Research Article

Impact of Propolis Nanoemulsion on Listeria monocytogenes Contaminating Chilled Stored Breaded Chicken Panne

Aalaa S. Saad1*, Taghreed H. A. Ali2, Nayerah Alatfeehy3, Dalia Elmasry4

1Biotechnology Department, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Egypt; 2Reference Lab for Examination of Food of Animal Origin, Food Hygiene Department, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Egypt; 3Department of Bacteriology, Reference Laboratory for Veterinary Quality Control on Poultry Production (RLQP), Animal Research Institute (AHRI), Agriculture Research Center (ARC); 4Nanomaterials research and Synthesis unit, Animal Health Research Institute (AHRI), Agricultural Research Center (ARC), Egypt.

Received | September 16, 2023; Accepted | December 20, 2023; Published | January 20, 2024

*Correspondence | Aalaa S. Saad, Biotechnology Department, Animal Health Research Institute (AHRI), Agriculture Research Center (ARC), Egypt; Email: alaa.samir87@yahoo.com

Citation | Saad AS, Ali THA, Alatfeehy N, Elmasry D (2024). Impact of propolis nanoemulsion on Listeria monocytogenes contaminating chilled stored breaded chicken panne. Adv. Anim. Vet. Sci. 12(2): 297-304.

DOI | http://dx.doi.org/10.17582/journal.aavs/2024/12.2.297.304

ISSN (Online) | 2307-8316

 

 

Copyright: 2024 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

Introduction

Nanotechnology involves using tiny materials that can undergo new changes. Nano-propolis comprises small propolis particles that are more easily absorbed by the body. It is expected to have a more substantial antibacterial effect than regular propolis (Barsola and Kumari, 2022).

Propolis, alternatively referred to as bee glue, is an adhesive compound that resembles wax manufactured by bees through the combination of plant resins, saliva, wax, and pollen. Honeybees exploit propolis to protect the inside of their hives. Propolis in its raw form and the ethanolic and aqueous extracts have been demonstrated to exhibit antimicrobial properties, owing to the presence of polar phenolic substances, particularly the flavonoid portion (El-Sakhawy et al., 2023). The most widespread foodborne diseases in developed and developing nations are caused by Salmonella, Clostridium perfringens, Campylobacter, Staphylococcus aureus, and L. monocytogenes (CDC, 2019). L. monocytogenes is an intracellular facultative Gram-positive organism. Since L. monocytogenes can live on equipment and in manufacturing facilities, food items may become contaminated throughout the manufacturing process. In addition, it has been found that L. monocytogenes may survive challenging harsh environments, including low temperatures, high acidity, and salt content (Martín et al., 2022).

Chicken meat products are becoming increasingly popular due to their convenience in preparing quick meat meals and their ability to offer a solution for the shortage of fresh meat, which is often too expensive for many families with limited incomes. However, the extensive handling of chicken nuggets may heighten the risk of cross-contamination with pathogenic microorganisms (Fayed and Saad, 2021).

The hly gene produces listeriolysin O (LLO), the primary L. monocytogenes virulence factor (Quereda et al., 2021). LLO works by helping L. monocytogenes escape from intracellular phagocytic vesicles. LLO inactivation can cause hemolytic action depletion, phagosomal evasion obstruction, and virulence reduction, as the bacterium cannot reach the cytoplasm (Li et al., 2022).

The IAP gene produces the extracellular protein p60, the invasion-associated protein (IAP). As a crucial mouse hydrolase enzyme, it aids in separating the septum during the last stage of cell division. Additionally, it participates in L. monocytogenes’ attachment to the host cell and is crucial to the bacterium’s virulence and pathogenicity (Matle et al., 2020).

Based on the available information, there have been no previous studies on the effectiveness of PE and/or PNs in combating L. monocytogenes in breaded chicken panne or their influence on the expression of their toxin genes. Therefore, this study aims to investigate the antibacterial properties of PE and/or PNs against L. monocytogenes-contaminated breaded chicken panne during chilled storage and evaluate the expression of the toxin genes hlyA and IAP.

Materials and Methods

Bacterial strain

The Listeria monocytogenes (NLQP 333) strain used in this experiment was acquired from the National Laboratory for Veterinary Quality Control on Poultry Production (NLQP) and stored at -80°C. The frozen (glycerol stock) L. monocytogenes culture was activated by inoculation into Tryptone soya yeast extract broth (TSYEB; HiMedia), and a final concentration of around 108 CFU/mL was achieved through overnight incubation at 37°C. A sequence dilution was performed on 0.1% sterile buffered peptone water (pH = 7) to provide roughly 107 CFU/mL in the inoculated fluid (Lianou et al., 2018).

Preparation of PE

10 g of propolis and 70% ethanol to 100 mL in a volumetric flask at room temperature in shaker incubation for 5 hours (Ghavidel et al., 2021) while shaking vigorously. The supernatant was transferred to a new container for further use after the final extract was cooled to room temperature and centrifuged at 1500 rpm for five minutes. The Whatman paper filter No. 1 was utilized to filter the excerpt, which was stored at -20ºC until the start of the experiments. Before adding the extracts to the samples, a 0.45-m filter was used to filtrate and sterilize (Said et al., 2006).

Preparation and characterization of PNs

PNs were prepared in the Nanomaterials Research and Synthesis Unit. Then, PE (30 mL), tween 80 (30 mL), and distilled deionized water (40 mL) were homogenized for thirty minutes utilizing a 1500-watt homogeneous blender. Subsequently, distilled water was added gradually to the mixed oil phase in accordance with Rao (2011). Distinguish the nanoemulsion and assess the electrical conductivity, zeta potential (surface charge), and both size droplet and distribution polydispersity indexes (PDI), a measure of sample size-dependent heterogeneity. Due to the sample size distribution, accumulation, or aggregation of the example during isolation or analysis can result in the polydispersity of nanoemulsion using the Microtrac FLEX (12.0.1.0) instrument.

The nanoemulsion’s electrical conductivity and characterization were measured via high-resolution transmission electron microscopy (HRTEM) monitoring at the Faculty of Agriculture, Cairo University, using a JEM 1400F HRTEM equipped with a 300 keV beam energy. The chemical fingerprint of PNs was conducted by the Thermo Nicolet 380 Fourier Transform Infrared (FT-IR) spectrometer supplied with the Smart SplitPea horizontal Attenuated Total Reflectance (ATR) microsampling device. Additionally, it is accompanied by the Thermo Electron Nicolet Centaurus FT-IR Contact Alert microscope, which has a Triton 10x objective with a numerical aperture of 0.71. The system is operated using the Omnic PC workstation.

MTT cytotoxicity assay

Stock solutions of the drug under investigation were prepared using 10% DMSO in ddH2O and additional dilutions to working solutions using DMEM to determine the half-maximum cytotoxic concentration (IC50). The sample’s cytotoxic activity was identified in BNL cells using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) technique with minimal modifications. Briefly, the cells were sown in 96-well plates (100 uL/well) at 3105 cells/mL density and incubated for 24 hours at 37°C in 5% CO2. Cells were given varied concentrations of the tested substances in triplicate after 24 hours.

After 72 hours, the supernatant was discarded. Cell monolayers were subsequently rinsed three times with sterile 1x phosphate-buffered saline (PBS). MTT solution, amounting to 20 l of a stock solution containing 5 mg/mL, was added to each well. The wells were incubated at 37°C for 4 hours before medium aspiration.

The generated formazan crystals were melted in each well with 200 l of acidified isopropanol (0.04 M HCl in 100% isopropanol = 0.073 mL HCL in 50 mL isopropanol).

The absorbance of formazan solutions was quantified at a maximum wavelength of 540 nm utilizing a multi-well plate reader (BMG LABTECH®FLUO star Omega, Germany) with a reference wavelength of 620 nm. The proportion of cytotoxicity relative to untreated cells was computed using the subsequent equation. Using a plot of per cent cytotoxicity against sample concentration, the cytotoxic 50% concentration (TC50) was determined (Mostafa et al., 2020).

Antimicrobial efficacy of PE and PNs

The standard broth dilution method was used to determine PE and PNs’ antimicrobial effectiveness by assessing the microorganisms’ observable growth within the broth medium (CLSI, 2019). The MIC was determined by serial double dilutions for each examined material obtained in tryptone soy yeast extract broth (TSYEB) medium using a sterile 96-well round-bottom polystyrene microtiter plate (12 columns x 8 rows) as described by Markowska et al. (2018). Two-fold serial dilutions were prepared from PE and PN to acquire the final dilutions of 1/1, 1/4, 1/8, 1/16, 1/32, 1/64, and 1/128 with an L. monocytogenes concentration of 107/mL CFU (adjusted by 0.5 McFarland’s) in tryptone soya yeast extract broth (TSYEB; HiMedia), while the control solely comprised inoculated broth. Plate incubation lasted for twenty-four hours at 37°C. At the MIC endpoint, the minimum concentration is reached at which no discernible growth is observed in the tubes. The MIC value was confirmed by observing the wells’ visual clouding both before and after incubation.

Preparation of breaded chicken panne and inoculation

1500 g of boneless, skinless chicken breast were purchased from markets. The boneless, skinless chicken breast was examined to ensure it was free from L. monocytogenes contamination. After that, the boneless, skinless chicken breast was cut into thin, 25-g pieces and marinated in salt and black pepper (Moschonas et al., 2012). After marinating, the parts were immersed in an equivalent amount of 2×107 CFU/mL overnight L. monocytogenes working culture, maintained at 4ºC for 20 minutes to allow for bacterial adhesion, and dried for fifteen minutes at laminar airflow (model NuAire). After that, all inoculated chicken pieces were divided into three groups (Moschonas et al., 2012):

Control group: marinated boneless skinless chicken breast parts immersed in sterile PBS without any treatment corresponding to PE and PN dipping treatment.

PE-group: marinated boneless skinless chicken breast pieces were treated (dipped) into PE and let to dry at laminar air flow for 15 minutes.

Lastly, the PNs-group marinated boneless skinless chicken breast pieces were treated (immersed) into PN and left to dry for 15 minutes at laminar airflow.

The dried groups were dipped in egg emulsion before breading. Each group was packaged in sterile plastic bags aseptically. For L. monocytogenes enumeration, samples were collected from each group following inoculation (zero time) and relative hlyA and IAP expressions, and then each group was saved at 4ºC in a refrigerator. The samples were examined every three days until spoilage. The experiment was repeated three times.

L. monocytogenes viable count

According to the FDA (2017), 25 g of every group were homogenized utilizing a stomacher (Seward stomacher 80 Biomaster, England) with 225 mL of sterile BLEB (Buffered Listeria Enrichment Broth) without the selective agent to prepare homogenate. The samples were stomached, and a ten-fold serial dilution was performed. Based on the work of Ottaviani and Agosti (AlOA) agar media, 1 mL of each sample was put directly on three plates of Listeria chromogenic agar base. The inoculum was applied using a sterile bent glass streaking rod. For quantifying L. monocytogenes, the plates were inverted and incubated at 35 degrees Celsius for 48 hours.

Sensory evaluation

Twelve experts from the Food Hygiene Department of the Animal Health Research Institute (ARC) joined as the reviewers. The color, flavor, taste, and overall approval of breaded chicken panne were compared with PE and PN to plain breaded chicken (neither contained PE nor PNs). For each of the four descriptors, the experts were requested to evaluate the samples in order of intensity on a 9-point hedonic scale, with nine being the mean (Pimentel et al., 2016). The examiner judged the model rejected if the stated findings fell below point five.

Gene expression assessment 

Following the manufacturer’s instructions, mRNA was extracted using a FastPure® DNA/RNA Mini kit. 200 µL of the sample and 500 µL of Lysis Solution were added to a 1.5 mL RNase-free tube and vigorously vortexed. Following its addition to the adsorption column, the mixture underwent a one-minute high-speed centrifugation. Once the filtrate was discarded, 600 µL of rinsing buffer was introduced into the adsorption column, which was then centrifuged at high speed for 30 seconds. One more washing cycle was performed. The adsorption column was moved to a new 1.5 mL centrifuge tube, 50 µL of elution buffer was introduced, and the mixture was incubated for one minute at room temperature before rapid centrifugation for 1 minute. The extract was kept until use at -70°C.

 

Table 1: Primer used in this study

Gene	Primer sequence (5’ to 3’)	Reference
16S rRNA	F: CCTACGGGAGGCAGCAG	(Gou et al., 2010)
	R: GTATTACCGCGGCTGCTG
hlyA	F: GCAGTTGCAAGCGCTTGGAGTGAA	(Swetha et al., 2015)
	R: GCAACGTATCCTCCAGAGTGATCG
iap	F: CAAACTGCTAACACAGCTACT	(Bubert et al., 1999)
	R: TTATACGCGACCGAAGCCAAC

 

The expression levels of L. monocytogenes toxin genes (hlyA and IAP) (Table 1) were determined by qPCR utilizing a HERA SYBR® Green RT-qPCR Kit (Willowfort) and a real-time PCR detection system (Applied Biosystems). Amplification was performed using 10 µL reaction volumes containing 0.5 µL of each primer and 1 µL of RNA. The subsequent conditions for thermal cycling were applied: reverse transcription at 55°C for 30 minutes followed by activation at 95°C for 5 min, 40 cycles of denaturation at 95°C for 10 seconds, annealing (60°C for 16srRNA and hlyA and 58°C for IAP) for 30 seconds, and extension at 60°C for 30 seconds. The synthesized oligonucleotide primers (OligoTM) were utilized in this study (Table 1).

Statistical analysis

The imaging and statistical analyses were conducted utilizing Microsoft Excel software. To assess the comparative expression of target genes, the 2−ΔΔCT method was utilized in comparison with the control group. To determine the ΔCT values, the average CT values of the target genes were subtracted from those of the endogenous control gene 16srRNA (Livak, Schmittgen, 2001).

Results and discussion

Preparation and characterization of PNs

The process of producing nanoemulsion involves various factors that affect the shape and size of the particles, including particle size, morphology, and size distribution. The shape and size of the particles are typically measured using HRTEM. The ProN particles, for instance, had an average length of 19.783 nm, with a narrow size distribution (polydispersity index: 0.253), indicating high homogeneity (Figure 1a). Further analysis revealed the absence of particle aggregation and uniform spherical morphology.

According to the FT-IR analysis, the nanoemulsion that contained 30% propolis had vibrational frequencies ranging from 3500 to 1500 cm-1. The medium C-H bending alkane vibration at 1458.50 cm-1 indicated the presence of a methylene group. Vibrations at 1364.92 cm-1 were attributed to phenol and alcohol groups, and vibrations at 1091.17 cm-1 represented secondary alcohol and showed the C-O-C bonding.

The H-bending and O-H group-extending areas vibrated at 3451.97 cm-1, indicating the presence of phenol and alcohol groups. The symmetric CH3 vibration at 2922.79 cm-1 suggested the presence of alkanes. These variances were primarily due to concentrations of phenol, flavonoids, and esters, and the accompanying spectrum variations were most noticeable in the fingerprint area (1800 - 600 cm-1). Additionally, the N-H stretching at 1640.50 cm-1 indicated the presence of primary amines.

The spectral features of phenol were identified through the interaction of C-O stretching vibrations and O-H deformation in the spectral range of 1405 to 1220 cm-1 (with maximum absorbance at 1375 cm-1). Additionally, a sequence of feeble pulses was observed between 1260 and 1180 cm-1, as illustrated in Figure 1C.

PE was characterized by its self-emulsifying properties, resulting in the production of a transparent nanoemulsion. The globule size of the nanoemulsion ranged from 13 to 45 nm, while the zeta potential was measured to be less than −38 mV. The thermodynamic stability of the PESE formulation, which consists of 150 mg/mL PE, 20% castor oil, 40%–70% Kolliphor EL, and 10%–40% polyethylene glycol (PEG) 400, was observed by Syukri et al. (2021).

Toledo et al. (2015) found significant similarities in the chemical composition of propolis between both entities. The spectral peaks at 3300, 2917, 2849, 1735, 1630, 1530, 1462, 1376, 1265, 1196, 1172, and 1030 cm-1 were particularly noteworthy.

Antimicrobial activity of PE and PNs

After being incubated aerobically at 37ºC for 24 hours, PE with a 0.1 g/mL concentration demonstrated antibacterial properties against L. monocytogenes in the 1/1 and 1/4 dilutions (50 and 25 mg/mL concentrations, respectively). This finding aligns with the study performed by Vică et al. (2022), which reported that 1/1, 1/4, and 1/8 dilutions exhibited inhibitory effects on L. monocytogenes.

Additionally, the study found that dilutions of PNs (1/1, 1/4, and 1/8) with concentrations of 150, 75, and 37.5 mg/mL, respectively, exhibited an inhibitory effect on L. monocytogenes.

The activity of PE and PNs on L. monocytogenes inoculated in breaded chicken panne

It is crucial to acknowledge that L. monocytogenes poses a significant risk as a processing contaminant for refrigerated food items due to its pervasive occurrence in the natural environment and its ability to thrive in cold temperatures. This result proves the relation between the risk of foodborne listeriosis and processed meat and poultry products.

Figure 2 displays the effect of PE and its nanoemulsion on L. monocytogenes in breaded chicken panne stored in a chilled environment. The results are presented as log CFU/g. The initial counts (after 1 hour on day 0) of the control group (Group 1), chicken panne treated with PE (Group 2), and breaded chicken panne treated with PNs (Group 3) were 5.7, 5.6, and 5.5 log CFU/g, respectively.

During chilled storage, viable L. monocytogenes reduced significantly (p < 0.05) over time in breaded chicken panne treated with PE and PNs. On the ninth day of preservation, the count went down to 2.2 log CFU/g in the PE group and 1.6 log CFU/g (50 CFU/g) in the PNs group. It’s interesting to note that using PE and PNs not only increased the shelf life of breaded chicken panne but also reduced the risk of L. monocytogenes (50 colony-forming units) (CFU/g or mL). This reduction brought the levels within the acceptable limits for L. monocytogenes in ready-to-eat foods. In the UK and European Union, the maximum limit is lower than 100 CFU/g (end-of-shelf life testing) for products on the market (El-Shenawy et al., 2011).

Additionally, the PE treatment group differed significantly from the group that received PNs on all experimental days (p < 0.05). Propolis exhibits greater efficacy against Gram-positive bacteria in comparison to Gram-negative bacteria as a result of the hydrolytic enzymes that are secreted by the outer membrane proteins of the latter. Consequently, these enzymes can decrease the effectiveness of propolis’ active components (Sforcin and Bankova, 2011; Kędzia and Hołderna-Kędzia, 2013).

The antimicrobial traits of propolis are attributed to its chemical constituents. Resin, composed of flavonoids and phenolic compounds, is a significant component of propolis. Candles and oils containing oleic acid, palmitic acid, and fiber of necessary oils and aromatics are also present. Pollen, which is low in amount, contains protein, free amino acids, vitamins, and minerals. Other substances, such as ketones, lactones, steroids, and sugars, are also in propolis (Değirmencioğlu, 2013). Propolis’s antibacterial activity is due to specific polar and phenolic lipophilic molecules, especially flavonoid compounds. These molecules interact with bacterial cells, causing damage to their cell walls and membranes, ultimately leading to cell lysis and death. Propolis contains various highly polar and lipophilic groups such as carbonyl, electronegative, amine, imine, sulfide, thiol, methoxy, and hydroxyl groups that contribute to its antibacterial properties (Echeverría et al., 2017, Sanpa et al., 2013).

It has been found that nanoparticles (NPs) exhibit more significant antibacterial activity than propolis extract (PE) owing to their smaller size and higher surface area-to-volume ratio. These properties make them highly reactive, allowing them to avoid some of the limitations of raw propolis. NPs are generally utilized to enhance the conveyance of pharmaceutical substances to their intended targets (Afrasiabi et al., 2020).

hlyA and IAP genes expression assay

The findings from the study on the comparative expression of L. monocytogenes hlyA and IAP genes in breaded chicken panne with PE and PNs at inhibitory levels then preserved by chilling have been presented in Figure 3. The expression of both genes was notably decreased (p < 0.05) in the groups that received treatment in comparison with the untreated (control) group. Additionally, the PNs group showed a more significant decrease in gene expression than the PE group (p < 0.05). On day 0, the relative expression of the hlyA gene was 0.90 and 0.80 in the PE and PNs groups, respectively. By the ninth day, the expression levels were 0.25 in the PE group and 0.12 in the PNs group. Similarly, on day 0, the relative expression of the IAP gene in the PE and PNs groups was 0.91 and 0.81, respectively. By the ninth day, it had decreased to 0.29 in the PE group and 0.12 in the PNs group.

The study suggests that propolis reduces gene expression by binding to bacterial proteins and peptides, changing their 3D designs, inhibiting cell division, enzymatic inactivation, and protein synthesis (Bouarab-Chibane et al., 2019). In addition, the flavonoids’ B ring may impair bacterial systems and reduce their function, inhibiting nucleic acid synthesis (Uzel and Sorkun K, 2005; Uzel et al., 2005).

Sensory evaluation

Figure 4 exhibits the findings of the sensory evaluation of chilled, stored, breaded chicken panne treated with PE and PNs. The assessment criteria included color, taste, flavor, and overall acceptability. The scores for PE were 8.3, 7.75, 7.8, and 7.5 for color, taste, flavor, and overall acceptability, respectively. Similarly, the scores for PNs were 7.9, 6.3, 6, and 6.1, respectively. The treatment of chicken fillets with either PE or PNs did not significantly affect the mean rating for overall product acceptability, color, flavor, and taste relative to the breaded chicken panne. This result aligns with the results of Mahdavi-Roshan et al. (2022), who discovered that marinated chicken breast samples treated with propolis extract and refrigerated were not qualitatively different from fresh specimens. On the 6th day, the odor changed faster in the control group than in the experimental groups, possibly due to protein degradation. The use of PE and PNs prolonged this process. This result follows a study by Mahdavi-Roshan et al. (2022), which found that PE can increase the longevity of marinated chicken breast when preserved at a chilled temperature.

Conclusion

Controlling the existence of L. monocytogenes in food products is of the highest priority for ensuring food safety. Natural bioactive substances such as PE and PNs effectively inhibit L. monocytogenes growth and toxin production. These promising results offer the potential for developing natural product-based biocontrol techniques to control L. monocytogenes growth in chicken and chicken products. Therefore, our research supports using natural and bio-based products as adequate disease controls in the food industry.

Recommendation

Additional research is necessary to ensure that propolis is considered a clean-label product, maintains its shelf life, and does not compromise consumer health.

Acknowledgments

We want to express our gratitude to the Biotechnology Department, Reference Lab for Examination of Foods of Animal Origin, Food Hygiene Department Reference Laboratory for Veterinary Quality Control on Poultry Production (RLQP), and Nanomaterials Research and Synthesis Unit, Animal Health Research Institute, ARC, Giza, Egypt, for their support.

Novelty statement

Propolis exhibited antimicrobial properties against several pathogenic microorganisms. However, its application is limited in food systems owing to its strong taste and low solubility. Numerous studies have demonstrated that, with some modifications, it could be utilized in food systems. The current research found that PE and PNs are potent inhibitors of L. monocytogenes growth and/or toxin generation. At the same time, PNs were more potent against L. monocytogenes growth and its toxin expression.

Authors contribution

Aalaa Saad designed the experiment and the gene expression calculation. Taghreed Ali performed the bacteriological work of the investigation. Nayerah Alatfeehy performed the MIC. Dalia Elmasry performed the preparation and characterization of nanoemulsions. All authors participated in writing and revising the entire manuscript.

References

Afrasiabi S, Pourhajibagher M, Chiniforush N, Bahador A. (2020). Propolis nanoparticle enhances the potency of antimicrobial photodynamic therapy against Streptococcus mutans in a synergistic manner. Sci. Rep., 10:15560. https://doi.org/10.1038/s41598-020-72119-y.

Barsola B, Kumari P. (2022). Green synthesis of nano-propolis and nanoparticles (Se and Ag) from ethanolic extract of propolis, their biochemical characterization: A review. Green Process. Synth., 11 (1). 659-673. https://doi.org/10.1515/gps-2022-0059.

Bouarab-Chibane L, Forquet V, Lantéri P, Clément Y, Léonard-Akkari L, Oulahal N, Degraeve P, Bordes C.  (2019). Antibacterial properties of polyphenols: characterization and QSAR (Quantitative structure-activity relationship) models. Front Microbiol, 10:829. https://doi.org/10.3389/fmicb.2019.00829.

Bubert A, Hein I, Rauch M, Lehner A, Yoon B, Goebel W, Wagner M. (1999). Detection and differentiation of Listeria spp. by a single reaction based on multiplex PCR. Appl Environ Microbiol.;65(10):4688-92.

CDC. (2019).  Centers for Disease Control and Prevention, National Center for Emerging and Zoonotic Infectious Diseases (NCEZID). Last accessed 13 Nov. 2023. https://www.cdc.gov/ncezid/what-we-do/our-topics/foodborne-disease.html#:~:text=According%20to%20CDC%20esti

mates%2C%20the,%2C%20Campylobacter%2C%20and%20Staphylococcus%20aureus.

CLSI. (2019). Auto verification of Medical Laboratory Results for Specific Disciplines. Eighth Ed. CLSI guideline M07-A8. Wayne, PA: Clinical and Laboratory Standards Institute. 

Değirmencioğlu HT.  (2018). Evaluation of phenolic profile, botanical origin, antioxidant and antimicrobial activities of Turkish propolis. M.S. thesis. Yeditepe Univiristy, İstanbul, Turkey.

Echeverría J, Opazo J, Mendoza L, Urzúa A, Wilkens M. (2017). Structure-activity and lipophilicity relationships of selected antibacterial natural flavones and flavanones of Chilean flora. Molec, 22:608. https://doi.org/10.3390/molecules22040608.

El-Sakhawy M, Salama A, Mohamed SA. (2023). Propolis applications in food industries and packaging. Biomass Convers Biorefin, 16:1-6. https://doi.org/10.1007/s13399-023-04044-9.

El-Shenawy M, El-Shenawy M, Mañes J, Soriano JM. (2011). Listeria spp. in street-vended ready-to-eat foods. Interdiscip Perspect Infect Dis. https://doi.org/10.1155/2011/968031.

Fayed AMS, Saad ASA (2021). Effect of microencapsulated allyl-isothiocyanate on survival of Salmonella Enteritidis and enterotoxin production in ready to eat chicken nuggets. Adv. Anim. Vet. Sci. 9(9): 1442-1448. http://dx.doi.org/10.17582/journal.aavs/2021/9.9.1442.1448.

FDA (Food and Drug Administration). (2017). detection of listeria monocytogenes in food and environmental samples, and enumeration of listeria monocytogenes in foods. Chapter 10, www.fda.gov/food/laboratory-methods-food/bacteriological-analytical-manual-bam.

Ghavidel F, Javadi A, Anarjan N, Jafarizadeh-Malmiri H. (2021). New approach in process intensification based on subcritical water, as green solvent, in propolis oil in water nanoemulsion preparation. Green Process. Synth,10(1), 208-218.  https://doi.org/10.1515/gps-2021-0022.

Gou J, Lee HY, Ahn J. (2010). Inactivation kinetics and virulence potential of Salmonella Typhimurium and Listeria monocytogenes treated by combined high pressure and nisin. J of food protec.,1,73(12):2203-10.

Kędzia B, Hołderna-Kędzia E. The antibiotic activity of native and European propolis. Postępy Fitoterapii. 2013 lased accessed 19 Aug. 2023 https://www.czytelniamedyczna.pl/4404,aktywnosc-antybiotyczna-propolisu-krajowego-i-europejskiego.html

Li R, Liang Q, Tian S, Zhang Y, Liu S, Ou Q, Chen Z, Wang C. (2022). Hemolysin function of Listeria is related to biofilm formation: transcriptomics analysis. Vet Res, 53(1); 113. https://doi.org/10.1186/s13567-022-01124-y.

Lianou A, Moschonas G, Nychas GJ, Panagou EZ. (2018). Growth of Listeria monocytogenes in pasteurized vanilla cream pudding as affected by storage temperature and the presence of cinnamon extract. Food Res Int, 106:1114-22. https://doi.org/10.1016/j.foodres.2017.11.027.

Livak KJ, Schmittgen TD. (2001). Analysis of Relative Gene Expression Data Using Real- Time Quantitative PCR and the 22DDCT Method. Methods. 25:402-8.

Mahdavi-Roshan M, Gheibi S, Pourfarzad A. (2022). Effect of propolis extract as a natural preservative on quality and shelf life of marinated chicken breast (chicken Kebab). LWT, 1:155:112942. https://doi.org/10.1016/j.lwt.2021.112942.

Markowska G A, Milczarek B, Markowska K, Wolska KI. (2018). The Effect of Silver Nanoparticles on Listeria monocytogenes PCM2191 Peptidoglycan Metabolism and Cell Permeability. Pol J Microbiol.,67(3):315-320. https://doi.org/10.21307/pjm-2018-037.

Martín I, Alía A, Rodríguez A, Gómez F, Córdoba JJ. (2021). Growth and Expression of Virulence Genes of Listeria monocytogenes during the Processing of Dry-Cured Fermented “Salchichón” Manufactured with a Selected Lactilactobacillus sakei. Biol; 10(12), 1258. https://doi.org/10.1016/j.indcrop.2019.111588.

Matle I, Mbatha KR and Madoroba E. (2020). A review of Listeria monocytogenes from meat and meat products: Epidemiology, virulence factors, antimicrobial resistance and diagnosis. Onderstepoort J Vet Res, 87(1),1-20. https://doi.org/10.4102/ojvr.v87i1.1869.

Moschonas G, Geornaras I, Stopforth JD, Wach D, Woerner DR, Belk KE, Smith GC, Sofos JN. (2012). Antimicrobials for reduction of Salmonella contamination in uncooked, surface-browned breaded chicken products. J Food Prot,75(6):1023-8. https://doi.org/10.4315/0362-028X.JFP-11-492.

Mostafa A, Kandeil A, AMM Elshaier Y, Kutkat O, Moatasim Y, Rashad AA, Shehata M, Gomaa MR, Mahrous N, Mahmoud SH, GabAllah M. (2020). FDA-approved drugs with potent in vitro antiviral activity against severe acute respiratory syndrome coronavirus 2. Pharm;13(12):443. https://doi.org/10.3390/ph13120443.

Pimentel TC, da Cruz AG, Deliza R. (2016). Sensory evaluation: sensory rating and scoring methods. Encyclopedia of food and health.,744-9.

Quereda JJ, Morón-García A, Palacios-Gorba C, Dessaux C, García-Del Portillo F, Pucciarelli MG, Ortega AD. (2021). Pathogenicity and virulence of Listeria monocytogenes: A trip from environmental to medical microbiology. Virulence. 12(1):2509-2545. https://doi.org/10.1080/21505594.2021.

Rao J, McClements D J. (2011). Formation of Flavor Oil Microemulsions, Nanoemulsions and Emulsions: Influence of Composition and Preparation Method. J. of Agri. & Food Chem, 59(9): 5026–5035. https://doi.org/10.1021/jf200094m .

Said SA, Khan SA, Ahmad I, Ali HS. (2006). Chemical composition of Egyptian and UAE propolis. Pak J Pharm Sci,19(1):58-61.

Sanpa S, Popova M, Bankova V, Tunkasiri T, Eitssayeam S, Chantawannakul P. (2015). Antibacterial compounds from propolis of Tetragonula laeviceps and Tetrigonamelanoleuca (Hymenoptera:Apidae) from Thailand. PLOS ONE, 10: e0126886. https://doi.org/10.1371/journal.pone.0126886. 

Sforcin JM, Bankova V. (2011). Propolis: is there a potential for the development of new drugs?. J. Ethnopharmacol;133(2):253-60.

Swetha CS, Rao TM, Babu AJ, Kumar E. (2015). Process Optimization for the Detection of Listeria monocytogenes and listeriolysin O from Spiked Chicken Meat by Polymerase Chain Reaction. J Meat Sci.,10(2):7-15.

Syukri Y, Fitria A, Hanifah S, Idrati M. (2021). Development of New Indonesian Propolis Extract-Loaded Self-emulsifying: Characterization, Stability and Antibacterial Activity. Adv Pharm Bull.,11(1):120-129. https://doi.org/10.34172/apb.2021.013.

Toledo LD, Bavato MI, Rosseto HC, Cortesi R, Bruschi ML. (2015). Pharmaceutical films made from the waste material from the preparation of propolis extracts: development and characterization. Braz. J. Pharm. Sci., 51, 847-859. https://doi.org/10.1590/S1984-82502015000400011.

Uzel A, Sorkun K, Önçağ. (2005). Chemical compositions and antimicrobial activities of four different Anatolian propolis samples. Microbiol Res;160: 189-195. https://doi.org/10.1016/j.micres.2005.01.002.

Vică ML, Glevitzky M, Heghedűş-Mîndru RC, Glevitzky I, Matei HV, Balici S, Popa M, Teodoru CA. (2022). Potential effects of romanian propolis extracts against pathogen strains. Int.  J. Environ. Res. Public Health, 19(5):2640. https://doi.org/10.3390/ijerph19052640.