Submit or Track your Manuscript LOG-IN

Analysis of Polymorphism of Growth Hormone Secretagogue Receptor in Sheep

PJZ_52_3_1161-1164

 

 

Analysis of Polymorphism of Growth Hormone Secretagogue Receptor in Sheep

Jun Yan Bai*, Hong Deng Fan, You Bing Yang, Xu Wang, Heng Cao, Xue Yan Fu and Yu Qin Wang

College of Animal Science and Technology, Henan University of Science and Technology, Luoyang 471003, China

ABSTRACT

The purpose of this study was to find candidate genes regulating the growth and development of sheep. The polymorphism of GHSR gene in five sheep populations was analyzed by PCR and sequencing techniques. The results showed that large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep, hu sheep all have two mutation sites (C155T and C624T). For locus C155T, allele frequencies of C in large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep and hu sheep were 0.73, 0.83, 0.54, 0.69 and 0.68 respectively, which indicated that C was the dominant allele in five sheep populations. For locus C624T, allele frequencies of C in large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep and hu sheep were 0.70, 0.87, 0.52, 0.70 and 0.76 respectively, which indicated that C was the dominant allele in five sheep populations. The C155T mutation site of GHSR-3 gene led to a codon change from GCC to GCT, both of which coding the same aa, alanine, indicating C155T was a synonymous mutation site. The C624T mutation site of GHSR-4 gene led to a code change from CTT to CCT, and the corresponding aa changed from leucine to proline, which was a missense mutation site.


Article Information

Received 20 March 2019

Revised 22 May 2019

Accepted 20 June 2019

Available online 13 March 2020

Authors’ Contribution

JYB conceived and designed the study, collected samples, analyzed the data and wrote the article. YBY and YQW helped in sampling. HDF and XW helped in analysis of data. HC and XYF helped in writing of article.

Key words

Small tailed han sheep, Large tailed han sheep, GHSR gene, SNP, Polymorphism

DOI: https://dx.doi.org/10.17582/journal.pjz/20190320070305

* Corresponding author: junyanbai@163.com

0030-9923/2020/0003-1161 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan



GHRL is an endogenous ligand with growth hormone secretagogue rcceptor (GHSR) or ghrelin receptor found in mammals in recent years. The binding of GHRL to receptor GHSR can specifically stimulate GH release and increase animal appetite, thus regulating body weight, energy metabolism and fat accumulation. In livestock production, GHRL gene and GHSR gene have been reported in ducks (Nie et al., 2009; Li et al., 2009; Li et al., 2010), cattle (Zhang et al., 2011), goats (Bai et al., 2019), which reveal that they are important candidate genes for body growth and development. Therefore, exploring the combination effect of GHRL gene and GHSR gene has guiding significance for livestock breeding and production.

Considering importance of GHSR on sheep growth, GHSR gene was used as the candidate gene of sheep growth traits to search possible SNP sites. Research results lay foundations for genetic marker of sheep growth traits and provide scientific theoretical references for breeding and quality identification of other sheep species.

 

Materials and methods

Blood samples (10mL) were collected from venous in wings of large tailed han sheep (50), small tailed han sheep (50), yuxi fatty tailed sheep (50), dorper sheep (50), hu sheep (50) and processed by ACD anti-freezing (1:6). Genomic DNA was extracted by whole blood DNA kit provided by Beijing Dingguo.

The primer sequences of GHSR gene were from Song et al. (2015) (Table I). The primers were synthesized by Beijing Dingguo Changsheng Biotechnology Co., ltd. The total size of the PCR reaction system was 12.5μL, including 8.65μL of ddH2O, 1.25μL of 10×buffer, 0.75μL of Mg2+(25 mmol/L), 0.5μL of DNA template, 0.5μL (10 mmol/L) of upstream and downstream primers, 0.25μL of dNTPs, and 0.1μL of Taq enzyme. The PCR amplification process was as follows: denaturation for 3 min at 95; denaturation for 45 s at 94, annealing for 60s at 55 or, extension for 60s at 72 and 30 cycles, extension for 12 min at 72, and preserving at 4. GHSR-3and GHSR-4 amplification products of mixed DNA were sent to Beijing Qinke Xinye Biotech Co., Ltd for sequencing. Assembly analysis of sequencing results was carried out by DNAStar and SeqMan program.

Sequencing peak diagram read by SeqMan program in DNAStar software and Chromas software for calibration and sequencing comparison of sequencing results. Scaleplate in Mwsnap software was

 

Table I. The information of primer sequences.

Primer name

Sequences

Amplifi-cation fragment

Produc-tion size (bp)

Annealing temper-ature ()

GHSR-3

F:CGTTCTCTTTCTCATTGTCTTTTCA

R:TCCCAAGTTCTGCTGTGCTAT

E2-3’UTR

413

55.0

GHSR-4

F:TCACTCATTATTCTACACCAGAAGC

R: ACACCCAATGTCCAAATTAAGG

3’UTR-E2

549

57.3

 

Table II. Estimation of SNP allele frequency of GHSR gene in sheep.

Loci

Large tailed han sheep

Small tailed han sheep

Yuxi fatty tailed sheep

Dorper sheep

Hu sheep

C155T

C (0.73)

C (0.83)

C (0.54)

C (0.69)

C (0.68)

T (0.27)

T (0.17)

T (0.46)

T (0.31)

T (0.32)

C624T

C (0.70)

C (0.87)

C (0.52)

C (0.70)

C (0.76)

T (0.30)

T (0.13)

T (0.48)

T (0.30)

T (0.24)

 

used to measure peak height corresponding to different SNP alleles. Gene frequency was estimated according to the following formula (Bai et al., 2016a, 2016b, 2017): F1= Hi/(H1+H2) (i=1, 2), where F1 is frequency of an allele at SNP site, H1 and H2 are heights of peak 1 and peak 2 of this SNP allele on the sequencing diagram.


 

Results and discussion

Figure 1 shows agarose gel electrophoresis (2%) results of PCR amplification products of GHSR gene in sheep. PCR products of GHSR-3 and GHSR-4 have single band (Fig. 1).

Based on comparison observation of sequencing results, it found that large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep, hu sheep all have two mutation sites (SNP sites). C155T and C624T were detected in PCR products of GHSR-3 and GHSR-4. Sequencing maps of these two mutation sites are shown in Figure 2.

For locus C155T, allele frequencies of C in large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep and hu sheep were 0.73,0.83,0.54,0.69,0.68,


 

respectively, which indicated that C was the dominant allele in five sheep populations. For locus C624T, allele frequencies of C in large tailed han sheep, small tailed han sheep, yuxi fatty tailed sheep, dorper sheep and hu sheep were 0.70,0.87,0.52,0.70,0.76, respectively, which indicated that C was the dominant allele in five sheep populations (Table ).


 

At present, there are few studies on SNPs of GHSR and GHRL genes. Liu et al. (2013) found exons 2 and 3’UTR of GHSR in Qianbei Ma sheep and found G996A locus, which is closely related to body weight. Song et al. (2015) detected G200A mutation in exon 2 of GHSR to exon 3 of Guizhou white goat and Guizhou black goat, and C14T mutation in exon 4 of GHRL. Luo et al. (2014) found C345T mutation in GHRL gene exon of Guizhou goats, which was significantly associated with body weight, height and chest circumference. In this study, C155T and C624T mutation sites were found in GHSR exons 2 to 3’ -UTR in five Henan local sheep. Sequence comparison confirmed that there were two mutation sites in sheep.

By comparing the amino acid of C155T mutation site of GHSR-3 gene, it was found that the mutation site changed from GCC to GCT, and both before and after mutation were alanine, which was synonymous mutation site (Fig. 3). Amino acid comparison of C624T mutation site of GHSR-4 gene showed that the mutation site changed from CTT to CCT, from leucine to proline, and was a missense mutation site (Fig. 3).

Prediction of amino acid structure showed that the fat index of CTT of GHSR-4 gene was higher than that of CCT, which belonged to hydrophobic structure, had good stability and was conducive to fat deposition. The prediction of secondary structure of GHSR-4 showed that the structure of GHSR-4 was mainly alpha-helix, which was consistent with the prediction of secondary protein of Song et al. (2015), The transformation of amino acid CTT into CCT resulted in the transformation of protein 17-22 beta into beta folding. The results of gene localization and functional prediction showed that CCT protein encoded more in nucleus and mitochondria, and increased fatty acid metabolism, which was consistent with the results of long-term evolution of sheep.

 

Acknowledgements

Sincere gratitude goes to the much starker choices-and graver consequences-in national modern mutton sheep industry technology system (CARS-39) and National spark program(2015GA750002).

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Bai, J.Y., Jia, X.P., Yang, Y.B., Pang, Y.Z. and Wang, Y.Q., 2017. Indian J. Anim. Res., 51: 856-859.

Bai, J.Y., Wang, X., Yang, Y.B., Zhang, X.H., Pang, Y.Z. and Li, H.W., 2016a. R. Bras. Zootec., 45: 604- 607. https://doi.org/10.1590/S1806-92902016001000004

Bai, J.Y., Jia, X.P., Yang, Y.B., Pang, Y.Z. and Qi, Y.X., 2016b. Pakistan J. Zool., 48:931-935.

Bai, J.Y., Zhao, Y.G. and Wang, Y.Q., 2019. Pakistan J. Zool., 51:1-4.

Li, H.F., Zhu, W.Q., Xu, W.J., Song, W.D., Gao, Y. and Chen, K.W., 2009. Jiangsu J. agric. Sci., 25: 576-582.

Li, J.Y., Zhan, K., Xu, Y.Y., Zhao, R.H. and Tang, Z.J., 2010. J. Anhui. agric. Sci., 10: 7379-7381.

Liu, B., Luo, W.X., Cai, H.F. and Sun, Y.Y., 2013. Guangdong agric. Sci., 22: 161-165.

Luo, K.P., Song, T.W., Sun, Y.Y., Liu, B., Luo, W.X., Huang, A.Z. and Zhang, X., 2014. Guangdong agric. Sci., 1: 162-165.

Nie, Q., Fang, M., Xie, L., Peng, X., Xu, H., Luo, C. and Zhang, D., 2009. J Biomed. Biotechnol., 567120. https://doi.org/10.1155/2009/567120

Song, T.W., Cai, H.F., Luo, W.X., Liu, R.Y., Zhang, Y.Y., Sun, Y.Y. and Liu, B., 2015. Sci. Agric. Sin., 1: 140-153.

Zhang, A.L., Zhang, L., Yang, M.M., Zhang, L.Z. and Chen, H., 2011. J. S. Chin. Agric. Univ., 32: 92-96.

To share on other social networks, click on P-share. What are these?

Pakistan Journal of Zoology

June

Vol. 52, Iss. 3, Pages 825-1224

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe