Effect of N-Acetylcysteine Oral Administration on Cutaneous Wound Healing

Nida Sadaqat1, Sheheyar Ahmed Khan1, Amna Bibi1, Sadaf Zahra1, Muhammad faisal Salamt1, Noreen Latief2 and Fatima Ali1*

1Institute of Molecular Biology and Biotechnology (IMBB), The University of Lahore (UOL), Lahore, Pakistan.

2Center of Excellence in Molecular Biology, University of The Punjab, Lahore, Pakistan.

ABSTRACT

Thermal injury is prevalent and a burdensome critical care problem due to inadequate safety measures. A severe burn is associated with release of inflammatory mediators including reactive oxygen and nitrogen species (ROS, RNS), which are implicated in pathophysiological events in burn patients. Excessive productions of free radicals are harmful and implicated in tissue damage and multiple organ failure. Supplementation of antioxidants has proven beneficial in decreasing free radicals in burns. The aim of the present study was to investigate the effect of N-acetyl cysteine (NAC) on biochemical alterations during the post-burn stage in scalded rats. Twenty-four male Sprague-Dawley rats were anesthetized and dorsum was shaved. Second-degree skin burn was induced by immersing an iron mold (1.0 cm2 in diameter) in boiling (100°C) water for 5 min and placed on the back of the rats for 20 sec without applying pressure. Rats were divided into three groups; control group, burn injury group, burn injury + NAC group. Wound size and histopathological changes of epidermis were evaluated for the various groups. Hydroxyproline was estimated in wound tissue. Wounded skin tissues were cut off and stored at − 20°C for PCR and ELISA analysis. The therapeutic effects of a NAC supplementation for a short period of time on rat skin wound healing were investigated. The NAC treatment promoted an improvement of wound healing by reducing the oxidative stress, improving wound closure, reducing tissue inflammation with no significant change in blood parameters. There were no significant differences in weekly and final body weights and no significant changes observed in hematological and biochemical markers. A significant increase in collagen synthesis was observed in the NAC treated group with up-regulation of VEGF, IGF-1, PCNA, SDF-1 and CXCR-4 and down regulation of caspase3, P53 and CRP. The study showed that NAC is totally safe to use on rats. Hence for the future it is suggested that more experiments should be conducted for use in humans in conjugation medication for healing burn wounds.

Article Information

Received 18 October 2021

Revised 15 May 2022

Accepted 07 June 2022

Available online 07 September 2022

(early access)

Published 25 September 2023

Authors’ Contribution

Conceptualization; FA., Experimental work; NS, SAK, AB, SF, and MFS, Acquisition of data; NS, NL, FA, Analysis, interpretation of data and original draft preparation;FA., Review and editing; NS and FA. All authors have seen and approved the manuscript.

Key words

Burns, N-acetyl cysteine, Oxidative stress, Rats wound healing

DOI: https://dx.doi.org/10.17582/journal.pjz/20211018061015

* Corresponding author: fatima.ali@imbb.uol.edu.pk

030-9923/2023/0006-2539 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Thermal burn injury remains a great challenge to clinicians. Thermal burns cause an injury to the different layers of the skin (Ye and De, 2017). The type of burn and the severity of the burn depend on the number of skin layers affected. The pathophysiology of thermal burn causes damage to skin anatomy leading to its functional impairment (Greenhalgh, 2019). Thermal injury in human and animals models may be complicated by dysfunction of organs distant from the original burn wound (Kaddoura et al., 2017). The physiopathological events following thermal injury are not limited to the skin surface but its effects also disturb the cell structure and functions mediating acute inflammatory reaction and cause tissue swelling (Lateef et al., 2019).

