Submit or Track your Manuscript LOG-IN

Isolation and Characterization of Microsatellite Loci from an Ice Fish, Neosalanx tangkahkeii (Osmeriformes, Salangidae)

PJZ_51_5_1853-1857

 

 

Isolation and Characterization of Microsatellite Loci from an Ice Fish, Neosalanx tangkahkeii (Osmeriformes, Salangidae)

Jie Zhang1,2,*, Baradi Waryani3,4 and Qihai Zhou2,*

1Key Laboratory of Animal Ecology and Conservation Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, 100101, P.R. China.

2Guangxi Key Laboratory of Rare and Endangered Animal Ecology, College of Life Sciences, Guangxi Normal University, Guilin 541004, P.R. China.

3Department of Fresh Water Biology and Fisheries, University of Sindh, Jamshoro

4Key Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, Beijing, 100101, P.R. China.

ABSTRACT

The icefish Neosalanx tangkahkeii is an endemic species in East Asia. It has a wide range of distribution in Chinese waters including coastal waters, inland lakes, and outflowing rivers south of the Yangtze River and its delta. In order to maintain stable high production of salangids, fertilized eggs from native or introduced populations of icefish were frequently introduced to various types of water throughout China mainland except for Tibet Plantae. The genetic diversity and molecular invasive mechanism are urgently needed for both native and invasive populations. Present investigation details 12 polymorphic microsatellite loci and 12 to 26 alleles per locus denoted. Whereas, d expected and observed heterozygosity values ranged from 0.902 to 0.972 and 0.750 to 0.958, respectively. Moreover, the polymorphic information content (PIC) values ranged from 0.869 to 0.949. The cross-species amplification and applicability were also evaluated on Protosalanx chinensis, Neosalanx anderssoni, Neosalanx argentea and Neosalanx oligodontis, and 6-7 loci were amplified in these species. The outcome of the present investigation would be useful in understanding genetic diversity, gene flow and the population structure of this species in the future.


Article Information

Received 06 March 2018

Revised 09 April 2018

Accepted 11 April 2018

Available online 12 July 2019

Authors’ Contribution

JZ conceived the project, performed the experiments and draft main text. BW took part in sampling and PCR, and co-drafted the manuscript. QHZ participated in study design and coordination.

Key words

Microsatellite loci, Neosalanx tangkahkeii, Polymorphic, Salangidae, Genetic diversity.

DOI: http://dx.doi.org/10.17582/journal.pjz/2019.51.5.1853.1857

* Corresponding authors: zhangjie@ioz.ac.cn; zhouqh@ioz.ac.cn

0030-9923/2019/0005-1853 $ 9.00/0

Copyright 2019 Zoological Society of Pakistan



Introduction

The icefish Neosalanx tangkahkeii belongs to the family Salangidae and order Osmeriformes. This species is endemic to the East Asia and has a wide range of distribution in Chinese waters including coastal waters, inland lakes, and outflowing rivers in the south of the Yangtze River and its delta (Xie and Xie, 1997; Zhang et al., 2007a; Zhao et al., 2008; Kim and Park, 2002; Nakabo, 2002; Nelson, 2006).

From nineteen fifties to nineteen seventies N. tangkahkeii remained a potential target species in the area. However, its catch appeared to be in drastic situation by mean of the common threats of habitat degradation from agricultural irrigation, reclamation, rapid industrialization as well as overfishing. On the other hand, the nationwide introduction of N. tangkahkeii was initiated in 1979 in Yunnan Province, which has highest biodiversity and endemism of freshwater fish fauna in China (Chen et al.,1998). Thirteen thousand fertilized eggs from nine pairs of parent fish of N. tangkahkeii were laid in Dianchi Lake in April 1979. The introduced individuals changed their reproductive strategy and establish the population successfully (Gao et al., 1984). By 1994, N. tangkahkeii has been introduced to 15 provinces, with a total inland water area of 270, 000 ha in the nation, including more than 90% of plateau lakes and reservoirs in Yunnan Province (Gu, 1998). The salangids further invaded 1,000,000 ha water area in all provinces and Regional National Autonomies in mainland China by the end of 2000, with the exception of Tibet (Li et al., 2002). The introduction of icefish brought in economic benefits but severely threatened biodiversity, especially in plateau lakes in Yunnan Province (Kang et al., 2015). The population genetics study must be conducted on both natural and introduced populations by using more sensitive gene makers since there was no clear introduction history recorded and the population genetic information before or after introduction. Recently, microsatellite markers appeared to be very popular in the studying population structure and provide valuable information for theoretical population to the biologists and conservationists (Newman and Squire, 2001; Liu et al., 2017). Besides, it is a powerful tool helping in assessing resource status. Here we describe isolation and characterization of 12 microsatellite loci extracted from N. tangkahkeii collected from Chinese waters.

 

Materials and methods

Collection of sample and DNA isolation

A total of 30 specimens were collected from the Dianchi Lake, Yunnan Province. The samples were preserved in 95% ethanol and brought to the laboratory for further DNA extraction. Genomic DNA was isolated from muscle tissue using standard proteinase-K/phenol-chloroform extraction (Sambrook et al., 1989). UV spectrophotometer was used to estimate the concentration and purity of DNA.

Isolation of microsatellite loci and polymorphism analysis

The FIASCO (Fast Isolation by AFLP of Sequences Containing) method was employed for the isolation of microsatellite loci (Zane et al., 2002). The purified total DNA was digested with MseI to obtain suitable-sized fragments (MseI F: 5’-TACTCAGGACTCAT-3’ and MseI R: 5’-GACGATGAGTCCTGAG-3’), then ligated to double-stranded AFLP linkers. Ligation products were hybridized to 5’-biotinylated oligonucleotides (AG)8 and (AC)8 probes to enrich the target fragments by the streptavidin magnetic beads. The enriched DNA fragments were amplified with the primer MseI-N and cloned into the pEASY-T1 vector (TransGen Biotech) before transforming into Trans5α Chemically Competent Cells (TransGen Biotech). The transformants were grown at 37°C on Luria-Bertani (LB) agar plate containing ampicillin 11-13h for enrichment. In total, 303 positive clones were picked out screened with a standard blue-white selection. Then they were verified by Polymerase chain reaction (PCR) technique using two vector primers (M13F and M13R) and (AG)8/(AC)8 oligonucleotide and visualized by 2% agarose gel electrophoresis.

 

Table I.- Characterization of twelve Neosalanx tangkahkeii microsatellite loci: locus designation, primer sequences, repeat motif, annealing temperature (Ta), size of clone allele, number of alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He), polymorph information content (PIC) and GenBank accession number.

Locus

Primer sequence (5′-3′)

Repeat motif

Ta (°C)

Size rang (bp)

Na

Ho

He

PIC

GenBank accession No.

NT-I-13

F:TGGGTAACAGAACAAGCAGGGTAT R:CAGTAAAGATCCAGGGAGTTCAGG

(AC)19

58

177-215

24

0.8

0.9

0.94

MG9 87068

NT-I-17

F:CCCCTTTAGTGAGCCTGTGTTTGT R:TGAAGGGTGTGATAAGAGGGTGTT

(CT) 14

55

44-86

23

0.9

0.9

0.94

MG9 87069

(AC) 25

268-318

NT-I-19

F:GTGTGAGTGTGGGTAGGATGATGT R:GCTAGATGCACGGCTGATAAAAT

(AC)32

55

189-252

21

0.9

0.9

0.93

MG9 87070

NT-I-31

F:GAATCCCACCAGTCACTTATCAAT R:AGGCGTCTCCGAATCTGCT

(AC)55

61

138-247

26

0.9

0.9

0.94

MG9 87071

NT-I-83

F:AAGTATCGACCTGTTTCTGCTATC R:AGAACAACACAATGAGTCCGTAAC

(AC)24

55

187-235

23

0.9

0.9

0.93

MG9 87072

NT-I-91

F:CCGACTGCGCCACACGA R:AACCAGGATCCGAGCCACTTC

(GT)15

55

248-278

18

0.7

0.9

0.90

MG9 87073

NT-II-05

F:ACGGGCCAGTCACAGTC R:ATCTCCCCCATTTCTTCTCT

(AG)22

55

133-176

20

0.8

0.9

0.92

MG98 7074

NT-II-09

F:TGGAGAAGAACATCGACTGAACA R:TATACTATCCTCTCCGCTTTGGTG

(AG)22

55

164-208

12

0.81

0.9

0.86

MG98 7075

NT-II-59

F:AGAAGGCTGTATTTGTGCTGTC R:ATGATTAGGTGAGAGGAAGATGC

(CT)25

60

336-385

21

0.8

0.9

0.93

MG9 87076

NT-II-61

F:TAGTTTAGGAGTCTTTTGGTGATA R:AGGCCTTGCTGTTTGAT

(AC)48

55

121-217

22

0.9

0.9

0.94

MG9 87077

NT-II-83

F:GAACCCACTCTATCATCTGC R:ATTACACTTCCTTTCTTATCTTTG

(AG)84

55

427-594

20

0.9

0.9

0.92

MG98 7078

NT-II-99

F:GAACGCACCAGGCAAACTAAACA R:CCCCTCCCTGCTCTAATCGTG

(AG)23

55

288-334

26

0.9

0.9

0.94

MG9 87079

(AC)56

477-587

 

Table II.- Cross-species amplification of 12 microsatellite loci in Protosalanx chinensis, Neosalanx anderssoni, Neosalanx argentea and Neosalanx oligodontis.

NT-I-13

NT-I-17

NT-I-19

NT-I-31

NT-I-83

NT-I-91

NT-II-05

NT-II-09

NT-II-59

NT-II-61

NT-II-83

NT-II-99

P. chinensis

+

+

+

+

-

-

+

-

-

+

-

+

N. anderssoni

+

+

+

-

-

+

-

-

+

+

-

-

N. argentea

+

+

+

+

-

+

-

-

+

+

-

-

N. oligodontis

+

+

+

+

-

+

-

-

+

+

-

-

+ indicates successful amplification; - indicates failed amplification.

 

Out of 303, only 27 clones were suitable for primer design and amplification of polymorphic loci, and these primers were designed using the software primer Primer 5 (Lalitha, 2000). A total of 24 individuals were used for genotyping, and all PCR reactions were conducted in an Applied Biosystems (ABI) 2720 Thermal Cycler, which being performed with 30 cycles of a 15µl reaction volumes containing 100-200 ng genomic DNA, 7.5 µl 2×EasyTaq PCR Supermix (TransGen Biotech), and 1.5 pmol each of primer pairs (upstream primer fluorescently labeled with FAM, HEX or TAMRA). 30 cycles of amplification were used: denaturation at 95°C for the 30s, with annealing temperature in Table I for 30 s and extension at 72°C for 30s. PCR products were determined on an ABI PRISM 3730 genetic analyzer (Applied Biosystems) on the basis of GS500 and estimated using GENEMARKER (Version 1.85, Applied Biosystems).

Data analysis

GENEPOP version 3.4 Software (Raymond and Rousset 1995) was used to test Hardy-Weinberg equilibrium (HWE), the number of alleles at each locus (NA), vlinkage disequilibrium (LD), polymorphic information content values, observed (Ho) and expected heterozygosity (He). Polymorphism information content (PIC) was estimated using PIC-CALC version 0.6.

 

Results and discussion

Out of 303 positive clones, 27 clones were utilized for primer design and amplification of polymorphic loci. The number of alleles per locus ranged from 12 to 26, the expected heterozygosity (HE) and observed heterozygosity (HO) values ranged from 0.902 to 0.972 and 0.750 to 0.958. Moreover, the polymorphic information content (PIC) values ranged 0.869 to 0.949 with most of the above 0.900. Although 19 polymorphic microsatellite loci from Neosalanx have been reported (Liu et al., 2015), the PIC varied from 0.258 to 0.893 with most of those lower than 0.600. Three loci were detected significant deviations from HWE after Bonferroni correction (Table I). Some reasons can cause this situation such as insufficient sample size, but no evidence is sufficient to linkage disequilibrium among pairs of loci in the samples. Eventually, 12 microsatellite loci were isolated and characterized successfully from N. tangkahkeii by following the PCR conditions described above. Polymorphic information of those 12 microsatellite loci was shown in Table I.

Four primitive lineages within close related Neosalanx and Protosalanx species were identified in the previously studied (Zhang et al., 2007b). In addition cross-species amplification and applicability were also evaluated on Protosalanx chinensis, Neosalanx anderssoni, Neosalanx argentea and Neosalanx oligodontis for these 12 polymorphic microsatellite loci, Study showed 11 polymorphic microsatellite loci in the Relict gull by cross-species amplification (Lin et al., 2018). The PCR reactions were also performed according to the previous conditions.

In conclusion, seven of these micro satellite loci were suitable for Protosalanx chinensis, Neosalanx argentea and N. oligodontis, and six loci for N. anderssoni, respectively (Table II). N. tangkahkeii and P. chinensis have been introduced into many lakes and reservoirs because of their high commercial value. But it has reported that the populations in some waters are unstable (Hu and Chen et al., 1998; Huang and Chang 2001; Kang et al., 2015). Previous studies on the molecular mechanism of invasion indicated that some fish populations have undergone genetic bottlenecks and low genetic diversity (Salmenkova, 2008), while others experienced rapid population expansion with potential genetic diversification after its introduction (Chen et al., 2012). In order to maintain stable high production, fertilized eggs either from native or introduced populations of icefish was frequently introduced to the various types of waters throughout China mainland except for Tibet Plantae. Thus, the genetic diversity is urgently needed to be detected whether the founder effect or the rapid population expansion occurs within and among native and introduced salangids populations.

 

Conclusion

It is concluded that microsatellite loci developed here will be a useful tool to evaluate the genetic diversity, gene flow and the population structure of this species in the future.

 

Acknowledgement

This study was funded by a grant from the Ministry of Science and Technology of China (Grant No. 2014FY210100) and Guangxi Key Laboratory of Rare and Endangered Animal Ecology, in Guangxi Normal University (16-A-02-03). The authors thank Dr. Baowei Zhang, Ms. Mei Ding, and Dr. Tao Pan for their kind help in lab work and technical analysis. Special thanks to Mr. Xinming Feng who made great effort to collect samples during fieldworks.

 

Statement of conflict of interest

Authors have declared no conflict of interest.

 

References

Chen, Y.R., Yang, J.X. and Li, Z.Y., 1998. The diversity and present status of fishes in Yunnan Province. Chin. Biodiv., 6: 272–277.

Chen, Q., Wang, L.C., Zhao, G.J., Chapman, D.C. and Zsigmond, J., 2012. Microsatellite genetic diversity and differentiation of native and introduced grass carp populations in three continents. Genetica, 140: 4-6. https://doi.org/10.1007/s10709-012-9663-8

Gao, L.C., Zhuang, D.D., Zhang, K.X. and Qian, Z.W., 1984. The reproductive effect of introduced salangids Neosalanx in Dianchi Lake. Fish. Sci. Technol. Inform., 6: 27-29.

Gu, L.W., 1998. The national status of the salangids introduction from Taihu Lake. Mod. Fish. Inform., 13: 23-25.

Hu, C.L., Chen, W.X. and Liu, J.S., 1998. Status of transplantation and enhancement of ice fishes in China and their development strategies (in Chinese). Reserv. Fish., 2: 3-7.

Huang, Z.L. and Chang J.B., 2001. Can icefish (Salangidae) production be predicted? (In Chinese with English abstract). Acta Ecol. Sin., 21: 86-93.

Kang, B., Deng, J., Wang, Z. and Zhang, J., 2015. Transplantation of icefish (Salangidae) in China: Glory or disaster. Rev. Aquacul., 7: 13–27. https://doi.org/10.1111/raq.12047

Kim, I.S. and Park, J, Y., 2002. Freshwater fishes of Korea. Kyohak, Seoul.

Lalitha, S., 2000. Primer Premier 5. Biotech Software and Internet Report. pp. 270–272.

Li, S.F., 2001. A study on biodiversity and its conservation of major fishes in the Yangtze River. Shanghai Scientific and Technical Publishers, Shanghai.

Lin, W., Gong, K., Chen, H. and Xianguo, L., 2018. Microsatellite loci identified by cross-species amplifications in the globally vulnerable Relict gull, Larus relictus. Pakistan J. Zool., 50: 791-793. http://dx.doi.org/10.17582/journal.pjz/2018.50.2.sc8

Liu, Z.W., Herzig, A. and Schiemer, F., 2000. Growth of the icefish Neosalanx pseudotaihuensis (Salangidae) in Xujiahe Reservoir, central China. Environ. Biol. Fish., 59: 219-227.

Liu, Y., Li, C. and Xiong, F., 2015 Isolation and characterization of 19 polymorphic microsatellite loci from Neosalanx taihuensis, a rapidly invasive and adaptive species. Biochem. Syst. Ecol., 61: 121-123. https://doi.org/10.1016/j.bse.2015.06.010

Liu, H.X., Ye, Y.W., Li, Y., Liu, X.L., Xiong, D.M. and Wang, L.X., 2017. Genetic characterization of the endangered Brachymystax lenok tsinlingensis (Salmonidae) populations from Tsinling Mountains in China using microsatellite markers. Pakistan J. Zool., 50: 743-749.

Nakabo, T., 2002. Fishes of Japan with pictorial keys to the species. Tokai University Press, Tokyo.

Nelson, J.S., 2006. Fishes of the world, 4th edition. John Wiley and Sons, Inc., Hoboken, New Jersey, pp. 624.

Newman, R.A. and Squire, T., 2001. Microsatellite variation and fine-scale population structure in the wood frog (Rana sylvatica). Mol. Ecol., 10: 1087-1100. https://doi.org/10.1046/j.1365-294X.2001.01255.x

Raymond, M. and Rousset, F., 1995. Genepop (version 3.4): Population genetics software for exact test and ecumenicism. J. Hered., 86: 248-249. https://doi.org/10.1093/oxfordjournals.jhered.a111573

Salmenkova, E.A., 2008. Population genetic processes in introduction of fish. Russian J. Genet., 44: 758-766. https://doi.org/10.1134/S1022795408070028

Sambrook, J. Fritsch, E.F. and Martiatis, T., 1989. Molecular cloning: A laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, New York.

Wang, Z.S. Lu, C., Hum, H.J. Xu, C.R. and Leu, G.C., 2005 Freshwater ice fishes (Salangidae) in the Yangtze River basin of China: Spatial distribution patterns and environmental determinants. Environ. Biol. Fish., 73: 253-262. https://doi.org/10.1007/s10641-005-2146-3

Waters, J.M., Saruwatari, T., Kobayashi, T., Oohara, I., Mc Dowall, R.M. and Wallis, G. P., 2002. Phylogenetic placement of retropinnid fishes: Data set incongruence can be reduced by using asymmetric character state transformation costs. System. Biol., 51: 432-449. https://doi.org/10.1080/10635150290069887

Xie, Y.H. and Xie, H., 1997. Classification, distribution and population ecology of Salangidae fishes. Chin. J. Fish., 10: 11-19.

Yang, J.X., 1996. The invasive and native fish species n Yunnan Province. In: Protecting Chinese biodiversity (eds. S. Wang, B. Xie and Y. Xie). China Environmental Science Press, Beijing, pp. 129-138.

Zane, L., Bargelloni, L. and Patarnello, T., 2002. Strategies for microsatellite isolation: A review. Mol. Ecol., 11: 1-16. https://doi.org/10.1046/j.0962-1083.2001.01418.x

Zhao, L.J., Zhang, J., Liu, Z., Funk, S.M., Wei, F., Xu, M. and Li, M., 2008. Complex population genetic and demographic history of the salangid, Neosalanx taihuensis, based on cytochrome b sequences. BMC Evolut. Biol., 8: 201. https://doi.org/10.1186/1471-2148-8-201

Zhang, J., Li, M., Xu, M.Q., Takita T. and Wei, F.W., 2007a. Molecular phylogeny of icefish Salangidae based on complete mtDNA cytochrome b sequences, with comments on estuarine fish evolution. Biol. J. Linn. Soc., 91: 325-340. https://doi.org/10.1111/j.1095-8312.2007.00785.x

Zhang, J., Wei, F.W. Li, M. and Xu, M.Q., 2007b. Threatened fishes of the world: Hemisalanx prognathus (Regan 1908) (Salangidae). Environ. Biol. Fish., 78: 209-210. https://doi.org/10.1007/s10641-006-0011-7

To share on other social networks, click on P-share. What are these?

Pakistan Journal of Zoology

December

Vol. 51, Iss. 6, Pages 1999-2399

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe