Immunosuppressive, Anti-Inflammatory, and Antioxidant Effects of Simvastatin on Pristane Induced Arthritis

Azza M. El-Kattawy1, Tarek Abou Zed1, Randa Megahed1 and Mohammed El-Magd2*

1Department of Biochemistry, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt

2Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh, Egypt

ABSTRACT

The current therapeutic approaches to the autoimmune disease rheumatoid arthritis depend mainly on synthetic anti-arthritis compounds that usually cause many adverse effects. The anti-arthritic effect of the hypocholesterolemic drug simvastatin (Sim) has been confirmed, however, its actual mechanism of action has not been investigated yet. Therefore, this study aimed to unveil the biochemical and molecular changes that accompany the application of Sim as anti-arthritic in a mouse model of pristane-induced arthritis. Female Swiss albino mice (20-30g) were randomly divided into 5 groups (n= 10/group): control, Sim control, pristane-induced arthritis, Sim co-treated, and Sim post-treated group. Sim treatment significantly 1) downregulated the expression of immunomodulatory genes [interferon gamma (IFNγ) and lactoferrin (LF)], 2) decreased the expression of inflammation-related genes [tumor necrosis factor alpha (TNFα) and interleukin 1 beta (IL1β)], 3) declined the expression of matrix metalloproteinase-3 (MMP3), transforming growth factor beta (TGFβ), and oxidized-LDL receptor (OLR1), 4) upregulated the expression of the anti-inflammatory gene IL10, 5) reduced the levels of the oxidative markers [lipid peroxide marker malondialdehyde (MDA) and nitric oxide (NO)], 6) increased the levels of antioxidant markers [reduced glutathione (GSH) and superoxide dismutase (SOD)]. These findings conclude that administration of Sim relieved pristane-induced arthritis, with best improvement in the Sim co-treated (prevention) group. Thus, Sim could be used as a protective drug against rheumatoid arthritis based on its immunomodulatory, anti-inflammatory, and antioxidant effects.

Article Information

Received 14 February 2022

Revised 15 April 2022

Accepted 18 May 2022

Available online 08 August 2022

(early access)

Published 01 September 2023

Authors’ Contribution

AE and TA presented basic concept and idea, did formal analysis of data and supervised the project. TA revised the manuscript. RM conducted the experiment and wrote the first draft.ME analysed data and interpreted it, wrote and revised the manuscript.

Key words

Simvastatin, Pristane, Arthritis, Anti-inflammatory, Antioxidant

DOI: https://dx.doi.org/10.17582/journal.pjz/20220214010205

* Corresponding author: [email protected]

0030-9923/2023/0005-2349 $ 9.00/0

Copyright 2023 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Rheumatoid arthritis (RA) is an autoimmune, chronic inflammatory disease affecting mainly the synovial membrane (Adamopoulos, 2015; Yang et al., 2021) with higher susceptibility in females than in males especially in the elderly with 45-50 years of age (Kustiarini et al., 2019). The synovial membrane (synovium) cells, synoviocytes , showed higher activities of CD 4+ T-lymphocytes, and higher levels of NF-kβ which induced the production of inflammatory cytokines such as tumor necrosis factor α (TNFα) and interleukin 1β (IL1β), adhesion molecules such as transforming growth factor β (TGFβ), and matrix-degrading molecules like matrix metalloproteinase-3 (MMP3) in RA patients (Edupuganti et al., 2015; Zaiss et al., 2021). However, the anti-inflammatory cytokine interleukin in 10 (IL10) was significantly reduced in the synoviocytes and sera of RA patients (Barbosa et al., 2017). Moreover, these cytokines attract a very large number of inflammatory cells that release reactive oxygen species (ROS) causing overproduction of the lipid peroxidation biomarker MDA and reduction of antioxidant markers such as reduced glutathione (GSH) and superoxide dismutase (SOD) in the blood of RA patients and animals (Ahmed et al., 2015; Yu et al., 2015).

Among the different methods used to induce RA in animals, pristane induced arthritis is preferable due to earlier onset of (Hou et al., 2011). It also specifically targets large joints that show severe inflammation with little involvement of other organs (Faisal et al., 2015; Sangaletti et al., 2021). Accordingly, pristane-induced arthritis has been extensively used in rodents as a model of RA (De Franco et al., 2014). Pristane can induce RA by activating macrophage and overproducing ROS, causing oxidative stress damage for the synovium (Mohamed et al., 2014; Sangaletti et al., 2021).

The currently used anti-arthritic drugs such as glucocorticoids and non-steroidal anti-inflammatory drugs cause several complications and side effects on many organs such as stomach, liver, and kidney, especially when used for long-duration with overdoses (Cai et al., 2021). Therefore, it is an urgent demand to find new, safe compounds to treat RA. The hypocholesterolemic drugs, statins, are recommended for the treatment of chronic inflammatory diseases (Mohamed et al., 2021). These drugs decrease cholesterol levels through inhibition of 3-hydroxy-3-methylglutary-CoA reductase (McCarey et al., 2004). In addition to their hypocholesterolemic effects, statins such as simvastatin (Sim) can also induce immunosuppressive effects through blocking major histocompatibility complex class II (MHCII) and interferon γ (IFNγ) (Barbosa et al., 2017). Moreover, statins can inhibit the release of chemokines and other factors from the vascular endothelium leading to inhibition of macrophages and lymphocytes recruitment with a subsequent reduction in proinflammatory cytokines (Greenwood and Mason, 2007). Sim can also inhibit the activation of macrophages and lymphocytes in different rodent models of arthritis (Ahmed et al., 2015; Gottschalk et al., 2014).

The oxidized low-density lipoprotein (oxLDL) plays a crucial role in the pathogenesis of atherosclerosis (Shaw, 2004). High levels of oxLDL were found in joints of RA patients (Dai et al., 2000; McMahon et al., 2006). On the other hand, lactoferrin (LF), an essential first-line defense molecule against infection that induces innate immune cells proliferation, is the main target for the majority of autoimmune responses (Hu et al., 2017). A large number of LF-specific autoantibodies were detected in the blood of RA patients (Kida et al., 2011; Wong et al., 2009). However, little is known regarding the effect of statins, as powerful hypolipidemic and anti-inflammatory agents, on the levels of oxLDL or LF.

With the aforementioned observations, the immunosuppressive effects of statins along with the fact that statins are mostly well-tolerated drugs (Maron et al., 2000) offer a rationale for investigating the underlying mechanisms of Sim action during the treatment of a mouse model of pristane-induced arthritis. Therefore, this study was conducted to investigate these mechanisms using molecular and biochemical approaches.

MATERIALS AND METHODS

Mice

This study was carried out in accordance with US National Institutes of Health Guidelines, agreed with the principle of Helsinki’s animal ethics, and was approved by the Research Ethics Committee of Faculty of Veterinary Medicine, Kafrelsheikh University. The present study was carried out on 50 female Swiss albino mice of 20-30g body weight. They were housed in wire cages with soft-wood chips for bedding. They were given a commercial basal diet and water ad libitum with a light/dark system of 12 h/12h.

Experimental design

The mice were randomly divided into 5 groups (n = 10/ group). In the control group (Cnt), mice were intraperitoneally injected with 0.5 ml/mouse saline (as a vehicle) twice with 7 weeks interval. In the Sim control group (Sim), mice were orally (by gavage) received 10 mg/kg/day simvastatin (ADWIC Chemical Co. Cairo, Egypt) for 65 days (Palmer et al., 2004). In the pristane-induced arthritis group (RA), each mouse was intraperitoneally injected with 0.5 ml pristane (2, 6, 10, 14 tetramethylpentadecane, Sigma-Aldrich Chemical Co. St. Louis, USA) twice with 7 weeks interval (Patten et al., 2004). The severity of arthritis was rated visually by evaluating the degree of inflammation in joints as previously described (De Franco et al., 2014; Leung et al., 2003). In the Sim co-treated group (RA+Sim-co), mice were intraperitoneally injected with 0.5 ml/mouse pristane twice at 7 weeks interval and orally given 10 mg/kg/day simvastatin daily for 65 days starting from the first pristane injection. In the Sim post-treated group (RA+Sim-post), mice were intraperitoneally injected with 0.5 ml/mouse pristane twice with 7 weeks interval and given 10 mg/kg/day simvastatin orally daily for 65 days starting from the appearance of arthritis clinical manifestations at the 60th day of the experiment.

Sampling

At the end of the treatment period (Day 125), mice were euthanized by exsanguination, knee and ankle joints were immediately excised and the synovium was carefully dissected from each joint. The tissue specimens were split into two parts; the first part was homogenized (for biochemical assay) and the second one was kept at -70°C (for RNA extraction).

Real-time PCR (qPCR)

Real-time PCR (qPCR) was used to assess the altered expression of IFNγ, LF, TNFα, IL1β, IL10, MMP3, TGFβ, and lectin type oxidized LDL receptor 1 (OLR1) in the synovium following treatment with Sim. Total RNA was extracted using a commercially available kit (Gene JET RNA Purification Kit, Thermo Scientific, # K0731, USA) following the manufacturer protocol and as previously detailed (Abou-Easa et al., 2014). RNA integrity was determined by electrophoresis on 1.5% agarose gels, and concentration and purity were evaluated by Quawell nanodrop Q5000 (USA). The obtained total RNA was reverse transcribed to cDNA following the manufacturer’s procedure (Thermo Scientific, #EP0451, USA). A PCR mixture (20µl) included cDNA, 2XMaster Mix (Quanti Tect SYBR Green), and mice-specific primers (Table I) was then prepared and placed in the thermal cycler (Step One Plus, Applied Biosystem, USA). We used the following thermal cycles for all genes: Initial denaturation (94°C/ 4 min/1 cycle), denaturation (94°C/40 s/40 cycles), annealing (60°C/30 s//40 cycles), and extension (72°C/30 s/40 cycles). The melting curve condition and fold change calculation based on cycle threshold (Ct) of target genes and the housekeeping (β actin) gene using the Livak method (2−ΔΔCt) were performed as previously detailed (Elgazar et al., 2018; Saleh et al., 2014; Selim et al., 2019). The samples were analyzed in triplicates along with non-template control (NTC) and negative reverse transcription controls in each plate.

 

Table I. Primers used for real-time PCR.

Gene	Forward primer 5`→3`
INFγ	F ACTGGCAAAAGGATGGTGAC R TGAGCTCATTGAATGCTTGG
LF	F AAACAAGCATCGGGATTCCAG R ACAATGCAGTCTTCCGTGGTG
IL1β	F AAATCTCGCAGCAGCACATCAA R CCACGGGAAAGACACAGGTAGC
IL10	F CGGGAAGACAATAACTGCACCC R CGGTTAGCAGTATGTTGTCCAGC
TNFα	F GACAAGGCTGCCCCGACTACG R CTTGGGGCAGGGGCTCTTGAC
TGFβ	F GCAACATGTGGAACTCTACCAGA R GACGTCAAAAGACAGCCACTCA
MMP3	F CTCTGGAACCTGAGACATCACC R AGGAGTCCTGAGAGATTTGCGC
OLR1	F GTCATCCTCTGCCTGGTGTTGT R TGCCTTCTGCTGGGCTAACATC
β actin	F ACTATTGGCAACGAGCGGTT R CAGGATTCCATACCCAAGAAGGA

 

Biochemical assays

Synovial membrane samples were homogenized with phosphate buffer saline (PBS), centrifuged at 12000 xg for 15 min at 4 °C, and then the supernatant was collected for measurment of oxidative and antioxidant parameters. The levels of oxidative stress markers [lipid peroxide marker malondialdehyde (MDA) and nitric oxide (NO)] and the levels of the antioxidant marker [reduced glutathione (GSH)] and the activities of the antioxidant enzyme superoxide dismutase (SOD) were measured in homogenized synovial membrane specimens using commercially available kits (Biodiagnostics, Egypt) and as previously described (El-Bayomi et al., 2018; Saleh and El-Magd, 2018).

