ETV5 is a Putative Differentially Expressed Transcription Factor of Interleukin 1β Under Neuroinflammatory Conditions in Murine Cerebellum

Abeedha Tu-Allah Khan and Abdul Rauf Shakoori*

School of Biological Sciences, University of the Punjab, Quaid-e-Azam Campus, Lahore 54590, Pakistan

ABSTRACT

Neuroinflammation is the underlying cause of a number of neurodegenerative disorders. While the current understanding of its molecular mechanisms is continually increasing, the identification and consequently the roles of transcription factors (TFs) in the respective molecular events under neuroinflammatory conditions in distinct brain regions is still lacking. To address the said gap in knowledge, first we have identified the TFs specific to IL-1β a key player in mediating inflammatory process using online databases. Next, we identified the interacting partners of the significantly differentially expressed TFs out of the selected ones, and the mRNA expression changes were studied for both the differentially expressed TF along with its interacting partners. Finally, we explored the expression of these genes from some online available RNA-seq datasets for brain tissue, neurons, microglia and astrocytes. The results showed significant upregulation of Etv5 TF in male mouse brain hippocampus along with a significant downregulation of three of its predicted interacting partners, i.e., Cop1, Det1 and Bcl6b. Besides presenting new targets for neuroinflammation studies, the discrepancies of expression between different brain regions as well as among the genders suggest that more data with respect to intricate brain region resolution along with single cell data could reflect subtle changes in brain microenvironments and individual cells, which can lead to a more precise pathological understanding of the neuroinflammatory process.

Article Information

Received 12 June 2022

Revised 05 August 2022

Accepted 22 August 2022

Available online 25 November 2022

(early access)

Published 26 July 2023

Authors’ Contribution

ARS conceptualization, methodology, funding acquisition, project administration, resources, supervision, writing (review and editing). AT-AK conceptualization, investigation, methodology, writing (original draft). Both the authors have read and approved the final submission.

Key words

Neuroinflammation, Neurodegeneration, Transcription factors, Gene expression analysis, RT-PCR, RNA-seq analysis

DOI: https://dx.doi.org/10.17582/journal.pjz/20220612100622

* Corresponding author: [email protected], [email protected]

0030-9923/2023/0005-2033 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

The inflammation of brain and spinal cord, together constituting our central nervous system (CNS), is known as neuroinflammation. Being implicated in a variety of somatic and neurological illnesses, the most common cues of its initiation known till date are toxicity to various metabolites, traumatic brain and spinal cord injuries, viral and/or bacterial toxicity, and autoimmune mediated neuroinflammation (Lyman et al., 2014; Feinstein et al., 2016). Apart from being central to the mutual pathology of a number of acute and chronic neurological disorders, neuroinflammation has also been found to be a major cause and aggravating factor for the development of neurodegenerative diseases. Moreover, its role in the early development of some chronic conditions, e.g., dementia, has also been reported (Lyman et al., 2014; Kwon and Koh, 2020; DiSabato et al., 2016).

Being pleiotropic mediators and effectors of cells’ and tissues’ inflammatory processes and of various autoimmune disorders, interleukin-1 α (IL-1α) and interleukin-1 β (IL-1β) are archetypal proinflammatory cytokines. Of these, IL-1β also performs crucial homeostatic functions in a healthy organism. These include the regulation of body temperature, sleep, and feeding (Dinarello, 1996, 2004). Consequently, its overproduction is associated with various pathophysiological anomalies such as inflammatory bowel disease, rheumatoid arthritis, osteoarthritis, vascular diseases, neuropathy, Alzheimer’s disease and multiple sclerosis (Braddock and Quinn, 2004).

Some of the common documented events during the process of neuroinflammation include: Increased activation of brain’s resident immune cells (glial cells), altered permeability of blood brain barrier (BBB), leukocyte invasion, and increased concentration of the pro-inflammatory cytokines (Rejo et al., 2008; Guzyman-Martinez, 2019). IL-1 being upregulated in several of the neurodegenerative disorders such as Parkinson’s disease (PD) (Leal et al., 2013; Stojakovic et al., 2017), Alzheimer’s disease (Cacabelos et al., 1991, 1994), multiple sclerosis (Lin and Edelson, 2017) and amyotrophic lateral sclerosis (Meissner et al., 2010), also makes IL-1β a key player in the process of neuroinflammation too, along with other inflammatory processes of the body. The pathways activated by overproduction of IL-1β include NFkB-dependent transcription of some other pro-inflammatory cytokines such as TNF-α, interferons and IL-6; activation of neutrophil recruiting chemokines; and stimulation of synaptophysin and Tau proteins’ production in neurons (Acuner-Ozbabacan et al., 2014; Fan et al., 2007; Pyrillou et al., 2020).

The regulatory elements of IL-1B include a TATA box within the promoter, a CRE (cAMP responsive element), an AP-1 (activator protein 1) promoter site, an SP-1/PU.1 (the ETS family of transcription factor) binding site, and an NF-κB (nuclear factor kappa B) binding site (Tjitro et al., 2018; Perez et al., 1999; Lahiri et al., 2002; Shirakawa et al., 1993). The induction of IL-1B gene expression can be brought about via various stimuli including both microbial and non-microbial types. The initial translation product is a propeptide (31 kD), the pro-IL-1β, which is cleaved to the mature and biologically active form of IL-1β by the action of cysteine protease caspase-1 (Zepter et al., 1997; Herzog et al., 2005; Eder, 2009).

The presence of both neuroinflammation and tissue damage in post mortem brain tissues makes it difficult to determine whether upregulation of IL-1B is caused by, or a consequence of neuroinflammation (Hewett et al., 2012). This also urged the need to explore IL-1B along with its potential mediators to get a better understanding of its precise role in the process of neuroinflammation. This study was therefore aimed at identification of the transcription factors (TF) specific to IL-1B promoter/enhancer region and then study their differential expression under neuroinflammatory conditions using in vivo LPS mouse models.

MATERIALS AND METHODS

Identification and Screening of TFs for the promoter/enhancer region of IL-1B

Various online available databases were utilized for the identification of the promoter region of Il-1B gene. These include GeneCards (https://www.genecards.org/), the eukaryotic promoter database (https://epd.epfl.ch//index.php), and super-enhancer database (http://www.licpathway.net/sedb/). These databases also identified the TFs having the binding sites for the promoter of Il-1B and among them, only those TFs were preferred having the highest scores from the online databases. The resulting TFs were further screened on the basis of their tissue specific high or low expression profiles so as to select only those relevant to the tissue being used in the study i.e., brain.

Neuroinflammation murine models

Male and female BALB/c mice, approximately 6 weeks of age, were housed in groups of 4 in cages containing rodent bedding. Food and water were available ad libitum and temperature was maintained at 25°C. All experiments were carried out on mice divided into two groups, experimental drug group and vehicle control group receiving physiological saline injections only.

BALB/c mice 6-8 weeks of age were administered with a single dose of 5 mg/kg of lipopolysaccharide (LPS) solution (Sigma Cat # L2880-25MG) dissolved in 0.9% saline solution via intraperitoneal route. The controls received injections of saline solution only. The sacrifice of animals was carried out after 24 h of LPS treatment.

Animal killing and dissections

The mice were sacrificed by cervical dislocation. Briefly, the backside of a knife was placed on the dorsal side of the neck at the junction between skull and the vertebrae. Then a little pressure was applied through the knife while pulling the animal from its tail so as to dislocate the head from the rest of the body in a single jerk to minimize animal discomfort. The bioethical clearance certificate was obtained from the Bioethics Committee of the School of Biological Sciences, University of the Punjab.

The brains were further dissected to get two regions i.e., hippocampus and cerebellum. These two regions are shown in the Supplementary Figure S1 which represents the regional map of murine brain. The protocol for dissection of these regions was followed from Li (2011). The cerebellum is located on the dorsal side of the brain and on the lower side as can be seen in the Figure 1. First, the portion of the brain containing the cerebellum was separated from the cerebral cortices by making a vertical cut. Then the tissue underneath the cerebellum consisting of midbrain, pons and medulla was separated from it very carefully with the help of fine curved forceps.

The dissection of hippocampi is a bit difficult than the cerebellum as they are located on the inside of the cerebral cortices and are covered with tissue. Therefore, the dissection procedure of hippocampus is explained a little more as in the Figure 1B, C since the crescent shaped hippocampi are placed on the dorsal side of the brain covered with a fatty tissue the removal of which makes the hippocampus visible.

 

qRT PCR of IL-1β TFs

For total cell RNA extraction, the tissues were homogenized in TRIzol reagent via trituration and total RNA was extracted according to the manufacturer’s protocol. The RNA was used for complementary cDNA synthesis after DNase treatment using Revert Aid First Strand cDNA synthesis kit (Thermofisher Scientific, Cat # K1622).

Extracted RNA was quantified using pico200 spectrophotometer at A260/280. For DNase treatment of RNA sample, Invitrogen kit (Cat # 18068015) was used for this procedure as per instructions of the kit. The cDNA was synthesized using Maxima H Minus First Strand cDNA Synthesis Kit (Cat # K1681).

The quantitative expression analysis of genes was done by real time PCR analysis. Maxima SYBR Green/ROX qPCR master mix (2X; Thermofisher Scientific, Cat # K0222), cDNA, and 5 µM forward and reverse primers’ mix were used for RT-PCR (the sequences of the primers are provided in Table I. Two-step thermal cycle protocol with optimized annealing temperatures (Table I) of each primer pair was used for amplification and quantification of amplicons on PikoReal Real-Time PCR system (Thermofischer Scientific). Melting curve data with every 0.2°C increment was taken to determine the uniformity of PCR product. HMBS was used as a reference gene in the study. Significance analysis for fold differences of biological replicates was done using t-test for means.

 

Table I. Sequences of primers used for RT-PCR along with their optimized annealing temperatures.

Gene name	Primer	Sequence (5’-3’)	Optimized primer annealing temperature	Product length (bp)
HMBS	Forward	CACTGGCTTCCCGTTCACTA	58-61	160
	Reverse	GCCAGGGGAGGTGAGAAAC
ETV5	Forward	CAAGGTCAAGAAAACCCGCC	60	70
	Reverse	CGCTGAGGGACCTTAATCGG
KLF16	Forward	GTGGCCCTAATCAACACTCCT	60	186
	Reverse	AGATGGTGCAGCTACCAAGAC
COP1	Forward	ATGCAGCCATGAATGTGTGT	59	233
	Reverse	TGTCCACTTGCTGTTTGCTC
DET1	Forward	GTCTTGTACCCGTGGTGCTT	60	172
	Reverse	AAAACCAGGACGCCTACCTT
GDNF	Forward	GCCAGCCAGAGAGAAAACAC	59	234
	Reverse	AAGGCATTAGCTTTGGAGCA
BCL6B	Forward	ACAGCTGGGTTTGAATGTCC	60	246
	Reverse	AAGGCAGCCCTCTTTTCTTC
DUSP6	Forward	GAATAATCCGGCGAGAAACA	60	168
	Reverse	AATGAAGGTGCCCAGTTTTG

 

Cross-examination of differentially expressed genes via expression atlas

The genes, for which mRNA expression was significantly differential, were further cross examined with respect to their protein expression at basal level using Expression Atlas database (Expression Atlas, 2020). This database is maintained by the European Bioinformatics Institute that is a hub of information for RNA and protein expression for different studies, organisms, and experimental conditions. Since mRNA of Etv5 was being differentially expressed in the cerebellum of both the genders, its basal level protein was checked using this database.

Functional protein-protein association networks

For studying the functional protein association networks of Etv5, STRINGS (Search Tool for Retrieval of Interacting Genes and protein, Version 11.0, https://string-db.org/), BioGRID (https://thebiogrid.org/), Database of Interacting Proteins (DIP, https://dip.doe-mbi.ucla.edu/dip/Main.cgi) and IntAct (https://www.ebi.ac.uk/intact/home) databases were used (Szklarczyk et al., 2018) to find not only the established biological interacting partners from experiments and curated databases but also the predicted interactions from gene neighborhood, fusions, co-occurrence, co-expression, homology and text-mining techniques.

The re-analysis of RNA-seq datasets taken from Gene Expression Omnibus (GEO) database was done (Khan et al., 2022). In short, fastq files of LPS versus control treated mouse brain (accession number GSE153369), neurons, astrocytes and microglia (accession number GSE75246) were analysed using different packages from R Bioconductor such as limma, edgeR, gplots, org.Hs.eg.db, RcolorBrewer and Glimma (Warnes et al., 2005; McCarthy et al., 2012; Ritchie et al., 2015; Su et al., 2017). and the average expression along their p values were noted for significance analyses.

RESULTS

Putative TFs of IL-1B

The online search resulted in the identification of a number of TFs interacting with IL-1B gene regulatory elements. Further sorting of these TFs on the basis of their differential expression in different tissues resulted in the identification of Klf16 and Etv5 exhibiting the highest expression in brain as compared to other tissues (Supplementary Table SI).

mRNA expression analysis of TFs under neuroinflammatory conditions

mRNA expression analysis revealed that Klf16 did not show any significant difference in expression in both the brain regions of male and female mice (Fig. 2). However, in case of Etv5, significant (p < 0.005) upregulation of 1.25 folds was observed only in male hippocampus (Fig. 3A). Quite interestingly, its expression was found to be downregulated in male cerebellum (Fig. 3B) as well as in female hippocampus (Fig. 3C) and cerebellum (Fig. 3D), although these fold differences were found to be non-significant.

 

 

After getting significant expression difference in Etv5 transcript, we further searched for the interacting protein partners of Etv5 of both human and mouse origin of which the mRNA expression of Cop1, GDNF, Det1, Bcl6b and Dusp6 was further analyzed using RT-PCR. The protein partners for mouse and human Etv5 protein from STRING database are given in Figure 4 in the form of node diagrams. Supplementary Table SII shows the interacting protein partners of Etv5 from all the databases for mouse and human, respectively.

 

In line with the significant upregulation of Etv5 gene, three of its interacting partners, i.e., Cop1, Det1 and Bcl6b showed significant downregulation, while non-significant upregulation was observed for GDNF and Dusp6 in male hippocampus. In male cerebellum, significant downregulation of Bcl6b and Dusp6 was seen. In female mice, only Bcl6b was found to be showing significant downregulation in both the hippocampus and cerebellum.

When the protein expression of Etv5 was checked as a validation to see its baseline conditions under normal conditions via Human Protein Atlas project (Expression Atlas, 2020), it was found that in the cerebellum of both male and female subjects, its expression was moderate (Fig. 5).

Expression of ETV5 from RNA seq data sets

When the expression of Etv5 and its selected interacting partners was checked from RNA-seq data sets for brain tissue, neurons, microglia and astrocytes, only Det1 significant difference in average expression with a value of -1.729 (p < 0.005) (Table II).

 

Table II. Average expression of Etv5 from LPS treated neuroinflammation RNA-seq datasets. * (p < 0.05), ** (p < 0.005), NS (p > 0.05 = non-significant).

Genes	Average expression
	Brain	Neurons	Microglia	Astrocytes
Etv5	-0.424ns	6.352ns	N/A	N/A
Cop1	N/A	0.73ns	N/A	-1.310ns
GDNF	-0.913ns	-0.619ns	N/A	N/A
Det1	N/A	N/A	N/A	-1.729**
Bcl6b	0.524NS	0.351NS	N/A	N/A
Dusp6	-0.160ns	0.624	N/A	N/A

 

DISCUSSION

This study was focused on the identification of IL-1B specific transcription factors of brain as IL-1β serves a pivotal role in the mediation of inflammatory responses. Consistent with the significant differential expression of Etv5 mRNA only in male hippocampus, most of its interacting partners (Cop1, Det1 and Bcl6b) also showed significant differential expression (downregulation) only in male hippocampus. An interesting difference to note was that while Etv5 was being upregulated, the interacting partners were being downregulated in male hippocampi. In the male cerebellum, the only genes significantly differentially expressed were Bcl6b and Dusp6 (downregulation), and in female hippocampi and cerebellum only Bcl6b showed significant downregulation. Further exploration of the genes under study from the RNA-seq data sets of LPS treated brain tissue as well as from neurons, microglia and astrocytes revealed significant downregulation of Det1 in astrocytes (Table II). Among all the genes, Bcl6b was found to be common among the two brain regions in both the genders, all exhibiting downregulation of it. Also, the downregulation of Det1 in male hippocampus was corroborated with its down regulation in astrocytic RNA-seq data.

Being a member of the PEA3 family of TFs, Etv5 binds to a conserved DNA motif having sequence GGAA/T (Oh et al., 2010). Some of the important known roles of Etv5 include: Coordination of limb development; regulation of epithelial-to-mesenchymal transition in some cancer types; control of gene expression in spermatogonial stem cells; inhibition of sonic hedgehog gene expression; and positive regulation of some miRNAs important in spermatogonial stem cells renewal (Zhang et al., 2009; 2010; Wu et al., 2011; Niu et al., 2011). Besides these, although still poorly understood, the roles of Etv5 in immune responses include an increased interferon gamma (IFN-γ) production from TH1 cells (Thieu et al., 2008; Ouyang et al., 1999), increased IL-17 production in TH17 cells (thus playing a role in allergic inflammation development) (Pham et al., 2014), and suppression of the activation of adipose tissue resident macrophages (Hu et al., 2021). Since activation of these macrophages contributes in the development of chronic inflammation, and Etv5 being identified as a major suppressor of the process, the upregulation of Etv5 transcript in male hippocampus in the current study presents an interesting target for future studies of Etv5 on brain resident macrophages i.e., microglia. Corroborated with the previous studies indicating a regulatory role of Etv5 on transcriptional activation of IL-10, IL-17 and IL-9 expression (Pham et al., 2014; Koh et al., 2016, 2017), the precise mechanism of its role in macrophage activation regulation is yet to be unveiled.

We observed a downregulation of Cop1 gene in hippocampi of both the genders and in male cerebellum although significant results were those of male hippocampus only. Previous studies have found a neuroprotective role of Cop1 in neurodegenerative disorders (Gorantla et al., 2007, 2008). Corroborating the neuroprotective role, recent knockout studies of Cop1 have shown an increased pro-inflammatory response in brain resident macrophages, i.e., microglial cells (Ndojaa et al., 2020). Since Det1 is a partner of Cop1 E3 ubiquitin ligase complex, its downregulation is in concert with Cop1 downregulation (which has been found to be almost double in magnitude to that of Det1 (Fig. 3B). Previous roles of Det1 have been found in the mediation of cellular differentiation and proliferation in multicellular organisms (Nassrallah et al., 2018), however, no known roles could be found of Det1 in the process of neuroinflammation. Similarly, although previous roles of Bcl6b and Dusp6 have been found in the regulation of inflammatory responses (Bunting and Melnick, 2013) and endothelial inflammation (Hsu et al., 2018), respectively, their precise roles in the process of neuroinflammation are yet to be studied. These findings present important genes for further detailed studies with respect to the modulation of neuroinflammatory process in hippocampus tissue. Also, the brain region along with gender differences are also evident from the current study highlighting the need to focus on individual brain regions of each gender.

CONCLUSIONS AND RECOMMENDATIONS

In the current study, we have presented the expression profiles IL-1B associated transcription factor Etv5 along with some of its interacting partners as molecular targets of neuroinflammatory process. Also, the current study presents the dissection of these TFs with respect to not only the two important brain regions hippocampus and cerebellum due to their functional implications in memory and motor function, respectively, but also with respect to gender differences. Moreover, the identification of significantly differentially expressed genes present interesting target genes for further studies on neuroinflammation. Furthermore, future research on the extensive molecular characterization of all brain regions as well as individual cell types could provide a complete landscape not only for the recognition of each of these brain regions and cells in the process of neuroinflammation, but also would guide the development of more targeted therapeutic interventions.

ACKNOWLEDGEMENT

Funds for this study were provided by the University of the Punjab.

DECLARATIONS

Ethical statement

The study was approved by the Institutional Review Board (IRB) and Institutional Animal Care and Use Committee (IACUC) of University of the Punjab

Data availability statement

All the data has been included in this article.

Supplementary material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20220612100622

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Acuner-Ozbabacan, S.E., Gursoy, A., Nussinov, R., and Keskin, O., 2014. The structural pathway of interleukin 1 (IL-1) initiated signaling reveals mechanisms of oncogenic mutations and SNPs in inflammation and cancer. PLoS Computat. Biol., 10: e1003470. https://doi.org/10.1371/journal.pcbi.1003470

Braddock, M., and Quinn, A., 2004. Targeting IL-1 in inflammatory disease: New opportunities for therapeutic intervention. Nat. Rev. Drug Discov., 3: 330-340. https://doi.org/10.1038/nrd1342

Bunting, K.L., and Melnick, A.M., 2013. New effector functions and regulatory mechanisms of BCL6 in normal and malignant lymphocytes. Curr. Opin. Immunol., 25: 339-346. https://doi.org/10.7554/eLife.37892

Cacabelos, R., Alvarez, X.A., Fernandez-Novoa, L., Franco, A., Mangues, R., Pellicer, A., and NIshimura, T., 1994. Brain interleukin-1 beta in Alzheimer’s disease and vascular dementia. Meth. Find. exp. clin. Pharmacol., 16: 141-151.

Cacabelos, R., Franco-Maside, A., and Alvarez, X.A., 1991. Interleukin-1 in Alzheimer’s disease and multi-infarct dementia: neuropsychological correlations. Meth. Find. exp. clin. Pharmacol., 13: 703-708.

Dinarello, C.A., 1996. Biologic basis for interleukin-1 in disease. Blood, 87: 2095-2147. https://doi.org/10.1111/jnc.13607

Dinarello, C.A., 2004. Therapeutic strategies to reduce IL-1 activity in treating local and systemic inflammation. Curr. Opin. Pharmacol., 4: 378-385. https://doi.org/10.1016/j.coph.2004.03.010

DiSabato, D.J., Quan, N., and Godbout, J.P., 2016. Neuroinflammation: The devil is in the details. J. Neurochem., 139(S2): 136-153. https://doi.org/10.1111/jnc.13607

Eder, C., 2009. Mechanisms of interleukin-1beta release. Immunobiology, 214: 543-553. https://doi.org/10.1016/j.imbio.2008.11.007

Expression Atlas, 2020. Human immunochemistry data on 83 different normal cell types from 44 tissue types from the human protein atlas project. [cited 2020 21 Aug]; Available from https://www.ebi.ac.uk/gxa/experiments/E-PROT-3/Results?geneQuery=%5B%7B%22value%22%3A%22ensg00000244405%22%7D%5D https://www.surveymonkey.co.uk/r/EAsurvey22

Fagerberg, L., Hallstroem, B.M., Oksvold, P., Kampf, C., Djureinovic, D., Odeberg, J., Habuka, M., Tahmasebpoor, S., Danielsson, A., Edlund, K., Asplund, A., Sjoestedt, E., Lundgerg, E., Szigyarto, C.A.K., Skogs, M., Takanen, J.O., Berling, H., Tegel, H., Mulder, J., Nilsson, P., Schwenk, J.M., Lindskog, C., Danielsson,F., Mardinoglu, A., Sivertsson, A., von Feilitzen, K., Forsberg, M., Zwahlen, M., Olsson, I., Navani, S., Huss, M. Nielson, J., Ponten, F. and Uhlen, M., 2014. Analysis of the human tissue-specific expression by genome-wide integration of transcriptomics and antibody-based proteomics. Mol. Cell. Proteomics, 13: 397-406. https://doi.org/10.1074/mcp.M113.035600

Fan, Z., Soderr, S., Oehler, S., Fundel, K. and Aigner, T., 2007. Activation of interleukin-1 signaling cascades in normal and osteoarthritic articular cartilage. Am. J. Pathol., 171: 938-946. https://doi.org/10.2353/ajpath.2007.061083

Feinstein, D.L., Kalinin, S. and Braun, D., 2016. Causes, consequences, and cures for neuroinflammation mediated via the locus coeruleus: Noradrenergic signaling system. J. Neurochem., 139(S2): 154-178. https://doi.org/10.1111/jnc.13447

Gorantla, S., Liu, J., Sneller, H., Dou, H., Holguin, A., Smith, L., Ikezu, T., Volsky, D.J., Poluektova, L., and Gendelman, H.E., 2007. Copolymer-1 induces adaptive immune anti-inflammatory glial and neuroprotective responses in a murine model. https://doi.org/10.4049/jimmunol.179.7.4345

Gorantla, S., Liu, J., Wang, T., Holguin, A., Sneller, H.M., Dou, H., Kipnis, J., Poluektova, L., Gendelman, H.E., 2008. Modulation of innate immunity by copolymer-1 leads to neuroprotection in murine HIV-1 encephalitis. Glia, 56: 223-232. https://doi.org/10.1002/glia.20607

Guzman-Martinez, L., Maccioni, R.B., Andrade, V., Navarrete, L.P., Pastor, M.G. and Ramos-Escobar, N., 2019. Neuroinflammation as a common feature of neurodegenerative disorders. Front. Pharmacol., 10: 1008. https://doi.org/10.3389/fphar.2019.01008

Herzog, C., Kaushal, G.P. and Haun, R.S., 2005. Generation of biologically active interleukin-1beta by meprin B. Cytokine, 31: 394-403. https://doi.org/10.1016/j.cyto.2005.06.012

Hewett, S.J., Jackman, N.A. and Claycomb, R,J., 2012. Interleukin-1β in central nervous system injury and repair. Eur. J. Neurodegr. Dis., 1: 195-211.

Hsu, S.F., Lee, Y-B., Lee, Y-C., Chung, A-L., Apaya, M.K., Shyur, L-F., Cheng, C-F., Ho, F-M., and Merng, T-C., 2018. Dual specificity phosphatase DUSP6 promotes endothelial inflammation through inducible expression of ICAM-1. FEBS J., 285: 1593-1610. https://doi.org/10.1111/febs.14425

Hu, R.D., Zhang, W., Li, L., Zuo, Z-Q., Ma, M., Ma, J-F., Yin, T-T., Gao, C.Y., Yang, S-H., Zhao, Z-B., Li, Z-J., Qiao, G-B., Lian, Z-X. and Qu, K., 2021. Chromatin accessibility analysis identifies the transcription factor ETV5 as a suppressor of adipose tissue macrophage activation in obesity. Cell Death Dis., 12: 1023. https://doi.org/10.1038/s41419-021-04308-0

Khan, A., Khalid, Z., and Shakoori, A.R., 2022. Identification of transcription factors differentially expressed under neuroinflammatory conditions: Analysis of rna-seq datasets combined with an unconventional exploratory approach. Crit. Rev. Eukary. Gene Expr., https://doi.org/10.1615/CritRevEukaryotGeneExpr.2022044272

Koh, B., Hufford, M.W., Pham, D., Olson, M.R., Wu, T., HJaberen, R., Sun, X. and Kaplan, M.H., 2016. The ETS family transcription factors Etv5 and PU.1 function in parallel to promote Th9 cell development. J. Immunol., 197: 2465-2472. https://doi.org/10.4049/jimmunol.1502383

Koh, B., Hufford, M.W., Sun, X., and Kaplan, M.H., 2017. Etv5 regulates IL-10 Production in Th cells. J. Immunol., 198: 2165-2171. https://doi.org/10.4049/jimmunol.1600801

Kwon, H.S. and Koh, S-H., 2020. Neuroinflammation in neurodegenerative disorders: The roles of microglia and astrocytes. Transl. Neurodegener., 9: 42. https://doi.org/10.1186/s40035-020-00221-2

Lahiri, T., Moore, P.E., Baraldo, S., Whitehead, T.R., Mckenna, M.D., Panettieri Jr., R.A. and Shore, S.A., 2002. Effect of IL-1beta on CRE-dependent gene expression in human airway smooth muscle cells. Am. J. Physiol. Lung Cell. mol. Physiol., 283: L1239-1246. https://doi.org/10.1152/ajplung.00231.2001

Leal, M.C., Casabona, J.C., Puntel, M. and Pitossi, F.J., 2013. Interleukin-1β and tumor necrosis factor-α: Reliable targets for protective therapies in Parkinson’s Disease? Front. Cell. Neurosci.,7:1-10. https://doi.org/10.3389/fncel.2013.00053

Li, K.W., 2011. Springer protocols: Neuroproteomics (Neuromethods, 57). Humana Press, Springer, New York.

Lin, C.C. and Edelson, B.T., 2017. New Insights into the role of IL-1β in experimental autoimmune encephalomyelitis and multiple sclerosis. J. Immunol., 198: 4553-4560. https://doi.org/10.4049/jimmunol.1700263

Lyman, M., Lloyd, D.G., Ji, X., Vizcaychipi, M.P., and Ma, D., 2014. Neuroinflammation: The role and consequences. Neurosci. Res., 79: 1-12. https://doi.org/10.1016/j.neures.2013.10.004

McCarthy, D.J., Chen, Y. and Smyth, G.K., 2012. Differential expression analysis of multifactor RNA-Seq experiments with respect to biological variation. Nucl. Acid Res., 40: 4288-4297. https://doi.org/10.1093/nar/gks042

Meissner, F., Molawi, K., and Zychlinsky, A., 2010. Mutant superoxide dismutase 1-induced IL-1beta accelerates ALS pathogenesis. Proc. natl. Acad. Sci. USA, 107: 13046-13050. https://doi.org/10.1073/pnas.1002396107

Nassrallah, A., Rougee, M., Bourbousse, C., Drevensek., S., Fonseca, S., Iniesto, E., Ait Mohamed, O., Deton-Cabanillas, A-F., Zebulon, G., Ahmed, I., Stroebel, D., Masson, V., Lombard, B., Eeckhout, D., Gevaert, K., Loew, D., Genovesio, A., Breyton, C., De Jaeger, G. Bowler, C., Rubio, V., and Barneche, F., 2018. DET1-mediated degradation of a SAGA-like deubiquitination module controls H2Bub homeostasis. Elife, 7: e37892. https://doi.org/10.7554/eLife.37892

Ndoja, A., Reja, R., Lee, S-H., Wenbster, J.D., Ngu, H., Rose, C.M., Kirkpatrick, D.S., Modrusan, Z., Chen, Y-J. J., Dugger, D.L., Gandham, V., Xie, L., Newton, K. and Dixit, V.M., 2020. Ubiquitin ligase COP1 suppresses neuroinflammation by degrading C/EBPβ in microglia. Cell, 182: 1156-1169.e12. https://doi.org/10.1016/j.cell.2020.07.011

Niu, Z., Goodyear, S.M., Rao, S., Wu, X., Tobias, J.W., Avarbock, M.R., and Brinster, R.L., 2011. MicroRNA-21 regulates the self-renewal of mouse spermatogonial stem cells. Proc. natl. Acad. Sci. USA, 108: 12740-12745. https://doi.org/10.1073/pnas.1109987108

Oh, S., Shin, S. and Janknecht, R., 2010. ETV1, 4 and 5: An oncogenic subfamily of ETS transcription factors. Biochim. biophy. Acta, 1826: 1-12. https://doi.org/10.1016/j.bbcan.2012.02.002

Ouyang, W., Jacobson, N.G., Bhattacharya, D., Gorham, J.D., Fenoglio, D., Sha, W.C., Murphy, T.L., and Murphy, K.M., 1999. The Ets transcription factor ERM is Th1-specific and induced by IL-12 through a Stat4-dependent pathway. Proc. natl. Acad. Sci. USA, 96: 3888-3893. https://doi.org/10.1073/pnas.96.7.3888

Perez, R.L., Ritzenthaler, J.D., and Roman, J., 1999. Transcriptional regulation of the interleukin-1beta promoter via fibrinogen engagement of the CD18 integrin receptor. Am. J. Respir. cell. mol. Biol., 20: 1059-1066. https://doi.org/10.1165/ajrcmb.20.5.3281

Pham, D., Sehra, S., Sun, X. and Kaplan, M.H., 2014. Transcription factor Etv5 controls TH17 cell development and allergic airway inflammation. J. Allergy clin. Immunol.,134: 204-214. https://doi.org/10.1016/j.jaci.2013.12.021

Pyrillou, K., Burzynski, L.C., and Clarke, M.C.H., 2020. Alternative pathways of IL-1 activation, and its role in health and disease. Front. Immunol., 11: 613170. https://doi.org/10.3389/fimmu.2020.613170

Ritchie, M.E., Phipson, B., Wu, D., Hu, Y., Law, C.W., Shi, W., and Smyth, G.K., 2015. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucl. Acid Res., 43: e47-e47. https://doi.org/10.1093/nar/gkv007

Rojo, L.E., Fernwandez, J.A., Maccioni, A.A., Jimenez, J.M., and Maccioni, R.B., 2008. Neuroinflammation: Implications for the pathogenesis and molecular diagnosis of Alzheimer’s disease. Arch. med. Res., 39: 1-16. https://doi.org/10.1016/j.arcmed.2007.10.001

Shirakawa, F., Saito, K., Bonagura, C.A., Galson, D.L., Fenton, M.J., Webb, A.C., and Auron, P.E., 1993. The human prointerleukin 1 beta gene requires DNA sequences both proximal and distal to the transcription start site for tissue-specific induction. Mol. cell. Biol., 13: 1332-1344. https://doi.org/10.1128/mcb.13.3.1332-1344.1993

Stojakovic, A., Paz-Filho, G., Arcos-Burgos, M., Licinio, J., Wong, M-L. and Mastronardi, C.A., 2017. Role of the IL-1p pathway in dopaminergic neurodegeneration and decreased voluntary movement. Mol. Neurobiol., 54: 4486-4495. https://doi.org/10.1007/s12035-016-9988-x

Su, S., Law, C.W., Ah-Cann, C., Asselin-Labat, M-L., Blewitt, M.E. and Ritchie, M.E., 2017. Glimma: Interactive graphics for gene expression analysis. Bioinformatics, 33: 2050-2052. https://doi.org/10.1093/bioinformatics/btx094

Szklarczyk, D., Gable, A.L., Lyon, D., Junge, A., Wyder, S., Huerta-Cepas, J., Simonovic, M., Doncheva, N.T., Morris, J.H., Bork, P. Jensen, L.J., and von Mering, C., 2018. STRING v11: Protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucl. Acids Res., 47: D607-D613. https://doi.org/10.1093/nar/gky1131

Thieu, V.T., Yu, Q., Chang, H-C., Yeh, N., Nguyen, E.T., Sehra, S., and Kaplan, M.H., 2008. Signal transducer and activator of transcription 4 is required for the transcription factor T-bet to promote T helper 1 cell-fate determination. Immunity, 29: 679-690. https://doi.org/10.1016/j.immuni.2008.08.017

Tjitro, R., Campbell, L.E., Basova, L., Johnson, J., Najera J.A., Lindsey, A., Marcondes, M.C.G., 2018. Modeling the function of TATA box binding protein in transcriptional changes induced by HIV-1 Tat in innate immune cells and the effect of methamphetamine exposure. Front. Immunol., 9: 3110. https://doi.org/10.3389/fimmu.2018.03110

Warnes, G., Bolker, B., Bonebakker, L., Gentleman, R., Huber, W., Liaw, A., Lumley, T., Maechler, M., Magnusson, A., and Moeller, S., 2005. Gplots: Various R programming tools for plotting data. 2. https://cran.r-project.org/package=gplots

Wu, X., Goodyear, S.M., Tobias, J.W., Avarbock, M.R. and Brinster, R.L., 2011. Spermatogonial stem cell self-renewal requires ETV5-mediated downstream activation of brachyury in mice. Biol. Reprod., 85: 1114-1123. https://doi.org/10.1095/biolreprod.111.091793

Zepter, K., Haffner, A., DeLuca, D., Tang, H., Fisher, P., Chavinson, J., and Elmets, C., 1997. Induction of biologically active IL-1 beta-converting enzyme and mature IL-1 beta in human keratinocytes by inflammatory and immunologic stimuli. J. Immunol., 159: 6203-6208.

Zhang, Z., Sui, P., Dong, A., Hassell, J., Cserjesi, P., Chen, Y-T., Behringer, R.R. and Sun, X., 2010. Preaxial polydactyly: interactions among ETV, TWIST1 and HAND2 control anterior-posterior patterning of the limb. Development, 137: 3417-3426. https://doi.org/10.1242/dev.051789

Zhang, Z., Verheyden, J.M., Hassell, J.A., and Sun, X., 2009. FGF-regulated Etv genes are essential for repressing Shh expression in mouse limb buds. Dev. Cell, 16: 607-613. https://doi.org/10.1016/j.devcel.2009.02.008