Submit or Track your Manuscript LOG-IN

5′ Flanking Region of Kappa-Casein Gene is Highly Polymorphic in Eight Dromedary Camel Breeds of Pakistan

PJZ_52_4_1623-1626

 

 

5′ Flanking Region of Kappa-Casein Gene is Highly Polymorphic in Eight Dromedary Camel Breeds of Pakistan

Masroor Ellahi Babar*

Department of Molecular Biology, Virtual University of Pakistan, Lahore, Pakistan.

ABSTRACT

Kappa-casein played critical role in the expression of milk protein. It stabilizes the milk micelle and gene 5’ flanking region which works valuably in transcription regulation. Current study illustrates that Kappa-casein gene 5︠ flanking region in Dromedary camel of Pakistan is highly polymorphic and it is phylogeneticaly linked with other mammals. The analyses of the sequence of 5︠ flanking region in various breeds reveals the presence of different polymorphic regions includes cysteine nucleotide deletion, AT bases insertion and transvertions (C>G; G>T). Deletion of A bases at c.1-1075 and hetrozygosity (CT) at the c1-1046 were analyzed along with some other SNPs are very important. These evidences points towards the change of expression of those protein which are nearest to the region of gene regulation and enhancer region. After observing taxas several distinct clads of camel breeds it was found that Kharani breed showed the close relationship with the C. dromedarius camel and all the breeds show a common ancestor that is sheep. For Casein loci in the Pakistani breeds these SNPs are the first to be reported.


Article Information

Received 19 June 2019

Revised 11 August 2019

Accepted 11 September 2019

Available online 01 May 2020

Key words

Kappa-casein gene, Polymorphism, camel, Pakistan

DOI: https://dx.doi.org/10.17582/journal.pjz/20190619100629

* Corresponding author: masroor.ellahi@vu.edu.pk

0030-9923/2020/0004-1623 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan



Camel is a species of unique characteristics which enable them to adopt and survive in harsh desert environment and also economically and historically very important species throughout the world particularly in the Asia and Africa (Schwartz, 1992; Nagarajan et al., 2012; Pauciullo et al., 2013; Sabahat et al., 2020) Milk from camel is very important in arid and semi-arid regions throughout the world for the survival of Pastoral, Nomad and Bedouin households and after the domestication of camel a huge population of migrants are being supported worldwide. Camel of Dromedary species is much important domestically than the other 5 species of family camelidae (Camelus bactrianus, Lama Guanicoe, Lama Glama, Vicugnavicugna and Vicugnapacos). During the lactation period of twelve to eighteen months, 3 to 10 kg per day milk production is estimated by dromedary camel (Farah et al., 2007). The milk contains about 3.1% fat and 2.9% protein depending upon the management conditions, feeding, breed and lactation stage (Al haj and Al Kanhal, 2011). Due to high amount of casein as chief constituent of camel’s milk protein (Sawaya et al., 1984), the milk of camel is significantly have higher nutritive value than other milking animals milk (Barłowska et al., 2011). The fraction of casein is about 52 - 89% (Al haj and Al Kanhal, 2011; Ereifej et al., 2011) and further divided into 4 fractions i.e. k-CN, b-CN as1- and as2 (Ochirkhuyag, et al., 1997; El-Agamy, 2007), which are encoded by 4genes, CSN3, CSN2 CSN1S1 and CSN1S2, respectively (Kappeler et al., 1998). In the milk of camel, the chief fractions are (65%) b-CN, (22%) as1-CN and (3.5%) k-CN respectively (El-Agamy, 2007). The polymorphic sites are present in these casein proteins related genome sequence in the species of the most animals. The function of protein in the milk of camel could be articulated by using different electrophoretic methods or chromatographic like isoelectric focusing (IEF) or SDS-PAGE (Alim et al., 2005; Zhang et al., 2005; Ereifej et al., 2011).

However, in Pakistan camel breeds inconsistency in the milk protein level is hardly described. Globally increasing interest rate of camel’s milk is because valuable benefits could be gained through it. So, the current study was simulated to expose the polymorphism in 5︠ flanking region and genetic relatedness with other mammals of Kappa-casein gene in Pakistani dromedary camel.

 

Materials and methods

Blood samples were collected from Cholistan area of Pakistan in vaccutainers from different camel breads including Bareela, Pahri, Mareecha, Thari, Watni, Kachi, Kharani and mix breed and studied. Manual method were used to extract genomic DNA following the method of (Sambrook and Russell, 2001) from each sample and concentrations were brought to the same level 50 mg/μl.

Amplification of purified extracted DNA was done using kappa-casein gene 5 flanking region. designing of primers was carried out by primer designing software known as primer3 software (Table I) and NCBI was used as source for the targeted gene sequence (Accession no. AJ409280.1). PCR amplification methods included following conditions such as initial denaturation at 95°C (5 min), primer annealing temperature was adjusted according to the (Table I), extension of the gene was performed at 72°C for 45 seconds and final extension was carried out at 72°C for 10 min. Then PCR product was sent for sequencing with ABI 3100 genetic (Applied Biosystem) sequence analyzer.

Sequenced data was manually aligned and analyzed. MEGA 6 software package was used for the construction of phylogenetic tree (Kumar et al., 2016).

 

Table I. Kappa-casein gene 5’ flanking region primer list.

Primer Name

Product Size (bp)

Primer sequence

k-casein3F

390

AGTGTGTGACCAGCTATTATCA

AGGTCTTGCTTGGCAGTAG

k-casein3R

k-casein1F

459

CTGAACAGCAGAAGCCAACT

k-casein1R

AGGTGAAACATTCGGGAAAT

k-casein2F

598

CCCCAGAGAAATGTATGCAA

k-casein2R

TCAATCAACGAGTTCCACCT

 

Results and discussion

Phosphoproteins are the main important constituent of mammalian milk and Kappa-casein belong to this phosphoproteins family, also Kappa casein is a glycosilated protein, (as1, β, as2, κ). An important role is played by Kappa-casein for the calculation of specific function and size in caseinmicelle stabilization. The examination of 5 flanking region of Kappa casein provides us very useful information about the transcription analysis factors. About the expression regulation of gene this analysis is very helpful. Mutation of any type in this particular patch, change the mRNA stability or modify the transcription rat (Rijnkels, 1998). So, this preceded to the alteration in the components of specific protein of milk. In the current study, to examine the presumed regulatory regions among various breeds of dromederius camel sequencing of 5 flanking region Kappa-casein gene was conducted for SNP discovery. In the upstream position of Kappa-casein gene, various polymorphic positions were observed as shown in the Table II.

Various single nucleotide substitutions, transversions (C>G, G>T), transition (A>G), deletion and insertion of nucleotide were observed. Transversions of G>T at the position 1578 has been described for the milk and yield of milk protein also in Holstein cattle. Genetic variations in camel milk protein alpha casein have also been reported (Shuiep et al., 2013). Kappeler et al. (1998) has described non-allelic variants of similar fraction of casein as an exchange of amino acid. Pauciullo et al. (2013) have been recently reported 17 SNPs (polymorphic sites) in camels and also analyzed CSN3 Kappa-casein gene. By using the available reference sequences of species including; Capra hericus, Bostaurus, Ovisaries, Camelusdromedarious and, a polygenetic tree of studied k-casein gene of camelbreeds from Pakistan was formulated to see the genetic accordance with them. Phylogenetic tree is shown in Figure 1.


 

In the cattle polymorphism in the κ-casein was described well by (Prinzenberg et al., 2008) sheep (Ceriotti et al., 2004; Caroli et al., 2009) and goat (Jann et al., 2004; Prinzenberg et al., 2005). In CSN3 gene cows and Goats express most allelic polymorphism than the other farm animals (Ramunno et al., 2004; Caroli et al., 2009). Yahyaoui et al. (2003) described that the solubility of casein was affected by allelic polymorphism in κ-casein gene C-terminal region However, the analysis of coding region sequence of κ-casein in association studies is not always reliable (Heck et al., 2009) and might be attributed to the existence of intragenic haplotypic variants combination in the noncoding and regulatory regions (Prinzenberg et al., 2003).

Kappeler et al. (2003) examined the close association with different species by describing the 5 flanking regions of milk gene for camel milk. 5’-upstream sequences arrangement of protein genes for camel milk was closely associated with their analogous complements from the other animal species. In the mammary gland, these are

 

Table II. Kappa casein gene 5’ flanking region polymorphic variations different breads of camel of Pakistan.

Sr#

Position

Sequence change

Type of change

Sr #

Position

Sequence change

Type of change

Kachi breed

Watni breed

1

c.1-1075

del. A

Deletion

1

c.1-1075

del. A

Deletion

2

c.1-1046

GT

Heterozygous

2

c.1-1046

GT

Heterozygous

3

c.1-707

del. G

Deletion

3

c.1-982

GC

Heterozygous

4

c.1-684

A>T

Transversion

4

c.1-707

del. G

Deletion

5

c.1-683

T>G

Transversion

5

c.1-1156

AT

Insertion

6

c.1-402

Ins. T

Insertion

7

c.1-340

Ins. T

Insertion

Kharani breed

8

c.1-321

Ins. T

Insertion

1

c.1-1046

GT

Heterozygous

9

c.1-1085

del. A

Deletion

2

c.1-982

GC

Heterozygous

10

c.1-1081

Ins. A

Insertion

3

c.1-707

del. G

Deletion

11

c.1-1036

A>G

Transition

12

c.1-1035

A>G

Transition

Thari breed

13

c.1-682

del. G

Deletion

1

c.1-707

del. G

Deletion

14

c.1-525

GA

Heterozygous

Mareecha breed

Pahari breed

1

c.1-1075

del. A

Deletion

1

c.1-1075

del. A

Deletion

2

c.1-1046

GT

Heterozygous

2

c.1-1046

GT

Heterozygous

3

c.1-982

GC

Heterozygous

3

c.1-982

GC

Heterozygous

4

c.1-707

del. G

Deletion

4

c.1-707

del. G

Deletion

5

c.1-684

A>T

Transversion

5

c.1-684

A>T

Transversion

6

c.1-683

T>G

Transversion

6

c.1-683

T>G

Transversion

7

c.1-1088

G>T

Transversion

7

C1-1057

ins T

Insertion

8

c.1-1087

A>G

Transition

9

c.1-1054

C>T

Transition

Mixed Breed 3500-4000

Breela Breed

1

c.1-1075

del. A

Deletion

1

c.1-1075

del. A

Deletion

2

c.1-1046

GT

Heterozygous

2

c.1-1046

GT

Heterozygous

3

c.1-982

GC

Heterozygous

3

c.1-982

GC

Heterozygous

4

c.1-707

del. G

Deletion

4

c.1-707

del. G

Deletion

5

c.1-684

A>T

Transversion

5

c.1-684

A>T

Transversion

6

c.1-683

T>G

Transversion

6

c.1-1081

ins. A

insertion

7

c.1-690

ins. G

insertion

 

gene expression level independent in the other species. An interesting fact about the 5’-upstream sequences of camels is to show the significant relatedness in the conditions in which the particular genes were delineate to express a fantastically different level in various specie’s lactating mammary glands e.g. k-CN in case of camel and bovine (Kappeler et al., 1998). This sequence relatedness stipulate that the modulation of gene expression has to be regulate to little perpetuated areas within the 5’-upstream sequence. Mutations in these areas will commence, eradicate or modify the tissue and stage specific proclamation of milk protein genes.

Kappa-casein is considered as an important biomarker for milk production in dairy animals. On comparing different camel breeds, kappa-casein gene is observed to be very polymorphic from upstream region and could prove to be a proficient molecular marker in selection. As not enough information is available so the polymorphism found in in the current study in the casein cluster in camels can be used as the first genetic marker in the arrangement of the 5’-upstream sequence. Data collected from different breeds of camels in the current study which indicated polymorphic sites would promote practicability for a quick directional selection in esteem of such allele.

 

Statement of conflict of interest

The authors declare there is no conflict of interest.

 

References

Al-Ayadhi, L.Y., and Elamin, N.E., 2013. Evidence-based Complem. Altern. Med. eCAM, 2013: 602834. https://doi.org/10.1155/2013/602834

Al haj, O.A. and Al Kanhal, H.A., 2011. Int. Dairy. J., 20: 811-821. https://doi.org/10.1016/j.idairyj.2010.04.003

Alim, N., Fondrini, F., Bonizzi, I., Feligini, M. and Enne, G., 2005. Pakistan J. Nutri., 4: 112-116.

Barłowska, J., Szwajkowska, M., Litwińczuk, Z. and Król, J., 2011. Compreh. Rev. Fd. Sci. Fd. Safe., 10: 291-302. https://doi.org/10.1111/j.1541-4337.2011.00163.x

Caroli, A.M., Chessa, S. and Erhardt, G.J., 2009. J. Dairy Sci., 92: 5335–5352. https://doi.org/10.3168/jds.2009-2461

Ceriotti, G., Chessa, S., Bolla, P., Budelli, E., Bianchi, L., Duranti, E. and Caroli, A., 2004. J. Dairy Sci., 87: 2606-2613. https://doi.org/10.3168/jds.S0022-0302(04)73386-X

El-Agamy, E.I., 2007. Small Rumin. Res., 68: 64-72. https://doi.org/10.1016/j.smallrumres.2006.09.016

Ereifej, K.I., Alu’datt, M.H., AlKhalidy, H.A., Alli, I. and Rababah, T., 2011. Fd. Chem., 127: 282-289. https://doi.org/10.1016/j.foodchem.2010.12.112

Farah, Z., Mollet, M., Younan, M. and Dahir, R., 2007. Livest. Sci., 110: 187-191. https://doi.org/10.1016/j.livsci.2006.12.010

Heck, J.M.L., Schennink, A. and van Valenberg, H.J.F., 2009. J. Dairy Sci., 92: 1192–1202. https://doi.org/10.3168/jds.2008-1208

Jann, O.C., Prinzenberg, E.M., Luikart, G., Caroli, A. and Erhardt, G., 2004. J. Dairy Res., 71: 188-195. https://doi.org/10.1017/S0022029904000093

Kappeler, S., Farah, Z. and Puhan, Z., 1998. J. Dairy Res., 65: 209-222. https://doi.org/10.1017/S0022029997002847

Kappeler, S.R., Farah, Z. and Puhan, Z., 2003. J. Dairy Sci., 86: 498–508. https://doi.org/10.3168/jds.S0022-0302(03)73628-5

Kumar, S., Stecher, G. and Tamura, K., 2016. MEGA7: Mol. Biol. Evolut., 33: 1870-1874.

Lipkin, E., Tal-Stein, R., Friedmann, A. and Soller, M., 2008. J. Dairy Sci., 91: 1614-1627. https://doi.org/10.3168/jds.2007-0655

Nagarajan, G., Swami, S.K., Ghorui, S., Pathak, K., Singh, R. and Patil, N., 2012. Res. Vet. Sci., 92: 420-426. https://doi.org/10.1016/j.rvsc.2011.03.028

Ochirkhuyag, B., Chobert, J.M., Dalgalarrondo, M., Choiset, Y. and Haertlé, T., 1997. Lait, 77: 601-613. https://doi.org/10.1051/lait:1997543

Pauciullo, A., Shuiep, E.S., Cosenza, G., Ramunno, L. and Erhardt, G., 2013. Gene, 513: 22–30. https://doi.org/10.1016/j.gene.2012.10.083

Prinzenberg, E.M., Gutscher, K., Chessa, S., Caroli, A. and Erhardt, G., 2005. J. Dairy Sci., 88: 1490-1498. https://doi.org/10.3168/jds.S0022-0302(05)72817-4

Prinzenberg, E.M., Jianlin, H. and Erhardt, G., 2008. J. Dairy Sci., 91: 1198-1203. https://doi.org/10.3168/jds.2007-0746

Prinzenberg, E.M., Weimann, C. and Brandt, H., 2003. J. Dairy Sci., 86: 2696–2705. https://doi.org/10.3168/jds.S0022-0302(03)73865-X

Ramunno, L., Cosenza, G. and Rando, A., 2004. Gene, 334: 105–111. https://doi.org/10.1016/j.gene.2004.03.006

Rijnkels, M., Kooiman, P.M., Platenburg, G.J., van Dixhoorn, M., Nuijens, J.H., de Boer, H.A. and Pieper, F.R., 1998. Trans. Res., 7: 5-14. https://doi.org/10.1023/A:1008892720466

Sabahat, S., Nadeem, A., Javed, M., Zahoor, M.Y., Hashmi, A.S., Yasein, G. and Abbas, G., 2020. Pakistan J. Zool., 52: 1-4.

Sambrook, J. and Russell, D., 2001. Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sawaya, W.N., Khalil, J.K., Al-Shalhat, A. and Al-Mohammad, H., 1984. J. Fd. Sci., 49: 744-747. https://doi.org/10.1111/j.1365-2621.1984.tb13200.x

Schwartz, H., 1992. Anim. Res. Dev., 35: 86- 98. https://doi.org/10.1007/BF00400861

Shuiep, E.S., Giambra, I.J., Yas, M., Zubeir, I.E. and Erhardt, G., 2013. Int. Dairy J., 28: 88–93. https://doi.org/10.1016/j.idairyj.2012.09.002

Yahyaoui, M.H., Angiolillo, A., Pilla, F., Sanchez, A. and Folch, J.M., 2003. J. Dairy Sci., 86: 2715–2720. https://doi.org/10.3168/jds.S0022-0302(03)73867-3

Zhang, H., Yao, J., Zhao, D., Liu, H., Li, J. and Guo, M., 2005. J. Dairy Sci., 88: 3402-3410. https://doi.org/10.3168/jds.S0022-0302(05)73024-1

To share on other social networks, click on P-share. What are these?

Pakistan Journal of Zoology

August

Vol. 52, Iss. 4, Pages 1225-1630

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe