Submit or Track your Manuscript LOG-IN

Isolation and Characterization of 25 Polymorphic Microsatellite Markers of Sepiella japonica

PJZ_52_1_377-380

 

 

Isolation and Characterization of 25 Polymorphic Microsatellite Markers of Sepiella japonica

Jiaxin Guo1, Xiumei Zhang1,2, Xiaoyan Wang2, Liqin Liu2 and Tianxiang Gao1,*

1Fishery College, Zhejiang Ocean University, Zhoushan 316022, China

2National Engineering Research Center for Marine Aquaculture, Zhoushan 316022, China

ABSTRACT

Sepiella japonica was once one of the major fisheries in Zhejiang province of China. The availability of highly polymorphic markers was important to conduct the conservation of S. japonica. In this study, next-generation sequencing and de novo assembly were used for potential useful microsatellite markers obtaining of S. japonica. A total of 120 microsatellite markers were designed and tested, 25 primer pairs showed polymorphism among S. japonica individuals. Number of alleles, observed and expected heterozygosity per locus ranged from 2 to 8, 0.083 to 0.922 and 0.042 to 0.866, respectively. The PIC ranged from 0.04 to 0.829. These markers will be useful in evaluation germplasm and genetic composition in the further research.


Article Information

Received 09 July 2018

Revised 02 September 2018

Accepted 19 September 2018

Available online 07 October 2019

Authors’ Contributions

XZ and TG designed the research. XW performed experiments. LL and XW analyzed the data. JG wrote the paper.

Key words

Sepiella japonica, Common Chinese cuttlefish, Microsatellite loci, High-throughput transcriptoeme sequencing.

DOI: https://dx.doi.org/10.17582/journal.pjz/2020.52.1.sc3

* Corresponding author: 18368081585@163.com

0030-9923/2020/0001-0377 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan



Sepiella japonica was once one of major fisheries in Zhejiang province China (Li et al., 2011). The peak annual catch production reached sixty seven thousand tones in Zhejiang province (Li et al., 2011). But the natural population of S. japonica was decreasing dramatically because of over-fishing since the 1980s (Li et al., 2011). S. japonica artificial breeding were broken through in 2003 (Chang and Wu, 2009). With the implement of artificial breeding and stock enhancement, S. japonica resources was recovering (Wu et al., 2006). Reproduction cycle of S. japonica was half a year in artificial cultured condition, which is different from that in the nature condition (Song and Wang, 2009). The faster reproduction rate in cultured population may affect the structure of cultured S. japonica population. Then finally affect wild S. japonica populations though artificial populations releasing. Thus, it is urgent to understand germplasm situation and genetic composition of the S. japonica population accurately. More loci need to be developed for evaluation germplasm and genetic composition of the S. japonica.

Microsatellite markers were one of the most powerful tools for population structure and genetic diversity analysis due to their genetic co-dominance, multi-allelic variation, relative abundance, and high reproducibility (Rajwant et al., 2011). In recent years, there have been a few related reports on the development of microsatellite markers of the S. japonica (Wu et al., 2010; Guo et al., 2013). Former researches used clones and enrichment methods mostly. The traditional methods were time-consuming, laborious, and require a good knowledge of genomic information. Thus, more efficient and accurate methods were needed for microsatellite markers development.

In recent years, high-throughput sequencing developed rapidly (Csencsics et al., 2010) and be used in some aquatic species (Shan et al., 2018). It is widely used in the development of microsatellites for animals and plants (Yu et al., 2011; Zhu et al., 2012). The objective of our study was to develop polymorphic microsatellite markers of S. japonica from transcriptome. It will be benefit for the genetic research of the S. japonica in future researches.

 

Materials and methods

Samples of S. japonica were collected from the aquaculture farm of Zhoushan (China) and one of them (female) was send to BioMarker Biotech Inc. for High-throughput transcriptome. Tissue samples of eyestalk, peduncle, tentacle, gill, muscle and ovary were rapidly sampled, snap-frozen in liquid nitrogen and stored at -80°C prior to RNA extraction. And tissues samples were pooled in equal amounts for total RNA extraction, transcriptome Illumina sequencing and de novo assembly. Putative SSR markers were screened using the SSRHUNTER 1.3 software (http://www.biosoft.net/dna/SSRHunter.htm). The criteria used in SSRHUNTER to identify microsatellites were as follows: 6 repeats for di-nucleotide, 5 repeats for tri-nucleotide and tetranucleotide. Primers were designed using the PRIMER 5.0 program (http://www.premierbiosoft.com/).

Polymorphism evaluation was tested using 30 S. japonica individuals. Genomic DNA was isolated from muscle tissue by proteinase K digestion followed by a standard phenol-chloroform method. Amplification was carried out in a volume of 25µL, which contained approximately 100ng of DNA as template, 2.5µL dNTP (2.5 mM each), 2.5 µL 10×buffer,2µL MgCl2 (20 mM), 1µL primers (10 mM each), and 0.25µL of Taq DNA polymerase (5U/μL). Polymerase chain reaction were run under the following thermal cycle condition: at 94°C for 5 min, followed by 35 cycles of denaturing at 94°C for 1 min, 45s at the optimal annealing temperature of primers (Table I), and extending 72°C for 1.5 min, and an extra extension 72°C for 10 min. The products of PCR were electrophoresed on 8% denaturing polyacrylamide gels for 4-5 h at 12 W. The sizes of the alleles were estimated according to the 8 bp DNA ladder. Finally, the target bands were visualized by silver staining.

The expected and observed heterozygosity (HE and HO, respectively), allele number (NA), polymorphism information content (PIC) were analyzed using the CERVUS 3.0 (Kalinowski et al., 2007). Hardy-Weinberg equilibrium (HWE) and Tested for linkage disequilibrium (LD) were calculated by GENEPOP 4.0 (Rousset, 2008). All results for multiple tests were corrected using Bonferroni’s correction (Rice, 1989).

 

Table I.- Characterization of 25 polymorphic microsatellite loci in Sepiella japonica.

Locus

Repeat motif

Primer sequence (5'-3')

TA (°C)

NA

Expe cted size (bp)

HO

HE

PIC

Accession No.

SSR40

(AGC)5

F: CCAGACACAGTAGGTTGCTT

54

6

198- 210

0.25

0.643

0.593

MH492333

R: AAGAAGAATTAGGCAGGCACTT

SSR39

(TC)7

F: GGTCATCTCTGGTAAGATTCAC

49

7

180- 200

0.417

0.866

0.829

MH492334

R: TCTGGTTCTCCGCCTGTT

SSR49

(AT)6

F: ACTGCTACGGCGACACTT

52

6

178-186

0.125

0.56

0.519

MH492335

R: GTTCATCTTCTTGTAACGTGGA

SSR52

(AT)6

F: TACTGCCTCCTGGTTACTATGT

58

6

220 -232

0.125

0.657

0.604

MH492336

R: CTGAATTGAAACTGCACCTGAA

SSR54

(TG)6

F: ACTGAAACTTGAAAGGAAGGGA

55

6

196- 220

0.833

0.781

0.736

MH492337

R: CTGTCTGAAAGTCGTCACTTGT

SSR53

(AT)6

F: TTCCCTGATGTAAACACCAAGT

56

200- 212

0.292

0.827

0.788

MH492338

R: CCGGTCAGTACACCTTCAAT

SSR56

(TG)6

F: CCTTCCTTAACTGCTCTTCGTA

53

8

120- 148

0.792

0.558

0.479

MH492339

R: CACACTCTCATTCACTTACACA

SSR57

(AT)6

F: AACGAGGGACGCTGGAAAT

55

3

156- 164

0.083

0.298

0.272

MH492340

R: GCAGTGCAAACAGACTCAGT

SSR58

(AG)6

F: AACCATAATGGTAGGCAGAGA

54

6

140- 152

0.429

0.789

0.74

MH492341

R: CTCTTTCACTCACTCTCACTCT

SSR62

(TAA)5

F: AAACGCTAACAAAGACGAATGG

55

2

120 -125

0.217

0.264

0.225

MH492342

R: GCTTCCAACACAAACCTCTATC

SSR70

(CA)6

F: TCTTCCCTTCGGAACAGACATA

61

2

130- 142

0.083

0.082

0.077

MH492343

R: CCACCTGACTCGCAATAGC

SSR73

(TGC)5

F: GCTTGCGAGGAAGATGAAGG

58

2

120- 130

0.042

0.042

0.04

MH492344

R: AGCACCATTGACAATACTACCA

SSR80

(AT)6

F: CCCAATAATATGTTTCTCGTCG

48

3

210- 222

0.25

0.228

0.206

MH492345

R: GCCATCCACTGGTGTTAGAT

SSR86

(CA)6

F: TCCGCAAACACATTTAGAGAAC

50

2

220 -232

0.125

0.12

0.11

MH492346

R: CCGTGATGACCTGGCAGAA

Locus

Repeat motif

Primer sequence (5'-3')

TA (°C)

NA

Expe cted size (bp)

HO

HE

PIC

Accession No.

SSR89

(AG)6

F: TGAGCAGCACTAAACAGAATCT

55

5

152- 164

0.922

0.624

0.533

MH492347

R: AGAGACAGCACTAACTGGAATG

SSR91

(CAC)5

F: CTGTATCTCTTCTGCCTCTTCA

58

6

100 -120

0.375

0.629

0.572

MH492348

R: CGTTGTTGTTGTTGTTGCTATC

SSR95

(GT)6

F: AGCATTACAACAATGACAAGGC

55

5

155- 180

0.864

0.807

0.754

MH492349

R: AGAATGTTCCCAGGCAATGAAA

SSR98

(TA)6

F: CACTAATACTGCAACACACA

56

6

215- 227

0.579

0.747

0.694

MH492350

R: ATCAGGCAGTGGTCTCTT

SSR100

(AT)6

F: CAATACGAACATCGCCAGAAC

55

4

170- 185

0.892

0.611

0.519

MH492351

R: TGTTGGTAGTGTTGGAATGGAA

SSR103

(GT)6

F: ATGTGACCTCTACTGCTGACC

54

4

200-220

0.565

0.699

0.623

MH492352

R: CCTCACAAGCATTAAGCTACCA

SSR104

(GA)6

F: CTTCAGAGCCAAAGAAAGTCAT

55

4

108-120

0.333

0.698

0.624

MH492353

R: CCCTCACAACATCTTCCAGTTA

SSR3

(ATA)7

F: CAAGCTGATGAATTAGCGATGA

52

4

200-221

0.231

0.702

0.622

MH492329

R: TCCTTCTGGCATATTCCCTG

SSR6

(AG)9

F: ATCAGGATGCGACATTAGGC

55

8

180-210

0.625

0.855

0.806

MH492330

R: GCTTGACAACACTTGGCTCA

SSR16

(GCAC)5

F: TGACCAAATGACAGGGAACA

54

7

140-170

0.846

0.794

0.732

MH492331

R: ACTTCTCCTCATGGTGGTGG

SSR17

(TCG)7

F: AACCTGTTCGCACTTTGTCA

56

8

220-240

0.211

0.801

0.752

MH492332

R: CAGTGAAGAGGCACGTTCAA

TA, annealing temperature; NA, observed number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; PIC, polymorphic information content. *Significant deviation from HWE (P < 0.05).

 

Results and discussion

A total of 13,471 simple sequence repeats were identified from 58,224 unigenes, which included 1693 di-nucleotide, 1761 tri-nucleotide, and 139 quad-nucleotide simple sequence repeats. 120 primers were designed base on repetition times and flaking sequence priority. 98 of the 120 primers were successfully amplified, but only 25 loci showed polymorphic (Table I). Number of alleles, observed and expected heterozygosity per locus ranged from 2 to 8, 0.083 to 0.922 and 0.042 to 0.866, respectively. The PIC ranged from 0.04 to 0.829. Three loci significantly deviated from Hardy-Weinberg equilibrium after Bonferroni correction (P <0.05), but no significant linkage disequilibrium was found between all these loci.

The results of this study indicated that high throughput sequencing technology based on transcriptome was an effective method for developing microsatellite markers of S. japonica. These microsatellite markers will be helpful for further S. japonica germplasm and genetic composition evaluation.

 

Acknowledgements

We are grateful to Ping Hong-Ling and Zhang Tao for sample collection. This study is supported by National Natural Science Foundation of China (41676153; 41406138), the Science and Technology Project of Zhejiang province (2015F50055) and the Scientific Research Start-up Funds of Zhejiang Ocean University.

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Chang K.M. and Wu, C.W., 2009. J. Zhejiang Ocean Univ. (Nat. Sci.), 28: 257-263.

Csencsics, D., Brodbeck, S. and Holderegger, R., 2010. J. Hered., 101: 789-793. https://doi.org/10.1093/jhered/esq069

Guo, B.Y., Qi, P.Z., Zhu, A.Y., Lv, Z.M., Wang, W.C. and Wu, C.W., 2013. Genet. mol. Res., 12: 2376-2379. https://doi.org/10.4238/2013.December.19.5

Kalinowski, S.T., Taper, M.L. and Marshall, T.C., 2007. Mol. Ecol., 16: 1099-1106. https://doi.org/10.1111/j.1365-294X.2007.03089.x

Li, J.J., Guo, B.Y. and Wu, C.W., 2011. J. Zhejiang Ocean Univ. (Nat. Sci.), 30: 381-386.

Rajwant, K.K., Manoj, K.R., Sanjay, K., Rohtas, S. and Dhawan, A.K., 2011. Euphytica, 177: 309-334. https://doi.org/10.1007/s10681-010-0286-9

Rice, W.R., 1989. Evolution, 43: 223-225. https://doi.org/10.1111/j.1558-5646.1989.tb04220.x

Rousset, F., 2008. Mol. Ecol. Resour., 8: 103-106. https://doi.org/10.1111/j.1471-8286.2007.01931.x

Shan, B., Liu, Y., Yang, C., Liu, S. and Sun, D., 2018. Pakistan J. Zool., 50: 2273-2278

Song, W.W. and Wang, C.L., 2009. Oceanol. Limnol. Sin., 40: 590-595.

Wu, C.W., Chi, C.F., He, G.Y., Lü, Z. and Xu, M., 2010. Acta Oceanol. Sin., 29: 121-124. https://doi.org/10.1007/s13131-010-0083-2

Wu, C.W., Zhao, S.J. and Xu, D.N., 2006. Acta Oceanol. Sin., 37: 231-237.

Yu, J.N., Won, C., Jun, J., Lim, Y.W. and Kwak, M., 2011. PLoS One, 6: e26933. https://doi.org/10.1371/journal.pone.0026933

Zhu, H., Senalik, D., McCown, B.H., Zeldin, E.L., Speers, J., Hyman, J., Bassil, N., Hummer, K., Simon, P.W. and Zalapa, J.E., 2012. Theoret. appl. Genet., 124: 87-96. https://doi.org/10.1007/s00122-012-1787-9

To share on other social networks, click on P-share. What are these?

Pakistan Journal of Zoology

December

Vol. 51, Iss. 6, Pages 1999-2399

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe