Co-Treatment of Caffeic Acid Phenethyl Ester with Chitosan Nanoparticles Inhibits DNA Methylation in HepG2 Cells

Hepatocellular carcinoma (HCC), a destructive liver cancer disease, leads to high morbidity and mortality all over the world. Infection with hepatitis C and B viruses is the main predisposing factor for HCC (Forner et al., 2012). Although liver transplantation can increase the survival time beyond 5 years, the prognosis is still poor due to the high rate of HCC recurrence (Wang et al., 2010). The application of natural products as alternative therapies for cancer remedies is quickly growing all over the world (Mahfouz et al., 2021; Mansour et al., 2021; Othman et al., 2021; Zedan et al., 2021).

Among these natural products chitosan, which is a chitin polymer derivative, has anti-cancer potential on a large variety of cancer cells (Abbaszadeh et al., 2020; Elkeiy et al., 2018; Subhapradha et al., 2017). However, due to poor bioaviliabity, the use of chitosan as an adjuvant to chemotherapeutics was limited (Torchilin, 2006). To conquer their limited uses, chitosan nanoparticles (CNPs) were commonly used as a carrier to deliver anti-cancer drugs to tumors (Ajun et al., 2009). CNPs can also inhibit the HCC progression both in vitro (Loutfy et al., 2016; Subhapradha and Shanmugam, 2017) and in vivo (El-Denshary et al., 2015; Elkeiy et al., 2018; Subhapradha et al., 2017). The anti-cancer effects of CNPs are mediated by the induction of free radical scavenging activities (El-Denshary et al., 2015; Elkeiy et al., 2018; Subhapradha et al., 2017), necrosis (Elkeiy et al., 2018; Qi et al., 2007; Xu et al., 2009), apoptosis (Loutfy et al., 2016), and anti-angiogenesis effect (Xu et al., 2009).

Caffeic acid phenethyl ester (CAPE) is one of the main components which is derived from caffeic acid extracted from honeybee propolis (Murtaza et al., 2014). CAPE can also be prepared in the lab by mixing caffeic acid with phenethyl alcohols (Kurata et al., 2010). CAPE exerts potent free radical scavenging, antimicrobial, and anti-inflammatory properties (Erdemli et al., 2015; Rzepecka-Stojko et al., 2015). Moreover, CAPE can ameliorate abamectin-induced hepatotoxicity (Abdel-Daim and Abdellatief, 2018). CAPE has an anti-cancer effect against a large variety of cell lines but with no cytotoxic effect on normal cells (Chen et al., 2004; Grunberger et al., 1988; Morin et al., 2017; Ozturk et al., 2012). This anti-cancer effect is mediated though induction of DNA damage and cell cycle arrest with a notable decline in expression of the oncosuppressor p53 gene (Hsu et al., 2013; Ishida et al., 2018; Kabała-Dzik et al., 2017; Tseng et al., 2014). The chemopreventive potential of CAPE has also been attributed to its antioxidant activities that scavenge free radicals and reduce oxidative stress (Chen et al., 2001). It was also reported that CAPE plays a crucial role in the inhibition of angiogenesis, invasion, and metastasis of CT26 colon adenocarcinoma cells (Liao et al., 2003). Additionally, CAPE enhanced the efficacy of the radiation therapy of tumors though the modulation of the NF-kB pathway (Chen et al., 2004; Khoram et al., 2016). However, the anticancer effect of CAPE is limited due to its rapid degradation into caffeic acid by secreted esterase enzymes (Ishida et al., 2018; Wadhwa et al., 2016). To overcome this disadvantage, CAPE was given in combination with other more stable molecules. Co-treatment with CAPE and γ-cyclodextrin (γCD) induced higher cytotoxicity in cancer cells (Ishida et al., 2018; Wadhwa et al., 2016).

