Simon Mwangi Kihu1*, George Chege Gitao1, Lily Caroline Bebora1, Njenga Munene John1, Gidraph Gachunga Wairire2, Ndichu Maingi1, Raphael Githaiga Wahome1, Davis Njuguna Karanja1, Julius Otieno Oyugi3, Ernest Lutomia3
... infection of sheep and goats, is widely distributed in Middle East, Central and South Asia, China and Africa. Whereas PPR antibodies were first reported in Kenyan small stock as early as 1995, the clinical disease was observed later in 2006 following dramatic and devastating PPR outbreaks in Turkana County. In this context, an outbreak of PPRV was observed in Tukana County in 2011 and the current study detail the clinical, pathological and laboratory findings...
Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4
...the presence of PPRV in goats of southern Tanzania district of Tandahimba bordering Mozambique was reported. The aim of this study was to perform molecular typing of PPRV strains that caused outbreak in Tandahimba district in 2011. A total of 17 (sheep=0, goats=17) out of 27 (sheep=3, goats=24) were positive for PPRV N gene. The nucleotide sequence and phylogenetic analysis clus- tered the...
Rodolfo Villagra-Blanco1*, Gaby Dolz1, Danilo Montero-Caballero2, Juan Jose Romero-Zuniga2
... the presence of BTV in goats and wild ruminants, and to identify serotypes present in the country....
Haq Aman Ullah1*, Aneela Zameer Durrani2, Muhammad Ijaz2 and Aqeel Javeed3
...ntrate mixture of dairy goats was investigated in district Lahore of Pakistan. A total of Twenty 20 goat farms were randomly selected and out of that 40 feed samples 2 from each farm were collected in the month of April. All the samples were analysed for the determination of aflatoxin B1 by using reverse phase High Performance Liquid Chromatography (HPLC. Out of total samples Aflatoxin B1 was detected in 33 feed samples, wit...
Moustafa Kardjadj
...stock including cattle, goats, sheep, pigs and wild ungulates. Wide prevalence of the disease in Asia and Africa associated with huge economic losses to livestock farming and industry has increased global concern for the disease. Currently, 3 serotypes of FMD virus (O, A and SAT-2) and 06 lineage are circulating in the North Africa, of which serotype O is responsible for most of the outbreaks. However, the rapid ...
Vinayagamurthy Balamurugan*, Gurrappa Naidu Govindaraj and Habibur Rahman
...al disease of sheep and goats. PPR is enzootic in India as more number of outbreaks have occurred in the past and now occurring regularly, round the year and most frequently during the lean period throughout the country. In some Indian states viz. Andhra Pradesh, Karnataka, and Chhattisgar h the PPR outbreaks in sheep and goats have declined after implementing the strategic mass vaccination programme. The decreased number of...
Moustafa Kardjadj1, Pam Dachung Luka2
...ant plague of sheep and goats that serves as a major constraint in the development of the small ruminant’s production within an infected area. The virus is endemic across much of the developing world and has spread into the developed European borders. The small ruminants industry within an infected state or region is often disproportionately affected with its attending impact on poverty in what are already the poorest areas of the globe. PPR is considere...
Gurrappa Naidu Govindaraj, Vinayagamurthy Balamurugan*, Habibur Rahman
...n young and adult sheep/goats, body weight loss in young and adult sheep/goats, milk loss, loss due to increased inter-lambing/kidding period, loss due to increased abortion, cost of high feeding and rearing inputs in young and adult sheep/goats etc. The results revealed that at the annual 10% incidence level, the estimated total loss due to PPR in sheep and goat
Ahmed Zein Mahmoud1, Muaz Abdellatif 2, 3*, Luai Shazali1
...us antibodies in sheep, goats and camels at Hail, Bagaa, Shenan and Ghazalah, Saudi Arabia. Serum samples (n=400), collected during 2012–2013 from sick and clinically healthy herds, were subjected to antibodies detection using c-ELISA. Out of examined animals, 83 (62.9%) goats and 70 (33.2%) sheep were detected positive against PPRV antibodies, whereas camels appeared to be seronegative. Based upon the seasonal variati...
Amitha Reena Gomes1, Belamaranahally Muniveerappa Veeregowda2, Sonnahallipura Munivenkatappa Byregowda1, Vinayagamurthy Balamurugan3*
...PR), a viral disease of goats and sheep caused by a morbillivirus of the family paramyxoviridae is a major threat to small ruminant farming. Global announcement of PPR eradication by 2030 has opened lot of research gaps for the development of vaccines and diagnostics for differentiating infected and vaccinated animals. With the advent of recombinant DNA technology, recombinant protein based vaccines and/or diagnostics are being tested in various ...
Klara Fischer1*, Erika Chenais1,2, Emeli Torsson1, Jonas Johansson Wensman1
...al disease of sheep and goats. Domestic sheep and goats are important species for the livelihoods of poor people in many developing countries. Within societies where PPR is now spreading, poverty is widespread and the disease is expected to have significant negative impacts on livelihoods. In resource-constrained marginalised societies, it is often difficult to collect disease data in conventional ways. Participatory epidemi...
Mohammad Mushfiqur Rahman1, Rokshana Parvin1, Ataur Rahman Bhuiyan1, Mohammad Giasuddin2, Shah Md. Ziqrul Haq Chowdhury3, Mohammad Rafiqul Islam1, Emdadul Haque Chowdhury1*
... spleen and trachea) of goats and a sheep during the year 2008-2012. The partial N gene of ten isolates and partial F gene of eight isolates were amplified by RT-PCR, and were sequenced. The phylogenetic analysis revealed that PPRVs circulating in Bangladesh belonged to Lineage IV and they formed a separate sub-cluster along with recent isolates from Nepal, Bhutan and China. On genetic analyses, it appeared that the N gene of PPRV is less conserved as compared...
Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4
...mixed herd of sheep and goats. Goats in the herd showed characteristic signs of PPR including nasal and ocular discharges, high temperature, diarrhea and ulcerative lesions in the oral cavity. A total of eighteen goats from a herd of sixty, were affected and two goats succumbed within two weeks. Interestingly, the disease was exclusively observed in g
Jannatul Noor, Md. Ahaduzzaman, Mir Md. Afzal Hossain, Mohammad Alamgir Hossain, Sardar Abdur Rahim and Md. Samun Sarker
...e prevalence of tick in goat’s population of three different areas (Kaptai, Kattoli and Chittagong Veterinary and Animal Sciences University) of Chittagong, Bangladesh. A total of 60 goats were examined for tick infestation in three places using random positive sampling technique. Among the breed, Black Bengal goats were highly affected (53.33%) followed by Jamuna pari (33.33%) and c...
Zuhao Huang1, Feiyun Tu2 and Dianhua Ke1*
...align: justify;">Blue-throated Bee-eater Merops viridis (Coraciiformes: Meropidae) is a bird species of family Meropidae with a very large distribution. The complete mitochondrial genome of Blue-throated Bee-eater M. viridis was determined. The mitogenome is a circular DNA molecule of 18,295 bp and comprises of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and two control regions CR and CCR, which...
Ecevit Eyduran1, Daniel Zaborski2*, Abdul Waheed3, Senol Celik4, Koksal Karadas5 and Wilhelm Grzesiak2
...n the indigenous Beetal goat of Pakistan. Moreover, the results obtained with the data mining algorithms were compared with multiple linear regression (MR). A total of 205 BW records including one categorical (sex) and six continuous (head girth above eyes, neck length, diagonal body length, belly sprung, shank circumference and rump height) predictors were utilized. The Pearson correlation coefficient between the actual and predicted BW (r) and root-mean-squa...
Bibi Tayyaba Batool1, Aemal Tareen1, Shahjahan Shabir Ahmed1, Hira Ejaz1, Mohammad Azam Kakar1, Syed Abdul Rehman2, Mohammed Saeed1, Zafar Ahmad3, Mohammad Masood Tariq3, Mohammad Arif Awan3 and Muhammad Naeem Shahwani1*
...tuberculosis in cattle, goats and sheep in some primary dwelling districts of Balochistan. Our results showed that brucellosis was found 2.2% positive from Quetta district and 0.6% positive from Pishin district and bovine (TB) was found 0.60% positive from Quetta and none from Pishin district of Balochistan....
Rashid Ahmed Khan* and Muhammed Naveed
...secticide, emamectin benzoate with other conventionally used insecticides against B. zonata. The results revealed the high toxicity of emamectin benzoate with LC50 value of 38.25 followed by trichlorfon, λ-cyhalothrin and imidacloprid with LC50 values of 44.21, 58.98 and 187.81 ppm, after 24 h post treatment, respectively. Based on our experimental results it is concluded that emamectin benzoa...
John G. Bruno
...ttached to streptavidin-coated magnetic beads (SAv-MBs) and used to capture their cognate and related E. coli serovars. Capture was assessed by fluorescence microplate assessment following acridine orange staining. While there was significant cross-reactivity between the various captured serotypes, each of the anti-LPS aptamer candidates showed a preference for its cognate E. coli serotype. Results suggest that these aptamers may be useful for enriching specif...
KM Fakhrul-Islam, Mohammad Shah Jalal, Sonnet Poddr, Md Nurul Quader, Md Sahidur-Rahman, Avijit Dutta and Shuvo Mazumder
...cattle, buffalo, sheep, goats, and wild animals around the globe. This highly contagious disease causes severe economic loss due to reduced productivity of the affected animals as well as increased mortality in calves and kids. In this study proportionate prevalence of FMD in cattle was estimated and the distribution of FMD according to different factors was evaluated. Both retrospective and prospective FMD clinical cases were included considering clinical sig...
Bahattin Cak1, Orhan Yilmaz1, Siddik Keskin2, Tahir Bayril3 and Mohammad Masood Tariq4*
...stics of Colored Mohair goat using four nonlinear growth models. Thirty (n=22 males and n=8 females) Colored Mohair kids were used. The kids were weighed at 2-week intervals from birth to 150 days. The Monomolecular, Gompertz, Richards and Three Parameter Logistic models were used. The best model was determined by considering the root mean square error, R2 % and asymptotic correlation coefficient criteria. We concluded that the Gompertz and Richards models wer...
Bin Wang, Bo Zhang, Nan Yang, Liang Dou and Jianghong Ran*
...n: justify;">The buff-throated partridge (Tetraophasis szechenyii) is endemic to western China and is known to cooperatively breed in a population habituated to supplemental feeding by humans. The social structure and demography of this species, however, have not been examined in natural populations. To determine if cooperative breeding occurs in populations unassociated with humans, we surveyed two natural populations in the Ganzi Tibetan Autonomous Prefectur...
Aziz-ul-Rahman, Farooq Yousaf, Naveed Anwar and Muhammad Abubakar
...arried out in sheep and goats of Jatoi and surrounding areas in Muzaffargarh districts South Punjab of Pakistan. A total of 965 serum samples were collected from sheep and goat’s farms from January to December 2015 with no history of vaccination. Haemagglutination inhibition (HI) test was performed using PPRV antigen to determine antibody titres level. The overall prevalence of antibodies to PPRV in g
Ahmed Zein Mahmoud, Muaz Abdellatif and Ahmed Abdalla
...ccinated sheep (n=683), goats (n=624) and camels (n=155) of all ages and sexes were collected in a cross-sectional study in Hail, Bagaa, Shenan and Ghazalah. Saudi Arabia. The seroprevalece was determined by NP-epitopes based competitive ELISA. The overall prevalence was 59.9%, goats had a significantly higher sero-prevalence of 75.3% compared to 59.4% obtained from sheep, whereas camels were seronegative. The prevalence of ...
Guang-Xin E1, Yong-Ju Zhao1, Zhong-Yuan Zhang1, Yan-Guo Han1, Wei-Wei Ni1, Ming-Xing Chu2, Yue-Hui Ma2, Jian-Ning He3, Huai-Zhi Jiang4, Jia-Hua Zhang1, Zhong-Quan Zhao1, Yan Zeng1, Ri-Su Na1, Gao-Fu Wang5, Hang-Xing Ren5 and Yong-Fu Huang1*
...in three high fecundity goats (Jianzhou big ear goat, Jining grey goat, Dazu black goat) and three low fecundity goats (Boer goat, Nubian goat, Inner Mongolia Cashmere goat). The results revealed a high diversity...
Kiran Afshan1*, Sarwat Jahan1 and Mazhar Qayyum2
...or sheep as compared to goat indicating high risk of infection in sheep. The current study showed that commercial bovine F. hepatica ELISA test is effective in Pakistan for small ruminants.
...
Zafrullah Khan1, Shah Alam Khan1*, Hamayoon Khan2, Naeem Khan3, Khwaja Junaid1 and Inamullah Khan1
...n: justify;">Bird cherry oat aphid (Rhopalosiphum padi L.) is a serious pest of wheat (Triticum aestivum L.) crop and causes significant production losses to the wheat crop in Pakistan. So far eight genes from the conventional wheat cultivars that are resistant to the attack of R. padi have been incorporated in the commercial wheat cultivars to help manage R. padi. During this study seven wheat genotypes were evaluated as ant...
Zafar Iqbal1* and Muhammad Khurshid2
... yellow leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. However, immunocapture of ToLCNDV could only be achieved by using the TYLCV-CP antisera followed by PCR detection by using specific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae), considered as a close relative of TYLCV, and cause severe losses for many economica...
Abdul Malik1,4, Ghulam Abbas1*, Hameeda Kalhoro2, Illahi Bux Kalhoro3, Syed Sajjad A. Shah4 and Halima Kalhoro3
...re fed with commercial floating pellets having 35% crude protein at 2% body weight twice a day for 60 days and eggs were collected weekly. Results showed that fertilized eggs were found to be greater in number at low salinity level as compared to higher salinity level. Survival of fry ranged from 1058 to 1100 at salinity level of 0‰ – 20‰ with 5% increment, after which fry number decreased significantly (P<0.05). The fertilized eggs did ...
Wazha Mugabe1,2, Lawrence Akanyang1, Mackenzie Nsinamwa1, Batanani Moatswi1, Naledi Matthews1, Kealeboga Dipheko1, Imtiaz Ahmed Ujjan3 and Assar Ali Shah2*
...iet for browser such as goat as well as maintenance purposes for cattle in the dry season. Thus understanding the dynamics on rangeland response to grazing could prove worthy in finding an equilibrium point for optimizing animal productivity, with limited range degradation. Therefore, the current study was aimed at determining and comparing fodder tree species composition along grazing gradient in fenced and unfenced grazing area in the Gaborone North Region. ...
S. K. Mukhopadhyay and M. V. Santha Kumar
Studies on the biosafety of botanical insecticides to native natural enemies of mulberry ecosystem
...nations along with dimethoate and dichlorvos on four coccinellid bio-control agents (Micraspis crocea, Micraspis discolor, Brumus suturalis and Scymnus bourdilloni ). All botanicals tested showed least mortality and was on par with unsprayed control. Dimethoate (0.1%) was highly toxic causing 100% mortality. Whereas, dichlorvos (0.1%) was least toxic in comparison to dimethoate. Botanical ...
S.K. Sahoo
Incidence and management of mustard aphid (Lipaphis ery-simi Kaltenbach) in West Bengal
...gainst L. erysimi, Dimethoate 30EC and Oxydemeton-methyl 25EC were proved to be more effective. The plots treated with Dimethoate and Oxydemeton-methyl recorded minimum aphid infestation in most of the observations, there by produced more yield ranging from 1151.6 to 1310.3 kg seed/ha. Incremental cost benefit ratio indicated that most favourable return was obtained under Dimethoate 30EC (...
Dipak Mandal, Paramita Bhowmik and M.L. Chatterjee
Evaluation of new and conventional insecticides for the management of mustard aphid, Lipaphis erysimi Kalt. (Homoptera: Aphididae) on rapeseed (Brassica juncea L.)
... WG at 27g a.i/ha, dimethoate 30% EC at 375g a.i/ha and chlorpyriphos 50% + cypermethrin 5% EC (Canon) at 375g a.i/ha. Chlorpyriphos (93.50%) found to be most effective treatment followed by chlorpyriphos + cypermethrin (92.76%), thiamethoxam (90.70%) and imidacloprid (90.46%) and dichlorvos (82.81%) showed least effective. Highest yield was recorded from chlorpyriphos + cypermethrin (18.45 q/ha) treated plot followed by thiamethoxam (17.86 q/ha), chlorpyripho...
Anjan Bhattacharyya, Suhrid Ranjan Barik & Pritam Ganguly
New pesticide molecules, formulation technology and uses: Present status and future challenges
...ater emulsifiable gel, floating granules, drift less dust, macro and micro encapsulated suspension, hollow fibers, monolithic matrix, laminated structures etc can avoid these problems. The prime motto for these developments is to give protection to the crops along with safety to the natural enemies of different pests as a whole safety to environment.
...
Sohail Ahmed, Muhammad Arshad and Babar Hassan*
...lication in contrast to coating method. Drying of woods prior to resin application was also effective in resisting termites’ infestation. The findings of treatment with resins are discussed with previously cited effects of resins and its implication in wood preservation.
...
Amir Ismail1, Muhammad Riaz1,2*, Saeed Akhtar1, Amjad Farooq3, Muhammad Arif Shahzad1 and Ahmad Mujtaba4
...les of cow, buffalo and goat. The level of Pb was found to exceed the maximum permissible limit (0.02 µg/g) set by Codex Alimentarius Commission in 53% milk samples. In 44% milk samples the level of Cd was found to exceed the permissible limit (0.0026 µg/g) set by International Dairy Federation (1979). The mean levels of Ni, Cu and Co were found in the normal ranges. The data for estimated daily intake of heavy metals through milk showed that infan...
Wenqiao Hui1, Jishun Tang1, Dejian Zhu1, Qian Ban2* and Sheng Chen1*
...efficiency. Anhui white goat is a native Chinese breed, with the characters of early time puberty onset and high fecundity. However, the molecular mechanism of puberty onset has not been well understood. It has been demonstrated leptin act as a critical metabolic cue linking adipose and the onset of puberty. In the present study, we first assessed the morphological changes in adipose tissue at pre-puberty and puberty onset stages of go...
Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla3
...of PPR/FMD in sheep and goats in Hail. Saudi Arabia. During the outbreaks 271 (20.6%) died out of 648 (49.3%) of affected animals, the overall morbidity in goats (33.3%) was higher as compared to sheep (12.3%), with a case fatality rate in goats reached 74.69% in the 2nd outbreak. Affected animals exhibited fever, stomatitis, mucopurulent to bloody nasal/ocular discharges, watery to bloody...
Netti Aryani1, Azrita2, Ainul Mardiah3 and Hafrijal Syandri2*
...moved from each of the floating net cages to be measured and weighed. The biomass of fish was calculated, and the amount of feed was adjusted. The feeding rate significantly (p< 0.05) influenced the final fish weight, net weight gain (NWG), average daily growth (ADG), specific growth rate (SGR), and feed conversion ratio (FCR). The maximum growth of giant gourami was found at 6% feeding rate. However, the best feed conversion ratio (1.34±0.18) was ob...
Zahid Mehmood*, Alam Zeb and Muhammad Ayub
...m sorbate and sodium benzoate) on the storage stability of muskmelon jam. The treatments included MJ1 (Muskmelon + Sucrose + no preservatives), MJ2 (Muskmelon + Sucrose + 0.1% sodium benzoate), MJ3 (Muskmelon + Sucrose + 0.1% potassium sorbate), MJ4 (Muskmelon + Sucrose + 0.01% potassium metabislulphite), MJ5 (Muskmelon + Sucrose + 0.05% sodium benzoate + 0.05% potassium sorbate), MJ6 (Mus...
Muhammad Qaisar Nawaz
...ive sowing technique for oat forage production under salt affected conditions. Two sowing methods i.e. broad cast and drill sowing with 30 cm apart rows and four nitrogen levels (75,100,125 and 150 % of N recommended dose i.e. 150kg ha-) were tested. Recommended dose of PK fertilizer (85-60 PK kg ha-1) was used uniformly with experimental N rates. Data on plant height (132.00 cm), number of plants (91.33 m-2), number of tillers...
Jianping Li1, Qian Jiang2, Wei Chen2, Yumei Li3, Huaizhi Jiang4, Jinlong Huo5 and Qiaoling Zhang2*
... gene and its protein ingoats of different fur colors. The effect of KIT mutations on KIT protein expression was examined in white cashmere and black cashmere goats. A single A→G missense mutation in exon 13 differentiated cashmere goats with different colors. Only a histidine (H)→arginine (R) amino acid (AA) change was detected at KIT exon 13 in both the whi...
Shaista Naz* and Noor Paio Khan
...e major one followed by goats and sheep. Livestock was found significant at household level in two aspects of income provision and of lowering household and farm budget. Livestock income was derived from the sale of milk, milk products (such as yogurt, butter and butter oil), other products (like farm yard manure and dung cakes) and animals which included calves, goats and sheep mainly. The major share of livestock income wa...
Guang-Xin E1, Yong-Ju Zhao1, Yue-Hui Ma2, Ming-Xing Chu2, Jia-Hua Zhang1, Zhong-Quan Zhao1, Hui-Jiang Gao2, Huai-Zhi Jiang3, Di Liu4, Li Liu5, Yan-Bin Zhu6, Wang-Dui Basang6, Luo-Bu Danjiu7, Tian-Wu An8, Xiao-Lin Luo8, Shi-Cheng He7 and Yong-Fu Huang1,*
...ondominant follicles of goats. These data will contribute to research on the molecular mechanisms of dominant follicle selection in goats. In this study, 90276370 and 115579236 clear reads in dominant and nondominant follicles of goat were generated through Illumina paired-end sequencing, and their mapping rate was 84.99% and 84.47%, respectively. A total of 12577 differentially expressed ...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4 and Lorenzo Gallus4
...re fed with commercial floating pellet (35% protein) at 3% body weight per day for 40 days. Results showed that fish growth was significantly (P<0.05) higher in term of weight gain, WG % of initial weight, mean daily WG, SGR, feed conversion and survival rate from 15‰ to 30‰ salinity than those reared in 35‰ and 40‰ salinity. Condition factor was found to be significantly higher on 40‰ salinity than 15‰ to 35&permil...
Ann Milliken Pederson
...nching a dry, parched throat with a long cool drink of water. Indeed, Peters claims that humans have an “ontological thirst” for the ultimate and this book attempts to satisfy the thirst or at least provide the water to drink. In a world where fragmentation, brutality, and chaos mark the lives of so many, it is no wonder that people long for wholeness, healing, transformation, and an encounter with the ultimate. Ted Peters’ new book locates t...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4, Lorenzo Gallus4 and Syed Sajjad A. Shah2,3
...re fed with commercial floating pelleted feed constituting 35% crude protein with 2% body weight twice a day. Eggs were collected on weekly basis by cultch removal method. Results showed that the highest fecundity, fertility, hatchability and survival of fry were obtained on salinity of 0%-15% and significantly decreased on 20‰ and 25‰. The eggs per gram body weight were also recorded in all treatments and highest eggs were obtained i.e. 4...
Muhammad Abubakar,1,2,* Aamer Bin Zahur,1,3 Khalid Naeem1,3, Muhammad Azeem Khan1,3 and Subhan Qureshi4
...ng disease of sheep and goats. Present study was designed to have an insight into the epidemiology of PPR under field conditions in the country using molecular tools. A total of eighty-four (n = 84) PPR outbreaks were investigated during the study (2010 to 2013). The highest number of outbreaks was reported from Punjab province (n = 38) followed by Sindh (n = 21) and Khyber Pakhtunkhwa (KPK, n = 10). In 48 out of 84 outbreaks, disease occurred in g
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Ghulam Dastagir4, Sara Ferrando5, Lorenzo Gallus5, Asad Ali Muhammad1,6, Abdul Jabbar2 and Khalil-ur-Rehman2
...re fed with commercial floating pellet (35% protein) with 3% of total biomass day-1 for 50 days. Results showed that the growth increment reared on 10‰ - 20‰ salinity were significantly highest in term of weight gain, WG % of initial weight, daily weight gain, specific growth rate, condition factor and survival rate than those reared on 25‰ and 30‰. Feed conversion ratio was found similar in all levels which is not signif...
Yanjie Guo1, Weini Wu1, Hongmei Wang2, Xiao Guo2 and Yongping Xu2,*
... ganglion of the female goat. Our results showed that IL-18Rα mRNA and proteins are expressed in the IMG, which provides molecular evidence for the study of immune and neuro-modulation in the female reproductive system.
...
Naheed Akhtar, Muhammad Ashfaque, Waseem Ahmad Gillani*, Ata-ul-Mohsin**, Afzala Tashfeen and Irshad Begum*
...hum padi L., bird cherry oat aphid at National Agricultural Research Centre, Islamabad. Twenty National Uniform Wheat Yield Trials (NUWYT), Normal and 12 (NUWYT) rainfed varieties/ lines were evaluated for seedling bulk test to know the resistant, moderately resistant and susceptible wheat varieties/ lines. These results revealed that varieties Diamond and Margalla-99 and lines V-99022, 99B2278 and 7-03 were partially resistant, two lines V-00125 and SD-66 wer...
Abid Hussain*, Imdad Hussain Mirza and Muhammad Azeem Khan**
...-align: justify;"> Goats have helped people to survive and thrive for countless generations. Proper feeding and management is of fundamental importance to the success of any goats’ enterprise. In Pothowar region of Punjab, household and sedentary system of goat production is practiced. The availability of feed varies according to the season. Goat<...
Nadeem Akmal, Hassnain Shah*, Muhammad Azam Niazi** and Waqar Akhtar*
...ed on the assessment of goat breed improvement intervention through supply of 65 Beetal bucks in rainfed Pothwar. To judge short term impact and assessment, a survey was carried out of both buck holder and non-holder beneficiaries in six project tehsils, after one year of buck distribution. Data were collected from a sample of 38 buck holders and 31 beneficiary farmers using a structured pretested questionnaire. The main influencing factor in keeping bucks was...
Muhammad Afzal, Sarfraz Ahmad , Abdul Salam Baloch* and Qazi Bashir Ahmad**
...mals (389 sheep and 336 goats) from Quetta livestock market was collected for one year on quarterly basis with a minimum sample of 150 animals. The objective was to determine seasonal price variation considering the effects of different attributes of the animals namely, live weight, age, gender, body score and time of sale of animals. The results indicated that there were significant differences in prices among seasons. The seasons considered in the study were...
Nay Naing Htoo1, Basit Zeshan1,2,*, Aung Tun Khaing1, Than Kyaw1, Erkihun Aklilu Woldegiorgis1 and Mohd Azam Khan1
...div>...
Qin Liu1,2, Feiwei Liu1, Xiuyue Zhang1, Nan Yang1 and Jianghong Ran1,*
...s.
...
A. N. Naqvi and K. Fatima*
INCIDENCE OF LIVESTOCK DISEASES IN NOMAL AND NALTAR VALLEYS GILGIT, PAKISTAN
...it. The data on cattle, goat, sheep and donkey were collected from the Animal Husbandry Department from 2003 to 2007. In total 19259 animals were found affected with various diseases. The disorders reported in the area were digestive diseases, infections, mastitis, reproductive diseases, endoparasites, ectoparasites, wounds, hematuria, respiratory diseases, emaciation, hemorrhagic septic-emia, tumour, blue tongue, cow pox, enterotoxaemia, tetanus, paralysis an...
Nasia Batool*, Imtiaz Ahmad Qamar**, Imdad Hussain Mirza** and Muhammad Fateh Ullah Khan**
MIXING LESS PALATABLE GRASSES WITH UREA, MOLASSES AND EFFECTIVE MICROORGANISMS AND ITS EFFECT ON CHEMICAL COMPOSITION AND DIGESTIBILITY IN GOATS
...on and digestibility in goats. (HC), (CA), (SH) and (DB) were used and the combinations were grass + 4% molasses, grass + 4% urea, grass + 4% urea + 4% molasses, grass + 4% urea + 1:100 EM, grass + 1:100 EM + 4% molasses, grass +1:100 EM + 4% molasses + 4% urea. Proximate analysis of samples was carried out. Crude protein content of mixtures improved as compared with sole grasses. Digestibility of HC supplemented with urea, molasses and EM in various combinati...
Khalid Naseem*, Naseem Bibi**, Saeeda Raza*, Amer Mumtaz*, Nouman Rashid Siddiqui*, Amina Bibi*** and Muhammad Ahsan Khan****
DEVELOPMENT, CHARACTERIZATION AND EVALUATION OF HIGH ENERGY BISCUITS FOR COMBATING MALNOURISHMENT AMONG CHILDREN IN PAKISTAN
...pplementing chickpea and oat in patent flour (fine flour) with different ratio (5%, 10%, 15% and 20 %). Biscuits with no supplementation were kept as control treatment. Chemical and sensory evaluation of supplemented biscuits was carried out. An increase in nutritive values have been observed with an increase in supplementation level. Proximate analysis shows that T and T get the highest values for protein, zinc and iron. Results of all treatments were in acce...
Imtiaz Ahmad Qamar*, Maqsood Ahmad*, Gulshan Riaz* and Sartaj Khan*
PERFORMANCE OF SUMMER FORAGE LEGUMES AND THEIR RESIDUAL EFFECT ON SUBSEQUENT OAT CROP IN SUBTROPICAL SUBHUMID POTHWAR, PAKISTAN
...ffects on the succeeding oat crop at the National Agricultural Research Centre, Islamabad, Pakistan, under rainfed conditions without application of fertilizers in Randomized Complete Block Design. The highest dry matter yield was obtained from millet (8.9 -1 -1 -1 tha ), followed by cowpeas (4.5 tha ), sesbania (4.4 tha ), rice beans (2.9 -1 -1 tha ), lablab bean (2.2 tha ) while cluster bean produced lowest dry matter -1 (1.7 tha ). Cluster bean had the high...
Abdul Hassan*, Muhammad Ishaq*, Nisar Ali Shah* and Arshad Farooq*
MILK PRODUCTION POTENTIAL IN KHYBER PAKHTUNKHWA
...r year, 95 lit milk per goat per year and 64 lit of milk per sheep per year. The data in comparison to the National and World average, is far below from probable production levels. Except in buffaloes and goats where the farm level production of milk is higher than the World and sheep where the farm level production of milk of Khyber Pakhtunkhwa is higher than Pakistan and World. Overall the milk production of Khyber Pakhtun...
ZafarUllah*, Muhammad Azim Malik*, Muhammad Ansar*, Shahzada Sohail Ijaz* and Muhammad Rasheed*
WINTER FORAGE QUALITY OF OATS (AVENA SATIVA), BARLEY (HORDEUM VULGARE) AND VETCH (VICIA SATIVA) IN PURE STAND AND CEREAL LEGUME MIXTURE
...te the forage quality of oats, barley and vetch grown in pure stands and cereallegume mixtures. Treatments comprised oats pure stand, oats in oatsvetch mixture, barley pure stand, barley in barley-vetch mixture, vetch pure stand, vetch in oats-vetch mixture and vetch in barley-vetch mixture. Forage yield and quality of...
Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*
EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
...ity in small ruminants. Goats fed II , HC II , HC II , HC II and HC had similar 100% 25% 75% 50% 50% 75% 25% 100% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in general more digestible with more than 65% dry matter digestibility. The lowest digest...
Muhammad Tahir* and Nawal Zafar*
FORAGE YIELD AND QUALITY PERFORMANCE OF RABI CEREALS SOWN ALONE AND IN BLENDED POPULATION AT VARIABLE SEED RATIOS
...hree cereal crops wheat, oat and barley sown alone and blended together at different seed proportions (100%: 0%, 75% + 25%, 50% + 50% and 25% + 75%) at the Agronomic Research Area, Department of Agronomy, University of Agriculture, Faisalabad, during 2013-14. The results showed that the crop mixtures and their variable seed ratios showed significant effects on fodder yield and quality traits. -1 The maximum number of tillers, number of leaves plant , leaf area...
Shahid Iqbal Khattak*, Muhammad Amjad Nadim**, Mohammad Safdar Baloch**, Kashif Waseem** and Muhammad Sohail***
IMPACT OF VARIABLE SEEDING DATES ON CEREALS' PERFORMANCE UNDER AGRO-ECOLOGICAL CONDITIONS OF DERA ISMAIL KHAN
...heat, triticale, barley, oat) were assigned to main plots while six different sowing dates (October 15, November 1 & 15, December 1 & 15 and January 1) were kept in subplot. The experiment was replicated four times with a sub-plot size of 5 m × 1.8 m (9 m ). Sowing of barley took minimum time to 50 % heading (99.08 days) which led the same towards earlier maturity (131.21 days) while oat crop showed prolonged m...
Mehwish Kiran*, Muhammad Saleem Jilani*, Kashif Waseem*
and Muhammad Sohail**
EFFECT OF ORGANIC MANURES AND INORGANIC FERTILIZERS ON GROWTH AND YIELD OF RADISH ( L)
...manure (PM) @ 10 t ha , goat manure (GM) @ 15 t ha , press mud (PrM) @ 20 t ha , sewage sludge (SS) @ 20 t ha and nitrogen, phosphorus, potassium (NPK) @ 120-65-100 kg ha . Data on leaf plant , leaf length (cm), fresh leaf weight plant (g), dry leaf weight plant (g), root length (cm), root diameter (cm), fresh root weight plant (g), dry root weight plant (g), total biomass plant (g), root yield pot (g) and root yield (t ha ) were recorded and analyzed statisti...
Wazha Mugabe1,3,Gaolebale Segolame Mpapho1, John Kamau1, Wameotsile Mahabile2, Shalaulani James Nsoso1, Kealeboga Dipheko1 and Assar Ali Shah3,*
...airy sectors.
...
Mohammad Nazeer* and Safdar Hussain Shah
...ng economy of Pakistan. Goat is population wise one of the major livestock specie of Pakistan. This study was conducted to analyze morphological traits of four indigenous goat breeds of Khyber Pakhtunkhwa (KP) province of Pakistan. The breeds selected for this study were namely Damani, Surguli, Kaghani and Gaddi. Data was collected from two districts to the south (Dera Ismail Khan and Kohat) and two districts to the north (K...
Aitezaz Ahsan1*, Muhammad Usman1, Ihsan Ullah2, Aamer Bin Zahur3 and Adnan Rasheed Malik4
... a disease of sheep and goat, particularly in the regions of Africa, Middle East and Asia. Besides clinical signs and symptoms of PPR various diagnostic assays, both serological and molecular, have been developed and are applied for estimating the current status of the disease. This review article focuses on the development of different molecular diagnostic assays from conventional reverse transcriptase polymerase chain reaction to real time reverse transcript...
Zheng Quan Jiang1,2, Feng Shan Li3, Jiang Hong Ran1,*, Chen Hao Zhao1, Man Zhang1 and Hua Li4
...t, dirt mound nest and floating grass nest. The nest length, nest width, nest height and nest volume among the four types of nests all were significantly different in the order: floating grass nests >dirt mound nests >grass mound nests >natural island nests, indicating that nest size was related to nest type. Among the three kinds of nest-site habitats, there were no significant differences in nest length and nest w...
Saba Parveen Samo1, Moolchand Malhi1,*, Javed Gadahi2, Yan Lei3, Allah Bux Kaciwal1 and Saeed Ahmed Soomro1
...div>...
Ali Haider Saleem1,*, Khalid Javed2, Masroor Ellahi Babar3, Tanveer Hussain3, Asad Ali2, Afzal Ali2, Nisar Ahmad2, Muhammad Zahid Farooq1 and Muhammad Dawood2
...tc. in cattle, buffalo, goat and sheep worldwide. LEP gene polymorphism and associations have not been extensively reported in Lohi sheep of Pakistan, so this study aimed to find any variations in gene sequence and possible association with growth rate to explore meat potential of this breed. A total of 18 Lohi animals were selected from the flock. After the DNA extraction from blood samples, a 1486 bp fragment of exon three was amplified and sequenced. Sequen...
Nilgün Paksoy1, Hikmet Dinç2 and Serap Kılıç Altun3,*
...Cd, V and Ba in donkey, goat, and sheep milk samples. Fifty-six individual milk samples were collected from 17 lactating donkeys, 19 goats, and 20 sheeps in three different Turkish Farms. The samples were analyzed by inductively coupled plasma - mass spectrometry (ICP-MS). Minimum and maximum levels of Na, Mg, P, K, Ca, Fe, Cu, Zn in donkey milk samples were 108.6-202.7, 48.6-76, 355-670, 565-1053, 279-637, 1.86-5.8, 0.052-0...
Humaira Jabeen and Nazia Jamil*
... produce polyhydroxyalkanoates (PHA). Strain Acinetobacter seohaensis produced 40.6% bio-plastic when supplemented with coconut oil. This percentage is even higher than the glucose, which was 16.6 % after 24 h of incubation. The other competent strains i.e. Exiguobacterium indicum, Bacillus acidiceler were not able to utilize the coconut oil but produced 5 and 22% bio-plastic when supplemented with 2% glucose after 24 h of incubation, resp...
Senol Celik1,*, Ecevit Eyduran2, Adile Tatliyer3, Koksal Karadas4, Mehmet Kazim Kara2 and Abdul Waheed5
...n Daera Din Panah (DDP) goat. Based on coefficient of determination (R2), adjusted coefficient of determination (R2ADJUSTED) and root mean square error (RMSE) were used. Janosheck model was chosen as the most appropriate model for its highest R2 (0.999) and smallest RMSE (0.124). Growth related parameters (A, B, k, and d) of the Janoscheck non-linear model were estimated as 43.000, 0.905, 0.124 and 0.950, respectivel...
Sherin Reda Rouby
...rd to cattle, sheep and goat. Diseases caused by capripoxviruses are transboundary in nature and are regularly spread into neighboring, non-endemic regions with significant economic implication. Capripoxvirus isolates are extremely conserved with genome identities of at least 96% between SPPV, GTPV and LSDV. The LSDV is similar in antigenicity and in cultural characteristics to SPPV. The current study was delineated to identify capripoxviruses from differ...
Ashraf Sayed Awaad1 and Mohamed Zaki Fathy2*
...r epidural injection in goats based on the anatomy of the lumbosacropelvic region and confirmed by computed tomography (CT) as well as successful application of the needle within the epidural space guided by ultrasonography (US). This study was conducted on seven lumbosacropelvic regions of goat cadavers and five live goats of both sexes ranged between 25-30 kg body weight. Longitudinal an...
Gulnaz Malik1, Abdul Qadir1 and Hafiz Azhar Ali Khan2,*
... spinosad, emamectin benzoate, lufenuron and thiamethoxam. For this purpose, toxicities of insecticides were tested at three different temperatures 20°C, 25°C and 30°C, on whole wheat grains which was artificially infested with S. oryzae under laboratory conditions. The toxicities of spinosad, emamectin benzoate, lufenuron and thiamethoxam increased 2.65, 1.59, 1.64 and 3.00 folds (positive temperat...
Danyu Zhang1, Ying Liu1, Qinxin Shi1, Zhiwei Peng1, Yan Hua1 and Zhijun Hou1,2,*
... by the saturated NaCl floating and next sequencing methods. The parasites were Capillaria sp., Baylisascaris devosi, Echinochasmus sp., and two Coccidianspecies. The Echinochasmus sp. andtwo Coccidian species were first time found either in sable or in other martens. The 434 genus of bacteria, belong to 30 phylum, the more popular bacteria were Proteobacteria (33.54%), following by Firmicutes (18....
Mumtaz Ali Khan1, Aneela Zameer Durrani1, Sher Bahadar Khan2, Shehla Gul Bokhari1, Ikramul Haq1,*, Imdad Ullah Khan3, Naimat Ullah4, Naimat Ullah Khan4, Kashif Hussain1 and Azmat Ullah Khan2
...e responses in rabbits, goats and sheep. C. perfringens were isolated from enterotoxaemia suspected sheep and goats from the endemic areas of Khyber Pakhtunkhwa Province, Pakistan during 2016. The isolates were initially identified through colony characters, Gram staining and biochemical tests. The identified isolates were quantified on blood agar and confirmed through PCR. Toxins were extracted, quantified, formalize...
Maryam Javed*, Farwa Saghir, Naveera Aziz, Maham Saeed, Asif Nadeem and Wasim Shehzad
...(Ovis aries) and goat (Capra hircus). Selected marker V158M is present in exon-8 of COMT gene. Each specie was subjected to blood sampling (n=20 each). DNA was extracted, purified, quantified and amplified through PCR by using specific primer set. Then Sanger’s method of DNA sequencing was used. Multiple sequence alignment demonstrated that sheep and goat were having the wild base Guanine against which th...
Irshad Ali1, Mohammad Masood Tariq2,*, Abdul Waheed2, Ferhet Abbas Yousafzai1, Farhat Abbas Bokhari1, Majed Rafeeq1, Muhammad Ali1, Muhammad Adnan Attique1, Shahid Amin3 and Tahir Hameed1
...her, whereas, the inner coat of this animal has black lining (the natural insulator), provides an excellent insulation capability against heat. Furthermore, very large pendulous dewlap and naval flap provides larger skin surface area to the animal to protect it from extreme weather conditions. Sexual dimorphism was found with regard to growth in these animals. The overall means for birth weight (B wt), and weights at 120 days, 180 days, 240 days, 365 days, 730...
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
...ke buffalo, cow, sheep, goat and camel. The buffalo and sheep milks have comparatively higher fat, solid-not-fat and total solid contents than other milks. Maximum whey proteins were found in the sheep milk (0.78%) whereas cow milk had lowest contents (0.54%). Non-casein-nitrogen (NCN) contents in sheep milk were higher followed by camel and buffalo milks. Electrophoresis study of caseins on Urea-PAGE showed darker bands of αS1-CN and β-C...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1, Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
...ts of CCPP in sheep and goats in Northern Pakistan. The current study was thus aimed to identify relative abundance of members of MM in small ruminants suspected of CCPP in Northern region of Pakistan. A total of 300 samples, (150 sheep and 150 goats) were randomly collected from nasal discharge, pleural fluid and lung tissues, and streaked into Pleuropneumonia like organism (PPLO) medium for isolation and identification of ...
Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla3
...equenced from sheep and goats (n=12). Nucleotide identity among Hail strains was identified to be 96.2-100%, while identity with previously sequenced Saudi Arabian strains and with reference PPRV retrieved from GenBank was found to be 94.1-98% and 81.2-100%, respectively. Phylogenetic analysis revealed that Hail PPRV strains clustered in four separate groups within lineage IV indicating genetic divergence based on N gene. These findings further support the con...
G. Venkatesan* and Amit Kumar
...ot limited to sheep and goats, which lead to high economic impact in developing countries including India. The causative agent, Orf virus (ORFV) belong to the genus Parapoxvirus (PPV) of the family poxviridae produces a typical papillomatous, cauliflower like external growth around mouth regions and rarely the lesions are found in other parts of the body and internal organs. Another characteristic feature of ORFV including other PPVs is the ability to re-infec...
Mudassar Javed1,Muhammad Zeeshan Majeed1,*, Muhammad Sufyan1, Sajjad Ali2 and Muhammad Afzal1
...es tested, emamectin benzoate and indoxacarb caused the most significant reduction of okra borers, followed by abamectin and lambda-cyhalothrin. While among the botanicals, Azadirachta indica, Citrullus colocynthis and Nicotiana tabacum caused the most significant reduction of okra borers in both years, followed by Curcuma longa and Corymbia citriodora. These synthetic insecticides and botanicals on average reduced okra fruit infest...
Muhammad Mobashar1, Muhammad Tahir1, Shahbaz Javaid2,*, Muhammad I. Anjum2, Insha Gul3, Nazir Ahmad1 andAbdul Sami1
...es on nutritive value of oat hay and milk yield and composition. Total of 9 Holstein Friesian lactating cows with nearly similar lactation stage and body weight were fed on three rations with proportions of 40% oat hay from different maturity stages i.e. boot, flowering and dough and 60% total mixed ration. The results showed that animals fed with oat hay from flowering stage (ratio...
Kiran Aqil1, Muti-ur-Rehman Khan2, Asim Aslam2, Aqeel Javeed5, Rizwan Qayyum1, Farooq Yousaf,1 Farkhanda Yasmeen1, Muhammad Luqman Sohail3 and Sajid Umar4,*
...viral disease of sheep, goat and other small ruminants, imparting substantial economic losses. In current study, antiviral activity of six dilutions of Nigella sativa (N. sativa)alcoholic extracts against the PPRV was investigated in vitro. Vero cell lines infected with PPRV were treated with six dilutions alcoholic extracts of N. sativa (200, 100, 50, 25, 12.5 and 6.25 µg/mL). The antiviral effects were judged by 3-(4,5)-dimethylthi...
Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
...cific strains in sore throat patients. However, the intraspecific association was noticed among these genes. Coa and spa polymorphism and association analysis indicated that spa negative isolates possess Coa of 1200 and 900bp, whereas spa positive isolates contain Coa of 650bp and 750bp. The most prevalent genes, spa, CPs8 and sea may be considered as molecular targets in designing treatment and co...
Imran Taj1,*, Ferhat Abbas1, Zafar Ahmad1, Mohammad Kamran Taj1, Deedar Ahmad2, Zahoor Ahmed2, Ghulam Mohammad2, Ajaz-ul-Haq1, Farooq Shahzad1 and Sabiha Azam3
...ollected from sheep and goats suffering from seasonal diarrhea. C. perfringens type D was identified through different biochemical tests and PCR. Antibiograms and lab animal trials were also carried out on local isolates of C. perfringens type D. Out of 204 analyzed samples, 89.18 % were found positive while 10.82 % were negative for C. perfringens type D. The division wise distribution showed that Quetta, Zhob, Sibi and Kalat were more ef...
Merica Slišković1, Meta Povž2, Marina Piria3,*, Goran Jakšić4, Ana Gracanin5 andGorana Jelić Mrčelić1
...nd its distribution in Croatia and Slovenia. In 2009, the schooling of sichel were observed at a high-water level in the Mur River of Slovenia. In total, 14 specimens were sampled by fishermen using sport fishing techniques. The age, condition, length-weight relationship (LWR), 20 morphometric and four meristic traits, were analysed. Fulton condition coefficient and LWR value indicated that sichel specimens’ were well adapted to the environmental conditi...
Qudrat Ullah1,*, Huma Jamil1, Zafar Iqbal Qureshi1, Muhammad Saqib2 and Heinrich Neubauer3
... samples (500 each from goats and sheep) were collected from animals kept at the respective livestock farms. An indirect-Enzyme Linked Immunosorbent Assay (iELISA) was used to detect anti-C. burnetii antibodies in the serum. Serological analysis revealed overall flock-level sero-prevalence of 92.3% which varied from 88.88% in sheep and 100% in goat, while individual level sero-prevalence was 15.6% in sheep and 15.0% i...
Bata Shalangwa Ishaku1*, Maimadu Abdullahi1, Dakwang Nalong1, Rengkat Jonah1 and Olabode Mayowa2
...dies in pigs, sheep and goats at slaughter in Jos, Plateau State Nigeria. Five hundred (500) serum samples comprising of 300 pigs, 100 each of sheep and goats were collected and analyzed for Toxoplasma gondii antibodies (IgG) using latex agglutination test (LAT). Serum samples with LAT titer >10 IU/ml were considered positive. The study showed that 176 of the 500 samples analyzed were positive for Toxoplasma gondii antibo...
Inzimamul Haq1*, Shahid Sattar1, Bashir Ahmed1, Qamar Zeb2 and Amjad Usman3
... Proclaim (Emamectin benzoate® 1.9 EC) + T. chilonis, Confidor® (Imidacloprid 200 SL) + T. chilonis, Chlorpyrifos® 40 EC + T. chilonis, Neem seed extract + T. chilonis and release of T. chilonis alone were applied to the Jalal variety. For C. partellus infestation, the data was recorded on the basis of leaf injury scale from 1 to 5 and percent dead hearts. Results showed that Imidacloprid + T. chilonis resulted in significantly lower leaf injury m-...
Shaista Naz1*, Noor Paio Khan1, Naveed Afsar2 and Ashfaq Ahmad Shah3
...ved in buffalo, cattle, goats and sheep rearing with higher possession of small ruminants (goats and sheep), while men were found dominant in large ruminants’ possession (buffalo and cattle). Women’s higher time allocation to livestock management activities depicted their higher level of participation in livestock management was found high as compared to their male counterparts. Women’s participation was fo...
Fehmeeda Fatima, Asif Nadeem* and Maryam Javed
...able subspecies of wild goat (Capra aegagrus), which faced serious population threats. In the present study, HSP70.1 gene has been partially sequenced (1344 bp) to study genetic diversity and evolutionary characteristics of Sindh ibex. In this research, samples of Sindh ibex were collected from Kirthar National Park, Sindh, Pakistan, the gene of interest was amplified, PCR products were sequenced and data was analyzed. The results of genetic diversity i...
Amjad Islam Aqib1,*, Shagufta Nighat2, Rais Ahmed3, Saba Sana3, Muhammad Ameen Jamal4, Muhammad Fakhar-e-Alam Kulyar2 , Naimat Ullah Khan5, Mian Saeed Sarwar5, Muhammad Asif Hussain5, Asadullah5, Attaur Rahman5 and Sadeeq ur Rahman5,*
...purpose, a total of 384 goat milk samples were screened for SCM through surf field mastitis test (SFMT) and mastitis-positives cases were further investigated for isolation of S. aureus using standard procedures. Coagulase gene was PCR amplified from the clinical isolates to categorize them into Coagulase positive Staphylococci (CPS) and coagulase negative Staphylococci (CNS). A questionnaire was used to record risk factors associated with...
Haniya Mazhar1, Naaz Abbas2, Zahid Hussain3, Amir Sohail4, Syed Shahid Ali4*
Extracellular lipase production from Bacillus subtilis using agro-industrial waste and fruit peels
...flower meal, wheat bran, oat bran, rice bran and sugar cane bagasse was 23.83, 12.17, 10.40 10.00 and 16.23 U/ml, respectively. The lipase production by B. subtilis using peels of different fruits, including banana, orange, water melon and melon as carbon source, was 27.17, 21.37, 10.57 and 8.43 U/ml, respectively. The corn cob produced 12.27 U/ml while waste oils of various industries produced 16.17 U/ml (Shan oil), 13.67 U/ml (automobile), 13.37 U/ml (unbran...
Jun Yan Bai1,*, Yong Gang Zhao2 and Yu Qin Wang1
...date genes that control goat growth and explore SNP loci of GHRL genes, thus laying foundations for genetic marker of growth traits of goats. In this study, GHRL genes of black goat and Yaoshan goat were collected for PCR amplification. Polymorphism of goat species was tested by sequencing technology. Results demonstra...
Zhongquan Zhao*, Tianyuan Yang, Lei Qiao, Qijie He and Zinuo Dai
...teristics of Dazu black goats (1056 kidding, 584 adult does and 224 adult bucks) have been researched in this study. The results showed that the age of puberty, sex maturity and breeding for male and female kids were 102.0±4.2 days vs. 117.0±8.7 days; 216.0±28.5 days vs. 195.0±22.4 days; 490.0±38.5 days vs. 355.0±27.5 days, respectively. Estrous cycle was 20.1±0.5 days. The duration of the natural estrous period...
Fatih Korkmaz1, Veysel Parlak2, Özgür Kaynar3, Arzu Ucar2, Gonca Alak1,* and Muhammed Atamanalp2
...omum), and chitosan coatings on the rainbow trout fillets were evaluated based on the protein profile, bacterial content (total aerobic mesophilic, psychotropic and lactic acid bacteria, Pseudomonas and Enterobacteriaceae), lipid peroxidation (TBARS), total volatile basic nitrogen (TVB-N) and pH values on quality during 12 days. The decrease in bacterial growth activity, physicochemical values (TVB-N, TBARS and pH) and prolonged shelf life in a natu...
Muhammad Huzaifa Mehmood1, Muhammad Ahmad Iqbal2, Muhammad Daood1, Muhammad Rizwan Tariq3*, Khubaib Ali3
...e quality of rabbit meat oat is used as feed for rabbits, because oat is good source of dietary ingredients. In this study 2-4% oat seeds were used to investigate their dietary response. The range of oat that is used in this research will improved the blood lipid and fatty acid profiles and reduced the percentage of fat of rabbit meat. Rabbits were ...
Saira Zaheer1, Abrar Hussain1*, Aqsa Khalil1, Muhammad Mansha1, Muhammad Lateef2
...heep, deer, buffalo and goat, etc. Various synthetic anthelmintics have been used, on wide scale, to control the helminths infections.But the parasite worms have developed multiple resistances against the synthetic anthelmintics. Hence, various biological controls, vaccines and local medicinal plants are being explored to control the parasitic worms. The aim of this study was to evaluate the anthelmintic potential of two local plants, Albizia lebbeck <...
Iqra Bano1,*, Moolchand Malhi2, Pershotam Khatri3, Saeed Ahmed Soomro2, Hira Sajjad4, Ambreen Leghari5, Muhammad Awais2, Safia Kandhro6 and Shakeel Ahmed Lakho5 and Munaza Soomro7
...twelve cross breed male goats of age (2-3 months) having 8-9 kg body weight. After 15 days of adaptation period, they were divided into two groups viz. control (C) and selenium yeast supplemented (SY) (n=6), respectively. Basal diet given to the animals consist of roughage and concentrate at the ratio of 65:35. In group C, the goats received only basal diet while in group SY the goat
Naveed Ahmad1,*, P.J.A. Siddiqui1, Amjad Ali1, Khan Mir Khan2, Rafaqat Masroor3, Noor ul Akbar4, Muhammad Amin5 and Mohammad Attaullah6
...) were stocked in each floating net cage (1.5m x 1.5m x 1.5m), with three replicates of each treatment. The diets were fed to visual apparent satiation two times a day for a period of eight weeks. At the end of the trial, P40 appeared to have significant (P<0.05) influence on the growth performance. The percent weight gain, average daily weight gain and specific growth rate (SGR) increased significantly by increasing dietary protein level from...
Manzoor Hussain1, Muhammad Awais2, Farhatullah3, Saiqa Bibi1, Muhammad Rameez Khan3, Afifa Khalid1 and Sajid Ali3*
...nown about the status of oat crown rust in Pakistan. This study was designed to assess crown rust status and field based partial resistance of 16 exotic oat lines introduced from Europe along with local check, under natural field conditions at District Mansehra, Pakistan. Data on crown rust severity and host reaction was taken at three scoring dates to assess partial resistance using area under rust progress curve, infection...
Muhammad Zain Saleem1,*, Raheela Akhtar1, Asim Aslam1, Muhammad Imran Rashid2, Zafar Iqbal Chaudhry1, Muhammad Adeel Manzoor1, Bilal Ahmed Shah3, Rais Ahmed4 and Muhammad Yasin5
...s in both sheep and goats. Brucellosis in sheep and goats is caused by B. ovis and B. melitensis, respectively but B. abortus (causative agent of bovine) may cross the species barrier to infect the small ruminants which may complicate the control measures of brucellosis because most of the control programs rely on serological screening of brucellosis rather than molecular assay which could confirm th...
Muhammad Usman Ghani1*, Muti Ur Rehaman Khan1, Asim Aslam1, Zubair Shabbir2, Li Bo3 and Naveed Anwar4
... current study 12 (25%) goats out of 48 were PCR positive. In case of sheep, 7 (14.58%) out of 48 were PCR positive. Tissues were taken for histopathological studies. Gross pathological finding includes scraps on commissure, ulcerations, vesicles on in oral cavity, erosion on dental pads, warts on external ears, ulceration on udder and scrotum. Increase in WBC, lymphocytes, monocytes count while decrease in RBC, platelets count and Hb concentration in diseased...
Senol Celik
...ctors from 130 Pakistan goats. Also, sex factor was included as a possible nominal predictor in the current study. To measure predictive performances of the tested algorithms, model evaluation criteria such as the correlation coefficient between actual and predicted LBW values (r), Akaike’s and corrected Akaike information criterion (AIC and AICc), root-mean-square error (RMSE), mean absolute deviation (MAD), standard deviation ratio (SDratio)...
Mumtaz Ali Khan1,*, Sher Bahadar Khan2, Shakoor Ahmad2, Irshad Ahmad3, Ikramul Haq4, Kashif Prince1, Asad Ullah5, Muhammad Shoaib2, Shahid Zaman6, Amjad Islam Aqib7, Ghazunfar Rashid1, Mahboob Ali1, Imdad Ullah Khan4,Imad Khan5, Naimat Ullah4 and Muhammad Shahid8
...type D epsilon toxin in goats to sort out better immunogenic approach. This study was conducted on total of 36 healthy animal of equal number of rabbits and goats. Each species was divided randomly into three equal (n=6) groups. Group A was supplemented vitamin E and group B was without vitamin E supplementation in both species. Animals of both groups were vaccinated with enterotoxaemia vaccine. Group C was kept as negative ...
Mohammed Al Bratty1,*, Hassan A. Alhazmi1,2, Desam Nagarjuna Reddy3, Abdul Jabbar Al-Rajab3, Sadique A. Javed1 and Zia ur Rehman1,4
.... Methyl-(7Z)-7-hexadecenoate, methyl-(9E)-octadecenoate and methyl tetracosanoate were found to be the principal fatty acid esters, while E-pentatriacont-17-ene and 2,4-dimethylpentane were identified as predominant aliphatic hydrocarbon compounds. The propolis extract has exhibited remarkable antimicrobial activity against certain strains of bacteria and yeasts. In general, significant a...
Muhammad Raza Khan1, Tariq Mahmood1,*, Hira Fatima1, Faraz Akrim2, Shaista Andleeb1 and Abdul Hamid1
..., horse, cow, sheep and goats, resulting in a negative perception among the locals. Most of the depredation occurs at night time while maximum livestock are depredated during winter season.
...
Muhammad Usman Akhtar1,2, Abdul Qayum3, Anshan Shan1,*, Shuli Chou1, Hyeonsoo Jo4, Syed Waqas Ali Shah4 and Ishfaq Muhammad5
...eld of lactating Beetal goats. Thirty five lactating Beetal goats were randomly divided into five groups (seven goats per group) in a randomized complete block design. Five isocaloric and isonitrogenous diets were formulated to contain 30, 40, 50, 60 and 70% RDP of dietary protein represented as 30RDP, 40RDP, 50RDP, 60RDP and 70RDP, respectively. Feed intake was recorded, nutrient digestib...
Abdul Razzaq1*, Muhammad Islam2, Zahra Islam3, Zahida Fatima1, Munib Hussain4 and Farmanullah5,6
...hogens in grazing sheep/goats throughout the world which impairs productivity and leads to high economic losses. In most part of the world, drug resistance against anthelmintic is now very common. In this context, various alternative control programs including herbal use against these worms is also an important option. To explore the problem, three available synthetic anthelmintic (Oxfendazole alone, oxfendazole-Levamisole combination and Ivermectin) were admi...
Shwe Yee Win1, Lat Lat Htun1, Myint Myint Hmoon1, Hla Myet Chel1, Yu Nandi Thaw1, Nyein Chan Soe1, Htet Lin Oo3 and Saw Bawm2*
...ens. Centrifugal sugar floatation and sedimentation methods were carried out to detect the gastrointestinal parasites. The overall occurrence of gastrointestinal parasites in village chickens was 60.5% (121/200). Six species of gastrointestinal parasites were observed as Capillaria spp. (30.0%, 60/200), Ascaridia galli (24%, 48/200), Eimeria spp. (20.5%, 41/200), Raillietina spp. (17%, 34/200), Strongyloides spp. (2.5%, 5/200) and Subulura brumpti (2.0%, 4/200...
Haq Aman Ullah1,*, Aneela Zameer Durrani2, Muhammad Ijaz2, Aqeel Javeed3, Muqadder Shah1 and Ikramul Haq1
...parameters of lactating goats. Thirty two lactating Beetal goats of 3-4 y age, weighing 40.91±0.285, were randomly selected, and equally divided into four groups. Group A was kept as control while animals of groups B, C, and D were individually fed daily with 30µg, 40µg and 50µg of AFB1, respectively, through naturally contaminated cotton seed cake for a 10 days period. Milk samples were tested for a...
Aftab Shaukat1,2,*, Tauseef ur Rehman3, Rizwan Shukat4, Shahid Ali Rajput5,
Shadab Shaukat6, Muhammad Ahsan Naeem2,5,8, Mubashar Hassan2,5, Tabassam Fatima2,5,
Fayyaz Ahmad1, Muhammad Usman Saleem7, Fatima Arooj1, Ashar Mehfooz2 and Anas Sarwar Qureshi2
...y weight gains of teddy goat kids.
...
Iffat Nawaz1*, Farhatullah1, Fida Muhammad1, Sajid Ali2 and Ghulam Muhammad Ali3
...or, seed shape and seed coat pattern. Twenty-nine different colours of common beans were observed in these 96 accessions with pre-dominance of red colour. Four different seed shapes were observed i.e., Cuboid, oval, truncate fastigiated and kidney shape. Cuboid seed shape was predominant with a frequency of 46.8%. Seed coat pattern was absent in 51% accessions. Five different seed coat pat...
Awais Bin Shahid1, Moolchand Malhi1,*, Saeed Ahmed Soomro1, Muhammad Giasuddin Shah2, Nazeer Hussain Kalhoro3, Asmatullah Kaka4, Rajoo Mal1, Muhammad Awais Soomro1, Saba Parveen Samo1 and Muhammad Nawaz Sanjrani5
...status in rumen of goats. A total of ten goats were randomly divided into two groups; control (C, n=5) and selenium yeast (SY, n=5). Animals were fed concentrate (2 % BW) as basal diet without (C) or with selenium yeast (SY, @ 0.3 mg.Se.kg-1.diet) supplementation. Hay and water was provided ad libitum. The results revealed that the molar concentrations of propionate and the total short cha...
Muhammad Sohail Memon1*, Khadim Ullah1, Altaf Ali Siyal1,2, Naimatullah Leghari1, Ahmed Ali Tagar1, Khalil Ahmed Ibupoto1, Syed Tahir Ata-ul-karim3, Muhammad Tahir4 and Noreena Memon1
...s measured through cutthroat flume at each irrigation interval and the total water consumed by ridge ground was 500 mm. The solute transport and soil water content in the root zone was also simulated by HYDRUS-2D. The results reveal that the salts moved upward to the top (upper layers) and concentrated at the center of the ridge for treatments T2 and T3 but leached down from the furrow bottom. Whereas, the simulations carried out by HYDRUS-2D model showed that...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
...ion in cattle, buffalo, goats and sheep. A total of 120 blood were taken from jugular vein of different breeds of cattle (Achai, Achai x Jersey, Holstein Friesian and Jersey), buffalo (Nilli Ravi, Aza Kheli and non-descript), goats (Beetal, Teddy and non-descript) and sheep (Bulkhi, Karri and non-descript). In cattle, the average sensitivity, specificity, false pregnancy prognostic value, false non-pregnancy prognostic value...
