Research article

Detection of Mblk-1 Gene Polymorphisms in Honey Bees and their Influence on Resistance to Varroa Destructor Mites

Kristina Morkūnienė*, Rūta Insodaitė, Laimutis Kučinskas, Renata Bižienė

Lithuanian University of Health Sciences, Institute of Biology Systems and Genetic Research, LT- 47181 Tilžės st. 18, Kaunas, Lithuania.

Received | January 13, 2023 Accepted | February 20, 2023; Published | November 01, 2023

*Correspondence | Kristina Morkūnienė, Lithuanian University of Health Sciences, Institute of Biology Systems and Genetic Research, LT- 47181 Tilžės st. 18, Kaunas, Lithuania; Email: kristina.morkuniene@lsmuni.lt

Citation: Morkūnienė K, Insodaitė R, Kučinskas L, Bižienė R (2023). Detection of mblk-1 gene polymorphisms in honey bees and their influence on resistance to varroa destructor mites. S. Asian J. Life Sci. 11: 1-6.

DOI | http://dx.doi.org/10.17582/journal.sajls/2023/11.1.6

ISSN | 2311–0589

Introduction

Varroosis is considered a major pest of honey bees Apis mellifera. It is an invasive disease caused by Varroa destructor mites that infect bees at any stage of their development (Bokaie et al., 2013). Varroa mites are obligatory ectoparasites which feed on fat bodies of developing larvae/pupae and adult honey bees (Ramsey et al., 2019) and reproduce in the brood (Rosenkranz et al., 2010). Parasites feed on the hemolymph of honey bee brood and adult bees and reduce their viability and productivity, disrupting normal development. The mite is responsible for low brood emergence rates and decreased adult life expectancy, which finally leads to loss of colonies. The main reasons that make honey bees susceptible to pathogenic infections are: high social behavior, genetic homogeneity, and close physical contact (Chen et al., 2007, van Dooremalen et al., 2012, Guichard et al., 2020).

Several authors have studied the effects of Varroa feeding on the honey bee (De Grandi-Hoffman et al., 2004, Nazzi et al., 2016, Traynor et al., 2020) however, given the frequent concurrent presence of viruses with Varroa, such effects could well be related to the combined action of the parasite and the pathogens than to the mite alone. The prevalence of Varroa mites has increased the frequency of viral infections such as: Acute Bee Paralysis Virus (ABPV), Israeli Acute Paralysis Virus (IAPV), Kashmir Bee Virus (KBV), Sacbrood Virus (SBV), and Deformed Wing Virus (DWV) among bees’ colonies. For that reason, Varroa destructor mites can act as transfer vectors for different bee viruses (Yue et al., 2005, Boecking et al., 2013). The spread of varroosis and its relation with viral infections causes significant economic losses to beekeepers (Clermont et al., 2014). In addition, Varroa mite may intensify the problems of pollination in the future.

Various chemical substances, application techniques, and methods are currently used to control the mite’s population. However intensive use of many chemical substances against the V. destructor mites increased of resistance and decrease their efficiency and contamination of products such as honey and beeswax (Milani 1999, Wallner, 1999). Natural products – essential oils and formic acid, are also used against V. destructor mites however, their effectiveness is not as good as chemical substances (Bokaie et al., 2013).

It has been observed that some bees’ colonies are able to defend themselves against V. destructor mites without additional chemical or natural substances. Several studies have shown that V. destructor parasitism alters the expression pattern of immune-related (Yang et al., 2005, Navajas et al., 2008, Hamiduzzaman et al., 2012) and behavioral-related genes in honey bees (Le Conte et al., 2011). The resistance of honey bees is linked to genetic factors that determine some of their behavior to protect against parasites. Mushroom body large-type Kenyon cell-specific protein-1 (Mblk-1) was identified as a novel transcription factor that may play important roles in higher bee brain functions. The Mblk-1 gene is specifically expressed in a subtype of mushroom bodies neurons called large-type Kenyon cells (Park et al., 2002, Menzel et al., 2006). In honey bees, the mushroom bodies receive multimodal information and play important roles in higher-order learning and social behavior (Takayanagi-Kiya et al., 2017). A study by Conlon and coauthors (2018) demonstrate that changes in the Mblk-1 gene may be related to parasite resistance. In V. destructor resistant bees’ family’s genome, they identified three single nucleotide polymorphisms at 7454459, 7454648, and 7454648 positions of the Mblk-1 gene. These three polymorphisms change the amino acid sequence of the Mblk-1 protein and might be the answer to why some bees’ colonies are more resistant to V. destructor compared to others (Conlon et al., 2019).

In this study we aimed to reveal the relationship of polymorphisms at positions 7454459, 7454648 and 7454648 of the Mblk-1 gene on the risk of varroosis.

Materials and Methods

Study population

A group of 43 treated for the Varroa destructor and 59 untreated domestic workers honey bees were collected from 4 apiaries located in different regions of Lithuania. The group of untreated domestic bees was also included with 15 wild workers honey bees.

Mblk-1 genotyping

Genotyping of Mblk-1 gene polymorphisms was carried out at the Laboratory of Genetics of the Institute of Biology Systems and Genetic Research of LUHS. Genomic DNA was extracted from workers honey bees body tissues using a genomic DNA purification kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s recommendations. For the study were selected three Mblk-1 gene polymorphisms located in chromosome 15: 7454459 (Asn → Thr), 7454648 (Gln → Arg), and 7454648 (Leu → Pro). SNPs in Mblk-1 gene were estimated by using genotyping kits which were constructed according to Table 1 by Applied Biosystems. Applied Biosystems 7900HT Real-Time Polymerase Chain Reaction System (Applied Biosystems, Foster City, CA, USA) was used for SNPs detection. The cycling program started with heating at 95˚C for 10 min, followed by 40 cycles at 95˚C for 15 s and at 60˚C for 1 min. Finally, allelic discrimination was performed using SDS 2.3 software provided by Applied Biosystems.

Statistical analysis

Statistical analysis was performed using IBM SPSS Statistics 20 software (IMB Corp., Armonk, NY, USA). The results are presented as total numbers, percentages, mean, and standard deviation (SD). The distribution of SNP genotypes in treated and untreated for Varroa destructor was evaluated by Hardy-Weinberg equilibrium (HWE) using the chi-square test. The homogeneity of the distribution of polymorphism genotypes between honey bee groups was compared using χ² and Fisher one-tailed and two-tailed tests. The association between the Mblk-1 gene polymorphisms and Varroa destructor was estimated by computing odds ratios (ORs) and their 95% confidence intervals (Cls) from logistic regression in five inheritance models: Recessive (wild-type homozygous with heterozygous vs. minor allele homozygous), dominant (wild-type homozygous vs. heterozygous with minor allele homozygous), overdominant (wild-type homozygous with minor allele homozygous vs. heterozygous) and additive inheritance model.

Polymorphisms located at 7454459 (Asn → Thr), 7454648 (Gln → Arg), and 7454648 (Leu → Pro) positions of the Mblk-1 gene are on chromosome 15, therefore haplotype analysis was carried out. Estimation of haplotype frequencies and haplotype association with frequencies of at least 5% were carried out using PLINK software version 1.07 (Purcell et al., 2007). Results were considered statistically significant when the p-value was less than 0.05.

Results

All analyzed Mblk-1 gene polymorphisms genotypes and allelic in treated for Varroa destructor mites and untreated honey bees are presented in Table 2. The distribution of all SNPs in both groups was consistent with the HWE. Statistically significant differences were revealed in the distribution of the Mblk-1 gene polymorphism at position 7454459 (Asn → Thr) among analyzed honey bee groups.

 

Table 1: Primer and probes sequences designed for genotyping single-nucleotide poly-morphisms in Mblk-1 gene

Mblk-1 gene SNP location	Forward primer	Reverse primer	VIC marked probe	FAM marked probe
7454459 Asn → Thr	CAGAGGATGTCTACAACATTCTTTTAAAAAATCA	GCCGATATATTTCTTTCATTTAACATTTAATGAATTATAA	ATTTTAATTATATGAAATAGAAACAT	ATTATATGAAATGGAAACAT
7454648 Gln → Arg	ACGAAAAATTTTGTTATTGTATTCGAAATACATAGATGT	TCCCCATCTTATGTGTTGAAAGCAT	ACTTGTCAAAATAAAGTTAAAT	CTTGTCAAAATAAGGTTAAAT
7454648 Leu → Pro	GAGGAAATAAAGCATAAGGGATAATGTCGATAT	CACACAATCAAATTTAAATGATCAGTGACGAT	TTGTATCATCCGATCTGTTTT	ATCATCCGACCTGTTTT

 

Table 2: Distribution of genotypic and allelic frequencies for single nucleotide polymorphisms at Mblk-1 gene positions 7454459 (Asn → Thr), 7454648 (Gln → Arg), and 7454648 (Leu → Pro) in the treated for Varroa destructor domestic honey bees (n=43) and untreated domestic and wild honey bees (n=74) groups

Mblk-1 SNP position			Not treated bees, n (%)	p-Value HWE	Treated bees, n (%)	p-Value HWE	p-Value
7454459 (Asn → Thr)	Genotype	GG	50 (67.57)	0.091	37 (86.05)	0.056	0.017
		GA	20 (27.03)		5 (11.63)
		AA	4 (5.40)		1 (2.35)
	Allele	G	120 (81.10)	-	79 (91.86)	-	0.001
		A	28 (18.90)		7 (8.14)
7454648 (Gln → Arg)	Genotype	CC	67 (90.54)	0.811	41 (95.35)	0.687	0.223
		CT	6 (8.12)		2 (5.65)
		TT	1 (1.35)		0 (0.0)
	Allele	G	140 (94.59)	-	87 (97.67)	-	0.721
		A	8 (5.41)		2 (2.33)
7454648 (Leu → Pro)	Genotype	GG	70 (94.59)	0.482	42 (97.67)	0.210	0.855
		GA	4 (5.41)		1 (2.33)
		AA	0 (0.00)		0 (0.00)
	Allele	G	144 (97.30)	-	85 (98.84)	-	0.465
		A	4 (2.70)		1 (1.16)

 

Polymorphism, at position 7454459 (Asn → Thr) mutant allele A was more common in untreated domestic and wild honey bees (18.90% and 8.14% respectively; p=0.001) compared to treated domestic bees which are persistently infected with the disease (Table 2). The distribution of Mblk-1 gene polymorphism at position 7454459 (Asn → Thr) genotypes among the studied honey bee groups was also statistically significant. Wild type homozygote GG genotype was more common between treated for Varroa destructor domestic bees, and heterozygote GA genotype was more common between untreated domestic and wild honey bees’ group (7454459 (Asn → Thr) genotypes GG, GA: 86.05% and 11.63 % vs. 67.57% and 27.03% respectively; p=0,017). Other analyzed polymorphisms at positions 7454648 (Gln → Arg) and 7454648 (Leu → Pro) of the Mblk-1 gene did not show any statistically significant distribution of genotypes and alleles between analyzed honey bee groups (Table 2).

Associations between Mblk-1 gene polymorphisms at positions 7454459 (Asn → Thr), 7454648 (Gln → Arg),

7454648 (Leu → Pro), and varroosis according to the inheritance models are presented in Table 3. Binomial logistic regression analysis showed that the recessive (p=0.004), overdominant (p=0.009), and additive (p=0.010) variables were significant of Mblk-1 gene polymorphism at position 7454459 (Asn → Thr) (Table 3). The lowest Akaike information criterion (144.295) was for the recessive model (OR=0.166, 95% CI=0.05-0.56, p=0.004) of Mblk-1 gene

 

Table 3: Model selection according to Akaike information criteria (AIC) for Mblk-1 gene polymorphisms at positions 7454459 (Asn → Thr), 7454648 (Gln → Arg), and 7454648 (Leu → Pro)

Mblk-1 gene SNP position	Model	OR (95% Cl)	p-Value	AIC
7454459 (Asn → Thr)	Dominant (GG vs. GA+AA)	3.561 (0.313-1.479)	0.306	152.752
	Recessive (AA vs. GA+GG)	0.166 (0.049-0.562)	0.004	144.295
	Overdominant (GA vs. GG+AA)	0.165 (1.593-4.631)	0.009	145.735
	Additive	0.118 (0.920-0.726)	0.010	145.719
7454648 (Gln → Arg)	Recessive (AA vs. GA+GG)	0.303 (0.583-9.087)	0.234	152.460
	Overdominant (GA vs. GG+AA)	0.213 (0.583-1.714)	0.412	152.460
	Additive	0.157 (0.110-1.548)	0.079	153.450
7454648 (Leu → Pro)	Recessive (AA vs. GA+GG)	0.738 (0.108-2.516)	0.699	153.736
	Overdominant (GA vs. GG+AA)	0.738 (0.183-1.516)	0.649	153.136
	Additive	0.714 (0.202-2.528)	0.412	153.614

 

Table 4: Haplotype association of single nucleotide polymorphisms at Mblk-1 gene at positions 7454459 (Asn → Thr), 7454648 (Gln → Arg) and 7454648 (Leu → Pro) with varroosis

SNPs positions   7454459 (Asn → Thr) - 7454648 (Gln → Arg) - 7454648 (Leu → Pro)	Frequency		Chi-square	Degrees of freedom	p-Value
Haplotype	Treated	Not treated
G-G-G	0.986	0.973	1.041	1	0.059
A-A-G	0.003	0.006	0.578	1	0.893
A-G-G	0.009	0.014	0.084	1	0.841
G-A-G	0.001	0.005	0.072	1	0.874
G-G-A	0.001	0.002	0.978	1	0.894

 

polymorphism at position 7454459 (Asn → Thr) (Table 3). Other analyzed Mblk-1 gene polymorphisms inheritance models did not show any statistically significant results.

Association analysis between the risk of varroosis and haplotypes for Mblk-1 gene polymorphism at positions 7454459 (Asn → Thr), 7454648 (Gln → Arg), and 7454648 (Leu → Pro) are shown in Table 4. The linkage disequilibrium between these three polymorphisms (D’ value) was 0.662. However, the analysis did not show any statistically significant results.

Discussion

The honey bee (Apis melifera) is one of the most valuable pollinators worldwide. Over the last few decades, increased honey bee colony losses have been reported possibly as a result of a growing number of interacting threats, such as habitat losses, nutritional deficiencies, pesticides, pests, and pathogens (Guichard et al., 2020). Among the parasitic threats, the invasive mite V. destructor is often identified as the main macrobiotic cause of colony losses of honey bees. In contrast to the original host (A. cerana) V. destructor is lethal to A. melifera due to unlimited reproduction in both the drone and worker brood, which subsequently leads to high infection levels, threatens colony survival and reproduction (Amdam et al., 2004, Zaobidna et al., 2017).

In recent years it has been reported that some colonies in Europe, Africa, and America become resistant to V. destructor. It was observed that this phenomenon could be related to brood cell size, smaller colony sizes, alterations of brood volatile compounds, and behavioral defense such as mite-infested brood removal (Hawkins et al., 2021). Bees’ tolerance to V. destructor is also characterized by differences in the expression of genes related to embryonic development, cell metabolism, immune response, regulation of neuronal development, neuronal sensitivity, and olfaction. These insights were obtained by comparing two groups of bees: Varroa-susceptible and Varroa-resistant (Navajas et al., 2008).

Grooming behavior which is one of the behavioral resistance mechanisms based on the genetic basis in honey bees is a defense response against parasitic mites that may be directly related to transcription factor Mblk-1 expression changes (Yildis et al., 2020, Kaskinova et al., 2020). But exact causes that lead to Mblk-1 expression changes in different bees’ phenotypes are not known yet.

Conlon and coauthors (Park et al., 2002) in the study of Mblk-1 polymorphisms among bee colonies in which mite reproduction was successful vs unsuccessful separate three SNPs which segregate better between these two phenotypes. In our study, only one SNP, at position 7454459 (Asn → Thr) of the Mblk-1 gene showed statistically significant separation between two different bees’ phenotypes. According to that, our findings suggest that Mblk-1 gene polymorphism at 7454459 (Asn → Thr) position may have an impact on honey bee’s resistance to V. destructor mites by affecting Mblk-1 expression. Whereas Mblk-1 is preferentially expressed in the neuronal circuits of mushroom bodies, it may play an important role in grooming and hygienic behaviors (Ji et al., 2014).

Conclusions

No other pathogen or parasite has had a comparable impact on honey bees, in part because varroa only recently adapted from its original host, the Asian honey bee (Apis cerana) to exploit a naïve host with inadequate innate defenses (Traynor et al., 2020). V. destructor is one of the greatest threats to the honey bees, Apis mellifera, worldwide, breeding varroa-tolerant honey bees is an ideal strategy, as it either reduces or eliminates the need for acaricides with-out requiring additional Varroa control measures. In this study, we identified Mblk-1 SNP, which may be involved in resistance to V. destructor. Our finding confirmed that changes in gene, effects on grooming behavior may play important roles in the resistance to V. destructor. However, expression changes among this gene due to SNP at 7454459 (Asn → Thr) position may be investigated in future studies. Nevertheless, farmers are recommended to breed those honey bees’ colonies that are not infected with V. destructor mites, thus spreading the Mblk-1 polymorphism at position 7454459 (Asn → Thr) of the gene and reducing the use of chemical substances required for the treatment of the disease.

Acknowledgments

The research was funded by European Agricultural Guarantee Fund and the state budget of the Republic of Lithuania in accordance with the approved financing plan of the Suport Program for the Lithuanian Beekeeping Sector for 2020–2022.

Conflict of Interest

The authors declared that there is no conflict of interest.

novelty statement

All authors confirm that the manuscript has not been published elsewhere and is not currently being reviewed by another journal.

authors contribution

Author’s contribution to the concept, assumptions and methodology used int the article (%): Kristina Morkūnienė 30%, Rūta Insodaitė 30%, Renata Bižienė 30%, Laimutis Kučinskas 10%.

References

Amdam G.V., Hartfelder K., Norberg K., Hagen A., Omholt S.W. (2004), Altered physiology in worker honey bees (Hymenoptera : Apidae) infested with the mite Varroa destructor (Acari : Varroidae): A factor in colony loss during overwintering?. J. Econ. Entomol., 97: 741–7. https://doi.org/10.1603/0022-0493(2004)097[0741:APIWHB]2.0.CO;2

Boecking O., Genersch E. (2013). Varroosis – the ongoing crisis in bee keeping. J. Consum. Protect Food Safety,. 3(2): 221–228. https://doi.org/10.1007/s00003-008-0331-y

Bokaie S., Sharifi L., Mehrabadi M. (2013). Prevalence and epizootical aspects of varroasis in golestan province, northern iran. J Ar-thropod Borne Dis., 1:102-107.

Chen Y.P., Siede R. (2007). Honey bee viruses. Adv. Virus Res., 70:33–80. https://doi.org/10.1016/S0065-3527(07)70002-7

Clermont A., Eickermann M., Kraus F., Georges C., Hoffmann L., Beyer M. A (2014). survey on some factors potentially affecting losses of managed honey bee colonies in Luxembourg over the winters 2010/2011 and 2011/2012. J. Apicult. Res., 53: 43–56. https://doi.org/10.3896/IBRA.1.53.1.04

Conlon B.H., Aurori A., Giurgiu A.I., Kefuss J., Dezmirean D.S., Moritz R.F.A., Routtu J. (2019). A gene for resistance to the Varroa mite (Acari) in honey bee (Apis mellifera) pupae. Molecul. Ecol., 28(12): 2958-2966. https://doi.org/10.1111/mec.15080

De Grandi-Hoffman G., Curry R. (2004). A mathematical model of Varroa mite (Varroa destructor Anderson and Trueman) and honeybee (Apis mellifera L.) population dynamics. Int. J. Acarol. 30: 259–274. https://doi.org/10.1080/01647950408684393

Guichard M., Dietemann V., Neuditschko M. (2020). Advances and perspectives in selecting resistance traits against the parasitic mite Varroa destructor in honey bees. Genet. Sel. Evol., 52: 71. https://doi.org/10.1186/s12711-020-00591-1

Guichard M., Dietemann V., Neuditschko M. (2020). Dainat B. Three decades of selecting honey bees that survive infestations by the parasitic mite Varroa destructor: outcomes, limitations and strategy Preprints Article e2020030044., https://doi.org/10.20944/preprints202003.0044.v1

Hamiduzzaman M.M., Sinia A., Guzman-Novoa E., Goodwin P.H. (2012). Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.). J. Invertebr. Pathol., 111:237–243. https://doi.org/10.1016/j.jip.2012.09.001

Hawkins G.P., Martin S.J. (2021). Elevated recapping behaviour and reduced Varroa destructor reproduction in natural Varroa resistant Apis mellifera honey bees from the UK. Apidologie., 52: 647–657. https://doi.org/10.1007/s13592-021-00852-y

Ji T., Yin L., Liu Z., Liang Q., Luo Y., Shen J., Shen F. (2014). Transcriptional responses in eastern honeybees (Apis cerana) infected with mites, Varroa destructor. Genet. Mol. Res., 13(4): 8888-8900. https://doi.org/10.4238/2014.October.31.4

Kaskinova M.D., Gaifullina L.R., Saltykova E.S., Nikolenko A.G. (2020). Genetic markers for the resistance of honey bee to Varroa destructor. 24(8): 853-860. https://doi.org/10.18699/VJ20.683

Menzel R., Leboulle G., Eisenhardt D. (2006). Small brains, bright minds. Cell, 124(2):237-9. https://doi.org/10.1016/j.cell.2006.01.011

Milani N. (1999). The resistance of Varroa jacobsoniOud To acar-icides. Apidologie. 30:229–234. https://doi.org/10.1051/apido:19990211

Navajas M., Migeon A., Alaux C., Martin-Magniette M., Robinson G., Evans J., Cros-Arteil S., Crauser D., Le Conte Y. (2008). Differential gene expression of the honey bee Apis mellifera associated with Varroa destructor infection. BMC Genom., 9:301. https://doi.org/10.1186/1471-2164-9-301

Nazzi F., Le Conte Y. (2016). Ecology of Varroa destructor, the Major Ectoparasite of the Western Honey Bee, Apis mellifera. Ann. Rev. Entomol., 61(1): 417-432. https://doi.org/10.1146/annurev-ento-010715-023731

Le Conte Y., Alaux C., Martin J.F., Harbo J.R., Harris J.W., Dantec C., Séverac D., Cros-Arteil S., Navajas M. (2011). Social im-munity in honeybees (Apis mellifera): transcriptome analysis of varroa-hygienic behaviour. Insect Mol. Biol., 20: 399–408. https://doi.org/10.1111/j.1365-2583.2011.01074.x

Park J.M., Kunieda T., Takeuchi H., Kubo T. (2002).DNA-binding properties of Mblk-1, a putative transcription factor from the honeybee. Biochem Biophys Res. Commun., 291(1): 23-8. https://doi.org/10.1006/bbrc.2002.6397

Purcell S., Neale B., Todd-Brown K., Thomas L., Ferreira M.A., Bender D., Maller J., Sklar P., de Bakker P.I., Daly M.J., Sham P, C. (2007). PLINK: A tool set for whole-genome association and population-based linkage analysis. Am. J. Hum. Genet,. 81(3): 559-575. https://doi.org/10.1086/519795

Ramsey S.D., Ochoa R., Bauchan G., Gulbronson C., Mowery J.D. (2009).Varroa destructor feeds primarily on honey bee fat body tissue and not hemolymph. Proc Natl. Acad. Sci. U S A,; 116(5): 1792-1801. https://doi.org/10.1073/pnas.1818371116

Rosenkranz P., Aumeier P., Ziegelmann B. (2010). Biology and control of Varroa destructor. J. Invertebr. Pathol., 103(Suppl 1): S96–S119. https://doi.org/10.1016/j.jip.2009.07.016

Takayanagi-Kiya S., Kiya T., Kunieda T., Kubo T. (2017). Mblk-1 Transcription Factor Family: Its Roles in Various Animals and Regulation by NOL4 Splice Variants in Mammals. Int. J. Mol. Sci., 18(2): 246. https://doi.org/10.3390/ijms18020246

Traynor K.S., Mondet F., de Miranda J.R., Techer M., Kowallik V., Oddie M.A.Y., Chantawannakul P., McAfee A. (2020). Varroa destructor: A Complex Parasite, Crippling Honey Bees Worldwide. Trends Parasitol., 36(7):592-606. https://doi.org/10.1016/j.pt.2020.04.004

van Dooremalen C., Gerritsen L., Cornelissen B., van der Steen J.J.M., van Langevelde F., Blacquiere T. (2012). Winter survival of indivi-dual honey bees and honey bee colonies depends on level of Varroa destructor infestation. PLoS One., 7(4): e36285. https://doi.org/10.1371/journal.pone.0036285

Wallner K. (1999). Varroacides and their residues in bee products. Apidologie., 30: 235–248. https://doi.org/10.1051/apido:19990212

Yang X., Cox-Foster D.L. (2005). Impact of an ectoparasite on the immunity and pathology of an invertebrate: evidence for host immunosuppression and viral amplification. Proc Natl Acad Sci USA,. 102: 7470–7475. https://doi.org/10.1073/pnas.0501860102

Yıldız B., Karabağ K. (2020). Effects of Neural Gene Expressions on Grooming Behavior in Honey Bees. Black Sea J. Engineer. Sci., 3(2): 60-63. https://doi.org/10.34248/bsengineering.646925

Yue C., Genersch E. (2005). RT-PCR analysis of Deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol, 86(Pt 12):3419-3424. https://doi.org/10.1099/vir.0.81401-0

Zaobidna E.A., Zółtowska K., Łopieńska-Biernat E. (2017). Varroa destructor induces changes in the expression of immunity-related genes during the development of Apis mellifera worker and drone broods. Acta Parasitol., 62: 779–89. https://doi.org/10.1515/ap-2017-0094