Submit or Track your Manuscript LOG-IN

Matheus Nunes Weber1, Simone Silveira1, André Felipe Streck1, Luís Gustavo Corbellini2, Cláudio Wageck Canal1*

...ntial implementations of commercial barrier by other countries can possibly reason the placement of governmental veterinary measures in the near future.

...

Salma Shaheen, Muhammad Jamil Khan, Saleem Jilani

... Khan during 2009- 11. A commercial product called Bio-Aab was used as a source of EM. Organic manure was first mixed with Bio-Aab, left for 7 to 15 days at room temperature (20oC) and then applied to appropri- ate pots. The treatments of farm yard manure (FYM) @ 10 t ha-1, press mud @ 20 t ha-1, compost @ 0.7 t ha-1 and poultry manure @ 5 t ha-1 were applied with half of the recommended dose of NPK @ (75:60:30 kg ha-1) with or without EM. In 2009-10, the appl...

Masood ur Rahman1*, Zahid Mahmood2, Taj Ali2, Muhammad Aziz Irfan Mufti3, Jehangir Khan Seyal4, Munir Ahmad5

E-mail | [email protected]

 

Sarhad Journal of Agriculture, Vol. 31, Iss. 1
...The gears were formed of commercial gun metal (Cu 87.76%, Sn 7.74, Zn 1.52%), gun metal (Cu 88%, Sn 7.38%, Zn 1.78%), and gear bronze (Cu 85.92%, Sn 4.96%, Zn 2.93%, Ni 1.23%). The gear compositions were determined using atomic absorption. The gears under test exhibited significant difference in surface wear among each other. As compared to gear bronze commercial gun metal and gun metal showed surface wear of 245% and 109% r...

Rodolfo Villagra-Blanco1*, Gaby Dolz1, Danilo Montero-Caballero2, Juan Jose Romero-Zuniga2

...luetongue virus (BTV) by commercial enzyme-linked immunosorbent assay (ELISA). Antibodies were detected in 290 sheep from fourteen different flocks, distributed in all analyzed regions (Central, Chorotega, Atlantic Huetar, North Huetar, and Central Pacific) determining regional seropositivity between 63.5% and 100.0%, as well as an overall prevalence of 80.8 %. The within flock seropositivity percentages ranged between 0% and 100.0%. Flocks with the highest se...

Behzad Hussain1, 2, Abdullah Iqbal2, Muhammad Abubakar2*

...e. There is currently no commercially available vaccine for this disease. It is recommended that the disease can be controlled by adopting preventive measures such as avoiding of tick bites and contact with blood of the suspected animal. 

...

Amtul Jamil Sami1*, Madeeha Khalid1, Sara Iqbal1, Maira Afzal1 and A.R. Shakoori2

...cedure was performed for commercial dyes. The dye was removed due to the interaction with the polysaccharide starch and flocculation phenomenon. Chitosan starch based polymer composites can be used as an efficient and cost effective method to treat waste water polluted with carcinogenic dyes by coagulation-flocculation. Moreover this method is beneficial over other methods that employ toxic polymers or mineral coagulants.

...

Muhammad Khurshid, Muhammad Nafees, Inam-ur-Rahim and Wajid Rashid

...on from pure nomadism to commercial vegetable farming in upland areas and this has exposed the traditional nomadic life to socio-economic and environmentally vulnerability in upland areas.

...

Metin Duru1*, Asuman Arslan Duru1, Köksal Karadaş2, Ecevit Eyduran3, Harun Cinli4 and Mohammad Masood Tariq5

...e white laying hens as a commercial type through two-way ANOVA, to estimate the Pearson correlation between pairs of egg external and internal characteristics and to predict each of egg internal characteristics from egg external characteristics, treatment and week through CHAID analysis. A total number of eighty, 56 weeks old Hy-Line White laying hens (commercial type) of nearly similar initial body weight (1360.6±14....

Haji Muhammad, Zafar Iqbal* and Saira Saleemi

... Thirty two species were commercially important. Alpha Diversity Indices study showed that fish diversity of the River was quite rich (species richness, 70) and diverse, (Shannon’s index=3.66), (Simpson-D=0.96), Evenness was also high (Evenness (H/S) =0.55) and Chao-1 (70.75). The Quadrate diversity Indices were applied to the data and Bootstrap replicates mean values of the following indices were recorded as Chao 2 (70.8), Jackknife 1 (72.9), Jackknife ...

Muhammad Imran*, Munir Ahmad, Muhammad Naeem, Muhammad Farooq Nasir, Imran Bodlah, Muhammad Nasir and Umer Ayyaz Aslam Sheikh

...bumblebees for efficient commercial mass rearing.

...

 Ali Murad Rahoo1,2, Tariq Mukhtar3,*, Simon R. Gowen1, Rehana Kanwal Rahoo4 and Shaukat Ibrahim Abro5

... 4 days whereas with the commercial dose (8,000), nematodes did migrate to the larvae and caused some infection after 2, 3 and 4 days. Greatest invasion took place with the highest dose (80,000) with 8 IJ successfully finding and penetrating the larvae. A positive correlation was observed between dose and time and invasion of the host. It is concluded that application of EPN in cadavers may be appropriate in Pakistan because of the non-availability of industri...

Adedeji A.J, Sati N.M, Pewan S.B, Ogbu K.I, Adole J.A, Lazarus D.D, Ijiwo S.J, Okpanachi A, Nwagbo I.O, Joannis, T.M and Abdu P.A

...d ISA Brown pullets in a commercial poultry farm in Jos, Plateau State, Nigeria with mortality of up to 79.12%. The clinical signs observed were prostration, ruffled feathers, diarrhea, anorexia, trembling and mortality that lasted for 6 days. Postmortem findings include ecchymotic hemorrhages in the breast and thigh muscles, mucosa of the junction between the proventriculus and gizzard, severely enlarged and hemorrhagic bursa of Fabricius (BF) and splenomegal...

Hira Akhter1, Bilal Aslam2*, Naveed Shahzad3, Tanzeela Farooq4, Muhammad Umer5 and Muhammad Hidayat Rasool2

...tections in asymptomatic commercial layers from Faisalabad district of Punjab, Pakistan. Overall 120 blood samples, 24 tissue samples from each organ (trachea, lung and intestine) were collected from the 12 commercial layer flocks selected randomly at the age of 35-50 weeks without any direct clinical manifestation of avian influenza. Serum collected from 120 birds was tested for antibodies against H9N2 by using Haemagglutin...

Rongrong Li1, Kun Li2, Xiaoqiang Wang2, Houqiang Luo2, Gang Qiu2, Hui zhang2, Yanfang Lan2 and Jiakui Li2,3*

.... gondii antibodies by a commercial enzyme-linked immunosorbent assay kits and an indirect hemagglutination test. The results showed that seroprevalence in Tibetan pigs were 25.6% by ELISA. On gender basis, the prevalence was found 25.1% in males and 27.8% in females. By the method of IHA, the seroprevalence in Tibetan pigs were 21.6%, and the prevalence was found 23.1% and 21.4% in males and females, respectively. The results indicates that the Tibetan gigs w...
Mahanama De Zoysa1, Si-yun Ryu1, Hyeon-cheol Kim2 and Bae Keun Park1*
...atus) purchased from commercial aquarium in Korea. Based on the morphological comparison with all Argulus species, isolated fish lice was identified as Argulus japonicus Thiele, 1899. A. japonicus is native to Asia, which also is a habitat for its typical hosts, such as goldfish and common koi carp (Cyprinus carpio). A. japonicus has not previously been described from goldfish from the ornamental facilities in Korean. Thi...
Kiran Afshan1*, Sarwat Jahan1 and Mazhar Qayyum2
...e diagnostic accuracy of commercially available bovine F. hepatica enzyme-linked immunosorbent assay (ELISA) for the detection of IgG against fascioliasis in sera of small ruminants. The result of current study indicated diagnostic accuracy of test 95.6%, while sensitivity and specificity of this assay for small ruminants was 97.83% (95% CI: 92.35% to 99.67%) and 93.75% (95% CI: 87.54% to 97.44%) respectively. In field this test indicated significant (p...
Sameera Akhtar1*, Muhammad Akram Muneer1, Khushi Muhammad1, Muhammad Yasin Tipu1, Muhammad Anees2, Imran Rashid1, Raza-ur-Rehman3 and Irshad Hussain1
...ild birds, as well as in commercial and backyard poultry.
...
Zafrullah Khan1, Shah Alam Khan1*, Hamayoon Khan2, Naeem Khan3, Khwaja Junaid1 and Inamullah Khan1
...been incorporated in the commercial wheat cultivars to help manage R. padi. During this study seven wheat genotypes were evaluated as antixenosis, antibiosis and tolerance. These tested genotypes were (Pir Sabaq-2004, Atta-Habib, Saleem-2000, Serin-2010, Khyber-87, Sarhad-82, and Khushal-69) in three separate experiments. Antibiosis resistance was identified to R. padi in wheat cultivar (Serin-2010), where a minimum number of R. padi

Iftikhar Ahmad, Abdul M. Saleem, Ghulam Mustafa, Khurram Ziaf, Irfan Afzal and Muhammad Qasim

...Cl and KNO3­) can be commercially used by the growers for early, uniform and healthy nursery stand of the tested species, which can ensure uniform maturity and flower harvesting of ornamentals.

...
Abdul Malik1,4, Ghulam Abbas1*, Hameeda Kalhoro2, Illahi Bux Kalhoro3, Syed Sajjad A. Shah4 and Halima Kalhoro3 
...ions. They were fed with commercial floating pellets having 35% crude protein at 2% body weight twice a day for 60 days and eggs were collected weekly. Results showed that fertilized eggs were found to be greater in number at low salinity level as compared to higher salinity level. Survival of fry ranged from 1058 to 1100 at salinity level of 0‰ – 20‰ with 5% increment, after which fry number decreased significantly (P<0.05). The fertili...
Nadeem Rashid1,*, Masroor Ahmad Bajwa1, Mohammad Masood Tariq1, Tanvir Ahmad2, Majed Rafeeq1, Zafar Ahmad1, Mohammad Arif Awan1, Mohammad Ali1, Muhammad Zahid Mustafa1, Muhammad Shafee1, Asad Ulah1 and Amanullah Khan3
... flavus) in finished commercial broiler feed and among the isolated strains of A. flavus having capacity to produce aflatoxin was investigated in this study. Finished commercial broiler feed samples (n=96) were collected from broiler chicken farms in and around Quetta district. Physical properties i.e. moisture and pH were determined by oven drying and pH meter, respectively. Viable fungal count of the feed...
Salman Khalid1,*, Abdul Rehman2, Mohammad Yasin Amir1, Abdul Rehman1, Imran Sarfaraz1 and Muhammad Asif1
...k’s infestation in commercial layer, a double blind randomized controlled trial was conducted. For therapeutic trials, the 80 birds (n= 60 infested with ticks, n= 20 healthy birds) were selected and divided into four groups (A, B, C and D), each comprising of 20 birds. Group A and B were treated with Ivermectin @ 0.2mg/Kg orally for two days and Fipronil (Spray at once), respectively. Group C was kept as positive control whereas the ticks free birds were...

Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

...g economic losses in the commercial poultry production sectors. Due to potential of H9N2 infections in human, LPAI H9N2 poses serious public health risk. Therefore, development of new potent and cost-effective influenza vaccines is urgently needed to safeguard poultry and to contain zoonosis. The primary goal of this study was to develop H9 plasmid-based DNA vaccine against the currently circulating AIV subtype H9N2 targeting HA gene of the virus A/Turkey/Egyp...

Muhammad Asif Zahoor1, Zeeshan Nawaz1, Abu Baker Siddique1, Sajjad ur Rahman2 and Shahid Ali1*

... birds (30 samples) in a commercial farm, using classical isolation and compared with molecular identification of Mycoplasma infections. A total of 96 tissue samples from trachea, air sacs, lungs and oral swabs along with blood from each bird were collected and initially subjected to isolation of Mycoplasma spp. using brain heart infusion broth supplemented with horse serum. The blood was used for serum plate agglutination assay. Thereafter, the samples were s...
Maoying Zhu, Yuntao Ji, Xiaoyu Wang, Junying Pu and Changqing Qu*
...tential to be helpful in commercial and clinical application of ADSCs.
...

Zia Ur Rahman1*, Syed Mehar Ali Shah1, Hidayat Ur Rahman1, Fida Mohammad1, Mian Ahmad Raza1 and Ijaz Ahmad Khan2

...e accessions and the two commercial rice cultivars displayed susceptible reactions. Seven rice accessions viz. UoA-2, UoA-5, UoA-11, UoA-48, UoA-53, UoA-102, and UoA-123 showed moderate levels of resistance while eleven rice accessions viz. UoA-4, UoA-6, UoA-22, UoA-41, UoA-60, UoA-67, UoA-68, UoA-84, UoA-126, UoA-129 and UoA-133 displayed strong resistance against the disease. The use of these resistant rice accessions are, therefore, recommended for deployin...

Muhammad Khurshid1,2*, Muhammad Nafees1, Mehmet Somuncu2

...vestock production in to commercial agricultural system and shaped an uncertain environment that is not suitable for both landless nomadic pastoralism and ecological sustainability. This study reflects that how this agriculture encroachment may have contributed to the pastoral resources degradation and subsequent landless pastoralist’s marginalization in uplands of Naran. Extensive field surveys carried out during last three years (2013-2016) to understa...

M. B. Meah

Biopesticides for crop growth and crop protection
... are in the pipeline for commercial use.

...

B. Ramanujam, R. D. Prasad, S. Sriram and R. Rangeswaran

Mass production, formulation, quality control and delivery of Trichoderma for plant disease management
...edium in deep tanks on a commercial scale. Biomass from the liquid fermentation can be made into different formulations like, dusts, granules, pellets, wettable powders. Trichoderma formulations can be applied to the seed either by dry seed treatment or by seed biopriming for control of several soil-borne diseases of some field crops. Similarly, seedlings of horticultural crops and rice are treated by dipping the roots in Trichoderma suspensions before plantin...

Bijan Kumar Das

Incidence of Aleurocanthus spp. (Aleyrodidae: Hemiptera) on betelvine (Piper betle L.) and their interaction with host plants
...eraceae. In India, it is commercially cultivated over an area of 50,000 ha as an important and potential cash crop. In spite of the tremendous potentially of the crop, cultivation of betelvine is highly risky and returns are uncertain because of its susceptibility to several pests and diseases, aggravated by the nature of the plantation. A good number of hemipteran insect pests occur in betelvine ecosystem which dwindle betelvine yield potentiality. Among thes...

Madhuban Gopal, Rajesh Kumar and Arunava Goswami 

Nano-pesticides - A recent approach for pest control
...and mites as compared to commercial sulphur.

 

...

T. P. Ghosh, D. Mandal, S. Laha and M. K. Dasgupta 

Dynamics and severity model in managing fungal diseases
...g 1996-1997 in different commercial perennial ornamentals in gardens and nurseries at Bolpur, Santiniketan and Sriniketan of Birbhum District, West Bengal, India, to study the fungal diseases of some commercial ornamentals. The leaf spot of Ficus religiosa (c.o. Alternaria sp.) is the first record. Fifteen fungal diseases have been formally described from West Bengal for the first time on these twelve ornamentals. Monthly dy...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...he birds in group A were commercial broiler chicks having maternal derived antibodies and were challenged with IBDV field isolate at the rate of 0.1ml of EID50 (virus titer 105.50/100μl) on 2nd week of age through eye drops. Group B specific antibody negative (SAN) chicks were challenged with same dose at 2nd week of age. While the group C and D was unchallenged control containing commercial
Yasemin Bircan Yildirim* and Hediye Tugce Vurmay
...and intestine tissues of commercially important finfish species: saddled seabream (Oblada melanura), gilthead sea bream (Sparus aurata), Bogue (Boops boops), horse mackerel (Trachurus mediterraneus), red mullet (Mullus barbatus), brushtooth lizardfish (Saurida undosquamis), grey mullet (Mugil cephalus), threadfin bream, (Nemipterus randalli), which were caught from the Iskenderun Bay at 6 different locati...

Mahmoud Said1*, Abd El Satar Arafa1, Mohammed A. Rohaim2* and Hussein A. Hussein2

...l of one hundred day old commercial broiler chicks were vaccinated with LaSota. A group of chicks (n=40) were immunized using baculovirus (H5 and ND) inactivated vaccine via subcutaneous route. Birds (n=20) were then either challenged with 106 EID50 using Egyptian avian influenza H5N1 and Newcastle disease genotype VII. Comparative blood profiling in vaccinated and challenged, non-vaccinated and non-challenged and non-vaccinated and challenged indicated that M...
Rafi Ullah1, Sarzamin Khan1,*, Abdul Hafeez1, Asad Sultan1, Nazir Ahmad Khan2, Naila Chand1 and Naseer Ahmad1 
...al with silkworm meal in commercial broiler rations. A total of 150 day-old broiler chicks (Ross 308) were randomly distributed into fifteen replicate groups (n=10), and consequently reared on five experimental diets according to a completely randomized design. Feed intake was higher in D4 group in comparison with other groups (P < 0.05). Live body weight was higher in D4 group than D2, D3 and D5 groups (P < 0.05). FCR and dressing percentage were simila...

Wesam Hasan Mohamed Mady1*, Bing Liu2, Dong Huang2, Abdel Satar Arafa1, Mohamed Khalifa Hassan1, Mona Mehrez Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

...economic losses for both commercial and backyard poultry production sectors. Owing to public health risk, effective control of the virus in imperative. DNA vaccination is a promising new approach for the prevention and treatment of many viral diseases because of its ability to induce both humoral and cellular immune responses against antigens encoded by recombinant DNA. The goal of this study was to construct Egy-H5 plasmid DNA-based vaccine against a currentl...
Talha Nazir1,2,*, Muhammad Dildar Gogi2, Muhammad Zeeshan Majeed1, Waheed ul Hassan2, Abdul Hanan2 and Muhammad Jalal Arif
...he field efficacy of six commercial insecticides viz.; Blaster 72.5%WP (imidacloprid + acephate), Bugatti 50%SC (imidacloprid + bifenthrin), Confidor 20%SL (imidacloprid), Jozer 202SL (imidacloprid + acetamiprid), Pouch 35%SC (pyriproxyfen + etofenprox) and Senator 41.6%EC (imidacloprid + pyriproxyfen) against sucking insect pest complex and also determined their side-effect on natural enemies of these insect pests such as ants, parasitoid wasps, green ...
Tanveer Ahmad1, Hafiz Sultan Mahmood1*, Zulfiqar Ali1, Muhammad Azeem Khan2 and Shahid Zia3
...otential and needs to be commercialised in sisal growing areas of the country.
...
Gülnur Metin* and İlker Aydin
...s were obtained from commercial fishermen between November 2008 and January 2011. The total length and weight of the females or males were measured as 7.3–17.5 cm and 2.6-38.9 g or 7.8–15.4 cm and 2.6-41.6 g, respectively. The samples were composed of 56.6% females and 46.6% males, with a female to male ratio of 1:0.77. The spawning period was determined from May to October. The total lengths at first maturity of females and males were 10.64 cm...
Nargis Bano and Khalid Mahmood Qureshi*
...centration could be used commercially to improve yield of strawberry.
...

Lucas Pedroso Colvero1, Paulo Eduardo Brandão2*, Cesar Alejandro Rodriguez Rosales2, Hanny Swam3 and Laura Yaneth Buitrago Villarreal1 

 

... effect of two different commercial inactivated water-in-oil multivalent vaccines; vaccine A contains IBV (Massachusetts M41 and D274 strains), NDV (Clone 30), aMPV (BUT 8544) and IBDV (classic strain) whereas vaccine B contains IBV (Massachusetts M41 and a Brazil type strain), NDV (LaSota strain), aMPV (TRT strain) and IBDV (GP82 strain). Viscosity values for vaccines A and B where determined to be 40.2cP and 83.3cP, respectively, and a microscopic examinatio...
Zia-ur-Rehaman1, Naila Chand1, Sarzamin Khan1 and Rifat Ullah Khan2,*
...n=242) of four different commercial strains (Ross, Hubbard, Cobb and Arber Acer) were placed in brooding room in first two weeks and then chicks were divided into two groups: TN and HAT zones. Chicks in TN group were housed at constant room temperature, while chicks in HAT zone were kept at high ambient temperature. Chicks in each group were further divided into four sub groups. Each sub group was further subdivided into four replicates having ten chicks ...

Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3* 

...ncer. VEGF TrapR1R2 is a commercial anti-angiogenic fusion protein. Our earlier studies demonstrated the anti-angiogenic and anti-proliferative activities of VEGFR1(D1-D3)-Fc and RNV66 in in vitro functional assays. We compared the anti-tumorigenic properties of these three molecules for tumor volume reduction in xenotransplanted SCID mice and by histopathological and immunohistochemical analyses. Our results demonstrated that fusion protein VEGFR1(D1-D3)-Fc e...
Faiz Muhammad1,*, Syed Khurram Fareed1, Urooj Zafar1, Taseer Ahmed Khan2 and Aqeel Ahmad1
...y significant disease in commercial poultry industry. This study aimed to develop and optimized a novel tPCR approach to detect Mycoplasma gallispeticum, Mycoplasma synoviae and nonpathogenic mycoplasmas at the same in a single PCR reaction collected from diseased chicken. Direct PCR from the clinical samples produced false negative results. Both culture and PCR were combined as culture-enhanced PCR approach. Three different DNA crude preparation...
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...from among the available commercial okra cultivars. Okra cultivars showed significant variations from comparative susceptibility to comparative resistance. On the basis of fruit and shoot infestation caused by H. armigera,Manchali, RK-516, OH-152 and Tarnab Nargis were found comparatively susceptible, Rama Krishna, NS-810, Baharti Kaspori, Lady Finger-1 and Lady Finger-2 showed intermediate resistant reaction while KT-458, Bhindi Punjab Selection, Arka ...
Quang Minh Dinh
...ypauchen vagina is a commercial fish, but little is known on its population parameters. This study was carried out at downstream of Hau River in the Mekong Delta, Vietnam to provide fundamental information on the population biology of T. vagina based on length-frequency distribution analysis of 1,527 individuals. The male to female T. vagina ratio was not significantly different within and between seasons, and the parameters of the von Bertal...

Malak Atiq Ullah Khan* and Fida Mohammad 

...could be recommended for commercialization in Khyber Pakhtunkhwa. 

...

Sajid Muhammad* and Fida Mohammad 

...eding lines which can be commercialized after fulfilling procedural requirements. 

...

Farah Rauf Shakoori, Momina Shokat, Faiza Saleem and Tanzeela Riaz

...e is of great importance commercially because of its high stability at elevated temperatures and in alkaline conditions. The present study was aimed to isolate and screen xylanase producing bacteria and to optimize cultural conditions for maximum production of enzyme from locally isolated bacteria and to optimize the assay conditions under which enzyme possessed maximum activity. Two bacterial isolates XPB-GS02 and XPB-CW01 with maximum activity ratio showed 1...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4 and Lorenzo Gallus
...ions. Fish were fed with commercial floating pellet (35% protein) at 3% body weight per day for 40 days. Results showed that fish growth was significantly (P<0.05) higher in term of weight gain, WG % of initial weight, mean daily WG, SGR, feed conversion and survival rate from 15‰ to 30‰ salinity than those reared in 35‰ and 40‰ salinity. Condition factor was found to be significantly higher on 40‰ salinity than 15‰...
Zia ur Rehman1, Naila Chand1, Rifat Ullah Khan2,*, Sarzamin Khan1 and Muhammad Subhan Qureshi3
...al profitability of four commercial broiler strains in two different temperature zones i.e., thermoneutral zone (TN) and high ambient temperature zone (HAT) group. Day-old broiler chicks (n=242) of four different commercial strains (Ross, Hubbard, Cobb and Arber Acer) were placed in brooding room for the first two weeks and then chicks were divided into two groups: TN and HAT. Chicks in TN group were housed at constan...
Yakut Gevrekçi* and Çiğdem Takma
...ds were collected from a commercial flock in west of Turkey. The analysis performed with cathegorical (cage and line) and continuous (hatch, age at sexual maturity and body weight of sexual maturity) predictors and a continuous response variable (EP). The Spearman’s rho correlation coefficients among all predictor variables were significantly changed from 0.88 to -0.65. Age of sexual maturity was found the most predictor variable that affecting EP and it...
Ozgur Altan*
...d part could not be used commercially by substituting the fish meal in a rate of one-to-one, and that it could be included in the formulation as a second class raw material although it is not as valuable as fish meal in terms of amino acid balance.
...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool3, Fatima Ahmed4, Saiqa Tabassum3,6, Syeda Madiha3, Tahira Perveen3 and Saad Bilal Ahmed5
... the chickens are reared commercially through feeds and battery cages allowing maximum weight gain and growth in considerably less time. The constituents that are fed to chickens concentrate in the flesh and bring deleterious health outcomes on the consumers. The ill effects account for hyper-lipidemias and imbalance in the steroidal sex hormones may result in the development of cysts in the ovaries with resultant difficulties in reproduction. The present stud...
Qamar-un-Nisa1, Muhammad Younus2,*, Muti-ur-Rehman1, Azhar Maqbool3 and Sajid Umar4

 

...er model. Three-week-old commercial broilers were inoculated with either vNDV, E. coli serotype O78 or both agents simultaneously or 3 days apart. The birds were clinically observed and swabbed daily. They were killed at 4 and 14 days after single or dual inoculations and were inspected for gross lesions. Samples of the respiratory organs (trachea, lungs, and air sacs) were taken for histological analyses. All the infected subjects showed clinical signs...

Ayesha Bibi*, Musharaf Ahmad and Shaukat Hussain 

...tandard procedures using commercially available kit i.e. protinase-K (sigma). 27 out of 34 isolates were confirmed as Cmm having 614bp band. Black nightshade (Solanum nigrum L) was the only weed from which pathogen was consistently isolated. From Northern KP, a total of nine weeds including; Solanum nigrum L., Solanum americanum Mill., Solanum Sarrachoides Sedntner, Amaranthus blitoides S. Wats, Amaranthus albus L., Lactuca serriola L., Amaranthus retroflexus ...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4, Lorenzo Gallus4 and Syed Sajjad A. Shah2,3
... 1:3. They were fed with commercial floating pelleted feed constituting 35% crude protein with 2% body weight twice a day. Eggs were collected on weekly basis by cultch removal method. Results showed that the highest fecundity, fertility, hatchability and survival of fry were obtained on salinity of 0%-15% and significantly decreased on 20‰ and 25‰. The eggs per gram body weight were also recorded in all treatments and highest eggs were obtained ...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Ghulam Dastagir4, Sara Ferrando5, Lorenzo Gallus5, Asad Ali Muhammad1,6, Abdul Jabbar2 and Khalil-ur-Rehman2 
...ions. Fish were fed with commercial floating pellet (35% protein) with 3% of total biomass day-1 for 50 days. Results showed that the growth increment reared on 10‰ - 20‰ salinity were significantly highest in term of weight gain, WG % of initial weight, daily weight gain, specific growth rate, condition factor and survival rate than those reared on 25‰ and 30‰. Feed conversion ratio was found similar in all levels which ...

Fazal Ullah1*, Muhammad Sajid1, Syeda Leeda Gul2, Bibi Zainub1 and Maaz Khan

...nge fruits can be stored commercially up to 60 days at room storage conditions (Storage Temperature: 12 ± 2 °C and RH: 70 - 80%). HWT can serve as a dynamic means of maintaining the postharvest quality of sweet orange fruits during long term storage with economic benefits. 

...
Muhammad Naeem1, Bushra Sadia1,2,*, Faisal Saeed Awan1and Muhammad Anjum Zia3
...anced SK production with commercial applications.
...

Raania Ahsan* and Zafar Altaf**

... the release of a normal commercial variety

...

Zaheer Ahmad, M. Yaqub Mujahid, M. Anwar Khan, Shaheena Yasmin, M. Asif and Maqsood Qamar*

...ng and was approved as a commercial variety namely NARC-2009 for cultivation in rainfed areas of Pakistan.

...

 Mohammad Siddique Munawar, Shazia Raja, Elizabeth Stephen Waghchoure* and Muhammad Barkat**

...work was undertaken in a commercial apiary that showed visual signs of AFB infection. Twenty four hives positive for AFB were identified from the apiary (4 colonies in each replicate). Half of the colonies were treated with shook swarm method while other half were left without any treatment. The treated colonies showed significant difference from untreated colonies (t test, P< 0.005) and moribund colonies got recovered with increased bee population while th...

 Sumia Bint Zaman, Sidra Majeed and Shahid Ahmad*

...ld win. Before launching commercial production of Jatropha in Pakistan key issues need to be addressed including maintaining the goal of food security, water scarcity, cost-effectivity, and feasibility of Jatropha in comparison with oilseeds, pulses, feed crops and fuel-wood plants.

...

 Sarfraz Ahmad, Shaista Koukab, Nayyar Razzaq, Muhammad Islam, Aneel Rose*, and Muhammad Aslam**

 Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*

... and its suitability for commercial cultivation even in the area under small holdings, the investigation suggest its genetic as well as biochemical investigation for the production of commercial varieties and exploitation of the plant for economic benefits of the local communities.

...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...fectious bronchitis from commercial poultry. Initially the isolated IB-virus was characterized by RFLP using enzymes Alu I, Hae III, BstYI and XcmI. On the basis of its distinct RFLP pattern from other known IBV vaccine strains, the isolate was named as KU145467_NARC/786_Pakistan_2013 (also named as Pak-786) was subjected to Spike gene sequencing covering the amino-terminus region of 01 to 974 base pairs. The S protein sequence was submitted to the GenBank wit...

Anish Shrestha 

... be potential and viable commercial enterprise 

...

 Gulzar S. Sanghera and Wassem Hussain*

HETEROSIS IN RELATION TO COMBINING ABILITY PER SE PERFORMANCE IN TEMPERATE RICE (ORYZA SATIVA L.)
...on large scale for their commercialization under temperate conditions. 

...

 Asrar Ali*, Ehsan-ul-Haq**, Abdul Rehman***, Javed Khan, Waseem Ahmad Gillani** and Maria Rauf*

BIOLOGICAL PARAMETERS AND PREDATORY POTENTIAL OF MENOCHILUS SEXMACULATUS FAB. (COLEOPTERA:COCCINELLIDAE) AT VARYING TEMPERATURE ON RHOPALOSIPHUM PADI L.
...quality mass rearing and commercialization of predatory beetle, M. sexmaculatus was ascertained.

...

 Maqsood Qamar*, S. Dilanawaz Ahmad Gardazi**, Riaz-ud-Din*, Muhammad Sohail* and Syed Haider Abbas*

PARTIAL RESISTANCE TO STRIPE RUST AND ITS EFFECT ON SUSTAINABILITY OF WHEAT YIELD
... field. Eleven Pakistani commercial wheat cultivars/advance lines including check (Inqalab 91) were assessed for the level of partial resistance against stripe rust using Area Under the Disease Progress Curve (AUDPC), disease severity (DS) and epidemic growth rate in comparison with wheat cultivar, Inqalab 91. During 2007 cropping season, natural epidemic was developed and relative AUDPC was recorded from 0 to 100% whereas the 2008 cropping season was dry and ...

 Arshed Bashir*, Fatima Ahmad**, Irfan Mehmood*, Muhammad Qasim*, Mazher Abbas* and Sonila Hassan*

ECONOMICS OF RED MEAT PRODUCTION IN PUNJAB
...zed specialized farm and commercial farms. Four districts of Punjab (Gujranwala and Sialkot from rice-wheat zone and Chiniot and Faisalabad from mixed cropping zone) were selected for data collection and 76 red meat producers were interviewed. The results showed that commercial farms were dominated by cows while the small sized specialized farms were dominated by buffaloes. The mean age, sale price and live weight of sold bu...

 Sameera Arshad*, Iftikhar Hussain*, Maqsood Anwar* and Sarwat Naz Mirza*

HABITAT SURVEY FOR RECOGNIZING BIRD ATTRACTANTS AROUND BENAZIR BHUTTO INTERNATIONAL AIRPORT, ISLAMABAD, PAKISTAN
...acting sites followed by commercial habitat ranking (6), habitat near water bodies and landfill sites (5.6), followed by habitat with old buildings as dominant feature (4), landfill sites (2.9) habitat near sport ground (1.8), however bird score of these two sites, was 2 and 3, respectively. Habitat representing modern housing society with covered trash transfer facility (with rank, 1.3) had least bird attracting sites. About 64 plant species and 34 bird speci...

 Quratulain*, Muhammad Aslam**, Muhammad Khalid Rafique*, Mian Atiq Ahmad* and Rashid Mahmood***

POPULATION DYNAMICS OF ROSE APHID MACROSIPHUM ROSAE L. ON DIFFERENT CULTIVARS OF ROSA INDICA L. IN PAKISTAN
...rmers growing roses on a commercial scale should grow Christan Diar to avoid aphid attack. Maximum average number of aphid nymph, winged and wingeless adults on leaves, buds and flowers were 11.11, 4.97 and 10.13, respectively observed on Perfecta variety

...

 Sidra Majeed*, Mubbashira Nazir*, Sumia Bint Zaman * and Waqas Farooq*

POTENTIAL OF SUGAR BEET PRODUCTION IN PAKISTAN: A REVIEW
...ssues and constraints in commercial production of sugar beet. Trends were analyzed using existing published statistics. Water requirement of sugarcane is almost three-fold of the sugar beet. Sugar beet will not put pressure on water resources if cultivated on commercial scale. The government is in favor of beet sugar but sugarcane mill owners are reluctant to encourage sugar beet cultivation due to some technical barrier. Be...

Basharat Hussain Shah*, F. S. Hamid*, Shams ul Islam*, Fayaz Ahmad*, Sohail Aslam*, and Noorullah Khan*

EVALUATION OF DIFFERENT PEA (PISUM SATIVUM L.) GENOTYPES FOR YIELD AND OTHER ATTRIBUTES AT SHINKIARI, MANSEHRA
...urpose six advance lines/commercial pea varieties were collected from Ayub Agricultural Research Institute (AARI) Faisalabad and one local variety was included in the experiment as a control. The experiment was conducted during 2014-15 at National Tea & High Value Crops Research Institute (NTHRI) Shinkiari, Mansehra. Altogether seven pea genotypes were laid out in Randomized Complete Block Design (RCBD) with three replications. Normal agronomic practices w...

 Nusrat Habib*

RELATIVE PROFITABILITY ANALYSIS OF SUNFLOWER IN DISTRICT SWABI AND MARDAN
...province during 1976 but commercially adopted by a large number of farmers only by 1990's. Sunflower cultivation trend kept on increasing from the year 1990 to 1999. Since then a continuous decreasing trend in adoption of sunflower has been observed. The present research work was planned to estimate the relative cost effectiveness of sunflower with competing crops like sugarcane and tobacco to find out the major factors which caused the decreasing trend of sun...
Wazha Mugabe1,3,Gaolebale Segolame Mpapho1, John Kamau1, Wameotsile Mahabile2, Shalaulani James Nsoso1, Kealeboga Dipheko1 and Assar Ali Shah3,*
...meat type breeds. With a commercial mindset, improved goat management and cooperative pooling and marketing of milk the current farming setup of using meat breed for milk could prove beneficial to both the meat and dairy sectors.
...
Muhammad Abu Bakar1, Muhammad Anjum Aqueel1, Abu Bakar Muhammad Raza1, Muhammad Arshad1, Rashid Mahmood2,* and Ziyad Abdul Qadir2
Alaeldein M. Abudabos*, Abdullah N. Al-Owaimer, Elsayed O.S. Hussein and Mutahar H. Ali
...to examine the effect of commercial vitamin C supplement (VC100, 200 mg/kg), on performance of broilers. Two levels of environmental temperatures: normal (22°C) and high (32°C) and two levels of vitamin C in drinking water (with and without) were arranged in a factorial arrangement resulted in four dietary treatments for the period from 15 to 30 days of age. Results revealed a significant two way interaction for body weight gain (BW) and feed intake (F...
Fouzia Tabssum1* and Syed Shahid Ali2
...nce; they are being used commercially in a variety of ways such as clarification of the juices in beverage industries, tea making, and wastewater treatment among others. The present investigation was undertaken to isolate pectinase-producing bacteria from local habitats. To enrich the diversity of isolated bacteria that produce pectinase, samples were collected from the soil, water, fruits and vegetables wastes. Initial screening of pectinase producing bacteri...
Fouzia Tabssum1* and Syed Shahid Ali2
...nce; they are being used commercially in a variety of ways such as clarification of the juices in beverage industries, tea making, and wastewater treatment among others. The present investigation was undertaken to isolate pectinase-producing bacteria from local habitats. To enrich the diversity of isolated bacteria that produce pectinase, samples were collected from the soil, water, fruits and vegetables wastes. Initial screening of pectinase producing bacteri...
Ligia Neves Scuarcialupi, Laila Andreia Rodrigues Beserra, Julia Rosas Hochheim, Rodrigo Martins Soares, Fabio Gregori*
...(RVG) found in Brazilian commercial avian farms. A total of 97 intestinal contents was collected between 2008 and 2015 from 10 Brazilian states, and submitted to two different RT-PCR, targeting a fragment of viral VP6-coding nucleotide sequence of each viral group. Amplicons were further submitted to genetic sequencing and analyzed by phylogenetic analysis. There were 5 RVF positive samples (5.15%) in 2 broilers, 1 laying hen and 2 breeders. Only one RVG sampl...

Osama Elshazly1, AbdelSatar Arafa1, Mohammed A. Rohaim2, Ismaeil M. Reda2 and Hussein A. Hussein2*

...ve/dead birds, including commercial and backyard flocks, in five different locations in Egypt between the years of 2015 and 2016. All samples were screened using virus isolation, as well as antigenic and molecular detection methods. Full-length hemagglutinin (HA) sequences of six representative H5N1 isolates were analysed to study their genetic evolution followed by estimation of their evolutionary rates among different virus clusters. This analysis revealed a...
Hamayun Khan1,*, Abdul Wahab1, Navaid Kazi2, Younas Muhammad1,Summaya Kazi3, Salman Kazi4, Azmatullah Khan1, Ikramullah Khan5 and Shakoor Ahmad1
..., day 25 and day 28 with commercially accessible kits for biochemical markers that includes glucose, total protein, albumin, creatinine, triglycerides, blood urea nitrogen (BUN), alanine transaminase (ALT) and aspartate transaminase (AST). The current study demonstrated the ascertained value in amniotic fluid for glucose, total protein and albumin at day 18, 25 and 28 was 42.9±0.80, 37.4±0.90, 36.5±0.88mg/dl; 17.9±0.30, 16.1±...
Arshad Mahmood Malik1, Khalid Mahmood Mughal2, Sarfraz Ahmed Mian2 and Atta Ullah Khan2
...nique entity involved in commercial production of hydroponic products in Pakistan. Data on various production and economic variables was collected from FMP during 2009 to 2013. Variable of the study were area, area allocation decisions of farmer, customer structure, markets, costs involved in production process and revenue earned from selling of the produce in both local and in export market. Yield of hydroponic tomatoes was measured in hectares. Benefit cost ...
Pasqua Rotondi1, Maria Antonietta Colonna1, Giuseppe Marsico1, Francesco Giannico1, Marco Ragni1 and Anna Maria Facciolongo2,*
... treatments: C) control: commercial pelleted feed; L) pelleted feed containing 3% extruded linseed; LO) pelleted feed containing 3% extruded linseed and 0.6% dried oregano inflorescences. Kids were slaughtered at 60 days of age. Diet did not affect in vivo performances, dressing percentage, pH and meat colour, but it influenced meat tenderness, that was lower (P<0.01) in meat from kids receiving oregano, probably due to the lesser (P<0.05) fat con...

Muhammad Adnan Khan1*, Majid Suhail Hashmi1, Ali Muhammad1, Muhammad Muneeb1, Haris Bilal1 and Gul Wali

...0:20) blended squash for commercial feasibility to this product. 

...

Nashwa Mohamed Eid1, Al-Hussien Mohamed Dahshan1, El-Shayma El-Nahass2, Basma Shalaby3 and Ahmed Ali1* 

...o study was conducted in commercial broiler chickens, where, 2 groups of 10 day-old broilers were fed a balanced ration with addition of thyme (0.25%) or clove (0.125%). Birds were then challenged with CP (1×108 CFU) together with another 2 groups without EOs at 15 days of age. Starting from 3 days’ post infection (DPI), the second 2 set of birds without EOs addition were fed ration containing 0.25% and 0.125% thyme and clove oils as treatment in c...
Jia-kui Li1,2,*, Kun Li2, Zhao-qing Han2, Hui Zhang2, Xiao-qiang Wang2, Hou-qiang Luo2, Yan-fang Lan2 and Gang Qiu1,2
...l detection by employing commercial enzyme-linked immunosorbent assay (ELISA) kit to test the prevalence of BVDV(Bovine Viral Diarrhea Virus) in yaks in Hongyuan, Sichuan province, a cold climate and high altitude area of China. Totally, 516 yak serum samples were randomly got during 2012 to 2014. BVDV was found highly prevalent among the adult yaks (51.1%; 95% CI: 46.5-55.6) and calves (60.5%; 95% CI: 43.4-76.0), respectively. The prevalence of BVDV infection...
Hazrat Nabi1, Irshad Hussain2, Muhammad Adil3, Amar Nasir3,*, Arbab Sikandar3, Saeed Khan1 and Nasrullah Khan3

 

...aluate the impact of two commercial mycotoxin binders (Mycotox® and Mycofix® Plus 3.0) on the humoral immunity, lymphoid organs and growth performance of broilers. In this study, a total of 118 day-old broiler chicks were used, of which 108 were randomly divided into 6 groups (A to F) on day 14th. Aflatoxins derived from Aspergillus parasiticus were mixed in the feed measuring 150 ppb and fed to various broiler g...
Sumaira Maqsood1,*, Muhammad Afzal2, Muhammad Anjum Aqueel2, Waqas Wakil3 and Hafiz Azhar Ali Khan1,*
... the present study three commercial formulations of biorational insecticides viz., Bacillus thuringiensis (DiPel®), NPV (SpltNPV) and Flubendiamide (Belt®) evaluated (alone and in combination) against S. litura under field condition. Minimum plant infestation (7.60±0.40%) was observed three days after application when B. thuringiensis and flubendiamide were applied in combination (@0.5 kg/...
Abdul Wajid1,*, Asma Basharat2, Muhammad Akbar Shahid3, Sidra Tul Muntaha1, Abdul Basit4, Tanveer Hussain5, Muhammad Farooq Tahir6, Muhammad Azhar7, Masroor Ellahi Babar1 and Shafqat Fatima Rehmani2

Irfan Ali Sabir1, Saeed Ahmad1*, Muhammad Nafees2, Ahmad Sattar Khan1, Maryam3 and Ishtiaq Ahmad

...pects. Diverse seventeen commercial and noncommercial indigenous and exotic mango varieties were selected to collect and analyze fruit morphological data under randomized complete block design (RCBD). There was significantly high fruit weight and pulp contents in ‘Kensington Pride’. Total soluble solids (TSS) were higher (21.9 B°) in ‘Chaunsa’, while, titratable acidity (TA) was lowest in ‘L...
Naeem Ahmad1,* and Zulqurnain2*
... earthen ponds, fed with commercially available feed. Similar feeding regime and physical conditions were maintained for both treatments. It was found that there was no significant difference in final total length (TL) and standard length (SL) of the fish in both treatments (P>0.05). However, average monthly weight gain, final total wet weight (WW) and weight gain with increase in TL were higher in GIFT-Th as compared to GIFT-Tw (P<0.05). There was no si...

Mian Noor Hussain Asghar Ali, Liaquat Ali Jamali, Shakeel Ahmed Soomro*, Shakeel Hussain Chattha, Khalil Ahmed Ibupoto, Naseer Ahmed Abbasi and Noor Mehdi Qumi  

...crose, purity, fiber and commercial cane sugar. The results revealed that weight loss and fibre content throughout increased with increasing storage period. However, a decrease was observed with increasing storage period for brix content, sucrose content, purity percentage and commercial cane sugar percentage under both storage conditions. The observations of results further revealed that sugarcane covered with trash provide...
Shafaq Fatima*, Sumrin Sahar and Khalid Lone
...>) is the most important commercial carp in South Asia due to its higher growth, flesh quality and increased market demand. Present study investigated the seasonal variations in gonadosomatic index (GSI) and profiles of sex steroids such as testosterone (T), 11-ketotestosterone (11-KT), estradiol-17β (E2), cortisol (C), progesterone (P) and 17α-hydroxyprogesterone (17α-HP) during annual reproductive cycle under semi-arid climate con...

Muhammad Abu Sufyan Ali, Syed Attaullah Shah*, Ghaffar Ali and Muhammad Fayaz 

...s price. Residential and commercial encroachment on fertile irrigated farmlands at urban fringe is alarming. More than half of the sampled transacted farmland parcels were used for residential and commercial units’ construction. Farmland potential for commercial or residential use creates a value expectation and it capitalizes into farmland price. The value, however, does not influen...

Mushtaq Hussain Lashari1*, Fozia Afzal1 and Umer Farooq

...for toxoplasmosis with a commercial latex agglutination kit (Antec Diagnostic products, UK). The overall prevalence was 26.76%. The significant (P<0.05) higher seroprevalence was observed in males (34.28%) than in females (19.44%). For analysis of hematological parameters blood samples were collected. The mean values for hemoglobin (Hb), Packed Cell Volume (PCV), Red Blood Cells Count (RBC), Mean Corpuscular Volume (MCV), Mean Corpuscular Hemoglobin (MCH), ...

Mohsin Iqbal1, Farid Asif Shaheen1*, Farah Naz2, Muhammad Usman Raja2, Muhammad Fiaz3 and Muhammad Nadeem1 

...n towards development of commercial formulations of bio-pesticides to be used against this grain beetle and other stored product insect pests. 

...

Asma Sohail1*, Kashif Sarfraz Abbasi1, Maryum Arif2 and Fatima Najam1 

...UV rays. This limits the commercial application of these oils. To overcome such problems encapsulation could be a gentle approach. Prior to encapsulation, oil extraction was done by using five different solvents including ethyl acetate, n-hexane, methanol, diethyl ether and chloroform in which ethyl acetate yielded 53% oil. Pumpkin seed oil was encapsulated using gel entrapment i.e. extrusion method and indirect diffusion method using Ca-alginate. Pumpkin seed...
Tevfik Ceyhan1,*, Osman Samsun2 and Okan Akyol1
...fish were collected from commercial fisheries, using encircling nets between October 2016 and December 2017 in Sinop, Central Black Sea. The length and weight distribution of all garfish samples ranged from 28.8 to 51.6 cm TL and from 26.6 to 177.2 g, respectively. Female: male ratio was 0.3:1. The LWR parameters (a, b, r2) were computed as 0.0009 ± 0.50, 3.040 ± 0.32 and 0.902 ±0.40, respectively. The age of garfish was ...
Muhammad Mohsin1, Dai Guilin1,*, Chen Zhuo1, Yin Hengbin1 and Muhammad Noman2
...ic implications of major commercially hunted fish species. In this study maximum sustainable yield (MSY) of Carangoides fishery from Sindh, Pakistan is estimated by using catch and effort data. For data analysis, two specialized fishery software CEDA (catch and effort data analysis) and ASPIC (a stock production model incorporating covariates) were employed. Three surplus production models (SPMs) viz., Fox Model (FM), Schaefer Model (SM) and Pella-Tomli...

 Abir Ishtiaq, Muhammad Naeem*

Length-weight relationships and condition factor for farmed Catla catla (Hamilton, 1822) from southern Punjab, Pakistan
... /> renowned and highly commercial freshwater major carp, thaila (Catla catla) from farming system. Mean±S.E. total
length (TL) and body weight (W) of studied samples have been calculated as 39.29±0.23 cm and 827.43±14.55 g,
respectively. For LWRs, specimens of C.catla were collected from fish ponds and grouped into three categories on
the basis of the feed offered to them which contained 15%, 20% and 25% crude protei...

Nabila Roohi, Mehjabeen, Samina Ashraf*

Effects of cigarette smoking on serum proteins profile in male active and passive smokers
...ofile was analyzed using commercially
available kits by using automated clinical chemistry analyzer. Serum total proteins
have shown a significant decrease in smokers in comparison with controls. A
significant depression in serum albumin was observed in smokers due to increased
excretion of albumin in bound state with the chemicals, whereas, total globulins,
gamma globulins and non-gamma globulin serum proteins have shown sig...

 Siddra Tayyab Akhtar, Anjum Nasim Sabri

Twitching, swimming, swarming in biofilm forming strains in response to chemical and physical factors
...ment by
expensive commercial detergents, we could change the physical environment of
sewage systems as well as flooding some specific chemicals, which disrupt
bacterial motilities and biofilm formation.

...

Masab Umair Khan, Syed Mehar Ali Shah, Hidayat-ur-Rahman, Arshad Iqbal* and Ezaz Aslam 

...1620 are recommended for commercial cultivation after multi-location trials and onward utilization in maize breeding programs. 

...

Muhammad Shahzad Akbar, Muhammad Zeeshan Majeed* and Muhammad Afzal 

...mparative efficacy of 10 commercial formulations of new-chemistry insecticides against Odontotermes obesus (Isoptera: Termitidae), one of the most economic subterranean termite species in Indo-Pak region. Label-recommended dose rates of insecticides were tested against worker termites using modified filter paper disc method according to completely randomized design. All insecticides caused significant mortality of termites as compared to control treatment. For...

Misbahullah, Shad Khan Khalil, Asim Muhammad*, Afza Tabassum and Shah Fahad  

...lign: justify;">Although commercial herbicide are very effective in controlling weeds but their continuous use causes toxicity and develop resistance in weeds and pollute underground drinking water. Alternative environmental friendly methods are needed to explore possibility of weed control and enhance crop yield. Sorghum extract and their application times on weed dynamics, phenology and leaf tracts of variety Atta Habib was sown at the Research Farm of Agron...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...a widely-distributed and commercially-important aquaculture species. In this study, two prostaglandin E synthase 2 (PTGES2) orthologs were identified. The full length ortholog PTGES2a was 1,575 bp and contained a 1,167-bp Open Reading Frame that encoded a protein of 388 amino acids. The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length ortholog PTGES2b was 1,457 bp and contained a 729-bp ORF t...
Muhammad Shabir Shaheen1, Shahid Mehmood1, Athar Mahmud1, Jibran Hussain1, Ahmed Sultan Jatoi2, Muhammad Yaqoob3, Sohail Ahmad1 and Arshad Javid4,*
...ted by using 720 day-old commercial broilers, 240 from each of the 3 strains (Ross 308, Cobb 500, Hubbard classic). All the chicks having uniform body weight were randomly distributed into 36 replicates having 20 birds each according to completely randomized design and were fed the same quantity of feed. The birds were subjected to 4 heating systems during brooding (Floor Heating, Diesel, Gas and Electricity Bulb). Growth performances, blood glucose, cholester...
Sumaira Maqsood1,*, Muhammad Afzal2, Muhammad Saleem Haider1, Hafiz Azhar Ali Khan1, Muhammad Ali1, Muhammad Ashfaq1, Muhammad A. Aqueel2 and Muhammad Irfan Ullah2
...odoptera litura is a commercial pest of diverse field crops comprising cauliflower (Brassica oleracea var. botrytis). Current inspections were carried out to determine their impact on larval mortality, pupal and adult emergence by exposing three field strains of S. litura (Faisalabad, Chiniot and Sargodha), under laboratory conditions. Both NPV and Bt were applied using diet incorporation method. Two concentrations of a NPV base...
Ajmal Khan Kassi1,*, Humayun Javed1 and Tariq Mukhtar2
...rphic characteristics of commercially grown okra cultivars and resistance or susceptibility to Helicoverpa armigera is lacking, therefore, in the present study relationship between physico-morphic characteristics and resistance or susceptibility of okra cultivars to H. armigera was evaluated. The heights and stem girths of comparatively resistant varieties were statistically greater as compared to intermediate resistant and comparatively suscepti...
Hande Küçükönder1, Pınar Çelebi Demirarslan1,*, Aykut Burgut2 and Mustafa Boğa3
...duction performance in a commercial poultry enterprise with a hybrid approach. In accordance with this purpose, the hybrid approach has two main objectives: i) Determination of the effective period for which the output factors [(chicken survival rate (%), egg yield (%)] are optimized at the same time and the appropriate value ranges for the input factors [temperature (oC), humidity (%) and feed per hen (g)] that provide effectiveness ii) Determinati...

 Abdul Khaliq1, Muhammad Irfan Ullah1,*, Muhammad Afzal1, Akhlaq Ahmad2 and Yasir Iftikhar3

...ious threat to effective commercial use of fumigants in various quarantine treatments. Therefore, resistant strains of Tribolium castaneum (Herbst), Rhizopertha dominica (Fabricius) and Sitophilus oryzae (Linnaeus) were tested against phosphine and bio fumigants to check their fitness and potential following by F1 generation. Phosphine fitness in term of mortality mean calculated at 300 ppm was minimum against weevil but highly ...
Iram Maqsood1,2,3 and Ke Rong *1,2
...rict regulation over its commercial use and illegal hunting. All of these strategies give a revival hope to this world most endangered species and give a chance to be part of this ecosystem biodiversity in perspective future. China contributed greatly to conserve ecological and cultural roles of Chinese alligators and its sustainable utilization.

...

Ihsan Ullah Khan*, Muhammad Arshad, Muhammad Ayub Khan, Muhammad Ashraf, Ashiq Saleem, Sundas Awan, Samra Azam and Shamim Ul Sibtain Shah 

..., six inbred lines and a commercial check (Hysun-33). The recorded data on days to flowering initiation (DFI), days to flowering completion (DFC), days to maturity (DM), plant height (PHT, cm), stem thickness (ST, mm), head diameter (HD, cm), 100-grain weight (100-GW, gm), oil content percentage (OC %) and seed yield (SY, kg ha-1) revealed statistically significant differences. All the crosses out-performed the standard check in terms of seed yield (kg ha-1) w...

Ragia S. Mohamed1, Rania F. El Naggar2, Mamdouh. M. Hamoud1, Mohamed M. Hamoud3, Abdulrhman M. Gamal1, Samah E. Laban1, Shimaa A.E. Nasr1, Manal M. Zaki1, ElShaimaa Ismael1, Osama K. Zahran1* 

Fukuan Du1,2, Yongkai Tang1, Juhua Yu1, Shengyan Su1, Fan Yu1, Jianlin Li1, Hongxia Li1, Meiyao Wang1 and Pao Xu1,2,*
...i>Coilia nasus) is a commercially important species. However, eco-environment deterioration and overfishing have almost caused extinction of the species in the Yangtze River. Therefore, it is very urgent to perform genetic research on C. nasus to protect the wild population. In this study, we sequenced the brain transcriptome of C. nasus using Illumina Hiseq 4000 platform. We obtained 123,764 unigenes with an average length of 1092 bp and a t...

Syed Atif Hasan Naqvi* 

...biological agents may be commercializing to help farmers to combat the disease. There is a need to use environmentally safe approaches to overcome the loss of grain yield in rice due to this disease. Climate change has a serious effect on this disease because in current scenarios cropping pattern has been changed and the stakeholders has shifted to some other crops rather the practicing ones. Since, farming community has adopted rice crop in non-core areas of ...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
... and microorganism, gain commercial importance for improving the yield and nutraceutical properties of juice processing industry, degumming of fibre plants and maximum oil recovery. These enzymes break down complex polysaccharide polymers of plant tissues into simpler monomer like D-galacturonic acids. In this study, polygalacturonase from grape skin was purified by salting out with ammonium sulfate, gel filtration on Sephadex G-75 column and ion exchange on Q...

Muhammad Rehan1, Asim Aslam1, Muti-ur-Rehman Khan1, Muhammad Abid2, Shakeel Hussain3, Javeria Umber4, Ahsan Anjum1 and Altaf Hussain2* 

...ously cause outbreaks in commercial poultry throughout the world. Despite intensive vaccination, ND is endemic in Pakistan and locally known as Ranikhet. Wild birds are considered natural reservoirs of Newcastle disease virus (NDV) and some common resident or migratory wild birds are associated with outbreaks of ND in commercial poultry in Pakistan. Continuous isolation of new genotypes in Pakistan shows the evolving nature ...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
...th and chronic stress in commercial-scale in-pond raceway systems under this experimental conditions.
...
Asghar Khan1,*, Aneela Zameer Durrani1, Arfan Yousaf2, Jawaria Ali Khan1, Mamoona Chaudhry1, Mumtaz Ali Khan3, Habibunnabi4 and Amjad Khan5
...rvey was conducted in 30 commercial and subsistent farms in Pothohar region of Rawalpindi district, Punjab. Where randomly 196 lactating buffaloes were sampled. Data on several health, management and bio-security variables was collected in face to face interviews from farmers, managers and owners. Milk samples collected were subjected to California Mastitis Test.Data entry and validation was performed through Epi-Data. Data analysis was performed through SPSS....

Tahira Jatt1, Ghulam Sarwar Markhand1, Lane Rayburn2, Ray Ming3, Mushtaque Ahmed Jatoi1 and Ameer Ahmed Mirbahar1,4* 

... of the seven indigenous commercial date palm varieties and four wild type date palm of Sindh province, Pakistan by using the traditional Fuelgen squash method. Results indicated that all seven commercial varieties and four wild types of date palm are diploid in nature and having 2n=36 chromosomes. First time detailed karyotype of these varieties have been developed which includes total chromosome length (TCL), relative leng...
Rana Waqas Arshad1, Asim Aslam1, Muhammad Saeed Imran1, Kamran Ashraf2 and Raheela Akhtar1,*
...ent study was to compare commercially available vaccines of infectious bursal disease (IBD). Three experimental groups, each having 100 broiler birds were placed in the same environmentally controlled house. Samples of blood and bursa of Fabricius were collected from slaughtered birds after every 7 days till the end of experiment (35 days). The size of bursas and the bursa/body weight ratios were significantly greater in live vector vaccine group than other va...

Amjad Ali1*, Wiqar Ahmad1, Muhammad Zeeshan1, Farmanullah Khan2 and Muhammad Motasim Billah1 

... in combination with two commercial biofertilizers; Bizote-N and Rhizogold to lentils during Winter 2015 in an RCB design and the residual effect was evaluated on soil micro-nutrient status and chemical properties after maize harvest in Summer 2016. Particle sizes in the above order showed 3, 2 and 2% increase in soil pH over the control (7.63) and 15, 10 and 6% increase in soil EC over the control (125 mS cm-1), respectively. Their OM contents (1.73, 1.68 an...

Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan 

...ed as a major threat for commercial and traditional poultry industry in Egypt, even in vaccinated flocks. A total of 8121 different samples (organs and swabs) that represented 588 NDV suspected flocks were collected from poultry farms showing respiratory manifestation and/or drop in egg production during 2015-2018. Out of 588 NDV outbreaks 95 flocks were confirmed positive NDV by rRT-PCR using genotyping primers, with a prevalence rate of 16.2%. NDV outbreaks ...

Wesam Mady*, Nahed Yehia, Mohammed Hassan Elhussieny, Azhar Gaber Shalaby, Moataz Mohamed El Sayed, Neveen Rabie Bakry, Asmaa Shaaban, Abdel Satar Arafa, Afaf Abdel Baset Mahmoud and Wafaa Mohammed Hassan 

...omic losses for both the commercial and backyard poultry production sectors. The aim of this work is to study the Situation and molecular characterization of HPAIV (H5N8) in backyard poultry production sector in Egypt. In this study, a total of 7505 samples of tracheal swabs representing 1180 backyard poultry flocks were collected based on the surveillance conducted by the GOVS (General Organization for Veterinary Services), Egypt during the period from May 20...
Nazia Qamar* and Sher Khan Panhwar
... were collected from the commercial catches from July 2013 to March 2015. Fish length and otolith length for five species recorded as S. commersonnianus TLcm = 16.3−88.4, OLcm = 0.3−0.9; S. lysan TL=23.2−73, OL = 0.2−0.7; S. tala TL = 48.5−55.5, OL = 0.6-0.9; S. tol TL =18.9−68, OL =0.3− M. cordyla TL= 18.4−47, OL = 0.3−0.9. The otolith dimensions suc...
Naheed Ikram and Nafisa Shoaib*
...m 14 different genera of commercially important marine fishes Acanthopagrus sp. Parastromateus niger, Nemipterus sp., Pampus argenteusIlisha sp., Alepes djedabaEpinephelus sp., Teraponjarbua, Terapon puta, Scomberomorus koreanus, Epinephelus coioides, Lutjanus sp., Pomadasys sp. and Lutjanus johnii procuredfrom Kemari fish harbor (Pakistan). Our study sh...
Shujjah Haider1,*, Ayesha Maqbool1, Tariq Pervez1, Saima Parveen1, Arfan Ahmad2, Zahid Iqbal3, Javed Iqbal3, Shahid Mehmood3, Amanullah Khan4 and Sajid Umar5
...tudy was conducted on 25 commercial layer flocks from different regions of district Chakwal, Pakistan. A total of 358 blood samples were collected from different regions of district Chakwal and subjected to serological tests including enzyme linked immusorbant assay (ELISA) and rapid plate agglutination assay (RPA). The overall seroprevalence of MG detected through iELISA and RPA was 29.88 % and 20.67% respectively. Moreover, age-wise study revealed high preva...
Nida Zia1, *, Ayesha Maqbool2, Muhammad Safdar3, Umm-I-Habiba1, Altaf Mehmood4, Muhammad Usman5, Zahid Iqbal6, Javed Iqbal6, Shahid Mehmood6, Amanullah Khan7 and Sajid Umar8
...iability and immunity in commercial broilers. The main aim of the present study was to detect and characterize FAdVs. Liver tissues were collected from poultry flocks showing clinical signs of HHS and investigated using PCR assay for FAdVs. The FAdVs were detected in 8 samples collected from different flocks. Positive PCR amplicons were sequenced to genetically identify the FAdVs. Phylogenetic analysis revealed two distinct clusters among FAdVs. One cluster co...
Suhu Duan, Liuan Li*, Zaiqiang Li, Mengran Qin, Zhenzhen Fan, Keyan Zhang, Qian Wang, Zhongmou Zhang, Bailiang Yang
...tty acids in yolk of the commercially available ordinary chicken eggs and Brand A and Brand B black-bone chicken eggs, thus providing theoretical and practical references for selective consumption of chicken eggs. The results have shown that a total of 18 types of fatty acids are detected in 3 types of chicken egg yolk, including 6 types of saturated fatty acids (SFA), 12 types of unsaturated fatty acids (UFA), 6 types of monounsaturated fatty acids (MUFA), an...

Muhammad Usman Ghazanfar, Muhammad Imran Hamid, Mubashar Raza, Waqas Raza*, Misbah Iqbal Qamar 

...growth of the plants and commercially used as bio-fungicide against soil borne plant pathogens. The present study was conducted with the aim to determine the efficacy of Trichoderma species using dual culture and pot assays against Phytophthora infestans (late blight) and Fusarium oxysporum (wilt) of tomato on different compost including carbon rich compost, nitrogen rich compost and nutrient enriched compost. The species of Trichoderma includes T. harzianum a...

Wajid Khan* and Raziuddin 

...negative best parent and commercial heterotic effects were observed in 17 and 13 hybrids for maturity, respectively. Desired significant positive best parent and commercial heterotic effects were observed in 18 and 21 hybrids for primary branches plant-1, 19 and 10 hybrids for pods main raceme-1, 11 and 05 hybrids for 1000-seed weight and 18 and 01 hybrid for seed yield plant-1, respectively. Top ranking F1 hybrids were, AUP...

Masood Ahmad* and Abdur Rab 

...: justify;">Gladiolus is commercially important flowering plant famous for its excellent flowers worldwide. In order to meet the high demand for its quality plants especially cut flowers. Gladiolus is commercially propagated by corms. The quality and health of corm is one of the important factors that affect the production and quality of gladiolus florets and spikes as well as corm production. Keeping in view, the significan...
Zia-ud-Din1, Muhammad Nauman Aftab2, Tanveer Hussain3,*, Irfana Iqbal4 and Asma Zafar5
...ence, the households and commercial farmers are suggested to prefer Mushki variety of Aseel chicken as attempt to produce Aseel females and probiotic supplementation would be of high economic viability for such flocks.
...
Shanshan Cai1, Tianxiang Gao2, Binlun Yan3, Aiyi Zhu1 and Xiumei Zhang1,2,*
...trituberculatus is a commercially important species in Chinese fishery industry. However the natural resources of swimming crabs are declining and enhancement programs are being conducted for resources restoration for decades. In this study, 524 female broodstock from 10 hatcheries and 547 recaptured crabs from 6 investigations were used to assess the proportion of released individuals and evaluate the effect of the program in Shandong Province in 2014. Pa...
Rais Ahmed1,2,*, Muhammad Khalid Mansoor1,2, Iftikhar Hussain1, Muhammad Saqib3, Muhammad Hammad Hussain4, Amjad Islam Aqib5, Haleema Sadia6, Javed Muhammad7, Asma Irshad8, Kashif Prince5, Muhammad Zain Saleem9 and Abdul Whab Manzoor10
...dom and then tested by a commercially available ELISA kit for the detection of antibodies against Mycobacterium avium subsp. paratuberculosis (MAP). Data were analyzed using chi square for ELISA and odds ratio for finding association of species, gender, body weight, age and body condition score (BCS) with prevalence of antibodies against MAP. Seropositivity against MAP was significantly (P<0.05) detected. Male and female animals were equally s...
Muhammad Aslam Farooqi*, Bakhtawar Irsa, Sajjad Ali, Asif Sajjad, Muhammad Waqar Hassan and Sohail Akhtar

 

...ed insecticides to their commercial formulated field dose applications, they were causing a potential threat to A. mellifera at their maximum recommended dose except spirotetramat.
...
Muhammad Furqan Shahid1*, Tahir Yaqub1, Muhammad Yasin Tipu2, Asim Aslam2, Saima Yaqub1, Aziz-ul-Rahman3, Muzaffar Ali1
...) variants isolated from commercial, backyard poultry and fancy birds (partridge). Commercial broiler birds were infected experimentally at the dose of 106 EID50 by using these three isolates. Results revealed that onset of clinical signs was started at 2nd day post infection (DPI) followed by severity in redness and swelling of eyes, sneezing and lacrimation at 3rd DPI that lasts ...

Khaled Kaboudi* 

...wild birds. Infection in commercial poultry flocks causes important economic losses, related to high mortality, decrease in animal performance and aggravation of infection by other pathogens. Although H9N2 is endemic in many regions of the world, such as Middle East and North Africa, where the first outbreaks were described since the end of 1990s, many features about epidemiology and genetic characteristics are still little known. This review summarized the ep...
Tanzeela Riaz, Fiza Sana-Ullah Khan, Farah Rauf Shakoori
...s which occupies a great commercial position because of their high stability under alkaline and acidic conditions. The current research was planned to isolate, screen and optimize mannanase production from Bacillus megaterium from decayed fruits. Microorganisms were isolated from fruits, soil and water samples obtained from different localities of Lahore city, Pakistan. Locally isolated microorganisms were screened for their mannanase producing characte...
Syed Maaz Nadeem1*, Muti ur Rehman Khan1, Asim Aslam1, Ali Ahmad Sheikh1, Arfan Ahmad1* and Muhammad Anees2
...void future outbreaks in commercial poultry.
...

Ghulam Hussain1, Muhammad Asrar1, Dilbar Hussain2, Khurum Zia3, Abdul Rashid4*, Hina Anwar5, Muhammad Azeem1, Saddam Hussain1 and Sabeen Asghar1 

...evaluate and compare the commercially available pesticides and indigenously available plant extracts. The efficacy of following insecticides and plant extracts viz. Cascabela thevetia leaf extract @ 300ml/acre, Azadirachta indica @ 300ml/acre, Profenofos @600ml/acre., Crown 70WS @125gm/acre, Match 50EC@250ml/acre, Helmat 40EC@600ml/acre and Confidor 20SL@ 250ml/ acre were evaluated on cotton against 3rd instar cotton mealy bug. Data was collected after 3,6,12,...
Nazir Ahmad Khan1,*, Mudassir Alam1, Rafiullah khan1, Kamran Khan2 and Sadeeq ur Rahman3
...ric feeds were prepared: commercial feed (control) containing only CM; (ii) diet containing only QPM200; (iii) diet containing only QPM300; (iv) diet containing 50% each of the QPM. Birds fed on QPM300-based diet had higher (P < 0.05; 2438.5 g) final body weight and better (P < 0.05; 1.743) feed to weight gain efficiency throughout the experimental period. Eight days in vivo digestibility assay showed that QPM300 had higher (P < 0.05; 81.7%) dr...
Ammara Blouch1, Ata ul Mohsin2, Muhammad Naeem2 and Rashid Mahmood1*
...to check the efficacy of commercial biopesticides under controlled environmental conditions. Bio pesticides are important alternates for chemical control of economically damaging insect pests like leaf worm, Spodoptera litura Fabricius. In this study, two commercial products including Dipel with Bt sub speciess kurstaki and Turex with Bt sub speciess kurstaki and aizawai were tested ...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4

 

...cate. Fish were fed with commercial feed containing 29% crude protein and gross energy of 3,340.50 kkal/kg of feed and cultured for 90 days. The physicochemical parameters of water were always at satisfactory levels for fish culture throughout the experiments except for NH3-N (0.05 mg/L) and NO2-N (0.02 mg/L): water temperatures ranged from 27.5 to 30.5 °C, DO 4.3 to 5.6 mg/L, pH 6.56 to 6.96, alkalinity 50.65 to 52.25 mg/L, and hard...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool4, Laraib Liaquat3, Fatima Ahmed5, Asra Khan1, Tahira Perveen3, Mirza Jawad ul Hasnain6, Saima Khaliq7 and Saad Bilal Ahmed8
...y for standard chow rat, commercial chicken feed, commercial chicken meat and organic chicken meat over a six-week period. Plasma levels of tumor necrosis factor alpha (TNF-α) and alpha-fetoprotein (AFP) were estimated before and after the administration of different meals. After the experiment, the liver samples were weighed and histopathologically evaluated using a knodell score to assess portal hypertension and live...

Malak Atiq Ullah Khan1*, Fida Mohammad2, Fahim Ullah Khan3, Sheraz Ahmad2, Mian Ahmad Raza1 and Tariq Kamal

...could be recommended for commercialization in the province of Khyber Pakhtunkhwa, Pakistan. Furthermore, stability parameters can supplement the use of AMMI and GGE biplot analysis to get more credible and reliable scrutiny of wheat genotypes in METs. 

...
Irfan Shahzad Sheikh, Masroor Ahmad Bajwa, Nadeem Rashid, Muhammad Zahid Mustafa, Mohammad Masood Tariq*, Majed Rafeeq, Abdul Samad, Tauseef M Asmat and Asad Ullah
Kadir Seyhan1,*, Nimet Selda Başçinar2, Nadir Başçinar3 and Umar Khan3
...nus;1.46 g) was fed with commercial pellets under similar conditions to avoid the ingress of any other variable such as temperature and dietary energy density. Their stomach contents were sampled at predetermined postprandial times, and were dried at 60° C to constant weight. The course of GE in both sizes of S. fontinalis fry was best described by the square root model. The relationship between GER and body mass was then determined by a power funct...
Boxin Dou, Ying Liu*, Yumeng Liu, Lili Fan, Yongqiang Ma, and Yanguo Shi
...s activity with selected commercial antihypertensive pharmaceutical. A new peptide with ACE inhibition properties was obtained by using alkaline protease to enzymatic hydrolysis of RB crude protein purified by ultrafiltration, size exclusion chromatography and RP-HPLC. Using consecutive chromatographic techniques successively, the acidic hydrolysates of RB proteins were fractionated and the new ACE inhibitory triplet was isolated and identified. The amino acid...

Amjad Usman1*, Arshad Khan1, Ruidar Ali Shah2 and Toheed Iqbal3 

...this study was to screen commercially available tomato genotype and to identify the morphological plant characters responsible for resistance against S. dorsalis. For this purpose, five commercially cultivated tomato genotypes (Riogrande, Riogrande H, Bombino, Roma VF and Roma) were evaluated against thrips (S. dorsalis) at A.R.I. Tarnab, Peshawar, Pakistan during spring 2017 in randomized complete block design with three re...

Muhammad Zeeshan Nazar*, Ayyan Umer, Zahid Mahmood Sarwar, Faiz Ullah Faiz and Sikandar Hussain 

...reared on wide range for commercial purpose. Silkworm is susceptible to various pathogenic diseases. Among the all bacterial diseases of B. mori, flacherie is injurious disease that is initiated by entomo-pathogenic bacteria, Bacillus thuringiensis var. sotto (Bts). The impact of this infectious disease is weight loss, reduction in cocoon quality as well as quantity and source of infestation for healthy larva. In current study, the 3rd instar larva of B. mori ...
Xuhui Zhang1, Zhiyuan Sun2, Jinfeng Cai1, Guibin Wang1, Zunling Zhu1, Linguo Zhao3 and Fuliang Cao1,*
...s. Three hundred day-old commercial Arbor Acres (AA) broiler chicks were randomly allocated into 5 dietary treatments including five variations: control group, fed with the basal diets; NF group, the addition of 3 g/kg NF products; FR1, FR2 and FR3 groups, addition of FR products 1 g/kg, 3 g/kg and 6 g/kg, respectively. There was no difference in body weight gain, feed intake and feed intake/gain ratio between treatments. Compared with the control group, the p...

Muhammad1*, Muhammad Suleman Bacha2 and Syed Akhtar Ali Shah1 

...stic sources followed by commercial (26.9%), institutions (5.8%) and industrial (2.9%) sources. While the majority of respondents (81%) were concerned about the unsafe disposal of solid waste and are willing to pay for organic fertilizer alternative to chemical fertilizer for urban agriculture. We also found that socio-economic variables namely education, monthly expenses, and agriculture farm size positively affect farmers’ WTP for organic fertilizer. C...
Samia Afzal*,Sadia Zahid, Iram Amin, Muhammad Shahid and Muhammad Idrees
...hikungunya virus using a commercial ELISA kit. Twenty seven (5.4%) and thirty five (7%) samples were IgM and IgG positive, respectively. All antibody positive samples and a subset of negative samples (195) were further subjected to PCR for confirmatory purposes. Two different sets of primers were used for the identification of the viral genome. Thirty samples were found PCR positive and a subset of ten samples was direct sequenced. Sequence analysis showed 94%...

Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan

...loes raised on different commercial dairy farms and exposing the hazards linked with milk-born tuberculosis infection in the area where unpasteurized milk is normally used in the central zone of Khyber Pakhtunkhwa (KP), Pakistan. A total of 1225 cattle and 1175 buffaloes of more than one year were studied for the prevalence of bovine tuberculosis. A total of 1608 milk samples (793 from cattle and 815 from buffaloes) were collected from already PPD (purified pr...

Cornelius Arome Omatola*, Samson Daniel Iyeh, Shedrach James Abuh, Charles Kehinde Mofolorunsho, Martin-Luther Oseni Okolo and Phoebe Queen Akoh 

...HBV, HCV and HSV-2 using commercially available immunochromatographic based kits and for syphilis using non-treponemal and treponemal antibody test. Socio-demographic and obstetric parameters were obtained using structured questionnaires. Sixty-four (25.6%) out of 250 women had at least one STI. The overall prevalence of syphilis, HIV, HBV, HCV and HSV-2 were 28(11.2%), 21(8.4%), 10(4.0%), 5(2.0%) and 0% respectively. Women who were married, unemployed, aged 1...

Aqsa Ahmad1, Iftikhar Ahmad1* and Malik Fiaz Hussain Ferdosi

...es of SD, PH and PM. For commercial cut antirrhinum production, substrates with locally available components of CC, RH and RM can be recommended. 

...
Imran Khan1, Muhammad Nawaz1,*, Aftab Ahmad Anjum1, Mansur-ud-Din Ahmad2, Adnan Mehmood1, Masood Rabbani1, Amina Mustafa1 and Muhammad Asad Ali1
...oup 09 started receiving commercial probiotic Protexin (1g/litre) at day 01 to 35 and challenge bacteria at daye 07. Group 10 started receiving antibiotic at day 01 to 10 and challenge bacteria at day 07. Birds were challenged with a single dose of 106 cfu of Salmonella enteritidis by oral gavage. D-xylose absorption capacity and gut morphometric parameters (villus height, crypt depth and villus height to crypt depth ratio) were studied at da...
Muhammad Saeed Imran1, Asim Aslam1*, Muhammad Yasin2, Tahir Yaqoob2 and Beenish Zahid3
...estigate the efficacy of commercially available vaccines against each virus alone as well as co-infections with NDV and IBV in commercial poultry. For assessment of vaccine efficacy, commercial chickens were vaccinated with La Sota (against NDV) and Massachusetts (against IBV) vaccine preparations. After screening the protective titers in birds at 19 days post inoculation three week-old br...
Fermín López-Uriostegui1, Jesus T. Ponce-Palafox2*, Fabiola Lango-Reynoso1, María R. Castañeda-Chávez1, Itzel Galaviz-Villa1, Sergio Castillo-Vargasmachuca2 and Arturo Ruiz Luna3
...atment. Prawns were fed (commercial shrimp feed with 35% protein, 12% lipid) daily at a ratio of 10% body weight, twice a day (10:00 and 18:00 h). The optimal growth intervals were from 26 to 29°C and from 3 to 11‰ of salinity, and survival was at 23 to 29°C and 0 to 5‰. The greatest effect of the temperature-salinity interaction was on the upper extremes of response. The analysis of response surfaces showed that the final weight and weig...

Tingting Li, Shuangshuang Geng, Long Xie, Huiyan Xu, Aolin Luo, Pengwei Zhao, Huan Yang, XingWei Liang, YangQing Lu, XiaoGan Yang* and KeHuan Lu*

...m cells (SSCs). To date, commercialized murine and human GDNF have typically been used for the in vitro culture of SSCs from domestic animals. However, whether endogenous GDNF is superior to xenogenic GDNF in SSC culture in vitro remains unclear. To answer this question, the buffalo GDNF gene was cloned and integrated into the PiggyBac eukaryotic expression vector, which was stably expressed in Sertoli cells, thus establishing a PB-GDNF-Sertoli c...
Dil Afroza Khanom1, Amirun Nesa1, Muhammad Abu Sayed Jewel1, Muhammad Ayenuddin Haque1, Alok Kumar Paul1, Sonia Iqbal2, Usman Atique2,3*, Lubna Alam4
... investigated edible and commercially valuable fish species viz. Gudusia chapra and Eutropiichthys vacha, for the muscular tissue bioaccumulation of selected heavy metals (Pb, Cd, Cr, Zn, Cu, and Mn) and their human health risks. A total of 50 fish species (25 individuals each) were examined from the Padma River, Bangladesh, and subjected to heavy metals presence and loads by detection after wet digestion of samples. The resul...

Noor Islam1*, Rashid Mahmood1, Ghulam Sarwar1, Sarfaraz Ahmad2 and Saleem Abid

...or various attributes of commercial apiary of honey bee, Apis mellifera in Kohat from June to October 2018. Data were recorded for consumption rates, sealed worker brood area, strength of honey bee colonies and honey yield. Data analysis showed significant difference among all diets tested and check (i. e. control colonies). Diet 2 induced the highest consumption rate (71.90 g per colony), maximum sealed worker brood area (1562.0 cm2 per colony), mean highest ...
Saira Saleemi1*, Zafar Iqbal1, Abdul Nasir Khalid2
...ed fungal infection in a commercial fish silver carp. The impact of fungal infection on fish and aquaculture industry is discussed. New data on fungal infection is added and contributed.
...

Anurag Sharma*, Naresh Kumar, Geetanjali Singh and Anika Sharma 

...lactagogue activity. The commercially available drugs pose health threats and prove detrimental to both human and animal health. The traditional use of herbal preparations suggests that they are safe and effective, however, scientific validation is still required for many of them especially for animal use. The phyto-pharmacological research on these two natural products show a ray of hope for the discovery of new active compounds with a novel structure that ha...

Ehsan-Ul-Haque1, Akbar Hayat1*, Muhammad Asim1, Sajjad Hussain2, Muhammad Shakeel Hanif3, Muhammad Zubair1, Muhammad Abdullah Jamil1 and Faheem Khadija1 

...lts were incorporated in commercial wax to control postharvest decay in Willow leaf mandarin (Citrus reticulata Blanco) and Kinnow mandarin (Citrus reticulata Blanco). Sodium bicarbonate and Potassium sorbate incorporated (6% w/v concentration) in wax were used to compare with commercially used fungicide (Thiabendazole). Study was conducted at 4±1 C° with 90±05% relative humidity for 60 days followed by one...

Ahmad Hussain1*, Syed Murtuza Mehdi2, Amjad Ali3, Muhammad Adeel3, Mohammed Hassan Jabal4, Farid Nasir Ani4 

INVESTIGATION THE TRIBOLOGICAL CHARACTERISTICS OF CASTOR OIL WITH MINERAL OIL BLENDS
... is discussed its use as commercial lubrication oil is
also outlined, The tribological attributes are investigated through the well known four ball tribotester method. In the
experiments, castor oil is blended at volumetric ratio ranging from 20 to 80 % with commercial mineral oil, where
the setup is consictent with ASTM D4172. Results indicate that a mix of castor oil with comme...

Muhammad Amjad*1, Abdur Rafai1, Saeed Badshah1, Rafi Ullah Khan1, Sajjad Ahmad1 

FINITE ELEMENT ANALYSIS OF THE REAL LIFE LOADINGS ON THE TI-27NB HIP BONE IMPLANT
...ysis was performed using commercial FEA software ANSYS. The implant model
was meshed using tetrahedral element type. The simulation result show that maximum stress occurs at the neck of
the implant for each loading case. The stress level was approximately equal to the strength of Ti-27Nb in 100 Kg,
stand up position case. 

...

Anjum and Ahmad Khan*

Phenology, Crop Stand and Biomass of Wheat in Response to Farmyard Manure and Soil Amendments
...dquo;humic plus” a commercial product having 40% humic acid, and effective microbes from “bioaab” a commercial product having beneficial microbes like bacteria, yeast and actinomycetes. Average over years, the maximum days to anthesis (126 days), physiological maturity (154 days) and enhanced emergence (9 days) were observed with 20 Mg FYM ha-1. The emergence m-2 (126), leaf area tiller-1 (107 cm2), plant h...

Wisal Shah*, Muhammad Nafees**, Muhammad Iqbal***

EVALUATION OF MARBLE SLURRY WASTE FOR PREPARATION OF COMMERCIAL GRADE CEMENT
...nufacturing of cement on commercial scale. Waste marble slurry was obtained from marble processing units
and compares it with the calcium carbonate used in the cement industry by analyzing it for physical and chemical
characteristics. Cement was made in the laboratory according to standard formulation. Commercial brand available

Nisar Mohammad*, Mohammad Mansoor Khan* Noor Mohammad*

CHARACTERIZATION OF TALC-CARBONATE ROCK OF MINGORA EMERALD MINES, DISTRICT SWAT, KHYBER PAKHTUNKHWA, PAKISTAN
... devising a suitable and commercial processing technique for the said talc carbonate rocks. Thorough investigations were conducted using SEM-EDX X-Rays Diffraction (XRD) ,

Nisar Mohammad٭, Mohammad Mansoor Khan٭, Noor Mohammad٭

EXTRACTION OF HIGH QUALITY TALC FROM TALC-CARBONATE ROCK OF MINGORA EMERALD MINES BY FLOTATION AND LEACHING
...adation of indigenous noncommercial talc resources from other locations. These rocks host emerald crystals and the debris are dumped after excavation and extraction of emerald crystals. Controll of environmental threat caused by these rock dumps is an additional benefit of the research. Two step froth flotation process with AF65 (Poly propylene Glycol, Cyanamid) as frother, Sodium hexa metaphosphate as depressant for carbonates, equal mixture of oleic aci...

Kamran Ghasemi1*, Mostafa Emadi2, Asghar Bagheri3 and Mehdi Mohammadi1

Casing Material and Thickness Effects on the Yield and Nutrient Concentration of Agaricus bisporus
...g layers comprising commercial casing soil (CCS), spent compost (SC), coco peat (CP) and vermicompost in three thicknesses (2, 4 and 6 cm) were evaluated in this study for production of Agaricus bisporus. The CCS treatment had the most mushroom yield (27.03 Kg m-2) whereas CP casing layer showed the minimum yield (4.43 Kg m-2). The same results were obtained in total yield of compost and biological efficiency. The CCS treatment induced ...

Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood

...uation of impacts of new commercial products “Quantis” and “Acevit-C” on growth, yield and antioxidative behaviour of bottle gourd cv. Aakash F1. Three level of Quantis (6 ml, 8 ml, 10 ml) and Acevit-C (100 ppm, 150 ppm and 200 ppm) were applied as foliar treatment following RCBD design. Results showed that impact of foliar application of both Quantis and Acevit-C on bottle gourd growth and reproductivity were significant. Moreover, app...

Arifa Khan1*, Danish Anwar2, Shazia Erum3, Naveeda Riaz1, Shahid Riaz4, Tariq Rafique3 and Zafer Iqbal2

Screening of Exotic Potato Germplasm against Potato Virus PVX, PVY and PLRV through Biological and Serological Test (ELISA)
...d could be suggested for commercial cultivation in Pakistan.

...
Ishrat Perveen1, Yasar Saleem2 and Javed Iqbal Qazi3* 
...en kabab samples of four commercially available brands (K, S, D and B) were analysed for the simultaneous determination of HCAs i.e. 2-amino-3-methyl-imidazo[4,5-f] quinoline (IQ), 2-amino-3,8-dimethylimidazo [4,5-f] quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenylimidazo [4,5-b] pyridine (PhlP) using HPLC-UV detector. Quantitative analysis of the control samples (only thawed at room temperature) revealed presence of HCAs in K, S, D and B...
Chao Zhao1,2, Sigang Fana2 and Lihua Qiua2,3,*
...lity and diseases affect commercial shrimp production, the relation between these factors are less studied. Therefore, we aimed to investigate the effect of bacterial dynamics and water quality factors on Penaeus monodon larvae. We recorded the survival rates, water quality (total ammonia, nitrite, and nitrate concentration), heterotrophic bacteria, and vibrios during different P. monodon stages(nauplii, zoea, mysis stage, postlarvae). In po...

Pankaj Kumar Jha1,2*, M. Golam Shahi Alam1 and Farida Yeasmin Bari1

Pregnancy and Lambing Rate Following Laparoscopic Artificial Insemination with Two Different Types of Diluent and Frozen-thawed Sperm Dose in Ewes
...ferent types of diluent (commercial Triladyl® and home-made tris based) and number of frozen-thawed ram sperm (100 × 106 and 50 × 106 sperm dose) on pregnancy and lambing rate following laparoscopic artificial insemination (LAP-AI) in indigenous ewes in Bangladesh were studied. A total of 78 non- pregnant ewes were synchronized for oestrus with two doses of 100 μg PGF2α (Cloprostenol) 9 days apart. The ewes were randomly assigned to on...

Shaiza Rasool1, Iftikhar Ahmad1*, Khurram Ziaf1, Irfan Afzal2, Muhammad A.S. Khan1, Muhammad Aashir Sajjad1 and Muhammad Zain Ali1

Seed Conditioning Effects on Germination Performance, Seedling Vigor and Flower Production of Zinnia elegans
...nd may be recommended to commercial growers of zinnia or other annual flowers.

...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...d suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, University of Swabi, Pakistan in the year 2019. Three bulb sizes of tuberose viz., large (2.5cm dia), medium (1.5cm dia) and small (1cm dia) were planted in three type of planting media viz., M1(Sandy soil+ Compost; 3:1; v/v), M2 (Sandy soil+ Humic acid; 20:1; v/v) and M3 (Sandy soil + Potting soil; 3:1; v/v) in Randomized Complete Block Design ...

Muhammad Zamin1*, Anees Muhammad1, Ibadullah Jan1, Hidayat Ullah1, Shahen Shah2, Muhammad Amin3 and Haroon Ur Rashid4

Production of Tuberose (Polianthes tuberosa L.) as Affected by Bulb Size and Planting Medium
...d suitable bulb size for commercial production of tuberose, an experiment was conducted in the Horticulture Nursery, University of Swabi, Pakistan in the year 2019. Three bulb sizes of tuberose viz., large (2.5cm dia), medium (1.5cm dia) and small (1cm dia) were planted in three type of planting media viz., M1(Sandy soil+ Compost; 3:1; v/v), M2 (Sandy soil+ Humic acid; 20:1; v/v) and M3 (Sandy soil + Potting soil; 3:1; v/v) in Randomized Complete Block Design ...

Zulnorain Sajid1*, Muhammad Ramzan2 and Noreen Akhtar1

Foraging Behavior and Pollination Ecology of Bumble Bee and Honey Bee in Pakistan; A Review
...tables, fruits and crops commercially. Honey bee can dispense 80% in insect pollination and considered as a best pollinator towards crop pollination, Bumblebee are more efficient and competent pollinator due to their buzzing behavior, efficiency to forage at low temperature, vibration to burst the pollen sac, high speed to flower visitation at low temperature and solitary colony structure. In northern areas of Pakistan bumblebees are natural pollinators. The v...

Joseph Anejo-Okopi1*, Dorcas Yilger Gotom1, Noble Allison Chiehiura1, Julius Ocheme Okojokwu1, David Ochola Amanyi2, John Otumala Egbere1, Joshua Adetunji1, Otobo Innocent Ujah3 and Onyemocho Audu4

The Seroprevalence of Zika Virus Infection among HIV Positive and HIV Negative Pregnant Women in Jos, Nigeria
...ibodies was done using a commercial sandwich enzyme-linked immunosorbent assay (ELISA) kit to qualitatively analyze Human Zika virus IgG (ZV-IgG) in human serum. A total of 90 pregnant women was recruited, and the overall seroprevalence was (14.4%) for Zika virus (20.0% HIV positive and 8.9% negative) IgG antibodies. A significant association was found with age category among the HIV negative pregnant women p=0.012, and in the history of blood transfusion amon...
Kui Zhang1,2, Ping Geng1, Sher Khan Panhwar3, Khadim Hussain Memon4 and Zuozhi Chen1,2,*
...available for few of the commercial marine fish species in Pakistani waters. Most commercial fish species lack assessments of maximum sustainable yield (MSY) and allowable catch, a situation that hinders effective fisheries management. A Catch–MSY model based on statistical catch data and prior information on population parameters was applied to assess the total allowable catch (TAC) and MSY values for 24

Tasleem Akhtar1, 2, Ghazanfar Ali1,* and Nuzhat Shafi2

...factor are presented for commercially important Schizothoracinae from Neelum and Jhelum rivers during 2015-2016. In the present study, four species of Schizothorax had been found, in which three species were already reported (S. esocinus, S. plagiostomus and S. progastus) and one new species (S. niger) was found first time in AJK. One hundred and fifty-nine specimens of S. plagiostomus, 74 specimens of S. esocinus, 21 specime...
Mudussar Nawaz1, Iahtasham Khan2, Muhammad Shakeell*, Arfan Yousaf1, Zahid Naseer1, Munibullah1, Ali Zohaib3, Riaz Hussain4 and Qudrat Ullah5

Samia Ikram1*, Riaz ur Rehman1, Farwa Batool2 and Atyab Amjad3

Evaluation of Bird of Paradise for Commercial Flower Production by using Organic Manures
...bird and is an important commercial crop of tropical area. The present research work was designed to investigate the effect of different organic manures on the growth of Bird of paradise as commercial crop in agro metrological conditions of Islamabad during 2016-2018. Following four treatments were designed: T1 (control), T2 (Top dressing with FYM), T3 (Top dressing with leaf manure), T4 (Top dressing with sewage sludge). Ma...
Mumtazur Rahman1, Farhan Anwar Khan1,*,Umar Sadique1, Ijaz Ahmad1, Shakoor Ahmad1, Faisal Ahmad1,2, Hayatullah Khan1,3, Muhammad Saeed1, Faiz Ur Rehman1, Ibrar Hussain1, M. Faraz Khan1, M. Izhar ul Haque1 and Hanif-ur-Rehman1,3

...tibility of Mccp against commercially available quinolones in Pakistan by broth microdilution method. Quinolones including moxifloxacin, levofloxacin, ciprofloxacin, and enrofloxacin were selected for in vitro susceptibility of Mccp Pakistan strain. The concentration for each drug was measured distantly depending on high concentration available in the market and was then used in various concentrations ranges from higher to lower i.e. moxifloxacin 80-0.1...

Muhammad Abdullah1, Syed Attaullah Shah1, Khurram Nawaz Saddozai1, Jahangir Khan1*, Mohammad Fayaz1, Irfan Ullah1* and Sabeeh Ullah2

Analysis of Agricultural Land Price Determinants and Policy Implications for Controlling Residential and Commercial Encroachments: Facts from District Swabi (Pakistan)
...eir high residential and commercial potential. Developmental projects for roads, hospitals, universities and gas supply infrastructure in the surroundings of Swabi city are resulting human influx from rural areas, and are increasing demand for residential and commercial units in the suburbs. This high demand is pulling land prices and causing utilization of fertile agricultural land for residential and ...
Muhammad Mohsin1, Yin Hengbin2,* and Zhang Luyao3
...rces particularly having commercial importance. Thus, this study is the first time attempt to know whether Spanish mackerel, a major landed fishery resource in Shandong, China, is experiencing overexploitation or not by estimating its stock status. For this purpose, long data series, 2006-2016, comprised of catch and effort figures was statistically analyzed to know maximum sustainable yield (MSY) of this resource and its ongoing regime. In total, three surplu...

Muhammad Iqbal1, Muhammad Ehetisham ul Haq1*, Muhammad Kamran1, Muhammad Idrees1, Shahid Nazir2, Ihsan Ullah3, Sumera Naz1, Shaukat Ali1 and Muhammad Zafar Iqbal2

Morpho-Molecular Characterization of Xanthomonas Axonopodis Pv. Citri Associated with Kinnow (Mandarin) and its Management
...The relative efficacy of commercially available antibiotics against the pathogen was evaluated in the lab and in field conditions. A systematic survey of randomly ten localities/sampling sites was conducted for a reliable estimation of citrus canker disease in District Sargodha of Punjab Province. Nine sampling sites showed 90 % the presence of Xanthomonas axonopodis pv. citri and only one site was free of citrus canker disease. Total cellular DNA was isolated...

Ghulam Rabbani1, Uzma Javed1*, Javed Iqbal2, Ruqeah Mustafa3, Ghulam Shabbir2 and Fida Hassan Shah4

Barani Mash a Newly Developed Disease Resistant and High Yielding Mash Cultivar for Rainfed Areas of Punjab, Pakistan
...l for its cultivation on commercial level in rainfed areas of Punjab. “Barani Mash” will prove to be a good alternative of existing cultivars and cultivation of this cultivar would help to increase the productivity and income of mash growers in Barani tract.

...

Zaheer Ahmed Deho*, Saifullah Abro and Muhammad Rizwan

Assessment of Stability for Seed Cotton Yield of Cotton Genotypes Across Different Environmental Conditions of Sindh Province
...IA-95 and NIA-96 and two commercial check varieties in Sindh province of Pakistan viz. Sadori and CRIS-342 were planted under four different locations Tando Jam, Mirpurkhas, Sakrand and Ghotki environment conditions. Seed cotton yield data was recorded from each location and stability analysis (genotype x environment interaction) was performed. The pooled analysis of variance for seed cotton yield, showed highly significant (P< 0.05) differences for varieti...

Inam Ul Haq1*, Humara Umar2, Naeem Akhtar3, Muhammad Azhar Iqbal2 and Muhammad Ijaz1

Techniques for Micropropagation of Olive (Olea europaea L.): A Systematic Review
... olive oil. However, the commercial micropropagation of olive trees is currently not enough because of production cost and globally; it is mostly used for research and development on various aspects of olives. In this review, efforts are made to document the different techniques for successful initiation of olive micropropagation techniques because presently in Pakistan this technique is used at very limited research and development scale besides having basic ...

Muhammad Aman Ullah Khan1*, Muhammad Talha Aslam1, Abdul Rehman1, Muhammad Nawaz2, Muhammad Jahanzaib Khan1, Muhammad Ahsin Ayub3, Arbaz Ahmad Khan1, Muhammad Adil Rehman1, Bilal Ahmad Shahzad1, Sajid Hussain1, Muhammad Umair Hassan1 and Riaz Ahmad1

 

 

...e juice purity (CJP) and commercial cane sugar (CCS) (%), however, trench spacing significantly affected the sugar yield. The maximum sugar yield (13.51 t ha-1) was obtained in 120 cm apart trenches and the minimum sugar yield (11.56 t ha-1) was obtained in 90 cm spaced trenches. Amongst clones, maximum brix (24.01%), SC (17.96%), CJP (80.38%), CCS (12.51%) and sugar yield (13.62 t ha-1) were recorded in US-127 and the lowest w...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6 
...um strains isolated from commercial broiler chicken by three different methods i.e., congo red, test tube and air liquid interface coverslip, (2) biofilm quantification at different time intervals and (3) monitor antibiofilm effect of three proteolytic enzymes including trypsin, chymotrypsin and proteinase k against S. Gallinarum. We observed that S. Gallinarum has strong biofilm forming ability as observed by dark black colonies on congo ...
Asima Batool1, Ghulam Abbas2*, Zuhair Hasnain3, Nasira Perveen4 and Muhammad Naeem Akhtar5
... maize (Zea mays) commercial hybrids were screened for checking their comparative response against high temperature / heat stress at Botany Department, Agriculture University, Faisalabad. Germinated maize seedlings / plants were placed in the glass fitted canopies, where canopy temperature was found 7-10°C higher than ambient temperature along with light reflection was enough for optimum photosynthesis. Th...
Muhammad Nawaz Kandhro1*, Nadia Mangrio1, Aijaz Ahmed Soomro1, Zia-ul-Hassan Shah2, Ghulam Sughra Mangrio3, Nihaluddin Mari4, Zulfiqar Ali Abbasi1 and Shazia Parveen Tunio5
 
 
...>-1), brix (%) and commercial cane sugar (%)were recorded under double sett (parallel to furrow). As regards NPK levels, 281-140-275 kg ha-1 (25%>recommended) produced significantly increased in growth and yield characters particularly, cane yield (t ha-1) and brix (%). The findings of the study further suggested that interaction of double sett (parallel to furrow) with NPK levels 281-140-275 kg ha-1 (25%>recommende...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
...isolated from vaccinated commercial broiler flocks showing respiratory manifestation in Menofia governorate, Egypt during 2019. Those viruses showing deaths and haemorages of inoculated SPF ECE eggs, harvested allantoic fluids showed haemagglutination activity by using 1% RBCs and also haemagglutination inhibition in case of using NDV reference antiserum, As well as realtime polymerase chain reaction by using standardized NDV specific primers and finally eight...

 Amjad Ali1*, Pirzada Jamal Ahmad Siddiqui1, Naveed Ahmad2,Shabir Ali Amir3, Rafaqat Masroor3,Seema Shafique1 and Zaib-un-Nisa Burhan1

...ignificance (ecological, commercial) of these natural resources via print and electronic media for a sustainable ecotourism. Further, to better understand the effects, regular monitoring monitoring and scientific research (environmental, biological parameters) is recommended.
...
Bram Brahmantiyo1,*, Henny Nuraini2,3, Astari Wibiayu Putri3, Maizirwan Mel4,5 and Cecep Hidayat6 
 

...uring the experiment was commercial feed. A complete randomized design with unbalanced data analysis was used for quantitative traits and descriptive analysis for qualitative traits. Qualitative characteristics of hair color variation of Hyla rabbit was different than other with 7.7 % pointed on their white hair color, and hip type compact of Hycole, Hyla and New Zealand White were 90 %, 84.6 % and 76.9 %, respectively. Quantitative characteristics of chest de...
Haris Setiawan1, Aris Winaya1,*, Herwintono Herwintono1, Mulyoto Pangestu2 and Yayuk Kholifah3
 

...on Center, Indonesia and commercial SFE. Semen from the same bull were collected and processed according to the protocol at Singosari AI Centre. Semen extender were supplemented with SFE, G0 = 0 % SFE, G1 = 2 % SFE, G2 = 4 % SFE, G3 = 6 % SFE and G4 = 8 % SFE. Each of the treatments was repeated three times. The sperm mortality and motility datafrom SFE treatments were analyzed using Analysis of Variance (ANOVA). The results showed no significant effect on the...

Anwar Ali1,5*, Horia Shaukat2, Munir Ahmed3,5, Ahmed Bostani4 and Syed Ashiq Hussain3

...ntly applied properly on commercial scale in few countries. It has different impact on different type of muscles, so basic know how of changes occurring when it is applied to different kind of muscles should be known to get maximum benefits from this technology.

...

Raza Ullah Khan1*, Ahmad Khan1, Mohammad Zameer Khan1, Fayyaz Hussain1, Zafar Islam2 and Muhammad Asad Hameed2

...ic substances along with commercial inorganic fertilizers. Though findings in this study showed KOH as cost effective extractant vis a vis NaOH. However, further characterization could not confirm it. The presence of hydrophobic and hydrophilic nature of sites could be utilized to develop slow release plant nutrients based on humic substances.

...
Asim Faraz1*, Abdul Waheed1, Hafiz Muhammad Ishaq1 and  Muhammad Shahid Nabeel2 
...l has good potential for commercial camel farming and it could be the source for future food production especially in arid and semi-arid areas of Pakistan. Research work on production potential of Marecha camel is scanty. In the current study, 10 male Marecha calves (Camelus dromedarius) around 300±30 days of age were weaned at 9 months age and used in 90 days trial to study their growth rate. Calves were raised in two groups with 5 each under st...

Imrana Khushk1, Abdul Nabi Jatt2, Abdul Sattar Qureshi1*, Choudhary Haider Ali3, Muhammad Aqeel Bhutto1, Imran Ibrahim Khaskheli1, Sartar Iqbal Panhwer1

...nificant difference when commercial cellulase youtell#7 and onsite produced cellulase were used in saccharification of high solid wheat straw simultaneous saccharification and fermentation (SSF). However, onsite produced cellulase does not need enzyme purification, packing and transportation. Hence, the production of bioethanol and lactic acid cost reduced at large extent by using on-site produced cellulase in the saccharification of lignocellulosic material.&...
Md. Alal Hossen1, Mohammad Amzad Hossain1*, A.K.M. Munzurul Hasan1,2, Bipresh Das1, Sohel Mian1, Mohammed Mahbub Iqbal1
 
...tify;">Mystus gulio is a commercially important estuarine small catfish in Bangladesh and it is prone to decreasing due to natural and anthropogenic changes. Information of induced breeding of this catfish and its embryonic development could contribute to database and conservation approach. The S-GnRHa dose optimization and embryonic-larval development study were conducted in a freshwater condition in order specify optimal dose of synthetic hormones in induced...

Muhammad Ashraf Sumrah1*, Muhamad Jan1, Azhar Hussain2, Shoaib Akhtar1, Hussain Nawaz1, Muhammad Afzal3 and Humara Umar1

...rieties can be grown for commercial processing and product development.

...
Suman Bhattarai1*, Subodh Raj Pandey2, Jaya Prakash Dutta3, Meghnath Timalsena4 and Rajendra Bam5
... a profitable and viable commercial enterprise.

...

Muhammad Rafique1, Inam Ul Haq1*, Humara Umar2, Muhammad Jan2 and Muhammad Azhar Iqbal2

...sidered suitable for its commercial cultivation, where minimum temperature occurs between 10oC and 12oC during end March before olive flowering. In recent past, mass scale olive plantation over an area of 10,000 acres was done in these parts of the country. So, in order to ensure the sustainability of olive orchard development in Pakistan, a research trial was conducted to improve the rooting ability of olive cuttings to strengthen the local olive nursery setu...

Muhammad Shakil Ahmad1*, Muhammad Afzal1, Sylvain Nafiba Ouedraogo2 and Muhammad Zeeshan Majeed1

...enous potato growers for commercial cultivation in areas where S. litura threatens potato crop.

...
Sajid Ali1, Muhammad Avais1*, Aneela Zameer Durrani1, Kamran Ashraf2, Saira Jabeen1, Sajid Hameed3, Muhammad Awais1, Jawaria Ali Khan1 and Imtiaz Ahmad4 
...k factors of lameness at commercial dairy herds in Punjab, Pakistan. The sample size was 2,555 cows from 15 dairy herds assessed using a 5-point locomotion rating scale. A cow with a locomotion score of 3 or higher was considered to be lame. Lame cows were investigated for hoof and claw disorders based on clinical assessment. The prevalence of lameness at the herd-level ranged from 3.08% to 33.08% (overall = 14.20%). The prevalence based on severity showed tha...

Mian Muhammad Arif* and Malik Muhammad Shafi

...ity of different size of commercial broiler poultry farms in central region of Khyber Pakhtunkhwa. A total of 105 sample broiler poultry farms were selected through random sampling technique and data were collected for 483 flocks by means of interview schedule. Descriptive statistics was used for general analysis, while budgetary technique was used for profitability analysis. Ordinary Leased Square (OLS) technique was employed to find the effect of different i...
Assefa Tessema Tecklie1*, Abebe Getahun Gubale1, Seyoum Mengistou Yilma1, Tadesse Fetahi Hailu1 and Eshete Dejen Diresilign2
...tandard. There are three commercially important fish species, common carp (Cyprinus carpio), Nile tilapia (Oreochromis niloticus), and Catfish (Clarias gariepinus). Fishery of Lake Hayq is being used as source of livelihoods for about 2000 people living around the lake. Tehulederie, the largest district bordering the lake has established three months (May- July) as breeding seasons, however, the fishermen didn’t respect the regulatio...

Muhammad Tariq Mahmood1*, Muhmmad Akhtar2, Kaiser Latif Cheema2, Mushtaq Ahmad1, Muhammad Jahanzaib Khalid2, Afzal Zahid2, Muhammad Kashif3 and Zeshan Ali4

...ntial may be released as commercial variety for general cultivation in future.

...
Shafaq Fatima1,*, Farkhanda Manzoor1, Humaira Amman1, Zakia Kanwal1, Asma Latif1, Zeeshan Ali2, Hamid Iqbal Gondal2, Sumera Sajjad1 and Raja Shahnawaz Janjua3
...della); an important commercial carp in Asia. The present study investigated the effects of three different diets (A, 5% linseed flour; B, 5 % LO; C, 2.5 % linseed flour + 2.5% LO) on growth and fatty acids profile (C12:0– C22:6) in grass carp (age = 12 months). The trial continued for 31 days at ambient temperature. The control group was fed with soybean based commercial diet. No significant ...
RehamM. El-Bakrey1, Shimaa M.G. Mansour2, Mohammed A. El Sisi1 AndAmal A.M. Eid1
...uate the efficacy of the commercially applied AI vaccine regimens against challenge with three H5N1 HPAI viruses isolated from chickens, Egypt during 2009-2011. Both inactivated and recombinant fowlpox virus expressing H5 (rFP-AI-H5) vaccines were measured. Vaccine efficacy was evaluated by percentage of protection from mortality, morbidity and reduction in virus shedding from respiratory and/orintestinal tracts. Despite the H5 antibody responses in vaccinated...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
...er season. Six different commercial varieties of common
bean were evaluated for SLCV infection at three different growth stages. The evaluation
was performed using whitefly inoculation in insect proof green house. Two commercial
varieties (Tema and Giza 6) were found to be tolerant to SLCV infection in all tested
growth stages. The disease severity of the viral infection varied...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...n different locations on commercial strawberry fields. The percentages of infection were 3.7, 4.5, 15.7 and 20% in El-Behera, El-Kalubeia, El-Ismalia and El-Menofia respectively. SLRSV was transmitted either by Xiphinema americanumas nematode vector or mechanically from infected strawberry plants onto 16 host species belonging to seven families. Typical leaf curling, chlorosis, vein clearing and stunting were appeared on indicator host (cucumber) 3 weeks post ...

Safaa M. Mohammed*, Shahira A. Abdelwahab**,Fetaih,H⃰ ⃰ ,Neveen,R⃰ ,Abdel satar ,A⃰ and Mohamed S. Elshahidy**

...(TKPV) was recorded in 6 commercial turkey flocks aged 48-65days old. The disease was examined clinically ,histopathologically and immunohistochemically. Turkey pox virus was isolated on CAM of embryonated chicken eggs and identified by agar gel precipitation test and polymerase chain reaction .Two main types of TKPV infection were observed in examined flocks ,cutaneous and diphtheritic forms. Morbidity rate ranged from 5-15%with no mortalities .75% of examine...

Amir M. Walaa1 ; Ausama Yousif1; Walid H. Kilany2; Magdy El-Sayed1; Ahmed A. El-Sanousi1

.... Two hundred and eighty commercial one-day-old broiler saso chicks were divided into 8 groups (35 birds each). Groups 2, 3, 4&5 were vaccinated at one-day-old with live hitchner + IB Primer. Then all groups at 7 days old were boosted with inactivated combined NDV+IBV vaccines with different adjuvants except for group 1 & 2. Group 1 was kept as unvaccinated control. At 28 days all groups were challenged with a dose of 105.5 EID50/bird of Variant 2 geno...

Hanan M. El-Zahed, Hanaa A. Mostafa, Nermeen M. El Sayed and Lamiaa M. Omar

...nated with two different commercial live attenuated Chicken anemia virus (CAV) vaccines. One was vaccinated with 26 P4 strain vaccine subcutaneously and the other was vaccinated with Cux strain vaccine through drinking water (DW). Then the inactivated avian influenza (AI) H5N1 vaccine was inoculated intra-muscularly either at the 1st, 2nd or 3rd WPV with CAV vaccine forming three subgroups per each group. It is clearly observed that a relatively high levels of...

Serageldeen Sultan1, Nabila Osman2

...ayer breeder (n=235) and commercial broiler chickens (n=84) from different farm flocks (24 flocks) in Egypt. These samples were examined for the presence of avian HEV antibody using enzyme linked immuno-sorbent assay (ELISA). The results revealed that the occurrence of avian HEV was 15.7% (80/510) and 66.7% (16/24) of the examined flocks. HEV antibody prevalence increased as age dependent and most commonly occurred among broiler breeder flocks (10/24). In conc...

Asfand Raheel1, Syed Zulfiqar Ali2, Muhammad Waris2, Muhammad Basharat2, Basheer Ahmed2, Muhammad Arshad Ullah3, Syed Ishtiaq Hyder4 and Taqi Raza4*

Ehab M. El-Nahas1, Hemat S. El-Sayed2, Sawsan S. El-Basuni3, Gabr F. El-Bagoury1

...achusetts serotypes. The commercial H120 vaccine conferred partial protection against proventriculitis induced by Egypt/Qal/014p. Conclusion: IBV strains exhibiting proventriculitis were found co-circulating in broiler chickens in Egypt and optimum control of IBV in Egypt require preparation of vaccine from indigenous isolates beside periodic evaluation of cross-protective capabilities of such vaccine.

...

Salama M. El-Saghir1, 2

...etection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confir...

Abdou Nagy1, Fatma Abdallah1, Kareem Sweed2, Ahmed Salama3, Mohamed Omar4

... tested with
commercial indirect aMPV ELISA.
Results: Five out of 23 broiler, 6 out of 17 layer, 1 out of 6 Pekin duck and 1 out of 2 Muscovy duck
flocks showed positive results. On the other hand, the results showed significant difference in the net
profits as a measure of economic impact between infected and non-infected flocks in different
provinces.
Conclusion: The results denote that ...
Maha M. Khedr1, Reem A. Suliman1, Marwa F. Mohamed1, Mounir D. El Safty1, Hussein A.
Hussein2
...ht groups of one-day old commercial broiler chicks were kept in isolators along the whole
period of the study. Groups 1, 2 and 3 were vaccinated with the prepared vaccine; group 4, 5 and 6 were
vaccinated with one of the imported reassortant H5N1 containing 300 HAU at 1, 5 and 10 days of age;
respectively. Groups 7 and 8 were positive and negative groups for the challenge trial. Blood samples
were collected weekl...
Hussein A. Hussein, Maha Khedr, Reem A. Suliman, Marwa F. Mohamed, Mounir D. El
Safty
...s: Groups of one-day old commercial broiler chicks were divided in to 8 groups 1, 2 and 3 were
vaccinated with a prepared vaccine contain 500HAU of H5N1 reassortant antigen; while group 4, 5 and 6
were vaccinated with an imported reassortant vaccine with 500HAU antigen content of H5N1 at 1, 5 and 10
days of age; respectively. A group 7 was positive challenged control and group 8 negative challenged
groups. All ch...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
...p;in cattle on different commercial farms in subtropical conditions of Khyber Pakhtunkhwa (KP). A total of 120 cattle from different farms were randomly sampled and tested for the presence of A. marginale between May to August 2016. The study revealed that 15.0%, 20.8% and 29.1% of sampled animals were found positive for A. marginale using microscopic examination, indirect ELISA and PCR, respectively. Two major surface protein gene...
Abeera Razzaq1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qingyou Liu3
...strial, agricultural and commercial chemicals discharged into aquatic habitats could pose a serious threat to the aquatic life like fish. These metals have ability to induce the production of reactive oxygen species (ROS). These ROS can interact with nucleic acids and cause oxidation of DNA. The potential of ROS to damage DNA has become a topic of significant interest for environmental toxicology studies. Thepresent research was conducted to assess the genotox...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
... and detection of PVM in commercial potato seed tubers using RT-PCR.
Methods: The PVM was detected in symptomatic infected potato plants during growing seasons for
the cultivated commercial local tuber seeds using Double Antibody Sandwich-Enzyme Linked
Immuno-Sorbent Assay (DAS-ELISA). The PVM was mechanically isolated on potato cv. Diamant.
Host range was carried out by mechan...

Shimaa M. Gad1, Ahmed A. Kheder1, Mohamed A. Awad 2

...s in
several commercial ornamental plants, leads to serious economic losses all over the world. During
2017-2018, gazania showing phyllody, yellowing, proliferation, virescence and little leaf symptoms
was observed Giza, Egypt.
Objective: The current work aims the detection and molecular identification of phytoplasma infecting
Gazania in Egypt.
Methods: Phytoplasma disease was detected and...
Hanan Sayed1, Mohamed S. Madkour1, Hussein A. Hussein2, Mounir Mohamed Elsaft 3,
Marwa F. El saied3, Ahmed A El-Sanousi2
...ecific pathogen free and commercial layer chicken, the injection was
repeated as a booster vaccination one month after the first vaccination. Humoral immune response was
measured by HI for both H9N2 and LaSota viruses weekly for one and a half month after the booster
vaccination, then monthly until the end of duration. Challenge trials were carried out after a month
from the first vaccination, and after two and s...

Hanan Sayed 1, Mohamed S. Madkour 1, Hussein A. Hussein 2, Ahmed A El-Sanousi 2

...ecific pathogen free and commercial layer chicken, the injection was
repeated as a booster vaccination after a month from the first vaccination. Humoral immune response
for IBV was measured by ELISA weekly until about one month after the booster vaccination then
periodically till the end of duration. Challenge trial for both IB strain was repeated after a month from
the first vaccination and after two and six mon...
Karim M. Selim1, Abdullah A. Selim1, abdelsattar Arafa1, Hussein A. Hussein2, Ahmed A. El-Sanousi2
...2015 was isolated from a commercial
broiler farm in Egypt and characterized as a virulent strain was used for challenge. Contact
chicks were added in both groups post challenge.
Results: indicated that both programs can protect birds from mortalities (up to 100 %). The
parameters used in this evaluation are the antibody immune response using hemagglutination
inhibition (HI) assay, protection post chal...
Liangkun Pan1, Qun-Lan Zhou1*, Bo Liu1, Jiaxing Yan2 and Ajun Sun1
...>), fish were fed with a commercial diet for 16 weeks. Then high-throughput sequencing was applied to compare the microbiota between foregut and hindgut. The results showed that the microbial profiles between the foregut and hindgut were different based on the alpha-diversity and the cluster results. Dominant microbioorganisms of blunt snout bream at genus level were Cetobacterium spp., Lactococcus spp., CK-1C4-19, Rhodobacter spp. ...

Muhammad Rafique1, Muhammad Azhar Iqbal2, Inam Ul Haq1*, Muhammad Ramzan Anser2, Humara Umar2 and Muhammad Ashraf Sumrah2

...ion in Pakistan is being commercialized at a fast pace in selected agro-climatic regions. The demand for local plants is increasing and no scientific study has been previously carried out to standardize propagation technology concerning optimization of light intensity under greenhouse conditions. The current study was conducted at Izhar farms (Pvt.) Ltd. under the collaboration with Barani Agricultural Research Institute (BARI) Chakwal to find out the appropri...
Houqiang Luo1*, Yanfang Lan2, Ping Gan3, Wenjun Zhou4, Meng Wang1
Bing Hu5, Zhuning Zhang5, Yu Bai1* and Kun Li6*
...amined for antibodies by commercial rapid in-clinic ELISA kits. Ticks were collected from dogs and molecular detection methods were used to identify the tick species and CME by amplification of the cytochrome oxidase subunit I and disulfide oxidoreductase gene, respectively. The results indicated that 1.29% of the serum samples were positive for E. canis, and 5.50% of dogs were infested with ticks. The Wenzhou samples of R. sanguineus exhibited a...
Song Jiang1,2,3, Ming-ge Zhuang1,2,3, Fa-lin Zhou1,2, Qi-bin Yang1, Jian-hua Huang1, Li-shi Yang1 and Shi-gui Jiang1*
...ifferent diets including commercial parent shrimps feed (Diet A), Pheretima tschiliensis combination bait (Diet B), Pheretima tschiliensis (Diet C)and Nereis succinea combination bait (Diet D), and the effect of each diet on the maturity of parent shrimps was evaluated by testing the gonad weight increase rate, eggs amount, average spawning time and levels of VTG mRNA expression. The results showed that P. tschiliensis, as a closely...

Muhammad Madni Afzal1*, Shahbaz Talib Sahi1, Amer Habib1, Waqas Ashraf2, Muhammad Ahmad Zeshan3, Muhammad Raheel2 and Qaiser Shakeel2

...d worldwide. It is grown commercially throughout the country and contributes significantly to the economy of Pakistan. Onion is susceptible to many foliar, bulb and root fungal pathogens that badly destroy onion crops, greatly reducing its yield and quality. Fusarium oxysporum is a very common soil-borne fungus that causes basal rot onion and it has the ability to survive in the soil for many years without having a host. Many fungicides are available in the ma...
Mengke Wang1, Shucheng Huang2, Cai Zhang1*, Haizhou Gong1
Shunan Cuan1, Shuaishuai Wang1, Qi Shao1, Wenhao Xu1, Sudan Meng1
Pengfei Li1, Yuqin Wang1 and Zijun Yang1
...e considerable injury to commercial laying hens. However, the effects of monoammonium-glycyrrhizinate in improving liver lipid metabolism and antioxidant capacity of laying hens is unclear. The current study examined the ameliorative effects of monoammonium-glycyrrhizinate (MAG) on liver lipid metabolism and antioxidant capacity in laying hens. One hundred eighty 320-day-old Hy-Line brown laying hens were allocated to five equal groups and administrated with t...
Yuzhou Luo1, Ping Wang1, Kaijun Yu2*, Song Luo3 and Longjie Sun4
...g system. Furthermore, a commercial system was compared for validating the efficiency of our proposed algorithm. This work is the first study that successfully used breath sounds to classify sleeping conditions. The experiment validates the effectiveness of the proposed algorithm.
...
Yuli Andriani1*, Rintan Octaviana Julia1, Lintang Permata Sari Yuliadi1, Iskandar Iskandar1 and 
Yaya Rukayadi2
...nclusion of 12 % BPLM to commercial feed was able to enhance the color quality on the tail of the Swordtail fish, i.e average color 5 and a value of color 87.3. Supplementation of BPLM in feed does not significantly affect survival rate and water quality. These result indicated that usage of BPLM is safe as a sources of natural pigment for ornamental fishes, such as Swordtail fish.
...

Amir Muhammad Khan1, Laila Fayyaz2*, Raziuddin2, Sajid Ali1, Israr-ud-Din1, Sheraz Ahmad2, Haidar Ali1 and Ijaz Ahmad2

...ng a significant role in commercial edible oil production. To determine diversity within this specie, ten different genotypes of B. napus L. including Chinese (CA-2, CA-4, CA-5) and doubled haploid lines from a population were field-tested at the University of Agriculture, Peshawar (UAP). Genotypes were examined for seven morphological traits including days to flowering, primary branches mainstem-1, plant height, main raceme length, pods mainraceme-1, pod leng...
Azhar Abbas Khan*, Humaira Kanwal, Sumair Batool, Zeshan Hassan, Jawad Munawar Shah, Hafiz Muhammad Aatif, Ahmad Nawaz, Hasan Taha and Yasir Ishfaq

Kemi Funmilayo Omotesho1*, Philip Akintunde Fatodu1 and Toyin Benedict Ajibade2

... planning, budgeting for commercial agricultural development, and control of postharvest losses. The study analysed the record keeping behavior of youth farmers in Ekiti State. Specifically, it assessed the level of record keeping among farmers; examined their attitude towards record keeping; assessed the farmers’ knowledge of record keeping; determined their intentions towards keeping farm records; and identified the constraints to farm record keeping. ...
Zafer Karslı1,*, Dilek Şahin1, Meryem Öz2, Ünal Öz2 and Orhan Aral2
...experiment were fed with commercial cichlid feed containing no hormones and numbers of fry produced was recorded. At the end of 90-day feeding period in the first experiment, the best growth was obtained in 60 mg kg-1 Mt treated group (1.97±0.17 g). Sex conversion to all male population (100% male) was observed in 17α-Mt treated groups, while, conversion to 82.22, 86.67 and 86.67% females was observed in 17β-Es treated (20, 40 and ...

Mohammad Aquil Siddiqui1*, Muhammad Mahran Aslam1, Mahboob Ali Sial1, Nighat Seema Soomro1, Muhammad Tahir Khan1, Shafquat Yasmeen1, Shumaila Sial2 and Imtiaz Ahmad Khan1

...ratively higher than the commercial check variety. It was also tolerant against insect pest and diseases including Alternaria blight, powdery mildew, downy mildew and white rust. The agronomic study suggested that this mutant stain (R00-125/14) best fits in the existing cropping system and agronomic package of technology. Surhan-2012 is a first canola mutant variety developed through the induced mutagenesis (gamma irradiations), released for general cultivatio...

Samreen Khan*, Salma Javed, Tabassum Ara Khanum, Nasira Kazi

...dicinal plants and other commercially important trees from different four sites of district Lakki Marwat and subsequently assessed the presence of EPNs using last instar larva of greater wax moth Galleria mellonella L. as baited host. After completion of requisite process, resultantly the corresponding recovery rate of EPNs was found 10.9% which includes only genus Steinernema comprising two isolates of S. balochiense (24%), two isolates of S. siamkayai (24%) ...

Muhammad Waryam Warraich1, Mukkram Ali Tahir1, Noor-us-Sabah1*, Ghulam Sarwar1, Muhammad Aftab2, Fakhar Mujeeb3, Muhammad Zeeshan Maznoor1, Aneela Riaz4 and Sarfraz Hussain2

...ith recommended rated of commercial K fertilizers. After the crop was harvested, soil sampling was carried out followed by analysis in the laboratory. It was observed that use of press mud @ Yield 1 % in integration with SOP as chemical K fertilizer performed as best treatment by improving yield (4.11 t/ha) and yield contributing parameters like maximum plant’s height (95.10 cm), length of spike (11.04), number of fertile tillers (5.67), 1000 grains weig...

Sudip Debnath1, Dipta Sundar Sarker1, Pankaj Kundu1, Md. Shahin Parvez1, Shaikh Tareq Arafat1, Roshmon Thomas Mathew2, Yousef A Alkhamis2,3, Md Moshiur Rahman1, Sheikh Mustafizur Rahman1* 

...(Xiphophorus helleri), a commercially important live-bearing ornamental fish, is widely used in aquariums. It is omnivorous in nature and feeds on both live and formulated feeds. There is no study assessing the effect of formulated egg custard, live and commercial feeds on the growth performance and survival of swordtail. Therefore, the study was carried out to investigate the effect of a live feed (Tubifex), formulated egg ...

Anguara Khatun1*, Sachchidananda Das Chowdhury1, Bibek Chandra Roy2, S.M. Shafikul Gani3, Bipul Chandra Ray1, Tanvir Ahmed1 

...nd cost-effectiveness in commercial broiler production. Four hundred eighty Cobb 500 straight run broiler chicks were randomly allocated to three dietary treatments each of eight replications having 20 birds each. The basal diets were corn-soya broiler starter and broiler grower diets. Starter diet was fed up to 21 days and grower diet during 22-35 days. In treatment 1, chicks were fed a basal diet (Diet 1), in treatment 2, chicks received a basal diet plus a ...

Ghulam Abbas, Sultan Mahmood*, Ahsan ul Haq and Haq Nawaz

...udied. One hundred sixty commercial layers (24 weeks old) were purchased from a poultry farm and were reared in a group for one week (adaptation period). At the start of 25th week of age, these layers were divided into 20 experimental units/replicates (8 layers/ replicate), which were further allotted to five treatment groups (4 replicate/ treatment). Five diets (A, B, C, D and E) were prepared with or without addition of sodium bicarbonate. Diet A, was withou...

Mustafa Ozan Atasoy

...onstructs have been made commercially available so far. The efficacy of HVT-vectored vaccines has been assessed either individually or in combination with other vaccine formulations; hence, the optimal competence of these vaccines against viral diseases has been reported. Based on the current knowledge, this article outlines the benefits and drawbacks of HVT-vectored vaccines in combating health-threatening poultry infections and briefly pinpoints the future p...

Keqiang Wei1*, Yue Wei2 and Changxia Song1

...(Procambarus clarkii), a commercially important aquaculture species in China. Using polyclonal antibodies, the strong staining of these proteins in hepatopancreatic cells was observed. The synchronous expression of p38 and its phosphorylated form (p-p38) was mainly present in B- and R- cells, and their MOD values were 0.0055±0.0038 and 0.0046±0.0027, respectively. As its downstream transcription factors, both RelA (p65) and Nrf2 were widely distr...

Amjad Ali Channa1, Mansoor Tariq1*, Zaheer Ahmed Nizamani1, Nazeer Hussain Kalhoro2 

Masouras P.K.1, Nikolaou K.1,2, Laliotis G.P.1*, Koutsouli P.1, Bizelis I.1 

...tion for meat quality of commercial cuts in Greece and offer a valuable and facile tool for predicting IMF content by marbling values, enforcing the implementation of such an approach in larger data sets.

Keywords | Marbling, Intramuscular fat, Meat quality, Carcass, Beef, Cattle breeds 

...

Altaf Mahmood1*, Muhammad Athar Khan2, Saima Parveen3, Tanveer Hussain4 and Ayesha Azad5

...plored in six months old commercially raised eight female rabbits after oral administration of gossypol. Cotton seed cake with 0.25% free gossypol concentration was daily given to each rabbit at the rate of 4 grams per kg live weight for entire experiment period of 60 days. Analysis of fortnightly collected blood specimens revealed significantly (p <0.05) decreased hematocrit, total red blood cell count, mean corpuscular volume, haemoglobin concentration an...

Jarmuji Jarmuji1,3, Lili Warly2*, Mardiati Zain2, Khasrad Khasrad2

...lus is a modification of commercial sakura block by using earthworm flour as a source of protein as a substitute for rice bran. The treatments were arranged as follow: P0= OPF + concentrate + 10% commercial sakura block, P1 = OPF + concentrate + 6% sakura block plus, P2 = OPF + concentrate + 8% sakura block plus, P3 = OPF+ concentrate + 10 % sakura block plus, P4 = OPF + concentrate + 12% sakura block plus, P5 = OPF+ concent...

Sajad Ali Solangi1, Jamal-U-Ddin Hajano1*, Rehana Naz Syed1, Sohail Ahmed Otho2, Khadim Hussain Wagan1, Agha Mushtaque Ahmed2, Fahad Nazir Khoso2, Aftab Raza Jarwar3 and Suman Tarique Qazi1

...refore, in this study 12 commercial varieties of tomato such as, TO-1057, Advanta-1225, T-1359, Yaqui, Sahil, Ayushman, Early king, Advanta-1211, Kiara, Lima, Advanta-1209 and Ashoka were screened against the disease under field conditions during Rabi and Kharif growing season 2017-18. Observations were taken on disease incidence, severity and whiteflies population at interval of week after date of transplantation. Additionally, relationship among the disease ...

Saima Parveen1, Altaf Mahmood2*, Ayesha Azad3, Sajid Umar4, Nosheen Shoukat6, Mirza Muhammad Arsalan Azam5, Qurat-Ul-Ain5 and Nausheen Akhtar Malik1

...houses. Out of total 658 commercial farms with capacity of 4221800 broilers, across Chakwal, a representative sample of 70 farms with capacity of 448000 broilers was randomly selected for collection and analysis of disease data. Five years’ data of these randomly selected farms revealed highest (44.64%) crude morbidity during monsoon season followed by 23.92%, 22.12% and 17.49% for winter, spring and post-monsoon seasons respectively. The highest (14.90%...

Noor Muhammad* and Shah Alam Khan

...p. Results revealed that commercial cultivar ‘Zahoor’ comparatively performed well despite higher number of aphids found on itas compared its other counterparts “Abaseen, Omega and KS-75” and hence, was identified as tolerant to mustard aphid. This cultivar also exhibited strong vigor against mustard aphid and minimal symptoms of damages were observed. The yield losses based on DWT and TI in susceptible cultivar “Abaseen”was...

Hung Van Mai1, Tuan Duc Nguyen2, Nang Thu Tran Thi3 and Hung Phuc Nguyen4*

...The FSBM2 and FSBM3 were commercially available products, which were produced by fermentation of SBM with Lactobacillus spp. Five diets were formulated and denoted as FMD (fish meal-based diet), SBMD (SBM-based diet), FSBM1D (FSBM1-based diet), FSBM2D (FSBM2-based diet) and FSBM3D (FSBM3-based diet). Each diet was fed twice daily to three groups of juvenile pompano (20 fish/group, 36 g/fish) for 4 weeks. The results showed that the plasma total cholesterol lev...
Anjum Ara1, Usman Ali1, Muhammad Furqan2*, Zulfiqar Ali2
Muhammad Mudassar Shahzad3, Khawaja Basharat Ahmed4
Riaz Aziz Minhas4, Waqar Ahmed2, Zakir Hussain2 and Mian Aman Ullah2
...ts including killing for commercial use (73%), medicinal use (13%). Habitat degradation (32%) due to pollution, poisonous chemicals and cruel fishing techniques are serious issues for their survival while anthropogenic activities (10%) are responsible due to destruction of habitat. Limited awareness was observed among local inhabitants regarding importance, ecological role and legal status of freshwater turtles. Awareness and strict law enforcement is recommen...

Riaz Shah1*, Shaikha Hilal Al Ismaili2, Sheikha S. Al-Siaby1, Amal Mohammed Al Nasiri2, Thuraiya Hafidh Al Maskari2, Jamal AlSabahi3 and Huda Al-Ruqaishi3

...tial oils extracted from commercially available fresh and dried organic or conventionally grown basil available in Oman. The essential oils from Omani and Indian fresh conventionally grown basil, fresh organic Belgian basil, dried organic Egyptian basil and dried conventionally grown UAE basil were extracted using advanced microwave extraction system. The essential oils chemical composition was determined using Gas Chromatography Mass Spectrum (GCMS). Signific...

Muhammad Tariq Mahmood1*, Muhammad Akhtar2, Kaiser Latif Cheema2, Abdul Ghaffar3, Imtiaz Ali4, Muhammad Jahanzaib Khalid2 and Zeshan Ali5

...genotypes along with two commercial varieties were sown under tri-replicate randomized complete block design during the winter season of 2020-21. D2 statistics, principle component analysis and cluster analysis were employed to detect the most genetically variable and high yielding chickpea genotypes. D2 statistics extracted higher values for standard deviation and coefficient of variation indicating that the studied genotypes possess considerable amount of ge...

Muhammad Mohsin1, Zhang Luyao2*, Zhu Ting3, Yin Hengbin3 and Qian Chong3

...e exploitation status of commercial fishery resources becomes very important for their proper management. This study uses catch statistics, 2007-2018, of a vital fishery resource, viz., Ammodytes personatus (Girard, 1856) to know its stock status and ongoing economic implications. For this purpose, Surplus Production Models (SPMs) were applied to the data through two world famous fishery routines, viz., Catch and Effort Data Analysis (CEDA) and A Stock Product...

Ndumiso Malusi1, Andrew Bamidele Falowo2, Yiseyon Sunday Hosu3,4, Emrobowansan Monday Idamokoro3,4* 

Ghada Mohamed Safwat1*, Mohamed Ahmed Kandiel1, Omayma A.R. Abozaid2, Mahmoud Mohamed Arafa3, Sahar Omar Mohamed4

Rafiqul Islam1, Nasrin Sultana1*, Md. Abu Hadi Noor Ali Khan2 

... control group was given commercial broiler feed and the trial groups were given commercial broiler feed containing DEX at the rate of 3, 5, and 7 mg/kg respectively for 28 days. On days 7, 14, 21, and 28 of the trial, blood and heart samples were collected. The serum cholesterol and triglycerides levels were determined. The heart specimens were prepared for histomorphological examination after the gross morphologic and morp...

Nora Faten Afifah Mohamad1, Hassan Haji Mohd Daud1, Ruhil Hayati Hamdan2, Sharifah Raina Manaf3, Ain Auzureen Mat Zin2, Nik Nur Fazlina Nik Mohd Fauzi2

...tty acids profile of the commercial importance fish species. The fish species include the African catfish (Clarias gariepinus), Asian catfish (Clarias macrocephalus) and hybrid C. macrocephalus X C. gariepinus (CMxCG). The fatty acid profiles of fishes were performed using a liquid gas chromatographic examination of methyl esters. The overall mean of saturated fatty acid (SFA) composition was significantly higher (p<0.05) in C. macrocephalus (48.21 ±...

Safaa M. Barghash1*, Amani A. Hafez2

...ith two vaccines; one is commercial, and the other is a formalin-killed vaccine (prepared from a local strain), and subsequently challenged virulent P. multocida. The differences in the regulation of IFN-γ, TNF-α, IL12, IL6, and IL10 cytokine levels expression, were assessed as biomarkers of the clinical phase of infections. Results revealed that T. evansi infection has a significant influence on the performance of rats, and antibody responses agai...

Nazakat Nawaz1, Nasir Mahmood Cheema2*, Malik Muhammad Yousaf3, Muhammad Jahanzaib1, Mubashir Ahmad Khan1 and Muhammad Munir4

Doaa Khairy1, Mohamed Ali Osman2 and Fatma Abdel Mohsen Mostafa1*

...ally be developed into a commercial nematicide to be used in sustainable and organic farming systems.

...

Xiaopeng Tang1*, Kangning Xiong1, Peng Peng2 and Dun Deng2*

...%) may be used safely in commercial broilers diets.

...

Mashakgene Isaac Senoamadi, Thobela Louis, Tyasi Teedzai Chitura* 

...s in the study area were commercial anthelmintic drugs (38.3%), ethno-veterinary based methods (12%) while 46.8% did not control gastrointestinal parasites. It can be concluded that clinical haemonchosis presents a potential challenge in the study area due to a low adoption rate of internal parasite control measures among the farmers interviewed.

Keywords | Anthelmintic, Ethno-veterinary, Gastrointestinal parasites, Haemonchus contortus, Respondents&nb...

Anis Suraya Mohamad Abir1, Sakinah Yusof1, Abd Rahaman Yasmin1,2, Abdul Rahman Omar1,3, Kok Lian Ho4, Wen Siang Tan1,5, Abdul Razak Mariatulqabtiah1,6* 

... an important disease in commercial poultry farming, as it can affect many production-system variables, such as size, performance and viability. Studies on the interactions between chicken bone marrow-derived dendritic cells (chBM-DCs) and FWPV and its recombinant viruses are limited compared to other avian viral infectious diseases. Therefore, this study characterised the response of chBM-DCs to infection with the wild-type (WT) FP9 strain of FWPV compared to...

Momotaz Khanom*, Sheikh Mustafizur Rahman, Muhammad Yousuf Ali, Md. Shahin Parvez, Al-Hasan Antu, Md. Nazmul Ahsan 

...ormulated feed (FF), and commercial feed (CF) two times a day for 60 days. Results showed that larvae fed with formulated feed (FF) grew significantly faster than the other treatments (p<0.05). The weight gains were observed as 2.6 g in FF; 2.0 g in CF and 1.9g in LT and 1.54g in DT, respectively. Similarly, FF showed the highest specific growth rate (SGR) of 11.85±0.71%, but significantly differed only from that of DT (SGR=11.1; P< 0.5). Length-w...

Wafaa M.A. Ghoneem*, Muhammad M. Shaklouf, Ali M. Ali and Mohammed H. Bakr

...mentation product (LAFP) commercially named (Culbac®) on nutrients digestibility, milk yield and composition, blood biochemistry and immune system response of the animals. Culbac® was added at 0, 10 and 20g/h/d in G1 (control), G2 and G3, respectively. Digestion coefficients of the most nutrients and nutritive value did not significantly (P<0.05) differ between G2 and G1. However, G3 recorded lower values. WBCs, RBCs, Ht, Hb, lymphocytes, monocytes,...
Hafiz Liaqat Ali1, Muhammad Tahir Hassan1*, Muftooh Ur Rehman Siddiqi2, Mehwish Arshad1 and Muhammad Mudassar Sharif3
...I engines at a bench and commercial scales.
...

Abdul Majeed1, Zhenlin Liang2, Lixin Zhu2, Chunli Liu2, Muhsan Ali Kalhoro1,* and Faisal Saeed1

...al waters. A. djedaba is commercially important fish species from northern Arabian Sea, Pakistani waters. Present study was conducted on stock status of shrimp scad A. djedaba fishery from Balochistan coast, Pakistan. The data was collected from March 2019 to February 2020, and a total of 1,027 pairs of length-weight and length-frequency data distribution were measured. Computer software FiSAT package was used to analyze the growth and mortality rate parameter...

Feng Xu, Weijing Fan and Guobin Liu*

...MDA) were measured using commercial kit, and expression levels ofNEXN-AS1 and miR-410-3p were detected using real-time quantitative PCR analysis. The dual luciferase experiment was applied to verify the targeted relationship betweenNEXN-AS1 and miR-410-3p. HUVECs were transfected with NEXN-AS1 overexpression vector, and then treated with ox-LDL for 24 h before detecting the activity, apoptosis rate and oxidative stress level of HUVECs. The low concentrations (...

Amjed Ali1, Muhammad Tayyab1*, Abu Saeed Hashmi2, Asif Nadeem3, Shumaila Hanif4, Sehrish Firyal1, Shagufta Saeed1, Ali Raza Awan1 and Muhammad Wasim1

...p for the fulfillment of commercial needs of β-lactamase in Pakistan. The 1 kb β-lactamase gene was amplified by PCR using the genomic DNA of B. subtilis R5 as template. The purified PCR product was cloned in pTZ57R/T and sub-cloned in pET21a. Expression of recombinant protein was examined in BL21 CodonPlus (DE3) cells. SDS-PAGE confirmed the size of recombinant protein as 34 kDa. Recombinant β-lactamase was produced optimally when the BL21 Codo...
Luu Huynh Anh1, Huynh Tan Loc2, Nguyen Hong Xuan3, Le Minh Thanh1, Trinh Thi Hong Mo4, Ly Thi Thu Lan5, Nguyen Trong Ngu1*
...g/bird). The majority of commercially important traits in chickens improved after phage treatment, proving that these phages are capable of controlling O6 E. coli infected in Noi chickens.
 
Keywords | Bacteriophage, Carcass characteristic, Chicken, E. coli, Growth performance
...

Marwa Ragab Saeed Abdallah, Hussein Mohamed Hussein Mohamed, Mohamed Mohamed Talaat Emara, Mai Atef Mohamed

... may be safely used at a commercial scale to extend the durability of pastirma.

Keywords | Pastirma, Whey protein, Beeswax, DPPH, carbonyl compound. 

...

Asim Faraz1, Muhammad Yaqoob2, Nasir Ali Tauqir3, Hafiz Muhammad Ishaq1, Ayman Balla Mustafa4, Amir Ismail5, Muhammad Arslan Akbar6, Abdul Waheed1* and Muhammad Shahid Nabeel7

Sara Mohamed Hemeda1, R.H. Sayed2, Hani Hassan1, Sheima A.E.2, Hassan Aboul-Ella3, R. Soliman3*
...eveloped kits and by the commercially available new existing and commercially available SNAP β-Lactam test kit. The results were compared, and the determined specificity, sensitivity, and accuracy of the locally prepared kits were 93.7%, 95.3%, and 94.6%, respectively.
 
Keywords | Polyclonal antibodies (PAbs) production, Nano-gold applications, Lateral flow immunochromatographic assay (LFA)...

Amal Ramadan Fawy1, Hussein Yousef Ahmed2, El-Sayed S.E. Shabana3, Mohamed Abdelfattah Maky4*

...he quality status of the commercial beef burger in Egypt as well as the utilization of olive and rice bran oils as beef fat substitutes represents a promising technology for producing healthier burgers with enhanced quality characteristics.
 
Keywords | Beef burger, Olive oil, Rice bran oil, Fat replacer, Natural antioxidant
...
Genevieve R. Tabon1,2, Noraine P. Medina2, Mary Rose D. Uy-De Guia3, Claro N. Mingala2,3*
...s not commonly used on a commercial scale but in backyard production. The aim of the study was to assess the allelic variation in 30 Philippine native pigs (PNP). Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP) was done to evaluate the genotypes of ESR1 gene. Target gene was amplified and then subjected to RFLP using PvuII restriction enzyme. Results showed that all of the samples were found to be of AA genotype which is not the f...

Reyad R. Shawish, Reda E. Hamed*, Zakaria H. Elbayoumi 

...e safety of some grilled commercial RTE meat products in Egypt for human consumption in relation to PAHs concentrations with special reference to its health hazards. Moreover, it is highly recommended to look for safe, especially of natural origins, to reduce PAHs concentrations in the grilled meat products after exposure to smoking and processing techniques making it safer for human consumption.

Keywords | PAHs, Ready-to-Eat, Meat products, GC-MS, Egy...

Dede Kardaya*, Dewi Wahyuni, Elis Dihansih 

...d four rations including commercial rations (R1), nonconventional rations + 2% Asam gelugur leaf meal (AGLM) (R2), nonconventional rations + 4% AGLM (R3), and nonconventional rations + 6% AGLM (R4) in a completely randomized design with five replicates containing three ducks each. Ducks were reared in battery cages for five weeks. Measurements were taken on meat physical quality (pH, water binding capacity, cooking los...

Qian Chong1, Muhammad Mohsin2*, Zhu Ting1, Chen Qiqi1 and Ana Mehak3

...e a significant place of commercial fisheries in China as these resources are rich in fish fauna. However, decreased fish biomass catch has been observed during recent years, putting a big question about the ongoing stock status of commercial fisheries. Therefore, this paper strives to appraise the population dynamics of Trichiurus lepturus in Zhejiang, China which would help fishery managers. For this, authentic data, 1999 ...

Shahan Azeem1*, Muhammad Akram Muneer2, Liaquat Ahmad3, Sameera Akhtar1 and Talat Naseer Pasha4,5

...feed was procured from a commercial feed mill. The antibiotics were mixed in the feed as per the manufacturer’s instructions and offered ad libitum to the chickens for the entire study period. The chickens were vaccinated for NDV and AIV. None of the antibiotics adversely affected the development of NDV or AIV hemagglutination inhibition geometric mean titers. Flavomycin and zinc bacitracin did not adversely affect the mean splenic (1.27+0.20 g and 1.21+...

Deepesh Kumar Bhuptani1, Atta Hussain Shah1*, Gul Bahar Khaskheli1, Zubair Ahmed Laghari2, Ghulam Shabir Bahram1, Muneer Ahmed Jamali1, Tarique Ahmed Khokhar1 

...ected and analyzed using commercial ELISA kit. The results revealed that AFM1 was statistically higher (P˂0.05) in district Karachi (0.7223 µg/L) as compared to Thatta and Hyderabad (0.5897 µg/L and 0.5697 µg/L, respectively) than FDA limit (0.5 μg/L) however, it was found relatively similar (P>0.05) in Hyderabad and Thatta districts of Southern zone. In central zone, numerically AFM1 load was high (P>0.05) in samples of district Mi...

Zannatul Ferdous1, Abdul Goffar Sarder2, Mustasim Famous3*, Mahfuza Ferdous4, Shahabuddin Ahmed5 and Md. Amir Hossain6

... of 100 day-old Cobb 500 commercial broiler chicks were randomly divided into five groups (T0, T1, T2, T3, T4) and each treatment contain 20 broilers to carry out the work. The average initial weight of the chicks in all experimental groups was about the same. Weekly observations were recorded for live body weight up to 35 days and blood parameters of birds at day 14th, 21th and 35th days. The result showed comparatively better live weight in T4 which is treat...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...e organic acid group and commercial organic acid formulation group. Excluding negative control group, all other groups were orally challenged with 0.1 ml of the 6-Log 10 CFU/ml of the Campylobacter jejuni culture in normal saline via oral route. Cloacal samples were collected for Campylobacter count, body weight (BW) and feed conversion ratio (FCR), which were determined weekly and cumulatively for 35 days. The birds of a specific treatment group were given or...

Sharon Zulfiqar1, Mubashar Hussain1*, Kiran Aftab1, Muhammad Faheem Malik1, Rizwan Khursheed2, Somia Liaqat1 and Maimoona Kanwal1

...rmance of biological and commercial parameters of three bivoltine silkworm races fed on local mulberry. The disease-free eggs of Chinese, Korean and Bulgarian races were obtained from Sericulture Research Laboratory, Lahore. The silkworm eggs were incubated at standard conditions. Larval rearing was maintained at standard rearing conditions of temperature (25 ± 1°C), Relative Humidity (75 ± 5 %), and photoperiod (12 light: 12 dark). The exper...

Zhang Yan1,2 and Muhammad Mohsin3*

...fy;">Stock assessment of commercial fisheries is very important to ensure sustainable harvesting of fishery resources in China. Therefore, this study endeavors to estimate the fishery status of Trichiurus lepturus in Shandong, China. For this purpose, fishery statistics, 2007–2018 were statistically evaluated by surplus production models (SPMs). These models were applied to data through computer-based manually operated statistical routines, viz., ASPIC (...
Allah Bakhsh1, Attiq Akhtar2, Fiaz Hussain3, Hafiz Wasif Javaad4, Inam ul Haq5* and Humara Umar
...ams and establishment of commercial orchards in Soan Valley area of Punjab, Pakistan.

...

Nuraini Nuraini*, Yuliaty Shafan Nur, Ade Djulardi, Robi Amizar, Yesi Chwenta Sari

...nt variations consist of commercial ration (CR) and tofu dregs (TD) were treatment P1 (100% CR), P2 (80% CR + 20% TD), P3 (60% CR+ 40% TD), P4 (40% CR + 20% TD), P5 (20% CR + 80% TD) and P6 (100% TD). The observed variables were fresh weight, crude protein, and crude fat of Tmc. The Phase 2 application to laying quails is the utilization of Tenebrio molitor caterpillars in the diet. This stage used a Completely Randomized Design (CRD) with five treatments and ...
Abdulaziz A. Alaqil1*, Mohammed I. Buhaya2
...ochemical composition of commercial laying hens. A total of 180 Hy-Line brown laying hens 36-week-old were randomly divided into four groups (9 replicates x 5 birds each). The four groups were fed a basal diet formulated to contain; 0, 2, 4 or 6% LO for six weeks. Results showed a significant improvement in egg production performance with dietary LO inclusion ranged from 3 to 4%. Data revealed a significant reduction in egg yolk cholesterol content by 15, 17 a...

Hassan A. Aidaros, Eman M. Hafez, Halla E.K. El Bahgy* 

...ctericidal power of many commercial disinfectants such as quaternary ammonium compounds (QUATS), halogen releasing agents including iodine, chlorine and its compounds, but some were not affected, such as glutaraldehyde. Finally, the success of the disinfection process in different poultry farms mainly depends on the selection of suitable disinfectants.

Keywords | Disinfectant, Poultry, E.coli, Pasteurella multocida, Campylobacter jejuni , Staphylococcu...

Jun Wang*, Xiaoming Jiang and Zhiwei Sun

... first report on LRWs of commercial fish species in the whole mainstream of the Yellow River.The LRWs of five species have not been previously record. These data can serve as important baseline for conservation and management in the Yellow River fishery resources, which is very useful for evaluation of the status of the river ecological health.

...

Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed Elbayoumi1 , Sameh Abdel- Moez Ahmed Amer1, Asmaa Mahmoud Matoaq1 , Mohamed Abdel Aziz Kutkat1, Gomaa Abd El-Rhim Abdel-Alim2  

... of genotypes II or VII (commercially available or autogenously prepared). Different vaccination regimes are applied at various designated days to 260 commercial broiler chickens in 13 groups; 20 birds each. At 28 days-old, all groups were challenged with NDV genotype VII 1.1 strain “NDV-CHICKEN-EGY-ALEX-NRC-2020” to evaluate the protective immunity of applied protocols. Humoral immune response, clinical signs, p...

Dede Kardaya*, Ayu Ratnasari, Dewi Wahyuni 

... carcass percentage, and commercial percentage (wings, breasts, thighs, and back). The R1 diet produced a higher (p<0.05) slaughter weight and carcass weight than R2 and R3 diets, while the percentage of wings and thighs were higher (p<0.05) in R2 and R3 than R1. However, R1 diet produced a higher back percentage (p<0.05) than R2 and R3 diets. Supplementation of 6% GALM in diets decreased slaughter weight, carcass weight, and back percentage, maintain...

Sehrish Akram1, Abida Butt1* and Shakil Ahmad Khan2

...nsecticide imidacloprid (commercial formulation and technical grade) and heavy metal lead (Pb) against 2nd, 3rd, 4th and 5th instars of silkworm. For treatment, leaf-dipping method was used and toxicity calculated after 48h exposure to the treatment. Both chemicals showed high toxicity against all instars of silkworm. However, results indicated that imidacloprid was more toxic for silkworm larvae compared to lead. The acute toxicity of imidacloprid formulation...

Zheng-Yong Wen1, 2*, Chuan-Jie Qin1,2, Bin Li1,2, Rui Li1,2 and Xiao-Tao Shi3*

...y a solid foundation for commercial production of darkbarbel catfish.

...

Nishim Bhusal1, Bhuwan Raj Bhatt2*, Saroj Shrestha3 and Arjun Chapagain4

...alence of fasciolosis in commercial cattle farms of Tilottama Municipality, Rupandehi district, Nepal. A total of 270 fresh faecal samples were collected purposively from the study area with different ages, sex, stage, and breeds for examination (sedimentation method) to visualize eggs of Fasciola microscopically. The obtained data were coded and analysed using Microsoft Excel 2016. The overall prevalence of fasciolosis in cattle was found to be 15.56%. Age an...

Muhammad Tariq Navid1,2*, Mian Muhammad Awais2*, Muhammad Irfan Anwar2 and Masood Akhtar2

...nd seropositive by using commercially available ELISA kit. The supernatants from oro-pharyngeal and cloacal swabs of the seropositive samples were separated and divided into two segments; one was used directly to detect AI viral genome through RT-PCR while other segment was used for viral inoculation into the embryonated chicken eggs. The direct detection through RT-PCR confirmed H9 gene from cloacal swab samples in 6.9% of the seropositive sample while we cou...

Muhammad Izhar ul Haque1, Farhan Anwar Khan1*, Umar Sadique1, Hamayun Khan1, Zia ur Rehman1, Salman Khan1, Hayatullah Khan1,2, Faisal Ahmad1,3, Mumtazur Rahman1, Faiz Ur Rehman1, Muhammad Saeed1, Mehboob Ali1 and Saqib Nawaz1

...cted at random both from commercial farms and abattoirs. Additionally, tissue samples (intestine and mesenteric lymph node (MLN)) were collected at random from sheep and goats at abattoirs of district Peshawar. Analyses of serum samples by iELISA revealed the presence of antibodies against MAP in 9% sheep and 5% goats. Ziehl Nielsen (ZN) staining exhibited acid-fast bacilli (AFB) in 31% sheep and 23% goat’s fecal impression smears. Gross pathology in int...

Akbar Hayat1*, Ehsan Ul Haque1, Marayam Nasir2, Rab Nawaz3, Tariq Mahmood4 and Sohaib Afzaal1

...nctive results for their commercial exploitation. The attributes in analytical work for fruit quality evaluation were fruit size, weight, peel thickness, peel percentage, juice percentage, rag percentage, total soluble solids (TSS), acidity, TSS/acid ratio, number of segments, and number of seeds, maturity period and degree of granularity. This was ever important study in Pakistan for evaluating the citrus exotic material of latest generation. This endeavour l...

Sherif Abdelghany1, Hossam Mahrous Ebeid2*, Ahmed Abdelkader Aboamer2, Mohamed Ali Radwan1, Rania Agamy1 

...s level as well as adapt commercialized diagnostic tools for feeding practices in rural areas.

Keywords | Rural Regions, Dairy Farms, Feeding Practices, Milk Analysis, Milk urea nitrogen, Smallholders 

...

Chanathip Thammakarn1*, Sawanya Umphonphison1, Paitoon Kaewhom2, Kanokrat Srikijkasemwat1 

...CV2) was investigated in commercial farms at various regions of Thailand during the year 2018-2021. A total 2,002 serum samples were collected from 16 farms located in 10 provinces and tested by Enzyme-Linked Immunosorbent Assay. Among total serum samples, 914 samples were further tested by polymerase chain reaction (PCR) to detect ORF2 gene. The results revealed that 81.17% of pigs had low positive level antibody against PCV2, while 10.29% had high positive ...

Hafiz Husnain Nawaz1*, Ayesha Ahsan2, Amir Afzal1, Muhammad Ashraf Sumrah1, Muhammad Jan1, Kashif Ali1, Muhammad Arsalan1 and Rizwan Latif3

...xidants in comparison to commercially available C. sativa oil. The Folin-Ciocalteu reagent and the α, α-diphenyl-β-picrylhydrazyl (DPPH) test were used to measure the total phenolic content of oil and leaf extracts. Bioactive components included in plant extracts, such as tocopherol, chlorophyll, carotenoids, phenolics, flavonoids, and other scavenging components, make them more potent. Thus, the 50µg/ml concentration plant extract solut...

Riaz Noor Panhwar1*, Abdul Fatah Soomro1, Muhammad Chohan1, Illahi Bux Bhatti1, Ali Hassan Mari1, Samia Arain1 and Sagheer Ahmad2

...before releasing them as commercial varieties. The study was undertaken to evaluate variations in sugarcane genotypes employing four morphological (Cane thickness, cane height, millable stalks, and cane yield) and four quality-related (Brix, pol, purity, and commercial cane sugar percentage) traits. Experiments were conducted in plant crop for two consecutive years 2018-19 and 2019-20 during the autumn cropping season at Mak...

Marwa S. Khattab1*, Ahmed H. Osman1, Huda O. AbuBakr2, Rehab A. Azouz3, Asmaa A. Azouz4, Heba S. Farag5 

... and the side effects of commercial ivermectin drugs on the quality of skin collected from slaughterhouses in Egypt. Methodology: Overall, Ivermectin, pesticide, and veterinary drug residues were detected in 50 random bovine skin samples. Each sample was kept in a separate sterile plastic bag and transferred to the lab in an insulated icebox for detection of the presence of ivermectin residues using the high-performance liquid chromatography (HPLC) technique. ...

M. Mansoor Javed*, M. Aslam Mirza, M. Aziz ur Rehman and M. Saif ur Rahman

...nd 45 min in a multitier commercial toaster. Each product was analyzed for proximate composition, pepsin digestibility, KOH solubility and urease activity prior to inclusion in the experimental diets. A day old Cobb-500 broiler birds (n=432) were purchased commercially. Nine iso-caloric as well as iso-nitrogenous experimental formulations as starter diets (CP 22 %, ME 3000 Kcal/kg), grower diets (CP 20.5 %, ME 3075 Kcal/kg) ...

Ergi Bahrioglu1, Mustafa Hac Isa2, Sibel Cengiz2 and Ertan Ercan2*

... a fish feed-based diet (commercial extruded Seabass feed) in four different culture substrates (rice husk, peat, cocopeat, garden soil). There were altogether eight experimental groups with triplicates. The initial stocking density of white worms was 150 worms/unit (2.2 Liters of cylindrical containers), and all the experiments were carried out in the dark at a constant temperature at 18oC. Worms were collected from the substrate by heat treatment and the cou...

Most. Shakila Sarmin1,2, Md. Ashekur Rahman1,2, Most. Farida Parvin2,3, Mst. Shefaly Khatun4, Kazi Ahsan Habib5, Wasim Sabbir6, Jun Ohtomi7 and Md. Yeamin Hossain1*

... 720, female = 793) from commercial vessels operating in the Bay of Bengal (BoB), Bangladesh between January-December 2020. All lengths (TL, total; FL, fork; SL, standard length), were taken using a fish measuring board to 0.01 cm as well as a digital balance is used to weigh body weight (BW) to 0.01 g precision. The size structure (length-frequency distributions, LFDs) indicated that the males with TL 22.0-22.9 cm and females with 29.0-29.9 cm size group were...

Ghazala Nasreen1, Ali Hussain2, Komal Tayyab1, Muhammad Rashid3 and Sumaira Aslam1*

...ge), T3 (bioflocs + 50 % commercial diet and with zero water exchange) and T4 (bioflocs + 50 % commercial diet and with 10 % weekly water exchange). A control experiment C (commercial diet with daily water exchange) was run parallel. At the end of the experimental trial, the cultured fish were processed for the determination of hepatosomatic indices, levels of total soluble proteins and he...

Shabana Parveen1*, Naeem Tariq Narejo2, Ayaz Hussain Qadri1, Ghulam Dastagir3, Muhammad Hanif Chandio4, Pervaiz Khan4, Faheem Saddar5, Naveed Ahmad Abro6, Shahnaz Rashid7 and Ghulam Abbas7

...sh was procured from the commercial catch of local fisher community. The investigations were based on estimation of fecundity and its relationship with other body parameters, variation in egg size and calculation of gonadosomatic index. The results of fecundity estimation were based on 10 mature female fish ranging in size 30.4 to 43 cm and from 235.0 to 765.0 g in length and weight respectively. The lowest egg production (2193) was noted from small sized and ...

Ibrahim Samir Abd El-Hamid1, Alaa Emara Rabee2, Moustafa Mohamed M. A. Ghandour2, Rasha Salah Mohammed3, Ahmed Mohamed. Sallam4 

...ted with 5 g/head/day of commercial Quebracho tannins extract (QT). The findings showed that the PHM and QT groups had higher (P≤0.05) mean values of sperm concentration, mass motility, sperm motility, sperm viability, and cell membrane integrity. Plasma testosterone concentration and number of red blood cells were higher (P≤0.05) in both treated groups. However alanine aminotransferase, cholesterol, total antioxidant capacity and glutathione peroxidase ...

Nam Thanh Nguyen1,2,3, Linh Manh Ha4, Anh Thi Nguyen5, Nam Hoang Chu5, Hau Duc Tran5, Hung Phuc Nguyen5 and Thuy Thi Ta6*

...n the Indo-Pacific, is a commercial goby in Vietnam. Knowledge of the allometric growth patterns of morphometric characters, the length-weight relationship, and the conditions for assessing and managing the fish populations is unknown. The present study tested the intersex differences in growth of morphometric characters, sexual and seasonal change in length-weight relationship, and growth conditions for this species based on a year-round (2018‒2019) wild sp...

Hanaa H.A. Gomaa1*, Shimaa A.S. Hasan1, Nashwa Harb1, Amal H.A. Gomaa2 and Maha Anani3

...iremia were evaluated by commercial ELISA and real-time polymerase chain reaction (RT-PCR) techniques. Our findings revealed a very high frequency of HSV-1 and 2 infections among the studied pregnant women with percentages of 74.5% and 98.9%, respectively. Upon the interpretation of the HSV serological profiles, the past latent infection with HSV-1 and 2 were the most prevalent types of infection representing 74.5% and 92.5%, respectively, followed by HSV-2 re...

Jax Vincent Gamulo, Maye Pearl Bolina, Jessica Serena Brion, Via Crishiela Nicole Dela Rosa, Roxanne Francesca Maglaya, Carl Lexter Tan, Aimee Caye Chang* 

...is and as alternative to commercially available anthelmintic drugs. Eligibility criteria for inclusion and protocol was defined for systematic publication database searching. Final reference database consisted of eight (8) published journal articles with a total of 106 Fasciola flukes, published between years 2001 to 2021. The mortality time between tropical plant extracts and commercially available drugs posed a significant...

Ayesha Bakhtiar1, Sardar Azhar Mehmood2, Abdul Rauf Bhatti3*, Shabir Ahmad2, Naqash Khalid2, Javed Iqbal5, Azra Nadeem4 and Waqas Ahmad1

...ext-align: justify;">Two commercial vaccines against the Lasota strain of Newcastle disease (ND), the Lasota vaccine-1 and vaccine-2, and two vaccines against the Mukteswar strain of Newcastle disease, the Mukteswar vaccine-1 and vaccine-2, were assessed for their effectiveness and impact on the productivity of broilers. 75 days old broiler chicks overall were divided into five equal groups and given the following labels: A, B, C, D, and E. Each group was then...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel4, Abdelwahab M. Abdelwahab1,5
.... The study employed 270 commercial layers, 40-wk-old, that belonged to the W-36 Hy-Line chickens. The layers were randomly designated into five equal treatment groups (9 replicates × 6 hens per replicate for each treatment) according to the dietary inclusion levels of BSFL meal. The first group of birds were fed a basal diet of soybean-corn meals and served as a control (0% BSFL meal), while the remaining 4 groups were fed a basal diet in which the soyb...
Farid S. Nassar1,2, Abdulaziz M. Alsahlawi3, Mohammad A. Al-Mahaish4, Ahmed O. Abbas1,2*, Abdulaziz A. Alaqil1, Nancy N. Kamel5
...0 unsexed Cobb500™ commercial broiler chicks aged 1 day and weighing 46±1.5 g. Starting from the 22nd to the 42nd d of age, the chicks were randomly distributed according to the dietary inclusion levels of MWM into six treatment groups (6 replicate pens per group × 10 chicks per replicate, considering the equal ratio of males to females in each replicate). The first group of birds was fed a control finisher diet containing soybean-corn meal ...
Hagar Magdy Ahmed1, Mohamed Mahrous Amer2*, Khaled Mohamed El-Bayoumi1, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila1, Gomaa Abd El-Rhim Abdel Alim2
...ia/17” and/or some commercial immunostimulants (Lector® and Orego®) in commercial broiler chickens. The pathogenicity studies parameters included the effects on protection, growth performance and clinico-pathological changes. The results indicated that, immunostimulants can keep maternal immunity longer where lector® was the best; the decline in HI titers also indicates that bird groups not contract ND natu...

Nachaat Sakr

...or selected breeding and commercialization aims in the arid Mediterranean area; Bohoth 10 (bread wheat) and Arabi Aswad (barley) ranking among the most head blight resistant cereal cultivars.

...

Idrees Ahmad1, Muhammad Jamil2*, Hafiz Muhammad Zia Ullah1, Saira Saleem1, Syed Ahtisham Masood3, Umair Faheem4, Imran Akhtar5, Muhammad Abdullah6, Abdul Majid Khan5 and Naeem Iqbal7

...er. Its cultivation on a commercial scale will enhance the share of local edible oil production and will strengthen the national economy.

...

Kainat Bibi1*, Sajjad Khan1, Zulfiqar Ali Gurmani1, Fahad Karim Awan1 and Sajid Ali2 

...for inorganic treatments commercial fertilizers urea and di-amonium phosphate fertilizers were applied at recommended doses. Data was recorded on various morphological, yield and quality parameters. The result revealed that organically sown wheat varieties took more days to anthesis and maturity while more tillers, biological yield, grains yield and leaf area were recorded in inorganic treatments. Quality of organic produced wheat was comparatively better than...

Abdul Azis*, Afriani Afriani

...f seven days-old unsexed commercial strain Lohmann of broiler chicken. The experimental design was completely randomized, with 5 treatments and 4 replications. As a control, chickens were fed ad libitum (FR-0); chickens were given free access to feed during two periods of 2 hours from age 7-14 days (FR-1) and age 7-21 days (FR-2); chickens were given free ac­cess to feed during two periods of 4 hours from age 7-14 days (FR-3) and age 7-21 days (FR-4). Body...

Sadaf Aman1, Fouzia Tabssum2, Ali Hussain3, Shamsa Jabeen1 and Javed Iqbal Qazi1*

...ol group was served with commercial feed. Initial mean weights of the experimental fish was recorded as 40.00 ± 1.00, 40.33 ± 0.76 and 40.01 ± 1.00 g for T1, T2 and control groups, respectively. The highest weight gain was found in T1 (747.96 ± 1.9 g) and control group (479.35 ± 1.8 g). Significant differences were found in the feed conversion ratio between control group (2.02 ± 0.07), T1 (1.48 ± 0.03) and T2 (1...

Hasnain Raza1,2, Qun Liu1*, Muhammad Tariq Hanif2 and Yanan Han1

...ve major fish species of commercial importance exploited by heterogeneous fishing fleets in the Exclusive Economic Zones (EEZs) of Pakistan have been undertaken as a case study for the stock evaluation. Altogether, both the models estimated largely similar results. The stock status results indicate that Euthynnus affinis and Rachycentron canadum were healthy, while Scomberomorus commerson and Parastromateus niger were overfished and Lutjanus argentimaculatus w...

Van-Thanh Vo1, Thi-Hieu Tran1, Thi-Truc-Thao Nguyen1, Van-Tri Truong1, Cu-Thien Pham1, Thanh-Minh Pham2 and Huyen Nguyen Thi Thuong1*

...ments: control 1 – commercial feed + no infection; control 2 - commercial feed + infection of S. agalactiae; and 3 experimental treatments with essential oils concentrations of 0.125%; 0.25% and 0.5%. The study examined the blood cell morphology and physiological blood indices of red tilapia (including hemoglobin; hematocrit; red blood cells count; the total number of white blood cells and thrombocytes, erythrocyte siz...

Nasratullah Baloch1*, Naeem Tariq Narejo2, Hamida Narejo3, Muhammad Farooq Hassan4, Muhammad Hanif Chandio5, Faheem Saddar6, Dharti Shahnawaz Thebo7, Ghulam Abbas8 and Shahnaz Rashid8

...ucive for the rearing of commercial fish species in it.

...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...production of dextran, a commercially important product, with numerous applications in many industries such as food, medical, pharmaceutical, and cosmetics. In the current study, dextransucrase producing microorganisms were separated from different vegetables, fruits, and milk samples collected from the local market of Lahore, Pakistan. Sucrose-based medium, supplemented with vancomycin and tetracycline, was used for the selective growth of Leuconostoc ...
 
 ANSA KHALID, UZMA HAMEED* AND IKRAM-UL-HAQ 
...production of dextran, a commercially important product, with numerous applications in many industries such as food, medical, pharmaceutical, and cosmetics. In the current study, dextransucrase producing microorganisms were separated from different vegetables, fruits, and milk samples collected from the local market of Lahore, Pakistan. Sucrose-based medium, supplemented with vancomycin and tetracycline, was used for the selective growth of Leuconostoc ...
 
 MONIS HUSSAIN SHAH1*, RIAZ UR REHMAN2, RIAZ ALI SHAH1, RIZWAN RAFIQUE3, MUHAMMAD USMAN4, SAJIDA BIBI5 AND SADIA YASEEN

HIRA JAVAID*1, MALEEHA MANZOOR2, JAVED IQBAL QAZI3, XIONG XIAOCHAO4 & FOUZIA TABSSUM5

...roduction of biofuels at commercial level has been perceived as sustainable solution to the problem of energy and economic crisis. Of all the liquid biofuels, an important one is biodiesel, the fatty acids methyl esters. Due to beneficial decomposition of bio-waste resources towards clear environments, oils from single cell microbes (yeasts) are gaining attention. Further cost reliance of these microbes to produce single cell oils (SCOs) could be reduced by us...

Gulzhan Kalenovna Mussayeva1*, Alikhan Meldebekovich Meldebekov2, Nurgul Alikhanovna Meldebekova2, Gulshat Imanzhankyzy Shaykamal1, Batyrkhan Azimkhanovich Buralkhiyev2, Nurkuisa Mirzabekovich Rametov3 and Kanat Zhumanov4

...horn and the duration of commercial use. For the given purposes it is recommended to use such bulls of the Wis Burke Ideal line whose average milk productivity exceeds that of their coevals and the breed standard and simultaneously allows to keep productive longevity and reproductive ability. The results obtained in the course of research indicate the influence of such genotypic factor as ‘lineage’ on the productive longevity of Holstein cows. The ...

Omnia M. Khattab1, Morcos I. Yanni2, Hala K. Abdelmegeed2, Mahmoud Eliwa1, Naglaa M. Hagag1, Sara M. Elnomrosy1

...y in relation to vaccine commercially used, detecting sequence changes related to virus virulence or tropism. In this study Fifty-seven fecal samples were collected from suspected cases of cats. 19 fecal samples were positive using Rapid FLV Ag test kits kit (VDRG FLV/FIV Ab rapid kit). Fifty-seven blood samples of the same animals were subjected for hematological examination to investigate the severity of leukopenia. Thirteen out of nineteen samples were posi...

Hendy Musbawandi1, Mohammad H. Tamzil2*, Budi Indarsih2 

...for 4 weeks feeding with commercial feed produced by PT. Japfa Comfeed Indonesia Tbk. The study was designed using a completely randomized design using 180 chickens. All chickens were divided into three groups with six replicates each which were the first group was reared in a closed house, the second and third groups were reared in positive pressure and open houses. Each replicate, in each treatment, was reared in a different barn plot with the number of 10 c...

Yun Zhang*

...omes were isolated using commercial kit. The exosomes were observed by transmission electron microscope. Western blotting was done to detect the protein expression. Transmission electron microscope analysis revealed that exosomes could be significantly observed in the PE group. The expression of surface markers that included CD63 and CD81 were dramatically upregulated in PE group. The protein level of ET-1 and Ang-II were significantly increased in PE group, a...

Muhammad Arshad Iqbal*, Aamir Ghafoor, Irfan Ahmad, Muhammad Ijaz 

...fringens. A total of 180 commercial broiler chickens were obtained from local hatchery and were reared for 42 days. Three groups (A, B, C) of birds were divided into 3 subgroups with 20 birds in each group. Group A (-ve control) received diet without AGP or probiotic. Group B (+ve control) was fed with AGP. Group C was probiotic feed supplemented with B. amyloliquefaciens. All subgroups 1 were kept non-challenged, at day 21, subgroups 2 were challenged with 1x...

Keatisak Soisuwan1, Hatairat Plaimast2, Atichat Thongnum3, Soranot Chotnipat4, Manatsanun Nopparatmaitree4* 

...y treatment consisted of commercial broilers diets (corn-soybean based diet) supplemented with 0 or 100 g/ton of natural multi-enzymes feed supplementation (top-up feeding). Birds were provided ad libitum access to water and experimental diets. The results showed that natural multi-enzyme supplementation had no significant effect on the growth performances of broilers as compared to the control (P > 0.05). However, supplementation of natural multi-enzymes i...

Najamuddin Solangi1*, Mushtaque Ahmed Jatoi1, Adel Ahmed Abul-Soad2, Abdul Aziz Mirani1, Muhammad Aslam Solangi3 and Ghulam Sarwar Markhand1

...plantlet regeneration in commercially important date palm cvs. Begum Jungi and Ajwa. Spikelet explants of spathes (avg. 17, 28, 32 cm) excised at different intervals were used as initial explants. Results revealed that sterilization of spathes with 50% sodium hypochlorite (NaOCl) solution resulted in significantly highest survival, lowest mortality and contamination in spikelet explants. The spikelet explants obtained from immature spathes (avg. 17 cm) resulte...

Imran Ahmad

...by a texture analyzer. A commercial MIS (size ≤ 40 microns) was added to the puree of five arbitrarily selected fruits (strawberry, banana, and apple) and vegetables (beetroot and carrot) at three different levels (3%, 5%, 7% w/w). A Texture Analyzer determined hardness, adhesiveness, cohesiveness, gumminess, and chewiness. The difference among the treatments was analyzed using standard deviation and ANOVA (p ≤ 0.05). To evaluate the various samples, a f...

Nawfal Hammadi Jasim1, Yasmeen Jassim Mohammed2 , Jala Amir Salman Alahmed1, Majdy Faisal Majeed3* 

...de (MPH) or Retalin (the commercial name) . Objective: The effects of MPH on adult male rats have been evaluated in this study. Materials and methods: receiving an oral dose (2 daily MPH doses), represented by Group 1 (5 mg/kg/day in a 5% glucose solution), Group 2 received daily dosages of methylphenidate in escalating amounts (5, 8, 12, and 16 mg/kg/day in a 5% of sucrose solution), as well as Group 3 as control animals ( 5% glucose solution). Group 1 resem...

Sumbal Nazir1*, Farkhanda Manzoor2, Ishrat Perveen3, Anum Rana2, Irum Naureen1, Abad Ali Nadeem3 and Hafiza Najma Naeem2 

...l role in pollination of commercial crops. Some viral, bacterial, protozoan, and fungal pathogens are attached on the honeybees worldwide. These pathogens affect the honeybee population by creating disease in it, which also effect the economy of country. It destroys the honey production and causes a subsequent reduction in the crop yield. In this present work, we isolated and screened various honeybee pathogens i.e., Nosema apis, Nosema cerus, Acute bee paraly...

Pawinee Kingkan1, Thanathip Supcharoenkul1, Chaowit Rakangthong1, Chaiyapoom Bunchasak1, Komwit Surachat2,3, Wiriya Loongyai1* 

Javeria Khourshid*, Ghulam Abbas, Shahnaz Rashid, Asma Fatima* and Abdul Malik

...iversity of Karachi. Two commercially important fish species (Orechromis niloticus and Acanthopagrus berda) were used for this study and kept in two different treatment tanks with their replicates (n=10 each) designated as T1= OxyAqua and T2= simple aeration. Juveniles were fed on supplementary pelleted diet thrice daily at 2% of their total body weight. Results showed that WG and SGR were significantly higher in T1, in which we applied Oxy Aqua organic® p...

Mati Ullah1*, Muhammad Rizwan2, Ali Raza3, Xianlin Zhao4, Yanling Sun4, Sarah Gul5, Muhammad Ihtesham Waheed6, Muhammad Nadeem Khan7, Alvina Gul8, Sami Ullah Jan9* and Chao Huang4*

...d bacteria with numerous commercial and applied health applications. In the present study, we comparatively analysed the genomes of three strains (Lactobacillus rhamnosus ATCC 53103, Lactobacillus casei L9, and Lactobacillus paracasei W56) of LCG isolated from traditional yogurt samples using the next-generation sequencing approach. The GC contents of the characterized strains were in the range of 46.03 to 46.52% while the protein-coding sequences (CDS) were i...

Aditya Chowdhury Avi1,4*, Md Tariqul Islam1,4, Md Saiful Bari2,4, Rebeka Sultana Swapna Khandoker3, Goutam Buddha Das1 

...of broilers by feeding a commercial broiler-feed. A total of 120 unsexed commercial broilers (Ross-308) were randomly assigned to four treatment groups that contained 1%, 2%, and 3% FO in regular drinking water, as well as a control group. All of the birds were given enough commercial broiler-feed and water. The performance gained by broilers after 30 days of rearing from all supplemented ...

Monis Hussain Shah1*, Riaz Ur Rehman2, Riaz Ali Shah1, Farwa Batool3, Rizwan Rafique4, Muhammad Usman5, Sajida Bibi6, Sadia Yasin7 and Samida Qamar8

...sale and cultivation for commercial purposes as well. The evaluation of exotic varieties are very important for recommendation to local farmers for better yield. Four tulip varieties cv. Antarctica, Oxford, Ballerina and Apeldoorn were purchased for evaluation. The 100 bulbs of each variety were planted in the bed. The performance of the plants during 2017-18 were judged by observing the bulb germination percentage, leaf width (cm), leaf length (cm), scape len...

Skenndri Safae1*, Charrat Nadia2, Jmiai Mehdi3, Nassik Saadia1 

... biosecurity level of 18 commercial broiler farms scattered in the Doukkala area of the Casablanca-Settat region and the health of the digestive tract of the birds. The 18 farms were firstly categorized into three (3) groups according to their performances on a biosecurity level: P group for “poor” performances, D group for “decent” performances, and G group for “good” performances. Each farm was then sampled twice on day 11...

Muhammad Hasnain1*, Muhammad Hussnain Babar1, Ghulam Sarwar1, Muhammad Kashif Nadeem2, Sajid Nadeem3, Muhammad Akram4, Ali Raza4, Mussurrat Hussain5, Qaisar Abbas5 and Muhammad Shahid4

...the bio-efficacy of five commercial acaricidal formulationsviz., azocyclotine 25% WP (Gallop), fenpyroximate 5% SC (Unique-M), diafenthiuron 500 SC (Trophy), hexythiazon 10% WP (Nissorun) and abamectin 1.8% EC (Commando) against brinjal mites, Tetranychus urticae, on brinjal crop under field conditions. Brinjal vegetable was raised under standard agronomic practices. Field recommended dose of these acaricides were used knapsack sprayer. Results showed a signif...

Beenish Shahid1* and Muhammad Ijaz Khan2

...ffalo species limits the commercialization of in vitro embryo production technology in field conditions. The present study aimed to improve the cytoplasmic and nuclear maturation of in vitro matured oocytes of Nili Ravi buffalo in the presence of hormones. The denuded oocytes (DOs) obtained by repeated pipetting were collected from 2-8mm follicles. A series of experiments were conducted to evaluate the effects of oestradiol (2 μg/ml), recombinant human foll...

Rizki Palupi*, Arfan Abrar, Fitri Nova Liya Lubis, Yuni Kurniati, Bianca Ikriza Octa Nadia Putri 

...units. The feed used was commercial broiler chicken feed: a mixture of concentrate, corn, rice bran and fishmeal, and CCI according to the treatment. The observed variables were nutrient digestibility (dry matter, crude protein and crude fiber), hematological status and blood malondialdehyde levels in blood of broiler chickens. Data were analyzed by ANOVA and further tested by Duncan Multiple Range Test (DMRT). The results of this study indicated that the CCI ...

Muhammad Adeel Farooq1, Shaukat Ali1*, Ali Hassan1, Rida Sulayman1, Muhammad Ahsan Kaleem2, Hafsa Shahzad1, Muhammad Summer1, Arooj Latif1, Tahreem Tanveer1

...ylase is used in various commercial and research applications. Due to the high market demand for α-amylase, the production of this enzyme was increased in the current study employing a mutation in wild strains. To reduce costs, less expensive agro-wastes were used, such as soybean meal, wheat bran, apple peels, rice husk, and cucumber peels. The mutant strains of Bacillus subtilis (BSAA-5 to BSAA-40) and Bacillus licheniformis (BLAA-5 to BLAA-40) were pr...

Amirul Faiz Mohd Azmi1,4,Wan Nur Hanani Wan Roslan1, Athirah Zawani Zulkifli Amin Rashid1, Siti Aisyah Mohd Hafiz Ngoo1, Mohd Hezmee Mohd Noor1, Muhammad Azrolharith Rashid1, Mohd Zamri Saad2, Danung Nur Adli5, Hasliza Abu Hassim1,3* 

...0) was treated with 100% commercial diet without soybean waste, Group 2 (T1) was treated with 15% soybean waste + 85% commercial diet, and Group 3 (T2) was treated with 30% soybean waste + 70% commercial diet. For growth performance, the body weight and average daily gain were measured. Meat qualities were evaluated based on the dressing weight, pH, and meat proximate analysis. The results...
Maria Azam1, Tahir Mahmood Qureshi1, Saddam Hussain2, Amjad Islam Aqib3*, Shanza Rauf Khan4, Kashif Akram1, Misbah Ijaz5, Maheen Murtaza6, Afshan Muneer6 and Sammina Mahmood7
... S. aureus positive from commercial dairy while the resistance of these isolates against gentamicin, enrofloxacin, levofloxacin, and vancomycin was found to be 50, 40, 30, 30%, respectively. On the other hand, a disc diffusion assay was concluded with 24.525±0.806 mm (ZnO) followed by 16.475±0.950mm (MgO) and 13.150±1.392mm (Fe2O3). MgO stood first to contribute lowest Minimum inhibitory concentration (MIC) (1.302±0.564 mg/mL) follo...

Ni Putu Sarini1*, I Gde Suranjaya1, I Gusti Agung Arta Putra1, I Wayan Suarna1, Lindawati Doloksaribu1, I Ketut Puja2, I Ketut Gde Natakesuma3, I Gusti Ngurah Bagus Rai Mulyawan4 

...s were extracted using a commercial kit and the MC1R gene was then amplified by using a forward primer 5’ AGT TGA GCA GGA CCC TGA GA 3’, and a reverse primer 5’ CCA GTC ACC ACA GAG CGT TA 3’. The PCR products were further sequenced and analyzed to see variations of the MC1R gene of all cattle. The results indicated that the sequence of MC1R gene in the 10 Bali cattle has a nucleotide variation of 0.31% generated from Bos taurus and 0.2...

Satya Fahriani1, Hadri Latif2*, Herwin Pisestyani2, Zhang Shuqi3, Suyanto Chen3

...minimum F0 value of 2.8, commercial sterilization with retort method. Indonesia’s government does not have data on the effect of retorts on the safety and quality of EBN. This study aimed to examine the nitrite level and rehydration capacity of EBN after undergoing a retort process. The samples were 24 raw uncleaned white EBN from 4 swiftlet farmhouses (SFHs) collected using purposive sampling. Two SFH from Sanggau District, West Kalimantan Province, Ind...

Mohamed Mahrous Amer1*, Hanaa Sayed Fedawy2, Hoda Mohamed Mekky2, Khaled Mohamed Elbayoumi2, Ahmed Ali El-Shemy3, Mohamed Abd El-Rahman Bosila2

...-align: justify;">In the commercial broiler, cellulitis is considered one of the most economically prevalent problems due to the presence of the lesion leading to increased condemnations and carcass downgrading. Clinically cellulitis is a deep infection of broiler chicken skin caused by many bacterial species, mainly Escherichia coli (E. coli) and/ or Staphylococcus aureus (S. aureus), causing severe economic losses in poultry. This study was done on 14-day ol...

Muhammad Noman Khan* and Ghulam Nabi

... lime has acquired great commercial importance globally particularly in juice and medical industry. However, its poor yield discourage farmers from its cultivation. Plant nutrients particularly Potassium plays critical role in growth and yield of citrus crops. Therefore, for the possible solution the current study Potassium fertilizer source and timing regulate growth, flowering and yield in trees of sweet lime (Citrus limetta L.) was conducted during the year...

Peter Amuguni Mbato*, Wanzila Usyu Mutinda, Noah Kipkoech Maritim, Nicholas Edwin Odongo 

Sameh Abdel-Moez Ahmed Amer1*, Aly Mohammed Ghetas1, Asmaa Mahmoud Maatouq1, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1, Mohamed Abd El-Rahman Bosila1, Ahmed Ali El-Shemy2

...tes its efficacy against commercially available NDV genotype II vaccines in broiler chickens. Eighty chickens were housed in four groups (A, B, C and D) of 20 birds per group. Group A has been received the experimentally prepared inactivated genotype VII NDV vaccine by day 9 old, subsequently primed and boostered with commercial live attenuated genotype VII vaccine at 7 and 21 days-of age. While group B was treated with

Caiyun Li1, Tao Xu2, Luyang Zhang3, Xuesong Yan4, Yu Xin5, Li Li6 and Jinghua Chen7*

...s one of the special and commercial cultured fish in Shandong province, China, snakeheads play critical role in promoting the economic development of fisheries. However, the sustainable development of snakehead culture industry has been seriously impeded cause the forage fish as main sources of baits. This study reviewed the current situation of snakehead culture in Shandong, compared the advantages and disadvantages of feeding forage fish and compound feed fo...

Amistu KU1,2*, Monahan FJ2, Wims P2, Yonatan KY1 , Fahey AG2, Takele TA3 

... area is to operate on a commercial basis. 

...

Zeyad Kamal Imari 

... Three hundred and sixty commercial broiler chickens were used in this study. The broiler chickens were randomly placed in 36 pens with 6 groups, each group contained 6 pens with 10 birds for each pen. Six experimental diets with different levels of calcium (Ca) were formulated to be as follows: 1.4% Ca, 1.2% Ca, 1% Ca, 0.8% Ca, 0.6% Ca and 0.4% Ca. The polynomial regression equations were used to estimate nutritional requirements of calcium. Results show the...

Razia Sultana1, Shinawar Waseem Ali1*, Ghulam Murtaza2 and Shahid Mahmood2

...tly, it is also prepared commercially by using bacteria in different combinations. In this study, we aimed to detect and identify bacteria present in locally processed yogurt using the advanced next-generation sequencing (NGS) method. Yogurt samples were collected from open-air shops located in different areas of Pakistan. All yogurt samples were mixed to make one composite sample. DNA was extracted from yogurt using the phenol-chloroform (organic) method. Ext...

Khadija Begum, Azizunnessa and Md Ahaduzzaman*

... Bangladesh, goats are a commercially important animal that is raised both in urban and rural areas. Although goat farming is profitable, reproductive issues have been identified as a significant factor in the declining profitability of goat farming. The study aimed to investigate the prevalence of reproductive problems in does and how they are currently treated. Relevant data on different gynecological cases in does were collected from the record sheets of a ...
Jaffar Hussain*, Zeenat M. Ali and Syed Farman Ali Shah
...ion was not available on commercial scale. The biodiesel produced by esterification (one step) and Transesterification process (two step). The catalysts used were homogenous, heterogenous and enzymatic. The homogenous were alkaline and acidic. The alkaline catalyst undergoes saponification reaction when free fatty acid concentration was high. The acidic catalyst preparation was expensive and complicate exhibited slow rate of reaction. The biodiesel used in ble...

ZULNAIRAH REHMAN1*, AZMATULLAH KHAN2, ABDUL WAJID3 & AYESHA MAQBOOL4

...ples were
of commercial eggs, eighty were of non-commercial eggs and eighty were
of egg storing tray samples collected from local markets and house farms
of District Mianwali. The selective media used for the Salmonella was
hektoen enteric agar. The incidence of Salmonella in egg shells of
commercial eggs and non-

Aamir Ali, Hafiz Muhammad Tahir*, Azizullah, Shaukat Ali, Muhammad Farooq Bhatti, Muhammad Summer and Ali Haidar Gormani

... the pharmacological and commercial industries.
 
Novelty Statement | The mulberry leaves possess various therapeutic potentials. In this study, we have summarized all the therapeutic potentials of different mulberry leaves extracts. Moreover, the important phytochemicals of mulberry leaves and their biological activities are also discussed in details.
...

Retno Setyaningsih1, Sri Murtini2*, I Wayan Teguh Wibawan2, Surachmi Setiyaningsih2, Ekowati Handharyani3

...DV. Samples assayed with commercial ELISA Kit using DAS Technique. The informations (age, sex, breed) of antibody titers against RHDV from previous study is used for samples profiling. The results showed all samples negative for RHDV antigen with average value ±0.04 (positive cut off >0.334). Seroconversion of RHDV from all seven villages where most seroconversion are showed by samples from young rabbits compare to adult rabbits, female rabbits compa...

Nurul Isnaini*, Dedes Amertaningtyas, Hanief Eko Sulistyo, Aulia Puspita Anugra Yekti, Faizal Andri

...ed poultry waste 75% and commercially laying hens feed (starter); T2: mixed up-fermented dried poultry waste 50% and 50% commercially laying hens feed (starter); T3: mixed up-fermented dried poultry waste 25% and 75% commercially laying hens feed (starter); T4: 100% and commercially laying hens feed (starter). A statistical analysis was conducted using a...

Afshan1, Asad Ullah2*, Imad Khan2, Rafiq Ullah1, Tahira Tayyab1, Fatima Syed3, Raheela Taj3, Shumaila Gul4, Faiza Khan5, Ibad Ullah Jan6, Syed Weqas Ali7 and Assad Ullah8 

...th starter and finishing commercial corn based basal diet with different concentration of selenium powder. Basal diet (BD) was fed to Group A, which kept as negative control group and no dexamethasone (DE) was offered. Group B was considered as (+ve control group) fed with (BD+15mg DE/kg). The group C, was fed with (BD+0.2mg Se + 15mg DE/kg). Similarly, group D was fed with (BD+0.3mg Se+15mg DE). Group E, fed with (BD+0.4 Se+15mg/kg feed). At the end of the tr...

Waqas Ahmad*, Muhammad Naeem

...es. Here we identified a commercially important fish Notopterus notopterus and analysed its genetic diversity. For the purpose of identification 15 specimens of N. notopterus were collected from Satluj, Ravi, Indus, Jehlum and Chenab rivers of Pakistan and barcoded with mitochondrial COI gene. BLAST analysis confirmed 100% identity of Notopterus notopterus with reference sequences belonging to NCBI GenBank database. Genetic diversity was analysed by using PCR ...
Waheed Ahmad1, Muhammad Tayyab1*, Bushra Muneer2*, Abu Saeed Hashmi1, Mansurud Din Ahmad3, Shagufta Saeed1, Muhammad Nauman Aftab2, Sehrish Firyal1, Muhammad Wasim1, Muhammad Azam4, Muhammad Talha5 and Ali Raza Awan1
...as supplemented with the commercially available neutral protease (5000 IU/kg) that served as a positive control. The trial lasted for five weeks and during the trial period birds were offered ad libitum access to water and feed. The maximal weight gain was recorded when the feed was supplemented with 7500 IU/Kg of locally characterized protease. The evaluation of data of various groups obtained after 3rd, 4th and 5th weeks of trial demonstrated significant cha...

