

...strial state of Sargodha directly discharges its effluents that flow into a stream. This industrial wastewater was taken for this trial. The contaminants of the stream water were utilized for this trial to check its impacts on soil properties and growth of tomato plants. The physiochemical parameters of the soil such as pH, EC, organic matter, heavy metals and physiological parameters of the tomato plants were observed. Most of the soil parameters were proved ...

Alsi Dara Paryuni1, Soedarmanto Indarjulianto1, Tri Untari2, Sitarina Widyarini3*

...ngal infections by using direct Wood’s lamp examination and skin scrappings. Moreover, the identification of agents demonstrated that 58 (84%) and 11 (16%) of cats were infected by M. canis and T. mentagrophytes, respectively. Besides clinical signs, Wood’s lamp, and microscopic examination, the gold standard for M. canis idenification is Dermatophyte Test Medium. 
 
Keywords | Dermatophytosis, Cats, Zoonotic, M. c...

Saleem Hussain1, Muhammad Tayyab1, Tauqir Anwar1, Talha Nazir2*, Muhammad Zeeshan Majeed3, Zohaib Asad2,4, Muhammad Adnan3 and Tajwar Alam5

...ia azedarach L., neem Azadirachta indica A. Juss., tobacco Nicotiana tabacum L. and thorn apple Datura stramonium L.) against wheat aphid (Schizaphis graminum Rondani) under laboratory and field conditions. Using foliar spray method, toxicity bioassay was conducted with three different concentrations (i.e. 250, 500 and 1000 ppm) of methanolic plant extracts under controlled laboratory conditions, while three different concentrations (25, 50 and 75 g/L) of each...

Shabana Noureen1, Shirmeen Ijaz2, Saad Ullah3, Iqra Shafique Abbasi4 and Shakeel Ahmad5*

...ontent and communicating directly with the users in real-time. Currently, it has been used to communicate mental illnesses as well. To examine symptoms and major themes of social anxiety discussed on Twitter A qualitative research design was used in the current research. NCapture was used to randomly select 500 tweets of social anxiety published from 1st January 2022 to 30th June 2022. Nvivo was used to do a content analysis of tweets. The content analysis ref...

Muhammad Yaseen1, Muhammad Luqman1*, Sheer Abbas2, Usman Saleem1, Abdul-Gafar Ahmed3 and Muhammad Salman Aslam1

... of population connected direct or indirect to this sector. According to Davidson, humans for their improvement in quality life and economical purposes basically cause climate change. We can observe change in climate easily by increasing temperature and irregular pattern of rains. Agriculture and climate have strong relation with each other. So, the agriculture should develop continuously with ever growing population. Howeve...
 
 ASMAT MEHMOOD, ZAEEMA KHAN AND NAILA MALKANI* 
...Pakistan, and there is a dire need to address this problem. In addition, we recommend the development of an appropriate nationwide system of cancer registry. 
...

Ubaida Hussain1,2*, Amtul Jamil Sami1*, Shazia Rafique3*, Muhammad Idrees khan3 and Ahmad Ali Shahid3

...local medicinal plant Azadirachta indica (A. indica) extracts on expression of NS3 and NS5A nonstructural proteins of HCV 3a genotype. Owing to the fact that HCV patients can develop HCC, plant extract has also been tested for cytotoxic activity. Colorimetric analysis was done to determine the vitality of HepG 2 cells for 24 h after treatment with methanolic seed extract and minimum inhibitory concentration was calculated. HepG2 cell were transfected stably to...

Usman Ali1,2*, Basharat Ahmad1, Riaz Aziz Minhas1, Muhammad Kabir3, Muhammad Siddique Awan1, Liaqat Ali Khan1 and Muhammad Bashir Khan1

...20 to collect data using direct and indirect evidence. Maximum entropy (Maxent) models revealed an average AUC of 0.84 (+0.03) designating a high accuracy. Main predictors of HSM of black bear were elevation (34%), temperature (23%) and land cover (16%). This model predicted 1703 km2 as suitable habitat for black bear in Azad Jammu and Kashmir while 5802 km2 was not suitable for the species distribution. Most of the suitable...

Yang Hu, Jingxin Ding, Beilei Xu, Xiangming Sun, Guoyu Li, Hui Song, Zheng Zong and Wenlan Li*

...activity, and reveal its direct acting substances in the body, in this study, 30 female Wistar rats were orally administered with TGs, and serum fingerprints of blood samples collected at 10 different times were established by UPLC-Q-TOF-MS analysis. The estrogen-like activity of TGs was evaluated by determining the proliferation rate of Michigan Cancer Foundation-7 cells. The spectrum-effect relationship was analyzed by serum fingerprint of TGs to characteriz...

Anhar Ibrahim Elhanafy*, Amr Mohamed Mousa, Amaal Mohamed Kamal 

..., serum total bilirubin, direct bilirubin and in direct bilirubin, serum creatinine, urea content, serum total cholesterol, triglycerides, and low-density lipoprotein, and vice versa regarding the high-density lipoprotein concentration was observed, compared to control. Moreover, BV caused a decrement in malondialdehyde and nitric oxide levels whilst it enhanced GPx activity, SOD, IgG and IgM, compared to control. Furthermo...

Ahmad Jupri1*, Yuliana Vofi2, Faturrahman2, Immy Suci Rohyani1, Ernawati1, Bulkaini3, Djoko Kisworo3, Wardatul Jannah4 

...ring is not suitable for direct consumption by the community, so it needs to be boiled first to kill bacteria and minimize health problems. All samples, there were no coliform bacteria of the E. coli group. The bacteria in all samples were bacteria from other coliform groups. Therefore, further analysis is needed to determine the content of other bacteria in the water at the Joben spring, Pesanggrahan Montong Gading, East Lombok. 

...

Hala A. Amin1; A. Barakat2; A.A. Abou Zeid1

...noreagents. Hence, using directional cloning technology, a 38-KDa fusion protein containing a complete coat protein (CP) gene or Citrus tristeza virus (CTV) encoded by the expression vector plasmid (Pinpoint™ Xa3, Promega) with a fragment of biotin binding protein (BBP-rCTV-CP) was highly expressed and purified from E. coli cell culture. Antiserum obtained from rabbits after injection with the BBP-rCTV-CP fusion protein showed comparable reactivity in th...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
.... E. H. l. and M). The indirect-enzyme-linked immunosorbent assay (I-ELISA) detection Of SCMV strains showed the presence or five strains. i.e., SCMV-A. SCMV-B. SCMV-D, SrMV-H and SrMV-I. The electron microscopy of SCMV-E-infected sorghum plant cells proved the presence or the cytoplasmic inclusions characterized to the potyviruses. The virus was purified and an antiserum containing polyclonal antibodies specific to SCMVE strain was raised. Western blot immuno...

Seharish Munawar and Nuzhat Afsar*

...Phenomenon of imposex is directly connected with toxicity of tributyl (TBT) contamination and the source of this contamination is shipping traffic due to the use of TBT-based paints on ship hulls and the leaching of content into the water column. So, during the present study specimens of Tibia curta (Sowerby II, 1842), collected and investigated for the planned study from Gadani ship breaking yards (25.0361° N, 66.7136° E) which is the third largest sh...

Luqman1*, Zahid Hussain2, Tamana Bakht3, Fazli Wahab1, Miftah-ud-Din1, Haroon Khan2, Imran Shinwari1, Ata Ullah1, Liaqat Khan1 and Sara Hidayat

...ropping patterns (sowing directions) and weed control practices on onion crop. A two factorial RCBD experimental design was used for the experiment replicated three times. Factor A was termed as the cropping pattern (or sowing direction) with two levels (i.e. North-South and East-West), while the factor B included the treatments of Rumex crispus as mulch, Euphorbia helioscopia as mulch, wheat straw as mulch, a hand weeded tr...

Meng Wang, Dongliang Zhou, Huixia Li, Chunqin Wu,Yan Zhao and Houqiang Luo*

...f the bacterial cell, or directly to other cells. The bacterial secretion system plays an irreplaceable role in this process. Up to now, at least 11 kinds of secretion systems are involved in the pathogenesis role of bacteria, especially the formation of bacterial resistance. Therefore, the study of the bacterial secretion system is of great significance for antibiotic treatment of bacterial diseases. Most of the secretion systems identified so far are found i...

Syed Muhammad1*, Badar Naseem Siddiqui2, Farhat Ullah Khan1, Muhammad Adnan3, Sami Ullah3 and Nawab Khan4

Jaffar Hussain1*, Zeenat M. Ali1, Syed Farman Ali Shah1, Abdul Nasir Laghari2 and Munazza Sohail3

...e country. The 70 to 80% directly or indirectly Pakistani populations depend upon agriculture. Jatropha oil have density 909kg/m3,viscosity 25.63CST,flash point 250 oC and acid value was 1.20 mgKoH/g.

...

Lipigwe Lauya1*, Peace Nkiruka Okeke2, Chukwudi Chizorom Ibeh1, Bello Ozovehe Banimoh1 and Nanma Tongnan Cosmas1

Imtiaz Khan1*, Bashir Ahmad1, Ahmad ur Rahman Saljoqi1, Shah Alam Khan1, Javed Khan3 and Muhammad Azim Khan2

...sts which decrease yield directly and indirectly of sugarcane crop. For the safe management of P. perpusilla, field experiments were conducted to find the population of Pyrilla perpusilla on 12 different sugarcane varieties under field conditions at two different districts Charsadda and district Dera Ismail Khan of Khyber Pakhtunkhwa. Plot size 36×16 m (length × width) was selected in both localities for the cult...

Navjot Hothi 

...read of the disease is indirect transmission via vector movement, which peaks during the summer and monsoon months. Direct transmission of the virus is found to be effectively low. Appropriate precautionary measures need to be implemented now to curb the re-emergence of the disease. 

...

Achmad Firman1*, Sondi Kuswaryan1, Lilis Nurlina1, Muhamad Hasan Hadiana1, Marina Sulistyati1, Unang Yunasaf1, Dwi Cipto Budinuryanto2, Iman Trisman3

Yufang Liu1,2, Guiling Cao3, Yujing Xie3 and Mingxing Chu1*

...lly expressed genes were directly associated to the ovary development. According to the gene function analysis in KOG database, the known genes were clustered into 10 subdivisions in A group, 8 in E group and 9 in B group under three categories, mainly in posttranslational modification, protein turnover, chaperones, energy production and conversion, and transcription process. Pathway analysis in KEGG pathway database of the known genes revealed that the five p...

Antonius Agung Wiono1, Maria Elizabeth Nana Wijayanti1, Dhika Yonika Primacitra1, Trioso Purnawarman2, Andriyanto3, Aulia Andi Mustika3, Amaq Fadholly3* 

...turb the hormonal system directly affect livestock productivity. This research expected the effect of PhytoceeTM on mitigating the risk induced by heat stress and its productivity of broiler chicken.Materials and Methods:Broiler chicken were divided to six groups (normal control, negative control, heat stress treated vitamin C 200 g/ton and 400 g/ton, heat stress treated PhytoceeTM 200 g/ton and 400 g/ton). Its productivity was measured in different parameter...
Muhammad Rizwan1, Hamid Akbar1*, Aftab Ahmad Anjum1, Muhammad Arif Khan1, Aneela Zameer Durrani2, Muhammad Abid Hayat3, Anjum Masood4, Muhammad Talha Sajjad1 and Nadeem Raza2

Sumbul Zulfiqar and A.G. Rizwana*

...sence of these parasites directly affect fish reproduction and ultimately decline their populace. This research work was done to collect, observe and identify variety of nematodes (Philometrids) from female reproductive organs of marine edible fish Pomadasys maculatus (Bloch, 1793). Fishes were collected from Karachi coast, Kemari, further processed in parasitology lab, University of Karachi. Ovaries were inspected to observe presence of Philometra sp. and oth...
Tariq Ahmad1*, Anum Razzaq2*, Li Bo1, Faiz ur Rehman3, Gul Saba2, Omama Saqib1, Saif Ullah2 and Muhammad Suliman1

Amthal Ahmed Fouad1, Basem Mohamed Ahmed2, Momtaz Abdelhady Shahein1, Hussein Aly Hussein2* 

...mmune-chromatography and direct fluorescent antibody test (DFAT) were applied to detect RABV antigens in the brain of rabid dog. Relevant reads from the Ion S5 sequencing system were assembled into a draft genome. The draft genome was analyzed, re-assembled, and compared to representative RABV genomes from Africa and the Middle East region. Results: The complete genome of 5EG-QH19 strain extends for 11919 nt including the standard RABV protein genes in the cor...

Sumei Zeng and Yong Zhang*

...hnology has led to a new direction of innovative research in the field of animal husbandry. IOT technology has a variety of applications in the economic productivity of the livestock and poultry industry. The purpose of this study is to identify and rank IOT applications in dairy cattle industry productivity with a multi-criteria decision making approach and using the Complex Proportional Assessment (COPRAS) method. Evaluation indicators were selected by theme...

Nasir Ali1,2,6, Muhammad Ilyas2,3, Nazia Akbar1,2*, Gohar Rahman2, Shakirullah Khan4, Mujaddad Ur Rehman6, Abdul Samad5, Habib Ahmad1,2 and Bibi Nazia Murtaza7*

Fahad A. Al-Abbasi1*, Abdullah Samer Habib1, Vikas Kumar2 and Firoz Anwar1

...as. Five healthy workers directly involved with processing, handling from various departments without any prior disease were selected for blood profiling. Significant increase in S. aureus colonies were observed in fish samples compared to chicken in the month of September and October, 2017 and in fish and chicken meat from December, 2017 to June, 2018. In all samples TPC was more or less same for fish and chicken. E. coli was non traceable in any of the analy...
Muhammad Abdul Mannan1,2, Sharmin Chowdhury2, Md Abul Hashem3,4 and Md. Hazzaz Bin Kabir1,5*
.... contortus, followed by direct sequencing. Out of the 400 samples tested, 186 (46.5%) were positive for H. contortus. The parasite was found in 51.3% of sheep and 43.6% of goats. Through the sequencing analysis, 45 nad4 genotypes and 10 ITS-2 genotypes were discovered. The prevalence of Haemonchus contortus isolated was not influenced by demographic factors such as age, gender, breed, and seasons in the study. Our results highlight the state of our knowledge ...

Swagata Das Gupta1, Majharul Islam1, Towhida Kamal2,Md. Rayhan Faruque3,Md. Shohel Al Faruk4* 

...opic examination by direct wet smear and giemsa staining. The cankers were treated orally with metronidazole at a dose of 20 mg/kg body weight, and the farmer was also advised on the hygienic management of his farm. After careful treatment, all the clinically affected pigeons get cured within three days. 

...

Ahmed Jaafar Mousa*, Nothaila Rasheed Hamid 

...a cotton swab. Utilizing direct smear and polymerase chain reaction (PCR) techniques, 30 (30%) of the 100 collected samples were found to be positive. A DNA sequence of 372 bp length that partly encompassed the coding region of the ITS1-5.8s rRNA-ITS2 gene within ten samples (assigned 1-10) was amplified in this study. The PCR amplicons that were found in the amplified genetic region were directly sequenced. The detected var...

Muhammad Altaf1*, Arshad Javid2, Abdul Majid Khan3, Sadia Nazer4, Irfan5, Khalid Javed Iqbal6, Muhammad Sultan Haider7 and Sana Ashraf7

...inear count method viz., direct observation (personal count and record voices) and indirect observation (presences of carcasses, fecal pellets, pug marks and meeting with local communities). The habitat preferences of large, medium and small mammals varied significantly. A decrease in mammalian diversity was observed from forest habitat to urban landscapes. Indian wild boar, Asiatic jackal, Indian fox, jungle cat, Indian pan...

Tariq Jamil1, Muhammad Saqib2*, Abid Rashid3, Muhammad Hammad Hussain4, Khushal Khan Kasi5, Muhammad Haleem Tayyab2, Muhammad Azam Kakar5, Heinrich Neubauer1 and Mudassar Iqbal6*

...is. It is transmitted by direct contact or consumption of contaminated unpasteurized dairy milk. A total of 193 sera were collected from occupationally exposed participants in Quetta, Pakistan and analyzed by Rose Bengal Plate Test (RBPT). An overall 4/193 (2.1%, CI 0.6-5.2) seropositive were found. A higher seropositive rate was found in participants with >40 years age, livestock contact, poor socioeconomic group and no raw milk consumption. All variables ...

Jyotsana Shakkarpude1*, Aditya Mishra2, Deepika D. Caesar2, R.K. Sharma3, Anand Kumar Jain2, Sanju Mandal2, Rajesh Kumar Vandre4, Danveer S. Yadav5, Bhavna Ahirwar6 and C.P. Solanki6

...stpartum buffaloes which directly leads negative energy balance (NEBAL) and increases oxidative stress in animals. Betaine is a growth promoting nutritional additive used in livestock. Betaine contains three methyl groups and thus acts as a methyl donor for metabolic reactions. Betaine acts as molecular chaperone, as it repairs heat shock proteins. The present study was aimed to investigate the effect of dietary betaine on heat and metabolic stress during lact...

Rini Widyastuti1*, Rangga Setiawan1, Nurcholidah Solihati1, Siti Darodjah1, Kundrat Hidajat1, Mochamad Ali Mauludin2, Alkaustariyah Lubis3, Mas Rizky Anggun Adipurna Syamsunarno4, Sigit Prastowo5, Takdir Saili6, Arief Boediono7

...nnaires, interviews, and direct observation of the farms. The majority of members of Simpay Tampomas Farmers Group were males aged 41-59 years, who graduated from elementary school and had more than 10 years of experience in dairy goat farming. Furthermore, 75% of them had adequate literacy about the signs of heat, length of pregnancy, signs of delivery, and weaning of lamb. The results showed that less than 50% of farmers lacked awareness about the length of ...

Anshara Javed Qureshi and Ishrat Aziz*

...ed qualitatively through direct microscopy and floatation method. In this study, 18 (11 males and 7 females) out of the 100 samples (with a prevalence 18%) were found infected with Capillaria spp. of nematodes. The qualitative examination also revealed that the Capillaria spp. of nematodes was more prevalent in males (36.67%) than females (10%). This study will be helpful in raising awareness among pigeon owners for better control and treatment strategies for ...

Ehtesham Khan, Talha Ahmed, M. Irfan Anis* and Syed Ahsan Rehman

...ture in the form of mist directly to the roots. This type of farming uses the micro elements from the nutrient solution in the form of mist in a more efficient way than from soil. In this paper a goal of an automated aeroponics farming is advances in which focus is on eliminating present agricultural problems of Pakistan like water shortage, pest or insects, flood etc. The system is used to cultivate high quality crops while gathering continuous data and use t...

Abdul Kabir1*, Anees Ur Rahman2, Inzamam Ali Shah2, Ibad ur Rahman2 

...x is transmitted through direct contact with infected animals or their secretions, or through fomites. The disease poses a serious threat to the livestock industry and public health, especially in the absence of smallpox vaccination. This review summarizes the current knowledge on the epidemiology, transmission dynamics, clinical features, diagnosis, prevention, and control of buffalopox, with emphasis on the interplay between buffaloes, humans, and vectors. T...

Shudong Liu1,2, Shuai Wang1,2, Haoran Cui1 and Genyuan Chen1,2*

...erino sheep (ACMS) has a direct impact on the economic value of fine wool. It is generally considered to be caused by both genetic and environmental factors. We aimed to identify single nucleotide polymorphisms (SNPs) and genomic regions that are associated with ACMS in the Chinese Merino sheep population. To identify the genetic risk factors of alopecia in Chinese Merino sheep population, we carried out a genome-wide association study (GWAS). The 60 Chinese M...

Adeel Kazam1, Safdar Sidra2, Zulfiqar Ali1*, Rida Ahmad1,3, Ahmad Bilal1 and Aliza Batool1,3

.... Data were collected by direct (point count) as well as indirect method (interviews) from December 2020 to May 2021. In total, 139 avian species of 27,450 individuals were recorded at study sites. Results revealed that the species richness was maximum at Uchalli (133), followed by Khabbaki (92), Jahlar (88), and Ahmedabad lake (79). The Shannon Weiner index and Simpson index values for Jahlar lake, Uchalli lake, Khabbaki la...

Muhammad Ali Raza1*, Aneela Zameer Durrani2, Muhammad Muddassir Ali3, Tariq Usman4, Bilques Bano5, Nazia Rubab6, Syed Tasadak Mehdi7, Muhammad Wasim Iqbal8, Kumayl Hassan Akhtar9, Hira Hameed10

... activity of seeds of Azadirachta indica and other synthetic drugs comparatively compare and to justify the said seed consumption as an anthelmintic by the customary therapists of animals in South-Asia. Crude aqueous extract (CAE) from seeds of A. indica at the dosage of 2 g/kg of body weight,  levamisole HCL at the dose rate of 7.5 mg/kg and 3.0% oxyclozanide BP (vet), 1.5 levamisole hydrochloride BP (vet) and 0.382% cobalt sulphate in combination were a...

Zhimin Wu1,2, Yaping Yang1, Arshad Zahoor1, Aftab Shaukat1 and Ganzhen Deng1,2*

...es for the sensitive and direct perception to the abnormal changes. Due to few of relevant reports about different measurement methods and indexes, the simple radiographic findings are difficult to be used in accurate clinical evaluation. This test aimed to develop a radiographic method of comparing canine posterior lung field angles include vertebrophrenic angle (cranial), vertebrophrenic angle (caudal), sterno-diaphragmatic angle, costophrenic angle (left), ...

Milena Vlahovic*, Dragana Matic, Marija Mrdakovic, Larisa Ilijin, Anja Grcic, Aleksandra Filipovic, Jelica Lazarevic and Vesna Peric-Mataruga

...tments. PMM is also an indirect indicator of food consumption and was found to be significantly reduced compared to control in both acute effects and chronic treatment at 30 μg and its three-day recovery. The PMM reduction during acute treatments is a consequence of cadmium action, while in chronic treatment, the genetic factor (egg mass) plays a crucial role in the change of PMM. According to the index of plasticity, distinct phenotypes were not produced. ...

Rahmat Elahi1, Gulnaz Parveen1*, Nazara1, Faryal Ali2, Nain Tara3 and Saba Iqbal1

...ngi. This is a promising direction for future research and application in agricultural practices to ensure the seed safety.

...

 Shawki, Khaled K.; Carter, M.J.; Alnashar, Nariman M., El-Farrashl, Mohamed A. and Taher, Sahar

...es by producing antisera directed predominantly at the most conserved S-domain of Norovirus capsid.

...

Ibrahim l , Madiha Salah and Ikuta 2, Kazuyoshi

...ally useful tool for the direct and rapid detection of H5N1 in clinical specimens due to its high specificity. Additionally, an advantage over the other kit is specifically reacting with viruses of avian origin but not human or even swine origin, thus proving worthy for discriminating influenza A infections.

...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...vaccinated animals. An indirect ELISA was established, for detection of the antibody response to FMDV NSP 3ABC using commercial ELISA kit (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330) from Kafr ElSheikh Governorates during 2009 from cattle and buffaloes. The higher percentage of positive was detected in Sharkia (31.7%) while Kafr Elsheikh was (27.3%). The positive result of detection of antibodies against non structured protei...

El-Bramawyl , M . A. S. A. and El-Beshehy2, E. K. F.'

...has a good potencial for direct use in commercial faba bean breeding or for transfer to other faba bean genotypes.

...

Soliman*, Ahmed M.; Mahmoud**, Sabry Y. M. and Dawood*, Rehab A.

...us study and tested by indirect-enzyme linked immunosorbent assay (I-ELISA), transmitted to Chenopodium amaranticolor and then confirmed by immunosorbent electron microscopy (ISEM) for the presence of OYDV. PCR primers were used to ampli$' about 1.1 Kb fragment from the viral genome using RT-PCR from infected garlic plants, such fragnent were not obtained from healthylooking plants and/or virus-free seedlings of shoot-tips. The amplified products of OYDV was c...

El-Dougdougi, Kh. A.; Dawoud2, Rehab A.; Rezk2, A.A. and Sofy3, A.R.*

Nasr-Eldin1 , M. A.; El-Dougdoug2, K. A.; Othman2, B. Ahmedi , Sabah A, and Abdcl-Azizl , S. Il.

...s. In the present study, direct tissue-printing and dot-blot on the membranes, procedures has been applied on a large scale for an initial screening of HSVd, CEVd and PSTVd in Egypt. The results showed that the tissue print assays allowed clear discrimination between healthy and viroid-infected grapevine plants than dot-blot hybridization, the number Of HSVd-infected grapevine plants were 10 plants, PSTVd were 10 plants and the CEVd was detected with high inci...

SHARAW11'2*S S. S. A.; AL-HOFUFY2, A. N. and AL-BLOW12, M. H.

...cted and identified by indirect immune-fluorescent assay (IFAT) in Vero cells. A trial for development of a simple and rapid qualitative Real-time polymerase chain reaction (RT-PCR) was applied using primer site belongs to Capripowirus to detect CPV load in prepared tissue samples comparing to inoculated

...

Khatab, Eman A.H.; Zein, Salwa N. and Ahmed, Amal A.

...serum as determined by indirect ELISA with dilution of tissues 1/5 was 1/1024. Purification of the immunogamaglobulin G and conjugate of IgG with alkaline phosphatase were carried out to be used for ELISA detection. The concentrations of IgG and IgG conjugated with alkaline phosphatase were 1.0 mg/ml and 1:1000 respectively. Antiserum produced specific to BBTMV was used for virus detection by using different serological diagnostic methods. The percentages of v...
Mazharul A. M. 1, Md. S. Sarwar ,M. Nurullah 2, Keshab K. Adhikary I and M. Rahmatullah 1 
 
... Moringa oleifera and Azadirachta indica were used to treat chicken pox. Three plants, namely Cyathula prostrata, Amaranthus spinosus. and Calotropis procera were used to treat patients with rabies.
...
Arafa, A ; El-Kanawaty, Z; Hassan, M.K; Anwar, H.K  and  Mona M.Aly 
 
...l diagnosis was based on direct detection of viral RNA by real time PCR. Two positive cases from turkey and Grocer duck were processed for viral isolation and characterization. The level of antibodies was detected in vaccinated birds by HI test and the results were discussed to evaluate the role of vaccination in controlling the disease in these valuable zoo birds.

...

Eman, M. Abd El-Mottaleb.*; Ahmed, S.A."; Maysa, H.M.*; Salem, S.A.* and M. M. El-Shenawy

...ation was done by both Indirect Fluorescence Antibody Technique (IFAT) on tissue culture and inoculated mouse brain, while immunoperoxidase technique was done on bovine lung. Haematological examination revealed leucocytosis accompanied with neutrophilia (immature form) and lymphopenia. Histopathological examination clarified the most common lesion of field cases in lung in the form of pulmonary emphysema and alveolar collapse as well as interstitial pneumonia ...

Abdel Razek,B.Omar*and Magda M.Sayed**

...tation test (AGPT) and indirect fluorescent antibody technique (IFAT). Serum neutralization test (SNT) and ELISA tests were applied for titration and evaluation of the hyperimmune sera before conjugation with fluorescent. Total protein concentration of the prepared LSDV antisera was 0.8g/dl. Separation of anti-LSDV immunoglobulins 1gG were done using ammonium sulphate followed by conjugation with fluorescein isothiocyanate at pH 9.6. The anti-LSDV IgG conjugat...

Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar

...niversity were tested by direct antigen coatingenzyme linked immunosorbent assay (DAC-ELISA) using antisera against PVY, Potato virus X (PVX) and Potato leaf roll virus (PLRV). The results indicated the occurrence of single and mixed infections of three viruses in potato plants. Survey results indicated highly distribution of PVY infected plants, which its yield was affected strongly. Tubers of potato plants which gave a positive reaction to PVY only were coll...

Manal A. El-Shazly1, A. s. 2 Abdel Wahab and Salwa N. Zein3

...ra as determined using indirect ELISA were 1/3000 and 1/8000 for TSWV and IYSV, respectively. Authentic and induced antisera for both TSWV and IYSV  were used for virus detection using different serological diagnostic methods such as indirect ELISA and dot-blot immunoassay (DBIA) on nitrocellulose membranes.

...

S. A. Sidaros*, S. A. EL-Kewey*, Eman A. H. khattab**, M. M. ELsharkawy* 

...n sap was I :320 using indirect ELISA, whereas it was 1:280 for CABMV. Both of BBSV and CABMV were detected in stems and all flower parts (sepals, petals, pistils and anthers) in intact seeds and all seed parts (seed coats, cotyledons and embryos) of immature seeds obtained from infected faba been and cowpea plants. Both of the viruses were not detected in seed coat of ripened seeds and in roots of infected plants. BBSV was detected in stained seeds more than ...

S.Y.M. Mahmoud1 and M. Hashem2

...resence of BNYVV using indirect DAS-ELISA with specific polyclonal antibodies to C-terminal 60 amino acids of BNYVV coat protein and bait plants test, respectively. The results confirmed the presence of BNYVV in 46 out of 184 and 24 out of 50 root and soil samples, respectively. The virus was found with percentage of 65% in root samples collected from Kafr EI-Sheikh. The transmission experiments indicated that BNYVV was mechanically transmitted to Chenopodium ...

H. A. Hussein1, N.A. Mohamed2, F.M. Mohamed2 and M.A. Shalaby1

...cal isolates of BVDV are directly related to the presence of a helper virus which could be NCP homologous or heterologous. After 12 passages in cell culture. the obtained BVDVs in the harvests of CP BVDV infected cells may represent naturally defecting interfering viruses as a result of recombination mechanism.

...

Ahmed Abd El-Samie H. Ali

... infected and stained by direct double staining with both human and bovine anti-MHC class I and II antibodies labeled with phycoerythrin (pink) 1:20 and anti-BVDV polyclonal antibodies labeled with fluorescein isothiocyanate. FITC (green) 1:60. There was a reduction in the percentages of infected fibroblasts and PBMC expressing both MHC-I and Il. While mild reduction was observed in the percentages of PBMC expressing MHC-I molecules. Eight calves of the two gr...

Arwa H. El -Naggar, Nirmeen G. Shafiek, and M. S. Wassel.

...ation (SNT), ELISA and indirect fluorescent assay (IFA) tests were used to evaluate the hyper immune serum Before conjugation with fluorescent. The antibody titer reach 32 by SNT and 5984 by ELISA and identified by IFA to be Bovine rota. Separation of anti B. Rota immunoglobulins IgG "were done using activated Sepharose 4B followed by conjugation with fluorescein isothiocyanate at PH 9.6. The conjugated IgG was tested against reference B. Rota antigen usi...

Huda M. Hamid1, Fadia W. Al-Azawi2* and Zaid F. Makki3

...d which include DAM flow direction, mesh flow, agricultural area improvement, waterway division, and basin determination. These characteristics provide valuable insights into country’s water resources management, including the optimization of water use for different purposes and the strategies’ development to deal with water scarcity and drought. The analysis of hydrology characteristics in Iraqi dams has been conducted using remote sensing techniq...

Makmun1, Imam Mujahidin Fahmid2, Muhammad Saleh S. Ali2*, Muhammad Yamin Saud2, Rahmadanih3

Tabinda Nowsheen1, Sayed Wadood Ali Shah2, Ali Hazrat1*, Muhammad Yahya1, Gul Rahim1, Muhammad Mukhtiar4 and Muhammad Ajmal Khan3

Nasir Shah1,4, Muhammad Ibrahim1*, Zarnosh Habib2, Kalsoom3 and Zahir Shah4

...native plant species (Azadirachta indica, Zataria multiflora, Achillea santolina) and their various concentration (2, 1, and 0.5%) were used for the purpose. Firstly, the artificial diet of fruit flies was subjected to these treatments, while on the other hand chikoo fruits which were used for flies to settle on, were dipped in same concentrations of these plant extracts, and dried under shade and exposed to peach fruit flies for feeding for 15 days. All the t...

Makruf Arif1*, Claude Mona Airin1, Dwi Sunu Datrianto2, Vincentia Trisna Yoelinda1, Sarmin1, Yuda Heru Fibrianto1, Pudji Astuti1

...our study did not show a direct relation between testosterone and corticosterone levels in Stone Magpie birds with their contest experience.
 
Keywords | Contest, Corticosterone, Songbirds, Stone Magpie, Testosterone
...

Ruth Dameria Haloho1*, Jisril Palayukan1, Agus Setiadi2, Edy Rianto2, Nadlirotun Luthfi3

...ained by observation and direct interviews the farmers. The data was analysed descriptively and quantitatively. The study showed that there are two kinds of buffalo in West Sulawesi, the first one is the expensive buffalo and raised by intensive system. The expensive buffalo were consisted of Saleko, Doti Salamba and Bonga. The another one is Pudu (black) buffalo that reared by grazing system. The results showed that Return on Investment (ROI) of the buffalo f...

Wali Muhammad Mangrio1*, Hakim Ali Sahito1, Faheem Ahmed Jatoi1 and Fahmeeda Imdad Sahito2

...of the lemons. So, it is dire needed to conduct the research study on lemons to benefit the livelihood and pave the way for new researchers. Therefore, Integrated Pest Management strategies should be strongly recommended to secure and enhance the citriculture industry.

...

Shahid Iqbal1, Arshad Khan, Ali Hazrat1*, Gul Rahim, Mohammad Ihsan1, Umar Zad Gul1, Maryam Bibi1, Khadija Bibi1 and Muhammad Mukhtiar2

Aniqa Qaisar, Shabana Naz* and Sajida Arooj

...d Mn concentrations were directly associated with the LHead and LComet variations. This study concluded that heavy metals contamination exposure could be detected by a no-invasive way and Wildlife Park Bahawalnagar is most suitable for captivity with the least heavy metal contamination and genotoxicants.

...
Aatif Masood Ahmad Khan1, Masood Rabbani1*, Arfan Ahmad1, Muhammad Wasim2 and Sohail Raza1
...mples were used, one for direct PCR detection and other for the conventional diagnosis procedure. All isolates were identified as Avibacterium paragallinarum and required nicotinamide adenine dinucleotide phosphate (NAD) for their growth. The isolates were typical for Av. paragallinarum as they were not able to ferment neither galactose nor trehalose. Performing PCR of direct swab samples provided higher detection level as c...

Lijuan Liu1, Jinghang Chen2*, Min Wang3 and Wei Li4

... inhaled medications are directly administered to the respiratory tract to exert a therapeutic impact, which has clear benefits in the treatment of respiratory illnesses. However, existing inhaled medications are difficult to fulfill clinical prescription demands, and the research and development of novel inhaled pharmaceuticals has significant hurdles due to a lack of comprehensive theoretical and practical experience guidance. Personalized customization of c...

Waseem Abbas1, Dildar Hussain Kalhoro1*, Hasina Baloch1,  Muhammad Abubakar3, Muhammad Saleem Kalhoro1, Neluma Wali2, Mazhar Hussain Mangi1, Azhar Ali Laghari4, Shahid Hussain Abro1, Rani Wagan1 and Mehkar Hussain5

... plate test (RBPT) and indirect enzyme linked immunosorbent assay (I-ELISA). Seroprevalence at district Gilgit was recorded 6.66% in cows and 6.66% in yak while it was 3.33% in zo. Seroprevalence at Nagar district was recorded as 43.33% in cows and13.33% in yak while it was 10% in zo. The overall prevalence at district Gilgit was recorded 5.55% and it was 22.22% at Nagar district. The overall prevalence at summer season recorded was 20% and at winter season it...

Kalsoom Abdulrazaq1*, Bisma Arif1, Rimsha Mehboob2, Asma Mehboob3 

...animals. They can spread directly through contact with diseased animals, such as rabies, and through bites, or indirectly through exposure to contaminated surroundings and contaminated food. Vectors, such as mosquitoes or ticks, play a role in the transmission of diseases like West Nile fever and Lyme disease, respectively. Several factors impact diseases caused by zoonoses, and the convergence model classifies these compone...

Zaryab Murad1*, Sobia Bibi1, Shehr e Yar Ahmad1, Mohsin Ali Khan1, Rimsha Sadaf2, Mauz ul Haq1, Umair Manan1 and Muhammad Younas2

... doses (@ 60:60 kg ha-1) directly after transplantation and after 4 weeks of transplantation while DAP source was used for phosphatic fertilizer (@ 90 kg ha-1). In each pot, 20 days old rice nursery was selected and 10 healthy plants were transplanted into each pot. After successful and possible growth five most perfect and healthy plants were kept for experimental work. All the pots were kept in standing water condition and the pots were irrigated on the visu...

SAIMA SHARIF, SHAGUFTA NAZ, FARKHANDA MANZOOR, AYESHA NOOR & ZAHRA JAMIL

...between BMI and PEFR was direct and non-significant (r = 0.17 p > 0.05). In overweight subjects, there was inverse relationship between BMI and PFM (r = -0.494) and was highly significant. Similar result were obtained in obese females in which the inverse association was highly significant (r = -0.580; p < 0.01). It was concluded that subjects with the increase BMI demonstrated a decline in respiratory function. However in obese subjects, the peak expira...

SHEIKH AJAZ RASOOL1, MUHAMMAD SALMAN RASOOL2 & MUNAZZA AJAZ3

...des, bioaccumulation and directed flagella based shifting resulting out of hypo-doses of drug stimulation. Further, the prevalence of Enterobacteriaceae member strains has been witnessed producing Extended Spectrum β-Lactamases (ESBLs) and Carbapenemases. Drug resistance in viral entities has also posed challenge for public health programs. About 20% people die of viral hepatitis in one of Pakistan provinces. A counter malarial acrine drug is being tried ...

*AMNA SHOAIB, AROOJ SHEZAD, ARSHAD JAVAID, SUNDUS AKHTAR & ZOIA ARSHAD AWAN

...t disease suppression is directly linked with increase in activities of antioxidant enzyme (peroxidase, catalase, polyphenol oxidase and phenylalanine ammonia lyase) thus provides the basis for resistant in chickpea.

...

