Research Article

Epidemiological Surveillance for the Newly Classified Newcastle Disease Virus Genotype VII.1.1 in Chicken Flocks in Egypt

Sameh Abdel-Moez Ahmed Amer1*, Mohamed Abdel-Aziz Kutkat1, Mohamed Mahmoud Abdel-Baki1, Asmaa Mahmoud Maatouq1, Omnia Mohamed Kutkat2, Hagar Magdy Ahmed1, Khaled Mohamed El-Bayoumi1

1Department of Poultry Diseases, Veterinary Research Institute, National Research Centre, P.O. Code 12622, Dokki, Cairo, Egypt; 2Centre of scientific excellence for influenza virus, Environmental Research Institute, National Research Centre, P.O. Code 12622, Dokki, Cairo, Egypt.

Received | November 05, 2021; Accepted | December 31, 2021; Published | January 15, 2022

*Correspondence | Sameh Abdel-Moez Amer, Department of Poultry Diseases, Veterinary Research Institute, National Research Centre, P.O. Code 12622, Dokki, Cairo, Egypt; Email: [email protected]

Citation | Amer SA-MA, Kutkat MA-Z, Abdel-Baki MM, Maatouq AM, Kutkat OM, Ahmed HM, El-bayoumi KM (2022). Epidemiological surveillance for the newly classified newcastle disease virus genotype VII.1.1 in chicken flocks in Egypt. Adv. Anim. Vet. Sci. 10(3): 451-458.

DOI | http://dx.doi.org/10.17582/journal.aavs/2022/10.3.451.458

ISSN (Online) | 2307-8316

 

Introduction

Newcastle disease, caused by the Newcastle disease virus is a highly infectious disease affecting poultry and wild birds in the whole world. It has been known as the avian paramyxovirus type 1 (APMV-1) and classified in the family Paramyxoviridae, subfamily Avulavirinae, and genus Metaavulavirus (Seal et al., 2000). The NDV is a non-segmented negative-sense RNA virus which encoding six proteins; nucleoprotein (NP), phosphoprotein (P), matrix (M), fusion (F), hemagglutinin-neuraminidase (HN), and large polymerase (L) of 15,186–15,198 nucleotides (Rima et al., 2019).

Newcastle disease virus virulence is mainly determined by the cleavage site in the F protein, where the cleavage site motif 112R/K-R-Q-R/K-R↓F117 that is cleaved by a variety of proteases is indivative for velogenic and mesogenic strains of NDV resulting in systemic infection. While 112G/E-K/R-Q-G/E-R↓L117 motif is cleaved by specific respiratory and gastrointestinal systems trypsin like proteases only is a specific for lentogenic strains (Morrison, 2003).

Based on nucleotides sequence, about six distinct lineages of NDV have been identified by (Aldous et al., 2003). While in more traditional classification based on the completed F-gene sequence by Czegledi et al. (2006), NDV was divided into two groups class I and class II within a single serotype. In addition, two major divisions represented as class I and class II was demonstrated by Kim et al. (2007a and b), that Class I strains are a virulent in chickens and recently have been divided further into nine genotypes (1-9) based on a 374 base-pair portion of the F gene. Whereas class II viruses, are further divided into 16 genotypes isolated from wild bird and domestic poultry species (Abolnik et al., 2004). In which genotype VII among class II NDVs is one of the most worldwide prevalent genotypes causing severe outbreaks in recent years in Europe, Africa, the Middle East, South America and Asia (Zhang et al., 2010).

Daubney and Mansy (1948) were considered the first who diagnosed NDV in Egypt as early as 1948 by. Presently and according to Rohaim et al. (2016) and Sabra et al. (2017), NDV genotypes II, VI and VII are the common genotypes circulating in Egypt, in which genotype II viruses are mainly of vaccine type and virulent genotype VI was isolated mainly from infected pigeons and clustered as pigeon paramyxovirus. While, NDV sub-genotype VIId was considered as the predominant strain, that has led to several outbreaks in poultry since it was firstly isolated in Egypt in 2012 (Radwan et al., 2013). Since that time and in spite of intensive vaccination strategies with both live and killed NDV genotype II vaccines, high mortality rates are observed in most of chicken farms in Egypt (Orabi et al., 2017; Saad et al., 2017; Amer et al., 2019).

Dimitrov et al. (2019) have updated a recent nomenclature and classification of NDVs, that class I isolates are clustered in a single genotype with three sub-genotypes (1.1.1, 1.1.2 and 1.2). While class II viruses and due to their high genetic diversity, are clustered into 20 genotypes (I to XXI). In which NDV VII genotype, was sub-divided into sub-genotypes VII.1.1 and VII.1.2. Whereas the former sub-genotypes; VIIb, VIId, VIIe, VIIj, and VIIl, were all classified as sub genotype VII.1.1. While the sub-genotype VII.1.2, only comprises the former sub-genotype VIIf. Finally, formerly sub-genotypes VIIa, VIIh, VIIi, and VIIk were merged all into a separate single sub-genotype, namely VII.2 which considered being responsible for the Asia, Europe, the Middle East and Africa NDV outbreaks (Miller et al., 2015; Abolnik et al., 2018).

Newcastle disease viruses prevalence and genotypic diversity still a challenge for disease control that, ND outbreaks have still occurred annually worldwide with severe economic losses and elevated annual use of ND vaccines in spite of application of an intensive vaccination programs, have raised questions about the antigenic variation of the conventional classic vaccines efficacy against the field NDVs (Cho et al., 2008; Hu et al., 2011; Absalon et al., 2019). So as to, recent studies were investigated the role of either live or killed NDV vaccines designed based on the phylogenetic matching to field virus that can provide better protection in periodical NDV outbreaks (Yang et al., 2016; Kim et al., 2017; Amer et al., 2019). Therefore, the goal of this study was, to identify the most predominant circulated NDV genotypes and sub-genotypes suggested to be responsible for the current NDV outbreak in Egyptian poultry farms.

Materials and methods

Ethics statement

The animal handling and swabs sampling were carried out by specialized veterinarians to ensure birds welfare in accordance with the relevant policies regarding animal care and handling, that was approved with a registration no; 19312 by the Medical Research Ethical Committee (MREC) at the National Research Centre, Dokki, Cairo, Egypt.

Sample collection and preparation

A total collected number of 550 tracheal and cloacal swabs from commercial broilers, commercial layers and native breeds were pooled into 100 samples, which were obtained from five different Egyptian governorates (El-Behera, Alexandria, Menoufia, Kafr El-Sheikh and Giza) during an active surveillance programme in 2020 and 2021. Samples were collected under a septic condition from freshly dead and sick birds. The collected samples were placed in transport media supplied with 1% antibiotic-antimycotic mixture and stored at (-80C) for further isolation and identification of NDV.

Virus propagation in embryonated chicken eggs (ECE)

Each sample was processed in 200 μL phosphate-buffered saline containing 1% antibiotic-antimycotic mixture. Only 100 μL of each sample was inoculated through allantoic sac route of inoculation into 9-11 days-old ECE (3 eggs/ sample) (Alexander, 2009). The eggs were incubated at 37ºC and candled once daily for seven days. Any embryo mortality during the first 24 hours of incubation was discarded and considered as non-specific death. All died or survived embryos till day 7 post-inoculation were chilled over night at 4ºC. The allantoic fluid was a septically aspirated and stored at -80ºC in sterile screw-capped vials.

Haemagglutination test (HA)

The collected allantoic fluid was tested by slide HA test according to the procedures of the (OIE, 2012). ND LaSota vaccinal strain was used with 4 HAU as a reference control positive HA antigen in slide HA tests of ND (intervet international, B.V. Boxmeer, Holland, supplied by local agency).

Molecular identification by RT-PCR

The genomic RNA was extracted from allantoic fluid using QIAamp viral RNA mini kit (Qiagen™, USA) as recommended by manufacturer. One step RT-PCR method was carried out using specific primer to amplify the full-length F gene as discussed by Wulanjati et al. (2018).

• • Forward primer (28 bp): 5’GTCAGATCTTGATGGGCTCCAA ACCTTC 3’
• • Reverse primer (28 bp): 5’ATGAATTCTCACGCTCTTGTGGT GGCTC 3’

The thermal cycle program of RT-PCR was started by reverse transcription at 50oC for 60 min, initial denaturation at 94°C for 15min, followed by 40 cycles of; denaturation at 94°C for 20 sec, annealing at 57°C for 30 sec and elongation at 68°C for 3 min. Final elongation was done at 68°C for 7 min. The RT-PCR product was then screened by 1.5% agarose gel electrophoresis.

Sequencing and phylogenetic analysis

The targeted DNA Bands for six representative samples were excised from the gel, and were purified with QIAquick® PCR gel purification kits (QIAGEN, Valencia, CA, USA) as per manufacturer’s guidelines. The purified DNA of the selected samples was sequenced using the Sanger dideoxy sequencing method and the nucleotide sequences were then registered in Genbank (http://www.ncbi.nlm.nih.gov/Genbank) with accession numbers (Table 1).

All finely adjusted full F- gene sequences were blasted and aligned using DNASTAR® Lasergene software alignment tools and exported as Lasergene DNA files that was used as a base for phylogenetic analysis using Maximum likelihood method with various NDV genotypes that were obtained from Genbank.

Results and Discussion

Characteristics of NDV outbreaks

Swabs were collected from commercial broilers, commercial layers and native breeds poultry flocks either dead or suspected clinically to be infected with ND. The investigated flocks were showing increased mortalities in the last days before sample collection, layer flocks were suffering from a sudden drop in egg production with the production of abnormal eggs. Whereas, most of broiler and native breeds flocks were showing increased mortalities, decrease in the food consumption, abnormal respiratory sounds and low percent of the flocks were showing nervous signs.

Most of broiler farms were double vaccinated with only live NDV vaccines as LaSota and Hitchner B1. While commercial layer flocks were heavily vaccinated with at least double shots of both live and killed NDV vaccines of either genotype II or VII. Whereas, native breed farms are of the little vaccination attempts with or without vaccination regimes.

Postmortem examination of the investigated flocks showed different lesions of septicemic carcasses, petechial and hemorrhagic spots on the proventricular glands tips, greenish discoloration of the intestinal tract contents and hemorrhagic ulcers in the caecal tonsils, in addition to the non-specific respiratory lesions as nasal discharges, tracheitis and pneumonia.

Virus propagation in ECE and HA test

Samples were inoculated in one blind passage in 9-11 days-old ECE allantoic sac, whereas embryo mortalities were found in 88 samples between 48 to 96 hours post inoculation, as well as revealed pathological lesions of dead embryo include congestion of the entire embryo, edema of the head and petechial hemorrhages on the skin. Furthermore, the slide HA test was carried out for all samples after the blind passage in ECE revealing in which, 75 samples of them were HA positive, however HA negative samples were passaged twice in ECE before recorded as negative.

F protein conventional RT-PCR

Out of 75 HA positive samples were amplified with F protein specific primers, 62 samples were NDV positive showing 1681 bp single specific band (Figure 1).

Sequencing and phylogenetic analysis

Altogether, out of sixty the two positive NDV isolates by RT-PCR which resulted in 1681 bp F-gene amplicons, six isolates were subjected to nucleotide sequencing by Sanger method as representative sequences to five different Egyptian governorates (El-Behera, Alexandria, Menoufia, Kafr El-sheikh and Giza) and the resulted sequences were submitted and registered to Genbank (Table 1).

The prediction of the NDV pathotypes based on the deduced amino acid sequence of the F-gene cleavage site (112 to 117) showed that, the six selected isolates have sequence motif RRQKRF indicative for virulent NDV strains (Table 1 and Figure 2).

 

Table 1: Characteristics of the obtained Egyptian NDV isolates sub genotype VII.1.1 of the current study.

Isolate name	Accession number	Locus	Cleavage site motive of F- protein	Genotype	Host	Isolation year	Province
NDV-CH-EGY-BH-NRC-2021	MW590307	F- gene	112RRQKRF117	VII.1.1	Broilers	2021	El-Behera
NDV-CH-EGY-BEH- NRC-2021	MW603769	F- gene	112RRQKRF117	VII.1.1	Broilers	2021	El-Behera
NDV-CH-EGY-ALEX-NRC-2021	MW591503	F- gene	112RRQKRF117	VII.1.1	Broilers	2021	Alexandria
NDV-CH-EGY-MENOUFIA-VVT NRC-2021	MW603770	F- gene	112RRQKRF117	VII.1.1	Layers	2021	El-Menoufia
NDV-CH-EGY-KSH-VVTNRC-2021	MW603771	F- gene	112RRQKRF117	VII.1.1	Native breeds	2021	Kafr El-sheikh
NDV-CH-EGY-GIZA-VVTNRC-2021	MW603772	F- gene	112RRQKRF117	VII.1.1	Layers	2021	Giza

RRQKRF: R (Arginin), Q (Glutamine), K (Lysine) and F (Phenyl-alanine) amino acids.

 

The phylogenetic relationship analysis using full F-gene sequences was carried out by maximum likehood method revealing that, all study sequences were clustered together within class II NDV genotype VII, sub-genotype VII.1.1 strains as recently mentioned by (Dimitrov et al., 2019). Moreover, our isolates were found closely related to other NDV egyptian sub-genotype VII.1.1 (formerly GVIId), as well as genotype VII isolates from neighboring and regional countries like Turkey, Israel, Sudan and Mauritania in parallel with other worldwide genotype VII isolates from China, Taiwan, Ivory coast and Cameroon revealing the panzootic NDV genotype VII circulation all over the world (Figure 3).

 

Furthermore, Amino acid identity percent of our isolates with each other found ranged from 98.5%-99.6%. In addition, the study isolates were highly related to previously isolated and registered Egyptian NDV GVII.1.1 as Chicken-Egypt-D3538-2016, Chicken-Egypt-Luxor-2012 and NDV-Chicken-Egy-Menoufia-NRC-2019 with amino acid identity percent from 98.1% to 99.7%. While, identity percent of our isolates with different NDV vaccinal strains like LaSota, Hitchner- B1, clone -30, Connecticut and Komarov were found of high divergence and low similarity ranged from 63.2% to 80.3% (Table 2).

 

 Isolates of the study.

 

Newcastle Disease virus is considered one of the most infectious diseases and a global threat to poultry and other bird all over the world. Velogenic strains of ND especially genotype VII viruses had been associated with the most current worldwide outbreaks in Africa (Abolnik et al., 2018; Twabela et al., 2021), the Middle East (El-Naggar et al., 2018; Abd El-Fatah et al., 2021; Naguib et al., 2021), Asia (Rui et al., 2010; Zhang et al., 2011), Europe (Dimitrov et al., 2016; Fuller et al., 2018) and South America (Perozo et al., 2012; Absalon et al., 2019). NDV genotype VII was firstly isolated and identified in Egypt through an active surveillance from recent outbreaks affecting poultry farms between 2011 and 2012 by Radwan et al. (2013) and reported as velogenic NDV clustered in class II genotype VII which found closely related to other middle east isolates. Since that time, trials for isolation of VNDV genotype VII was successfully carried out by (Hussein et al., 2014; Abdel Aziz et al., 2016; Hagar et al., 2017; Naguib et al., 2021).

This study was dedicated mainly to investigate the epidemiology of NDV and characterization of NDV strains isolated from potential outbreaks in five Egyptian governorates in a period from 2020 to 2021. The epidemiological investigation of ND in this study was closely similar and related to those reported for NDV infection, 100 pooled samples were collected from broiler, commercial layer and native breed flocks in five different Egyptian governorates (El-Behera, Alexandria, Menoufia, Kafr El-Sheikh and Giza). The investigated flocks were showing increased mortalities in the last days before sample collection layer flocks were suffering from a sudden significant drop in egg production with the production abnormal eggs. Most broiler flocks were showing increased mortalities, decrease in the food consumption and abnormal respiratory sounds with the presence of greenish diarrhea and low percent of the flocks were showing nervous signs. While, postmortem examination of the investigated flocks were showing septicemic carcasses, petechial hemorrhagic spots on the tips of the proventricular glands, greenish coloration of the intestinal tract contents and hemorrhages with ulcerations in the caecal tonsils, in addition to the non-specific respiratory lesions as; nasal discharges, tracheitis and pneumonia as mentioned in previous studies by (Alexander and Senne, 2008; Alexander, 2009; Terregino and Capua, 2009; Han et al., 2017).

The propagation in ECE 9-11 days old remains the technique of choice as a confirmatory method for virulent NDV isolation than other techniques (OIE, 2012). In a trial for isolation of NDV, one blind passage was performed to 100 samples in 9-11 days old ECE allantoic sac, whereas embryo mortalities were found in 88 samples between 48 to 96 hours post inoculation, as well as revealed pathological lesions of dead embryo include; congestion of the entire embryo, edema of the head and petechial hemorrhages on the skin as previously detected by Pedersen (2011).The replication and existence of NDV in the harvested allantoic fluid was tested by haemagglutination via rapid slide HA test as NDV induces HA activity in consistent with the results reported by Terregino and Capua (2009); OIE (2012). Whereas, our results for slide HA test were showing 75 HA positive samples.

Polymerase chain reaction-based assays for NDV always have many benefits for identification of the virus and also play an important role in discrimination between the virus genotypes, as well as can be used in assessment of the NDV pathogenicty and virulence (Aldous et al., 2003). In the present work, conventional RT-PCR amplified 1681bp F-gene in 62 samples from out of 100 samples of tracheal and cloacal swabs pool. In this context, NDV was easily screened via RT-PCR in 3.6% of tested tracheal and cloacal samples in Egypt by (El-Naggar et al., 2018), while in contrary Schelling et al. (1999) failed to amplify the NDV RNA extracted from cloacal swabs of 115 different wild bird species using RT-PCR.

Mostly, amino acid sequences in the cleavage site of F-gene can predict the NDVs pathotypes and can be used instead of traditional methods such as intracerebral pathogenicty index test (ICPI) and mean death time (MDT) (Panda et al., 2004). Fusion protein has a prominent role in the virulence of NDV and could provide a specific protective immunity in birds against NDV (Kim et al., 2013), that can be used in the development of genotype-matched vaccines to the currently epidemic viruses to overcome the repeated ND outbreaks, as previously mentioned by (Amer et al., 2019). In this regard, Panda et al. (2004) and Dharmayanti et al. (2014) reported that, velogenic NDV strains have a motif 112RRQKRF117 with phenylalanine (F) at residue 117 of the F1 protein. Meanwhile, the low virulent strains comprise a motif 112GRQGRL117 in the same region with leucine (L) at the same position. In this regard and in agreement with our results, the six isolates of present study have multibasic amino acids sequence on cleavage site 112RRQKRF117 descriptive for velogenic NDV strains when sequenced with Sanger method.

In retrospect Miller et al. (2015) discussed that, genotype VII viruses were mostly generated from the Far East in the 1980s and then spread to other regions in Asia, Europe, Africa and even South America in the 1990s. Currently, genotype VII viruses are the most prevalent in ND outbreaks in Middle East (Naguib et al., 2021). In the present study, the phylogenetic relationship in accordance with the new classification system proposed by Dimitrov et al. (2019) revealed that, the six isolates were in a closely similarity to each other and related to sub-genotype VII.1.1 within genotype VII in class II NDVs which already registered in Egypt, neighboring countries and even geographically close countries.

In accordance with deduced amino acid identity, our study validates that the six isolates were highly related to the previously isolated Egyptian velogenic NDVs genotype VII.1.1 as Chicken-Egypt-D3538-2016, Chicken-Egypt-Luxor-2012 and NDV-Chicken-Egy-Menoufia-NRC-2019 with amino acid identity percent ranged from 98.1% to 99.7% as in agreement with previously referenced public genotype VII.1.1 in Egypt (Abd El-Fatah et al., 2021; Naguib et al., 2021). Otherwise, F-gene amino acid sequence identity of our isolates against LaSota and B1 vaccine strains revealed higher values of divergence in compared with the values between samples and other genotype VII isolates (Table 2) as in agreement with a previous study of Xiao et al. (2012) when conducted a symmetric analysis based on sequence identity of F protein for 8 virulent ND viruses isolated from Indonesia during 2009 and 2010 outbreaks that was also found higher than the sequence identity value of 8 NDVs against B1 and LaSota vaccine strains.

Conclusions and Recommendations

This study provides precious informations on the epidemiological situation and the prevalence of NDV strains in Egypt, so as to continuous monitoring of NDV in Egyptian poultry field is essential for the evaluation of these viruses’ genetic traits. In addition, NDV genotype VII.1.1 may probably be the predominant circulated sub-genotype in Egypt. Therefore, it is recommended to be applied as a candidate vaccine strain homologous to field virus to control the future outbreaks of genotype VII virus in Egypt.

Acknowledgments

The authors thank the laboratory of Veterinary Vaccines Technology (VVT), Central Labs, National Research Centre, Dokki, Cairo, Egypt for all kind of supports.

This work is mainly dedicated to the soul of Professor. Doctor Mohamed Abdel-Aziz Kutkat may Allah almighty rest and bless him.

Novelty Statement

Our study is considered one of the first trials in middle-east to isolate and characterize the newly classified NDV genotype VII 1.1 as the most prevalent strain currently circulated. Also, provides valuable and recent techniques in isolation and identification of the circulated viruses in poultry field.

Author’s Contribution

All authors equally participated in design, experimental procedure, writing, revised, and reviewing the manuscript.

Consent to publish

The authors grant the publisher the sole and exclusive license of the full copyright in the contribution. Consequently, the publisher shall have the exclusive right throughout the world to publish and sell the contribution in all languages and all other forms of electronic publication.

Conflict of interest

The authors have declared no conflict of interest.

References

Abd El Aziz MN, Abd El-Hamid HS, Ellkany HF, Nasef SA, Nasr Sh M, El-Bestawy AR (2016). Biological and molecular characterization of newcastle disease virus circulating in chicken flocks Egypt during 2014-2015. Zagazig Vet. J., 44(1): 9-20. https://doi.org/10.21608/zvjz.2016.7827

Abd Elfatah KS, Elabasy MA, El-khyate F, Elmahallawy EK, Mosad SM, El-Gohary FA, Abdo W, Al-Brakati A, Seadawy MG, Tahoon AE (2021). Molecular characterization of velogenic newcastle disease virus (Sub-Genotype VII.1.1) from wild birds with assessment of its pathogenicity in susceptible chickens. Animals, 11(2): 505. https://doi.org/10.3390/ani11020505

Abolnik C, Horner RF, Bisschop SP, Parker ME, Romito M, Viljoen GJ (2004). A phylogenetic study of South African Newcastle disease virus strains isolated between 1990 and 2002 suggests epidemiological origins in the Far East. Arch. Virol., 149(3): 603-619. https://doi.org/10.1007/s00705-003-0218-2

Abolnik C, Mubamba C, Wandrag DBR, Horner R, Gummow B, Dautu G, Bisschop, SPR (2018). Tracing the origins of genotype VIIh Newcastle disease in southern Africa. Transbound. Emerg. Dis., 65: 393–403. https://doi.org/10.1111/tbed.12771

Absalón AE, Cortés-Espinosa DV, Lucio E, Miller PJ, Afonso CL (2019). Epidemiology, control, and prevention of Newcastle disease in endemic regions: Latin America. Trop. Anim. Health Prod., 51: 1033–1048. https://doi.org/10.1007/s11250-019-01843-z

Aldous EW, Mynn JK, Banks J, Alexander DJ (2003). A molecular epidemiological study of avian paramyxovirus type 1 (Newcastle disease virus) isolates by phylogenetic analysis of a partial nucleotide sequence of the fusion protein gene. Avian Pathol., 32(3): 239-256. https://doi.org/10.1080/030794503100009783

Alexander DJ (2009). Ecology and epidemiology of Newcastle disease, In: Capua I and Alexander DJ (Eds), Avian Influenza and Newcastle Disease, Springer-Verlag Italia, pp. 19-26. https://doi.org/10.1007/978-88-470-0826-7_2

Alexander DJ and Senne, DA (2008). Newcastle disease and other avian paramyxoviruses. In: A laboratory manual for the isolation, identification and characterization of avian pathogens, Dufour-zavala L. (Editor in Chief) Swayne DE, Glisson JR, Jackwood MW, Pearson JE, Reed WM, Woolcock PR, 4th ed, Ameri, Ass. Of Avian Pathologists, Athens, GA, pp. 135–141.

Amer SAM, Ali MA, Kandeil AM, Kutkat MA (2019). Advancement in vaccination of broiler chickens with genotype-matched vaccines to currently epidemic Newcastle disease virus genotype VII in Egypt. J. World Poult. Res., 9(3): 117-123. https://doi.org/10.36380/jwpr.2019.14

Cho SH, Kwon HJ, Kim TE, Kim JH, Yoo HS, Park MH, Park YH, Kim SJ (2008). Characterization of a recombinant Newcastle disease vaccine strain. Clin. Vaccine Immunol., 15(10): 1572–1579. https://doi.org/10.1128/CVI.00156-08

Czegledi A, Ujvari D, Somogyi E, Wehmann E, Werner O, Lomniczi B (2006). Third genome size category of avian paramyxovirus serotype 1 (Newcastle disease virus) and evolutionary implications. Virus Res., 120(1–2), 36-48. https://doi.org/10.1016/j.virusres.2005.11.009

Daubney R, Mansy W (1948). The occurrence of Newcastle disease in Egypt. J. Comp. Pathol. Therapeut., 58: 189–200. https://doi.org/10.1016/S0368-1742(48)80019-6

Dharmayanti I, Hartawan R, Hewajuli DA, Indriani R (2014). Phylogenetic analysis of genotype VII of Newcastle disease virus in Indonesia. Afr. J. Microbiol. Res., 8(13): 1368-1374.

Dimitrov KM, Abolnik C, Afonso CL, Albina E, Bahl J, Berg M, Wong FYK (2019). Updated unified phylogenetic classification system and revised nomenclature for Newcastle disease virus. Infect. Genet. Evol., 74: 103917. https://doi.org/10.5897/AJMR2014.6601

Dimitrov KM, Bolotin V, Muzyka D, Goraichuk IV, Solodiankin O, Gerilovych A, Stegniy B, Goujgoulova GV, Silko NY, Pantin-Jackwood MJ, Miller PJ, Afonso CL (2016). Repeated isolation of virulent Newcastle disease viruses of subgenotype VIId from backyard chickens in Bulgaria and Ukraine between 2002 and 2013. Arch. Virol., 161: 3345–3353. https://doi.org/10.1007/s00705-016-3033-2

El-Naggar RF, Rohaim MA, Bazid A.H, Ahmed KA, Hussein HA, Munir M (2018). Biological characterization of wild-bird-origin avian avulavirus 1 and efficacy of currently applied vaccines against potential infection in commercial poultry. Arch. Virol., 163: 2743–2755. https://doi.org/10.1007/s00705-018-3916-5

Fuller C, Löndt B, Dimitrov K, Lewis N, van Boheemen S, Fouchier R, Coven F, Goujgoulova G, Haddas R, Brown I (2017). An epizootiological report of the re-emergence and spread of a lineage of virulent Newcastle disease virus into Eastern Europe. Transbound. Emerg. Dis., 64: 1001–1007. https://doi.org/10.1111/tbed.12455

Hagar MA, Amer MM, Elbayoumi KhM, Amer SAM, Kutkat MA (2017). Identification and sequencing of genotype VII of Newcastle disease virus from chicken flocks in six Egyptian governorates. Egypt. J. Vet. Sci., 48(1): 31-41. https://doi.org/10.21608/ejvs.2017.1236.1015

Han Q, Gao Z, Wua P, Xiao S, Wang Z, Liu P, Tong L, Hao H, Zhang S, Dang R, Yang Z (2017). Re-evaluation the immune efficacy of Newcastle disease virus vaccine in commercial laying chickens. Res. Vet. Sci., 111: 63–66. https://doi.org/10.1016/j.rvsc.2016.12.004

Hu Z, Hu S, Meng C, Wang X, Zhu J, Liu X (2011). Generation of a genotype VII Newcastle disease virus vaccine candidate with high yield in embryonated chicken eggs. Avian Dis., 55(3): 391–397. https://doi.org/10.1637/9633-122410-Reg.1

Hussein HA, Emara MM, Rohaim MA (2014). Molecular characterization of Newcastle disease virus Genotype VII in Avian influenza H5N1 infected broiler flock in Egypt. Int. J. Virol., 10(1): 46-54. https://doi.org/10.3923/ijv.2014.46.54

Kim LM, King DJ, Curry PE, Suarez DL, Swayne DE, Stallknecht DE, Slemons RD, Pedersen JC, Senne DA, Winker K, Afonso CL (2007b). Phylogenetic diversity among low-virulence Newcastle disease viruses from waterfowl and shorebirds and comparison of genotype distributions to those of poultry-origin isolates. J. Virol., 81: 12641–12653. https://doi.org/10.1128/JVI.00843-07

Kim LM, King DJ, Suarez DL, Wong CW, Afonso CL (2007a). Characterization of class I Newcastle disease virus isolates from Hong Kong live bird markets and detection using real-time reverse transcription-PCR. J. Clin. Microbiol., 45: 1310–1314. https://doi.org/10.1128/JCM.02594-06

Kim SH, Chen Z, Yoshida A, Paldurai A, Xiao S, Samal SK (2017). Evaluation of fusion protein cleavage site sequences of Newcastle disease virus in genotype matched vaccines. PLoS One, 12(3): e0173965. https://doi.org/10.1371/journal.pone.0173965

Kim SH, Wanasen N, Paldurai A, Xiao S, Collins PL, Samal SK (2013). Newcastle disease virus fusion protein is the major contributor to protective immunity of genotype-matched vaccine. PLoS One, 8(8): e74022. https://doi.org/10.1371/journal.pone.0074022

Miller PJ, Haddas R, Simanov L, Lublin A, Rehmani SF, Wajid A, Bibi T, Khan TA, Yaqub T, Setiyaningsih S, Afonso CL (2015). Identification of new subgenotypes of virulent Newcastle disease virus with potential panzootic features. Infect. Genet. Evol., 29: 216–229. https://doi.org/10.1016/j.meegid.2014.10.032

Morrison TG (2003). Structure and function of a paramyxovirus fusion protein. Biochim. Biophys. Acta, 1614: 73–84. https://doi.org/10.1016/S0005-2736(03)00164-0

Naguib MM, Höper D, Elkady MF, Afifi MA, Erfan A, Abozeid HH, Hasan WM, Arafa AS, Shahein M, Beer M, Harder TC, Grund C (2021). Comparison of genomic and antigenic properties of Newcastle Disease virus genotypes II, XXI and VII from Egypt do not point to antigenic drift as selection marker. Transbound. Emerg. Dis., 00: 1–15. https://doi.org/10.1111/tbed.14121

OIE Chapter 2.3.14. (2012). Newcastle disease. In manual of diagnostic tests and vaccines for terrestrial animals (Mammals, Birds and Bees); Biological standards commission World Organization for Animal Health; OIE: Paris, France, 1: 555–573.

Orabi A, Hussein A, Saleh AA, El-Magd MA, Munir, M (2017). Evolutionary insights into the fusion protein of Newcastle disease virus isolated from vaccinated chickens in 2016 in Egypt. Arch. Virol., 162: 3069–3079. https://doi.org/10.1007/s00705-017-3483-1

Panda A, Huang Z, Elankumaran, Rockemann DD, Samal SK (2004). Role of fusion protein cleavage site in the virulence of Newcastle disease virus. Microb. Pathog., 36: 1–10. https://doi.org/10.1016/j.micpath.2003.07.003

Pedersen JC (2011). Isolation of avian influenza and avian paramyxoviruses in chicken embryos from avian species. SOPAV- 1520, National veterinary services Laboratories Testing Protocol, Ames, Iowa, USA.

Perozo F, Marcano R, Afonso CL (2012). Biological and phylogenetic characterization of a genotype VII Newcastle disease virus from Venezuela: Efficacy of field vaccination. J. Clin. Microbiol., 50: 1204–1208. https://doi.org/10.1128/JCM.06506-11

Radwan MM, Darwish SF, El-Sabagh IM, El-Sanousi AA, Shalaby MA (2013). Isolation and molecular characterization of Newcastle disease virus genotypes II and VIId in Egypt between 2011 and 2012. Virus Genes, 47: 311-316. https://doi.org/10.1007/s11262-013-0950-y

Rima B, Balkema-Buschman A, Dundon WG, Duprex P, Easton A, Fouchier R, Kurath G, Lamb R, Lee B, Rota P, Wang L (2019). ICTV Virus Taxonomy Profile: Paramyxoviridae. J. Gen. Virol., 100(12): 1593–1594. https://doi.org/10.1099/jgv.0.001328

Rohaim MA, Helal AM, Hussein HA, LeBlanc N (2016). Genetic characterization of pigeon paramyxovirus Type 1 in Egypt. Br. J. Virol., 3: 27–32. https://doi.org/10.17582/journal.bjv/2016.3.2.27.32

Rui Z, Juan P, Jingliang S, Jixun Z, Xiaoting W, Shouping Z, Xiaojiao L, Guozhong Z (2010). Phylogenetic characterization of Newcastle disease virus isolated in the mainland of China during 2001-2009. Vet. Microbiol., 141: 246-257. https://doi.org/10.1016/j.vetmic.2009.09.020

Saad AM, Samy A, Soliman MA, Arafa A, Zanaty A, Hassan MK, Hussein AH (2017). Genotypic and pathogenic characterization of genotype VII Newcastle disease viruses isolated from commercial farms in Egypt and evaluation of heterologous antibody responses. Arch. Virol., 162: 1985–1994. https://doi.org/10.1007/s00705-017-3336-y

Sabra M, Dimitrov KM, Goraichuk IV, Wajid A, Sharma P, Williams-Coplin D, Afonso CL (2017). Phylogenetic assessment reveals continuous evolution and circulation of pigeon-derived virulent avian avulaviruses 1 in Eastern Europe, Asia, and Africa. BMC Vet. Res., 13: 291. https://doi.org/10.1186/s12917-017-1211-4

Schelling E, Thur B, Griot C, Audige L (1999). Epidemiological study of Newcastle disease in backyard poultry and wild bird populations in Switzerland. Avian Pathol., 28: 263–272. https://doi.org/10.1080/03079459994759

Seal BS, King DJ, Sellers HS (2000). The avian response to Newcastle disease virus. Dev. Comp. Immunol., 24(2–3): 257–268. https://doi.org/10.1016/S0145-305X(99)00077-4

Terregino C and Capua I (2009). Conventional diagnosis of Newcastle disease virus infection. In: Avian influenza and Newcastle disease, afield and laboratory manual. Capua, I. and Alexander, D.J. ed., Springer Milan, Milan, Italy, pp. 123–125. https://doi.org/10.1007/978-88-470-0826-7_10

Twabela AT, Nguyen LT, Masumu J, Mpoyo P, Mpiana S, Sumbu J, Okamatsu M, Matsuno K, Isoda N, Zecchin B (2021). A new variant among Newcastle disease viruses isolated in the Democratic Republic of the Congo in 2018 and 2019. Viruses, 13(2): 151. https://doi.org/10.3390/v13020151

Wulanjati M.P, Wijayanti N, Haryanto A (2018). Phylogenetic analysis of newcastle disease virus from Indonesian isolates based on DNA-sequence of fusion protein-encoding gene. Biotechnology, 17: 69-74. https://doi.org/10.3923/biotech.2018.69.74

Xiao S, Nayak B, Samuel A, Paldurai A, Kanabagattebasavarajappa M, Prajitno TY, Bharoto EE, Collins PL, Samal SK (2012). Generation by reverse genetics of an ef-fective, stable, live-attenuated Newcastle disease virus vaccine based on a currently cir-culating, highly virulent Indonesian strain. PLoS One, 7(12): e52751. https://doi.org/10.1371/journal.pone.0052751

Yang H, Zhao J, Xue J, Yang Y, Zhang G (2016). Antigenic variation of LaSota and genotype VII Newcastle disease virus (NDV) and their efficacy against challenge with velogenic NDV. Vaccine, 35: 27–32. https://doi.org/10.1016/j.vaccine.2016.11.048

Zhang R, Pu J, Su JL, Zhao JX, Wang XZ, Zhang SP (2010). Phylogenetic characterization of Newcastle disease virus isolated in the mainland of China during 2001–2009. Vet. Microbiol., 141(3–4): 246-257. https://doi.org/10.1016/j.vetmic.2009.09.020

Zhang S, Wang X, Zhao C, Liu D, Hu Y, Zhao J, Zhang G (2011). Phylogenetic and Pathotypical analysis of two virulent Newcastle disease viruses isolated from domestic ducks in China. PLoS One, 6: e25000. https://doi.org/10.1371/journal.pone.0025000