Isolation and Identification of Listeria monocytogenes from Raw Vegetables and Meat Sold in Quetta, Pakistan

Abdul Samad1, Raheela Asmat2, Muhammad Naeem1, Hamida Ali3, Mohammad Zahid Mustafa1, Ferhat Abbas1, Jannat Raza1,3 and Muhammad Tauseef Asmat1*

1Center for Advanced studies in Vaccinology and Biotechnology, University of Balochistan, Quetta, Pakistan

2Bolan Medical College, Quetta

3Department of Zoology, Sardar Bahadur Khan Women University, Quetta

ABSTRACT

Water and soil have been reported as the pivotal reservoirs for Listeria monocytogenes and its subsequent transmission to food chain, plant material and animals. In present study, 800 food samples consisting of beef and chicken meat, milk, salads and fresh vegetables were collected from retail markets of Quetta, Pakistan. Multiplex PCR was employed to identify the prevalent species and genes associated with virulence. Only 10 (1.25%) samples were found contaminated with Listeria monocytogenes. Milk samples were the most contaminated as 4 samples collected from retail shops or dairy farm were found positive for Listeria. While 2 samples of each beef, chicken meat and salad were contaminated with Listeria. The virulent genes inlA, inlB, prfA, hlyA, actA, plcA and iap were detected in all 10 positive samples for Listeria. The positive samples inventories were analyzed and were found that water used to wash the meat and vegetables was contaminated with Listeria. This study concludes that better hygienic measures should be adopted to keep the food material germ free.

Article Information

Received 02 April 2019

Revised 04 July 2019

Accepted 27 July 2019

Available online 14 February 2020

Authors’ Contribution

AS, FA and TMA designed the experiments. AS, MN and HA performed the experiments. TMA, JR and RA analyzed the data. All authors contributed in Manuscript writing.

Key words

Listeria monocytogenes, Raw vegetables, Meat, Virulent genes, Quetta

DOI: https://dx.doi.org/10.17582/journal.pjz/20190402110434

* Corresponding author: tauseefcasvab@gmail.com

0030-9923/2020/0002-0817 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan

The disease listeriosis is caused by Listeria monocytogenes which affects the extreme age and immuno-compromised people more severally when compared to other population (Lomonaco et al., 2009). Around, 17% fatality rate has been documented because of Listeria infections globally which is highest among all food borne pathogens (Helwigh, 2006). L. monocytogenes is prevalent in environment and has ability to survive under very adverse conditions (Razavilar and Genigeorgis, 1998). Although undercooked and fast foods are the main source of infection but L. monocytogenes can contaminate any type of food including vegetable and meat, when hygiene measures are ignored (Büla et al., 1995). Listeriosis may lead to pre-term birth, septic shock and death (Helwigh, 2006). To cause such fatal diseases, L. monocytogenes is equipped with several virulent factors. The contamination of food with virulent strains of L. monocytogenes, have severe implications on human health (Jensen et al., 2008). Among virulence factors of L. monocytogenes internalins (Inl) have been reported as the key factor (Wieczorek et al., 2012). For example, InlA is responsible for adhesion and invasion into host cells while InlC helps the L. monocytogenes during cell to cell spread. Similarly, InlJ helps the bacteria to cross the cell barriers (Shen et al., 2013). Moreover, L. monocytogenes has the capability to secrete toxin known as listeriolysin S, which helps to evade the phagocytosis of bacteria. These pathogenic factors along with several other virulent factors play an important role to cause fatal infection (Shen et al., 2013).

To treat listeriosis penicillin/ampicillin and gentamicin are drugs of choice but several studies have reported the antibiotic resistance to these drugs (Wieczorek et al., 2012). Moreover, L. monocytogenes isolated from food samples have shown antibiotic resistant to multiple drugs which may be because of irrational use of antibiotics (Shen et al., 2013).

Outbreaks of listeriosis originated from consumption of contaminated food have been documented around the globe (Feng et al., 2011). Almost all types of food items including meat and vegetables have been reported to be involved in outbreaks of L. monocytogenes (Yücel et al., 2005). To control and minimize the infections caused by L. monocytogenes, the very first step is to identify the source and reservoir of bacteria (Franciosa et al., 1998). To achieve this goal, determining the prevalence and level of contamination of food items with L. monocytogenes

 

Table I. Nucleotide sequence of the Oligonucleotide primers used for the detection of Listeria monocytogenes and their virulence associated genes.

Target genes	Sequence of the primers (5'-3')	Expected amplicon size (bp)	References
hly	F:CATTAGTGGAAAGATGGAATG R:GTATCCTCCAGAGTGATCGA	730	Blais and Phillippe, 1995.
plcA	F:CTGCTTGAGCGTTCATGTCTCATCCCCC R:CATGGGTTTCACTCTCCTTCTAC	1484	Notermans et al., 1991
prfA	F:CTGTTGGAGCTCTTCTTGGGTGAAGCAATCG R:AGCAACCTCGGTACCATATACTAACTC	1060	Notermans et al., 1991
inlA	F:GGCTGGGCATAACCAAATTA R:CTTTTGTTGGTGCCGTAGGT	629	Montero et al., 2015
inlB	F:CCTAAACCTCCGACCAAACA R:CCATTTCGCGCTTCTCTATC	293
inlJ	F:TGTAACCCCGCTTACACAGTT R:AGCGGCTTGGCAGTCTAATA	238	Liu et al., 2007
iap	F:ACAAGCTGCACCTGTTGCAG R:TGACAGCGTGTGTAGTAGCA	131	Furrer et al., 1991
inlC	F:AATTCCCACAGGACACAACC R:CGGGAATGCAATTTTTCACTA	517	Liu et al., 2007
actA	F:CGCCGCGGAAATTAAAAAAAGA R:ACGAAGGAACCGGGCTGCTAG	839	Suarez et al., 2001

 

is of utmost importance. In developed world studies have been conducted in routine to check the prevalence of L. monocytogenes in environment and food items but data is lacking from underdeveloped countries especially from Pakistan. This pilot study was designed to evaluate the contamination level and prevalent strains of L. monocytogenes in vegetables and meat sold in Quetta, Pakistan.

 

Materials and methods

From January to December, 800 food samples were collected randomly from street vendors and retailers in different areas of Quetta, Pakistan. The food items included poultry meat (n=200), beef meat (n=200), vegetables/salad (n=200) and fresh milk (n=200). The collected samples were transported to laboratory in sealed cold box for further processing.

The collected food samples were analyzed to determine the presence of L. monocytogenes. The enrichment, isolation and characterization were performed as been described earlier in detail (Chen et al., 2015).

Multiplex PCR was employed to detect the Listeria (Doumith et al., 2004) isolated from different food samples by targeting the virulent genes by specific primers. The details of primers used are given in Table I.

 

Results and discussion

To ensure food safety, detection of pathogenic bacteria should be a fundamental objective. The application of molecular techniques has facilitated the identification and characterization of major virulence-associated genes in L. monocytogenes. L. monocytogenes is made of multiple strains showing varied virulence potential. To implement effective control and prevention measures against L. monocytogenes infections, it is necessary to identify virulent, disease-causing strains from avirulent, non-pathogenic strain that are relatively harmless.

In current study, 800 samples were collected and screened for L. monocytogenes. Overall, the prevalence of L. monocytogenes was 1.25% (10/800). Out of 10, L. monocytogenes isolates, 1% (1/100) was found in fresh chicken, 1% (1/100) in processed chicken, 2% (2/100) in minced beef, 1% (1/100) in milk collected from dairy farm, 3% (3/100) in milk obtained from retail shops and 2% (2/100) in fresh salad whereas no L. monocytogenes isolate was found in diced beef samples (0/100) and fresh vegetables (0/100) (Table II).

