Research Article

Molecular Detection of Leucocytozoon spp. in Broiler Chickens in Baghdad City

Rana Mohammed Ibrahim1*, Haider Mohammed Ali Al-Rubaie2

1Department of Microbiology, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq; 2Department of Parasitology, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq.

Received | August 14, 2023; Accepted | November 06, 2023; Published | January 08, 2024

*Correspondence | Rana Mohammed Ibrahim, Department of Microbiology, College of Veterinary Medicine, University of Baghdad, Baghdad, Iraq; Email: [email protected]

Citation | Ibrahim RM, Al-Rubaie HMA (2024). Molecular detection of Leucocytozoon spp. in broiler chickens in Baghdad city. Adv. Anim. Vet. Sci., 12(1):113-119.

DOI | https://dx.doi.org/10.17582/journal.aavs/2024/12.1.113.119

ISSN (Online) | 2307-8316

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

The industry of domestic poultry plays a very important foundation of protein includes eggs and meat for humans, and plays a crucial role as a revenue provider in the national economy (Mirzaei et al., 2020). There are more than 200 morphologically identified avian haemosporidian species in avian (Bell et al., 2015). Their infections are the most prevalent infections of the different parasitic diseases that caused by haemosporidian parasites as a vector-borne parasites that infect 30 mammals, birds, amphibians, reptiles, over the world (Valkiünas, 2005). According to Takang et al. (2017) avian blood parasites are diseases that negatively affects 33 poultry productivity and results in economic losses; because they are known to causes pathogenic effects in their host that resulting in Emaciation, anemia, reproductive failure, growth retardation, decreased productivity, and high mortalities, as well as potential harmful effects on their community structure and behavior (Dunn et al., 2011; Gimba et al., 2014; Ogbaje et al., 2019). Plasmodium, Haemoproteus and Leucocytozoon well known as avian haematozoan infections of domestic and wild birds that can be decreased their productivity with high mortality and maybe affects their population’s dynamics (Mirzaei et al., 2020). Avian blood parasites that called leucocytozoids are infect a wide variety of avian hosts (Valkiünas et al., 2010; Zhao et al., 2014). All Leucocytozoids have a host-specific pathogenicity in the levels of the order, family and occasionally species (Forrester and Greiner, 2009). According to Levine et al. (1980) Leucocytozoon belongs to the Phylum Apicomplexa’s, suborder Haemsporonia and Its infection has been documented in a variety of birds and regions including Africa (Huchzermeyer, 1993; Permin et al., 2002; Sehgal et al., 2006), New Zealand (Hill et al., 2010), Spain (Merino et al., 1997), Turkey (Ozmen et al., 2005, 2009), and the United States (Stuht et al., 1999). It has been commonly arisen in domestic chickens (Gallus gallus domesticus) in Thailand, (Worasing et al., 2001; Tongkamsai and Napoon, 2015; Takang et al., 2017; Prasopsom et al., 2020), and in the other countries of Southeast Asia (Paperna et al., 2008).

Three distinct species of Leucocytozoons, including L. macleani (Sambon, 1908), L. caulleryi (Mathis and Lééger, 1909) and L. schoutedeni (Vandenbranden and Bequaert, 1913) were found in domestic chickens (Valkiünas, 2005; Forrester and Greiner, 2009). The pathogenicity of Leucocytozoon was determined by the severity of the infection (Smith et al., 2015). L. schoutedeni and L. macleani are much less pathogenic than L. caulleryi (Valkiünas, 2005). It affects circulating leucocytes (Suprihati and Yuniarti, 2017), as well as tissue erythrocytes, macrophages and endothelial cells. In addition, it leads to the formation of enormous tissue schizonts that can grow to 700 µ in length (Atkinson and Van Riper III, 1991). In Southeast Asia, the most two species affecting chickens are L. caulleryi and L. sabrazesi (Suprihati and Yuniarti, 2017). Acute clinical symptoms in the farmed poultry showed tachypnea, lethargy, anemia, green feces, reduced appetite, loss diarrhea, disturbances in the CNS (Central Nervous System) and leukocytosis (Legowo et al., 2017).

The molecular diagnosis techniques by using Polymerase Chain Reaction (PCR) mentioned high diversity of these parasites in bird’s communities (Ricklefs et al., 2007; Kim and Tsuda, 2010). Real Time- PCR is a highly effective diagnostic method in avian to determine the haemosporidian parasites in blood and liver samples (Bell et al., 2015; Lutz et al., 2015). Prasopsom et al. (2020) was found that the microscopically and molecular studies discovered the similarity in morphology and phylogenetic tree of some specific parasite (Leucocytozoon) in both fighting cocks and chickens.

Due to the very lack information about the use of qRT-PCR for detection Leucocytozoon in broiler chickens in Baghdad city, this study was conducted.

MATERIALS AND METHODS

Samples collection

From 1/11/2021, until 31/3/ 2022, fifty (33 males and 17 females) jugular venous blood samples (about 5 ml) were collected in EDTA tubes from broiler chickens, which had been obtained from several local markets in Baghdad city. Blood samples were divided into an equal part, the first one (about 2 ml) was utilized for thin blood smears and stained by Giemsa stain according to Soulsby (1982) and the second part (about 3 ml) was kept at -20 oC for molecular analysis by using nested and qRT –PCR. The second primers of Nested PCR were also used for qRT-PCR illustrate as follows:

The nested PCR program was done according to Suprihati and Yuniarti (2017) and The reaction components of second primers of nested PCR as follows:

Components	(Final volume) 25μL
Master mix or GoTaq® green master mix	12.5µl
Forward primer	10 picomols/µl ( 1 µl )
Reverse primer	10 picomols/µl ( 1 µl )
Reaction from PCR 1	1.5µl
Distill water	9µl

 

The optimal conditions for detection PCR as follows:

No.	Phases	Tm (oC)	Time	No. of cycles
1-	Initial denaturation	94oC	3 min	1 cycle
2-	Denaturation -2	94oC	45 Sec	35 cycle
3-	Annealing	56oC	30 Sec
4-	Extension-1	72oC	1min
5-	Extension -2	72oC	7 min.	1 cycle

 

DNA extraction

DNA extraction from blood samples was performed by using Quick-gDNA™ Blood MiniPrep (Catalog No. D3025 - USA) according to the manufacture procedure and the eluted DNA was stored at - 20oC and it was used in qRT-PCR.

Agarose gel electrophoresis

Electrophoresis was carried out according to Sambrook et al. (1989), after DNA was extracted in order to evaluate the interaction of PCR. The size of the band was 503bp of the bundle produce by the interaction of the PCR and the agarose gel should be distinguished when the standard DNA is present, that was previously prepared by add 1.5 g agarose to TBE buffer 100 ml and Red Safe stain melting with it. The agarose gel was created through condensation.

2-Primers:

Gene	Primers	Primers sequence	Tm (ᵒC)	GC (%)	Size of product (bp)	Reference
Cyt b	Forward	5′- ATGTGCTTTAGATATATGCATGCT -3′	50.55	33	503	Suprihati and Yuniarti (2017)
	Reverse	5′ GCATTATCTGGATGTGATAATGGT-3′	52.26	38

 

Conducting q real-time- PCR

Master Mix (2X) (KAPA SYBR FAST PCR) which contains a unique DNA polymerase designed for PCR and using SYBR Green fluorescent dye, MgCl2, and dNTPs. Based on the following table of each component that is needed:

Components	Volume (μl)	Final concentrations
qPCR Master Mix KAPA, SYBR FAST (2X) global	10	2X
Forward primer	1	0.2µM
Reverse primer	1	0.2µM
Nuclease-free water	3	-
Template DNA sample volume	5	1pg-100ng
Final volume	20	-

 

Cycling program of qRT- PCR

KAPA SYBR FAST PCR Master Mix (2X) is designed for high-performance Real-Time PCR. The kit contains a novel DNA polymerase engineered via a process of molecular evolution resulting in a unique enzyme specifically designed for quantitative real-time PCR (PCR) using SYBR green I dye chemistry. KAPA SYBR FAST DNA Polymerase has been engineered to perform optimally in stringent qPCR reaction conditions, exhibiting dramatic improvements in signal-to-noise ratio (fluorescence), quantification cycle (Cq), linearity, and sensitivity and proprietary buffer system improves the amplification efficiency of difficult targets, including both GC- and AT rich templates. KAPA SYBR FAST PCR Master Mix (2X) Kits are a ready to-use cocktail containing all components (except primers and template) for the amplification and detection of DNA in PCR. The KAPA SYBR FAST PCR Kit is supplied as a 2X master mix with integrated antibody-mediated hot start, SYBR Green Fluorescent Dye, MgCl2, dNTPs, and stabilizers.

