Research Article

 

Antimicrobial Resistance and Virulence Genotyping of Different Salmonella Serovars Isolated from Chickens in Egypt

 

Aly M. Ghetas1*, Abdelbaki, M.M1, Hanaa S. Fedawy1, Dalia M. Sedeek1, M. A. Bosila1, Samy. A.A2, Nagwa S. Rabie1

1Poultry Diseases Department, National Research Centre, P.O. 12622, Giza, Egypt; 2Microbiology and Immunology Department, National Research Center, , P.O. 12622, Giza, Egypt.

 

Received | July 22, 2021; Accepted | August 02, 2021; Published | November 01, 2021

*Correspondence | Aly M Ghetas, Poultry Diseases Department, National Research Centre, P.O. 12622, Giza, Egypt; Email: [email protected]

Citation | Ghetas AM, Abdelbaki MM, Fedawy HS, Sedeek DM, Bosila MA, Samy AA, Rabie NS (2021). Antimicrobial resistance and virulence genotyping of different salmonella serovars isolated from chickens in Egypt. Adv. Anim. Vet. Sci. 9(12): 2124-2131.

DOI | http://dx.doi.org/10.17582/journal.aavs/2021/9.12.2124.2131

ISSN (Online) | 2307-8316; ISSN (Print) | 2309-3331

Copyright © 2021 Ghetas et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

 

Introduction

 

Salmonellosis is a major zoonotic foodborne disease causing mortalities, gastroenteritis, and/or septicemia in humans (Majowicz et al., 2010; Newell et al., 2010; Eng et al., 2015). Salmonella Enterica serovars are responsible of millions of enteric infections and thousands of human deaths annually (Balasubramanian et al., 2019). Contaminated poultry and eggs act as a main reservoir for Salmonellae (Antunes et al., 2016). Contamination of poultry meats and meat products are happened due to improper hygienic measure throughout plants during evisceration, cooling, packaging, and transport stages (Zhang et al., 2013). Salmonellae infect poultry causing clinical signs and high mortality especially in young chicks. Furthermore, it can be transmitted vertically from broiler breeder chickens to their progeny (Barbour et al., 1999; Lister, 1988). Control and prevention of Salmonellosis in poultry farm are depending mainly on using antimicrobials at therapeutic or prophylactic levels (Paudyal and Yue, 2019; Yue, 2016)

 

Table 1: Antimicrobials used in this study

 

Antimicrobial agents	Conc. (mcg)	Diameter of inhibition zone (mm)
		S*	I*	R*
Amoxicillin/Clavulanic acid (AMC)	30 (20/10)	≥ 18	14-17	≤13
Ampicillin (AMP)	10	≥ 17	14-16	≤13
Cefaclor (CF)	30	≥ 18	15-17	≤14
Cefeprime (CPM)	30	≥ 25	19-24	≤18
Cefotaxime (CTX)	30	≥ 26	23-25	≤22
Chloramphenicol (C)	30	≥ 18	13-17	≤12
Ciprofloxacin (CIP)	5	≥ 21	16-20	≤15
Trimethoprim/sulphamethoxazole (COT)	25 (1.25/23.75)	≥ 16	11-15	≤10
Doxycycline Hydrochloride (DO)	30	≥ 14	11-13	≤10
Ertapenem (ETP)	10	≥ 22	19-21	≤18
Tetracycline (TE)	30	≥ 15	12-14	≤11
Norfloxacin (NX)	10	≥ 17	13-16	≤12
Gentamicin (GEN)	10	≥ 15	13-14	≤12
Kanamycin (K)	30	≥ 18	14-17	≤13
Streptomycin (S)	10	≥ 15	12-14	≤11

*These letters represent susceptibility to antimicrobials: S= sensitive, I = intermediate, R= resistant

 

Table 2: Oligonucleotide primers sequences of target Salmonella spp. genes with amplicon sizes.

 

Gene	Primer sequence	Amplicon size (bp)
spvB	F: CTATCAGCCCCGCACGGAGAGCAGTTTTTA	717
	R: GGAGGAGGCGGTGGCGGTGGCATCATA
spiA	F: CCAGGGGTCGTTAGTGTATTGCGTGAGATG	550
	R: CGCGTAACAAAGAACCCGTAGTGATGGATT
pagC	F: CGCCTTTTCCGTGGGGTATGC	454
	R: GAAGCCGTTTATTTTTGTAGAGGAGATGTT
cdtB	F: ACAACTGTCGCATCTCGCCCCGTCATT	268
	R: CAATTTGCGTGGGTTCTGTAGGTGCGAGT
msgA	F: GCCAGGCGCACGCGAAATCATCC	189
	R: GCGACCAGCCACATATCAGCCTCTTCAAAC
invA	F: CTGGCGGTGGGTTTTGTTGTCTTCTCTATT	1070
	R: AGTTTCTCCCCCTCTTCATGCGTTACCC
sipB	F: GGACGCCGCCCGGGAAAAACTCTC	875
	R: ACACTCCCGTCGCCGCCTTCACAA
prgH	F: GCCCGAGCAGCCTGAGAAGTTAGAAA	756
	R: TGAAATGAGCGCCCCTTGAGCCAGTC
spaN	F: AAAAGCCGTGGAATCCGTTAGTGAAGT	504
	R: CAGCGCTGGGGATTACCGTTTTG
orgA	F: TTTTTGGCAATGCATCAGGGAACA	255
	R: GGCGAAAGCGGGGACGGTATT
tolC	F: TACCCAGGCGCAAAAAGAGGCTATC	161
	R: CCGCGTTATCCAGGTTGTTGC
iroN	F: ACTGGCACGGCTCGCTGTCGCTCTAT	1205
	R: CGCTTTACCGCCGTTCTGCCACTGC
sitC	F: CAGTATATGCTCAACGCGATGTGGGTCTCC	768
	R: CGGGGCGAAAATAAAGGCTGTGATGAAC
lpfC	F: GCCCCGCCTGAAGCCTGTGTTGC	641
	R: AGGTCGCCGCTGTTTGAGGTTGGATA
sifA	F: TTTGCCGAACGCGCCCCCACACG	449
	R: GTTGCCTTTTCTTGCGCTTTCCACCCATCT
sopB	F: CGGACCGGCCAGCAACAAAACAAGAAGAAG	220
	R: TAGTGATGCCCGTTATGCGTGAGTGTATT
pefA	F: GCGCCGCTCAGCCGAACCAG	157
	R: GCAGCAGAAGCCCAGGAAACAGTG

 

F= forward, R= reverse

 

However, multiple antimicrobial resistant Salmonella strains developed due to haphazard use of antimicrobials at recommended doses or at sub-therapeutic doses which representing a public health hazard (Antunes et al., 2016; EFSA, 2013) . Thus, continuous monitoring of antimicrobial resistance have a high priority.

 

The severity of Salmonella infection in human and animals is depending on the presence of virulence genes (Ammar et al., 2016). Several virulence genes have been reported. Virulence genes encoded proteins such as: invA, orgA, prgH, spaN, tolC, sipB, pagC, msgA, spiA, sopB, lpfC, pefA, and spvB which responsible of adherence, invasiveness, entry to non-phagocytic cells, survival within macrophage, and growing within the host. Other virulence genes (sitC and iroN) were involved in iron acquisition, while cdtB was responsible of toxin biosynthesis (Skyberg et al., 2006). Thus, detection of virulence genes among different Salmonella serovars is always required. Therefore, the aim of our study was study virulence genotyping of 28 Salmonella strains representing 9 Salmonella serovars (S.Agama, S.Blegdam, S. Enteritidis, S. Gueuletapee, S. Infantis, S. Kentucky, S. Montevideo, S. Typhimurium and S. Virchow) by Multiplex PCR technique targeting 17 virulence genes. Moreover, the resistance profile of those Salmonella strains to 15 antimicrobials was performed.

 

Materials and methods

 

Bacterial strains

Twenty eight Salmonella strains representing different Salmonella serovars (S.Agama, S.Blegdam, S.Enteritidis, S.Gueuletapee, S.Infantis, S.Kentucky, S.Montevideo, S.Typhimurium and S.Virchow) were used in this study. These Salmonella strains were previously isolated, purified, and identified in our laboratory from sick chickens suspected to infect with Salmonellosis.

 

Antibiotic sensitivity assay

Antimicrobial susceptibility testing to Salmonella strains belong to different serovars against different antimicrobials (Table 1) were determined by disk diffusion method (Bauer et al., 1966). Briefly, adjustment of bacterial inoculums to the 0.5 McFarland standard, streaking onto Mueller-Hinton agar plates, placing standard antibiotic disks (HIMEDIA®), and aerobic incubation at 37°C for 24 h were subsequently performed. The diameter of inhibition zone were measured and Salmonella strains were categorized to resistant, intermediate, or susceptible to different antimicrobials according to the CLSI guidelines (CLSI, 2017).

 

Polymerase chain reaction (PCR)

Bacterial DNA extraction and multiplex PCR amplification: Extraction of bacterial DNA was done for each Salmonella strain according to extraction kit instructions (GF-1 bacterial DNA extraction kit, vivantis, Malaysia). All bacterial DNA were kept in -20. Primers used in this study are listed in (Table 2). Three sets of multiplex PCR were accomplished for each sample to amplify different virulence genes (Skyberg et al., 2006) as follow: (set 1) amplified spvB, spiA, pagC, cdtB, and msgA. While (set 2) amplified invA, sipB, prgH, spaN, orgA, and tolC. Finally (set 3) amplified iroN, sitC, lpfC, sifA, sopB, and pefA. Amplification was performed in a 50 µl reaction mixture that included 1 µl of template DNA, 25 µl of master mix (Cosmo PCR Master Mix, UK), 2.5 µl of 50 mM MgCl2, 0.5 µl of 10 µM forward and reverse primers, and the reaction mixture was completed to 50 µl using dd H2O. Twenty five amplification cycles were run after 5 min at 95 C as follow: 30 sec at 94 C, 30 sec at 66.5 C, and 2 min at 72 C, with a final cycle of 10 min at 72 C, followed by a hold at 4 C. PCR products obtained were subjected to horizontal gel electrophoresis in 1.5% agarose, and the size of the amplicons was determined by comparison with DNA marker (VC 100bp Plus DNA Ladder, vivantis).

 

Statistical analysis

Antimicrobial resistance rates were analyzed using the chi-square test and GraphPad Prism 5.

 

Table 3: Antimicrobial resistance profiles of isolated Salmonella serovars

 

Serovars (n)	Antimicrobial resistance
	AMCa	AMPa	CF	CPM	CTX	C	CIP	COT	DO	ETP	TE	NX	GEN	K	S
S. Blegdam (11)	7	6	3	0	0	0	0	1	0	0	0	0	0	0	0
S. Typhimurium (7)	7	6	2	4	4	1	1	1	1	0	2	1	0	2	2
S. Montevideo (3)	3	3	1	1	2	0	0	0	0	0	1	0	0	1	0
S. Gueuletapee (1)	1	1	0	0	0	0	0	0	1	0	0	0	0	1	0
S. Agama (2)	2	2	0	0	1	0	0	0	1	0	1	0	0	0	0
S. Enteritidis (1)	1	1	1	0	1	0	0	0	0	0	0	0	0	0	0
S. Kentucky (1)	1	1	0	0	0	0	0	0	0	0	0	0	0	0	0
S. Infantis (1)	1	1	1	0	0	0	0	0	0	0	1	0	0	0	0
S. Virchow (1)	1	1	1	0	0	1	0	0	0	0	1	0	0	0	0
Total (28)	24	22	9	5	8	2	1	2	3	0	6	1	0	4	2
*Resistant %	85.7%	78.5%	32 %	17.8%	28.5 %	7%	3.5 %	7%	10.7%	0%	21.3 %	3.5 %	0%	14.3 %	7%
*Intermediate %	7%	3.6%	7%	21.4%	3.5 %	10.7 %	0%	0%	10.7%	3.5 %	25 %	0%	3.5 %	17.8 %	21.4 %
*Sensitive %	7%	17.8%	60.7 %	60.7%	67.8 %	82 %	96.4 %	92.8 %	78.5%	96.4 %	53.6 %	96.4 %	96.4 %	67.8 %	71.4 %

AMC Amoxicillin-clavulanic acid, AMP Ampicillin, CF Cefaclor, CPM Cefeprime, CTX Cefotaxime, C Chloramphenicol, CIP Ciprofloxacin, COT Trimethoprim sulfamethoxazole, DO Doxycycline, ETP Ertapenem, TE Tetracycline, NX Norfloxacin, GEN Gentamicin, K Kanamycin and S Streptomycin.

*The percentage of the total number of isolates resistant, intermediate, or susceptible for a particular antimicrobial is indicated in the last three rows below each antimicrobial.

a The significantly higher antimicrobial resistance rate.

 

Table 4: Multiple antimicrobial resistance patterns of Salmonella serovars

 

Multi-drug resistant antimicrobials	Number of resistant Salmonella serovars									Total (26)
	S. Agama (n=2)	S. Blegdam (n=11)	S. Enteritidis (n=1)	S. Gueuletapee (n=1)	S. Infantis (n=1)	S. Kentucky (n=1)	S. Monte video (n=3)	S. Typhim urium (n=7)	S. Virchow (n=1)
AMC, AMP	1	6	-	-	-	1	-	1	-	9
AMC,AMP,CF	-	3	-	-	-	-	1	-	-	4
AMC,AMP,CPM	-	-	-	-	-	-	-	1	-	1
AMC,AMP,CTX	-	-	-	-	-	-	1	1	-	2
AMC,AMP,COT	-	1	-	-	-	-	-	-	-	1
AMC,AMP,CF,TE	-	-	-	-	1	-	-	-	-	1
AMC,AMP,CF,CTX	-	-	1	-	-	-	-	-	-	1
AMC,AMP,CPM,CTX	-	-	-	-	-	-	-	1	-	1
AMC,AMP,DO,K	-	-	-	1	-	-	-	-	-	1
AMC,AMP,CF,C,TE	-	-	-	-	-	-	-	-	1	1
AMC,AMP,CTX,DO,TE	1	-	-	-	-	-	-	-	-	1
AMC,AMP,CF,CPM, CTX,TE,K	-	-	-	-	-	-	1	-	-	1
AMC,AMP,CF,CPM, CTX,DO,TE,K,S	-	-	-	-	-	-	-	1	-	1
AMC,AMP,CF,CPM, CTX,C,CIP,COT,TE,NX,K,S	-	-	-	-	-	-	-	1	-	1

AMC Amoxicillin-clavulanic acid, AMP Ampicillin, CF Cefaclor, CPM Cefeprime, CTX Cefotaxime, C Chloramphenicol, CIP Ciprofloxacin, COT Trimethoprim sulfamethoxazole, DO Doxycycline, TE Tetracycline, NX Norfloxacin, K Kanamycin and S Streptomycin.

 

Table 5: Virulence genes percent detected in different Salmonella serovars

 

Virulence genes	S. Agama (n=2)	S. Blegdam (n=11)	S. Enteritidis (n=1)	S. Gueuletapee (n=1)	S. Infantis (n=1)	S. Kentucky (n=1)	S. Montevideo (n=3)	S. Typhimurium (n=7)	S. Virchow (n=1)	Total percent
spvB	2	10	1	0	0	0	0	6	1	71%
spiA	2	11	1	1	1	1	3	7	1	100%
pagC	2	10	1	1	1	1	3	7	1	96%
cdtB	2	0	0	0	0	0	0	0	0	7%
msgA	2	11	1	1	1	1	3	7	1	100%
invA	2	11	1	1	1	1	3	7	1	100%
sipB	2	7	1	1	1	1	3	7	1	86%
prgH	2	11	1	1	1	1	3	7	1	100%
spaN	2	4	1	0	1	1	3	5	0	61%
orgA	1	4	1	0	1	1	3	5	0	57%
tolC	2	11	1	1	1	1	3	7	1	100%
iroN	2	4	1	0	1	0	2	4	0	50%
sitC	2	10	1	1	1	1	2	7	1	93%
lpfC	2	11	1	1	1	1	3	7	1	100%
sifA	2	11	0	1	0	1	2	7	1	89%
sopB	2	11	1	1	1	1	3	7	1	100%
pefA	2	0	0	0	0	0	0	4	0	21%

 

Results

 

Antimicrobial resistance profile

Antimicrobial resistance profile to 28 Salmonella strains representing 9 serovars (S.Agama, S.Blegdam, S.Enteritidis, S.Gueuletapee, S.Infantis, S.Kentucky, S.Montevideo, S.Typhimurium and S.Virchow) were performed in this study. As shown in Table 3, the significantly higher rate of resistance was detected against amoxicillin-clavulanic acid (AMC) and ampicillin (AMP) (85.7% and 78.5% respectively) comparing to the significantly lower rate of resistance detected against etapenem (ETP), gentamicin (GEN), ciprofloxacin (CIP), and norfloxacin (NX) (0 %, 0%, 3.5%, and 3.5% respectively). The significantly high resistance rate to cephalosporin antibiotics were detected as follow: cefaclor (CF) (32%), cefotaxime (CTX) (28.5%), and Cefeprime (CPM) (17.8%) comparing to low resistance rate against ETP, GEN, CIP, and NX. Resistance to tetracycline (TE), kanamycin (K), trimethoprim/sulphamethoxazole (COT), chloramphenicol (C), and streptomycin (S) antimicrobials was 21.3%, 14.3%, 7% 7%, and 7% respectively. Multiple antimicrobial resistance was detected against 26 strains (Table 4): resistance to 2 out of 15 antimicrobials in 9 strains, resistance to 3 out of 15 antimicrobials in 8 strains, resistance to 4 out of 15 antimicrobials in 4 strains, and resistance to more than 4 antimicrobials in 5 strains. Interestingly, two S. Typhimurium strains were resist to 9 and 12 out of 15 antimicrobials used in this study.

 

Virulence genotyping

All 28 Salmonella strains were subjected to multiplex PCR targeting 17 virulence genes (spvB, spiA, pagC, cdtB, msgA, invA, sipB, prgH, span, orgA, tolC, iroN, sitC, lpfC, sifA, sopB, and pefA). As shown in Table 5, we detected 7 virulence genes in all Salmonella strains tested in this study (spiA, msgA, invA, prgH, tolC, lpfC, and sopB). The lowest rate of detection was cdtB and pefA genes (7% and 21% respectively). While other virulence genes were detected in different rate between different Salmonella strains as follow: spvB (71%), pagC (96%), sipB (86%), spaN (61%), orgA (57%), iroN (50%), sitC (93%), and sifA (89%). Interestingly, all 17 virulence genes were detected in S. Infants and one strain of S. Agama as shown in Figure (1).

 

 

There sets of multiplex PCR (1, 2, 3) for each isolate was performed as follow: Lane (1) is the result of the PCR reaction amplifying (from top to bottom) spvB, spiA, pagC, cdtB, and msgA. Lane (2) is the result of the PCR reaction amplifying (from top to bottom) invA, sipB, prgH, spaN, orgA, and tolC. Lane (3) is the result of the PCR reaction amplifying (from top to bottom) iroN, sitC, lpfC, sifA, sopB, and pefA. Lane (M) contains 100bp DNA Marker.

 

Discussion

 

A total of 28 Salmonella strains which representing 9 Salmonella serovars (S.Agama, S.Blegdam, S.Enteritidis, S.Gueuletapee, S.Infantis, S.Kentucky, S.Montevideo, S.Typhimurium and S.Virchow) were used in this study to perform antimicrobial resistance profile and virulence genotyping. In our study, a high resistance rates among different Salmonella strains were detected in AMC and AMP indicating the limited therapeutic value of these antibiotics to control salmonellosis. Salmonellae resistance to beta-lactam was previously reported in Egypt (Ammar et al., 2016; Khairy, 2015), Turkey (Siriken et al., 2015), Pakistan (Shah and Korejo, 2012), Brazil (Oliveira et al., 2006). Moreover, the resistance rates of Salmonella spp. to cephalosporin antibiotics, CF (2nd generation), CTX (3rd generation), and CPM (4th generation), were detected as 32%, 28.5%, and 17.8% respectively. Development of resistance against cephalosporins was previously detected (Abo-Amer and Shobrak, 2015; Elkenany et al., 2019; Mir et al., 2015) which has a public health consequences as these antimicrobials are used to treat serious Salmonella infections in human. Unfortunately, the resistance rate of Salmonella strains tested in this study to 3 or more antimicrobials was 65%. Interestingly, two S. Typhimurium strains were resist to 9-12 out of 15 antimicrobials. Thus, increasing resistance rates and multiple antimicrobial resistance among Salmonella strains (Ammar et al., 2016; Elkenany et al., 2019; Yu et al., 2021) could be due to haphazard use of antimicrobials at recommended doses or at sub-therapeutic doses which representing a public health hazard. Antimicrobial resistance among Salmonella is a serious public health problem that needs to be monitored continuously. Furthermore, using of alternatives instead of antibiotics to control salmonellosis in poultry is required.

 

We performed a multiplex PCR targeting 17 virulence genes of Salmonellae related to adherence, invasiveness, entry to non-phagocytic cells and killing of macrophages, survival within macrophage, growing within the host, iron acquisition, and toxin biosynthesis. Genes required for host recognition and invasion (invA, prgH, tolC, lpfC, and sopB) and also required for survival of Salmonella within macrophages (spiA and msgA) were detected in all Salmonella strains tested in this study. Both cdtB and pefA virulence genes were rarely detected (7% and 21% respectively) which agree with results previously reported (Skyberg et al., 2006). Moreover, cdtB gene which responsible for toxin biosynthesis (Haghjoo and Galan, 2004) was only detected in both strains of S. Agama while PefA gene encoded by virulence plasmid was detected in S. Agama (2/2) and S. Typhimurium (4/7). Interestingly, all virulence genes were detected in S. Infants and 1 out of 2 S. Agama tested in this study. S. Agama was previously isolated from the poultry environment, dead birds, and apparently healthy birds in Nigeria (Ahmed et al., 2019). Furthermore, it is a zoonotic pathogen as it was a cause of diarrhea (Bélard et al., 2007; Kudaka et al., 2006), neonatal meningitis and septicemia (Heaton et al., 2015).

 

Conclusion

 

Antimicrobial resistance profile and virulence genotyping to Salmonella strains representing 9 Salmonella serovars previously isolated and identified in our laboratory were performed in this study. Multidrug resistant Salmonella strains were described and many virulence genes were detected among Salmonella strains. Finally, continuous monitoring of antimicrobial resistant Salmonella strains, using of alternatives instead of antimicrobials in poultry, and strict public health and food safety regimens are required to decrease the human health risk associated with Salmonellosis.

 

Acknowledgment

 

We would like to thank Prof. Dr. Ebtehal Abd El Aty Elsayed, chief researcher in microbiology and serology unit in Animal Health Research Institute, for their technical support. This work was funded by national project (12010140) under a title (control of salmonellosis in chickens) in National Research Centre. Furthermore, the project has been approved by Medical Research Ethic Committee in National Research Centre under number 19157.

 

Conflict of interest

 

The authors declare that they have no conflict of interest.

 

authors contribution

 

Nagwa S. Rabie and Samy, A.A. carried out the research design and revised the manuscript. Abdelbaki, M.M., Hanaa S. Fedawy, M. A. Bosila, Dalia M. Sedeek, and Aly M. Ghetas performed antimicrobial resistance profile. Hanaa S. Fedawy also participted in revision of the maniscript. Aly M. Ghetas and Abdelbaki, M.M. achieved virulence genotyping. Aly M. Ghetas analyzed data and wrote the manuscript.

 

References

 

• Ahmed AO, Raji MA, Mamman PH, Kwanashie CN, Raufu IA, Aremu A, Akorede GJ (2019). Salmonellosis: Serotypes, prevalence and multi-drug resistant profiles of Salmonella enterica in selected poultry farms, Kwara State, North Central Nigeria. Onderstepoort J. Vet. Res. 86(1): a1667. https://doi.org/ 10.4102/ojvr.v86i1.1667

• Abo-Amer AE, Shobrak MY (2015). Isolation and molecular characterization of multidrug-resistant Salmonella, Shigella and Proteus from domestic birds Thai. J. Vet. Med. 45:23–34.

• Ammar AM, Mohamed AA, Abd El-Hamid MI, El-Azzouny MM (2016). Virulence genotypes of clinical Salmonella Serovars from broilers in Egypt. J. Infec. Dev. Ctries. 10:337–46.

• Antunes P, Mourão J, Campos J, Peixe L (2016). Salmonellosis: the role of poultry meat. Clin. Microbiol. Infect. 22:110–21.

• Balasubramanian R, Im J, Lee JS, Jeon HJ, Mageni OD, Kim JH, Rakotozandrindrainy R, Baker S, Marks F (2019). The global burden and epidemiology of invasive non-typhoidal Salmonella infections. Hum. Vacc. Immunother. 15: 1421-1426.

• Barbour E, Jurdi LH, Talhouk R, Qatanani M, Eid A, Sakr W, Bouljihad M, Spasojevic R (1999). Emergence of Salmonella enteritidis outbreaks in broiler chickens in the Lebanon: epidemiological markers and competitive exclusion control. Rev. Sci. Tech. 18:710–8.

• Bélard S, Kist M, Ramharter M (2007). Travel-related Salmonella Agama. Gabon Emerg. Infect. Dis. 13(5): 790–791. https://doi.org/10.3201/ eid1305.061275

• Bauer AW, Kirby WMM, Sherris JC, Truck M (1966). Antibiotic susceptibility testing by a standardized single disk method. Am. J. Clin. Pathol. 45(4): 493-496.

• CLSI (2017). Performance Standards for Antimicrobial Susceptibility Testing. 27th ed. Clinical and Laboratory Standards Institute, Wayne, Pennsylvania, USA.

• EFSA (European Food Safety Authority) (2013). EU summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2013. EFSA J. 2015; 13:4036.

• Elkenany R, Elsayed MM, Zakaria AI, El-sayed SA, Rizk MA (2019). Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and chicken carcasses in Egypt. BMC Vet. Res. 15:124. https://doi.org/10.1186/s12917-019-1867-z

• Eng SK, Pusparajah P, Mutalib NAb, Ser HL, Chan KG, Lee LH (2015). Salmonella: a review on pathogenesis, epidemiology and antibiotic resistance. Front. Life Sci. 8:284-29. https://doi.org/10.1080/21553769.2015.1051243

• Haghjoo E, Galan JE (2004). Salmonella typhi encodes a functional cytolethal distending toxin that is delivered into host cells by a bacterial-internalization pathway. Proc. Natl. Acad. Sci. U. S. A. 101:4614–4619.

• Heaton PA, Mazhar H, Nabahi A, Fernando AM, Paul SP (2015). Neonatal meningitis and septicaemia caused by Salmonella agama. Br J. Hosp. Med. (Lond). 76(8): 484-5. https://doi.org/10.12968/hmed.2015.76.8.484

• Kudaka J, Itokazu K, Taira K, Iwai A, Kondo M, Susa T, Iwanaga M (2006). Characterization of Salmonella isolated in Okinawa, Japan. Jpn J. Infect. Dis. 59 (1):15–9. PMID: 16495628.

• Khairy RMM (2015). Anti-microbial resistance of non-typhoid Salmonella in Egypt. Ferment. Techno. 4:2.

• Lister S (1998). Salmonella enteritidis infection in broilers and broiler breeders. Vet. Rec. 123:350.

• Majowicz SE, Musto J, Scallan E, Angulo FJ, Kirk M, O’Brien SJ, Jones TF, Fazil A, Hoekstra RN (2010). The global burden of nontyphoidal Salmonella gastroenteritis. Clin. Infect. Dis. 50:882–9.

• Mir IA, Kashyap SK, Maherchandani S (2015). Isolation, serotype diversity and antibiogram of Salmonella enterica isolated from different species of poultry in India. Asian Pac. J. Trop. Biomed. 5:561–7.

• Newell DG, Koopmans M, Verhoef L, Duizer E, Aidara-Kane A, Sprong H, Opsteegh M, Langelaar M, Threfall J, Scheutz F, van der Giessen J, Kruse H (2010). Food-borne diseases - the challenges of 20 years ago still persist while new ones continue to emerge. Int. J. Food Microbiol. 139:S3–15.

• Oliveira WF, Cardoso WM, Salles RPR, Romão JM, Teixeira RSC, Câmara SR, Siqueira AA, Marques LCL (2006). Initial identification and sensitivity to antimicrobial agents of Salmonella sp. isolated from poultry products in the state of Ceara, Brazil. Rev. Bras. Cienc. Avic. 8: 193-199.

• Paudyal N, Yue M (2019). Antimicrobial resistance in the “dark Matter”. Clin. Infect. Dis. 69: 379-380.

• Skyberg JA, Logue CM, Nolan LK (2006). Virulence genotyping of Salmonella spp. with multiplex PCR. Avian Dis. 50:77–81.

• Siriken B, Türk H, Yildirim T, Durupinar B, Erol I (2015). Prevalence and characterization of Salmonella isolated from chicken meat in Turkey. J. Food Sci. 80:M1044–50.

• Shah AH, Korejo NA (2012). Antimicrobial resistance profile of Salmonella serovars isolated from chicken meat. J. Vet. Anim. Sci. 2: 40-46

• Yu X, Zhu H, Bo Y, Li Y, Zhang Y, Liu Y, Zhang J, Jiang L, Chen G, Zhang X (2021). Prevalence and antimicrobial resistance of Salmonella enterica subspecies enterica serovars Enteritidis isolated from broiler chickens in Shandong Province, China, 2013-2015. Poult. Sci. 100: 1016-1023.

• Yue M (2016). Bacterial persistent infection at the interface between host and microbiota. Clin. Infect. Dis. 62: 1325-1326. https://doi.org/10.1093/cid/ciw136

• Zhang J, Fan X, Ge Y, Yan J, Sun A (2013). Distribution of Salmonella paratyphi A pagC gene and immunoprotective effect of its recombinant expressed products. Zhejiang Da Xue Xue Bao Yi Xue Ban. 42:171-176.