Research Article

Effect of a Polymorphism in Prolactin Gene on Some Reproductive Traits in TB Crossbred Ducks in Southern Vietnam

Ngoc Tan Nguyen1*, Tan Loi Le1, Thi Kim Ngan Vo1, Chi Hieu Do1, Tuan Thanh Hoang2, Nguyen Khang Duong3, Quang Minh Luu4

1Faculty of Biological Sciences, Nong Lam University in Ho Chi Minh City - Linh Trung Ward, Thu Duc City, Ho Chi Minh City, Vietnam; 2Vigova Poultry Research and Development Center - 496/101 Duong Quang Ham Street, Ward 6, Go Vap District, Ho Chi Minh City, Vietnam; 3Faculty of Animal Science and Veterinary Medicine, Nong Lam University in Ho Chi Minh City - Linh Trung Ward, Thu Duc City, Ho Chi Minh City, Vietnam; 4Ministry of Science and Technology. 113 Tran Duy Hung Street, Trung Hoa Ward, Cau Giay District, Ha Noi City, Vietnam.

Received | Mach 12, 2023; Accepted | April 11, 2023; Published | May 03, 2023

*Correspondence | Ngoc Tan Nguyen, Faculty of Biological Sciences, Nong Lam University in Ho Chi Minh City, Vietnam- Linh Trung Ward, Thu Duc City, Ho Chi Minh City, Vietnam; Email: [email protected], [email protected]

Citation | Nguyen NT, Le TL, Vo TKN, Do CH, Hoang TT, Duong NK, Luu QM (2023). Effect of a polymorphism in prolactin gene on some reproductive traits in TB crossbred ducks in Southern Vietnam. Adv. Anim. Vet. Sci. 11(6):886-892.

DOI | https://dx.doi.org/10.17582/journal.aavs/2023/11.6.886.892

ISSN (Online) | 2307-8316

Copyright: 2023 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Vietnam ranks second behind China for duck production with a population of around 86.8 million birds (FAOSTAT, 2022). Duck production plays a principal role in meat and egg production to meet market demands. Various local duck breeds are endemic, and these have comparative advantages compared to imported livestock due to high ability to adapt with local environments and good production characteristics as a result of less artificial selection (Subekti et al., 2019; Nova et al., 2020; Rafian et al., 2022). During past decades, climate change has impacted duck production in the Vietnam, especially in Mekong River Delta region, due to increased salinization. A new line of crossbred ducks was created based on the reciprocal hybridization between Bien strain and TC strain and named BT or TB crossbred ducks. TB ducks are crossbred between TC male and Bien female. Bien is a local duck strain that has a high ability to adapt to increased salinity (Le et al., 2020) and TC is a newly created line with high egg yield from crossing Triet Giang male (imported from China) and Co female (native duck) by Vietnamese scientists (Le et al., 2022). In birds, egg yield has evolved from the interaction of many genes. Recent increased understanding of avian genes and genomes, especially ducks, using different molecular markers has allowed scientists to screen for candidate genes in relation to egg yield productivity traits. Restriction fragment length polymorphism based on polymerase chain reaction (PCR-RFLP) is a regularly used for polymorphism genotyping studies (Hiyama et al., 2012; Roy et al., 2020). Many candidate polymorphism genes in layer ducks have been recognized and correlated with egg production, in which the prolactin (PRL) gene has important functions in living things, specifically in egg production in duck (Reddy et al., 2002; Susanti et al., 2012; Irma et al., 2014; Mazurowski et al., 2016; Wang et al., 2011; Chuekwon and Boonlum, 2017; Ghanem et al., 2017; Astuti, 2019; Sabry et al., 2020), goose (Tang et al., 2021) and chicken (Cui et al., 2006; Rashidi et al., 2012; Roy et al., 2020; Manoharan et al., 2021; Rohmah et al., 2022). The prolactin gene was identified in ducks at 10 kb in length and comprising 4 introns and 5 exons (Kansaku et al., 2008). This gene plays a key role in reproductive traits (Wang et al., 2011). Research on PRL gene polymorphism in Indonesian local ducks documented exon 2 (Susanti, 2015) and exon 4 (Indriatia et al., 2016) or in chicken (Rohmah et al., 2020). In exon 5, a single nucleotide polymorphism (SNP) showed a positive correlation with egg production in Chinese ducks (Wang et al., 2011), Indonesian local ducks (Susanti et al., 2012; Astuti, 2019; Purwantini et al., 2020; Rafian et al., 2022) and Egyptian duck breeds (Sabry et al., 2020) or in chicken (Rohmah et al., 2022). Current study investigated polymorphism of the prolactin gene in exon 5 to determine the effect of genetic polymorphism on some reproductive traits of BT crossbred ducks.

MATERIALS AND METHODS

Animals

The birds in this study, as 331 TB crossbred ducks (32 males, 299 females, Figure 1), were reared at the VIGOVA Poultry Research and Development Center. Ducks were housed in pens as confined area, and individual ducks were identified by a fitted wing band. The commercial feed was used for ducks during the experiment in according with their age, such as a starter period (0 to 8 weeks) comprising 19-21% crude protein (CP) and 2850-2950 kcal of metabolizable energy (ME) ad libitum, a grower period (9 to 17 weeks) consisting of 14-15% CP and 2700-2800 kcal of ME with a restricted feeding regime, and a laying stage (18 to 70 weeks) as 17-18% CP and 2700-2 800 kcal of ME ad libitum. Fresh clean water was freely supplied.

 

The ducks were weighed (BW) in the morning before they were fed at 8 and 18 weeks of age to monitor the feeding regime. Reproductive traits related to egg production were recorded as followed AFE (age at first egg; in days), MEW (mean weight of eggs; in grams) as average daily egg weight collected during weeks 37 and 38 of age, and TNE (total number of eggs) calculating as the number of eggs laid until 38 weeks of age.

Collection of sample and DNA extraction

Blood samples were collected from 331 ducks at 8 weeks of age, with handling in accor­dance with good practitioner to minimize suffering for animals. The fresh blood (1 mL) was taken from the wing vein by a professional technician, stored in a tube with EDTA, then placed on ice at 4oC and transported to the laboratory within 12 hours.

Primer information

The sequence with access number AB158611.1 (Anas platyrhynchos) from GenBank was used to design a primer by primer 3 software. The sequences of primers were 5’- TGCAAAGTCAGATTCCACCA -3’ and 5’- GCAAAGCAACAAGAACACCA-3’ with 536 bp fragment length as forward and reverse primer used.

DNA amplification, PCR-RFLP assay and electrophoresis

Genomic DNA extraction was performed using a TopPURE® blood DNA exctraction kit (ABT-Vietnam) according the manufacturer’s instructions, extracted DNA were measured OD value using Bio-drop machine (UK) and stored at -80 oC until used (Nguyen et al., 2022). Extracted DNA from 331 individual samples was exposed to genotypic analysis. Polymerase chain reaction (PCR) was applied with a thermal cycler machine (BIOER, China), using 25 µL volume for the reaction following Nguyen et al. (2022), consisting of 2 µL (25 ng/μL) DNA template, 1 µL (10 pM each) prim­ers (Phu Sa, Vietnam), 12.5 µL of My TaqTM Mix 2X (Bioline, UK), with free nucleic ddH2O added to make up to 25 µL. The PCR procedure was performed with 35 cycles: (1) 95ºC for 4’, (2) 95ºC for 30”, (3) 59ºC for 30”, (4) 72ºC for 30”, (5) repeated step 2-4 for 35 cycles and (6) 72ºC for 5’. The PCR products were observed using 1% agarose gel with GelRed (30 min, 100V) with a 100 bp DNA ladder under UV light (GelDoc It2 - UVP, USA) after electrophoresis applied.

The fragment length with 536 bp of PCR products was digested with 10 units of PstI restriction enzyme at 37ºC overnight. The digested products were then electrophoresed at 50V for 1 hr on 2% agarose gel with GelRed. Individual PCR-RFLP fragment sizes in each sample were recorded based on a standard DNA molecular ladder (100 bp) by observing the band pattern under UV light (GelDoc It2-UVP, USA). The expected three genotypes of PstI PCR-RFLP were 536 bp for the CC genotype, 536/406/130 bp for the TC genotype and 406/130 bp for the TT genotype.

Data analysis

Observations of fragments and genotyping were manually performed following the procedure of Darabi et al. (2010). Allele frequency and genotype frequency were calculated according to the formula of Nei and Kumar (2000). Determinations of observed heterozygosity (Ho) and expected heterozygosity (He) were based on the formulae of Weir (2011) and Nei and Kumar (2000), respectively. The polymorphic information content (PIC) was appraised using the formula of Botstein et al. (1980). To test the effect of the prolactin gene polymorphism on reproductive traits, one-way analysis of variance followed by the Tukey’s test was applied, with significant difference set at P<0.05.

RESULTS AND DISCUSSION

PCR and PCR-RFLP assay

A fragment of 536 bp of the PRL gene in exon 5 was successfully amplified in all duck samples and the representative electrophoresis image with the 536 bp fragment was clearly observed in the Figure 2. Similar with current study, many studies have also successfully amplified the target gene on exon 5 of the prolactin gene with various fragment sizes in ducks (Mazurowski et al., 2016; Ghanem et al., 2017; Yurnalis et al., 2019; Purwantini et al., 2020) or in chicken (Rashidi et al., 2012; Mitrofanova et al., 2017; Perdamaian and Daryono, 2020; Rohmah et al., 2022).

 

 

As shown in Figure 3, polymorphism at the PRL/Pstl with two alleles (C and T) and three genotypes (CC: 536 bp; TT: 406/130 bp and TC: 536/406/130 bp) was clearly distinguished. The C and T allele frequencies were 0.811 and 0.189. According to sex, the C and T allele frequencies of in male birds were 0.797 and 0.203, while frequencies of the C and T alleles in female birds were 0.813 and 0.187. The allelic frequency for allele C (0.811) was significantly higher than for allele T (0.189) (Table 1), with the trend of allelic frequency in this study similar to several previous studies in various duck breeds (Chuekwon and Boonlum, 2017; Yurnalis et al., 2019; Sabry et al., 2020), while other research reported balanced allelic frequencies in investigated ducks (Mazurowski et al., 2016; Rafian et al., 2022). The disparities between the study results were caused by different sources of domestic breeds, selected certain traits applied, patterns of genetic mutations and

 

Table 1: Distribution of genotype and allele frequency in ducks at PRL/PstI polymorphism site.

Generation	Parameter	Genotypic frequency			Allelic frequency		He	PIC
		CC	CT	TT	C	T
Male	N	19	13	0	0,797	0,203	0,324	0,271
	Observed frequency	0,594	0,406	0
	Expected frequency	0,625	0,324	0,041
Female	N	195	96	8	0,813	0,187	0,304	0,258
	Observed frequency	0,652	0,321	0,027
	Expected frequency	0,661	0,304	0,035
Total	N	214	109	8	0,811	0,189	0,306	0,260
	Observed frequency	0.647	0,329	0,024
	Expected frequency	0,658	0,306	0,036

 

He: expected heterozygosity; PIC: Polymorphic information content.

 

levels of material genetic recombination (Rafian et al., 2022). Investigation of PRL/PstI in exon 5 in duck breeds including Shanma, Shaoxing, Jingyun, Jingjiang, Youma and F2 found that some breeds were balanced in allele frequency (Shanma, Shaoxing and Jingyun), while other breeds (Jingjiang, Youma and F2) were dominant in one allele (Wang et al., 2011).

Sequence analysis of depicted samples for representative genotypes was showed in the Figure 4. The results indicated that the transition mutation T>C was found (site 403 in the Figure 4) and that resulted in three genotypes were observed as illustrated in Figures 3 and 4. The similar patterns are also reported in several reports in duck (Cui et al., 2006; Kansaku et al., 2008; Purwantini et al., 2020) or chicken (Rohmah et al., 2020).

 

As for genotype frequencies, the CC, CT and TT genotypes were 0.647, 0.329 and 0.024 for total populations or 0.652, 0.321 and 0.027 for the female group (Table 1). However, in the male group, only two genotypes were identified as CC and CT with observed frequencies 0.594 and 0.406, respectively while the TT genotype was not detected. Rafian et al. (2022) reported that monomorphism in the PRL/PstI locus was found in local Joti ducks from Indonesia, contrasting with other research (Wang et al., 2011; Ghanem et al., 2017; Yurnalis et al., 2019) as well as our present study. Abdel-Kafy et al. (2015) mentioned balanced allelic frequency in the population due to higher frequency of heterozygoty (TC) than homozygoty (CC and TT) in the PRL/PstI locus in ducks. Differences among reports might due to long term genetic selection that resulted in high homogeneity and frequencies of unfavorable alleles accumulated under artificial selection (Perdamaian and Daryono, 2020) or the directed selection for increased egg production has supported the favourable allele (Roy et al., 2020).

The observed heterozygosity value was 0.306 and equally to the expected heterozygosity (Table 1), it indicates that the population is relatively diverse. According to Wang et al. (2011), heterozygosity is an index to use for estimating the genetic diversity levels in the population, and the heterozygosity value more than 0.5 is considered high genetic diversity (Karabag et al., 2016). The PIC value as showed in the Table 1 was 0.260 that indicated the polymorphic at PRL/PstI locus had moderate level because of the PIC ranking in 0.25<PIC<0.5 according to Botstein et al. (1980).

 

Table 2: Effect of PRL/PstI genotype on some reproductive traits in TB crossbred duck.

Genotype	N	Age first egg (days)	Egg yield up to 38 weeks of age (egg)	Egg weight (g)
CC	188	145.3a±1.8	99.3a±1.5	72.3±0,3
CT	89	152.3b±1.7	93.2b±1.6	71.2±0.6
TT	6	153.2b±3.8	91.7b±2.2	70.6±0.7

 

The relationship between PRL/PstI polymorphism and some reproductive traits are presented in Table 2. The data from Table 2 elucidated that the group of ducks with the CC genotype achieved sexual maturity earlier than the CT or TT genotypes (145.3 vs 152.3 and 153.2 days, respectively). Contrary, no association between the polymorphism at PRL/PstI site and age at the first egg was found in native Chinese ducks (Wang et al., 2011) or Indonesian local duck (Purwantini et al., 2020). It was documented that high body weight at hatch (BWH) had earlier sexual maturity in the association with PRL gen polymorphism (Rashidi et al., 2012). In fact, the association of polymorphism at PRL/PstI locus in exon 5 on sex maturity is scare and still unknown the mechanism and it needs more study for clearly explanation.

For egg yield, individuals with the CT and TT genotypes had significantly lower egg numbers up to 38 weeks of age compared to CC (92.4 and 91.7 vs 99.3 eggs/bird, P<0.05). No significant differences in average egg weight were found among the three genotypes (CC, CT and TT: 72.3, 71.2 and 70.6 g/egg, respectively; P>0.05). Investigated from five native duck breeds (Shanma, Shaoxing, Jinyun, Jingjiang and Youxian), Wang et al. (2011) reported that polymorphism at PRL/PstI in exon 5 was detected, and ducks bearing CC genotype possessed higher egg production as well as egg weight than those of the CT genotype. Similar results of polymorphism at the PRL/PstI locus in different duck breeds and its relationship with reproductive traits such as egg production ability was also reported in other studies in ducks (Ghanem et al., 2017; Bai et al., 2019; Rohmah et al., 2022) or in chicken (Cui et al., 2006). In chicken, PRL/PstI +/+ genotype was associated with higher egg production at the age of 40 wks (Nagaraja et al., 2000) or at 48 and 57 weeks of age (Li et al., 2008) than PRL/PstI -/- genotype have reported similar trend of results on egg production in this current study.

The prolactin gene is considered as candidate marker gene for egg production in birds because it plays an important role in broodiness behavior that specifically controls the egg yield variability due to reducing egg biosynthesis during the period of broody (Chen et al., 2007; Perdamaian and Daryono, 2020). When the onset of broodiness is activated, the elevation of plasma prolactin, which can be variation in tropical chicken breeds, causes follicle regression on the ovary and then ceases egg production (Li et al., 2013; Banu et al., 2017) of birds in general, especially in ducks. Several factors affect broodiness, including intrinsic factors such as genetic diversity due to mutation and other mechanism related to epigenetic condition, for example: DNA methyl- or demethylation, histone acetyl- or deacetylation) or extrinsic factors such as ambient temperature, humidity, availability of feed compositions and sources and photoperiodicity which alter organism behavior toward broodiness associated with egg production ability (Geng et al., 2014; Perdamaian and Daryono, 2020).

CONCLUSIONS AND RECOMMENDATIONS

This document is the first report of genetic polymorphism of the PRL/PstI locus in exon 5 of TB crossbred duck in Vietnam. Two kinds of alleles with three genotypes were identified for PRL/PstI polymorphism. Ducks with CC genotype possess a lower age at first egg and higher total egg numbers up to 38 wks of age than the group of ducks with CT and TT genotypes. The polymorphic site at PRL/PstI can be considered a candidate gene for supporting genetic selection in ducks to improve egg production.

ACKNOWLEDGMENT

Our sincere appreciation goes to all the staff at VIGOVA for carefully recording the phenotype data of the ducks during this experimental study.

NOVELTY STATEMENT

To the best of our knowledge, this is the first study in Vietnam reporting on the polymorphism of the prolactin gene on exon 5 in TB crossbred ducks as an alternative crossbred duck with high ability to adapt to salinity conditions in response to global warming due to climate change.

AUTHOR’S CONTRIBUTION

All authors generally discussed about the experimental design, read and approved the manuscript in each step. NGUYEN, N.T covered all the research, wrote and revised the manuscript. LE, T.L., VO TKN and DO CH contributed equally to the work on DNA extraction, design primer and amplification of target gene and sequence analysis. HOANG, T.T and LUU, QM donated to sample collection and statistical analysis, respectively. DUONG, N.K. was responsibility for evaluating the manuscript and checking the plagiarism.

Conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abdel-Kafy EM, Hussein AB, Abdel-Ghany SM, Gamal El-Din AY, Badawi YM (2015). Single nucleotide polymorphisms in the growth hormone gene are associated with some performance traits in the rabbit. Int. J. Biol. Pharm. Allied Sci., 4(2): 490-504.

Astuti D (2019). The characters and diversity of prolactin and growth hormone genes in the local Turi Ducks of Indonesia. AIP Conf. Proc., 2155: 020045. https://doi.org/10.1063/1.5125549

Bai DP, Hu YQ, Li YB, Huang ZB, Li A (2019). Polymorphisms of the prolactin gene and their association with egg production traits in two Chinese domestic ducks. Br. Poult. Sci., 60(2): 125-129. https://doi.org/10.1080/00071668.2019.1567909

Banu N, Rashid MB, Hasan MM, Aziz FB, Islam MR, Haque MA (2017). Effect of anti-prolactin drug and peppermint on broodiness, laying performance and egg quality in indigenous hens. Asian J. Med. Biol. Res., 2: 547-557. https://doi.org/10.3329/ajmbr.v2i4.30995

Botstein D, White RL, Skolnick M, Davis RW (1980). Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet., 32: 314-331.

Chen CF, Shiue YL, Yen CJ, Tang PC, Chang HC, Lee YP (2007). Laying traits and underlying transcripts, expressed in the hypothalamus and pituitary gland that were associated with egg production variability in chickens. Theriogenology, 68: 1305-1315. https://doi.org/10.1016/j.theriogenology.2007.08.032

Chuekwon K, Boonlum S (2017). Association of prolactin gene with egg production in khaki Campbell ducks. Walailak J. Sci. Tech., 14(11): 849-853.

Cui JX, Du HL, Liang Y, Deng XM, Li N, Zhang XO (2006). Association of polymorphisms in the promoter region of chicken prolactin with egg production. Poult. Sci., 85: 26–31. https://doi.org/10.1093/ps/85.1.26

Darabi F, Shahabadi N, Maghsudi M, Kashanian S (2010). DNA binding and gel electrophoresis studies of copper (II) complex containing mixed aliphatic and aro­matic dinitrogen ligands. DNA Cell Biol., 29: 329–336. https://doi.org/10.1089/dna.2009.1001

FAOSTAT, 2022. https://www.fao.org/faostat/en/#home

Geng AL, Xu SF, Zhang Y, Zhang J, Chu Q, Liu HG (2014). Effects of photoperiod on broodiness, egg-laying and endocrine responses in native laying hens. Br. Poult. Sci., 55(2): 264-269. https://doi.org/10.1080/00071668.2013.878782

Ghanem HM, Ateya AI, Saleh RM, Hussein MS (2017). Artificial insemination vs natural mating and genetic PRL/PstI locus polymorphism and their effect on different productive and reproductive aspects in duck. Adv. Anim. Vet. Sci., 5(4): 179-184.

Hiyama G, Okabayashi H, Kansaku N, and Tanaka K (2012). Genetic variation in the growth hormone promoter region of Anas platyrhynchos, a Duck Native to Myanmar. J. Pout. Sci., 49: 245-248. https://doi.org/10.2141/jpsa.011062

Indriatia M, Sumantri C, and Susantic T (2016). Analysis of prolactin gene exon 4 diversity in Peking, White Mojosari, and Peking White Mojosari Crossbreed. Media Peternakan, 39(1): 14-19. https://doi.org/10.5398/medpet.2016.39.1.14

Irma, Sumantri C, Susanti T (2014). Single nucleotide polymorphism of prolactin gene exon two in ducks of Pekin, Mojosari and Pekin Mojosari crossbred. J. Ilmu Peternak. dan Vet., 19(2): 104-111. https://doi.org/10.14334/jitv.v19i2.1038

Kansaku N, Hiyama G, Sasanami T, Zadworny D (2008). Prolactin and growth hormone in birds: Protein structure, gene structure and genetic variation. J. Poult. Sci., 45(1): 1-6. https://doi.org/10.2141/jpsa.45.1

Karabag K, Balcıoglu MS, Karlı T, Alkan S (2016). Determination of genetic diversity using 15 simple sequence repeats markers in long term selected Japanese quail lines. Asian-Australas. J. Anim. Sci., 29: 1696-1701. https://doi.org/10.5713/ajas.15.0940

Le TH, Duong XT, Le VT, Nguyen THT (2022). Selection for creating VST1 egg-type duck line with high egg yield and quality. J. Anim. Husband. Sci. Tech., 273: 2-12 (Abstract in English).

Le TH, Le VT, Duong XT, Pham TNT, Nguyen TS, Nguyen VD (2020). The results of selection and creation of two sea duck lines for production in mangrove area. J. Anim. Sci. Technol., 117: 15-28 (Abstract in English).

Li HF, Shu JT, Du YF, Shan YJ, Chen KW, Zhang XY, Han W, Xu WJ (2013). Analysis of the genetic effects of prolactin gene polymorphisms on chicken egg production. Mol. Biol. Rep., 40: 289-294. https://doi.org/10.1007/s11033-012-2060-7

Li HF, Zhu WQ, Chen KW, Wu X, Tang PQ, Gao YS (2008). Association between GHR and IGF-1 gene polymorphisms and reproductive traits in Wenchang chickens. Turk. Vet. J. Anim. Sci., 32(4): 281-285.

Manoharan A, Sankaralingam S, Anitha P, Chacko B, Aravindakshan TV (2021). PCR-RFLP analysis of single nucleotide polymorphism (SNP) C-2402T at the promoter region of prolactin gene and its association with positively correlated production traits in White Leghorn Chicken. Indian J. Anim. Res., 56(8): 917-920. https://doi.org/10.18805/IJAR.B-4391

Mazurowski A, Frieske A, Wilkanowska A, Kokoszynski D, Mroczkowski S, Bernacki Z, Maiorano G (2016). Polymorphism of prolactin gene and its association with growth and some biometrical traits in ducks. Ital. J. Anim. Sci., 15(2): 200-206. https://doi.org/10.1080/1828051X.2016.1153405

Mitrofanova OV, Dementeva NV, Krutikova AA, Yurchenko OP, Vakhrameev AB, Terletskiy VP (2017). Association of polymorphic variants in MSTN, PRL, and DRD2 genes with intensity of young animal growth in Pushkin breed chickens. Cytol. Genet., 51: 179-184. https://doi.org/10.3103/S0095452717030082

Nagaraja SC, Aggrey SE, Yao J, Zadworny D, Fairfull RW, Kuhnlein U (2000). Trait association of a genetic marker near the IGF-I gene in egg-laying chickens. J. Hered., 91(2): 150-156. https://doi.org/10.1093/jhered/91.2.150

Nei M, Kumar S (2000). Molecular evolution and phylogenetics. Oxford Univ Press, New York, ISBN: 9780195135848.

Nguyen NT, Nguyen PKN, Phan TH, Le TL, Nguyen TK, Hoang TT, Pham CT, Nguyen CD, Duong NK (2022). Genetic diversity of native buffalo populations in Vietnam based on mitochondrial d-loop nucleotide sequence. Adv. Anim. Vet. Sci., 10(9): 2059-2067. https://doi.org/10.17582/journal.aavs/2022/10.9.2059.2067

Nova TD, Syahruddin E, Zein R (2020). The productivity of duck in different temperature cage management. J. Nat. Indonesia, 18(1): 43-61. https://doi.org/10.31258/jnat.18.1.43-61

Perdamaian ABI, Daryono BS (2020). Polymorphism of prolactin and prolactin promoter genes and its association with broodiness and body weight in Indonesian chicken lines. Iran. J. Appl. Anim. Sci., 10(2): 311-316.

Purwantini D, Santosa RSS, Santosa SA, Susanto A, Candrasari DP, Ismoyowati SAS (2020). Prolactin gene polymorphisms and associations with reproductive traits in Indonesian local ducks. Vet. World, 13(11): 2301-2311. https://doi.org/10.14202/vetworld.2020.2301-2311

Rafian T, Yurnalis Y, Fenita Y, Iskandarsyah R (2022). Polymorphism of prolactin gene (PRL/PstI) in Sikumbang Jonti duck using PCR-RFLP methods. J. Sain Peternak. Indones., 17(3): 170-174. https://doi.org/10.31186/jspi.id.17.3.170-174

Rashidi H, Rahimi-Mianji G, Farhadi A, Gholizadeh M (2012). Association of prolactin and prolactin receptor gene polymorphisms with economic traits in breeder hens of indigenous chickens of Mazandaran province. Iran. J. Biotechnol., 10(2): 129-135.

Reddy IJ, David CG, Sarma PV, Singh K (2002). The possible role of prolactin in laying performance and steroid hormone secretion in domestic hen. Gen. Comp. Endocrinol., 127: 249-255. https://doi.org/10.1016/S0016-6480(02)00034-5

Rohmah L, Darwati S, Ulupi N, Khaerunnisa I, Sumantri C (2020). Novel mutation of exon 5 prolactin gene in IPB-D1 chicken. J. Ilmu Peternak. Vet., 25(4): 173-189. https://doi.org/10.14334/jitv.v25i4.2525

Rohmah L, Darwati S, Ulupi N, Khaerunnisa I, Sumantri C (2022). Polymorphism of prolactin (PRL) gene exon 5 and its association with egg production in IPB-D1 chickens. Arch. Anim. Breed., 65: 449-455. https://doi.org/10.5194/aab-65-449-2022

Roy BG, Saxena VK, Roy U and Kataria MC (2020). PCR-RFLP study of candidate genes for egg production in layer chicken. Arch. Anim. Poult. Sci., 1(3): 52-59. https://doi.org/10.19080/AAPS.2020.01.555563

Sabry NM, Mabrouk DM, Abdelhafez MA, El-Komy EM, Mahrous KF (2020). Polymorphism of the prolactin gene in Egyptian duck breeds J. World Poult. Res,. 10(4): 587-598. https://doi.org/10.36380/jwpr.2020.67

Subekti K, Solihin DD, Afnan R, Gunawan A, Sumantri C (2019). Polymorphism of duck HSP70 gene and mRNA expression under heat stress conditions. Int. J. Poult. Sci., 18: 591-597. https://doi.org/10.3923/ijps.2019.591.597

Susanti T (2015). Prolactin as a candidate gene controlling molting and egg production of duck. Indones. Bull. Anim. Vet. Sci., 25: 23-28. https://doi.org/10.14334/wartazoa.v25i1.1125

Susanti T, Noor RR, Hardjosworo PS, Prasetyo LH (2012). Relationship between prolactin hormone level, molting and duck egg production. J. Indonesian Trop. Anim. Agric., 37: 161-167. https://doi.org/10.14710/jitaa.37.3.161-167

Tang J, Guo M, Fu J, Ouyang HJ, Tian YB, Shen X, Huang YM (2021). Polymorphism analysis and expression patterns of the IGF1 gene in the Shitou goose. Arch. Anim. Breed, 64: 315-323. https://doi.org/10.5194/aab-64-315-2021

Wang C, Liang ZH, Yu WH, Feng YP, Peng XL, Gong YZ, Li SJ (2011). Polymorphism of the prolactin gene and its association with egg production traits in native Chinese ducks. S. Afr. J. Anim. Sci., 41(1): 63-69. https://doi.org/10.4314/sajas.v41i1.66044

Weir BS (2011). Genetic data analysis II methods for discrete population genetic data, Sinauer Associates Inc, Sunderland, 1196, ISBN: 9780878939022.

Yurnalis A, Kamsa A, Putra DE (2019). Polymorphism of prolactin genes and its association with body weight in Bayang ducks, local duck from West Sumatera, Indonesia. Earth Environ. Sci., 287: 012009. https://doi.org/10.1088/1755-1315/287/1/012009