Inayat ul Islam1, Rooh Ullah1, Ahmed Zia2, Abdul Rauf Bhatti2*, Maryum Ilyas2, Sohail Hayat1 and Khabab Hayat1

Muhammad Wasif Gulzar*, Riffat Maqsood, Muhammad Zain, Muhammad Suleman, Tayyab Ur Rehman, Sana Asif, Abdul Wadood and Jawad Hussain

Yousef Abdal Jalil Fadladdin1, Ateeq Ullah2*, Raheela Nawaz3, Yagoob Garedaghi4, Abbas M.A. Al-Azab5 and Mashael Abdullah Aldamigh6

...samples was processed in direct smear methods and examined under microscope first under low power objectives and then higher power Lense. Evidence of infection was noted by the presence of helminth eggs. Out of 200 samples 65% (n=130) were found to be infected with 2 species of soil transmitted helminths including 27% (n=54) A. lumbricoides and 35.5% (n=71) A. duodenale. Regarding ages, 11-12 years were highly infected. Females were observed to be infected mor...

Xin Niu1, Xuelan Fang2, Sang Ba3, Yihao Fang1,4, Davide Fornacca1,7, Kun Tan1,4, Yanpeng Li1,4,5*, Zhipang Huang1,4,5* and Wen Xiao1,4,5,6,7

...easons and elevation. No direct encounters between the two species were captured by camera traps, although they did appear up in the same camera traps at altitudes between 2,900 m - 3,500 m. M. mulatta was also observed at elevations below 2,500 m, near the farmland and villages. The two monkey species were mostly recorded at an altitudinal spectrum within 3,100 m - 3,500 m, but with significant differences in seasonal frequencies in the same elevational gradi...

Shahbaz Hussain1, Asif Ameen2*, Muhammad Ehsan Safdar3, Atif Naeem1, Ahmad Jawad1, Madad Ali1, Muhammad Ather Nadeem3, Ghulam Abbas2, Muhammad Arif2, Muhammad Ahmad Zafar4, Zahid Hassan5

...pests in rice sown under direct-seeded rice (DSR) technology. Herbicide-based weed management is becoming increasingly popular, but there is a dire need to choose appropriate herbicides and their effective dose for controlling weeds in DSR fields. A field trial was conducted to appraise the comparative efficacy of three post-emergent herbicides applied at different doses [Clover 20% EC (bispyribac sodium) at 39.54, 59.30, an...

Shahzad Aslam1*, Amjad Rashid Kayani2, Muhammad Irfan Ashraf3, Muhammad Azhar Jameel2 and Kiran Sahar4

...e data were collected by direct field observations on five selected groups: A, B, C, D and E of rhesus monkey in various parts of the study area. Food remnants method was used in combination with fecal analysis and visual observation for food composition. Both macroscopic and microscopic fecal analysis were carried out using 150 fecal pellets, collected from study area. The microhistological fecal analysis showed the presence of 29 dietary plant species as com...

Qurrat ul Ain Shafique1, Sana Batool2, Hanfa Ashfaq2, Asima Tayyab2, Roquyya Gul3 and Mahjabeen Saleem1*

...owth of these cell lines directly. Thus, refolded IL-2 had activity identical to that of authentic IL-2 and enhanced the anti-tumor activity of HepG-2 as compared to MCF-7 cells. These conclusions suggest the potential use of the refolded cytokine as immunotherapeutic agent for treatment of hepatocellular carcinoma.

...

Abdelghafour El-Hamzaoui*, Mouloud Lamtai, Laila Ibouzine‑Dine, Sofia Azirar, Mohamed Yassine El-Brouzi, Ayoub Rezqaoui, Aboubaker El-Hessni, Abdelhalem Mesfioui

...studies has delineated a direct link between GBH exposure and the development of neurodegenerative disorders. These compounds are also suspected of being involved in the induction of affective disorders. The present study was undertaken to examine the dose-dependent impact of GBH exposure over 8-week period on anxiety- and depression-like behaviors in male Wistar rats, administering daily subcutaneous injections of four different doses 25, 50, 75, and 100 mg/k...

Muhammad Ilyas Riaz1, Masood Rabbani1*, Sohail Raza1, Ali Raza Awan2, Aleena Kokab1, and Rida Haroon Durrani1

...RB51 strain through site-directed mutagenesis. For virulence attenuation comparison with the parent RB51 strain, the constructed mutant was evaluated for attenuation estimation and clearance in BALB/c mice. The B. abortus ΔpurD mutant exhibited significant attenuation of virulence and cleared from the mice spleen after 20th DPI when inoculated at the dose of 108 CFU per mice. In contrast to this, the parent RB51 strain induces splenomegaly and showed hig...

Muhammad Ayyub, Mitha Khan*, Syed Abdul Malik, Sakhawat Ali, Syed Shamsullah, Mujeeb ur Rehman, Ikhlaq Ahmed, Ameer Uddin, Habibullah Kakar, Mohammad Zahid, Khalil Ahmed, Mana Khan, Mukhtiar Ahmed, Muhammad Rafiq Khetran, Zia ul Haq and Muhammad Azam

Huma Naz1*, Sajid Abdullah2, Tanveer Ahmed3*, Khalid Abbas2, Syed Qaswar Ali Shah1, Muhammad Rizwan1, Fareeha Latif4, Adnan Ahmad Qazi1, Muhammad Adeel Hassan5

... aquatic biodiversity is directly affected by overuse of insecticides. Present study was conducted to find out the genotoxic effect of insecticides on DNA damage and nuclear anomalies in RBCs of Labeo rohita after exposure to chlorpyrifos+endosulfan (CPF+END) by using Comet and Micronucleus Assay. Twenty fingerlings of L. rohita was kept in LC50 concentration of CPF+END, (1.95±0.02 μgL-1 for 96 h) for 5 days after acclimatization. The blood sample of...

Yanfei Cai1, Jiahong Feng1 and Wanlong Zhu1,2,3*

... phenomenon brings a new direction for research of obesity problem, but the lack of an animal of metabolic healthy obesity limits its study. Tupaia belangeri is a new type of experimental animal emerging in recent years and is extremely widely used in various disease models because of its evolutionary status and high affinity with primates. Here, in order to judge whether this new experimental animal can serve as special materials in obesity research, we const...

Ali Hazrat1*, Qasir Ali2, Mohammad Nisar1, Khan Sher2, Tour Jan1 and Abid Ullah1

Mona Adel El-Wakeel1*, Salah El-Din Abd El-Ghany Ahmed, Sanaa Abd El Rahman Mohamed
and Nadia Khalil Messiha
...div>
transplanting directly. Results revealed that the maximum inhibition of both weeds in both
seasons (2018 and 2019) was recorded by PLP at 60g + Acetic acid 5% as compared to
unweeded control. Concerning C. annuum growth parameters and yield traits, sole
application of PLP at successive rates is more effective than PLP at the same successive
rates with acetic acid 5%. So, it was observed that PLP at 60g...

Mona Adel El-Wakeel1 and Ibrahim Mohamed El-Metwally1

...ce at the same rates but directly at the same time with sowing of common
bean seeds. Additionally, four untreated control treatments were applied for comparison.
The recorded results revealed the inhibitory allelopathic effects of orange peels powder
on both weeds with direct relationship between the orange peels rate and it's inhibitory
effects. However, the pre-sowing treatme...

Pradeep Shah1*, Shrawan Kumar Sah2, Komal Bahadur Basnet2 and Mina Nath Paudel3

...-align: justify;">In dry direct seeded rice (DDSR), weeds are the major problems limiting the productivity of crop. Sesbania co-culture with DDSR as well as seed rates of rice affect weed density by smothering effect on weeds and therefore can be a better weed management technique. Two year field experiments were conducted at Regional Agricultural Research Station, Parwanipur, Bara, Nepal from 2015 to 2016 to assess the effect of Sesbania knockdown dates and s...

Amir Ehsan1*, Muhammad Ehsan Safdar1, Amjed Ali1

...c thresholds of weeds in direct-seeded rice. To get estimates of economic thresholds of two weeds in direct seeded rice, two-year field trials were conducted at research area of College of Agriculture, University of Sargodha, Punjab-Pakistan. Treatments included 0, 22, 44, 66 and 88 plants m-2 densities of each of Echinochloa colona and Digera arvensis laid out in randomized complete block design. Augmented densities of E. c...
Barkatullah1, Sumayya Noreen1.Khushnood Ur Rehman1, Zahid Ali Butt2, Tabassum
Yaseen3, Kamran Akbar3, and Salma Noreen3
... extracts is
directly related to the duration of soaking i.e. 48 h extracts were more effective than 24 h.
among all parts the highest activity was shown by leaves followed by fruit, bark, Rainwater,
and then mulching. From the above experiment, it is strongly suggested that the tested
portions of Z. mauritania have significant negative allelopathic effects on the tested plant
species. Additional stud...

Aya A. Saber1, Mohamed Fawzy2*, MokhtarM. EL-Tarabili2, Eman K. El Sayed2

...onth post-second dose. Indirect ELISA test results validated and confirmed the SNT results. Simultaneous Vaccination of cattle with BEF and RVF vaccines had no negative effect on the calves’ immune response as all vaccinated calves augmented acceptable levels of BEF and RVF specific antibodies. Therefore, calves can be vaccinated simultaneously against BEF and RVF safely with protective titers of antibodies.

...

Wali Muhammad Mangrio1*, Faheem Ahmed Jatoi1, Hakim Ali Sahito1, Fahmeeda Imdad Sahito2, Bhugro Mal3 and Naseem Qureshi4

...cticides viz., (T1) = Azadirachta indica oil, (T2) = Azadirachta indica leaves extract, (T3)= Calotropis gigantea leaves, (T4) = Citrullus colocynthis fruit were applied against B. amydraula population and (T5)= as control. The result revealed that neem oil caused maximum larvae reduction % in all three replications at (50.25%), (43.30%), (34.04%) overall (42.53%) in both years. Neem leaves extract (40.95%), (35.83), (34.08)...

