Research Article

Detection of Streptococcus thoraltensis in Raw Milk with Special Reference to Their Antibiogram

Hams M.A. Mohamed1, Mona A. El-Zamkan2*

1Department of Microbiology, Faculty of Veterinary Medicine, South Valley University, Qena, 83523, Egypt; 2Department of Food Hygiene and Control, Faculty of Veterinary Medicine, South Valley University, Qena,83523, Egypt.

Received | November 11, 2021; Accepted | December 31, 2021; Published | February 15, 2022

*Correspondence | Mona A. El-Zamkan, Department of Food Hygiene and Control (Milk Hygiene), Faculty of Veterinary Medicine, South Valley University, Qena, 83523, Egypt; Email: m_zam@vet.svu.edu.eg

Citation | Mohamed HMA, El-Zamkan MA (2022). Detection of Streptococcus thoraltensis in raw milk with special reference to their antibiogram. Adv. Anim. Vet. Sci. 10(3): 630-638.

DOI | http://dx.doi.org/10.17582/journal.aavs/2022/10.3.630.638

ISSN (Online) | 2307-8316

 

Introduction

Streptococcus is a genus that includes a wide variety of Gram-positive, coccus-shaped, chain-forming, facultative anaerobic and catalase-negative species (Hardie and Whiley, 1997). Now, this genus contains 129 recognised species (Parte et al., 2020), because of better phenotypic and genetic identification techniques.

The genus Streptococcus plays a major role in animal and human medicine due to its zoonotic potential (Renzhammer et al., 2020). The unusual S. thoraltensis organism is a recently identified strain of Streptococci and was first described in 1997, where it was isolated from the intestinal tracts of swine by Devriese et al. (1997), and later from rabbit feces by Borø et al. (2010). It belongs to the large, unusual Streptococcus spp. group of Gram-positive, catalase-negative and esculin-hydrolysing cocci, and do not have defined group antigens (Facklam, 2002). Based on the distances computed by the approximately-maximum-likelihood algorithm, it was found that S. thoraltensis forms a group with S. hyovaginalis, S. halotolerans, and S. pluranimalium in the genus Streptococcus termed the pluranimalium group (Pan et al., 2018).

Streptococcus thoraltensis has been isolated from the nasal and oropharyngeal mucosa of healthy people (Dhotre et al., 2016; Al-Wakeel, 2017; Al-Tamimi et al., 2019), water pools (Alaidarous et al., 2017), and from meat (Araby et al., 2020). It was thought that S. thoraltensis is non-pathogenic in humans, but recently, very little is known about the pathogenic potential of such bacterium to humans. However, the first chorioamnionitis of human infection by S. thoraltensis has been described in 2015 (Vukonich et al., 2015) followed by many case reports of bacteraemia, endocarditis, pneumonia, fever of unknown origin, and abscess (Petridis et al., 2018; Bustami et al., 2019; Wazir et al., 2019; Hai et al., 2020). The increase in human infections case reports could emphasize its impact on the public health. There are few available records about the resistance rates of S. thoraltensis towards commonly applied antibiotics. Therefore, more knowledge about the susceptibility patterns of these bacteria is needed, especially due to the ability of this species to cause diseases in animals and humans.

Biofilm is one of the virulence factors and is considered as an important source of contamination of milk and milk products with spoilage and/or pathogenic microorganisms, and spoilage enzymes (Teh et al., 2014). Protease enzyme; a virulence factor of the bacteria causing endocarditis has the ability to cause unfavourable changes in milk (ICMSF, 1980; Al-Salih et al., 2012). So, this work aims to provide an overview of phenotypic characters, the antimicrobial susceptibility of S. thoraltensis isolates obtained from raw milk and their ability to form biofilms and produce protease enzyme.

Materials and Methods

Ethical approval

Ethical approval was not required for this study.

Isolation and identification

One hundred raw milk samples of large ruminants (cows and buffaloes) and small ruminants (sheep and goats) (50 samples each) were collected from small scale producers, farmers and markets. The samples were examined for the presence of Streptococcus species. The milk samples were cultured on Modified Edwards Medium (Thermo Scientific™, CM0027B) supplemented with sheep blood (5-7% v/v) and incubated at 39°C for 48-72h under microaerophilic conditions (5% CO2) (Borø et al., 2010). The preliminary identification scheme was done according to Borø et al. (2010) and Wyder et al. (2011) as following; bacteriological examination including, Gram’s staining, culturing on blood agar, catalase test, oxidase test, hydrolysis of arginine and esculin, and CAMP reaction. This identification was confirmed by using the Vitek2 system according to a standard procedure using VITEK® 2 GP ID card (BioMérieux).

Antimicrobial susceptibility testing

The antimicrobial susceptibility profile of the isolates was performed using standard disk diffusion method (Oxoid, Thermo Fisher Scientific, Basingstoke, United Kingdom). The test was performed using eight antibiotics belonging to 7 classes including: β-lactams (penicillin-G, 10 μg, oxacillin OX,1 µg), macrolides (erythromycin (Ery, 15 μg)), glycopeptides (vancomycin (Van, 30μg)), phenicols (chloramphenicol (C, 30μg)), and cyclines (tetracycline (TET, 30μg)), Oxazolidinone (Linezolid (LZD, 30µg), lincosamides (Clindamycin, 2 µg). Briefly, each bacterial suspension at a concentration of 105 CFU/mL was inoculated on sheep blood Mueller-Hinton agar plates and incubated under microaerophilic conditions (5% CO2) for 48-72h hours at 39°C. The percentage of susceptibilities was calculated based on Clinical Laboratory Standards Institute (CLSI, 2018).

Biofilm formation

Biofilm assays were implemented as described by Tenke et al. (2006) and Hatt and Rather (2008) in triplicates. S. thoraltensis isolates were incubated in 10 mL of Tryptic Soy Broth (TSB) with 1% glucose for 24 hours at 37°C. Then, 20 µl of each bacterial suspension was transferred to three wells of sterile 96-well polystyrene microtiter plates holding 180 µl of TSB with 1% glucose and 200 µl of uninoculated TSB with 1% glucose broth assigned as a negative control. The microtiter plate was incubated at 39°C for 24 hours. Next, the broth was cautiously withdrawn, and the wells were washed three times with sterile phosphate-buffered saline. Biofilms were then fixed with methanol for 20 minutes, flicked, and air-dried in a flipped position at 50ºC for about 30 minutes. Biofilms were stained with crystal violet (2%) for 15 min. The wells were washed twice with distilled water then dried. The dyed adherent cells were resolubilized in 150 µl of acetic acid (33%) for 30 minutes without shaking at room temp. Finally, a microtiter plate reader was used to estimate the OD of each well at 570 nm. The cut-off value (ODc)= average negative control OD + (3 SD of negative control). Each isolate was characterized as one of the following phenotypes: OD <ODc denoted as non-biofilm producers, ODc< OD < 2ODc denoted as weak biofilm producers 2ODc < OD < 4ODc denoted as moderate biofilm producers and OD > 4ODc denoted as strong biofilm producers.

Detection of antimicrobial resistance and virulence genes

Extraction of bacterial DNA

DNA was extracted from the isolates using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH).

PCR amplification

Four antimicrobial resistant genes (Pbp1A, ermB, vanB2 and optrA), and two biofilm genes (brpA and lmb) were used. The used primer sequences and length of amplified products were detailed in Table 1. Uniplex PCR reaction was performed in a 25- µl mixture reaction that composed of, Emerald Amp Max PCR Master Mix (Takara, Japan) (12.5 µl), 1 µl of each primer (20 pmol concentration), water (4.5 µl) and DNA template (6 µl). An Applied biosystem 2720 thermal cycler was used to accomplish the reaction, then, followed by electrophoresis on agarose gel (1.5%) (Applichem, Germany, GmbH) used to separate the PCR amplicon.

Proteolytic activity on agar plates

Proteolytic activity of the isolates was determined according to Pailin et al. (2001). The Isolates’ suspensions were inoculated as 2 µl spots on the skim milk agar plates and incubated at 35°C for 48 h under microaerophilic condition (5% CO2). Translucent halos around the colonies were indicative for the proteolytic activity.

Results and Discussion

Streptococcus species could be detected in 25% of the examined samples. The phenotypic analysis of our isolates showed general characters of Streptococcus as Gram-positive cocci grouped into chains, negative for catalase, CAMP negative, Voges-Proskauer; hippurate; alkaline phosphatase was weak, hydrolysis of mannitol. These characters are similar between the species of Streptococcus but, there were four suspected isolates that hydrolyzed aragnin, weakly fermentated L-Arabinose with moderate acid production and tolerated 6.5% NaCl in mannitol salt agar, mild alpha hemolysis. These characters differentiate between these four species isolates and other Streptococcus spp., also the growth of these isolates was inhibited completely on bile esculin media and these characters differentiate between the four isolates and Enterococcus spp. So, the Vitek2 system confirmed these four isolates as Streptococcus thoraltensis. Furthermore, two isolates showed strong and moderate ability to form biofilm on microtiter plate and only one isolate showed strong proteolytic activity on skim milk agar (Figure 1). The phenotypic characters including Gram staining and biochemical reactions of the obtained Streptococcus thoraltensis isolates are displayed in Table 2.

Table 1: Primers sequences, target genes, amplicon sizes and cycling conditions.

Target gene	Primers sequences	Amplified segment (bp)	Primary denaturation	Amplification (35 cycles)			Final extension	Reference
				Secondary denaturation	Annealing	Extension
ermB	CATTTAACGACGAAACTGGC	425	94˚C 5 min.	94˚C 30 sec.	51˚C 40 sec.	72˚C 45 sec.	72˚C 10 min.	Schlegelova et al., 2008
	GGAACATCTGTGGTATGGCG
optrA	AGGTGGTCAGCGAACTAA	1395	94˚C 5 min.	94˚C 30 sec.	53˚C 1 min.	72˚C 1 min.	72˚C 12 min.	Wang et al., 2015
	ATCAACTGTTCCCATTCA
vanA	GGGAAAACGACAATTGC	732	94˚C 5 min.	94˚C 30 sec.	50 1min	72˚C 50 sec.	72˚C 7 min	Al-Tamimi et al., 2019
	GTACAATGTGGCCGTTA
	TCCCACTGTTCCATATCGTCA
Pbp1A	AAACAAGGTCGGACTCAACC	430	94˚C 5 min.	94˚C 30 sec.	57˚C 40 sec.	72˚C 45 sec.	72˚C 10 min.	Mosleh et al., 2014
	AGGTGC­TACAAATTGAGAGG
brpA	TGA AGC TAA GTT GAA TGC TGC	534	94˚C 5 min.	94˚C 30 sec.	42˚C 40 sec.	72˚C 45 sec.	72˚C 10 min.	Alves-Barroco et al., 2019
	GAA CCA CCA TCA GAC AAG GT
lmb	AGTCAGCAAACCCCAAACAG	397	94˚C 5 min.	94˚C 30 sec.	50˚C 40 sec.	72˚C 40 sec.	72˚C 10 min.	Kaczorek et al., 2017
	GCTTCCTCACCAGCTAAAACG

Table 2: Phenotypic characters of isolates with comparison to the properties reported for the other previous S. thoraltensis isolates:

Phenotypic characters		Isolates	S. thoraltensis	References
Gram staining and biochemical reaction
Gram staining		4/4	Gram-positive cocci grouped into chains	Facklam, (2002), Borø et al. (2010)
hemolysis on blood agar		4/4	Partial hemolysis(alpha) on blood agar	Devriese et al. (1997), Al-Tamimi et al. (2019)
Growth on mannitol salt agar		4/4	Positive tolerance to 6.5% NaCl	Al-Tamimi et al. (2019)
Catalase activity	-ve	4/4	Negative result	Hardie and Whiley (1997), Wazir et al. (2019)
Aragnin hydrolysis	+ve	4/4	Positive result	Devriese et al. (1997)
L-arabinose	Moderate fermentation and weak acid production	4/4	weak acid production	Devriese et al. (1997)
Hydrolysis of esculin	+ve	4/4	Positive result	Borø et al (2010)
Acidification of lactose	+ve	4/4	Postive result	Wazir et al. (2019)
Voges-Proskauer	Weak +ve	4/4	Positive results	Devriese et al. (1997)
Urease test	-ve	3/4		Borø et al. (2010)
	+ve	1/4		Borø et al. (2010)
Hippurate hydrolysis	W +ve	4/4	positive result	Devriese et al. (1997)
alkaline phosphatase	V	2/4	positive result	Devriese et al. (1997)
	W +ve	2/4
Indol	-ve	4/4	Negative result	Borø et al. (2010)
Biofilm formation
Microtiter plate	Strong	1/4	NR*
	Intermediate	1/4
Proteolytic activity	Translucent halos around the colonies	1/4	NR*

NR: not recorded.

 

The antibiogram of all the isolates showed resistance to B-lactams (penicillin and oxacillin), while, two isolates were resistant to erythromycin, vancomycin. Three isolates showed resistance to linezolid while four isolates showed intermediate resistance to tetracycline, respectively. All the isolates were susceptible to chloramphenicol and clindamycin (Table 3).

Screening of S. thoraltensis isolates for the presence of antimicrobial resistance genes revealed that Streptococcus thoraltensis harbored different antimicrobial genes as, Pbp1A gene encoding resistance for B-lactams drugs, vanA and optrA genes encoding vancomycin and linezolid resistance, respectively. While ermB gene encoding erythromycin resistance could not be detected in the isolates (Figure 2). Also, it was found that lmb gene was detected in one isolate however, brpA gene could not be detected in any isolate (Figure 3). The phenotypic and genotypic characters of the obtained S. thoraltensis isolates are summarized in Figure 4.

Our study describes the presence of Streptococcus thoraltensis in raw milk samples. This was possible by the use Vitek2 system as an identification method that results in a rapid and reliable modern technique to identify veterinary bacteria (Garcia-Garrote et al., 2000; Hernández-Durán et al., 2017). It wasn’t possible to identify the isolates by conventional methods of Streptococci identification due to the absence of precise specificity and accuracy biochemical tests that resulted in species definitions that are often qualified by a number of exceptions; moreover, these organisms grow slowly and may need extra factors for isolation and characterization (Collins et al., 1984; Facklam, 2002). Many studies illustrated the role of Vitek2 system in identifying S. thoraltensis (Dhotre et al., 2014; Petridis et al., 2018; Al-Tamimi et al., 2019).

 

Table 3: Antibiogram of the obtained S. thoraltensis isolates.

Antibiogram	Results	Number of isolates (N/4)
Penicillin	R	4/4
Oxacillin	R	4/4
Vancomycin	R	2/4
	IR	1/4
Erythromycin	R	2/4
	IR	2/4
Tetracycline	IR	4/4
Linezolid	S	1/4
	R	3/4
chloramphenicol	S	4/4
clindamycin	S	4/4

 

World Health Organization stated that Streptococcus infections are still one of the most serious problems facing recent medicine (Krzyściak et al., 2013). Antibiotic therapy is one of the principal choices in the treatment of human and animal infections. Consequently, antibiotic resistance problem has long been the focus of numerous research teams around the world as a source of genes linked to drug resistance in people and animals (Pol and Ruegg, 2007; Thomas et al., 2015). However, the available records about S. thoraltensis resistance to antibiotics are limited. The present study represented the antibiotic susceptibility profile as shown in Table 2. Therefore, knowledge about susceptibility patterns of this bacteria is needed, especially due to its potential hazards to animals and humans. The antimicrobial resistance profile of S. thoraltensis was variable among studies (Vukonich et al., 2015; Dhotre et al., 2016; Petridis et al., 2018; Bustami et al., 2019; Wazir et al., 2019; Renzhammer et al., 2020; Hai et al., 2020).

Streptococcus spp. are, in general, sensitive to penicillin, and this compound remains the drug of choice, but unfortunately, these genera of pathogenic bacteria are quickly developing resistance to this antibiotic (Käppeli et al., 2019). This makes it imperative to expedite the search for new antimicrobials and technologies that can be used for therapy in veterinary medicine. Furthermore, Al-Tamimi et al. (2019) found that all S. thoraltensis isolates were fully resistant to most antibiotics that had been used in including penicillin, methicillin, and vancomycin, also Park et al. (2014) recorded a sensitivity of S. thoraltensis isolates to tetracyclines despite of their high resistance to vancomycin.

In the current study, the unjustifiable misuse of antimicrobials may have led to resistance of S. thoraltensis to most antibiotics, which may cause treatment failure. Also, the resistance to vancomycin would be a disastrous problem because it is the antibiotic of latest recourse for a huge number of multiple-antibiotic-resistant strains.

In addition to the phenotypic method, genotypic detection of the antibiotic resistance, using selected genes showed the presence of penicillin-binding protein gene (pbp1A) among the isolates. The beta-lactams are the most widely used and efficient of all antibiotics. However, widespread resistance has emerged among most common pathogens over the past few decades, (Hakenbeck et al., 1999). Navarre and Schneewind (1999) found that one of the common resistance mechanisms to β-lactam antibiotics is the alterations of penicillin-binding proteins (PBPs) that catalyze polymerization, and the cross-linking peptidoglycan precursors in the bacterial cell wall biosynthesis step.

In the present work, molecular analysis indicated the presence of vanA gene in S. thoraltensis isolates. This may be due to vanA is the most common gene isolated from vancomycin-resistant Enterococci and owing to taxonomical and structural resemblances between Enterococci and Streptococci. The possibility of vancomycin resistance of S. thoraltensis to be mediated by vanA was considered (Park et al., 2014). Unlike, Desjardins et al. (2004) who detected erm genes in different species of Streptococcus belonging to different groups (8%), our isolates lacked ermB gene. Leclercq (2002) elucidated that this resistance may be due to methylation of the ribosomal drug binding site, which resulted in macrolides, lincosamides, and streptogramin resistance, also methylases are encoded by the erm genes and may be inducible or constitutively expressed. Macrolide resistance here may be due to the expression of other erm gene classes than ermB.

The multidrug resistance of both two S. thoraltensis isolates could be due to their ability to form biofilms as the detected strong and moderate biofilms on microtiter plate. Biofilm is defined as “a matrix-enclosed microbial accretions which can adhere both to biological and non-biological surfaces” (Kaczorek et al., 2017). Once bacterial biofilms attached, biofilm cells can withstand unfavourable environmental conditions, such as nutrient depletion or treatment with antimicrobial substances (Jahid and Ha, 2014). Also biofilms on processing equipments/ surfaces are the main source of contamination of dairy products (Srey et al., 2013; Cappitelli et al., 2014).

One of the biofilm producing isolates harboured lmb gene which its role in biofilm was supported when its mutant resulted in profound defects in biofilm maturation (Boles et al., 2010), while the brpA-deficient mutant was found to be a reason for severe defects in biofilm formation when grown in a glucose-containing medium on polystyrene surfaces (Wen and Burn, 2002; Yoshida and Kuramitsu, 2002).

To best our search efforts, we could not find reports regarding the prevalence of biofilm formation among S. thoraltensis strains, however, many investigations have been conducted to assess the potential of Streptococcus spp. to form biofilms (Boonyayatra and Pata, 2016; Kaczorek et al., 2017; Moliva et al., 2017; Bonsaglia et al., 2019; Pieranski et al., 2021). The production of biofilms was considered as a significant factor in the pathogenesis of numerous diseases, both in humans (e.g., endocarditis) and in animals (e.g. mastitis) (Jung et al., 2012; Gomes et al., 2016). Accordingly, S. thoraltensis role as a mastitis initiating bacteria was emphasized in a large study, where it was the only isolated bacterium from 31.45% and 1.34% of 173,345 milk samples collected from clinical and non-clinical mastitis cases, respectively, and was also included in a cluster of pathogens known to be associated with sever mastitis (Díaz Cao et al., 2020). While, Kim et al. (2017) found that S. thoraltensis represents 1.6% of bacterial pathogens in mastitis-affected farms.

A few numbers of Streptococci have proteolytic activities which lead to bitterness in milk and its products, in addition to unfavorable changes (ICMSF, 1980). One of S. thoraltensis isolates was found to have proteolytic power on skimmed milk agar and this isolate is a strong biofilm producer. The proteolysis and the lipolysis produced per dairy bacterial cell were found to be higher within biofilm cells than within planktonic cells (Teh et al., 2012). The accumulation of enzymes within biofilms may also aid in the survival of the dairy bacteria within a dairy environment. Moreover, protease enzyme produced by viridans Streptococcus spp. was found to be associated with endocarditis (Straus, 1982; Al-Salih et al., 2012).

Isolation of S. thoraltensis from nasal and oropharyngeal mucosa of healthy people (Dhotre et al., 2016; Al-Wakeel, 2017; Al-Tamimi et al., 2019) and from water bowels (Alaidarous et al., 2017) makes human, water and/ or dairy utensils the most common source of milk contamination with this microorganism especially with its ability to produce biofilm.

Although Streptococcus thoraltensis is recently identified and was known to be non-pathogenic in humans, however, recently very little is known about the pathogenic potential of such bacterium to humans, providing a new insight in the field of microbiology. It is associated with cases of Chorioamnionitis (Vukonich et al., 2015), bacteraemia (Petridis et al., 2018; BHE, 2021; Wazir et al., 2019); endocarditis (Hai et al., 2020) and genital infection in women (Al-Wandawy et al., 2020) and has been isolated from organs of diseased humans working in the meat industry (Renzhammer et al., 2020). These recent health issues make S. thoraltensis represent a higher underestimated risk for zoonotic potential warrants further investigations. Also, its role as a mastitis pathogen deserves closer attention and should be properly identified by veterinary diagnostic laboratories. Furthermore, they express high resistance rates that appear to be directly related to the industry’s antimicrobial usage and could be further applied as biological markers for resistance monitoring.

Conclusions and Recommendations

In conclusion, this work reports the isolation of four bacterial strains which appeared to be S. thoraltensis. Considering these results, we cannot exclude a potential risk for human health related to the consumption of raw milk. Thus, the prevalence of S. thoraltensis in the dairy food chain necessitates more investigations. Additionally, as S. thoraltensis appeared to be associated with cases of clinical and subclinical mastitis, the role of this opportunistic pathogen needs to be closely monitored. It is essential to tightly regulate the use of antibiotics to avoid the emergence of antibiotic resistant strains of these bacteria which is a considerable recent hazard to humans.

Acknowledgments

The authors are grateful to all staff members in the Department of Food Hygiene and Control, and Microbiology Department, Faculty of Veterinary Medicine, South Valley University, Egypt.

Novelty Statement

This research highlights the role of raw milk as a source of the recently identified Streptococcus thoraltensis that resulted in increased human infection case reports. S. thoraltensis could be detected in raw milk samples and showed different antimicrobial resistance to different antimicrobials and one isolate showed biofilm formation and proteolytic activity.

Author’s Contribution

Authors contributed equally in the manuscript.

Conflict of interest

The authors have declared no conflict of interest.

References

Alaidarous M, Alanazi M, Abdel-Hadi A (2017). Isolation, identification, and antimicrobial susceptibility of bacteria associated with water pipe contaminants in selected area of Saudi Arabia. Biomed. Res. Int., 2017: 8042603. https://doi.org/10.1155/2017/8042603

Al-Salih G, Al-Attar N, Delbosc S, Louedec L, Corvazier E, Loyau S, Michel JB, Pidard D, Duval X, Meilhac O (2012). Role of vegetation-associated protease activity in valve destruction in human infective endocarditis. PLoS One, 7: e45695–e45695. https://doi.org/10.1371/journal.pone.0045695

Al-Tamimi M, Himsawi N, Abu-Raideh J, Abu jazar D, Al-jawaldeh H (2019). Isolation of fully vancomycin-resistant Streptococcus thoraltensis from the nasal cavity of a healthy young adult. Microb. Drug Resist., 25: 421–426. https://doi.org/10.1089/mdr.2018.0092

Alves-Barroco C, Roma-Rodriguesa C, Balasubramanian N, Guimaraes A, Ferreira-Carvalho BT, Muthukumaran J, Nunes D, Fortunato E, Martins R, Santos-Silvad T, Figueiredo A.M.S, Fernandesa AR, Santos-Sanches I (2019). Biofilm development and computational screening for new putative inhibitors of a homolog of the regulatory protein BrpA in Streptococcus dysgalactiaesubsp. Dysgalactiae. Int. J. Med. Microbiol., 309: 169-181. https://doi.org/10.1016/j.ijmm.2019.02.001

Al-Wakeel SS (2017). Microbiological and molecular identification of bacterial species isolated from nasal and oropharyngeal mucosa of fuel workers in Riyadh, Saudi Arabia. Saudi J. Biol. Sci., 24: 1281-1287. https://doi.org/10.1016/j.sjbs.2015.12.001

Al-Wandawy AH, Zwain LA, Omer SA (2020). Investigation of vaginal bacteria in healthy and in women with genital infection. Ann. Trop. Med. Publ. Health, pp. 23. https://doi.org/10.36295/ASRO.2020.231360

Araby E, Nada HG, Abou El-Nour SA, Hammad A (2020). Detection of tetracycline and streptomycin in beef tissues using Charm II, isolation of relevant resistant bacteria and control their resistance by gamma radiation. BMC Microbiol., 20: 186. https://doi.org/10.1186/s12866-020-01868-7

BHE (Public Health England) (2021). Laboratory surveillance of pyogenic and non-pyogenic streptococcal bacteraemia in England: 2020 update. Health Protection Report Volume 15 Number 19. Available at: https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/1036011/hpr1921_strptcccl-BSI_2020.pdf

Boles BR, Thoendel M, Roth AJ, Horswill AR (2010). Identification of genes involved in polysaccharide-independent Staphylococcus aureus biofilm formation. PLoS One, 5(4): e10146. https://doi.org/10.1371/journal.pone.0010146

Bonsaglia ECR, Latosinski GS, Rossi RS, Rossi BF, Possebon FS, Pantoja JCF, Fernandes Júnior A, Rall VLM (2019). Biofilm production under different atmospheres and growth media by Streptococcus agalactiae isolated from milk of cows with subclinical mastitis. Arch. Microbiol., 202: 209–212. https://doi.org/10.1007/s00203-019-01727-8

Boonyayatra S, Pata P (2016). Antimicrobial resistance of biofilm-forming streptococcus agalactiae isolated from bovine mastitis. J. Vet. Sci. Technol., 7: 374. https://doi.org/10.4172/2157-7579.1000374

Borø S, McCartney CA, Snelling TJ, Worgan HJ, McEwan NR (2010). Isolation of Streptococcus thoraltensis from rabbit faeces. Curr. Microbiol., 61: 357-360. https://doi.org/10.1007/s00284-010-9619-0

Bustami N, Mismar A, Obeidat F (2019). Isolation of Streptococcus thoraltensis from an abdominal wall abscess in a young female: A case report. J. Clin. Case Rep., 9: 1212.

Cappitelli F, Polo A, Villa, F (2014). Biofilm Formation in food processing environments is still poorly understood and controlled. Food Eng. Rev., 6: 29–42. https://doi.org/10.1007/s12393-014-9077-8

CLSI (2018). Performance standards for antimicrobial susceptibility testing. 27th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2018.

Collins MD, Farrow JAE, Katic V, Kandler O (1984). Taxonomic studies on streptococci of serological groups E, P, U and V: Description of Streptococcus porcinus sp. nov. Syst. Appl. Microbiol., 5: 402–413. https://doi.org/10.1016/S0723-2020(84)80041-7

Desjardins M, Delgaty KL, Ramotar K, Seetaram C, Toye B (2004). Prevalence and mechanisms of erythromycin resistance in group A and group B Streptococcus: implications for reporting susceptibility results. J. Clin. Microbiol., 42: 5620-5623. https://doi.org/10.1128/JCM.42.12.5620-5623.2004

Devriese LA, Pot B, Vandamme P, Kersters K, Collins MD, Alvarez N, Haesebrouck F, Hommez J (1997). Streptococcus hyovaginalis sp. nov. and Streptococcus thoraltensis sp. nov., from the genital tract of sows. Int. J. Syst. Bacteriol., 47: 1073–1077. https://doi.org/10.1099/00207713-47-4-1073

Dhotre S, Suryawanshi N, Nagoba B (2014). Isolation of Streptococcus thoraltensis from human oral cavity. Indian J. Dent., 5: 140–141. https://doi.org/10.1016/j.ijd.2014.03.003

Dhotre S, Suryawanshi N, Nagoba B, Selkar S (2016). Rare and unusual isolates of viridans Streptococci from the human oral cavity. Indian J. Pathol. Microbiol., 59(1): 47.

Díaz Cao JM, Barreal ML, Pombo B, Prieto A, Alonso JM, Iglesias A, Lorenzana R, López-Novo C, Díez-Baños P, Fernández G (2020). Evaluation and cluster analysis of inflammatory reactions of dairy cattle mastitis pathogens in milk samples submitted for microbiological examination. Spanish J. Agric. Res., 17: e0505. https://doi.org/10.5424/sjar/2019174-15316

Facklam, R (2002). What happened to the streptococci: Overview of taxonomic and nomenclature changes. Clin. Microbiol. Rev., 15: 613-630. https://doi.org/10.1128/CMR.15.4.613-630.2002

Garcia-Garrote F, Cercenado E, Bouza E (2000). Evaluation of a new system, VITEK 2, for identification and antimicrobial susceptibility testing of enterococci. J. Clin. Microbiol., 38: 2108-2111. https://doi.org/10.1128/JCM.38.6.2108-2111.2000

Gomes F, Saavedra MJ, Henriques M (2016). Bovine mastitis disease/ pathogenicity: Evidence of the potential role of microbial biofilms. Pathog. Dis., 74: ftw006. https://doi.org/10.1093/femspd/ftw006

Hai PD, Son PN, Thi THN, Thanh BN, Thi VHL, Manh DN (2020). A case of Streptococcus thoraltensis bacteremia and prosthetic valve endocarditis in a 68-year old Vietnamese man. Am. J. Case Rep., 21: e925752-e925752. https://doi.org/10.12659/AJCR.925752

Hakenbeck R, Grebe T, Zahner D, Stock JB (1999). Beta-Lactam resistance in Streptococcus pneumoniae: penicillin-binding proteins and non-penicillin-binding proteins. Mol. Microbiol., 33: 673–678. https://doi.org/10.1046/j.1365-2958.1999.01521.x

Hardie JM, Whiley RA (1997). Classification and overview of the genera streptococcus and enterococcus. J. Appl. Microbiol., 83: 1S-11S. https://doi.org/10.1046/j.1365-2672.83.s1.1.x

Hatt JK, Rather PN (2008). Role of bacterial biofilms in urinary tract infections. current topics in microbiology and immunology. Springer Berlin Heidelberg, 2008: 163-192. https://doi.org/10.1007/978-3-540-75418-3_8

Hernández-Durán M, López-Jácome LE, Colín-Castro AC, Cerón-González G, Ortega-Peña S, Vanegas-Rodríguez ES, Mondragón-Eguiluz JA, Franco-Cendejas R (2017). Comparison of the Micro Scan Walk Away and VITEK 2 Compact systems for the identification and susceptibility of clinical Gram-positive and Gram-negative bacteria, 6(3): 105-114.

ICMSF (1980). International commitlee microbiological specification for foods. Effect of processing on microorganisms.Futher contamination P.419. Microbial ecology of food. Vol. Food Commodities Academic Press Univ. of Toronto press, Toronto, Canada.

Jahid IK, Ha SD (2014). The paradox of mixed-species biofilms in the context of food safety. Comp. Rev. Food Sci. Food Saf., 13: 990-1011. https://doi.org/10.1111/1541-4337.12087

Jung CJ, Yeh CY, Shun CT, Hsu RB, Cheng HW, Lin CS and Chia JS (2012). Platelets enhance biofilm formation and resistance of endocarditis-inducing streptococci on the injured heart valve. J. Infect. Dis., 205: 1066-1075. https://doi.org/10.1093/infdis/jis021

Kaczorek E, Małaczewska J, Wójcik R, Siwicki AK (2017). Biofilm production and other virulence factors in Streptococcus spp. isolated from clinical cases of bovine mastitis in Poland. BMC Vet. Res., 13: 398. https://doi.org/10.1186/s12917-017-1322-y

Käppeli N, Morach M, Zurfluh K, Corti S, Nüesch-Inderbinen M, Stephan R (2019). Sequence types and antimicrobial resistance profiles of Streptococcus uberis isolated from bovine mastitis. Front. Vet. Sci., 6: 234. https://doi.org/10.3389/fvets.2019.00234

Kim D, Kim EK, Seong WJ, Ro Y, Ko DS, Kim NH, Kim JH, Kwon HJ (2017). Identification of microbiome with 16S rRNA gene pyrosequencing and antimicrobial effect of egg white in bovine mastitis. Korean J. Vet. Res., 57: 117-126. https://doi.org/10.14405/kjvr.2017.57.2.117

Krzyściak W, Pluskwa KK, Jurczak A, Kościelniak D (2013). The pathogenicity of the Streptococcus genus. Eur. J. Clin. Microbiol. Infect. Dis., 32: 1361-1376. https://doi.org/10.1007/s10096-013-1914-9

Leclercq R (2002). Mechanisms of resistance to macrolides and lincosamides: Nature of the resistance elements and their clinical implications. Clin. Infect. Dis., 34: 482-492. https://doi.org/10.1086/324626

Moliva MV, Cerioli F, Reinoso EB (2017). Evaluation of environmental and nutritional factors and sua gene on in vitro biofilm formation of Streptococcus uberis isolates. Microb. Pathog., 107: 144-148. https://doi.org/10.1016/j.micpath.2017.03.028

Mosleh MN, Gharibi M, Alikhani MY, Saidijam M, Kalantarian G (2014). Antimicrobial susceptibilities and distribution of resistance genes for β-Lactams in Streptococcus pneumoniae Isolated in Hamadan. Jundishapur J. Microbiol., 7(10): e12714. https://doi.org/10.5812/jjm.12714

Navarre WW, Schneewind, O (1999). Surface proteins of gram-positive bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol. Mol. Biol. Rev., 63: 174-229. https://doi.org/10.1128/MMBR.63.1.174-229.1999

Pailin T, Kang DH, Schmidt K, Fung DYC (2001). Detection of extracellular bound proteinase in EPS-producing lactic acid bacteria cultures on skim milk agar. Lett. Appl. Microbiol., 33: 45–49. https://doi.org/10.1046/j.1472-765X.2001.00954.x

Pan Y, An H, Fu T, Zhao S, Zhang C, Xiao G, Zhang J, Zhao X, Hu G (2018). Characterization of Streptococcus pluranimalium from a cattle with mastitis by whole genome sequencing and functional validation. BMC Microbiol., 18: 182. https://doi.org/10.1186/s12866-018-1327-0

Park C, Nichols M, Schrag SJ (2014). Two cases of invasive vancomycin-resistant group B streptococcus infection. N. Engl. J. Med., 370: 885-886. https://doi.org/10.1056/NEJMc1308504

Parte AC, SardàCarbasse J, Meier-Kolthoff JP, Reimer LC, Göker M (2020). List of prokaryotic names withstanding in nomenclature (LPSN) moves to the DSMZ. Int. J. Syst. Evol. Microbiol., 70: 5607–5612. Available at: https://www.bacterio.net/genus/streptococcus, https://doi.org/10.1099/ijsem.0.004332

Petridis N, Apsemidou A, Kalopitas G, Pilianidis G, Avramidis I (2018). Streptococcus thoraltensis bacteremia: First described case as a fever of unknown origin in human. Case Rep. Infect. Dis., 2018: 7956890. https://doi.org/10.1155/2018/7956890

Pieranski MK, Rychlowski M, Grinholc M (2021). Optimization of Streptococcus agalactiae biofilm culture in a continuous flow system for photoinactivation studies. Pathogens, 10: 1212. https://doi.org/10.3390/pathogens10091212

Pol M, Ruegg PL (2007). Treatment practices and quantification of antimicrobial drug usage in conventional and organic dairy farms in Wisconsin. J. Dairy Sci., 90: 249–261. https://doi.org/10.3168/jds.S0022-0302(07)72626-7

Renzhammer R, Loncaric I, Ladstätter M, Pinior B, Roch FF, Spergser J, Ladinig A, Unterweger C (2020). Detection of various Streptococcus spp. and their antimicrobial resistance patterns in clinical specimens from Austrian Swine Stocks. Antibiot (Basel, Switzerland)., 9: 893. https://doi.org/10.3390/antibiotics9120893

Schlegelova J, Vlkova H, Babak V, Holasova M, Jaglic Z, Stosova T, Sauer, P (2008). Resistance to erythromycin of Staphylococcus spp. isolates from the food chain. Vet. Med., 53(6): 307-314. https://doi.org/10.17221/1856-VETMED

Srey S, Jahid IK, Ha SD (2013). Biofilm formation in food industries: A food safety concern. Food Contr., 31: 572-585. https://doi.org/10.1016/j.foodcont.2012.12.001

Straus DC (1982). Protease production by Streptococcus sanguis associated with subacute bacterial endocarditis. Infect. Immun., 38: 1037-1045. https://doi.org/10.1128/iai.38.3.1037-1045.1982

Teh KH, Flint S, Palmer J, Andrewes P, Bremer P, Lindsay D (2014). Biofilm an unrecognised source of spoilage enzymes in dairy products? Int. Dairy J., 34: 32-40. https://doi.org/10.1016/j.idairyj.2013.07.002

Teh KH, Flint S, Palmer J, Andrewes P, Bremer P, Lindsay D (2012). Proteolysis produced within biofilms of bacterial isolates from raw milk tankers. Int. J. Food Microbiol., 157: 28-34. https://doi.org/10.1016/j.ijfoodmicro.2012.04.008

Tenke P, Kovacs B, Jäckel M, Nagy E (2006). The role of biofilm infection in urology. World J. Urol., 24: 13-20. https://doi.org/10.1007/s00345-005-0050-2

Thomas V, de Jong A, Moyaert H, Simjee S, El Garch F, Morrissey I, Marion H, Vallé M (2015). Antimicrobial susceptibility monitoring of mastitis pathogens isolated from acute cases of clinical mastitis in dairy cows across Europe: VetPath results. Int. J. Antimicrob. Agents, 46(1): 13-20. https://doi.org/10.1016/j.ijantimicag.2015.03.013

Vukonich M, Moline H, Chaussee M, Pepito B, Huntington MK (2015). Case report: Chorioamnionitis attributed to Streptococcus thoraltensis. South Dakota J. Med., 68: 298-299.

Wang Y, Lv Y, Cai J, Schwarz S, Cui L, Hu Z, Zhang R, Li J, Zhao Q, He T, Wang D (2019). A novel gene, optrA, that confers transferable resistance to oxazolidinones and phenicols and its presence in Enterococcus faecalis and Enterococcus faecium of human and animal origin. J. Antimicrob. Chemother., 70: 2182-2190. https://doi.org/10.1093/jac/dkv116

Wazir M, Grewal M, Jain AG, Everett G (2019). Streptococcus thoraltensis Bacteremia: A case of pneumonia in a postpartum patient. Cureus, 11: e5659-e5659. https://doi.org/10.7759/cureus.5659

Wen ZT, Burne RA (2002). Functional genomics approach to identifying genes required for biofilm development by Streptococcusmutans. Appl. Environ. Microbiol., 68: 1196-1203. https://doi.org/10.1128/AEM.68.3.1196-1203.2002

Wyder AB, Boss R, Naskova J, Kaufmann T, Steiner A, Graber HU (2011). Streptococcus spp. and related bacteria: their identification and their pathogenic potential for chronic mastitis - a molecular approach. Res. Vet. Sci., 91: 349-357. https://doi.org/10.1016/j.rvsc.2010.09.006

Yoshida A, Kuramitsu HK (2002). Multiple Streptococcusmutans genes are involved in biofilm formation. Appl. Environ. Microbiol., 68: 6283-6291. https://doi.org/10.1128/AEM.68.12.6283-6291.2002