Role of Glutathione S Transferase Polymorphism in the Pathogenesis of Cardiovascular Diseases: A Case Control Study

Muhammad Akram1*, Muhammad Imtiaz Shafiq2, Amber Malik3, Farmanullah Khan4, Munir Ahmad Bhinder5 and Muhammad Sajjad6

1SFINHS, Federal Post Graduate Medical Institute, Shaikh Zayed Medical Complex Lahore

2School of Biochemitry and Biotechnology, University of the Punjab, 54590-Lahore

3Federal Post Graduate Medical Institute, Shaikh Zayed Medical Complex, Lahore

4Profesional College of Medical Sciences (PCMS), Takhti Nasarti Near PTCL Exchange Chokara (27300) District Karak (KPK) Pakistan.

5Department of Human Genetics and Molecular Biology, University of Health Sciences, Lahore

6School of Biological Sciences, University of the Punjab, 54590-Lahore, Pakistan.

ABSTRACT

Cardiovascular diseases (CVDs) are major health problems all over the world. Oxidative stress contributes an important pathological role in the development of CVDs. To counter this oxidative stress, the most important natural antioxidant defense mechanisms include endogenous glutathione concentration, superoxide dismutase, catalase, and glutathione S-transferase (GST). GST neutralizes reactive oxygen species to regulate physical homeostasis in the body. The target of this study was to evaluate the molecular role of GST genotypic polymorphism involved in the development of CVD. For this case-control study, a total of 504 participants including 261 CVD patients and 243 healthy individuals were enrolled after taking informed consent. The analysis of the three allelic variants GSTM1, GSTT1, and GSTP1 was carried out through PCR-based amplification. Amplification of GSTM1 and GSTT1 was performed using the specific primers designed by Primer-3 software. GSTT1 and GSTMI genotypes were determined by comparing the sizes of amplified PCR product of genotypes with β Globulin gene, used as internal standard and 100-bp DNA ladder. GSTP1 genotype was determined using the PCR-restriction fragment length polymorphism. Analysis of data was carried out using SPSS software Version 22.0. Statistical significance of p< 0.05 was considered as valuable results. Results demonstrated that Null and GSTP1b(105) genotypes were more frequent in CVD patients than controls (23.0 vs 8.6 and 69.0 vs 44.4) with strong statistical association of Null=OR: 0.317, CI: 0.126-0.797 and GSTP1b(105) OR: 0.360, CI: 0.192 – 0.677 respectively. GSTM1 and GSTT1 were less frequent in CVD patients (46.0% vs 74.1% and 49.4% vs 74.1%) with significant statistical association of GSTM1= OR: 3.367, CI: 1.75-6.44 vs GSTT1=OR: 2.292, CI: 1.52-5.60 respectively. These findings concluded that Null and GSTP1b(105) genotypes have a significant association with CVD in the Pakistani population.

Article Information

Received 18 January 2022

Revised 23 Fabruary 2022

Accepted 04 February 2022

Available online 15 April 2022

(early access)

Published 19 August 2022

Authors’ Contribution

MA designed and conducted the research work. FK assisted in data analsysis. MAB and MS reviewed the article and manuscript writing. AM and MIS supervised the work and helped in manuscript preparation.

Key words

GST, Cardiovascular diseases, Polymorphism, Coronary heart diseases, GST genotypes, Oxidative stress coronary artery disease, GSTP1 Ile105Val polymorphism

DOI: https://dx.doi.org/10.17582/journal.pjz/20220118110100

* Corresponding author: [email protected]

0030-9923/2022/0006-2659 $ 9.00/0

Copyright 2022 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Cardiovascular Diseases (CVDs) are the leading cause of death worldwide and are a major health problem globally (Amini et al., 2021). According to an estimation, CVD has caused 17.8 million deaths in 2017 worldwide and millions of disability (Roth et al., 2018). Further, worldwide CVD mortality is projected to be 23.4 million, involving 35% of all deaths in 2030 (Jilani et al., 2021). Statistically in Pakistan, 15.36 % of deaths are caused by CVDs, and about 0.2 million lives suffered from coronary heart diseases (CHD) since 2011 (Zeb et al., 2016). Various modifiable (lifestyle such as diet, physical inactivity, and stress), and non-modifiable (oxidative stress, poor antioxidant system, and genetic predisposition) risk factors have critical roles in the development of various heart diseases (Qasim, 2012). Dyslipidemia, the key feature of cardiovascular diseases, arises due to elevated serum lipoproteins levels (Syed et al., 2010).

High levels of cholesterol, triglycerides, LDL, and low level of anti-atherogenic HDL are the major risk factors for various types of chronic heart disease (Kontush and Chapman, 2006). Oxidative stress (OS), originating as a result of irregularities between free radicals production and antioxidant defense, destroy proteins, nucleic acids, and lipids. OS also leads to cellular dysfunctions which result in various pathological conditions including cancer, diabetes, and atherosclerosis (Zhao et al., 2022). Experimental and clinical pieces of evidence showed that OS plays a significant role in the pathology of CVD. Moreover, OS is also involved in dyslipidemia and other various pathological disorders which lead to the development CVD. OS is generated as a consequence of the interaction of ongoing metabolism and a variety of environmental factors (Natarajan et al., 2010). The well-known most potent natural non-enzymatic and enzymatic antioxidant defense mechanisms included endogenous glutathione (GSH) concentration, superoxide dismutases, catalases, and glutathione S-transferases (GST). GST neutralizes the reactive oxygen species to regulate physical homeostasis in the body (Tiwari et al., 2013). 

GSH participates in several physiological functions e.g, it keeps the sulfhydryl group of proteins in the reduced state, detoxification of foreign hazardous compounds, transportation of amino acids, assist in enzymatic degradation of endogenous peroxide and also acts as a co-enzyme for many enzymatic reactions. It has also been demonstrated that GSH has a vital role in detoxifying the cells from free oxygen radicals to prevent damage from oxidative stress (Yan et al., 2020). GST is a family of stress-responsive detoxification enzymes with the ability to react to active compounds generated by reactive oxygen species (Aldini et al., 2013). GSTs isoenzymes possess tissues specific expressions and represent an important multigene family of isoenzymes prevalently expressed in almost all higher animals. It has been demonstrated that these isoenzymes help in the conjugation of GSH to a diversity of ionic molecules, and establish the role of the GST family as cell housekeepers, always active for detoxification of cellular toxic molecules (Rahman et al., 2012). GSTs allele/null genotype unable to cope the body against toxic free radicals causes tissues injury (Shimizu et al., 2004).

Several studies have shown that patients with chronic diseases, for example, heart disease, malignancies, diabetes, and even arthritis exhibit lower plasma levels of GSH than healthy individuals, indicating that GSH provides a protective role against such chronic conditions (Forman et al., 2009). Various studies have described the association of plasma or RBCs level of GSH to CVD (Bajic et al., 2019). A deletion in the GST gene has caused the polymorphisms with two variants GSTT1 and GSTM1. The individuals with the total absence of these two enzymes, due to deletions are called Null genotypes. Many studies produced great concordance (> 95%) among the genotypic and phenotypic ratios (Phulukdaree et al., 2012). In other studies, high frequency of genotypes M1 and P1 has been demonstrated in coronary artery disease (CAD) patients with smoking (Singh et al., 2011). This research aims to assess the genetic role of GST polymorphism in the development and progression of CVD. Many studies suggest that GSTP1 Ile105Val polymorphism could have strong associations with the development of coronary heart diseases (Singh et al., 2011; Shimizu et al., 2004). However, the results in the literature remained elusive, which might be due to the limitation of individual studies with a relatively small sample size. Therefore, we also aimed to conduct a case study to rule out the overall effects of the GSTP1 Ile105Val genetic polymorphism as a risk of CHD.

Materials and Methods

Study sample collection

A case-control study was conducted at Sheikh-Zayed Hospital, Lahore, Pakistan. The study was conducted after approval from the Ethical Review Board of Federal PGM Institute of Sheikh-Zayed Medical Complex Lahore. After taking informed consent of total of 504 participants, 261 CVD patients and 243 controls (Healthy Individuals) were enrolled. Patients suffering from different cardiovascular disorders e.g. coronary artery disease (CAD), acute coronary syndrome (ACS), including myocardial infarction of ST-elevation and non-ST-elevation were included.

A questionnaire was used to record the personal record of participants containing demographic data e.g. age, weight, height along with the history of smoking and other diseases. Blood samples were collected under sterile conditions from all participants at Shaikh Zayed hospital, the 6cc blood was obtained from the cubital vein by using venipuncture out of which 3cc drained in tubes with 3.2% sodium citrate containing vial for plasma extraction, and the remaining 3cc blood was stored in EDTA blood vials for DNA extraction.

Analysis of genetic polymorphism

GSTM1, GSTT1, and GSTP1 genes amplification were performed using the specific primers for each isoform designed by “Primer 3 software. A mixture of 25 μl PCR master mix (15 pmol of each oligo, 800 μM of dNTPs, 2.5 mM MgCl2, 1x PCR buffer, 0.5U of Taq DNA-polymerase and 100 ng genomic DNA template) was used for PCR reaction in each PCR tube. PCR products were electrophoresed in 2% agarose gel. GSTT1 and GSTMI genotypes were determined by comparing the sizes of amplified PCR product of genotypes with β Globulin gene, used as internal standard and 100-bp DNA ladder. And GSTP1 genotype was determined by using the technique of PCR-RFLP. Following primers were applied for the determination of genetic polymorphism (Table I).

For amplification of GSTP1 following PCR conditions were applied, the initial denaturation of 96°C for 5 min, 30 cycles of DNA denaturation at 96°C for 30 sec, primers annealing at 55°C for 30 sec and amplification at 72°C for 30 sec, followed by a single cycle of final DNA amplification of 72°C for 5 min. A 176 bp PCR product was amplified and subjected to RFLP to analyze the polymorphic restriction sites. For this purpose, 0.5 μl (5 U) restriction enzyme BsmAI (Fermentas) and 4.5 μl restriction reaction buffer were mixed in 15 μl PCR product in 25 μl reaction tube and left for overnight in shaking incubator at 37°C for digestion. Restriction amplicons were electrophoresed on 3% agarose gel and visualized under UV light. PCR amplicons containing homozygous allele G105 were subjected to complete digestion and produced two fragments of 91bp and 85bp, respectively. 

Statistical analysis

The collected data was evaluated using the SPSS v22.0 software (Statistical Package for Social Sciences). Data were expressed as the mean ± SD (continuous variables) or by frequency and the percentage (categorical variables). The Independent Samples t-test was used to compare the means of continuous significant variables of independent groups in normal distribution data. A chi-squared statistical test was used to assess and compare the genotype frequencies between CVD and healthy individuals as separate groups. To evaluate the effect of genotype on the cardiovascular risk an odds ratio (OR) with a 95% confidence interval was used. The association between GST genotypes and different biochemical parameters was retrieved, by using Pearson’s or Spearman’s correlation coefficient depending upon the linearity and normality of data. Statistical significance of data was considered at p< 0.05.

 

Table I. List of primers used for genetic polymorphism.

Genes/Alleles	Oligonulceotides (5`→3`)		Annealing
GSTT1	Sense	TTCCTTACTGGTCCTCACATCTC	58°C and 72°C
	Antisense	TCACCGGATCATGGCCAGCA
GSTM1	Sense	GAACTCCCTGAAAAGCTAAAGC	58°C and 72°C
	Antisense	GTTGGGCTCAAATATACGGTGG
GSTP1	Sense	ACCCCAGGGCTCTATGGGAA	55°C
	Antisense	TGAGGGCACAAGAAGCCCCT

 

Table II. Demographic parameters of 261 CAD patients and 243 healthy control groups.

	CAD patients No’s (%)	Healthy individuals (n=243) No’s (%)	χ2 value T- test (p-value)
Gender
Male	225 (86.2%)	60 (24.7%)	64.60 (<0.001***)
Female	36 (13.8%)	183 (75.3%)
Age (Years)
Mean age	53.63±13.34	49.38±14.48	1.98 (0.049*)
Age ≤ 40	36.12±4.14	31.09±6.9	5.92 (0.261)
Age ˃ 40	58.03±11.48	55.78±10.35	2.31 (0.026*)
Smoking	96 (36.8%)	N/A
Non-smoking	165 (63.2%)	N/A

 

* p<0.05, ** p<0.01, ***p<0.001: *significant, **strong significant, *** Very strong significant.

 

RESULTS

The statistical analysis of demographic variables regarding gender, age, and smoking of CVD patients and healthy controls produced significant probability value (p-value) ranging from p<0.05 to p<0.001 as shown in Table II. In cases 225 (86.2%) were male and 36 (13.8%) were female. The overall mean age was 53.63±13.34, in Age ≤ 40 was 36.12±4.14 and in Age ˃ 40 (years) was 58.03±11.48 respectively. In Controls mean age was 49.38±14.48, in Age ≤ 40 was 31.09±6.9 and in Age ˃ 40 (years) was 55.78±10.35 respectively. There was a prominent association between gender and groups (P-value = 0.001). It was observed that the mean age of both groups exhibit a significant difference (P-value = 0.049).

PCR amplification of GST variants e.g. M1 and T1 (Fig. 1) showed that Null genotype does not produced any band for GSTT1 and GSTM1 genes, but only bands for internal control were generated. Whereas healthy control samples produced bands for GST1 and GSTM1 genes, and CAD diseased patient’s samples produced either GSTT1 or GSTM1 bands along with bands of β Globulin gene as internal control.

 

The restriction (BsmAI) digestion of GSTP1 homozygous Ile/Ile genetic variant produced two DNA fragments of 484 and 9 base pairs, the fragment of 9 base pairs is constant and is considered as an internal standard during the restriction digestion. The heterozygous Ile/Val variant generated four fragments of different lengths of 484, 259, 225, and 9 base pairs whereas, the mutant homozygous Val/Val genotype gives three fragments of 225, 259, and 9 base pairs, respectively (Fig. 2).

 

Frequencies of GST genotypes (M1, T1, and P1) among MI patients and healthy participants are mentioned in the form of a graph (Fig. 3), where GSTM1 is present in 120(46.0%) cases and 180(74.1%) in controls. GSTT1 is present in 129(49.4%) cases and 180(74.1%) in controls. GSTP1 ILE105Allele (a) was present in 198(75.9%) cases and 174(71.6%) in controls. Null genotype is present in 60(23.0%) cases and 21(8.6%) in controls. 

The statistical analysis (Table III) revealed that patients with GSTM1 have 3.367 (OR: 3.367, CI: 1.75-6.44) fold more risk of having CVD. The patients with GSTT1 genotype exhibit 2.92 (OR: 2.292, CI: 1.52-5.60) fold more chances of developing CVD. The patients with Null genotype have 0.317 (OR: 0.317, CI: 0.126-0.797) times more chances for CVD. The patients who have GSTP1 ILE105Allele (a) was present have 0.802 (OR: 0.802, CI: 0.403-1.598) times have more chances of having CVD. GSTP1 ILE105Allele (b) was present in 60(69.0%) cases and 36(44.4%) in controls. The patients who have GSTP1 ILE105Allele (b) was present have 0.360 (OR: 0.360, CI: 0.192–0.677) times have more chances of having CVD. 

 

Table III. Relationship of genotype and allele frequency in patient CAD and control group.

GST genotyping based variables		CAD group (n=261) N (%)	Control group (n=243) N (%)	χ2 value	OR (95%CI)	p-value
GSTM1	No (-)	141 (54.0%)	63 (25.9%)	13.74	3.367(1.75-6.44)	<.001***
	Yes (+)	120 (46.0%)	180 (74.1%)
GSTT1	No (-)	132 (50.6%)	63 (25.9%)	10.74	2.92 (1.52-5.60)	.001**
	Yes (+)	129 (49.4%)	180 (74.1%)
Null	No (-)	201 (77.0%)	222 (91.4%)	6.40	0.317 (0.126-0.797)	.011*
	Yes (+)	60 (23.0%)	21 (8.6%)
GSTP1	No (-)	63 (24.1%)	69 (28.4%)	0.393	0.802 (0.403-1.598)	.531
	Yes (+)	198 (75.9%)	174 (71.6%)
GSTP1 ILE105 Allele (a)	No (-)	63 (24.1%)	69 (58%)	0.393	0.802 (0.403-1.598)	.531
	Yes (+)	198 (75.9%)	174 (71.6%)
GSTP1 Val105 Allele (b)	No (-)	81 (30.0%)	135 (55.6%)	10.299	0.360 (.192-.677)	.001**
	Yes (+)	180 (69.0%)	108 (44.4%)
ILE105/Val105 (a/b)	a/a	75 (28.7%)	135 (55.6%)	21.595	- .635(.296-1.36) 3.905(1.636-9.32)	- .243 .002**
	a/b	123 (47.1%)	36 (14.8%)
	b/b	63 (24.1%)	72 (29.6%)

 

* p<0.05, ** p<0.01, ***p<0.001: *significant, **strong significant, *** Very strong significant.

 

DISCUSSION

Oxidative stress is a major cause of changes in hemodynamics, leading to the formation of thrombosis and atherosclerosis which ultimately results in endothelial cellular damage in vasculature. This kind of cyclic inflammation in arterial wall lesions and atherosclerotic plaques plays a major role to increase the level of C-reactive protein in CAD patients. The mild inflammation due to the activation of leucocytes in the atherosclerotic region has a significant role in the production of reactive oxygen species (ROS) to overcome or limit the spread of exotic or endogenous toxic materials, this strategy at the same time also exposes the essential biomolecules to the oxidative stress (Zhao et al., 2022; Palmer et al., 2003).

This study demonstrates the linkage of wild-type genotypes GSTP1A105/A105 and GSTM10/0 with CVD. The presence of allele GSTP1 G105 in healthy individuals indicates the importance of this genetic variant in increasing the potential of antioxidant defense mechanisms. GST functions as a base catalyst, accelerating the rate of GSH conjugation to hydrophobic substrates molecules by de-protonation of GS by an active tyrosine. Mutation of codon 105 in the GST gene causes the Ile to Val amino acid substitution. The GST105 mutation has been reported previously in some studies, to cause the co-ordinates deflection of atomic H-site in side-chains, thus changing the GST catalytic activity and enhancing susceptibility of individuals to develop smoking-related CAD (Zhang et al., 2018; Singh et al., 2011; Hulsman and Holvoet, 2010). Earlier literature also demonstrated that GST105 has sevenfold increased conjugation and catalytic abilities for aromatic epoxides (Hu et al., 1997).

Many Asian and European countries e.g. India, Bangladesh, Saudi Arabia, Turkey, and Italy have reported that Null genotype (individuals absent in both GSTT1 and GSTM1) have two to eight-fold increased risk of CAD in their populations (Khanum et al, 2020; Cora et al., 2013). Whereas, a study from Taiwan reported no significant association between CAD and Null genotype (Yeh et al., 2013). However, in this study, the frequency of Null genotype was recorded (OR= 0.317, CL: 0.126-0.797) which is quite less than previously reported from China (Zhou et al., 2010). 

These different results from different countries might be due to the interaction of different environmental factors to different ethnic races with diverse genetic makeup. It is a known fact that GSTP1 has a significant role in maintaining the cellular redox state due to its glutathionylation and antioxidant activities (Tew et al., 2011). It has been observed that 198 individuals from the CAD group have been found positive for GSTPI, statistically which is very high in this study (OR=0.802 and CL: 0.403-1.598). GSTP1 is also required for the activation of peroxiredoxin protein VI (Prdx6), which detoxifies the lipid peroxides especially in biological membranes (Manevich et al., 2013). Even the role of GSTPI in synchronizing the activation of endothelial lining cells during atherosclerosis has been studied well (Mowbray et al., 2008). Data also suggest that differential expression of GSTPI also interferes with the Prdx6 activities indicating the GSTPI genotypic individuals will have a prominent antioxidant response (Manevich et al., 2013). A study demonstrated that increased levels of GSTP1 expression in CAD patients, were strongly associated with declined GSTP1: JNK (JNK: c-Jun N-terminal kinase) interaction then resulted in activation of the JNK-MAPK (mitogen-activated protein kinase) signaling cascade, which is important for cardiomyocyte apoptosis (Andrukhova et al., 2014). 

Studies have reported a common polymorphism in GSTPI at position 105 with Ile/Val in CHD patients with altered antioxidant activity (Phulukdaree et al., 2012). A study has demonstrated that the variant of the GSTP1-Val genotype exhibits an elevated level of TNFα, indicating the pathological importance of GSTP1 polymorphism (Simeunovic et al., 2019). This study demonstrates that the Pakistani population has a high frequency of GSTPI-Val genotype (OR= 0.360, CL: 0.192-0.677) which might contribute to declined antioxidant activity in HF patients and may also disturb the plasma concentration of MDA, TNFα in CAD patients (Rababa’h et al., 2018; Pocok et al., 2013). 

CAD is a group of destructive disorders caused by genetic and environmental factors, which interact differently in different ethnic groups. Despite the number of investigations, the exact mechanism of interactions of these factors is still unknown (Khanam et al., 2020). Several genes have been reported to be associated with CAD including myocardial infarction (Cicoira et al., 2001; Çine et al., 2002). It is suggested that GST isoforms have a significant role in decreasing antioxidant activity leading to atherosclerotic plaque formation (Singh et al., 2011; Bhat et al., 2016). Two isoforms (M1 and T1) of GST are reported to be directly involved in CAD and MI (Abu-Amero et al., 2006). In this study, we have explored the relationships of these two isoforms (GSTM1 and GSTT1) in Pakistan.

In this study, the frequencies of GSTM1 in CAD and control groups were markedly different. The risk of occurring of CAD due to GSTM1 is 3.37 times (OR=3.367; 95% CI= 1.75-6.44; p< 0.001) higher in patients than null genotype (OR=0.317; 95% CI= 0.126-0.797; p=0.011). Moreover, the association of GSTT1 (OR=2.92; 95% CI= 1.52-5.44; p=0.001) is 2.92 fold higher in patients than the control group and null genotype. All these findings show a very close association to a study conducted in Bangladesh, where the GSTM1 genotypic allele frequencies were prominently different between the two groups, and the M1 was more frequent in myocardial infarction (MI) than the control group. The risk of occurring CAD was 2.5-fold (OR= 2.5; 95% CI= 1.4–4.3; p< 0.01) higher in patients in comparison to null genotypes (Khanam et al., 2020). Our findings regarding null genotype (OR=0.317; 95% CI= 0.126-0.797; p=0.011) are supported by a very similar study conducted on the North Indian population which suggest that GSTT1 null genotype could provide protection against CAD, on the other hand, GSTM1 could be involved in development and pathogenesis of CAD in the population of Punjab (Bhat et al., 2016).

CONCLUSION

It is concluded that Null and GSTP1 b(105) are significantly associated with CVD. However, this study was conducted on samples collected from a single hospital which was a limitation so these results could not be considered for all regions of Pakistan. So an extensive study with samples collected from all populated regions of the country would certainly produce more conclusive findings, which would help in the early diagnosis of CAD using GST molecular genotyping.

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abu-Amero, K.K., Al-Boudari, O.M., Mohamed, G.H. and Dzimiri, N., 2006. T null and M nullgenotypes of the glutathione S-transferase gene are risk factor for CAD independent of smoking. BMC Med.Genet., 7:1-7.

Aldini, G., Vistoli, G., Stefek, M., Chondrogianni, N., Grune, T., Sereikaite, J., Sadowska-Bartosz, I. and Bartosz, G., 2013. Molecular strategies to prevent, inhibit, and degrade advanced glycoxidation and advanced lipoxidation end products. Free Radic. Res., 47: 93-137. https://doi.org/10.3109/10715762.2013.792926

Amini, M., Zayeri, F. and Salehi, M., 2021. Trend analysis of cardiovascular disease mortality, incidence, and mortality to incidence ratio: Results from global burden of disease study 2017. BMC Publ. Hlth., 21: 1-12. https://doi.org/10.1186/s12889-021-10429-0

Andrukhova, O., Salama, M., Krssak, M., Wiedemann, D., El-Housseiny, L., Hacker, M., Gildehaus, F.J., Andrukhov, O., Mirzaei, S., Kocher, A. and Zuckermann, A., 2014. Single dose GSTP1 prevents infarction induced heart failure. J. Card. Fail., 20: 135-145. https://doi.org/10.1016/j.cardfail.2013.11.012

Bajic, V.P., Van Neste, C., Obradovic, M., Zafirovic, S., Radak, D., Bajic, V.B., Essack, M. and Isenovic, E.R., 2019. Glutathione “redox homeostasis” and its relation to cardiovascular disease. Oxid. Med. Cell. Longev., 2019: 1-14. https://doi.org/10.1155/2019/5028181

Bhat, M.A. and Gandhi, G., 2016. Association of GSTT1 and GSTM1 gene polymorphisms with coronary artery disease in North Indian Punjabi population: A case-control study. Postgrad. med. J., 92: 701-706. https://doi.org/10.1136/postgradmedj-2015-133836

Cicoira, M., Zanolla, L., Rossi, A., Golia, G., Franceschini, L., Cabrini, G., Bonizzato, A., Graziani, M., Anker, S.D., Coats, A.J. and Zardini, P., 2001. Failure of aldosterone suppression despite angiotensin-converting enzyme (ACE) inhibitor administration in chronic heart failure is associated with ACE DD genotype. J. Am. Coll. Cardiol., 37: 1808-1812. https://doi.org/10.1016/S0735-1097(01)01237-2

Çine, N.A.C.İ., Hatemi, A.C. and Erginel-Unaltuna, N., 2002. Association of a polymorphism of the ecNOS gene with myocardial infarction in a subgroup of Turkish MI patients. Clin. Genet., 61: 66-70. https://doi.org/10.1034/j.1399-0004.2002.610113.x

Cora, T., Tokac, M., Acar, H., Soylu, A. and Inan, Z., 2013. Glutathione S-transferase M1 and T1 genotypes and myocardial infarction. Mol. Biol. Rep., 40: 3263-3267. https://doi.org/10.1007/s11033-012-2401-6

Forman, H.J., Zhang, H. and Rinna, A., 2009. Glutathione: Overview of its protective roles, measurement, and biosynthesis. Mol. Aspects Med., 30: 1-12. https://doi.org/10.1016/j.mam.2008.08.006

Hu, X., Ji, X., Srivastava, S.K., Xia, H., Awasthi, S., Nanduri, B., Awasthi, Y.C., Zimniak, P. and Singh, S.V., 1997. Mechanism of differential catalytic efficiency of two polymorphic forms of human glutathione s-transferase p1-1 in the glutathione conjugation of carcinogenic diol epoxide of chrysene. Arch. Biochem. Biophys., 345: 32-38. https://doi.org/10.1006/abbi.1997.0269

Jilani, U.A., Iqbal, M., and Jilani, S.A., 2021. Cardiovascular disease risk factors awareness and prevalence amon college students in Karachi City. Pak. J. Publ. Hlth., 11: 87-94. https://doi.org/10.32413/pjph.v11i2.718

Khanam, J., Hossain, D., Hosen, B., Uddin, M., Kabir, A. and Bari, M.A., 2020. Association of glutathione S-transferase theta 1 and mu 1 genes polymorphisms with the susceptibility of myocardial infarction in Bangladesh. Rep. Biochem. mol. Biol., 9: 366. https://doi.org/10.29252/rbmb.9.3.366

Kontush, A. and Chapman, M.J., 2006. Antiatherogenic small, dense HDL guardian angel of the arterial wall? Nat. clin. Pract. Cardiovasc. Med., 3: 144-153. https://doi.org/10.1038/ncpcardio0500

Manevich, Y., Hutchens, S., Tew, K.D. and Townsend, D.M., 2013. Allelic variants of glutathione S-transferase P1-1 differentially mediate the peroxidase function of peroxiredoxin VI and alter membrane lipid peroxidation. Free. Radic. Biol. Med., 5: 62-70. https://doi.org/10.1016/j.freeradbiomed.2012.10.556

Mowbray, A.L., Kang, D.H., Rhee, S.G., Kang, S.W. and Jo, H., 2008. Laminar shear stress up-regulates peroxiredoxins (PRX) in endothelial cells: PRX 1 as a mechanosensitive antioxidant. J. biol. Chem., 283: 1622-1627. https://doi.org/10.1074/jbc.M707985200

Natarajan, P., Ray, K.K. and Cannon, C.P., 2010. High-density lipoprotein and coronary heart disease: current and future therapies. J. Am. Coll. Cardiol., 55: 1283-1299. https://doi.org/10.1016/j.jacc.2010.01.008

Palmer, C.N., Young, V., Ho, M., Doney, A. and Belch, J.J., 2003. Association of common variation in glutathione S-transferase genes with premature development of cardiovascular disease in patients with systemic sclerosis. Arthritis Rheumat., 48: 854-855. https://doi.org/10.1002/art.10955

Phulukdaree, A., Khan, S., Moodley, D. and Chuturgoon, A.A., 2012. GST polymorphisms and early-onset coronary artery disease in young South African Indians. S. Afr. med. J., 102: 7. https://doi.org/10.7196/SAMJ.5520

Pocock, S.J., Wang, D., Pfeffer, M.A., Yusuf, S., McMurray, J.J., Swedberg, K.B., Ostergren, J., Michelson, E.L., Pieper, K.S. and Granger, C.B., 2006. Predictors of mortality and morbidity in patients with chronic heart failure. Eur. Heart J., 27: 65-75. https://doi.org/10.1093/eurheartj/ehi555

Qasim M., 2012. International the News. http://www.thenews.com.pk/Todays-News-6-134656-Cardiovascular-diseases-claim-200,000-lives-annually-in-Pakistan. Sept 29, 2012.

Rababa’h, A.M., Guillory, A.N., Mustafa, R. and Hijjawi, T., 2018. Oxidative stress and cardiac remodeling: An updated edge. Curr. Cardiol. Rev., 14: 53-59. https://doi.org/10.2174/1573403X14666180111145207

Rahman, T. , Hosen, I., Islam, M. and Shekhar, H., 2012. Oxidative stress and human health. Adv. Biosci. Biotechnol., 3: 997-1019. https://doi.org/10.4236/abb.2012.327123

Roth, G.A., Abate, D., Abate, K.H., Abay, S.M., Abbafati, C., Abbasi, N., Abbastabar, H., Abd-Allah, F., Abdela, J., Abdelalim, A. and Abdollahpour, I., 2018. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980–2017: A systematic analysis for the global burden of disease study 2017.  Lancet, 392: 1736-1788.

Shimizu, H., Kiyohara, Y., Kato, I., Kitazono, T., Tanizaki, Y., Kubo, M., Ueno, H., Ibayashi, S., Fujishima, M. and Iida, M., 2004. Relationship between plasma glutathione levels and cardiovascular disease in a defined population: The Hisayama study. Stroke, 35: 2072-2077. https://doi.org/10.1161/01.STR.0000138022.86509.2d

Simeunovic, D., Odanovic, N., Pljesa-Ercegovac, M., Radic, T., Radovanovic, S., Coric, V., Milinkovic, I., Matic, M., Djukic, T., Ristic, A. and Risimic, D., 2019. Glutathione transferase P1 polymorphism might be a risk determinant in heart failure. Dis. Markers, 2019: 1-14. https://doi.org/10.1155/2019/6984845

Singh, N., Sinha, N., Kumar, S., Pandey, C.M. and Agrawal, S., 2011. Glutathione S-transferase gene polymorphism as a susceptibility factor for acute myocardial infarction and smoking in the North Indian population. Cardiology, 118: 16-21. https://doi.org/10.1159/000324066

Syed R, Deeba F, and Jamil K., 2010. Role of GSTM1 Gene polymorphism and its association with Coronary Artery Disease. J. clin. med. Res., 2: 22-25.

Tew, K.D., Manevich, Y., Grek, C., Xiong, Y., Uys, J. and Townsend, D.M., 2011. The role of glutathione S-transferase P in signaling pathways and S-glutathionylation in cancer. Free Radic. Biol. Med., 51: 299-313. https://doi.org/10.1016/j.freeradbiomed.2011.04.013

Tiwari, B.K., Pandey, K.B., Abidi, A.B. and Rizvi, S.I., 2013. Markers of oxidative stress during diabetes mellitus. J. Biomark., 2013: 1-8. https://doi.org/10.1155/2013/378790

Yan, C., Duan, L., Fu, C., Tian, C., Zhang, B., Shao, X. and Zhu, G., 2020. Association between glutathione S-transferase (GST) polymorphisms and schizophrenia in a Chinese Han population. Neuropsychiatr. Dis. Treat., 16: 479. https://doi.org/10.2147/NDT.S235043

Yeh, H.L., Kuo, L.T., Sung, F.C., Chiang, C.W. and Yeh, C.C., 2013. GSTM1, GSTT1, GSTP1, and GSTA1 genetic variants are not associated with coronary artery disease in Taiwan. Gene, 523: 64-69. https://doi.org/10.1016/j.gene.2013.02.052

Zeb, J., Zeeshan, M., Zeb, S., Mehmood, Q., Zeb, R., Ali, K. and Husain, M., 2016. Knowledge about risk factors and warning symptoms in patient suffering from cardiovascular diseases. Pak. Heart J., 49: 2.

Zhang, M., Ye, J., Xu, Q., Feng, Y., Yuan, X., Yu, H., Wang, Y. and Yang, Y., 2018. Genome-wide association study of cold tolerance of Chinese indica rice varieties at the bud burst stage. Pl. Cell Rep., 37: 529-539. https://doi.org/10.1007/s00299-017-2247-4

Zhou, J., Hu, J. and Guan, H., 2010. The association between copy number variations in glutathione S-transferase M1 and T1 and age-related cataract in a Han Chinese population. Invest. Ophthalmol. Vis. Sci., 51: 3924-3928.

Zhao, J., Qiao, L., Dong, J., and Wu, R., 2022. Antioxidant effects of irisin in liver diseases: mechanistic insights. Oxid. Med. Cell. Longev., 2022: 1-11. https://doi.org/10.1155/2022/3563518