Thermal injury also induces the activation of hypermetabolism causing damage to cell antioxidant system and results in increased production of proinflammatory cytokines, as well as the reactive oxygen species (ROS), leads to secondary complication like oxidative stress. Oxidative stress is a phenomenon caused by an imbalance between production and detoxification of ROS in cells (Nielson et al., 2017; Auger et al., 2017). Antioxidant system acts as a defense barrier for the cells. Burn patients may face the challenge of oxidative stress induced injury along with burn injury. For the assurance of burn patient health there is a need to design a strategy which strengthens the antioxidant defense system.

The impairments associated with burn injury are usually treated, either by medication or surgical procedure, or combination of both. During the wound healing process ROS are produced by inflammatory cells. In this context, antioxidant therapies are suggested to accelerate wound healing by controlling oxidative stress. N-acetyl cysteine (NAC), is a precursor of glutathione (GSH) which is an endogenous antioxidant. Antioxidant therapy for wound healing is promising, however few animal and clinical studies are available. NAC confers several beneficial effects in human and animal models, and is being investigated in acetaminophen toxicity, cystic fibrosis, diabetes, perioperative atrial fibrillation, acute cholestasis-induced renal failure, chronic obstructive pulmonary disease, and acute smoke inhalation injury. Keeping in view of therapeutic nature of NAC, it is hypothesized that NAC would also accelerate wound healing. So, the main purpose of the study was to determine the effect of NAC in burn wound healing.

MATERIALS AND METHODS

Experimental animals

The study included 24 Sprague-Dawley male rats, each having a weight of 250±30 g. Rats were housed in individually ventilated cages with 12/12-h light/dark cycles, food and water ad libitum. The rats were treated according to the ethical guidelines of the Institutional Animal Ethical Committee Institute of Molecular Biology and Biotechnology, Lahore Pakistan. Institutional Animal Ethical Committee approved all experimental procedures. All the procedures were performed in accordance with the approved guidelines of the Institutional Animal Ethical Committee of the University of Lahore (Ethics certificate no. IMBB/UOL/19/696).

Preparation of burn wound model

The rats were anesthetized by intraperitoneal administration of ketamine (50 mg/kg) and xylazine (10 mg/kg). After anesthesia the dorsa of the rats were shaved and swabbed with 70% ethanol for asepsis. Second-degree skin burn was induced by immersing an iron mold (1.0 cm2 in diameter) in boiling (100°C) water for 5 min and placed on the back of the rats for 20 seconds without applying pressure. After burn the excision of the burn skin wound was made in dorsal skin to create excisional burn wound model on the same day. Animals were housed individually in clean cages. Rats were individually caged and received a single dose of paracetamol (75 mg/kg b.w.) immediately after surgery.

Experimental procedure

The rats were divided into three groups each of four rats: Group 1 (Control) were without any injury. Group 2 (burn injury group) animals were given injury as described, above and then normal saline orally (p.o.) gavage method for 7 consecutive days. Group 3 (Burn injury + NAC treated Group) were given burn injury and then given N-acetylcysteine (NAC, Sigma Aldrich, USA) at 150mgkg−1 by gavage method for 7 consecutive days. After 14 days of treatment, animals were euthanized and tissues were harvested and processed for biochemical measurements.

Measurement of wound contraction

An excision wound margin was traced on a sheet of sterile autoclaved transparent paper and then placed on 1 mm2 graph paper on the day of wounding and subsequently at a gap period of 3 days till 14th day. Changes in wound area were measured and results were expressed as percentage (%) of the original wound area by using the following formula: (Initial wound size-specific day wound size)/ Initial wound size x 100. Wounds were considered completely healed when moist granulation tissue was no longer apparent and the wound was covered with new epithelium.

Histopathological studies

Wound tissue specimens from control, burn and treatment groups were taken after 14 days of absolute healing excision, and after tissue processing paraffin sections of 5 µm thickness were cut and stained with hematoxylin and eosin. Sections were qualitatively assessed under the light microscope and observed in respect of fibroblast proliferation, collagen formation, angiogenesis and epithelialization.

Hydroxyproline assay

The wound area was excised at the size of 1.0 cm x 1.0 cm and analyzed to estimate the amount of hydroxyproline in wound tissue. Hydroxyproline content was determined according to our previously published protocol (Ali et al., 2021).

Collection of blood and hematological studies

Five ml of blood were drawn from heart after given anesthesia from all groups for hematological and biochemical study. Blood from each sample was divided into two portion; first drawn in EDTA vacutainer tube and second in without EDTA vacutainer tube. All blood samples were sent to diagnostic lab immediately for analysis after collection. The serum and plasma samples were frozen at -20°C for biochemical analysis. The whole blood samples were analyzed using an automatized blood analyzer (Urite, China) for hemoglobin (Hb), red blood cell count (RBC), white blood cell count (WBC), platelets, and lymphocytes.

Serum biochemical analyses

All biochemical analysis was performed at Center for Research in Molecular Medicine (CRIMM), The University of Lahore. The following biochemical parameters were analyzed: Blood chemistry (glucose, lactate dehydrogenase, sodium, potassium, calcium, chloride, and phosphate): Lipid profile (total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL), and low-density lipoprotein (LDL): Liver profile (alanine aminotransferase (ALT), aspartate aminotransferase (AST), total protein, albumin, and bilirubin): Renal profile (urea, and creatinine) were performed according to the manufacturer’s protocol of reagent kits purchased from bio diagnostics.

Measurement of antioxidant enzyme activities

Wound tissue was rinsed with ice-cold saline, and homogenized using a homogenizer. The homogenate was processed on ice at a concentration of 10% in potassium phosphate buffer (50mM, pH 7.8) containing mammalian protease inhibitors. The homogenates were then centrifuged for 30 min at 4,500 rpm and 4°C. This homogenate were used to determine the activities of glutathione reductase (GSH), catalase (CAT), and superoxide dismutase (SOD), and level of malondialdehyde (MDA), according to procedure previously described (Ali et al., 2017).

PCR analysis

Total RNA were isolated from skin samples using TRIzol reagent (Invitrogen, USA) and were quantified with ND-1000 spectrophotometer (NanoDrop Technologies, USA). cDNA was synthesized from RNA (1µg) using Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase kit (Invitrogen Corporation, USA). Reverse transcriptase PCR (RT-PCR) analysis of groups was carried out for Caspase-3, p53, HIF-1, VEGF-A, IGF-1, PCNA and β-actin was performed, β-actin was used as an internal control. The RT-PCR was carried out using a GeneAmp PCR system 9700 (Applied Biosystem) for 35 cycles. Gene bands were quantified by using ImageJ software, according to the instructions given in user guide. The sequences (5’ to 3’) and product lengths (bp) for the primer pairs are mentioned in (Table I).

Indirect ELISA

Indirect ELISA for VEGF, IGF-1, SDF-1, CXCR-4, CRP and β-actin was performed according to our previously published protocol (Ali et al., 2021). Description of Primary and secondary antibodies used are as follows: anti-VEGF rabbit antibody, anti-IGF-1 rabbit antibody, anti-SDF-1 rabbit antibody, anti-CXCR-4 rabbit antibody, anti-CRP rabbit antibody, anti-IGF-1 rabbit antibody, and anti-β-actin mouse antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Followed by 1h incubation with HRP-conjugated anti-Rabbit and anti-Mouse IgG (Rockland, Limerick, PA).

 

Table I. Blood parameters of rats before and after exposure to treatment.

Parameters	Control	Burn	Burn+NAC
Blood parameter
WBC count 109/l	12.34±4.00	10.94±4.13	12.10±6.05
RBC count 1012/l	7.15±0.01	6.19±0.05	7.00±0.05
Haemoglobin g/dl	14.23±0.12	12.50±0.05	13.09±0.08
PLT count 109/l	886.8±126.2	745.7±255.4	833.0±267.0
Liver function test
AST (IU/l)	151.4±5.93	154.3±5.63	152.1±6.78
ALT (IU/l)	71.42±0.44	73.20±0.96	72.30±1.59
Cholesterol mg/dl	59.78±2.89	61.00±3.50	60.70±1.53
Triglycerides mg/dl	66.56±2.89	68.00±2.89	67.18±2.89
Albumin mg/dl	4.36±0.04	4.25±0.41	4.35±0.07
Bilirubin mg/dl	0.056±0.00	0.051±0.07	0.058±0.01
Renal test
Urea mg/dl	34.89±1.20	37.00±3.18	35.95±2.81
Creatinine mg/dl	0.35±0.02	0.37±0.03	0.35±0.03
Serum electrolyte
Potassium (mmol/l)	5.09±0.09	8.39±0.56	6.43±0.33
Phosphate (mg/dl)	12.67±0.33	13.10±0.05	12.87±0.18
Sodium (mmol/L)	145.0±1.49	135.0±5.08	148.2±2.73
Calcium (mg/dl)	10.23±0.14	8.767±0.03	9.467±1.45
Chloride (mmol/L)	108.2±0.14	97.86±0.14	108.2±0.14

 

Statistical analysis

All experimental data was analyzed using Graphpad prism v 7.0 software. (GraphPad Software, La Jolla, CA). Student’s unpaired t-test was used to determine statistical difference between any two groups whereas for more than two groups, 1-way or 2-way ANOVA with Bonferroni post-hoc test was used. Each experiment was conducted thrice in triplicate using separate cultures. One symbolic sign for statistical significance denotes p≤0.05, two signs denote p≤0.01 and three signs denote p≤0.001.

RESULTS

Effect of NAC on wound healing

To evaluate the effects of NAC treatment on burn wound closure, wound contraction was measured. An increase in wound-healing activity was observed in the rats treated with NAC, as compared with the burn group (Fig. 1A).

 

Figure 1A and C shows that the wound area was consistently reduced as the time progresses from to day 14. The wound healing rate is significantly increased in NAC treated group, from 33.0% on day 3 to 65.3%, 77.7% and 89.7 % on day 7, 10 and day 14. In comparison, the burn group exhibited 21.0%, 44.85%, 61.29% and 76.9 % contraction on day 3, 7, 10, and 14, respectively.

Increase in hydroxyproline content indicates increased collagen synthesis which in turn leads to enhanced wound healing (Nayak and Pereira, 2006). In our study, hydroxyproline content were found to be significantly increased in the NAC treated group (0.73 ± 0.005 mg/g of tissue) than the burn group (0.56 ± 0.01 mg/g of tissue) which implies more collagen deposition in treated groups than the burn group (Fig. 1D). Significant differences were observed in hydroxyproline concentrations between groups II and III when compared with control group I.

Histological examination of skin tissue

Figure 2 shows histological evidence for wound healing. There is a moderate level of granulation tissue in control group whereas mild in burn and burn+NAC group this indicate formation of new connective tissue, and microscopic blood vessels. Fibroblasts are responsible for the contractile process in wound closure. So presence of too many fibroblasts at wound site indicates that wound are still in the phase of healing. Neutrophils are absent in all treatment groups (Table I and Fig. 2). Neutrophil are helpful in normal wound healing process and recruited to injury site soon after injury. However, in normal skin and healed skin neutrophils are not frequently observed on day 14 the number of inflammatory cells were also reduced significantly, epithelialization level was increased in burn+NAC compared with the burn group.

 

Hematological and serum biochemical parameters

Table II shows the effect of NCA on hematological parameters, liver function test, renal test and serum electrolytes of rats inflicted with burn injury on skin. We noticed decrease in RBC’s count, HB concentration, and increase in the WBC’s count in burn group in comparison to control whereas burn+NAC group shows similar results to control group. Liver enzymes activity were analyzed where there was increase in AST, ALT, enzyme activities in burn group as compared with control group and burn+NAC group. In addition, burn group show little variation (decrease) in serum albumin and total bilirubin compared with normal control and burn+NAC group. The level of cholesterol and triglycerides changed non-significantly in all treatment groups. Kidney function analysis show non-significant increase in serum creatinine and urea in burn group comparison to control group and burn+NAC group. Serum electrolytes: Burns also lead to increase in potassium level and phosphate level while sodium, calcium and chlorine level was decreased compared to control group and burn+NAC group.

Oxidative stress markers

Figure 3 shows activities of CAT, GSH, SOD, and MDA measured in skins of rats inflicted with skin burn injury and them treatment with NAC. On the 14 days post-wounding, CAT (0.117 ± 0.004 nm), GSH (0.199 ± 0.004 nm), SOD (0.199 ± 0.005 nm) activities was significantly reduced in burn group when compared to control group CAT (0.550 ± 0.015 nm), GSH (0.580 ± 0.003 nm), and SOD (0.528 ± 0.022 nm). The activity of MDA was increased burn group (0.461 ± 0.016 nm) when compared with control group (0.134 ± 0.002 nm) (Fig. 3D). Treatment with NAC had significant effect on enzyme activities. Figure 3A showed that treatment of wound with NAC resulted in an increased SOD activity (0.471 ± 0.021 nm). Figure 3B showed that treatment of wound with NAC resulted in an increased GSH activity (0.467 ± 0.004 nm). Figure 3C showed that treatment of wound with NAC resulted in an increased CAT activity (0.353 ± 0.008 nm). Figure 3D showed that treatment of wound with NAC resulted in decreased MDA activity (0.299 ± 0.025 nm).

 

Table II. Primer sequences.

Gene	Primer sequence	Size (bp)
Casp-ase 3	5’ACAGAGCTGGACTGCGGTAT3’ (F) 5’TGCGGTAGAGTAAGCATACAGG3’ (R)	104
P53	5’TTGGATCCATGTTTTGCCAACTGGCC3’(F) 5’TTGAATTCAGGCTCCCCTTTCTTGCG3’(R)	120
HIF-1	5’-CTAGGGATGCAGCACGATCT-3’ (F) 5’-AGATGGGAGCTCACGTTGTG-3’ (R)	100
VEGF	5’GCCCTGAGTCAAGAGGACAG3’ (F) 5’GAGGAGGAGGAGCCATTACC3’ (R)	284
IGF-1	5’GCTGAAGCCGTTCATTTAGC3’ (F) 5’CCACCCAGTTGCTATTGCTT3’ (R	193
PCNA	5’-TGACCCTCACCGATACAACA-3’ (F) 5’-CTGTACAGCACAGCCACGTT-3’ (R)	123
β actin	5’-GCTGTGTTGTCCCTGTATGC-3’ (F) 5’-GAGCGCGTAACCCTCATAGA-3’ (R)	102

 

 

Gene expression profiling

Gene expression profiling was done on the control, burn and NAC-treated groups. The results of this profiling showed decreased levels of caspase-3, p53 (apoptotic genes), and HIF-1 (hypoxic gene), and elevated levels of VEGF (angiogenesis gene) and IGF-1 (survival gene) NAC treated group as compared with the burn group (Fig. 4A, B). The wound area was measured by tracing the wound margin, and its surface area was calculated using Image J software (National Institutes of Health, Bethesda, MA, USA).

 

Protein level

To monitor the effect of NAC on wounded skin sample release of growth factors (IGF-1, VEGF), progenitor cell mobilization (SDF-1, CXCR-4), β-actin, and inflammation makers (CRP) were observed. β-actin was used as an internal control. As shown in Figure 4C-H, the levels of IGF-I and VEGF were high in the Burn+NAC group (VEGF=0.554 ± 0.013 nm; IGF=0.180 ± 0.002 nm) compared with burn group (VEGF=0.385 ± 0.020 nm; IGF=0.148 ± 0.021 nm) (P < 0.05). Burn+NAC group showed significantly reduce CRP level (0.162 ± 0.001) compared with burn group (0.208 ± 0.003).

The level of progenitor cell mobilization maker in skin wound sample indicated that the level of SDF-1 and CXCR-4 were high in Burn+NAC group (SDF-1= 0.516 ± 0.009 nm; CXCR-4= 0.462 ± 0.015 ± 0.009 nm) compared with burn group (SDF-1= 0.427 ± 0.012 nm; CXCR-4= 0.516 ± 0.009 nm) (P<0.05) (Fig. 4F-G). β-actin level remain almost remain same in Burn+NAC (0.471 ± 0.002 nm) and burn group (0.457 ± 0.002 nm) (Fig. 4H). Whereas the level of these markers in control group are as follow; (VEGF=0.567 ± 0.016 nm; IGF=0.230 ± 0.010 nm; SDF-1=0.627 ± 0.009 nm; CXCR-4=0.613 ± 0.007 nm; CRP=0.106 ± 0.006 nm; β-actin=0.476 ± 0.001 nm).

Discussion

Previous reports have attributed the effectiveness of NAC as an antioxidant, as a precursor of glutathione (GSH) synthesis in the body. Wound healing is a complex and highly regulated process that initiates at the time of physical injury and continues till the healing process (Velnar et al., 2009). The objective of wound healing is to heal wounds in the shortest time period with least pain that will improve the quality of the patient’s life. There are many studies conducted on antioxidant treatment methods to speed up the wound-healing process. Many therapeutic effects of NAC, including mucolytic, antioxidant, anti-aging, and antitumor effects, have been reported (Šalamon et al., 2019). In this study the therapeutic effects of a NAC supplementation for a short period of time on skin wound healing in rats were investigated. The NAC treatment promoted an improvement of wound healing by reducing the oxidative stress, improving wound closure with no significant effect on biochemical parameters. In this study, significant wound closure was observed in NAC treated rats. Increased wound contraction in treated rats might be a result of the enhanced activity of fibroblasts in the treated rats as after histological analysis we find few fibroblast as compared to burn groups that indicate that the tissue is still under healing process.

Burn depth in the skin is categorized as superficial, superficial partial-thickness, deep partial-thickness, full-thickness and subdermal burns (Meyerholz et al., 2009). In this study, we mainly focus on superficial partial-thickness burns so we analyzed the tissue parameters through recording epidermal morphological and biochemical changes. Microscopic examination of healed tissue sections revealed that the tissue regeneration was much faster in the NAC treated group compared to control wounds. H and E staining results show less infiltration of lymphocytes, enhanced proliferation of fibroblasts as a result of NAC treatment compared with control rats. Significant increase in hydroxyproline content in the NAC treated group revealed the enhanced migration of fibroblast cells and collagen synthesis during the wound healing process. The decreased collagen content in burn rats may be a result of inflammation, which inhibits fibroblast proliferation and leads to delayed healing. Hydroxyproline is a non-essential amino acid found in collagen. Previous studies show that the increased while its decreased level leads to poor wound-healing (Chen et al., 2012).

We analyzed the hematological and biochemical changes in the burn and treated animals, levels of these parameters are very important in animal care. These parameters are helpful for making inference about given therapy as these parameters tell us how the body is responding to the thermal injury. Our results show non-significant differences in the treatment group compared with control group which indicated that oral administration of NAC did not alter these parameters.

In thermal burns, excessive production of free radicals recruits inflammatory cells at the injury site which may lead to endothelial dysfunction (Mittal et al., 2014). However, this excessive production of free radicals can be minimized with help of antioxidants, such as SOD, catalase and glutathione. Antioxidants reduce oxidative stress and accelerate burn wound healing process (Comino-Sanz et al., 2021). So it is necessary to estimate these antioxidants in healed tissue. Significant alterations in the antioxidant profile, combined with elevated levels of MDA, which is a marker of fatty acid oxidation, may lead to impaired wound healing in rats (Bilgen et al., 2019). In the present study, the levels of SOD, CAT, GSH and MDA were quantified in healed tissues. The results demonstrated that treatment with NAC significantly increased the activity of SOD, CAT, GSH, and reduced the levels of MDA compared with the burn group.

The process of regeneration is dependent on proliferation of fibroblast and secretion a number of growth factors and cytokines (Zarei and Soleimaninejad, 2018); however, proliferation and secretion of these factors diminishes with oxidative stress (Guo and Dipietro, 2010). Beneficial effect of NAC treatment on wound regeneration was also confirmed by PCR and ELISA results. NAC treatment also increases the expression of IGF-1, VEGF and PCNA as compared to burn group this indicate that NAC favor the tissue regeneration by reducing the oxidative stress. VEGF has been shown to increase vascular permeability, promotes angiogenesis, attracts monocytes to the site of injury and is also involved in neovascularization (DiPietro, 2016). NAC as antioxidant reduce the oxidative stress and it is confirmed by decreased expression of HIF-1, HIF-1, is an important transcription factor in the cellular response to hypoxia (Li et al., 2019).

Our results showed a significant increase in SDF-1 and CXCR-4 expression in NAC treated group as compared to burn group. SDF-1/CXCR4 axis is involved in homing, engraftment, neo-vascularization and cell proliferation (Cencioni et al., 2012). The results of the present study are in accordance with other studies that demonstrated significant role of SDF-1/CXCR4 signaling in wound repair and regeneration (Chen et al., 2021). Our results also shows that NAC resulted in decreased expression of caspase-3, P53 and CRP.

CONCULSION

We have demonstrated that NAC administration can significantly enhance wound healing. This study showed that NAC is totally safe to be use in rats and in human as it is helpful in wound repair.

ACKNOWLEDGEMENTS

The present study was supported by the National Research Program for Universities Higher Education Commission, Pakistan (Grant no. 7517).

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Ali, F., Aziz, F. and Wajid, N., 2017. Effect of type 2 diabetic serum on the behavior of Wharton’s jelly-derived mesenchymal stem cells in vitro. Chronic Dis. Transl. Med., 3: 105-111. https://doi.org/10.1016/j.cdtm.2017.02.006

Ali, F., Wajid, N., Sarwar, M.G., and Qazi, A.M., 2021. Oral administration of aloe vera ameliorates wound healing through improved angiogenesis and chemotaxis in sprague dawley rats. Curr. Pharm. Biotechnol., 22: 1122-1128. https://doi.org/10.2174/1389201021999201001204345

Auger, C., Samadi, O. and Jeschke, M.G., 2017. The biochemical alterations underlying post-burn hypermetabolism. Biochim. biophys. Acta Mol. Basis Dis., 1863: 2633-2644. https://doi.org/10.1016/j.bbadis.2017.02.019

Bilgen, F., Ural, A., Kurutas, E.B., and Bekerecioglu, M., 2019. The effect of oxidative stress and Raftlin levels on wound healing. Int. Wound J., 16: 1178-1184. https://doi.org/10.1111/iwj.13177

Cencioni, C., Capogrossi, M.C. and Napolitano, M., 2012. The SDF-1/CXCR4 axis in stem cell preconditioning. Cardiovasc. Res., 94: 400-407. https://doi.org/10.1093/cvr/cvs132

Chen, H., Li, G., Liu, Y., Ji, S., Li, Y., Xiang, J., Zhou, L., Gao, H., Zhang, W., Sun, X. and Fu, X., 2021. Pleiotropic roles of CXCR4 in wound repair and regeneration. Front. Immunol., 12: 1743. https://doi.org/10.3389/fimmu.2021.668758

Chen, W.C., Liou, S.S., Tzeng, T.F., Lee, S.L. and Liu, I.M., 2012. Wound repair and anti-inflammatory potential of Lonicera japonica in excision wound-induced rats. BMC Complement. Altern. Med., 12: 1-9. https://doi.org/10.1186/1472-6882-12-226

Comino-Sanz, I.M., López-Franco, M.D., Castro, B. and Pancorbo-Hidalgo, P.L., 2021. The role of antioxidants on wound healing: A review of the current evidence. J. clin. Med., 10: 558. https://doi.org/10.3390/jcm10163558

DiPietro, L.A., 2016. Angiogenesis and wound repair: when enough is enough. J. Leukoc. Biol., 100: 79-984. https://doi.org/10.1189/jlb.4MR0316-102R

Greenhalgh, D.G., 2019. Management of burns. N. Engl. J. Med., 380: 2349-2359. https://doi.org/10.1056/NEJMra1807442

Guo, S.A., and DiPietro, L.A., 2010. Factors affecting wound healing. J. Dent. Res., 89: 219-229. https://doi.org/10.1177/0022034509359125

Kaddoura, I., Abu-Sittah, G., Ibrahim, A., Karamanoukian, R. and Papazian, N., 2017. Burn injury: review of pathophysiology and therapeutic modalities in major burns. Annls Burns Fire Disast., 30: 95.

Kumar, S.A., Khare, P., Kumar, N.H., Raghuwanshi, N. and Srivastava, R., 2016. Hydroxyproline: A potential biochemical marker and its role in the pathogenesis of different diseases. Curr. Protein Pept. Sci., 17: 596-602. https://doi.org/10.2174/1389203717666151201192247

Lateef, Z., Stuart, G., Jones, N., Mercer, A., Fleming, S. and Wise, L., 2019. The cutaneous inflammatory response to thermal burn injury in a murine model. Int. J. mol. Sci., 20: 538. https://doi.org/10.3390/ijms20030538

Li, H.S., Zhou, Y.N., Li, L., Li, S.F., Long, D., Chen, X.L., Zhang, J.B., Feng, L. and Li, Y.P., 2019. HIF-1α protects against oxidative stress by directly targeting mitochondria. Redox Biol., 25: 101109. https://doi.org/10.1016/j.redox.2019.101109

Meyerholz, D.K., Piester, T.L., Sokolich, J.C., Zamba, G.K. and Light, T.D., 2009. Morphological parameters for assessment of burn severity in an acute burn injury rat model. Int. J. exp. Pathol., 90: 26-33. https://doi.org/10.1111/j.1365-2613.2008.00617.x

Mittal, M., Siddiqui, M.R., Tran, K., Reddy, S.P. and Malik, A.B., 2014. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox signal., 20: 1126-1167. https://doi.org/10.1089/ars.2012.5149

Nayak, B.S. and Pereira, L.M.P., 2006. Catharanthus roseus flower extract has wound-healing activity in Sprague Dawley rats. BMC Complement. Altern. Med., 6: 41. https://doi.org/10.1186/1472-6882-6-41

Nielson, C.B., Duethman, N.C., Howard, J.M., Moncure, M. and Wood, J.G., 2017. Burns: Pathophysiology of systemic complications and current management. J. Burn Care Res., 38: e469-e481. https://doi.org/10.1097/BCR.0000000000000355

Šalamon, Š., Kramar, B. and Marolt, T.P., 2019. Medical and dietary uses of N-acetylcysteine. Antioxidants, 8: 111. https://doi.org/10.3390/antiox8050111

Velnar, T., Bailey, T. and Smrkolj, V., 2009. The wound healing process: An overview of the cellular and molecular mechanisms. J. Int. med. Res., 37: 1528-1542. https://doi.org/10.1177/147323000903700531

Ye, H. and De, S., 2017. Thermal injury of skin and subcutaneous tissues: A review of experimental approaches and numerical models. Burns, 43: 909-932. https://doi.org/10.1016/j.burns.2016.11.014

Zarei, F. and Soleimaninejad, M., 2018. Role of growth factors and biomaterials in wound healing. Artif. Cells, nanomed. Biotechnol., 46(Sup1): 906-911. https://doi.org/10.1080/21691401.2018.1439836