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
...receptor gene of Nubian goat (white, pure black and brown flower) was cloned and analyzed by systematic bioinformatics. The result showed that the coding region of the MC1R gene of Nubian goat was 954 bp in length and encoded 317 amino acids. The results of multiple sequence comparison showed that the clones were 99%, 87%, 86%, 85%, 84%, 81%, and 77% similar to the published pig, cow, human, dog, sheep, mouse, and chicken, r...
Anand Kushwaha, Amit Kumar, Aparna Madhavan, Durga Goswami, Golmei Poulinlu and Gnanavel Venkatesan*
...iral diseases of sheep, goats and cattle. They are endemic in most parts of the globe associated with significant production losses due to high morbidity, high mortality rate and animal trade restrictions. Though several diagnostics including molecular tools are available, recombinant protein based diagnostic assays namely ELISA is safer and robust to handle large sample size and also to minimize labor/time. However, the genus Capripoxvirus encodes putative 14...
Elmas Ulutaş1,*, Abdullah Eryavuz2, Aziz Bülbül2, Abdur Rahman3,*, İsmail Küçükkurt4 and Cangir Uyarlar5
...and oxidative status in goats. In this study, twenty four male Angora goats each of 12 months of age, and weighing approximately 35 kg were divided into four groups as: control group (C) fed with basal diet containing 31.76 ppm Zn, experimental group 1 fed with basal diet supplemented with 500 ppm Zn, experimental group 2 fed with basal diet supplemented with 750 ppm Zn and experimental group 3 fed with basal diet supplement...
Abdul Kabir¹, Amjad Hussian Mirani¹, Jam Kashif1, Shumaila Manzoor2, Abdullah Iqbal3*, Ihsan Ullah Khan4 and Muhammad Abubakar2
...on systems of sheep and goat in district Nowshera, KPK. A total of 246 serum samples were randomly collected from three age groups (<1 year, 1-2 year and >2 years) of sheep and goats. Competitive ELISA was performed to evaluate sero-prevalence of PPR in goats and sheep. The swab and tissue samples were collected from the surrounding areas from suspected sheep and g
Kenneth Nnamdi Anueyiagu*, James Jingmang Kopmut, Chrysantus Achi Lagi and Kelly Nkem Okoh
...stock comprising sheep, goats, and cows between October 2017 and April 2018. Samples were enriched in peptone water broth, incubated at 37oC for 24 hours, and sub-cultured onto Mannitol Salt Agar and thereafter standard bacterial procedure continued. A total of 83 (51.9%) S aureus isolates were identified, 54 (33.8%) MRSA, and 15 (9.4%) Methicillin Susceptible Staphylococcus aureus (MSSA). The study showed a statistical association between the prevalence of MR...
Muhammad Waseem, Tariq Mahmood*, Abid Hussain, Abdul Hamid, Faraz Akrim, Shaista Andleeb and Hira Fatima
...ic black bear including goats (75%), sheep (14%), and cows (11%), amounting to economic loss of 15,240 US$. Moreover, 16,420 kg maize was damaged by Asiatic black bear having a worth of 3284 US$.
...
Yan-Guo Han, Jia-Yuan Wu, Ri-Su Na, Wei-Jiang Si, Yu-Qin Han, Yan Zeng, Yong-Ju Zhao and Yong-Fu Huang*
...ng mutton odour of male goats. In this study, 20 male goats aged eight weeks were randomly divided into the oral and plasmid-injected KISS1. DNA vaccine groups (groups T1 and T2) and the empty vector groups (groups C1 and C2) for immunisation. Blood samples were collected at 0, 3, 6, 10 and 14 weeks after primary immunisation for the detection of kisspeptin antibodies and testosterone by indirect enzyme-linked immunos...
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...ary yeast in transition goats. Therefore, a trial was planned to elucidate the effects of various inclusion levels of live dried yeast (Saccharomyces cerevisiae) on dry matter intake (DMI), body condition score (BCS), body weight (BW) and serum health biomarkers in Beetal goats during the transition period. Twenty-four Beetal goats were randomly allotted to three groups YSC0, YSC5 a...
Ghulam Mohi Uddin Paracha* and Yasser Durrani
...isulphite and sodium benzoate) on the storage stability at ambient temperature (25 ± 5°C) of blended pulp of peach and persimmon. Effect of preservatives on physico-chemical parameters (total soluble solids, pH, titratable acidity, total phenolic compounds, ascorbic acid content and antioxidant activity) and sensory evaluation of blends was carried out. The treatments in this study included BPo [peach persimmon blend (6:4)], BP1 [peach persimmon ble...
Muhammad Rasheed1*, Zafar Ullah1, Muhammad Ansar1, Asma Hassan1, Shahzada Sohail Ijaz2, Muhammad Hussain Shah4 and Muhammad Arshadullah3
...rage growth and yield of oats (Avena sativa) and vetch (Vicia sativa) grown in mixture stands under conservation and conventional tillage systems. The highest number of tillers plant-1 (11) for Oats was recorded in oats-vetch mixture under conventional tillage (CT) while comparing minimum tillage (MT) to zero tillage (ZT) 43 percent higher yield of oats ...
Majeeda Rasheed1*, Tanveer Akhtar1, Nadia Mukhtar2, Muhammad Furqan Shahid2, Muhammad Imran3, Saima Yaqub2
...ll ruminants (sheep and goat) have been frequently reported. Despite PPRV is endemic in Pakistan, information on disease serosurveillance of prevailing strains in Gilgit-Balitistan (GB) territory is scarce. Therefore, the current study was designed to assess the seroprevalence of PPRV and to evaluate potential risk factors involved in the transmission of PPR disease in four distinct locations of GB province. We reported occurrence and risk factor analysis of P...
Md. Al-Amin Tan1, Mst. Antora Akter1, Md. Sabuj Rahman1, Marzia Rahman2 and Md. Mahmudul Alam1*
...Povidone-iodine (PI) in goat. Seven surgical fields were prepared for evaluating seven formulations of these antiseptics. The bacterial swabs collected at different stages of skin preparations were transferred in nutrient broth and cultured in Plate Count Agar for counting of Colony Forming Unit (CFU). Results revealed that Chlorxylenol was less efficacious than PI and Chlorhexidine gluconate when mean CFU was counted at different stages of surgical field prep...
Korkmaz Bellitürk1, Zubair Aslam2, Ali Ahmad2* and Sami ur Rehman2
...ysis of raw material of goat manure, cow dung, sheep manure and their vermicompost products. The earthworms for vermicomposting, Eisenia fetida (an epigeic species), were used as the test species. The samples were collected from prepared vermicompost and raw material for chemical and physical examination. For these samples, the pH, EC, organic matter, C:N ratio, phosphorus, potassium, calcium, magnesium, iron, nitrogen, sulfur and heavy metals i.e. tin, cadmiu...
Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5*
... with zoonotic Moroccan goat and bovine strains. The amino acid sequences of the antigenic regions inside VP8* proteins showed high conservation between the amino acid sequences of human and animal strains bearing P[14] proteins, and revealed several changes with respect to the RotaTeq™ and Rotarix™ vaccine strains. This report suggests a possible reassortment event between human and domestic animal rotaviruses. Continuous surveillance in the post ...
Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1*
...erformance of sheep and goat. The animals were fed on Maize, Sorghum, and Millet. For this purpose, a total of 90 animals (n=45 sheep) and (n=45 goats) were randomly assigned into six groups (n=15) each under 2x3 factorial arrangement. All groups of both species were fed maize, millet and sorghum randomly. Results indicated that goat spent more time to eat than sheep while sheep rumination...
Hafiz Muhammad Imran Javed* and Mushtaq Ahmed
...al disease of sheep and goats. The present study compared the select genetic markers of the vaccine and field strains originating from the field outbreaks for phylogenetic analysis, nucleotide and deduced amino acid sequence analyses, and a comparison of three-dimensional protein structures. The N gene ORF was 1578 nucleotide long with a single open reading frame encoding 526 amino acids. Similarly, the ORF of F gene was 1641 nucleotide long which encoded 547 ...
M. Hammouchi1*, G. Sebbar1, N. Touil2, C. Loutfi1, Y.S. Malik3, M. El-Harrak1 and O. Fassi-Fehri4
...exotic breeds of Alpine goats were observed to be highly susceptible to the disease, with mortality rates approaching 100%, contrary to local breeds which were less susceptible to the disease. In the present study, animals of local breed of Moroccan sheep (Timahdid) were experimentally infected using the protocol previously validated for Alpine goats. The infected animals showed mild or no clinical signs of disease, with low...
Nabeel Maqsood1,2*, Afzal Khan1, Muhammad Khalid Alamgir2, Shaukat Ali Shah1, Muhammad Fahad3
PTFE THIN FILM COATING ON 316L STAINLESS STEEL FOR CORROSION PROTECTION IN ACIDIC ENVIRONMENT
...
behavior in HCL. Hard coating is often required for protection of 316L SS from wear and corrosion. In this research
paper polytetrafluoroethylene (PTFE) was coated on 316L SS by spin coating technique to modify their corrosion
resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion property of the 316L SS and PTFE
coa...
paper polytetrafluoroethylene (PTFE) was coated on 316L SS by spin coating technique to modify their corrosion
resistance in acidic media containing Hydrochloric acid (HCL). The anticorrosion property of the 316L SS and PTFE
coa...
Farid Ullah Khan*, Adeel Ahmed*, Uzair Khan Jadoon*, Fahim Haider*
MODELING, SIMULATION AND FABRICATION OF AN UNDERSHOT FLOATING WATERWHEEL
...cation of an undershot floating waterwheel for power generation
for run-of-the-river applications. For the undershot floating waterwheel, analytical modeling and simulation are performed
to estimate the optimal design parameters. Moreover, the dependence of output power on various parameters
of waterwheel is also investigated during simulations. It is found, during analysis that the water flow velocity i...
for run-of-the-river applications. For the undershot floating waterwheel, analytical modeling and simulation are performed
to estimate the optimal design parameters. Moreover, the dependence of output power on various parameters
of waterwheel is also investigated during simulations. It is found, during analysis that the water flow velocity i...
Hafiz Khurram Shurjeel1, Muhammad Anjum Aqueel2, Ejaz Ashraf3*, Asad Ali4 and Arooba Rubab5
Effect of Insecticides on the Longevity of Apis mellifera L. (Hymenoptera: Apidae)
...itenpyram, emamectin benzoate) applied at flowering stage of sunflower (variety Hysun-33). After three days of pesticides application, Apis mellifera was exposed to insecticides, placing three honey bee colonies in the center of each plot in the field. Four frames from each colony and twenty cells from each frame were selected as samples for further studies. After egg hatching larval duration was recorded until pupal duration starts. The honey bees were caged ...
Nisar Mohammad٭, Mohammad Mansoor Khan٭, Noor Mohammad٭
EXTRACTION OF HIGH QUALITY TALC FROM TALC-CARBONATE ROCK OF MINGORA EMERALD MINES BY FLOTATION AND LEACHING
...lc can be separated as float at pH 6 - 7±0.2 in rougher flotation and 10 - 11±0.2 in cleaning flotation, depressant dosage 0.10kg/ton, and collector dosage of 1.2 kg/ton. Talc concentrate at recovery of about 60 - 70% with a grade of 92.50% from an ore containing about 50 to 70% talc was obtained. The final concentrate was treated with various leaching reagents. Dilute HCl (30%) + stannous chloride (300 ppm) gave better results. It reduced iron c...
Sumaira, Ali Mujtaba Shah*, Ghulam Asghar Solangi, Ifra Anwar, Qudratullah Kalwar
...sheep, ass, horse, yak, goat, bison and camel while the 80 % milk is produced by cows. Milk of camel plays an essential part in the diet of human. Additionally, camel milk comprises numerous fatty acids and enzymes. Hence camel milk has many beneficial effects, such as antiviral, antibacterial, anti-diabetic, anti-carcinogenic and anti-ageing. Besides, camel milk contains abundant proteins which are conductive to improve the immunity functions. Thus, it is nec...
Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh
...xt-align: justify;">PARC oat is a newly approved lodging-resistant, late-maturing, and high-yielding fodder oats variety developed at Fodder and Forage Research Program, National Agricultural Research Centre (NARC) Islamabad, Pakistan. This variety was selected from material imported from New Zealand for better agronomic characters and improved fodder yield. For initial two years (2006-07 and 2007-08) selections were made, a...
Ali Hazrat1*, Mohammad Nisar1, Khan Sher2, Jehandar Shah2, Tour Jan1 and Abid Ullah1
Taxonomic and Medicinal Study of Papilionaceae of District Upper Dir, Khyber Pakhtunkhwa, Pakistan
...laria juncea forage for goats and cattle and also toxic alkaloids, particularly in the seeds and pods, Lathyrus cicera is used as a green manure, soil cover for preventing erosion and in breeding program for the plant species, Medicago minima is rich source of vitamins A, C, and E, green manure and fixes atmospheric nitrogen, Robinia pseudo-acacia is astringent, diuretic, emetic, emollient, laxative, poison, purgative, sedative, tonic, emetic and for toothache...
Israr Yasin1, Ismail Qureshi1*, Shahjahn Qaimkhani1, Gulam Mustafa Solangi3, Ismail Qaimkhani1, Ismail Brohi1 and Abdul Ahad Soomro2
A Perspective on Household Dairy Farming in District Naushahro Feroze, Sindh, Pakistan
... Average number of 5.55 goats per households was reported by 35% of all the households. On an overall basis, 2,365 liters of buffalo milk was computed from 600 households, while 1,033 liters (43.7%) was used in households and 1,332 (56.3%) liters was sold. About 1,868 liters of cow milk were computed from 600 households, while 915 liters (49%) of milk used in households and 953 (51.0%) liters were sold. Majority of houses supply milk to milk collection agents ...
Muhammad Shakeel1*, Mudussar Nawaz1, Zahid Naseer1, Muhammad Fiaz1, Asghar Khan1, Muhammad Imran Khan1, Awais Ur Rehman1, Ahmad Yar Qamar2 and Ali Raza3
Caprine and Ovine Serological Evidence of Brucellosis in Five Districts of Punjab, Pakistan
... in different sheep and goat breeds in five districts of Punjab, Pakistan. A total of 1239 serum samples were collected from male (n=73) and female (n=1166) different sheep (n = 865; Pak-Karakal, Thalli, Lohi, Kajli and non-descript type) and goat (n = 374; Teddy, Beetal and non-descript type) breeds of variable age groups (0 months to 4years). All the serum samples were analyzed using Rose Bengal Plate Test (RBPT) and serop...
Amit Sharma1* and Pankaj Sood2
Sonographic Assessment of Ovarian Follicular Dynamics during Breeding and Non-Breeding Season in Gaddi Goats
...cular dynamics in Gaddi goats. Transrectal ultrasonographic ovarian examinations were carried out during a full estrous cycle in breeding (B; January-February, n=7) and 21 days in non-breeding (NB; May-June, n=11) seasons. Blood sampling on alternate days was done during both the seasons for serum progesterone (P4) estimations. Follicular growth was characterized by presence of three to five numbers of follicular waves in both seasons. Significantly higher (P&...
Abdul Jalal, Abdur Rab* and Naveed Ahmad
Aloe Vera Gel Coating Retains Persimmon Fruit (Diospyros kaki) Quality during Storage at Room Temperature
...re and decay incidence. Coating of persimmon fruits with 30% Aloe vera gel retarded the storage related changes and retained high fruit firmness, acidity and ascorbic acid as well as lower total soluble solids and decay incidence than control fruits. In control fruits (0 days storage + Distilled water treatment), the fruit firmness (3.33 kg cm-2), acidity (0.29%), and ascorbic acid content (46.25 mg/100g) decreased to 0.06%, 16.47 mg/100g and 0.56 kg cm-2, res...
Joseph Anejo-Okopi1*, Obinna Oragwa Arthur2, Ocheme Julius Okojokwu1, Sarah Joseph1, Geoffrey Chibueze1, Joshua Adetunji1, Joseph Ameh Okwori3, David Ochola Amanyi4, Otobo I. Ujah5 and Onyemocho Audu6
Seroprevalence of Rift Valley Fever Virus Infection among Slaughtered Ruminants in Jos, North-Central, Nigeria
...0 livestock (cattle and goats) at selected slaughter locations in Jos Metropolis. Questionnaires were administered to obtain information on animal species, sex, and localities of origin. The blood samples were screened for RVFV antibodies using competitive Enzyme Linked-immunosorbent Assays (C-ELISA) to detect anti-RVFV IgG/IgM. Eleven out of 100 samples tested positive for anti-RVFV antibodies (prevalence=11%). Seropositive cases were more among cattle (16.0%...
Zahir Shah1*, Saima Munawar1, Ihsan Ullah2, Taif Shah3, Haq Aman Ullah1, Saqib Nawaz1, Farhan Anwar Khan1 and Manoj Kumar Shah4
Combined Physico-chemical and Analgesic Effects of Electroacupuncture Plus Clonidine in Goats
... (EA) plus clonidine in goats. Thirty-six female goats were randomly allocated equally in six equal groups. The control group received 0.9% normal saline, 2nd, 3rd and 4th groups were treated with 10, 15, and 20µg/kg of clonidine respectively, while 5th and 6th groups were treated with EA and EA plus 10µg/kg of clonidine, respectively. Pain threshold, cardio-respiratory effects, rectal temperature, hematological ...
Moazam Ali1, Wajid Ali2, Ayhan Ceyhan2 and Zeeshan Ahmad Bhutta3*
Pigmentation Genome Influence in Animals and Human Interventions in its Course of Action
... pigmentation of fiber, coat, and hairs in animals. Melanin production in an intricate course is under the control of Melanocortin 1 Receptor, alpha Melanocyte stimulating hormone and Agouti signaling gene. In most animals, three different alleles encoding melanocyte-stimulating hormone receptor MC1R of extension (E) locus and ED allele determining the blackish coat color, a recessive e allele represented red c
Shahid Ahmed1,2*, Huiqing Su1, Xuqian Sun1, Peng Feng1, Yongpan Chen1, Liang Yu1, Qian Liu1 and Heng Jian1
Performance of Cereal Varieties against Cereal Cyst Nematode (Heterodera avenae)
... Beijing and 10 lines of oats from Jilin Province were screened against H. avenae. The results showed that 5 wheat and 7 oat lines ranked as resistant genotypes while 9 wheat and 3 oat lines were ranked as moderately resistant and 1 wheat line and the local check were highly susceptible to H. avenae. These genotypes need to be exploited in breeding program to introduce the resistance gene ...
Babar Zahoor, Basharat Ahmad*,Riaz Aziz Minhas and Muhammad Siddique Awan
...mong livestock (n=304), goats, sheep and cattle were reported killed between 2013 and 2015. The total estimated cost of livestock killings during 2103-2015 was $38260 and estimated cost ($25180) during 2015 was significantly different from 2013 and 2014 (χ2=19463.28; df=2; p≤0.001). During the study period livestock (n=8) and human (n=3) injuries, and one case of human killing by black bear were also reported. People of the area had negative ...
Zeki Aras1*, Gökçenur Sanioğlu Gölen1, Zafer Sayin2 and Ali Evren Haydardedeoğlu3
...nfertility in sheep and goats worldwide. The aim of this study was to investigate the presence of C. abortus in abomasum content of aborted sheep and goat fetuses from provinces of the Central Anatolia of Turkey by PCR. A total of 105 aborted sheep fetuses and 15 aborted goat fetuses were collected from 120 different herds in the lambing seasons 2015-2016. Chlamydial DNA was detecte...
Mudussar Nawaz1, Iahtasham Khan2, Muhammad Shakeell*, Arfan Yousaf1, Zahid Naseer1, Munibullah1, Ali Zohaib3, Riaz Hussain4 and Qudrat Ullah5
...llosis in buffaloes and goats of Islamabad Capital Territory, Pakistan. A total of 341 milk samples from buffaloes (n=180) and goats (n=161) were screened by (Milk Ring Test) MRT and milk i-ELISA for anti-Brucella antibodies. Higher prevalence was found in buffaloes (5.6% and 16.1%) than in goat (4.97% and 1.9%) both through MRT and i-ELISA respectively. Commercial production and ol...
Mumtazur Rahman1, Farhan Anwar Khan1,*,Umar Sadique1, Ijaz Ahmad1, Shakoor Ahmad1, Faisal Ahmad1,2, Hayatullah Khan1,3, Muhammad Saeed1, Faiz Ur Rehman1, Ibrar Hussain1, M. Faraz Khan1, M. Izhar ul Haque1 and Hanif-ur-Rehman1,3
...l ruminants, especially goats. It is an economically important disease, causing high morbidity and mortality in goats. More recently Mccp Pakistan strain has been identified and isolated by our laboratory. Alarmingly, antimicrobials in animals are inappropriately using and resultantly leading to antimicrobial resistance (AMR) including mycoplasmas, which are causing serious infections in ruminants. Since the growth curve of ...
Muhammad Yasir*, Mansoor ul Hasan, Muhammad Sagheer, Amer Rasul, Rameesha Amjad Ali and Habib ur Rehman
Evaluation of Spinosad Applied to Grain Commodities for the Control of Stored Product Insect Pests
... (wheat, maize, rice and oats) at concentrations of 0.25, 0.50 and 1 mg Kg-1 under laboratory conditions maintained at 28 ± 2oC, 65 ± 5% RH and continuous darkness. Seven bioassays were conducted by releasing the insects on treated commodities after different post treatment periods (0,1, 2, 3, 4, 5 and 6 months). The mortality of three insect species was recorded at tested concentrations in all the treated commodities after the exposure period of...
Masoud Hassani1* and Omid Madadgar2,3
Serological Evidence of Bluetongue in Iran: A Meta-Analysis Study
...uetongue, sheep, ovine, goat, caprine, cow, cattle, bovine, buffalo, camel, Iran and prevalence alone or in combination in both English and Farsi language. After reviewing 82 published articles, a total of 48 studies from 29 articles were eligible to be included in this meta-analysis study. The total seroprevalence of bluetongue in apparently healthy sheep, goat, cow and camel at animal level based on ELISA test was 50.4% (9...
Sidra Shehzadi, Sher Bahadar Khan*, Umar Sadique and Saqib Nawaz
Isolation and Molecular Identification of Clostridium perfringens Type D in Goats in District Peshawar
... particularly sheep and goat widespread in Pakistan due to endemic outbreak in every spring season; therefore the current study was conducted for isolation and molecular identification of new strains of C. perfringens Type D for effective diagnosis, treatment and vaccination. A total of 100 fecal samples were collected aseptically from four different zones of district Peshawar during the period of February, 2019 to April, 2019. C. perfringens ...
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
...nants (93 sheep and 107 goats) without any apparent signs of theileriosis were examined to diagnose Theileria piroplasms. During sampling, blood was amassed by puncturing the jugular vein in eppendorf comprising EDTA as anticoagulant coated tubes for the detection of Theileria piroplasms. DNA was extracted from collected samples and subjected to PCR amplification to determine ovine and caprine theileriosis. Through a questio...
Said Sajjad Ali Shah1*, Muhammad Ilyas Khan1, Aziz Ullah1, Hayat Ullah2 and Faisal Ahmad2
Coprological Examination of Small and Large Ruminants in Central Zone of Khyber Pakhtunkhwa
...% in sheep and 68.5% in goats. Trichostrongylus (32.8%) was recorded as highly prevalent in cattle followed by amoeba (10.2%) and Fasciola (6.1%), while in buffaloes fasciola was recorded higher followed by amoeba (19%) and Trichostongylus (5.35%). Haemonchus contortus was the most prevalent intestinal parasite in the study area followed by Trichostrongylus in small ruminants, whereas mixed infection in goats was recorded as...
Arnab Tanveer, Shabana Naz*, Azhar Rafique and Asma Ashraf
...smear method and fecal floatation technique was used for isolation and identification of endo-parasites. Modified McMaster technique was used to calculate Eggs per gram. The data was subjected to ANOVA and Tukey-HSD (post hoc test). Six species of endo-parasites were identified from Jallo Wildlife Park. Eimeria (7500) and Ascaris (1100) were the most abundant. Murree Wildlife park had only two species i.e. Eimeria (3850) and Strongyloid...
Zhen-Yang Wu1, Li Li1, Yu-Hua Fu2, Sheng Wang3, Qing-Ming An1, Xiao-Hui Tang4, Xiao-Yong Du3,5,* and Fei Zhou6,*
...Tibetan carpets and its coat color as one of important economic traits which can affect wool price directly. In this study, to investigate the functional roles of genes in Tibetan sheep skin with different coat colors, we sequenced genes from six skin samples using Solexa sequencing. The RNA-Seq analysis generated 63,283,784 and 63,644,062 clean reads in black and white skin, respectively. A total of 60 differentially expres...
Maria Syafiqah Ghazali1, Azlan Che’ Amat2 and Nor Azlina Abdul Aziz1*
...cysts by simple faecal floatation and formalin – ether sedimentation technique. All large felines in the zoo were infected with gastrointestinal parasites. A total of six species of gastrointestinal parasites were recovered including four nematodes (Toxocara cati, Ancylostoma spp., Toxascaris leonina, and Oxyuris sp.), a cestode (Spirometra sp.), and a protozoan (Isospora sp.). Half (n=5/10) of the large felines ...
Faiz Muhammad Khand1,Allah Bux Kachiwal2, Zubair Ahmed Laghari2, Shakeel Ahmed Lakho1, Pershotam Khattri2, Saeed Ahmed Soomro2, Nazar Ali Korejo2 and Ambreen Leghari1*
...estational age of teddy goat by B-mode ultrasound measurement of embryonic or fetal parts and uterine diameter throughout pregnancy by transrectal approach. Three parameters crown rump length (CRL), trunk diameter (TD), and uterine diameter(UD)were selected for measurement of gestational age with the weekly interval from 3rd week to 15 weeks of gestation of 12 pregnant teddy goats, all three parameters were...
Qin Liu1,2, Bin Wang1,3, Yu Xu1,4, Xiuyue Zhang1, Tao Zeng1* and Jianghong Ran1*
...ize: small;">The buff-throated partridge (Tetraophasis szechenyii), a sexually mono chromatic Galliformes species, is an endangered bird endemic to western China. Previous studies suggested that it had the behavior of facultative cooperative breeding, which was rarely reported in Galliformes. In this study, we isolated 17 tetra-nucleotide microsatellite loci to test parentage and kinship for a wild population with 29 individuals from 10 different famili...
Kamal Al-Samawi1, Mohamed Al-Hassan2, Hussein Migdadi3,4*, Megahed Ammar5 and Salem Alghamdi3
...n of pregnancy in Aardi goats compared to progesterone and ultrasound (US) were evaluated. Female goats were synchronized using the ovsynch protocol level in combination with natural mating (NM). Blood samples were collected at 1, 7, 15, 23, 35, and 60 days post NM. Levels of ISG15 and ISG17 mRNAs were assayed using real-time PCR, and serum progesterone (P4) concentrations were assayed using an ELISA kit...
Natalija Grittner1, Radomir Mandić2,* and Milivoje Urošević3
...cattle, buffalo, sheep, goats, pigs, chickens, geese, turkeys, ducks, guinea fowls, dogs and bees were analyzed. The number of populations these indigenous breeds in Serbia has been shown in this paper. It is proposed that 15 breeds (13 breeds and 2 strains), which are not protected by the Decree of the Ministry of Agriculture of Serbia on animal genetic resources, be included in the Decree in the future, in order to preserve and improve their numbers. An urge...
Tanveer Hussain, Masroor Ellahi Babar*, Akhtar Ali and Fiaz Hussain
...ope, wild yak, domestic goat, sheep, water buffalo and cattle for biological positioning of dromedary camel. The results reconfirmed the classical biological classification.
...
Muhammad Ihtisham1, Noor Amjad2, Muhammad Nauman3, Asghar Ali3, Khawar Riaz3, Muhammad Sajid3, Muhammad Owais Shahid*3
...erminate. The hard seed coat can be scarified successfully through acid treatment. Sophora is a beautiful ornamental plant and its seeds have the same issue. In this experiment, seeds of Sophora secondiflora were treated with H2SO4 and then sown at different dates. Both H2SO4 scarification and sowing time had a significant effect on germination and seedling growth. The seeds scarified with sulfuric acid for 135 min gave the maximum plant height (25.42 cm), lea...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
...he composition of Kilis goat milk in two different seasons on the basis of alcohols, ketones, aldehydes, esters, indoles, carboxylic acids, aromatic hydrocarbons and terpenes. Milk samples were collected at the early and late lactation periods from Hatay and Kilis, Turkey. During both periods, the goats consumed a diversity of plant species. Milk collected from Kilis had 15.27-16.10% total solids,5.70-6.50% fat and 4.80-5.10...
Rukhsar Ali* and Ali Muhammad
...rvatives i.e. sodium benzoate (SB), potassium metabisulphite (KMS) and potassium sorbate (PS) on physicochemical qualities (total soluble solids, pH, acidity, phenolic compounds, total sugars, antioxidant activity, Vitamin C content) and sensory evaluation as color, taste, and overall acceptability stored at ambient conditions (25±2⁰C) for six months with twenty days interval. Based on sensory analysis, the best suitable blend was selected within diff...
Ijaz Ahmad* and Bakhtiar Gul
...estivum L.) against wild oat (Avena fatua L.) and milk thistle (Silybum marianum L. Gaertn), the two most troublesome weeds of the wheat crop in Pakistan. Four treatments viz. wheat, wheat + S. marianum, wheat + A. fatua, wheat + S. marianum and A. fatua were examined to check their effect on the growth dynamics of wheat, A. fatua and S. marianum. The experiment was carried out in 2018-2019 using Completely Randomized Design (CRD) and replicated thrice. The re...
Naimat Ullah Khan1*, Muhammad Hassan Saleem2, Aneela Zameer Durrani2, Nisar Ahmad2, Muhammad Shafee3, Ayesha Hassan2, Mumtaz Ali Khan2 and Nadeem Rashid3
...of cryptosporidiosis in goats in three selected districts of southern Khyber Pakhtunkhwa (KPK), Pakistan. A total of 1440 fecal samples were collected from goats, 120 samples per month from each of 3 districts for twelve months. Identification of oocysts was done through conventional acid fast ZN staining. Prevalence in District Bannu was 48/480 (10%) followed by District Lakki Marwat12.08 % and in Kohat 19.16 %, respectivel...
Khurram Goraya1,*, Qais ALRawahi1, Sultan ALBalushi1, Hani ALSaadi1, Sami ALRahbi1, Zahir ALAlawi1, Muhammad Hammad Hussain2 and Madad Hussain1
...n bodies (n=3, 6%) and bloat (n=2, 4%). The exact cause of death could not be established in 5 (10%) mortalities. Internal organs were screened for the presence of adult worms. However, no parasite was observed in these animals. These findings demonstrated that more than 50% mortalities could be reduced by only controlling aggression-related injuries and taking precautionary measures against natural disasters like a cyclone. On the other hand, the absence of i...