The ten isolates of L. monocytogenes isolated from different food sources were analyzed for the presence of virulence associated genes employing the multiplex PCR (Supplementary Fig. 1 and 2).

All the ten Listeria isolates (100%) were positive for hlyA, plcA, prfA, actA, iap, inlA, and inlB genes while 70% of the isolates were positive for inlC gene and only 50% for inlJ gene (Table III).

The overall prevalence of L. monocytogenes contamination in food samples observed in the present investigation was 1.25% (10/800). However, results of this study indicate lower prevalence as compared to other studies conducted by Nayak et al. (2015) in India (9%), Braga et al. (2017) in Uruguay (11.2%), Ismaiel et al. (2014) in Egypt (13.3%), Chen et al. (2015) in China (22%) and by Montero et al. (2013) in Chile (25%) in foods. Likewise, investigating the raw meat samples in China Wu et al. (2015) found a higher prevalence of L. monocytogenes isolates (23.7%). In Iran Pournajaf et al. (2016) isolated L. monocytogenes in 5.2% of the processed meat samples and 7.4% of dairy products. Difference in prevalence may be due to the types of analyzed food during the investigation in this study.

 

Table II. The prevalence of Listeria monocytogenes isolates in different food items in Quetta.

Food items	No. of samples analyzed	Samples contaminated with Listeria (n/%)
Fresh chicken	100	1 (1%)
Processed chicken	100	1(1%)
Beef diced	100	0(0%)
Beef minced	100	2(2%)
Milk dairy farm	100	1(1%)
Milk retail shops	100	3(3%)
Fresh vegetables	100	0(0%)
Fresh salad	100	2(2%)
Total	800	10 (1.25%)

 

Table III. Occurrence of virulence-associated genes present in L. monocytogenes isolated from various foods.

Source	No. of isolates	Virulence-associated genes
		hlyA	plcA	prfA	actA	iap	inlA	inlB	inlC	inlJ
Food	100%	+	+	+	+	+	+	+	-	-
	70%	-	-	-	-	-	-	-	+	-
	50%	-	-	-	-	-	-	-	-	+

 

In this study the highest prevalence of L. monocytogenes contamination was observed in milk samples (3%) obtained from retail shops followed by fresh salad (2%) and minced beef samples (2%). These findings highlight the potential role of these food types in the spread of L. monocytogenes and alert the health personnel about proper handling and cooking (Cossart et al., 2011). Wu et al. (2015) observed higher contamination frequency (5.7%) in vegetables in China. In another study, Cordano and Jacquet (2009) analyzed frozen and fresh vegetables from 2000 to 2005, reporting a L. monocytogenes prevalence of 26 and 10%, respectively.

L. monocytogenes comprises multiple strains that exhibit varying virulence potential. Although the differences in the virulence potential is not completely due to the presence of these genes, but these virulence makers play an important role in the pathogenicity of L. monocytogenes. Thus, detection of these markers may represent a quick approach for preliminary discrimination of potentially virulent strains from avirulent strains of L. monocytogenes. It has been suggested that diagnosis of pathogenic Listeria spp. and listerial infections should ideally be based on virulence markers (Notermans et al., 1991). Moreover, the importance of PCR has been investigated for detection of L. monocytogenes from foods (Gouws and Liedemann, 2005).

In the present study a multiplex PCR was standardized for the simultaneous detection of inlA gene and the hlyA, plcA, prfA, actA, iap, inlB, inlC and inlJ gene for the virulence determination of the pathogen.

Genotypic characterization of L. monocytogenes isolates from the different food samples in this study revealed the presence of inlA gene in all isolates (100%); these results are similar to those obtained by Liu et al. (2007) in USA and Almeida et al. (2000) in Brazil. Study conducted by Jung et al. (2003) showed that the inlA gene is species-specific, thereby suggesting their species-wide sequence conservation. Multiple virulence factors, including phosphatidylinositol phospholipase C (plcA), haemolysin (hlyA), actin polymerization protein (actA), invasive associated protein (iap), and internalin A (inlA), are necessary for the pathogenesis of L. monocytogenes. Therefore, detection of just one virulence factor by PCR is not always sufficient to identify L. monocytogenes strains. In addition, it is plausible that spontaneous mutations enable the removal of one or more virulence determinants in some L. monocytogenes strains. Thus, simultaneous detection of multiple virulent genes in a single assay is desirable as it reduces the time and labor involved and will be useful for large-scale investigations for detection of pathogenic strains of Listeria (Rawool et al., 2007). According to this study, the prevalence of inlC and inlJ virulence genes was 70% and 50% respectively which is comparable with the findings by Pounajaf et al. (2016) reporting the prevalence of inlC and inlJ genes in 64% and 57% of clinical samples and 84% and 78% of food specimens, respectively. These findings implicate a role of the virulence genes inlA, inlC and inlJ in the pathogenesis of L. monocytogenes isolates.

In this study the multiplex PCR detected hlyA gene in 100% of L. monocytogenes isolates. Similar findings were reported by Jallewar et al. (2007). However, the result of this study is not in agreement with the result of Usman et al. (2016), who reported the carriage of hlyA gene by 25%. It may be possible that some L. monocytogenes strains may lack one or more virulence determinants because of spontaneous mutations (Cooray et al., 1994).

 

Conclusion

The overall prevalence of L. monocytogenes in food was found to be 1.25%. L. monocytogenes carried the virulence genes including hlyA, plcA, prfA, actA, iap, inlA, inlB, inlC and inlJ genes indicating the pathogenic potential of the Listeria isolates. The highest prevalence in milk, fresh salad, minced beef samples in this study highlight the potential that these foods may play an important role in the spread of foodborne pathogen and alert to health personnel about the need to proper handling and cooking in individuals.

 

Supplementary material

There is supplementary material associated with this article. Access the material online at: https://dx.doi.org/10.17582/journal.pjz/20190402110434

 

Statement of conflict of interest

The author declare no conflict of interest.

 

References

Almeida, P.F.D., and Almeida, R.C.D.C., 2000. Fd. Contr., 11: 97-101. https://doi.org/10.1016/S0956-7135(99)00067-5

Blais, B.W. and Phillippe, L.M., 1995. Identification of presumptive positive Listeria monocytogenes from foods by the polymerase chain reaction. Polyscience, Quebec, Canada.

Braga, V., Vázquez, S., Vico, V., Pastorino, V., Mota, M.I., Legnani, M. and Varela, G., 2017. Brazilian J. Microbiol., 48: 689-694. https://doi.org/10.1016/j.bjm.2017.01.010

Büla, C.J., Bille, J. and Glauser, M.P., 1995. Clin. Infect. Dis., 20: 66-72. https://doi.org/10.1093/clinids/20.1.66

Chen, M., Wu, Q., Zhang, J., Wu, S. and Guo, W., 2015. Front. Microbiol., 6: 1026. https://doi.org/10.3389/fmicb.2015.01026

Cooray, K.J., Nishibori, T., Xiong, H., Matsuyama, T., Fujita, M. and Mitsuyama, M., 1994. Appl. environ. Microbiol., 60: 3023-3026.

Cordano, A.M. and Jacquet, C., 2009. Int. J. Fd. Microbiol., 132: 176-179.

Cossart, P., 2011. Proc. Nat. Acad. Sci. USA, 108: 19484-19491. https://doi.org/10.1073/pnas.1112371108

Doumith, M., Buchrieser, C., Glaser, P., Jacquet, C. and Martin, P., 2004. J. clin. Microbiol., 42: 3819-3822.

Feng, Y.F., Ran, L. and Zhang, L.S., 2011. Dis. Surveill., 26: 654–659.

Franciosa, G., Pourshaban, M., Gianfranceschi, M. and Aureli, P., 1998. Eur. J. Epidemiol. 14 205–210. 10.1023/A:1007448210169. https://doi.org/10.1023/A:1007448210169

Gouws, P.A. and Liedemann, I., 2005. Fd. Technol. Biotechnol., 43: 201-205.

Helwigh, B., 2006. Trends and sources of zoonoses, zoonotic agents and antimicrobial resistance in the European Union in 2004.

Ismaiel, A.A.R., Ali, A.E.S. and Enan, G., 2014. Fd. Sci. Biotechnol., 23: 179-185. https://doi.org/10.1007/s10068-014-0024-5

Jallewar, P.K., Kalorey, D.R., Kurkure, N.V., Pande, V.V. and Barbuddhe, S.B., 2007. Int. J. Fd. Microbiol., 114: 120-123. https://doi.org/10.1016/j.ijfoodmicro.2006.09.034

Jensen, A., Williams, D., Irvin, E.A., Gram, L. and Smith, M.A., 2008. J. Fd. Protec., 71: 1028-1034.

Jung, Y.S., Frank, J.F., Brackett, R.E. and Chen, J., 2003. J. Fd. Protec., 66: 237-241. https://doi.org/10.4315/0362-028X-66.2.237

Liu, D., Lawrence, M.L., Austin, F.W. and Ainsworth, A.J., 2007. J. Microbiol. Meth., 71: 133-140.

Lomonaco, S., Decastelli, L., Nucera, D., Gallina, S., Bianchi, D.M. and Civera, T., 2009. Int. J. Fd. Microbiol., 128: 516-520. https://doi.org/10.1016/j.ijfoodmicro.2008.10.009

Montero, D., Bodero, M., Riveros, G., Lapierre, L., Gaggero, A., Vidal, R.M. and Vidal, M., 2013. Front. Microbiol., 6: 1-8.

Nayak, D.N., Savalia, C.V., Kalyani, I.H., Kumar, R. and Kshirsagar, D.P., 2015. Vet. world, 8: 695-701. https://doi.org/10.14202/vetworld.2015.695-701

Notermans, S.H., Dufrenne, J.O.H.N., Leimeister-Wächter, M., Domann, E. and Chakraborty, T., 1991. Appl. environ. Microbiol., 57: 2666-2670.

Pournajaf, A., Rajabnia, R., Sedighi, M., Kassani, A., Moqarabzadeh, V., Lotfollahi, L. and Irajian, G., 2016. Rev. Soc. Brasil. Med. Trop., 49: 624-627. https://doi.org/10.1590/0037-8682-0403-2015

Rawool, D.B., Malik, S.V.S., Shakuntala, I., Sahare, A.M. and Barbuddhe, S.B., 2007. Int. J. Fd. Microbiol., 113: 201-207.

Razavilar, V. and Genigeorgis, C., 1998. Int. J. Fd. Microbiol., 40: 149-157. https://doi.org/10.1016/S0168-1605(98)00014-2

Shen, J., Rump, L., Zhang, Y., Chen, Y., Wang, X. and Meng, J., 2013. Fd. Microbiol., 35: 58-64.

Suárez, M., González-Zorn, B., Vega, Y., Chico-Calero, I. and Vázquez-Boland, J.A., 2001. Cell. Microbiol., 3: 853-864.

Usman, U.B., Kwaga, J.K.P., Kabir, J., Olonitola, O.S., Radu, S. and Bande, F., 2016. Canadian J. Infect. Dis. med. Microbiol., 2016. 4313827.

Wieczorek, K., Dmowska, K. and Osek, J., 2012. Foodbor. Pathog. Dis., 9: 681-685. https://doi.org/10.1089/fpd.2012.1137

Wu, S., Wu, Q., Zhang, J., Chen, M. and Hu, H., 2015. PLoS One, 10: e0136682.

Yücel, N., Çitak, S. and Önder, M., 2005. Fd. Microbiol. 22: 241–245.