Evidence of Brucella abortus in Non-Preferred Caprine and Ovine Hosts by Real-time PCR Assay

Blood samples were collected from 471 sheep and 960 goats using a convenient sampling procedure from Kasur (Latitude: 31.0896° N, Longitude: 74.1240° E) and Sheikhupura (Latitude: 31.6243° N, Longitude: 74.1240° E) because these areas have been reported for brucellosis (Ahmed et al., 2017). The small ruminants of theses herds were also having mixed farming, sharing of pasture, same housing, history of abortion and close contact with seropositive large ruminants. The blood samples were collected in a vacutainer without anticoagulant then serum was separated and stored at -20°C.

All samples were serologically screened through Rose Bengal antigen obtained from Veterinary Research Institute Lahore (Baloch et al., 2017). All seropositive samples were used for DNA by ExgeneTM Blood SV-mini Kit (GeneALL® Biotechnology Co. Ltd, Songpa-gu, Korea) according to manufacturer’s instruction. Genomic samples were stored after quantification at -20°C till further investigation .

Genomic amplification was performed by using prepared Real-AmpTM SYBR qPCR master mix (Cat# 801-020, GeneALL® Biotechnology Co. Ltd, Songpa-gu, Korea). A reaction mixture of 20µL containing 4µL of master mix, 0.5µL (500nmol) of each species specific primers (Newby et al., 2003) forward: 5ʹ CCATTGAAGTCTGGCGAGC 3ʹ and reverse: 5ʹ CGATGCGAGAAAACATTGACCG 3ʹ, 1µL of DNA and 14µL of nuclease free water were used for amplification. The cycle threshold (Ct-value) below 40 was considered as positive. A reference strain of B. abortus (BA-544) obtained from Veterinary Research Institute (VRI) Lahore, Pakistan was used as positive control. Amplification of desired DNA was done in 96-well microplate (Thermo Fischer Scientific Inc., Waltham, USA) using a 7500 Real Time PCR System, Thermo cycler system of ABI. Initial denaturation at 94°C for 10 min followed by 40 cycles of each consisting denaturation at 95°C for 10 sec, annealing at 60°C for 10 sec and extension at 72°C for 10 sec. Final extension was done at 72°C for 3 min. Double stranded PCR product was detected by fluorescent dye associated with SYBR green-I at each extension step. An amplification curve of PCR product was analyzed and recorded through computerized software.

Data was analyzed risk estimation of odds ratio (95% CI: confidence interval) by using Statistical Package for Social Science (SPSS for Windows version 20, SPSS Inc., Chicago, IL, USA). Standard error sample proportion of standard deviation was calculated by using SEP formula as given. SEP = Square root [P (1 – P)/ n].

Through RBPT it was found out that, 118 (12.29% ± 0.0105) samples of goats out of 960 and 91 (19.32% ± 0.289) serum samples of sheep out of 471 were seropositive. After quantitative PCR, the PCR product size of B. abortus was found to be 156bp which confirmed that 74 samples (62.71% ± 0.044) out of 118 seropositive samples in goats and 63 samples (69.23% ± 0.048) out of 91 seropositive samples of sheep had B. abortus.

The present study was conducted in Sheikhupura and Kasur districts because the disease is prevalent not only in ruminants but soil is also niche for Brucella infection (Ahmed et al., 2017). Previously B. abortus biovar-1 was detected in 86% blood samples and 64% milk samples of goats by PCR assay (Leal-Klevezas et al., 2000). In Nigeria an abortion due to B. abortus was confirmed in ewes. The same biovar of Brucella was isolated from cattle which were kept in close contact with sheep, confirmed the cross-species transmission (Ocholi et al., 2005). Junaidu et al. (2010) used the serum samples of goats after slaughtering. They found out 12.03% samples positive for B. abortus. It was due to grazing habit in Nigeria where cattle graze with sheep and goats. In Egypt, despite eradication program of brucellosis, the disease was endemic in animals. The study revealed the cross-species infection of B. abortus from cattle to non-preferred host. Close farming could be the risk factor for continuous presence of brucellosis among cattle, buffalo, sheep and goats (Wareth et al., 2015). Previously, a study was conducted in Pakistan, in which all the seropositive serum samples of small ruminants were positive for B. abortus by real-time PCR but none of the B. melitensis was detected. B. abortus was identified as a causative agent for abortion in small ruminants (Ali et al., 2015). There could be number of risk factors which might have role in cross infection of species. These risk factors should be analyzed for effective planning. In a country like Pakistan where no strict biosafety measures are present, this could be the main reason of control failure. Mixed farming could be the reason of transmission of B. abortus to small ruminants where both small and large animals share the same pasture. Animals may secrete the infection (Samad et al., 2018). Brucella could survive in soil and other fomites (Ahmed et al., 2017). Same housing and herd presence of seropositive animals in mix farming system could play a role in transmission (Ali et al., 2015). Ectoparasites have been recently investigated as responsible for Brucella transmission. Ticks, mites and lice have also role in Brucella transmission (Wang et al., 2018). These ectoparasites with fomites, water and soil should be included in investigation of cross transmission of Brucella species. Due to cross infection of Brucella species in their non-preferred host brucellosis is increasing day by day. Abortion due to B. abortus in small ruminants cannot be identified on serogical basis. The serological based screening may lead to misleading planning for control program. Species specific identification of Brucella is significant in control measures (Shahzad et al., 2017). Early and accurate detection of Brucella species and its biovar/ biotype are fundamental for the control and eradication of brucellosis.

Little attentions was paid to inter-species transmission in previous studies. In the present study we used the molecular assay for confirmation of B. abortus in sheep and goats. It can be concluded that B. abortus could be a problem of small ruminants.

The research project was funded by European Union funded project of PLCIP/PITCO and Higher Education Commission of Pakistan (PIN No. 213-53245-2AV2-034) in collaboration with Veterinary Research Institute Lahore, Livestock and Dairy Development Department, Government of Punjab, Pakistan.

There is no conflict of authors of this paper.