Statistical analysis

The difference between the groups was determined by one-way ANOVA using GraphPad Prism 8 (GraphPad Software, Inc., La Jolla, CA, USA). Data were presented as mean ± standard error of the mean (SEM). Duncan’s multiple range test (DMRT) was applied as a post hoc test and significance was set at p< 0.05.

Results

Sim downregulated the expression of immunomodulatory genes

Changes in the relative expression of the two immunomodulatory genes interferon γ (INFγ) and lactoferrin (LF) genes in the synovium of pristane-induced arthritic mice following treatment with Sim were determined using real-time PCR (qPCR). The results of qPCR are shown in Figure 1. We found a significant upregulation in the expression of INFγ and LF genes in the untreated pristane-induced arthritic group (G3, RA) as compared to the control (G1, Cnt) and Sim control (G2, Sim) group. However, pristane-induced arthritic mice (G3, RA) treated with Sim [G4 (RA+Sim-co) and G5 (RA+Sim-post)] showed a significantly downregulated expression relative to the RA group. Among the two treated groups, the co-treated (prophylactic) group (G4, RA+Sim-co) showed significantly lower INFγ and LF expression than the post-treated (G5, RA+Sim-post) group. On the other hand, no significant difference in gene expression was noticed between the two controls groups (G1 (Cnt) and G2 (Sim)). These findings infer a potent immunosuppressive potential for Sim against pristane-induced arthritis, particularly when applied as a prophylactic treatment.

Sim inhibited the expression of inflammatory genes

Mice injected with pristane (G3, RA) exhibited a significant elevation in the expression of the two inflammatory genes IL1β, TNFα in the synovium compared to the two control groups [G1 (Cnt) and G2 (Sim)] (Fig. 2). Administration of Sim significantly downregulated this elevated expression with lowest expression in the co-treated group (G4, RA+Sim-co). On the other hand, the anti-inflammatory IL10 gene was significantly decreased in the arthritic group (G3) compared to the two controls groups (G1 and G2). Treatment with Sim significantly

 

 

upregulated IL10 expression, with higher expression in the co-treated group (G4), relative to the arthritic group (G3). These results imply that Sim had an anti-inflammatory effect on arthritis induced by pristane with best effect when given as a prevention therapy.

Sim reduced expression of arthritis-related genes

The expression of TGFβ1, MMP3, and OLR1 in the synovium was significantly higher in the arthritic group (G3) than in the control groups (G1 and G2) (Fig. 3). Arthritic mice treated with Sim (G4 and G5) exhibited significant downregulated expression of TGFβ1, MMP3, and OLR1 genes, with lowest expression in the co-treated group (G4), relative to the untreated arthritic mice (G3). However, the expression of these genes in the treated groups (G4 and G5) was still significantly higher than the control groups (G1 and G2). Again, no significant difference in TGFβ1, MMP3, and OLR1 expression was observed between the two control groups (Fig. 3). These results suggest that Sim had a notable anti-arthritic effect with better influence for the prevention approach.

 

Sim decreased oxidative stress and enhanced antioxidant status

Figure 4 shows the effect of Sim treatment on the lipid peroxide MDA and the oxidative stress marker NO as well as the activities of antioxidant enzymes GSH and SOD in the synovium of the pristane-induced arthritic mice. Arthritic mice (G3) showed significant elevation in MDA and NO levels and significant reduction in GSH and SOD levels relative to the control animals (G1 and G2). Administration of Sim restored these markers to levels close to the control. Again, the co-treated group (G4) exhibited lower levels of oxidants marker (MDA and NO) and higher levels of antioxidant markers (GSH and SOD). These data indicate that Sim could diminish oxidative stress damage in the synovium generated by pristane with a better effect in the co-treated group.

 

Discussion

Several previous studies reported a notable antiarthritic effect of the hypocholesterolemic drugs statins including simvastatin (Sim). However, little is known regarding the biochemical and molecular alterations associated with this effect. To the best of our knowledge, this is the first study to report that treatment with Sim ameliorated arthritis triggered by pristane with best improvement when animals pre-treated with Sim (prophylactic group). This anti-arthritic effect could be mediated through, at least in part, potent immunomodulatory, anti-inflammatory, and antioxidant effects of Sim.

The immunomodulatory potential is one of the main mechanisms by which Sim can induce its anti-arthritic effect. Several evidence obtained from experimental trials showed that statins possess powerful immunomodulatory potential independent of their hypocholesterolemic effects (Cai et al., 2021; Sparrow et al., 2001; Yang et al., 2021). Supporting this notion, we also found a potent immunosuppressive effect for Sim as revealed by downregulated expression of the immunoregulatory INFγ and LF genes in the synovium of pristane-induced arthritic mice treated with Sim compared to the untreated arthritic mice. Consistent with our findings, a large body of previous in vivo and in vitro studies revealed that treatment with statins including Sim could significantly inhibit the expression of IFNg and MHCII in synoviocytes, endothelial cells, synovial fluid neutrophils, and macrophages (Cross et al., 2003; Mostafa et al., 2020; Mulhaupt et al., 2003). Additionally, Sim inhibits T lymphocytes and macrophages proliferation and activation in vitro (Leung et al., 2003) and in patients with hypertriglyceridemia (Krysiak and Okopień, 2013). LF regulates the functions of several immune cells and ultimately induces both innate and adaptive immune responses (Ibrahim et al., 2019; Legrand, 2011). To the best of our knowledge, this is the first study to report an inhibitory effect of Sim on LF expression levels in the synovium of arthritic animals.

The anti-arthritic potential of Sim can also be attributed to its anti-inflammatory effect. Indeed, we reported a significant downregulation in gene expression of the proinflammatory cytokines IL1β and TNFα and a significant upregulation of the anti-inflammatory IL10 in synovium of arthritic mice following treatment with Sim. Sim does not only reduce the production of pro-inflammatory cytokines (TNFα, IL8, and I1β) in animals and patients (Marino et al., 2014; Shevchuk et al., 2020; Wang et al., 2015) but it also inhibits the release of inflammatory cytokines in RA patients and animals (Ahmed et al., 2015; Barbosa et al., 2017; Pereira et al., 2014). Sim and other statins could also exert anti-inflammatory effects through inhibition of iNOS and COX1 expression (Colucci et al., 2013; Myasoedova et al., 2020; Tan et al., 2016). The anti-inflammatory cytokine IL10 found in the synovial fluid and synovium of RA patients (Katsikis et al., 1994) derived mainly from T and B lymphocytes and macrophages (Brennan and Foey, 2002). As an anti-inflammatory molecule, we found an increase in the expression of the IL10 gene after treatment of arthritic group with Sim. Similarly, Sim induced the production of IL10 in the synovium of a rat model of complete Freund’s adjuvant-induced arthritis (Barbosa et al., 2017) and serum of patients with chronic obstructive pulmonary disease (Maneechotesuwan et al., 2015). Moreover, the in vitro inhibition of IL10 significantly elevates TNFα and IL1β (Katsikis et al., 1994). IL10 decreases MHC class II that subsequently inactivates T cells and prevents cytokines formation (Fillatreau et al., 2008; O’Garra and Vieira, 2007). It also triggers activation of CD8 T cells, enhancing their cytotoxic potential (Moore et al., 2001).

The lipoprotein-associated phospholipase A2 (Lp-PLA2), is a platelet-activating factor that can also catalyze the cleavage of the oxLDL into its highly immunogenic metabolites (Tselepis and Chapman, 2002). A large variety of epitopes on oxLDL metabolites were recognized by particular autoantibodies in humans with a higher activity of Lp- PLA2 (Lourida et al., 2006; Nezos et al., 2021; Papathanasiou et al., 2008; Tsouli et al., 2006). A higher level of oxLDL was detected in joints of RA patients (Dai et al., 2000; McMahon et al., 2006). To the best of our knowledge, this is the first study to report that administration of Sim resulted in a significant downregulation of the OLR1 gene in the synovium of arthritic mice.

MMP3 is mainly formed by immune cells activated by inflammatory cytokines and can destroy different members of collagens that are the main tissue constituents of the joint (Guerrero et al., 2021; Yamaguchi et al., 2008). MMP3 is another arthritis-related marker that could be targeted by Sim. Our results showed a significant decrease in MMP3 expression following treatment with Sim. In support, Aktas et al. (2011) reported that the antiarthritic potential of Sim is mediated through inhibition of MMP3 expression in the joint of osteoarthritic rats. MMP3 levels were also elevated in the blood and synovial fluid of RA patients (Cunnane et al., 2001). Statins reduced the expression of MMP3 in rabbit macrophages and human chondrocytes (Abeles and Pillinger, 2006).

In the present study, treatment with pristane significantly upregulated TGFβ expression in arthritic mice. These findings agreed with Bira et al. (2005) who found elevated expression of TGFβ and its receptor in synovial fibroblasts of patients with RA. To the best of our knowledge, this is the first study to report downregulated expression of TGFβ in the synovium of the arthritic mice following treatment with Sim.

In addition to inflammation, oxidative stress participated in the damage of joint tissue during the pathogenesis of RA (Mahajan and Tandon, 2004). The anti-arthritic influence of Sim could also be mediated by its antioxidant properties. In support, we found that Sim decreased the oxidant (MDA, NO) and increased the antioxidant (GSH, SOD) markers in the synovium of arthritic mice. In agreement, previous studies reported the similar antioxidant potential for Sim in rat models of arthritis (Ahmed et al., 2015) and ischemic heart failure (Cho et al., 2014). Statins can inhibit oxidative stress by lowering the release of lipid peroxide MDA and NO (Fenster et al., 2003; van Boheemen et al., 2021). Elevation of MDA levels in the arthritic mice could trigger cell membrane damage of synovial membrane cells and increase free radicals production leading to oxidative stress damage particularly when endogenous antioxidant systems fail to compensate for the ROS.

Conclusions

Sim has a potent anti-arthritic effect against pristane-induced arthritis and this effect could be mediated through, at least in part, its immunomodulatory, anti-inflammatory, and antioxidant effects. In general, mice co-treated with Sim and pristane conferred better effects against arthritis than post-treated animals. This highlights the impact of using Sim as a prophylaxis (prevention) better than treatment. Therefore, Sim could be used as a protective drug against rheumatoid arthritis.

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Abeles, A.M., and Pillinger, M.H., 2006. Statins as antiinflammatory and immunomodulatory agents: A future in rheumatologic therapy? Arthritis Rheum. Off. J. Am. Coll. Rheumatol., 54: 393-407. https://doi.org/10.1002/art.21521

Abou-Easa, K., El-Magd, M., Tousson, E., Hassanin, A., Shukry, M., and Salama, M., 2014. Pineal gland plays a role in gonadal development after eyelids separation in puppies. Int. J. Morphol., 33: 7-18. https://doi.org/10.4067/S0717-95022015000100001

Adamopoulos, I.E., 2015. Autoimmune or autoiflammatory? Bad to the bone. Int. J. clin. Rheumatol., 10: 5. https://doi.org/10.2217/ijr.15.1

Ahmed, Y.M., Messiha, B.A.S., and Abo-Saif, A.A., 2015. Protective effects of simvastatin and hesperidin against complete freund’s adjuvant-induced rheumatoid arthritis in rats. Pharmacology, 96: 217-225. https://doi.org/10.1159/000439538

Aktas, E., Sener, E., and Gocun, P.U., 2011. Mechanically induced experimental knee osteoarthritis benefits from anti-inflammatory and immunomodulatory properties of simvastatin via inhibition of matrix metalloproteinase-3. J. Orthop. Traumatol. Off. J. Ital. Soc. Orthop. Traumatol., 12: 145-151. https://doi.org/10.1007/s10195-011-0154-y

Barbosa, C.P., Bracht, L., Ames, F.Q., de Souza Silva-Comar, F.M., Tronco, R.P., and Bersani-Amado, C.A., 2017. Effects of ezetimibe, simvastatin, and their combination on inflammatory parameters in a rat model of adjuvant-induced arthritis. Inflammation, 40: 717-724. https://doi.org/10.1007/s10753-016-0497-x

Bira, Y., Tani, K., Nishioka, Y., Miyata, J., Sato, K., Hayashi, A., Nakaya, Y., and Sone, S., 2005. Transforming growth factor beta stimulates rheumatoid synovial fibroblasts via the type II receptor. Mod. Rheumatol., 15: 108-113. https://doi.org/10.1007/s10165-004-0378-2

Brennan, F.M., and Foey, A.D., 2002. Cytokine regulation in RA synovial tissue: Role of T cell/macrophage contact-dependent interactions. Arthritis Res. Ther., 4: S177. https://doi.org/10.1186/ar556

Cai, M., Ni, W.J., Han, L., Chen, W.D., and Peng, D.Y., 2021. Research progress of therapeutic enzymes and their derivatives: Based on herbal medicinal products in rheumatoid arthritis. Front. Pharmacol., 12: 626342. https://doi.org/10.3389/fphar.2021.626342

Cho, K.I., Koo, S.H., Cha, T.J., Heo, J.H., Kim, H.S., Jo, G.B., and Lee, J.W., 2014. Simvastatin attenuates the oxidative stress, endothelial thrombogenicity and the inducibility of atrial fibrillation in a rat model of ischemic heart failure. Int. J. mol. Sci., 15: 14803-14818. https://doi.org/10.3390/ijms150814803

Colucci, R., Fornai, M., Duranti, E., Antonioli, L., Rugani, I., Aydinoglu, F., Ippolito, C., Segnani, C., Bernardini, N., Taddei, S. Blandizzi, C. and Virdis, A., 2013. Rosuvastatin prevents angiotensin II-induced vascular changes by inhibition of NAD(P)H oxidase and COX-1. Br. J. Pharmacol., 169: 554-566. https://doi.org/10.1111/j.1476-5381.2012.02106.x

Cross, A., Bucknall, R.C., Cassatella, M.A., Edwards, S.W., and Moots, R.J., 2003. Synovial fluid neutrophils transcribe and express class II major histocompatibility complex molecules in rheumatoid arthritis. Arthritis Rheum., 48: 2796-2806. https://doi.org/10.1002/art.11253

Cunnane, G., FitzGerald, O., Beeton, C., Cawston, T.E., and Bresnihan, B., 2001. Early joint erosions and serum levels of matrix metalloproteinase 1, matrix metalloproteinase 3, and tissue inhibitor of metalloproteinases 1 in rheumatoid arthritis. Arthritis Rheum., 44: 2263-2274. https://doi.org/10.1002/1529-0131(200110)44:10<2263::AID-ART389> 3.0.CO;2-1

Dai, L., Lamb, D., Leake, D., Kus, M., Jones, H., Morris, C., and Winyard, P., 2000. Evidence for oxidised low density lipoprotein in synovial fluid from rheumatoid arthritis patients. Free Rad. Res., 32: 479-486. https://doi.org/10.1080/10715760000300481

De Franco, M., Peters, L.C., Correa, M.A., Galvan, A., Canhamero, T., Borrego, A., Jensen, J.R., Gonçalves, J., Cabrera, W.H., and Starobinas, N., 2014. Pristane-induced arthritis loci interact with the Slc11a1 gene to determine susceptibility in mice selected for high inflammation. PLoS One, 9: e88302. https://doi.org/10.1371/journal.pone.0088302

Edupuganti, S.R., Eder, V., Ternant, D., Courtehoux, M., Tranquart, F., Goupille, P., Paintaud, G., and Mulleman, D., 2015. F-18 fluorodeoxyglucose positron emission tomography can detect early response to adalimumab, a tumor necrosis factor-α antagonist, in rheumatoid arthritis: A prospective pilot study. Joint Bone Spine, 82: 381-383. https://doi.org/10.1016/j.jbspin.2015.01.014

El-Bayomi, K.M., Saleh, A.A., Awad, A., El-Tarabany, M.S., El-Qaliouby, H.S., Afifi, M., El-Komy, S., Essawi, W.M., Almadaly, E.A., and El-Magd, M.A., 2018. Association of CYP19A1 gene polymorphisms with anoestrus in water buffaloes. Reprod. Fertil. Dev., 30: 487-497. https://doi.org/10.1071/RD16528

Elgazar, A.A., Selim, N.M., Abdel-Hamid, N.M., El-Magd, M.A., and El Hefnawy, H.M., 2018. Isolates from Alpinia officinarum Hance attenuate LPS induced inflammation in HepG2: Evidence from in silico and in vitro studies. Phytother. Res., 32: 1273-1288. https://doi.org/10.1002/ptr.6056

Faisal, R., Chiragh, S., Popalzai, A.J., and Rehman, K.U., 2015. Anti inflammatory effect of thymoquinone in comparison with methotrexate on pristane induced arthritis in rats. J. Pak. med. Assoc., 65: 519-525.

Fenster, B.E., Tsao, P.S., and Rockson, S.G., 2003. Endothelial dysfunction: Clinical strategies for treating oxidant stress. Am. Heart J., 146: 218-226. https://doi.org/10.1016/S0002-8703(02)94796-4

Fillatreau, S., Gray, D., and Anderton, S.M., 2008. Not always the bad guys: B cells as regulators of autoimmune pathology. Nat. Rev. Immunol., 8: 391. https://doi.org/10.1038/nri2315

Gottschalk, O., Dao Trong, M.L., Metz, P., Wallmichrath, J., Piltz, S., Jauch, K.W., Jansson, V., and Schmitt-Sody, M., 2014. Simvastatin reduces leucocyte- and platelet-endothelial cell interaction in murine antigen-induced arthritis in vivo. Scand. J. Rheumatol., 43: 356-363. https://doi.org/10.3109/03009742.2013.879606

Greenwood, J., and Mason, J.C., 2007. Statins and the vascular endothelial inflammatory response. Trends Immunol., 28: 88-98. https://doi.org/10.1016/j.it.2006.12.003

Guerrero, S., Sánchez-Tirado, E., Agüí, L., González-Cortés, A., Yáñez-Sedeño, P., and Pingarrón, J.M., 2021. Simultaneous determination of CXCL7 chemokine and MMP3 metalloproteinase as biomarkers for rheumatoid arthritis. Talanta, 234: 122705. https://doi.org/10.1016/j.talanta.2021.122705

Hou, W.K., Meng, L.S., Zheng, F., Wen, Y.R., Zhu, W.H., Jiang, C.S., He, X.J., Zhou, Y., and Lu, S.M., 2011. Methotrexate ameliorates pristane-induced arthritis by decreasing IFN-γ and IL-17A expressions. J. Zhejiang Univ. Sci. B, 12: 40-46. https://doi.org/10.1631/jzus.B1000078

Hu, L., Hu, X., Long, K., Gao, C., Dong, H.L., Zhong, Q., Gao, X.M., and Gong, F.Y., 2017. Extraordinarily potent proinflammatory properties of lactoferrin-containing immunocomplexes against human monocytes and macrophages. Sci. Rep., 7: 4230. https://doi.org/10.1038/s41598-017-04275-7

Ibrahim, H.M., Mohammed-Geba, K., Tawfic, A.A., and El-Magd, M.A., 2019. Camel milk exosomes modulate cyclophosphamide induced oxidative stress and immuno-toxicity in rats. Fd. Funct., 10: 7523-7532. https://doi.org/10.1039/C9FO01914F

Katsikis, P.D., Chu, C.Q., Brennan, F.M., Maini, R.N., and Feldmann, M., 1994. Immunoregulatory role of interleukin 10 in rheumatoid arthritis. J. exp. Med., 179: 1517-1527. https://doi.org/10.1084/jem.179.5.1517

Kida, I., Kobayashi, S., Takeuchi, K., Tsuda, H., Hashimoto, H., and Takasaki, Y., 2011. Antineutrophil cytoplasmic antibodies against myeloperoxidase, proteinase 3, elastase, cathepsin G and lactoferrin in Japanese patients with rheumatoid arthritis. Modern Rheumatol., 21: 43-50. https://doi.org/10.3109/s10165-010-0356-9

Krysiak, R., and Okopień, B., 2013. Lymphocyte-suppressing action of simvastatin in patients with isolated hypertriglyceridemia. Pharmacol. Rep., 65: 756-760. https://doi.org/10.1016/S1734-1140(13)71056-9

Kustiarini, D.A., Nishigaki, T., Kanno, H., and To, H., 2019. Effects of Morinda citrifolia on rheumatoid arthritis in SKG Mice. Biol. Pharm. Bull., 42: 496-500. https://doi.org/10.1248/bpb.b18-00480

Legrand, D., 2011. Lactoferrin, a key molecule in immune and inflammatory processes. Biochem. Cell Biol., 90: 252-268. https://doi.org/10.1139/o11-056

Leung, B.P., Sattar, N., Crilly, A., Prach, M., McCarey, D.W., Payne, H., Madhok, R., Campbell, C., Gracie, J.A., and Liew, F.Y., 2003. A novel anti-inflammatory role for simvastatin in inflammatory arthritis. J. Immunol., 170: 1524-1530. https://doi.org/10.4049/jimmunol.170.3.1524

Lourida, E.S., Papathanasiou, A.I., Goudevenos, J.A., and Tselepis, A.D., 2006. The low density lipoprotein (LDL)-associated PAF-acetylhydrolase activity and the extent of LDL oxidation are important determinants of the autoantibody titers against oxidized LDL in patients with coronary artery disease. Prostaglandins, Leukot. Essent. Fatty Acids, 75: 117-126. https://doi.org/10.1016/j.plefa.2006.03.012

Mahajan, A., and Tandon, V.R., 2004. Antioxidants and rheumatoid arthritis. J. Indian Rheumatol. Assoc., 12: 139-142.

Maneechotesuwan, K., Wongkajornsilp, A., Adcock, I.M., and Barnes, P.J., 2015. Simvastatin suppresses airway IL-17 and upregulates IL-10 in patients with stable COPD. Chest, 148: 1164-1176. https://doi.org/10.1378/chest.14-3138

Marino, F., Maresca, A.M., Castiglioni, L., Cosentino, M., Maio, R.C., Schembri, L., Klersy, C., Mongiardi, C., Robustelli Test, L., Grandi, A.M. and Guasti, L., 2014. Simvastatin down-regulates the production of interleukin-8 by neutrophil leukocytes from dyslipidemic patients. BMC Cardiovasc. Disord., 14: 37. https://doi.org/10.1186/1471-2261-14-37

Maron, D.J., Fazio, S., and Linton, M.F., 2000. Current perspectives on statins. Circulation, 101: 207-213. https://doi.org/10.1161/01.CIR.101.2.207

McCarey, D.W., McInnes, I.B., Madhok, R., Hampson, R., Scherbakova, O., Ford, I., Capell, H.A., and Sattar, N., 2004. Trial of atorvastatin in rheumatoid arthritis (TARA): Double-blind, randomised placebo-controlled trial. Lancet, 363: 2015-2021. https://doi.org/10.1016/S0140-6736(04)16449-0

McMahon, M., Grossman, J., FitzGerald, J., Dahlin-Lee, E., Wallace, D.J., Thong, B.Y., Badsha, H., Kalunian, K., Charles, C., and Navab, M., 2006. Proinflammatory high-density lipoprotein as a biomarker for atherosclerosis in patients with systemic lupus erythematosus and rheumatoid arthritis. Arthritis Rheum. Off. J. Am. Coll. Rheumatol., 54: 2541-2549. https://doi.org/10.1002/art.21976

Mohamed, A.E., El-Magd, M.A., El-Said, K.S., El-Sharnouby, M., Tousson, E.M., and Salama, A.F., 2021. Potential therapeutic effect of thymoquinone and/or bee pollen on fluvastatin-induced hepatitis in rats. Sci. Rep., 11: 15688. https://doi.org/10.1038/s41598-021-95342-7

Mohamed, M.A., Mahmoud, M.F., and Rezk, A.M., 2014. Effect of pentoxifylline and pioglitazone on rheumatoid arthritis induced experimentally in rats. Menoufia med. J., 27: 766. https://doi.org/10.4103/1110-2098.149748

Moore, K.W., de Waal Malefyt, R., Coffman, R.L., and O’Garra, A., 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol., 19: 683-765. https://doi.org/10.1146/annurev.immunol.19.1.683

Mostafa, T.M., Hegazy, S.K., Elshebini, E.M., Saif, D.S., and Elabd, A.H., 2020. A comparative study on the anti-inflammatory effect of angiotensin-receptor blockers and statins on rheumatoid arthritis disease activity. Indian J. med. Res., 152: 393-400. https://doi.org/10.4103/ijmr.IJMR_640_19

Mulhaupt, F., Matter, C.M., Kwak, B.R., Pelli, G., Veillard, N.R., Burger, F., Graber, P., Lüscher, T.F., and Mach, F., 2003. Statins (HMG-CoA reductase inhibitors) reduce CD40 expression in human vascular cells. Cardiovasc. Res., 59: 755-766. https://doi.org/10.1016/S0008-6363(03)00515-7

Myasoedova, E., Karmacharya, P., Duarte-Garcia, A., Davis, J.M., 3rd, Murad, M.H., and Crowson, C.S., 2020. Effect of statin use on the risk of rheumatoid arthritis: A systematic review and meta-analysis. Semin. Arthritis Rheum., 50: 1348-1356. https://doi.org/10.1016/j.semarthrit.2020.03.008

Nezos, A., Skarlis, C., Psarrou, A., Markakis, K., Garantziotis, P., Papanikolaou, A., Gravani, F., Voulgarelis, M., Tzioufas, A.G., Koutsilieris, M., Moutsopoulos, H.M., Kotsifaki, E. and Mavragani, C.P., 2021. Lipoprotein-Associated Phospholipase A2: A novel contributor in sjögren’s syndrome-related lymphoma? Front. Immunol., 12: 683623. https://doi.org/10.3389/fimmu.2021.683623

O’Garra, A., and Vieira, P., 2007. TH 1 cells control themselves by producing interleukin-10. Nat. Rev. Immunol., 7: 425. https://doi.org/10.1038/nri2097

Palmer, G., Chobaz, V., Talabot-Ayer, D., Taylor, S., So, A., Gabay, C., and Busso, N., 2004. Assessment of the efficacy of different statins in murine collagen-induced arthritis. Arthritis Rheum., 50: 4051-4059. https://doi.org/10.1002/art.20673

Papathanasiou, A.I., Lourida, E.S., Tsironis, L.D., Goudevenos, J.A., and Tselepis, A.D., 2008. Short-and long-term elevation of autoantibody titers against oxidized LDL in patients with acute coronary syndromes: Role of the lipoprotein-associated phospholipase A2 and the effect of atorvastatin treatment. Atherosclerosis, 196: 289-297. https://doi.org/10.1016/j.atherosclerosis.2006.10.033

Patten, C., Bush, K., Rioja, I., Morgan, R., Wooley, P., Trill, J., and Life, P., 2004. Characterization of pristane-induced arthritis, a murine model of chronic disease: response to antirheumatic agents, expression of joint cytokines, and immunopathology. Arthritis Rheum., 50: 3334-3345. https://doi.org/10.1002/art.20507

Pereira, M.C., Cardoso, P.R., Da Rocha, L.F., Jr., Rêgo, M.J., Gonçalves, S.M., Santos, F.A., Galdino-Pitta, M.R., Dantas, A.T., Duarte Â, L., and Pitta, M.G., 2014. Simvastatin inhibits cytokines in a dose response in patients with rheumatoid arthritis. Inflamm. Res. Off. J. Eur. Histamine Res. Soc., 63: 309-315. https://doi.org/10.1007/s00011-013-0702-4

Saleh, A.A., Amber, K., El-Magd, M.A., Atta, M.S., Mohammed, A.A., Ragab, M.M., and Abd El-Kader, H., 2014. Integrative effects of feeding Aspergillus awamori and fructooligosaccharide on growth performance and digestibility in broilers: promotion muscle protein metabolism. BioMed. Res. Int., 2014: 946859. https://doi.org/10.1155/2014/946859

Saleh, A.A., and El-Magd, M.A., 2018. Beneficial effects of dietary silver nanoparticles and silver nitrate on broiler nutrition. Environ. Sci. Pollut. Res., 25: 27031-27038. https://doi.org/10.1007/s11356-018-2730-7

Sangaletti, S., Botti, L., Gulino, A., Lecis, D., Bassani, B., Portararo, P., Milani, M., Cancila, V., De Cecco, L., Dugo, M. Tripodo, C. and Colombo, M.P., 2021. SPARC regulation of PMN clearance protects from pristane-induced lupus and rheumatoid arthritis. iScience, 24: 102510. https://doi.org/10.1016/j.isci.2021.102510

Selim, N.M., Elgazar, A.A., Abdel-Hamid, N.M., El-Magd, M.R.A., Yasri, A., Hefnawy, H.M.E., and Sobeh, M., 2019. Chrysophanol, physcion, hesperidin and curcumin modulate the gene expression of pro-inflammatory mediators induced by LPS in HepG2: In silico and molecular studies. Antioxidants, 8: 371. https://doi.org/10.3390/antiox8090371

Shaw, P.X., 2004. Rethinking oxidized low-density lipoprotein, its role in atherogenesis and the immune responses associated with it. Arch. Immunol. Ther. Exp. Eng. Ed., 52: 225-239.

Shevchuk, S.V., Seheda, Y.S., Kuvikova, I.P., Shevchuk, O.V., and Galiutina, O.Y., 2020. The effect of atorvastatinum in the treatment of patients with rheumatoid arthritis. Wiad. Lek., (Warsaw, Poland: 1960), 73: 2427-2430. https://doi.org/10.36740/WLek202011117

Sparrow, C.P., Burton, C.A., Hernandez, M., Mundt, S., Hassing, H., Patel, S., Rosa, R., Hermanowski-Vosatka, A., Wang, P.R., and Zhang, D., 2001. Simvastatin has anti-inflammatory and antiatherosclerotic activities independent of plasma cholesterol lowering. Arterioscler. Thromb. Vasc. Biol., 21: 115-121. https://doi.org/10.1161/01.ATV.21.1.115

Tan, W., Xue-bin, C., Tian, Z., Xiao-wu, C., Pei-pei, H., Zhi-bin, C., and Bei-sha, T., 2016. Effects of simvastatin on the expression of inducible nitric oxide synthase and brain-derived neurotrophic factor in a lipopolysaccharide-induced rat model of Parkinson disease. Int. J. Neurosci., 126: 278-286. https://doi.org/10.3109/00207454.2015.1012758

Tselepis, A.D., and Chapman, M.J., 2002. Inflammation, bioactive lipids and atherosclerosis: Potential roles of a lipoprotein-associated phospholipase A2, platelet activating factor-acetylhydrolase. Atheroscler. Suppl., 3: 57-68. https://doi.org/10.1016/S1567-5688(02)00045-4

Tsouli, S.G., Kiortsis, D.N., Lourida, E.S., Xydis, V., Tsironis, L.D., Argyropoulou, M.I., Elisaf, M., and Tselepis, A.D., 2006. Autoantibody titers against OxLDL are correlated with Achilles tendon thickness in patients with familial hypercholesterolemia. J. Lipid Res., 47: 2208-2214. https://doi.org/10.1194/jlr.M600109-JLR200

van Boheemen, L., Turk, S., Beers-Tas, M.V., Bos, W., Marsman, D., Griep, E.N., Starmans-Kool, M., Popa, C.D., van Sijl, A., Boers, M. Nurmohamed, M.T. and van Schaardenburg, D., 2021. Atorvastatin is unlikely to prevent rheumatoid arthritis in high risk individuals: results from the prematurely stopped STAtins to Prevent Rheumatoid Arthritis (STAPRA) trial. RMD Open, 7. https://doi.org/10.1136/rmdopen-2021-001591

Wang, T., Cao, X.B., Chen, X.W., Huang, P.P., Zhang, T., Chen, Z.B., and Tang, B.S., 2015. Influence of simvastatin on dopaminergic neurons of lipopolysaccharide-induced rat model of Parkinson’s disease. Asian Pac. J. trop. Med., 8: 64-67. https://doi.org/10.1016/S1995-7645(14)60189-9

Wong, S., Francis, N., Chahal, H., Raza, K., Salmon, M., Scheel-Toellner, D., and Lord, J., 2009. Lactoferrin is a survival factor for neutrophils in rheumatoid synovial fluid. Rheumatology, 48: 39-44. https://doi.org/10.1093/rheumatology/ken412

Yamaguchi, H., Kidachi, Y., Umetsu, H., and Ryoyama, K., 2008. Hypoxia enhances gene expression of inducible nitric oxide synthase and matrix metalloproteinase-9 in ras/myc-transformed serum-free mouse embryo cells under simulated inflammatory and infectious conditions. Cell Biol. Int., 32: 940-949. https://doi.org/10.1016/j.cellbi.2008.04.008

Yang, Y., Guo, L., Wang, Z., Liu, P., Liu, X., Ding, J., and Zhou, W., 2021. Targeted silver nanoparticles for rheumatoid arthritis therapy via macrophage apoptosis and re-polarization. Biomaterials, 264: 120390. https://doi.org/10.1016/j.biomaterials.2020.120390

Yu, Y., Li, S., Liu, Y., Tian, G., Yuan, Q., Bai, F., Wang, W., Zhang, Z., Ren, G., Zhang, Y. Ren, G., Zhang, Y. and Li, D., 2015. Fibroblast growth factor 21 (FGF21) ameliorates collagen-induced arthritis through modulating oxidative stress and suppressing nuclear factor-kappa B pathway. Int. Immunopharmacol., 25: 74-82. https://doi.org/10.1016/j.intimp.2015.01.005

Zaiss, M.M., Joyce Wu, H.J., Mauro, D., Schett, G., and Ciccia, F., 2021. The gut-joint axis in rheumatoid arthritis. Nat. Rev. Rheumatol., 17: 224-237. https://doi.org/10.1038/s41584-021-00585-3