Influence of Hygienic Measures on Enterobacteriaceae Prevalence and Antimicrobial Resistance in Poultry Farms

Poultry is an important source of protein due to its cheaper prices and high nutritional value. Therefore, poultry farming has become one of the most important industries worldwide and has significantly developed and increased in recent years (Hussain et al., 2015).  Poultry hygiene is a critical point, especially in intensive farms with closed housing that facilitates the spreading of bacterial contamination such as Enterobacteriaceae (Nechyporenko et al., 2018). Enterobacteriaceae are widely distributed in nature and can be found in soil, feed, and water. They normally inhabit the gastrointestinal tract of birds, humans, and animals and might cause serious infections in poultry under certain circumstances.

Salmonella, Escherichia coli (E. coli), and Shigella are the major cause of food-borne infection all around the world. Poultry and its products are considered the main vehicle for these pathogens causing serious economic losses and huge public health hazards, in addition to huge numbers of annual mortalities (Kamboh et al., 2018). Salmonella causes serious clinical symptoms and high mortality at young ages less than 6 weeks, older chicks may show stunting and uneven growth (Kim et al., 2007). E. coli causes economic loss in broilers due to high mortality and weight loss and a decrease in egg production and profitability in layer and breeder farms (Vandekerchove et al., 2004). Shigella can infect chickens (shigellosis) causing gastroenteritis, the development of serious complications, and death and it is known for its zoonotic capabilities (Pashazadeh et al., 2017). Antimicrobials are widely used in poultry farms as one of the methods to control the bacterial diseases that result from improper hygiene; they aren’t only used to treat and prevent infectious diseases but also as prophylaxis, and growth promotors. On the other side, bacteria had built up great resistance to antibacterial substances. This complex situation increases the development of multi-drug resistant bacteria (MAR) in poultry (Saliu et al., 2017).

The present study aimed to investigate the prevalence of some Enterobacteriaceae species such as Salmonella, E. coli, and Shigella in different poultry farms and monitor the antimicrobial resistance of the isolated Enterobacteriaceae species with the detection of some resistance genes such as tetA and blaSHV.

A total number of 2160 samples and swabs were collected from twelve poultry farms, 180 samples, and swabs from each farm in three visits per farm, and five samples were collected per visit from each type of samples and swabs. The samples included litter, pen litter, stored feed, feed from the feeders, water, drinkers, droppings, dust, swabs from walls, birds’ cloaca, worker’s hands, and wheels of vehicles, 180 samples per each. The collection of samples was approved with Institutional Approval Number (BUFVTM 04-07-22).

The present study was carried out on twelve poultry farms. The selection of the farms was based on their geographical location, hygienic level, housing system, and type of production. All farms are located in Qalyubia Governorate, Egypt, as well as all farms use public chlorinated tap water as a water source. The most used antibiotics in studied poultry farms were oxytetracycline, doxycycline, amoxicillin, and flumequine. The basic information on poultry farms under study and the applied hygienic measures were listed in (Table 1).

One gram of each sample was put in nine ml of buffer peptone water (BPW) to be ready for bacteriological examination (Soliman and Hassan, 2017).

Isolation of Salmonella: The previously prepared samples were incubated aerobically in BPW at 37ºC for 24 h. From the pre-enrichment tubes, one ml was inoculated into nine ml Rappaport Vassiliadis (RV) broth and incubated aerobically at 42ºC for 24 h. A loop full of selectively enriched broth was streaked separately onto Xylose Lysine Desoxycholate (XLD) agar and Hektoen enteric (HE) agar and incubated at 37ºC for 24 h. The suspected colonies were pink with or without black centers colonies on XLD and clear colonies with or without black centers on HE agar. One colony from the presumptive Salmonella colonies was subcultured onto XLD agar until the pure homogenous colonies were obtained. The pure suspected colonies were subcultured onto nutrient agar plates for further identification. These procedures were carried out after (Hassan and Osama, 2021).

Isolation of E. coli: The previously prepared samples were incubated aerobically in BPW at 37ºC for 24 h. A loop full of the non-selective enriched broth was streaked onto Eosin Methylene Blue (EMB) agar and incubated at 37°C for 24 h. The suspected colonies were metallic green in reflected light with a blue-black center in transmitted light. The typical colonies were subcultured onto EMB agar until the pure cultures with homogenous colonies were obtained. The pure colonies were subcultured onto nutrient agar plates for further identification. These procedures were carried out after (Jozić et al., 2018).

Isolation of Shigella: The samples were pre-enriched in peptone water and incubated anaerobically at 41.5ºC for 20 h. A loop full of the non-selective enriched samples was inoculated onto McConkey agar (low selectivity), XLD agar (moderate selectivity), and HE agar (high selectivity) and incubated at 37ºC for 24 h, the suspected colonies were smooth colorless colonies on McConkey agar, pale red on XLD agar, and ranged from clear to pale green colonies on HE agar. The pure suspected colonies were subcultured onto McConkey agar plates for further identification. These procedures were carried out after (ISO, 2004).

Biochemical identification of Enterobacteriaceae: The purified suspected colonies of Salmonella, E. coli, and Shigella were identified based on biochemical tests panel following the standard test protocol described in FDA’s Bacteriological Analytical Manual (FDA, 2012), (Gupta et al., 2017), and (Omara et al., 2017), respectively.

Table 1: The basic information and hygienic measures of poultry farms under study.

Table 2: Antimicrobial discs, concentration, and interpretation of their action on the isolated Enterobacteriaceae.

Table 3: The prevalence of Salmonella and E. coli in collected samples and swabs from different poultry farms (mean ± SE).

a, b & c: There is no significant difference (P>0.05) between any two means for each farm separately, within the same column have the same superscript letter.

Table 4: Different Salmonella and E. coli serotypes were isolated from different poultry farms.

Table 5: Antibiotic susceptibility of isolated Salmonella and E. coli serotypes.

Serological identification of Enterobacteriaceae: The positive isolates of Salmonella were serologically identified according to Kauffman’s white scheme (Kauffman, 1974), by using Salmonella antiserum according to (Cruickshank et al., 1975) for the detection of Somatic (O) and flagellar (H) antigens. Meanwhile, the positive E. coli were serologically identified according to (Kok et al., 1996) by using rapid diagnostic E. coli antisera sets for detection of somatic (O) and capsular (K) antigens.

Antibiotic Resistance of Enterobacteriaceae: The disk diffusion method was done according to (CLSI, 2015) to test the sensitivity of isolated Enterobacteriaceae by using eleven antibiotics. The concentrations of antimicrobial discs and the diameters of the inhibition zone of the tested strains were demonstrated in (Table 2). MAR index for each strain was determined according to the following formula, isolates classified as intermediate were considered sensitive to MAR index (Cusack et al., 2019).

MAR index = No. of resistance / total No. of tested antibiotics.

Molecular detection of antibiotic resistance genes by using cPCR was carried out after (Momtaz et al., 2012). The isolated Salmonella and E. coli serotypes were subjected to cPCR for detection of two resistant genes, these genes were the blaSHV resistance gene for β lactams (amoxicillin and ampicillin) and tetA resistance genes for tetracyclines (oxytetracycline and doxycycline). The genomic DNA extraction was carried out using a QIAamp DNA mini kit (Catalogue No.51304). The master mix was carried out according to the Emerald Amp GT PCR master mix (Takara, Code No. RR310A kit). The Oligonucleotide primers for tetA gene F, 5′GGTTCACTCGAACGACGTCA′3 and R, 5′CTGTCCGACAAGTTGCATGA′3 with 576 bp according to (Dipineto et al., 2006). While primers of the blaSHV gene were F, 5′AGGATTGACTGCCTTTTTG′3 and R, 5′ATTTGCTGATTTCGCTCG′3, with 392 bp according to (Bisi-Johnson et al., 2011). The cycling conditions of the primers during cPCR were carried out according to a specific Emerald Amp GT PCR master mix (Takara kit).

The statistical analyses were carried out following (Mahmoud and Abd Abd El-Hamed, 2018) to analyze the prevalence of Salmonella and E. coli in collected samples and swabs from different poultry farms by using General Linear Models (GLM) of SPSS Statistics 25 (IBM Corp., Somers, NY, USA). Studied trials were subjected to a two-way ANOVA. Multiple comparisons were carried out by applying the Duncan test. The significance level was set at a P value < 0.05.

Salmonella and E. coli had the highest prevalence in the duck farms (36.2% and 54.3% respectively). In contrast, the lowest prevalence of Salmonella and E. coli were in the breeder chicken farms (10.19 % and 29.28 % respectively). The prevalence of Salmonella was the highest in pen litter (49.45%), while it was the lowest in stored feed and hand swabs (1.67% per each). On the other hand, the prevalence of E. coli was the highest in droppings (85%), while it was the lowest in stored feed (10%), as shown in (Table 3).

Seven serotypes of Salmonella were isolated; the most isolated Salmonella serotype was S. Agona (39.76%). On the other hand, fifteen E. coli serotypes were isolated; the most isolated E. coli serotype was O26 (22.9%), as shown in (Table 4).

The different Salmonella serotypes showed 100% resistance against doxycycline, ampicillin, and amoxicillin. In contrast, the serotypes of Salmonella showed 100% sensitivity to gentamicin. Moreover, the different serotypes of E. coli showed the highest resistance (90%) against oxytetracycline, doxycycline, ampicillin, and amoxicillin. In contrast, all serotypes of E. coli were susceptible to gentamicin and cefotaxime, as shown in (Table 5). The highest MAR index (.727) was shown in S. Enteritidis followed by S. Kentucky (.545) and E. coli O164 had the highest MAR index (.909), followed by O114 (.727), as shown in (Table 6).

The resistant gene tetA was detected in S. Typhimurium and S. Enteritidis serotypes, in addition to O26, O119, O124, O114, O55, O164, and O157 serotypes. While the resistant gene blaSHV was detected in S. Agona, S. Kentucky S. Typhimurium, and S. Enteritidis, in addition, O26, O119, O124, O114, O164, and O157 serotypes of E.coli as shown in (Tables 7 and 8) and (Figures 1 and 2).

Table 6: Antimicrobial resistance profile of isolated Salmonella and E. coli serotypes.

Table 7: The tetA and blaSHV resistant genes in isolated Salmonella from different poultry farms.

Table 8: The tetA and blaSHV resistant genes in isolated E. coli from different poultry farms.

Enterobacteriaceae are serious contamination facing poultry industries as they are one of the most important groups of bacteria which can infect the poultry and cause dangerous diseases. Improper biosecurity measures and poor hygiene in poultry farms are the main cause of the introduction and spreading of Enterobacteriaceae (Khan et al., 2016).

Our results showed that there was a negative relationship between the poultry farms’ hygiene and the prevalence of Enterobacteriaceae. The duck farms were the most contaminated farms with Salmonella and E. coli; in contrast, the breeder chicken farms recorded the lowest prevalence. This is might be due to the variation in the level of hygienic measures of each farm as breeder chicken farms were the highest, unlike the duck farms (Noha and Halla, 2019). Moreover, the variation in the survival capabilities of Salmonella and E. coli in poultry farms is affected by many factors such as poultry husbandry systems, antibiotic use, environmental temperature, stress factors, in addition, age, type, immune status, and physiological status of birds (Rukambile et al., 2019).

Salmonella and E. coli were isolated from litter, droppings, birds’ cloaca, drinkers, feed, dust, vehicles’ wheels, farms’ walls, and workers’ hands, but Salmonella prevalence was the highest in pen litter (49.45%). The main source of Salmonella spreading in poultry farms was the contaminated litter that could be contaminated by the surrounding environment, dust, insects, free-living animals, and rodents (Noha and Halla, 2019). On the other hand, the contamination of E. coli was the highest in birds’ droppings (85%), birds’ droppings were the main source of E. coli contamination in different poultry farms (Blaak et al., 2015).

The isolated Salmonella serotypes were S. Agona, S. Kentucky, S. Derby, S Typhimurium, S. Enteritidis, S. Molade, and S. Virchow. While, the isolated E. coli serotypes were O26, O44, O119, O86, O124, O114, O55, O112, O164, O157, O91, O152, O128, O153, and O127. The appropriate management practices, proper hygiene, and biosecurity measures in poultry farms are very essential for the control of Enterobacteriaceae (Rukambile et al., 2019).

