Oral SS-14 DNA Vaccine is More Potent than Oral SS-28 DNA Vaccine in Promoting Rat Lactation

Yan-Guo Han1,2, Jun-Hua Ye1, Qin-Tao Zhao1, Yong-Jie Huang2, Kai Li2, Yong-Fu Huang2 and Li Xu1,*

1Nanchang Police Dog Base of Ministry of Public Security, Nanchang 330100, China

2Chongqing Key Laboratory of Forage and Herbivore, Chongqing Engineering Research Centre for Herbivores Resource Protection and Utilization, College of Animal Science and Technology, Southwest University, Chongqing 400715, China

ABSTRACT

The study aimed at comparing the effect of oral somatostatin 14 (SS-14) and somatostatin 28 (SS-28) DNA vaccines in promoting lactation of rats. Fifteen female SD rats were randomly divided into three groups and were orally vaccinated, respectively SS-14 (Group T1) and SS-28 (Group T2) DNA vaccines fused tPA signal peptide and CpG adjuvant and delivered by attenuated Salmonella choleraesuis at weeks 0, 3 and 6 of the study, and rats in control group (Group C) was orally given empty vector vaccine. Blood samples were collected before primary immunization and at weeks 3, 5 and 7 after primary immunization and body weight of offspring were weighed at weeks 0, 2 and 4 after birth. Both SS-14 and SS-28 DNA vaccines induced humoral immune response, however, antibody response in T1 group were significantly stronger than that in T2 and C groups. Serum GH levels in T1 group was significantly higher than those in T2 and C groups, and serum PRL levels in T1 group was significantly higher than that in control group. Body weight of offsping rats in T1 group were significantly higher than that in control group at weeks 2 and 4 after birth, and body weight of offsping in T2 group were significantly higher than that in control group only at week 4. Oral SS-14 DNA vaccine fused tPA signal peptide and CpG adjuvant and delivered by attenuated Salmonella choleraesuis was more effective than that oral SS-28 DNA vaccine in promoting lactation of rats.

Article Information

Received 09 September 2018

Revised 22 October 2018

Accepted 29 October 2018

Available online 19 June 2019

Authors’ Contribution

YGH and LX planned the experiment. YGH, JHY and LX executed the experiment and drafted the manuscript. QTZ, JHY, KL, YFH helped in laboratory work, statistical analysis and preparation of manuscript.

Key words

Somatostatin 14, Somatostatin 28, DNA vaccine, Lactation, Rats.

DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.5.1711.1719

* Corresponding author: xuli7403112018@126.com

0030-9923/2019/0005-1711 $ 9.00/0

Copyright 2019 Zoological Society of Pakistan

Introduction

Immunoneutralization against hormones have been considered as an effective method in improving animal growth and reproductive performance (Han et al., 2008; Liu et al., 2016; Dan et al., 2016). The active immunization against somatostatin (SS) has been proven to be very effective in improving animal growth performance (Wu et al., 2012; Liang et al., 2014). However, there have been only a few studies and controversy on the effect of active immunization against somatostatin on milk production. The active immunization against exogenous somatostatin can significantly increase milk production of mice or ewes by promoting the secretion of pituitary GH or PRL (Van Kessel et al., 1990; Bai et al., 2011). However, there are also some studies showing that immunization against somatostatin does not significantly promote animals’ lactation (Yi et al., 1999; Kim et al., 2002).

In mammals, somatostatin is not species-specific and mainly contains two biologically active forms, SS-14 and SS-28 amino acids (Ding et al., 2014). SS-28 is an N-terminally extended form of SS-14 (Pradayrol et al., 1980). In the peripheral blood, the SS-28, but not SS-14, is the main form of somatostatin and it has a slower metabolic rate compared to SS-14 (Patel et al., 1973; Tannenbaum et al., 1986). In addition, some studies showed that SS-28 has a significantly longer acting than that SS-14 in inhibiting spontaneous GH secretion (Tannenbaum et al., 1982, 1986). The principle of hormone immunoneutralization is that the antibody produced binds to endogenous hormone which results in that the endogenous hormone cannot bind to its receptor (Dan et al., 2016; Lei et al., 2017). In theory, when the amount of antibody is large enough, the immune effect produced by SS-28 vaccine should be greater than that of SS-14 vaccine, because that SS-28 is the main form and has slower metabolic rate in the peripheral blood. Some studies have showed that the immunization against SS-14 can improve animal lactation (Van Kessel et al., 1990; Bai et al., 2011), however, there are very few studies on the immunization effect against SS-28 in enhancing animal lactation (Yi et al., 1999). Therefore, to further promote animal lactation performance, it is very necessary to compare the immunization effects of SS-14 and SS-28 on animal lactation.

Attenuated choleraesuis is an effective and low-cost tool for delivering SS DNA vaccines. In addition to being able to induce humoral and cellular immune responses, the DNA vaccine delivered by attenuated choleraesuis can also induce a long-lasting mucosal and systemic immune responses (Toussaint et al., 2013; Han et al., 2017; Chen et al., 2018). In addition, the DNA vaccine delivered by attenuated choleraesuis do not require protein antigen extraction and synthesis which is more convenient and cost effective (Lin et al., 2015; Liu et al., 2016). The oral SS-14 DNA vaccine delivered by attenuated Salmonella typhimurium (CSO22) can significantly improve the lactation by enhancing the body weight of offspring mice at weeks 1 and 2 of lactation (Bai et al., 2011). However, the oral SS DNA vaccine contained a kanamycin antibiotic resistance gene which can cause the safety issue of antibiotic residue (Liang et al., 2014). In addition, the oral SS DNA vaccine by attenuated Salmonella typhimurium did not significantly enhance the weaning weight of offspring mice (week 3 of lactation) (Bai et al., 2011). Salmonella choleraesuis C500 with the asd and crp genes deleted has been widely used to construct non-antibiotic resistance DNA vaccines, in which the antibiotic resistance marker has been replaced by non-antibiotic resistance asd+ balanced-lethal host-vector system which contains a complementing asd+ expression plasmid (Han et al., 2014; Liang et al., 2014; Liu et al., 2016). Therefore, to further improve safety and efficiency of oral SS DNA vaccine in enhancing lactation, a non-antibiotic resistance and more effective oral SS DNA vaccines should be developed and applied.

To the best of our knowledge, the non-antibiotic resistance oral SS-14 or SS-28 DNA vaccines has not been applied to improve animals’ lactation. Therefore, the study aims to compare the immunization effect of novel non-antibiotic resistance oral SS-14 and SS-28 DNA vaccines in enhancing lactation of female rats. The immunization effect of oral SS DNA vaccines against somatostatin 14 and 28 was evaluated by serum anti-somatostatin antibody, serum GH, PRL and IGF-1 levels, and offsping rats’ weight of different lactation period.

 

Materials and methods

Vaccine construction

The tPA (tissue plasminogen activator signal peptide)-CpG (three 6 hexameric CpG motifs, 5′- TCGTCGTTTTGTCGTTTTGTCGTT -3′)-HBsAg-S-2SS-14 (two copies of SS-14 gene inserted into the hepatitis B surface antigen S gene)-FLAG (a protein label), tPA-CpG-HBsAg-S-2SS-28 (two copies of SS-28 gene inserted into HBsAg-S gene)-FLAG fusion genes and single CpG were synthesized chemically (Sangon Biotechnology Co., Ltd, Shanghai, China). The three genes were inserted separately into pVAX-asd plasmid (asd gene coding for aspartate-b-semialdehyde dehydrogenase), and then these recombinant plasmids (pVAX-tPA-CpG-HBsAg-S-2SS-14-asd, pVAX-tPA-CpG-HBsAg-S-2SS-28-asd and pVAX-CpG-asd) were electroporated, respectively into the attenuated S. choleraesuis C500 with the asd and crp genes deleted. These novel recombinant oral SS-14 DNA vaccine C500 (ptCS/2SS-14-asd) and SS-28 DNA vaccine C500 (ptCS/2SS-28-asd) (Fig. 1) were identified by PCR and sequencing.

Animals

Fifteen specific-pathogen-free (SPF) female SD rats aged seven weeks were purchased from Chongqing Academy of Chinese Materia Medica (Chongqing, China) and raised in the Southwest University Experimental Animals House (Chongqing, China) based on the guidelines of the Committee on the Care and Use of Laboratory Animals of China. One week after caging, these female rats were randomly divided into SS-14 (Group T1), SS-28 (Group T2) DNA vaccine groups and control group (Group C) for immunization and mating.

Immunization and sampling

All rats were orally pretreated with 1 mL sodium bicarbonate solution (7.5%) for 30 min before immunization, and then they were separately given orally with SS-14, SS-28 DNA vaccines and empty vector vaccine at a dose of 5 × 109 CFU dissolved in 1 mL of sterile PBS. Subsequently, these rats were mated individually with adult male SD rats for one week. The immunization were boosted for twice at weeks 3 and 6 after primary immunization. Serum samples were obtained from eye socket before primary immunization (before mating) and at weeks 3 (first day after childbirth), 5 (week 2 after childbirth) and 7 (week 4 after childbirth) after primary immunization by centrifugation at 1157 × g for 10 min and stored at -20 °C for further use.

Detection of anti-SS antibodies

Specific anti-somatostatin antibodies were tested by an indirect enzyme-linked immunosorbent assay (ELISA) method (Bai et al., 2011). In brief, 96-well ELISA plates were coated with 100 ng/well of SS-14 or SS-28 antigen diluted in a bicarbonate buffer (pH 9.6) at 4°C for overnight. After washing three times with PBST (0.05% Tween-20 in a phosphate buffer saline),

 

these samples were blocked with 1% bovine serum albumin dissolved PBST at 37 °C for 1 h. Serum samples of tested rat were serially 2-fold diluted in PBST from 1:25 up to 1:3200, and then each well were added to 100 μl for incubating at 37 °C for 1 h. Negative control serum sample from preimmune rats were used. Specific SS bound antibodies were tested by adding horseradish peroxidase-labelled rabbit anti-rat IgG secondary antibodies (Abbkine, Inc., Redlands, CA, USA) diluted in PBST (1:5000) and incubated subsequently at 37 °C for 1 h. Tetramethylbenzidine substrate was used for the enzyme reaction by incubating the samples at 37 °C for 25 min. 2 MH2SO4 was applied to stop the reaction and the absorbance was detected at 450 nm by the Bio-Rad iMark Microplate Absorbance Reader (Bio-Rad, Hercules, CA, USA). End-point titers of these samples were determined as reciprocal of the highest serum dilution in which the absorbance was greater than the mean plus two standard deviations of negative control samples at the same dilution (Tannenbaum et al., 1982, 1986).

Detection of serum hormone levels

Serum GH, PRL and IGF-1 concentrations in rats were detected by radioimmunoassay (Beijing Sino-UK Institute of Biological Technology, Beijing, China). The intra-assay and inter-assay coefficients of variation were less than or equal to 15%, respectively.

Detection of lactation

One day after primary immunization, adult male rats were put into individually the cage to mate with the vaccinated female rats. Following parturition, the number of offspring rats of per litter was reduced to eight (four females and four males), and weaned after 4 week. Body weight of offspring rats from SS-14, SS-28 DNA vaccine groups and control group was measured at weeks 0 (first day after childbirth), 2 and 4 after birth to compare lactation performance.

Statistical analysis

The differences between groups in terms of anti-SS antibody titers, serum GH, PRL and IGF-1 levels, and body weight of offspring rats were analyzed by one-way ANOVA and Duncan’s test of SAS 8.1 analytical software (SAS Institute, Inc., Cary, NC, USA). p < 0.05 was considered as statistically significant and all the data was expressed as mean ± SD.

 

Results

Vaccine designing and identification

Oral SS DNA vaccines encoding polypeptides of different lengths somatostatin was engineered which contained two copies of SS-14 or SS-28 gene, tPA signal peptide and CpG motifs (Fig. 1). The recombinant SS-14 and SS-28 DNA vaccines were identified by PCR (Fig. 2) and sequence analysis (data not shown). There was a 1086 bp amplified band in the electrophorogram after amplifying the SS-28 DNA vaccine (Lane 1, Fig. 2), and there was a 1002 bp amplified band after amplifying the SS-14 DNA vaccine (Lane 2, Fig. 2), suggesting that the recombinant oral SS-14 and SS-28 DNA vaccines was successfully developed.

 

 

Anti-SS antibody response

SS-specific antibody titers in both SS-14 and SS-28 DNA vaccine groups were significantly higher than that in control group at weeks 3 and 7 after primary immunization (Fig. 3, p < 0.05). However, SS-specific antibody titers in SS-14 DNA vaccine group were significantly higher than that in SS-28 DNA vaccine group at week 7 after primary immunization (Fig. 3, p < 0.05).

 

Serum GH, PRL and IGF-1 levels

Serum GH concentrations in SS-14 DNA vaccine group were significantly higher than that in SS-28 DNA vaccine group and control group at weeks 5 and 7 after primary immunization (Fig. 4A, p < 0.05). However, no significant difference was observed on serum GH concentrations between SS-28 DNA vaccine group and control group at weeks 0, 5 and 7 after the primary immunization (Fig. 4A, p > 0.05).

Serum PRL concentrations in SS-14 DNA vaccine group were significantly higher than that in control group at week 5 after primary immunization (Fig. 4B, p < 0.05). However, there was no significant difference on serum PRL concentrations between SS-28 DNA vaccine group and control group at weeks 0, 5 and 7 after the primary immunization (Fig. 4B, p > 0.05).

There was no significant difference on serum IGF-1 concentrations between SS-14 DNA vaccine group and SS-28 DNA vaccine group or control group at weeks 0, 5 and 7 after the primary immunization (Fig. 4C, p > 0.05). In addition, there was also no significant difference on serum IGF-1 concentrations between SS-28 DNA vaccine group and control group at weeks 0, 5 and 7 after the primary immunization (Fig. 4C, p > 0.05).

 

Effect of immunization on lactation

There were no significant difference on birth weight of offspring rats among groups at first day after childbirth. Body weight of offspring in SS-14 DNA vaccine group was significantly higher than that in control group at weeks 2 and 4 after childbirth, and was significantly higher than that in SS-28 DNA vaccine group at week 2 after childbirth (Fig. 5, p < 0.05). However, body weight of offspring rats in SS-28 DNA vaccine group was significantly higher than that in control group only at week 4 after childbirth (Fig. 5, p < 0.05).

 

Discussion

Long-term active immunoneutralization of somatostatin is a potential method of improving animal lactation performance. GH/IGF-I axis and PRL play a vital role in the development of the mammary gland and animal lactation and they are mainly regulated by GH-releasing hormone and somatostatin (García-Tornadú et al., 2006; Villa-Osaba et al., 2016; Lékó et al., 2017). Somatostatin exerts an inhibitory effect on the secretion of pituitary GH and PRL and consequently animal lactation (Vale et al., 1974; Luque et al., 2016). Somatostatin is mainly consisted of two biologically active components somatostatin-14 and somatostatin-28 (Ding et al., 2014). Although somatostatin-14 DNA vaccine delivered by attenuated Salmonella typhimurium improved the mice lactation performance, the oral somatostatin DNA vaccine used a kanamycin antibiotic resistance gene as a selection marker which can cause the safety issue of antibiotic residue (Liang et al., 2014), and the humoral response induced by the oral somatostatin DNA vaccine is still weak (Bai et al., 2011). Somatostatin-28 has a significantly longer acting than that somatostatin-14 in inhibiting spontaneous GH secretion (Tannenbaum et al., 1982, 1986), however, there are very few studies on the lactation-promoting effect against SS-28 DNA vaccine. tPA signal peptide and CpG adjuvant and can effectively improve the DNA vaccines’ immunogenicity (Wang et al., 2011; Li et al., 2016), however, they have not been widely used in the construction of oral somatostatin DNA vaccines. Therefore, to improve the safety and efficacy of somatostatin DNA vaccine in enhancing animal lactation, we developed the novel non-antibiotic resistance SS-14 and SS-28 DNA vaccines fused tPA signal peptide and CpG adjuvant and and delivered by attenuated S. choleraesuis C500 deleted the asd and crp genes.

In this study, the novel oral SS-14 DNA vaccine delivered by attenuated S. choleraesuis C500 induced stronger humoral immune response and subsequently more effective stimulation of GH and PRL secretion than that oral SS-28 DNA vaccine. Both the anti-SS antibody titers in the oral SS-14 and SS-28 DNA vaccines was significantly higher than that in control group. In the study of lactation promotion, previous studies showed that immunization of only SS-14 vaccine can induce humoral immune response in lactation studies (Yi et al., 1999; Bai et al., 2011). However, our results indicated that the immunization of both oral SS-14 DNA vaccine and SS-28 DNA vaccine can induce a strong humoral immune response. The anti-SS antibody titers in oral SS-14 DNA vaccine group was significantly higher than that in oral SS-28 DNA vaccine group and control group. The result indicated that oral SS-14 DNA vaccine induced stronger humoral immune response than oral SS-28 DNA vaccine. The antibody titer in oral SS-14 and SS-28 DNA vaccines delivered by attenuated S. choleraesuis C500 was significantly higher than that in control group from day after childbirth to week 4 after childbirth, however, Bai et al. (2011) study showed that the antibody titer in oral SS-14 DNA vaccine delivered by attenuated Salmonella typhimurium significantly higher than that in control group only from week 2 after the booster immunization to the day after childbirth, and there was no significant difference in antibody titer between oral SS-14 DNA vaccine group and control group at week 3 after childbirth. The result indicated that novle oral SS-14 and SS-28 DNA vaccines fused tPA signal peptide and CpG adjuvant and delivered by attenuated S. choleraesuis C500 can induced stronger immune response than that oral SS-14 DNA vaccine delivered by attenuated Salmonella typhimurium. At weeks 5 and 7 after primary immunization, the GH concentration in the SS-14 DNA vaccine group was significantly higher than that in the SS-28 DNA vaccine group and control group, however, there was no significant difference in GH concentration between oral SS-28 DNA vaccine group and control group. Meanwhile, the PRL concentration in the SS-14 DNA vaccine group was significantly higher than that in control group, however, there was no significant difference in PRL concentration between oral SS-28 DNA vaccine group and control group. Previous studies also showed that immunization of SS-14 DNA vaccine can stimulate the secretion of GH and PRL by the immunoneutralization of anti-SS antibody induced (Hugues et al., 1986; Bai et al., 2011; Liang et al., 2014). These results indicated that immunization of the novel oral SS-14 DNA vaccine may stimulate the secretion of GH and PRL more effectively than that novel oral SS-28 DNA vaccine. Interestingly, there was no significant difference in IGF-1 concentration between oral SS-14 DNA vaccine and control group or between oral SS-28 DNA vaccine and control group, which may be because that the GH levels produced was not high enough or the shoter half-life of plasma IGF-1 (Guler et al., 1989; Carro et al., 2000). However, lower GH levels still can promote the mammary development and lactation by the binding to the GH receptor or PRL receptor (Ng et al., 1997; Xu et al., 2013).

Immunization of novel SS-14 DNA vaccine improved the weight of offspring rat during lactation more effectively than that SS-28 DNA vaccine. The body weight of offspring in SS-14 DNA vaccine was significantly higher than that in SS-28 DNA vaccine group and control group at week 2 after childbirth which was in middle stage of lactation, and the body weight of offspring in SS-14 DNA vaccine was still significantly higher than that in control group at week 4 after childbirth which was at weaning (late stage of lactation). Bai et al. (2011) study showed that oral SS-14 DNA vaccine delivered by attenuated Salmonella typhimurium can significantly improve the weight of offspring mice in the middle stage of lactation, however, our studies showed that oral SS-14 DNA vaccine can significantly improve the weight of offspring rats in the middle and late stage of lactation, which indicated that oral SS-14 DNA vaccine fused tPA signal peptide and CpG adjuvant and delivered by attenuated S. choleraesuis C500 can promote animal lactation more permanently than that oral SS-14 DNA vaccine delivered by attenuated Salmonella typhimurium. Interestingly, the body weight of offspring rats in SS-28 DNA vaccine group was significantly higher than that in control group at weaning, however, there was no significant difference in the GH and PRL levels between the SS-28 DNA vaccine group and control group. In the late stage of lactation, the offspring need to maintain the growth through diet and lactation (Daneshvar et al., 2015). Therefore, the significant difference of the body weight of offspring rats between SS-28 DNA vaccine group and control group may be due to the differences of individual feeding and nutrition of the offspring rats at weaning. These results indicated the oral SS-14 DNA vaccine fused tPA signal peptide and CpG adjuvant and delivered by attenuated S. choleraesuis C500 was more effective than that SS-28 DNA vaccine in promoting lactation of rats.

 

Conclusion

The oral SS-14 DNA vaccine fused tPA signal peptide and CpG adjuvant and and delivered by attenuated S. choleraesuis C500 can induce stronger humoral immune response and subsequently promote rat lactation more effectively than that oral SS-28 DNA vaccine. Further studies should be conducted to study the effect molecular mechanism and of oral SS DNA vaccine on milk composition.

 

Acknowledgement

This work was financially supported by the National Key Research and Development Plan of China (2016YFD0501008, 2018YFD0502003), the Chongqing Research Program of basic research and frontier technology (CSTC2015JCYJBX0002) and the Fundamental Research Funds for the Central Universities of China (XDJK2018C026).

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Bai, L.Y., Liang, A.X., Zhang, J., Yang, F.F., Han, L., Huo, L.J. and Yang, L.G., 2011. Effects of immunization against a DNA vaccine encoding somatostatin gene (pGM-CSF/SS) by attenuated Salmonella typhimurium on growth, reproduction and lactation in female mice. Theriogenology, 75: 155-163. https://doi.org/10.1016/j.theriogenology.2010.08.001

Carro, E., Nunez, A., Busiguina, S. and Torres-Aleman, I., 2000. Circulating insulin-like growth factor I mediates effects of exercise on the brain. J. Neurosci., 20: 2926-2933. https://doi.org/10.1523/JNEUROSCI.20-08-02926.2000

Chen, W.Z., Li, Y.M., Yu, X., Li, Y., Li, W.K., Wang, Q.L., Liang, A.X., Li, X., Yang, L.G., Han, L., 2018. The efficacy, biodistribution and safety of an inhibin DNA vaccine delivered by attenuated Salmonella choleraesuis. Microb. Biotechnol., 11: 248-256. https://doi.org/10.1111/1751-7915.13029

Daneshvar, D., Khorvash, M., Ghasemi, E., Mahdavi, A.H., Moshiri, B., Mirzaei, M., Pezeshki, A. and Ghaffari, M.H., 2015. The effect of restricted milk feeding through conventional or step-down methods with or without forage provision in starter feed on performance of Holstein bull calves. J. Anim. Sci., 93: 3979-3989. https://doi.org/10.2527/jas.2014-8863

Dan, X., Han, L., Riaz, H., Luo, X., Liu, X., Chong, Z. and Yang, L., 2016. Construction and evaluation of the novel DNA vaccine harboring the inhibin α (1-32) and the RF-amide related peptide-3 genes for improving fertility in mice. Exp. Anim., 65: 17-25. https://doi.org/10.1538/expanim.15-0044

Dan, X., Liu, X., Han, Y., Liu, Q. and Yang, L., 2016. Effect of the novel DNA vaccine fusing inhibin α (1-32) and the RF-amide related peptide-3 genes on immune response, hormone levels and fertility in Tan sheep. Anim. Reprod. Sci., 164: 105-110. https://doi.org/10.1016/j.anireprosci.2015.11.018

Ding, Y., Fan, J., Li, W., Peng, Y., Yang, R., Deng, L. and Fu, Q., 2014. The effect of albumin fusion structure on the production and bioactivity of the somatostatin-28 fusion protein in Pichia pastoris. J. Ind. Microbiol. Biotechnol., 41: 997-1006. https://doi.org/10.1007/s10295-014-1440-5

García-Tornadú, I., Rubinstein, M., Gaylinn, B.D., Hill, D., Arany, E., Low, M.J., Díaz-Torga, G. and Becu-Villalobos, D., 2006. GH in the dwarf dopaminergic D2 receptor knockout mouse: Somatotrope population, GH release, and responsiveness to GH-releasing factors and somatostatin. J. Endocrinol., 190: 611-619. https://doi.org/10.1677/joe.1.06902

Guler, H.P., Zapf, J., Schmid, C. and Froesch, E.R., 1989. Insulin-like growth factors I and II in healthy man. Estimations of half-lives and production rates. Acta Endocrinol., 121: 753-758. https://doi.org/10.1530/acta.0.1210753

Han, L., Liang, A., Zhang, J., Fang, M., Hua, G.H., Sang, L., Geng, L.Y., Wang, H.R. and Yang, L.G., 2008. Evaluation of the VP22 gene adjuvant for enhancement of DNA vaccine against somatostatin in mice. Animal, 2: 1569-1574. https://doi.org/10.1017/S175173110800284X

Han, L., Zhen, Y.H., Liang, A.X., Zhang, J., Riaz, H., Xiong, J.J., Guo, A.Z. and Yang, L.G., 2014. Oral vaccination with inhibin DNA delivered using attenuated Salmonella choleraesuis for improving reproductive traits in mice. J. Basic Microbiol., 54: 962-968. https://doi.org/10.1002/jobm.201300052

Han, Y., Liu, Q., Yi, J., Liang, K., Wei, Y. and Kong, Q., 2017. A biologically conjugated polysaccharide vaccine delivered by attenuated Salmonella Typhimurium provides protection against challenge of avian pathogenic Escherichia coli O1 infection. Pathog. Dis., 75: 1-11. https://doi.org/10.1093/femspd/ftx102

Hugues, J.N., Enjalbert, A., Moyse, E., Shu, C., Voirol, M.J., Sebaoun, J. and Epelbaum, J., 1986. Differential effects of passive immunization with somatostatin antiserum on adenohypophysial hormone secretions in starved rats. J. Endocrinol., 109: 169-174. https://doi.org/10.1677/joe.0.1090169

Kim, J.Y., Cho, K.K., Chung, M.I., Kim, J.D., Woo, J.H., Yun, C.H. and Choi, Y.J., 2002. Effects of active immunization against somatostatin or its analogues on milk protein synthesis of rat mammary gland cells. Asian-Australas. J. Anim. Sci., 15: 570-575. https://doi.org/10.5713/ajas.2002.570

Lei, M., Cai, L., Li, H., Chen, Z. and Shi, Z., 2017. Transcriptome sequencing analysis of porcine granulosa cells treated with an anti-inhibin antibody. Reprod. Biol., 17: 79-88. https://doi.org/10.1016/j.repbio.2017.01.002

Lékó, A.H., Cservenák, M. and Dobolyi, Á., 2017. Suckling induced insulin-like growth factor-1 (IGF-1) release in mother rats. Growth Horm. IGF Res., 37: 7-12. https://doi.org/10.1016/j.ghir.2017.10.003

Li, J., Yu, J., Xu, S., Shi, J., Xu, S., Wu, X., Fu, F., Peng, Z., Zhang, L., Zheng, S., Yuan, X., Cong, X., Sun, W., Cheng, K., Du, Y., Wu, J. and Wang, J., 2016. Immunogenicity of porcine circovirus type 2 nucleic acid vaccine containing CpG motif for mice. Virol. J., 13: 185. https://doi.org/10.1186/s12985-016-0597-0

Luque, R.M., Cordoba-Chacon, J., Pozo-Salas, A.I., Porteiro, B., de Lecea, L., Nogueiras, R., Gahete, M.D. and Castaño, J.P., 2016. Obesity- and gender-dependent role of endogenous somatostatin and cortistatin in the regulation of endocrine and metabolic homeostasis in mice. Scient. Rep., 6: 37992. https://doi.org/10.1038/srep37992

Liang, A., Riaz, H., Dong, F., Luo, X., Yu, X., Han, Y., Chong, Z., Han, L., Guo, A. and Yang, L., 2014. Evaluation of efficacy, biodistribution and safety of antibiotic-free plasmid encoding somatostatin genes delivered by attenuated Salmonella enterica serovar Choleraesuis. Vaccine, 32: 1368-1374. https://doi.org/10.1016/j.vaccine.2014.01.026

Lin, I.Y., Van, T.T. and Smooker, P.M., 2015. Live-attenuated bacterial vectors: Tools for vaccine and therapeutic agent delivery. Vaccines, 3: 940-972. https://doi.org/10.3390/vaccines3040940

Liu, Q., Han, L., Rehman, Z.U., Dan, X., Liu, X., Bhattarai, D. and Yang, L., 2016. The efficacy of an inhibin DNA vaccine delivered by attenuated Salmonella choleraesuis on follicular development and ovulation responses in crossbred buffaloes. Anim. Reprod. Sci., 172: 76-82. https://doi.org/10.1016/j.anireprosci.2016.07.004

Liu, X., Liu, Q., Xiao, K., Li, P., Liu, Q., Zhao, X. and Kong, Q., 2016. Attenuated Salmonella Typhimurium delivery of a novel DNA vaccine induces immune responses and provides protection against duck enteritis virus. Vet. Microbiol., 186: 189-198. https://doi.org/10.1016/j.vetmic.2016.03.001

Ng, S.T., Zhou, J., Adesanya, O.O., Wang, J., LeRoith, D. and Bondy, C.A., 1997. Growth hormone treatment induces mammary gland hyperplasia in aging primates. Nat. Med., 3: 1141-1144. https://doi.org/10.1038/nm1097-1141

Patel, Y.C. and Wheatley, T., 1973. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology, 52: 456-467. https://doi.org/10.1016/0042-6822(73)90341-3

Pradayrol, L., Jörnvall, H., Mutt, V. and Ribet, A., 1980. N-terminally extended somatostatin: The primary structure of somatostatin-28. FEBS Lett., 109: 55-58. https://doi.org/10.1016/0014-5793(80)81310-X

Tannenbaum, G.S., Ling, N. and Brazeau, P., 1982. Somatostatin-28 is longer acting and more selective than somatostatin-14 on pituitary and pancreatic hormone release. Endocrinology, 111: 101-107. https://doi.org/10.1210/endo-111-1-101

Tannenbaum, G.S. and Patel, Y.C., 1986. On the fate of centrally administered somatostatin in the rat: Massive hypersomatostatinemia resulting from leakage into the peripheral circulation has effects on growth hormone secretion and glucoregulation. Endocrinology, 118: 2137-2143. https://doi.org/10.1210/endo-118-5-2137

Toussaint, B., Chauchet, X., Wang, Y., Polack, B. and Le Gouëllec, A., 2013. Live-attenuated bacteria as a cancer vaccine vector. Exp. Rev. Vaccines, 12: 1139-1154. https://doi.org/10.1586/14760584.2013.836914

Vale, W., Rivier, C., Brazeau, P. and Guillemin, R., 1974. Effects of somatostatin on the secretion of thyrotropin and prolactin. Endocrinology, 95: 968-977. https://doi.org/10.1210/endo-95-4-968

Van Kessel, A.G., Korchinski, R.S., Hampton, C.H. and Laarveld, B., 1990. Effect of immunization against somatostatin in the pregnant ewe on growth and endocrine status of the neonatal lamb. Domest. Anim. Endocrinol., 7: 217-227. https://doi.org/10.1016/0739-7240(90)90028-X

Villa-Osaba, A., Gahete, M.D., Cordoba-Chacon, J., de Lecea, L., Castaño, J.P. and Luque, R.M., 2016. Fasting modulates GH/IGF-I axis and its regulatory systems in the mammary gland of female mice: Influence of endogenous cortistatin. Mol. Cell. Endocrinol., 434: 14-24. https://doi.org/10.1016/j.mce.2016.06.014

Wang, J.Y., Song, W.T., Li, Y., Chen, W.J., Yang, D., Zhong, G.C., Zhou, H.Z., Ren, C.Y., Yu, H.T. and Ling, H., 2011. Improved expression of secretory and trimeric proteins in mammalian cells via the introduction of a new trimer motif and a mutant of the tPA signal sequence. Appl. Microbiol. Biotechnol., 91: 731-740. https://doi.org/10.1007/s00253-011-3297-0

Wu, B., Qi, R., Li, B., Yuan, T., Liu, H., He, J., Lin, Z., Li, W., Fu, Y. and Niu, D., 2012. Effect of active immunization against a recombinant mouse granulocyte-macrophage colony-stimulating factor/somatostatin fusion protein on the growth of mice. Mol. Biol. Rep., 39: 6773-6779. https://doi.org/10.1007/s11033-012-1502-6

Xu, J., Sun, D., Jiang, J., Deng, L., Zhang, Y., Yu, H., Bahl, D., Langenheim, J.F., Chen, W.Y., Fuchs, S.Y. and Frank, S.J., 2013. The role of prolactin receptor in GH signaling in breast cancer cells. Mol. Endocrinol., 27: 266-279. https://doi.org/10.1210/me.2012-1297

Yi, I., Lim, D., Kim, J., Chung, M., Choi, Y., Kim, Y. and Kim, J., 1999. Effects of active immunization against somatostatin or somatostatin analogues on milk production in rats. Nutr. Res., 19: 1061-1072. https://doi.org/10.1016/S0271-5317(99)00066-4