Submit or Track your Manuscript LOG-IN

Cloning, Polymorphism and Tissue Expression of TAC3 Gene in Sheep

PJZ_52_4_1541-1546

 

 

Cloning, Polymorphism and Tissue Expression of TAC3 Gene in Sheep

Wenping Hu1, Xiangyu Wang1, Xiaodi Sun2, Ran Di1, Qiuyue Liu1, Zhangyuan Pan1, Xiaofei Guo1, Xiaohan Cao1, Jinyu Wang2, Yingjie Zhang3, Mei Jin4, Yuze Yang5 and Mingxing Chu1*

1Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193, P.R. China.

2College of Animal Science and Technology, Yangzhou University, Yangzhou 225009, P.R. China.

3College of Animal Science and Technology, Hebei Agricultural University, Baoding 071000, P.R. China.

4College of Life Science, Liaoning Normal University, Dalian 116029, P.R. China.

5Beijing General Station of Animal Husbandry, Beijing, 100101, P.R. China.

Wenping Hu and Xiangyu Wang contributed equally.

ABSTRACT

TAC3 gene is related to the regulation of animal reproductive function. Here we tried to find out the association of the expression and polymorphism of TAC3 gene with the estrus of sheep. TAC3 expression in uterus and pituitary gland increased in estrus of Small Tail Han sheep and Tan sheep. The TAC3 expression level in uterus might relate with estrus of sheep. Two mutations of TAC3 were found in intron 1 (C327T) and exon 2 (G1803A) separately. Although there were significant differences of C327T/G1803A genotype distributions in five different sheep breeds, it did not relate with the year-round estrus. The relationship between these polymorphisms of TAC3 and the litter size of Small Tail Han sheep was not found.


Article Information

Received 03 March 2017

Revised 09 March 2019

Accepted 11 September 2019

Available online 17 April 2020

Authors’ Contribution

WH, XW and MC designed the experiments. ZP, XG and XC collected the samples. XS performed the experiments. WH wrote the article. WH and XW analyzed the data.

Key words

TAC3 gene, Small Tail Han sheep, Tan sheep, Polymorphism, Tissue expression

DOI: https://dx.doi.org/10.17582/journal.pjz/20170303090335

* Corresponding author: mxchu@263.net

0030-9923/2020/0004-1541 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan



INTRODUCTION

Many peptides with neurotransmitter activity have been identified including acetylcholine and noradrenaline, in addition to the classical neurotransmitters. Neurokinin B (NKB, encoded by TAC3) is a member of the tachykinin superfamily of neuropeptides that includes substance P and neurokinin A (Almeida et al., 2004). NK3-R is cognate G protein-coupled receptor (NKB’s receptor) which encoded by TACR3. Mutations in TAC3 and TACR3 encoding this ligand-receptor pair were identified in a Turkish population of normosmic Idiopathic Hypogonadotropic Hypogonadism (nIHH) patients (Topaloglu et al., 2009). Genome-wide single nucleotide polymorphism (SNP) analysis was performed, four homozygous mutations were found in nine IHH families, which caused three amino acid changes (M90T, G93N, P353S) (Topaloglu et al., 2009). As a neurotransmitter, NKB is primarily expressed in the central and peripheral nervous system, such as the human hypothalamus and basal forebrain. NKB is also expressed in the outer syncytiotrophoblast of the placenta (Chawla et al., 1997). It may be associated with pre-eclampsia and pregnancy-induced hypertension.

The timely secretion of gonadal sex steroids is essential for the process of sexual maturity, including the initiation of puberty, the postpubertal maintenance of secondary sexual characteristics. It is also essential for the normal perinatal development of male external genitalia (Topaloglu et al., 2009). Normal gonadal steroid production requires the actions of the gonadotropins from pituitary gland. Follicle-stimulating hormone (FSH) and luteinizing hormone (LH) are controlled by the pulsatile delivery of gonadotropin releasing hormone (GnRH) from the hypothalamus (Plant, 2008).

NKB and NK3-R could affect GnRH secretion (Topaloglu et al., 2009). Kisspeptin expressed in hypothalamic neurons is a regulator of GnRH secretion. Human, animal, cellular, and bioinformatic models have been instrumental in defining the genetic control of GnRH. Many genes were found to affect GnRH neuronal migration, such as KAL1, FGFR1, FGF8, NELF, PROK2, PROKR2. KISS1-R, GNRH1 were found to influence GnRH secretory activity, and GNRHR could affect pituitary GnRH responsiveness. NKB and NK3-R were the newest proteins on this list (Gianetti et al., 2010). NKB could also inhibit LH secretion (Navarro et al., 2009).

TAC3 gene is related to the regulation of animal reproductive function (Loffler et al., 2004; Page et al., 2000; Pintado et al., 2003). Many factors would influence the estrus of animals. The genetics and environment including temperature, nutrition and photoperiod were considered as the main factors (Zhao et al., 2019). For seasonal estrous animals, photoperiod plays a vital role in the regulation of seasonal estrus following environmental changes (Olcese, 1995). By the different estrous reaction, animals could be classified into long-day estrous animals and short-day estrous animals. Hamster and horse are long-day estrous animals, while deer and some sheep, like Tan sheep, Suffolk, and Texel sheep are short-day estrous animals. However, some animals do not have obviously seasonal estrus and could be in estrus all the year round, which called all year-round estrous animals, such as Wistar rat, cattle, swine, White Dorper sheep and Small Tail Han sheep. The year-round estrus of sheep has a considerable value, and it helps to improve productivity and bring economic benefit. As all year-round estrous animals, Small Tail Han sheep has high fecundity, and it is a unique genetic resource in China. This research aimed to find whether TAC3 is associated with year-round estrus of sheep, like Small Tail Han sheep, and to provide some useful information for the molecular breeding to cultivate high fecundity sheep.

 

Materials and methods

269 Small Tail Han sheep were fed in Beijing Shengsifuming LLC (Changping, Beijing, China), and 180 Tan sheep were fed in Tan sheep breeding field (Yanci, Ningxia, China). These sheep were all pluriparous ewe and lambed in the same year. Ten mL blood sample per ewe were collected from these sheep. Genomic DNA was extracted by Phenol/chloroform extracting method, and stored at -20 0C.

Five primers were designed according to sheep TAC3 sequences (GenBank No: NC_007303) and synthesized in Sangon Biotech (Shanghai) Co. Ltd. (Table I).

The PCR amplification program was: 950C for 5 min, 34 cycles of 950C for 30 s, annealing for 30 s (annealing temperature was shown in Table 1), and 720C for 1 min and a final extension at 720C for 5 min. The PCR mixture contained 1 μL of genomic DNA (50-100 ng/μL), 10 μL 2×Taq PCR Master Mix (Biomed, Beijing, P.R. China), 0.5 μL (20 μM) each of forward and reverse primers, and 8 μL ddH2O in a 20 μL volume, and run on a Bio-Rad T100 Thermal Cycler (Bio-Rad, California, USA).

PCR products were recovered using Agarose Gel DNA Fragment Recovery Kit Ver. 2.0 (TaRaKa), and then ligated into the pMD19-T vector at 160C overnight. After ligation, DNA was transformed into the competent cell (Escherichia coli Top10). Positive clones were identified by the restriction enzyme and then sequenced by Sangon Biotech (Shanghai) Co. Ltd.

Small Tail Han sheep on spring estus, spring diestrus, and fall estus condition, Tan sheep on spring anestrus, fall estus and fall diestrus were selected, and tissue samples were collected from three sheep on each estrus condition. Total RNA was extracted by RNA. cDNA was synthesized Prime Script TM RT reagent kit (TaKaRa, Dalian, China). Real-time PCR amplification reaction mixture containing 0.4 μL of each primer (10 μM) (forward primer: GCCAGCGTAGGTCCTAAGGA; reverse primer: AGACCCACAAAGAAGTCATGCA), 2 μL of cDNA, 10 μL of SYBR Green Real-time PCR Master Mix (2×), 0.4 μL of ROX Reference Dye II (50×) and 6.8 μL of ddH2O in 20 μL volume. The amplication condition was 95ºC for 5 min, followed by 40 cycles of 95ºC for 15 s, 60ºC for 30 s and 72 ºC 20 s, and then 72 ºC 2 min. The dissociation curve was analyzed after amplification.

Statistical analyses were carried out using SPSS 15.0 software (SPSS Inc, Chicago, IL, USA).

 

Results and discussion

To know the association between TAC3 gene expression and year-round estrus of sheep, real-time qPCR was used to detect mRNA expression of TAC3 in the hypothalamus, pituitary gland, ovary, uterus, adrenal gland and pineal gland in different estrus of 2.5 years-old Small Tail Han sheep and Tan sheep (Table II). The results showed that the TAC3 gene expressed in six tissues of different estrus. The TAC3 expression level in the uterus in fall estrus of Tan sheep (162.91±13.78) was remarkably higher than that in spring estrus (23.87±8.43) and fall estrus (15.29±2.56) of Small Tail Han sheep (P < 0.01). The TAC3 expression level in the uterus in spring estrus (23.87±8.43) and fall estrus (15.29±2.56) of Small Tail Han sheep was higher than that in spring diestrus of Small Tail Han sheep (0.29±0.08) and that in spring anestrus of Tan sheep (0.32±0.14). The TAC3 expression level in the pituitary gland in spring estrus and fall estrus of Small Tail Han sheep, and fall estrus of Tan sheep were significantly higher than that in spring diestrus of Small Tail Han sheep, and spring anestrus and fall diestrus of Tan sheep (P < 0.01). It suggested that TAC3 expression in uterus and pituitary gland increased in estrus of both sheep breeds. A very high TAC3 expression level in uterus might be essential to drive Tan sheep estrus. It suggested the TAC3 expression level in uterus might affect seasonal estrus of Tan sheep.

 

Table I. Primer sequence, amplified region, fragment size and annealing temperature for Small Tail Han sheep TAC3 gene.

Primers

Primer sequence ( 5'→3')

Amplified region

Fragment size (bp)

Annealing temperature (0C)

P1

F:TGCTCTTCCACCCTTAGTAACCT

Intron 1

836

52

R:TCTCCTCCACAACTGAACCC

P2

F:TTGGGATGAGACAGGAGTAGGATG

Intron 1

822

52

R:GCATAACCGCTGGGAGTTTGTT

P3

F: GTCTCCCAAATCTTGCTGCGTC

Exon 2- Exon 3

979

57

R:CCTTAGCCCACCCTCTCTGTCTAC

P4

F:TGGCTTCTTGAATGATTGAGGG

Exon3- Exon 5

1063

54

R:CTACAAAGAGGGTTCCAAACGCAGC

P5

F:TGGTGGGATACAGAAACAGA

Exon 5 and 3′flank region

865

58

R:AGGCTGGAAAGAGATGAGAAAGA

 

Table II. Expression level of TAC3 mRNA in different tissues of Small Tail Han and Tan sheep.

Breeds

Estrus

Pituitary gland

Hypothalamus

Ovary

Uterus

Adrenal gland

Pineal gland

Small Tail Han Sheep

Spring Estrus

3.31±0.97A

0.15±0.04C

3.96±1.42AB

23.87±8.43B

0.03±0.01B

0.12±0.02C

Spring Diestrus

0.23±0.06B

0.80±0.20ABC

1.17±0.48B

0.29±0.08C

0.06±0.01B

0.31±0.04BC

Fall Estrus

2.63±1.02A

0.38±0.05ABC

5.37±1.23AB

15.29±2.56B

0.28±0.03B

0.55±0.09B

Tan Sheep

Spring Anestrus

0.52±0.23B

0.86±0.23AB

2.64±1.26AB

0.32±0.14C

0.07±0.03B

0.36±0.13BC

Fall Estrus

2.95±1.11A

0.25±0.05BC

5.88±0.52A

162.91±13.78A

0.16±0.03B

0.15±0.03C

Fall Diestrus

0.51±0.17B

1.02±0.14A

1.02±0.14B

1.08±0.27BC

1.15±0.41A

1.00±0.07A

 

A, B, C means the P value < 0.01. The number after “±” represents standard error.

 

Table III. Allele and genotype frequencies of the SNP in TAC3 in five sheep breeds.

Breed

Small Tail Han sheep

White Dorper

Tan sheep

Suffolk

Texel

C327T

Number

185

47

56

35

35

Genotype frequency

CC

0.78(145)

0.96(45)

0.59(33)

0.77(27)

1.00(35)

CT

0.19(34)

0.04 (2)

0.32(18)

0.23(8)

0 (0)

TT

0.03(6)

0 (0)

0.09(5)

0 (0)

0 (0)

Allele frequency

C

0.88

0.98

0.75

0.89

1

T

0.12

0.02

0.25

0.11

0

H-W test

χ2

4.5

0.02

1.14

0.58

--

G1803A

Number

193

41

54

38

43

Genotype frequency

AA

0.04(8)

0 (0)

0.18(10)

0 (0)

0 (0)

AG

0.29(56)

0.07(3)

0.52(28)

0.26(10)

0 (0)

GG

0.67(129)

0.93(38)

0.30(16)

0.74(28)

1.00 (43)

Allele frequency

A

0.19

0.04

0.44

0.13

0

G

0.81

0.96

0.56

0.87

1

H-W test

χ2

0.37

0.06

0.14

0.87

--

 

Note: The numbers in the brackets are the individuals that belong to the respective genotypes.

 

As a critical central regulator of gonadal function, TAC3 might relate to the reproduction of human or animals (Pintado et al., 2003). Navarro et al. found TAC3 and TACR3 genes were expressed in the Arc of female mice. The expression was inhibited by estradiol (E2) (Navarro et al., 2009). In the hypothalamus of postmenopausal women, TAC3 gene expression was elevated. Estrogen replacement decreased the level of TAC3 expression within hypothalamus cells, and the number of NKB mRNA-expressing neurons was also decreased. In ovariectomized rats, TAC3 gene expression was elevated, and the expression level reduced after estrogen treatment. Plasma concentrations of NKB were elevated in pre-eclampsia and pregnancy-induced hypertension (Page et al., 2000). D’Anna et al., 2004 also found NKB plasma levels in the pre-eclamptic were significantly higher than controls (D’Anna et al., 2004). The elevated levels of NKB in early pregnancy may be an indicator of hypertension and pre-eclampsia (Page et al., 2000).

Five pairs of primers (P1 to P5) of TAC3 gene were designed to clone Small Tail Han sheep TAC3 DNA sequence (as shown in Figure A). The PCR products were cloned and sequenced, a 3296 bp DNA sequence without exon 1 of TAC3 was obtained. TAC3 gene was also cloned from Tan sheep. By sequence alignment with Tan sheep (seasonal estrous sheep), two mutations were found in intron 1 (C327T) and exon 2 (G1803A) (as shown in Figure B). The PCR products of primer P1 or P3 were digested entirely with BIP I or Sml I restriction endonuclease, and genetic polymorphisms of TAC3 were investigated by PCR-RFLP. Three genotypes, CC (327/469 bp), CT (327/469/796 bp) and TT (796 bp), were found after digested with BIP I. Three genotypes, AA (979bp), AG (390/589/979 bp) and GG (390/589 bp) were found after digested with Sml I (as shown in Figure C).

The frequencies of these alleles and genotypes were calculated in year-round estrous sheep breeds (Small Tail Han sheep, White Dorper sheep) and seasonal estrous sheep breeds (Tan, Suffolk, and Texel sheep) by PCR-RFLP (Table III). At locus of C327T, the dominant allele in these five sheep breeds was C. Texel sheep only had CC genotype, White Dorper sheep and Suffolk sheep had CC/TT genotype, while Small Tail Han sheep and Tan sheep had all three genotypes, CC/CT/TT. At locus of G1803A, the dominant allele in these five sheep breeds was G. Texel sheep only had GG genotype, White Dorper sheep and Suffolk sheep had GG/AA genotype, while Small Tail Han sheep and Tan sheep had all three genotypes, GG/AG/AA. There was no association between the frequencies of these alleles and genotypes with the different estrous breeds. Moreover, the difference of the C327T/G1803A genotype distributions of TAC3 in five sheep breeds was analyzed (Table IV). It displayed the polymorphisms of TAC3 gene was not related with the year-round estrus.


 

Least squares mean and standard error for litter size of different genotypes in 327 and 1803 loci of TAC3 gene in Small Tail Han sheep were analyzed (Table V). There was no significant difference (P > 0.05) of litter size was found in different genotypes for the two loci.

Although many studies have been done on TAC3 in human and rodents, the study in sheep is very rare. In this study, we tried to find out the association of polymorphism and expression of TAC3 gene with the estrus and fertility of sheep. Two mutations of TAC3 were found in intron 1 (C327T) and exon 2 (G1803A) separately. TAC3 expression in uterus and pituitary gland increased in estrus of Small Tail Han sheep and Tan sheep, and TAC3 expression level in uterus might relate with estrus of sheep. It implied the expression of TAC3 might relate with estrus of sheep. The mechanism of year-round estrus of sheep is still unknown. However, it is essential for the molecular

 

Table IV. Test of difference of the C327T/G1803A genotype distributions of TAC3 in five sheep breeds.

Breed

Small Tail Han sheep

White Dorper

Tan sheep

Suffolk

White Dorper

7.72*/11.18**

Tan sheep

9.02*/28.38***

19.00***/38.06***

Suffolk

1.45/1.87

13.75**/5.18

4.86/19.61***

Texel

9.25**/19.56***

1.53/3.26

19.24***/49.75***

14.65***/12.91**

 

breeding to cultivate high fecundity sheep. More research about TAC3 and the mechanism of year-round estrus need to be performed.

 

Table V. Least squares mean and standard error for litter size of different genotypes in two loci of TAC3 gene in Small Tail Han sheep.

Locus

Genotype

Number of ewes

Litter size

327

CC

145

2.34a±0.08

CT

34

2.30a±0.16

TT

6

2.26a±0.21

1803

AA

8

2.30a±0.20

AG

56

2.31a±0.14

GG

129

2.34a±0.10

 

Note: Least squares means with the same superscript for the same pair of primer have no significant difference (P>0.05).

 

Acknowledgments

This work was supported by the National Natural Science Foundation of China (No. 31501941, No. 31472078, No. 31572371, No. 31501926), by Central Public-interest Scientific Institution Basal Research Fund (No.Y2017JC24, No. 2017ywf-zd-13, No. 2018ywf-yb-1, No. 2018ywf-yb-2), by The Agricultural Science and Technology Innovation Program of China (No. ASTIP-IAS13), by The Earmarked Fund for China Agriculture Research System (No. CARS-38).

 

Ethics statement

All the animals were cared for under guidelines comparable to those laid down by the Council on Animal Care and were approved by the Animal Ethics Committee of Chinese Academy of Agricultural Sciences for the use of animals in scientific research.

 

Statement of conflict of interset

The authors declare that there is no conflict of interests regarding the publication of this article.

 

References

Almeida, T.A., Rojo, J., Nieto, P.M., Pinto, F.M., Hernandez, M., Martin, J.D. and Candenas, M.L., 2004. Tachykinins and tachykinin receptors: Structure and activity relationships. Curr. Med. Chem., 11: 2045-2081. https://doi.org/10.2174/0929867043364748

Chawla, M.K., Gutierrez, G.M., Young, W.S., McMullen, N.T. and Rance, N.E., 1997. Localization of neurons expressing substance P and neurokinin B gene transcripts in the human hypothalamus and basal forebrain. J. Comp. Neurol., 384: 429-442. https://doi.org/10.1002/(SICI)1096-9861(19970804)384:3<429::AID-CNE8>3.0.CO;2-5

D’Anna, R., Baviera, G., Corrado, F., Crisafulli, A., Ientile, R., Buemi, M. and Squadrito, F., 2004. Neurokinin B and nitric oxide plasma levels in pre-eclampsia and isolated intrauterine growth restriction. Int. J. Obstetr. Gynaecol., 111:1046-1050. https://doi.org/10.1111/j.1471-0528.2004.00257.x

Gianetti, E., Tusset, C., Noel, S.D., Au, M.G., Dwyer, A.A., Hughes, V.A., Abreu, A.P., Carroll, J., Trarbach, E., Silveira, L.F., Costa, E.M., de Mendonça, B.B., de Castro, M., Lofrano, A., Hall, J.E., Bolu, E., Ozata, M., Quinton, R., Amory, J.K., Stewart, S.E., Arlt, W., Cole, T.R., Crowley, W.F., Kaiser, U.B., Latronico, A.C. and Seminara, S.B., 2010. TAC3/TACR3 mutations reveal preferential activation of gonadotropin-releasing hormone release by neurokinin B in neonatal life followed by reversal in adulthood. J. Clin. Endocrinol. Metab., 95: 2857-2867.

Loffler, S., Schulz, A., Hunt, S.P. and Spanel-Borowski, K., 2004. Increased formation of corpora lutea in neurokinin 1-receptor deficient mice. Mol. Reprod. Dev., 68: 408-414. https://doi.org/10.1002/mrd.20093

Navarro, V.M., Gottsch, M.L., Chavkin, C., Okamura, H., Clifton, D.K. and Steiner, R.A., 2009. Regulation of gonadotropin-releasing hormone secretion by kisspeptin/dynorphin/neurokinin B neurons in the arcuate nucleus of the mouse. J. Neurosci., 29: 11859-11866. https://doi.org/10.1523/JNEUROSCI.1569-09.2009

Olcese, J., 1995. The mammalian pineal gland and reproduction. Controversies and strategies for future research. Adv. Exp. Med. Biol., 377:1-14. https://doi.org/10.1007/978-1-4899-0952-7_1

Page, N.M., Woods, R.J., Gardiner, S.M., Lomthaisong, K., Gladwell, R.T., Butlin, D.J., Manyonda, I.T. and Lowry, P.J., 2000. Excessive placental secretion of neurokinin B during the third trimester causes pre-eclampsia. Nature, 405: 797-800. https://doi.org/10.1038/35015579

Pintado, C.O., Pinto, F.M., Pennefather, J.N., Hidalgo, A., Baamonde, A., Sanchez, T. and Candenas, M.L., 2003. A role for tachykinins in female mouse and rat reproductive function. Biol. Reprod., 69: 940-946. https://doi.org/10.1095/biolreprod.103.017111

Plant, T.M., 2008. Hypothalamic control of the pituitary-gonadal axis in higher primates: key advances over the last two decades. J. Neuroendocrinol., 20:719-726. https://doi.org/10.1111/j.1365-2826.2008.01708.x

Topaloglu, A.K., Reimann, F., Guclu, M., Yalin, A.S., Kotan, L.D., Porter, K.M., Serin, A., Mungan, N.O., Cook, J.R., Ozbek, M.N., 2009. TAC3 and TACR3 mutations in familial hypogonadotropic hypogonadism reveal a key role for Neurokinin B in the central control of reproduction. Nat. Genet., 41:354-358. https://doi.org/10.1038/ng.306

Zhao, Z., Yang, T., Qiao, L., He, Q. and Dai, Z., 2019. Reproductive characteristics of Dazu Black Goats: A newly discovered Chinese indigenous breed resource with high litter sizes. Pakistan J. Zool., 51: 399-403.

To share on other social networks, click on P-share. What are these?

Pakistan Journal of Zoology

August

Vol. 52, Iss. 4, Pages 1225-1630

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe