Proliferation Capacity and Expression of Cell Cycle Genes in Normal and Gestational Diabetes Affected WJMSCs

Nabila Rasheed1, Shumaila Usman2*, Madeeha Sadiq3, Bushra Wasim3, Kanwal Haneef4, Hafsa Shafqat3, Tabinda Urooj3 and Saman Rashid4

1Department of Anatomy, RYK Medical and Dental College, Rahim Yar Khan, Pakistan

2Department of Molecular Medicine, Ziauddin University, Karachi

3Department of Anatomy, Ziauddin University, Karachi

4Dr. Zafar H. Zaidi Center for Proteomics, University of Karachi, Karachi

ABSTRACT

Wharton’s jelly derived mesenchymal stem cells (WJMSCs) are a well-known source for the regenerative approach. Current investigation shows that the metabolic disorders like gestational diabetes mellitus (GDM) are not only responsible for several disease factors in adult life but also have adverse effects on perinatal environment as well as on the cellular properties of WJMSCs. This study was designed to determine the effects of gestational diabetes mellitus (GDM) on proliferation of WJMSCs (GDM-WJMSCs). Mesenchymal stem cells were isolated from Wharton’s jelly tissue of normal(healthy) samples and from the GDM affected sample. The isolated cells were characterized for the presence of stem cells markers by Immunocytochemistry. After characterization, the analysis of GDM effect on WJMSCS proliferation rate was analyzed by calculating the population doubling time of the cells at different passages (P0-P3). Moreover, the expression of the important cell cycle genes (CDCA2, CDCA8, CDC20, and CCNA2) was analyzed by quantitative PCR to determine the effect of GDM at gene level. The isolated cells expressed the stem cell specific marker CD90 which confirmed that the isolated cells are WJMSCs. Population doubling time (PDT) was found to be increased in the early passages (P0-P1) in GDM-WJMSCs as compared to control WJMSCs. However, at later passages (P2, P3 stages) PDT was decreased and an improvement in the proliferation rate was observed. The fold change expression of cell cycle genes was found to be decreased in GDM-WJMSCs as compared to control WJMSCs. This study concluded that the GDM affect the expression of cell cycle genes, hence the cells proliferate slow as compared to the normal cells. The GDM affected cells had a high population doubling time in the early passages but when the cells were grown in vitro in controlled environment the cells proliferate efficiently, suggesting that the GDM affected WJMSCs can also be utilized for the regenerative purpose after improving the proliferation rate of the cells.

Article Information

Received 25 October 2021

Revised 15 May 2022

Accepted 01 June 2022

Available online 02 August 2022

(early access)

Published 31 July 2023

Authors’ Contribution

NR collected the data, wrote the article, analyzed all the data and did all the experiments with seniors’ supervisors. SU designed the study, conducted the experiment and analyzed the data. MS helped out in formulation of data and arranged all the data in sequence and helped in writing. BW supervised the study with her expertise. KH performed the isolation of primary culture planned the study, and helped out to in different experiments. HS, TU and SR helped out in sample collection, procedures and writing.

Key words

Gestational diabetes, Regenerative medicine, Population doubling time, Wound healing, Inverted microscope

DOI: https://dx.doi.org/10.17582/journal.pjz/20211025081055

* Corresponding author: [email protected]

0030-9923/2023/0005-2221 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Regenerative medicine is a branch of medicine related to evolving treatments for the repair of injured, unhealthy or impaired cells, tissues or organs to maintain the normal function of the cells (Bajada et al., 2008). Invention and exploration in nanotechnologies, tissue engineering, bioimaging and stem cells are vital to the advancement of regenerative medicine, as validated by current case studies and scientific trials (Forraz and McGuckin, 2011).

In the human body, an endogenous system of renewal and renovation are present, where stem cells are present nearly in every tissue. These cells have two important properties, i.e., self-renewal ability, and the capability of multiline age differentiation into diverse cell lineages. High differential potential, easy isolation procedures and good proliferation rate made them a decent choice for regenerative medicine application (Kolli et al., 2010; Azzopardi and Blundell, 2018).

On the basis of sources, we classify the stem cells into two main categories, embryonic and non-embryonic stem cells. The embryonic stem cells (ESCs) are pluripotent, self-recommencing cells, isolated from the blastocyst cell mass and can be distinguished into all three germ layers cells (b) Non-Embryonic Stem cells, typically include stem cells from adult sources, have limited differentiation ability. These cells can be sequestered from several tissues including bone marrow, adipose tissue, dental tissues, skin, umbilical cord and placenta and are the widely used stem cells in different clinical conditions (Li et al., 2017).

Large numbers of mesenchymal stem cells (MSCs) are present in Wharton jelly tissue, that grasp countless prospective for usage in cell-based beneficial and clinical approaches because of the inherent capability of self-renewal and differentiation into numerous cells i.e., adipose tissue, bone marrow, skeletal muscle and cartilage (Ross et al., 2006) dependent on the precise micro environment.

Wharton’s Jelly derived MCSs are utilized for different clinical conditions. Literature reports that their properties are altered by several metabolic conditions. Recent studies have shown a link between gestational diabetes mellitus (GDM), a communal metabolic condition during pregnancy and development of functional alterations in stem cells properties (An et al., 2017). GDMis a temporary metabolic condition resulting from glucose derangement and intolerance due to insulin insensitivity during pregnancy (Buchanan et al., 2012). Literature reports that gestational diabetes affects the cellular characteristics of WJ-MSCs. GDM affected WJMSCs also showed decreased multiline age distinction capacities than normal WJ-MSCs. Additionally, GDM affected WJ-MSCs showed diminished mitochondrial activity which causes reduced proliferation capacity of MSCs and premature senescence (Jensen and Mehta, 2016; Lawlor, 2013; Kim et al., 2014). In 2015 a study showed the role of gestational diabetes related endothelial dysfunctioning. Microarray data shows different genes like CDC20, CDC A2, CDCA8 participate in different steps of cell division cycle. CDC A2 gene translates a pointing subunit of the cell-cycle related protein phosphatase which helps in nuclear envelope renovation and regulate the DNA damage reaction. CDCA8 gene encodes the protein which is essential for chromatin-stimulated microtubule maintenance and formation of spindles and CDC20, functions to initiate chromatin separation and cell cycle entrance into anaphase. These genes have been reported to be altered in GDM (Samar et al., 2015).

This study was designed to determine the effects of GDM on the proliferation of the WJMSCs by analyzing the population doubling time of the cells at different passages and on the gene expression of cell cycle genes. This study was different from the previous study (Samar et al., 2015) as. Samar et al. (2015) identified the decreased function of cell cycle genes from microarray data and worked on endothelial cells. We identified for the very first time about the actual cause of decreased proliferation rate in diabetic WJMSCs at genetic level.

MATERIALS AND METHODS

Study setting

This was an experimental study, performed at Multi-Disciplinary Research Lab and PCR lab Ziauddin University Karachi, Pakistan after taking ethical approval from the Ethical Research Committee Ziauddin University.

Inclusion criteria

Umbilical cords were obtained from normal and gestational diabetic mothers of full-term cesarean sections, aged between 18 to 30 yrs. (primary gravida), after taking informed consent. The verdict of GDM was founded on the International Association of Diabetes and Pregnancy Study Groups Consensus and Panel recommendation, (OGTT at 20 weeks, controlled GDM patients by diet and exercise).

Exclusion criteria

All Hepatitis B and C positive mothers, a pre-pregnancy diagnosis of diabetes any complicated pregnancies with conditions of fetal anomaly/ IUGR, PIH, preeclampsia, ruptured membranes/ placenta previa were excluded for the study.

Isolation and expansion of WJMSCs

The tissue was washed many times with sterilized PBS solution and cut into 3mm thick portions. After that Wharton’s jelly was scratched with the help of the scalper. Trypsin was added for tissue digestion and cells harvesting. Following digestion, the tissue pieces were cultured in Dulbecco’s modified eagle medium (DMEM) containing pen/strep, antifungal drug, sodium pyruvate, L glutamine and 10% fetal bovine serum (FBS) in 5 % CO2 incubator at 37 °C for further cell proliferation.

Subculturing

When 80% cells confluency was achieved, cells were transferred into T25 cm flasks. Medium were aspirated prior cells washing with sterile PBS. 2-3 mL of 0.25% trypsin was added to the cells and incubated at 37 °C for 4-5 min. After incubation whole medium was supplemented to inhibit the trypsin action and the detached cells were collected in falcon tubes, followed by centrifugation at 300 X g for about 8 min. The cell pellet was re-suspended in the fresh medium and cultured in two T25 flasks for further cell proliferation.

Characterization of WJMSCs by immunocytochemistry

For the confirmation of isolated WJMSCs, Immunocytochemistry was performed WJMSCs (~10,000 cells) were cultured in 24 well plate. After proper cell attachment, medium was aspirated and the cells were gently rinsed twice with 1X PBS, fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS for 15 min. The cells were rinsed 2-3 times with 1X PBS and incubated in blocking solution overnight at 4 °C with primary antibodies at 1:100 dilution against CD90 and ACTIN. After incubation, the antibody solution was removed and cells were rinsed with PBS and incubated for 1 h at RT with Alexa fluor 546 donkey anti rabbit secondary antibody at a dilution of 1:200. This was followed by washing with 1X PBS. Nuclei were counterstained with 0.5μg/mL 4, 6 Diamidino-2-phenylindole (DAPI) for 5mint. Finally, cells were rinsed 5 times with PBS, and observed under inverted fluorescent microscope (Floid cell imaging system).

After the confirmed presence of WJMSCs by Immunocytochemistry, experiments for population doubling time and gene expression analysis were performed.

Population doubling time

It is defined as the period unit used by a cell inhabitant to grow and double its number. For population doubling time (PDT), normal-WJMSCs and GDM-WJMSCs were plated on 6-well culture plates at 10,000 cells per well. The experiment was done in triplicates. Time taken by the cells to reach 80-90% confluency was observed. The cells were harvested with trypsin and the PDT was calculated at different passages (P0, P1, P2, P3) by using the following formula.

PDT= culture time (CT)/population doubling number (PDN)

Population doubling number = log Ni/Nf*3.31 where, Ni = initiating numbers; Nf = numbers at harvesting stage.

Gene expression analysis of cell cycle genes (CDCA2, CDCA8, CDC20, CCNA2)

RNA isolation and quantification

RNA was isolated from the cultured cells in 30μl reaction volume using TRIZOL method. Medium was removed and cells were washed with 1X PBS twice. After that cell were trypsinzed and the pellet was resuspended in Trizol reagent. Chloroform was added for the phase separation for 15 min followed by centrifugation at 12000 X g. After centrifugation, upper aqueous part was used for the extraction of RNA. Chilled isopropanol was added for RNA precipitation and then centrifuged at 10,000 X g for about 10 min at 4 oC. 75% ethanol was added for rehydration of RNA. Pellet obtained after centrifugation was dried out and resuspended in 30μL sterile, nuclease free water. The isolated total RNA was quantified with Multi Scan Sky Spectrophotometer.

CDNA synthesis

One microgram RNA was reverse transcribed using Revert Aid First Strand cDNA synthesis kit (Invitrogen, USA) according to manufacturer’s protocol. For the reaction, 1 μg RNA, 1 μL oligo Di was added in the mixture and the total volume was made to 12 μL with Nuclease free water. Then the mixture was incubated at 70°C for 5 min. After that 4 μL 5X reaction buffer, 2 μL dNTPs and 1μL RNase out (20U/μL) were supplemented within the solution tube and incubated at 25 °C for 5 min. After this incubation process, 1 μL of Reverse Transcriptase enzyme was further added, and the sample was incubated at 42°C for 60 min and at 70 °C for 10 min. After incubation, the cDNA was stored at -20 °C for further usage

Quantitative PCR

Expressions of cell division cycle genes were analyzed by quantitative-PCR. All the experiments were done in triplicates. The primers used for q-PCR are enlisted in Table I. 0.4 μL cDNA was added in 9.6 μL SYBR Green master mix and 10μl primers to create a total of 20 μL volume. The denaturation, annealing and extension steps were repeated for 40 cycles. CT values were acquired and relative fold change was calculated by using the following formula. GAPDH was used as housekeeping gene.

ΔCt = Ct (Gene of interest)- Ct (Housekeeping gene)

ΔΔCt = ΔCt (Sample) – ΔCt (Control)

Fold Change = 2^ (- ΔΔCt)

 

Table I. List of primers of cell cycle genes.

Marker	Primer sequences 5`→3`	Product size	Annealing temperature
CDCA2	F: TTGGATGAGGAGTGGTTGGGTGT R: TTGGTTGTGGCTGAGAATGCCTT	181	56˚C
CDCA8	F: GCTCGTTCACCAAGGTTCAGCTTA R: TCTCGATCAGTCCTTCCACACCTA	188	57˚C
CDCA20	F: TCCATTGTGACCTTCAGCCT GCTA R: CTTGGATGCCTGGAGAGTCAATCA	180	57˚C
CCNA2	F: GGGGTCAGCTCGTTACTCAAATTTA R: CACTTCTGGCCACACTTCATACGCA	186	58C

 

Statistical analysis

SPSS version 20 was used for investigating the data. All numerical morals were obtained as mean± S.E of mean. The mean and SEM of the treatment group was generated by independent sample t test. P-value < 0.05 was taken as significant.

RESULTS

Characteristics of WJMSCs

The isolated cells had shown positive expression of the stem cell marker (CD90) and the internal control (Actin) confirming the isolation of WJMSCs from the Wharton’s jelly of the cord tissue (Fig. 1a, b).

 

PDT

For PDT WJMSCs (control) and GDM-WJMSCs were allowed to grow in the 6 well plate at different passages and the time taken by the cells to reach the confluency was calculated. It was observed that the GDM WJMSCs showed significant decreased proliferation rate with increased PDT especially at P0, P1 stages as compared to WJMSCs (control). We also found that the PDT decreased at later passages i.e., P2, P3 in both groups (Tables II, III).

Expression of cell cycle genes

To determine the effect of GDM on cell proliferation at gene level, the expression of cell cycle genes was analyzed by quantitative PCR and compared with control. GDMWJMSCS showed decreased expression of CDCA2, CDCA8, CDCA20 and CCNA2 (p< 0.001) as compared to the control cells (Fig. 2).

 

Table II. Effect of GDM on population doubling time (PDT) of WJMSCs. GDM WJMSCs showed a significantly significant decreased proliferation rate with increased population doubling time. We also find out with increased passaging stage (P2, P3) within both groups, PDT was decreased and an improvement in the proliferation rate was seen for both groups implicating betterment for GDM WJMSCs group as well.

Passage stage	Control Mean±S.D	GDM WJMSCs Mean±S.D	P value
P0	39.26±0.3	40.12±0.6	0.009
P1	33.7±0.64	35.4±0.40	0.018
P2	22.4±0.30	26.1±0.20	0.0001
P3	15.66±0.35	16.83±0.15	0.015

 

Independent sample t test was used. Significant at <0.05.

 

Table III. Multiple comparison of PDT in GDM group.

Stages	GDM MEAN±S.D	Oneway ANOVA P-value	Multiple comparison
P0	40.1±0.6		P0-P1 P0-P2 (significant) P0-P3
P1	35.4±0.40		P1-P0 P1-P2 (significant) P1-P3
P2	26.1±0.20	<0.0001*	P2-P0 P2-P1 (significant) P2-P3
P3	16.8±0.15		P3-P0 P3-P1 (significant) P3-P2

 

*, p-value <0.05; **, p-value <0.01; ***, p-value <0.001; *, significant; **, highly significant; ***, very highly significant.

 

 

DISCUSSION

GDM, a communal metabolic condition occurs due to intolerance of glucose during second trimester of gestation (Kanafi et al., 2013). This condition is mostly pronounced due to the abnormalities in the metabolism of carbohydrate in pregnancy period which leads to glucose intolerance. However, majority of these women are reported to have normal carbohydrate tolerance postpartum (Imam, 2012). The main problem is high glucose level in maternal blood which passes through the placenta into the fetal blood. GDM may result in type 2 diabetes in 50% of women who had GDM in later life. It’s well known that diabetes is characterized as causing metabolic syndrome and the root cause of many adverse medical conditions. Studies show that Asian women have a greater tendency this glucose intolerance condition than those of other continents. Many adverse effects of GDM have been reported that affects the mother and fetus both, early diagnosis and suitable treatment is imperative for better outcomes of GDM affected pregnancies (Vrachnis et al., 2012).

Different literature reports decreased proliferation rate in stem cells affected by hyperglycemic state during pregnancy. Kim et al. (2014), and Baines et al. (2014) showed a substantial alteration in the propagation of UCMSCs isolated from GDM patients compared to control. Their study revealed that GDM affected stem cells did not proliferate till passage 6 or 7 compared to N-UCMSC in cultured environment. Another study reported that hyperglycemia during pregnancy leads to reduction in the proliferation rate and increased doubling time of stem cells to divide and proliferate (Leboyer et al., 2016).

