ResearchersLinks
Pakistan Journal of ZoologyA ResearchersLinks journal
Submit manuscriptReview for this journal

Short Communication · Volume 49, Issue 5, 4 October 2017 · Open Access

Association between the COMT Gene and Obsessive Compulsive Disorder: A Case-Control Study

· · · · · · · ·

Affiliations & Notes ⌄
  1. 1University of Veterinary and Animal Sciences, Lahore, Pakistan 2Virtual University of Pakistan, Lahore, Pakistan 3Bacha Khan University, Charsadha, KPK, Pakistan 4Sir Ganga Ram Hospital, Lahore, Pakistan , * Corresponding author: masroor.ellahi@vu.edu.pk
Article Info ⌄
Journal:
Pakistan Journal of Zoology
Published:
4 October 2017
Download PDF ePub eFLIP Set Alert Get Rights Reprints

From the article

  • Our results were found significant with p-value 0.0078 (Table IV) revealing that this genetic variation (G>C) has some effective role in the development of OCD.
  • Significant association of COMT genetic variant Val158Met (p-value 0.002) with OCD has been observed in a case-control study.
  • Our analysis showed that COMT genetic variation c.G745C contribute significantly with OCD.
  • This study provides significant evidence for an association between C allele with Pakistani OCD patients.

Selected from the article's own text.

Abstract

This studyaimedto find out the genetic variations in Catechol O Methyl transferase (COMT) gene and association of these genes with obsessive compulsive disorder (OCD) in the Pakistani Patients. We selected OCD patients (n=100) following the Diagnostic Statistical Manual-IV (DSM-IV) criteria and controls (n=120) from Sir Ganga Ram Hospital and Panjab Institute of Mental Health, Lahore from August 2011 to January 2014. During the sample collection the factors like age/period, employment status and marital status were considered after informed consent. We found one single base change G>C at c.745 resulting in a nonsynonymous change p.E249Q in theCOMT gene. In-silico analysis predicted it to be damaging and disease causing. Screening of case and control group data showed no deviation from Hardy-Weinberg equilibrium with p-value 0.879 and 0.32, respectively. There was no significant difference in age (p-value 0.081), employment status (p-value 0.34) and matrimonial status (p-value 0.28) but there was a significant difference in their education (p-value 0.0002). The prevalence of C allele was 13.5% in disease, 5.83% in controls and found significant with p-value 0.007. These findings suggest that c.G745C in COMT gene has a significant association and a possible role in the OCD development in Pakistani patients.

Materials and methods

The conduct of this study was approved by the Ethics Committee of the University of Veterinary and Animal Sciences, Lahore. Blood samples of OCD patients (n=100) were collected from Sir Ganga Ram Hospital and Punjab Institute of Mental Health, Lahore. All the patients were given written informed consent for participation in this study.

The demographic distribution of both control and diseased groups are mentioned in Table I. All patients met criteria for either a current (South Africa) or a lifetime (Netherlands) diagnosis of OCD or subclinical OCD according to DSM-IV criteria . Diagnoses were established using the Structured Clinical Interview for Axis I disorders (SCID-I/P) or the Mini International Neuropsychiatric Interview (MINI) version 5.0.0. . We enrolled unrelated healthy controls (n=120) without any family history of psychiatric disorder. DSM-IV criteria (American Interview for Axis I disorders (SCID-I/P) was used for the diagnosis of OCD symptoms and severity of OCD was measured by Y-BOCS scale , b).

Table I.- Demographic characteristics of the subjects with OCD and without OCD included in the study.

 

Case Group

 Control Group p-value
Age (yr) 26.08 ± 7.6 29.6 ± 7.3 0.081
Gender
Male 55 (55%) 70 (58%) 1.000
Female 45 (45%) 50 (41%) 1.000
Education in years 8.3±4.8 10.6±2.9 0.0002
Employment
Employed 43 (43%) 81 (67.5%) 1.000
Unemployed 57 (57%) 39 (32.5%) 1.000
Marital status
Unmarried 45 (45%) 76 (63.3%) 1.000
Married 55 (55%) 44 (36.6%) 1.000
Family history of OCD
No 68 (68%) 120 (100%)  
Yes 32(32%) 0 (0%)  
Age at onset 24.2±6.2 -  
Duration of illness 8.2±5.8 -  
Mean Y-BOCS score
Y-BOCS Obs score 12.8±2.6 -  
Y-BOCS Comp score 12.2±3.6 -  
Total 25±6.2 -  

Comp, compulsions; Obs, obsessions; OCD, obsessive compulsive disorder; Mean+SD, Mean + standard deviation; Y-BOCS, yale-brown obsessive compulsive scale.

For amplification of COMT, genomic DNA was extracted from leukocytes through standard protocol . Primers designed from Primer 3 software to amplify all the coding regions of COMT gene (Table II). Amplification used SuperScript III platinum Taq Polymerase (Invitrogen Carlsbad. CA), dNTPs, MgCl2 (Fermantas brand). Amplified product was sequenced using ABI3130xl automated sequencer (Applied Biosystem Inc, Foster City, CA). Sequence was aligned for nucleotide change detection.

Sequencing data was aligned using NCBI BLAST tool. Allelic and genotypic frequency distribution was calculated for Hardy-Weinberg Equilibrium. Chi-square (X2) test was used for categorical variables and Student’s t-test for continuous variables. In-silico analysis was performed to predict the possible effect of sequence change through mutation tester, polyphin2 and exon splicing enhancer.

Table II.- Primers used for coding region of COMT gene.

Gene Primer used Tm
COMT-1

F: GGGGCTACTTGTGGCTAGA

R: CAGTTCCCATCCAGATTCC

F: 57.9

R: 57.8
COMT-2

F: GGAAGGGGCTCAGGTAT

R: AGAGTGGACATGTGCTCAG

F: 54.8

R: 54.5
COMT-3

F: GGAGGAGCACAGAGCAC

R: TGGGGTGATAACAGCTTC

F: 55.0

R: 54.3
COMT-4

F: GAGGTGAAATACCCCTCCAG

R: TCAGTGAACGTGGTGTGAAC

F: 58.4

R: 58.1
COMT-5

F: TGTCATCCCAGAACCCTA

R: ATCTCCACCCACCACAG

F: 54.6

R: 54.8

COMT-6

F: TAGTGAGGAGCACCCATC

R: GCCAGTGTTAGTAAAGAAGTCA

F: 54.3

R: 54.0

F, forward; R, reverse, Tm, melting termperature.

Table III.- Allele frequency distribution calculation using chi-square test.

COMT gene

 GG GC CC

HWE p-value

 Sig. level
Case group (n=100) 75 23 2 0.879

Not significant
Control group (n=120) 107 12 1 0.32

Not significant

COMT, Catechol O Methyl transferase; n, number; sig., significance.

Results

The aim of this study was to explore the genetic variations in the COMT gene among Pakistani OCD patients. The demographic distribution of the both OCD and control groups is illustrated in Table I and showed no significant difference in age (p-value 0.081), employment status (p-value 0.34) and marital status (p-value 0.28) while it was significant (p-value 0.0002) for their education. We found one single base change G>C at c.745 in the COMT gene resulting in a nonsynonymous change E249Q. In OCD group, sequencing result for the C allele showed homozygosity in two samples (n=2) and heterozygosity in twenty three samples (n=23) while the control group showed homozygosity in one sample (n=1) and heterozygosity in twelve samples (n=12). Allele frequency distribution for the OCD group (p-value=0. 87) and for the control group (p-value=0.325) calculated through Chi-Square test was found as nonsignificant. Our data is in accordance with the Hardy-Weinberg equilibrium (Table III). Variation was tested to find the association of the C allele with the case group using online fisher exact test (http://www.socscistatistics.com/tests/fisher/Default2.aspx). Our results were found significant with p-value 0.0078 (Table IV) revealing that this genetic variation (G>C) has some effective role in the development of OCD.

In-silico analysis performed through mutation taster (http://www.mutationtaster.org/cgi-bin/MutationTaster/MutationTaster69.cgi), exon splicing enhancer software and polyphin2 softwares. This change is predicted to be as an alternate splicing site in the gene. This effect on splicing site can lead to the formation of truncated protein or wrong gene product which then may lead to disease and prove damaging.

Table IV.- Association analysis of c.G745C of COMT gene with OCD using fisher exact test.

COMT gene G C p-value Sig. level
Case group (n=100) 173 27 0.0078 Significant
Control group (n=120) 226 14

Discussion

In the present study, we found a significant association between genetic variant c.G745C and OCD in Pakistani patients with p-value 0.00786. A functional genetic variant in the COMT gene changes the amino acid valine to methionine at 158 position. This change catalyzes the dopamine up to four times than the rate of methionine (Lachman et al., 1996b). Scientists observed low expression of COMT gene in OCD patients studied through real time quantitative reverse transcription reaction .

The COMT gene was found to be a risk factor for schizophrenia . Previously Lachman et al. (1996b) observed a functional genetic variant G>A (rs4680) in the COMT gene associated with OCD and some other anxiety related traits like extraversion and neuroticism . Some other studies did not find association of rs4680 with psychiatric disorders . Different genetic variations in the COMT gene have been found to be associated with several personality traits, i.e. aggression and avoidance ; . In a case–control study, rs4680 was found in the COMT gene in association with some psychotic symptoms and schizophrenia ; and in emotional processing .

The most studied polymorphism for OCD in the COMT gene is rs4680 (G>A). The rs4680 lowers the expression level of COMT gene in Bipolar spectrum disorder and in Velo-cardio-facial-syndrome (VCFS) observed in US population (Lachman et al., 1996a). This low enzyme activity increases the susceptibility of different psychiatric disorders . Several studies suggested that the COMT gene has a significant role in the causation of neuro-psychiatric disorders ; .

In our sequencing data, we found a nonsynonymous mutation at position c.745 of COMT gene that changed the protein structure by changing the amino acid from glutamic acid to glutamine at p.249 postion. This genetic variant has been observed in 98 patients. Allele frequency distribution followed the Hardy-Weinberg equilibrium among diseased (p-values 0.0879) and control group (p-value=0.032). In-silico analysis showed this genetic variation as splice site is broken and possibly causes disease. COMT gene is found to be associated with OCD with p-value 0.049 . Meta-analysis of anxiety related traits has showed p.Val158Met in the COMT gene associated with the higher neuroticism (p-value 0.03) in Caucasian population and higher harm avoidance (p-value 0.004) in Asian population . Significant association of COMT genetic variant Val158Met (p-value 0.002) with OCD has been observed in a case-control study. The same group performed a meta analysis for case-control data and found the association of the COMT gene with OCD (p-value 0.001) . Genetic aspects of rs4680 is associated (p-value=0.01) with bipolar disorder, mood disorder, anxiety related disorder and OCD ; ; . The genetic variant c.G745C found in COMT gene has association with OCD in Pakistani patients compared to the normal from the same ancestory.

Conclusion

Our analysis showed that COMT genetic variation c.G745C contribute significantly with OCD. This study provides significant evidence for an association between C allele with Pakistani OCD patients. This study could be helpful for investigation of genetic aspects of other psychiatric disorders in Pakistani population.

Acknowledgements

Higher Education Commission of Pakistan is highly acknowledged for providing funds for this study.

Conflict of interest statement

We declare that we have no conflict of interest.

References

  1. Alsobrook, J.P., Zohar, A.H., Leboyer, M., Chabane, N., Ebstein R.P. and Pauls, D.L., 2002. Am. J. med. Genet., 114: 116-120. https://doi.org/10.1002/ajmg.10040[CrossRef]
  2. Axelrod, J., 1957. Science, 126: 400-401. https://doi.org/10.1126/science.126.3270.400[CrossRef]
  3. Caspi, A., Moffitt, T.E., Cannon, M., McClay, J., Murray, R., Harrington, H., Taylor, A., Arseneault, L., Williams, B., Braithwaite, A., Poulton, R. and Craig, I.W., 2005. Biol. Psychiat., 57: 1117-1127. https://doi.org/10.1016/j.biopsych.2005.01.026[CrossRef]
  4. First, M.B., Spitzer, R.L., Gibbon M.L. and Williams, J.B.W., 2002. Structured clinical interview for DSM-IV-TR Axis I Disorders, Research Version. Biometrics Research, New York State Psychiatric Institute,, Patient Edition. (SCID-I/P) New York.
  5. Goodman, W.K., Price, L.H., Rasmussen, S.A., Mazure, C., Delgado, P., Heninger, G.R. and Charney, D.S., 1989a. Arch. Gen. Psychiat., 46: 1012-1016. https://doi.org/10.1001/archpsyc.1989.01810110048007[CrossRef]
  6. Goodman, W.K., Price, L.H., Rasmussen, S.A., Mazure, C., Fleischmann, R.L., Hill, C.L., Heninger, G.R. and Charney, D.S., 1989b. Arch. Gen. Psychiat., 46: 1006-1011. https://doi.org/10.1001/archpsyc.1989.01810110048007[CrossRef]
  7. Harrison, P.J. and Weinberger, D.R, 2005. Mol. Psychiat., 10: 40-68. https://doi.org/10.1038/sj.mp.4001630[CrossRef]
  8. Hasler, G., Kazuba, D. and Murphy, D.L., 2006. Am. J. med. Genet., Part B, Neuropsychiat. Genet., 141b: 403-408.
  9. Hemmings, S.M. and Stein, D.J., 2006. Psychiat. Clin. N. Am., 29: 411-444. https://doi.org/10.1016/j.psc.2006.02.011[CrossRef]
  10. Henderson, A.S., Korten, A.E., Jorm, A.F., Jacomb, P.A., Christensen, H., Rodgers, B., Tan, X. and Easteal, S., 2000. Am. J. med. Genet., 96: 102-107.
  11. Hettema, J.M., Neale, M.C. and Kendler, K.S., 2001. Am. J. Psychiat., 158: 1568-1578. https://doi.org/10.1176/appi.ajp.158.10.1568[CrossRef]
  12. Karayiorgou, M., Sobin, C., Blundell, M.L., Galke, B.L., Malinova, L., Goldberg, P., Ott, J. and Gogos, J.A., 1999. Biol. Psychiat., 45: 1178-1189. https://doi.org/10.1016/S0006-3223(98)00319-9[CrossRef]
  13. Karno, M., Golding, J.M., Sorenson, S.B. and Burnam, M., 1988. Arch. Gen. Psychiat., 45: 1094-1099. https://doi.org/10.1001/archpsyc.1988.01800360042006[CrossRef]
  14. Katerberg, H., Cath, D.C., Denys, D.A., Heutink, P., Polman, A., van Nieuwerburgh, F.C., Deforce, D.L., Bochdanovits, Z., van Balkom, A.J. and den Boer, J.A., 2010. Am. J. med. Genet., Part B, Neuropsychiat. Genet., 153b: 167-176.
  15. Kessler, R.C., Berglund, P., Demler, O., Jin, R., Merikangas, K.R. and Walters, E.E., 2005. Arch. Gen. Psychiat., 62: 593-602. https://doi.org/10.1001/archpsyc.62.6.593[CrossRef]
  16. Lachman, H.M., Morrow, B., Shprintzen, R., Veit, S., Parsia, S.S., Faedda, G., Goldberg, R., Kucherlapati, R. and Papolos, D.F., 1996a. Am. J. med. Genet., 67: 468-472.
  17. Lachman, H.M., Papolos, D.F., Saito, T., Yu, Y.M., Szumlanski, C.L. and Weinshilboum, R.M., 1996b. Pharmacogenetics, 6: 243-250. https://doi.org/10.1097/00008571-199606000-00007[CrossRef]
  18. Lee, L.O. and Prescott, C.A., 2014. Psychiat. Genet., 24: 52-69. https://doi.org/10.1097/YPG.0000000000000018[CrossRef]
  19. Lelli-Chiesa, G., Kempton, M.J., Jogia, J., Tatarelli, R., Girardi, P., Powell, J., Collier, D.A. and Frangou, S., 2011. Psychol. Med., 41: 779-788. https://doi.org/10.1017/S0033291710001431[CrossRef]
  20. Massat, I., Kocabas, N.A., Crisafulli, C., Chiesa, A., Calati, R., Linotte, S., Kasper, S., Fink, M., Antonijevic, I., Forray, C., Snyder, L., Bollen, J., Zohar, J., De Ronchi, D., Souery, D., Serretti, A. and Mendlewicz, J., 2011. Neurosci. Lett., 498: 218-221. https://doi.org/10.1016/j.neulet.2011.05.012[CrossRef]
  21. Muller, T., 2015. Drugs, 75: 157-174. https://doi.org/10.1007/s40265-014-0343-0[CrossRef]
  22. Pooley, E.C., Fineberg, N. and Harrison, P.J., 2007. Mol. Psychiat., 12: 556-561. https://doi.org/10.1038/sj.mp.4001951[CrossRef]
  23. Rasmussen, S.A. and Tsuang, M.T., 1986. Am. J. Psychiat., 143: 317-322. https://doi.org/10.1176/ajp.143.3.317[CrossRef]
  24. Rujescu, D., Giegling, I., Gietl, A., Hartmann, A.M. and Moller, H.J., 2003. Biol. Psychiat., 54: 34-39. https://doi.org/10.1016/S0006-3223(02)01748-1[CrossRef]
  25. Sambrook, J. and Russel, D.W., 2001. Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory, New York, pp. 631-632.
  26. Sampaio, A.S., Hounie, A.G., Petribu, K., Cappi, C., Morais, I., Vallada, H., do Rosario, M.C., Stewart, S.E., Fargeness, J., Mathews, C., Arnold, P., Hanna, G.L., Richter, M., Kennedy, J., Fontenelle, L., de Braganca Pereira, C.A., Pauls, D.L. and Miguel, E.C., 2015. PLoS One, 10: e0119592. https://doi.org/10.1371/journal.pone.0132894[CrossRef]
  27. Sheehan, D.V., Lecrubier, Y., Sheehan, K.H., Amorim, P., Janavs, J., Weiller, E., Hergueta, T., Baker, R. and Dunbar, G.C., 1998. J. clin. Psychiat., 59 (Suppl 20): 22-33.
  28. Shifman, S., Bronstein, M., Sternfeld, M., Pisante, A., Weizman, A., Reznik, I., Spivak, B., Grisaru, N., Karp, L., Schiffer, R., Kotler, M., Strous, R.D., Swartz-Vanetik, M., Knobler, H.Y., Shinar, E., Yakir, B., Zak, N.B. and Darvasi, A., 2004. Am. J. med. Genet., Part B, Neuropsychiat. Genet., 128b: 61-64.
  29. Stein, M.B., Fallin, M.D., Schork, N.J. and Gelernter, J., 2005. Neuropsychopharmacology, 30: 2092-2102. https://doi.org/10.1038/sj.npp.1300787[CrossRef]
  30. Tai, C.H. and Wu, R.M., 2002. Acta med. Okayama, 56: 1-6.
  31. Tsankova, N., Renthal, W., Kumar, A. and Nestler, E.J., 2007. Nat. Rev. Neurosci., 8: 355-367. https://doi.org/10.1038/nrn2132[CrossRef]
  32. Umehara, H., Numata, S., Tajima, A., Kinoshita, M., Nakaaki, S., Imoto, I., Sumitani, S. and Ohmori, T., 2015. Human Psychopharmacol., 30: 372-376. https://doi.org/10.1002/hup.2485[CrossRef]
  33. Wang, Z., Xiao, Z., Inslicht, S.S., Tong, H., Jiang, W., Wang, X., Metzler, T., Marmar, C.R. and Jiang, S., 2009. J. Anx. Disor., 23: 660-664. https://doi.org/10.1016/j.janxdis.2009.02.004[CrossRef]
  34. Weissman, M.M., Bland, R.C., Canino, G.J., Greenwald, S., Hwu, H.G., Lee, C.K., Newman, S.C., Oakley-Browne, M.A., Rubio-Stipec, M. and Wickramaratne, P.J., 1994. J. clin. Psychiat., 55 (Suppl): 5-10.

Related articles

Services

Article usage statistics

Loading…

Association between the COMT Gene and Obsessive Compulsive Disorder: A Case-Control Study · ResearchersLinks