Research Article

 

Molecular and Phenotypic Characterization of Antimicrobial Resistance in Gram Negative Bacteria Recovered from Subclinical Mastitis

 

Gamal Younis, Amal Awad*, Nour Ashraf

Department of Bacteriology, Mycology and Immunology; Faculty of Veterinary Medicine; Mansoura University; Mansoura, 35516, Egypt.

 

Editor | Kuldeep Dhama, Indian Veterinary Research Institute, Uttar Pradesh, India.

Received | February 15, 2017; Accepted | April 14, 2017; Published | April 21, 2017

*Correspondence | Amal Awad, Department of Bacteriology, Mycology and Immunology; Faculty of Veterinary Medicine; Mansoura University; Mansoura, 35516, Egypt; Email: amalabdo@mans.edu.eg

Citation | Younis G, Awad A, Ashraf N (2017). Molecular and phenotypic characterization of antimicrobial resistance in gram negative bacteria recovered from subclinical mastitis. Adv. Anim. Vet. Sci. 5(5): 196-204.

DOI | http://dx.doi.org/10.17582/journal.aavs/2017/5.5.196.204

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2017 Younis et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

Introduction

 

Mastitis is consider the common infectious disease affects dairy cattle and cause numerous losses on the dairy production. Large part of this cost is not related to cows with clinical mastitis but it is the result of sub clinically mastitic cow with consequent decrease in milk production (Ott and Novak, 2001). Clinical mastitis has apparent symptoms but SCM has concealed symptoms most farmers are ignorant of it. SCM has direct and indirect significances which causes serious economical loss for the farmers (Godkin et al., 1990). The major economic losses are caused by decrease in milk production, premature culling and treatment costs which account for 78, 14 and 8% of the total loss, respectively (Scheprs and Dijkhuizen, 1991). Another significant economic loss is due to extra work for the farmer.

 

Coliforms, i.e. E. coli and Klebsiella spp., are natural intestinal flora of the bovine (Sandholm and Pyörälä, 1995). It is spread and contaminates the environment through faeces, and contaminates bovine udder and subsequently results in clinical and subclinical mastitis.

 

Multiple drug resistance of mastitis pathogens has been stated worldwide (Waller et al., 2011; Chaudhary and Payasi, 2013). This is because of impromptu use of the antibiotics by farmers either to improve animal performance or in treatment. The emergence of MDR especially those exhibiting resistance to cephalosporins due to production beta- lactamases has attracted attention worldwide. Antimicrobial resistance mechanism can be spread by genetic mutation which occur at low rate and acquistation to a lot of genes that mediate the resistance to their host microorganism, this acquistation of resistant gene is the main contributor for spreading of antimicrobial resistance and this occur either by horizontal transfer or vertical transfer, the horizontal transfer include: mobile genetic parts such as plasmid and transpons (Xu et al. 2012), integron also have been documented to play major role in spreading of the resistant genes (Hall and Collis, 1995; Mazel, 2006).

 

The purpose of this study was to investigate the prevalence of SCM in dairy farms in Dakahlia governorate, Egypt. Furthermore, to identify gram negative pathogens, determine their antibiotic susceptibility phenotypes with detection of β-lactamase encoding genes, sulphonamide encoding gene and integron classes.

 

Materials and methods

 

Samples Collection

 

A total of 180 milk samples were collected from 3 different dairy farms located in the district of Mansoura city, Dakahlia,Egypt. 15 randomly selected animal from each farm, four samples were collected from the 4 quarters of each animal with no signs of clinical mastitis. Milk samples were tested physically and with CMT to reveal subclinical mastitis prevalence. The samples were collected under aseptic condition,briefly; the udder was washed with warm water, dried and the teat disinfected with 70% alcohol. About15 ml discarded from the fore milk and the next 15 ml collected into screw cap bottles and transported to the laboratory on ice box. Samples were stored at 4ºC from the time of collection until time of examination.

 

Bacteriological Examination

 

Bacterial culture and isolation were performed at the Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Mansoura University, Egypt. For bacteriological examinations, Milk samples were centrifuged for 15 minutes at 3000 rpm and a loopful was sampled from the sediment and inoculated on MacConkey’s agar. The inoculated plates were then incubated at 37◦C for 24 and 48hr and the isolates were identified conventionally according to (Edwards and Ewing, 1986).All gram negative bacterial isolates were confirmed biochemically using API 20E system (BioM´erieux, Marcy-l’´Etoile, France)

 

Antimicrobial Susceptibility Testing:

 

All bacterial isolates were screened for their antibiotic susceptibility against 11 antibiotic agents by disc diffusion method on Mueller-Hinton agar (Oxoid Ltd.) using the following disks (Oxoid) amoxacillin (AX; 25μg),doxytetracyclin (DO; 30μg), Rifapime (RA; 5 μg), chloramphenicol (C; 30 μg), azithromycin (AZM; 15μg), sulphamethoxazole-trimethoprim (SXT; 25μg), gentamycin (CN;10μg), levofloxacin(LEV; 10 μg), norfloxacin (NOR; 10μg),vancomycin (VA; 30μg), clindamycin( DA; 10 μg). The inhibition zones were scored as sensitive, intermediate susceptibility and resistant according to the Clinical and Laboratory Standards Institute guidelines (CLSI, 2010). The isolates were defined as multidrug-resistant if they exhibited resistance to three or more different antimicrobials classes (Magiorakos et al., 2012).

 

Molecular Characterization of Antibiotic Resistant Genes

 

Bacterial DNA for PCR analysis was prepared using a Genomic DNA purification kit QIAamp DNA Mini Kit Catalogue no.51304 according to the manufacturer’s instructions. The presence of genes associated with resistance to sulfonamides (sul1), beta-lactams (blaSHV, blaTEM, blaCTX) were determined by PCR and the set of primers from Metabion (Germany), used for each gene is shown in Table 1. Preparation of PCR Master Mix according to Emerald Amp GT PCR mastermix (Takara) Code No. RR310A kit: PCR reactions were performed in a total volume of 25 µl, including template DNA (6μl), forward and reverse primers (1μl), 12.5μl of Emerald Amp GT PCR mastermix (2x premix) and 4.5μl of PCR grade water. Amplification reactions were carried out using Applied Bio systems 96-well thermal cycler. Temperature and time conditions of each primer during PCR are demonstrated in Table 2. Electrophoresis of amplified products was carried out using 1.5% agarose gel stained with ethidium bromide and detected by UV transillunination. Amplified genes were identified on the basis of fragment size.

 

Screening for Class 1 and Class 2 Integrons

 

Genomic DNA was extracted using QI Aprep Spin Miniprep Kits Catalogue no. 27104 following the user instruction. PCR amplification of classes 1 and 2 integrase genes was performed in 25 μL reaction mixtures including, 1 μl of each primer (Metabion, Germany) (Table 1), Template DNA (6μl), 12.5μl of Emerald Amp GT PCR mastermix (2x premix) and 4.5μl of PCR grade water,. Amplifications were performed in a Thermal Cycler (Applied Bio systems 96-well) using the program mentioned in Table 2. The amplified PCR products were separated by electrophoresis in 1% agarose gels and visualized after staining with ethidium bromide.

 

Table 1: Primers sequence used in PCR assay

 

Primer	Sequence	Amplified product	Reference
blaTEM	ATCAGCAATAAACCAGC	516 bp	Colom et al., (2003)
	CCCCGAAGAACGTTTTC
blaSHV	AGGATTGACTGCCTTTTTG	392 bp
	ATTTGCTGATTTCGCTCG
Sul1	CGGCGTGGGCTACCTGAACG	443 bp	Sabarinathet al., 2011
	GCCGATCGCGTGAAGTTCCG
Int1	CCTCCCGCACGATGATC	280 bp	Kashif et al., (2013)
	TCCACGCATCGTCAGGC
Int2	TTATTGCTGGGATTAGGC	250 bp
	ACGGCTACCCTCTGTTATC
blaCTX	ATG TGC AGY ACC AGT AAR GTK ATG GC	593 bp	Archambault et al., (2006)
	TGG GTR AAR TAR GTS ACC AGA AYC AGC GG

 

Results

 

A total of 180 milk samples from 3 different dairy farms were tested. Of these, 55.56% (100/180) affected with subclinical mastitis after testing by CMT. A total of 35 gram negative bacterial isolates have been recovered including, E. coli 28.57% (10/35) followed by K.pneumonia 14.28% (5/35), P. mirabilis 11.42% (4/35) S. liquefaciens 8.57% (3/35), E. agglomerans 2.85%(1/35), E. aerogenes 8.57% (3/35), C. diversus 2.85% (1/35), C. freundii 5.7% (2/35), E. cloacae 2.85% (1/35), ,P. retttgeri 5.7% (2/35),, P. vulgaris 5.7% (2/35), Y. enterocolitica 2.85% (1/35) (Table 3).

 

Antimicrobial susceptibility tests were conducted on the 35 gram negative bacterial isolates identified in this study. Variable resistance patterns were seen among the used antibiotics (Table 4). Bacterial isolates were showing a high resistance to amoxicillin 35(100%), clindamycin 31(88.75%), rifapime 28(80%), trimethoprim/sulfamethoxazole 26 (74.3%), vancomycin 24(68.6%), a moderate resistance to azithromycin18(51.4%), gentamycin 17(48.6%), doxycycline 17(48.6%), chloramphenicol 13(37.1%) and a low resistance to norofloxacin 6(17.14%) and levofloxacin 3(8.57%) (Table 3). All bacterial isolates revealed MDR.

 

Genetically, all 35 gram negative bacterial isolates were screened for the presence of β-lactamase encoding genes (blaTEM, blaSHV, blaCTX) and sulfonamide encoding gene (sul1). The detection rate of β-lactamases resistance genes

 

Table 2: Cycling conditions of the different primers during PCR

 

Gene	Primary denaturation	Secondary denaturation	Annealing	Extension	No. of cycles	Final extension
blaTEM	94˚C 5 min.	94˚C 30 sec	54˚C 45 sec	72˚C 45 sec	35	72˚C 10 min.
blaSHV	94˚C 5 min.	94˚C 30 sec	54˚C 45 sec	72˚C 45 sec	35	72˚C 10 min.
sul1	94˚C 5 min.	94˚C 30 sec.	60˚C 45 sec	72˚C 45 sec	35	72˚C 10 min.
Int2	94˚C 5 min.	94˚C 30 sec.	50˚C 30 sec.	72˚C 30 sec.	35	72˚C 7 min.
Int2	94˚C 5 min.	94˚C 30 sec.	48˚C 30 sec.	72˚C 30 sec.	35	72˚C 7 min.
blaCTX	94˚C 5 min.	94˚C 30 sec	60˚C 45 sec	72˚C 45 sec	35	72˚C 10 min.

 

Table 3: Distribution of different bacteria isolates in cow’s milk samples.

 

Bacteria	Number	Percentage
E. coli	10	28.57%
Klebsiella pneumonia	5	14.28%
Proteus mirabilis	4	11.42%
Providencia rettgeri	2	5.7%
Proteus vulgaris	2	5.7%
Serratia liquefaciens	3	8.57%
Enterobacter agglomerans	1	2.85%
Yersinia enterocolitica	1	2.85%
Citrobacter freundii	2	5.7%
Enterobacter cloacae	1	2.85%
Enterobacter aerogenes	3	8.57%
Citrobacter diversus	1	2.85%
Total	35	100%

 

was higher; blaTEMwas detected in all gram negative strains, blaSHV was detected in 80% (28/35) meanwhile blaCTX was found in 60% (21/35).sul1 was detected 28 (80%) isolates. Regarding to integron classes, Class 1 integron was detected in 91.4% (32/35) and Class 2 integrons could not be identified in all the gram negative isolates.

 

Discussion

 

In this study the prevalence of subclinical mastitis is 55.56% (100/158) this high prevalence agrees with an earlier report by (Chye et al., 2004; Marimuthu, 2014) who suggested that the high prevalence of subclinical mastitis was possibly as a result of unhygienic milking practices, In our study we focused on gram negative bacteria recovered

 

from examined samples. a variety of gram negative bacterial spp. have been recovered from cow’s milk samples,E.coli was the most common in between gram negative bacteria isolates 10 (28.57%). These results agreed with several previous studies (Gianneechini, 2002; Makovee and Ruegg, 2003; Malinowski, 2006). The high incidence of E.coli that cause mastitis in our study may be due to post milking teat dipping and the usual use of drugs in dry period, which effect on contagious Gram positive bacteria not on environmental one such as E.coli (Fang and Pyoralai, 1996).

 

 

 

Table 4: Percentage of antimicrobial resistance in bacterial isolates:

 

Antimicrobial drug	Code	Antimicrobial class	Sensitive	Resist
Gentamycin	CN	Aminoglycosides	18(51.4%)	17(48.6%)
Levofloxacin	LEV	Quinolones	32(91.4%)	3(8.57%)
Norofloxacin	NOR	Quinolones	29(82.85%)	6(17.14%)
Vancomycin	VA	Glycopeptide	8(22.9%)	27(77.14%)
Trimethoprim/sulfamethoxazole	SXT	Sulphonamides	9(25.7%)	26(74.3%)
Doxycycline	DO	Tetracyclines	18(51.4%)	17(48.6%)
Clindamycin	DA	Lincosamides	4(11.4%)	31(88.75%)
Amoxicillin	AX	ß-Lactam	0.00	35(100%)
Rifapime	RA	Rifamycin	7(20%)	28(80%)
Chloramphenicol	C	Phenicols	22(62.85%)	13(37.1%)
Azithromycin	AZM	Macrolides	17(48.6%)	18(51.4%)

 

Table 5: Antimicrobial resistance profiles and resistance gene pattern of gram negative bacterial isolates.

 

Samples	Strain	Integron class 1	Integron class 2	Antibiotic resistance pattern	Resistance genes
1	E.coli	+	-	AX, RA, STX, CN, VA.	TEM, CTX, SUL1
2	E.coli	+	-	AX, DO,RA,AZM,SXT,CN,NOR,VA, OX	TEM,CTX,SUL1
3	E.coli	+	-	AX,RA,AZM,STX,CN,VA.	TEM,SHV,CTX,SUL1
4	E.coli	+	-	AX,DO,RA,SXT,CN,LEV,NOR,VA.	TEM,SHV,CTX,SUL1
5	E.coli	+	-	AX,DO,RA,C,AZM,SXT,VA.	TEM,SHV,CTX,SUL1
6	E.coli	+	-	AX,DO,RA,SXT,CN,RF,NOR,VA,OX	TEM,SHV,SUL1
7	E.coli	+	-	AX,C,AZM,SXT,CN,NOR,OX.	TEM,SHV,SUL1
8	E.coli	+	-	AX,DO,CN,LEV,VA.	TEM,SHV,SUL1
9	E.coli	+	-	AX,SXT,CN,VA.	TEM,SHV,CTX,SUL1
10	E.coli	+	-	AX,RA,C,AZM,SXT,VA,OX.	TEM,SHV,CTX,SUL1
11	K.pneumoniae	+	-	AX,RA,SXT,CN	TEM,SHV ,SUL1
12	K.pneumoniae	+	-	AX,RA,SXT,RF,VA.	TEM,SHV,CTX,SUL1
13	K.pneumoniae	+	-	AX,RA,SXT,CN	TEM,SHV,SUL1
14	K.pneumoniae	+	-	AX,RA,C,STX,CN,NOR.	TEM,SHV,CTX,SUL1
15	K.pneumoniae	+	-	AX,RA,VA.	TEM,SHV,SUL1
16	P.mirabilis	+	-	AX,RA,SXT,CN,VA.	TEM,SHV,CTX,SUL1
17	P.mirabilis	+	-	AX,RA,RF,OX.	TEM,SHV,CTX
18	P.mirabilis	+	-	AX,RA,C,CN.	TEM,SHV,CTX,SUL1
19	P.mirabilis	+	-	AX,DO,RA,C,AZM,CN,VA.	TEM,CTX
20	S.liquefaciens	+	-	AX,DO,SXT,RA,C,AZM,VA.	TEM,SHV,CTX,SUL1
21	S.liquefaciens	+	-	AX,DO,RA,C, SXT.	TEM,SHV,CTX,SUL1
22	S.liquefaciens	-	-	AX,RA,SXT,VA.	TEM,SHV,SUL1
23	E.aerogenes	-	-	AX,DO,C,AZM,SXT,VA,OX.	TEM,SHV,SUL1
24	E.aerogenes	-	-	AX,RA,AZM,VA,OX.	TEM,SHV,CTX,SUL1
25	E.aerogenes	+	-	AX,DO,RA,C,RF,AZM,VA.	TEM,SHV,SUL1
26	P.rettgeri	+	-	AX,DO,RA,AZM,SXT,VA	TEM,CTX,SUL1
27	P.rettgeri	+	-	AX,AZM,SXT,CN,NOR,OX.	TEM,SHV,CTX.
28	C.freundii	+	-	AX,DO,RA,C,AZM,SXT,VA,	TEM, CTX,SUL1
29	C.freundii	+	-	AX,DO,RA,AZM,SXT,VA.	TEM,SHV,CTX
30	P.vulgaris	+	-	AX,DO,C,RF,VA.	TEM,SHV
31	P.vulgaris	+	-	AX,RA,AZM,SXT,VA.	TEM,CTX,SUL1
32	E. agglomerans	+	-	AX,DO,RA,AZM,SXT,CN,LEV,VA,OX.	TEM,SHV,CTX,SUL1
33	E.cloacae	+	-	AX,DO,RA,AZM,SXT, VA	TEM,SUL1
34	Y.enterocolitica	+	-	AX,DO, RA,C,SXT,CN,VA.	TEM,SHV,SUL1
35	C.diversus	+	-	AX, AZM,VA.	TEM,SHV,SUL1

 

In addition, it may be attributed to lower hygienic measures and the high contamination of bedding that result in udder infection come from fecal contamination from the contaminant beddings (Liebiseh et al., 1994) Furthermore K. Pneumoniae was recorded in our study with incidence of 14.28% which is higher than the result reported by (Lalrinthuanga et al., 2003) and lower than (Katsande et al., 2013).

 

Due to excessive use of antibiotic leads to appearance of multidrug resistance (MRD) phenomenon. Which lead to blocking the ability of antimicrobial agents in treating the infectious diseases (Martinez and Baquero, 2002). The antimicrobial resistance of bacteria is consider one of the most dangerous public health that the animal which carry antibiotic resistance bacteria affect human health as enter human food chain through consuming meat and any other animal products, By water run off from farms and any other pathways (Collignon et al., 2005).

 

 

 

 

The multidrug resistant pathogens which have ability to pile up resistance genes are the main cause of defeat in treatment of infectious diseases this lead to increasing rate of morbidity and mortality, and a larger economic loss, for health care apparatus and individuals (Lipsitch et al., 2002). All GNB (35%) isolated were multidrug resistance. Findings of our study are higher than the result of (Hammad and Shimamoto, 2011) who recorded that 4 out a total of 75 isolates (5.3%) only seen to be multidrug resistant.

 

In many countries the bacteria isolated from bovine mastitis show resistant phenotypes; Even though, there is difference in the resistance patterns of bacterial groups among the countries, which may demonstrate differences in anti-microbial treatment (Bengtsson et al., 2009; Hawari and Al-Dabbas 2008; Lipsitch et al., 2002). The level of resistance of certain antibiotics in GNB this may explained by excessive use of these antibiotics in treatment of animal in Egypt.

 

Resistance of sulfonamide in gram negative bacteria isolated from human, animals, world wide show high prevalence (Moreno et al., 2006). In our study the prevalence of sul1 encoding gene was 85.7% (Figure 1) which was higher that of (Arabi et al., 2015) who recorded sul1 in 81% of resistant isolates also (Hindi et al., 2013) who detected sul1 in 15% of the examined samples and (Antunes et al., 2005) reported sul1 in 76% of resistant sulfonamides isolates. The resistance to sulfonamides in gram negative bacteria result from acquisition of either two genes of sul1 or sul2 that code (DHPS) which resist this drug. Most multi-resistant gram-negative bacteria harbor Class 1 integrons which carry the sul1 gene (Liu et al., 2009)

 

Phenotypically, GNB have high resistance to large number of antimicrobials agent used in this study. Particularly, β-lactams, GNB have 100% resistant to amoxicillin and this resistance properties associated with 100%, 80% and 60% prevalence of blaTEM, blaSHV and blaCTX (Figure 2, 3 and 4) This is may be due to the ability of many of the enterobacteriaceae to have internsic resistance to β-lactams by releasing β-lactamases (Susic, 2004) which break the β-lactam ring and stop the action of antibiotic. SHV-, OXA-,TME-, .CMY-, and CMT-M are the most dominant β- lactamases in Gram-negative bacteria. In our study, blaTEM found in all isolates (100%) that agree with (Medina et al., 2011) who reported that 97.1% of E.coli isolates (226) recovered from lambs affected with diarrhea and from healthy sheep had blaTEM, and (Bailey et al., 2006) who detected blaTEM in all E.coli strains (25) which recovered from faecal flora of healthy humans. Higher than the result of (Park et al., 2005) who detected blaTEM taken from E.cloacae, C.freundii, S.marcescens. also (Hammad and Shimamoto, 2011) who identify blaTEM in 26% of E.coli and K.pneumonia isolates (23) from milk samples. SHV- defined as one of ESBLs which encoded by chromosomal genes in isolates of K. pneumonaie spread by mobile element as plasmids between microbial societies, particularly Enterobacteriaceae family (Paterson and Bonomo, 2005). In this study, SHV-was detected in 80% of the tested isolates which was higher than (Arabi et al., 2013)who reported 53.2% of ESBL –producing isolates have blaSHV. Also, (Tasli and Bahar, 2005) who revealed SHV-in 74.3%. The blaCTX-M is one of the most prevalent ESBLs genes. In this study, blaCTX -gene found 21 isolates of 35 gram negative bacteria (60%). The higher result recorded by (Geser et al., 2012) reported that 78 isolates (85.7%) had CTX- gene fom E.coli, E.cloacae and C.youngae isolates taken from milk samples in Switzerland (Tinelli et al., 2012). In another study carried out by (Valenza et al., 2014) 95.2% of E.coli isolates had CTX-M gene.

 

Integrons play major role in the prevalence of antibiotic resistance genes among GNB (Rowe-Magnuset al., 2011)Class 1 integrons are spread widely among isolates of family Enteobacteriaceae from animal and human origin. Class1 integrons are the more common and well characterized type (Goldsteinet al., 2001) In our study, class1 integron was detected in 91.4 % of Gram negative isolates, (Figure 5) this result was higher than the result of (Seputeine et al., 2010) who reported that 40% of E.coli that antibiotic resistant load class1 integrons and (Dessie et al., 2013) recorded that E.coli isolated from poultry in Korea carry 54(54.5%) of class 1 integrons. (Wang et al., 2008) identify class1 integron in (56.9%) of E.coli isolated from bovine mastitis. Also (Ahmed and Shimamoto, 2011) found that gram negative bacteria isolated from bovine mastitis in Egypt carry class1 integron. Class 2 integron did not identified in all tested isolates which agreed with the result of (Wang et al., 2008) who could not identify class 2 integron in E.coli from bovine mastitis in Inner Mongolia.While (Ahmed and Shimamoto, 2011) detected class 2 integron in 6 (5.4%) isolates of gram negative bacteria isolated from bovine mastitis in Egypt. Our results revealed a strong relation between multi drug resistance and the high prevelence of class 1 integron.

 

Conclusion

 

In Conclusion, mastitis causing economic problem in dairy industry, and the good treatment based on the selection of the suitable antimicrobial drugs. So that, the antibiotic susceptibilities of bacteria recovered from mastitis must be observed periodically. Molecular characterization to this resistance play role in limiting the emergence of this resistance and subsequently decrease the risk of dissemination of resistance bacteria through the food chain.

 

Acknowledgments

 

We acknowledged Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Mansoura University, Egypt for support and supply of instruments and devices.

 

Author’s Contribution

 

G. Y. designed the experiment and revised the manuscript; A.A performed the tests, analyzed and interpreted the data, and wrote the manuscript. N.A collected samples, isolated strains and participated in manuscript writing. All authors approved the final version of the manuscript for publication.

 

Conflict of interest

 

The authors declare that there is no conflict of interest.

 

References

 

Ahmed AM, Shimamoto T (2011). Molecular characterization of antimicrobial resistance in Gram-negative bacteria isolated from bovine Mastitis in Egypt. The Societies and Blackwell Publishing Asia Pty Ltd. 55(5): 318–327. https://doi.org/10.1111/j.1348-0421.2011.00323.x

Antunes P, Machado J, Sousa JC, Peixe L (2005). Dissemination of sulfonamide resistance genes (sul1, sul2, and sul3) in Portuguese salmonella enterica strains and relation with integrons. Amer. Soc. Microbio. 49(2): 836-839. https://doi.org/10.1128/aac.49.2.836-839.2005

Arabi H, Pakzad I, Ayat N, Hosainzadegan H, Azizi F, Taherikalani M, Samadi N, Sefidan AM (2015). Sulfonamide resistance genes sul M in extended spectrum beta lactamase(ESBL)and non ESPL producing Escherichia coli isolated from Iranian hospitals. Jundishapur J. Microbial. 8(7): 19961. https://doi.org/10.5812/jjm.19961v2

Archambault M, Petrov P, Hendriksen RS, Asseva G, Bangtrakulnonth A, Hasman H, Aarestrup FM (2006).Molecular characterization and occurrence of extended-spectrum beta-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgar https://doi.org/10.1089/mdr.2006.12.192 ia, and Denmark. Microb Drug Resist. 12(3): 192-8.

Bailey, J.K., Pinyon, J.L., Anantham, S. and Hall, R.M. (2006) Distribution of the blaTEM gene and blaTEM containing transposons in commensal Escherichia coli.J. Antimicrob Chemother. 66(4): 745-751. https://doi.org/10.1093/jac/dkq529

Bengtsson B, Unnerstad HE., Ekman T, Artursson K, Nilsson M, Waller KP (2009). Anti-microbial susceptibility of udder pathogens from cases of acute clinical mastitis in dairy cows.Vet. Microbial.136: 142-149. https://doi.org/10.1016/j.vetmic.2008.10.024

Bradford PA (2001) Extended-spectrum β-lactamases in the 21 stcentury: characterization, epidemiology, and detection of this important resistance threat. Clin. Microbiol. Rev. 14: 933–951. https://doi.org/10.1128/CMR.14.4.933-951.2001

Chaudhary M, Payasi A (2013) Prevalence of heterogeneous glycopeptide intermediate resistance in methicillin-r https://doi.org/10.3844/ajidsp.2013.63.70 esistant Staphylococcus aureus. Am. J. Infect. Dis. 9: 63-70.

Chye FY, Abdullah A, Ayob MK (2004). Bacteriological quality and safety of raw milk in Malaysia. Food Microbiol. 21: 535-541. https://doi.org/10.1016/j.fm.2003.11.007

Collignon P, Wegener HC, Braam P, Butler CD (2005). The routine use of antibiotics to promote animal growth does little to benefit protein under nutrition in the developing world. Clin. Infect.Dis. 41: 1007-1013. https://doi.org/10.1086/433191

Clinical and Laboratory Standards Institute (2010). Performance standards for antimicrobial susceptibility testing; 20th informational supplement M100-S20 CLSI, Wayne, PA.

Colom K, Pèrez J, Alonso R, Fernández-Aranguiz A, Lariňo E, Cisterna R (2003). Simple and reliable multiplex PCR assay for detection of blaTEM,blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett. 223 (2003): 147-151. https://doi.org/10.1016/S0378-1097(03)00306-9

Dessie HK, Bae DH, Lee YJ (2013). Characterization of integrons and their cassettes in Escherichia coli and Salmonella isolates from poultry in Korea. Poult. Sci. 92 (11): 3036-3043. https://doi.org/10.3382/ps.2013-03312.

Edwards PR, Ewing WH (1986). Edwards and Ewing’s Identification of Enterobacteriaceae, 4th edn. New York: Elseviers Science Publishing Co., Inc.

Fang W, Pyoralai S (1996). Mastitis causing Escherichia coli : Serum sensitivity and susceptibility to selected anti bacterials in milk. J. Dairy. Sci. 79(1): 76-82. https://doi.org/10.3168/jds.s0022-0302(96)76336-1.

Geser N, Stephan R, Hächler H (2012). Occurrence and characteristics of extended-spectrum β-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet. Res. 8: 21. https://doi.org/10.1186/1746-6148-8-21.

Gianneechini R, Concha C, Rivero R, Delucci I, Moreno J (2002). Occurrence of clinical and sub-clinical mastitis in dairy herds in theWestLittoral region in Uruguay. Aeta Vet. Scand. 43(4): 221:230.

Godkin A, Leslie K, Martin W (1990). Mastitis in bulk tank milk culture in Ontario. Highlights. 13(2):13-16.

Goldstein C, Lee M.D, Sanchez S, Hudson C, Phillips B, Register B, Grady M, Liebert C, Summers AO, White DG, Maurer JJ (2001). Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother. 45: 723-726. https://doi.org/10.1128/AAC.45.3.723-726.2001

Hall RM, Collis CM (1995). Mobile gene cassettes and integrons: capture and spread of genes by site-specific recombination. Mol. Microbiol. 15: 593–600. https://doi.org/10.1111/j.1365-2958.1995.tb02368.x

Hammad AM, Shimamoto T (2011). Asymptomatic Intramammary Infection with Multidrug-Resistant Gram-Negative Bacteria in a Research Dairy Farm: Incidence and Genetic Basis of Resistance. J. Vet. Med. Sci. 73(8): 1089-92. https://doi.org/10.1292/jvms.10-0361

Hawari AD, Al-Dabbas F (2008). Prevalence and distribution of mastitis pathogens and their resistance against anti-microbial agents in dairy cows in Jordan. Am. J. Anim. Vet. Sci. 3: 36-39. https://doi.org/10.3844/ajavsp.2008.36.39

Hindi AK, Shubbar EE, Addos SA (2013). Molecular study on distrbution of Sul1and sul2 genes among salmonella enterica causing enteric fever.Magazine of Al kufa. Uni. Biol. 5(2): 2073-8854.

Kashif J, Buriro R, Memon J, Yaqoob M, Soomro J, Dongxue D, Jinhu H, Liping W (2013). Detection of Class 1 and 2 Integrons, β-Lactamase Genes and Molecular Characterization of Sulfonamide Resistance in Escherichia coli Isolates Recovered from Poultry in China. Pak. Vet. J. 33(3): 321-324

Katsande S, Matope G, Vdengu M, Pfukenyi DM (2013). Prevalence of mastitis in dairy cows from small holder farms in Zimbabwe. J. Vet. Res. 80(1): 1-7.

Lalrinthuanga C, Ralte EL, Hmarkung A (2003). Incidence of mastitis , bacteriology, antibiogram in dairy cattle in Aizawl,Mizoram. Ind. Vet. J. 80 (9): 931-932.

Liebiseh G, Dorn H, Liebiseh A (1994). Control of files and summer mastitis in grazing cattle by use of cyfluthriu- societa. Italiana di Buliatra.1: 765-768.

LipsitchM, Singer RS, Levin BR (2002). Antibiotics in agriculture: when is it time to close the barn door? PNAS. 99: 5752-5754. https://doi.org/10.1073/pnas.092142499

Liu W, Feng Y, Wang Y, Zou Q, Chen F, Guo J, Pen Y, Ji Y, Li Y, Hu S, Johnston, Liu G, Liu S (2009). Salmonella paratyphi C: Genetic Divergence fromSalmonella choleraesuis and Pathogenic Convergence with Salmonella typhi. Plosone. 4(2): 1-7.

Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, Paterson DL, Rice LB, Stelling J, Struelens MJ, Vatopoulos A, Weber JT, Monnet DL (2012). Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 18: 268-81. 27.

Makovee JA, Ruegg PL (2003). Results of milk samples submitted for microbiological examination examination in Wisconsin from 1994- 2001. J. Dairy. Sci. 86: 3466- 34722. https://doi.org/10.3168/jds.S0022-0302(03)73951-4

Malinowski E, Lassa H, Kłlossowska A, Smulski S, Markiewicz H,  Kaczmarowski, M (2006). Etiological agents of dairy cows mastitis in western part of Poland. Pol. J. Vet. Sci. 9: 191-194.

Marimuthu M, Abdullah FF, Mohammed NK, Poshpum SS, Adamu L, Osman AY, AbbaY, Tijjani A (2014). Prevalence and antimicrobial resistance assessment of subclinical mastitis in milk samples from selected dairy farms American J. Anim. Vet. Sci. 9 (1): 65-70. https://doi.org/10.3844/ajavsp.2014.65.70

Martinez JL, Baquero F (2002). Interaction among strategies associated with bacterial infection: pathogenicity, epidemicity and antibiotic resistance. Clin. Micro. Rev. 15(4): 647- 679. https://doi.org/10.1128/CMR.15.4.647-679.2002

Mazel D (2006). Integrons: agents of bacterial evolution. Nat. Rev. Microbio. l4: 608–620. https://doi.org/10.1038/nrmicro1462

Medina A, Horcajo P, Jurado S, De La Fuente R, Ruiz-Santa-Quiteria JA, Domı ́nguez-Bernal G, Orden JA (2011). Phenotypic and genotypic characterization of antimicrobial resistance in enterohemorrhagic Escherichia coli and atypical enteropathogenic E. coli strains from ruminants. J. Vet. Diagn. Invest. 23(1): 91 – 95. https://doi.org/10.1177/104063871102300114

Moreno E, Prats G, Sabate M, Perez T, Johnson JR, Andreu A (2006). Qui­nolone, fluoroquinolone and trimethoprim/sulfamethoxazole resistance in relation to virulence determinants and phyloge­netic background among uropathogenic Escherichia coli. J. Anti­microb. Chemother. 57(2):204–11. https://doi.org/10.1093/jac/dki468

Ott SL, Novak PR (2001). Association of herd productivity and bulk-tank somatic cell counts in US dairy herds in 1996. J. Am. Vet. Med. Assoc. 218: 1325-132. https://doi.org/10.2460/javma.2001.218.1325

Park YJ, Park SY, Oh EJ, Park JJ, Lee KY, Woo GJ, Lee K (2005). Occurrence of extended-spectrum β-lactamases among chromosomal AmpC-producing Enterobacter cloacae, Citrobacter freundii, and Serratia marcescens in Korea and investigation of screening criteria. Diagn. Microbiol. Infect. Dis. 51(4): 265–269. https://doi.org/10.1016/j.diagmicrobio.2004.11.009

Paterson DL, Bonomo RA (2005). Extended-spectrum beta-lactamases: a clinical update. Clin. Microbiol. Rev. 18(4): 657-86. https://doi.org/10.1128/CMR.18.4.657-686.2005

Rowe-Magnus DA, Guerout AM, Ploncard P, Dychinco B, Davies J, Mazel D (2001). The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. Proc. Natl. Acad. Sci. USA 98(2): 652-657. https://doi.org/10.1073/pnas.98.2.652

Sabarinath A, Tiwari KP, Deallie C, Belot G, Vanpee G, Matthew V, Sharma R, Hariharan H (2011). Antimicrobial Resistance and Phylogenetic Groups of Commensal Escherichia Coli Isolates from Healthy Pigs in Grenada. Available from: www.webmedcentral.com

Sandholm M, Pyörälä S (1995). Coliform Mastitis. In: Sandholm, M., Honkanen-Buzalski T, Kaartinen L, Pyörälä S (ed.) (University of Helsinki, Faculty of Veterinary Medicine), The Bovine Udder and Mastitis. pp. 149-160. Gummerus Kirjapaino, Jyväskylä. (ISBN 951-834-047- 1.

Scheprs JA, Dijkhuizen AA (1991). The economics of mastitis and mastitis control in dairy cattle: a critical analysis of estimates published since 1970. Prev. Vet. Med. 10: 213-224. https://doi.org/10.1016/0167-5877(91)90005-M

Seputiene V, Povilonis J, Ruzauskas M, Pavilonis, A, Suziedeliene E (2010). Prevalence of trimethoprim resistance genes in Escherichia coli isolates of human and animal origin in Lithuania. J. Med. Micro. 59(3): 315 – 322.  https://doi.org/10.1099/jmm.0.015008-0

Susic E (2004) Mechanisms of resistance in Enterobacteriaceae towards beta-lactamase anti biotics. Aeta. Med. Croatica. 58:307-312.

Tasli H, Bahar I.H (2005). Molecular characterization of TEM- and SHV- derived extended spectrum beta lactamases in hospitals – based Enterobacteriaceae in Turkey.Jpn. J. Infect. Dis. 58: 162-167.

Tinelli M, Cataldo MA, Mantengoli E, Cadeddu C, Cunietti, E, Luzzaro F, Rossolini, GM, Tacconelli E (2012). Epidemiology and genetic characteristics of extended-spectrum b-lactamase-producing Gram-negative bacteria causing urinary tract infections in long-term care facilities. J. Antimicrob. Chemother.67: 2982–2987 https://doi.org/10.1093/jac/dks300

Valenza G, Nickel S, Pfeifer Y, Eller C, Krupa E, Reindl VL, Holler C (2014). Extended-spectrum β-lactamase (ESBL) producing Escherichia coli as intestinal colonizers in the German community. Antimicrob. Agents Chemother.58(2): 1228-30. https://doi.org/10.1128/AAC.01993-13

Waller KP, Aspan A, Nyman A, PerssonY, Gronlund AU (2011). CNS species and antimicrobial resistance in clinical and subclinical bovine mastitis. Vet. Micribiol.152: 112-116. https://doi.org/10.1016/j.vetmic.2011.04.006

Wang GQ, Wu CM, Du XD, Shen ZQ, Song LH, Chen X, Shen JZ (2008). Characterization of integrons –mediated antimicrobial resistance among Escherichia coli isolated from bovine mastitis .Vet. Microbiol. 127(1-2): 73-8. https://doi.org/10.1016/j.vetmic.2007.08.003

Xu Z, Li L, Shirtliff M, Peters B, Li B, Peng Y, Alam M, Yamasaki S, Shi L (2012). Resistance class 1 integron in clinical methicillin-resistant Staphylococcus aureus strains in southern China, 2001–2006. Clin. Microbiol. Infect.17(5): 714-8. https://doi.org/10.1111/j.1469-0691.2010.03379.x