Research Article

Prevalence, Virulence Determinants and Antimicrobial-Resistant Profile of Edwardsiella tarda Isolated from Nile Tilapia (Oreochromis niloticus) in Egypt

Samah Samir, Amal Awad*, Gamal Younis

Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Mansoura University, 35516, Egypt.

Received | December 16, 2021; Accepted | February 05, 2022; Published | April 01, 2022

*Correspondence | Amal Awad, Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Mansoura University, 35516, Egypt; Email: [email protected]

Citation | Samir S, Awad A, Younis G (2022). Prevalence, virulence determinants and antimicrobial-resistant profile of edwardsiella tarda isolated from nile tilapia (oreochromis niloticus) in egypt. Adv. Anim. Vet. Sci. 10(5): 1031-1038.

DOI | http://dx.doi.org/10.17582/journal.aavs/2022/10.5.1031.1038

ISSN (Online) | 2307-8316

 

 

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

 

Introduction

Edwardsiellosis is one of the most common bacterial illnesses, inflicting significant economic losses in many countries’ fish farms. The disease is caused by E.tarda which is a gram-negative, motile, facultative anaerobic, short rod-shaped bacterium (1μm in diameter and 2-3 μm long) (Mohanty and Sahoo, 2007). E. tarda has been described as the causative agent of infections in more than 20 fish species (Abbott & Janda 2006; Mohanty & Sahoo 2007). It’s also classified as a serious food- and waterborne illness, similar to Aeromonas, Vibrio, and Salmonella (typhoid fever), which cause high mortality in people with severe underlying conditions such liver cirrhosis (Hirai et al. 2015).

The pathogenic strains of E. tarda have virulence genes that might be absent in non-pathogenic strains (Srinivasa Rao et al., 2003; Yang et al., 2012; Castro et al., 2016). The infection process of E. tarda occurred due to the presence of several potential pathogenic properties, such as AHL-synthase (edwI), chondroitinase (cds1), sensor protein (qseC), and vibrioferrin synthesis (pvsA) (Mohanty and Sahoo 2007), which can survive within macrophages and infect a wide range of hosts. Chondroitinase and other enzymes play a key role in the pathogenicity of the pathogenic strains (Tam Harvey & Chan 1982). Detection of virulence-related genes is very important for understanding the pathogenesis of this bacterium.

Antibiotic resistance is one of the most serious threats to aquaculture sustainability and human life nowadays (WHO, 2003). The transfer of R-plasmids is the main cause of this occurrence (Aarestrup, 2005). The rise of multidrug-resistant (MDR) bacterial pathogens is seen as a public health problem, and various prior studies have suggested that multidrug-resistant bacterial pathogens can be transmitted through a variety of sources, posing a hazard to public health.

Previously, cultured fish were not thought to be significant vectors of human infections. This scenario is changing, partially as a result of rising animal numbers as a result of a quickly expanding business, and partly as health care practitioners become more aware of infections in aquatic species that can cause human illness. Concerns about the sector are also addressed, as well as potential remedies. The Nile tilapia (Oreochromis niloticus) is Egypt’s most economically important fish species and is consumed widely in Egypt. Although interaction between people and aquatic animals and their pathogens has expanded dramatically in the last several decades, zoonotic diseases from fish particularly E. tarda, which is currently considered an emerging gastrointestinal zoonotic pathogen that is acquired from aquatic animals have gotten little attention. As a result, the goal of this work was to determine the prevalence, distribution of virulence-related genes, antibiotic susceptibility profile, and biofilm production capability of E.tarda retrieved from Nile tilapia.

Materials and methods

Sampling

A total of 250 apparently healthy fresh fish were aseptically collected from five fish farms located at Dakahlia governorate. Fish samples were collected and packed individually in polythene bags from different sampling areas in an icebox and transported rapidly to the laboratory for bacteriological examination.

Bacteriological Examination

Aseptically, tissue samples from internal organs (kidneys, liver, spleen, spleen , and gills) were inoculated in MacConkey broth and incubated at 37°C for 24 hrs followed by inoculation on Xylose Lysine Deoxycholate (XLD) agar and incubated at 37°C for 24 hours. The suspected colonies were carefully selected and subcultured on MacConkey agar plates. All non-lactose fermenting colonies (pale colonies) were purified on Tryptic Soy Agar (TSA) plates for further identification (Lima et al. 2008; Markey et. al., 2013).

DNA extraction

About 3 to 5 colonies of overnight culture were picked up and suspended in 100ml distilled water, the mixture was heated for 10 minutes, and the cell debris was sedimented by centrifugation at 1000g for 10 minutes. Sterile Eppendorf tubes were used to transfer the supernatants containing DNA and stored at -20°C till molecular examination.

Molecular characterization of E. tarda

Suspected E.tarda isolates were confirmed by PCR targeting ATPase domain of DNA Gyrase (gyrB). A species-specific primer (gyrB) was utilized provided by Metabion, Germany. Four sets of primers targeting the cds1, edw1, qseC, and pvsA genes were also used to detect virulence-related genes in all verified E. tarda isolates, as described in a recent work by Castro et al. (2006). The primers used in the current study for amplification of various genes and sizes of PCR amplicons are illustrated in Table 1. A 25 μl reactions including 12.5 μl of 2X PCR master mix (enzynomics, Korea), 1 μl of each primer (forward and reverse) of 20 pmol concentration, 4.5 μl of PCR grade water, and 6 μl of template DNA were used for PCR amplification, as shown in Table 2. A 96-well Applied Biosystems 2720 thermal cycler was used for the PCR procedure. PCR products were electrophoresed in a 1.5 % agarose gel and seen under UV trans-illumination after being stained with 0.5 g/ml ethidium bromide.

Sequencing reaction

For sequencing, a purified product of the gyrB gene from one representative E. tarda strain was used. For sequencing, an Applied Biosystems 3130 automated DNA sequencer was used (ABI, 3130, USA). Using a Perkin-Elmer/Applied Biosystems Bigdye Terminator V3.1 cycle sequencing kit (Cat. No. 4336817, Foster City, CA). To demonstrate sequence identity to GenBank accessions, the sequences

 

Table 1: Oligonucleatide primers sequences

Gene	Predicted function	Sequence	Amplified product	Reference
Edwardsiella tarda gyrB1	ATPase Domain	GCATGGAGACCTTCAGCAAT	415 bp	Park et al., 2014
		GCGGAGATTTTGCTCTTCTT
Cds1	Chondroitinase	TCTCCACCCATAATGCCACG	435 bp	Castro et al., 2016
		CAAACGGCGTCGTGTAGTCG
EdwI	AHL-synthase	ATCCGCAGCATCGAATGGCT	360 bp
		GAAGGATAACGATGTGGTGT
QseC	Sensor protein	CAGCAGTAGCAGGATCACCA	260 bp
		ATGGACGTATGCTGCTCAAC
PvsA	Vibrioferrin synthesis	CTGGAGCAGTACCTCGACGG	313 bp
		CGATGCTGCGGTAGTTGATC

 

Table 2: Cycling conditions for PCRs

Gene	Primary denaturation	Secondary denaturation	Annealing	Extension	No. of cycles	Final extension
Edwardsiella tarda gyrB1	94˚C 5 min.	94˚C 30 sec.	50˚C 40 sec.	72˚C 45 sec.	35	72˚C 10 min.
Cds1	94˚C 5 min.	94˚C 30 sec.	55˚C 40 sec.	72˚C 45 sec.	35	72˚C 10 min.
edwI	94˚C 5 min.	94˚C 30 sec.	55˚C 40 sec.	72˚C 40 sec.	35	72˚C 10 min.
qseC	94˚C 5 min.	94˚C 30 sec.	55˚C 30 sec.	72˚C 30 sec.	35	72˚C 7 min.
pvsA	94˚C 5 min.	94˚C 30 sec.	55˚C 40 sec.	72˚C 40 sec.	35	72˚C 7 min.

 

were compared to sequences in a nucleotide database using the National Center for Biotechnology Information’s Basic Local Alignment Search Tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The sequences of gyrB have been deposited in the gene bank under the accession number MW911830.

Phylogenetic analysis

The CLUSTAL W multiple sequence alignment program, version 1.83 of the MegAlign module of Lasergene DNAStar software Pairwise, which was designed by Thompson et al. (1994), was used to compare sequences, and phylogenetic analyses were performed in MEGA6 using maximum likelihood, neighbor joining, and maximum parsimony (Tamura et al., 2013).

Antimicrobial susceptibility testing

Antimicrobial susceptibility of E. tarda isolates was tested using the Kirby–Bauer disc diffusion method on Mueller–Hinton agar (Oxoid) plates, as per the Clinical and Laboratory Standards Institute guidelines (CLSI, 2015) against ten different antimicrobials (Oxoid), neomycin (N; 30 μg), ampicillin (AM; 10 μg), penicillin (P; 10 I.U), cefoperazone (CEP; 75 μg), cefuroxime (CXM; 30 μg), amikacin (AK; 30 μg), streptomycin (S; 10 μg), ciprofloxacin (CIP; 5 μg), clindamycin (DA; 2 μg), and amoxicillin were utilized as antimicrobial discs (Oxoid). The selected antimicrobial agents are commonly used for fish farming in Egypt. The results were categorized as susceptible, moderate, or resistant according to clinical and laboratory standards (CLSI 2018). If a single strain was resistant to three or more antibiotic classes, it was classified as multidrug-resistant (MDR) (Waters et al., 2011). Multiple antibiotic resistance index (MARindex) was calculated by dividing the total number of antimicrobial resistances for each isolate by the total number of antimicrobials tested (Krumperman 1983).

Biofilm formation

The tube method was used to examine the ability of E. tarda isolates to generate biofilms. A loopful of each isolate was inoculated separately in 5 mL trypticase soy broth (TSB; Becton Dickinson, Sparks, USA). After a 24-hour incubation period at 28°C, 1 ml of the incubated broth was transferred to a sterilized 4-ml TSB and incubated for another 24 hours at 28°C. A TSB tube that had not been inoculated was used as a control. The previously inoculated broth was carefully eliminated after incubation, and the tubes were stained with 1 percent crystal violet for 15 minutes; excess stain was discarded, and the tubes were washed with deionized water. The stained tubes were reversed to allow them to dry correctly.

Results

Phenotypic characterization of E.tarda isolates

On the surface of XLD agar, E. tarda showed characteristic pale colonies with black centers and white color colonies on macConkey’s agar plate (non-lactose fermenter). Indole, methyl red, catalase, glucose fermentation, and nitrate reduction tests were tested positive for E.tarda, but lactose and sucrose fermentation, urease, and Voges-Proskauer tests were tested negative. The total prevalence of E. tarda among the examined fish was 6% (15/250). The total E.tarda isolates retrieved from organs tissue samples was 40 isolates. The distribution of E.tarda among the examined fish samples was 12 (4.8%) in gills followed by liver samples 9 (3.6%), kidneys 7 (2.8%), skin and spleen 6 (2.4% each) as illustrated in Table 3. There was no statistically significant difference in the prevalence of E. tarda among the investigated fish’s internal organs (P < 0.05).

 

Table 3: Distribution of E.tarda isolates in fish organs tissue samples

%	No. of isolates	Organ
2.8%	7	Kidneys
3.6%	9	Liver
4.8%	12	Gills
2.4%	6	Skin
2.4%	6	Spleen
16%	40	Total

 

Molecular characterization of E.tarda

E. tarda isolates were confirmed by PCR assay targeting gyrB gene which was successfully identified in all isolates (Figure 1). One representative E. tarda isolate was selected for sequencing. By comparing the sequence to sequences in a nucleotide database using the National Center for Biotechnology Information’s Basic Local Alignment Search Tool, our sequence displayed 100% similarity to the E.tarda published sequences and recorded in GeneBank under the accession number of MW911830 (Figure 3).

Distribution of virulence gene in E.tarda isolates

By screening E.tarda for the presence of four selected virulence-related genes, edw1 gene was amplified in 30 isolates (75%), cds1 gene was amplified in 28 isolates (70%), qseC was amplified in 17 isolates (42.5%) and pvsA gene was harbored by one isolate (2.5%) (Figure 2).

 

Table 4: Antibiogram of Edwardsiella tarda

Antimicrobial class	Antimicrobial agent	Disc potency	No. & percent(%) of isolates
			S	R
B – lactams	Penicillin (p)	10 IU	3 (7.5%)	37 (92.5%)
	Ampicillin (Am)	10 μg	0 (0.0%)	100%
	Amoxicillin (AX)	25 μg	0 (0.0%)	100%
Cephalosporin	Cefuroxime (CXM)	30 μg	0 (0.0%)	100%
	Cefoperazone (CEP)	75 μg	24(60%)	16 (40%)
Aminoglycoside	Amikacin (AK)	30 μg	6 (15%)	34 (85%)
	Streptomycin (S)	10 μg	22 (55%)	18 (45%)
	Neomycin (N)	30 μg	24 (60%)	16 (40%)
Li ncosamide	Clindamycin (DA)	2 μg	0 (0.0%)	100%
Fluroquinolone	Ciprofloxacin (CIP)	5 μg	35 (87.5%)	5 (12.5%)

 

Table 5: Antimicrobial resistance patterns detected in E. tarda isolates.

MAR index	NO. of antibiotics resistant to each isolate	Antibiotics Resistance pattern	Isolate NO.
0.5	5	P, AM, CXM, DA, AX	4
0.6	6	P, AK, AM, CXM, DA, AX	5
0.6	6	N, AK, Am, CXM, DA, AX	1
0.6	6	AK, S, AM, CXM, DA, AX	1
0.7	7	CEP, P, S, AM, CXM, DA, AX	1
0.7	7	N, P, S, AM, CXM, DA, AX	1
0.7	7	P, AK, CIP, AM, CXM, DA, AX	1
0.7	7	P, AK, S, Am, CXM, DA, AX	5
0.7	7	N, P, AK, AM, CXM, DA, AX	3
0.7	7	CEP, P, AK, AM, CXM, DA, AX	2
0.8	8	N, P, AK, CIP, AM, CXM, DA, AX	1
0.8	8	CEP, AK, CIP, S, AM, CXM, DA, AX	1
0.8	8	CEP, P, AK, CIP, AM, CXM, DA, AX	1
0.8	8	N, P, AK, S, AM, CXM, DA, AX	1
0.8	8	N, CEP, P, AK, AM, CXM, DA, AX	4
0.8	8	CEP, P, AK, S, AM, CXM, DA, AX	3
0.9	9	N, P, AK, CIP, S, AM, CXM, DA, AX	1
0.9	9	N, CEP, P, AK, S, AM, CXM, DA, AX	3
1	10	N, CEP, P, AK, CIP, S, AM, CXM, DA, AX	1

 

Antibiotic susceptibility of E. tarda

All of the obtained E. tarda isolates (n = 40) were tested for their antibiotic susceptibility. The tested isolates exhibited a remarkable resistance to ampicillin, amoxicillin, clindamycin, and cefuroxime (100% each) followed by penicillin (92.5 %), amikacin (85%), streptomycin (45%), neomycin (40%), and cefoperazone (40%). While they were highly sensitive to ciprofloxacin (87.5%) (Table 4). Multiple antimicrobial-resistant (MAR) was displayed by all isolates and MDRindex ranges from 0.5 to 1 and P, AK, AM, CXM, DA, AX was the most common antimicrobial resistant pattern among the tested isolates (Table 5).

Biofilm production by E. tarda isolates

Out of 40 E.tarda isolates, 33 (82.5%) were positive for biofilm development, with 18 isolates (54.5%) being weak, 6 isolates (18.2%) being moderate, and 9 isolates (27.3%) being strong biofilm producers. While 7 isolates (17.5%) did not develop biofilms.

Discussion

Edwardsiella tarda is a widespread fish pathogen that causes one of the most devastating septicemic illnesses in freshwater fish, resulting in significant financial losses in fish farms throughout the world, including North America, Japan, Taiwan, Thailand, and Africa. It causes mortality in a variety of fish populations, including carp, tilapia, eel, catfish, mullet, salmon, trout, and flounder. (Bragg, 1991; Durborow et al., 1991; Baya et al., 1997; Galal, 2002). Furthermore, it has the potential to induce gastroenteritis, liver abscesses, meningitis, skin abscesses, and valvular endocarditis in humans. (Mizunoe et al., 2006; Choresca et al., 2011).

A PCR approach based on the use of the gyrB gene as a taxonomic marker for the detection of E. tarda in diseased fish has been previously developed by.Lan et al. (2008). The ATPase domain of DNA gyrase, an enzyme required for DNA replication, is encoded by the gyrB gene, a single-copy gene found in all bacteria (Huang, 1996). In this study, gyrB gene was successfully amplified in 40 morphologically and biochemically identified isolates with an overall prevalence of 6% (15/250). A higher prevalence was recorded by Eissa et al. (2016) who detected E. tarda in 9.6% among examined marine fish, Abd El-tawab et.al. (2020) detected E. tarda in 21% from O.niloticus and C. gariepinus. Algammal et al. (2022) detected an overall prevalence of 12% in examined fish samples. On the other hand, a lower prevalence was reported by Ali et al. (2008) who detected E.tarda in 3.7% in Tilapia zillii. The diversity of E.tarda prevalence in the different study may contributed to geographical location, temperature and quality of water and stocking density.

Studying the virulence factor of E.tarda may be help in the prevention and development of new strategies for treatment as well as enhancing our understanding of the bacterium infection process. The distribution of virulence genes in this study was opposite to Abd El-tawab et al. (2020) who detected pvsA gene (2/3, 66.66%) and edw1 gene (0/3, 0%) in E. tarda isolates. Detection of edw1 gene of E. tarda is very important virulence marker gene to confirm E. tarda pathogenicity (Sakai et al., 2007). The edwI and qseC genes are quorum sensing sensor proteins that also govern biofilm formation, flagellar motility, and the secretion system of E. tarda (Weigel, 2015). Presence of these genes in E.tarda isolates confirmed their virulence (Abdeltwab et al., 2021). Similarly, the presence of chondroitinase (cds1) in 77.2 % of E.tarda isolates could indicate their propensity to colonize and produce biofilms, and therefore disease development (Abdeltwab et al., 2021). Our results demonstrated that cds1 encoding a chondroitinase enzyme found in 28 isolates (70%) unlike Castero et al. (2016) who recorded this gene in all the European turbot isolates of E. tarda, edwI, and qseC genes which help E. tarda to reach to Quorum sensing and biofilm formation was amplified in 30 isolates (75%) and 17 isolates (42.5%) respectively. In a study performed in Egypt by Algammal et al. (2022)edwI, and qseC genes were identified in 100% of the tested isolates, while, cds1 gene was detected in 77.2%. Vibrioferrin is a type of the siderophores that provide E. tarda to iron which essential for growth in host and expressed to its virulence factors that helps in the survival and replication of E. tarda (Kokubo et al., 1990). In this study, vibrioferrin (pvsA) gene was detected in one isolate (2.5%). Similarly, vibrioferrin detected in E. tarda by Castro et al. (2016). While, Algammal et al. (2022) couldn’t detected pvsA gene in their study.

A biofilm is a clump of microorganisms that can mediate adhesion to a cell surface. E. tarda’s ability to form biofilm is important in disease pathogenesis because bacteria living in biofilms are difficult to remove from surfaces, can resist antimicrobial agents and the immune system of the host, and are easy to adhere to host tissues, resulting in relapses of infection, outbreaks of serious diseases, and the production of virulence factors (Oana and Tim, 2011). In the present study, 33 out of 40 isolates were able to form biofilm with different degrees.

Antimicrobial drugs can be used in treatment and disease prevention in aquaculture (Bischoff et al., 2005). Overuse of antimicrobial agents, on the other hand, has the potential to cause antibiotic resistance in harmful bacteria, making them less susceptible to antibiotics. Regarding to antimicrobial susceptibility testing, the E. tarda isolates showed a substantial difference in susceptibility to the various antimicrobial drugs tested. The majority of the recovered isolates were susceptible to ciprofloxacin, but were highly resistant to ampicillin, amoxicillin, clindamycin, cefuroxime penicillin, and amikacin. All E.tarda were multiple antimicrobial resistant to five or more antimicrobial agents. Similarly, multiple antibiotic resistance was found in 84–87.5 % of E. tarda strains recovered from finfish and shellfish in West Bengal and Bihar, India (Kumar et al., 2016). Algammal et al. (2022) also reported MDR in E. tarda in Nile tilapia and African catfish. MAR index in this study ranges from 0.5-1 which revealed that cultured freshwater tilapia in Egypt received high-risk exposure to the used antibiotics.

Multiple antimicrobial resistance (MAR) is a global public health threat that has been described as huge global epidemic outbreaks (Crump et al., 2015). As a result, this analysis confirms microbial resistance, demonstrating the potential of resistant bacteria being transferred to humans through the consumption of aquaculture products. (Kikomeko et al., 2016). Antibiotic resistance hazard and associated resultant health effects have been on the increase globally, and while most developing countries are the worse affected; because there are several situations, and human attitudes that support the development and spread of resistant microbes; such as inappropriate drug administration (Tiamiyu et al., 2015).

conclusion

In conclusion, the presence of MDR E.tarda in fish farms necessitates the use of antibiotics with caution and the therapeutic use of probiotics and immunostimulants to treat bacterial infections should be used as an alternative to antibiotics.

Conflict Of interest

None.

novelty statement

The frequency of virulence-related genes and Multi antimicrobial resistance (MAR) were observed in high percentages of the tested E.tarda in fish farms constitutes a hazard to aquaculture as well as a significant public health concern in Egypt.

authors contribution

AS collected samples, performed the experiments and write the original draft. AA and GY designed the study, supervised all experiments, revised and edit the manuscript. All authors approved the final version of the manuscript for submission.

References

Aarestrup FM (Ed.), (2005). Antimicrobial Resistance in Bacteria of Animal Origin. ASM Press. https://doi.org/10.1128/9781555817534.

Abbott SL, Janda JM (2006). The genus Edwardsiella. In Prokaryotes (ed. by M. Dworkin, S. Falkow, E. Rosenberg. K.-H. Schleifer & E. Stackebrandt). 6: 72–89 Springer, New York.

Abd El-tawab AA, El-Hofy FI, El-Gohary MS, Sedek AA (2020). Edwardesiellosis in freshwater fish with special reference for detection of some virulence genes by PCR. Int. J. Fisheries Aquat. Stud. 8(5): 229-234.

Abdeltwab A, Rizk, AM, Selim A, Elwakil R (2021). Biofilm formation Edwardsiella tarda isolated from fresh water fishes. Benha Vet. Med. J. 40(1): 1-5. https://doi.org/10.21608/bvmj.2021.59428.1333

Ali AH, Radwan IA, Ali WM, Hassan WH (2008). Microbiological characterization of Edwardsiella and Yersinia microorganisms isolated from diseased Tilapias at Beni-Suef Governorate (Doctoral dissertation, Ph. D. Thesis, Fac. of Vet. Med., Univ. of Beni-Suef, Egypt).

Algammal AM, Mabrok M., Ezzat M, Alfifi KJ., Esawy AM., Elmasry N., El-Tarabili RM (2022). Prevalence, antimicrobial resistance (AMR) pattern, virulence determinant and AMR genes of emerging multi-drug resistant Edwardsiella tarda in Nile tilapia and African catfish, Aquaculture., 548: 1, 2022,737643.

Baya AM, Romalde JL, Green DE, Navarro RB, Evans J, May EB, Toranzo AE (1997). Edwardsiellosis in wild striped bass from the Chesapeake Bay. J. Wildlife Dis. 33(3): 517-525. https://doi.org/10.7589/0090-3558-33.3.517

Bischoff KM, White DG, Hume ME, Poole TL, Nisbet DJ (2005). The chloramphenicol resistance gene cmlA is disseminated on transferable plasmids that confer multiple-drug resistance in swine Escherichia coli. FEMS Microbiol. Lett. 243(1): 285-291. https://doi.org/10.1016/j.femsle.2004.12.017

Bragg RR (1991). Health status of salmonids in river systems in Natal. III. Isolation and identification of bacteria. Onderstep. J. Vet. Res. 58(2): 67–70.

Castro N, Toranzo AE, Barja JL, Nunez S, Magarinos B (2006). Characterization of Edwardsiella tarda strains isolated from turbot, Psetta maxima (L.). J. Fish Dis. 29(9): 541-547. https://doi.org/10.1111/j.1365-2761.2006.00750.x

Castro N, Osorio CR, Buján N, Fuentes JC, Rodríguez J, Romero M, Magarinos B (2016). Insights into the virulence‐related genes of Edwardsiella tarda isolated from turbot in Europe: genetic homogeneity and evidence for vibrioferrin production. J. Fish Dis. 39(5): 565-576. https://doi.org/10.1111/jfd.12389

Choresca Jr, CH, Gomez DK, Shin SP, Kim JH, Han JE, Jun JW, Park SC (2011). Molecular detection of Edwardsiella tarda with gyrB gene isolated from pirarucu, Arapaima gigas which is exhibited in an indoor private commercial aquarium. African J. Biotechnol. 10(5): 848-850.

Clinical and Laboratory Standards Institute. (2015) Performance Standards for Antimicrobial Susceptibility Testing; 25th Informational Supplement M100-S25. Clin. Laborat. Standards Institute, Wayne.

Clinical And Laboratory Standard Institute (CLSI) (2018). Performance Standards for Antimicrobial Susceptibility Testing, Twenty eight Informational supplement (M100– S28). Wayne, PA: CLSI.

Crump JA, Medalla FM, Joyce KW (2015). Antimicrobial resistance among invasive nontyphoidal Salmonella enterica isolates in the United States: national antimicrobial resistance monitoring system, 2015. J. Antimicrob .Agt. Chemo. 20 11; 55: 1148-54.

Durborow RM, Taylor PW, Crosby MD, Santucci TD (1991). Fish mortality in the Mississippi catfish farming industry in 1988: Causes and treatments. J. Wildlife Dis. 27(1): 144-147. https://doi.org/10.7589/0090-3558-27.1.144

Eissa I, El Lamie M, Ismail M, Abd Elrehim A (2016). Studies on Edwardsiellosis in Some Marine Fishes Using Molecular Diagnosis at Suez bay. Suez Canal Vet. Med. J. SCVMJ, 21(2): 57-66. https://doi.org/10.21608/scvmj.2016.62652

Galal NF, Soliman MK, Zaky V H (2002). Studies on Edwardsiella infection in some freshwater fish. MV Sc (Doctoral dissertation, Thesis, Fac. of Vet. Med., Alex. Univ., Egypt).

Hirai Y, Asahata-Tago S, Ainoda Y, Fujita T, Kikuchi K (2015). Edwardsiella tarda bacteremia. A rare but fatal water-and foodborne infection: review of the literature and clinical cases from a single centre. Canadian J. Infect. Dis. Med. Microbiol. 26(6): 313-318. https://doi.org/10.1155/2015/702615

Huang WM (1996). Bacterial diversity based on type II DNA topoisomerase genes. Annu. Rev. Genet. 30: 79–107.

Kokubo T, Iida T, Wakabayashi H (1990). Production of siderophore by Edwardsiella tarda. Fish Pathol. 25(4): 237-241. https://doi.org/10.3147/jsfp.25.237

Kikomeko, H. (2016). Antimicrobial resistance of Escherichia coli found in intestinal tract of Oreochromis niloticus. Uganda J. Agric. Sci. 17(2): 157-164. https://doi.org/10.4314/ujas.v17i2.3

Krumperman PH (1983). Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl. environ. microbiol. 46(1): 165-170. https://doi.org/10.1128/aem.46.1.165-170.1983

Kumar P, Adikesavalu H, Abraham TJ (2016). Prevalence of Edwardsiella tarda in commercially important finfish and shellfish of Bihar and West Bengal, India. J. Coast. Life Med. 4 (1): 30–35. https://doi.org/10.12980/jclm.4.2016apjtd-2014-0184

Lan J, Zhang XH, Wang Y, Chen J, Han Y (2008). Isolation of an unusual strain of Edwardsiella tarda from turbot and establish a PCR detection technique with the gyrB gene. J. Appl. Microbiol. 105(3): 644-651. https://doi.org/10.1111/j.1365-2672.2008.03779.x

Lima LC, Fernandes AA, Costa AAP, Velasco FO, Leite RC, Hackett JL (2008). Isolation and characterizaton of Edwardsiella tarda from pacu Myleus micans. Arq. Bras. Med. Vet. e Zootec. 60(1):275-277. https://doi.org/10.1590/S0102-09352008000100040

Markey B, Leonard F, Archambault M, Cullinane A, Maguire D (2013). Clinical veterinary microbiology second Ed. MOSBYELSEVIER Chapter 3: 49-58.Chapter 6 :79-102, Chapter 17 : 239-274.

Mizunoe S, Yamasaki T, Tokimatsu I, Matsunaga N, Kushima H, Hashinaga K, Kadota JI (2006). A case of empyema caused by Edwardsiella tarda. J. Infect. 53(6): e255-e258. https://doi.org/10.1016/j.jinf.2006.03.001

Mohanty BR, Sahoo PK (2007). Edwardsiellosis in fish: a brief review. J. Biosci. 32(3): 1331-1344. https://doi.org/10.1007/s12038-007-0143-8

Oana C, Tim TN (2011). Antibiotic Tolerance and Resistance in Biofilm Infections book chapter 13 p.215 Thomas Bjarnsholt •Claus Moser • Peter Qstrup Jensen • Niels HQiby Springer Science Business Media.

Park, Seong Bin, et al (2014). «Development of a multiplex PCR assay to detect Edwardsiella tarda, Streptococcus parauberis, and Streptococcus iniae in olive flounder (Paralichthys olivaceus). J. Vet. Sci. 15.1 (2014): 163-166.

Sakai T, Iida T, Osatomi K, Kanai K (2007). Detection of type 1 fimbrial genes in fish pathogenic and non-pathogenic Edwardsiella tarda strains by PCR. Fish Pathol., 42(2): 115-117. https://doi.org/10.3147/jsfp.42.115

Srinivasa Rao, P. S., Lim, T. M., & Leung KY (2003). Functional genomics approach to the identification of virulence genes involved in Edwardsiella tarda pathogenesis. Infection and Immun., 71(3), 1343–1351. https://dx.doi.org/10.1128/IAI.71.3.1343-1351.2003.

Tam YC, Harvey RF, Chan ECS (1982). Chondroitin sulfatase-producing and hyaluronidase-producing oral bacteria associated with periodontal disease. J. Canadian Dental Assoc. 48: 115–120.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Molecul. Biol. Evol. 30(12): 2725-2729. https://doi.org/10.1093/molbev/mst197

Tiamiyu AM, Soladoye MO, Adegboyega TT, Adetona MO (2015). Occurrence and antibiotic sensitivity of bacterial strains isolated from Nile Tilapia, Oreochromis niloticus obtained in Ibadan, Southwest Nigeria. J. Biosci. Med. 3(05): 19. https://doi.org/10.4236/jbm.2015.35003

Thompson JD, Higgins DG, Gibson TJ (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research. Microbes Infect. 14:26 –34. https://doi.org/10.1016/j.micinf.2011.08.005.

Waters AE, Contente-Cuomo T, Buchhagen J, Liu CM, Watson L, Pearce K, Foster JT, Bowers J, Driebe EM, Engelthaler DM, Keim PS (2011). Multidrug-resistant Staphylococcus aureus in US meat and poultry. Clin. Infect. Dis. May 15;52(10):1227-30.

Weigel WA, Demuth DR (2015). QseBC, a two-component bacterial adrenergic receptor and global regulator of virulence in Enterobacteriaceae and Pasteurellaceae. Molecul. Oral Microbiol. 31:379–397.

WHO (2003). Publishes guidance to minimize both terrorist and unintentional threats to food. Week.Releas. (1997–2007) 7 (6). https://doi.org/10.2807/esw.07.06.02158- en.

Yang M, Lv Y, Xiao J, Wu H, Zheng H, Liu Q, n Wang Q (2012). Edwardsiella comparative phylogenomics reveal the new intra/inter-species taxonomic relationships, virulence evolution and niche adaptation mechanisms. PloS one. 7(5): e36987. https://doi.org/10.1371/journal.pone.0036987