Epigenetic changes, like histone modification, modulate gene expression by altering the accessibility of transcription factors to chomatin (Song et al., 2011). HDAC inhibitors possess anti-cancer potential (Wagner et al., 2010). CAPE, which is structurally related to the hydroxamic acid HDAC inhibitor, induces breast cancer apoptosis, and this effect is accompanied by epigenetic changes including aggregation of acetylated histone proteins that regulate the expression of oncogenes (Omene et al., 2013). However, it is still unclear whether CNPs could induce epigenetic changes in HCC. Also, the precise epigenetic molecular mechanisms for the combined therapy of CAPE and CNPs on HCC are still unclear. Therefore, this study was conducted to investigate the epigenetic mechanism of CAPE and/or CNPs on HepG2 cells.

CNPs were prepared by dissolving chitosan powder (MW:340 KDa, 89% purity, Marine Hydrocolloids Company, Meron, India) in sodium tripolyphosphate (STPP) as previously detailed (Du et al., 2009). Transmission electron microscope (TEM, JEM-2100, JEOL) was used to determine the size of the prepared CNPs as previously described but without using negative staining (Elkeiy et al., 2018). Dynamic light scattering (DLS) was used to measure CNPs size distribution utilizing a Nano ZS zeta sizer system (Malvern Instruments). CAPE was purchased from Sigma-Aldrich (white powder, ≥97% purity as detected by HPLC, Saint Louis, MO, USA, Cas. No. 104594-70-9).

The human HCC cell line HepG2 was purchased from VACSERA (Egypt). MTT assay was performed to detect the cytotoxic potential of CAPE and CNPs on HepG2 cells. Approximately 10,000 cells per well of the 96-well plate were grown in a complete medium (DMEM, 10% fetal bovine serum, GIBCO, USA) at 37 °C, 5% CO2 for 24 h before the addition of variable concentrations of CAPE or CNPs (3.125–100 μg/ml). After incubation for 2 days, MTT (5 mg/ml) was added, and the cells were re-incubated for 4 h before the addition of 100 μl dimethyl sulfoxide (DMSO). The optical density (570 nm) was plotted against the concentrations to calculate the inhibition concentration of 50% by GraphPad Prism software.

The genomic DNA was extracted from HepG2 treated with CAPE and/or CNPs at concentrations equal to their IC50 values using QIAamp DNA extraction kits (Qiagen, GmbH, Germany) following the manufacturer’s instructions and as previously detailed (Abd-Allah et al., 2015). Methylamp™ Global DNA Methylation Quantification Colorimetric Kit was used to detect the concentrations of global DNA methylation though the detection of a 5-mC antibody, rather than particular gene DNA methylation, following the manufacturer’s guidelines. The 5-Aza-dc is a powerful DNA demethylation compound and is utilized as a positive control. The levels of methylated DNA, which are proportionate to the optical density intensity, are calculated using an Elisa reader.

Real-time PCR (qPCR) was used to relatively quantify the expression of apoptosis-related genes (Bax and Bcl2) and DNA methylation-related genes (DNMT1 and Ube2e2) in HepG2 after treatment with CAPE and/or CNPs at concentrations equal to their IC50 values with incubation for 24 h at 37 °C and 5% CO2. Total RNA was extracted (Gene JET RNA Purification Kit, # K0731, Thermo Scientific, USA) and cDNA was obtained (Thermo Scientific, #EP0451). RNA integrity was determined by electrophoresis on 1.5 % agarose gels, and concentration and purity were evaluated by Quawell nanodrop Q5000 (USA). The qPCR mixture contained cDNA, 2XMaster Mix (QuantiTect SYBR Green, Germany), and the following primers:

Bax (sense 5’ CCTGTGCACCAAGGTGCCGGAACT 3’ and antisense 5’ CCACCCTGGTCTTGGATCCAGCCC3’); Bcl2 (sense 5’AGGAAGTGAACATTTCGGTGAC3’ and antisense 5’ GCTCAGTTCCAGGACCAGGC3’); DNMT1 (sense 5’ AGGTGGAGAGTTATGACGAGGC 3’ and antisense 5’ GGTAGAATGCCTGATGGTCTGC3’); Ube2e2 (sense 5’ CGTGAAAGTGTTCAGCAAGAACC3’ and antisense 5’ GGAGGGTCCAATGTGATTTCTGC 3’), and the housekeeping β actin gene as an internal control (sense 5’ CACCAACTGGGACGACAT 3’ and antisense 5’ ACAGCCTGGATAGCAACG 3’). The thermal conditions of 40 cycles included: denaturation at 94 °C for 40 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. These cycles were preceded by an initial denaturation cycle of 94 °C for 4 min. The melting curve condition and fold change calculation based on cycle theshold (Ct) of target genes and the housekeeping (β actin) gene using the Livak method (2−ΔΔCt) were performed as previously detailed (Elgazar et al., 2018; Saleh et al., 2014; Selim et al., 2019).

Statistical analysis was performed using one-way ANOVA followed by the Duncan test as a post hoc test (GraphPad Prism software) to determine the difference between groups. Data were expressed as mean ± standard error of mean (SEM) and the significant values were detected at p≤ 0.05.

The shape and diameters of the prepared CNPs were determined by TEM and the results were shown in Figure 1. CNPs appeared spherical with variable diameters (150 to 300 nm). This size range was further confirmed using DLS.

The cytotoxic effect of CAPE and CNPs on HepG2 cells was determined using the MTT assay and the obtained results were presented in Figure 2. The results showed a significant inhibitory effect for CAPE and CNPs on HepG2 cells with IC50 values 14.26 ± 1.23 and 25.98 ± 1.62 µg/ml compared to the control cells (Fig. 2). These findings imply that both CAPE and CNPs had potent dose-dependent cytotoxic effects against HepG2 cells with better effect for CAPE.

Effects of CAPE and/or CNPs on the expression of apoptosis-related genes (Bax and Bcl2) in HepG2 cells were determined by real-time PCR (qPCR). Treatment with CAPE or CNPs significantly (P<0.05) upregulated the expression of Bax and significantly (P<0.05) downregulated the expression of Bcl2, with a better effect for CAPE, compared to the control group (Fig. 3). Co-treatment with CAPE and CNPs showed higher mRNA levels of Bax and lower mRNA levels of Bcl2 than individual treatment with either CAPE or CNPs. However, the treated groups (CAPE and/or CNPs) exhibited significantly higher Bax and significantly lower Bcl2 expression than the control group. These results inferred that the combined treatment with CAPE and CNPs caused a cytotoxic effect against HepG2 cells though induction of apoptosis.

To evaluate the influence of CAPE and/or CNPs on global DNA methylation in HepG2, the cells were treated with CAPE and/or CNPs at doses equal to their IC50 for 72 h and the obtained results were presented in Figure 4. The thee treated groups exhibited significantly lower DNA methylation levels than the control (untreated) cells. HepG2 co-treated with CAPE and CNPs showed a significant reduction in DNA methylation levels compared to cells individually treated with either CAPE or CNPs. However, the thee treated groups showed significantly higher DNA methylation levels than cells treated with the positive control 5-Aza-dc.

To further confirm the effect of CAPE and/or CNPs on DNA methylation, the expression of DNA methylation-related genes (DNMT1 and Ube2e2) in HepG2 was detected using qPCR. Cells treated with CAPE and/or CNPs showed significantly (P<0.05) downregulated expression of DNMT1 and Ube2e2, with lowest expression in cells co-treated with CAPE and CNPs, compared to the control (untreated) group (Fig. 5). CAPE-treated cells exhibited lower expression than CNPs-treated cells. These results along with those of global DNA methylation implied that the combined treatment with CAPE and CNPs reduced DNA methylation in HepG2 cells.

This study was conducted to check whether CAPE and CNPs apoptotic effects on HepG2 cells involved epigenetic changes. To the best of our knowledge, this is the first study to report that the co-treatment with CAPE and CNPs induced notable apoptosis accompanied by a reduction in global DNA methylation and the expression of DNA methylation-related genes (DNMT1 and Ube2e2) in Hepg2. CNPs prepared in the present study had a similar average size as those used in many studies (Elkeiy et al., 2018; Feyzioglu and Tornuk, 2016; Loutfy et al., 2016) but with a smaller size than CNPs prepared by Badawy et al. (2020). The cytotoxic effect of CNPs against HepG2 cells was consistent with that of Elkeiy et al. (2018) with a similar IC50 of 25 μg/ml. Similarly, the obtained IC50 of CAPE on Hepg2 cells was close to that reported by other studies on a large variety of cancer cells (Chen et al., 2004; Grunberger et al., 1988; Morin et al., 2017; Ozturk et al., 2012).

In the present study, we found that the cytotoxic effect of CAPE and/or CNPs was mediated though the induction of apoptosis as revealed by upregulation of the Bax gene and downregulation of the Bcl2 gene with best apoptotic effects for the cells co-treated with both CAPE and CNPs. In agreement with our results, other studies reported the similar apoptotic potential for CNPs on HepG2 (Loutfy et al., 2016) and DENA-induced HCC in rats (Loh et al., 2010; Subhapradha et al., 2017), and for CAPE on a large variety of cell lines (Chen et al., 2004; Grunberger et al., 1988; Morin et al., 2017; Ozturk et al., 2012). Apoptotic pathway involves many genes which divided into two main categories. The apoptotic genes comprise Bax, cytochome c, p53, caspase 3, 7, 8 and 9, while the anti-apoptotic genes consist of Bcl2 and survivin. There are two main types of apoptosis; extrinsic and intrinsic which both end with activation of caspase 3 (the end product of apoptosis). The intrinsic apoptotic pathway is subdivided into mitochondrial-dependent and mitochondrial independent subtype (Abu Gazia and El-Magd, 2018; Attia et al., 2022; Badawy et al., 2019; El-Demerdash et al., 2021).

Epigenetic gene regulations have been known to play an important role in carcinogenesis. DNA methylation is one of the main epigenetic modifications that modulate gene expression though altering the accessibility of transcription factors to chomatin which could participate in cancer formation (Song et al., 2011). DNA methylation occurs primarily in the promoter CpG islands of the genome though several DNA methyltransferases (DNMTs), such as DNMT1 (Sarabi and Naghibalhossaini, 2015). The expression and activities of DNMTs are increased in HepG2 cells (Gailhouste et al., 2018). Our results showed that treatment with CAPE and/or CNPs reduced the percentage of global DNA methylation and the mRNA levels of DNMT1 and Ube2e2) in HepG2 cells. Consistent with our findings, CAPE induced breast cancer apoptosis, and this effect is accompanied by epigenetic changes including aggregation of acetylated histone proteins that regulate the expression of oncogenes (Omene et al., 2013). Additionally, CNPs have also been recognized as potent inhibitors for DNMT1 in HepG2 cells (Abbaszadeh et al., 2020). As a methylase, DNMT1 is one of the main enzymes that plays a crucial role in DNA methylation (Dan and Chen, 2016). It also involves in regulation of the cell cycle and induction of apoptosis in many cancer cell lines (Loo et al., 2018; Xu et al., 2018). Other studies also reported a potent inhibitory effect for CAPE on HDAC enzymes that are involved in epigenetic modifications associated with apoptosis of breast cancer cells (Omene et al., 2013). Again, we found superior inhibitory effects on DNA methylation for CAPE and CNPs when given together compared to the individual therapy by each alone. As limitations, this study focused only on in vitro experiments. However, it is crucial to confirm these results on animal model before the clinical trials on human.

Combined therapy with CAPE and CNPs had potent apoptotic effects accompanied by inhibitory effects on DNA methylation of HepG2 cells compared to individual therapy with either CAPE or CNPs alone. Therefore, this combined therapy could be used as adjuvant therapy and/or chemoprevention. However, further investigations are required, especially clinical trials, to verify the clinical efficacy of this combination on liver cancer treatment and prevention.

This study was funded by the deanship of scientific research (DSR) at King Abdulaziz University, Jeddah, Saudi Arabia has funded this project, under grant number (FP-85-42).

The authors have declared no conflict of interest.