Genetic Structure of Octopus minor (Sasaki, 1920) (Cephalopoda: Octopoda) from Chinese Waters using Mitochondrial ATPase 6 Gene

Specimens of Octopus minor were collected from commercial trawl catches from eight different geographical locations, Dalian, Donghsan, Nantong, Qingdao, Shanghai, Wenzhou, Xiamen, and Zhoushan (Supplementary Fig. S1). Samples were preserved following standard procedure at the site, and were transported to the laboratory in 95% ethyl alcohol and placed in refrigerator until further investigation. Total genomic DNA was isolated from muscle tissues (Liu et al., 2017), extracted DNA was electrophoresed and concentrated DNA was further diluted with DEPC water to reach working concentration (20ng/ µl) for PCR reactions.

The complete ATPase 6 gene was amplified by PCR, using primers ATP6F2 5´ACATGCCACAATTATCACCA 3´ andATP6R 5´ AGCTTAATAAGAGCGTAACG 3´. The pair of primers were designed from mtDNA gene sequence taken from NCBI accession number AB158363. The PCR mixture consisted of 0.2µM of each primer, 5.0µL of 10XTaq Plus polymerase buffer, 0.2 mM of dNTPs, 2 units of Taq Plus DNA polymerase, and 1 µL of DNA template. The PCR conditions were as follows: denaturation at 94 ◦C for 5 min, 35 cycles at 94 ◦C for 30 s, annealing at 55 ◦C for 30 s, and extension at 72 ◦C for 30s, and the final extension at 72 ◦C for 10 min. The PCR products were electrophoresed on a 1.5% agarose gel to check integrity, and visualized, using Molecular Imager Gel Doc XR system (Bio- Rad USA). The PCR products were sequenced, using ABI 3730 automated sequencer for which the same PCR primers were used. The DNA sequences were aligned using CLUSTALW and sequence composition was estimated using software MEGA 6 (Tamura et al., 2013). Analysis of genetic differentiation, AMOVA, molecular diversity indices, genetic differentiation values and Fst values were determined with software ARLEQUIN (Excoffier and Lischer, 2010). Haplotype and nucleotide diversity was estimated, using DnaSP (Librado and Rozas, 2009). The neighbor joining tree was constructed to evaluate genetic relationship between the populations using MEGA 6 (Tamura et al., 2013). The haplotype networking was created, using NETWORK software version 5.0.0.1 (Bandelt et al., 1999).

ATPase 6 gene was sequenced from 154 individuals of eight populations. Only 672 bp fragment of ATPase 6 of O. minor was used for data analyses. The average nucleotide composition of T, C, A, and G were 42.5%, 18.4%, 31.9% and 7.2%, respectively. A total of 30 haplotypes, 140 polymorphic sites were identified based on 154 individuals from eight populations. The haplotype diversity was higher (0.740) whereas nucleotide diversity was lower (0.04845) in the investigated populations of O. minor. The average number of nucleotide variations, “K” was 32.028. The details of each population are given in Table I. The high haplotype diversity was observed in Zhoushan following Xiamen, Nantong, Qingdao, Wenzhou, Dongsha, Dalian, and Shanghai, respectively.

n, sample number; P. sites, number of polymorphic sites; Hap., Haplotype; Hap. div., Haplotype diversity; Nucl. div., Nucleotide diversity; Avg. diff., average number of differences; DL, Dalian; DS, Dongshan; NT, Nantong; Q, Qingdao; SH, Shanghai; W, Wenzhou; X, Xiamen; Z, Zhoushan.

The AMOVA test validates 8.76% within population and 91.24% among populations (Supplementary Table I). The population structure illustrated high and significant FST value of 0.912* at P < 0.05. The Tajima’s D test defined significant negative values ranging (-0.684 - -2.728). The detailed description of Tajima’s D, Fu’s Fs, corresponding P values and mismatch distribution parameter estimates are shown in Supplementary Table II, whereas the pairwise FST between populations of O. minor are described in Table II. The phylogenetic analysis revealed three lineages. The lineage one clustered five populations. Second lineage included the Xiamen and Wenzhou populations while Lineage three distinctly distinguishes Dongshan population (Fig. 1).

For abbreviations, see Table I.

The phylogenetic relationship illustrated, using neighbor-joining (NJ) method which exhibit three lineages. The lineage one is extended group that describes populations from six location. However Dongshan population was distinctly different from rest of populations. The Lineage II is supported with a bootstrap value of 64% whereas the Lineage III supported with a bootstrap value of 100%. Lineage II included the individuals of Xiamen and Wenzhou populations, and Lineage III distinctly describes the Donghshan population (Fig. 2).

The haplotype network (Fig. 2) revealed that haplotype 1 (Hap1) contributed 48.051% of total O. minor individuals and appeared in six populations. Hap6 and Hap 11 shared by Nantong and Xiamen populations, whereas the Hap16 and Hap 17 was shared by Wenzhou and individuals of Xiamen population. Rest of the haplotypes are unique in their respective populations.

The genetic structure and relationship of O. minor populations in the present study was analyzed using ATPase 6 gene which is essential for successful recovery and long-term conservation strategies of important cephalopod species. The genetic diversity ensures evolutionary potential and even a small decrease or increase in genetic diversity causes significant threat to wild populations inhabiting variable environment (Yang et al., 2008). Therefore, such studies play major role in collection information on the conservation genetics of a species (Crandall et al., 1999; Divya et al., 2015).

In this investigation, one hundred fifty four individuals from eight different localities of Chinese coastal waters were investigated. The results revealed 140 polymorphic sites, 30 haplotypes and high Hd values and low nucleotide diversity. AMOVA analysis of ATPase 6 sequences revealed genetic variation in O. minor. These variations are similar to findings reported by earlier workers in a number of Cephalopod species (Chang et al., 2010; Guo et al., 2011; Li et al., 2013; Lü et al., 2011).

Wright (1978) described relationship between FST values and degree of differentiation: FST 0-0.05 denotes little differentiation among populations; FST 0.05-0.15 indicate moderate differentiation, whereas FST 0.15-0.25 means high distinction and above 0.25 demonstrate very high differentiation (Gao et al., 2016).

The pairwise FST values shows highest FST value in Wenzhou population then Donghsan population, other populations have comparatively lower FST values. The phylogenetic tree and pairwise distance results may suggest a sub-species of Donghsan population. The morphological analysis also suspected this population as a sub-species.

The genetic diversity among populations or marine organisms influenced by certain factors, such as geographic segregation, habitat differences, and human activities (Hedrick, 1999; Chang et al., 2010). The lifestyle differences make it hard to carry out suitable gene exchange; as a result, variations revealed different geographical clades. Such general rules are also applied to target species because long armed octopus O. minor also has meager dispersal potential and it is adapted to benthic environment. Adult O. minor are sessile and juveniles develop directly, benthic eggs without a planktonic larval stage (Dong, 1988, 1991). Therefore, O. minor fishery require special care for exploitation and management of future resource along the coast of China. Lü et al. (2013) reported that long armed octopus fishery needs a special care for exploitation when many populations involved over a wide range of geographic distance.

This study would solely provide species specific information on its genetic structure and population variability in Chinese waters.

This research was supported by the National Natural Science Foundation of China (NSFC) (41576131) and Talented Yong Scientist Program (PAK-15-012).

There is supplementary material associated with this article. Access the material online at: http://dx.doi.org/10.17582/journal.pjz/2019.51.1.sc5

Authors declared no conflict of interest.