Characterization of Recombinant Thermostable Phytase from Thermotoga naphthophila: A Step for the Fulfilment of Domestic Requirement of Phytase in Pakistan
Characterization of Recombinant Thermostable Phytase from Thermotoga naphthophila: A Step for the Fulfilment of Domestic Requirement of Phytase in Pakistan
Furqan Sabir1, Muhammad Tayyab1,*, Bushra Muneer2, Abu Saeed Hashmi1, Ali Raza Awan1, Naeem Rashid3, Muhammad Wasim1 and Sehrish Firyal1
1Institute of Biochemistry and Biotechnology, University of Veterinary and Animal Sciences, Abdul Qadir Jillani (Outfall) Road, Lahore
2Institute of Industrial Biotechnology, Government College University, Lahore
3School of Biological Sciences, University of The Punjab, Lahore
ABSTRACT
Supplementation of feed with phytase is the most suitable strategy for the availability of free phosphorus for the growth of monogastric poultry birds. Current study deals with the production and characterization of recombinant thermostable phytase from Thermotoga naphthophila (PHYTN). This study was an initial step for the fulfilment of domestic industrial requirement of phytase in Pakistan. The PCR resulted in the amplification of 1.8 kb phytase gene. SDS-PAGE confirmed the size of recombinant protein as 70 kDa. The optimization studies demonstrated the maximal production of recombinant phytase, when the recombinant cells were induced with 1.4 mM IPTG with the post induction time of 6 hours. PHYTN showed maximal activity at 80°C in 50 mM sodium acetate buffer pH 6. Presence of Fe3+ or Cu2+ showed an enhancing effect on the PHYTN activity. Thermostability studies demonstrated that PHYTN retains 88% residual activity when the protein was incubated at 80°C for 1.5 h in the presence of 1.5 mM Fe3+. The enzyme exhibited Km and Vmax values of 50 mM and 2500 µmole/min respectively when sodium phytate was used as substrate. The stability of enzyme at a wide range of temperature and pH makes it a potential candidate to be used in the poultry feed industry.
Article Information
Received 02 September 2016
Revised 14 March 2017
Accepted 27 September 2017
Available online 12 October 2017
Authors’ Contribution
FS did experimental work. MT planned and supervised the study and guided for manuscript write-up and editing. ASH, NR and SF facilitated the student for the conduction of experiments. ARA, BM and MW helped during writing the manuscript.
Key words
PHYTN, Thermotoga naphthophila, Recombinant phytase, Poultry feed, Phytate.
DOI: http://dx.doi.org/10.17582/journal.pjz/2017.49.6.1945.1951
* Corresponding author: [email protected]
0030-9923/2017/0006-1945 $ 9.00/0
Copyright 2017 Zoological Society of Pakistan
Introduction
Phytate (myo-inositole hexakisphosphate) is the storage form of phosphorus in plants especially in cereal, legumes and oilseeds which are being used as major component of animal feed (Reddy et al., 1982). Monogastric animals like poultry, pigs and humans doesn’t have ability to hydrolyze phytate (Lie and Porres, 2003) present in their feed and passed it as such in their manure which results in the phosphorus pollution and water eutrophication in periphery of intensive livestock population area (Kim et al., 2006). Due to presence of six reactive phosphate groups, phytate chelates important minerals such as Fe3+, Ca2+, Zn2+ and Mg2+ (Andritotis and Ross, 2003) or form irreversible complexes with amino acids or proteins and make digestive enzymes ineffective (Pallauf and Rimbach, 1996). Addition of inorganic phosphorus in the animal feed was a common practice being performed for the fulfillment of the phosphorus requirement that increases the overall cost and contribute to environmental pollution (Kim et al., 2006).
Supplementation of poultry feed with phytase results in the hydrolysis of phytate and the availability of free phosphorus for the growth of monogastric animals (Dvorakova, 1998). Production of phytases have been reported from bacteria (Bawane et al., 2011; Bohm et al., 2010; Nuge et al., 2014; Rodriguez et al., 1999), fungi (Mishra and Tiwari, 2013; Mullaney et al., 2000; Wyss et al., 1999), plants (Zhang et al., 2013) and animals (Cho et al., 2006). Microbial phytases are being preferred on plants or animals due to the ease in production. The poultry feed palletization process takes place at high temperature where most of the mesophilic enzymes become denatured, so there is need of thermostable phytase that can withstand high temperature of palletization.
Current study involves the domestic production of recombinant thermostable phytase from Thermotoga naphthophila. This locally produced phytase was purified and characterized. The phytase was also utilized to examine its efficacy in poultry birds (not part of this studies) with the aim to fulfill the local industrial demand of phytase in Pakistan and to save the huge foreign exchange for the import of phytase.
Materials and Methods
Cloning of phytase gene
The genomic DNA of Theromotoga naphthophila was purchased from Leibniz institute DSMZ-German collection of microorganisms and cell cultures, Germany. The phytase encoding gene was amplified using
PHY-TN-F (ATTGAGACATATGGAGTCAAAACCC) and PHY-TN-R (ATTACTAAAGCTTACTCTTCTGCCTTC)
as forward and reverse primers, respectively. The forward primer contained the unique restriction site of NdeI. The amplified PCR product was purified using DNA extraction kit (Thermoscientific, Life Sciences, USA) and the purified PCR product was ligated in pTZ57R/T using T4 DNA ligase (Thermoscientific, Life Sciences, USA). The ligated vector was utilized for the transformation of E.coli DH5α competent cells and positive clones were selected on the basis of blue white screening (Sambrook and Russel, 2001). The plasmid DNA was isolated and the presence of insert in the vector was confirmed by single and double digestion using NdeI and HindIII.
Expression studies of recombinant phytase
The phytase gene was subcloned in the pET21a and was utilized for the transformation of BL21 CodonPlus cells. Overnight grown culture of transformed BL21 CodonPlus cells were diluted to 1% with fresh LB media and was incubated at 37°C till the OD reached 0.4. The cells were induced with 1mM IPTG followed by further incubation at 37°C for 4.5h. The cells were harvested by centrifugation, resuspended in 50mM sodium acetate buffer pH 6 and were lysed by sonication using ultrasonic processor (Sonics, Newtorn, USA). The soluble part after lysis was incubated at 80°C for 1h in the water bath. The production of recombinant protein was examined by analyzing the heat treated samples through SDS-PAGE (Lamilli, 1970).
Optimization for the production of recombinant phytase
Maximal production of PHYTN was examined by varying the IPTG concentration from 0.1 to 1.5mM and post induction incubation time from 1 to 10h. The sample were withdrawn after every 1 h and the production was analyzed on SDS-PAGE.
Purification of recombinant phytase
The recombinant protein was purified using various chromatographic techniques. The samples after heat treatment was applied on pre equilibrated DEAE sephadex A-50 column using 50 mM sodium acetate buffer pH 6. The unbound proteins were washed away and the elution of bound protein was done with the NaCl gradient in the same buffer. The fractions after ion exchange chromatography were examined by SDS-PAGE. The partially purified fractions with phytase activity were pooled and was loaded to pre equilibrated Sephadex G-50 column using same buffer. The purity of the fraction was analyzed through SDS-PAGE.
Activity assay
Phytase activity was measured using a modified ferrous sulfate-molybdenum blue assay (Zhang et al., 2010). The 25 µl enzyme solution was incubated with 475 µl of sodium phytate (5mM) in 50mM acetate buffer (pH 6.0) at 80°C for 15 min. The enzyme reaction was subsequently terminated by the addition of 500 µl of 10% (w/v) trichloroacetic acid. The released phosphate was measured at 700 nm after adding 1000 µl of freshly prepared coloring reagent [1% (w/v) ammonium molybdate, 3.2% (v/v) sulfuric acid solution, and 7.2% (w/v) ferrous sulfate solution]. One unit of phytase activity was defined as the amount of enzyme required to liberate 1 µmol phosphate per min under the assay conditions. Phytase activity units were calculated using standard curve of K2HPO4.
Effect of temperature on PHYTN activity
Effect of temperature was analyzed by examining the PHYTN activity at various temperature ranging from 40 to 100°C. Regarding the thermostability studies, recombinant protein was incubated at 80°C in water bath in the presence or absence of metal ions. The samples were withdrawn after every 10 min and were utilized to examine the residual activity (Ali and Taj, 2016).
Effect of pH on PHYTN activity
The activity was examined at various pH ranging from 2 to 9 using 50 mM of each of Glycine-HCl buffer (2-4), sodium acetate buffer (4-7) and Tris HCl buffer (7-9). The activity was recorded and the data was utilized to find out the optimum pH.
Effect of metal ion on PHYTN activity
The activity was examined in the presence of 1mM of each of EDTA, Mg2+, Mn2+, Co2+, Cu2+, Fe3+, Ca2+ and Zn2+.
Effect of substrate concentration
PHYTN activity was observed by increasing the substrate concentration from 1 to 20 mM. The obtained data was utilized to plot the Lineweaver-Burk plot and for the estimation of the kinetic parameters.
Results
The PCR resulted in the amplification of 1.8 kb phytase gene. The presence of gene in recombinant vector was confirmed by restriction digestion. Single restriction with NdeI resulted in the linearization of the vector while the double digestion resulted in the liberation of the insert from recombinant vector. The deduced nucleotide sequence of phytase gene showed maximum homology of 46% with Oryza sativa, 45.5% with Triticum aestivum (Li et al., 2013), 43.4% with Aspergillus fumigatus (Suresh and Das, 2014), 35.12% with Glycine max (Singh et al., 2013), 30.9% with Bacillus subtilis (Bawane et al., 2011) and 29.64% with Obesumbacterium proteus (Zinin et al., 2004).
SDS-PAGE determined the production of recombinant phytase as intracellular protein having molecular weight of 70 KDa (Fig. 1). The optimal PHYTN production was observed when BL21 CodonPlus cells harboring pET21a containing phytase gene were induced with 1.4 mM IPTG with post induction incubation period of 6h at 37°C.
Increase in temperature from 40 to 80°C revealed a linear increase in PHYTN activity. Maximal activity was recorded at 80°C while further increase in temperature resulted in the decreased activity (Fig. 2). The protein showed stability and retains 57% residual activity when the PHYTN was incubated for 1.5 h at 80°C in the absence of metal ions (Fig. 3, unfilled circle). The incubation of protein in the presence of Cu2+ or Fe3+ was also studied as these ions were involved in the enhancement of PHYTN activity. The presence of Cu2+ or Fe3+ showed a stabilizing effect on the PHYTN structure. In the presence of Cu2+ (Fig. 3, unfilled triangle) or Fe3+ (Fig. 3, filled circle) the protein retained 74% or 88% residual activity respectively with an incubation of 1.5h at 80 °C. The PHYTN activity was increased with the increase in pH from 2 to 6 with optimal activity between pH 6 to 7 in 50 mM sodium acetate buffer (Fig. 4). Further increase in pH showed a decline in activity.
Abolishment of activity in the presence of 1mM EDTA confirmed the metal dependence of PHYTN. Presence of Cu2+ or Fe3+ showed an enhancing effect on the PHYTN activity when used at a final concentration of 1mM. 1.5 mM Fe3+ was recorded to be optimal concentration for the maximal activity of PHYTN. Kinetic studies demonstrated the Km and Vmax of 50 mM and 2500 µmole/min, respectively (Fig. 5) when sodium phytate was used as substrate.
Discussion
The study was conducted for the domestic production of recombinant thermostable phytase for the poultry feed industry of Pakistan. In the current study, the recombinant phytase was produced and characterized. Poultry trials were conducted to examine the efficacy of this phytase in poultry birds (not part of this study). The local production of recombinant thermostable phytase will be beneficial for the feed industry of Pakistan as this will result in cheaper availability of phytase in near future and will save a huge foreign exchange for the import of phytase.
The comparison of amino acid sequence of PHYTN with the reported phytase showed that PHYTN showed maximum identity of 46 and 45.5 % with various purple acid phosphatases i.e. Oryaza sativa and Triticum aestivum, respectively (Li et al., 2013). The PHYTN sequence homology analysis with reported purple acid phosphatase demonstrated that PHYTN didn’t share various conserved domains “DXG and GDXXY” which are specialized for the incorporation of metal ion and for enzyme function (Hegeman and Grabau, 2001). The PHYTN required Fe3+ as cofactor that is a unique characteristic of purple acid phosphatases (Dionisio et al., 2011). PHYTN is a unique phytase as sequence similarity, dependence on iron for activity keep it close to purple acid phosphatase but the absence of conserved catalytic domains make this phytase unique.
PHYTN showed optimal activity at 80°C which is higher as compared to 70°C for phytase from Bacillus subtilis (Lei et al., 2013) while the same behavior was shown by fungal phytase from Aspergillus sp. L117 (Lee et al., 2005). The PHYTN showed maximum activity in the presence of 50 mM acetate buffer pH 6 that is different as compared to 4.5 for phosphatases from Glycine max while fungal phytase from Aspergillus niger while Triticum aestivum showed similar pH optima (Lei et al., 2013). PHYTN is a metal dependent enzyme that require Cu2+ or Fe3+ for its activity. Previous reports demonstrate that purple acid phosphatase from wheat, barley maize and rice also require Fe2+ for their activity (Dionisio et al., 2011). The presence of Mn2+, Mg2+, Co2+, Ca2+ and Zn2+ showed an inhibitory effect on the activity of PHYTN (Table I). Similar behavior was reported for the activity of phytase from metagenome derived phytase (Tan et al., 2015) and a phytase from Pseudomonas putida, whose activity was also inhibited in the presence of Zn2+ (Dharmsthiti et al., 2005).
Table I.- Effect of Metal Ions on PHYTN activity.
Divalent cation or EDTA or detergent |
Relative activity (%) |
None |
100 |
EDTA |
0 |
Metal Ions* | |
Zn2+ |
62 |
Mg2+ |
75 |
Ca2+ |
78 |
Mn2+ |
80 |
Co2+ |
86 |
Cu2+ |
115 |
Fe3+ |
158 |
*Metal chlorides were used in the activity assay.
Thermostability studies demonstrated that PHYTN was found to be stable with 88% residual activity even after an incubation of 1.5 h at 80°C. This stability is higher as compared to reported phytase from A. niger (Wyss et al., 1998); whereas, the phytase from Aspergillus sp. L117 showed higher level of stability (Lee et al., 2005). It was examined that 1.5 mM Fe3+ concentration is required for the maximal activity of PHYTN that is quite higher than 0.1 mM Fe3+ for optimal phytase activity from Talaromyces thermophilus (Singh and Satyanarayana, 2013).
Poultry trials demonstrated that the supplementation of PHYTN in poultry feed resulted in increased feed consumption, weight gain and improved FCR as compared to negative control. The supplementation of feed with PHYTN (1000 IU/kg) clearly exhibited a significant effect on bird feed consumption (2660 to 2780 g), weight gain (999.83 to 1122.8 g) and in the improvement of FCR from 2.66 to 2.48.
Conclusion
Current study deals with the successful characterization of recombinant thermostable phytase from T. naphthophila. The characterization studies demonstrated enzyme stability at a wide range of temperature and pH that makes it a potential candidate to be used in the poultry feed industry of Pakistan. However, experiments at large scale will be essential for the utilization of this phytase for poultry feed supplementation.
Acknowledgements
Higher Education Commission for providing the funds/scholarship for the completion of the research.
Statement of conflict of interest
The authors have no conflict of interest.
References
Ali, S. and Taj, A., 2016. Direct production of an extracellular tyrosinase from Rhizopus oryzae NRRL-1510 by solid substrate fermentation. Pakistan J. Zool., 48: 1051-1058.
Andriotis, V.M. and Ross, J.D., 2003. Isolation and characterisation of phytase from dormant Corylus avellana seeds. Phytochemistry, 64: 689-969. https://doi.org/10.1016/S0031-9422(03)00415-1
Bawane, R., Tantwai, K., Rajput, L.P.S., Kadam-Bedekar, M., Kumar, S., Gontia, I. and Tiwari, S., 2011. Molecular analysis of phytase gene cloned from Bacillus subtilis. Adv. Stud. Biol., 3: 103-110.
Böhm, K., Herter, T., Müller, J.J., Borriss, R. and Heinemann, U., 2010. Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme. FEBS J., 277: 1284-1296. https://doi.org/10.1111/j.1742-4658.2010.07559.x
Cho, J., Choi, K., Darden, T., Reynolds, P.R., Petitte, J.N. and Shears, S.B., 2006. Avian multiple inositol polyphosphate phosphatase is an active phytase that can be engineered to help ameliorate the planet’s “phosphate crisis”. J. Biotechnol., 126: 248-259.
Dionisio, G., Madsen, C.K., Holm, P.B., Welinder, K.G., Jørgensen, M., Stoger, E., Arcalis, E. and Brinch, P.H., 2011. Cloning and characterization of purple acid phosphatase phytases from wheat, barley, maize and rice. Pl. Physiol., 156: 1087-1100. https://doi.org/10.1104/pp.110.164756
Dharmsthiti, S., Chalermpornpaisarn, S., Kiatiyajarn, M., Chanpokapaiboon, A., Klongsithidej, Y. and Techawiparut, J., 2005. Phytase production from Pseudomonas putida harbouring Escherichia coli appA. Process Biochem., 40: 789-793. https://doi.org/10.1016/j.procbio.2004.02.008
Dvorakova, J., 1998. Phytase: Sources, preparation and exploitation. Folia Microbiol., 43: 323-338.
Hegeman, C.E. and Grabau, E.A., 2001. A novel phytase with sequence similarity to purple acid phosphatases is expressed in cotyledons of germinating soybean seedlings. Pl. Physiol., 126: 1598-608. https://doi.org/10.1104/pp.126.4.1598
Kim, T., Mullaney, E.J., Porres, J.M., Roneker, K.R., Crowe, S., Rice, S., Ko, T., Ullah, A.H.J., Daly, C.B., Welch, R. and Lei, X.G., 2006. Shifting the pH profile of Aspergillus niger phyA phytase to match the stomach pH enhances its effectiveness as an animal feed additive. Appl. Environ. Microbiol., 72: 4397-4403. https://doi.org/10.1128/AEM.02612-05
Lamilli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 277: 680-685. https://doi.org/10.1038/227680a0
Lee, D.H., Choi, S.U. and Hwang, Y.I., 2005. Culture Conditions and Characterizations of a New Phytase-Producing Fungal Isolate, Aspergillus sp. L117. Mycobiology, 33: 223-229. https://doi.org/10.4489/MYCO.2005.33.4.223
Li, R., Lu, W., Gu, J., Li, X., Guo, C. and Xiao, K., 2013. Molecular characterization and functional analysis of OsPHY2, a phytase gene classified in histidine acid phosphatase type in rice (Oryza sativa L.). Afri. J. Biotechnol., 10: 11110-11123.
Lie, X.G. and Porres, J.M., 2003. Phytase enzymology, application and biotechnology. Biotechnol. Lett., 25: 1787-1794. https://doi.org/10.1023/A:1026224101580
Lei, X.G., Weaver, J.D., Mullaney, E., Ullah, A.H. and Azain, M.J., 2013. Phytase: A new life of an old enzyme. Annu. Rev. Anim. Biosci., 1: 283-309. https://doi.org/10.1146/annurev-animal-031412-103717
Mishra, I.G. and Tiwari, S., 2013. Molecular characterization and comparative phylogenetic analysis of phytases from fungi with their prospective applications. Fd. Technol. Biotechnol., 51: 313-326.
Mullaney, E.J., Daly, C.B., Sethumadhavan, K., Rodriquez, E., Lei, X.G. and Ullah, A.H., 2000. Phytase activity in Aspergillus fumigatus isolates. Biochem. biophys. Res. Commun., 275: 759-763. https://doi.org/10.1006/bbrc.2000.3234
Nuge, T., Hashim, Y.Z.H., Farouk, A.A. and Salleh, H.M., 2014. Cloning and expression of a novel phytase gene (phyMS) from Mycobacterium smegmatis. Adv. Enzyme Res., 2: 27-38. https://doi.org/10.4236/aer.2014.21003
Pallauf, J. and Rimbach, G., 1996. Nutritional significance of phytic acid and phytase. Arch. Anim. Nutr., 50: 301-319.
Reddy, N.R., Sathe, S.K. and Salunkhe, D.K., 1982. Phytates in legumes and cereals. Adv. Fd. Res., 28: 1-92. https://doi.org/10.1016/S0065-2628(08)60110-X
Rodriguez, E., Han, Y. and Lei, X.G., 1999. Cloning, sequencing, and expression of an Escherichia coli acid phosphatase/phytase gene (appA2) isolated from pig colon. Biochem. biophys. Res. Commun., 257: 117-123. https://doi.org/10.1006/bbrc.1999.0361
Sambrook, J. and Russell, D.W., 2001. Molecular cloning: A laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, New York, pp. 1-123.
Singh, P., Punjabi, M., Jolly, M., Rai, R.D. and Sachdev, A., 2013. Characterization and expression of codon optimized soybean phytase gene in E. coli. Indian J. Biochem. Biophys., 50: 537-547.
Singh, B. and Satyanarayana, T., 2013. Phytases and phosphatases of thermophilic microbes: Production, characteristics and multifarious biotechnological applications. In: Thermophilic microbes in environmental and industrial biotechnology, 2nd ed. Springer Netherlands, pp. 671-687. https://doi.org/10.1007/978-94-007-5899-5_25
Suresh, N. and Das, A., 2014. Molecular cloning of alkaline phosphatase, acid phosphatase and phytase genes from Aspergillus fumigatus for applications in biotechnological industries. J. Pharm. Sci. Res., 6: 5-10.
Tan, H., Wu, X., Xie, L., Huang, Z., Gan, B. and Peng, W., 2015. Cloning, overexpression and characterization of a metagenome-derived phytase with optimal activity at low-pH. J. Microbiol. Biotechnol., 25: 930-935. https://doi.org/10.4014/jmb.1411.11012
Wyss, M., Pasamontes, L., Rémy, R., Kohler, J., Kusznir, E., Gadient, M. and van Loon, A.P., 1998. Comparison of the thermostability properties of three acid phosphatases from molds: Aspergillus fumigatus phytase, A. niger phytase, and A. niger pH 2.5 acid phosphatase. Appl. environ. Microbiol., 64: 4446-4451.
Wyss, M., Brugger, R., Kronenberger, A., Remy, R., Fimbel, R., Oesterhelt, G., Lehmann, M. and Van, A.P., 1999. Biochemical characterization of fungal phytases (myo-ino-sitol hexakisphosphate phosphohydrolases): catalytic prop-erties. Appl. environ. Microbiol., 65: 367–373.
Zhang, G.Q., Dong, X.F., Wang, Z.H., Zhang, Q., Wang, H.X., and Tong, J.M., 2010. Purification, characterization, and cloning of a novel phytase with low pH optimum and strong proteolysis resistance from Aspergillus ficuum NTG-23. Biosci. Rep., 101: 4125-4131. https://doi.org/10.1016/j.biortech.2010.01.001
Zhang, G.Q., Ying, Y.W., Ng, T.B., Chen, Q.J. and Wang, H.X., 2013. A phytase characterized by relatively high pH tolerance and thermostability from the Shiitake mushroom Lentinus edodes. BioMed. Res. Int., 2013: Article ID 540239. https://doi.org/10.1155/2013/540239
Zinin, N.V., Serkina, A.V., Gelfand, M.S., Shevelev, A.B. and Sineoky, S.P., 2004. Gene cloning, expression and characterization of novel phytase from Obesumbacterium proteus. FEMS. Microbiol. Lett., 236: 283-290. https://doi.org/10.1111/j.1574-6968.2004.tb09659.x
To share on other social networks, click on any share button. What are these?