Research Article

Genetic Transformation of Tobacco Serine Acetyltransferase 4 (NtSAT4) gene in Brassica napus L.

Hala Rajab1, Muhammad Sayyar Khan1*, Safdar Hussain Shah1 and Syed Mehar Ali Shah2

1Institute of Biotechnology and Genetic Engineering, The University of Agriculture Peshawar, Khyber Pakhtunkhwa, Pakistan, Postal code 25130; 2Department of Plant Breeding and Genetics, The University of Agriculture Peshawar, Khyber Pakhtunkhwa, Pakistan, Postal code 25130.

Received | August 27, 2019; Accepted | October 18, 2019; Published | November 25, 2019

*Correspondence | Muhammad Sayyar Khan, The University of Agriculture Peshawar; Email: sayyar@aup.edu.pk

Citation | Rajab, H., M.S. Khan, S.H. Shah and S.M.A. Shah. 2019. Genetic transformation of tobacco serine acetyltransferase 4 (NtSAT4) gene in Brassica napus L. Sarhad Journal of Agriculture, 35(4): 1224-1233.

DOI | http://dx.doi.org/10.17582/journal.sja/2019/35.4.1224.1233

Keywords | Brassica napus, Transformation, Serine acetyltransferase, Cysteine, Agrobacterium

Introduction

Increasing industrialization and rapidly growing world populations have brought many challenges in the form of pollutants, which pose serious threats to our environment, agriculture and human health (Gairola et al., 1992; Mazess and Barden, 1991). Although some of the heavy metals like zinc (Zn), iron (Fe), copper (Cu), molybdenum (Mo), cobalt (Co) and manganese (Mn) are nutritionally essential in trace amounts, their excess is potentially harmful (Keeling et al., 2003). Exposure of plants to such toxic elements like Cadmium (Cd), Arsenic (As), Lead (Pd) and mercury (Hg) proved to have acute and chronic toxic effects on the plants’ health and productivity (Divrikli et al., 2006). Due to their strong affinity with the soil, they cannot be removed by normal cropping or rain water so they remain to be non-biodegradable (Tandi et al., 2004). On worldwide level, Cd sedimentation ranged between 0.03-1 mg/kg while on average the level of Cd in soil in various regions in Pakistan ranged from 0.02 to 184 mg/kg (Muhammad et al., 2011; Perveen et al., 2012).

Various conventional methods used to clean up these environmental pollutants are laborious and economically not feasible particularly in developing countries. The use of phytoremediation to clean up the environment through plants has been reported to be 10-100 folds cheaper and easier to be implemented (Pilon-Smits, 2005), though, plants’ tolerance and their accumulation to such pollutants is a limitation.

The use of Brassica napus (canola) for phytoextraction has gained interest for cleaning the lands polluted with heavy metals (Van Ginneken et al., 2007). The species of Brassicaceae family has exhibited an extraordinary hyperaccumulator ability to heavy metal accumulation (Ebbs and Kochian, 1997). B. napus was reported to be one of the most suitable plants and can act as one of the most powerful phytoaccumulator to be used in heavy metal contaminated areas to clean up the environment (Angelova et al., 2017). Thus transformation of oilseed rape via Agrobacterium tumefaciens to manipulate and enhance its tolerance to heavy metals bears great potential. The transformation of B. napus via tissue culture is a laborious but most efficient plant transformation method (Moloney et al., 1989). Among the various direct DNA transfer methods, Agrobacterium transformation via tissue culture is considered to be a cost effective technique delivering the specific gene of interest and avoiding the possibility of random vector sequences and foreign DNA integration into the plant genome (Bhalla and Singh, 2008; Nielsen, 2003; Rommens et al., 2004).

The accumulation of heavy metals or xenobiotics triggers the abiotic defense response of plants to form Glutathione (GSH). GSH is one of the most important antioxidant thiol compound which functions in sequestering, chelating these harmful substances in the plants and thus protects them against oxidative stresses including drought and heavy metals (Farago and Brunold, 1994; Foyer and Noctor, 2005; Mullineaux and Rausch, 2005; Rüegsegger and Brunold, 1992). Therefore, one of the promising approaches to enhance the tolerance potential of the plants against abiotic stresses is the genetic manipulation of GSH biosynthesis in plants (Pilon-Smits and Pilon, 2002). To achieve elevated in planta GSH contents, various genes in the assimilatory sulfate reduction pathway have been overexpressed in different plant species. Serine acetyltransferase (SAT, EC 2.3.1.30) which catalyses the acetylation step of L-serine along with the acetyl-CoA is one of the rate limiting enzyme in this context. SAT forms a complex with O-acetylserine-(Thiol) lyase (OAS-TL), which is essential for its activity (Bogdanova and Hell, 1997; Droux et al., 1998; Kredich, 1996). Cys synthesis is tightly regulated by the feedback inhibition of SAT by Cys itself. A Cys-insensitive SAT isoform, was successfully screened by a cDNAs encoding Cys-insensitive SAT isoform from Nicotiana tabacum (Wirtz and Hell, 2003). In this context, NtSAT4 from tobacco was found to be feedback insensitive compared to other SAT isoforms causing a strong GSH production in E. coli host. The Cys-insensitive SAT4 differs from the other SATs by a 3 amino acid deletion at position 380 of the conserved C-terminal end and an insertion of 2 Ser and Cys residues at position 190 of the variable region. The expression of this isoform in bacteria resulted in 50-fold increase of Cys and in turn increases GSH. This NtSAT4 has proved to exhibit complete insensitivity up to 0.6 mM for Cys (Wirtz and Hell, 2003).

In this study, NtSAT4 gene was successfully cloned and subsequently overexpressed in B. napus plant via tissue culture method using cotyledonary explants. The expression of NtSAT4 was targeted to cytosol, plastid and mitochondria. The aim of the study was to obtain stable B. napus transformants overexpressing NtSAT4 to enhance the potential of the plants against heavy metals via overproduction of glutathione.

Materials and Methods

Cloning of NtSAT4 gene in overexpression constructs

NtSAT4 gene to be used as probe was amplified from a cDNA clone (kindly provided by Professor Ruediger Hell, Centre for Organismal Studies, Heidelberg University) using the following specially designed primers.

Forward NtSAT4: 5ʹ-GATCCCATGTCTATAACTACGTTAAATTTCT-3′

Reverse NtSAT4: 5ʹ- AGCTAAATTACATAATCAGACCACTCA-3′

The PCR amplified fragment was then cloned into pCAP primary vectors (pCAP_NtSAT4) with the help of suitable restriction enzymes. Antibiotic-resistant clones were selected for plasmid extraction and further screening of the positive clones was carried out through sequencing. The following primers were used for sequencing.

Forward 35S: 5′-GCAAGTGGATTGATGTGATATC-3′

Reverse NtSAT4: 5′-GCC TAC CAT TTG ACC ATAA TTT ATG-3′

After confirmation, the NtSAT4 fragment, restricted from the pCAP vector was gel purified and successfully cloned into a binary vector pBinAR (Wirtz and Hell, 2003) to produce the cytosolic construct (pBinAR_NtSAT4). The NtSAT4 gene expression in this binary vector is driven by 35S promoter. For the mitochondrial targeting, the NtSAT4 fragment, restricted from the pCAP vector was gel purified and cloned into the binary vector pBinAR-SHMT to produce the mitochondrial overexpression construct (pBinAR-SHMT_NtSAT4). Similarly, for the plastid targeting, the gel purified restricted fragment was cloned in to pBinAR-TKTP containing the plastidic transit peptide signal to get the plastidic overexpression construct (pBinAR-TKTP_NtSAT4). The positive clones from each construct were confirmed via sequencing.

Plant material

The B. napus seeds of genotypes Abasyn-95, Durr-e-Nifa, Nr-1, Nr-6, Nr-7 and ‘Oscar’ were used as the starting material for the study. The seeds of cultivar OSCAR were available at the Institute of corresponding author whereas seeds of all other lines were kindly provided by Nuclear Institute for Food and Agriculture (NIFA), Peshawar, Pakistan.

Plant transformation via floral dip method

The B. napus genotypes ‘Abasyn-95’ and ‘Durr-e-Nifa’ were subjected to transformation by Clough and Bent (1998) floral dip method and grown under long day in the glass house at 25 oC with 16 hrs light and 8 hrs dark conditions. A colony of transformed AGL1 with NtSAT4 gene was allowed to grow overnight in 5ml LB media with antibiotics rifampicin 25 mgL-1, carbenicillin 50 mgL-1 and kanamycin 50 mgL-1. This was subcultured in a 250 ml LB medium and grown to an OD600 of 0.8-1.2. The bacterial was harvested at 6000×g at 4 °C for 15 min. The Agrobacterium pellet was resuspended in transformation medium (sucrose 50 gL-1 and Silwett L-77, 200 µlL-1 acetosyringone) to an OD600 0.8-1.2. The plant’s floral buds were placed in the transformation solution and dipped for about 20 sec, then kept in dark for 24 hrs and later shifted to long day conditions in the glass house to for seed setting.

Plant transformation via tissue culturing

Plant growth conditions: The B. napus genotypes Abasyn-95, Durr-e-Nifa, Nr-1, Nr-6, Nr-7 and Oscar seeds were grown in long day conditions i.e., 16h/8h light/dark at 25 oC with a light intensity 600-3300 lux and humidity 50%. Seeds were surface sterilized and placed on ½ MS media (Murashige and Skoog, 1962) and allowed to germinate in dark or dim light ~660 Lux for 4-5 days.

Transformation using hypocotyls explants: The hypocotyls were removed and cut from the germinated seedlings and pre-cultured for two days. These were infected with transformed strain of Agrobacterium harbouring NtSAT4 genes without or with transit peptides for plastids and mitochondria, for an hour in liquid MS media containing 500 µl an overnight inoculum, acetosyringone 100 µM and sucrose 20%. The media was then replaced with a fresh MS media and allowed to co-cultivate for 48 hrs (Wallbraun et al., 2009). The hypocotyls were transferred to selection MS media containing the suitable hormones (Table 1) and carbencillin 300 mgL-1 to induce callus formation. The developed calli were then shifted to regeneration media to develop green shoots in MS media supplemented with hormones (Table 2), kanamycin 25 mgL-1, carbenicillin 300 mgL-1 and kept to grow under long day conditions.

Table 1: Formulations of growth regulators for callus induction media.

Callus induction media	Auxin mgL-1	Cytokinin mgL-1
CIM 1	NAA 4	BAP 0.4, Kinetin 0.4
CIM 2	NAA 3	BAP 0.3, Kinetin 0.3
CIM 3	2, 4-D 3	BAP 0.3
CIM 4	2, 4-D 0.3	BAP 3
CIM 5	2, 4-D 0.3	BAP 0.2
CIM 6	2, 4-D 0.6	BAP 0.2
CIM 7	2, 4-D 1	BAP 0.2
CIM 8	NAA 0.2	BAP 0.75

 

Transformation using cotyledon explants: The cotyledons of the genotype ‘Oscar’ were cut from the seedling and infected with MS media containing Agrobacterium culture harbouring NtSAT4 gene without or with transit peptides for plastids and mitochondria at OD650nm=0.05 with addition of acetosyringone 100 µM) and regenerated as described by Bhalla and Singh (2008). The cotyledons were dipped into the infection medium in a petri plate for 30 sec and then transferred to a solid co-cultivation MS medium containing MES 0.5 gL-1, 20 g sucrose, pH 5.8, phytagel 4 gL-1, BAP 0.75 mgL-1, NAA 0.2 mgL-1, GA3 0.01 mgL-1and AgNO3 30 µM and kept in dark for 48 hours. The explants were transferred for callus induction to the same MS media plates with the addition carbencillin 500 mgL-1 for one week. The calli were further transferred to shoot induction MS media containing MES 0.5 gL-1, 20 g sucrose, pH 5.8, phytagel 4 gL-1; supplemented BAP 3 mgL-1, NAA 0.2 mgL-1, GA3 0.01 mgL-1, AgNO3 30 µM, carbencillin 500 mgL-1 and kanamycin 50 mgL-1 for four weeks under long day conditions. The shoots were transferred to rooting media supplemented with MS media, MES 0.5 gL-1, sucrose 10 gL-1, IBA 1-3 mgL-1, phytagel 4 gL-1 and kept to develop roots for 2 weeks. The rooted plants were removed, roots washed with luke warm water to remove traces of media and inserted into soil and kept covered to acclimatize under high humidity. Once the plants had acclimated to the glass house conditions, these were uncovered and grown to set flowers. Each plant’s flowers were covered by perforated plastic bags to ensure self fertilization.

Table 2: Combination and concentration of growth regulators for shoot induction media.

Shoot induction	Media Cytokinin mgL-1	Auxin mgL-1	Gibberellin mgL-1
SIM 1	BAP 3	NAA 0.3	--
SIM 2	BAP 0.5	2, 4-D 2	--
SIM 3	BAP 3	NAA 0.5	--
SIM 4	BAP 1	IBA 0.01	GA3 0.01
SIM 5	BAP 3, Coconut water 10%	NAA 0.5	--
SIM 6	BAP 3, Zeatin 1	NAA 0.5	--
SIM 7	Zeatin 3	NAA 0.5	--
SIM 8	Zeatin 4	NAA 0.5	--
SIM 9	BAP 4	NAA 0.4	--
SIM 10	BAP 3	NAA 0.2	GA3 0.01

 

Extraction of gDNA from leaves and Polymerase chain reaction

The gDNA from B. napus leaves was extracted by CTAB method according to Rogers and Bendich (1989). For testing the integration of NtSAT4 gene, the extracted genomic DNA was used as template against the following two different NtSAT4 gene specific primer pairs NtSAT4_F: GCGCACCCATTCCTGAAAAG and NtSAT4_R: TCTGTGAGCACCCCTAGGAA, generating a product of ~250 bp; NtSAT4 F1: GTCTATAACTACGTTAAATTCTG and NtSAT4 R1: CATAATCAGACCACTCATATG, generating a product of ~900 bp.

RNA extraction and reverse transcription PCR (RT-PCR)

Approximately 50 mg of ground leaf material was used for extraction of total RNA with the peq GOLD total RNA Kit. cDNA was synthesized from 500 ng of RNA with the RevertAid ™ Minus First Strand cDNA Synthesis Kit according to the manufacturer’s protocol. cDNA was analyzed for the expression of NtSAT4 through semi-quantitative PCR using NtSAT4 gene specific forward primer: TAGGGGTGCTCACAGAGGAT and reverse primer: GTCCTCGCCGGAACTTTCTT.

Results and Discussion

Production and characterization of NtSAT4 overexpressing oilseed rape lines via floral dip method

Brassica napus was transformed using three constructs that target the feedback-insensitive isoform of the rate limiting enzyme Serine acetyltransferase (SAT), i.e. NtSAT4 from tobacco under the 35S promoter either without transit peptide targeting the cytosol (Figure 1A) or with plastid transit peptide (TKTP) (Figure 1B) and mitochondrial signal sequence (SHMT) (Figure 1C) as described in materials and methods section. Sequencing analysis was carried out for the confirmation of each construct (Supplementary Figure 1).

B. napus cultivars ‘Abasyn-95’ and ‘Durr-e-NIFA’ were transformed with Agrobacterium tumefaciens containing each of the three constructs by floral dip method. Seeds (F2 generation) from about 200 independent putative transgenic lines carrying the three constructs were analyzed by genomic PCR using NtSAT4 (NtSAT4 F1 and R1) specific primers. Out of 200 independent lines, 60 showed positive results for the gene specific primers (Figure 2).

The positive lines were selected and analyzed for their transcript levels using reverse transcription PCR

(RT-PCR) analysis. In comparison to negative and positive controls, the analysis of cDNAs with NtSAT4 specific primers from these selected lines showed no clear overexpression of the gene of interest (Data not shown). Therefore, it became necessary at this stage to have an alternate procedure to obtain stable transformants from oilseed rape.

Generation of tissue cultured transformed B. napus lines via Agrobacterium infection

Transformation of hypocotyls explants: In order to select the most suitable line(s) among the local genotypes for our transformation experiments, seeds of B. napus genotypes i.e., Nr.1, Nr.2, Nr.6 and Nr.7 along with cultivars Durr-e-NIFA and Abasyn-95, were surface sterilized and grown in vitro on half-MS media for seed germination. The hypocotyls of the germinated seedlings were cut in small pieces and kept on callus induction media with different composition for efficient callus induction. The data from these experiments showed great variations among genotypes in terms of producing calli on each of the callus induction media. Among these eight compositions of callus induction media (CIM) as described in Table 1; CIM 1 i.e. MS media containing hormones NAA 4 mgL-1, BAP 0.4 mgL-1 and Kinetin 0.4 mgL-1, showed maximum induction of callus. The response to induce callus is highly genotype dependent as evident from the responses of different genotypes in the same media composition. Among the tested lines, NIFA Nr.6 and NIFA Nr. 2 lines were the most responsive genotypes in terms of callus induction capacity (Figure 3A). All lines showed significant variation in terms of callus induction with specifically Durr-e-NIFA genotype producing the lowest number of calli.

Among the different shoots induction media (SIM) compositions SIM1 i.e. MS media containing NAA 0.3 mgL-1 and BAP 3 mg L-1 showed highest efficiency in shoot induction followed by SIM 4 (Figure 3B and C) as described in Table 2.

Similar to callus induction, response of different genotypes to regeneration also showed high dependency upon the genotype with varying responses to similar media composition. Here again NIFA Nr.6 and NIFA Nr. 2 proved to the best among tested genotypes in terms producing regenerated shoots followed by NIFA Nr. 1. The rest of genotypes showed varying responses to shoot induction with Durr-e-NIFA variety showing the lowest. Based on these findings, we subsequently used these most responsive genotypes i.e. NIFA Nr.1, NIFA Nr.2 and NIFA Nr.6 (Ahmad et al., 2016) in our transformation experiments to develop NtSAT4 overexpression lines.

Although in the absence of Agrobacterium pressure, NIFA Nr.1 and NIFA Nr.6 performed well in terms of producing calli and regeneration but after transformation presumably due to selection pressure the calli producing capabilities of both lines were significantly reduced compared to non-transformed conditions. The calli from both lines were very recalcitrant and the shoots outgrowths from these calli turned purple presumably due to anthocyanin production and bleached subsequently (Figure 3D). The already reported transformation and tissue culture responsive variety Oscar (Belide et al., 2013; Bhalla and Singh, 2008; Zhang et al., 2005) was therefore included in the subsequent experiments.

Transformation of cotyledons explants

B. napus cultivar “Oscar” was further used to be transformed with the three NtSAT4constructs according to Bhalla and Singh (2008)with some modifications. The cotyledons were cut, infected by Agrobacterium harboring the constructs, and then kept for co-cultivation and callus induction in MS media containing the respective hormones. The explants’ cut ends showed swellings, indicating the onset of callus induction (Figure 4A).

The calli were shifted to shoot induction MS media with optimized hormone concentrations and allowed to regenerate directly for 2 to 4 weeks under controlled long day conditions (Figure 4B). Fully developed shoots (Figure 4C) on shoot outgrowth MS media for 2 weeks, developed roots on root induction media in 2-3 weeks (Figure 5A).

Acclimatization of the plants to soil and glass house conditions

The plants with well developed root were removed from the media, washed to remove traces of media and placed into soil in covered small pots to ensure high humidity (Figure 5B). The plants well acclimated to soil conditions were uncovered for few days. These were then shifted to the glass house for the development of stable transgenic plants for flowering and seed setting (Figure 5C).

Transformation efficiency and survival rate

A total of about more than 580 explants were successfully grown through tissue culture procedure undergoing infection, co-cultivation, callus induction and shoot regeneration. There were 76% successfully regenerated shoots and 9% lost under kanamycin selection. However, 13% of the explants were lost due to contamination. The non-transgenic plants turned white or purple showing anthocyanin production due to stress, eventually died and later discarded (Figure 6).

Selection of positive gDNA integrated NtSAT4 lines from F1 generation

Samples from the leaf of plantlets growing on transformation media containing kanamycin 50 mgL-1 were screened for their gene integration by genomic DNA PCR analysis. The leaf material was used to extract DNA with CTAB method by PCR using the specific gene NtSAT4 primers NtSAT4_F/ NtSAT4_R for amplification. Out of 312 plants tested for gDNA, only 110 plants showed positive signal (250 bp) for NtSAT4 gene, indicating that only 35% of the total plants were stably transformed (Figure 7).

Selection of positive gDNA integrated NtSAT4 lines from F2 generation

The positive expressing lines from F1 generation seeds were grown in small soil pots for further analysis. Leaf sample from F2 growing plants were used for gDNA extraction by CTAB method and analyzed for their NtSAT4 gene integration by PCR using the specific gene primers (expected product 250 bp). Among the plants positive lines selected from F1 generation, 64% showed positive gene integration through gDNA PCR in their F2 generation. The representative lines showing positive PCR signal for successful NtSAT4 gene integration targeted to different compartments have been shown (Figure 8). Thus, the positive signal from these lines confirmed successful integration of NtSAT4 gene and stable transformation which is transferred to next generations.

B. napus in our study was transformed with the NtSAT4 gene via floral dip method which showed no positive expression of the gene by their transcript analysis. One possibility that has been reported to be associated with the floral dip method in plant species other than Arabidopsis is that Agrobacteria cells carrying the transgene may have survived the antibiotic selection procedure in intercellular spaces of the plant organs (Davis et al., 2009). Upon genomic DNA extraction, the genomic DNA from plants is somehow contaminated by DNA from the Agrobacteria cells, and therefore gives false positive results in case of genomic DNA PCR analysis. The B. napus in our study was thus transformed via tissue culture by selecting the cultivar OSCAR reported to be one of the suitable genotypes for tissue culture propagation (Belide et al., 2013; Bhalla and Singh, 2008; Zhang et al., 2005). The shoot induction was successful at NAA 0.2 mgL-1 and BAP 3 mgL-1 using cotyledons which was also reported in many studies for B. napus (Bhalla and Singh, 2008; Petrie et al., 2012; Zhang and Bhalla, 2004). However, different concentrations of BAP such as 4.5 mgL-1 have been used in case of cotyledon explants regeneration (Mashayekhi et al., 2008). Roots were induced by IBA @ 3 mgL-1 which produced 100% successful root formation for shoots grown in ½ MS media containing 10 gL-1 sucrose. The same media composition was also used in other studies with 5 mgL-1 IBA (Cardoza and Stewart Jr, 2003), IBA 10 mgL-1 (Cegielska-Taras et al., 2008), NAA 0.2 mgL-1 (Wang et al., 2006). In our study cotyledons transformation showed an efficiency of 35%, while in other studies B. napus Oscar showed higher efficiencies like 68% (Zhang et al., 2005), in SLM046 cultivar 4.7% (Mashayekhi et al., 2008) and 4-25% efficiency (Cardoza and Stewart Jr, 2003); however, B. rapa showed an efficiency of 9% (Wahlroos et al., 2003). The great variations observed in terms of transformation efficiencies for above mentioned genotypes indicate that apart from transformation procedures, the transformation efficiencies are highly dependent on genotypes. The transformation method adopted in this study led to development of a large number of directly regenerated false positive lines presumably due to less effective selection pressure. The comparatively low transformation efficiencies observed for cultivar OSCAR in our study could therefore be attributed to the less effective selection in our method compared to Zhang et al. (2005).

The plants with developed roots were successfully acclimatized to soil conditions were transferred to the glass house for flowering and seed setting. The seeds of this F1 generation were germinated in soil and screened through gDNA PCR and the lines showing positive signal were selected and grown for the second generation (F2). The F2 generated plants were also tested for their genomic integration of NtSAT4 gene and several lines showed positive signal for each of the targeted compartmental lines showing positive integration of NtSAT4 gene in the OSCAR genome and thus successful stable transformation.

Conclusions and Recommendations

Successful stably transformed three kinds of NtSAT4 (Nicotiana tabacum serine acetyltransferase 4) overexpressor Brassica napus lines targeted to cytoplasm, plastids and mitochondria were developed. Following initial selection by selection marker, the independent lines from each compartment were further characterized for NtSAT4 gene integration by testing their gDNA by PCR using the NtSAT4 gene specific primers. The transgenic lines shall be tested for the NtSAT4 expression and SAT activity. Furthermore, the promising lines may be tested against heavy metals and oxidative stresses.

Acknowledgments

The authors pay their gratitude to the Higher Education Commission (HEC)-Pakistan for their funding through grant No. 20-2015/NRPU/RandD, and the German Academic Exchange Service DAAD for their financial support.

Novelty Statement

Previous attempts to enhance in planta cysteine and GSH contents via overexpressing the rate limiting enzyme of cysteine biosynthesis i.e. serine acetyltransferase (SAT) showed limited success because of the strong feedback inhibition of SAT by cysteine. To overcome this technical challenge, feedback insensitive isoforms of SAT from tobacco i.e. NtSAT4 was used in this study which has been reported to exhibit complete insensitivity up to 600 µM for Cys compared to feedback inhibition of SAT by 1.8 µM Cys in water melon, 2.9 µM Cys in Arabidopsis and 7.2 µM Cys in Spinach. Moreover, since Cys biosynthesis take place not only in the plastids, but also in the cytosol and mitochondria, therefore in this study the expression of NtSAT4 was targeted to these three compartments of the cell.

Author’s Contributions

HR conducted the research, MSK designed the project and experiments, HR and MSK wrote the first draft of the manuscripts. SHS, SMAS helped in supervision and critical revision of the data. All authors read and approved the final manuscript.

Supplementary Material

There is supplementary material associated with this article. Access the material online at: http://dx.doi.org/10.17582/journal.sja/2019/35.4.1224.1233

References

Ahmad, K., A. Jalal, H. Rajab, M. Ullah and M.S. Khan. 2016. Screening of promising Brassica napus L. genotypes for callus induction and regeneration. Int. J. Biol. Biotech. 13(2): 203-215

Angelova, V., R. Ivanova, J. Todorov and K. Ivanov. 2017. Potential of rapeseed (Brassica napus L.) for phytoremediation of soils contaminated with heavy metals. J. Environ. Prot. Ecol. 18(2): 468-478.

Belide, S., X.-R. Zhou, Y. Kennedy, G. Lester, P. Shrestha, J.R. Petrie and S.P. Singh. 2013. Rapid expression and validation of seed-specific constructs in transgenic LEC2 induced somatic embryos of Brassica napus. Plant Cell, Tiss. Org. Cult. 113(3): 543-553. https://doi.org/10.1007/s11240-013-0295-1

Bhalla, P.L. and M.B. Singh. 2008. Agrobacterium -mediated transformation of Brassica napus and Brassica oleracea. Nat. Prot. 3(2): 181-189. https://doi.org/10.1038/nprot.2007.527

Bogdanova, N. and R. Hell. 1997. Cysteine synthesis in plants: protein protein interactions of serine acetyltransferase from Arabidopsis thaliana. Plant J. 11(2): 251-262. https://doi.org/10.1046/j.1365-313X.1997.11020251.x

Cardoza, V. and C. Stewart Jr. 2003. Increased Agrobacterium-mediated transformation and rooting efficiencies in canola (Brassica napus L.) from hypocotyl segment explants. Plant Cell Rep. 21(6): 599-604.

Cegielska-Taras, T., T. Pniewski and L. Szała. 2008. Transformation of microspore-derived embryos of winter oilseed rape (Brassica napus L.) by using Agrobacterium tumefaciens. J. Appl. Genet. 49(4): 343-347. https://doi.org/10.1007/BF03195632

Clough, S.J. and A.F. Bent. 1998. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16(6): 735-743. https://doi.org/10.1046/j.1365-313x.1998.00343.x

Davis, A.M., A. Hall, A.J. Millar, C. Darrah and S.J. Davis. 2009. Protocol: Streamlined sub-protocols for floral-dip transformation and selection of transformants in Arabidopsis thaliana. Plant Methods. 5(1): 3. https://doi.org/10.1186/1746-4811-5-3

Divrikli, U., N. Horzum, M. Soylak and L. Elci. 2006. Trace heavy metal contents of some spices and herbal plants from western Anatolia, Turkey. Int. J. Food Sci. Tech. 41(6): 712-716. https://doi.org/10.1111/j.1365-2621.2005.01140.x

Droux, M., M.L. Ruffet, R. Douce and D. Job. 1998. Interactions between serine acetyltransferase and Oacetylserine (thiol) lyase in higher plants. Eur. J. Biochem. 255(1): 235-245. https://doi.org/10.1046/j.1432-1327.1998.2550235.x

Ebbs, S.D. and L.V. Kochian. 1997. Toxicity of zinc and copper to Brassica species: implications for phytoremediation. J. Environ. Qual. 26(3): 776-781. https://doi.org/10.2134/jeq1997.00472425002600030026x

Farago, S. and C. Brunold. 1994. Regulation of thiol contents in maize roots by intermediates and effectors of glutathione synthesis. J. Plant Physiol. 144(4): 433-437. https://doi.org/10.1016/S0176-1617(11)82119-X

Foyer, C.H. and G. Noctor. 2005. Redox homeostasis and antioxidant signaling: a metabolic interface between stress perception and physiological responses. Plant Cell. 17(7): 1866-1875. https://doi.org/10.1105/tpc.105.033589

Gairola, C., G. Wagner and J. Diana. 1992. Tobacco, Cd and health. J. Smoking-Related Dis. 3: 3-6.

Keeling, S., R. Stewart, C. Anderson and B. Robinson. 2003. Nickel and cobalt phytoextraction by the hyperaccumulator Berkheya coddii: implications for polymetallic phytomining and phytoremediation. Int. J. Phytorem. 5(3): 235-244. https://doi.org/10.1080/713779223

Kredich, N.M. 1996. Biosynthesis of cysteine. Escherichia coli and Salmonella. 514-527.

Mashayekhi, M., A. Shakib, M. Ahmad-Raji and K.G. Bezdi. 2008. Gene transformation potential of commercial canola (Brassica napus L.) cultivars using cotyledon and hypocotyl explants. Afr. J. Biotech. 7(24).

Mazess, R.B. and H.S. Barden. 1991. Bone density in premenopausal women: effects of age, dietary intake, physical activity, smoking, and birth-control pills. Am. J. Clin. Nutr. 53(1): 132-142. https://doi.org/10.1093/ajcn/53.1.132

Moloney, M.M., J.M. Walker and K.K. Sharma. 1989. High efficiency transformation of Brassica napus usingAgrobacterium vectors. Plant Cell Rep. 8(4): 238-242. https://doi.org/10.1007/BF00778542

Muhammad, S., M.T. Shah and S. Khan. 2011. Heavy metal concentrations in soil and wild plants growing around Pb–Zn sulfide terrain in the Kohistan region, northern Pakistan. Microchem. J. 99(1): 67-75. https://doi.org/10.1016/j.microc.2011.03.012

Mullineaux, P.M. and T. Rausch. 2005. Glutathione, photosynthesis and the redox regulation of stress-responsive gene expression. Photosyn. Res. 86(3): 459-474. https://doi.org/10.1007/s11120-005-8811-8

Murashige, T. and F. Skoog. 1962. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 15(3): 473-497. https://doi.org/10.1111/j.1399-3054.1962.tb08052.x

Nielsen, K.M. 2003. Transgenic organisms—time for conceptual diversification? Nat. Biotech. 21(3): 227. https://doi.org/10.1038/nbt0303-227

Perveen, S., A. Samad, W. Nazif and S. Shah. 2012. Impact of sewage water on vegetables quality with respect to heavy metals in Peshawar, Pakistan. Pak. J. Bot. 44(6): 1923-1931.

Petrie, J.R., P. Shrestha, S. Belide, M.P. Mansour, Q. Liu, J. Horne, P.D. Nichols and S.P. Singh. 2012. Transgenic production of arachidonic acid in oilseeds. Transgenic Res. 21(1): 139-147. https://doi.org/10.1007/s11248-011-9517-7

Pilon-Smits, E. 2005. Phytoremediation. Annu. Rev. Plant Biol. 56: 15-39. https://doi.org/10.1146/annurev.arplant.56.032604.144214

Pilon-Smits, E. and M. Pilon. 2002. Phytoremediation of metals using transgenic plants. Crit. Rev. Plant Sci. 21(5): 439-456. https://doi.org/10.1080/0735-260291044313

Rogers, S.O. and A.J. Bendich. 1989. Extraction of DNA from plant tissues. in Plant molecular biology manual. pp. 73-83. Springer. https://doi.org/10.1007/978-94-009-0951-9_6

Rommens, C.M., J.M. Humara, J. Ye, H. Yan, C. Richael, L. Zhang, R. Perry and K. Swords. 2004. Crop improvement through modification of the plant’s own genome. Plant Physiol. 135(1): 421-431. https://doi.org/10.1104/pp.104.040949

Rüegsegger, A. and C. Brunold. 1992. Effect of cadmium on γ-glutamylcysteine synthesis in maize seedlings. Plant Physiol. 99(2): 428-433. https://doi.org/10.1104/pp.99.2.428

Tandi, N., J. Nyamangara and C. Bangira. 2004. Environmental and potential health effects of growing leafy vegetables on soil irrigated using sewage sludge and effluent: a case of Zn and Cu. J. Environ. Sci. Heal. Part B. 39(3): 461-471. https://doi.org/10.1081/PFC-120035930

Van Ginneken, L., E. Meers, R. Guisson, A. Ruttens, K. Elst, F.M. Tack, J. Vangronsveld, L. Diels and W. Dejonghe. 2007. Phytoremediation for heavy metal-contaminated soils combined with bioenergy production. J. Environ. Eng. Lands Manage. 15(4): 227-236. https://doi.org/10.3846/16486897.2007.9636935

Wahlroos, T., P. Susi, L. Tylkina, S. Malyshenko, S. Zvereva and T. Korpela. 2003. Agrobacterium–mediated transformation and stable expression of the green fluorescent protein in Brassica rapa. Plant Physiol. Biochem. 41(9): 773-778. https://doi.org/10.1016/S0981-9428(03)00119-0

Wallbraun, M., K. Sonntag, C. Eisenhauer, G. Krzcal and Y. Wang. 2009. Phosphomannose-isomerase (pmi) gene as a selectable marker for Agrobacterium-mediated transformation of rapeseed. Plant Cell, Tiss. Org. Cult. 99(3): 345-351. https://doi.org/10.1007/s11240-009-9610-2

Wang, J., F. Zhao and P. Xu. 2006. Use of aroA-M1 as a selectable marker for Brassica napus transformation. Crop Sci. 46(2): 706-711. https://doi.org/10.2135/cropsci2005.0290

Wirtz, M. and R. Hell. 2003. Production of cysteine for bacterial and plant biotechnology: application of cysteine feedback-insensitive isoforms of serine acetyltransferase. Amino Acids. 24(1-2): 195-203. https://doi.org/10.1007/s00726-002-0313-9

Zhang, Y. and P.L. Bhalla. 2004. In vitro shoot regeneration from commercial cultivars of Australian canola (Brassica napus L.). Aust. J. Agric. Res. 55(7): 753-756. https://doi.org/10.1071/AR03209

Zhang, Y., M.B. Singh, I. Swoboda and P.L. Bhalla. 2005. Agrobacterium-mediated transformation and generation of male sterile lines of Australian canola. Aust. J. Agric. Res. 56(4): 353-361. https://doi.org/10.1071/AR04175