Research Article

Genetic Divergence of Local Goats in Ninh Thuan Province Vietnam

Ngoc Tan Nguyen1*, Minh Thanh Tram1, Thi Thu Pham1, Tan Loi Le1, Thi Khanh Ly Nguyen1, Tuan Thanh Hoang2, Cong Thieu Pham3, Nguyen Khang Duong4

1Faculty of Biological Sciences, Nong Lam University in Ho Chi Minh City, Vietnam. Linh Trung Ward, Thu Duc City, Ho Chi Minh City, Vietnam; 2Vigova Poultry Research and Development Center. 496/101 Duong Quang Ham Street, Ward 6, Go Vap District, Ho Chi Minh City, Vietnam; 3National Institute of Animal Sciences. No 9 Tan Phong street, Thuy Phuong Commune, Bac Tu Lien District, Hanoi City, Vietnam; 4Faculty of Animal Science and Veterinary Medicine, Nong Lam University in Ho Chi Minh City, Vietnam. Linh Trung Ward, Thu Duc City, Ho Chi Minh City, Vietnam.

Received | March 03, 2022; Accepted | April 30, 2022; Published | July 15, 2022

*Correspondence | Ngoc Tan Nguyen, Faculty of Biological Sciences, Nong Lam University in Ho Chi Minh City, Vietnam. Linh Trung Ward, Thu Duc City, Ho Chi Minh City, Vietnam; Email: nntan@hcmuaf.edu.vn, ngoctan0068@gmail.com

Citation | Nguyen NT, Tram MT, Pham TT, Le TL, Nguyen TKL, Hoang TT, Pham CT, Duong NK (2022). Genetic divergence of local goats in ninh thuan province vietnam. Adv. Anim. Vet. Sci. 10(8): 1761-1768.

DOI | http://dx.doi.org/10.17582/journal.aavs/2022/10.8.1761.1768

ISSN (Online) | 2307-8316

 

 

Copyright: 2022 by the authors. Licensee ResearchersLinks Ltd, England, UK.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Ninh Thuan is one province that is located in south central coast of Vietnam with major parts of province’s population are Cham and Raglai ethnic groups. The semi-arid conditions allow the coexistence of ruminant species such goats, sheep, cattle and buffaloes. The existence of small ruminants plays a pivotal role in daily local life. Goats are domestic animals that provide meat and milk. They can readily adapt to different climatic conditions such as arid or semi-arid, mountainous areas, tropical conditions and cold winters (Ganbold et al., 2020; Febriana et al., 2021). In Vietnam, most of the goats belong to two local breeds as De Co plus the local geographic name (Le et al., 2017) and Bach Thao that originated in Ninh Thuan Province and later spread to the whole country as dual purpose breeds (meat and milk). However, information on the genetic source of these goat breeds, especially Bach Thao remains unclear. A good understanding of the genetic sources of domestic animals is a basic requirement to evaluate breed relationships and optimize both conservation and development management (Barker et al., 1997; Martin-Burriel et al., 1999). mtDNA sequence variation is used to analyze the genetic divergence and promote the evolution of husbandry livestock populations (Ganbold et al., 2020). The divergence of mtDNA is vital in evaluating population structure and phylogeny, as well as the maternal origin of domestic livestock (Beja-Pereira et al., 2006; Rocha et al., 2011; Ly et al., 2015; Teinlek et al., 2018; Touma et al., 2019). Here, the genetic divergence and maternal genetic relations of local goat breeds in Ninh Thuan Province were evaluated to provide a principle database for a detailed conservation and development program strategy.

MATERIALS AND METHODS

Collection of whole blood samples and DNA extraction

The goats were handled by experienced workers and technicians to minimize the suffering of animals as the main priority. Blood samples were taken from the jugular vein of 49 individual goats comprising local goat breeds such as De Co (CO, n=10) and Bach Thao (BT, n=10) in Ninh Thuan Province. Three exotic goat breeds as Saanen (SA, n=10), Red Boer (RB, n=10) and White Boer (WB, n=9) raised at An Phu Dairy Cattle Company in Ho Chi Minh City were also sampled (Figure 1). DNA extraction was conducted using a TOPPURE® blood DNA extraction kit.

Primer design

A set of primers was designed using Primer3 software based on the retrieved sequence from GenBank with access number AB162216.1. A length of fragment with 687 bp in the hypervariable region was magnified by the primer set (5’-3’) as forward (TCCCACTCCACAAGCCTAC) and reverse (TAGGTGAGATGGCCCTGAAG).

DNA amplification

The PCR technique was applied to amplify the fragment of 687 bp in the D-loop by a MasterCycler Pro S machine (Eppendorf, Germany). Reactions were conducted in a total of 25 μL that consisted of 50 ng/μL (2 µL) DNA templates, 0.8 µL primers (Phu Sa, Vietnam), 12.5 µL of Mytaq Mix 2X (Bioline) and 8.9 µL nuclease-free water. PCR was performed consisting of initial stage at 95ºC for 4 min, then repeat as following steps for 35 cycles with 95ºC-57ºC-72ºC for 30 seconds for each, and final step at 72ºC for 5 min. Separation of the PCR products was applied by electrophoresis using agarose gel (1.5%, 30 min, 100V) with a 100 bp DNA ladder and observed under UV light.

Data analysis

The alignment of 49 sequenced samples with the mtDNA D-loop sequence selected in the GenBank database (AB162216.1) was applied using BioEdit (Version 7.2.5). Nucleotide haplotype diversity was calculated using DNA Sequence Polymorphism (Version 6.12.03 x64).

The genetic distance and phylogenetic tree using D-loop mtDNA sequences (576 bp) of 49 individual goats were applied using MEGAX software (Version 10.2.5). Eight sequences of D-loop mtDNA of Capra hircus retrieved from GenBank including KM279318.1 (India), AB162216.1 (Pakistan), LC484844.1 (Georgia), AB044299.1 (Laos), AB004081 (Capra hircus), AB110590.1 (Capra aegagrus blythi), AB004305.1 (Capra falconeri) and AJ317875.1 (Capra caucasia) were used as references for the ingroups, while Bos taurus (NC006853.1) was used as a reference for the outgroup to build the phylogenetic tree. Six retrieved sequences from GenBank representative for the maternal

 

Table 1: Nucleotide composition

Goat breed	N	Percentage (%)
		A	T	G	C	A+T	G+C
CO	10	32.82	27.95	14.02	25.21	60.77	39.23
BT	10	32.82	27.95	14.02	25.21	60.77	39.23
RB	10	32.25	28.81	14.51	24.42	61.06	38.94
WB	9	32.33	28.58	14.41	24.67	60.91	39.09
SA	10	32.50	28.36	14.25	24.84	60.36	39.14
Average	31	32.55	28.33	14.67	24.87	60.88	39.12

CO: Co goat; BT: Bach Thao goat; RB: Red Boer goat; WB: White Boer goat; SA: Saanen goat

 

Table 2: Nucleotide substitution in 599 bp fragment length of the D-loop

Items		Number	Substitution	Variable sites
Two variants	Singleton	9	C/T	180
			T/C	186; 318; 491; 632
			A/G	598
			G/A	553; 651
			C/G	611
	Parsimony	41	C/T	493; 466; 544; 547; 570; 576; 615; 720
			T/C	207; 235; 377; 500; 517; 520; 535; 539; 542; 545; 546; 550; 551; 580; 581; 607; 610; 636; 653
			G/A	298; 413; 468; 483; 490; 543; 589; 597
			A/G	201; 206; 317; 552; 562
			T/A	737

 

Table 3: Types of nucleotide substitution

Type of substitution	Number	Percentage (%)
Transitions
C/T	32	64
G/A	16	32
Total	48	96
Transversions
C/G	1	2
A/T	1	2
C/A
T/G
Total	2	4

 

Table 4: Haplotype and nucleotide diversity

Goat type	Number of samples	Number of haplotypes	Divergence index (mean ±SE)
			Haplotype	Nucleotide
CO	10	3	0.644±0.0125	0.00156±0.0000003
BT	10	2	0.533±0.00896	0.00089±0.00
RB	10	6	0.778±0.01889	0.00723±0.0000035
WB	9	6	0.833±0.016	0.00686±0.0000034
SA	10	9	0.987±0.00292	0.03031±0.0000186
Total	31	21	0.889±0.00089	0.03005±0.00000008

CO: Co goat; BT: Bach Thao goat; RB: Red Boer goat; WB: White Boer goat; SA: Saanen goat

 

Table 5: Haplotype distribution

Haplotype (H)	Number	Individual goats	Haplotype index (±SE)
H-1	13	CO1, CO6, CO7, CO8, CO10, BT1, BT4, BT5, BT8, BT9, BT10, SA1, SA8	Hd= 0.889±0.00089
H-2	1	CO2
H-3	9	CO3, CO4, CO5, CO9, BT2, BT3, BT6, BT7, SA9
H-4	2	SA2, WB8
H-5	1	SA3
H-6	1	SA4
H-7	1	SA5
H-8	1	SA6
H-9	1	SA7
H-10	1	SA10
H-11	5	RB1, RB2, RB8, RB9, RB10
H-12	1	RB3
H-13	1	RB4
H-14	1	RB5
H-15	1	RB6
H-16	1	RB7
H-17	1	WB1
H-18	1	WB2
H-19	4	WB3, WB4, WB7, WB9
H-20	1	WB5
H-21	1	WB6

CO: Co goat; BT: Bach Thao goat; RB: Red Boer goat; WB: White Boer goat; SA: Saanen goat

 

Table 6: Genetic distance among goat breeds

	CO	BT	SA	RB	WB
CO		0.001	0.006	0.010	0.010
BT	0.001		0.006	0.010	0.010
SA	0.037	0.037		0.004	0.005
RB	0.056	0.055	0.026		0.003
WB	0.058	0.058	0.029	0.011

Values above the diagonal show the margin of error of genetic distance, with genetic distance values below the diagonal. CO: Co goat; BT: Bach Thao goat; RB: Red Boer goat; WB: White Boer goat; SA: Saanen goat

lineage of domestic goats such as A (KR059184), B (KR059219), C (GU229280), D (KR059210), F (KR059213) and G (KR059226) were used to trace the maternal lineages of Ninh Thuan local goat breeds.

RESULTS AND DISCUSSION

Nucleotide and haplotype variation

Forty-nine sequences of D-loop fragment were analyzed, with average nucleotide composition for A, T, G and C 32.55, 28.33, 14.67 and 24.87% (Table 1). Base contents of C+G and A+T were 39.12 and 60.88%, respectively.

Ganbold et al. (2021) analyzed 174 sequences using a 452 bp fragment of hypervariable region 1 in mtDNA from 12 different Mongolian goat breeds. Results showed percentage of base content as A (31.0%), C (22.2%), G (16.5%) and T (30.3%), with the percentage of G+C (38.7%) lower than A+T (61.3%). The trend of low G+C content in this study was also observed in large ruminants such as buffaloes (Sari et al., 2021; Suhardi et al., 2021; Youssef et al., 2021).

 

Nucleotide polymorphism was analyzed from 49 sample sequences, with one WB sample discarded due to low sequencing quality. Results are presented in Figure 2 and Table 2. Fifty polymorphic sites were observed as 48 transitions and 2 transversions at 96 and 4%, respectively with no insertions or deletions (Table 3). The high level of mtDNA diversity of imported exotic goats in this study was due to the maternal effects of the forebears (Mannen et al., 2001). The proportion of transition/transversion was 25:1, indicating a strong bias of transition, higher than the 17:1 and 16.7:1 ratios documented in husbandry goat breeds (Luikart et al., 2001; Chen et al., 2005) or Indian local goats (Joshi et al., 2004) but lower than in Tanzanian indigenous goats (28.7:1) reported by Nguluma et al. (2021).

Many studies have documented that the trend of strong bias toward transitions is an obvious indicator for distinguishing mtDNA evolution, as observed in ruminant species such as buffaloes (Lau et al., 1998; Kierstein et al., 2004; Lei et al., 2007; Babar et al., 2011; Shaari et al., 2019; Raungprim et al., 2021), sheep (Guo et al., 2005; Ly et al., 2015), cattle (Lai et al., 2006) or chicken (Liu et al., 2004).

Evaluation of genetic diversity and distance

The diversity of nucleotide (π), haplotype (Hd) of two local goat breeds and three exotic goat breeds were evaluated. Highest value of nucleotide diversification (π) was recorded in SA goats (π = 0.03031±0.0000186), with moderate values in RB and WB (0.00723 and 0.00686, respectively), a lower value in CO goats (0.001561) and the lowest value in BT goats (0.00089). Similarly, haplotype divergence (Hd) ranged from 0.987 in SA to 0.533 in BT (Table 4). Average diversity values of Hd and π were 0.889±0.000899 and 0.03005±0.00000008, respectively. These results were similar to haplotype and nucleotide diversity of Mongolian or Tanzanian indigenous goats (Ganbold et al., 2021; Nguluma et al., 2021) but haplotype and nucleotide divergence within the local goat population in our study was lower.

The DNA sequences from 49 individual goats revealed 21 different haplotypes (Table 5). Most CO and BT were placed in haplotypes 1 (H-1) and 3 (H-3). Five Red Boer goats were placed in H-11, while four White Boer goats appeared in H-19. Saanen goats in this study showed higher diversity than CO and BT goats. By contrast, local goat breeds such as CO and BT showed reduced diversity compared to exotic goat breeds, possibly because exotic goats originated from diverse maternal sources. Average values of haplotype diversity indicated lower genetic divergence in the two local goat breeds. This was attributed to low mutation rates in the D-loop region as a result of reduced maternal gene sources from different geographical regions; however, further detailed studies are required to improve the current hypotheses.

As shown in Table 6, genetic distances between local goat breeds were smaller (0.001) when compared with imported exotic goat breeds (ranging 0.037-0.058). Genetic distances among local goat breeds were similar (0.001). By coincidence, genetic distances between SA and CO or BT were the same (0.037), between WB and CO or BT 0.058, and between RB and CO or BT 0.056 or 0.055, respectively. Sari et al. (2021) stated that a genetic distance value of less than 0.5 indicated closely related genetic livestock. The genetic relationship among local goats was similar to WB or RB goats. Febriana et al. (2021) examined the control region sequences of Indonesian local goats (Kacang, Kejobong and Senduro) and found that the genetic distance among these local goats was also low (0.0047-0.0061).

Analysis of phylogeny

The dendogram in Figure 3 indicated that most of the local goat breeds were grouped in one clade, while the exotic goat breeds were concentrated in other clades, indicating clear maternal divergence between local and exotic goat breeds. The phylogenetic tree also revealed that local goat breeds were closer to Laos goat breeds originating from the Indochina region. By contrast, most of the exotic goat breeds, except SA, developed into one clade and then separated into many small clusters that were closely related to Capra hircus maternal origin from India, Pakistan and Georgia. Evidence from the phylogenetic tree also revealed that nearly 50% of SA individual goats were placed in local goat breeds.

Identification of maternal lineages has been documented in many reports (Sultana et al., 2003; Sardina et al., 2006; Kamalakkannan et al., 2018). In our study, most of the Ninh Thuan local goat breeds in sub-lineage B developed from maternal lineage B, while all imported exotic goat breeds displayed multiple maternal lineages as A, D and F (Figure 3).

Naderi et al. (2007) analyzed mtDNA on a large scale and identified six haplogroups of domestic goats, while Ganbold et al. (2020) reported that sub-lineage B was also found in Chinese and Mongolian goats, similar to our results.

Many studies reported lineage A as an old lineage, widely distributed in Asian, European and African goat breeds (Pereira et al., 2005; Royo et al., 2009; Vacca et al., 2010). Recently, investigations of domestic goats in Brazil (Silva et al., 2019) and Arabia (Al-Araimi et al., 2017) reported that most belonged to maternal lineage A. More than 90% of the world’s goats were identified as belonging to lineage A (Wang et al., 2015; Deng et al., 2018; Ganbold et al., 2020; Nguluma et al., 2021). Maternal lineage B showed limited distribution and was only found on the Asian continent (southern and eastern areas), and in South Africa, while other lineages (C, G, F and D) were recorded in Southern Europe, Southwest Asia, Northern Africa and Italy, respectively (Pakpahan et al., 2016; Nguluma et al., 2021).

Further research is required to determine the relationship and position of Ninh Thuan local goats against other Vietnamese goat breeds and goats of Asian origin.

CONCLUSIONS AND RECOMENDATIONS

We, for the first time, report on mtDNA genetic variation of local goats in Ninh Thuan Province, Vietnam. The D-loop mtDNA diversity within the two local goat breeds was low, indicating a close genetic relationship with Indochina goats (Laos), separated into a sub-lineage from maternal lineage B. Further insights regarding the genetic diversity of Vietnamese local goats require further detailed in-depth studies.

acknowledgements

The authors offer their sincere appreciation for owner’s goat farms at Ninh Thuan province and An Phu Dairy Cattle Company in Ho Chi Minh City for donating the goat samples for this research.

CONFLICT OF INTERESTS

No conflicting interests were declared by the authors regarding any financial sources or materials discussed in this manuscript.

novelty statement

To our knowledge, this is the first study in Vietnam to report the genetic diversity of native goats in Ninh Thuan province based on mtDNA D-loop, and we strongly believe that our study will contribute to the scientific literatures on molecular genetic of Vietnamese native goat genetic resources and to provide as a useful database to develop the native goats conservation and development strategy.

authors contribution

All authors generally contributed to design the experimental works, read and approved the manuscript in each step.

NGUYEN, N.T: covered all the research, writing the manuscript. TRAM, M.T. and PHAM, T.T. contributed the work equally on DNA extraction, design primer and amplification of target gene. LE, T.L. and NGUYEN, T.K.L. contributed the work equally on sequence analysis. HOANG, T.T. and PHAM, C.T. shared the work equally for sample collection. DUONG, N.T. contributed to evaluate the manuscript and check the plagiarism as well as revised the manuscript.

REFERENCES

Al-Araimi NA, Al-Atiyat RM, Gaafar OM, Vasconcelosa R, Luzuriaga-Neiraa A, Eisae MO, Amirf N, Benaissag MH, Alfarish AA, Aljumaahi RS, Elnakhlaj SM, Salemk MIM, Ishagl IA, Khasmim ME, Beja-Pereira A (2017). Maternal genetic diversity and phylogeography of native Arabian goats. Livest. Sci., 206:88-94. https://doi.org/10.1016/j.livsci.2017.09.017

Babar ME, Hussain T, Imran M, Nagarajan M, Kumar S (2011). Mitochondrial DNA diversity patterns in Pakistani buffalo. Anim.. Genet., 43:315–317. https://doi.org/10.1111/j.1365-2052.2011.02250.x

Barker JSF, Moore SS, Hetzel DJS, Evans D, Tan SG, Byrne K (1997). Genetic diversity of Asian water buffalo (Bubalus bubalis): Microsatellite variation and a comparison with protein coding loci. Anim. Genet., 28:103-115. https://doi.org/10.1111/j.1365-2052.1997.00085.x

Beja-Pereira A, Caramelli D, Lalueza-Fox C, Vernesif C, Ferranda N, Casolih A, Goyachei F, Royoi L, Contid S, Larid M, et al. (2006). The origin of European cattle: evidence from modern and ancient DNA. Proc. Natl. Acad. Sci., 103:8113-8118. https://doi.org/10.1073/pnas.0509210103

Chen SY, Su YH, Wu SF, Sha T, Zhang YP (2005). Mitochondrial diversity and phylogeographic structure of Chinese domestic goats. Mol. Phylogenet. Evol., 37(3): 804-814. https://doi.org/10.1016/j.ympev.2005.06.014

Deng J, Feng J, Li L, Zhong T, Wang L, Gou J, Ba G (2018). Polymorphism, differentiation and phylogeny of 10 Tibetan goat populations inferred from mitochondrial D-loop sequences. Mitochodriaal DNA Part A Mapp Seq. Anal. 29(3):439-445. https://doi.org/10.1080/24701394.2017.1303491

Febriana A, Sutopo S, Kurnianto E, Widiyanto W (2021). Phylogenetic study and association between prominent genotype and haplotype of KISS1 gene with FSH level in Indonesian native goat breeds. J. Indonesian Trop. Anim. Agric., 46(4):282-294. https://doi.org/10.14710/jitaa.46.4.282-294

Ganbold O, Lee SH, Paek WK, Munkhbayar M, Seo DW, Manjula P, Khujuu T, Purevee E, Lee JH (2020). Mitochondrial DNA variation and phylogeography of native Mongolian goats. Asian-Austral. J. Anim. Sci., 33(6): 902-912. https://doi.org/10.5713/ajas.19.0396

Guo JL, Du X, Ma YH, Guan WJ, Li HB, Zhao QJ, Li X, Rao SQ (2005). A novel maternal lineage revealed in sheep (Ovis aries). Anim. Genet., 36(4): 331-336. https://doi.org/10.1111/j.1365-2052.2005.01310.x

Joshi MB, Rout PK, Mandal AK, Tyler-Smith C, Singh L, Thangaraj K (2004). Phylogeography and origin of Indian domestic goats. Mol. Biol. Evol., 21:454–462. https://doi.org/10.1093/molbev/msh038

Kamalakkannan R, Jose J, Thomas S, Prabhu VR, Nagarajan M (2018). Genetic diversity and maternal lineages of South Indian goats. Molecul. Biol. Rep. (https://doi.org/10.1007/s11033-018-4322-5) https://doi.org/10.1007/s11033-018-4322-5

Kierstein G, Vallinoto M, Silva A, Schneider MP, Iannuzzi L, Brenig B (2004). Analysis of mitochondrial D-loop region casts new light on domestic water buffalo (Bubalus bubalis) phylogeny. Mol. Phylogenet. Evol., 30(2): 308-324. https://doi.org/10.1016/S1055-7903(03)00221-5

Lai SJ, Liu YP, Liu YX, Li XW, Yao YG (2006). Genetic diversity and origin of Chinese cattle revealed by mtDNA D-loop sequences variation. Mol. Phylogenet. Evol., 38(1): 146-154. https://doi.org/10.1016/j.ympev.2005.06.013

Lau CH, Drinkwater RD, Yusoff K, Tan SG, Hetzel DJS, Barker JS (1998). Genetic diversity of Asian water buffalo (Bubalus bubalis): Mitochondrial DNA D-loop and cytochrome b sequence variation. Anim. Genet., 29:253-64. https://doi.org/10.1046/j.1365-2052.1998.00309.x

Le TT, Dinh VB, Nguyen TB, Luu QM, Tran TTT, Nguyen DT, Nguyen VB, Han JL, Periasamye K (2017). Evaluation of genetic diversity and structure of Vietnamese goat populations using multi locus microsatellite markers. Small Rumin. Res., 148: 43-50. https://doi.org/10.1016/j.smallrumres.2016.12.029

Lei CZ, Zhang W, Chen H, Lu F, Ge QL, Liu RY, Dang RH, Yao YY, Yao LB, Lu ZF, Zhao ZL (2007). Two maternal lineages revealed by mitochondrial DNA D-loop sequences in Chinese native water buffaloes (Bubalus bubalis). Asian-Aust. J. Anim. Sci., 20(4): 471-476. https://doi.org/10.5713/ajas.2007.471

Liu ZG, Lei CZ, Luo J, Ding C, Chen GH, Chan H, Wang KH, Liu XX, Zhang XY, Xiao XJ, Wu SL (2004). Genetic variability of mtDNA sequences in Chinese native chicken breeds. Asian-Austral. J. Anim., 17(7): 903-909. https://doi.org/10.5713/ajas.2004.903

Luikart G, Gielly L, Excoffier L, Vigne JD, Bouvet J, Taberlet P (2001). Multiple maternal origins and weak phylogeographic structure in domestic goats. Proc. Natl. Acad. Sci., 98: 5927-5932. https://doi.org/10.1073/pnas.091591198

Ly FH, Peng WF, Yang J, Zhao YX, Li WR, Liu MJ, Ma YH, Zhao QJ, Yang GL, Wang F, et al. (2015). Mitogenomic meta-analysis identifies two phases of migration in the history of Eastern Eurasian sheep. Mol. Biol. Evol., 32:2515-2533.   https://doi.org/10.1093/molbev/msv139

Mannen H, Nagata Y, Tsuji S (2001). Mitochondrial DNA reveal that domestic goat (Capra hircus) are genetically affected by two subspecies of bezoar (Capra aegagurus). Biochem. Genet., 39:145-154.

Martin-Burriel I, Garcia-Muro E, Zaragoza P (1999). Genetic diversity analysis of six Spanish native cattle breeds using micro-satellites. Anim. Genet. 30(3): 177-182. https://doi.org/10.1046/j.1365-2052.1999.00437.x

Naderi S, Rezaei HR, Taberlet P, Zundel S, Rafat SA, Naghash HR, ElBarody MAA, Ertugrul O, Pompanon F (2007). Large-scale mitochondrial DNA analysis of the domestic goat reveals six haplogroups with high diversity. PLoS One, 2:p.e1012. https://doi.org/10.1371/journal.pone.0001012

Nguluma A, Kyallo M, Tarekegn GM, Rose Loina R, Nziku Z, Chenyambuga S, Pelle R (2021). Mitochondrial DNA D-loop sequence analysis reveals high variation and multiple maternal origins of indigenous Tanzanian goat populations. Ecol. Evol., 11:15961-15971. https://doi.org/10.1002/ece3.8265

Pakpahan S, Artama WT, Widayanti R, Gede Suparta I (2016). Genetic characteristics and relationship in different goat populations of Indonesia based on cytochrome B gene sequences. Asian J. Anim. Sci., 10:29-38. https://doi.org/10.3923/ajas.2016.29.38

Pereira F, Pereira L, Van Asch B, Bradley DG, Amorim A (2005). The mtDNA catalogue of all Portuguese autochthonous goat (Capra hircus) breeds: high diversity of female lineages at the Western fringe of European distribution. Mol. Ecol., 14:2313-2318.

Raungprim T, Sarataphan N, Majarune S, Rattanatabtimtong S, Yungrahang S, Maitreejet W (2021). Comparison of morphological characteristics and maternal genetic lineages in Thai dwarf and swamp buffaloes (Bubalus b. carabanensis), Buffalo Bulletin., 40(1):57-70. https://doi.org/10.1111/j.1365-294X.2005.02594.x

Rocha J, Chen SY, Beja-Pereira A (2011). Molecular evidence for fat-tailed sheep domestication. Trop. Anim. Health Prod, 43:1237–1243. https://doi.org/10.1007/s11250-011-9854-9

Royo LJ, Traore A, Tamboura HH, Alvarez I, Kabore A, Fernandez I, Ouedraogo-Sanou G, Toguyeni A, Sawadogo L, Goyache F (2009). Analysis of mitochondrial DNA diversity in Burkina Faso populations confirms the maternal genetic homogeneity of the West African goat. Anim. Genet., 40:344-347. https://doi.org/10.1111/j.1365-2052.2008.01828.x

Sardina MT, Ballester M, Marmi J, Finocchiaro R, Van Kaam JB, Portolano B, Folch JM (2006) Phylogenetic analysis of Sicilian goats reveals a new mtDNA lineage. Anim. Genet., 37:376-378. https://doi.org/10.1111/j.1365-2052.2006.01451.x

Sari EM, Abdullah MAN, Koesmara H, Dagong MIA (2021). Phylogenetic analysis of Gayo and Toraya buffalo breed of Indonesian through mitochondrial D-loop region. Earth Environ. Sci., 788 (2021) 012013. https://doi.org/10.1088/1755-1315/788/1/012013

Shaari N, Jaoi-Edward M, Loo SS, Salisi MS, Yusoff R, Ghani AB, Saad MZ, Ahmad H (2019). Karyotypic and mtDNA based characterization of Malaysian water buffalo. BMC Genet., 20(1): 37. https://doi.org/10.1186/s12863-019-0741-0

Silva MNV, Pimenta-Filho EC, Arandas JKG, Medeiros RBN, Cavalcante-Neto A, Fonseca C, Ribeiro MN (2019). Genetic relationship between local Brazilian goat breeds based on mtDNA D-loop region similarity. Spanish J. Agric. Res., 17(4) e0407, 7 pages. https://doi.org/10.5424/sjar/2019174-14682

Suhardi S, Summpunn P, Wuthisuthimethavee S (2021). mtDNA D-loop sequence analysis of Kalang, Krayan, and Thale Noi buffaloes (Bubalus bubalis) in Indonesia and Thailand reveal genetic diversity. J. Indo Trop. Anim. Agric., 46(2): 93-105 https://doi.org/10.14710/jitaa.46.2.93-105.

Sultana S, Mannen H, Tsuji S (2003). Mitochondrial DNA diversity of Pakistani goat. Anim. Genet., 34:417-421. https://doi.org/10.1046/j.0268-9146.2003.01040.x

Teinlek P, Siripattarapravat K, Tirawattanawanich C (2018). Genetic diversity analysis of Thai indigenous chickens based on complete sequences of mitochondrial DNA D-loop region. Asian-Austral. J. Anim. Sci., 31:804-811. https://doi.org/10.5713/ajas.17.0611

Touma S, Shimabukuro H, Arakawa A, Oikawa T (2019). Maternal lineage of Okinawa indigenous Agu pig inferred from mitochondrial DNA control region. Asian-Austral. J. Anim. Sci., 32:501-507. https://doi.org/10.5713/ajas.18.0378

Vacca GM, Daga C, Pazzola M, Carcangiu V, Dettori ML, Cozzi MC (2010). D-loop sequence mitochondrial DNA variability of Sarda goat and other goat breeds and populations reared in the Mediterranean area. J. Anim. Breed Genet., 127:352-360. https://doi.org/10.1111/j.1439-0388.2010.00863.x

Wang GJ, Pi XS, Ji ZB, Qin ZJ, Hou L, Chao TL, Wang JM (2015). Investigation of diversity and origin of Chinese goats via mitochondrial DNA D-loop. J. Anim. Sci. 93:949-955. https://doi.org/10.2527/jas.2014-8420

Youssef NA, Curaudeau M, El Nahas SM, Hassan AAM, Hassanin A (2021). Haplotype diversity in the mitochondrial genome of the Egyptian river buffalo (Bubalus bubalis). Mitochondrial DNA Part B., 6(1): 145-147. https://doi.org/10.1080/23802359.2020.1852622