Muhammad Yousif Jakhrai1, Ahmed Nawaz Tunio2, Ali Mujtaba Shah1*, Tarique Ahmed Khokhar1, Muhammad Mohsen Rahimoon1
... analgesia in sheep and goats were key points for this review. However, these research papers were included in this study, were published between from 1999 to 2017. The bibliographies of these references were also used for reviewing the High epidural anesthesia in small animals. However, a total of 29 articles were reviewed for this study. The scope of lumbosacral epidural analgesia and also its clinical application was studied. The most commonly anesthetic ag...
Muhammad Adnan Fahad1, Muhammad Jamal Khan1, Sheraz Ahmed2* and Imtiaz Ali2
... current meter and cutthroat flume, respectively. Farmers were interviewed to find out the effect of watercourse improvement on crop productivity and water management practices using questionnaire proforma. The losses in five improved watercourses (lined sections) were 9, 28, 5, 11 and 20% per 1000 meter, respectively while that of unlined sections of the same watercourses were 23, 30, 50 and 21 % per 1000 m, respectively. Losses in unimproved watercourses wer...
Iqra Muzammil1, Muhammad Ijaz Saleem1, Amjad Islam Aqib2,*, Ambreen Ashar3, Syed Ashar Mahfooz1, Sajjad ur Rahman4, Muhammad Shoaib4, Muhammad Aamir Naseer1, Imran Khan Sohrani1, Javeed Ahmad1, Razaullah Saqi1, Fizzah Laeeq Lodhi1 and
Qaisar Tanveer5
...e nutraceutical milk of goat in agrobased countries is at risk of contamination with pathogenic strains of Staphylococcus aureus. The current study was designed to investigate prevalence of pathogenic strains of S. aureus, assessment of risk factors, and in-vitro antibiogram of non-biofilm producing S. aureus (nbpSA) and biofilm positive S. aureus (bpSA)from mastitic goats. The purposive sa...
Muhammad Khalid Mukhtar*, Sania Waliat, Shafaat Yar Khan, Naila Amjad
...nst bifenthrin and dimethoate was 11.068 µg/ml and 8.879 µg/ml, respectively. LC50 for field strains, Bhalwal L1 and L2, against bifenthrin was 96.184 µg/ml and 130.903 µg/ml, respectively whereas against dimethoate it was 74.340 µg/ml and 84.531 µg/ml, respectively. The resistance ratios for field strains of locations 1 and 2 against bifenthrin were 8.690 fold and 11.827 fold, respectivel...
Qudsia Nazir1, Muhammad Aftab1*, Ghulam Sarwar2, Aneela Riaz3, Sarfraz Hussain1, Ifra Saleem1, Amina Kalsom1, Noor-Us-Sabah2, Mukkram Ali Tahir2, Ateeq-ur-Rehman4 and Muhammad Arif1
...e prepared including Zn coated, bio-activated Zn coated and Zn blended urea at the 1.5% rate of formulate. The bio-activated Zn coated urea was prepared by inoculating the powdered organic material with Zinc solubilizing bacterium and then this material was mixed with ZnO. This bio-active Zn was coated on urea at 1.5% rates to formulate. Moreover, Zn ble...
Muhammad Irfan Ullah1*, Sana Majeed1, Muhammad Arshad1, Nimra Altaf1, Muhammad Luqman2, Asad Abdullah1 and Muhammad Afzal3
... effect of emamectin benzoate 1.9% EC alone and with botanicals; Parthenium hysterophorus L. and Moringa oleifera L. on the digestibility indices and survival of Spodoptera litura (Fabricius) (Lepidoptera: Noctuidae). The P. hysterophorus extract at 50 mg concentration was comparable to the alone application of emamectin benzoate in terms of reduced digestibility and survival of S. litura. Overall, 42.7% relative consumption...
Arshad Ali1, Muhammad Nasir Khan Khattak2*, Muhammad Ali Nawaz3 and Shoaib Hameed3
...the area that killed 15 goats, 2 sheep, and 4 cattle. The snow leopard and wolf predation was 31% and 39%, respectively. To estimate the occurrence, 10 transects were laid out in each survey area with 100 m length and 50 m width. Each transect was laid out with minimum distance of one km from each other. Higher sign density was found in the forest compared to the other habitats. Twenty brown bear signs were recorded at four sites of the study area. According t...
Ahmed A. Kheder
...d to amplify ~497bp for coat protein gene in RNA 2, the amplified product was confirmed with direct sequences. Phylogenetic analysis results indicated that SLRSV-Eg isolate under study (acc. no. MT648777.1), showed 65.9 – 99.5% nucleotide similarity with available homologous sequences from other crops. Reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of the most promising molecular diagnostic techniques was applie...
El-Habbaa, A.S.
...n sheep and
goats worldwide and in Egypt. Forty samples of skin lesions from suspected 30 sheep
and 10 goats from different areas of Qaliubeya governorate were subjected
tovirusisolation on embryonated chicken eggs (ECE), antigen detection using agar gel
immune-diffusion test (AGIDT) and indirect-Immunofluorescence assay (IFA) and
molecular detection of viral DNA us...
Abeer A. Feisall; B.A. Othman2; Kh.A. El-Dougdoug2 and H.S. Shalaby1
...div>than 15%; sodium benzoate at concentration of 0.5%; potassium sorbate at
concentration of 1.0 % and citric acid at concentration of 1.0% as well as in
presence of 5% of either Sodium hypochlorite or SDS. The phage DNA was
resistant to digestion with PvuI, BamHI, XhoI and EcoRI. The genome size of the
phage was estimated to be 18 kbp.
...
El-Bagoury, G.F., El-Nahas, E.M., El-Habbaa, A.S.
...buffaloes. Twenty Buffy coat samples were collected from each clinically infected cattle and buffaloes in Qaluobia province during the year 2014. The virus was isolated on BHK-21 cell line. Infected cells with BEFV showed 80% cytopathic effect (CPE) after 48 h by the 3rd virus passage. The isolates were serologically identified by neutralization and immunoflourescence techniques, and then molecularly identified using reverse transcription polymerase chain reac...
Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc
...n AI Antibody ELISA kit coated with AIV nucleoprotein and hemagglutination inhibition (HI) test against H5 and H9 antigens. The overall results using both ELISA and HI tests revealed that the prevalence of AIV antibodies was 12.6% (18/143). The seropositive samples represented 5/143 and 15/108 for ELISA and HI, respectively. The detection of both H5 and H9 antibodies in (4) samples indicated that co-infection may occur, while (10) samples were only containing ...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1
...as non-significant. The coat protein gene of
SLCV was PCR amplified from infected common bean plants. SLCV-CP was cloned in
pJET cloning vector and directly sequenced. The sequence alignment and phylogenetic
analysis showed a relatively high diversity among the three different isolates that the
identity ranged from 89 to 94%.
...
Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1
... specific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis....
Aly M. Abdel-Salam1 and Samah A. Mokbel2
...ate primer pair for the coat protein (CP) gene of Ilarvirus amplified products
similar to those produced from peach and apricot isolates of NRSV-infecting stone
fruits. Dot blotting immuno-binding assay (DBIA) showed positive reaction between
NRSV-infected apple sap and an Egyptian antiserum for NRSV. Purified preparation
from infected leaves, using the electro-elution technique yielded nucleoprotein which
...
Sahar Abd El Rahman1; Mohamed Eladl2 and Mohamed M. El-Diasty3
...Twelve samples of buffy coats were collected from dairy farms suspected from clinical investigations to be infected by bovine ephemeral fever virus. The virus was isolated intracerebrally in suckling mice then successfully identified by indirect immunofluorescence technique in the brain sections of positively inoculated mice. Reverse transcriptase polymerases chain (RT-PCR) reaction was performed directly on buffy coat sampl...
A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3
...eotide sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the isolates from Sudan, Iran and the other isolate from Saudi Arabia. The analysis showed that the highest nucleotide identities were 100% with other isolates that isolated fr...
Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2
...al disease of sheep and goats with high morbidity and mortality rates. A live attenuated PPR vaccine has been produced in Veterinary Serum and Vaccines Research Institute (VSVRI), Abbasia. It has and still been utilized to control PPR disease in endemic areas of the Arabian Gulf. In this study, the identity of four batches of PPR vaccines was tested as per the Office International des Epizooties (OIE) guidelines and Couacy-Hymann et al., 2002 using RT-PCR tech...
Asfand Raheel1, Syed Zulfiqar Ali2, Muhammad Waris2, Muhammad Basharat2, Basheer Ahmed2, Muhammad Arshad Ullah3, Syed Ishtiaq Hyder4 and Taqi Raza4*
...atural products, edible coatings and heat treatments can be efficaciously applied in a vast and specific commodity range to prevent great losses....
Aly M. Abdel-Salam
...PCR was used to amplify coat protein genes for the two viruses using specific primers. DAS-ELISA and immuno-blotting were used for evaluating the induced antisera. Results: Antisera for CYSDV and CVYV were produced efficiently and used for virus diagnosis through DAS-ELISA, DBIA, and TBIA. RT-PCR confirmed the nature of the two viruses. However mixed infection was noticed for CVYV and CVYV upon using duplex RT-PCR. Conclusion: Mixed infection with WTV is commo...
Salama M. El-Saghir1, 2
...ied 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence of PVS in Egypt for the second time; yielding 187
bp of the virus c
Abdullah Sheikh1,*, Faisal Almathen1,2 and Hairul Islam Mohamed Ibrahim3,4
...gene associate with the coat color of the animal. This is the first study of TYR gene expression analysis from various dromedary or Arabian camel (Camelus dromedarius) phenotypes from Saudi Arabia. The four camel groups included were white, diluted (light brown, creamy and fawn), black and dark brown representing eumelanin and pheomelanin coat colors. Generally, the TYR gene expresses less in non-pigment...
Coronavirus Disease (COVID-19) with Special Reference to Pakistan: A Review on its Different Aspects
Sahar Mubashar*, Tariq Mukhtar and Nasir Ahmad Khan
...ever, dry cough, sore throat, fatigue and diarrhea and shortness of breath in severe cases. The virus attacks throat, lungs and trachea converting them to virus factories to infect more cells. It attacks not only lungs but also other vital organs of the body like kidneys and heart. It is spread from human to human through respiratory droplets or direct contact. Moreover, there have been reports of the mixed infection of coro...
Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2
...ly related to sheep and goat pox. In Egypt, the protection from lumpy skin disease (LSD)
among cattle population was carried out using sheep poxvirus vaccine. Last year (2016-2017) revealed
many cases of LSD in sheep pox vaccinated cattle in Egypt.
Objective: In this study LSDV was isolated from sheep pox vaccinated cattle showing LSD signs to
confirm LSD viral infection even in sheep pox vaccinated cattle.
...
Ayman S. El-Habbaa1 and Mervat E. Radwan2
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...routs
using coat protein gene specific primers with an expected amplicon of 520 bp. Electron Microscopy
examination revealed that, the viral particles were slightly flexuous rod shape with about 680 x 13 nm
in size. Ultrastructure analysis showed different degrees of chloroplast degradation in PVM-infected
potato leaf tissues.
Conclusion: Occurrence of PVM was detected and confirmed in commercial pota...
Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2
...e performed for the AMV coat protein (CP) gene. An amplicon of the
predicted size (∼666 bp) derived from O. basilicum isolate was purified and cloned in E.Coli
into pCR®4-TOPO vector before proceeding to DNA sequencing and the alignment of
sequences.
Results: Electron microscope examination of negatively stained preparations from
symptomatic basil leaves revealed viral particles have a bacilli...
Ahmed M. Soliman
...rimers designed for the coat protein gene of CMV were used to detect the virus. RT-PCR products (657 bp) of coat protein gene of CMV were cloned and then sequenced.
Results: CMV was isolated from four vegetable crops (cucumber, tomato, pepper and watermelon) using ELISA and RT-PCR assays and the coat protein gene of the four isolates were submitted to GenBank. The CMV isolates ...
Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder
...culum. Detection of the coat protein gene of
CMV in infected leaves has been done by reverse transcriptase-polymerase chain reaction (RT-PCR),
and the appearance of 678 bp bands confirmed the expected size of such gene. Light and transmission
electron microscopy were used to study the cytological and histological changes that occurred in the
leaves of the sugar beet plant by the pathogen, as well as, to determine...
Arbab Zubair Ahmad1, Farman Ullah1, Hayat Badshah2, Muhammad Shehzad Khan1* and Bashir Ahmad1
...018. The cereals (maize, oat, wheat and barley) were evaluated on the basis of total adult emergence, egg laying ability, developmental time of S. cerealella and enhancing parasitism along with sex ratio of T. chilonis raised on eggs from moths reared on cereals. The response of cereals to S. cerealella in no choice test revealed significantly greater adult emergence (18.9±12.6) and egg laying efficiency (82.2±6.8 eggs/female) with shortest devel...
Kai Jin1,2,3, Chen Chen 1,2,3, Xinyu Sun1,2,3, Caiye Zhu1,2,3, Mahmoud F. Ahmed1,2,3,4, Qisheng Zuo1,2,3, Jiuzhou Song4 and Bichun Li1,2,3*
...yle="font-size: small;">Goat (Capra hircus) stearoyl-CoA desaturase 1 (SCD1) plays a crucial role in fatty acid metabolism including milk and muscular fatty acid. This study investigated the expression of SCD1 gene in goat and examined its inheritability and expression in transgenic SCD1 mice and goats. Our results suggested the possibility of generating transgenic g
Zunaira Noreen* and Khawar Sultan
...ow, common myna, grey-throated martin and bank myna, recorded >95% of the total population of birds. Species evenness was the highest for lake site (E= 0.938) indicating the most balanced type of ecosystem. Sparrows were found only in urban areas. Two opportunist species (house crow and common myna) were found to be the most successful in exploiting available resources. Foraging of birds in layers with aggressive species feeding first and development of new...
Yanqiang Zhou1, Lixin Wang1, Chunxiao Hao1, Xiuyun Li2, Shakeel Hussain1, Dongdong Shen1, Zhiwei Peng1, Qi`an Zhai1 and Zhijun Hou1,*
...ildebeest, alpacas, and goats with same husbandry and fence site in Harbin Zoo, China. From August 2015 to August 2016, 507 fecal samples of blue wildebeest (188), alpacas (195) and goats (124) were examined for gastrointestinal parasites by saturated sodium chloride floatation technique. The microscopic analysis, based on the morphology of oocysts, indicates that the present parasites are...
Waqar Ali1,3*, Muhammad Yaqoob2, Abida Arshad1, Guifu Dai3,Safir Ullah Khan1, Muhammad Arshad Malik4, Imran Ullah1 and Ihsan Ullah1
...dependently from beetal goats were tested for prevalence of clinical and subclinical mastitis through surf field mastitis test. The bacterial isolates identified through different biochemical test and colony morphology from positive milk sample were Staphylococcus aureus (25.4%), Escherichia coli (20.3%), Streptococcus (16.9%) in which (6.7%) Streptococcus agalactiae, and (10.1%) other streptococcus species, Pseudomonas aerugi...
Diana Rachmawati1*, Johannes Hutabarat1, Olga Anne2, Roy Hendroko Setyobudi3 and Tita Elfitasari1
...ture environment. Floating net aquaculture engineering of tiger grouper (Epinephelus fuscoguttatus Forsskål, 1775) on Bacillus subtilis supplementation in the diet is one of the solutions to overcome the deterioration of the aquaculture environment caused by the accumulation of dieting waste. The purpose of the research was to study the effects of B. subtilis supplementation in the diet on protein digestibility, the efficiency o...
Hafiz Muhammad Tahir*, Iram Liaqat*, Junaid Nadeem, Hammad Aamir and Shaukat Ali
...gregate gland secretion coating its surface, hence a borrowed property. Our study used direction application and disk diffusion method to investigate the antibacterial potential of Neoscona mukherji and N. theisi egg and web silk. For disk diffusion method, silk was first degummed to form degummed silk solution’ (DgS), then the degummed silk was dissolved to form the dissolved silk solution (DSS). The DgS and DSS solutions were tested against selected co...
Anwar Khan1, Fareeha Nosheen2,4, Bushra Tabassum2*, Olawale Samuel Adeyinka2, Khurram Shehzad3, Naila Shahid2, Arif Muhammad Khan4 and Idrees Ahmad Nasir2
...yle="font-size: small;">Coat protein gene of potato virus X is a structural protein that plays a vital role in viral transmission and pathogenesis. RNA interference or post transcriptional gene silencing is a regulatory conserved mechanism that uses small interfering RNAs to control the expression of desired gene by inhibiting mRNA transcription. The present study aims to investigate the potential role of different siRNAs in down-regulating the mRNA expression...
Usman Asghar1*, Muhammad Faheem Malik1, Umer Rashid2, Naeem Mahmood Ashraf2, Sumera Afsheen1 and Muhammad Hashim1
...issues of cow, buffalo, goat, donkey and a dog. A set of degenerative primers was designed for Polymerase Chain Reaction (PCR) of the cytochrome b gene fragment. All PCR was accomplished at the same reaction conditions. Amplified products had a length of 400 bp, which was our estimated length. After the sequencing of these amplicons, In silico restriction analysis was performed for each specie. Restriction endonuclease TfiI was selected for further analysis. R...
Raheela Noor Memon1*, Nadir Ali Birmani1, Naeem Tariq Narejo2 and Shahnaz Rashid3
...arasites in Cyprinuscarpioat Chilya, Fish Hatchery, Thatta, Sindh from February 2019 to January 2020. A total of 107 samples of Cyprinuscarpio were tested during the research and helminths were found in 17 out of 107. Various helminths groups were identified including trematode and acanthocephalan. Other helminths groups, such as cestodes and nematodes were not noted. These helminths infected the gut of Cyprinuscarpio including trematode and acanthocephalan. N...
Tajnees Pirzada1*, Weenghar Ali Chandio1, Mansoor Ali Kalhoro2, Mir Munsif Ali Talpur1, Waheed Ali Mirbahar1, Abdul Ghafar Solangi1, Zulfiquar Ali Jumani1 and Rehana Kerio1
...les and humic acid (HA) coated nanoparticles were evaluated for Brassica campestris seed germination. A simple one-pot method was used to synthesize HA/ZnO NPs involving zinc oxide nanoparticles (ZnO) core (20-35 nm in diameter) and humic acid shell. HA/ZnO NPs were used to investigate the effect on the germination profile of Brassica campestris. Germination profile parameters were measured as root-shoot length, germination index, fresh and dry weight for 15 d...
Farhat Iqbal1, Abdul Waheed2*, Zil-e-Huma3 and Asim Faraz2
... measurements of beetal goats (1 – 7 years in age) of Pakistan. In order to test the performance of candidate methods, various evaluation measures such as the mean absolute error, root mean squared error, mean absolute percentage error, coefficient of determination and the correlation between the actual and predicted body weights were calculated. A 10-fold cross validation was used on the training dataset for tuning the hyperparameters of the models wher...
Manar M. Farouk1*, Amal El-Molla1, Fayez A. Salib1 and Yousef A. Soliman2
...ome diarrheic sheep and goats belonging to mixed reared flocks in Giza governorate, Egypt, 2) Investigate the presence of enterotoxin(stn) gene in the recovered Salmonella spp. strains, and 3) Build a phylogenetic tree for the partial codon sequence of stn gene of some recovered strains in order to provide a scientific basis for the implementation of practical preventive measures. A total number of 518 diarrheic sheep and g
Nida Sadaqat1, Abdul Wajid2, Quratul Ain2, Muhammad Zia Akbar2, Farkhanda Manzoor4, Muhammad Sarwar Khan1, Nasir Ali3, Masroor Ellahi Babar3 and Tanveer Hussain3*
...al tissues in sheep and goats. Scrapie resistant/susceptibility have been associated with the presence of PRNP gene polymorphisms. We analyzed the polymorphisms in PRNP gene sequences in 49 wild Punjab urial (Ovis vignei punjabiensis). Four novel amino acids polymorphisms (p.Q149E, p.Q155E, p.Y228L and p.L253F) were detected in PRNP gene. The urial was monomorphic at codon 149 and 155 and polymorphic at codon 228 and 253. These amin...
Amina, Muhammad Zahid Rashid and Amina Rashid
...te the role of chitosan coating on partially mature guava to retain good quality and prolong shelf life in cold (11°C). Different chitosan concentrations i.e. 20% 30% and 40% were coated and stored at 11°C temperature. These fruits were compared with control (non-treated) fruit after 15 days. It was observed that the fruits coated with 40% chitosan showed minimum weight losses of 1...
Iffat Nawaz1*, Tahseen Zeb1, Bibi Saima Zeb2 and Javaria Sherani3
...ation, seed shape, seed coat pattern and seed color) was studied by using standard Chi square test for homogeneity of populations. Results showed that agro climatic conditions have no influence on the qualitative traits. Secondly, each landrace has its own specific and distinguishing trait like flower color, growth habit. Moreover, the traits were found highly heritable and genetically controlled as no environmental influence was observed based on two years da...
Muhammad Usman Hanif, Abu Bakar Muhammad Raza, Muhammad Zeeshan Majeed*, Muhammad Arshad, Muhammad Irfan Ullah
...ides (i.e. emamectin benzoate 1.9 EC, spinosad 240 EC and lufenuron 50 EC) and the aqueous extracts of three local plant species (i.e. Eucalyptus camaldulensis Dehn., Citrus limon L. and Azadirachta indica A. Juss) against the grubs and adults of E. vigintioctopunctata. Three concentrations of each synthetic insecticide (i.e. 2.5, 2 and 1.5%) and botanical extract (i.e. 10, 7.5 and 5%) were bioassayed using standard leaf-dip method. Results revealed that spino...
Mohammed Naji Ahmed Odhah1,2*, Dhary Alewy Almashhadany6, Abdullah Garallah Otaifah7, Bashiru Garba5, Najeeb Mohammed Salah2, Faez Firdaus Abdullah Jesse4*, Mohd Azam Khan G.K3
...s of cattle, sheep, and goats) slaughtered in the abattoirs in Dhamar Province-Yemen. The samples were collected from the Central Corporation Slaughterhouse in Dhamar-Yemen from January 2019 to November 2020. During this period, a total of 29,071 and 5,705 samples were collected from local and imported food animals respectively. The results of analysed samples revealed that the distribution of the hydatid cysts among the local slaughtered animals were 318 (11 ...
Tilahun Woretaw1, Netsanet Beyero2*, Yonatan Kassu3
...ves, oxen, bull, sheep, goat, and equine, respectively. The drinking mixture of P. schimperiana in milk, and water was higher during the dry season and lowered during the wet season. The estimated biomass yields were 4.34±0.13 kg and 5.56±0.119 kg in the dry and wet seasons, respectively. Further feeding trial experiments should be conducted on live animals especially on a dairy animal for studying the response, for optimal production, productivi...
Ijaz Rasool Noorka1,2*, Bilal Ahmad Khan3*, Kafeel Ahmad4, Zafar Iqbal Khan4, Muhammad Ather Nadeem3, Amer Nawaz2, Tasneem Ahmad5 and Humayun Bashir4
...rsquo;s (Cow, Sheep and Goat) and two origins (Blood and Feces) were selected. Standard samples preparation methods were worker to check occurrence of the heavy rock’s metals in the forage and soil samples. The Atomic Absorption Spectrophotometer was used to check Iron (Fe). The results revealed that Fe were found in safe limit, as per WHO. ...
Shireen S. Aboelwafa¹, Alsagher O. Ali², Rania Hamada³, Hassan Y.A.H. Mahmoud2*
...ry especially sheep and goats. Sheep and goats are thought to be biological indicators of environmental contamination with T. gondii and N. caninum oocysts. In addition, in developing countries such as Egypt, where sheep and goat meat is commonly consumed, T. gondii and N. caninum infection in small ruminants may also affect public health risks. So that we estimate the prevalence of T. gon...
Kusuma Adhianto*, Satria Ibnu Lenanto, Akhmad Dakhlan, Muhamad Dima Iqbal Hamdani
... developing one type of goat family, namely Saburai goat. The Saburai goat is a meat goat type from = grading up between male Boer goat female Etawa Grade (PE) goat. The objectives of this research were to find out the value of genetic and phenotypic correlation between weaning weigh...
Elfadil Elfadul Babiker1, Khalid Ahmed Abdoun2*, Fahad AL Juhaimi1, Kashif Ghafoor1, Riyadh Salih Aljumaah2 and Ahmed Abrahim Al-Haidary2
...n the serum of ewes and goats fed on alfalfa hay-based diet (AHD) supplemented with 25% Moringa oleifera (MOD) or Moringa peregrine (MPD) leaves. Thirty ewes (2 years old and 50-60 kg BW) and 30 goats (2 years old and 35-40 kg BW) were randomly allocated to 3 experimental groups, consisting of 10 ewes and 10 goats each. The 3 experimental groups of either ewes or g...
Tintin Rostini1*, Irwan Zakir1, Danang Biyatmoko2
...erformance of Jawarandu goats. In this study were used total of 20 goats Jawarandu, 1.-1,5 years old, weighing about 13,46±1.55kg. were divided into four treatments consisting of TR0 (basal ration of palm waste-based local feed without Curcuma and yeast), TR1 (basal diet with 0.5% yeast), TR2 (basal diet with 2% Curcuma flour) and TR3 (basal diet with 0.5% yeast and 2% Curcuma flour). Meanwhile, the variables measur...
Sadaf Shahid1, Abdul Razzaq2, Gul-Makai1, Asim Shamim3*, Hafiz Muhammad Rizwan4, Rana Hamid Ali Nisar5, Qaiser Akram6, Mohsin Nawaz3
... in different breeds of goat and sheep. A total of 840 animals were investigated during the winter and summer seasons to determine ticks prevalence. The overall prevalence of tick infestation in the sheep and goat population of the Quetta district was 12.26%. Five species of ticks i.e. Ixodes (3.98%), Haemaphysalis (1.90%), Hyalomma (7.38%), Rhipicephalus (7.14%), and Boophilus (2.62%) were prevalent in the study area. A non...
Lungile Gumede1,2, Thobela L. Tyasi1, Teedzai Chitura1*, Khanyisile R. Mbatha3
... diets of wether BaPedi goats following vaccination with blanthrax vaccine. Twelve clinically healthy BaPedi goats with an average body weight of 19 ± 1.47 kg and an average age of 11±0.26 months were randomly selected from the flock at the University of Limpopo experimental farm. The experiment was conducted in three phases which are adaption, vaccination and moringa inclusion over 42 days. At the end of the f...
Noura El-Shahat Attia1*, Abd El-Khalek Ramadan El-Sheikh1, Mohamed Omia Siam2
Bikash Puri1, Anil K. Tiwary2, Bharata Regmi3,4, Dinesh K. Singh1, Doj R. Khanal5 and Manoj K. Shah3*
...tle, buffalo, sheep and goat) and screened for Bluetongue virus (BTV) antibodies in sera using a cELISA kit. Out of 220 sera samples, 92 were positive for BTV, accounting for 41.8% prevalence in ruminants. Seroprevalence rate was the highest in Buffaloes (58.3%) followed by sheep and goats (each 40%), and cattle (37.5%). The BTV seropositivity varied significantly (p<0.001) among ruminants in different sampling areas with...
Sana Khalid1,2*, Muhammad Zia-ur-Rehman2,3, Usman Hameed2,4, Shabnum Shaheen1, Muhammad Naveed Shahid5, Khajista Jabeen1, Farah Khan1, Muhammad Saleem Haider1
... justify;">Gemini virus coat protein (CP) is an important element of vector specificity and mandatory for insect transmission as well regardless of the type of gemini virus. This study was planned to conduct virus acquisition and transmission experiments using screen cages in an insectary for the period of one month. For this purpose non-viruliferous whiteflies (B cryptic species) were reared and used to acquire the viruses for 48-72 h from the agroinfiltered ...
Asmaa Sh. Fayed1*, Safaa M. Abo El-Soud2
...igerated storage. After coating meat samples, we analyzed their microbial, chemical, and sensory properties after 0, 3, 5, 7, 9, and 11 days of chilled storage. GA/ zein wax sheets significantly reduced (p < 0.05) the abundance levels of total bacteria, and psychrotrophic bacteria, as well as pH, thiobarbituric acid (TBA), and total volatile base nitrogen (TVB-N), especially for 4% GA/ zein wax film. The coatings resulted...
Muhammad F Tajol Ariffin1, Chai M Hian1, Muhammad Z Sukiman1, Mohd F Ghazali1, Siti M Zainal Ariffin2*
...subclinical mastitis in goats. Thirty lactating goats were divided into two groups (n=15 per group) challenged either by intramammary infusion of 1 x 103 cfu/mL Staphylococcus aureus (S. aureus) or phosphate-buffered saline (control). The haptoglobin (Hp), serum amyloid A (SAA) and α1-acid glycoprotein (AGP) levels in serum and milk were measured at pre-and post-infection (6, 24, 48 and 72 h) using the ELISA method. Th...
Mariam Arain1, Asghar Ali Kamboh1* and Muhammad Javed Arshed2
...nd immune parameters in goats. Twelve female cross breed goats (BW: 10-12 kg) were equally divided into two groups i.e., Control that offered basal diet and Se supplemented group that offered basal diet + selenium yeast (0.15mg/kg BW). In basal diet concentrate was fed at the rate of 2% body weight while roughage (hay)was given as ad-libitum. The dietary treatments were continued for 2 months. The results showed that microbi...
Taghreed Mohamed Nabil1, Randa Mohamed Hassan1, HebatAllah Hamdy Mahmoud2, Mohamed Gomaa Tawfiek2, Usama Kamal Moawad1*
...ickness of the muscular coat, which allow the turkey hens to be adaptive for egg formation and transportation along their reproductive tract during the egg-laying period.
Keywords | Histochemistry, Laying Turkey hens, Oviduct, SEM, Sperm host glands
...
Mashakgene Isaac Senoamadi, Thobela Louis, Tyasi Teedzai Chitura*
...hundred and sixty-three goats were evaluated for clinical haemonchosis using the FAMACHA© diagnostic system. Information on the methods of control used by the smallholder farmers was gathered through a questionnaire-based survey that was carried out by interviewing forty-seven Small ruminants farmers (both males and females) of mixed ages. The average FAMACHA© score for the goats was three while for sheep the avera...
Amira M. Nowier1, Hassan R. Darwish2, Sherif I. Ramadan3, Nadia A. Abo El-Maaty2 and Othman E. Othman2*
...ne among three Egyptian goat breeds (Zaraibi, Damascus and Barki) and to investigate the effect of α-lactalbumin gene polymorphism, goat breed, type of birth, season of kidding, litter size and lactation stage on body weight and milk yield traits in Egyptian goats. One hundred and sixty blood samples were collected for DNA extraction; 74 from Zaraibi, 41 from Damascus, and 45 from Ba...
Treatment Approaches of Ovine Fungal Diseases using Antibiotics and Ethnoveterinary Medicinal Plants
Djadouni Fatima* and Meliani Amina
...gn: justify;">Sheep and goats are both small ruminants with wide distributions due to their production of milk, wool, and meat. As such the diseases of these animals are of great economic importance to humans. Poor nutrition, poor breeding, poor hygiene and poor management systems are the most responsible factors of these diseases that cause annually significant livestock losses affecting the economy, animal diversity and ecological balance. These diseases are...
Jabbar Khan1, Mehwish Jehan1, Zeeshan Mutahir2, Muhammad Rafi1, Muhammad Ismail1, Aamer Abbas1 and Jabbar Tanveer3
...gn: justify;">Nurturing goat is a traditional profession of marginal farmers and landless workers in different regions of under-developed countries. The present study was conducted to determine the effect of vitamin E and selenium (Se) on physiological and hormonal status of Damani goat in Dera Ismail Khan, under high ambient temperature. Forty Damani healthy, non-pregnant goats having sim...
Ahmed M. Darwish1*, Hassan R. Darwish1, Dalia M. Mabrouk1, Mohamed A. Abdelhafez1, Ahmed M. Abdel-Salam2, Ibrahim E. Mohamed3, Ibrahim M. Farag1
...in Zaraiby and Damascus goats. 80 samples of blood and milk were collected from farm animals in Sakha, Egypt. The potential of hydrogen (pH), fat, protein, lactose, and solid not fat (SNF) were determined by biochemical methods in all milk samples. Different genotypes of β-LG and LEP genes were detected by single-strand conformation polymorphism (SSCP-PCR), and then validated by sequence analysis. The results of SSCP-PCR showed a monomorphic pattern for t...
Thobela Louis Tyasi1*, Lubabalo Bila2, Nkgaugelo Kgasago3, Siza Mthi4
...th African non-descript goat kids. A total of 46 new-born South African non-descript goat kids (30 females and 16 males) were used for the study. Analysis of variance and Pearson’s correlation were used for data analysis. Results showed that the mean live body weight of females and males was 2.11±0.05 and 2.76±0.12 respectively. Correlation analysis revealed that body weight (BW) was positively correlated...
Uzochukwu Ephraim Emeto, Chukwuemeka Calistus Okolo* and Nwakaego Ernestina Nweze
... containers for faecal floatation test and haematocrit determination. Gender and body condition scores (BCS) of horses were noted, while age groups and body weight were estimated by dentition and normogram methods respectively. The results showed that 89.9% [confidence interval (CI) 86.4%, 93.4%] of the horses harboured gastrointestinal endoparasites including strongyles (81.3%), Parascaris equorum (8.2%), Oxyuris equi (21.1%), Strongyloides westeri (13.5%), A...
Basanta Kumar Adhikari1*, Deepak Subedi1*, Sumit Jyoti1, Krishna Kaphle2, Chet Narayan Kharel3, Doj Raj Khanal4
...of Nepal. A total of 89 goat serum samples were tested by using a competitive enzyme-linked immunosorbent assay (c-ELISA) for the presence of antibodies against Mycoplasma capricolum capripneumoniae. Out of the total serum sample tested, 3 were seropositive for CCPP giving an overall apparent seroprevalence of 3.37% and true seroprevalence of 3.4%. Significantly higher seroprevalence (p<0.05) was observed among goats with...
Syarif Husen1*, Devi Dwi Siskawardani2, Setiawan Deny Rexmardi1, Erny Ishartati1, Muhidin Muhidin1, Jumpen Onthong3 and Ivar Zekker4
...arcoal+cocopeat+bokashi(goat manure) + bokashi(cowmanure), andhuskcharcoal+ cocopeat+bokashi(cow manure) + bokashi(poultrymanure)resulted13.38stemcutting(G0). The beneficial roles of bokashi in increasing organic matters concentration in the soil, and it was able to repair air and groundwater systems that supported plant roots growth and optimum capability to absorb nutrients.
...
Tabassum Ara Khanum, Nasir Mehmood* and Shahina Fayyaz
...aculum slightly curved, boat shaped with flat distal end eight pairs of bursal papillae were present. Tail (46-68) µm long conical with fine tip, leptoderan bursa. Female 1223-1742 µm long, anterior to middle vulva 48.7 (37-55) % tail filiform 156-206 µm long, 7-18.7 times as anal body width long. Detailed taxonomical studies of new species are given with measurements, descriptions, illustrations and photomicrophotographs along with bri...
Zilu Zhang1, Ning Wang2, Ce Hou1, Laiba Shafique1, Saif ur Rehman1, Zhuyue Wu2, Zhiqiang Wang1, Mingsong Wei3* and Kuiqing Cui1*
...">Studies have reported goat Polled Intersex Syndrome(PIS) a 11.7-kb deletion triggers intersexuality and polledness in goats. To determine the effect of PIS region on horned phenotype of Guanzhong dairy goats, four specific primers (PIS1-1, PIS1-2, PIS2 and PIS3) covering PIS fragment were designed, and four DNA fragment were amplifed and sequenced. A 12.814kb sequence was assembled conta...
Tariq Mahmood1*, Shakeela Ismail1, Faraz Akrim2, Muhammad Farooq1, Nadeem Munawar1 and Muhammad Raza Khan1
...prey were donkey, yalk, goat and sheep, while among wild prey golden marmot (Marmota caudata), house mouse (Mus musculus), Palm Civet (Paguma larvata), Royel’s Pika (Ochotona roylei) and markhor (Capra falconeri) were frequently consumed. Winter diet of grey wolf contained more proportion of livestock (59%) compared to wild prey (41%) whereas its summer diet contained more proportion of wild prey (53%). The grey wolf was found as one of the major predato...
I Gusti Lanang Oka Cakra1*, Anak Agung Ngurah Badung Sarmuda Dinata2, I Gede Mahardika1, I Gusti Nyoman Gde Bidura1
...on of Etawah crossbreed goats. A total of 20 goats with an average initial body weight of 18.22 ± 3.09 kg were used in the study with a randomized block design consisting of 4 treatments and 5 replications. The four treatments tested were as follows: A: elephant grass + concentrate A (without HLF); B: treatment A + concentrate B (with 5% HLF); C: treatment A + concentrate C (with 10% HLF); and treatment D: Treatment A...
Tri Eko Susilorini1*, Ahmad Furqon2, Wike Andre Septian1, Desinta Wulandari3, Suyadi Suyadi3
...ilk properties. Senduro goat is local breeds in Indonesia that provide milk. This study was aimed to analyse CSN3 gene polymorphism and its association with milk production and composition on Senduro goat. A total of 42 lactating Senduro goat were used in study from parity 1 to 4. Blood and milk samples were collected in Senduro district, Lumajang. The traits observed were milk yield, fat,...
Aiman Batool1, Muhammad Sohail Sajid1,2*, Hafiz Muhammad Rizwan3**, Asif Iqbal4, Imaad Rashid5, Ibadullah Jan6, Faiza Bano7, Fiaz Ahmad8, Waqas Ahmad1, Muhammad Nisar Khan1
...e more prevalent in the goat population. A higher prevalence of GI, haemo and ectoparasites was observed in young animals, females and Damani breed of sheep and goat. Among the extrinsic factors, a significantly (P < 0.05) higher prevalence of endoparasites was determined in grazing animals (goat = 91.30%; sheep = 89.60%), animals with a poor hygienic measure (g...
Emtenan M. Hanafi1*, Fouad M. Tawfeek2, Walid S. El Nattat1, Moetazza M. Alshafei3, Seham S. Kassem3, Kawkab A. Ahmed4, Enas N. Danial5, Hagar Elbakry3, Hoda S. El-Sayed2
...yphenol or health potentioators.
Keywords | Spirulina platensis, Bifidbacterium longum, Spermatozoa profile, Male fertility
...
Marwa Ragab Saeed Abdallah, Hussein Mohamed Hussein Mohamed, Mohamed Mohamed Talaat Emara, Mai Atef Mohamed
...x (WPI/BW) as an edible coating to improve the quality and extend the shelf life of sliced pastirma stored under either aerobic or vacuum packaging. Pastirma was produced, sliced, and then allocated to four groups; the first group was aerobically packed and used as control, the second group was vacuum packed, while the third and fourth groups were coated with WPI/BW then packed in either polyethylene or vacuum bags. All grou...
Sara Mohamed Hemeda1, R.H. Sayed2, Hani Hassan1, Sheima A.E.2, Hassan Aboul-Ella3, R. Soliman3*
... lateral flow kits was coated with polyclonal unlabeled goat anti-rabbit antibodies. If the tested milk sample contains a high antibiotic level that exceeds the permissible limits it will be consumed by reaction with the gold anti-β-lactam antibody conjugate in the conjugation pad and the test line read negative with no color development, while if the tested samples contain antibiotics lower than the permissible limits...
Yasmin M.M. Mahmoud
...four lactating Damascus goats were selected one-month pre-calving, with an average body weight of 39.33±1.41 kg at the start point of the feeding trial and at the 3rd to 4th milking seasons. Experimental diets were used to estimate the effect of partially replacing berseem hay (BH) with broccoli by-products (BB) in goats, rations on nutrient digestibility, milk production, some physiological properties of blood and he...
Yasmin M. M. Mahmoud*
...ile.
Keywords | Goats, Chicory, Digestibility, Productive performance, Blood
...
M. Fatmawati1, L.T. Suwanti2*, Mufasirin3
Ngoc Tan Nguyen1*, Minh Thanh Tram1, Thi Thu Pham1, Tan Loi Le1, Thi Khanh Ly Nguyen1, Tuan Thanh Hoang2, Cong Thieu Pham3, Nguyen Khang Duong4
...chondrial DNA) of local goat breeds in Ninh Thuan Province, Vietnam was studied to provide useful information on their origin. Blood samples were taken from two local goat breeds in Ninh Thuan (De Co = CO and Bach Thao = BT, 10 samples each) and three other exotic goats including Saanen (SA; 10 samples), Red Boer (RB; 10 samples) and White Boer (WB; 9 samples) raised at An Phu Dairy Compan...
Makhamadi Abramatov1*, Abdurakhim Kuchboev2, Bakhtiyor Ruziev3 and Khumoyun Sobirov2
..., including sheep - 25, goats - 21 and, cattle – 22 of these 27 species belonged to in are geohelminthes, and only 1 species was biohelminthes the main core of nematodes of the gastrointestinal tracts of domestic ruminants is 14 species, 11 - facultative and 3 - potential. The total infection was 76.7% in sheep, 61.7% in goats and 55.3% in cattle. Twenty species were common to all ruminants. Trichostrongylus vitrinus a...
Mostafa El-Sebelgy1*, Hanafy Madbouly2, Sabry Tamam2, Nagwa Ata1, Kawther Zaher1
Kusuma Adhianto*, Chairul Rahman Arif, Dian Kurniawati, Akhmad Dakhlan
...d Objective: One of the goats developed in Lampung Province is the Saburai goat. Selection is an action to select livestock with good genetic quality. This study aims to determine the genetic potential of male and female Saburai goats that have good genetic quality at weaning based on their estimated breeding value (EBV) and to determine which individuals are eligible to be retained in the...
Arsalan Maqbool1,2, Faez Firdaus Abdullah Jesse1,3*, Eric Lim Teik Chung3,5, Abd Wahid Haron3, Mohd Azmi Mohd Lila5, Bura Thlama Paul3,4, Khaliq ur Rehman Bhutto3,6
...monal profile of female goats experimentally infected with Mannheimia haemolytica serotype A2 during rainy and hot seasons. Twenty-four healthy female, non-pregnant does were used, and divided into two equal groups, 12 does were further allocated into 3 groups (n=4), control, non-vaccinated and vaccinated in each season. After acclimatization and synchronization procedure, the vaccinated group was administered with 2 mL of alum-precipitated pasteurellosis vacc...
Eman M. Aboelela1, Mohamed A. Sobieh2, Eman M. Abouelhassan3, Doaa S. Farid4, Essam S. Soliman2*
...ogs and spring in white-coated cats; and during summer in the single and fall in the multiple housing system of dogs and during summer in the single and spring in the multiple housing system of cats. Highly significant (P < 0.01) increases during spring, spring, winter, winter, and spring seasons in dogs and spring, spring and summer, spring, and fall seasons in cats consumed dry, cooked, raw, canned, and mixed food respectively. Species-specific PPinfestat...
Lin Li1,2, Pingsheng Ye1, Xi Chen1, Shuping Yan1 and Yuanshu Zhang1*
...(MFD). Six Saanen dairy goats were randomly divided into 2 groups and fed either a high-forage (HF) diet or a high- concentrate (HC) diet. The high-concentrate diet caused lower milk fat content and milk fat yield, namely induced MFD. While, the net hepatic TG production (portal vein - hepatic vein) significant increase in the HC group (P<0.01) and it was positive value. The net hepatic glucose, cholesterol and BHBA productions (portal vein - hepatic vein) ...
Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*
...tein was then used as a coating antigen to establish an indirect ELISA method for detecting the T. gondii antibody in pet cats, whose reaction conditions were optimized. The SAG2 gene was successfully cloned into a pET-21a (+) prokaryotic expression vector, and the recombinant plasmid pET-21a-SAG2 was obtained. The size of the recombinant protein was approximately 19 kDa, and it was expressed mainly in the form of an inclusion body. The optimal reaction condit...
Muhammad Haris Raza Farhan1*, Qamar Iqbal1, Tariq Jamil1, Muhammad Fayaz2, Abdul Kabir2,3, Eid Nawaz2, Marjan Ali2, Shumaila Manzoor2
...population of sheep and goats. History taken from the farm owner revealed the mortality of 8 animals within the duration of 14 days following a pattern of anorexia, no fever, emaciation, recumbency, and ultimately death. A detailed physical and clinical examination of animals revealed signs of dehydration, emaciation, anorexia, nutritional stress, and high fever in animals. Tick infestation was found on the skin of animals while Babesia was found in the blood ...
Murat Durmuş* and Nazan Koluman
...pe crossbreed sheep and goats. For this purpose, 10 head of lambs of the Cukurova Assaf type (75% Ost-Friz + 25% Awassi) and 10 head kids of Improved Cukurova Boer type (10% Native Hair Goat + 90% Boer) were used as animal material in the experiment. Kids and lambs were housed in two different paddocks during the eight-week trial period and performance data such as feed consumption and live weight gain were recorded during t...
Idrissa Sacko1, Madou Dao1, Souleymane Sanogo1,2*, B. Michel Orounladji2, Kaly Diakité1, Diakaridia Traore3, Mamadou D. Coulibaly1, Amadou B. Cisse1
...mes; Sahelian crossbred goat’s semen in Mali. From January to August 2020, a total of 45 ejaculates have been collected from 03 bucks (5/8 Anglo-Nubian, 3/8 Sahelian Goat) using artificial vagina. Semen volume, mass motility and live and dead sperm counts (spz) were measured by direct reading and electronic microscopy with a direct image transfer system on screen, respectively. Sperm concentration and total sperm count...
Xinran Wang1,2 and Lizhi Zhou1,2*
... the presence of patrol boats and photography enthusiasts. Moreover, results showed that there was a significant difference in the frequency of the synchronized vigilance wave among disturbance intensity levels (low vs. high: Q = 33.94, P < 0.001; low vs. moderate: Q = 3.557, P = 0.033730; high vs. moderate: Q = 28.24, P < 0.001). Under high anthropogenic disturbance, wintering cranes mostly adopted coordinated vigilance mode (50%, 482.28±113.12s)...
Ejaz Ur Rehman1, Shakeel Ahmad2, Fathul Bari3*, Tanveer Khan2, Naveed Ullah Khan2, Abdullah Khan4 and Romaan Hayat Khattak2
...lign: justify;">White-throated kingfisher Halcyon smyrensis is a common resident of wetlands in Asia including Pakistan. Breeding ecology and time budget activity was investigated in 16 active nests at 6 different sites during the current study. Nest construction was primarily initiated by the male while female joined later on. Mean size of circumference of the nest was 3.27 inch, mean length of tunnel 2.82 feet. Clutch size varied between 1 and 5 with an aver...
Iqtidar Hussain1*, Shakeel Ahmad Jatoi2, Muhammad Jawad Nazir1, Ehtesham Ul Haq1, Faheem Abbas1 and Muhammad Saqib Raza Shah1
...determined in cultivated oat (Avena sativa L.), maize (Zea mays L.), rice (Oryza sativa L.), pearl millet (Pennisetum glaucumL.), bread wheat (Triticum aestivum L.) and sorghum [Sorghum bicolor (L) Moench. Response of aqueous leaves extract was assessed through various agronomic and physiological parameters including number of plants emerged, leaves per plant, chlorophyll content, root and shoot length, plant fresh and dry biomass were studied. The strong phyt...
Sri Suharyati, Siswanto, Madi Hartono, Kusuma Adhianto*
......
Madumetja Cyril Mathapo and Thobela Louis Tyasi*
...f twenty-five (25) Boer goat males aged between one and two years were used in the study. Testicular length (TL), scrotal circumference (SC), body weight (BW), body length (BL), heart girth (HG), rump height (RH), withers height (WH) and sternum height (SH) were measured. Pearson’s correlation and simple linear regression were used for data analysis. Phenotypic correlation outcomes indicated that SC had a positive statistically significant (P<0.05) co...
Amoon Danial1, Shahan Azeem1*, Sohail Raza1 and Muhammad Hassan Mushtaq2
...prevalence of BoHV-1 in goats accompanied by cattle in the areas where seropositive cattle have been previously identified. A total of 126 blood samples were collected from goats located in areas of Lahore District where previously cattle were seropositive for BoHV-1. Competitive ELISA was performed to detect antibodies for glycoprotein E of BoHV-1. Of 126 sampled goats 13 (10.3%) were ser...
Al-Hassan M. Mostafa1*, Gehan Mohammed Sayed2
...ortus (H. contortus) in goat was evaluated. Goats were divided into 4 groups; the 1st one represented control negative (clinically normal). All animals of other groups were infected via stomach tube with 1750 of 3rd stage larvae of H. contortus (L3) and subsequently subdivided into positive infected untreated group (second group), positive infected and orally treated group with garlic juice, 5ml/ animal, (third group) and po...
Sajjad Khan, Fahad Karim Awan*, Zulfiqar Ali Gurmani, Muhammad Usama Hameed, Allah Bakhsh and Kainat Bibi
...alt and drought tolerant oat cultivars. For the purpose in-vitro study was conducted at NARC fodder laboratory to study the response of two oat cultivars namely NARC and PARC Oat against drought and salinity stress. Salt concentration of 80 mmolLˉ¹ showed non-significant effect on germination % and shoot length of both oat cultivars except salt con...
Semine Dalga* and Kadir Aslan
...giones capitis of Gurcu goats were examined topographically. Twelve adult goat skulls of both sexes (n=6 males and n=6 females) that did not produce fertile offspring were used in the study. Twenty different morphometric measurements were taken on the skull. Four distinct reference points were measured for the selection site of the infraorbital foramen. A reference point was used for the selection site of the oval foramen. I...
Juweria Abid1, Shakeel Ahmad2, Humaira Wasila3, Tooba Asif4, Muhammad Farooq5* and Attaullah Jan6
...of fresh (cow, buffalo, goat, sheep and camel) and processed milk types (S1, S2, S3, S4 and S5) commonly consumed in Khyber Pakhtunkhwa (KP), Pakistan. Samples were collected from three different districts of KP and after composite sampling dried in oven and stored at room temperature for further biochemical analysis. Samples were then analyzed for minerals content, total phenolic compounds, total flavonoids and antioxidant activity. Physicochemical characteri...
Othman E. Othman1*, Lingjiang Min2, Amira M. Nowier3
...from ovaries of Zaraibi goats belonging to two different fertility groups: high (HFG) and low (LFG) fertility groups. The extracted DNA was subjected to WGS after treatment with bisulfite. The findings declared that a small difference in the DNA methylation levels is present among high and low fertility groups. The methylated C frequencies in contexts: CG, CHG and CHH were 89.89%, 2.39%, 7.72% and 90.19, 2.34%, 7.47% in high and low fertility groups, respectiv...
Sonia Kanwal1, Muhammad Naeem1*, Zaib Un Nisa1, Rabia Farhat1 and Zia Ur Rehman2
...n Lohi sheep and Beetal goats. The experiments were performed on 30 ewes and 30 goats between 1.5 to 5 years age group were selected from Bahadar Nagar Farm, Okara, Pakistan. Both the sheep and goats were grouped into three different lactating stages: [lac I (n=10), lac II (n=10) and lac III (n=10)]. Blood samples were collected during all production stages and serum has been preserved at ...
Hossam Mahrous Ebeid1, Ahmed Abdelkader Aboamer1*, Amgad Ahmed Abu Elella2, Ibrahim Mohamed Khattab3, Osama Hefny Matloup1, Fatma Ibrahim Hadhoud1
...ting lactating Damascus goats’ diets with DMSC on milk production. Three cannulated rams (50.60± 3.05 kg, body weight) were used to assess the ruminal degradability of DM, NDF, and ADF for DMSC using in sacco technique. Fifteen lactating Damascus goats (averaging 45.4± 0.5 kg, body weight and averaging milk yield 900±65 g/head/day) were randomly assigned to one of three treatments for 6 weeks to st...
Hayrettin Çayiroglu1*, Füsun Coskun1, Hüseyin Çayan1, Ayse Gül Filik2 and Ahmet Sahin1
...parameters in lactating goats. In this study, ten lactating goats in the second lactation were used. Their milk yields were closer to each other. Experimental goats were divided into 2 groups as control (C) and Fenugreek (F), equally. They were individually kept in pen sized 2x2 m. C goats did not consume fenugreek seed while F g...
Lobna M.A. Salem, Nashwa O. Khalifa, Marwa O. Abd El-Halim*
...eep, cattle, buffaloes, goats, and camels in Qualyobia, Egypt. The genetic identity of Fasciola species was examined by the analysis of forward and reverse sequences of the ITS2 of the rDNA gene that amplified in 300bp. Out of 286 slaughtered animals {88 sheep, 26 goats, 68 cattle, 25 buffaloes and 79 camels} in the regions of Qualyobia, 51 (17.8%) had Fasciola spp. morphologically {27/51(52.9%) were identical to F. hepatica...
Shad Mahfuz1,2†, Hong-Seok Mun1,3†, Veasna Chem1, Keiven Mark B Ampode1,4, Muhammad Ammar Dilawar1,5, Hae-Rang Park1, Il-Byung Chung1, Young-Hwa Kim6, Chul-Ju Yang1,5*
... insects, denatonium benzoate, and thiophanate-methyl) were used as repellents. The repellent ingredients were used to hang over the feeders. Among the tested natural and chemical ingredients as a repellent, the average number of feeding approaches in repellent feeder was significantly lower (P < 0.05) in bitrex chemical (denatonium benzoate) and thiophanate-methyl chemical. No differences were noted in the number of feed...
Hanaa H.A. Gomaa1*, Dalia Y.Z. Amin1, Mona A. Ismail1 and Khalid A. El-Dougdoug2
...ypt orchards. The viral Coat protein gene structure resembles that of members of the genus Trichovirusin the family Flexiviridae. In this study, the virus isolated from fig plants belongs to the genus Trichovirus in the family Flexiviridae....
Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1
... sheep (Ovis aries) and goats (Capra aegagru hircus) in district Peshawar. Serum and fecal samples were collected at random both from commercial farms and abattoirs. Additionally, tissue samples (intestine and mesenteric lymph node (MLN)) were collected at random from sheep and goats at abattoirs of district Peshawar. Analyses of serum samples by iELISA revealed the presence of antibodies against MAP in 9% sheep and 5% g
Jie Li, Gaofu Wang, Xiaoyan Sun, Lin Fu, Peng Zhou* and Hangxing Ren*
...fluence on Youzhou dark goat skin pigmentation remains unclear. The present study cloned goat KITL gene sequence, predicted the physicochemical properties of the gene-encoding protein, and analyzed the different expression level in goat tissue. The result showed that the coding region of goat KITL gene was 825-bp long and encoded 274 amino acids. T...
Jeki Mediantari Wahyu Wibawanti1,3, Sri Mulyani2*, Rudy Hartanto1, Ahmad Ni’matullah Al-Baarri2, Yoyok Budi Pramono2, Anang Mohamad Legowo2
... the characteristics of goat milk. This study used a Completely Randomized Design (CRD) with five treatments and four replications, with differences in the addition of synbiotics inulin from extracted mangrove apple and Lactobacillus plantarum. Yogurts with no synbiotic were used as a control, while yogurts with synbiotics of 2, 4, 6, and 8% (v/v) were used in another treatment.The results of goat milk yogurt showed that the...
Shahid Amin1*, Jabbar Khan1, Imran Khan2, Dost Muhammad1, Kamran Ullah Khan1, Naqeeb Ullah Khan1, Muhammad Azhar Jameel3
... samples (Sheep, n=250, Goat, n=250) were collected from different areas of South Waziristan. Samples were processed meant for the incidence of haemo-parasites and diverse hematological limitations were anticipated. Prevalence of haemo-parasitic diseases was recorded as 14.4, 10.4 and 7.2% for anaplasmosis, theileriosis and babesiosis, respectively. Different risk factors were studied but statistical significant changes (p<0.05) were observed in prevalence ...
Hira Jabbin1, Muhammad Arshad1*, Naunain Mehmood1, Wardah Hassan1, Syed Zakir Hussain Shah2 and Farzana Siddique3
...fectiveness of chitosan coatings as natural preservative was assessed on rancidity development and quality changes in mori fillets during 28 days of storage. The control and chitosan coated samples were analyzed periodically at intervals of 7 days, for determination of pH, water holding capacity, water extractable proteins, salt extractable proteins, thiobarbituric acid reactive substances (TBARS) and sensory quality of mori...
Abdullah Iqbal1, Muhammad Abubakar2, Shumaila Manzoor3, Muhammad Kamran Ameen4 and Rani Faryal1*
...st PPR vaccine in local goats. Group 1 and group 2 goats were given mineral supplementation and fat-soluble vitamin supplementation for 21 days. Group 3 goats were twice dewormed with Fenbendazole. Group 4 bucks were kept as controls. All bucks were vaccinated with the Pestivac vaccine. Antibodies detection was done using competitive ELISA from serum samples. Antigen shedding by vaccinated...
Antonius1,3, Anuraga Jayanegara2*, Komang Gede Wiryawan2, Simon Petrus Ginting3, Anjas Asmara Samsudin4, Elizabeth Wina5
...ss causes a decrease in goats’ performance and meat quality. The objective of this experiment was to evaluate the impact of supplementing gambir (Uncaria gambir) leaf extract as a natural antioxidant source on goat performance and meat quality. A total of 18 Boerka goats (body weight of 21±2 kg) were divided randomly into three dietary treatments (six replicates each), specifi...
Ahmed M. El-Waziry1,2*, Saeid M. Basmaeil1, Ibrahim A. Alhidary1, Gamaleldin M. Suliman1,3, Mutassim M. Abdelrahman1, Maged A. Al-Garadi1
...nophores in the diet of goats. Therefore, more research are needed concerning the influence of ionophores on ruminal fermentation, performance and characteristics of carcass of goats.
Keywords | Ionophores, Ruminal Fermentation, Animal Performance, Carcass Characteristics, Meat Quality
...
Zaheer Ahmed Lashari1, Muhammad Saleem Sarki1, Saleem Maseeh Bhatti1, Muhammad Sachal Khokhar1 and Zohaib ur Rehman Bughio2*
...ost 1), banana plants + goat manure (Compost 2) and banana plants + cattle manure (Compost 3) in 3:1 ratio were prepared in cemented pits. The prepared composts were sampled and analyzed for selected parameters. Afterwards, a field experiment was executed to study the effect of prepared composts and their integration with inorganic fertilizer on growth and yield of onion (Allium cepa L.). The treatments were: T1=Control (No NPK and/or Compost), T2=Recommended ...
Ibrahim Samir Abd El-Hamid1, Alaa Emara Rabee2, Moustafa Mohamed M. A. Ghandour2, Rasha Salah Mohammed3, Ahmed Mohamed. Sallam4
...immunological traits in goat males under heat stress conditions.
Keywords | Herbs additives, Quebracho tannins, Antioxidants, Sperm quality, Damascus goats.
...
Maskur1*, Muhammad Muhsinin1, Sulaiman Ngongu Depamede2
... ...
Jin-Ming Zhao1,2, Yun Fang2 and Yue-Hua Sun2*
...ch as egg candling and floating. Our results confirmed the conveniency and accuracy of the weight loss method in estimating nest ages of Chinese grouse. We further discussed some cautions when applying the weight loss method. We recommended investigators to use the weight loss method rather than the candling or egg floating methods to determine avian nest ages in future field studies....
Monu Karki, Amit Kumar and Gnanavel Venkatesan*
...’s viz. sheep and goats, ensuring its presence and related economic loss all over the world. The virus is the prototype member of the Parapoxvirus genus of the Poxviridae family and is known to cause zoonotic affection sporadically. The main attraction to this virus has always been its wide range of virulence factors, known to be responsible for deceiving the host’s defense strategies and causing re-infection within a year of infection. From viroce...
Oluwatoyin Adenike Fabiyi1*, Mariam Temitope Baker2 and Gabriel Ademola Olatunji2
...methyl ester; ethyl octanoate; 9, 12-octadecadienoic acid methyl ester; dodecanoic acid; octadecanoic acid methyl ester; decanoic acid; octadecanoic acid ethyl ester and tetradecanoic acid as the major components while the infra red spectral diagnostic signals agree with the expected vibrational frequencies corresponding to C-H and carbonyl C=O functional groups of fatty acid and esters. Jew’s mallow plants infected with Meloidogyne incognita on the fiel...
S. Ahmed†, Q. Liu and H. Jian
...ctin) were used as seed coating. All four Bacillus isolates significantly reduced nematode infection of wheat roots when juveniles were used as inoculum after 10 days post inoculation. Noteworthy reduction in white female cyst development was observed on roots treated with Avermectin seed coating followed by isolates B. cereus XZ 24-2-1, B. cereus XZ-33-3, B. weihenstephansis MH-58-60-01 and B. thuringiensis MH 032-003 as co...
Mengxue Sun1, Yanjiao Li1,2, Zhen Gao1, Qinghua Qiu1,2*, Xianghui Zhao1,2, Lanjiao Xu1,2, Huan Liang1,2, Ke Pan, Mingren Qu and Kehui Ouyang1,2*
...ments on low pH-induced goat rumen epithelial cells acidosis, cells were exposed to solutions with a pH of 7.4, 5.8, 5.6, 5.2, and 5.0 for 3, 6, 12, and 24 h. The precise pH was adjusted using volatile fatty acids (acetate, propionate, and butyrate). All the cell viability in low pH treatment declined more than 50% for 12 h stimulation, and cells treated with low pH for 12 h was selected to be optimal ruminal acidosis model. Cells were then cultured with niaci...
Majid Ali*, Hafiz Abdul Majid, Farman Ullah, Tahir waseem, Muhammad Rashid Khan
...zed from both sheep and goat. Out of the total blood sample (62.39%) total prevalence were recorded for all type of hemoprotozoa. In which highest prevalence was recorded for theleriosis 46.13%, followed by anaplasmosis 29.13%, mixed infection 17.66% while the lowest prevalence was recorded for babesiosis which is 7.06%. Seasonal wise overall prevalence was recorded highest in monsoon 48.69%, 52.46% followed by summer 34.34%, 30.49% and winter 16.95%, 17.04% f...
Shaker Al-Suwaiegh
...bolites of growing Ardi goats were explored. Twenty one growing Ardi goats, 27.0 ± 0.40 kg body weight and aged 4.0 - 5.0 months, were randomly allocated to three equal groups (seven/group) as Azolla pinnata (10.0 and 20.0 % daily feed) and control groups. The trial lasted 12 weeks. Feed intake, feed efficiency, and body weight gain were determined. In addition, nutrients’ digestibility were determined. Blood sa...
Roni Pazla1, Novirman Jamarun1*, Elihasridas1, Arief1, Gusri Yanti2, Zaitul Ikhlas2
...rotein source in Kacang goat rations. Avocado waste to optimize rumen bioprocessing. This research aimed to obtain good performance from Kacang goats through appropriate ration formulation based on fermented forage (sugarcane shoots and tithonia) with avocado waste. This formulation is expected to minimize the use of concentrate in the ration. This study used 16 male Kacang goats aged one ...
Hidayat Ullah1, Sadia Tabassum1, Sultan Ayaz2, Shumaila Noreen1, Atta Ur Rehman1, Naveed Akhtar3, Muhsin Ali3, Zaib Ullah3* and Sajid Mahmood1,4
...ens were collected from goats and sheep breeds of the Hazara Division and identified into seven species on morphometrics basis, in which four species were recorded new to this area. Out of identified seven species, four tick species Rhipicephalus microplus, Hyalomma rufipes, Rhipicephalus haemaphysaloides, Haemaphysalis bispinosa were identified from goats and three species Hyalomma marginatum, Hyalomma excavatum, Rhipicepha...
Asmaa A. Darwish*, Mona A. Mahmoud, Adel M. El-Kattan
...ella-infected sheep and goat at Matrouh governorate and suggest new markers for brucellosis. Sera were obtained randomly from ewes and does then tested serologically by the Rose Bengal Plate test (RBPT) and competitive ELISA test (cELISA). The animals of each specie were divided into 2 groups: the control group CG (results of both tests were negative) and the diseased group DG (results of one or both tests were positive). The clinicopathological parameters wer...
Muhammad Sohail1* , Zubair Ali1, Hamidullah1, Yasir Amin1, Mehwish Malik1, Said Sajjad Ali Shah2
...h but slightly lower in goats (25.5%) as compared to sheep breeds followed by Haemonchus (17.9%), Strongylus (16.9%) and Eimeria (10.2%). The effect of Species of animals on occurrence of Gastrointestinal Parasites in Small ruminant was found highly significant (p-value˂0.001). Mixed infections were more pronounced in Kaghani sheep (33.5%) followed by Rambouillet (31.3%), Angora (28%), Beetal (23.5%) and Ramghani (21.1%). It was found that mixed infections we...
Imdad Hussain Soomro1, Gulfam Ali Mughal1, Naeem Rajput1, Rameez Raja Kaleri2,6*, Deepesh Kumar Bhuptani3, Raza Ali Mangi4, Ghulam Mustafa Solangi5, Sheva Dhari6, Abdul Wahid Solangi6 and Zoya Parveen Soomro6
...firmation of Tapri male goat raised under the intensive housing management system. This study was performed at the Livestock Experimental Station, Sindh Agriculture University, Tandojam. For this purpose, twelve Tapri male goat kids of six months age were purchased from local market and divided into two groups, each group contains six kids. (Group A was fed with fresh maize grass and Group B was fed with maize feeding silage...
Arief1, Roni Pazla2*, Rizqan1, Novirman Jamarun2
...lity of Etawa Crossbred Goat. The supplemented treatments were: A; control ration (60% forage (CF) + 40% concentrate (CC)), B (30% CF + 30% Tithonia diversifolia (T) + cassava leaves (CL)) + 30% CC + 10% palm concentrate (PC) ), C (30% CF + 30% (T+CL) + 20% CC + 20% PC), and D (30% CF + 30% (T+CL) + 10% CC + 30% PC). The parameters observed were milk production, milk fat, and lactose content, intake and digestibility of fat, crude fiber, and nitrogen-free extr...
Hemayet Hossain1, Md. Masud Parvej1*, Khadiza Akter Brishty3, Muhammad Ali4, Junayed Ahmed4, Asibul Hasan4, Rubel Miah4, Md. Piplu Mia4, Saad Muhammad Rafe-Ush-Shan4, Md. Nazmul Alam4 and Md. Zahidul Islam Khan2
...ere cattle and 305 were goats, respectively. The selected clinical cases were diagnosed through anamnesis, physical examination, clinical signs, gross pathology or postmortem examination, and clinical examination using common laboratory techniques. A total of 28 infectious and non-infectious diseases and disorders in ruminants were detected, whereas the pooled prevalence (PP) of the infectious disease group in cattle was 38.44%, (95% CI: 33-42) and in g
Ghulam Mustafa Solangi4, Zaheer Ahmed Nizamani1*, Mansoor Tariq1, Zubair Ahmed Leghari2, Asghar Ali Kamboh3, Barirah Rehman Talpur1
...s significant losses in goat population throughout Asia, Middle East, Europe and Africa. In order to investigate the seroprevalence of CCPP in goat population of Sindh province, a total of 800 serum samples from four districts of Sindh (Thatta, Tharparkar, Jamshoro and Larkana) representing four agro-ecological zones of Sindh were examined by using c-ELISA. The overall seroprevalence of CCPP in goat<...
Fathin Faahimaah Abdul Hamid1, Mohd Farhan Hanif Reduan1*, Jasni Sabri1 , Faez Firdaus Jesse Abdullah2,Mohammed Naji Odhah1, Nur Athirah Binti Abdul Manaf1, Mohd Jefri Norsidin2 , Siti Nor Che Yahya1, Intan Noor Aina Kamaruzaman1, Nur Zul Izzati Mohd Rajdi1
...y of infection. Healthy goats (n=20) were equally divided into 5 groups: Mannheimia haemolytica 107 concentration was inoculated intranasally to all goats except goats of Group 1 which served as the negative control, Group 2 was the positive control, Group 3 goats treated with oxytetracycline, Group 4 goats were treate...
M. A. Abou El- Nasr1, Kh. A. Dougdoug1, Hayam S. Abdelkader2, and Rehab A.
Dawoud2
...tion, the viral protein coat gene was expressed as 6xHis-tagged PPV/CP fusion protein in E. coli M15 cells. The fusion protein was confirmed by western blot analysis....
M. A. Amer1; M. H. El-Hammady2; H. M. Mazyad1; A. A. Shalabyl and F. M. Abo-El-abbas
Om-Hashem M. EI-Banna1, M. A. S El-Kady2, E. A Salama1 and Salwa N. Zein2
...egion (UTR) between the coat protein and ꞵb gene. It was clear that five bases, and 18 out of 1 16 amino acids were found different. three amino acids insertion, and one amino acid deletion. Little differences were also observed regarding the 5' UTR of RNA γa as six nucleotides were changed. 12 out of 162 amino acids were differed and one amino acid deletion. Gl19 strain cross reacted specifically with the monoclonal antiserum raised against the c
A.S. Gamal El din1; Sohair I. El-Afifi2; A. S. Sadik 2; Nashwa M. A. Abd El-Mohsen1; and H. M. Abdelmaksoud1
...amount of PVY (N-Egypt) coat protein produced by gene expression technique in E. coli through: (I) Insertion of CP gene isolated by RT-PCR into Pinpoint Xa-l Vector by ligation and propagation after transformation process in E. coli. (2) Isolation of plasmid DNA. then used restriction enzymes Bam HI and Bgl II to identify clones containing inserts. To confirm the fragment inserted of CP gene sequence. PCR was performed using specific primers for PVYN CP gene. ...
Hala A. Amin1; A. Barakat2; A.A. Abou Zeid1
...n containing a complete coat protein (CP) gene or Citrus tristeza virus (CTV) encoded by the expression vector plasmid (Pinpoint™ Xa3, Promega) with a fragment of biotin binding protein (BBP-rCTV-CP) was highly expressed and purified from E. coli cell culture. Antiserum obtained from rabbits after injection with the BBP-rCTV-CP fusion protein showed comparable reactivity in the serological detection of CTV. This antiserum could be used at dilution or 1: ...
E. K. Allam.1; B. A. Othman.1; Hayam S. Abdelkader2; and Noher A. Mahmoud2
...ragment (321 bp) of the coat protein gene of GFLV was amplified by reverse transcription-polymerase chain reaction (RT-PCR) using two primers specific for the coat protein gene or GFLV. Nucleotide sequences of the RT-PCR products confirmed that these sequences were amplified from the GFLV coat protein gene. A specific GFLV Dig labeled DNA probe was prepared by PCR and detected the GFLV vir...
A.l. Abd El-Fattah; A.s. Saclik M.M. El-Kholi; I.A. Åbdcl-Hmnid and M.A. Madkour
...lymerase to amplify the coat protein chain reaction (CP) gene (RT-PCR) Of SCMV-E to amplify strain. the ThecDNA that directly amplified cp gene was used as a template using the internal primer combination in PCR for confirmation its specificity to the SCMV-cp gene as a PCR product with a size Of about 400 bp was amplified. The cp gene PCR product was cloned into the pGEM-T easy vector and introduced into Escherichia coli strain DH5_ and the plasmid was then is...
Zhao Fulin1,2, Liang Chen2, Tao Lin1, Jiang Yanting3, Ouyang Yina3, Hong Qionghua3* and Chu Mingxing1*
... kidding performance of goats. Mass ARRAY®SNP typing technology was applied to genotype the SNPs of FGFR1 and EBP41L5 genes, of which the genetic characteristics of Yunshang Black goat (YS, n=544), Jining Grey goat (JN, n=133) and Liaoning Cashmere goat (LN, n=91) were explored. Then the association was analyzed between FGFR1 and EBP41L5 and kidding ...
Kétomon Pierre Challaton1*, Coovi Guénolé Akouedegni1, Kadoéito Cyrille Boko2, Goué Géorcelin Alowanou1,3, Pascal Venant Houndonougbo4, Aboudou Habirou Kifouly1, Mawulé Sylvie Hounzangbé-Adoté1
...n.
...
...
Muhammad Kefayatullah* and Said Wahab
...ne the effect of edible coatings on the storage life of apricot fruit. The fruits were stored at 5±1°C with 85–90% relative humidity during the period of analysis. The data regarding various parameters were recorded at each 7days intervalup to 28 days of storage. The samples T1 (control), SA1 (1 % sodium alginate), SA2(2 % sodium alginate), MC1(1 % methyl cellulose), MC2(2 % methyl cellulose), P1(1 % pectin), P2(2 % pectin), BW1(1 % bees wax),...
Muhammad Hasnain1, Qudsia Nazir2, Ifra Saleem2*, Syed Shahid Hussain Shah1, Muhammad Asif Ali1 and Noor ul Ain3
...ombined effects of urea coated with bio-augmented Zn 1% (Engro zabardast urea (EZU)-a fertilizer source of N and Zn) on rice growth, yield, and Zn bio- fortification. The applied treatment (EZU) was compared with control (recommended N, P and K) and ZnSO4 + urea and P, K. Results clearly indicated that the application of EZU showed improved Zn concentration significantly in rice grains, which were maximum (66.8%) and minimum (55.3%) increase was in rice observ...
Indira Jurinskaya1*, Tynyshtyk Kenzhebaeva2, Kairat Iskakov3, Bekzat Niyazbekov1
...sing the down output of goats of local breeds and reducing the cost of manual labor in the technology for obtaining down. The research was carried out at the “Aiganym” farm of the Zhambyl district on one-year-old goats of the Kazakh coarse-haired and Gorno-Altai downy breeds as well as their crossbreeds. Animal groups were formed according to the principle of analogue groups, taking into account age and live weig...
Rogia SA Gomez*, Said H Mbaga
...species such as cattle, goats, and rabbits (41.7%). The average mortality rate recorded in these farms was 11.7%. Biosecurity Index Score ranged from 44-66% (mean 53.83 ±4.23). There was low adoption of biosecurity between the farm’s boundary and the poultry houses. The study concludes that in the Pwani region biosecurity was moderately applied, which shows that farmers in this region are aware of the need to exercise biosecurity measures to preve...
Asmaa A. Darwish*, Adel M. El-Kattan, Mona A. Mahmoud, Mohamed T. Ragab, Amani A. Hafez
... infection in sheep and goat with special reference to their value as biomarkers for the disease. Vaginal swabs were collected from 110 ewes and 150 does for bacteriological examination. Blood samples were collected for immunological, hormonal, and iron profile estimation. The total recovery of B. melitensis was 13.50% with nearly equal percentages in sheep (13.60%), and goat (13.33%). B. melitensis isolates had bvfA gene, v...
Ikram Ullah1, Zaib Ullah2*, Junaid Khan1, Sajid Mahmood1, Zafar Iqbal3 and Naveed Akhtar2
...etables (27.1%, 22.6%). Goats were the most (47.61%) predated animals, followed by sheep and cattle (37.14%, 12.38%). Human casualties were rare and mostly accidental, while victims often experienced deep injuries. Local communities faced annually Rs.167,922 (US$ 1085.47) agriculture loss and Rs. 1,620,000 (US$ 10,731.19) livestock loss during 2015-19. Generally, local inhabitants expressed negative attitudes (48%), and they were in favor of eliminating bears ...
Yufang Liu1,2, Guiling Cao3, Yujing Xie3 and Mingxing Chu1*
... on the reproduction of goats, goats at different growth stages from two breeds (Jining Grey (JG) goats and Liaoning Cashmere (LC) goats) were divided into three groups with three replicates (juvenile stage (JG 30d vs. LC 30d, AO group), puberty (JG 90d vs. LC 180d, BO group) and the same age control of puberty (JG 90d vs. LC 90d, EO group). Ovary tissue...
Salvator Minani1,2*, Eric Nsengiyumva1, Anatole Bigirimana1,2, Arnaud Cubahiro1,2, Dieudonné Ntakirutimana1,2 and Vénuste Bizoza1,2
...ncluding 69 cattle, 190 goats, and 6 sheep were inspected to determine the presence of Fasciola spp. in their livers. The prevalence of Fasciola spp. was 13.04% (95% CI: 5.10-20.99) in cattle, 3.16% (95% CI: 0.67-5.64) in goats and 0.00% in sheep. The difference between the prevalence of Fasciola spp. in cattle and goats was statistically significant (OR= 4.60 (95% CI: 1.57-13.46), χ2 ...
Luigi Liotta1, Vincenzo Lopreiato1, Fariborz Asroosh2 and Alireza Seidavi2*
...rranean buffalo, Talesh goat and Saanen goat. Milk samples were collected during 2021. The main characteristics and constituents of milk including colour, odour, taste, freezing point, dry matter free of fat, acidity (lactic acid), density (in 15 °C), pH, fat and protein were determined according to the standard methods. Macro and micro elements of milk were analyzed using inductively coupled plasma mass spectrometry. Da...
Xiaoyan Yang1* and Xiuli Xu2
...ssages, including the throat and lungs. Influenza-like virus in adults is partly due to changes in the body’s defense system. The present study was performed to evaluate influenza-like virus effects in adults. This case-control study was performed on 50 patients admitted to the Third Affiliated Hospital of Henan University of Traditional Chinese Medicine during the autumn and winter seasons with myocardial infarction and 50 patients as controls. History,...
Malik F.H. Ferdosi1*, Arshad Javaid2, Iqra Haider Khan2 and Muhammad Kaleem Naseem1
...-5,11,14,17-eicosatetraenoate (3.56%), methyl linoleate (4.38%), and linoleic acid (2.94%). These compounds possess various biological activities as reported in the previous literature.
...
Muhammad Shoaib Azeem1, Hafiz Qadeer Ahmed2,3*, Adil Shahzad2,4, Umar Farooq2,5, Ghayyoor Ahmad6, Muhammad Yaqoob3, Jamal Nasir1
...bstract | Popularity in goat meat has led to increased interest in studying the retail cuts and offal yield of goat carcasses. This study aimed to investigate the effect of age and sex on the percentage of retail cuts and offal yield of local goats in Pakistan. Thirty-six goats were randomly selected and divided into four groups based on sex and age. Gro...
Karamat Shah1, Muhammad Fiaz Khan1, Zaib Ullah2*, Rashid Ali Khan1, Sajid Mahmood1, Naveed Akhtar2 and Muhammad Naeem Awan3
...the study area were the goats and sheep, (38.98%). The rate of depredation of livestock has been recorded to increase in the early summer season (60%), spring (15%), followed by winter (12%), and autumn is less (13%). Wildlife damage maize crop and majorly attack on the area of crops which are close to the forest in summer....
Asadullah Memon1, Asghar Ali Kamboh1*, Saeed Ahmed Soomro2, Muhammad Ammar Khan3, Akeel Ahmed Memon4 and Hubdar Ali Kolachi1
...tensis in 178 sheep and goat samples obtained from Hyderabad, Tando Allahyar, and Mirpurkhas districts of Sindh Province of Pakistan. The results revealed that the seroprevalence of Q fever was significantly (p<0.05) higher than chlamydiosis and brucellosis (43.82% vs. 37.7% and 17.98%). The districts-wise incidences of seroprevalence were also significant in this study, as C. burnetii antibodies were significantly (p<0.05) higher in Hyderabad than Tando...
Ni Putu Sarini1*, I Gde Suranjaya1, I Gusti Agung Arta Putra1, I Wayan Suarna1, Lindawati Doloksaribu1, I Ketut Puja2, I Ketut Gde Natakesuma3, I Gusti Ngurah Bagus Rai Mulyawan4
...ali cattle. ...
Saddam Hussein Mahmoud* and Shaimaa Nabhan Yassein
... isolated from Mastitic goats. To investigate the prevalence of mycotic mastitis, related to goats in Baghdad, 166 lactating goats were examined and 332 milk samples were collected from (January – July) 2022. 10 ml of milk were collected in sterile test tubes, an equal volume of milk and CMT reagent were gently shaken in a paddle and the reaction was noticed within (10-15) seconds. T...
Novirman Jamarun1, Roni Pazla1*, Arief2, Elihasridas1, Gusri Yanti3, Rani Winardi Wulan Sari4, Zaitul Ikhlas4
...s of energy sources for goats and Tithonia diversifolia as a source of forage protein. This study aims to determine the intake, body weight gain, and digestibility of nutrients of goats fed mangrove leaves and T. diversifolia with different levels. The research employed 16 one-year-old goats and divided them into groups according to their body weight. The concentrate utilized in the study ...
Lili Zhao1, Fan Zhao1 and Yaping Jin2*
... the functionalities of goat trophoblast cells (GTCs). The Grp78 gene was efficiently knockout by using the CRISPR/Cas9 system, which resulted in altered morphology and function of GTCs. The cell shape showed a subrounded configuration, and the cell size also significantly increased. Furthermore, Grp78 knockout significantly decreased proliferation and adhesion activity, while increasing invasion activity. The secretion of estradiol and progesterone was also d...
Irtaza Hussain1, Muti ur Rehman Khan1*, Asim Aslam1, Masood Rabbani2 and Ahsan Anjum1
...various risk factors in goats and sheep through qualitative enzyme linked immunosorbent assay (ELISA). This technique is sensitive and cost-effective for detecting disease in large no of animals. For this purpose, serum samples from 350 goats and 91 sheep were collected on the 20th day post-infection for detection of antibodies, and essential information related to potential risk factors was collected through a questionnaire...
Deny Anjelus Iyai1*, Ambo Ako2, Sitti Nurani Siradjuddin2, Budiman Nohong2
...00% -66.67%. Cattle and goat feed is more available with a range of 39-84 (16.96% -36.52%). Whereas for pigs it is quite low, which is in the range of 0-3 (0.00% -75.00%). ...
Mohammed Naji Odhah1,2, Faez Firdaus Abdullah Jesse1*, Bura Thlama Paul3,4, Bashiru Garba5, Zaid Mahmood1, Eric Lim Teik Chung6, Mohd Azmi Mohd Lila7
...y crossbred female Boer goats were assigned into three groups (A, B and C), each comprising of 4 goats. Group A (Negative control group) was inoculated intradermally with 2 ml of sterile phosphate-buffered saline (PBS-pH 7); Group B (Mycolic acid group) was inoculated intradermally with 2 ml of immunogenic Mycolic acid extract (1g /ml); while group C (Positive control group) was inoculated intradermally with 2 ml of 109 colo...
Ishtiaq Ahmed1*, Hamid Ullah2, Zubair Ali2, Muhammad Sohail2, Yasir Amin2 and Afrasyab1
...weight gain, rough body coat, gastro intestinal disturbance like lack of appetite, reduced milk production, alopecia and bottle jaw. The study on prevalence of gastrointestinal helminths parasite of large and small ruminants was conducted in and around district Haripur. Faecal samples (n=633) were randomly collected and were examined for the presence of helminths parasites, in which 463 (73.0%) were found positive for the eggs of different GIT helminths. Seven...
Arnold Christian Tabun*, Ferdinan Suharjono Suek, Cardial L Leo Penu, Johanis A. Jermias, Thomas Lapenangga
... in Kupang with varying coat color. The research objective was to determine the Bali cows with different coat color in Kupang district based on DNA analysis using the cytochrome b (CYT B) gene. The methods used CYT B gene base methods of DNA analysis such as DNA extraction, Polymerase Chain Restriction, DNA sequencing, and identification of DNA sequences nucleotide. Bali cows with sorrel, black and white c
Meryem Betmezoğlu1*, Dilek Arsoy2 and Mahmut Çerkez Ergören3
...orm encephalopathies in goat and sheep is crucial for animal breeding, health and welfare, together with food safety and security. Goat production and indigenous goat breeds (Cyprus Native hair Goat, Damascus) are important for the Cyprus’s agricultural diversity Therefore, the allele frequencies of Caprine Prnp gene variants should be well underst...
Ayoola J. Shoyombo1, Ake A. Moses1, Comfort I. Ukim2, Mustapha A. Popoola2, Olayinka O. Alabi1, Noah C. Edozie1, Faith Ogbor1, Jacob Kuusu1, Ekemini M. Okon3*
Di Zhou1, Qingmeng Long1*, Rong Yang1, Xiaoshan Tan1, Jun Li1, Mingyan Tang1, Zhonghai Zhao3, Ye Ao2, Zhinan Zhou1 and Changxue Chen1
...s for the Guizhou black goat. We utilized mRNA collected from uterine, ovarian and fallopian tube tissues of goats with the same pedigree and analyzed the results using bioinformatics and qRT-PCR. We found 8120 differentially expressed genes (DEGs) in ovarian tissues (3205 up- and 4915 down-regulated), 5255 DEGs in the fallopian tubes (1317 up- and 3888 down-regulated) and 5180 DEGs in uterine tissue (2597 up- and 2583 down-...
Khadija Begum, Azizunnessa and Md Ahaduzzaman*
...ustify;">In Bangladesh, goats are a commercially important animal that is raised both in urban and rural areas. Although goat farming is profitable, reproductive issues have been identified as a significant factor in the declining profitability of goat farming. The study aimed to investigate the prevalence of reproductive problems in does and how they are currently treated. Relevant data o...
Muhammad Abdul Mannan1,2, Sharmin Chowdhury2, Md Abul Hashem3,4 and Md. Hazzaz Bin Kabir1,5*
...mic losses to sheep and goat breeding operations worldwide. To combat this problem and minimize economic damage, effective preventative measures should be aimed at high-risk populations and a thorough understanding of the epidemiology is crucial. This study aimed to improve the understanding of the molecular epidemiology of Haemonchus contortus in sheep and goat carcasses in the Chattogram Metropolitan area in Bangladesh. A ...
Muhammad Faizan1, Muhammad Nasir1, Muhammad Waqar Hassan1*, Ghulam Sarwar2 and Moazzam Jamil3
...maculatus included seed coat color, texture and see size and among which beetles laid more eggs due to dark color of seeds while there was no strong effect of seed texture and seed size on egg output by C. maculatus. Study of other factors included seed hardness which was maximum in chickpea genotypes followed by cowpea in descending order and least seed hardness was in mung bean genotypes. Correlation of factors with growth index, percent weight loss and matu...
Ahmed Jaafar Mousa*, Nothaila Rasheed Hamid
...s were taken from the throat, pharynx, crop, and esophagus with a cotton swab. Utilizing direct smear and polymerase chain reaction (PCR) techniques, 30 (30%) of the 100 collected samples were found to be positive. A DNA sequence of 372 bp length that partly encompassed the coding region of the ITS1-5.8s rRNA-ITS2 gene within ten samples (assigned 1-10) was amplified in this study. The PCR amplicons that were found in the amplified genetic region were directly...
Syed Shakeel Shah1, Ayesha Jameel1, Sabila Afzal1*, Muhammad Zubair2, Iram Fatima Bokhari1
...d by sedimentation and floatation to recover parasites eggs, cysts and larvae. A high prevalence of about 47.58% was described in this study. Coriander was the highest contaminated vegetable (51.42%), followed by mint (48.57%). The carrot was the minimum contaminated vegetable with 40% contamination. Examination of vegetables revealed 12 genera of parasites along with aquatic mites (5.74%). Taenia was the most prevalent parasite (25.28%) followed by Ascaris (2...
SAGHIR AHMAD*, WARDA HANIF & SANA YOUNAS
...imultaneously in sheep, goat and humans associated with the sheep and goat farming from Bahawalpur, Pakistan from May, 2016 to April 2017. 640 blood samples were taken from sheep, goats, farmers and non-farmer humans (160 each). Blood sera were examined to detect anti-Toxoplasma antibodies (IgG) by employing latex agglutination test (LAT). The findings showed the seroprevalence of T. gondi...
Shaker B. Al Suwaiegh
...d serum biochemistry of goats in arid subtropics. Twenty-four goats average 29.70 ± 1.17 kg body weight (BW) were randomly distributed over four groups. The goats were fed four diets composed of 50.0% concentrates and 50.0% forages. The four diets formulated according to replacement of alfalfa hay with giant reed were control alfalfa hay diet (T1; 50.0% alfalfa hay) and giant reed r...
Abdul Latif Rind1*, Shahid Hussain Abro1, Rameez Raja Kaleri2,3, Ghulam Mustafa Solangi4, Raza Ali Mangi5, Muhammad Anees Memon6, Depeesh Kumar Bhuptani7, Sana Noor8, Zainab Lanjar9, Zahid Ali Mangrio10 and Abdul Wahid Solangi1
...among various breeds of goat and sheep in district, Sanghar, Sindh, Pakistan. Two hundred samples of oculo-nasal discharge were gathered and subjected to Ic-ELISA testing to identify PPR antigens. The analysis of PPR prevalence was carried out according to breed, sex, age, and Taluka. The overall PPR prevalence was found to be 20%, with the highest prevalence rate (50%) observed in Jam Nawaz Ali Taluka and the lowest (7.5%) in Shahdadpur Taluka. The prevalence...
Muhammad Umar Farooq1, Kashif Ishaq1*, Muhammad Imran Khan1, Muhammad Farooq Iqbal1, Tanveer Ahmad1, Jamil Akbar1, Asim Fraz2, Sara Naeem1 and Aansa Latif1
...sion ratio (FCR) of the goats. The current study was planned to improve the Beetal male kid’s performance using a compensatory growth tool. A total of twelve male Beetal kids with an average weight of 20±2 kg and approximately 6 months old were randomly selected and kept for 85 days including 15 days of an adjustment period. There were two phases of the experiment. During the restriction phase; the animals were divided into three groups i.e. T1=fe...
Romaan Hayat Khattak1, Liwei Teng1,2*, Naimat Ullah Khan3, Aamir Ali3, Abdul Hadi4 and Zhensheng Liu1,2*
...ic evidence of yellow-throated marten from Nizampur National Park (NNP), Nowshera district Khyber Pkahtunkhwa (KP) Pakistan. The presence of this species indicated that this ecosystem has rich biodiversity, providing plenty of resources for the survival of yellow-throated marten. However, keeping in view the diet ecology of yellow-throated marten we assume that it may have some negative im...
Waseef Ullah Khan*, Yasser Durrani and Muhammad Ayub
...reservatives (sodium benzoate and potassium sorbate) for preserving mango OLE blend over a 90 days period. The findings demonstrated that the inclusion of OLE effectively preserved the chemical quality and sensory characteristics of mango OLE blend with added chemical preservatives. Results showed that all samples retained total soluble solids between (17.89-20.80˚Brix), pH (4.06- 4.91), color (6.94 to 8.01), flavor (5.34 to 6.34) and taste (5.59-6.99). The r...
Arief1*, Roni Pazla2
... justify;">The value of goat’s milk is influenced by its content. Forage is the main element that forms milk fat. We aimed to enhance the production of FCM (Fat-Corrected Milk) in Etawa crossbreed goats through the use of a mixture of high-quality forages such as Mirasolia diversifolia (Md), Indigofera zoolingeriana (Iz), and Gliricidia sepium (Gs) with palm concentrate (PC). We used a completely randomized design, imp...
Rini Widyastuti1*, Rangga Setiawan1, Nurcholidah Solihati1, Siti Darodjah1, Kundrat Hidajat1, Mochamad Ali Mauludin2, Alkaustariyah Lubis3, Mas Rizky Anggun Adipurna Syamsunarno4, Sigit Prastowo5, Takdir Saili6, Arief Boediono7
...-align: justify;">Dairy goat production efficiency can be achieved through adequate reproductive performance and appropriate breeding practice. This study aims to explore farmers’ profiles, behaviours, and existing knowledge about reproductive management practices in traditional dairy goat farming. The study were carried out among Simpay Tampomas Farmers Group in Sumedang, West Java, Indonesia. The sample population co...
Sri Suharyati, Tiwi Aries Pani, Akhmad Dakhlan, Syahrio Tantalo, Kusuma Adhianto*
... performance of Saburai goats was due to the limited number of females so almost all Saburai goats were selected as potential stock in the area. This results in a low intensity of selection and a lower increase in the growth of the next generation. This research was conducted in Gisting and Sumberejo Subdistricts, Tanggamus District and we aimed to determine the body weight and body sizes of Saburai g
Umar Salisu Ahmad1, Adamu Abdul Abubakar1,2*, Hassan Abubakar Bodinga1, Nura Abubakar1, Ekaete Ime Oviawe1, Zaid Shehu3, Abubakar Musa Mayaki3
... defecation using a KC-bloat failed, and the calf died on examination table. Postmortem examination of the cases revealed that polyethylene bags, plastic materials, and other indigestible materials mixed with ruminal ingesta were found in the rumen. In conclusion, careful examination of rumen impaction should be considered now in calve 6-month below when presented with gastrointestinal abnormalities in developing countries. With accurate radiographic diagnosti...
Anshara Javed Qureshi and Ishrat Aziz*
... direct microscopy and floatation method. In this study, 18 (11 males and 7 females) out of the 100 samples (with a prevalence 18%) were found infected with Capillaria spp. of nematodes. The qualitative examination also revealed that the Capillaria spp. of nematodes was more prevalent in males (36.67%) than females (10%). This study will be helpful in raising awareness among pigeon owners for better control and treatment strategies for capillariasis and also t...
Lukmanhy1*, Enny Yuliani1, I Wayan Lanus Sumadiasa1, Lalu Ahmad Zaenuri1, Mardiansyah2
...semen quality of Kacang goats at 5°C storage. Semen samples were collected twice a week from a 2-year-old Kacang goat using an artificial vagina. The study design consisted of three treatments; T0, T1, T2 and T3, consisting of 0%, 10%, 15%, and 20 % of sugarcane juice, respectively. The measured parameters included progressive motility, viability, and abnormalities of spermatozoa. The data obtained were analyzed using th...
Hermawan Setyo Widodo1,2*, Tridjoko Wisnu Murti1, Ali Agus1, Ambar Pertiwiningrum1
...and SA. However, the SP goat only has A and F alleles in equal frequency, and the E allele was only found on SA. The AF genotype predominated on all breeds in almost half of its population, thus, the most diverse was SA. The Hardy-Weinberg disequilibrium of PE and SA indicated the influence of the breeding program. The genotypes affected the αs1 casein, total casein, and αs1/β ratio, in which AA was highest. The A, F, and N allele expressions ...
Hassan Anwar1, Talha Anwar2, Khurram Muaz3, Muhammad Riaz4* and Rabia Anwar5
...21. Although, barley and oat are also nutrient rich but are less appealing to consumers due to their texture, taste, and chewability. This study aimed to prepare chapatis from wheat, barley, and oat flour mixed in different proportions to achieve a consumer acceptable combination. Gluten was also added to give better texture, chewability and taste. To test the likeliness of people, we tested 14 chapatis on a hedonic scale of...
Cahya Alamsyah Putra Anugerah1*, Ita Krissanti1, Diky Ramdani2
...b>s. ...
Asma Sadia Authoy2, Aneek Chanda2, Aparna Datta3, Md Shohel Al Faruk4, Towhida Kamal1*
.... Dogs with ash-colored coats (77.27%) and white-coated dogs (84.62%) showed higher susceptibility than black-coated (47.62%) and brown-coated (58.82%) dogs. Vaccination showed statistical significance for both dogs and cats, whereas deworming was significant only for cats. The study highlights the need for further investigation through structured survei...
Ghusoon Hasan Jadaan1*, Khalisa K. Khudair2
... The CCH and cis CH, benzoate trans -CH, the C-O, CH2 and CH3,(C=C),(C=O), CH2 and CH3 which operate as reducing and stabilizing agents were revealed by FTIR analysis of CPNPs. The SiO2NPs’ FTIR spectrum shows two vibrations that can be attributed to SiO2’s Si—O—Si and Si—O vibrations, respectively. Thirty-two Female rats that had reached adult were randomly split into four groups: Control; T1: received oral 200 mg/kg of SiO2 - N...
El-Absawy, E.A.; Mahmoud, Amal; Hemeida, A.A. and Helmy, M.
...resented portion of the coat protein (CP) gene and 3' untranslated regions (UTR). Phylogenetic tree showed two main strain groups: Group I regroups PVYN and PVY stains, while Group 11 includes pvy0, pvyw and PVYN:O strains. The Egyptian PVY isolate was clearly classified within group I, and was more closely related to PVY strains. Ten nucleotide substitutions resulted in 3 conserved amino acid substitutions (VI*I, G7*E, M or V and S8*G) and were able to differ...
Nassarl , Entsar A.; El-Dougdoug , Kh. A.; Osmanl , M.E; Dawoud3, Rehab
A. and Kinawy l , Aliaa H.*
...equence analysis of the coat protein gene demonstrated that the virus represents an isolate of the Tobamoviridae Family. The isolated virus was nominated as TMV Chrysanthemum Egyptian isolate (TMV-Ch-EG). This virus isolate caused severe disease symptoms in Chrysanthemum plants with mosaic, mottling and flower discoloration. The virus was purified biologically using serial transfer of the single local lesion technique on Nicotiana gultinosa. The induced antise...
Sharawil , S.S.A. and Abd El-Rahim2, I.H.A.•
... of PPR among sheep and goats in Qalyubia Province, Egypt at 2006. In this study six of this PPRV isolates were confirmed by reverse transcriptase-PCR (RT-PCR) using primer set for fusion protein (F) epitope, then cDNA were send to Institute of Animal Health Pirbright, England to analyze for their nucleotide sequences of this F protein gene and phylogenic analysis properties, by matching with other reference world recorded isolates. The gene sequenced a ...
*El-Helaly, Sahar H.; ** Ahmed, Amal A.; * Awad, M.A. and ** Soliman, A.M.'
...uence analysis of their coat protein (CP) gene. The sequence of the coat protein gene (CP) of AMV was determined from cDNA clones. The CP gene was cloned into pGEM-T Easy vector, and transformed into Escherichia coli (E. coli) strain DH5a. The recombinant plasmids were obtained and sequenced. The nucleotide sequences were compared with corresponding viral nucleotide sequences reported in GenBank. The analysis showed that nuc...
El-Tarabili M. M., El-Shahidy M. S., Rifaat M. M., Kania S. A. and Abdelwahab Shahira A.
... bison, also cattle and goat can be infected. The MCF is caused by gammaherpes viruses, genus rhadinovirus; which includes a group of viruses including ovine herpesvirus-2 (OvHV-2), caprine herpesvirus 2 (CpHV-2) and white tailed dear strain (MCFV-WTD). Malignant catarrhal fever virus infection characterized by sporadic occurrence, fever and high mortality. In this study two real time PCR assays had been used to detect the MCF virus strains in both cattle and ...
Hassanein, S.A.*; Ibrahim, A.K**; Mervat, M.M.* and Nahed,K.A.*
... from cattle, sheep and goat in Egypt were compared by virus neutralization, (VN), Restriction Fragment Length Polymorphism (RFLP) and Random Amplified Polymorphic DNA (RAPD) analysis. Antigenic comparison using VN test and their effect on MDBK cell culture detected no difference, thus demonstrating the close antigenic relationship between the examined herpesviruses. Using the restriction endonucleases BamHI and EcoRI revealed no difference between the examine...
JEHAN A. M. GAFER.' HUSSEIN, H.A. and REDA I.M.
...from diseased sheep and goats for the isolation of PI-3 virus. The samples were taken from diseased animal at seven different Governorates Kaffer el sheikh, Alexandria, EL Behaira, Port Said, Demiatta El-Qalubia and Giza through the winter seasons of years 1999 to 2003. The virus was successfully isolated from three ovine samples after three successive passages on MDBK•cells. The isolated viruses were then titerated and identified using different biologic...
Abeer, E.Mansour and Hegazi, A.Z.
...ttle, buffaloes, sheep, goats and camels. Five animals of each species were vaccinated using a dose of I ml for sheep and goats and 2 ml for cattle, buffaloes and camels inoculated subcutaneously. It was found that both of the immune parameters were generally increased gradually to reach the highest value of cellular immunity by the 2e day, while that of neutralizing antibodies was reached by the week to the 10th week ...
Laila,A. Sedeek; Fatma,S. Mohamed and Manal Abo El-Yazyed
... the immune response of goats to the concomitant immunization with PPR and bivalent FMD (type A and O) vaccines. The study included four groups of local breed goats, where the first received modified live PPR virus vaccine; the second received inactivated bivalent FMD virus vaccine; and the third group received simultaneous vaccination with PPR and FMD vaccines. A separate group was left non-vaccinated and served as control....
Afaf, A. Khedr*; Hyam Farouk* and Taradi, A.Said. **
...mic losses in sheep and goats flocks. This study was planned to experimental evaluation of simultaneous vaccination against Brucella and attenuated RVF (smith burn strain) diseases in sheep using serological test including SNT and ELISA test revealed that there was no antagonizing effect between the two vaccines on the immune response of vaccinated animals and the results showed that no significance differences in antibodies titer in all sheep groups which vac...
S.A. Sidaros, S.A. El-Kewey , Hala A. Amin;Eman A.H. Khatab , A.A. Emeran l , Samaa Abd El-Khalilk and M.A.S. El-Kady
...imer pair for the PMMoV coat protein gene (PMM-F and PMM-R) revealed 470 bp amplified product. Dot blot hybridization was used to establish the authenticity and specificity to the RT-PCR amplified Products of PMMoV. The coat protein gene of an Egyptian isolate of PMMoV was cloned and sequenced, The sequence contained a full-length ORF coding for the viral CP. It comprises 473 nt and a polypeptide chain of 157 amino acids wit...
El-Dougdoug, Kh.A. t , S.A. Ghaza12 , A.A. Mousa2, H. Fahmyj and A.R. sofy2
...5) where base number of coat protein gene ARC isolate 571 bp; TB isolate 529 bp and TN isolate 546 bp....
Sabry Y. M. Mahmoud; Maher H. Hosseny and Mamdouh H. Abdel-Ghaffar
...ested by direct antigen coatingenzyme linked immunosorbent assay (DAC-ELISA) using antisera against PVY, Potato virus X (PVX) and Potato leaf roll virus (PLRV). The results indicated the occurrence of single and mixed infections of three viruses in potato plants. Survey results indicated highly distribution of PVY infected plants, which its yield was affected strongly. Tubers of potato plants which gave a positive reaction to PVY only were collected at harvest...
* Amal Abou El-Ela, A.
...fy of the 3' end of the coat protein gene (RNA-3)- Nucleic acid hybridization was useful for the detection of PNRSV in herbaceous and woody plant tissues. In successful attempt to eliminate the virus from infected dormant rose cuttings by heat therapy resulted in 29.6% virus elemination of (PNRSV).
S. A. Sidaros*, S. A. EL-Kewey*, Eman A. H. khattab**, M. M. ELsharkawy*
...nd all seed parts (seed coats, cotyledons and embryos) of immature seeds obtained from infected faba been and cowpea plants. Both of the viruses were not detected in seed coat of ripened seeds and in roots of infected plants. BBSV was detected in stained seeds more than un-stained seeds obtained from infected faba bean plants. ...
S.Y.M. Mahmoud1 and M. Hashem2
...60 amino acids of BNYVV coat protein and bait plants test, respectively. The results confirmed the presence of BNYVV in 46 out of 184 and 24 out of 50 root and soil samples, respectively. The virus was found with percentage of 65% in root samples collected from Kafr EI-Sheikh. The transmission experiments indicated that BNYVV was mechanically transmitted to Chenopodium amaranticolor, C. quinoa, Beta Vulgaris cvs. Pleno. Tripl and Gloria. D. macrocarpa and B. m...
A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl
...to amplify 200bp of the coat protein gene as a molecular procedure for diagnosis. Electron microscopy of purified preparation of PRMV showed presence of isometric particles 28 nm in diameter. Ultrathin section for electron microscopy examination of infected peach leaves shows virus particles in vacuoles. Tubules structure scattered in the cytoplasm or associated with plasmodesmata was shown. Extensive severe degeneration of chloroplast and mitochondria structu...
A.A.Farrag; I.A.M. Ibrahim and, H.M. Mazyad
...amplify fragments using coat protein gene primers (358bp) of the viral coat protein gene. PCR product was used to generate ACLSV-specific probe to detect the virus in infected plants using non-radioactive molecular hybridization methods. The result showed that it is more sensitive than DASELISA and can be used for large scale detection. PCR product was cloned and sequenced. Comparison between local isolate sequence and other...
A-New-Whitefly-Transmitted-Geminivirus
...solates showed that the coat protein and the replicase genes of putative TYMV-QaIubia are not identical to TYLCV resembled genes, at least at the flanking regions of each gene. According to the results obtained from the PCR products and indicator host plants, it can be concluded that they are two different Geminiviruses. Based on host range and symptomatology, the TYMV-QaIubia appeared to cause infections only to some species of the family Solanaceae, in contr...
A. A. El-Kholy1, S. Vilcek2 and A. M. Daoud1
...ify;">Sixty-seven buffy coat specimens, obtained from clinically suspected cattle at farms located in Belbees. El-Sharquia, were screened for BVDV. Only 9/67 of the tested specimens (13%) were BVDV positive by reverse transcription-polymerase chain reaction (RT-PCR). Whereas virus isolation followed by immunostaining procedure in cell culture confirmed only 6/9 BVDVs that were cytopathogenic. Direct sequencing of the RT-PCR amplicons revealed an extreme nucleo...
Nahed A. Mohamed l, H. A. Hussein2, Fathia M. Mohamed1 and M. A. Shalaby2
...samples including buffy coat and organs were collected from apparently health Screening buffaloes in Cairo, Mansoura and Suez governorates in Egypt during the year 1999. Screening of samples by GAPT using standard known anti-BVDV antisera revealed that three positive samples for the presence of BVDV antigen. In a trial for the isolation of the BVDV, 69 buffy coat samples were inoculated in MDBK cells, five selected samples t...
M.R. Abd-El Wahab l, H.A. Hussein2, T.M. Asfourl and M.A. Shalaby2
... BVDV RNA in some buffy coat samples, collected from the cohoused camels in the area where dead camels were found (BVDV-positive). revealed positive results. However. genotyping of such positive samples using RT-PCR genotyping based assay revealed negative for the presence of BVDV type I, II, and border disease virus. After 3 passages of the detected positive buffy coats on MDBK cells. no CPE was detected suggesting that the...
Ahmed Abd El-Samie H. Ali
...e detected in the buffy coat cells on days 3, 5, and 7 post infections. Most calves developed low neutralizing antibody titers as type I (3, 12, 18 and 44) and type-2 (6, 16, 20 and 48) on days 5, 7, 10 and 15 post infection, respectively. There was a significant and minor diminution in the expression of the MHC-II and MHC-I molecules respectively in virus infected calves on days 3-, 5-, 7-, and 10-days post infection when compared to control calves. There was...
Musaad A. Al-Dubaib
..., native cattle, sheep, goats, and camels in Al-Qassim, and surrounding regions were tested for bovine leukemia virus (BLV) antibodies for different animal species. Agar gel immunodiffusion was carried out using commercial diagnostic reagents. All samples of herds having positive cases with immunodiffusion were tested by ELISA. Positive cases were recorded among samples of the Holstein cattle with both serological tests. Prevalence rates differed from one farm...
Anak Agung Ayu Sri Trisnadewi*, I Gusti Lanang Oka Cakra
...te for etawa crossbreed goats. The experiment used a randomized block design (RBD) with four treatments and each treatment was repeated four times, so there were 16 experimental units. The four treatments were: A = silage with 0% corn straw silage + 60% elephant grass silage + 40% concentrate; B = 20% corn straw silage + 40% elephant grass silage + 40% concentrate; C = 40% corn straw silage + 20% elephant grass silage + 40% concentrate; D = 60% corn straw sila...
Nguyen Binh Truong1,2*, Ho Xuan Nghiep1,2, Tran Trung Tuan1,2
...r male Saanen crossbred goats were used in the Latin Square design (4 x 4) to evaluate the effects of feed supplement combinations on feed intake, nutrient digestibility and nitrogen retention. The feed sources were finely ground and used in the experiment were Maize (Ma), Brocken rice (Br), Cassava chip (Ca) and Wheat (Wh). The proportion of combination (% dry matter intake) in two energy feed sources was 15% and 15% such as MaCa, MaWh, BrCa and BrWh. The res...
Lingang Dai1,2,3, Xiang Chen1,2,3, Jiajin Huang1,2,3, Jiali Xu1,2,3, Meimei Xiao1,2,3, Jiajing Chen1,2,3 and Yong Ruan1,2,3*
...justify;">Guizhou white goat is an excellent local goat breed in China, however, it has the disadvantages of smaller individuals, slower growth rate and low feed conversion rate, so, we introduced Boer goat as the male parent and crossed with Guizhou white goat to obtain F3 generation of Boer × White goat hybrid ...
Rehan Ahmed Siddiqui1,2*, Shabana Usman Simjee2,3, Nurul Kabir4, Muhammad Ateeq3,5, Kevin Joseph Jerome Borges6, Muhammad Raza Shah3 and Rahman M. Hafizur2
Syed Roohullah Jan1, Kareem Akhtar2*, Uroosa1, Muhammad Zeeshan Zahir3, Abdul Shakoor4
...; line-height: normal;">Coatings generated using traditional methods undergo oxidation and contamination problems. Cold spray is recently used to obtain pure coatings without oxidation. In this work coatings of Ag-Sn-Cu powder are achieved on the Aluminum substrate and human teeth, using the high-pressure cold spray technique. The powder when mixed with Mercury is called amalgam and is com...
Ram Prasad Ghimire
...ghage feeds for grazing goats. A study was conducted in order to determine the fodder quality of some common pasture browse species among them. The study included the analysis of fodders in the laboratory for nutrient composition, the feeding experiment determining fodder intake and weight gain monitoring in the goats, and a subsequent in-vivo experiment determining the apparent digestibility of fodder nutrients of those bro...
Limbang Kustiawan Nuswantara, Eko Pangestu, Marry Christiyanto, Santoso Dwi Pratomo, Elyza Zahrotul Muhtaromah
...utrients (TDN) of dairy goats. This study used dairy goats in the lactation phase were 10 of the Etawa Crossbreed and 6 Sapera. The materials used are feed in the form of tofu dregs, elephant grass and concentrate composed of distillers dried grains with soluble (DDGS), corn gluten feed (CGF), coconut cake, soybean meal, wheat bran, molasses, gamal leaf flour, calliandra leaf flour. and indigofera leaf flour and then made in...
Kadhim Kh. K. Al-Khayat1*, Athmar K. A. Al-Azawi2
...ith clear fluid, white floating scolex (evagenated or invagenated) or pus-filled in the older cysts , distribution of cysts was 47.27% (26/55) in mesentery, 21.82% (12/55) in liver, 21.82% (12/55) free within abdominal cavity and 9.09% (5/55) in omentum with Significant differences (P<0.05). The cyst diameters range between 7-21mm. in length and 4-10mm. in width. The PCR amplification results of 14 positive samples for NAD1 (500bp.) and COX1 (446bp.) ...
Pratap A. Divekar1,2*, Sampat K Patel2, Guru Pirasanna Pandi G3, Manimurugan C2,4, Vikas Singh2 and Jagdish Singh1
... Spinosad, emamectin benzoate, indoxacarb and chlorantraniliprole were also the found best treatments in controlling DBM and CB. No phytotoxic symptoms were observed in any treatment after spray application. Chlorpyriphos, deltamethrin, lambda-cyhalothrin and flubendiamide were found adverse to natural enemies. Thus, spinetoram, spinosad, emamectin benzoate, indoxacarb and chlorantraniliprole are recommended to manage DBM an...
Rehana Shahida1, Shagufta Naz1*, Tasnim Farasat1, Saima Sharif1, Shah Jahan2 and Farkhanda Manzoor1
... status were recorded. Proatherogenic parameters like plasma glucose level, serum levels of insulin, thrombomodulin and IL-6 were measured by ELISA. The serum level of thrombomodulin was assessed as a measure of vascular damage. This study showed significantly elevated serum concentration of IL-6 and altered lipid profile in diabetes individual when compared with the control subjects. IL-6 and thrombomodulin was progressively higher in diabetic group. IL-6 cor...
Tran Trung Tuan1,2, Nguyen Binh Truong1,2*
...d nitrogen retention of goats. Four female goats, with an average initial body weight used in this experiment was 27.7±1.63 kg at about 10 months old. The experiment was designed as Latin Square with 4 treatments and 4 replications. The study composed of 4 periods. Each period lasted for 3 weeks with 2 weeks for adaptation, followed by 1 week for data collection of feed intake, faeces, and urine to determine the nutri...
Junita Mayasari, Vira Oktavia, Indri Juliyarsi, Ade Sukma, Sri Melia*
...lus brevis of fermented goat milk DSM02. The addition of porang flour is A (0%), B (0.25%), C (0.50%), D (0.75%), and E (1%). The parameters observed in this study were total titrated acid, pH, dietary fiber content, water content, protein content, viscosity, total lactic acid bacteria, and organoleptic tests. The results showed that adding porang flour to fermented goat milk significantly (P<0.05) decreased the total lac...
Zahid I. Mohammed
...n increasing demand for goat meat worldwide for it is lean and nutritious. So, this calls for understanding the factors that affect the quality of goat meat to guarantee its acceptability on the part of the consumer. The current study was conducted at many private farms in Baquba city from December 2022 until February 2023 to assess the impacts of Spirulina supplement on several physiological and biochemical traits in Black ...
Shahid Iqbal1, Arshad Khan, Ali Hazrat1*, Gul Rahim, Mohammad Ihsan1, Umar Zad Gul1, Maryam Bibi1, Khadija Bibi1 and Muhammad Mukhtiar2
...ters: leaf colors, seed coat color, and seed shape. For quantitative trait, the maximum coefficient of variance (0.95%) was found in petiole length, biomass per plant (0.49%), and pod per plant (0.41%), whereas the minimum coefficient of variance showed by leaf width (0.25%), followed by leaf length (0.27%) and internode length (0.29%). Coefficient correlation analysis was computed for all the quantitative traits, where a positive correlation was recorded for ...
Lendrawati*, Tinda Afriani, Eli Ratni
... of adult female Kacang goats based on certain body measurements and to investigate correlation and regression. This study used 91 heads of Kacang Does collected from Talawi village from 2021-2022. The body weight (BW) data was regressed and associated with body dimensions (body length = BL, chest girth = GH and shoulder height = SH) using the SPSS program. The Pearson correlation (r) between body weight and measurements was calculated and the degree of fit of...
Xin Yan Ku1, Phek Jin Kwong1*, Chaiw Yee Teoh1, Mohammad Mijanur Rahman2, Fakar Fariz3
...a gigantea, Pre-weaning goat, Growth performance
...
Nawab Ali1, Akeel Ahmed Memon1, Asmatullah kaka1, Amjad Hussain Mirani2, Muhammad Ibrahim Panhwar3*, Nisar Ahmed Solangi1, Kashif Ali Malik1, Fazul U Rahman1, Moin Akhtar Vistro1
...lity assessment, twenty goats were selected and divided into two experimental groups, viz., group A and B (n=10/group). The goats of both groups were synchronized using the Ovsynch protocol. Group A goats were inseminated with semen extended in a TEY extender without selenium supplementation (control) and group B goats were inseminated with 02 mM seleniu...
Shahabaz Ul Haq1, Khurram Ashfaq1, Arsalan Khan2*, Adeel Khalid1, Shahrood Ahmed Siddiqui3,4, Raheela Taj5, Asad Ullah6, Hidayatullah Soomro7 and Muhammad Wasim Usmani8*
...ustify;">Udder edema in goats is a condition that significantly impacts animal welfare and dairy production. This study aimed to analyze the epidemiological and semiotic aspects of udder edema in the goat population of Faisalabad, Pakistan. A cross-sectional study was conducted at the OPD clinic of the University of Agriculture, Faisalabad, over a one-year period in 2018. Sixty goats, comp...
Addisu Jimma1,2*, Aberra Melesse1, Aynalem Haile3, Tesfaye Getachew3
... (such as conformation, coat color, litter size, growth, and lambing interval), socio-economic benefits, off-take, flock structure, and trends since the CBBP started. To address this gap, a study involving 260 randomly selected farmers, with 130 being CBBP members and 130 non-members owning sheep from similar locations, was conducted. The results revealed significant differences (p<0.05) in various aspects between CBBP members and non-members. CBBP partici...
Abdul Asim Farooq1,2*, Muhammad Arif Khan1, Hamid Akbar1,
Muhammad Ashraf3, Saima Inayat4, Muhammad Usman Saleem5,
Saeed Murtaza2, Maqbool Hussain Shah2 and Muhammad Arshad Javid5
... bones in female Beetal goats fail to heal or show delayed healing that leads to intensified morbidity. Bone marrow aspirate (BMA) has been suggested as an efficient biological adjuvant for healing long bone fractures. BMA comprises bone mesenchymal stem cells. This study aims to assess the potential of autologous BMA on metacarpal and metatarsal fracture of Beetal goats presented at the surgery clinic of the University of V...
Fika Yuliza Purba1,4*, Andi Magfira Satya Apada1, Andi Ariyandy2, Irwan Ismail1,4, Subaedy Yusuf3,4
...ncluding cattle, sheep, goats, buffalo, pigs, etc. Therefore, this study aimed to examine hematological and biochemical profile of cattle, based on different stages of FMD infection. A total of 24 blood samples were collected from Bali cattle, then grouped into 4, based on the estimated age of lesion inflicted on the animals: Group A (no lesions), Group B (early stage), Group C (advanced stage), and Group D (recovery stage). The results showed that the white b...
Muhammad Usman1, Majid S. Hashmi1, Ayaz Ahmad1*, Fawad Ahmad2 and Zahid Alam1
..., Stevia: 0%, Sodium Benzoate: 0.1%, Water: 72%), OD1 (Juice: 15%, Sugar: 0%, Stevia: 0.065%, Sodium Benzoate: 0.1%, Water: 84.83%), OD2 (Juice: 15%, Sugar: 0%, Stevia: 0.070%, Sodium Benzoate: 0.1%, Water: 84.83%), and OD3 (Juice: 15%, Sugar: 0%, Stevia: 0.075%, Sodium Benzoate: 0.1%, Water: 84.82%). These treatments were assessed over a three-month sto...
Ping Sheng Ye1, Lin Li2, Yu Long Wu3 and Yuan Shu Zhang1*
...IGF-1 axis on lactating goats fed with high-concentrate diets. Ten lactating goats were used and randomly divided into two groups, in a 2×2 Latin square experiment design with different forage to concentrate rations of 40:60 (the control group) and 60:40 (the high-concentrate group), respectively. During the experiment, milk samples were collected to assay the content of milk compositions; plasma samples were collected...
Elie Brigitte Mawussi1*, Arnaud Koffi Assah2, Essozimna Abalo Kulo1
...reeding of Saanen dairy goat imported from Belgium was undertaken in southern Togo early year 2020. This study evaluates reproduction and milk production performance of Saanen dairy goat raised in southern Togo. The animals are raised in permanent stable and fed with local fodders. They are subjected to veterinary care against trypanosomiasis and parasites. The mineral supplement was provided by the lick stone. Water was con...
Dio Fico Felsidan Diatmono1, Seraphina Kumala1, Pradita Iustitia Sitaresmi2, Stefani Winda Paramita1, Megawati Andi1, Yustina Yuni Suranindyah3, Diah Tri Widayati1*
...lood metabolites, Dairy goats, Follicular phase, Luteal phase, Nutrients, Ovarian cycle
...
Apurbo Kumar Mondal1, Md. Rabiul Auwul2, Md. Momotaj Hossen3, Md. Sodrul Islam1*, Narayan Paudyal4, Md. Shahidul Islam1 and Kazi Khalid Ibne Khalil1
...al disease of sheep and goats that impacts productivity and international animal trade globally. Meta-analysis serves as the most suitable approach for obtaining pooled data from individual studies. This study aimed at using a random-effects model of meta-analysis to compile the estimates of the global prevalence and potential risk factors of PPR among sheep and goats. Based on the selection criteria and quality assessment s...
Syed Awais Hussain Shah1*and Rizwan Ali2 2
... disorders, mouth and throat sour etc. This research provides a lot of Ethnomedicinal knowledge which depicts men’s interaction with plants....
Syeda Fakehha Naqvi1, Iqra Haider Khan1 and Arshad Javaid1
...(0.61%), methyl octacosanoate (0.55%) and tetracosanoic acid (0.30%) were present in low concentrations. A thorough literature survey showed that most of the identified compounds possessed antifungal and/or antibacterial properties while very few of them also possessed antioxidant potential. This study concludes that n-hexane soluble fraction of methanolic stem extract of C. murale is a big storehouse of antimicrobial compounds....
*Arshad Javaid1, Syeda Fakehha Naqvi1 and Iqra Haider Khan1
...6-diyl
dibenzoate (3.29%); dihexyl phthalate (4.99%); tricosanoic acid (2.74%); dioctyl phthalate
(4.99%), hexanal (3.05%) and ergostane (1.29%). Literature survey showed that 10 of the
identified compounds exhibited various biological activities including antifungal,
antibacterial, antioxidant, anticancer and antipsoriatic. However, this study concludes that
most of the compounds were antimicrobial i...
Nittaya Thongtip1, Sukanya Poolthajit1, Sirikhan Thartrak1, Qiongxian Yan2, Suntorn Wittayakun1*
...tration of growing male goats. Eight crossbred Boer (BW = 22.6 + 0.62 kg) growing male goats at approximately 12 months of age were assigned in a replicated 4x4 Latin square design. Treatments were as follows: 1) control with no supplementation (CON), 2) rumen-protected D-Aspartate (RDA), at 132.74 mg/kg body weight (BW), 3) zinc bio-complex (ZBC) at 73.74 mg/kg BW, and 4) supplementation of RDA at 132.74 mg/kg BW plus ZBC ...
Suparada Saphaphan, K. Teepalak Rangubhet, Phongthorn Kongmun*
...s production technique, Goats
...
Fitrimawati*, James Hellyward
...uch as the beef cattle, goats and also buffalo, laying hens, broilers, local chickens and ducks. The data obtained were analyzed using the Analytical Hierarchy Process (AHP) method. This research produces the leading commodities competitively and becomes the priority to be developed in West Sumatera, such as the beef cattle, goats and also buffalos, broilers, local chickens and ducks. Based on competitiveness concept, the fi...
MUHAMMAD AZIM KHAN,Khan Bahadar Marwat
IJAZ AHMAD KHAN,GUL HASSAN
GUL HASSAN,Imtiaz Khan,MUHAMMAD ISHFAQ KHAN
Muhammad Nabeel,Ali Ahsan Bajwa,Sehrish Sadia,Wahaj Nafees,SHAHIDA KHALID
Gul Hassan , Haroon Khan, Imtiaz Khan , Malik Ghulam Rabbani
MUHAMMAD ANJUM ALI,ZAFAR ABBAS,MUHAMMAD NAWAZ,GHULAM ABBAS,RAFFAQAT HUSSAIN,Muhammad Aslam
MOHAMMAD SADIQ,AYUB KHAN,HABIB UR REHMAN,MASOOD UR REHMAN
Jaweria Gul,INAYAT ULLAH AWAN,Muhammad Salim Marwat,Asif Latif Baloch,Inayat Ullah Khan,Ahmad Saeed,Ahmad Saeed,Rubina Naz
Fatemeh Bena Kashani , Eskandar Zand , Hasan Mohammad Alizadeh
Muhammad Sarwar Cheema , Muhammad Akhtar
A. H. Muhammad Saiful , Qin Yu, Mechelle J. Owen , Stephen B. Powles
Etawah Crossbreed Goat Farming for Income Enhancement of Households in Purworejo District, Indonesia
Migie Handayani1*, Dwidjono Hadi Darwanto2, Jamhari Jamhari2
...ncing Etawah crossbreed goat farming in Purworejo, Central Java, Indonesia. The study employed a survey method. The study purposely selected three sub-districts in the Purworejo District as the study sites. A quota sampling method was applied to select 90 respondents in each sub-district, resulting in 270 respondents. Data and information in the study were measured on an annual basis. Data were analyzed using a combination of quantitative descriptive and infer...
Katleho Lephuting, Lebelo Joyceline Selala, Kwena Mokoena, Thobela Louis Tyasi*
.... A total of 19 Savanna goat bucks between the ages of 2 and 3 years old were used as experimental animals. Three testicular measurement traits namely testicular length (TL), testicular diameter (TD), and scrotal circumference (SC) were collected using a measuring tape. Body weight (BW) was collected using the electronic weighing scale. Data was analysed using Pearson’s correlation and simple linear regression. Phenotypic correlation results indicated th...
Muhammad Nawaz Rajpar and Mohamed Zakaria
...November, 2008. White-throated Kingfisher (Halcyon smyrnensis) 66 captures; 32.84% and Yellow Bittern (Ixobrychus sinensis); 49 captures; 24.38% were the two most abundant waterbird species while Yellow-vented Bulbul (Pycnonotus goiavier) 379 captures; 29.68% and Peaceful Dove (Geopelia striata) 152 captures; 11.90% were the two most abundant terrestrial bird species in the study area. In contrast, eight waterbird and nine terrestrial bird...
Tanvir Hussain
...nto two portions i.e. uncoated and coated. The coating was done with commonly used five finishes (Lacquer, Varnish, Wax polish, Spirit polish and Linseed oil) in wood woodworking. Wooden plates were kept for one year in outdoor natural climatic conditions and data of climatic factors and wood weathering was recorded. Results revealed that all the finishes gave good protection to wood speci...
Ajiboye, A. A.1, Ebofin, A. O.1, M. O. Atayese,2, M. O. Adedire3, D. A. Agboola1 and M. Kadiri1
...rmancy due to hard seed coat. Dormancy in P. africana and D. guineensis was terminated by soaking of seeds in 90% concentrated sulphuric acid for 10-15 minutes; and mechanical scarification using coarse sand, gravel and emery cloth abrasion. The percentage germination in pretreated seeds ranged between 70-100%. The emery cloth treatments gave the best result. The proximate analysis of the seeds including the moisture content, dry matter, fibr...
Naveed Ahmed and Ghulam Ali Bajwa
...e 2.5 EC, Emmamectin Benzoate 1.9 EC, Confidor 20 SL,DDVP 80 EC and untreated check against the Walnut Stem borer, Aeolesthes sarta Solsky on Walnut trees. In all the treatments the borer holes were plugged with mud after treatment application while plain mud plastering was done in control. Results of the post-spray data recorded after 7 and 14 days revealed that all the insecticides were significantly effective in reducing the larval population of the...
Iqtidar Hussain and Adnan Noor Shah
...et, wild safflower, Wild oat, common lambsquaters, Bird�s seed grass, Broad leaved dock and Umbrella milkweed .In addition to the control, 10 ml of dry leaf water extract was applied at intervals of 3 days for each treatment. The data obtained after 20 days showed that the fresh weight and dry weight of each tested weed were significantly reduced compared to the treatment with water (control). Germination, root length (cm), shoot length (cm) and chlorophyll co...
Abdus Sadiq and Jehandar Shah
...istan. The white fungal coating studded with
mature black fruiting bodies was mainly present on the lower surface of the leaves, but a few patches were also observed on the upper surface of a very few leaves and fruit....
Mohammad Shariq Khan, Altaf Ahmad and Anwar Ahmad Khan
...ing material for curing goats and lamb skins. This natural resource is exploited on large scale to the tune of 2.2 million kg. per annum for the manufacture of ephedrine which is exported to different countries of the world and is also used in the medicines prepared by the pharmaceutical concerns of Pakistan....
Ghulam Rasul
.../i>) resembles the wild goat and belongs to genus Capra, family Bovidae and sub-order Artiodactyla. Its horns are rounded in the front instead of edged as that of wild-goat. In cross-section they are triangular and the grooving is very striking. In Europe, the Ibex is now found only in the Alps in a small area of Northern Italy, but it has been introduced to special reserves in Switzerland and elsewhere. In Asia, it is found...
Mahmood Iqbal Sheikh
...arid then subjected to floatation test on water to find out if the filled seed could be separated from the empty. 500 seeds each were taken from the settled and floated seeds of each locality and cut open....
Relph R. Stewart
...ace of the lake or had floated down from higher levels. They had sunk to the bottom and there were many layers of leaves in the clay along with Trapa fruits and a few seeds. Many of the leaves were of oaks, maples, birch and willows which seemed to be similar to modem species and some I could not identify. The most interesting seemed to be a Ginkgo or a fem leaflet resembling it. I named the specimens as far as I could, without a great deal of microscopic work...
Mahmood Iqbal Sheikh
...stly due to a hard seed coat, seeds of Melia azedarach, Zizyphus mauritiana and Cassia fistula were put to miscellaneous treatments....
Mahmood Iqbal Skeikh
...ermeable or hard seed coats is well known method to hasten the tree seed germination. Ceratonia siliqua, Pistacia khinjuk and Sapindus mukorossi were treated with concentrated sulphuric acid for different periods of times....
G. M. Khattak
..., and bamboos, were floated down the Karnafuli river to supply the Chittagong and other markets. Dacca, under the Moghul rule, was a great ship building centre and its timber supply was from the Chittagong Hill Tracts (STEBBING, 1921). The Chittagong Hill Tracts have since ancient times been inhabited by the Chakma, Mog, Murung, Tripura, and Lushai tribes who subsist on shifting cultivation (jhuming). They cut and burn the forests and ...
Abdul Aziz Khan and M. Jamil Khan
...cal pieces of sheep and goat skins were tanned with pine and imported mimosa solids for comparative studies of light leather
producing qualities under similar tanning conditions. For production of heavy leather, depickled buffalo hide pieces were tanned. Comparative studies of shrinkage temperature, tensile strength and elongation of resultant leather indicate that chir pine solids produce
somewhat better leather as compared to that obtained by tanning with ...
Hanan Yousif Jasim1*, Rasha Munther Othman2, Wasan Moaed Shaker3
...astitis cows, sheep and goats in Basrah/Iraq. A total of 26/70 (37.14%) was primarily isolated on fermented Mannitol salt agar (MSA) and examined by Gram stain. All suspected Staphylococcus sp. isolates were further detection by PCR and analysis the partial sequencing of the 16s rDNA gene and compared with those in the GenBank to find variances in the sequence using the BLAST tool (http://www.ncbi.nlm.nih.gov). The sequencing results of the 16s rDNA gene was s...
Danh Mo
... Hitch. as a forage for goats. Using twelve plots from a 48 m2 land area, the first experiment showed that the biomass of Wedelia in fresh and dry matter (DM) rose significantly (P<0.05) when harvesting at times from 3, 5, 7 to 9 weeks following planting and regeneration. With a yield of 22.4 tons/ha/year, the harvest period of 9 weeks had the best yield. Wedelia tends to lose nutritive value (P<0.05) when harvesting time increases (crude protein, CP 10....
Saiful Islam1*, Muhammad Zubair Khan1 and Haroon Khan2
...section area. The free-floating hydrophytes trapped in the outlets and culverts dipping its flow. In this apprehension a research study was conducted to investigate the effects of hydrophytes on canal capacity and at the outlets on the performance of the secondary canal known as Yar Hussain Minor (YHM) of Maira branch canal; part of the upper Swat canal irrigation system in Khyber Pakhtunkhwa (KP) province of Pakistan. Maira branch canal and its secondary cana...
Rwaida Adnan Ali1, Rahman Hussain Hamza¹, Hayder Mohammed Hassan Habeeb1, Ali J. Al-Nuaimi2
...three genetic groups of goat bucks. In this investigation, twelve mature bucks (average weight= 25 kg, average age= 2 years) were used: Cyprus (n=4), local black (n=4), and crossbreed (Cyprus X local black) (n=4). Semen and blood samples were collected from all groups every 2 weeks for 3 months. Semen volume, sperm concentration, mass activity , individual motility, live and dead sperm, abnormal sperm, testis weight, testicle circumference, testis length, red ...
Oghenesuvwe Okpara1, Omunizua Chukwuemeka Julius Ominizua2, Ufuoma Godstime Sorhue1*, Lawrence Bratte1
Tanveer Hussain1, Abdul Wajid1, Jabbar Khan2, Asif Nadeem1, Misbah Hussain1, Qurat ul-Ain1 and Masroor Babar1*
...products of 4 breeds of goat were bidirectionally sequenced to decipher polymorphisms. Only a single substitution (T→A) was found in non-coding region of IL-2 gene. Comparison of IL-2 gene sequence of all four breeds with other goat breeds showed high similarity in sequence. Phylogenetic analysis of our local breeds with other mammals showed that IL-2 was highly variable. This high substitution rate could be due to chan...
Gautam Kumar Deb1*, Md Faizul Hossain Miraz1, SM Jahangir Hossain1, Shahrina Akter1, Md. Ahsanul Kabir1, Md Ruhul Amin2, Md Panir Choudhury1, Nure Hasni Desha1
... and concentrate feed. Bloat, diarrhea, colds, fevers and skin diseases are common among others. Mares experience first heat at 24.02±2.61 months and conceive at 27.09±3.64 months. Foaling length, gestation interval and estrous length were recorded as 26.98±3.14 months, 11.58±0.46 months and 21.25±0.75 days respectively. Chestnut and bay are the predominant coat colors among others. Male ho...
Nasir Ali Tauqir1*, Asim Faraz2, Muhammad Imran Babar3 and Irfan Shahzad Sheikh3
...tu digestion kinetics of oat fodder in Nili Ravi buffalo bulls. Four cannulated buffalo bulls were used for in situ screening of oat fodder harvested at 100 days of age sown using different levels of phosphorous and phosphorous plus nitrogen fertilizers. Dry matter (DM) and crude protein (CP) content were higher (p<0.05) in oat fodder supplemented with P and NP fertilizer as compared to...
Dwi Putri Nurmala1, Tri Eko Susilorini1, Osfar Sjofjan2*, Danung Nur Adli2
...idant activity in dairy goats using a meta-analysis method. A comprehensive literature search was conducted, selecting studies published from 2005 to 2023 that examined selenium supplementation in dairy goats. Using R software 4.3.3 (2024-02-29 ucrt), data from 16 studies were analyzed using meta-regression analyses. Selenium supplementation in dairy goats significantly enhanced GSH-Px act...
Iwona Szatkowska1, Jan Udała2, Daniel Zaborski3*, Ewa Czerniawska-Piątkowska1, Wilhelm Grzesiak3, Małgorzata Wasielewska1 and Jerzy Wójcik4
...te the fact that PIS in goats has been known to breeders and scientists for several decades, many of its aspects, including the molecular reason, are still controversial and require further detailed research....
Abdul Ghaffar1*, Kashfa Akram1, Habiba Jamil1, Riaz Hussain2, Ghulam Abbas3, Fozia Afzal4, Ahrar Khan5,6, Rabia Tahir7, Muhammad Ahmad Chishti1 and Shahnaz Rashid3
...ormalities, including throat infection, nasal allergy, skin allergy, eye irritation, uric acid levels, muscle and respiratory infections, hepatitis, restlessness, and chest tightness, were significantly more prevalent among pesticide-exposed individuals. Hematological parameters revealed significant decreases in hemoglobin, white blood cell count, erythrocytes, hematocrit, mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemog...
Olagbaju Olawole1, 2, Ayoola Mathew*1, Lawal Tunde1, Olorunleke Solomon3, Oladejo Opeyemi1, Oguntunji Abel1 , Alabi Olufemi1 , Aderemi Foluke1, Ajayi Abimbola1
...est African dwarf (WAD) goats is low estrus detection, this study investigates the use of vaginal electrical resistance (VER) as estrus detection in WAD goats. Thirty-six (36) WAD does were randomly divided into two synchronization protocols and a control; Group 1 was the control without hormonal treatment, Group 2, was administered with double prostaglandin, and Group 3 Ovsynch protocols. The results revealed that does in t...
...s of lymph of sheep and goats, and to determine multiple drug resistance of C. pseudotuberculosis in sheep and goats in Halal Food Industries, Modjo, Ethiopia. A total of 450 animals (100 sheep and 350 goats) were examined during antemortem and postmortem inspections. Bacteriological isolation and identification of the collected lymph nodes were performed and then confirmed by PCR. Then, t...
Paulus Klau Tahuk*, Gerson Frans Bira, Wolfhardus Vinansius Feka
...eared young male Kacang goats. A total of 15 Kacang goats were divided into 3 treatment groups: T1, fed with an energy level (TDN) of 70.038% + crude protein 13.448%; T2, fed with TDN 72.295% + crude protein 13.922%; and T3, fed with TDN 73.264% + crude protein 13.473%. The rations consisted of native grass, Gliricidia sepium leaf meal, ground corn, pollard bran, and rice bran. Variables observed included feed intake and dig...
Catur Suci Purwati1, Chusnul Hanim2*, Lies Mira Yusiati2, Budi Prasetyo Widyobroto3
...le of etawah crossbreed goats. A total of 15 goats with an average initial body weight of 15 - 23 kg and age 8 - 12 months, were used in the study with completely randomised design (CRD) consisting of three treatments and six replications. The three treatments tested were as follows: A: without adding cinnamon powder (0 g/kg feed DM); treatment B: Concentrate with cinnamon powder addition (30 g/kg feed DM); treatment C: Conc...
Safaa Sabbar Atiyah1*, Ali Abdullah Zuairi Al-Sadoon2, Shifaa Kadhum Jieish2
...al spermatozoa of local goats during the cooling process for different periods. The AEAV was prepared and stored in the refrigerator until the time of use. Epididymal spermatozoa were diluted by a Tris extender and divided into three treatments: T1 with a Tris extender only (control group), T2: 0.02 AEAV, and T3: 0.03 AEAV. Epididymal sperm were cooled at 5 ºC for 0, 24, 48, 72, 96, and 120 hours. The results show a significant effect (P≤0.01) of AEAV ...
Never Assan1,2, Michael Musasira3, Maphios Mpofu3, Nicholas Mwayera4, Kwena Mokoena5, Thobela Louis Tyasi5*
...168 indigenous Matebele goat females of Zimbabwe. LBM and BWT were recorded at various stages of permanent incisor eruption (PE): second pair (I2), third pair (I3), fourth pair (I4), full mouth (FM), and broken mouth (BM). The LBMs were measured using a ruler and centimeter-calibrated tailor’s tape, while BWT was measured using an electronic weighing scale in kilograms. The correlation between BWT and LMBs was assessed using Pearson’s correlation a...
Afnan Ahmed Allhyani1, Mohamed Baeshen1, Nagwa Thabet Elsharawy2,3*
...nts, Meat preservation, Goat meat
...
Marlon Reinaldo Castro-García1*,Vanessa Gabriela Espinoza-Posligua1, Francisco Horley Cañarte-García1, Doris Fernanda Rizzo-Alcivar2, Christian Simón Rivadeneira-Barcia1 and Alex Alberto Dueñas Rivadeneira3
...ologies, such as edible coatings. The aim of the present study was the characterization of Cordia lutea gum films. The films were prepared by heating gum-water solutions at 80 ±1 ° C for 5 minutes. The chemical analyzes of acidity, pH and ° Brix were made in the gum of C. lutea. The variables determined in the films were opacity, thickness, tensile strength, water vapor permeability, elasticity, film solubility and microbiological ...
Nadlirotun Luthfi1, Edy Rianto2*, Endang Purbowati2, Christina Maria Sri Lestari2, Agung Purnomoadi2, Nurul Mukminah3
...young and mature Kacang goats at different feeding levels. Sixteen goats were divided into two age groups (young and mature) and fed at either low feeding level (maintenance) or high feeding level (production). The ration contained 18% crude protein (CP) and 75% total digestible nutrients (TDN). Parameters evaluated included nutrient intake, acetate, propionate, and butyrate concentrations, rumen ammonia levels, microbial pr...
Aasma Rasheed1, Dilbar Hussain2, Usama Saleem1, Saddam Hussain3, Zeeshan Javed1, Mashal Shahzadi1, Muhammad Sohail Qadir2, Muhammad Saleem2, Abdul Ghaffar2, Mawra Rafique4, Ayesha Ikram5, Saad Rasheed1 and Muhammad Asrar1*
...secticides Emamectin benzoate (200ml/acre), Indoxacarb (175ml/acre), Lufenuron (200ml/acre), Spinetoram (80ml/acre), Chlorantraniliprole (50ml/acre), and Flubendiamide (50ml/acre) were tested on C. septempuctata. The leaf dip bioassay method was performed by collecting sunflower leaves and a 2cm leaf disc with larvae was dipped in insecticides. Data regarding mortality was recorded after 24, 48, 72, 96, and 120 hours. Mortality rates were as follows: 28% for e...
Rafika Febriani Putri1, Chairdin Dwi Nugraha2, Ari Ardiantoro3, Irida Novianti1, Irisa Trianti4, Wike Andre Septian1, Ahmad Furqon5, Kuswati Kuswati1, Nashi Widodo6, Suyadi Suyadi1*
...ect on the body weight, goat behavior, and how these changes are reflected in blood parameters. In the context of this study, specific behavioral and hematological parameters might be indicators of stress in Kacang goats. 15 male Kacang goats aged 12-19 months were used in this research. The 4% feed level group had the highest average body weight. The 2% level group showed the lowest avera...
Muhammad Saleem1*, Dilbar Hussain1, Tamseela Mumtaz2, Saeed Ahmad3, Muhammad Ihsan Ullah3, Muhammad Luqman3, Muhammad Shafqat4, Fiaz Hussain5, Muhammad Sajjad6, Kaynat Shahzadi2, Muhammad Jawad Saleem1 and Muhammad Hasnain1
...role 20SC, emamectin benzoate 1.9EC, and one insect growth regulator (IGR), lufenuron, 50EC was tested against H. armigera larvae by using leaf dip bioassay method under laboratory conditions at Entomological Research Institute, Faisalabad. On the basis of LC50 values chlorantraniliprole and emamectin benzoate was proved most effective insecticide to control this polyphagous pest as compared to pyriproxyfen and lufenuron whi...
Zulfiqar Ali1, Asad Ullah2*, Shumaila Gul3, Maryam Begum4, Raheela Taj5, Tahira Tayyeb1, Maiz ur Rahman1, Muhammad Owais Khan1, Rafiq Ullah1, Imad Khan2, Ali Gohar2, Shakirullah Khan6, Khudija Ghani7 and Muneeb Islam8
...kistan. A total of 5000 goats and sheep of various ages, breeds, sexes, and locations were inspected and examined for tick infestation. A total of 1774 goats and 1044 sheep were found to be tick infested, and the percentage prevalence was 59.37 for goats and 51.45 for sheep were recorded. Our studies showed tick diversity, infestation rate, and numerous factors (season, age, and gender of ...
Hussein Ali Naji1, Saad Hashim Al-Husseiny2, Zainab Abdul Hussein Saud3 and Wesssam Monther Mohammed Saleh1*
...cting cattle, sheep and goats, which are more susceptible than other animals, and has spread all the Europe countries since 2011. In the current study was amid to investigate the seroprevalence of Schmallenberg virus antibodies in cattle in Basra and Al_Qadisiyah Provinces in south Iraq from September 2019 to august 2021. In a total 78 serum samples of cattle aged from 2-5 years were analyzed with competitive enzyme – linked immunosorbent assay for Schma...
Md. Gausur Rahman1*, S.M. Harun-Ur-Rashid1, Md. Golam Azam1, Md. Ahsan Habib2, Golapi Rani Devsharma1
...irect smear method and floatation technique. Among the examined birds, 56 Sonali chickens (28.00%) were infected with gastrointestinal parasites including Ascaridia sp., Raillietina sp. and Eimeria sp. Among these parasites, Eimeria sp. (15.5%) was the most prevalent (P<0.001) parasite, followed by Ascaridia sp. (11.5%) and Raillietina sp. (1.00%), respectively. A significantly (P<0.01) higher prevalence of gastrointestinal parasites was recorded among S...
Jahid Hasan Tipu1, Md Ashraful Islam2, Md Altafur Rahman3, Md. Nazim Uddin4, Obaidul Islam5*
...h girth in Black Bengal goats. A total of 125 Black Bengal goats were selected from Sylhet Government Goat Development Farm and Khadimnagar union of Sylhet Sadar upazila of Bangladesh. Goats were categorized into different groups based on their age and sex. Live weight was estimated by digital balance, and other body measurements were estimated by measur...
Hussein Jabar Jasim*, Naer Abdulbari Madlool Alkaabawi, Ali Naser Kathem
... 49.27%, and rough hair coat 52.89%. Also, results of epidemiological investigation discovered that out of 138 examined horses, 75 tested positives for ascariasis, with infection rate of 54.34% depended to flotation technique. A correlation was observed between climatic conditions and the occurrence of ascariasis, with the highest infection rates occurring in winter (73.1%) and the lowest in summer (26.6%). Regarding gender, infection rates were 66.6% for fema...
Jawwad Rehman1,2, Muhammad Khizar1, Muhammad Naeem1, Atique Ahmed Behan3*, Huma Rizwana1, Nasir Rajput4, Ghulam Shabir Barham5, Syed Uzair Ali Shah1, Nisar Subhani2,4
...ile in lactating Pateri goats. Fourteen goats were selected and randomly divided into two groups of seven (n=7 per group). Group A was kept in cages while Group B was kept under an open housing system. Both groups were provided with feed and fresh drinking water ad libitum for a 90-day experimental trial. Milk yield and composition, including ash, fat, lactose, protein, total solids, pH, and specific gravity, were significan...
Muhammad Nauman Hanif1*, Tanveer-ul-Haq1, Muhammad Naeem Akhtar2*, Abid Hussain3 and Amar Matloob4
...ifenthrin, emamectin benzoate, metalaxyl, and mancozeb) pesticides in cauliflower. A survey of the cauliflower production area was performed to collect information about pesticides used for insect pest and disease management. Farmers were applying lufenuron, bifenthrin, emamectin benzoate, metalaxyl, and mancozeb. The cauliflower plant and soil samples were collected with the frequency of 1, 3, 5, 7, and 15 days after the ap...
Yusuf Subagyo*, Merryafinola Ifani, Hermawan Setyo Widodo
...anakan Etawa crossbreed Goats (PE), which needed to be comprehensively explored. Dried C. calothyrsus leaves were extracted with 70% ethanol, hexane, and chloroform. Twenty PE does on the third week of lactation with an average body weight of 35.22 kg and 1.5 to 2.0 years old were used. The experimental design of this research was a Completely Randomized Design (CRD). Animals were divided into four treatments, each using five lactating g<...
Muhammad Tahir1, Muhammad Saqib1, Shahbaz ul Haq2, Shahrood Ahmed Siddiqui3,4, Khurram Ashfaq1, Urfa Bin Tahir5, Mughees Aizaz Alvi1*, Shujaat Hussain6, Talha Javaid1, Raheela Taj7, Muneeb Islam8, Imad Khan9, Asad Ullah9* and Shakirullah Khan10
...alence in sheep than in goats at 29.35% and 13.11%, respectively and there was high prevalence in Mundri breed and lowest in Thalli at 40% and 10.96%, respectively. The district wise data showed that Bhakkar has highest prevalence 31.30% and Khanewal showed lowest prevalence 11.40%. Data showed that Non-lactating animals showed high prevalence 35.29% and lactating animals have low prevalence 10.74%. Pregnant and non-pregnant animals have big differences of 10....
Ali Bain*, Musriah, La Ode Nafiu, La Ode Muh. Munadi, La Ode Muhsafaat, Nur Santy Asminaya, Astriana Napirah, Widhi Kurniawan, Fuji Astuty Auza, Deki Zulkarnain
...uid of Etawa crossbreed goats. The experimental trial consisted of five treatment rations with four replicates arranged in a randomized block design. The treatment rations were a mix of 60% concentrate (25% fermented corn cobs and 75% agricultural by-products) and 40% forage supplemented with different levels of CaS-soybean oil (0%, 1.5%, 2.5%, 3.5% and 4.5%). The measured research parameters were (i) fermentation characteristics (pH, NH3-N and total volatile ...
Manar Mousa Alhussein*, Eman Faisal Albghdady
... effect of estradiol benzoate (50 µg/rat) on the epididymis in male Wistar rats pre-puberty (aged 50 days). Ten male rats, aged 35 days, were divided equally into control (G1) and treatment (G2) groups. Rats in control were subcutaneously administered 0.25 ml of olive oil; treated rats received subcutaneous injections of 50 µg/rat of estradiol benzoate dissolved in 0.25 ml of olive oil for 15 successive days. Aft...
Aamara Ibrahim1, Ihsan Mabood Qazi1, Majid S. Hashmi1, Ayaz Ahmad1*, Hisham Javed1, Fawad Ahmad2 and Sadia Mukhtar1
...ying how mixing cow and goat milk affects the physical, chemical, microbiological and taste aspects of cottage cheese. Different concentrations (%) of cow and goat milk were mixed such as (CG1 (100:0) served as control, CG2 (90:10), CG3 (80:20), CG4 (70:30), CG5 (60:40), CG6 (50:50) and CG7 (0:100)) to prepare milk blends. The analysis of physical and chemical properties showed notable differences in composition among the mi...
Mahmoud Saber1, Sabry A. Mousa2, Hisham A. Abdelrahman3, Eman Rashad4, Ramadan Sary5, Meray N. Ramsis5*
...he rumen in native-bred goats. Fifteen healthy female goats were used; five of them were kept as control group, while the remaining ten goats were divided randomly into two groups each one contained five goats. The first group was given sodium lauryl sulfate (SLS) in an 8% solution and the second group was administered dioctyl sodium sulphosuccinate (DOS...
Nguyen Thi Hanh Chi1,2, Ho Xuan Nghiep1,2, Tran Trung Tuan1,2, Nguyen Binh Truong1,2*
...d nitrogen retention of goats. The study was conducted in the experimental farm of An Giang University, which is part of Vietnam National University Ho Chi Minh City, from February to May 2024. Four male Saanen crossbred goats aged five months (15.4±3.32 kg) were studied using a Latin Square design (4 × 4) over 21 days/periods. The four treatments were maise and cassava chips (Ma.C); broken rice and cassava chip...
Nuttanun Leamkrajang, Somkiert Prasanpanich, K. Teepalak Rangubhet, Phongthorn Kongmun*
...ffalo, beef cattle, and goat), while the dietary treatments consisted of two roughages to concentrate ratios: 100:0 and 70:30, using dry leucaena leaves as the source of roughage. The kinetic values of fermentation, gas production, and IVDMD showed significant differences across treatments (p<0.05). The swamp buffalo and the 70:30 ratio exhibited the greatest gas production and IVDMD, while beef cattle followed, and goats...
Saranyah Sathiaganeshan1,2, Nur Aina Natasha Yusoff1, Siti Juzailah Zuraimi1, Rukayat Omolara Folarin1,3, Satya Narayana Rao Ramasamy1,4, Asmad Kari1, Enike Dwi Kusumawati⁵, I Wayan Karyasa⁶ and Connie Fay Komilus1*
...nic fertilizer which is goat dung. Then, proximate analysis was done on OWF and commercial feed. Five dietary treatments consisting different percentages (%) such as Control (0% OWF+ 100% Commercial Feed), Treatment 1 (5% OWF+ 95% Commercial Feed), Treatment 2 (10% OWF+ 90% Commercial Feed), Treatment 3 (15% OWF+ 85% Commercial Feed), Treatment 4 (20% OWF+ 80% Commercial Feed) were given for feeding experiment in triplicates. Body Weight Gain (BWG), Average Da...
Javeria1,2*, Mudasser Habib1,2 and Muhammad Salahuddin Shah1,2
...uminants i.e. sheep and goats. It exerts socioeconomic impacts on livestock in the developing countries. The current study was designed to investigate the genetic relationships of the PPRV strains circulating in some districts of Punjab, Pakistan after detecting by PCR. Samples showing definite clinical signs, were collected from reported disease outbreaks and subjected to RT-PCR based on detecting the nucleoprotein (N) gene of the virus which showed 63% posit...
Rukayat Omolara Folarin1,2, Nurhadirah Hairil1, Nurafiqah Anis Ismail1, Putri Athirah Zamrifana1, Lina Nadhirah Abdullah1, Muhammad Afiq Zabhin1, Ariff Imran Alkaf1, Farrah Izzuanie Zainudin1, Hanisah Basir1, Asmad Kari1, Enike Dwi Kusumawati3, I Wayan Karyasa4 and Connie Fay Komilus1*
... identify the effect of goat manure liquid fertilizer on growth performance, production yield and proximate composition of all four parts of wheatgrass, including the appropriate day of harvesting. This study used a complete randomised design (CRD) with four treatments in triplicates. Four treatment levels were control (C) without goat manurer; Treatment 1 (T1): 100 gof goat manure per 1 l...
Norsyasya Shari1, Nur Nabilah Husin1, Zalilawati Mat Rasid1, Maaruf Abdul Ghani2 and Noroul Asyikeen Zulkifli1*
...ate (GMS) and sodium benzoate. There were five treatments consisting of control without added sugar Control, CMD with 5% added sugar (CMD5), CMD with 6% added sugar (CMD6), CMD with 7% added sugar (CMD7) and CMD with 8% added sugar (CMD8). The physico-chemical properties, proximate analysis and sensory test of formulated coconut milk drink were conducted. The water and fat were the major components of CMD. The increased in sugar concentration significantly red...
Lahbib Cheikhi, Hafidha Boucherit* and Abdelkrim Benaradj
...in the oases are sheep, goat and poultry farming. These animals are well adapted to eco-oasis conditions, characterized by a continental desert climate. The main activity of the farmers 86% of the farms surveyed is mixed (crop-livestock) and 14% are of the crop-only type. It should be noted that livestock farming in oasis systems is based on family farming based on isolation, where sheep are separated for fattening, while goat
Shaila Akter1, MD Zobayer Rahman2*, Farzana Islam1, Zamal Hussan1, Rasel Mia3, Kazi Rabeya Akther1, Nirmal Chandra Roy1
... additional commercial floating powdered feed was administered. Finally, species obtained an average weight of 2.82±0.14 g, a final length of 9.0±0.40 cm, a mean final weight gain of 2.82±0.14 g, and a relative growth rate of 589.67±55.70%, lower FCR of 0.78±0.03 value with maximum growth. These changes took place during the T2 trial, keeping the feed ratio at 75% feed and 25% floc. The survival rate, on the other hand, remai...
Lalu Ahmad Zaenuri*, Rodiah Rodiah
... filtrate, Spermatozoa, Goat
...
Muhammad Abdul Basit1, Lionel Kinkpe1,3*, Abdur Rahman1, Boko Michel Orounladji2, Hafiz Qadeer Ahmed3, Muhammad Subbayyal Akram4, Elodie Dimon5, Gadah Albasher6, Syed Muhammad Suhail1
...gnificant challenges to goat production, particularly for small-scale farmers who depend on these animals for their livelihoods. This study extends existing research on alternative feeding systems by investigating the global relevance of feeding strategies—stall-feeding, semi-grazing, and grazing—on the performance and profitability of three Pakistani goat breeds: Makhi Cheeni, Barbari, and non-descript. A total ...
Hazem Sawalha*, Mujahed Abu-Alrub, Bashar Abu-Alrub, Abdalsalam Kmail**
...fecting young sheep and goats, with significant implications for Palestinian agricultural economy and animal production. This investigation explores the incidence and impact of contagious ecthyma Orf virus in sheep and goats across various age groups in Jenin governorate, Palestine. Employing ELISA testing and histopathological examination, the study aims to provide a comprehensive understanding of the disease’s manife...
H.A. Abdul-Ratha1*, Sahar Mahdi Hayyawi2, Essam F. AL-Jumaily3
... and gel filtration chromoatography by sepharose 6B for acidocin purification was carried out. The effectiveness of pure acidocin was tested against culture of Staphylococcus aureus that produced biofilm of 3 mm. The study included the use of the Electron microscope to investigate the mode of acidocin and biofilm action on the bacterial cell membrane. The acidocin product indicated that pore formation important for bactericidal activity against cell membrane w...