Our results indicated that all examined samples were free from Shigella species and this result may be due to the high sensitivity of Shigella species to unfavorable macroclimatic environmental conditions. It is destroyed by dryness and direct sunlight and is sensitive to different antibiotics (Ibrahim and Abo El-Makarem, 2021).

The routine prophylactic use of antibiotics in different poultry farms leads to an increase in the prevalence of an antibiotic-resistance against many bacterial species which is considered one of the most important public health hazards (Omara et al., 2017). Our result demonstrated that Salmonella species showed 100% resistance against doxycycline, ampicillin, and amoxicillin. Moreover, Salmonella species showed 85.7% resistance against flumequine. In previous studies, this high Salmonella resistance was reported against the same antibiotics in Egypt (Al-baqir et al., 2019), India (Waghamare et al., 2018), Pakistan (Kamboh et al., 2018), Bangladesh (Parvin et al., 2020), western Algeria (Yahya et al., 2021) and Côte d’Ivoire (Assoumy et al., 2021).

While, the E. coli species showed 90% resistance against oxytetracycline, doxycycline, ampicillin, and amoxicillin (Kamboh et al., 2018). This resistance may be attributed to the prolonged use of these antibiotics (Diab et al., 2019). On the other hand, E. coli isolates showed relatively low resistance against norfloxacin and cefotaxime (20% each). A previous incompatible study in Pakistan reported that E. coli isolates showed high resistance against flumequine, enrofloxacin, ciprofloxacin, and norfloxacin (76.7%, 79.6%, 82.5%, and 73.7% respectively), it demonstrated that this high resistance was due to extensive use of these antibiotics as feed additives in tested poultry farms for diseases prevention (Kamboh et al., 2018).

Gentamicin and cefotaxime antibiotics had the highest effect against E. coli species (Harakeh et al., 2005). In addition, Gentamicin had the highest effect on Salmonella species. This result was previously reported in, Egypt (El-Sharkawy et al., 2017). A previous study in Egypt reported that the isolated Salmonella showed complete resistance against gentamicin and ceftriaxone (100 %). It demonstrated that these antibiotics were commonly used by poultry producers as a preventive tool (Al-baqir et al., 2019). In contrast, these antibiotics weren’t commonly used in the tested poultry farms in our study and this proved the strong relationship between prophylactic use of the antibiotics and the development of antimicrobial resistance in poultry farms.

The results revealed that multidrug resistance was observed in all Salmonella isolates against four antibiotics or more and in all E. coli isolates against three antibiotics or more (except in O44). This high prevalence of multidrug resistance in Salmonella and E. coli has been previously reported in Egypt (Amer et al., 2018), Bangladesh (Matin et al., 2017), Pakistan (Kamboh et al., 2018), western Algeria (Yahya et al., 2021) and in Côte d’Ivoire (Assoumy et al., 2021).

The tetA gene was detected in (28.5%) of Salmonella and (70%) of E. coli serotypes, while the blaSHV gene was detected in (57.1%) of Salmonella and (60%) of E. coli serotypes. These genes were previously detected in Salmonella and E. coli isolates from poultry farms by (El-Sharkawy et al., 2017).

Our results showed that the serotypes of Salmonella and E. coli which had the highest MAR index also had the two resistant genes (tetA and blaSHV). In contrast, the serotypes which had the lowest MAR index didn’t have the two resistant genes (tetA and blaSHV). The results of the disk diffusion test were confirmed by the results of cPCR (Phagoo and Neetoo, 2015).

Improving the hygiene practices and enforced application of the maximum biosecurity measures in different poultry farms can reduce the prophylactic use of antibiotics and as a result, the drug residues can be minimized in eggs and poultry meat. In addition; minimize the anti-microbial resistance and reduce the cost of using antibiotics.

The authors especially thank the poultry producers who participated and helped to complete this study. The authors also extend their thanks and appreciation to all members of the Department of Hygiene and Veterinary Care, Faculty of Veterinary Medicine, Benha University for their assistance in completing this study.

The authors declared that they had no competing interests.

All authors contributed equally to this study.

This study was the first study in Qalubia governorate, Egypt aimed to detect resistance genes of the field Enterobacteriaceae strains already present in the poultry farm environment and isolated from the environmental samples as feeders, drinkers, dust, walls, and wheels of vehicles.