Submit or Track your Manuscript LOG-IN
Latest Blogs: https://researcherslinks.com/en/kahoot-login/ https://researcherslinks.com/en/blooket-login/ https://researcherslinks.com/en/comcast-login/ https://researcherslinks.com/en/gimkit-login/

Advances in Animal and Veterinary Sciences

AAVS_9_4_462-472

 

 

Research Article

 

Ovine Theileriosis: Clinical, Pathological and Molecular Investigations

 

Mahmoud Eliwa1, Khaled Mohamed Ahmed Mahran2*, Waheed Ali Mousa3, Naglaa Hagag1, Mohamed Ibrahim Shaalan4, Mostafa Mahmoud Bashandy2

1Genome Research Unit, Animal Health Research Institute (AHRI), Dokki, Egypt; 2Department of Clinical Pathology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt; 3Department of Parasitology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt; 4Department of Pathology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt.

 

Abstract | Ovine theileriosis is a hemoprotazoan infection transmitted by tick bites which cause severe economic loss. This study aimed to survey Theileria infection of sheep in different localities of Egypt (Cairo, Giza and Al Monofia) by using microscopic and molecular detection associated with clinicopathological and pathological investigations. A total of 152 sheep blood samples were selected from farms and veterinary clinics. Microscopic examination of blood smears revealed that the incidence of Theileria infection was 21.7% while the incidence was 36.8% using PCR assay (universal Theileria spp. Primer). The use of species-specific primers showed a result of 53.6% single infection; Theileria ovis, and 46.4% mixed infection; T. ovis and Theileria lestoquardi. According to the results of PCR, animals were divided into 3 groups: Theileria negative group, T. ovis group and mixed T. ovis and T. lestoquardi group. The examination of both infected groups revealed non-significant changes between them. The hemogram revealed significant macrocytic hypochromic anemia, leukopenia, neutropenia, lymphopenia, monocytopenia, eosinopenia and thrombocytopenia in Theileria infected groups compared with Theileria negative group. Biochemical analysis revealed significant hypoproteinemia, hypoalbuminemia, total and indirect hyperbilirubinemia with elevations of AST and GGT activities with increase in concentration of BUN and creatinine while no significant changes in A:G ratio values and direct bilirubin concentration in Theileria infected groups compared with Theileria negative group. The pathological investigation revealed lymphocytic depletion and necrosis with hemorrhages in lymph node and spleen. Sequencing and phylogenetic analysis were performed by targeting the 18S rRNA gene of Theileria spp. In conclusion, according to our knowledge, this is the first report of phylogeny of T. lestoquardi infected sheep in Egypt.

 

Keywords | Sheep, Theileriosis, Clinicopathological, Molecular investigations

 

Received | September 28, 2020; Accepted | December 04, 2020; Published | February 15, 2021

*Correspondence | Khaled M.A. Mahran, Department of Clinical Pathology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt; Email: k.mahran@cu.edu.eg

Citation | Eliwa M, Mahran KMA, Mousa WA, Hagag N, Shaalan MI, Bashandy MM (2021). Ovine theileriosis: Clinical, pathological and molecular investigations. Adv. Anim. Vet. Sci. 9(4): 462-472.

DOI | http://dx.doi.org/10.17582/journal.aavs/2021/9.4.462.472

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2021 Eliwa et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

INTRODUCTION

 

Ovine theileriosis is one of the most important hemoprotazoan infections transmitted by tick bites (Zhao et al., 2019) which hinder the development and productivity of livestock industry, and result in severe economic losses as reduced productivity, high cost of treatment and the death of infected animals (Zhang et al., 2014; Elsify et al., 2015). Theileria is a genus belonging to Theileriidae family in Piroplasmida order. This order belongs to the Apicomplexa phylum (Levine, 1985).

 

The ovine theileriosis is a worldwide disease that is reported in different geographical areas including the Middle East, East and North Africa, India, China, Central Asia, and Eastern and Southern Europe (Razmi et al., 2019). In Egypt, the Theileria was first discovered in 1914 (Littlewood, 1915). The incidence of ovine theileriosis by microscopic examination was 33.75% in different 4 governorates (El-Fayoum, Giza, Cairo and El-Gharbia) (Radwan and El–Kelesh, 2009), 77.93% in Halayeb and Shalatin (Fadel et al., 2010) and 15.56% in Giza (Hegab et al., 2016).

 

The predominant clinical signs of ovine theileriosis are pyrexia, loss of appetite, gross enlargement of prescapular lymph nodes, pale mucous membranes, lacrimation and presence of ticks or tick bites on various parts of the body (Çöl and Uslu, 2006; Al-Fetly, 2012).

 

Diagnosis of theileriosis is mainly based on clinical signs in infected animals, and microscopic examination of stained thin blood and lymph node smears. In addition, Theileria species can be differentiated by using serological assays as enzyme-linked immunosorbent assay (ELISA), and molecular techniques such as polymerase chain reaction (PCR) (Bakheit et al., 2006; Youssef et al., 2015). PCR product may be sequenced to confirm the identity of the parasite (AL-Hosary et al., 2015; Rjeibi et al., 2016).

 

Hematological and biochemical alterations during Theileria infection in sheep were reported in several studies as result of multiple organs affection causing numerous gross and microscopic pathological changes (Akhter et al., 2017). These alterations provide some information about the severity and pathogenicity of the disease, and guide for the differential diagnosis and prognosis of the disease condition (Çöl and Uslu, 2006; Al-Fetly, 2012; Yaghfoori et al., 2017).

 

This study aims to survey the prevalence of ovine theileriosis in certain areas of Egypt (Cairo, Giza and Al Monofia), and to demonstrate the hematological, biochemical and pathological changes during Theileria infection with the identification of Theileria species by molecular techniques such as PCR, sequencing and phylogenetic analysis.

 

MATERIALS AND METHODS

 

Animals subjected to study

A total of 152 sheep were subjected to general examination and sampling in different localities of Cairo, Giza and Al Monofia (Table 1). The animals were randomly selected from farms, slaughterhouses and veterinary clinics. The animals were divided into 3 groups according to PCR result: negative group (96 sheep), T. ovis infected group (30 sheep) and mixed infection with T. ovis and T. lestoquardi group (26 sheep). This study was approved (VetCU10102019091) from the Institutional Animal Care and Use Committee (IACUC) of Faculty of Veterinary Medicine, Cairo University, Egypt.

 

Clinical examination of animals

All sheep, under the study, were subjected to the general clinical examination. Moreover, they were examined for the presence of ticks or tick bites, anemic mucous membrane and enlarged lymph nodes were also considered.

 

Table 1: Numbers of examined sheep according to different geographical localities.

 

Location Number of sheep
1. Badr center (Al Monofia) 29
2. Bahtim and Marg (Cairo) 47
3. Kafr Tohormous and Faisal (Giza) 29
4. Al Oubour (Cairo) 13
5. Al-Saff (Giza) 34
Total  152

 


Samples collection

Blood and serum collection

The blood samples were collected from jugular vein by a sterile needle. The samples were divided into sterile air-vacuumed tubes with potassium salt of ethylene diamine tetra acetic acid (EDTA) as anticoagulant for hematological and molecular examination and into plane tubes for serum collection for biochemical examination.

 

Lymph node biopsy

The prescapular lymph nodes biopsies were aspirated by fine needle aspiration after sterilization of sampling site (Almeria et al., 2001).

 

Organ tissue specimens

Swollen lymph nodes and enlarged spleen were collected just after slaughter of the animals in the slaughterhouse and preserved in 10% neutral buffered formalin, for histopathological examination (Suvarna et al., 2012).

Microscopic smear examination

Blood and lymph node smears were prepared on clean slide, air dried, fixed by methanol and stained with Field stain (Soulsby, 1982). The blood smears were examined microscopically to detect intra-erythrocytic merozoites and schizonts in lymphocytes, while the lymph node smears were examined to detect the schizonts (Koch’s blue bodies) inside the lymphocytes.

 

Polymerase chain reaction (PCR)

The DNA of Theileria was extracted from collected whole blood by using Thermo Scientific GeneJET Genomic® extraction kit (Life Technologies Inc., Carlsbad, California, USA) according to the manufacturer’s instructions. The used primers are listed in Table 2 as universal Theileria spp. (Allsopp et al., 1993) and specific primers; T. lestoquardi (Kirvar et al., 1998) and T. ovis (Altay et al., 2005). A universal Theileria spp. primer was used for all collected blood samples while the specific primers were only applied on the positive samples resulted from universal Theileria spp. primer. The PCR amplifications were performed in total volume of 25 µl containing 6.5 µL of template DNA, 12.5 µl of Thermo Scientific® 2× PCR Master mix (Life Technologies Inc., Carlsbad, California, USA), and 3 µl of each forward and reverse primer (20 pmol/µl). The PCR reactions were carried out in a thermocycler (BIO-RAD®, Singapore). The PCR cycling program were done according to Riaz and Tasawar (2017) as; initial denaturation at 94°C for 15 min for 1 cycle followed by denaturation, annealing and extension for 35 cycles at temperature (94, 60 and 72°C, respectively). At last final extension at 72°C for 7 min in 1 cycle. The PCR products were checked on 1.5% agarose gel stained with ethidium bromide, visualized and photographed using a gel document system (BIO-RAD®, Singapore).

 

Clinicopathological examination

Hematological studies

Hematological studies were performed by using Exigo vet® hematology analyzer on whole blood samples. The examination included RBCs count, hematocrit (Hct), hemoglobin (Hb) concentration, red cell indices [mean corpuscular volume (MCV) and mean corpuscular hemoglobin concentration (MCHC)], total leukocyte count (TLC) and platelet count. Differential leukocyte count (DLC) were performed manually by the method described by Weiss and Wardrop (2010).

 

Biochemical analysis

The biochemical examination was performed on serum samples by using commercial biochemical diagnostic kits provided by Vitro Scient®, Egypt. The biochemical parameters included total proteins (Doumas et al., 1981), albumin (Doumas et al., 1971), globulin, A/G ratio, aspartate aminotransferase (AST) (Reitman and Frankel, 1957), gamma-glutamyl transpeptidase (GGT) (Persijn and van der Slike, 1982; Szasz, 1969), total, direct and indirect bilirubin (Jendrassik and Grof, 1938), blood urea nitrogen (BUN) (Sampson et al., 1980) and creatinine (Jaffé, 1986).

 

Histopathological examination

The collected tissues were routinely processed and stained with hematoxylin and eosin (H and E) for microscopic examination (Suvarna et al., 2012). Additionally, spleen smears were stained with Prussian blue stain to demonstrate the hemosiderin pigment deposition (Cluzel et al., 2016).

 

Sequencing and phylogenetic analysis

The gene-specific PCR amplicons of the 18S rRNA gene of T. ovis and T. lestoquardi were size-separated using agarose gel electrophoresis, excised and purified from gels using the QIAquick® Gel Extraction Kit (Qiagen, Germany). Further, purified products from gel were used directly for cycle sequencing reactions using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, USA). Products of cycle sequencing reactions were purified using DyeEx® Spin Kit (Qiagen, Germany) and sequenced on an ABI 3500XL® Genetic Analyzer (Life Technologies, USA). The obtained sequences of T. lestoquardi and T. ovis were uploaded at GenBank and given the accession numbers; MT002826 and MT002827, respectively. The 18S rRNA genes of MT002826 and MT002827 sequences were assembled, aligned and edited using the Bioedit® software, version 7.2.5 (Hall, 1999). A Basic Local Alignment Search Tool (BLAST) was used on the National Centre for Biotechnology Information (NCBI) platform. Phylogenetic trees were constructed by using molecular evolutionary genetics analysis (MEGA®) software version 10.1.7 (Kumar et al., 2018) on the bases of maximum likelihood methodology (Hasegawa et al., 1985).

 

Table 2: Primers design of different Theileria primers sets.

 

Primer Target gene Primer specificity Product size (bp)
Universal spp. 18S rRNA

F.5'-AGTTTCTGACCTATCAG-3'

R.5'-TTGCCTTAAACTTCCTTG-3'

1098

Specific T.ovis

18S rRNA

F. 5'-TCGAGACCTTCGGGT-3

R.5'-TCCGGACATTGTAAAACAAA-3'

520

Specific T.lestoquardi

18S rRNA

F. 5'-GTGCCGCAAGTGAGTCA-3'

R.5'GGACTGATGAGAAGACGATGAG3'

785


 

Statistical analysis

The data were expressed as mean ± standard deviation (SD). Analysis of variance was performed by one-way ANOVA using SPSS version 25.0 for windows (Statistical Package for the Social Sciences; SPSS Inc., Chicago, USA).

 

RESULTS

 

Clinical signs

Clinical manifestations of ovine theileriosis in infected sheep and their incidence were listed in Table 3.

 

Table 3: The incidence of clinical signs of theileriosis in sheep.

 

Clinical signs Number of sheep
Fever 39
Cachexia and emaciation 33
Lacrimation and conjunctivitis 28
Pale mucous membrane 26
Tick bite wound 10

 

 

Prevalence of theileria infection

The microscopic examination of blood smears revealed the presence of intracellular forms of Theileria piroplasms and schizonts in 33 out of 152 samples (21.7%) while its incidence by using PCR (universal Theileria spp. Primer) was 56 out of 152 (36.8%) of examined animals. Moreover, the use of microscopic examination of blood smears and PCR assay revealed different prevalence in the different localities from which the samples were collected, Table 4.

 

Table 4: The prevalence of ovine theileriosis in the different localities.

 

Location Number of sheep Diagnostic techniques
Blood smears PCR
1. Bahtim and marg (Cairo) 47 2 4.3% 14 29.8%
2. Al Oubour (Cairo) 13 0 0.0% 0 0.0%
3. Kafr tohormous and faisal (Giza) 29 12 41.4% 13 44.8%
4. Al-Saff (Giza) 34 18 52.9% 28 82.4%
5. Badr center (Al Monofia) 29 1 3.4% 1 3.4%
Total 152 33 21.7% 56 36.8%

 


Microscopic examination

The microscopic examination of blood smear revealed pleomorphic (round, oval, rod and comma) piroplasms (Figures 1 and 2). They were observed as individual (one piroplasm per erythrocyte), double, triple and tetra-forms. Moreover, the microschizonts were observed in the lymphocytes of blood smear (Figure 3) while the macroschizonts (Koch’s blue bodies) were demonstrated in the lymphocytes of lymph nodes smears (Figure 4). The infected RBCs showed crenation, spherocytosis and acanthocytosis.

 

 

Polymerase chain reaction assay (PCR)

The use of specific primers assured the presence of T. ovis and T. lestoquardi in the different localities, Table 5. However, T. lestoquardi was only identified in association of T. ovis (mixed infection) in Al-Saff (Giza) group. The product size of universal Theileria, T. lestoquardi and T. ovis were 1098bp (Figure 5), 785 bp (Figure 7) and 520 bp (Figure 6), respectively.

 

Table 5: Prevalence of Theileria infections with different species.

 

Infection Number of sheep Infection (%)
T. ovis 30 53.6%

T. lestoquardi + T. ovis (mixed)

26 46.4%
Total 56 100%

 

 

 

Hematological changes

There was significant decrease in RBCs count, hematocrit, Hb concentration, MCHC, TLC, neutrophils, lymphocytes, monocytes, eosinophils, and platelets with significant increase of MCV in infected groups compared with Theileria negative group (Table 6). There were no significant differences between T. ovis group and mixed Theileria group.

 

 

 

Biochemical changes

Significant increases in AST, GGT, total bilirubin, indirect bilirubin, urea, and creatinine with significant decreases in total proteins and albumin were recorded in infected groups in comparison with Theileria negative group. Moreover, there was no significant change in the values of A:G ratio and direct bilirubin (Table 7). There were no significant differences between T. ovis group and mixed Theileria group.

 

 

 

 

Table 6: Hematological parameters of Theileria infected and control groups.

 

Parameter Unit

Theileria negative group

Theileria ovis group

Mixed Theileria group

RBCs count

×106 cell/μl

9.84±0.88a

6.72±0.76b

6.62±0.33b

Hct %

29.25±1.12a

22.97±1.94b

21.81±1.26b

Hb g/dl

10.21±0.91a

7.11±0.54b

6.88±0.39b

MCV fl

29.72±3.17a

34.27±2.51b

33.01±2.60b

MCHC %

33.86±1.54a

30.83±1.26b

31.44±1.08b

TLC

×103 cell/μl

14.98±1.32a

9.51±0.84b

6.65±0.26b

Neutrophils

×103 cell/μl

5.05±0.27a

4.31±0.19b

3.58±0.14b

Lymphocytes

×103 cell/μl

8.08±0.81a

4.29±0.25b

2.41±0.19b

Monocytes

×103 cell/μl

1.493±0.088a

0.755±0.033b

0.528±0.027b

Eosinophils

×103 cell/μl

0.356±0.056a

0.151±0.016b

0.124±0.026b

Platelets

×103 cell/μl

286.58±13.55a

202.11±15.81b

188.47±9.25b


Different superscripts in the same raw refer to significant changes (p<0.05).

 

Table 7: Biochemical parameters of Theileria infected and control groups.

 

Group Unit

Theileria negative group

Theileria ovis group

Mixed Theileria group

Total proteins g/dl

7.98±0.47a

6.48±0.69b

6.73±0.41b

Albumin g/dl

3.82±0.15a

3.29±0.33b

3.25±0.28b

Globulin g/dl

4.16±0.38a

3.19±0.17b

3.48±0.72b

A:G ratio  

1.51±0.099a

1.68±0.076a

1.42±0.088a

AST U/L

26.21±3.96a

45.63±2.52b

65.25±5.56b

GGT U/L

24.13±1.57a

41.99±1.49b

40.33±1.01b

Total bilirubin mg/dl

0.930±0.052a

1.309±0.065b

1.118±0.021b

Direct bilirubin mg/dl

0.608±0.054a

0.573±0.038a

0.618±0.012a

Indirect bilirubin mg/dl

0.624±0.061a

1.002±0.035b

0.997±0.021b

Urea mg/dl

23.16±1.74a

46.92±1.27b

50.53±1.10b

Creatinine mg/dl

0.983±0.178a

1.609±0.209b

1.346±0.124b


Different superscripts in the same raw refer to significant changes (p<0.05).

 

Macroscopic and histopathological changes

The examined organs (spleen and lymph nodes) showed severe enlargement with sub-capsular hemorrhages (Figures 8 and 9). Meanwhile, the microscopic examination of spleen revealed diffuse depletion of the lymphoid tissue, degenerative changes in the septal connective tissue and multiple necrotic foci with diffuse hemorrhages accompanied with deposition of hemosiderin pigment (Figure 10). Moreover, depletion and necrosis of lymphoid follicles were observed in the lymph nodes (Figure 11).

 

Phylogenetic analysis

The comparison of the18S rRNA T. Lestoquardi partial sequence (MT002826) revealed 100% homology with T. lestoquardi from bovine/Egypt (KF771185), ovine/Tunisia (KM117212 and KJ458988), ovine/China (AF081135) and ovine/Iraq (KC778786). Also, there was a 99% homology with the bovine T. annulata from France (KF429799), Turkey (AY508463), Pakistan (MG599090) and Spain (DQ287944) (Figure 12) while the 18S rRNA T. ovis partial sequence (MT002827) revealed 100% homology with the ovine T. ovis from South Africa (MG203885), France (EU622911), Turkey (KT851436), China (FJ603460), Tanzania (MG725961) and India (MH819508) (Figure 13).

 

 

 

 

DISCUSSION

 

Ovine theileriosis is an important hemoprotazoan disease of sheep causing severe economic losses as reduced productivity and sometimes cause high mortality of infected animals (Zhao et al., 2019). In this study, the ovine theileriosis infected animals showed the common clinical signs of the disease as pyrexia, cachexia, emaciation, lacrimation, conjunctivitis, pale mucous membrane and tick bite wounds.

 

Microscopic examinations of blood smears, prepared from the animals of this study, revealed that the incidences of Theileria species were 4.3%, 0.0%, 41.4%, 52.9% and 3.4% in Bahtim and Marg, Al Oubour, Kafr Tohormous and Faisal, Al-Saff, and Badr center; respectively, with an overall incidence of 21.7% while by using PCR (universal Theileria spp. primer) the incidences were 29.8%, 0.0%, 44.8%, 82.4% and 3.4% in the same localities with an overall incidence of 36.8%. These results are approximately similar to the results of Hegab et al. (2016) who reported a prevalence of 17.08% by using microscopic examination of blood smears and 40% by using PCR in the resident sheep samples collected from different localities of Egypt.

 

 

 

According to the results of PCR (by using universal and spp. specific primers), the animals of this study, were divided into 3 groups: Theileria negative group, T. ovis group and mixed T. ovis and T. lestoquardi group. The clinic pathological examination of the animals of the groups under the study revealed significant changes of some parameters in both infected groups in comparison with the Theileria negative group. Moreover, the significance was more prominent in the mixed group than the T. ovis group due to there is co-infection with T. lestoquardi and T. ovis.

 

The microscopic examination of blood smears of infected animals showed pleomorphic intra-erythrocytic piroplasms and microschizont inside lymphocytes while the lymph node smears showed macroschizont (Koch’s blue bodies) inside the lymphocytes. These microscopic findings are similar to Çöl and Uslu (2006) and Hegab et al. (2016).

 

Results of erythrogram revealed significant macrocytic hypochromic anemia in the infected groups compared with Theileria negative group. The hemolytic anemia occurs due to presence of parasites inside the RBCs causes hemolysis result from erythrocytic fragility (Mahmoud et al., 2019) and stimulation of erythrophagocytosis in reticuloendothelial system (Razmi et al., 2019). A permanent tick blood sucking causing chronic blood loss (Minnat and Abdulwadood, 2012). These results agreed with the results recorded by Al-Fetly (2012), Razavi et al. (2015) and Sohail et al. (2018).

 

The leukogram of infected groups showed significant leukopenia due to neutropenia, lymphopenia, monocytopenia and eosinopenia, compared with the Theileria negative group. This leukopenia may be explained as a results of destruction of infected lymphocytes due to presence of schizogony of parasite inside them (Mahmoud et al., 2019) while the decrease of other cells may be due to the suppression of bone marrow and leukopoiesis as a result of parasitic products and increase TNF-α production (Razmi et al., 2019). Moreover, Weiss and Wardrop (2010) reported that the eosinopenia and pancytopenia in Theileria infected animals may be due to parasitic toxins or different causes of necrosis, fibrosis, or suppression in bone marrow. These results were in agreement with Çöl and Uslu, (2006), Yaghfoori et al. (2017), Minnat and Abdulwadood (2012) and Khan et al. (2017) while leukocytosis in Theileria infected sheep were demonstrated in some studies that results due to stage of infection and proliferation of lymphocytes in the lymphoid organs as a defensive response to parasitic infection (Al-Fetly, 2012; Sohail et al., 2018; Razmi et al., 2019).

 

Significant thrombocytopenia was also reported in the infected groups compared with Theileria negative group. The thrombocytopenia in Theileria infection occurred due to increased platelets destruction, consumption and degranulation in peripheral circulation (Çöl and Uslu, 2006) and/or due to the pancytopenia resulting from production of TNF-α or bone marrow suppression as result of parasitic toxins (Razmi et al., 2019).

 

The liver affection during ovine theileriosis was proved by significant hypoproteinemia, hypoalbuminemia, total and indirect hyperbilirubinemia. The AST and GGT activities were significant increased. Moreover, the values of A:G ratio and direct bilirubin have no significant changes in both infected groups compared with the Theileria negative group. Hypoproteinemia and hypoalbuminemia in Theileria infection might be resulted from synthesis reduction in liver due to liver failure, extravascular release proteinaceous fluids from diseased lymph nodes and/or reduction in protein intake due to anorexia during infection (Sohail et al., 2018; Mahmoud et al., 2019). The increased liver enzymes activities were explained by the leakage from liver damages as necrosis and degeneration of the hepatocytes, severe damage of the hepatobiliary system and increased sinusoidal spaces (Gunes et al., 2016; Akhter et al., 2017; Yaghfoori et al., 2017). The total and indirect hyperbilirubinemia were due to hemolysis of infected RBCs inside the reticuloendothelial system causing hemolytic anemia and liver failure (Akhter et al., 2017; Yaghfoori et al., 2017; Mahmoud et al., 2019).

 

The kidney function tests revealed significant increase of BUN and creatinine; azotemia of both infected groups compared with Theileria negative group. This azotemia may be related to the deposition of immune complexes of Theileria spp. in the renal tissue causing focal or diffuse coagulative necrosis and/or increased protein catabolism due to inappetence during Theileria infection (Baghshani et al., 2012; Elbasheir and Elhussein, 2013; Yaghfoori et al., 2017).

 

The histopathological changes included depletion and necrosis with hemorrhages of lymphoid follicles of lymph nodes and diffuse depletion of the lymphoid tissue with degenerative changes and hemorrhages in the spleen. The lymphocytic depletion and necrosis may explain the recorded lymphopenia in the Theileria infected groups (Akhter et al., 2017).

 

According to previous studies, a conserved gene of 18S rRNA is specific target for Theileria species detection by using PCR assay as described by Liu et al., 2010 as a sensitive diagnostic tool for ovine theileriosis. In this study, different primer sets were used for Theileria spp.; a universal primer (Allsopp et al., 1993) and species-specific primers for T. ovis (Altay et al., 2005) and T. lestoquardi (Kirvar et al., 1998). Different Theileria species as T. ovis and T. lestoquardi were identified by using specific primer sets. From positive samples of universal primers 36.8% were identified as 53.6% T. ovis and 46.4% mixed infection with T. ovis and T. leastoquardi.

 

Sequencing and phylogenetic analysis were performed using a blood sample collected from Al-Saff (Giza) that was positive to T. lestoquardi and T. ovis. The 18S rRNA gene of T. lestoquardi and T. ovis were partially sequenced (GenBank Accession Numbers MT002826 and MT002827). The isolate of T. leastoquardi (MT002826) revealed 100% homology with T. lestoquardi from bovine/Egypt (KF771185), ovine/Tunisia (KM117212 and KJ458988), ovine/China (AF081135) and ovine/Iraq (KC778786). This isolate showed 99% homology with T. annulata from France (KF429799), Turkey (AY508463), Pakistan (MG599090) and Spain (DQ287944). Our isolate was clustered in a single clade with T. lestoquardi, T. annulata, T. parva and T. taurotragi. This result is consistent with a previous report about T. lestoquardi from ovine source in Tunisia (Rjeibi et al., 2016) and T. lestoquardi from buffaloes source in Egypt (AL-Hosary et al., 2015). The isolate of T. ovis (MT002827) revealed 100% homology with T. ovis from South Africa (MG203885), France (EU622911), Turkey (KT851436), China (FJ603460), Tanzania (MG725961) and India (MH819508).

 

CONCLUSION

 

The infected sheep showed several clinical manifestations as pyrexia, cachexia, emaciation, lacrimation, conjunctivitis, pale mucous membrane and tick bite wounds. Hematological examination of the ovine theileriosis showed macrocytic hypochromic anemia with pancytopenia affecting the three lineages of hematopoiesis. Moreover, the disease causes multiple organ affections reflected in biochemical results as hypoproteinemia, hypoalbuminemia, hyperbilirubinemia, azotemia with increase of liver enzymes activities. according to our knowledge, this is the first report of phylogeny of T. lestoquardi in sheep in Egypt.

 

ACKNOWLEDGEMENTS

 

The authors would like to acknowledge the veterinarians in veterinary clinics, sheep farms and slaughterhouse who helped in sample collection. We also thank the staff of Genome Research Unit and Clinical Pathology unit in Animal Health Research Institute (AHRI) and Department of Clinical Pathology, Faculty of Veterinary Medicine for supportive technical assistance.

 

Author’s Contribution

 

Mostafa Bashandy, Khaled Mahran and Waheed Mousa: Conceptualization.

Mahmoud Eliwa: Samples collection.

Mahmoud Eliwa and Khaled Mahran: Cinicopathologic investigations.

Mahmoud Eliwa and Naglaa Hagag: Molecular studies.

Mohamed Shaalan: Histopathological examination.

Khaled Mahran: Data analysis.

Mahmoud Eliwa and Khaled Mahran: Writing the manuscript.

All authors read and approved the final version.

 

FUNDING

 

This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

 

CONFLICT OF INTEREST

 

The authors have declared no conflict of interest.

 

REFERENCES

 

  • Akhter W, Aslam A, Rehman MU, Rehman HU, Rashid I, Akhtar R (2017). Comparative pathological changes in sheep infected with Theileria annulata and non-infected control. J. Hellenic Vet. Med. Soc., 68(4): 629–634. https://doi.org/10.12681/jhvms.16064
  • Al-Fetly DRH (2012). Detection of Theileria spp. in blood samples and estimation of haematological and biochemical changes in sheep in Al-Diwaniya. Kufa J. Vet. Sci., 3(2): 45–53.
  • AL-Hosary AAT, Ahmed L, Seitzer U (2015). First report of molecular identification and characterization of Theileria spp. from water buffaloes (Bubalus bubalis) in Egypt. Adv. Anim. Vet. Sci., 3(12): 629–633. https://doi.org/10.14737/journal.aavs/2015/3.12.629.633
  • Allsopp BA, Baylis HA, Allsopp MT, Cavalier-Smith T, Bishop RP, Carrington DM, Sohanpal B, Spooner P (1993). Discrimination between six species of Theileria using oligonucleotide probes which detect small subunit ribosomal RNA sequences. Parasitology, 107: 157–165. https://doi.org/10.1017/S0031182000067263
  • Almeria S, Castellà J, Ferrer D, Ortuño A, Estrada-peña A, Gutiérrez JF (2001). Bovine piroplasms in Minorca (Balearic Islands, Spain): A comparison of PCR-based and light microscopy detection. Vet. Parasitol., 99: 249–259. https://doi.org/10.1016/S0304-4017(01)00464-2
  • Altay K, Dumanli N, Patricia J, Holman B, Aktas M (2005). Detection of Theileria ovis in naturally infected sheep by nested PCR. Vet. Parasitol., 127: 99–104. https://doi.org/10.1016/j.vetpar.2004.09.012
  • Baghshani H, Razmi GR, Yaghfouri S, Dezaki AA (2012). Investigation of selected biochemical parameters in sheep naturally infected with theileriosis. Comp. Clin. Path., 21: 1417–1420. https://doi.org/10.1007/s00580-011-1308-2
  • Bakheit MA, Seitzer U, Ahmed JS (2006). A new recombinant protein-based ELISA for the diagnosis of malignant theileriosis of sheep and goats. Parasitol. Res., 98: 145–149. https://doi.org/10.1007/s00436-005-0034-6
  • Cluzel C, Javard R, Grimes C (2016). Pathology in practice. Javma J. Am. Vet. Med. A., 249(10): 1153–1155. https://doi.org/10.2460/javma.249.10.1153
  • Çöl R, Uslu U (2006). Haematological and coagulation profiles during severe tropical theileriosis in cattle. Turk. J. Vet. Anim. Sci., 30: 577–582.
  • Doumas B, Watson W, Biggs H (1971). Albumin standards and the measurement of serum albumin with bromcresol green. Int. J. Clin. Chem. Diagn. Lab. Med., 31: 87-96. https://doi.org/10.1016/0009-8981(71)90365-2
  • Doumas BT, Bayse DD, Carter RJ, Peters T, Schaffer R (1981). A Candidate reference method for determination of total protein in serum I. Development and validation. Clin. Chem., 27(10): 1642–1650. https://doi.org/10.1093/clinchem/27.10.1642
  • Elbasheir M, Elhussein AM (2013). Theleria lestoqurdi on some haematological and biochemical parameters in desert ewes during pregnancy. J. Vet. Med. Anim. Prod., 4(2): 88–95.
  • Elsify A, Sivakumar T, Nayel M, Salama A, Elkhtam A, Rizk M, Mosaab O, Sultan K, Elsayed S, Igarashi I, Yokoyama N (2015). An epidemiological survey of bovine Babesia and Theileria parasites in cattle, buffaloes, and sheep in Egypt. Parasitol. Int., 64(1): 79–85. https://doi.org/10.1016/j.parint.2014.10.002
  • Fadel NGM, El-Refai MA, Wahba AA, Shaker MHM, Elebeedy AA, Hafez MA, Harba SAR (2010). Survey on parasitic diseases of sheep and goats and the related clinicopathological changes in east –south of Egypt. Egypt. J. Appl. Sci., 25(5): 298–313.
  • Gunes N, Arsoy D, Aktas M, Ozubek S, Ozuicli M, Aydin L, Selcuk O (2016). Changes in some biochemical parameters in small ruminant theileriosis. Bulg. J. Agric. Sci., 22(2): 303–307.
  • Hall TA (1999). BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser., 41: 95–98.
  • Hasegawa M, Kishino H, Yano T (1985). Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol., 22(2): 160–174. https://doi.org/10.1007/BF02101694
  • Hegab AA, Fahmy MM, Mahdy OA, Wahba AA (2016). Parasitological and molecular identification of Theileria Species by PCR-RFLP method in sheep, Egypt. Int. J. Adv. Res. Biol. Sci., 3(7): 48–55.
  • Jaffé M (1986). About the precipitate that picric acid produces in normal urine and about a new reaction of creatinine. Hoppe Seylers Z. Physiol. Chem., 10: 391–400.
  • Jendrassik L, Grof P (1938). Colorimetric method of determination of bilirubin. Biochem. Z., 297: 81–82.
  • Khan A, Ashfaq K, ud Din I, ul Haq R, Jamil M, Ullah B, Ullah S, ur Rehman H, Ullah F (2017). Bovine theileriosis: Prevalence, estimation of hematological profile and chemotherapy in cattle in Dera Ismail Khan, Khyber Pakhtunkhwa Province, Pakistan. Am. Sci. Res. J. Eng. Technol. Sci., 32(1): 8–17.
  • Kirvar E, BIlhan T, Katzer F, Wilkie G, Hooshmand-Rad P, Brown D (1998). Detection of Theileria lestoquardi (hirci) in ticks, sheep, and goats using polymerase chain reaction. Ann. N. Y. Acad. Sci., 849: 52–62. https://doi.org/10.1111/j.1749-6632.1998.tb11033.x
  • Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018). MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol., 35(6): 1547–1549. https://doi.org/10.1093/molbev/msy096
  • Levine ND (1985). Apicomplexa: The piroplasms. Vet. Protozool., pp. 291–328.
  • Littlewood W (1915). Annual report for 1914. Ministry of agriculture Egypt, Vet. Ser., 39(5).
  • Liu Q, Zhou YQ, He GS, Oosthuizen MC, Zhou DN, Zhao JL (2010). Molecular phylogenetic studies on Theileria spp. isolates (China) based on small subunit ribosomal RNA gene sequences. Trop. Anim. Health Prod., 42: 109–114. https://doi.org/10.1016/j.ympev.2009.09.034
  • Mahmoud MHS, Al-dhalimy AMB, Al-dujaily AH (2019). Study of hematological and biochemical changes in sheep and goats infected with theileriosis at Al-Najaf province, Iraq. Biochem. Cell. Arch., 19(1): 803–806.
  • Minnat TR, Abdulwadood I (2012). Study of clinical, hematological and serological diagnosis of ovine theileriosis in Basrah province. Basra J. Vet. Res., 11(4): 1–18.
  • Persijn J, van der Slike W (1982). A new method for the determination of gamma glutamyletrans-peptidase in serum. J. Clin. Chem. Clin. Biochem., 14: 421–427.
  • Radwan IGH, El–Kelesh EA (2009). Identification of Theileria species in sheep andgoats by ploymerase chain reaction (PCR). Kafrelsheikh Vet. Med. Journal, 3rd Sci. Conf., pp. 460-473. https://doi.org/10.21608/kvmj.2009.108505
  • Razavi SM, Espandarnia A, Rakhshandehroo E, Ghane M, Nazifi S (2015). Malignant ovine theileriosis: Serum concentrations of some inflammatory components and adenosine deaminase activity. Comp. Clin. Path., 24: 639–643. https://doi.org/10.1007/s00580-014-1959-x
  • Razmi G, Yaghfoori S, Mohri M, Haghparast A, Tajeri S, Republic I (2019). The haematological, proinflammatory cytokines and IgG changes during an ovine experimental theileriosis. Onderstepoort J. Vet. Res., 86(1): a1629. https://doi.org/10.4102/ojvr.v86i1.1629
  • Reitman S, Frankel S (1957). A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol., 28: 56–63. https://doi.org/10.1093/ajcp/28.1.56
  • Riaz M, Tasawar Z (2017). A study on molecular surveillance of Theileria spp. infection and its impact on hematological and biochemical changes in naturally infected small ruminants at Multan, Pakistan. Pure Appl. Biol., 6(4): 1427–1435. https://doi.org/10.19045/bspab.2017.600154
  • Rjeibi MR, Darghouth MA, Rekik M, Amor B, Sassi L, Gharbi M (2016). First molecular identification and genetic characterization of Theileria lestoquardi in sheep of the Maghreb region. Transbound. Emerg. Dis., 63: 278–284. https://doi.org/10.1111/tbed.12271
  • Sampson EJ, Baird MA, Burtis CA, Smith EM, Witte DL, Bayse DD (1980). A coupled-enzyme equilibrium method for measuring urea in serum: Optimization and evaluation of the AACC study group on urea candidate reference method. Clin. Chem., 26(7): 816–826. https://doi.org/10.1093/clinchem/26.7.0816
  • Sohail A, Khan MY, Burni T, Khalil IH, Mehar S, Shah A (2018). A Study on molecular surveillance of Theileria spp. infection and its impact on hematological and biochemical changes in naturally infected small ruminants at Multan, Pakistan. ARPN J. Agric. Biol. Sci., 13(1): 1–7.
  • Soulsby E (1982). Helminths, arthropods and protozoa of domesticated animals (7th ed.). Baillier Tindall and Cassel Ltd.
  • Suvarna KS, Layton C, Bancroft JD (2012). Bancroft’s theory and practice of histological techniques E-book (7th ed.). Elsevier Health Sciences.
  • Szasz G (1969). A kinetic photometric method for serum gamma-glutamyletranspeptidase. Clin. Chem., 15: 124–136. https://doi.org/10.1093/clinchem/15.2.124
  • Weiss DJ, Wardrop KJ (2010). Schalm’s veterinary hematology (eds. Weiss DJ and Wardrop KJ); 6th ed.). Blackwell Publishing Ltd.
  • Yaghfoori S, Mohri M, Razmi G (2017). Experimental Theileria lestoquardi infection in sheep: Biochemical and hematological changes. Acta. Tropica., 173: 55–61. https://doi.org/10.1016/j.actatropica.2017.05.029
  • Youssef SY, Yasien S, Mousa WMA, Nasr SM, El-Kelesh EAM, Mahran KM, Abd-El-Rahman AH (2015). Vector identification and clinical, hematological, biochemical, and parasitological characteristics of camel (Camelus dromedarius) theileriosis in Egypt. Trop. Anim. Health Prod., 47: 649–656. https://doi.org/10.1007/s11250-015-0771-1
  • Zhang X, Liu Z, Yang J, Chen Z, Guan G, Ren Q, Liu A, Luo J, Yin H, Li Y (2014). Multiplex PCR for diagnosis of Theileria uilenbergi, Theileria luwenshuni, and Theileria ovis in small ruminants. Parasitol. Res., 113(2): 527–531. https://doi.org/10.1007/s00436-013-3684-9
  • Zhao L, Wang J, Ding Y, Li K, He B, Li F, Zhang L, Li X, Liu Y (2019). Theileria ovis (Piroplasmida: Theileriidae) detected in melophagus ovinus (Diptera: Hippoboscoidea) and ornithodoros lahorensis (Ixodida: Argasidae) removed from sheep in Xinjiang, China. J. Med. Entomol., 1915(10): 1–5. https://doi.org/10.1093/jme/tjz193
  •  

     

     

    Advances in Animal and Veterinary Sciences

    September

    Vol. 12, Iss. 9, pp. 1622-1845

    Featuring

    Click here for more

    Subscribe Today

    Receive free updates on new articles, opportunities and benefits


    Subscribe Unsubscribe