The qReal-Time PCR conditions were illustrated as follows:

Steps	Temp.(°C)	Time	Cycles
Enzyme activation	95	5:00 min.	Hold
Denaturation	95	30 sec.	40
Annealing	٥1	30 sec.
Extension	72	30 sec.
	90	15 sec.	100

 

Statistical analysis

Chi square was use to evaluate the effects of Leucocytozoon spp. infection in the broiler chickens under the significant level P ≤ 0.05% (Al-Mohammed et al., 1986).

RESULTS AND DISCUSSION

The total infection rate of Leucocytozoon spp. by thin blood smears in broiler chickens was 10% (5/50) ,which divided in the females 11.76 % (2/17) and in the males 9.09 % (3/33) with significant differences (P≤ 0.05) (Table 1; Figure 1) ,while by qRT-PCR the infection rate was 4% (2/50) ,in males 1/33 ( 3.03%) and in females 1/17 (5.88%) with significant differences (P≤ 0.05) (Table 2; Figures 2, 3).

 

Table 1: Shows the infection rate of Leucocytozoon spp. in broiler chickens by thin Giemsa stained blood smears.

No. of samples examined	No. of positive (%)	Males positive (%) (No. 33)	Females positive (%) (No. 17)
50	5(10)	3(9.09)	2(11.76)
χ2	45

 

P≤0.05

 

Table 2: The infection rate of Leucocytozoon spp. in broiler chickens by using qRT-PCR.

No. of samples examined	No. positive (%)	Males positive (%) (No. 33)	Females positive (%) (No.17)
50	2(4)	1(0.03)	1(5.88)
χ2	48

 

P≤0.05

 

 

A highest diversity of haemosporidian parasites in the birds has been possess, including the different genera: Leucocytozoon, Haemoproteus, and Plasmodium (Valkiünas, 2005). Haemoproteus and Leucocytozoon are the best-known species, and both are rather host-specific and closely related to the other species (Bennett et al., 1993; La Pointe et al., 2012), while the most common blood parasites were Leucocytozoon species and Plasmodium species (Aiyedu et al., 2022). The infections with Leucocytozoon were found in chickens and in different birds Southeast Asia (Prasopsom et al., 2020).

 

 

It had been identified morphologically with molecular tests (Martinsen et al., 2006). All these diagnostic examinations have differences in their advantages and disadvantages, but the combination of them was the best choice for diagnosis of this parasite and other avian haemosporidian (Cosgrove et al., 2006; Valkiünas et al., 2008; Garamszegi, 2010). The stained thin blood smears were used for finding the characteristic gametocytes (Valkiünas, 2005; Forrester and Greiner, 2009). The total infection of the Leucocytozoon in the present study by Giemsa stained blood smears was 10% that was to be relatively agree with Legowo et al. (2017) who recorded from Giemsa blood smears of chicken breeder’s, 11 samples were positive (6.88%), while disagree with Takag et al. (2017) who found infection rates of backyard chickens that involved of L. caulleryi (0.47%) and L. sabrazesi (72.66%). Also, Prasopsom et al. (2020) found an infection rate in chickens and fighting cocks was 46% by Giemsa blood-stained smears.

The total infection rate of Leucocytozoon spp. by using qRT-PCR was 4% that disagree with Win et al. (2020) who firstly microscopic detection and molecular identification of Leucocytozoon parasites from seven different areas of Myanmar and in the blood smears were detected the gametocytes from village chickens 17.6% (81/461), while by nested PCR targeting mitochondrial cytochrome b (cyt b) genes of the parasite (17.6%). Nevertheless, based on microscopic inspection, Piratae et al. (2021) discovered that 22 out of 250 (8.8%) samples had confirmed Leucocytozoon infections, but using nested-PCR, 50 samples tested positive, 5 of which were L. schoutedeni (2%), and 45 of which were Leucocytozoon sp. (18%). On than same hand, in the indigenous Thai chickens the prevalence of L. sabrazesi was 68.61% of 446 Giemsa stain thin blood smears from 108 farms in Nan province, Thailand (Jaijan et al., 2012). On the other hand, it was lower than the prevalence of L. schoutedeni infected village chickens (18.3%) in Uganda and Cameroon (Sehgal et al., 2006). The blood samples composed from 345 birds (19 guinea fowls and 326 chickens) examined by thin blood smear for detected blood parasites, the most prevalent blood parasite was Leucocytozoon sp. (42.90%) then followed by Plasmodium spp. (33.62%) was recorded by Aiyedun et al. (2022). Leucocytozoon was present in 2.9% of the 335 birds samples (Mirzaei et al., 2020). Approximately seventy-two blood samples (from 26 chickens, 22 pigeons and 24 ducks) were used in a different investigation. Leucocytozoon 146 species were found in the blood of chickens (34.6%), ducks (58.3%), and in pigeons (22.7%), as Haemoproteus species and Leucocytozoon sp. (Momin et al., 2014). Ahmadov et al. (2019) had been recorded an infection rate of Leucocytozoon of 125 chickens (Gallus gallus domesticus) 12.8 % (16/125). Additionally, of 17 wild birds from 9 species (n=1332) were discovered to have the leucocytozoon and the overall frequency was 1.3% (Shurulinkov and Golemansky, 2003), and Mirzaei et al. (2020) found the prevalence of the parasite was 2.9% in the avian blood parasite. In general, PCR technologies is acknowledged as a technical innovation which is important to the identification of microorganisms, enhancing the sensitivity, accuracy, and precision of the diagnosis of many infectious illnesses of farm animals, including avian species. The PCR technology, RT has arisen as technical innovations that are playing an ever-increasing role in clinical diagnostics and research laboratories. It is the ideal approach for the quick identification of infections, particularly those difficult to grow. The screening of illnesses that are challenging to cultivate in the lab is another use for it. Due to its ability to identify microorganisms early, PCR technology has found use in Parasitology as well, assisting in the accurate diagnosis and treatment of parasitic infections (Das et al., 2017). A highly successful method for detecting about the haemosporidian parasites in avian blood and liver samples was qRT-PCR. This methodology is an important instrument in the rapidly developing field of avian haemosporidian research since the real-time PCR test demonstrated superior efficacy to two commonly used molecular transmission approaches, traditional PCR and nested PCR (Bell et al., 2015). In the past, it was discovered that parasites were present in a different samples (Teal et al., 2012; Xu et al., 2015). A number of Leucocytozoon spp. genes were created in the similar manner, followed by the cytochrome b gene (cyt b). According to Hellgren et al. (2004) and Bernotienè et al. (2016), it was frequently the gene that was utilized the most. For these parasites, slower molecular clocks have been proposed than for the host cells (Bensch et al., 2013). Generally, the differences between the results of present study and the previous studies may have been due to geographical and seasonal differences (Prasopsom et al., 2020) or to the ecological conditions on farms that adds a lot to the rate of the Leucocytozoon infections (Legowo et al., 2017). Additionally, it is anticipated that changes in the environment will have an impact on how common and widespread vector-borne haemosporidian parasites are (Van Hemert et al., 2019). Conversely, the prevalence of haemosporidian infections of chickens in was substantially correlated with chicken species, breeds of poultry, age, and sex (Aiyedun et al., 2022). The protocol for real-time screening of samples has dramatically increased, but the throughput of sample screening or exact species fertility is unknown due to high genetic diversity, deficient sampling in highly diverse regions, and the limitations of any screening method for haemosporidian, whether using a straight forward microscope or molecular techniques (Bell et al., 2015). The infections has low intensity can also be overlooked by such molecular approaches, such as nested PCR (Valkiünas et al., 2008). The diversity of Leucocytozoon may be a great in areas through a diverse bird population (Lutz et al., 2015), at some host populations besides that (Reeves et al., 2015). According to studies (Lutz et al., 2015). The difficulty in detecting haemosporidian DNA is further exacerbated by the fact that host DNA are significantly more concentrated in samples than parasite DNA (Freed and Cann, 2006). Restriction digestion and the microscopy protocol (Beadell and Fleischer, 2005), income significantly more time than the nested PCR was quiet necessary to amplify DNA for sequencing, even though it took a lot longer than real-time PCR (Bell et al., 2015), for its aptitude to generate both quantitative and qualitative results, RT- PCR is regarded as a quick and perfect platform for diagnosing a variety of infectious diseases (Avlami et al., 2010), as a result, its cost was safely increased significantly without compromising sensitivity, and screening time was reduced (Bell et al., 2015). On the other hand, the slightly elevated occurrence of infections with Plasmodium spp. and Leucocytozoon spp. revealed the area’s mosquitoes and Simulium spp. insect vectors were convenient (Simulium spp. and Mosquitoes) in the area (Aiyedun et al., 2022; Prasopsom et al., 2020) referred to the high blood parasite infection rate in both backyard chickens and FCs that may have been due to the free-range habitats that could increase intermediate insect host contacts. According to Valkiünas et al. (2008) the primary way to these parasites identifying was the microscopic inspection of blood films. Although, analysis of blood films is an efficient means to recognize and quantify parasites, the prevalence estimates may rely on the method employed in their detection and necessitates experience in creating, staining, and studying such films (Fallo et al., 2005).

CONCLUSIONS AND RECOMMENDATIONS

Based on the data of the results, this is the first study in Baghdad city concluded to detection of Leucocytozoon spp. infection in broiler chickens diagnosed by using (qRT-PCR), a highly successful method for detection the presence of haemosporidian parasites in avian blood. This methodology is an important tool in the rapidly developing field of avian haemosporidian research since the real-time PCR test demonstrated superior efficacy and commonly used as molecular screening approaches, single PCR and nested PCR.

ACKNOWLEDEMENTS

The authors are thankful to the head of Veterinary Medicine, the staff of Microbiology Department and Parasitology Department of Veterinary Medicine College, University of Baghdad, Iraq for their cooperation and the facilities they provided during our study processing.

NOVELTY STATEMENTS

It is the first study in Baghdad city, Iraq to detect Leucocytozoon spp. infection in broiler chickens that diagnosed by using nested and qRT-PCR. The early diagnosis of parasite have an economic benefit through reduce the infection in the hosts (avian and birds) and using the suitable treatment to limit its spread in the area.

AUTHOR’S CONTRIBUTION

RMI: Research article, experiment design preparing materials, work the real time qPCR, get the results and data creation. HMAA-R: Proposal and writing article.

Conflict of interest

The authors have declared on conflict of interest.

REFERENCES

Ahmadov EI, Hasanova JV, Mammadova FZ, Samadova SO, Topchiyeva SA (2019). Leucocytozoonosis in Chickens (Gallus gallus domesticus). Acta Sci. Med. Sci., 3(2): 110-112.

Aiyedun JO, Elagroudi MG, Ola-Fadunsin SD, Nuhu M, SandaI M, Hussain K, Ganiyu IA, Musa RM (2022). Cross-species prevalence and risk factors associated with avian haemoparasitic infections in Kwara Central, Nigeria. Zag. Vet. J., 50(2): 116-125. https://doi.org/10.21608/zvjz.2022.130463.1177

Al-Mohammed NT, Al-Rawi KM, Younis MA, Al-Morani WK (1986). Principles of statistics, University of Baghdad. Directorate of Dar-Al Kutub for Printing and Publishing University of Al-Mosul. (In Arabic). pp. 56-78.

Atkinson CT, van Riper III C (1991). Bird-parasite interactions. Oxford University Press, UK.

Avlami A, Bekris S, Ganteris G, Kraniotaki E, Malamou-Lada E, Orfanidou M, Paniara O, Pantazatou A, Papagiannitsis CC, Platsouka E, Stefanou I, Tzelepi E, Vagiakou H, Miriagou V (2010). Detection of metallo-β-lactamase genes in clinical specimens by a commercial multiplex PCR system. J. Microbiol. Methods, 83(2): 185–187. https://doi.org/10.1016/j.mimet.2010.08.014

Beadell JS, Fleischer RC (2005). A restriction enzyme-based assay to distinguish between an avian haemosporidians. J. Parasitol., 91: 683–685. https://doi.org/10.1645/GE-3412RN

Bell JA, Weckstein JD, Fecchio A, Tkach VV (2015). A new real-time PCR protocol for detection of avian haemosporidians. Parasit. Vectors, 8: 383. https://doi.org/10.1186/s13071-015-0993-0

Bennett GF, Peirce MA, Ashford RW (1993). Avian haematozoa mortality and pathogenicity. J. Nat. Hist., 27(5): 993-1001. https://doi.org/10.1080/00222939300770621

Bensch S, Hellgren O, Križanauskienè A, Palinauskas V, Valkiünas G, Outlaw D, Ricklefs RE (2013). How can we determine the molecular clock of malaria parasites? Trend. Parasitol., 29: 363–243, 369. https://doi.org/10.1016/j.pt.2013.03.011

Bernotienè R, Palinauskas V, Lezhova T, Murauskaitè D, Valkiünas G (2016). Avian haemosporidian parasites (Haemosporida): A comparative analysis of different polymerase chain reaction assays in detection of mixed infections. Exp. Parasitol., 163: 31–37. https://doi.org/10.1016/j.exppara.2016.01.009

Cosgrove CL, Day KP, Sheldon BC (2006). Co-amplification of Leucocytozoon by PCR diagnostic tests for avian malaria: A cautionary note. J. Parasitol., 92: 1362–1365. https://doi.org/10.1645/GE-879R.1

Das H, Ali MA, Kalita P Ch, Doley PJ (2017). PCR and its role in diagnosis of poultry diseases. Life Sci. Leaflets, 86: 29-35.

Dunn JC, Cole EF, Quinn JL (2011). Personality and parasites: Sex dependent associations between avian malaria infection and multiple behavioral traits. Behav. Ecol. Sociobiol., 65: 1459– 1471. https://doi.org/10.1007/s00265-011-1156-8

Fallon SM, Bermigham E, Ricklefs RE (2005). Host specialization and geographic localization of avian malaria parasites: A regional analysis in the Lesser Antilles. Am. Natur., 165(4): 466-480. https://doi.org/10.1086/428430

Forrester DJ, Greiner EC (2009). Leucocytozoonosis. In:. Parasitic diseases of wild birds. Atkinson CT, Thomas NJ, Hunter DB (Eds.) Blackwell Publishing Inc. Ames, IA, USA, pp. 54–107. https://doi.org/10.1002/9780813804620.ch4

Freed LA, Cann RL (2006). DNA quality and accuracy of avian malaria PCR diagnostics: A review. Condor., 108: 459–73. https://doi.org/10.1093/condor/108.2.459

Garamszegi LZ (2010). The sensitivity of microscopy and PCR-based detection methods affecting estimates of prevalence of blood parasites in birds. J. Parasitol., 96: 1197–1203. https://doi.org/10.1645/GE-2531.1

Gimba FI, Zakaria A, Mugok LB, Siong HC, Jaafar N, Moktar MA, Rahman ARR, Amzah A, Abu J, Sani RA, Amin-Babjee SM, Sharma RSK (2014). Haemoparasites of domestic poultry and wild birds in Selangor, Malaysia. Malaysian J. Vet. Res., 5: 43–51.

Hellgren O, Waldenström J, Bensch S (2004). A new PCR assay for simultaneous studies of Leucocytozoon, Plasmodium, and Haemoproteus from avian blood. J. Parasitol., 90: 797–802. https://doi.org/10.1645/GE-184R1

Hill AG, Howe L, Gartrell BD, Alley MR (2010). Prevalence of Leucocytozoon spp. in the endangered yellow-eyed penguin Megabytes antipodes. Parasitology, 137: 1477-1485. https://doi.org/10.1017/S0031182009991910

Huchzermeyer FW (1993). A host-parasite list of the haematozoa of domestic poultry in sub-Saharan Africa and the isolation of Plasmodium durae Herman from turkeys and francolins in South Africa. Onderstepoort. J. Vet., 60: 15-21.

Jaijan A, Posuya W, Saenbuaphan N (2012). Prevalence and risk factors of blood parasites in indigenous Thai chickens in Nan province during November 2011 to August 2012. Nan Provincial Livestock Office. Nan, Thailand.

Kim KS, Tsuda Y (2010). Seasonal changes in feeding pattern of Culex pipienspallens govern the transmission dynamics of multiple lineages of avian malaria parasites in Japanese wild bird community. Mol. Ecol., 19(24): 5545-5554. https://doi.org/10.1111/j.1365-294X.2010.04897.x

La Pointe DA, Atkinson CT, Samuel MD (2012). Ecology and conservation biology of avian malaria. Ann. NY. Acad. Sci., 1249: 211-226. https://doi.org/10.1111/j.1749-6632.2011.06431.x

Legowo D, Khotimah SH, Suwanti LT (2017). Blood parasite infection prevalence in kampong chicken breeder’s group in Garut. Vet. Med. Int. Conference, KnE. Life Sci., pp. 308–315. https://doi.org/10.18502/kls.v3i6.1139

Levine ND, Corlies JO, Cox FFG, Deroux G, Grain J, Honigberg BM, Leedale GF, Loeblich III AR, Lom J, Lynn D, Merinfeld EG, Page FC, Poljansky G, Sprague V, Vavra J, Wallace FG (1980). A newly revised classification of the protozoa. J. Parasitol., 27: 37-58. https://doi.org/10.1111/j.1550-7408.1980.tb04228.x

Lutz HL, Hochachka WM, Engel JI, Bell JA, Tkach VV, Bates JM, Hackett SJ, Weckstei JD (2015). Parasite prevalence corresponds to host life history in a diverse assemblage of Afrotropical 288 bids and haemosporodian parasites. PLoS One, 10(4): e0121254. https://doi.org/10.1371/journal.pone.0121254

Martinsen ES, Paperana L, Schall JJ (2006). Morphological versus molecular identification of avian Haemosporidia: An exploration of three species concepts. Parasit., 133 : 279-288. https://doi.org/10.1017/S0031182006000424

Merino S, Potti J, Fargallo JA (1997). Blood parasites of passerine birds from central Spain. J. Wild Dis., 33(3): 638-641. https://doi.org/10.7589/0090-3558-33.3.638

Mirzaei F, Siyadatpanah A, Norouzi R, Pournasir S, Nissapatorn V, Pereira ML (2020). Blood parasites in domestic birds in central Iran. Vet. Sci., 7: 126. https://doi.org/10.3390/vetsci7030126

Momin MA, Begum N, Dey AR, Paran MS, Alam MZ (2014). Prevalence of blood protozoa in poultry in Tangail, Bangladesh. IOSR J. Agric. Vet. Sci., 7: 55–60. https://doi.org/10.9790/2380-07735560

Ogbaje CI, Okpe JA, Oke P (2019). Haemoparasites and haematological parameters of Nigerian indigenous (local) and exotic (broiler) chickens slaughtered in Makurdi major markets, Benue State, Nigeria. Alex. J. Vet. Sci., 63: 90–96. https://doi.org/10.5455/ajvs.53637

Ozmen O, Haligür M, Adanır R (2009). Identification of different protozoa species from a common buzzard (Buteo buteo). Turk. J. Vet. Anim. Sci., 33: 257-260. https://doi.org/10.3906/vet-0803-29

Ozmen O, Halıgür M, Yukarı BA (2005). A Study on the presence of leucocytozoonosis in wild birds of Burdur. Turk. J. Vet. Anim. Sci., 29: 1273-1278.

Paperna I, Keong MSC, May CYA (2008). Haemosporozoan parasites found in birds in Peninsular Malaysia, Singapore, Sarawak and Java. Raffles Bull. Zool., 56: 211–243.

Permin A, Esmann JB, Hoj CH, Hove T, Mukaratirwa S (2002). Ecto-endo- and haemoparasites in free-range chickens in the Goromonzi district in Zimbabwe. Prev. Vet. Med., 54: 213-224. https://doi.org/10.1016/S0167-5877(02)00024-7

Piratae S, Vaisusuk K, Chata W (2021). Prevalence and molecular identification of Leucocytozoon spp. in fighting cocks (Gallus gallus) in Thailand. Parasit. Res., 120: 2149-2155. https://doi.org/10.1007/s00436-021-07131-w

Prasopsom P, Salakij C, Lertwatcharasarakul P, Pornpranom P (2020). Hematological and phylogenetic studies of Leucocytozoon spp. in backyard chickens and fighting cocks around Kamphaeng Saen, Thailand. Agr. Nat. Resour., 54: 595–602.

Reeves AB, Smith MM, Meixell BW, Fleskes JP, Ramey AM (2015). Genetic diversity and host specificity varies across three genera of blood parasites in ducks of the Pacific Americas flyway. PLoS One, 0116661. https://doi.org/10.1371/journal.pone.0116661

Ricklefs RE, Swanson BL, Fallon SM, Martinez-Abrain A, Scheuerlein A, Gray J, Latta SC (2007). Community relationships of avian malaria parasites in Southern Missouri. Ecol. Monogr., 75: 543-559. https://doi.org/10.1890/04-1820

Sambrook J, Fritschi EF, Maniatis T (1989). Molecular cloning: A laboratory manual 2nd ed. Cold Spring Harbor Laboratory Press, New York. University of Texas, South Western Medical Center, USA.

Sehgal RN, Valkiunas G, Iezhova TA, Smith TB (2006). Blood parasites of chickens in Uganda and Cameroon with molecular descriptions of Leucocytozoon schoutedeni and Trypanosoma gallinarum. J. Parasitol., 92: 1336-1343. https://doi.org/10.1645/GE-927R.1

Shurulinkov P, Golemansky V (2003). Plasmodium and Leucocytozoon (Sporozoa: Haemosporida) of wild birds in Bulgaria. Inst. Zool. Bulgar. Acad. Sci. Sofia, Bulgaria. 42: 205–214.

Smith MM, Schmutz J, Apelgren C, Ramey AM (2015). A real-time, quantitative PCR protocol for assessing the relative parasitemia of Leucocytozoon in waterfowl. J. Microbiol. Methods, 111: 72-77. https://doi.org/10.1016/j.mimet.2015.01.027

Soulsby EJL (1982). Helminths, arthropods and protozoa of domesticated animals. 7th edition. London. Baillière Tindall. Pp:792-793.

Stuht JN, Bowerman WW, Best DA (1999). Leucocytozoonosis in nestling bald eagles in Michigan and Minnesota. J. Wildl. Dis., 35: 608-612. https://doi.org/10.7589/0090-3558-35.3.608

Suprihati E, Yuiarti WM (2017). The phylogenetics of Leucocytozoon caulleryi infecting broiler chickens in endemic areas in Indonesia. Vet. World, 10(11): 1324–1328. https://doi.org/10.14202/vetworld.2017.1324-1328

Takang P, Pikulkaew S, Awaiwanont N, Numee S (2017). Prevalence and risk factors of blood parasite infection in backyard chickens in Chiang Mai. Chiang Mai Vet. J., 15(3): 157–167.

Teal AE, Habura A, Ennis J, Keithly JS, Madison-Antenucci S (2012). A new real-time PCR assay for improved detection of the parasite Babesia microti. J. Clin. Microbiol., 50: 903–908. https://doi.org/10.1128/JCM.05848-11

Tongkamsai S, Napoon W (2015). Parasitemia in natural infection of Leucocytozoon sabrazesi in chickens in Eastern Thailand. In: Proceedings of the 14th Chulalongkorn University Veterinary Conference CUVC: Responsible for Lives. April 20–22, Bangkok, Thailand, pp. 119.

Valkiünas G (2005). Avian malaria parasites and other Haemosporidia. 1st ed. CRC Press. Boca Raton, FL, USA. https://doi.org/10.1201/9780203643792.ch0

Valkiünas G, Sehgal RNM, Iezhova TA, Hull AC (2010). Identification of Leucocytozoon to group (Haemosporida: Leucocytozoidae), with remarks on the species taxonomy of leucocytozoids. J. Parasitol., 96: 170–177. https://doi.org/10.1645/GE-2109.1

Valkiünas G, Iezhova TA, Križanauskienė A, Palinauskas V, Ravinder NMS, Bensch SA (2008). Comparative analysis of microscopy and PCR-based detection methods for blood parasites. J. Parasitol., 94: 1395–1401. https://doi.org/10.1645/GE-1570.1

Van Hemert C, Meixell BW, Smith MM, Handel CM (2019). Prevalence and diversity of avian blood parasites in a resident northern passerine. Parasit. Vectors, 12: 292. https://doi.org/10.1186/s13071-019-3545-1

Win SY, Chel HM, Hmoon MM, Htun LL, Bawm S, Win MM, Murata S, Nonaka N, Nakao R, Katakura K (2020). Detection and molecular identification of Leucocytozoon and Plasmodium species from village chickens in different areas of Myanmar. Acta Trop., https://doi.org/10.1016/j.actatropica.2020.105719

Worasing R, Kongkeaw W, Tiptara A, Anant S (2001). Leucocytozoonosis with avian malaria in layer chicken and treatment. Proceedings of the 39th Kasetsart University Annual Conference. Bangkok, Thailand, pp. 557–553.

Xu W, Morris U, Aydin-Schmidt B, Msellem MI, Shakely D, Petzold M, Jbörkma A, Martesson A (2015). SYBR green real-time PCR-RFLP assay targeting the Plasmodium cytochrome b gene – a highly sensitive molecular tools for malaria parasite detection and species determination. PLoS One, https://doi.org/10.1371/journal.pone.0120210

Zhao W, Cai B, Qi Y, Liu S, Lu M, Chen X, Qiu C, Peng W, Li J, Su X (2014). Multi-strain infections and ‘relapse’ of Leucocytozoon sabrazesi gametocytes in domestic chickens in southern China. PLoS One, 9(4): e94877. https://doi.org/10.1371/journal.pone.0094877