In 2012 a study reported that because of increased level of LDH due to diabetes, proliferation rate was reduced in diabetes affected WJMSCs. This condition mostly found in those females stem cells who were proned to GDM at high levels and their glucose level was controlled by insulin (Kolluru et al., 2012), which may be further exert their own effect to increase the LDH levels and cause decrease cell proliferation.

Another study stated that due to hyperglycemic condition, increased activity of senescence associated beta-galactosidase was found and also an augmented manifestation of cell division cycle inhibitors (p16, p21 and p27 expression), in GDM WJMSCs compared to NWJMSCs signifying their effects on premature cellular senescence.

An et al. (2017) compared the proliferation rate between GDM affected MSCs and normal MSCs. Their findings suggested that GDM leads to adverse effects on cell harvesting and proliferation rate of MSCs during early passaging stages. However, they also found that the decelerated proliferative ability of GDM-MSCs during early passages was improved at later passaging stages because of low glucose conditions (An et al., 2017).

In this study, we assessed the proliferation rate of WJMSCs isolated from the normal and GDM patients and found out decreased proliferation rate in GDM WJMSCs as compared to control cells at the early passage stages (P0, P1). Another very important finding we noted was that, at later passages (P2, P3), the population doubling time was decreased in both groups of WJMSCs, and especially in GDM affected WJMSCs (Fig. 2). This positive finding favors our argument that if favorable environment is provided to the GDM WJMSCs, they have the capability to grow and will improve and increase their proliferation rate as well. This brings us to our proposal that we can treat these cells to make them efficient, for different clinical purposes.

We also performed the gene expression analysis of cell cycle genes, which regulate the different stages of cell cycle. Samar et al. (2015) discussed the cause of decreased cells proliferation in human umbilical cord derived endothelial cells. They found them mechanism of reduced proliferation, which would be due to alterations in the level of VEGF expression and secretion since proliferation of endothelial cells is mainly controlled by VEGF. They also described the role of gestational diabetes in endothelial dysfunction. From his microarray data that the different cell cycles genes participate at different steps of the cell division cycle, altered due to GDM (Samar et al., 2015).

In this study it was observed that the expression of the cell cycle genes was significantly (p<0.001) decreased in GDMWJMSCs as compared to the control cells (Fig. 3). We conclude that GDM plays an important role in the cell cycle delay which is evident from the expression of these cell cycle genes, leading to increase population double time hence slow proliferation of the cells. However, as the cells were cultured in the controlled conditioned the proliferation rate was found to be improved.

Several preconditioning approaches have been used to improve stem cell functions by treatment with various growth factors, hypoxic shock, and anti-aging compounds (Penno et al., 2011; Petersen et al., 2011). Furthermore, studies on WJSMCs would help to shed light on the molecular mechanisms and processes underlying the developing route to metabolic conditions like diabetes and obesity.

CONCLUSION

This study concluded that the actual cause of decreased proliferation rate in GDM-WJMSCs is the down regulation of cell cycle genes. The GDM affected cells had a high population doubling time in the early passages but when the cells were grown in vitro in controlled environment the cells proliferate efficiently. This shows that in the presence of favorable environment, GDM WJMSCs will propagate and maintain their integrity. Suggesting that the GDM affected WJMSCs can also be utilized for the regenerative purpose after improving the proliferation rate of the cells.

These findings may prove to be beneficial in the utilization of these cells for different clinical applications and in stem cells banking. Further studies are required to evaluate the complete molecular mechanism of functional alterations in GDM WJMSCs and improve their clinical and therapeutic approaches.

ACKNOWLEDGMENT

This research was reinforced by research allowances as of Ziauddin University. The authors thankful to the Ziauddin hospital Clifton and North Campuses for providing support in sample collection and experimental procedures.

Statement of conflicts of interest

The authors have declared no conflict of interest.

REFERENCES

An, B., Kim, E., Song, H., Ha, K.S., Han, E.T., Park, W.S., Ahn, T.G., Yang, S.R., Na, S. and Hong, S.H., 2017. Gestational diabetes affects the growth and functions of perivascular stem cells. Mol. Cells, 40: 434. https://doi.org/10.14348/molcells.2017.0053

Azzopardi, J.I., and Blundell, R., 2018. Umbilical cord stem cells. Stem Cell Discov., 8: 1. https://doi.org/10.4236/scd.2018.81001

Baines, H.L., Turnbull, D.M. and Greaves, L.C., 2014. Humanstem cell aging: Do mitochondrial DNA mutations have a causal role? Aging Cell, 13: 201–205. https://doi.org/10.1111/acel.12199

Bajada, S., Mazakova, I., Richardson, J.B. and Ashammakhi, N., 2008. Updates on stem cells and their applications in regenerative medicine. J. Tissue Eng. Regenerat. Med., 2: 169-183. https://doi.org/10.1002/term.83

Buchanan, T.A., Xiang, A.H. and Page, K.A., 2012. Gestational diabetes mellitus: risks and management during and after pregnancy. Nat. Rev. Endocrinol., 8: 639. https://doi.org/10.1038/nrendo.2012.96

Forraz, N. and McGuckin, C.P., 2011. The umbilical cord: A rich and ethical stem cellsourceto advance regenerative medicine. Cell Prolif., 44: 60-69. https://doi.org/10.1111/j.1365-2184.2010.00729.x

Hadarits, O., Zoka, A., Barna, G., Al-Aissa, Z., Rosta, K., Rigo, J., Jr., Kautzky-Willer, A., Somogyi, A., and Firneisz, G., 2016. Increased proportion of hematopoietic stem and progenitor cell population in cord blood of neonates born to mothers with gestational diabetes mellitus. Stem Cells Dev., 25: 13-17. https://doi.org/10.1089/scd.2015.0203

Imam, K., 2012. Gestational diabetes mellitus. Adv. Exp. Med. Biol., 771: 24–34. https://doi.org/10.1007/978-1-4614-5441-0_4

Jensen, H.A. and Mehta, J.L., 2016. Endothelial cell dysfunction as a novel therapeutic target in atherosclerosis. Exp. Rev. Cardiovasc. Ther., 14: 1021-1033. https://doi.org/10.1080/14779072.2016.1207527

Kanafi, M.M., Ramesh, A., Gupta, P.K., Bhonde, R.R., 2013. Influence of hypoxia, high glucose, and low serum on the growth kinetics of mesenchymal stem cells from deciduous and permanent teeth. Cells Tissues Organs, 198: 198e208. https://doi.org/10.1159/000354901

Kim, J., Piao, Y., Pak, Y.K., Chung, D., Han, Y.M., Hong, J.S., Jun, E.J., Shim, J.Y., Choi, J. and Kim, C.J., 2014. Umbilical cord mesenchymal stromal cells affected by gestational diabetes mellitus display premature aging and mitochondrial dysfunction. Stem Cells Dev., 24: 575-586. https://doi.org/10.1089/scd.2014.0349

Kolli, S., Ahmad, S., Lako, M., and Figueiredo, F., 2010. Successful clinical implementation of corneal epithelial stem cell therapy for treatment of unilateral limbal stem cell deficiency. Stem Cells, 28: 597–610. https://doi.org/10.1002/stem.276

Kolluru, G.K., Bir, S.C., and Kevil, C.G., 2012. Endothelial dysfunction and diabetes: effects on angiogenesis, vascular remodeling, and wound healing. Int. J. Vasc. Med., 2012: 918267. https://doi.org/10.1155/2012/918267

Lawlor, D.A., 2013. The society for social medicine John Pemberton lecture 2011. Developmental overnutrition an old hypothesis with new importance. https://doi.org/10.1093/ije/dys209

Leboyer, M., Oliveira, J., Tamouza, R., and Groc, L., 2016. Is it time for immunopsychiatry in psychotic disorders? Psychopharmacology (Berl.), 233: 1651–1660. https://doi.org/10.1007/s00213-016-4266-1

Li, S., Zhu, Y., Yeung, E., Chavarro, J.E., Yuan, C., Field, A.E., Missmer, S.A., Mills, J.L., Hu, F.B. and Zhang, C., 2017. Offspring risk of obesity in childhood, adolescence and adulthood in relation to gestational diabetes mellitus: A sex-specific association. Int. J. Epidemiol., 46: 1533-1541. https://doi.org/10.1093/ije/dyx151

Manea, A., Manea, S.A., Todirita, A., Albulescu, I.C., Raicu, M., Sasson, S., and Simionescu, M., 2015. High-glucose-increased expression and activation of NADPH oxidase in human vascular smooth muscle cells is mediated by 4-hydroxynonenal-activated PPAR and PPAR cell. Tissue Res., 361: 593-604. https://doi.org/10.1007/s00441-015-2120-0

Mantovani, C., Raimondo, S., Haneef, M.S., Geuna, S., Terenghi, G., Shawcross, S.G., and Wiberg, M., 2012. Morphological, molecular and functional differences of adult bone marrow- and adiposederived stem cells isolated from rats of different ages. Exp. Cell Res., 318: 2034-2048. https://doi.org/10.1016/j.yexcr.2012.05.008

Penno, G., Pucci, L., Lucchesi, D., Lencioni, C., Iorio, M.C., Vanacore, R., Storti, E., Resi, V., Di Cianni, G., and Del-Prato, S., 2011. Circulating endothelial progenitor cells in women with gestational alterations of glucose tolerance. Diab. Vasc. Dis. Res., 8: 202-210. https://doi.org/10.1177/1479164111408938

Petersen, K.F., Befroy, D., Dufour, S., Dziura, J., Ariyan, C., Rothman, D.L., DiPietro, L., Cline, G.W. and Shulman, G.I., 2011. Mitochondrial dysfunction in the elderly: possible role in insulin resistance. Science, 300: 1140–1142. https://doi.org/10.1126/science.1082889

Rochette, L., Zeller, M., Cottin, Y., and Vergely, C., 2014. Diabetes, oxidative stress and therapeutic strategies. Biochim. biophys. Acta, 1840: 2709–2729. https://doi.org/10.1016/j.bbagen.2014.05.017

Ross, J.J., Hong, Z., Willenbring, B., Zeng, L., Isenberg, B., Lee, E.H., Ross, J.F., Hong, Z., Willenbring, B., Zeng, L., Isenberg, L., Lee, E.H., Reyes, M., Keirstead, S.A., Weir, E.K., Tranquillo, R.T. and Verfaillie, C.M., 2006. Cytokine-induced differentiation of multipotent adult progenitor cells into functional smooth muscle cells. J. clin. Invest.,116: 3139e49. https://doi.org/10.1172/JCI28184

Samar, A.S., Wantang, L., Yonghong, P.W., Roberts, D.W., and Anne, M.G., 2015. The role of maternal gestational diabetes in inducing fetal endothelial dysfunction. Cell. Physiol., 23: 2695-2705.

Singh, C.K., Kumar, A., Lavoie, H.A., Dipette, D.J., and Singh, U.S., 2013. Diabetic complications in pregnancy are resveratrol a solution? Exp. Biol. Med. (Maywood), 238: 482–490. https://doi.org/10.1177/1535370212473704

Sohni, A., Mulas, F., Ferrazzi, F., Luttun, A., Bellazzi, R., Huylebroeck, D., Sohni, A., Mulas, F., Ferrazzi, F., Luttun, A., Bellazzi, R., Huylebroeck, D., Ekker, C. and Verfailli, C.M., 2012. TGFbeta1-induced Baf60c regulates both smooth muscle cell commitment and quiescence. PLoS One, 7: e47629. https://doi.org/10.1371/journal.pone.0047629

Son, J.H., Paek, S.L., Moon, H.E., Yoon, S.H., Hur,Y.S., Park, H.W., Ha, J.Y., Kim, K-H., Shim, J.H., Yoo, S.H., Son, J.H., Paek, S.L., Kim, I.K., Hwang, J.H., Kim, D.G., Kim, H., Jeon, B.S., Park, S.S. and Paek, S.H., 2013. Mitochondrial dysfunction of immortalized human adipose tissuederived mesenchymal stromal cells from patients with Parkinson’s disease. Exp. Neurobiol., 22: 283-300. https://doi.org/10.5607/en.2013.22.4.283

Vrachnis, N., Antonakopoulos, N., Iliodromiti, Z., Dafopoulos, K., Siristatidis, C., Pappa, K.I., Deligeoroglou, E., and Vitoratos, N., 2012. Impact of maternal diabetes on epigenetic modifications leading to diseases in the offspring. Exp. Diab. Res., https://doi.org/10.1155/2012/538474

Ziaei, M., Zhang, J., Patel, D.V. and McGhee, C.N., 2017. Umbilical cord stem cells in the treatment of corneal disease. Surv. Ophthalmol., 62: 803-815. https://doi.org/10.1016/j.survophthal.2017.02.002