Mukkram Ali Tahir1, Noor-us-Sabah1*, Muhammad Waryam Warraich1, Ghulam Sarwar1, Muhammad Aftab2, Fakhar Mujeeb3, Muhammad Zeeshan Maznoor1, Aneela Riaz4 and Sarfraz Hussain2

...ss mud @ 1 %) along with commercial K fertilizer (SOP) performed superior by resulting in maximum K content in shoot (2.13 %), K content in root (1.12 %) and K content in soil (330 ppm). Similarly, highest fresh weight (42.43 g) and dry biomass (14.37 g) of wheat were also observed when SOP was used in combination with press mud as CSF. Press mud found to be most effective CSF compared to compost and fly ash. 

...

Saboor Naeem and Amjad Usman*

... For this purpose, seven commercially available brinjal genotypes viz. Nutech Seeds, Durga Seeds, F1 Hybrid Brinjal, Brinjal Malni, Bharat Kaveri F1, Advanta 303 and Black long were tested for resistance/ susceptibility against L. orbonalis in spring and autumn brinjal crop under natural field conditions during 2020, Experiment was carried out under randomized complete block design with three replications. Results revealed that none of the tested genotype was ...

Muhammad Afzal1, Muhammad Ashraf Sumrah2*, Azhar Hussain2, Zoma Saleem2, Syed Hamza Mehfooz2 and Javeria Sherani3

...dardization of promising commercial variety of avocado for cultivation in Punjab. Avocado varieties Murree Gola and Ceylon blue were tested in different locations for their performance. Data was collected for both varieties which shown that Murree Gola flowering is 8-10 days earlier than that of Ceylon blue, while ripening is 6-12 days later in Murree Gola as compared with Ceylon blue. Flowering duration remained 15 days in Murree Gola and 13 days in Ceylon bl...

Nguyen Huu Van1*, Nguyen Thi Mui1, Dinh Van Dung1, Van Ngoc Phong1, Tran Ngoc Long1, Le Tran Hoan1, Le Duc Thao1, Vo Thi Minh Tam1, Ngo Mau Dung1, Bui Van Loi1, Nguyen Xuan Ba1, Ton Nu Minh Thi2, Nishino Naoki2

...sing different levels of commercial concentrate in the diet on nutrient digestibility, rumen volatile fatty acid (VFA) profile, growth and carcass performance of Phan Rang sheep raised in Ninh Thuan province, Vietnam. Twenty-five intact male Phan Rang sheep averaging body weight of 15.4 ± 1.3 (SD) kg/animal were randomly assigned to five groups with different levels of concentrate, including: control (C) (ad libitum access to grass feeding); 0.75% (cont...

Khalid Alhudaib

... was performed using the commercially available for PNRSV. Result showed that 30 (11 Apricot and 19 Peach) out of 166 leaf samples were infected with PNRSV. Total RNA, from the same samples used in ELISA test, was extracted in accordance with its instructions to confirm ELISA results. RT-PCR was performed using PDV, PNRSV and PPV specific primers. RT-PCR resulted in the amplification of a 346 bp fragment as expected and negative result with PPV and PDV. The ob...
Hassanein, Suzan A.; Abd El-Wahab, Wafaa; Eweis, Moustafa and Mahmoud, Mervat M.
...tructural proteins using commercial ELISA kit (Priocheck). The overall percentage of positive was 38.9 %. The higher percentage of positive detected in Behaira (48%), then Mounofya (45.3%) while Kafer El-sheikh was the lowest (23.7%). The positive results of detection of antibodies against non structured proteins of FMDV indicate that these samples come from natural infected animals.

...

Raof*, Amal M. A.; Haleem*, Iman Y.; Aly*, Nawal M.; * *Garhy, M.M. and Hosny***, Gehan A.

...e to FMDV NSP 3ABC using commercial ELISA kit (Prio-check) for l065 serum samples were collected (735) from Sharkia and (330) from Kafr ElSheikh Governorates during 2009 from cattle and buffaloes. The higher percentage of positive was detected in Sharkia (31.7%) while Kafr Elsheikh was (27.3%). The positive result of detection of antibodies against non structured proteins of FMDV indicates that these samples come from natural infected animals. The further work...

Omarl , Dalia M.; El-Ibiaryl , Elham A.; Sadik2, Atef S.; Abdel-Ghaffar2, Mamdouh. H. and Othman2, Badawy A.

...(HPAI) H5Nl affected the commercial poultry production sector and backyards in Egypt and resulted dramatic economic losses to the poultry industry of Egypt and continue to pose a serious threat to public health. The present study was designed for detection and isolation of Avian Influenza Viruses (AIV) circulating among poultry since their first detection in 2006. Tracheal and cloacal swabs were taken from the freshly dead birds. Till now (2010) the tested swa...

El-Bramawyl , M . A. S. A. and El-Beshehy2, E. K. F.'

...encial for direct use in commercial faba bean breeding or for transfer to other faba bean genotypes.

...

Abo Elmagd l , Enas K.; Abdel-Wahab l , Kouka S.; Alrasheedy l , Zeinab E. and Khalifa2, Ahmed S.

Arafa, A ; El-Kanawaty, Z; Hassan, M.K; Anwar, H.K  and  Mona M.Aly 
 
...ubtype H5N1 affected all commercial poultry sectors as well as rural and backyard level in Egypt. This outbreak also was extended to include the zoo birds In Giza zoo. This study records the isolation and characterization of H5Nl virus from different species of the zoo birds and also studies the immune states of the vaccinated birds after application of H5Nl vaccine for the first time one month after the introduction of early outbreaks of 2006. Viral diagnosis...

Hussein, HA; sultan, HA. Al Deeb AH and AA. El-Sanousi

...ome broiler breeders and commercial layers from the period Of December 2006 to February 2008 and tested for the immune response to the multiple vaccination with different H5Nl and H5N2 avian influenza vaccines (Reassortant H5N1 and 6 types of H5N2 vaccines) by hemaggtutination inhibition (HI) test using heterologous H5 antigen which represent non of the vaccine antigens. The samples were collected from 578 houses mostly commercial

Arafa, A.; Kanawaty, Z.; Abdclwhab. E. M.; Hassan, M.K.; and Aly M.M.

...fluenza much easier than commercial poultry farms. Avian Influenza subtype H7 was isolated from wild migratory ducks in El-Abassa Lake at El-Sharkia Governorate in 2007. To avoid repeating the scenario of H5N1 introduction to Egypt through wild migratory ducks to Egyptian poultry sectors, this prompted us to survey avian influenza in Egyptian wetlands, especially El-Abassa Lake and neighboring areas. Eleven villages around the lake were included in the surveil...

M.A. Farag*, Abeer, E. Mansour* and s.M. 

...ges of 66%. Sheep fed on commercial ration treated with 40gykgm ration of prepared AFB and challenged at three weeks post vaccination showed protection percentage of 33%, decrease in antibody titers and low values of AOD. The immunosuppressive effects of BVDV and AFBI on the immune response of sheep vaccinated with bivalent FMD vaccine were discussed.

...

A. A. Kheder1; I. A. M. Ibrahim2; H. M. Mazyadl

... from naturally infected commercial peach trees growing under field conditions at El Dakahlia Governorate, using DAS-ELISA. The detected virus is recorded for the first time in Egypt. Virus identification was performed using symptom expression. host range. graft transmission. serological tests i.e., DAS-ELISA, TBIA and DBIA, physical properties, electron microscope (EM) and reverse transcription Polymerase Chain Reaction (RT-PCR). Field survey was carried out ...

A.A.Farrag;  I.A.M. Ibrahim and, H.M. Mazyad

...n different locations on commercial peach orchards. Percentages of infection were 6.3, 6.7, 12.3 and 10.9 in Menofia (Khatatba) . EL-Behira (EL-Nobaria North Sinai (Rafah) and Dakahlia (Metghamr), respectively. ACLSV was transmitted mechanically from peach trees those showing less vigorous and some abnormalities on growth without leaf symptoms to different herbaceous hosts including Chenopodium quinoa wild, Ch. amaranticolor (Cost&Reyyn) and Phaseolus vulg...

Seham A. El-Zeedy1, Dalia A. Abd El-Moaty1, H. A. Hussein2 and M. A. Shalaby2

...ctious bursal disease in commercial chicken flocks worldwide are due to the spread of very virulent IBDV. Two Egyptian isolates Of IBDV isolated from Giza (Giza/2000) and Qalyubia (Kal/2001) governorates were characterized by RT/PCR-RFLP assay of a 643 bp hyper variable region Of VP2 gene using BstNI, MboI, and SspI restriction enzymes. The presence of Sspl site in Giza/2000 identified it as vvIBDV while the absence of this site in Kal/2001 beside the obtained...

H.A. SULTANl, H.A. HUSSEIN2, and F.F. EL-KHAYAT3

...5 % (average 17.75 %) in commercial broilers. commercial layer replacement pullets and native Baladi varieties, respectively. On the other hand. 30% (9/30) of these outbreaks occurred at 18-21 days of age and the mortality rates ranged between 1.4-4.9% (average 3.15%) in commercial broilers and native Baladi varieties. IBDV was detected in 100% of the tested bursal homogenates from acutely...

Musaad A. Al-Dubaib

...on was carried out using commercial diagnostic reagents. All samples of herds having positive cases with immunodiffusion were tested by ELISA. Positive cases were recorded among samples of the Holstein cattle with both serological tests. Prevalence rates differed from one farm to another and with both serological tests. With agar gel immunodiffusion, the prevalence rate in 3 farms were 43.13%, 21.79% and 6.25%. The prevalence rates with ELISA in the same herds...

Skeikh Mustafizur Rahman1*, Mst. Shirin Sharmin Khan1, Yousef Ahmed Alkhamis2,3, Roshmon Thomas Mathew2, Md. Moshiur Rahman1, Mohammed Monirul Islam4, Md. Asadujjaman5 and Md. Golam Sarower1

...e and ash) of eleven non-commercial marine fish species namely Johnius argentatus, Harpodon nehereus, Cynoglossus lingua, Johnius elongatus, Sillaginopsis panijus, Pomadasys hasta, Setipinna phasa, Megalaspis cordyla, Rita rita, Gonialosa manmina and Scatophagus argus obtained from the Bay of Bengal. The samples were collected from raw fish (as a whole), different body parts (head, middle and tail) and processed fish (boiled and dried). This study further comp...

Wisnu Jaka Dewa1,2, Ekowati Handharyani3*, Sri Purwaningsih4, Silmi Mariya5 

... from WiDr cells using a commercial kit. The mRNA concentration was then measured with a UV-Vis microvolume spectrophotometer at 260/28 nm. Relative expression of bax and bcl-2 to house keeping gene GAPDH was measured on a real time PCR machine. Relative gene expression was calculated using the ΔΔCt method. The result showed that bax gene expression increases 4.36, 4.77 and 4.63 times in 125, 62.5 and 31.25 ppm concentration, respectively. The expr...

Pedro Nunes1*, José Teixeira1,2, José Luís Mourão1,2,3, Divanildo Monteiro1,2,3, Victor Pinheiro1,2,3

...ed Olive Cake (EOC) into commercial rabbit diets on zootechnical performance, carcass characteristics, and visceral development. To achieve this, a total of 60 hybrid rabbits (New Zealand x Californian) were employed. Three distinct diets were formulated, progressively substituting alfalfa with EOC at levels of 0%, 5%, and 10%. Zootechnical performance was monitored by recording weekly feed consumption and growth performance. Visceral development and carcass t...

Muhammad Yasin1, Azhar Abbas Khan2*, Sana Rubab2 and Sumaira Maqsood3

...les) in combination with commercial diatomaceous earth (DE) formulation Inert-PMS alone and in integrate manners against these pests. Beauveria bassiana was applied at 1×106 and 1×107 conidia/ml alone, or in combination with DE at 50 and100 ppm. Adult insects were exposed to the treated wheat for 5, 10 and 15 days at 27±2 ºC and 65±5% r.h. in an incubator. The mortality of Tribolium castaneum adults was 100% even after 10 days of...

Joseph Oyiguh Abraham1, Cornelius Arome Omatola1*, Martin-Luther Oseni Okolo1, Ruth Foluke Aminu1, Emmanuel Edegbo1, Olubunmi Marvelous Emurotu1, Danjuma Muhammed2, Jesse Joseph Chock3, Helen Ojomachenwu Ocean4 and Yahaya Ocholi5

...and HIV antibodies using commercial immunoassay test kits. Relevant demographic information was obtained from each participant with a structured questionnaire. Of the 1000 participants, HBV, HCV, and HIV were detected in 28 (2.8%), 2 (0.2%) and 3 (0.3%), respectively. However, no participant was simultaneously infected with any two or three viruses. The age group 21-40 years demonstrated greater exposure to HBV (7.57%), HCV (0.37%), and HIV (1.17%) infection t...

Muhammad Nadeem1, Muhammad Naveed2,3*, Muhammad Shafiq2, Irfan Rasool2 and Muhammad Afzal Zahid2

...rop variety grown on the commercial scale and under different conditions becomes vulnerable to various kinds of issues involving both biotic and abiotic plant stresses, alone or in combinations. This demands their substitution with new and improved genotypes possessing higher productivity and inherent resistance/tolerance against yield-limiting stresses. In this context, this editorial reports the development of a new chickpea kabuli variety “Noor-2019&r...

Eman Said El-Hadad*, Hesham Ahmed Madian, Mahmoud A.E. Hassan, Mohamed Fahmy Saad, Abdelghany M. El-Shhat, Entesar Zakaria Eliraqy

... and fed ad libitum on a commercial mash diet (15.2% CP and ME of 2690 Kcal/kg). The control group (G1) was fed on a basal diet, while G2 and G3 were fed the basal diet with 0.2 and 0.4 g AR/kg, respectively. At the end of an experimental period of three months, five ganders were slaughtered for blood collection and histological study. Hematological and plasma biochemical parameters, liver and kidney function, and antioxidant markers were determined. Results s...

Irfan Ullah1, Asad Ullah2*, Tahira Tayyeb1, Rafiq Ullah1, Muhammad Hanif1, Faiza Khan3, Imad Khan2, Raheela Taj4, Fatima Syed4, Shumaila Gul5, Muhammad Sadeeq6, Muneeb Islam7, Arsalan Khan8 and Khudija Ghani9

... chicks were bought from commercial hatchery and randomly divided into five groups with eight replicas(n=5) in each group. Broiler chickens were fed with starter and finishing commercial corn based basal diet (BD) with different doses of inorganic Selenium (Se) powder. Group-A was kept negative control provided with BD twice a day. Group-B was positive control group fed with 15mg DEX/kg twice/day. The Group-C was fed with BD...

Moazama Batool1*, Saima Naz2*, Ghulam Abbas3, Ahmad Manan Mustafa Chatha4, Mamoona Mahmood1, Asma Aziz1 and Fatima Yasmin2

Shirina Akter Toma1, Shah Ahmed Belal2, Md Abdul Baset3, Md Nazim Uddin3*

...high, and breast meat of commercially spent hens and broilers. The commercial spent hens (n=30) and broilers (n=30) were slaughtered at market age (306 days spent hen and 28 days broiler). The thigh, drumstick, breast, and wing muscles from both sides of the carcasses were separated. The right thigh, drumstick, breast, and wing meat was vacuumed pack and kept at 4°C until it was examined for cooking loss, drip loss, pH, ...

Zaryab Murad1*, Sobia Bibi1, Shehr e Yar Ahmad1, Mohsin Ali Khan1, Rimsha Sadaf2, Mauz ul Haq1, Umair Manan1 and Muhammad Younas2

... from industries and the commercial sector caused serious health issues. Continuous irrigation with contaminated water caused several health problems as rice (Oryza sativa L.) had the potential that can adsorb a greater amount of Cd. The use of metals polluted rice as a staple food now becomes the main way for exposing human health to metals, thereby the amendment of biochar gained greater attention to sorb and control the uptake of heavy metals by rice. A pot...

AAMIR MAHMOOD1, ZAHOOR AHMAD SAJID* & SHEZA AYAZ KHILJI2

... and 1mM) treatment. The commercially available cultivar (cv. Faisal) of maize was planted in earthen pots for 15 days. After fifteen days of growth, seedlings were irrigated with saline water (120 mM NaCl) and SA was applied for 60 days simultaneously. To observe the germination, seed were also primed with same concentrations in petri dishes. After 60 days on final treatment harvesting was carried out, leaf samples were taken for analyzing biochemical attribu...
MAIMOONA KANWAL, MUBASHAR HUSSAIN*, ZAHEER ABBAS1, SHAKIL AHMAD KHAN2, FATIMA
ZAFAR & RIZWANKHURSHEED2
...g is being practiced for commercial purpose in different parts of Pakistan by rural masses as a cottage industry. Silk seed improvement through importation is one of the key initiative towards popularising and ameliorating silk production in Pakistan. The performance of Bulgarian race of silkworm reared on local mulberry supplemented with vitamins(Band C) in addition to amino acids (Alanine and Glycine) was evaluated at24 - 28 ○C and 70±...

Aziz Ahmed1*, Anila Naz Soomro2, Muhammad Ramzan Ali1, Muhammad Aleem Khan1 and Hasina Basharat1

...y-prepared media and one commercially available media i.e., ACTi fish while control is freshwater on sperm quality parameters i.e., percent motility, motility interval, sustainability, and fertilization rates in Nile tilapia (Oreochromis niloticus). The experimental design was CRD with four treatments and three replicates. Lab prepared (Activation media A and B), one commercially available (Activation media C) and freshwater...

Nurcholis1*, Syetiel M. Salamony1, Abdullah Baharun2

...lities as Andromed ® commercial diluent. The ability to maintain cell membrane integrity is indicated by the RR value reaching 77.99%. In conclusion, Supplementation of myrmecodia extract in 2 mL of egg yolk Tris diluent affected sperm protection during the equilibration and cryopreservation processes, following Indonesian National Standard 4869-1:2021 frozen bovine semen. 
 
Keywords | Cryopreservation, Myrmecodia extract...

Dilruba Akter Mir1, Md. Sahidul Islam¹*, Mosammat Mahamuda Khatun1, Sharmin Zaman1, Bidyut Matubber², Nazmin Sultana Runa3, Zannatul Ferdous3, Tithe Saha3, Md. Anwar Jahid4  

...e control strategies for commercial chickens.  

...

Dilruba Akter Mir1, Md. Sahidul Islam¹*, Mosammat Mahamuda Khatun1, Sharmin Zaman1, Bidyut Matubber², Nazmin Sultana Runa3, Zannatul Ferdous3, Tithe Saha3, Md. Anwar Jahid4  

...e control strategies for commercial chickens.  

...

Muhammad Usman1, Majid S. Hashmi1, Ayaz Ahmad1*, Fawad Ahmad2 and Zahid Alam1

...istics of the drink. For commercialization of the product large scale evaluation should be done to validate these findings in addition to microbial analysis. 

...

Umair Ahmad1*, Asad Sultan1, Sarzamin Khan1 and Muhammad Tahir2

...N, GPP1, and GPP2. CON a commercial corn-soybean meal-based diet as per ROSS-308 nutritional specifications. N-CON was a 6.5% PBM-based diet and to this group, a ginger-derived phyto-protease was added at two levels in treatments GPP1 (50 mg kg-1 feed) and GPP2 (100 mg kg-1 feed), respectively. Birds in group N-CON performed poorly for the performance traits like feed intake, weight gain and FCR. Phyto-protease addition at 100mg kg-1 feed exhibited significant...

Saadatin Nurul Jannah1, Edhy Sudjarwo1, Osfar Sjofjan2*

...used was 189 one-day-old commercial broiler chickens (unsexing). This study consisted of 9 treatments and 3 tests. The treatment used was T0(-): basal diet, T0(+): basal diet + antibiotic (zinc bacitracin 0.10%), T1: basal diet + 0.50 % garlic peel, T2: basal diet + 0.50 % shallot peel, T3: basal diet + 0.50 % onion peel, T4: basal diet + 0.25 % garlic peel and 0.25% shallot peel, T5: basal diet + 0.25 % garlic peel + 0,25% onion peel, T6: basal diet + 0.25% s...
Abdel Satar Arafa
...accination programme for commercial poultry to control the infection. The isolated viruses from poultry in Africa have been classified as G1 ‘Western’ Viruses and related to the circulating viruses in the Middle East. In addition to Y439 lineage recorded in South Africa farmed ostriches. The infection with H9N2 is frequently displaying moderate-to-high morbidity and mortality in the field especially when comes associated with bacterial or viral inf...
Luis Fernando Díaz-Toral1, Carlos Eddy Alvarado-Zamora1, Ernesto Gonzalo Cañarte-Bermúdez2*, José Bernardo Navarrete-Cedeño2, Gilmar Jesús Cañarte-Cañarte1 and Fernando David Sánchez-Mora1* 
...GR), in the Coker cotton commercial variety. This field trial was carried out during February-August 2020 in La Teodomira experimental farm of the National Institute of Agricultural Research (INIAP, Lodana, Manabí, Ecuador), with three periods of application and four doses of growth regulator in addition to control (without regulator). A randomized complete block design in additive factorial arrangement was used, with four repetitions. The variables, su...

Muhmmad Asif1, Khunsa Khakwani1, Muhammad Hasnain1*, Farrukh Ilahi1, Muhammad Hussnain Babar1, Shahid Munir Chuhan1, Jehanzeb Farooq1, Hafiz Ghazanfar Abbas1, Iqra Parveen1, Ghulam Sarwar2, Saeed Ahmad2 and Hammad Hussnain2

...ded as the most suitable commercial cotton cultivars for agro-climatic conditions of Faisalabad.

...

Akbar Khan Khajjak1,4*, Adnan Nazir2, Tehmina Mangan1 and Ali Raza1

...at farms were 87 percent commercially efficient, which indicates a great potential to enhance efficiency in the resources used in the productivity of wheat. It is evident that efficient usage of resources could add Rs.594.77 ($4.10) million of revenue each year to the economy. The research is based on and derived from wheat production, which is only for a single crop among various other crops. These findings would be quite useful in developing a precise policy...

Kiran Rani1*, R. Aliya1, Barkat Ali Solangi2, M. Kashif Pervez2, Nasrullah Akhtar3 and Farman Ahmed4*

...s and were compared with commercial antibacterial and antifungal drugs. It was found at the optimized dyeing condition has 1 percent formic acid as fixing agent with 120 min dyeing period. At this condition, the dye molecule shows 70 percent exhaustion and 59 percent fixation along with acceptable fastness and antimicrobial activities Furthermore, the dyed fabric shows effective inhibition against all tested organisms. Fabric samples showed greater antimicrobi...

Shazia Shafique1, Sobiya Shafique1 and Sonia Sahar1

... causal agent lower than commercial thresh hold level. Biological control provides safe fungal management program. Presently, the research was under taken to ascertain the antitoxic effect of Thymus serpyllum against eggplant leaf spot pathogens i.e., Exserohilum rostratum, Cladosporium cladosporioides and Curvularia clavata. For this, 10 concentrations of methanolic extract of plant (0.5% to 5%) were employed against the pathogens. Data analysis depicted that...

Wali Muhammad Mangrio1*, Faheem Ahmed Jatoi1, Hakim Ali Sahito1, Fahmeeda Imdad Sahito2, Bhugro Mal3 and Naseem Qureshi4

...gies with combination of commercial botanical pesticides. As an alternative and minimize the toxic chemical pesticides, because botanical insecticides are sustainable control mechanisms that show the potential to earn profitable yield.

...

Quart ul Ain1, Arfan Ahmad1*, Aftab Ahmad Anjum1 and Mamoona Chaudhry2

... comparative efficacy of commercial and self-prepared AIV H9 vaccines for their potential to stop or reduce viral shedding post challenge infection (PCI) and to develop humoral immunity. A total of 5 groups A, B, C, D and E comprising of 20 broiler birds each were made. Groups A, B and C were vaccinated on 6th day of age with imported (Ivac), local (Lvac) and self-prepared (Spvac) vaccines, respectively. Group D (virus challenged) and E (non- vaccinated/non-ch...

Asad Sultan1, Ziaul Islam2*, Faiza Shahzadi3, Sarzamin Khan1, Rafiullah Khan1 and Ihsan Ali4

..., and welfare indices of commercial broilers. A total of 320 one-day-old Cobb 500 chicks were divided into four treatment groups (80 chicks/group). The first control group (G1) was fed with the basal diet without supplementation of Y. schidigera extract. The second, third and fourth groups (G2, G3, and G4) were fed with Y. schidigera extract supplementation rate of 5, 10, and 15ml/200L to drinking water, respectively. The chicks that received Y. schidigera dem...
Manahil Wahab1 and Anwar Ali2
...ncient times, the modern commercial farm forestry has been started in the last three decades. Driving forces for adoption of farm forestry include inspiration from other farmers, self-initiatives and quick economic return. Majority of the respondents (72%) have planted trees for commercial purpose. The average number of trees per acre is 100. There has been a considerable increase in the number of trees on farmlands since 19...
Tanvir Hussain1, G. M. Nasir2, and Ayaz Marwat3
...Timbers. Wood samples of commercial/ non-commercial timbers were collected from different climate areas of Khyber Pakhtunkhwa. Basic anatomical data with three Dimensional images (3D) were loaded into the developed software program. Each species was properly given; Scientific name, possible local names, catalogue number, nature of wood (soft/hard), region, Identification features and its distribution. The developed software ...
Mohsen Dehghani
...y valued for developinga commercial products and fishery resources and also as sites burgeoning eco-tourism. Yet despite their ecological and economic importance, the rate and magnitude of mangrove conversion is relatively unknown. These forests can be considered as exceptional wetland ecosystems in southern coastal of Iran which are highly fertile and in terms of biodiversity are among the most important resources. Hara Protected Area with various socio-econo...
Alam Zeb, Fawad Habib, Sajid and Tilawat Khan
...lviculture of poplar and commercialistic nature of respondents. The Net Incomes (NIs) calculated per Avenue Kilometer of poplar plantation were (Rs.301838), (246622) and (Rs.164890) for Owners, Owner cum Tenants and Tenants respectively. Similarly their calculated Net Present Values (NPVs) at interest rate of 12% were Rs.171499, Rs.140127 and Rs.93688 in the above shown order of tenurial classes. Benefit Cost Ratios (BCRs) were 3.5 for Owners, 3.1 for Owner cu...
Rukhsana Kausar1, Mamoona Wali Muhammad2 and Mian Muhammad Shafiq3
... remove forests and make commercial areas and housing societies. To prevent land use conflict and to convince planners and policy makers it is important to evaluate non-tangible benefits (Ecotourism) of forests. Ecotourism is the travel to enjoy the world's amazing diversity of natural life and human culture without causing damage to either (Naeem et al., 2014). It is important to aware communities and public at large about conservation of natural r...
Muhammad Shabir Mughal and Muhammad Muslim
...or planting trees having commercial and medicinal value like Emblica officinalis (Amla), Moringa oilefera (Sohanjna), Acacia catechu (Katha, Khair) Terminalia belerica (Bhera) and Sapandis mukrossii (Retha) etc to augment income of inhabitants as well as conservation of genetic diversity for future prosperity. Jandi-Chontra to Baghsar locality of Tehsil Samani rich in herbal drugs and the main forest crop of this area was Chi...
Fariha Iqbal, Nowsherwan Zarif and Tariq Mahmood
... resources.

...
GPS Dhillon, Avtar Singh and DS Sidhu
...the potential clones for commercial cultivation.

Key words: poplar, heritability, genetic advance, clonal variation

...
Syed Said Badshah Bukhari, Ghulam Ali Bajwa and Miskeen Ali
... as potential breeds for commercial rearing.

Key words: Mulberry silkworm, hybrid vigour, heterosis, multiple evaluation index, sub-ordinate function

...
G. M. Nasir and Noreen Fatima
...Anatomical properties of commercially less important timbers grown in Punjab were studied to assess their technological properties and predict better utilization other than the traditional uses. Permanent slides of cross, radial and tangential sections of each species were prepared by standard laboratory techniques and observed under the microscope for various structural features. Data were collected for the frequency and dimensional measurements of different ...
Iqbal Mahmood
...when compared with other commercial hardwoods and is recommended for a number of uses. ...
Ghulam Mustafa Nasir, Noreen Fatima and Kanwar Muhammad Suleman
...decrease the pressure on commercial timbers grown and utilized in the country, some non-commercial timbers grown in NWFP such as Ber (Zizyphus mauritiana), Bakain (Melia azedarach), White Bakain (Ailanthus altissima), Phulai (Acacia modesta), Amaltas (Cassia fistula), Paper Mulberry (Broussonetia papyrifera), Ghaz (Tamarix aphylla), Chinar (Platanus orientalis) and Ipil...
Muhammad Afzal, Aqeela Mobeen Akhter and Masood Amjad
...tic Acid (NAA) and other commercial rooting hormone (powder form) with different concentrations and combinations. It has been researched out that true to type Shisham tube plants can be produced vegetatively through the application of rooting hormones, which are fit for field planting with in a period of 4 months. NAA with a concentration of 100 mg/l among the other rooting hormones proved to be more economical for production of these true to type tube plants....
Mohammad Athar and Syed Mahmood Nasir
...ng all of the state's commercial olive growing areas. Olive fruit fly was trapped from 19 tree species belonging to nine genera distributed in seven families of angiosperms. Olives (Family Oleaceae) were the preferred host of the olive fruit fly. Family Rosaceae has nine tree species followed by Rutaceae (five tree species) as host of olive fruit fly. Other host tree species were distributed in Anacardiaceae, Fabaceae, Lythraceae and Malpigiaceae. Mostly th...
Altaf Hussain and Raja Muhammad Zarif
...long been introduced for commercial forestry, agroforestry, erosion control and landscaping. Pakistan has a long history of introduction of foreign plant and animal species The main objective of introduction of exotic forest tree species was to fill the gap between supply and demand of timber, fuel-wood and fodder. Out of 700 alien species 2 forest tree species viz Broussonetia papyrifera, and Prosopis juliflora were recognized as high impact inv...
M. Saqib, Mushtaq Ahmad, Mir Ajab Khan and R. M. Zarif
...re found using efficient commercial fuels (LPG, Kerosine etc.) to meet their energy needs. The data show that the average household size in the study area is nearly 6 persons. The increase in household size results in increasing total fuel consumption....
Abdul Qayyum Khan, Bashir Ahmad Wani, Hakim Shah and S. Irfanullah
...nsumptive (household and commercial) and productive purposes (rural cottage industry, agriculture). Questionnaire, interview and Participatory Rural Appraisal (PRA) tools were used to carry out this survey. According to the survey results, firewood emerged as the largest source of energy used for cooking and heating. The consumption of firewood was 2.35 maunds/household/week. Annually each person consumes 1.13 tons of firewood for cooking and heating. Among th...
Zahid Rauf, G. M. Nasir and Sohaib Ahmed
...ed as substitute for the commercial wood species for manufacturing of various wood products....
Muhammad Tahir Laeeq
...high recognition for the commercial production of poplar wood. The search for fast growing tree species to meet the rapidly increasing demand for wood in the country lead to the introduction of exotic poplars in late fifties. The first introductions were from Italy followed by clones from U.S.A., Yugoslavia, Turkey, Netherlands. Australia, etc. Research work conducted over a period of 15 years indicated the suitability of some clones like Populus euramerica...
Mohammad Ayaz
...meet the traditional and commercial needs. In addition, artificial cultivation of Mushkbala, on one hand, will reduce burden on its natural survival and, on the other, provide employment opportunities to the local population....
Md. Serajuddoula, A. S. Khan, M. R. Islam and M. A. H. Shahjalal
...been carried out. Eleven commercially important mesophytic trees species were tried in two locations (Rangabali and Kukri-mukri). The data on survival, height and diameter was recorded and statistically analyzed. Out of eleven species jhaw (Casuarina equisetifolia), babla (Acacia nilotica) rain tree (Samania saman) payra (Pithecellobium dulce), sada koroi (Albizzia procera) and soan boloi (Hibiscus tilliaceus) showed p...
Bashir Ahmad
...nefits of investment in commercial forestry. Many farmers now grow forest tree with a commercial orientation. At the same time, however, forestry producers are affected by changes in the price received and paid and by technological and marketing developments. In order to enable farmers to achieve maximum economic benefit, knowledge about cost of production and returns from forest products is needed to make appropriate produ...
Hanif Gul and M. Ismail Chaudhry
...has been developed into commercial microbial insecticides. Many worker such as Smirnoff (1963), Sider, (1965), Mihalache et al. (1972), Podgwaite and Cambell (1972), Jaque (1972), Yendal et al. (1973) and Arru (1975) tried Bacilus thuringiensis in the form of Thuricide, Entobacterin, Dendrobacillus and Dipel against different forest defoliators with good results. Smirnoff et al. (1972) tried B. thuringiensis...
K. M. Siddiqui and Mohammad Amjad
... mainly depends upon non-commercial fuels to meet its domestic energy needs. They do not purchase any fuel from the market as fuelwood is a non-tradeable commodity in rural areas. The land owners obtain its supplies from their farmlands and other people collect it as a free good from the waste lands and public forests. But the situation in urban areas is altogether different. Here people purchase all fuels from the market to meet their domestic ener...
M. Iqbal Ahmad and K. E. Park Dr.
... produce a F1 hybrid for commercial fearing in Pakistan. 1,500 boxes of F1 hybrid disease free silkworm seed was produced in 1988 and 2,100 boxes in 1989, for the first time in the country for distribution amongst the farmer for rearing. During breeding and selection of the bi-voltine races sex limited mutants were also selected for further research....
K. M. Siddiqui
...niques for production of commercial silk seed, absence of adequate mulberry plantations, non-existence of local training facilities and constraints in processing and marketing of silk cocoons and raw silk. The prices of cocoons also fluctuate considerably from year to year, thus adversely affecting economic returns to the farmers....
K. M. Siddiqui M. Ayaz and A. Jah
...tution of wood fuel with commercial fuel to save the valuable forest wealth from misuse and destruction....
Mohammad Bashir Khan, Pazir Gul, Muhammad Farooq and F. W. Khan
... kin Baluchistan can be commercially exploited in order to save the amount of foreign exchange spend on the various products of the said plants....
S. M. Yasin, T. A. Qureshi and S. M. Raza
...ding strength of several commercial adhesives was determined through the shear strength of wood joints of Walnut (Juglans regia), Eucalytus camaldulensis and Juniper (Juniperus excelse) wood species. The durability of these adhesives was also estimated after conditioning the wood joints to 65%, 80% and 95% RH at 35°C. In addition the optimum pressing time for each adhesive was determined. Taking shear strength of walnut wood as a stand...
Anjum Amin
...iderable quantities for commercial exploitation but also it is imperative to initiate concerted efforts both by government and public to systematically establish cultivation of various medicinal plants....
K.M. Siddiqui, Jaleel Ahmad Khan and Iqbal Mahmood
...echanical properties of commercially available Chilgoza pine wood. These are compared with those of deodar wood. Testing of Chilghoza pine wood was done in accordance with the standard procedures. The wood properties of Chilghoza pine and deodar are comparable in air-dry condition. Some suggestions for proper utilization of Chilghoza pine wood are given....
M. Aliul Hassnain Fatime and S. Hasan Abbas
.... ...
Anwar Ahmad Khan and Shakeel Haider Zaidi
... and Southern Europe for commercial utility of its seed and essential oil which find a variety of uses in various industries. The fruits form an article of commerce and are extensively used by bakers and confectioners to flavour their products. Aniseed on distillation yield 2 to 3.5% essential oil, which contain 80 to 90% anethole, an important estrogenic agent used for the treatment of millennia. The bulk of oil is used in medicine, perfumery, soap an...
Bashir Hussain Shah, Hanif Gul and M. I. Chaudhry
...el and Bactospheine, the commercially available microbial insecticides based on Bacillus thuringiensis, have been tested against poplar defoliator (Ichthyura anastomosis Steph.) first in the laboratory then in the field. Both have shown their efficacy against the pest by giving complete mortality of larvae in 0.1% concentrations. The out-breaks of the defoliator can effectively be controlled without affecting the other biological control agents o...
Mussarrat N. Ali, Anwar Ahmad Khan and Shakeel Haider Zaidi
...el and Bactospheine, the commercially available microbial insecticides based on Bacillus thuringiensis, have been tested against poplar defoliator (Ichthyura anastomosis Steph.) First in the laboratory then in the field. Both have shown their efficacy against the pest by giving complete mortality of larvae in 0.1% concentration. The out-breaks of the defoliator can effectively be controlled without affecting the other biological control agents or...
Abdul Aziz Khan and M. Jamil Khan
... indigenous material for commercial production of vegetable tanned light and heavy-leather. Solids were prepared by extracting chir pine bark without any treatment as well as with 0.5%, 1.0%, and 2.0% sulphitation and thin drying the extract under reduced pressure. Pickled and deli med identical pieces of sheep and goat skins were tanned with pine and imported mimosa solids for comparative studies of light leather producing qualities under similar tanning co...
Ghaus Mohammad Khattak
...t Frontier Province, the commercially exploitable forests growing on moderately steep slopes have been managed under the uniform system. Till 1927 the forests were worked under the standard uniform system: rotation 100 years regeneration period 25 years, allotment of compartments to four periodic blocks, and calculation of the prescribed final annual yield by Cotta's formula. Since then, the Punjab shelterwood system has been adopted and the most common patter...
Mohammad Yasin and Qaim Hussain Shah
...od in the manufacture of commercial plywood. ...
Jalil Ahmad Khan and Pervaiz Akhtar
...n which determines their commercial exploitation for various purposes is the basic information about their technological properties. The lack of such information about the home grown species has always been a serious setback in their proper utilization. An investigation on the technical properties of Eucalyptus tereticornis was therefore undertaken in order to provide reliable data often required for determining its utility. The present study is just ...

Ahsan Abbas Abro1, Imrana Khushk1, Abdul Nabi Jatt2, Chaudhary Haider Ali3, Abdul Sattar Qureshi1*, Farah Naz Talpur4, Safia Bano1

...esel production from its commercialization prospects.  
 
Novelty Statement | Utilization of onsite produced lipase from locally isolated strain to produce biodiesel from waste cooking oil.
...

Muhammad Ramzan Ali1*, Hasina Basharat2, Aziz Ahmed1, Mubeen Fakhar1 and Aleem Khan1

...tween 35-40% CP. For the commercial production of African catfish 35% crude protein level in the feed was optimum.

...

Zahid Ali1,2, Muhsan Ali Kalhoro1*, Nazeer Ahmed1,3, Muhammad Shafi1, Faisal Saeed1 and Abdul Majeed1

... mainly pelagic fish and commercially important fishery resource from Pakistani waters. Study on population dynamics and stock appraisal is an important for the sustainable use of fishery resource. During current study the length-weight relationship, growth, mortality, and exploitation rate was estimated from Balochistan, Pakistan. The length frequency data (n=1635) and length-weight relationship (n=603) of fish was collected from three fish landing sites of B...

Ayoola Mathew Oluwaseyi1*, Aderemi Foluke Abimbola1, Alikwe Philip2 , Tumgbulu Samuel2, Eniufuoma Augustina2 

...ent diets consisted of a commercial starter and finisher feed with ECLM added at graded levels of 0,1,2,3, and 4g/100kg, T1 with 0g ECLM served as the control. Two hundred and twenty-five Arbor acre-day-old chicks were randomly assigned to the dietary treatments each replicated thrice for eight weeks. Results revealed that average body weight gain, average daily feed intake, and feed conversion ratio were significantly (p<0.05) affected by ECLM while spleen...

Walid Elmonir1*, Dalia Abdeltawab1, Hanem El-Sharkawy2 and Rasha N. Zahran3

...-typhoidal Salmonella in commercial and backyard egg production systems in Kafrelsheikh Governorate, Egypt. A total of 610 samples (200 egg shells, 200 egg contents, and 210 environmental samples) were collected from 10 commercial layers farms and 170 samples (50 egg shells, 50 egg contents, and 70 environmental samples) were collected from 10 backyard layers flocks. The overall prevalence of Salmonella was 4.1% for each pro...

Mati Ullah1*, Muhammad Rizwan2, Ali Raza3, Xianlin Zhao4, Yanling Sun4, Sarah Gul5, Muhammad Ihtesham Waheed6, Muhammad Nadeem Khan7, Alvina Gul8, Sami Ullah Jan9* and Chao Huang4*

...s for general as well as commercial applications. This study could also be used basis for similar studies.

...

Mahfuza Ferdous1, Sabuj Kanti Nath1 and Mustasim Famous2*

...he rest (21%) farms used commercial feed, 29% of farms were found using both commercial and hand-mixing feed. 71% of farmers were found to formulate ration on their own, whereas only 29% of farmers did ration formation by a technically skilled person. In for milk’s nutritive content, Total Solids content was higher at 12.46±0.51 in morning milk in the farms where commercial fe...

Maqsood Jan1, Muhammad Zubair Anjum1*, Zahir Muhammad1, Misbah Farooq1, Muhammad Qayash Khan2 and Shamim Akhter1

...o evaluate the effect of commercially prepared probiotics (PREPRO) containing Lactobacillus rhamnosus GG on body composition of grass carp (fingerlings). Grass carp is a fresh water fish of edible test and having multiple feed sources. The study was aimed to enhance the production and improve the meat quality of a grass carp in controlled environment. A total of 120 grass carp (fingerlings) were selected and stocked in 12 glass aquaria (n=10 fish in each) in a...

Noor Nemia Hafed 

...biologically active. The commercially available version of vitamin B12 used in food supplements and food fortification is called cyanocobalamin. The primary cobalamins found in foods are hydroxo-, methyl-, and 5’-deoxyadenosyl-cobalamins.Some processed foods may include sulphitocobalamin, which has a sulphite ligand chelated to the central cobalt atom in the corrin ring. One of the most prevalent vitamin deficiencies is a vitamin B12 insufficiency. It oc...

Jamal Abdul Nasir1, Naila Chand1, Abdul Hafeez1 and Rifat Ullah Khan2*

...control and was fed with commercial ration with no supplementation. Group PO-1 was fed with commercial ration supplemented with 10 g mushroom waste/kg of feed. While group PO-2 and group PO-3 was fed with commercial ration supplemented with 20g and 30g of mushroom waste/kg of feed respectively. The study revealed that there was no notable impact on feed intake. However, there was a signifi...

Abd El-Nasser Ahmed Mohammed1, Tarek Al-Shaheen1, Mohammed Al-Saiady2 and Ahmed El-Waziry3

...tein lactating cows in a commercial farm were assorted to a control group fed basal control diet and two treated groups fed diets containing extruded flaxseed (7.0%) and salmate (25 g/head/day). The basal control, extruded flaxseed and salmate diets were formulated to be isonitrogenous and isoenergetic diets. The diets were given to each group from three weeks pre-parturition to week 23 of lactation. Feed intake, milk production and composition and fatty acid ...

Desak Putu Mas Ari Candrawati*, I Gede Mahardika, I Gusti Nyoman Gde Bidura, Ni Wayan Siti

... addition of 0.2% PPS to commercial rations could increase feed efficiency and reduce total cholesterol levels in broilers. However, the addition of 0.2-0.6% PPS to commercial feed did not have a significant impact on suppressing pathogenic bacteria in broilers intestines. Therefore, the types of prebiotics, probiotics, and their combination, as well as method of administration and concentration were recommended to be explor...

Ria Dewi Andriani1, Lilik Eka Radiati1, Teti Estiasih2*

...study in comparison with commercial dairy creamer.
 
Keywords | Emulsifying activity, Emulsion stability, Hydrolyzed visceral oil, Particle size, Reconstituted dairy creamer
...
Adyasha Sahu1*, V. K. Venkataramani1, Natarajan Jayakumar1
Durairaja Ramulu1, Preetysh Nanda Patnaik1 and Sudhan Chandran2
...) are presented for four commercially important portunid crab species viz., Portunus pelagicus (Linnaeus, 1758), Portunus sanguinolentus (Herbst, 1783), Portunus gladiator Fabricius, 1798 and Charybdis natator (Herbst, 1794) collected from the Gulf of Mannar, Southeast coast of India. A total of 1,391 specimens were collected and measured from January to June 2022. All CLW and CWW relationships were linear (R2 >0.95 and R2 >0.91 respectively). The slope ...
Sohaila Fathi El-Hawary1, Nermeen M.L. Malak2, Reda A. Gomaa3, Hesham Z. Tawfeuk3, Suzan Ismail4, Nady Khairy Elbarbary5*

Raad M. Sayed-Lafi*

...a) species are among the commercially most valuable. To find patterns and trends in the published research on this subject, we used a bibliometric approach to evaluate the body of literature that has been published in the field of grass carp study over the last ten years (2013–2023). Based on articles retrieved from Scopus, the analysis was carried out; a total of 1751 research publications were examined. The bibliometric analysis’s findings showed...

Natalia Shchur1,2*, Tetiana Mazur1, Orest Katsaraba3, Ihor Halka2, Ludmila Shalimova2, Larisa Moskalenko4, Tetiana Ponomariova-Herasymiuk4, Maksym Lusta4, Vitalii Nedosekov1

...ions, and employing both commercial materials and those prepared from components. Additionally, a comparative assessment of two isolation methods was conducted using a model of 138 samples of cecal contents from poultry (n=106) and animals (n=32) from farms in Vinnytsia, Volyn, Kyiv, and Cherkasy regions. 97% of the isolates were obtained by direct plating, with 15.6% being pure cultures. The enrichment method with reduced cultivation time yielded 72.7% of Cam...

Noor Nemia Hafed 

...biologically active. The commercially available version of vitamin B12 used in food supplements and food fortification is called cyanocobalamin. The primary cobalamins found in foods are hydroxo-, methyl-, and 5’-deoxyadenosyl-cobalamins.Some processed foods may include sulphitocobalamin, which has a sulphite ligand chelated to the central cobalt atom in the corrin ring. Methods: There were 30 sick children and 30 healthy children among the pediatric pat...
Damat Damat1, Roy Hendroko Setyobudi2, Shazma Anwar3, Mohammed Ali Wedyan4
Zane Vincevica-Gaile5, Yogo Adhi Nugroho2, Tony Liwang2, Thontowi Djauhari Nur Subchi1*, 
Ahmad Fauzi1, Hanif Alamudin Manshur1, Devi Dwi Siskawardani1, Vritta Amroini Wahyudi1
Yolla Muvika Ananda1 and Hemalia Agustin Rachmawati1
...mpared to La Boitê commercial product from Brazil. Principal component analysis (PCA) and analysis of variance (ANOVA) tests were run for the purpose, followed by Tukey posthoc test for certain variables. The results demonstrated that Mengani CP was the most similar to La Boitê as their mineral, heavy metal, crude protein, crude fiber, and sugar contents were insignificantly different. Regarding dietary fiber content, it is slightly lower in Mengan...

Mohamed Ahmed Abaza1, Amany O. Selim2, Mona Abdallah3, Shimaa A.E. Atwa4, Hala El Daous5, Mona Abd-Allah Abd-Elrehim6, Mohamed M.S. Gaballa7, Reda R. Fathy1*

...ompared with colistin as commercial antibiotic at 5 days old. E. coli serotype O6 was the highest prevalent and pathogenic multi drug resistant bacterial strain.The assessment parameters were clinical signs, post-mortem lesions and histopathological picture which showed effective role of ZnO-NPs as bacterial inhibitor in the treated groups compared to control one. Quantitative analysis showed that ZnO-NPs significantly lowered gross lesion scores in the liver,...

Ngele Blessing Alfred, Agba Mary-Ibenreh Ogaboh*, Bassey Rosemary Anietie and Egeh Ajah Egwu

...ncentrations of a common commercial laundry detergent in Nigeria (Ariel) on maize seedlings’ germination, growth, and physiological processes, including oxidative stress enzymes activities and chlorophyll content. A mixture of sawdust and sand (1:1) was utilized as the growth medium. Detergent solutions with concentrations of 1g/l, 2.5g/l, and 5.0g/l were prepared, with deionized water as the control (0g/l). Maize seeds were sown in germination trays and...

Yingying Wang1, Sufen Zhao2* and Qunxiu Liu3*

...ainst both diseases with commercial vaccines for birds, but their immune status and the immune effect are not very clear. In order to determine the protective effect of the current AI (H9 subtype) and ND vaccines on wild birds in Shanghai Zoo and to explore a more reasonable and effective immunization scheme, the hemagglutination inhibition (HI) test was used to detect antibodies in some rare wild birds in the zoo six months after vaccination and to investigat...

Muhammad Jan1*, Muhammad Ashraf Sumrah2, Muhammad Azhar Iqbal1, Inam-ul-Haq1, Attiq Ur Rehman1, Javeria Sherani3, Muhammad Imran3 and Rizwan Latif4

Md. Gausur Rahman1*, S.M. Harun-Ur-Rashid1, Md. Golam Azam1, Md. Ahsan Habib2, Golapi Rani Devsharma1 

...e collected from various commercial Sonali farms and examined by direct smear method and floatation technique. Among the examined birds, 56 Sonali chickens (28.00%) were infected with gastrointestinal parasites including Ascaridia sp., Raillietina sp. and Eimeria sp. Among these parasites, Eimeria sp. (15.5%) was the most prevalent (P<0.001) parasite, followed by Ascaridia sp. (11.5%) and Raillietina sp. (1.00%), respectively. A significantly (P<0.01) hi...

Preetysh Nanda Patnaik1, V.K. Venkataramani1, N. Jayakumar1, R. Durairaja1, Adyasha Sahu 1 and C. Sudhan2*

...st. Four closely related commercially significant portunid crab species such as Portunus pelagicus, Portunus sanguinolentus, Charybdis natator and Portunus gladiator were selected based on body morphometry and morphology to delineate them by employing a truss network. With regard to conventional morphometry in portunid species, only few characters are seemed to be diagnostic and many characters are found to be overlapping. Hence, Truss morphometry was attempte...
Faiza Ghazanfar1, Masood Rabbani1*, Aamir Ghafoor2 and Muhammad Hassan Mushtaq3
...matic sampling method of commercial broiler farms in and around Lahore and examined for the presence of thermophilic C. jejuni. Their prevalence was found to be 53% (200/375). Confirmation was done by biochemical and molecular (Polymerase chain reaction) testing methods. Phylogenetic tree analysis was also performed for genetic identification of the species. in vitro antibiotic disc diffusion method of those selected isolates was performed against 20 most comm...

Aisha Khalid1,2, Roheela Yasmeen1*, Farah Ahmad1, Mudassar Aslam2, Muhammad Tayyab2  

...plemented with 500 IU of commercial neutral cellulase. Groups B, C, and D received diets supplemented with locally produced recombinant thermostable cellulase at concentrations of 500, 750, and 1000 IU/kg, respectively. The results, analyzed using ANOVA and Duncan’s Multiple Range Test, showed significant improvements (P < 0.05) in weight gain, feed intake, and feed efficiency ratio for enzyme-treated groups, particularly from the 3rd to 7th week of t...

Muhammad Khubaib1*, Muhammad Salman Khan1, Zia Ur Rahman2, Nafees Ahmad1, Muhammad Atif Haider1 and Mushtaq Ahmad Khan3

... dissolved oxygen and is commercially important worldwide. The objective of this study is to investigate the effect of different diet on growth performance of Channa marulius to develop a rearing technique for promoting it aquaculture. Four different diets i.e. chicken liver, BSF-larvae, commercial feed and beef mince- having different protein levels were administered to compare their suitability as food for the rearing of C...

Rico Anggriawan1*, Widya Paramita Lokapirnasari2, Sri Hidanah3, Muhammad Anam Al Arif4, Diyah Ayu Candra5

...quinolone antibiotic. On commercial poultry farms in Indonesia, the combination of enrofloxacin and tylosin Tylosin and enrofloxacin are often used together as they have a synergistic action against gram-positive and gram-negative bacteria. However, overuse of antibiotics can lead to drug residues in the final product, potentially jeopardizing the health of consumers. This research aims to identify the number of cases and residues of enrofloxacin and tylosin t...

Manel Ben Larbi1*, Ameni Askri1, Mariem Saidani1, Naceur M’Hamdi2, Ibrahim El Akram Znaïdi3, Nadia Ben Braiek4 and Hajer M’Hamdi5

...ions in five Arbor Acres commercial flocks at the age of 35 days. Some indicators were observed like hock lesions, lameness, pododermatitis, plumage cleanliness, and breast blister. The scores of welfares ranged between 0 and 100. The results showed higher scores for feeding, housing, and health (P < 0.001). The absence of prolonged thirst and hunger, litter quality, breast blister, and touch test had a score exceeding 70, which is why they were considered ...

Ishtiaq Ahmad Khan1, Sarzamin Khan1, Muhammad Shuaib1*, Sohaib ul Hassan2, Abubakar Sufyan3, Waqas Alam1, Muhammad Shahkar Uzair1, Aamir Khan4, Qudrat Ullah2, Muhammad Ayaz4 and Tayyab Khurshid5

...trials were conducted at commercial farms (n=147,500) to explore the performance of artificial insemination technique at various frequencies in meat-type floored and cage-housed breeder flocks during 1st and 2nd egg-laying cycles under the controlled environment where the average house temperature and RH were 25-28oC;75-85% and 21-24oC; 50-65% during summer and winter seasons, respectively. Birds were divided into six groups; the cage-housed flocks were either...
Roshita Ibrahim1*, Anis Nursyazwani Aminuddin1 and Mohd Nizam Lani2
...r among small farmers to commercially cultivate it in Malaysia. This study explored the impact of different physical stimulations on the growth and yield of grey oyster mushrooms. The treatments included individual applications of electrical shock (12V; 13A) and high light intensity (1500 Lux) which were studied previously, as well as combined treatments of electrical shock with high light intensity (ES-HLI) and alternating treatments of these two stimuli (alt...
Mohd Aiman Hamdan1, Muhammad Fitri Yusof2, Hajar Fauzan Ahmad3,Mufafikri Musa4, Najmuddin Mohd Ramli5,6 and Mohd Najib Razali5,6*
... nutrient profile of six commercial cat food available in Malaysia with comparison to the actual requirement of cats. The results showed that Grade A cat food product has a significantly higher protein, fat, moisture, and ash content in comparison to Grade B cat food. Meanwhile, Grade B has a significantly higher carbohydrate content as compared to Grade A cat food. The new cat food formulation innovated from this work via utilizing the local raw materials has...

Ehab Hussein1, Edris A.M.1 and Ghada A.K. Kirrella2*

...nder 2g and cinnamon 2g; commercial marinades were composed of Spices, onion 380g, garlic, salt 60g, sugar 210g, water 30mL and cooking oil 60 mL and then modified marinades that composed of basic marinade 520g and lemon Juice 25mL. Each group was examined for determination of their BaP, BaA, BbF and CHR polycyclic aromatic hydrocarbons (PAH4). The recorded results revealed that the mean values of PAH4 and total PAHs in untreated samples were 66.37±53.8...

Ahmed Shamkhi Jabbar1* and Saadoon Murad2

...ge. The effectiveness of commercially available chemical insecticides and biopesticides against cotton mealybugs was evaluated under lab and field conditions by using the secreted toxins of symbiotic bacteria Xenorahbdus nematophlia, Blaiser® as a biopesticide, and chemical pesticide Sivanto®. Our results indicate that the efficacy of secreted toxins by symbiotic bacteria X. nematophlia was the highest after the chemical pesticide Sivanto® and supe...

 Saranyah Sathiaganeshan1,2, Nur Aina Natasha Yusoff1, Siti Juzailah Zuraimi1, Rukayat Omolara Folarin1,3, Satya Narayana Rao Ramasamy1,4, Asmad Kari1, Enike Dwi Kusumawati⁵, I Wayan Karyasa⁶ and Connie Fay Komilus1*

...ysis was done on OWF and commercial feed. Five dietary treatments consisting different percentages (%) such as Control (0% OWF+ 100% Commercial Feed), Treatment 1 (5% OWF+ 95% Commercial Feed), Treatment 2 (10% OWF+ 90% Commercial Feed), Treatment 3 (15% OWF+ 85% Commercial Feed), Treatment 4 (20% OWF+ 80%

Moh Sofi’ul Anam1, Ali Agus1, Budi Prasetyo Widyobroto1, Gunawan2, Andriyani Astuti1*

...ochemical analyzer and a commercial kit. The findings showed no significant changes in the levels of AST, ALT, total protein, glucose, BUN, triglycerides, cholesterol, HDL, LDL, or creatinine (P>0.05) due to supplementation. However, the SUP group showed a significant increase in WBC (41.50%), lymphocyte count (74.70%), and MCHC (2.20%) (P<0.05), with no influence on other haematological parameters (P>0.05). Additionally, the SUP group exhibited signi...
Chang Guoliang1,2*, Pan Zhengjun1,2, Zhu Chuankun1,2, Zhao Haitao1,2
Yan Zhang3, Summaya Rajput4 and Laghari M. Younis4*
...ut up to now, no special commercial formulated feed has been developed for M. nipponense that meets its nutritional requirements. Generally, soybean lecithin oil (SO) is used as a major source of phospholipids and an emulsifier in aquatic animal feed, which is very costly. In recent years, as a good emulsifier, lysolecithin attracted increasing interest in fish species. In the present study, lysolecithin as a substitute for SO was used to observe the growth an...

Sadaf Aman1, Yung Fu Chang2, Javed Iqbal Qazi1*, Rahman Ullah3* and Farah Aman4

...ntrol group was fed with commercial feed. Before stocking, all the aquaria were dried for 3 days. One eighty hundred and eighty fish (Labeo rohita) were stocked in 9 aquaria. Twenty fishes were kept in each group. Before stocking, the fish was treated with KMnO4. In treatment 1 (T1) fish were fed with canola meal along with Lactobacillus rhamnosus (NR-113332.1). In treatment 2 (T2) fish were fed with corn gluten meal along with Lactobacillus rhamnosus. The fis...

Ashraf B. Said*, Ibrahim A. Ibrahim, Hoda I. Bahr, Marwa A. El-Beltagy

...ntrol (10 rats) fed with commercially available normal diet and other diabetic (60 rats) received high fat diet for 7 weeks then injected with STZ single dose (25mg/kg b.w/i.p) for T2DM induction. The diabetic one was allocated to 6 groups (10 each) based on their treatment: untreated group, metformin (Metformin HCl, 500mg/kg b.w/day), GLP-1 (Trulicity,1.5mg/kg b.w/week), BM stem cells (IV injected with 1x106 units/once), GLP-1 plus metformin and the last grou...

Humaira1, Afsana Huseynova Anvar2, Shaukat Ali3, Marcelo Franco4, Muhammad Irfan1*

...om current fossils-based commercial manufacturing practices to sustainable, ecofriendly production systems. Extensive metabolic engineering practices incorporating living systems for commercial manufacturing of cost-effective value-added products and biochemical from sustainable feed-stock show limited success as desired higher production rates run counter to life-sustaining metabolic activities. To address these challenges,...

Saima Bibi* and Nazir Ahmad

...(Phenolic compounds) and commercial tannic acid on the nutrient composition and in sacco digestibility of berseem fodder in three non-lactating ruminally cannulated Holstein cows at the University of Agriculture Peshawar, Pakistan. The cows were fed a diet of 90% fodder and 10% concentrate on a dry matter basis. Five Plant-derived phenolic compounds and commercial tannic acid at concentration of 1.5%, 3.0% and 4.5% were used...

Beenish Khanzada1*, Shagufta Jabeen2, Asif Ali1, Amna Fatimah1, Ishfa Zahid1, Esha Israr1, Arifa Iqbal1 and Ashas Waheed1

...e that was comparable to commercial plastic films.

...
Muhammad Safdar1*, Muhammad Younus2, Faiz-ul Hassan1 and Yasmeen Junejo3
...repared food samples and commercial foodstuffs including chicken karahi, beef biryani, chicken samosa, chicken pakora, haleem, nihari etc. were collected from Bahawalpur, Multan, and Rahim Yar Khan. DNA was extracted from all the targeted samples. We developed the first multiplex PCR assay to identify pork, donkey, and cow species origins in food products within a single tube. The assay utilizes specific primers [pork (Sus scrofa), donkey (Equus asinus), and c...
Qurat-ul-Ain1*, A. Ahmad2, Farhat Nazir Awan3, M. Rabbani1 and M. Hassan Mushtaq4
...ponse in comparison with commercial vaccine in experimental cattle calves. Calves of group A (n=5) and B (n=5) were vaccinated with self-prepared and commercial vaccines respectively followed by boosting 30 days post primary vaccination, while group C was kept as non-vaccinated control group. Blood samples were taken from each group after every 2 months up to one year post vaccination and tested through Ab capture ELISA. Ove...

Shaila Akter1, MD Zobayer Rahman2*, Farzana Islam1, Zamal Hussan1, Rasel Mia3, Kazi Rabeya Akther1, Nirmal Chandra Roy1

...ng the trial, additional commercial floating powdered feed was administered. Finally, species obtained an average weight of 2.82±0.14 g, a final length of 9.0±0.40 cm, a mean final weight gain of 2.82±0.14 g, and a relative growth rate of 589.67±55.70%, lower FCR of 0.78±0.03 value with maximum growth. These changes took place during the T2 trial, keeping the feed ratio at 75% feed and 25% floc. The survival rate, on the othe...

Qayssar Obaid Muhammed, Raed Hussain Salih Rabee*

...ection by three distinct commercial businesses at the ages of 8, 70, and 115 days, respectively. Additionally, they were also administered the vaccination through a spray administration on the same day. The control group did not get any vaccinations. Chicken specimens were collected 20 days after immunization, at ages of 30, 50, 70, 90, 110, 130, 150, 170, and after challenging at 200 days. The most pronounced levels of hemagglutination inhibition and ELIZA we...

Muhammad Mudasir Mushtaq1, Safdar Hassan1, Muhammad Sharif1*, Arfan Asghar2, Fawwad Ahmad1, Muhammad Khalid Bashir3, Muhammad Ashraf1, Mukarram Bashir1, Tahreem Fatima4, Muzammal Mushtaq5 

...rs. A total of 160 white commercial laying hens, aged 37 weeks, were distributed into four treatment groups with 5 replicates and 8 hens per replicate. The experimental duration was 8 weeks. The basal diet was supplemented with 0, 0.125, 0.250, and 0.375% humic acid. Blood samples were collected from the wing vein at the beginning and end of the trial. Blood parameters (CBC, LDL, HDL, AST, ALT, and cholesterol), antioxidant activity (TAC, SOD, and GPx), and se...

Rakhtasha Munir1, Shazia Rafique2*, Iram Amin1,2, Sameen Ahmed2, Ayesha Vajeeha2, Amjad Ali3, Muhammad Shahid2, Muhammad Umer Khan4 and Muhammad Idrees2

...A has been compared to a commercially available kit to determine the specificity and sensitivity of the designed diagnostic ELISA. The aim underlying this study was to develop an accurate, error-free, unambiguous, and cost-friendly in-house ELISA, for the detection of antibodies in Pakistan’s most prevalent dengue virus serotype 2 (DENV-2). The progress of this research would likewise foreshadow advancements of novel vaccines for future counteraction of ...

Pakistan Journal of Zoology

December

Pakistan J. Zool., Vol. 56, Iss. 6, pp. 2501-3000

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe