Developing Microsatellite Multiplex PCR Panels for Topmouth Culter (Culter alburnus) and their Application in Parentage Assignment

Jianjun Fu1, Shili Liu2, 3, Wenbin Zhu1, Yongyi Jia2, 3, Lanmei Wang1, Yufen Yang4, Zhimin Gu2, 3* and Zaijie Dong1*

1Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, Jiangsu, China

2Key Laboratory of Healthy Freshwater Aquaculture, Ministry of Agriculture and Rural Affairs, Zhejiang Institute of Freshwater Fisheries, Huzhou 212001, Zhejiang, China

3Key Laboratory of Freshwater Aquaculture Genetic and Breeding, Zhejiang Province, Zhejiang Institute of Freshwater Fisheries, Huzhou 212001, Zhejiang, China

4Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, Jiangsu, China

Jianjun Fu and Shili Liu contributed equally to this work.

ABSTRACT

The topmouth culter (Culter alburnus) is an economically important fish in China. However, natural stocks have been decreasing rapidly in recent years. Genetic improvement breeding programs of C. alburnus offer an essential strategy in developing a sustainable solution. In this study, we developed three multiplex PCR panels, including twelve microsatellite loci for C. alburnus, and applied parentage analyses using 36 candidate parents and 136 offspring from four independent artificial breeding pilots. Based on allele frequency analysis using 36 candidate parents, the number of alleles ranged from 7 to 22, observed heterozygosity ranged from 0.39 to 0.75, and expected heterozygosity ranged from 0.57 to 0.91. All loci were highly informative (polymorphic information content, PIC >0.5). We detected a significant correlation between exclusion probabilities for parent pairs (E-PP) and PIC (P<0.01). Simulation analysis revealed that a high assignment rate (>95%) was achieved when the number of candidate parents was less than 200. Meanwhile, real parentage analysis revealed that almost each offspring (135/136, 99.26%) was unambiguously assigned to a parent pair with high accuracy (100%), respectively. In addition, we detected significantly unequal progeny contributions of parents and parent pairs in total or in each artificial breeding pilots (P<0.01). In brief, we developed microsatellite multiplex PCR panels for C. alburnus with high capability of monitoring pedigree information, which can be used as a basic tool for family selection breeding of this species.

Article Information

Received 22 July 2018

Revised 01 April 2019

Accepted 06 May 2019

Available online 07 January 2021

Authors’ Contribution

JF, SL, ZG and ZD designed research. JF and SL performed experiments and contributed in manuscript writing. WZ, YJ, LW and YY collected the samples and analyzed the data.

Key words

Culter alburnus, Parentage assignment, Microsatellite, Multiplex PCR, Breeding

DOI: https://dx.doi.org/10.17582/journal.pjz/20180722120713

* Corresponding author: [email protected]; [email protected]

0030-9923/2021/0002-0401 $ 9.00/0

Copyright 2021 Zoological Society of Pakistan

INTRODUCTION

The topmouth culter (Culter alburnus) is a carnivorous pelagic fish belonging to the Cyprinidae family and widely distributed throughout large water bodies in China (Chen, 1998). It commonly feeds on small fish species, which plays an important role in the ecological equilibrium of water ecosystems. Its fast growth and distinctive flavor render it a major economic freshwater fish species in Eastern China, especially in the Lake Taihu area. Fish culture production of this species has expanded significantly over the past few decades (Wang et al., 2007), mainly due to the increasing market demand and improvements in artificial breeding and rearing techniques. Unfortunately, over-fishing, changes in living conditions and water pollution have all caused a sharp reduction in resource (Wang et al., 2007). Therefore, sustainable aquaculture of this species relies on effective conservation and rational utilization of wild resource. Recently, hybrid (Guo et al., 2018) and meiotic gynogenesis (Li et al., 2018) breeding methods were introduced to genetically improve the species, and reduce seed and broodstock demands from wild population. However, breeding strains were either limited or undetected in practice stocks.

Artificial selection is commonly conducted in many important fish species (Gjedrem et al., 2012) as an effective method to sustainably utilize wild resource and maintain culture production. However, as phenotypic selection usually targets a few outperforming individuals without knowledge of their pedigree, this can potentially lead to inbreeding and fitness depression (Fu et al., 2013), and subsequently limited genetic improvement. Therefore, accurate pedigree information is imperative in a successful breeding program (Lacy, 2012). Recently, microsatellite markers have shown promising practicability in parentage assignment with few loci and high accuracy (Luo et al., 2017; Sudo et al., 2018; Wang et al., 2018). Moreover, multiplex PCR methods are becoming more utilized for microsatellite loci co-amplification, which has considerably reduced time and costs in parentage analysis procedures. Nowadays, multiplex PCR panels have been successfully developed and utilized for parentage assignment in many aquaculture animals (Fu et al., 2013; Nie et al., 2012; Popa et al., 2015), and considered an effective marker-assisted selection breeding technique.

Despite its ecological and economic importance, studies on topmouth culter genetics remain limited (Guo et al., 2018; Liu et al., 2014; Wang et al., 2007) and selection breeding programs non-existent. Therefore, in this study, we developed three multiplex PCR panels involving twelve microsatellite loci with redesigned primers based on released sequences on GenBank database, and conducted parentage analysis using parent and offspring samples from four independent artificial breeding pilots. This approach not only proved effective in monitoring pedigree information, but also demonstrated great potential as an essential tool when developing breeding programs for C. alburnus.

 

MATERIALS AND METHODS

Fish samples and DNA extraction

Culturing and spawning of C. alburnus were carried out at Aquatic Breeding Farm of Zhejiang Institute of Freshwater Fisheries (Zhejiang, China). Thirty-six adult fish (24 females and 12 males) were used for artificial breeding from June 10 to June 15, 2017. Mating designs for four breeding pilots are shown in Table I. Pilot A and Pilot C consisted of eight females and four males, Pilot B and Pilot D consisted of four females and four males, and Pilot A and Pilot B shared four males in practice. Broodfish of four pilots were processed under hormone stimulation and artificial stripping. Milt samples were stripped in advance and stored in an icebox (about 4ºC) for a short time, and fertilized with the eggs stripped out. The fertilized eggs of four pilots were hatched in independent cylinders, and the fry cultured in four different ponds respectively. Thirty-four offspring were randomly sampled from each pilot after one-month nursery rearing.

Fin clips of broodstock and offspring were collected and stored in absolute ethanol until DNA extraction. Genomic DNA was extracted using a traditional phenol-chloroform method. DNA concentration and purity of samples were assessed using the Nano Drop 2000C spectrophotometer (Thermo scientific, US) and 1% agarose gel. Afterward, DNA concentration was adjusted to 20-50 ng/μL and stored at –20ºC for later PCR amplification.

 

Table I. Mating design of four artificial breeding pilots in C. alburnus.

Pilot	No. of females	No. of males
Pilot A	8	4*
Pilot B	4
Pilot C	8	4
Pilot D	4	4

 

Note: *, Pilot A and Pilot B shared four males

 

Microsatellite primer design and multiplex PCRs

The original sequences released on GenBank database (Liu et al., 2014) were chosen for designing primers. Novel primers were designed for microsatellite loci of differing product sizes. Amplification efficiency and polymorphism was tested using six parent samples. Primers with different product sizes were used in developing the multiplex sets. In this study, twelve primer pairs were successfully used in the multiplex PCR panels (Table II). Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and each forward primer was labeled with a fluorescent dye (HEX or FAM).

PCR amplification was performed at a total volume of 25 μL, which included: 12.5 μL 2× Taq PCR MasterMix (TianGen Biotech Co., Ltd., Beijing); 4.8 μL, 3.8 μL and 5.6 μL primer mixture (10 μM original concentration of each) for three multiplex PCR panels, respectively (Table II); 2 μL genomic DNA (20-50 ng/μL); and supplemented with DNase/RNase-free deionized water. PCR amplification was conducted under the following conditions: 10 min pre-denaturation at 94ºC followed by 35 cycles of denaturing 30 s at 90ºC, annealing 30 s at 52ºC, and prolonging 50 s at 72ºC; with a final prolonging at 72ºC for 10 min. Reaction products were resolved on Applied Biosystems 3730XL Genetic Analyzer (Applied Biosystems, USA) and sized relative to an internal size standard (GeneScan-500 ROX) using GeneMapper Version 3.5 software (Applied Biosystems, USA).

Data analysis

Estimates of genetic variation such as the number of alleles (Na), observed (Ho) and expected heterozygosity

 

Table II. Information of microsatellite loci and multiplex PCR panels (25 μl) in C. alburnus.

Locus	Accession No.	Label	Primer sequence (5'-3')	Volume (10 μM, μL)	Summary statistics of allele frequency analysis (N = 36 parents)
					Size (bp)	Na	Ho	He	PIC	E-PP	Fn
Multiplex PCR panel 1
Cal18	KC134229	FAM	F: CAAGGACAAGGATTATG	0.8	127-179	15	0.69	0.89	0.87	0.91	+0.12
		—	R: ATGAACACAACTTACC	0.8
Cal29	KC134240	HEX	F: AACTACCAATGCCTGATTCC	0.4	221-283	18	0.75	0.86	0.84	0.88	+0.07
		—	R: TACTGAGTGAGAAACCTTTCC	0.4
Cal06	KC134217	FAM	F: AGATGTCGTGGTTAGTTTCA	0.8	295-359	18	0.67	0.89	0.87	0.91	+0.13
		—	R: GCGTATTCCTCTCCTGATTC	0.8
Cal19	KC134230	HEX	F: TTCACGCACTTCAAACACT	0.4	400-430	10	0.46	0.82	0.78	0.82	+0.29
		—	R: GTATAACACAGAATGACACAGG	0.4
Multiplex PCR Panel 2
Cal50	KF111430	FAM	F: GAGAGCATTCAGGAAGCA	0.6	113-167	11	0.67	0.83	0.80	0.85	+0.11
		—	R: AAGTAGAGCGAGCAGAGA	0.6
Cal53	KF111433	HEX	F: TCATCAACTCTCACACTCTC	0.5	241-277	13	0.68	0.81	0.78	0.84	+0.11
		—	R: CCATATCCAGCACTCTAACA	0.5
Cal49	KF111429	FAM	F: GCGGTGTTCTGCTTCTTC	0.3	278-378	22	0.69	0.91	0.90	0.95	+0.14
		—	R: TGTGTCGTGATGGAGGAG	0.3
Cal54	KF111434	HEX	F: AGACCTCCTCCTCTTCTC	0.5	406-424	10	0.61	0.80	0.76	0.80	+0.15
		—	R: TGGCACAACAACACAGAC	0.5
Multiplex PCR Panel 3
Cal52	KF111432	FAM	F: GAATCTGCCGTTCTCACTA	0.8	126-158	7	0.47	0.57	0.54	0.57	+0.11
		—	R: ACCTGTCCACCTCAATCA	0.8
Cal46	KF111426	HEX	F: AAGAGACTGAACATTGAAGC	1.0	207-245	11	0.39	0.80	0.76	0.79	+0.34
		—	R: TTGGACTGAGAGAAGGAAAT	1.0
Cal17	KC134228	FAM	F: GCATAGTGACATCATAGCAT	0.5	264-308	15	0.67	0.90	0.87	0.92	+0.14
		—	R: ACCGCAACATTACAAAGAC	0.5
Cal01	KC134212	HEX	F: TTCCATATCCTCTCATCCTTCA	0.5	352-434	14	0.56	0.88	0.85	0.90	+0.23
		—	R: CCTGCTATTGTTTCTTTCATCC	0.5

Na, number of alleles per locus; Ho, observed heterozygosity; He, expected heterozygosity; PIC, polymorphism information content; E-PP, exclusion probability of parent pair; Fn, null allele frequency.

(He), polymorphic information content (PIC), exclusion probability for parent pairs (E-PP) and null alleles frequency (Fn) of twelve microsatellite loci were estimated based on the genotype data of 36 candidate parents via allele frequency analysis using Cervus 3.0 software (Marshall et al., 1998; Kalinowski et al., 2007). Correlation analysis for PIC and E-PP of loci were carried out using SAS software (SAS Institute, 1996).

Simulation analysis were performed to evaluate the probable performance of the microsatellite loci for parentage identification on C. alburnus breeding programs. Simulation analyses based on genotypes of 36 candidate parents were conducted using the likelihood-based approach in Cervus 3.0 software (Marshall et al., 1998; Kalinowski et al., 2007) and performed using the following parameters: 10,000 offspring and a pool of candidate parents, varying from 10 to 400 parents and 5 to 200 parent pairs; 98% of candidate parents were sampled and loci typed, 1% error rate in likelihood calculations. Real parentage analysis was performed using Cervus 3.0 software (Marshall et al., 1998; Kalinowski et al., 2007), based on genotype data of parents and offspring from four breeding pilots. Furthermore, both simulation and parentage analysis were carried out based on tested parents (the same candidate parent information was used in the simulation) in different multiplex panel(s), under the methods mentioned above.

Pedigree reconstruction was compared to known parental information from the mating design and sampling, and used to examine the accuracy of parentage assignment. Chi-square test was then applied to detect the different progeny contributions of parents and parent pairs using SAS software (SAS Institute, 1996).

 

RESULTS AND DISCUSSION

In this study, we developed three multiplex PCR panels with four microsatellite loci in each panel. Information and genotyping results of four multiplex PCR panels are shown in Table II and Figure 1. We used different product size designs and fluorescence dyes (FAM or HEX) that avoided alleles overlapping and optimized the genotyping process, respectively. This was highly effective and efficient in both time and cost compared with scoring each locus with independent PCR protocols.

 

We evaluated the genetic diversity parameters of twelve microsatellite loci using 36 candidate parents. The summary statistics are shown in Table II. We revealed that Na, Ho and He ranged from 7 to 22, 0.39 to 0.75, and 0.57 to 0.91, respectively. Genetic diversity parameters of microsatellite loci in C. alburnus were slightly higher in our study than previously reported (Liu et al., 2014), but lower than those reported in another study (Fu et al., 2013). It should be noted that the individuals tested and the detection methods were related to the diversity parameters (Liu et al., 2009). All twelve microsatellite loci were highly informative (PIC > 0.5) (Botstein et al., 1980), and exclusion probabilities for the parent pairs (E-PP) ranged from 0.57 to 0.92, which significantly correlated with the PIC of microsatellite loci (P<0.01; Fig. 2). These correlations are also reported in another study (Ma et al., 2013). Microsatellites with high genetic diversity parameters and hence relatively high statistical powers are therefore included in parentage assignments (Marshall et al., 1998; Tokarska et al., 2009).

 

Simulation assignment approaches estimate the theoretical power of microsatellite markers and allow the adjustment of marker-selection toward the best benefit direction (Hauser et al., 2011). In this study, we conducted simulation analyses (with sexes known or unknown, and varying number of parents) to assess the resolution capability of these twelve loci. According to the simulation results shown in Figure 3, all assignments for mother alone, father alone, and parent pairs were higher than 95% when the number of candidate parents was less than 200 parents (sexes unknown) or 100 parent pairs (100 father and 100 mother, sexes known). This is far greater than the minimum number of parent pairs recommended to prevent inbreeding and obtain a long-term response in a mass selection program (Bentsen and Olesen, 2002). The real parentage analysis for 36 candidate parents and 136 offspring are shown in Table III. The assignment rates for breeding pilots ranged from 97.06% to 100% (average was 99.26 %). We checked pedigree reconstruction with known mating and sampling information, which we used to assess the accuracy of parentage assignment (Jerry et al., 2006). All pilot assignments agreed with the true mating designs with 100% accuracy.

 

Table III. Parentage analysis results for four breeding pilots in strict confidence (95%).

Pilot	No. of individuals		Assignment rate (%)	Accuracy rate (%)
	Tested	Assigned
Pilot A	34	33+1*	97.06	100
Pilot B	34	34	100	100
Pilot C	34	34	100	100
Pilot D	34	34	100	100
Total	136	135	99.26	100

 

Note: * indicates with ambiguous assignment.

 

As shown in Figure 4, simulation assignment rates and parentage assignment rates, based on different multiplex PCR panel or panels, followed a similar trend. In general, we detected a higher assignment rate when we used more panels. Although, the parentage assignment rates were based on real data, they were commonly lower than those detected in simulations, which may due to the null alleles observed at many loci (Carlsson, 2008). Even so, our results highlight the use of simulation analyses to evaluate assignment capacity of multiplex PCR panels (or panel combinations) before breeding practice. We showed that the assignment rate of parentage analysis was higher than 80% when two panels were used (Panels 1 and 3, or Panels 2 and 3), and higher than 95 % when three panels were used. Consequently, using three multiplex PCR panels in this study is considered sufficient and efficient for pedigree reconstruction for C. alburnus.

 

In aquaculture breeding schemes, equalizing family size is challenging because of the unequal reproductive success of brooders during the breeding practice and differential survival among families (Kong et al., 2015). We detected nine full-sib families (from six dams and three sires) in Pilot A. In Fig. 5, we show different progeny contributions (number and percentage) for the parents and parent pairs in Pilot A. We detected significant unequal progeny contribution of parents and parent pairs in total for each breeding pilots (P<0.01). This phenomenon, which has also been observed in other aquatic species (Fu et al., 2016; Herlin et al., 2008; Loughnan et al., 2013; Rhody et al., 2014; Sudo et al., 2018), may result in higher rates of inbreeding in long-term selection due to a gradual decline of effective population size. Therefore, using molecular markers to monitor pedigree information could be used as an essential tool incorporated into breeding schemes of fish species, including C. alburnus.

 

CONCLUSIONS

In this study, we developed a multiplex PCR panels for C. alburnus that provides a powerful tool for parentage assignment and population genetic studies of this species. It can be used as an essential tool in developing breeding programs for C. alburnus.

 

ACKNOWLEDGMENTS

This study was supported by the Open Funds of Key Laboratory of Freshwater Aquaculture Fishery, Ministry of Agriculture and Rural Affairs (No. ZJK201508).

 

Statement of conflict of interest

The authors declare that there is no conflict of interests regarding the publication of this article.

 

REFERENCES

Bentsen, H.B. and Olesen, I., 2002. Designing aquaculture mass selection programs to avoid high inbreeding rates. Aquaculture, 204: 349-359. https://doi.org/10.1016/S0044-8486(01)00846-8

Botstein, D., White, R.L., Skolnick, M. and Davis, R.W., 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphism. Am. J. Hum. Genet., 32: 314.

Carlsson, J., 2008. Effects of microsatellite null alleles on assignment testing. J. Hered., 99: 616-623. https://doi.org/10.1093/jhered/esn048

Chen, Y.Y., 1998. Fauna Sinica, Osterichthyes, Cypriniformes (II). Science Press, Beijing.

Fu, J., Shen, Y., Xu, X., Chen, Y., Li, D. and Li, J., 2013. Multiplex microsatellite PCR sets for parentage assignment of grass carp (Ctenopharyngodon idella). Aquacult. Int., 21: 1195-1207. https://doi.org/10.1007/s10499-013-9623-z

Fu, J., Shen, Y.B., Xu, X.Y. and Li, J.L., 2016. Genetic parameter estimates for growth of grass carp Ctenopharyngodon idella, at 10 and 18 months of age. Aquaculture, 450: 342-348. https://doi.org/10.1016/j.aquaculture.2015.08.018

Gjedrem, T., 2012. Genetic improvement for the development of efficient global aquaculture: a personal opinion review. Aquaculture, 344-349: 12-22. https://doi.org/10.1016/j.aquaculture.2012.03.003

Guo, H.H., Zheng, G.D., Wu, C.B., Jiang, X.Y., and Zou, S.M., 2018. Comparative analysis of the growth performance and intermuscular bone traits in F1 hybrids of black breem (Megalobrama terminalis) (♀) × topmouth culter (Culter alburnus) (♂). Aquaculture, 492: 15-23. https://doi.org/10.1016/j.aquaculture.2018.03.037

Hauser, L., Baird, M., Hilborn, R., Seeb, L.W. and Seeb, J.E., 2011. An empirical comparison of SNPs and microsatellites for parentage and kinship assignment in a wild sockeye salmon (Oncorhynchus nerka) population. Mol. Ecol. Resour., 11: 150-161. https://doi.org/10.1111/j.1755-0998.2010.02961.x

Herlin, M., Delghandi, M., Wesmajervi, M., Taggart, J.B., McAndrew, B.J. and Penman, D.J., 2008. Analysis of the parental contribution to a group of fry from a single day of spawning from a commercial Atlantic cod (Gadus morhua) breeding tank. Aquaculture, 129: 143-155.

Jerry, D.R., Evans, B.S., Kenway, M. and Wilson, K., 2006. Development of a microsatellite DNA parentage marker suite for black tiger shrimp Penaeus monodon. Aquaculture, 255: 542-547. https://doi.org/10.1016/j.aquaculture.2005.11.026

Kalinowski, S.T., Taper, M.L. and Marshall, T.C., 2007. Revising how the computer program cervus accommodates genotyping error increases success in paternity assignment. Mol. Ecol., 16: 1099-1106. https://doi.org/10.1111/j.1365-294X.2007.03089.x

Kong, N., Li, Q., Yu, H. and Kong, L., 2015. Heritability estimates for growth-related traits in the Pacific oyster (Crassostrea gigas) using a molecular pedigree. Aquacul. Res., 46: 499-508. https://doi.org/10.1111/are.12205

Lacy, R.C., 2012. Extending pedigree analysis for uncertain parentage and diverse breeding systems. J. Hered., 103: 197-205. https://doi.org/10.1093/jhered/esr135

Li, T., Jia, Y., Gao, J., Zhao, J., Jiang, W., Gu, Z. and Yang, R., 2018. Optimization of shock conditions to induce gynogenesis in topmouth culter (Culter alburnus). Aquaculture, 490: 344-349. https://doi.org/10.1016/j.aquaculture.2018.03.005

Liu, F., Xia, J.H., Bai, Z.Y., Fu, J.J., Li, J.L. and Yue, G.H., 2009. High genetic diversity and substantial population differentiation in grass carp (Ctenopharyngodon idella) revealed by microsatellite analysis. Aquaculture, 297: 51-56. https://doi.org/10.1016/j.aquaculture.2009.09.008

Liu, S.L., Gu, Z.M., Jia, Y.Y., Zhao, J.L., Jiang, W.P., Li, Q. and Li, F., 2014. Isolation and characterization of 32 microsatellite loci for topmouth culter (Culter alburnus Basilewsky). Genet. mol. Res., 13: 7480-7483. https://doi.org/10.4238/2014.September.12.14

Loughnan, S.R., Domingos, J.A., Smith-Keune, C., Forrester, J.P., Jerry, D.R., Beheregaray, L.B. and Robinson, N.A., 2013. Broodstock contribution after mass spawning and size grading in barramundi (Lates calcarifer, Bloch). Aquaculture, 362-363: 88-96.

Luo, W., Wang, W., Wan, S., Lin, Q. and Gao, Z., 2017. Assessment of parental contribution to fast- and slow-growth progenies in the blunt snout bream (Megalobrama amblycephala) based on parentage assignment. Aquaculture, 217: 23-29. https://doi.org/10.1016/j.aquaculture.2016.07.003

Ma, Q., Ma, H., Chen, J., Ma, C., Feng, N., Xu, Z., Li, S., Jiang, W., Qiao, Z. and Ma, L., 2013. Parentage assignment of the mud crab (Scylla paramamosain) based on microsatellite markers. Biochem. Syst. Ecol., 49: 62-68. https://doi.org/10.1016/j.bse.2013.03.013

Marshall, T.C., Slate, J., Kruuk, E.B. and Pemberton, J.M., 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol., 7: 639-655. https://doi.org/10.1046/j.1365-294x.1998.00374.x

Nie, H., Li, Q. and Kong, L., 2012. Development of four multiplex PCRs in the Zhikong Scallop (Chamys farreri) and their validation in parentage assignment. Biochem. Syst. Ecol., 44: 96-101. https://doi.org/10.1016/j.bse.2012.04.018

Popa, O.P., Bartakova, V., Bryja, J., Reichard, M. and Popa, L.O., 2015. Characterization of nine microsatellite markers and development of multiplex PCRs for the Chinese huge mussel Anodonta (Sinanodonta) woodiana Lea, 1834 (Mollusca, Bivalvia). Biochem. Syst. Ecol., 60: 234-237. https://doi.org/10.1016/j.bse.2015.05.001

Rhody, N.R., Puchulutegui, C., Taggart, J.B, Main, K.L. and Migaud, H., 2014. Parental contribution and spawning performance in captive common snook Centropomus undecimalis broodstock. Aquaculture, 432: 144-153. https://doi.org/10.1016/j.aquaculture.2014.04.022

SAS-Institute, 1996. Statistical analysis system. SAS-Institute, Cary.

Sudo, R., Miyao, M., Uchino, T., Yamada, Y., Tsukamoto, K. and Sakamoto, T., 2018. Parentage assignment of a hormonally induced mass spawning in Japanese eel (Anguillla japonica). Aquaculture, 484: 317-321. https://doi.org/10.1016/j.aquaculture.2017.09.014

Tokarska, M., Marshall, T., Kowalczyk, R., Wójcik, J., M., Pertodi, C., Kristensen, T., N., Loeschcke, V., Gregersen, V.R. and Bendixen, C., 2009. Effectiveness of microsatellite and SNP markers for parentage and identity analysis in species with low genetic diversity: the case of European bison. Heredity, 103: 326-332. https://doi.org/10.1038/hdy.2009.73

Wang, P., Zhao, C., Chen, S., Yin, S., Wang, Q., Li, Z. and Zhou, G., 2018. Parentage identification Odontobutis potamophlia based on microsatellite DNA markers. J. Genet., 97: 563-568. https://doi.org/10.1007/s12041-018-0933-9

Wang, W., Chen L., Yang P., Hou, L., He, C., Gu, Z. and Liu, Z., 2007. Assessing genetic diversity of populations of topmouth culter (Culter alburnus) in China using AFLP markers. Biochem. Syst. Ecol., 35: 662-669. https://doi.org/10.1016/j.bse.2007.04.008