High Occurrence Rate of Multidrug-Resistant ESBL-Producing E. coli Recovered from Table Eggs in District Peshawar, Pakistan

Tasbihullah1, Sadeeq ur Rahman2,*, Tariq Ali3 , Umer Saddique1, Shakoor Ahmad1, Muhammad Shafiq4, Sultan Ayaz2, Hamayun Khan1, Ijaz Ahmad1 Asadullah2, Raheela Taj5, Hafiz Nidaullah6 and Alamgir Khan7

1Department of Animal Health, The University of Agriculture, Peshawar, Pakistan

2College of Veterinary Sciences and Animal Husbandry, Section Microbiology, Abdul Wali Khan University, Mardan, Pakistan

3Center of Microbiology and Biotechnology, Veterinary Research Institute, Peshawar, Pakistan

4Collge of Veterinary Medicine, Nanjing Agriculture University, Nanjing, China

5Institute of Chemical Sciences, The University of Peshawar, Peshawar, Pakistan

6Food Technology (Food Microbiology Section), School of Industrial Technology, Universiti Sains, Malaysia

7District Head Quarter Hospital, Timergara, District Dir Lower, Pakistan

Tasbihullah and Sadeeq ur Rahman have contributed equally as first co-authors.

ABSTRACT

Whilst food-producing-animals could be a pool of resistance-conferring elements in the existing animal production system in Pakistan, the issue has not yet judiciously been highlighted. This study was conducted to determine incidence of extended spectrum β lactamase (ESBL) - producing Escherichia coli in table eggs and human with history of close association with table eggs. For this purpose, a total of 200 table eggs and 50 stool samples from human were analyzed. Results showed that out of 80 E. coli isolates recovered from eggs, 20 (25%) were found to be ESBL-producers, while, of the 17 human-isolates, 4 (23.5%) were ESBL producers. PCR revealed that blaCTXM (blaCTXM-1=15 and blaCTXM-9=4) was carried by all 22 (91.6%) ESBL-producers with additional blaSHV2 (n=12) and blaNDM-1 (n=3), but no blaTEM was identified. A predominant combination of blaCTXM + blaSHV2 (n=12) followed by blaCTXM + blaNDM-1 (n=3) was determined. All these isolates (phylogroup D=14/24, A= 6/24 and B2=4/24) were found to be multidrug resistant displaying resistance against at least three different classes of antibiotics. Class 1 integron was carried by (21/24) followed by additional class 2 integron (15/24). A total of 8 isolates were harboring insertion sequence common region 1 (ISCR1), which was found to be linked with blaCTXM in 50% (4/8) isolates. Results of the current study indicate contamination of eggs with ESBL-producing E. coli suggesting to improve hygienic process for end consumer during- egg production.

Article Information

Received 13 May 2019

Revised 30 July 2019

Accepted 09 August 2019

Available online 20 March 2020

Authors’ Contribution

SUR designed and conceived the project. SUR, TU and TA performed the lab work. SA, AU, HM, IA, AK and IK helped in sample collection and processing and contributed in reagent. SUR, TA, US and HK wrote the manuscript.

Key words

Food-producing animals, E. coli, Extended spectrum β lactamase, Carbapenemase, Table eggs.

DOI: https://dx.doi.org/10.17582/journal.pjz/20190513220514

* Corresponding author: sadeeq@awkum.edu.pk

0030-9923/2020/0004-1231 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan

Introduction

Food-producing animals-associated antimicrobial resistance (FAAMR) contributes to a greater incidence of clinical infections and hence regarded as public health issue. Especially, spread of microorganisms resistant to β-lactams-and carbapenems-the most efficient and safe drugs when other drugs apparently fail to work- through food-producing animals (FPAs) and retail meat is alarming. ESBLs can inactivate antibiotics including third- and fourth-generation cephalosporins and monobactams, however, could not inactivate cephamycins and carbapenems, while carbapenemases inactivate carbapenem drugs (ur Rahman et al., 2018a). ESBLs and carbapenemases are predominantly produced by Enterobacteriaceae including Escherichia coli and are being implied as crucial mechanisms of resistance to cephalosporins and carbapenems, respectively (Queenan and Bush 2007; ur Rahman et al., 2018a; Younas et al., 2019).

ESBL-encoding genes have been categorized into three major classes - blaCTXM, blaSHV and blaTEM- of which, blaCTXM has been reported as the most successful and widespread genotype in Asia (Ali et al., 2017, 2016). The blaCTXM has been has been further divided into five subgroups (blaCTXM-1, blaCTXM-2, blaCTXM-8, blaCTXM-9, blaCTXM-25). The families of each of these three categories of blaCTXM, blaSHV and blaTEM have been expanded widely with more than 170 variants have been described for each ESBL genotype (http://www.lahey.org/studies) which have been reported worldwide from community as well as FPAs (Ali et al., 2016, 2017). It has been shown that ESLB-producing E. coli spread through contaminated food chain or water utilizing mobile genetic elements such as integron, insertion sequence common region 1 (ISCR1) and conjugative plasmids (Ali et al., 2016; Geser, 2015).

Carbapenemases are highly versatile family of β-lactamases recognizing almost all hydrolysable β-lactams, and inactivate carbapenem drugs (Nordmann and Poirel, 2002). Genes responsible for carbapenemase production are quite often acquired from other related bacteria or environment when present on mobile genetic elements such as conjugative plasmids. Some commonly identified carbapenemase enzymes are NDM-, OXA-48- and KPC- type of enzymes whose presence has been reported from various parts of the world (Queenan and Bush, 2007). E. coli expressing NDM- and OXA-48- type of carbapenemases has been increasingly reported from Pakistan largely from the clinical settings. Use of antibiotics in agriculture and FPAs is not strictly regulated in Pakistan, and the excessive use of antibiotics in poultry production may likely be the prime stimulus for the emergence of FAAMR (Kumar et al., 2009). Despite this, literature regarding ESBL-producing E. coli in FPAs in Pakistan is rare making it an ignored issue. For the very first time, we report on the incidence of ESBL -producing E. coli isolated from shells of table eggs and human dealing with these eggs in district Peshawar, Pakistan.

 

Materials and Methods

Study area and types of samples

This study was conducted during March 2016 and December 2016 in district Peshawar, Pakistan. Table eggs were obtained from farms, small grocery shops and supermarkets. Stool samples of those human who had history of constant physical contact with table eggs, such as shop keepers, workers at farms, drivers and helper loading and unloading table eggs for transport were collected from a collection at Khyber teaching hospital, Peshawar.

Ethics

The study was approved by the local institutional ethical committee and all work described here was performed according to local and institutional guidelines. A proper written consent for publication of the resultant data was obtained from donors and owners of the shops.

Sample collection

A total of 200 table eggs and 50 stools samples from human beings analyzed. Eggs were collected from small grocery shops (n=7), supermarkets (n=5) and poultry farms (n=3). Each point was visited two times approximately two weeks apart. A total of 50 human stool samples were obtained from collection of diagnostic lab of Khyber Teaching Hospital, Peshawar.

Isolation of E. coli

Isolation of E. coli from egg shells was performed as described earlier (Musgrove et al., 2005). About 2 g of human faecal samples were suspended in 5 ml of saline (0.9%) and 100 µl of each sample was plated directly on MacConkey agar (Abdallah et al., 2017) containing cefotaxime (1 µg/ml) and meropenum (0.5 µg/ml) for screening of ESBL and carbapenemase E. coli producers as advised by the clinical & laboratory standard institute (CLSI) (CLSI, 2014). Our previously confirmed E. coli producing CTXM (Ali et al., 2016) was used as positive control while E. coli ATCC 25922 was implied as susceptible control strain.

Identification of E. coli

Presumptive lactose fermenting pink colour colonies were picked up for further specie identification by API 20E kits as per manufacturer’s instruction (bioMérieux, Marcy I’Etoile, France) and specie specific PCR as mentioned elsewhere (Tantawiwat et al., 2005). Confirmed E. coli isolates were stored in brain heart infusion broth (BHI; Sigma-Aldrich) containing 30% glycerol at -80°C.

Confirmation of ESBL producers

Presumptive ESBL- and carbapenemase-producers were subjected to double disc synergy test as per recommendation of CLSI (2014). ESBL producers were confirmed by using antimicrobial discs of cefotaxime (30 μg), cefotaxime plus clavulanic acid (30/10 μg), ceftazidime (30 μg), ceftazidime plus clavulanic acid (30/10 μg) (Becton Dickison, Sparks, MD USA). The test was regarded positive when the zone of inhibition of cefotaxime plus clavulanic acid or ceftazidime plus clavulanic acid was ≥5mm larger than their respective single discs. E. coli ATCC 25922 (ESBL-negative) and Klebsiella pneumoniae ATCC 700603 (ESBL-positive) while quality control strain.

Genotypic screening for ESBL and carbapenemase encoding genes

Conventional PCR was performed on ESBL and carbapenemase positive isolates for the presence of blaCTX-M, blaSHV-2, and blaNDM-1 (Table I). Template DNA was prepared by conventional boiling method (Ali et al., 2016).

 

Table I.- Primers and target genes used in this study.

Primer name	Target gene	Sequence (5΄-3ʹ)	Size (bp)	Reference
β -lactamases
CTX-M –F CTX-M –R	blaCTXM	ATGGTTAAAAAATCACTGCG AAACCGTTGGTGACGAT	~873	(Paauw et al., 2006)
CTX-M9-F CTX-M9-R	blaCTXM9	TGGTGACAAAGAGAGTGCAACG TCACAGCCCTTCGGCGAT	~875	(Paauw et al., 2006)
SHV –F SHV -R	blaSHV	GGG TTA TTC TTA TTT GTC GC TTAGCGTTGCCAAGTGCTC	~567	(Chang et al., 2001)
CTXM1-F1 CTXM1-R	blaCTXM-1	GCT GTT GTT AGG AAG TGT GC CCA TTG CCC GAG GTG AAG	~490	(Shibata et al., 2006)
TEM-F TEM-R	BlaTEM	ATA AAA TTC TTG AAG ACG AAA GAC AGT TAC CAA TGC TTA ATC	~1086	(Yao et al., 2007)
NDM-F NDM-R	BlaNDM1	AGCTGAGCACCGCATTAG CGGAATGGCTCATCACGATC	~720	(Poirel et al., 2011)
Integrons and integron variable region
intI1-F intI1-R	intI1	CCT CCC GCA CGA TGA TC TCC ACG CAT CGT CAG GC	~280	(Dillon et al., 2005)
intI2-F intI2-R	intI2	AAA TCT TTA ACC CGC AAA CGC ATG TCT AAC AGT CCA TTT TTA AAT TCT A	~439	(Dillon et al., 2005)
intI3-F intI3-R	intI3	AGT GGG TGG CGA ATG AGT G TGT TCT TGT ATC GGC AGG TG	599	(Dillon et al., 2005)
intI1-VR-F ntI1-VR-R	intI1vari-able region	TCA TGG CTT GTT ATG ACT GT GTA GGG CTT ATT ATG CAC GC	variable	(White et al., 2000)
Specific to E. coli
UAL UAR	uidA	TGG TAA TTA CCG ACG AAA ACG GC ACG CGT GGT TAC AGT CTT GCG	~147	(Tantawiwat et al., 2005)
E. coli phylogrouping
ChuA-F ChuA-R	ChuA	GAC GAA CCA ACG GTC AGG AT TGC CGC CAG TAC CAA AGA CA	~279	(Clermont et al., 2000)
YjaA-F YjaA-R	YjaA	TGA AGT GTC AGG AGA CGC TG ATG GAG AAT GCG TTC CTC AAC	211-bp	(Clermont et al., 2000)
TspE4C2-F TspE4C2-R	TspE4C2	GAG TAA TGT CGG GGC ATT CA CGC GCC AAC AAA GTA TTA CG	152-bp	(Clermont et al., 2000)
ISCR1	ISCR1	CGC CCA CTC AAA CAA ACG GAG GCT TTG GTG TAA CCG	469-bp	(Ali et al., 2016)

F, forward; R, reverse.

 

PCR assays was also performed separately on the isolated-purified plasmid of random isolates using plasmid isolation kit TIANamp Bacteria DNA Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions, in order to show that the ESBL or carbapenemase encoding genes are located on the plasmids.

Primers were synthesized by Sunbiotech, Beijing. All PCR amplification reactions were carried out in thermo-cycler (Bio Rad T100) and products were resolved on 1% agarose gel. Klebsiella pneumoniae ATCC 700603 (ESBLs-positive strain), DNA from a previously confirmed NDM-1 producer were used positive controls, respectively, in all related PCR assays.

Antimicrobial susceptibility testing (AST)

Antimicrobial susceptibility testing was performed by Kirby–Bauer disk diffusion method and interpreted as per CLSI guidelines (CLSI, 2014). The following antibiotic disks were used, ampicillin (10 µg), cephalexin (30 μg), amoxicillin/clavulanic acid (20/10 µg), ceftazidime/clavulanate (30/10 µg), cefoxitin (30 µg), ceftazidime (30 µg), cefotaxime (30 µg), aztreonam (30 µg), meropenem gentamicin (10 µg), norfloxacin (10 µg), gentamicin (10µg), tetracycline (30µg) (Oxoid, UK). E. coli ATCC 25922 (ESBL-negative) and Klebsiella pneumoniae ATCC 700603 (ESBL-positive) were used as quality control strains. ESBL E. coli were declared as multidrug resistant (MDR) when found resistant to more than two categories of antimicrobial drugs (Magiorakos et al., 2012).

Phylogenetic analysis

A triplex PCR was applied to categorize E. coli into one of the four phylogenetic groups (A, B1, B2 and D) as described earlier (Clermont 2000).

Integron, variable region and insertion sequence ISCR1

PCR was used to identify one of the three types (Type 1-III) of integrons (Dillon et al., 2005), variable region of the intII positive isolates (Ali et al., 2016; White et al., 2000) and association of ISCR1 with ESBL/carbapenemase-encoding genes as we described earlier (Ali et al., 2016).

Statistical analysis

Data obtained were stated in absolute values, and percentages for which Microsoft excell was mainly used. Degrees of antimicrobial resistance and genotypes of ESBLs found in E. coli recovered from table eggs and human specimens were compared by chi-square test at P≤0.01 probability level using SPSS 16.0 analysis software.

 

Results

Isolation rate of E. coli and occurrence of ESBL and carbapenemase producers

Isolation rate and occurrence of ESBL producers is mentioned in Table II. A total of 40% (80/200) of table egg samples were found positive for E. coli, while a total of 17 (34%) human samples were declared positive for E. coli growth. Table eggs were found significantly highly contaminated (P ≤ 0.01) as compared to human samples. A total of 20 isolates (25%) from table eggs were ESBL producers, while 4 (23.5%) ESBL-producers were recovered from human (Table II).

Genotyping of ESBL producers

All 24 ESBL producers were further assayed for the presence of genes encoding ESBL and few commonly reported carbapenemase encoding genes. Our results indicated that 91.6% (22/24) isolates were harbouring blaCTXM gene (Table III). Further subtyping indicated that a total of 15 isolates were carrying blaCTXM-1 and 4 were

 

Table II.- Isolation frequency of ESBL and Carbapenemase producers.

Sample nature	Isolation rate	ESBL producers	MDR
Table eggs	80/200 (40%)	20/80 (25%)	24/80 (30%)
Human specimens	17/50 (34%)	4/17 (23.5%)	06/17 (35.3%)
Total	97/250 (38.8%)	24/97 (24.7%)	30/97 (30.9%)

 

Table III.- Genotyping of ESBL producers (n=24).

Genotypes	Number	Frequency
CTXM	22	91.6
CTXM-1	15	62.5
CTXM-9	4	16.6
SHV2	12	50.0
TEM	0	0.00
NDM-1	3	12.5
CTXM+SHV2	12	50.0
CTXM+NDM-1	3	12.5

 

Table IV.- Antibiotic susceptibility test of ESBL-(n=24).

Antibiotics	Abbr.	µg/ml	Resistant isolates (number) %		Intermediate isolates (number)%		Sensitive isolates (number)%
			Eggs	Human	Eggs	Human	Eggs	Human
Cephalexin	CLR	30	(24)100	(4)100	(0) 0.0	(0) 0.0	(0) 0.0	(0) 0.0
Ampicillin	AM	10	(20) 83.3	(3) 75	(4) 16.6	(1) 25	(0) 0.0	(0) 0.0
Cefotaxime	CTX	30	(21) 87.5	(3) 75	(2) 8.3	(1) 25	(1) 4.3	(0) 0.0
Ceftazidime	CZA	30	(22) 91.7	(3) 75	(2) 8.4	(1) 25	(0) 0.0	(0) 0.0
Cefepime	FEP	30	(17) 70.83	(3) 75	(4) 16.6	(1) 25	(3)12.5	(0) 0.0
Cefoxitin	FOX	30	(3) 12.5	(3)75	(1) 25	(1) 16.7	(18) 75.0	(0) 0.0
Aztreonam	AZT	30	(17) 70.83	(2) 50	(4) 16.6	(1) 25	(3) 12.5	(1) 25.0
Meropenem	MPN	10	(2) 8.4	(3) 75	(1) 25	(0) 0.0	(21) 87.5	(0) 0.0
Norfloxacin	NOR	10	(7) 29	(1) 25.0	(13) 54.1	(2) 50.0	(4) 16.5	(1) 25.0
Gentamicin	G	10	(8) 33.4	(3) 75.0	(8) 33.4	(1) 25.0	(8) 33.4%	(0) 0.0
Tetracycline	TE	30	(18) 75.0	(3) 75.0	(6) 25	(1) 25.0	(0)0.00	(0) 0.0

 

harbouring blaCTXM-9. A total of 2 isolates were harbouring both blaCTXM-1 and blaCTXM-9 in combination. A total of 12 isolates were carrying blaSHV2, while 3 isolates were also carrying blaNDM-1. Other combinations such as blaCTXM-1+blaSHV2 (n=12) and blaCTXM + blaNDM-1 (n=3) was also noticed (Tables III, IV). No blaTEM type was however amplified from any of the isolates.

Antibiotic susceptibility profile

All 24 under study isolates were tested further against a panel of drugs containing first-2nd and 3rd generation cephalosporins as well as non-β lactam drugs. All isolates were found resistant to first generation cephalosporin (Cephalexin). Majority, both of human and table eggs, of our isolates were found resistant to third- (ceftazidime, 91.7%, cefotaxime, 87.5%), and fourth (cefepime 70.83%)- generation cephalosporin, however, high susceptibility was detected towards carbapenem (meropenem,87.5%), cephamycins (cefoxitin, 75%); Table IV). Overall, most of the isolates were found to be MDR displaying resistance against more than two classes of antibiotics tested.

Integron, variable regions and insertion sequence ISCR1

Of the 24 isolates, 21 were carrying integron 1, while 15 were carrying additional integron 2. However, none of the isolates was found carrying integron 3. Variable region could be PCR amplified from 14 isolates, while insertion sequence common region 1 (ISCR1) was found in total of 8 isolates. Of these, ISCR1 was found linked with blaCTXM among 4 isolates (50%) (Table V).

 

Table V.- Integrons, variable regions and insertion sequence of ESBL and carbapenemase producers.

No.	ID	Origin	Genotype	Int. 1	Int. 2	Int. 3	VR	ISCR1	ISCR1+ESBL	PG
1	110	Eggs-PF	CTXM1, SHV-2	+	+	_	+	_	_	D
2	78	Eggs-SM	CTXM1, SHV-2	+	+	_	+	+	+	D
3	76	Eggs-SM	CTXM1, SHV-2	+	+	_	+	+	+	D
4	90	Eggs-PF	CTXM1, SHV-2	+	+	_	+	+	+	D
5	150	Eggs-GS	CTXM1, CTXM-9, SHV-2, NDM-1	+	+	_	+	+	+	D
6	135	Eggs-SM	CTXM1	+	+	_	+	+	_	D
7	33	Eggs-PF	CTXM-9, SHV-2	+	+	_	+	_	_	D
8	20	Eggs-SM	-	+	_	_	_	_	_	A
9	21	Eggs-SM	CTXM	+	+	_	_	_	_	A
10	15	Eggs-SM	CTXM	+	_	_	_	_	_	A
11	25	Eggs-GS	CTXM	+	+	_	+	_	_	D
12	62	Eggs-SM	-	+	+	_	_	+	_	D
13	16	Eggs-GS	CTXM	-	_	_	+	_	_	D
14	70	Eggs-PF	CTXM1, SHV-2	+	_	_	_	_	_	D
15	67	Eggs-GS	CTXM1, SHV-2	+	_	_	_	_	_	D
16	19	Eggs-SM	CTXM1, SHV-2	-	_	_	_	_	_	A
17	69	Eggs-SM	CTXM1, SHV-2	+	_	_	_	_	_	A
18	61	Eggs-SM	CTXM1, SHV-2	+	+	_	+	_	_	D
19	THU4	Hn-St	CTXM1, CTXM-9	+	-	_	+	+	_	B2
20	THI1	Hn-St	CTXM, NDM-1	+	+	_	+	+	_	B2
21	THU3	Hn-St	CTXM, NDM-1	+	+	_	+	_	_	B2
22	THI2	Hn-St	CTXM1, CTXM-9, SHV-2	+	+	_	+	_	_	B2
23	78	Eggs-PF	CTX-M1, SHV-2	+	+	_	+	_	_	D
24	19	Eggs-GS	CTX-M	_	_	_	_	_	_	A

 

Eggs-PF, egg samples taken directly from poultry farms; Eggs-SM, egg samples taken from super market; Eggs-GS, egg samples taken from ordinary grocery shop; Hn-St, human stool samples; Int.1, integron 1; Int. 2, integron 2; VR, variable region; P.G, phylogenetic group.

 

Discussion

ESBL-producing E. coli is becoming a huge challenge in clinical settings due to its ability to resistance β-lactams and carbapenems- the most effective drugs. The current increasing reports on ESBL- producing E. coli particularly from FPAs has major public health consequences in addition to compromising animal welfare (Adnan et al., 2017; Ali et al., 2016, 2017; ur Rahman et al., 2018b). Quite often, ESBL-producing isolates exhibit multidrug resistant phenotypes and could easily transfer these features to other bacteria through horizontal transfer by means of conjugative plasmids and mobile elements (Nordmann and Poirel, 2002). This phenomenon of emergence of drug resistance corroborates with that of toxin production in response to signals present in the surroundings of microbes (ur Rahman and van Ulsen, 2013).

Poultry industry is one of the most successful and dynamic industry contributing a lion share of 28.0% of total meat produced in the country and contributes 1.3% to national GDP (Economic Survey of Pakistan, 2016). In addition, poultry sector provides the cheapest sources of quality protein in the form of meat and eggs. However, unfortunately, use of antimicrobials in poultry sector is not strictly regulated in Pakistan encouraging blind and excessive use of antibiotics (Naeem et al., 2006). Consistent and excessive use of antimicrobial provides selective pressure for emergence of antimicrobial resistance. These resistant microbes would find its way to disseminate among the community or would enable to pass on its resistance-encoding elements to their surrounding ecosystem. Eggs laying hen are normally kept in open or semi-mechanized poultry sheds in Pakistan with abundant supply of antibiotics. In such scenario, laid eggs would have chances to get contaminated by bacteria carrying resistance elements (Huneau-Salaün et al., 2010). Besides environment, people working at such farms, transporters of eggs or those selling eggs at shops would also be at risk upon physical contact. Hence to protect consumers, various countries have implied various tools to sanitize eggs such as ultraviolet radiation and gaseous ozone. Our study revealed an overall 24.8% ESBL producing E. coli isolated mainly from shells of table eggs. Our results are in agreement with previous findings from Spain with 22.3% of egg shells were reportedly found contaminated with ESBL- E. coli (Grande-Burgos et al., 2016). The higher incidence rate of ESBL-producing E. coli is possibly due to overuse of antibiotics during poultry production. ESBL-producing-E. coli has been widely reported from human patients that were hospitalized in Pakistan and community (Abrar et al., 2017; Ullah et al., 2017) suggesting widespread colonization of ESBL producers. However, results of our study cannot be generalized as we analyzed limited number of samples from a single district Peshawar of Khyber Pakhtunkhwa province-Pakistan. Due to limited resources, we could not extend our study further to investigate the occurrence and trend of ESBL producing E. coli in eggs of backyards and different mechanized and open shed poultry farms in Khyber Pakhtunkhwa province. We speculate that the prevalence of ESBL will be higher than we have observed in the current study. We are currently extending our study to other districts, and our preliminary results support this notion.

As observed earlier, our study indicates that blaCTXM remained the predominant ESBL genotype in Pakistan (Khan et al., 2010) and other neighboring countries like China (Ali et al., 2016, 2017). This goes along with higher occurrence of SHV genotype in our study and as reported by others (Habeeb et al., 2013; Chang et al., 2001). Overall, our results suggest a higher incidence of ESBL producing E. coli in table eggs suggesting to improve hygienic process along the chain of egg production and discourage overuse of antibiotics.

 

Conclusion

We report on high occurrence of ESBL-producing E. coli recovered from table eggs carrying additional carbapenemase-encoding genes suggesting indiscriminate use of antibiotics. Hence, strict use of antibiotics and effective antimicrobial resistance surveillance program is highly needed for intervention.

 

Acknowledgments

This study was partially funded by National Natural Science Foundation of China under “International Young Scientist Award” (project No. 31550110200) and Relief International under the umbrella of USAID program “fighting zoonosis” awarded to Dr Sadeeq.

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Abdallah, H.M., Alnaiemi, N., Reuland, E.A., Wintermans, B.B., Koek, A., Abdelwahab, A.M., Samy, A., Abdelsalam, K.W. and Vandenbroucke-Grauls, C., 2017. Fecal carriage of extended-spectrum beta-lactamase-and carbapenemase-producing Enterobacteriaceae in Egyptian patients with community-onset gastrointestinal complaints: A hospital -based cross-sectional study. Antimicrob. Resist. Infect. Contr., 6: 62. https://doi.org/10.1186/s13756-017-0219-7

Abrar, S., Vajeeha, A., Ul-Ain, N. and Riaz, S., 2017. Distribution of CTX-M group I and group III beta-lactamases produced by Escherichia coli and Klebsiella pneumoniae in Lahore, Pakistan. Microb. Pathog., 103: 8-12. https://doi.org/10.1016/j.micpath.2016.12.004

Adnan, M., Khan, H., Kashif, J., Ahmad, S., Gohar, A., Ali, A., Khan, M.A., Shah, S.S.A., Hassan, M.F. and Irshad, M., 2017. Clonal expansion of sulfonamide resistant Escherichia coli isolates recovered from diarrheic calves. Pakistan Vet. J., 37: 253-255.

Ali, T., Rahman, S., Zhang, L., Shahid, M., Han, D., Gao, J., Zhang, S., Ruegg, P.L., Saddique, U. and Han, B., 2017. Characteristics and genetic diversity of multi-drug resistant extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli isolated from bovine mastitis. Oncotarget, 8: 90144. https://doi.org/10.18632/oncotarget.21496

Ali, T., Zhang, L., Shahid, M., Zhang, S., Liu, G., Gao, J. and Han, B., 2016. ESBL-producing Escherichia coli from cows suffering mastitis in China contain clinical class 1 integrons with CTX-M linked to ISCR1. Front. Microbiol., 7: 1931. https://doi.org/10.3389/fmicb.2016.01931

Chang, F.Y., Siu, L.K., Fung, C.P., Huang, M.H. and Ho, M., 2001. Diversity of SHV and TEM beta-lactamases in Klebsiella pneumoniae: Gene evolution in Northern Taiwan and two novel beta-lactamases, SHV-25 and SHV-26. Antimicrob. Agents Chemother., 45: 2407-2413. https://doi.org/10.1128/AAC.45.9.2407-2413.2001

Clermont, O., Bonacorsi, S. and Bingen, E., 2000. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. environ. Microbiol., 66: 4555-4558. https://doi.org/10.1128/AEM.66.10.4555-4558.2000

CLSI, 2014. Performance standards for antimicrobial susceptibility testing. Clinical and Laboratory Standard Institute, CLSI Document, Wayne, PA, pp. M100–S124.

Dillon, B., Thomas, L., Mohmand, G., Zelynski, A. and Iredell, J., 2005. Multiplex PCR for screening of integrons in bacterial lysates. J. Microbiol. Meth., 62: 221-232. https://doi.org/10.1016/j.mimet.2005.02.007

Geser, N.S. and Hächler, H.R., 2015. Occurrence and characteristics of extended-spectrum b-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet. Res., 8: 1-9. https://doi.org/10.1186/1746-6148-8-21

Grande-Burgos, M.J., Fernández-Márquez, M.L., Pérez-Pulido, R., Gálvez, A. and Lucas-López, R., 2016. Virulence factors and antimicrobial resistance in Escherichia coli strains isolated from hen egg shells. Int. J. Fd. Microbiol., 238: 89-95. https://doi.org/10.1016/j.ijfoodmicro.2016.08.037

Habeeb, M.A., Sarwar, Y., Ali, A., Salman, M. and Haque, A., 2013. Rapid emergence of ESBL producers in E. coli causing urinary and wound infections in Pakistan. Pakistan J. med. Sci., 29: 540. https://doi.org/10.12669/pjms.292.3144

Huneau-Salaün, A., Michel, V., Huonnic, D., Balaine, L. and Le Bouquin, S., 2010. Factors influencing bacterial eggshell contamination in conventional cages, furnished cages and free-range systems for laying hens under commercial conditions. Br. Poult. Sci., 51: 163-169. https://doi.org/10.1080/00071668.2010.482462

Khan, E., Schneiders, T., Zafar, A., Aziz, E., Parekh, A. and Hasan, R., 2010. Emergence of CTX-M Group 1-ESBL producing Klebsiella pneumonia from a tertiary care centre in Karachi, Pakistan. J. Infect. Devel. Count., 4: 472-476. https://doi.org/10.3855/jidc.674

Kumar, A., Ellis, P., Arabi, Y., Roberts, D., Light, B., Parrillo, J.E., Dodek, P., Wood, G., Kumar, A. and Simon, D., 2009. Initiation of inappropriate antimicrobial therapy results in a fivefold reduction of survival in human septic shock. Chest, 136: 1237-1248. https://doi.org/10.1378/chest.09-0087

Magiorakos, A.P., Srinivasan, A., Carey, R.B., Carmeli, Y., Falagas, M.E., Giske, C.G., Harbarth, S., Hindler, J.F., Kahlmeter, G., Olsson-Liljequist, B., Paterson, D.L., Rice, L.B., Stelling, J., Struelens, M.J., Vatopoulos, A., Weber, J.T. and Monnet, D.L., 2012. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect., 18: 268-281. https://doi.org/10.1111/j.1469-0691.2011.03570.x

Musgrove, M., Jones, D., Northcutt, J., Cox, N. and Harrison, M., 2005. Shell rinse and shell crush methods for the recovery of aerobic microorganisms and Enterobacteriaceae from shell eggs. J. Fd. Protec., 68: 2144-2148. https://doi.org/10.4315/0362-028X-68.10.2144

Naeem, M., Khan, K. and Rafiq, S., 2006. Determination of residues of quinolones in poultry products by high pressure liquid chromatography. J. appl. Sci., 6: 373-379. https://doi.org/10.3923/jas.2006.373.379

Nordmann, P. and Poirel, L., 2002. Emerging carbapenemases in Gram-negative aerobes. Clin. Microbiol. Infect., 8: 321-331. https://doi.org/10.1046/j.1469-0691.2002.00401.x

Queenan, A.M. and Bush, K., 2007. Carbapenemases: The versatile β-lactamases. Clin. Microbiol. Rev., 20: 440-458. https://doi.org/10.1128/CMR.00001-07

ur Rahman, S. and van Ulsen, P., 2013. System specificity of the TpsB transporters of coexpressed two-partner secretion systems of Neisseria meningitidis. J. Bact., 195: 788-797. https://doi.org/10.1128/JB.01355-12

ur Rahman, S., Ali, T., Ali, I., Khan, N.A., Han, B. and Gao, J., 2018a. The growing genetic and functional diversity of extended spectrum beta-lactamases. BioMed Res. Int., 2018: 14. https://doi.org/10.1155/2018/9519718

ur Rahman, S., Ahmad, S., Khan, I. and Pakistan, P., 2018b. Incidence of ESBL-producing-Escherichia coli in poultry farm environment and retail poultry meat. Pak. Vet. J., 39: 116-120. https://doi.org/10.29261/pakvetj/2018.091

Tantawiwat, S., Tansuphasiri, U., Wongwit, W., Wongchotigul, V. and Kitayaporn, D., 2005. Development of multiplex PCR for the detection of total coliform bacteria for Escherichia coli and Clostridium perfringens in drinking water. Southeast Asian J. Trop. Med. Publ. Hlth., 36: 162-169.

Ullah, W., Qasim, M., Rahman, H., Khan, S., Rehman, Z.U., Ali, N. and Muhammad, N., 2017. CTX-M-15 and OXA-10 beta lactamases in multi drug resistant Pseudomonas aeruginosa: First report from Pakistan. Microb. Pathog., 105: 240-244. https://doi.org/10.1016/j.micpath.2017.02.039

White, P.A., McIver, C.J., Deng, Y. and Rawlinson, W.D., 2000. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett., 182: 265-269. https://doi.org/10.1016/S0378-1097(99)00600-X

Younas, M., Rahman, S., Shams, S., Salman, M.M. and Khan, I., 2019. Multidrug resistant carbapenemase-producing Escherichia coli from chicken meat reveals diversity and co-existence of carbapenemase encoding genes. Pak. Vet. J., 36: 1-5.