Salim Saifullah, Muhammad Ilyas, Bashir Ullah and Sanam Zarif Satti*

...rainfall patterns, which directly influence plant growth and metabolism. Rosehips are used in the production of a variety of sweets and beverages, including syrup, marmalade, jellies, and jams. Therefore, high vitamin C content as well as TDW and TSS characteristics for rosehips are desired and preferable.

...
Muhammad Shakil Ahmad1, Muhammad Afzal1, Liu Yu Feng2
Muhammad Zeeshan Majeed1*, Hina Safdar3, Arif Mehmood1, Shahid Iqbal4 and Muhammad Adnan1
...formulations of neem (Azadirachta indica) causing 70–77% larval mortality in 72 h observation and exhibiting minimum medial lethal concentration (LC50) and time (LT50) values (i.e. 12.32 and 38.01 ppm and 16.67 and 11.68 days, respectively). Among microbial formulations tested, S. litura-nuclear polyhedrosis virus (NPV) and Bacillus thuringiensis kurstaki appeared as the most effective microbial treatments exhibiting minimum LC50 (3.78 × 103 OB mL-...
Inayat Ullah Awan , Khizar Hayat , Gul Hassan , Mushtaq Kazmi , Nazir Hussain
KASHIF ALI,Muhammad Shuaib,SAJJAD ALI,Tanweer Kumar,SHARIFULLAH,IKRAMULLAH KHAN
NAVEED AKHTAR,WAHEED MURAD,IKRAMULLAH KHAN,SAMIN JAN,HABIB UL HASSAN,AKASH TARIQ
FARZANA GUL,MASOOD JAN,MIR AJAB KHAN,Mushtaq Ahmad,MUHAMMAD ZAFAR,GUL JAN
Munawar Zeb,WISAL MUHAMMAD KHAN,Sara Hidayat,Haroon Khan,Bakhtiar Gul,Aamir Saleem
MUHAMMAD ILYAS,IJAZ AHMAD KHAN,Imtiaz Khan,MUHAMMAD ISHFAQ KHAN,Zahid Hussain,LUQMAN,FARHAT UN NISA SHEHZAD,Muhammad Ashfaq Khan,Bushra Khan
Riaz A. Mann, Shahbaz Ahmad, Gul Hassan , Mohammad Safdar Baloch
Muhammad Shuaib,SHARIFULLAH,HASHMATULLAH,RESHMAN NAZ,IKRAMULLAH KHAN,Rahamdad Khan,SABINA MUBARIK
Zafar Hussain , Muhammad Zubair , Wasif Nouman , Irfan Ashraf , Maryam , Rahmatullah Qureshi, Muhammad Farrakh Nawaz and Khalil Ahmed Ansari

Sri Purwanti1*, Wempie Pakiding1, Marhamah Nadir1, Nurhayu2, Kusumandari Indah Prahesti1, Sitti Nurani Sirajuddin1, Jasmal Ahmari Syamsu1,4, Andi Mushawwir3 

... and feed supplement) is directly related to an animal’s ability to maintain tissue temperature and metabolism, both of which affect the cardiovascular function and energy metabolism in chickens. This research aims to determine the value of lipid regulation and cardiovascular biomarkers of native chickens given a combination of maggot, indigofera and turmeric. A total of 120, 4-week-old male indigenous native chickens with an average initial weight of 42...

Muhammad Umair Khan*, Zahid Rauf, Abdur Rehman, Tanvir Hussain and Mansoor Ali Khan

...r production. There is a dire need for pulp and paper industry of Pakistan to find out locally available potential sources of raw material for pulp and paper production. This would be helpful to reduce imports and provide economic incentive to industrial and forestry sector of Pakistan. This study investigates the relationships between fiber characteristics (such as fiber diameter, fiber length, fiber lumen length and fiber wall thickness) and pulping properti...

Sariffudin Fatmona*, Sri Utami, Gunawan

...is needed. In this case, direct measurement is carried out in the field, in addition to observation and interview with the breeders. The number of cattle involved is 230 cattle and aged more than two years old. Furthermore, their weight was measured using the Djagra formulation. The variables studied include Post Partum Estrus, Post Partum Mating, Calving Interval, and Weight by calculating the mean, standard deviation, and variety coefficient. The results fur...

Roshan Ara1, Muhammad Ali Khanzada1, Amir Khan Korai1*, Abdul Mubeen Lodhi, Anam Mehwish Khanzada1, Khalid Hussain Qureshi1, Shakal Khan Korai2*

...chilli plants revealed a direct correlation between inoculum levels of M. incognita and infection severity, with higher inoculum levels resulting in increased knot formation, nematode counts in roots and soil and reduced shoot and root growth. Four chemical nematicides (Actara, Furadan, Ulala, and Rugby) were evaluated at various concentrations. Overall, all nematicides were effective in reducing M. incognita and increasing chilli plant growth. Higher doses of...
Ehtisham1, Rizwan ur Rehman1, Raja Wajahat1, Tabarak Ashraf1, Shabir Ahmad Jan1, Arz Muhammad1 and Ahmad Zamir2*
...food from humans, either directly from humans or by damaging human agricultural resources and this has developed an unavoidable conflict and competition both for food resources and shelter.

Keywords: Rhesus monkey, Impact, tourism, Ayubia National Park. ...
Basheer Ahmad1, Anwar Ali1, Salman Ahmad1, Nowsherwan Zarif1* and Saif Ullah Khan1
... cheque payment, and the director of I&HR also provided the necessary trainings. The forest guard provides on-site training for the nursery farmers. Out of 50 individuals who were interviewed, 68% believe that there are no significant types of damages in plantations, whereas 28% believe that damages have happened in plantations. In accordance with the survey, 38% of people do not engage in self-cultivation, 48% of people are tenants who work on other lands und...
Muhammad Rayyan1, Basheer Ahmad1, Anwar Ali1, Nowsherwan Zarif1*, Saif Ullah1 Khan and Salman Ahmad1
... that 45% of farmers are directly benefited from fuel wood from farmland, while 32.5% of farmers relied for fire wood on their land as well as from market. Overall, the findings indicated that factors related to socio-economic status, such as family size, land possession, subsidies received, livestock raising, types of energy used, and total income, significantly impacted the planting of trees on agricultural land. For the promotion of national agroforestry, p...
Muhammad Farooq1*, Lal Badshah2 and Sanam Zarif1
... sustainable. There is a dire need to provide an alternate source of energy to overcome the burden on rangeland resources.
Key words: Spectrum, Rangeland, Life form, Leaf size, Ashkhel, Shekhmalkhel
...
Mohsen Dehghani
...vest value as one of the direct use values based on data collected from questionnaire and sampling throughout Hara Protected Area during all seasons of 2011 and 2012. The results reveal that the poor pastures and economically undeveloped infrastructures in the region have led the local communities on the coastal areas to supply the livestock's fodder from mangrove leaves. Hence, the household incomes rely considerably on these habitats product, while econo...
Mubashir Jamil Khan1, Asad Abbas Khan2, Amir Saleem1, Lateef M. A.1, Muhammad Aslam1, Muhammad Mushtaq2, Abdul Ghaffoor2 Amna Btool1 and Arsalan Ali Khan1
...k production. There is a dire need to be aware of the seasonal variations in the nutritive value of grasses in order to optimize their forage use. The research was conducted to determine the seasonal variation in nutritional value of five grass species found in Kherimurat scrub forest and rangelands. General observations of increasing percentage of all nutrients except for dry matter were observed from summer to winter season and then reverse from winter to sp...
Syed Said Badshah Bukhari, Muhammad Yousaf Khan Syed Zakir Hussain Shah and Khalid Jan
Muhammad Shabir Mughal and Muhammad Muslim
...dus indica and Azadirachta indica. Singri is another large tract, where settlers cultivated agricultural crops like wheat, rice, maize, sugar-cane etc. This area had footprints of Hindu civilization near Singri Police Chouki, Seth Powaridas dug well on 9th January, 1860 for drinking water, currently the same well is being used for irrigation to forest nursery spread over an area of 5 acres. Singri area is fertile and suitable for planting trees havi...
Syed Said Badshah Bukhari, Ghulam Ali Bajwa and Miskeen Ali
...l agronomic traits. Both direct and indirect interactions were found among the traits. The highest genetic coefficient of variation (GCV) was 48.18% in total shoot length (TSL), while the lowest GCV was 3.27% in number of branches per plant (NB). The highest phenotypic coefficient of variation (PCV) was 48.19% in TSL, and the lowest PCV was 4.01% in moisture content. The PCV was slightly greater than GCV in all the traits. T...
Tanveer Haider, Aurangzeb Ashraf, Ambar Masud
...rticular compartment are directly and indirectly increasing day by day. Major pressures are increasing human population, overgrazing by animals, environmental pollution, like water contamination and forest fires. A thing of concern was the identification of a fast depletion of indicator species Dodonea viscosa. Forest fires occurred 1-2 times annually. All these factors show that vegetation is declining in the compart...
Mian Muhammad Shafiq and Hussain Bux Bhaagat
...onth of January 2006 and direct (field observation) and indirect (meeting with communities and wildlife staff) observation methods were used.

These lakes support a good population of waterfowls, Marsh crocodiles, otters and fish stock. About 1% of global population of globally threatened duck specie i.e. Marbled teal (Marmaronetta angustisvostris) breed in these lakes in May-July. According to the data Deh ...

Syed Said Badshah Bukhari and Ghulam Ali Bajwa
...an 11 million people are directly employed in forestry sector worldwide while over one billion poorest of the poor earn their livelihoods partially or fully from forests. Forest ecosystems sequester about 638 Giga ton carbons worldwide where Pakistan's share is about 0.05%. These silent friends of mankind, however, are diminishing at a rate of 13 million ha per annum worldwide, and contribution of illegal logging in it is about 27%. Apart from deforestatio...
Mamoona Wali Muhammad and Iftekhar Ahmed
...ning member and 70% were directly employed in fishery sector. 80% respondents had their own livestock and agriculture land. Avuaennia marina is mostly fed to the animals as lopped from vicinity forests. Water shortage, erosion and salinity were main problems faced by the agriculturists.

The study revealed that only 8% of the respondents were utilizing mangrove vegetation as a whole for fuel purpose. Responses about priority of importance of m...

Bashir Ahmed Wani1, Shakeel Haider Zaidi2, Hakim Shah3 and Muhammad Muslim4
Muhamamd Arif Chaudhary and Ejaz Ahmed
... part. Small out growths directed from heart wood into sapwood were noted in first 3 cross sections of first 3 consecutive logs.

Presence of i) white or black fungal material both on stem and root ii) exudation either of black or red blood colour iii) dry patches in stem/root and drying of roots and iv) white powdery streak in cross sections are leading to the conclusion that there have been the possibility of some fungal attack resulting in blockage o...

Altaf Hussain and Raja Muhammad Zarif
...>Direct and indirect health effects are increasingly serious and the damage done is often irreversible The effects are exacerbated by global changes and chemical and physical disturbances to species and ecosystem Alien tree species have long been introduced for commercial forestry, agroforestry, erosion control and landscaping. Pakistan has a long history of introduction of foreign plant and animal species The main objective of introduction of exoti...
Shams-ur-Rehman, Altaf Hussain and Riaz A. Khattak
...e or no progress in this direction Involving local communities in reforestation and selection of suitable species in combating salinity seem to be one of the economically viable approaches to reduce poverty as several million ha. area has been severely hit by this menace in many countries of South Asia. The paper describes the screening/selection of species following use of some soil amendments to successfully establish trees on these marginal and extremely lo...
G.A. Bajwa and H. Gul
...lant species, i.e. Azadirachta indica (Neem), Cassia fistula (Amaltas) and Calotropis procera (AK), to test their pesticidal effect, were tried separately and in mixture as growth inhibitor and pesticide in the laboratory against Plusia orichalcea, a serious defoliator of nursery plants being environmentally safe for this purpose seed of A. indica, bark of C. fistula and leaves & tender shoots of C. procera were...
Muhammad Afzal and Muhammad Hafeez
...s. Although fruits give direct satisfaction to the consumers but wood with several other important utilities has an unavoidable use of cooking food for human life.

Due to fast growing population, wood is becoming a scarce commodity in Pakistan. Productive land is also becoming short due to essential colonization for excessive population. Moreover, to feed this increasing population,more and more land is being put under food-production. The above s...

G. A. Bajwa and G. Zimmermann
...ormulation of Neem Azadirachta indica was tested in four concentrations of 3.2% 4.8%, 6.4%, and 8.0% against larvae of Lymantria dispar in the laboratory. 1st instar larvae of the pest were fed on neem sprayed leaves of Prunus domestica. 100 percent mortality was observed in all neem test treatments within 21 days. In the highest dose (8%) maximum mortality was recorded after 72 hours which may be due to contact action of neem oil formulat...
M. Mohiuddin and R. Ara
...s before sowing and sown directly in polyethylene bag, showed best germination percentages. The results of the study suggest that longer water soaking period of seeds and sowing in polyethylene bag with high temperature could be recommended for better seed germination of all three species studies....
Muhammad Ayaz
...s which they produce for direct and indirect human use. On this criterion, 42 species of trees both exotic and indigenous have been identified and discussed for their multiple uses in this paper....
G. A. Bajwa and H. Gul
...erall damage on the four directions differed significantly. The highest (36.49%) and the lowest (31.88%) overall damage was recorded on western followed by eastern (34.96%, 31.81%), southern (30.93%, 29.67%) and northern (30.29%, 28.95%) sides....
Muhammad Hafeez, Liaqat Hussain Jafri and Mohammad Rafiq
...wo common methods i.e., direct sowing vs tubed planting, an experiment was laid out in Shakaragarh Tehsil during July, 1987. Costs incurred on raising of Acacia nilotica by two methods was calculated. Results indicate that although the method of direct sowing is easier and apparently cheaper but in the long run, the method of raising kikar woodlots on farm lands by planting tubed plants is preferable....
M. Ismail Chaudhry and Ghulam Ali Bajwa
...f four drug plants Azadirachata indica, Dhatoora alba, Melia azedarach and Calotropis procera were used to determine their efficacy against Plecoptera reflexa larvae, an important defoliator of shisham plantations. In case of A. indica and M. azedarach seed powder was used for making 10% water extract and for D. alba and C. procera leaves, branches and stem were boiled in water for making 15% and 21% deco...
*Raja Muhammad Omer, **Shaukat Ali Khan and ***Charles R. Hatch
... the supply, demand and direct sale of tree seedlings from private farm nurseries, identifies limitations which prevent the marketing of tree seedlings, and suggests changes in forest department policies which could increase seedling sales....
Raza-ul-Haq
... for the seeding planted directly in forest soil due to root competition. For older plants (24-month-old) both shade and root competition are less important. Height growth of young seedling (3-24 month old) is not significantly affected by shade which is however highly co-related to seedling age. Significant growth was observed even under reduced PAR (2-4% of the open) showing the extreme shade-tolerant nature of the species. Age of the planting stocks ...
M. Ayaz
...artmentally, through the direct engagement and payment of forest workers. For this work an appropriate wage system is an important pre-requisite. At present there is no incentive oriented wage system (piece-rates) in forestry, which is developed on time and productivity principles. To develop a piece-rate on the basis of time demand and productivity considering tree variables and work place factors, time studies were carried out in Kaghan Valley on fel...
Rafique Ahmad Dr. and Nasreen Muzaffar Dr.
Iqbal Mohammad and John Sessions Prof. Dr.
..., mainly on low quality dirt roads (generally known as Guttoo roads) involving rehandling of logs at a transfer yard (transit depot). An improved timber transportation method using permanent forest rods and 2 x 4 turbo-charged (common wooden-bodied) straight trucks with trailer is proposed. The best combination of temporary and permanent roads is suggested as a fixed and variable cost network problem....
Mohammad Noor, Mohammad Khan and Gul Nabi
.... The data indicate that direct manipulations In semi-arid environment are essential for rapid improvement of overgrazed rangelands and secondary succession....
K. M. Siddiqui
...ends to bring about many direct and indirect changes in the environment, including in forest ecosystems, the extent of which depends upon rapidity, direction and magnitude of climate change. Minor changes in climate often occur and are of diurnal, seasonal of decadal and/or of regional nature, such as hot summer droughts of the 1980s in parts of Asia and Africa. Their affect was simi...
K. M. Siddiqui
...Some efforts were also directed towards establishment of energy plantations to reduce the need for fossil fuels and improve the lot of rural poor in third world countries. In the latter case, the efforts made little impact on existing enegry situation due to a number of reasons. The finanical inputs were rather small and that too scattered over large tracts of land. The requisite technical experience in developing woodfuel resources in rural areas on...
M. Iqbal Ahmad and I. A. Hafiz
... density of planting in directly related to the mulberey leaf yield. The spacings of 1 x 1 meter was found optional for improved management and high yield of mulberry plantations. The application of 200 Kg N per hectare, if applied 50% after sprouting of plants in spring and 50% after 20 days of leaf plucking, increased mulberry leaf yield by more then 100%. The PFI-1 early sprouting variety was selected and distributed among all forest departments of...
G. Stoehr, K. Brunner, J. A. Khan and I. Mahmood
...rings in relation to the direction of loading in strength tests on handles and the mechanical properties of wood on the ultimate strength of the handle was also studied....
M. I. Sheikh
...; Acacia nilotica, Azadirachta indica, Dalbergia sissoo and Eucalyptus camaldulensis has been reviewed. Distribution of the species, various nursery and field planting techniques, species trials, rate of growth and yield management of the plantations, water requirement etc. have been discussed....
Salahuddin Ahmad
...nty of things, they were directed to descend on earth where also they would be supplied with means of livelihood (edible vegetation such as fruit etc.)....
M.I. R. Khan
...initiative and under the directives of H.H. Sheikh Zayed bin Sultan Al Nahyan, the Ruler of Abu Dhabi. Since then, with the expansion of plantation, agricultural and landscaping projects, the raising of various types of nursuries has made considerable progress both in the public and the private sectors. More recently, indoor decorative plants are being acquired and kept by increasing number of people in their offices, shops, business premises, and residentia...
Mahmood Iqbal Sheikh
...involves supply of water direct to the plant roots through sub-surface irrigation. Since there would be no loss of water due to evaporation or seepage, the plants are supplied with a quantity just sufficient for their survival and growth....
Abdul Aleem
... a programme of research directed towards developing the basis within the natural and social sciences for the rational use and conservation of the resources of the biosphere, and for the improvement of the global relationship between man and the environment.
Because of its abiding concern for the conservation of renewable resources, the Pakistan Forest Institute hosted a seminar from August 13-15, 1977 on the Role of Social Sciences in the MAB Pr...
M. A. Quraishi, A. Khalique, Shahida Perveen and Perveen Akhtar
...stigation is in the same direction and aims to explore the diurnal fluctuations in water balance parameters of this mistletoe in relation to those of its host, under natural conditions. ...
Ishtiaq Ahmad Qazi
..., scale stick, range and direction finder besides functioning as an ordinary walking stick. Its accuracy is comparable with corresponding standard instruments. ...
M. A Quraishi and Manzoor Ahmad

Syed Saqlain Hussain1*, Muhammad Rasheed2, Zammurad Iqbal Ahmed2, Ghulam Jilani3, Muhammad Irfan4, Muhammad Kashif Aziz5, Fiaz Hussain1, Muhammad Akhlaq Mudassar1 and Zuhair Hasnain2

...njury at these stages is direly needed. Melatonin is known as N-acetyl-5-methoxytryptamine with chemical formula melatonin as C13H16N2O2. It is a versatile molecule with the speciality to lessen salt stress on the plant. However, mechanism of melatonin which is involved in salt stress mitigation is still under inspection of plant scientists. For the purpose, this research was carried out and the effects of melatonin priming was searched out viz., hydro-priming...

Syed Shahid Imran Bukhari

...ype of house and room is directly linked with its concentration. CO2 concentration is a surrogate indicator for the assessment of IAQ and ventilation efficacy. Average indoor CO2 can be helpful to identify ventilation system performance. Data was gathered from 50 asthmatic homes with natural ventilation located throughout the nine administrative towns of Lahore, Pakistan. The levels of CO2, the rate of air change, and the rate of ventilation per person per sec...

Dunia Tahseen Nema Al-Aridhi 

...scover whether they were directionally connected or not.
This study followed adults aged 18 and above with CKD stages (1-4) over a period of 12 months. It has been conducted in Al-Kindi Teaching Hospital- Baghdad / Iraq, during the period (2022-2023). Data, on demographics, clinical information and lab results including serum acid levels and estimated glomerular filtration rate (eGFR) were gathered at the beginning. The participants were monitored for ...

Muhammad Idrees1, Wisal Muhammad Khan1*, Haroon Khan2, Arshad Iqbal1, Nosheen Umar3, Shah Khalid1 and Nisar Ahmad4

Abid Hussain Khoso1, Mahmooda Buriro1*, Bakht-un-Nisa Mangan1, Naimatullah Laghari1, Muharam Ali Qambrani1, Allah Ditta2, Muhammad Saeed3, Taufiq Nawaz4

...t mulching materials can directly control weeds and indirectly regulate crop growth and development by improving soil fertility. An experiment was conducted to evaluate the “Comparative efficacy of different mulching materials to enhance growth and development and to control weed infestation in cotton” at Student’s Experimental Farm, Department of Agronomy, Sindh Agriculture University Tandojam Sindh-Pakist...

Saiful Islam1*, Muhammad Zubair Khan1 and Haroon Khan2

...ify;">Hydrophytes effect directly canal performance by reducing water flow, enhancing sedimentation, raising water level and reduce canal cross section area. The free-floating hydrophytes trapped in the outlets and culverts dipping its flow. In this apprehension a research study was conducted to investigate the effects of hydrophytes on canal capacity and at the outlets on the performance of the secondary canal known as Yar Hussain Minor (YHM) of Maira branch ...

Siti Fatonah*, Herman and Dewi Yuni Safitri

...n be applied by spraying directly to the field to inhibit weed emergence and weed growth in agricultural land as an alternative weed control.

...

Hafiz Muhammad Usama Shaheen1, Nasir Ahmed Rajput1*, Muhammad Atiq1, Ghalib Ayaz Kachelo1, Hadeed Ahmad1, Muhammad Wahab1, Muhammad Faran Tahir1 and Abuzar Hasnain2

...ry study showed that, Azadirachta indica exhibited the best results in-vitro (10.29 mm) followed by Allium sativum (12.24 mm). Under greenhouse conditions, the combination of Azadirachta indica and Allium sativum expressed significant effect against BLS of rice with least disease incidence percentage (18.07%), when applied as preventive treatment. These extracts could be significant in biological management strategies for th...
Tariq Ahmad1*, Anum Razzaq2, Hira Shahzadi2, Faiz Ur Rehman4, Li Bo1
Saif Ullah2, Omama Saqib1, Muhammad Tayyab Khan5, Muhammad Suliman1 and Ayesha Zulfiqar3

Hasina Basharat1, Muhammad Ramzan Ali2*, Aziz Ahmed2, Muhammad Zubair Anjum1 and Shamim Akhter1

...oduction parameters were directly increasing, ultimate yield were higher at 20,000 fish/acre followed by 15,000 and 10,000/acre. Financial analysis assessment of the present study showed encouraging net earnings at all stocking densities. Highest net profit as well as net production achieved at a stocking density of 20,000/acre followed by 15,000 and 10,000/acre stocking density. From this study it can be concluded that African catfish (Clarias gariepinus) can...

Muhammad Qasim1, Muhammad Zeeshan Majeed1*, Muhammad Arshad1, Umair Abbas1, Mehar Zubair Shehzad1 and Abu Bakar Muhammad Raza1,2

...s mortality response was directly proportional to insecticidal concentrations and exposure times. Significantly higher mortality was recorded by chlorpyrifos (100.0%) and fipronil (95.0%) at 72 h post-exposure with minimum LC50 values of 1.29 and 2.04%, respectively. Similar trend of effectiveness was exhibited by their LT50 values. Minimum mortality of C. heimi workers was recorded by the formulations of chlorantraniliprole and abamectin. Based on overall stu...
R. Javed1,2, T. Usman1, S. Niaz2, N. Ali2,3, H. Baneh4, K. Ullah5, I. Khattak1, M. Kamal1,2
S. Bahadar6, N.U. Khan1, S. Khan1,7, Y. Wang3*, Y. Yu3* and Mostafa K. Nassar8
...d lactose %) and SSC (by direct microscopic SCC method). The data were analysed using a generalized linear model of SAS studio for the effect of the SCC, breed, and herd on milk performance while wombat and CFC for the analysis of genetic and non-genetic factors. The results showed that animals with higher SCC have significantly lower (P<0.01) milk fat %. Breed-wise analysis showed significantly higher (P<0.01) protein % in Achai, lactose % in Jersey and...

Tanveer Hussain1, Abdul Wajid1, Jabbar Khan2, Asif Nadeem1, Misbah Hussain1, Qurat ul-Ain1 and Masroor Babar1*

... 4 breeds of goat were bidirectionally sequenced to decipher polymorphisms. Only a single substitution (T→A) was found in non-coding region of IL-2 gene. Comparison of IL-2 gene sequence of all four breeds with other goat breeds showed high similarity in sequence. Phylogenetic analysis of our local breeds with other mammals showed that IL-2 was highly variable. This high substitution rate could be due to changed selective pressure. These rapid changes may...

Camilo Romero Núñez1, Galia Sheinberg Waisburd2, Alberto Martin Cordero3, Rafael Heredia Cárdenas1, Laura Miranda Contreras1, Ariadna Flores Ortega4, Linda Guiliana Bautista Gómez5 

...problems; they can cause direct damage such as skin lesions and anemia and indirect problems spreading several infectious diseases, such as papulonodular dermatoses, Lyme disease, and viral encephalitis, or cause parasite-induced abortion. Because of the risk, they represent measures to control their spread, such as restricting global trade and sporting events. Therefore, the efficacy of fluralaner was evaluated against tick...

Camilo Romero Núñez1, Laura Miranda Contreras1, Rafael Heredia Cárdenas1, Ariadna Flores Ortega2*, Linda Guiliana Bautista Gómez3 

...e was assessed using the direct smear technique and Faust centrifugation-flotation with a 33% saturated solution of zinc sulfate. The overall prevalence of Toxocara was 33.09%. A significant association was observed (Chi2= 73.22, p= 0.0001) between age and positivity for this nematode. Access to the outdoors exhibited a strong association (Chi2= 48.31, p= 0.0001) with Toxocara spp. prevalence and was identified as a risk factor (OR= 1.63, p= 0.0001). Additiona...

Arshad Bhat1*, Abid Sultan2, M. Latief3, Parvaiz Rashid3, H.A. Malik4 and Iqra Qureshi5

... relationship (in either direction) between the three variables. The GSDP and horticulture production were the only variables for which the OLS showed a significant correlation. The study discovered a linear relationship between the dependent and independent variables of horticulture production and GSDP; however, the relationship failed the Granger Causality Test, indicating the absence of a cause-and-effect relationship. Given that agriculture is the backbone...

Aysha Fatima1, Safdar Ali1, Saira Azmat2, Luqman Amrao1, Muhammad Usman Ghani3*, Yasir Iftikhar4, Muhammad Ahmad Zeshan4*, Adeel Ahmad5 and Humaira Kalsoom6

...nts. Tomato germplasm (Nadir F1, Naqeeb F1, Johir, Gohar, Walter Gaint FM9 and Money Maker) were screened against Alternaria solani to find out the resistance potential against early blight under field conditions. Data of disease severity and disease incidence was recorded fortnightly that showed only a single variety “Johir” expressed resistant (R) response out of 6 entries. The response of 2 varieties “Nadir<...

Barkat Ullah Khan*, Ayaz Ahmad, Ashar Farooq, Muhammad Bilal Zia, Hammad-Ud-Din and Muhammad Atif Majeed

...6% records, representing direct sightings or visual identifications made by researchers and citizen scientists. Material samples account for 63.20% observations and are collected for genetic, morphological, or ecological analysis. Preserved specimens contribute 1.27% records and undergo preservation techniques for scientific study. The analysis of year-wise observations reveals an increasing trend in recorded observations from the 1980s to the early 2010s. The...

Murad Muhammad1,2,3*, Shahid Ullah1, Nimrah Ameen4, Abdul Wahab3,5, Abdul Basit6, Muqadas Batool7, Muhammad Nazim2,3 and Haroon Khan

Pakistan Journal of Weed Science Research

March

Vol.30, Iss. 1, Pages 01-43

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe