CDS Cloning, Sequencing and Bioinformatic Analysis of Vasoactive Intestinal Peptide in Wahui Pigeon

Fei Wang1, Xiaofen Hu1, Feng Wen2, Xiaoen Tang3, Shanshan Yang1,

Shengwei Zhong1, Zuohong Zhou1, Xu Yuan1 and Yong Li1,*

1College of Animal Science and Technology, Jiangxi Agricultural University, Nanchang 330045, Jiangxi, China

2College of Life Science and Engineering, Foshan University, Foshan 528231, Guangdong, China

3Fuzhou Husbandry Breeding Farm, Linchuan 344000, Jiangxi, China

ABSTRACT

Vasoactive intestinal peptide plays double roles as gastrointestinal hormone and neuropeptide. Due to few reports on vasoactive intestinal peptide in pigeon, the present study was aim to further explore the correlation between its molecular bioinformatics characteristics and biological function. After the desired RNA was extracted from the intestine of Wahui pigeons, the complete CDS of vasoactive intestinal peptide was obtained by PCR amplification and sequencing, in addition, a variety of bioinformatics analysis was performed to evaluate its structural characteristics. CDS of vasoactive intestinal peptide, encoding 132 amino acids, is 399 bp long in Wahui pigeon. Vasoactive intestinal peptide probably belongs to a hydrophilic peptide without any signal peptide and transmembrane structure, and mainly plays its biological function due to occupying 89.6% in cytoplasm. Furthermore, it consists of one N-glycosylation site and 17 phosphorylation sites, and the secondary structure contains 50.76% of alpha helix, 5.30% of beta turn, 9.09% of extended strand, and 34.85% of random coil. Phylogenetic tree analysis shows that Wahui pigeon hold the close relative characteristics with chicken, turkey, and Taeniopygia guttata. Besides its conservative evolutional characteristic, the simple structure, subcellular localization, hydrophobicity and hydrophilicity indirectly account for its extensive distribution and various functions as expected.

Article Information

Received 01 August 2021

Revised 03 October 2021

Accepted 12 October 2021

Available online 21 January 2022

(early access)

Published 12 August 2022

Authors’ Contribution

FW and YL conceived and conducted the study. FW and XT provided the methodology and resources. XH, SY, SZ, ZZ and XY made the investigation and analyzed the data. YL and FW wrote and revised the manuscript.

Key words

Wahui pigeon, Bioinformatic analysis, Cloning, CDS, Vasoactive intestinal peptide

DOI: https://dx.doi.org/10.17582/journal.pjz/20210801110807

* Corresponding author: liyong2912@163.com

0030-9923/2022/0006-2563 $ 9.00/0

Copyright 2022 by the authors. Licensee Zoological Society of Pakistan.

This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).

INTRODUCTION

Vasoactive intestinal peptide (VIP) was initially isolated and characterized from porcine duodenum in 1970 (Said and Mutt, 1970). In vivo, VIP widely distributes in various tissues as gastrointestinal hormone and neuropeptide. VIP is considered as the paradigm of an endogenous neuroendocrine-immune mediator with therapeutic potential for a variety of inflammatory disorders such as inflammatory bowel disease (Abad et al., 2012; Jönsson et al., 2012; Wu et al., 2015; Iwasaki et al., 2019). VIP can inhibit the neurodegeneration due to loss of neurons, which may be mediated by glial cells through the production of neurotrophic factors and the inhibition of proinflammatory mediators (Deng and Jin, 2017). In addition, VIP acts as an antimicrobial peptide in the pathological process of rheumatoid arthritis, reduces the expression of pattern recognition receptor and its inflammatory signal, down-regulates the production of proinflammatory cytokines and chemokines, and counterbalances Th subsets decreasing pathogenic Th17 cells and their capacity to shift to Th1 profile (Villanueva-Romero et al., 2018). In the recent study, the signal pathway between nervous system and immune system mediated by VIP opens up a new way for the treatment of allergy and plays an important role in the prevention of allergic diseases (Verma et al., 2017). Another study demonstrates an increased transepithelial passage of live commensal and pathogenic bacteria in the colon of irritable bowel syndrome subjects, the up-regulation of VIP is important in the regulation of this bacterial translocation through the mucosa (Bednarska et al., 2017). So far, VIP has continually been investigated as a known neuropeptide on its aspects, the structural characteristics and biological function of VIP have been abundantly acquired as well.

Pigeon is a kind of common poultry with tender meat, high protein, and low fat in China. In recent years, the market demand for pigeons has gradually increased. However, some bad managements, for example, wet litter, bad ventilation, high density, improper coccidiostat consumption and contaminated feeders, exaggerate intestinal parasite problems (Ruff, 1993). The parasitism often brings about severe effects on birds including malnutrition, retarded growth, low egg production, susceptibility to other infections, and death in young birds (Radfar et al., 2012), these similar intestinal diseases account for a large part of pigeon’s disease, so as to seriously threaten pigeon’s normal breeding. As an effective anti-inflammatory factor, VIP has the effect of inhibiting T cell proliferation (Gonzalez-Rey et al., 2007). In addition, VIP inhibits the production of inflammatory cytokines and chemokines by macrophages, microglia and dendritic cells via its receptors VPAC1 and VPAC2 (Gonzalez-Rey et al., 2007). VIP is also a signaling molecule between the nervous and immune system, and plays a role in immunity, especially in local mucosal immunity (Delgado and Ganea, 2013). However, there have been few reports on molecular bioinformatics of VIP such as the related functional structures. Here, Wahui pigeons’ intestines were used to obtain the coding region sequences of VIP by cloning and sequencing, and its sequence was analyzed and functionally predicted by bioinformatics software. The present results provide more detailed information for further exploration on the biological function of VIP in pigeon.

MATERIALS AND METHODS

Experimental animals

Ten healthy Wahui pigeons with half male and half female (26 days old, weighing 500±5 g) were purchased from Xixia Pigeon Farm (Nanchang, China) and provided with pigeon-starter feed and water. Raised in Animal Anatomy Laboratory for one day of fasting, pigeons were dissected after anesthetization on the next day. The intestines were quickly collected to put in liquid nitrogen, and then stored in refrigerator at -80oC. All of the procedures were performed in accordance with the Ethics Committee and Guidelines of Animal Experiments of our institute.

RNA extraction and cDNA synthesis

RNA was extracted from ileum according to Trizol method. Briefly, the frozen specimens were powdered in liquid nitrogen and homogenized in RNAiso Plus (TAKARA Bio Inc., Japan), from which 500 μl was transferred to EP tube. 200 μl chloroform was added to each tube, violently shaken for 15 s and centrifuged for 15 min (4 oC, 12000 r/min). The sample was divided into three layers: the yellow organic phase, the middle layer and the upper colorless water phase. The upper water phase was transferred to a new 1.5 ml EP tube, and then 500 μl isopropanol was added in this tube and mixed gently. The mixture was kept at room temperature for 10 min, was centrifuged for 10 min (4 oC, 12000 r/min). After the supernatant was discarded, total RNA was washed with 1 ml 95% ethanol prepared by RNase-Free ddH2O. Then 30 μl DEPC water (TAKARA Bio Corp., Japan) was added to fully dissolve and precipitate in refrigerator at -80 oC (Thermo Scientific, USA). RNA concentration and OD value were detected by ultraviolet spectrophotometer (Beckman Corp., USA). The first strand cDNA was synthesized using the EasyScript One-Step gDNA Removal and cDNA Synthesis SuperMix Kit (Transgen, China), and then placed in refrigerator at -20 oC.

PCR amplification and sequencing

PCR amplification primers were designed by Primer Premier 5.0 software according to VIP sequence of pigeon from GeneBank (Accession number: XM_021294865.1). CDS region of VIP was amplified by PCR using the above cDNA as a template. The PCR amplification mixture of 25 μl was as follows: 12.5 μl of 2×EasyPfu PCR SuperMix, 1 μl of each of the upstream and downstream primers (Table I), 2 μl of template, 8.5 μl of ddH2O. PCR reaction conditions was applied as follows: pre-denaturation at 95 oC for 5 min, denaturation at 94 oC for 30 s, annealing at 50.7 oC for 30 s, extension at 72 oC for 40 s, 35 cycles, extension at 72 oC for 8 min. The electrophoresis of PCR products was performed by using 1% agarose gel, and then the PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequence detection.

Bioinformatic analysis

The biological information of VIP was obtained by a series of predictive analysis based on CDS above. These items and software are shown as Table II.

RESULTS

CDS region of VIP

After PCR amplification, the target CDS region are 511 bp long as agarose gel electrophoresis (Fig. 1), subsequently, the nucleotide sequence was obtained by sequencing, and the open reading frame is of 399 bp length according to the sequence analysis by NCBI online.

Physicochemical properties and hydrophobicity analysis on VIP

The physicochemical properties of VIP were predicted by ProtParam software. The peptide is encoded by 132 amino acids (Fig. 2), the amino acid composition is shown in Table III, and the content of leucine is the highest with 12.9%. The molecular formula and mass of VIP are

 

Table I. The PCR primer sequences and predicted product length.

Item	Primer sequences (5’→3’)	Product length	Tm	Purpose
VIP-CDS	TTGCTGTTTGGATGTT CTTTGAAATACTATGTGGAA	511	50.7	PCR amplification

 

Table II. The software or tools applied in bioinformatic analysis.

Predicted subject	Software	Website
Physicochemical properties of protein Hydrophobic analysis Signal peptide analysis Transmembrane analysis Subcellular localization Phosphorylation site Glycosylation site Secondary structure Tertiary structure Functional structure	ProtParam Protscale SignalP TMHMM Serve v.2.0 Psort II NetPhos 3.1 Server NetNGlyc 1.0 SOPMA Phyre2 SAMRT	https://web.expasy.org/protparam/ https://web.expasy.org/protscale/ http://www.cbs.dtu.dk/services/SignalP/ http://www.cbs.dtu.dk/services/TMHMM/ http://www.psort.org/psorb http://www.cbs.dtu.dk/services/Net Phos/ http://www.cbs.dtu.dk/services/Net NGlyc/ https://npsa-prabi.ibcp.fr/cgi-bin/npsa_automal. pl? Page=npsa_sopma.html http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi? id=index http://smart.embl.de/smart/job_status.pl?Jobid=116547588181601533707646MhEAszEcjM

 

C654H1032N182O213S3 and 14948.66 u, respectively. The theoretical isoelectric point and the instability coefficient are 5.03 and 69.90, respectively. The fat coefficient and the average hydrophilicity are 78.33 and -0.703, respectively, therefore, it is probably unstable and hydrophilic peptide. According to the hydrophobicity prediction by Protscale program, it can be seen that Valine in the 67th position has the strongest hydrophobicity due to the hydrophobic value with 2.933, and Lysine in the 77th position has the strongest hydrophilicity due to hydrophilic value with -3.967. The hydrophilicity contributes to approximately 70% with larger hydrophilic region; accordingly, it should be a soluble peptide.

 

Table III. The amino acid composition of VIP in Wahui pigeon.

Amino acids	Number	Frequency (%)	Amino acids	Number	Frequency (%)
Arg (R)	8	6.1	Phe (F)	6	4.5
Asn (N)	7	5.3	Pro (P)	7	5.3
Asp (D)	13	9.8	Ser (S)	16	12.1
Gln (Q)	4	3.0	Thr (T)	3	2.3
Glu (E)	10	7.6	Tyr (Y)	4	3.0
Gly (G)	5	3.8	Val (V)	6	4.5
His (H)	3	2.3	Ala (A)	8	6.1
Ile (I)	3	2.3	Cys (C)	0	0
Leu (L)	17	12.9	Trp (W)	0	0
Lys (K)	9	6.8	Pyl (O)	0	0
Met (M)	3	2.3	Sec (U)	0	0

 

 

 

The signal peptide, transmembrane structure and subcellular localization of VIP

The signal peptide of VIP was predicted using SignalP5.0 software, but no signal peptide was found in VIP of Wahui pigeon, it infers that VIP is not a secreted peptide. Meanwhile, the peptide does not have a transmembrane structure based on the prediction of TMHMM software (Fig. 3).

According to the subcellular localization by PSORT II prediction, it distributes in the cytoplasm (89.6%), cytoplasmic membrane (5.1%), periplasm (2.6%), extracellular (2.6%), and outer membrane (0.1%), respectively, therefore, it can be inferred that VIP mainly exert its function in the cytoplasm.

 

Other structure prediction of VIP

As to the N-glycosylation site prediction of VIP by using NetNGlyc1.0, it was found that VIP has a potential N-glycosylation site at the 71st amino acid with a score of 0.7126 (Fig. 4). In the phosphorylation site prediction by using the NetPhos 3.1 server software online, when the threshold of potential phosphorylation site is set at 0.5, there are 17 potential phosphorylation sites in VIP, which consists of 12 Serine, 2 Threonine, and 3 Tyrosine sites (Fig. 5). There are probable six conserved protein kinase binding sites of unsp (including PKC, PKA, CKII, GSK3, and INSR in VIP), and its score has the highest value of 0.991 at 120.

 

 

The secondary structure of VIP in Wahui pigeon was predicted by ExPAsY’s SOPMA program. The Alpha helix of VIP has 67 amino acids, taking up 50.76%, and the Beta turn has 7 amino acids, taking up 5.30%. The extended strand has 12 amino acids, taking up 9.09%, and the Random coil has 46 amino acids, taking up 34.85%. The tertiary structural model was obtained by homology modeling of VIP with Phyre 2. The peptide is folded, bent and forms into a three-stage structure (Fig. 6).

 

The phylogenetic evolutionary analysis of VIP

VIP sequence of Wahui pigeon was compared with other nine different animals by using MUSCLE software including Gallus gallus (GeneID: NM_001177309.1), Meleagris gallopavo (GeneID: XM_010707199.3), Taeniopygia guttata (GeneID: XM_030268028.1), Danio rerio (GeneID: NM_001114553.3), Mus musculus (GeneID: XM_006512448.1), Rattus norvegicus (GeneID: NM_053991.1), Homo sapiens (GeneID: NM_003381.4), Bos taurus (GeneID: NM_173970.3), and Sus scrofa (GeneID: NM_001195233.1). According to the genetic sequence analysis established among ten different animals, the phylogenetic tree can be divided into three large groups, from which Wahui pigeon locates in the same small group with Meleagris gallopavo, Gallus gallus and T. guttata, the phylogenetic evolutionary trend indicates that there are the closest relative relationship between Wahui pigeon and other three kinds (Fig. 7).

 

DISCUSSION

VIP is a neuropeptide extensively distributed in tissues, it exerts pleiotropic functions in multiple systems, such as the gastrointestinal, cardiovascular, nervous, and immune systems (Villanueva-Romero et al., 2018; Kasacka et al., 2015; Jayawardena et al., 2017; Benitez et al., 2018). It has been reported that VIP can participate in regulating immune balance as an immunomodulatory and anti-inflammatory factor (Benitez et al., 2018; Li et al., 2017). Therefore, it has been considered as a potential candidate for treating various autoimmune and inflammatory diseases, and also has been effective in prevention of autoimmune diseases, such as diabetes mellitus, rheumatoid arthritis, EAE, sepsis and inflammatory bowel disease (Villanueva-Romero et al., 2018; Jimeno et al., 2010; Ibrahim et al., 2012; Tan et al., 2015; Shi et al., 2016; Jayawardena et al., 2017). In the treatment of lupus erythematosus, VIP modulates immune homeostasis of Th17/Treg by down-regulating serum levels of autoantibodies and renal levels of IL-17 and IL-6, and up-regulating renal levels of Foxp3 and IL-10, thereby improves renal functional defects, proteinuria and renal damage (Fu et al., 2019). VIP and its receptors are over-expressed in many common tumors, including bladder, breast, colon, liver, lung, pancreatic, prostate, thyroid, and uterine cancer, VIP and PACAP stimulate the growth of several cancer cell lines in vitro (Moody et al., 2016), as indicates VIP may affect tumor growth and differentiation. In addition, VIP widely distributes in the gastrointestinal mucosa, which has various functions such as regulating the physiology, biochemistry, immune function of the gastrointestinal tract, and resisting inflammation, taking on immunity, and relaxing muscles (Montagnese et al., 2015). In studies on live Salmonella typhimurium instead of LPS, VIP can down-regulate inflammatory mediators in human monocytes and murine macrophages (Foster et al., 2006; Askar et al., 2015; Ibrahim et al., 2018), thereby S. typhimurium probably increase its survival rate in humans and mice by VIP. According to study on the immunomodulatory effects of VIP and the increase in survival and growth of S. typhimurium, VIP reduced cytokines over-expressed (IL-1β, IL-6, TNF-α, IFN-γ and IL-10) in sepsis, and confirmed that VIP can be used as an adjuvant therapy for antibiotics in sepsis (Askar et al., 2020). The above studies demonstrate that VIP has enormous potential for the treatment of inflammatory diseases in the immunomodulation of innate immune responses.

According to the bioinformatics analyses in present study, on the one hand, Wahui pigeon is clustered with chicken, turkey, and T. guttata. The close relationship suggests the structure of VIP is evolutionarily conservative among these species. On the other hand, this simple structure and fine solubility account for the whole physiochemical and biological properties of VIP, and also greatly explain its extensive distribution in different tissues. It is indicated that the molecular characteristics are appropriate to play its functions in various systems.

CONCLUSIONS

In conclusion, we obtained CDS region of VIP gene with 511 bp in Wahui pigeon, and analyzed its molecular characteristics and properties, this simple molecular structure and characteristics are appropriate to take various functions in multiple systems.

ACKNOWLEDGEMENTS

The study was supported by the National Natural Science Foundation Project of China (No. 31960688 and 31360592) and Natural Science Foundation Project of Jiangxi Province (No. 20181BAB204016).

Statement of conflict of interest

The authors have declared no conflict of interest.

REFERENCES

Abad, C., Gomariz, R., Waschek, J., Leceta, J., Martinez, C., Juarranz, Y. and Arranz, A., 2012. VIP in inflammatory bowel disease: state of the art. Endocr. Metab. Immune Disord. Drug Targets, 12: 316-322. https://doi.org/10.2174/187153012803832576

Askar, B., Higgins, J., Barrow, P. and Foster, N., 2020. Immunomodulation by vasoactive intestinal peptide is associated with increased survival and growth of Salmonella typhimurium in mice. Cytokine, 125: 154787. https://doi.org/10.1016/j.cyto.2019.154787

Askar, B., Ibrahim, H., Barrow, P. and Foster, N., 2015. Vasoactive intestinal peptide (VIP) differentially affects inflammatory immune responses in human monocytes infected with viable Salmonella or stimulated with LPS. Peptides, 71: 188-195. https://doi.org/10.1016/j.peptides.2015.06.009

Bednarska, O., Walter, S.A., Casado-Bedmar, M., Ström, M., Salvo-Romero, E., Vicario, M., Mayer, E.A. and Keita, Å.V., 2017. Vasoactive intestinal polypeptide and mast cells regulate increased passage of colonic bacteria in patients with irritable bowel syndrome. Gastroenterology, 153: 948-960. https://doi.org/10.1053/j.gastro.2017.06.051

Benitez, R., Delgado-Maroto, V., Caro, M., Forte-Lago, I., Duran-Prado, M., O’Valle, F., Lichtman, A.H., Gonzalez-Rey, E. and Delgado, M., 2018. Vasoactive intestinal peptide ameliorates acute myocarditis and atherosclerosis by regulating inflammatory and autoimmune responses. J. Immunol., 200:3697-3710. https://doi.org/10.4049/jimmunol.1800122

Delgado, M. and Ganea, D., 2013. Vasoactive intestinal peptide: A neuropeptide with pleiotropic immune functions. Amino Acids, 45: 25-39. https://doi.org/10.1007/s00726-011-1184-8

Deng, G. and Jin, L., 2017. The effects of vasoactive intestinal peptide in neurodegenerative disorders. Neurol. Res., 39: 65-72. https://doi.org/10.1080/01616412.2016.1250458

Foster, N, Hulme, S.D. and Barrow, P.A., 2006. Vasoactive intestinal peptide (VIP) prevents killing of virulent and phoP mutant Salmonella typhimurium by inhibiting IFN-γ stimulated NADPH oxidative pathways in murine macrophages. Cytokine, 36: 134-140. https://doi.org/10.1016/j.cyto.2006.11.005

Fu, D., Senouthai, S., Wang, J. and You, Y., 2019. Vasoactive intestinal peptide ameliorates renal injury in a pristaneinduced lupus mouse model by madulating Th17/Treg balance. BMC Nephrol., 20: 350. https://doi.org/10.1186/s12882-019-1548-y

Gonzalez-Rey, E., Chorny, A. and Delgado, M., 2007. Regulation of immune tolerance by anti-inflammatory neuropeptides. Nat. Rev. Immunol., 7: 52-63. https://doi.org/10.1038/nri1984

Ibrahim, H., Askar, B., Barrow, P. and Foster, N., 2018. Dysregulation of JAK/STAT genes by vasoactive intestinal peptide (VIP) in Salmonella-infected monocytes may inhibit its therapeutic potential in human sepsis. Cytokine, 105: 49-56. https://doi.org/10.1016/j.cyto.2018.02.014

Ibrahim, H., Barrow, P. and Foster, N., 2012. VIP as a potential therapeutic agent in gram negative sepsis. Endocr. Metab. Immune Disord. Drug Targets, 12: 308-315. https://doi.org/10.2174/187153012803832611

Iwasaki, M., Akiba, Y. and Kaunitz, J.D., 2019. Recent advances in vasoactive intestinal peptide physiology and pathophysiology: focus on the gastrointestinal system. F1000 Res., 8: 1629. https://doi.org/10.12688/f1000research.18039.1

Jayawardena, D., Anbazhagan, A.N., Guzman, G., Dudeja, P.K. and Onyuksel, H., 2017. Vasoactive intestinal peptide nanomedicine for the management of inflammatory bowel disease. Mol. Pharm., 14: 3698-3708. https://doi.org/10.1021/acs.molpharmaceut.7b00452

Jayawardena, D., Guzman, G., Gill, R.K., Alrefai, W.A., Onyuksel, H. and Dudeja, P.K., 2017. Expression and localization of VPAC1, the major receptor of vasoactive intestinal peptide along the length of the intestine. Am. J. Physiol. Gastrointest. Liver Physiol., 313: G16-G25. https://doi.org/10.1152/ajpgi.00081.2017

Jimeno, R., Gomariz, R.P., Gutiérrez-Cañas, I., Martínez, C., Juarranz, Y. and Leceta, J., 2010. New insights into the role of VIP on the ratio of T-cell subsets during the development of autoimmune diabetes. Immunol. Cell Biol., 88: 734-745. https://doi.org/10.1038/icb.2010.29

Jönsson, M., Norrgård, O. and Forsgren, S., 2012. Epithelial expression of vasoactive intestinal peptide in ulcerative colitis: down-regulation in markedly inflamed colon. Digest. Dis. Sci., 57: 303-310. https://doi.org/10.1007/s10620-011-1985-3

Kasacka, I., Piotrowska, Ż. and Janiuk, I., 2015. Influence of renovascular hypertension on the distribution of vasoactive intestinal peptide in the stomach and heart of rats. Exp. Biol. Med., 240: 1402-1407. https://doi.org/10.1177/1535370215587533

Li, C., Zhu, F., Wu, B. and Wang, Y., 2017. Vasoactive intestinal peptide protects salivary glands against structural injury and secretory dysfunction via IL-17A and AQP5 regulation in a model of Sjögren syndrome. Neuroimmunomodulation, 24: 300-309. https://doi.org/10.1159/000486859

Montagnese, C.M., Székely, T., Csillag, A. and Zachar, G., 2015. Distribution of vasotocin and vasoactive intestinal peptide-like immunoreactivity in the brain of blue tit (Cyanistes coeruleus). Front. Neuroanat., 9: 90. https://doi.org/10.3389/fnana.2015.00090

Moody, T.W., Nuche-Berenguer, B. and Jensen, R.T., 2016. Vasoactive intestinal peptide/pituitary adenylate cyclase activating polypeptide, and their receptors and cancer. Curr. Opin. Endocrinol. Diabetes Obes., 23: 38-47. https://doi.org/10.1097/MED.0000000000000218

Radfar, M.H., Asl, E.N., Seghinsara, H.R., Dehaghi, M.M. and Fathi, S., 2012. Biodiversity and prevalence of parasites of domestic pigeons (Columba livia domestica) in a selected semiarid zone of South Khorasan, Iran. Trop. Anim. Hlth. Prod., 44: 225-229. https://doi.org/10.1007/s11250-011-0002-3

Ruff, M., 1993. External and internal factors affecting the severity of avian coccidiosis. In: Proc. Sixth Int. Coccidiosis Conf., pp. 73-79.

Said, S.I. and Mutt, V., 1970. Polypeptide with broad biological activity: Isolation from small intestine. Science, 169: 1217-1218. https://doi.org/10.1126/science.169.3951.1217

Shi, H., Carion, T.W., Jiang, Y., Steinle, J.J. and Berger, E.A., 2016. VIP protects human retinal microvascular endothelial cells against high glucose-induced increases in TNF-α and enhances RvD1. Prostaglandins Other Lipid Mediat., 123: 28-32. https://doi.org/10.1016/j.prostaglandins.2016.03.001

Tan, Y.V, Abad, C., Wang, Y., Lopez, R. and Waschek, J.A., 2015. VPAC2 (vasoactive intestinal peptide receptor type 2) receptor deficient mice develop exacerbated experimental autoimmune encephalomyelitis with increased Th1/Th17 and reduced Th2/Treg responses. Brain Behav. Immun., 44: 167-175. https://doi.org/10.1016/j.bbi.2014.09.020

Verma, A.K., Manohar, M., Venkateshaiah, S.U. and Mishra, A., 2017. Neuroendocrine cells derived chemokine vasoactive intestinal polypeptide (VIP) in allegic diseases. Cytokine Growth Factor Rev., 38: 37-48. https://doi.org/10.1016/j.cytogfr.2017.09.002

Villanueva-Romero, R., Gutiérrez-Cañas, I., Carrión, M., Pérez-García, S., Seoane, I.V., Martínez, C., Gomariz, R.P. and Juarranz, Y., 2018. The anti-inflammatory mediator, vasoactive intestinal peptide, modulates the differentiation and function of Th subsets in rheumatoid arthritis. J. Immunol. Res., 2018: 1-11. https://doi.org/10.1155/2018/6043710

Wu, X., Conlin, V.S., Morampudi, V., Ryz, N.R., Nasser, Y., Bhinder, G., Bergstrom, K.S., Yu, H.B., Waterhouse, C.C.M., Buchan, A.M.J., Popescu, O.E., Gibson, W.T., Waschek, J.A., Vallence, B.A. and Jacobson, K., 2015. Vasoactive intestinal polypeptide promotes intestinal barrier homeostasis and protection against colitis in mice. PLoS One, 10: e0125225. https://doi.org/10.1371/journal.pone.0125225