Comparative Silencing Effect of Different siRNA Fragments on Potato Virus X Coat Protein in Transient Transfection Assays

Anwar Khan1, Fareeha Nosheen2,4, Bushra Tabassum2*, Olawale Samuel Adeyinka2, Khurram Shehzad3, Naila Shahid2, Arif Muhammad Khan4 and Idrees Ahmad Nasir2

1Department of Microbiology, BUITEMS, Quetta, Pakistan

2Centre of Excellence in Molecular Biology, University of the Punjab, Lahore 53700, Pakistan

3Sahara Medical College, Narowal, Pakistan

4Department of Biotechnology, University of Sargodha, Sargodha, Pakistan

ABSTRACT

Coat protein gene of potato virus X is a structural protein that plays a vital role in viral transmission and pathogenesis. RNA interference or post transcriptional gene silencing is a regulatory conserved mechanism that uses small interfering RNAs to control the expression of desired gene by inhibiting mRNA transcription. The present study aims to investigate the potential role of different siRNAs in down-regulating the mRNA expression of potato virus X in cell culture assays. Three specific siRNAs against CP-PVX gene were designed in which siRNA 3 significantly reduced the CP-PVX mRNA expression in HepG 2 cells upto 91.91% (12.5 fold) as compared to siRNA 1 and siRNA 2 where knockdown percentages were only 20 and 73.04%, respectively as revealed by realtime PCR. Maximum knockdown values were obtained at 100 nM concentration of siRNA 1 and 2, while for siRNA 3 promising knockdown was obtained at 50 nM concentration. For long lasting effect of siRNAs, short hairpin RNA corresponding to siRNA3 was designed and tested against CP-PVX which resulted in a similar pattern of inhibition on RNA expression of target gene as synthetic siRNA3. It was found that mRNA expression of targeted gene was reduced to 91% depicting strong RNAi response generated by shRNA. Our findings support the possibility of using consensus siRNA and shRNA-based approach as a promising strategy in effective inhibition of PVX in in-vitro assay. Down regulation of potato virus X through coat protein gene targeted siRNA is a potential way of inhibiting invading virus and to effectively stop its systemic spread.

Article Information

Received 14 February 2019

Revised 19 May 2019

Accepted 28 January 2020

Available online 06 January 2021

(early access)

Published 12 November 2021

Authors’ Contribution

AK carried out the research. FN performed transfection assays. BT planned and designed the study. AOS helped in real-time assays. KS wrote the manuscript. NS prepared figures. AMK is the advisor of FN. AMK and IAN proofread the manuscript.

Key words

Coat protein gene, HepG 2-PVX infected cells, RNA interference, Potato virus X

DOI: https://dx.doi.org/10.17582/journal.pjz/20190214060247

* Corresponding author: [email protected]

0030-9923/2022/0001-0039 $ 9.00/0

Copyright 2022 Zoological Society of Pakistan

INTRODUCTION

Potato virus X (PVX) is the member of Potexvirus and a single stranded positive polarity RNA virus with genome size of 5.9 - 7.0 kb. It is the most prevalent potato virus that spread mechanically and infects solanaceous, Chenopodiaceae, Amaranthaceae and Fabaceae crops (Alhoot et al., 2012). Infection by PVX usually cause leaf molting and slight stunting, but in some cases the foliage may have distinct yellowing pattern depending upon the viral strain. A yield loss up to 10 – 50% was recorded in potato due to PVX alone (Bai et al., 2009) while mixed infection with PVY dramatically decrease the yield to 50 –70%.

Various antiviral strategies have been opted to create tolerance in plants against PVX. These include cross protection (Baulcombe, 1996), insertion of virus derived movement protein gene (Bitko et al., 2005), coat protein gene, replicase gene (Chapman et al., 1992), antisense RNA mediated resistance and virus induced gene silencing (Chen and Okayama, 1987). The resistance efficacy of all these strategies varies and scientists met with mixed success (Culver, 1996; Alba et al., 2002; Dalakouras et al., 2011). The resistance conferred by these strategies was protein mediated some and RNA mediated others. Mechanism behind the protein mediated resistance is still unclear but RNA mediated resistance is now termed as RNA interference (RNAi) which is now a powerful tool applied in functional genomics.

RNAi is a naturally conserved regulatory mechanism in eukaryotic organisms that has evolved against potential threats of viruses and transposons (Duan et al., 2008). It is a process of gene silencing where small interfering RNA (siRNA) triggers sequence specific degradation of cognate mRNA (Echeverri and Perrimon, 2006). siRNAs are 21 - 25bp long dsRNA molecules that act as RNAi pathway initiators and trigger systemic gene silencing (Elbashir et al., 2001). Currently, diverse gene silencing approaches; like sense/antisense RNA, shRNA, small/long hairpin RNA and miRNA precursors are being used to initiate RNAi pathway (Goregaoker et al., 2000; Faivre-Rampant et al., 2004; Gao et al., 2013).

Studies have shown that siRNAs can elicit a potent and sequence specific response in cultured cell lines without immune response (Hamilton and Baulcombe, 1999). Today, several strategies have been used to trigger RNAi response in cultured cells to knockdown targeted genes (Hannon and Rossi, 2004). In siRNA targeting strategies, off-target gene silencing and cross-reaction have also been reported (Hinton et al., 2013; Jackson et al., 2003). Initially the non-specific nature of siRNA was credited to the sequence and thermodynamics of siRNA. Recently, with the improvement in the siRNA design algorithms, the problems associated with these factors have been minimized but still bulk of siRNAs needs to be designed to recognize most potent siRNA. In the present study, we aimed to compare the effect of siRNA and shRNA to specifically target coat protein gene of local PVX isolate.

MATERIALS and METHODS

siRNA and shRNA oligo design and synthesis

A web-based siDESIGN algorithm was used to design potential siRNAs against CP-PVX gene and deduce the probable silencing efficiency. Three siRNAs were selected targeting CP-PVX gene at different positions. The designed oligos contain 29 bp including 8 bp of T7 promoter at 5’ overhang (Table I). The designed oligo templates were custom synthesized from ThermoScientific (USA) while siRNAs were synthesized by using siRNA construction kit (Ambion, USA) as per instructions. The annealed siRNAs comprising of sense, antisense oligos were used for subsequent transfection assays. For shRNA oligo, loop sequence and 3, 5 flanking sequences were taken from miR403, an active regulatory miRNA. The shRNA was 107 bp long and have overhangs for HindIII and XbaI restriction sites (Table I). These oligos were annealed and cloned in pCDNA3.1 (+) vector (Invitrogen).

Gene amplification and construction of expression vector

Primers PVXIF and PVFIR (Table I) were designed to amplify ~891bp full length coat protein gene of PVX (CP-PVX) from PVX positive potato samples. Amplified product was cloned TA vector and sequenced. Deduced sequence was submitted to NCBI database. Further, for in-vitro knockdown assay, CP-PVX gene was directionally cloned in pCDNA3.1 (+) vector (Invitrogen) utilizing HindIII and XbaI sites to obtain construct pVXC.

Cell culture and transfection

HepG2 cell line was maintained in DMEM media with 10% fetal bovine serum (Gibco) with penicillin and streptomycin antibiotic at 100 µg/ml. Cells were grown overnight and transfected at confluency with 3 × 105 cells per well in a 6 well culture plate. 50ng of pVXC DNA was transfect into the cell line and the different siRNAs at different concentration (10nM, 25nM, 50nM and 100nM) was subsequent co-transfected for 24 h. Transfection was mediated by Lipofectamine (Invitrogen) according to manufacture instruction. All experiments were done in triplicate.

Cells were grown overnight and transfected at confluency with 3 × 105 cells per 6-well format. The next day, co-transfections of pVXC and shRNA vector was done by using four different treatments. The first treatment (1:1) includes 100ng of pVXC and 100ng of shRNA, the second treatment (1:2) includes 100ng of pVXC and 200ng of shRNA, treatment 3 (1:3) includes 100ng of pVXC and 300ng of shRNA while the fourth treatment (2:1) includes 200ng of pVXC and 100ng of shRNA. Transfection was mediated by Lipofectamine (Invitrogen) according to manufacture instruction. All experiments were done in triplicate.

Expression analysis for CP-PVX mRNA

Total cellular RNA was isolated using TRIzol reagent (Invitrogen) 24 h/72 h post transfection and cDNA was prepared from 1µg of total RNA by using cDNA synthesis kit (Thermoscientific). Primers for Real Time PCR (RT-F and RT-R, Table I) were designed using primer 3 software (frodo.wi.mit.edu) to amplify a fragment of 120 bp. Real-time amplifications, using SYBR Green detection chemistry, were run in triplicate on thermocycler with pikoreal 3.1 software (Thermoscientific). Reactions were prepared in a total volume of 10 μl containing 1 μl cDNA, 0.5μl of each 10 pmoles primer, 5 μl of Maxima SYBR Green/ROX qPCR Master Mix (2X) (Thermoscientific) and 2.5 μl RNase/DNase-free sterile water (Qiagen). The cycling profile comprised of 35 cycles of denaturation at 94ºC for 30 sec, annealing at 56ºC for 30 sec and extension at 72ºC for 30 sec, after initial denaturation of 94ºC for 5 min.

The threshold cycle number (Cq) for transgene was normalized to the Cq for the GAPDH housekeeping gene simultaneously amplified with the samples. The knockdown efficiency of each siRNA/shRNA was calculated through Cq values compared to scrambled siRNA sample in a delta-delta Ct method.

 

Table I. Sequences of shRNA, siRNAs and primers with their identity used in the study. Amplified product size is also mentioned along with primer sequences. shRNA sequence contains siRNA 3 sense and antisense sequences (underlined) along with loop and 5′, 3′ flanking regions. These oligos also contain overhangs of restriction sites for cloning in expression vector.

Serial #	Name	Sequence (5’-3’)	Product size
1	shRNA-sense	TCGAGAGAGTCGTATTACGTCTGAAGCTGAAATGAATTAC AACCCTTTTCATCAGAAAAACTGTTGTTGTTTGTTGA TTTCAGCTTCAGACGTTTAATCTGTCTTTC
2	shRNA-Antisense	TCGAGAAAGACAGATTAAACGTCTGAAGCTGAAATGAAC AAACAACAACAGTTTTTCTGATGAAAAGGGTTGTAAT TGATTTCAGCTTCAGACGTAATACGACTCTC
3	PVX1sense	AAGGAACTGGATGCTGACTAACCTGTCTC
4	PVX1Antisense	AATTAGTCAGCATCCAGTTCCCCTGTCTC
5	PVX2sense	AATCAGCAAGATTGAGGCTATCCTGTCTC
6	PVX2Antisense	AAATAGCCTCAATCTTGCTGACCTGTCTC
7	PVX3sense	AACGTCTGAAGCTGAAATGAACCTGTCTC
8	PVX3Antisense	AATTCATTTCAGCTTCAGACGCCTGTCTC
9	PVX-RTF	GGCAGCAGCAATTAAAGAGG	120bp
10	PVX-RTR	GAAACCTTGTGCTTGCCAGT
11	PVXIF	GGACTGAACCTTGTGTCATCA	891bp
12	PVXIR	ATGAAACTGGGGTAGGCGTC

 

Statistical analysis

One-way ANOVA and post Dunnet’s test were applied on knockdown data obtained from real time PCR assays by employing Graph Pad Prism Software combined with Microsoft excel.

RESULTS

Oligos and construction vectors

A complete region of the PVX coat protein gene of 891bp was successfully amplified from PVX infected potato samples. The deduced sequences were submitted in NCBI Gene bank under accession # KC757709. Further, gene was successfully and directionally cloned under the influence of Cytomegalovirus promoter to make it expressed in mammalian cell line. Potential clones were confirmed through restriction digestion where the release of ~891 bp gene and ~5.4 kb vector confirmed its positivity (Fig. 1A). Similarly, shRNA oligo of ~107bp was cloned directionally in pCDNA3.1(+) and restriction digestion revealed two distinct fragments; one at ~ 5.4kb vector and 107 bp shRNA (Fig. 1B).

siRNAs selection based on their in-silico efficacy predict maximum knockdown values and favorable GC content of 42 - 47% along with antisense preference and no cross-silencing ability. The siRNA1 was nonspecific for CP-PVX; siRNA2 targets the CP gene at 404 bp with probable silencing score of 90; siRNA 3 target at 176 bp with probability score of 84 while siRNA3 target at 551 bp position in CP-PVX gene with 84 silencing score.

 

Inhibition of CP-PVX gene expression in HepG2 cells

Through semi-quantitative analysis, the expression level of CP-PVX gene in cultured cells was obtained at 1µg of DNA concentration while least was observed at 50 ng of DNA. Hence, for co-transfections, 50ng was used.

 

The siRNA1 did not induce significant silencing in the CP-PVX gene 24 h post transfection (Fig. 2A). However, significant silencing effect was exhibited in siRNA2 and siRNA3 respectively as three concentrations. siRNA2 reduced the CP-PVX mRNA expression to 10% at 10 nM siRNA concentration; 42.4% at 25 nM; 36.39% at 50 nM and 73.04% at 100 nM siRNA concentration (Fig. 2B). Similarly, siRNA3 reduced the CP-PVX mRNA expression to 43.95% at 10 nM siRNA concentration; 77.80% at 25 nM; 91.91 % at 50 nM and 68.8 % at 100 nM siRNA concentration (Fig. 2C). The Cq values were normalized with GAPDH Cq values. Hence, the knockdown percentage of CP-PVX mRNA expression in HepG2 cells was least with siRNA1 when compared with siRNA2 and siRNA3 knockdown values. siRNA1 reduced the mRNA expression of CP-PVX by 1.25 folds while siRNA2 was able to reduce the mRNA expression by 3.7 folds. While in parallel, siRNA3 was found to reduce the mRNA expression of CP-PVX mRNA to a significant extent (12.5 fold). These values are in comparison to scrambled siRNA taken as control in these assays (Fig. 2).

For shRNA mediated knockdown assay, 72 h post transfection, variable knockdown was observed among the four treatments. It was found that 1:1 treatment reduced the CP-PVX mRNA expression to 31%, 1:2 decreased the mRNA expression to 62%, 1:3 exhibited maximum knockdown of 91% while 2:1 treatment reduced the mRNA expression to 16% only (Fig. 3).

 

DISCUSSION

Over the past few decades, RNAi has emerged as a very powerful technique in functional genomics. The ancient antiviral defense of the cell has been exploited to trigger specific gene inhibition (Mocellin and Provenzano, 2004). In this study, the coat protein gene of potato virus X was targeted due to its vital roles in virus accumulation, encapsulation and systemic spread (Kretschmer and Sczakiel, 2003; Korf et al., 2005; Echeverri and Perrimon, 2006). Several studies have employed Virus-derived coat protein gene as well as various virus derived genes to confer resistance against targeted virus in plants (Goregaoker et al., 2000; Kalantidis et al., 2002; Krulko et al., 2009). RNAi technology is a proven technique of generating virus resistant line in plant, and there is a great need to identified siRNA fragment that would produce the most effective and efficient result. RNA interference was successful used; to generate tobacco lines againts PVY, barley lines resistant to barley yellow dwarf virus PAV (BYDV-PAV), maize lines resistant to maize dwarf mosaic virus (Korf et al., 2005). We have identified best coat protein siRNA that can effectively be used for producing transgenic potatoes against potato virus X.

Transfection is a very powerful non-viral technology which is used to deliver foreign nucleic acid into eukaryotic cells to study relative expression and many other defined parameters. The generalized work plan for RNAi knockdown experiments involve the synthesis of siRNA for specific target, the delivery of siRNAs in cell line mediated through transfection reagent and the detection of percentage knockdown incurred by siRNAs. The same theme was applied in the current report where we initially optimized transfection conditions for transgene expression in mammalian cell line HepG2. Optimal transfection conditions are necessary to optimize for achieving relatively high transfection efficiency and for least cellular toxicity in cultured mammalian cell line (Missiou et al., 2004). As in cell culture systems, maintenance of lower cellular toxicity is very crucial parameter because transfection reagent mediated toxicity can mask the phenotypic expression of the target being tested. We have investigated different concentration of various siRNA to elucidate the least concentration for optimal knockdown efficacy to avoid chance of unwarranted toxicity.

Down-regulation of CP-PVX gene by small interfering RNAs (siRNA) resulted in the gene inhibition at post-transcriptional level. To trigger a strong RNAi activity against CP-PVX gene, screening of appropriate and effective RNAi target regions is mandatory. At present, there is a lack of clear understanding on the mechanisms that determine the gene-silencing efficiency of a given siRNA. Since not all cognate siRNAs that target mRNA are equally effective (Prins et al., 2008). Recent studies have shown that the gene silencing efficiency of siRNA is strongly dependent upon the local structure of mRNA at the targeted region (Scherer and Rossi, 2003). Out of three siRNAs, only siRNA3 that target CP gene at 551 bp position was capable of down-regulating the target mRNA expression to a maximum extent depicting that there is considerable variation in silencing efficiency among siRNAs. This variation may be, in part, attributed to the different accessibilities of siRNAs to the target mRNA (Novina et al., 2002; Mocellin and Provenzano, 2004; Pei and Tuschl, 2006; Parashar et al., 2013; Holen et al., 2002; Xu et al., 2003).

Maximum production of siRNA was detected in cells transfected with siRNA3 as compared to siRNA2 transfected cells. While siRNA1 treated sample exhibited minimum expression of particular siRNA indicating partial or minimum degradation of target mRNA. However, siRNA2 gave maximum knockdown of 73.04% at 100 nM concentration while for siRNA3, best knockdown of the target mRNA up to 91.91% was achieved at 50 nM concentration of siRNA. There was no change in the trend of knockdown expression at 24 h and 72 h of incubation time. siRNA3 reduced the expression of CP-PVX mRNA maximally, which resulted in the production of more target-specific siRNA corroborate similar findings reported by Jayan and Casey (2002) and Stewart et al. (2003). Our result suggest that the siRNA sequence is a vital factor that influence the potency and specificity of CP-PVX silencing.

CONCLUSION

We have developed a high-throughput, cell-based assay system for rapidly selecting and screening of siRNAs that effectively reduce mRNA. Identification of sensitive sites in the target RNAs regarding siRNA effectiveness is another significant achievement of this study for future resistance in potato against PVX.

Statement of conflict of interest

The authors declare that there is no conflict of interests regarding the publication of this article.

REFERENCES

Alba, D., Flores, R. and Hernandez, C., 2002. Two chloroplastic viroids induce the accumulation of small RNAs associated with posttranscriptional gene silencing. J. Virol., 76: 13094-13096. https://doi.org/10.1128/JVI.76.24.13094-13096.2002

Alhoot, M.A., Wang, S.M. and Sekaran, S.D., 2012. RNA interference mediated inhibition of dengue virus multiplication and entry in HepG2 cells. PLoS One, 7: 34060. https://doi.org/10.1371/journal.pone.0034060

Bai, Y., Guo, Z., Wang, X., Bai, D. and Zhang, W., 2009. Generation of double-virus-resistant marker-free transgenic potato plants. Progr. Nat. Sci., 19: 543-548. https://doi.org/10.1016/j.pnsc.2008.08.005

Baulcombe, D.C., 1996. Mechanisms of pathogen-derived resistance to viruses in transgenic plants. Pl. Cell, 8: 1833. https://doi.org/10.2307/3870233

Bitko, V., Musiyenko, A., Shulyayeva, O. and Barik, S., 2005. Inhibition of respiratory viruses by nasally administered siRNA. Nat. Med., 11: 50 – 55. https://doi.org/10.1038/nm1164

Chapman, S., Hills, G., Watts, J. and Baulcombe, D., 1992. Mutational analysis of the coat protein gene of potato virus X: effects on virion morphology and viral pathogenicity. Virology, 191: 223-230. https://doi.org/10.1016/0042-6822(92)90183-P

Chen, C. and Okayama, H., 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell Biol., 7: 2745-2752. https://doi.org/10.1128/MCB.7.8.2745

Culver, J.N., 1996. Tobamovirus cross protection using a potex virus vector. Virology, 226: 228-235. https://doi.org/10.1006/viro.1996.0650

Dalakouras, A., Tzanopoulou, M., Tsagris, M., Wassenegger, M. and Kalantidis, K., 2011. Hairpin transcription does not necessarily lead to efficient triggering of the RNAi pathway. Transg. Res., 20: 293–304. https://doi.org/10.1007/s11248-010-9416-3

Duan, C., Wang, C. and Guo, H., 2008. Delayed resistance to cucumber mosaic virus mediated by 3’ UTR-derived hairpin RNA. Chin. Sci. Bull., 53:3301–3310. https://doi.org/10.1007/s11434-008-0440-0

Echeverri, C.J., Perrimon, N., 2006. High-throughput RNAi screening in cultured cells: A user’s guide. Nat. Rev. Genet., 7: 373-384. https://doi.org/10.1038/nrg1836

Elbashir, S.M., Harborth, J., Lendeckel, W., Yalcin, A., Weber, K. and Tuschl, T., 2001. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature, 411: 494-498. https://doi.org/10.1038/35078107

Faivre-Rampant, O., Gilroy, E.M., Hrubikova, Z., Hein, I., Millam, S., Loake, G.J. and Lacomme, C., 2004. Potato virus X-induced gene silencing in leaves and tubers of potato. Pl. Physiol., 134: 1308-1316. https://doi.org/10.1104/pp.103.037507

Gao, Q., Wang, W., Lan, Y., Chen, X., Yang, W., Yuan, Y., Tan, J., Zong, Y. and Jiang, Z., 2013. The inhibitory effect of small interference RNA protein kinase C-alpha on the experimental proliferative vitreoretinopathy induced by dispasein mice. Int. J. Nanomed., 8: 1563–1572. https://doi.org/10.2147/IJN.S37635

Goregaoker, S.P., Eckhardt, L.G. and Culver, J.N., 2000. Tobacco mosaic virus replicase-mediated cross-protection: contributions of RNA and protein-derived mechanisms. Virology, 273: 267–275. https://doi.org/10.1006/viro.2000.0430

Hamilton, A., Voinnet, O., Chappell, L. and Baulcombe, D., 2002. Two classes of short interfering RNA in RNA silencing. EMBO J., 21: 4671-4679. https://doi.org/10.1093/emboj/cdf464

Hamilton, A.J. and Baulcombe, D.C., 1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science, 286: 950–952. https://doi.org/10.1126/science.286.5441.950

Hannon, G.J. and Rossi, J.J., 2004. Unlocking the potential of the human genome with RNA interference. Nature, 431: 371-378. https://doi.org/10.1038/nature02870

Hinton, T.M., Challagulla, A., Stewart, C.R., Guerrero, C., Grusche, F.A., Shi, S., Bean, A.G., Monaghan, P., Gunatillake, P.A., Thang, S.H. and Tizard, M.L., 2013. Inhibition of influenza virus in vivo by siRNA delivered using ABA triblock copolymer synthesized by reversible addition-fragmentation chain-transfer polymerization. Nanomedicine, 0: 1-14.

Holen, T., Amarzguioui, M., Wiiger, M.T., Babaie, E. and Prydz, H., 2002. Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucl. Acids Res., 30: 1757–1766. https://doi.org/10.1093/nar/30.8.1757

Jackson, A.L., Steven, R.B., Janell, S., Sumire, V.K.I., Julja, B., Mao, M., Bin, L., Guy, C. and Peter, S.L., 2003. Expression profiling reveals off-target gene regulation by RNAi. Nat. Biotechnol., 21: 635-637. https://doi.org/10.1038/nbt831

Jayan, G.C. and Casey, J.L., 2002. Inhibition of Hepatitis Delta Virus RNA editing by short inhibitory RNA-mediated knockdown of ADAR1 but not ADAR2 expression. J. Virol., 76: 12399–12404. https://doi.org/10.1128/JVI.76.23.12399-12404.2002

Kalantidis, K., Psaradakis, S., Tabler, M. and Tsagris, M., 2002. The occurrence of CMV-specific short RNAs in transgenic tobacco expressing virus-derived double-stranded RNA is indicative of resistance to the virus. Mol. Pl. Microbe Interact., 15: 826–833. https://doi.org/10.1094/MPMI.2002.15.8.826

Korf, M., Jarczak, D., Beger, C., Manns, M.P. and Kruger, M., 2005. Inhibition of hepatitis C virus translation and subgenomic replication by siRNAs directed against highly conserved HCV sequence and cellular HCV cofactors. J. Hepatol., 43: 225-234. https://doi.org/10.1016/j.jhep.2005.02.046

Kretschmer, R. and Sczakiel, G., 2003. The activity of siRNA in mammalian cells is related to structural target accessibility: A comparison with antisense oligonucleotides. Nucl. Acids Res., 31: 4417–4424. https://doi.org/10.1093/nar/gkg649

Krulko, I., Ustyanenko, D. and Polischuk, V., 2009. Role of siRNAs and miRNAs in the processes of RNA-mediated gene silencing during viral infections. Cytol. Genet., 43: 63–72. https://doi.org/10.3103/S0095452709010113

Luo, K.Q. and Chang, D.C., 2004. The gene-silencing efficiency of siRNA is strongly dependent on the local structure of mRNA at the targeted region. Biochem. biophy. Res. Commun., 318: 303-310. https://doi.org/10.1016/j.bbrc.2004.04.027

Missiou, A., Kalantidis, K., Boutla, A., Tzortzakaki, S., Tabler, M. and Tsagris, M., 2004. Generation of transgenic potato plants highly resistant to potato virus Y (PVY) through RNA silencing. Mol. Breed., 14: 185-197. https://doi.org/10.1023/B:MOLB.0000038006.32812.52

Mocellin, S. and Provenzano, M., 2004. RNA interference: Learning gene knock-down from cell physiology. J. Transl. Med., 2: 39. https://doi.org/10.1186/1479-5876-2-39

Novina, C.D., Michael, F.M., Derek, M.D., Paul, J.B., Jonathan, R., Sang-Kyung, L., Ronald, G.C., Judy, L., Premlata, S. and Phillip, A.S., 2002. siRNA-directed inhibition of HIV-1 infection. Nat. Med., 8: 681-686. https://doi.org/10.1038/nm725

Parashar, D., Paingankar, M.S., Kumar, S., Gokhale, M.D., Sudeep, A.B., Shinde, S.B. and Arankalle, V.A., 2013. Administration of E2 and NS1 siRNAs inhibit chikungunya virus replication in vitro and protects mice infected with the virus. PLoS Negl. Trop. Dis., 7: 2405. https://doi.org/10.1371/journal.pntd.0002405

Pei, Y. and Tuschl, T., 2006. On the art of identifying effective and specific siRNAs. Nature Methods, 3: 670 – 676. https://doi.org/10.1038/nmeth911

Prins, M., Laimer, M., Noris, E., Schubert, J., Wassenegger, M. and Tepfer, M., 2008. Strategies for antiviral resistance in transgenic plants. Mol. Pl. Pathol., 9:73–83.

Scherer, L.J. and Rossi, J.J., 2003. Approaches for the sequence-specific knockdown of mRNA. Nature Biotechnol., 21: 1457–1465. https://doi.org/10.1038/nbt915

Shimizu, T., Ogamino, T., Hiraguri, A., Nakazono, E., Uehara, T., Nakajima, M. and Sasaya, T., 2013. Strong resistance against rice grassy stunt virus is induced in transgenic rice plants expressing double-stranded RNA of the viral genes for nucleocapsid or movement proteins as targets for RNA interference. Phytopathology, 103: 513-519. https://doi.org/10.1094/PHYTO-07-12-0165-R

Simon, M.C. and Garcia, J.A., 2011. Antiviral strategies in plants based on RNA silencing. Biochim. biophys. Acta, 1809: 722–731. https://doi.org/10.1016/j.bbagrm.2011.05.011

Stewart, S.A., Dykxhoorn, D.M., Palliser, D., Mizuno, H., Yu, E.Y., An, D.S., Sabatini, D.M., Chen, I.S.Y., Hahn, W.C., Sharp, P.A., Weinberg, R.A. and Novina, C.D., 2003. Lentivirus-delivered stable gene silencing by RNAi in primary cells. RNA, 9: 493–501. https://doi.org/10.1261/rna.2192803

Tabassum, B., Nasir, I.A. and Husnain, T., 2011. Potato virus Y mRNA expression knockdown mediated by siRNAs in cultured mammalian cell line. Virol. Sin., 26: 105-113. https://doi.org/10.1007/s12250-011-3161-x

Vickers, T.A., Koo, S., Bennett, C.F., Crooke, S.T., Dean, N.M. and Baker, B.F., 2003. Efficient reduction of target RNAs by small interfering RNA and RNase H-dependent antisense agents: A comparative analysis. J. biol. Chem., 278: 7108–7118. https://doi.org/10.1074/jbc.M210326200

Wu, Z.M., Shi, X., Xie, X.L., Wen, C.X. and Zhang, Q.L., 2005. Molecular identification of Hebe potato virus Y isolate and its detection by RT- PCR. J. Agric. Univ. Hebei., 28: 54-59.

Xu, Y., Zhang, H.Y., Thormeyer, D., Larsson, O., Du, Q., Elmen, J., Wahlestedt, C. and Liang, Z., 2003. Effective small interfering RNAs and phosphorothioate antisense DNAs have different preferences for target sites in the luciferase mRNAs. Biochem. biophys. Res. Commun., 306: 712–717. https://doi.org/10.1016/S0006-291X(03)01024-6

Zhang, Z.Y., Fu, F.L., Gou, L., Wang, H.G., Li, W.C., 2010. RNA interference based transgenic maize resistant to maize dwarf mosaic virus. J. Pl. Biol., 53: 297-305. https://doi.org/10.1007/s12374-010-9117-8