Expression Patterns of BMP15 Gene in Folliculogenesis of Buffalo (Bubalus bubalis)

Jinfeng Liu1,2, Yanhong Cao3, Tong Feng1, Laiba Shafique1, Chan Luo1, Peng Zhu1,4,* and Qingyou Liu1,*

1State Key Laboratory for Conservation and Utilization of Subtropical Agro-Bioresources, Guangxi University, Nanning, Guangxi 530005, PR China

2Guangxi Veterinary Research Institute, Guangxi Key Laboratory of Veterinary Biotechnology, Nanning, Guangxi, 530001, China

3The Animal Husbandry Research Institute of Guangxi Zhuang Autonomous Region, Nanning 53001, PR China

4Guangxi Key Laboratory of Beibu Gulf Marine Biodiversity Conservation, Qinzhou University, Qinzhou, Guangxi 530005, PR China

Jinfeng Liu and Yanhong Cao are the co-first authors.

ABSTRACT

In the present study, BMP15 gene of buffalo was cloned, analyzed, and its’ expression pattern was further determined. It consists of 1185 nucleotides that encodes 394 peptides bond. The BMP15 gene was observed to be expressed in cumulus tissue, granular tissue, hypophysis, genital ridge and tissues of ovary and testis. Moreover, QRT-PCR results showed that BMP15 was expressed in the whole process of embryogenesis and folliculogenesis, early high level and then down regulated. It was significantly expressed higher level in COCs of middle diameter sized follicles than that of small and large sized follicles. BMP15 gene expression enhanced until morula stage but it fell sharply at blastula stage. Immunohistochemistry exhibited BMP15 protein was located in germ cells of testis, in primordial granulosa cells, primary, secondary, and antral follicles of ovary, and none in theca cells. The more conspicuous reaction for BMP15 was observed in germ cells than cumulus cells and granulosa cells, particularly in primordial germ cells of genital ridge or in foetus ovary of buffalo. The expression pattern of BMP15 suggested that it may play a key role in the formation of primordial follicles as well as in the development and maintaince of early embryos in buffalo.

Article Information

Received 21 December 2018

Revised 25 January 2019

Accepted 31 January 2019

Available online 01 October 2019

Authors’ Contribution

QL designed the experiment. JL cloned the BMP15 gene and drafted the manuscript. YC analyzed the expression pattern of BMP15 gene in folliculogenesis. TF analyzed the data. CL analyzed the expression pattern of BMP15 gene in embryogenesis. PZ did the immunohistochemistry work. LS revised the manuscript.

Key words

Buffalo, BMP15, Expression pattern, Folliculogenesis, Embryogenesis.

DOI: https://dx.doi.org/10.17582/journal.pjz/2020.52.1.37.47

* Corresponding authors: 476819435@qq.com;

qyliu-gene@qq.com

0030-9923/2020/0037-0001 $ 9.00/0

Copyright 2020 Zoological Society of Pakistan

Introduction

In Asia, livestock including buffalo has been considered a vital part of agriculture for over 5000 years. But, in spite of its pronounced significance in the fiscal zone, it makes available milk, meat, and draft for agriculture, buffalo remains quite ignored. The reproductive efficacy also remains deprived chiefly due to late puberty, reduced expression of estrus, summer anoestrus, long postpartum service period and low conception rate (Singh, 2012). So to shed light on the mechanism of folliculogenesis and embryogenesis are central for enlightening the reproductive efficacy of buffalo. The method of ovarian folliculogenesis consists of production and distinction of the constitutive cells in developing germ cells. Ovarian folliculogenesis is categorized by the development of oocytes from the primordial germ cells stage to the mature ovulating Grafian follicle stage.

The whole process is organized by both extra ovarian elements, e.g. pituitary gonadotropins, and locally produced paracrine factors, bidirectional interaction between the oocyte and the adjacent somatic cells, it is broadly acknowledged that oocyte directs the differentiation of granulosa cell and promote the development of follicles. Oocyte is able to secrete the solvable paracrine growth factors (such as BMP15 and GDF9) by performing on its immediate granulosa cells, in turn to control the self-development of oocyte. In pre-antral follicles, the oocyte leads granulosa cells to control the development of oocyte. The interaction of oocyte-cumulus cell has been described to accomplish the prevention of cumulus cell luteinization and regulating steroidogenesis, inhibit the synthesis and suppressing LH receptor manifestation.

Bone morphogenetic protein 15 (BMP15 also known as GDF9B) are interrelated members of the transforming development element b (TGFb) superfamily that are formed by the ovary and have intense effects on fertility (Elvin et al., 2000; McNatty, 2003). In mice, GDF9 (Dong, 1996) but not BMP15 (Yan, 2001) is crucial for usual follicular growth. But, in sheep, both GDF9 and BMP15 are vital for typical follicular development (Juengel, 2002). Several studies (Otsuka et al., 2000, 2001; Otsuka and Shimasaki, 2002) also recognized three most important biological purposes of BMP15 in the ovary. Firstly, BMP15 is a forceful stimulator of GC mitosis; Secondly, BMP15 prevents the manifestation of FSH receptor mRNA in GCs, causing the consequent suppression of FSH-induced progesterone synthesis as well as FSH-induced manifestation of a battery of mRNAs in GCs; and Thirdly, BMP15 excites the expression of kit ligand mRNA in GCs. The significance of BMP15 in fertility in sheep was clarified that naturally taking place alterations in the BMP15 gene in Inverdale (FecXI) and Hanna (FecXH) ewes triggered the rise in the rate of ovulation in heterozygotes due, in part, to an increased FSH sensitivity of GCs but initiated infertility in homozygotes due to a block in the primary stage of folliculogenesis (Galloway, 2000).

Mice with directed omissions in the BMP15 gene are sub-fertile, indicating the significance of BMP15 in the mouse fertility. The sound effects of transmutations in the BMP15 gene on the development of placenta and the fertility of cattle, especially in ovarian folliculogenesis, are unfamiliar and well-intentioned of advance study. In this research work, the duplicating and manifestation study of the water buffalo BMP15 were studied.

 

Materials and methods

Collection of animal tissues samples

The water buffaloes were slaughtered by exsanguination and the required tissues including cardiac, alveolar, renal, hepatic, neural, oocytes, spermatocytes, skin, bone, muscle tissue, genital ridge, hypophysis, hypothalamus, granulosa tissues and cumulus tissues were removed. After that the required tissues were instantaneously freezed in liquid nitrogen and stored at -80°C before handling for the isolation of RNA.

Preparation of RNA and cDNA synthesis

The total RNA was extracted from removed tissues by using the RNAiso Plus reagent (TAKARA, Daliang, China) succeeding the manufacturer’s specifications. The concentration, purity and integrity of RNA were detected by NanoDrop 2000 (GENE, USA) and agarose gel electrophoresis, separately. Synthesis of cDNA was executed using the PrimeScript 1st Strand cDNA Synthesis (TAKARA, Daliang, China) from 2 μg of total RNA from each the removed tissues.

Cloning of BMP15 gene in water buffalo

RT-reactions were implemented as earlier defined by our lab (Huang, 2010), one pair of primers was considered and chosen for the final PCR amplification based on the Bos taurus BMP15 sequence (GenBank: NM_001031752.1) (Table I). The PCR was accomplished using the PrimeScript RT-PCR Kit (TAKARA, Daliang, China) at 94°C 5min, 94°C /30s, 55°C/30s and 72°C/1.5 min for a total of 35 cycles, with a final extension at 72°C for 7 min in a Biometra thermocycler. The PCR products were cloned into pMD-18T (TAKARA, Daliang, China) and then were sequenced by Invitrogen. The sequences were counting by DNAStar 7.1 that have been deposited to Gene Bank under accession number JQ326273.1.

Software for bioinformatics analysis

All sequence outputs (ABI trace files) were examined with the DNAStar Seqman module. Sequences were trimmed at high stringency. Software for bioinformatics analysis was list in (Table II). The BLAST search program was used to find homologies with nucleic acids and protein sequences. The ORF Finder was used to confirm open reading frames and translated to protein sequences. The physical and chemical properties of the putative BMP15 protein were predicted using the software on the ExPASy server.

 

Table I.- Primers used to amplify the BMP15 gene and expression analysis.

Products	Amplicon length (bp)	Primer name	Sequences (5’→3’)	Annealing temp. (°C)	Note
BMP15	1185	Bmp15-F1	ATGGTCCTTCTGAGCATCC	55	CDS cloning
		Bmp15-R1	TCACCTGCATGTACAGGACT
qBMP15	156	Bmp15-qRT-F	AAAGCCCAACCAATCACT	55	RT-qPCR
		Bmp15-qRT-R	GACACACGAAGCGGAGTC
qβ-actin	199	β-actin-qRT-F	ACCGCAAATGCTTCTAGG	55	RT-qPCR
		β-actin-qRT-R	ATCCAACCGACTGCTGTC

 

Table II.- Software for bioinformatics analysis.

Software	Website	Function
BLAST	http://blast.ncbi.nlm.nih.gov/Blast.cgi	Assemble sequences
ORF Finder	http://www.ncbi.nlm.nih.gov/gorf/gorf.html	Find CDS
MEGA5.0	-	Constructed phylogenetic tree
DNAMAN	-	Multiple sequence alignment
EXPASY	http://web.expasy.org/protparam/	Predict protein property
SMART[1] (Letunic, 2017)	http://smart.embl—heidelberg.de	Predict protein domains
SignIP[2] (Petersen, 2011)	www.cbs.dtu.dk/services/SignalP/	Predict signal peptides
Softberry	http://linux1.softberry.com/berry.phtml?topic=protcompan& group =programs&subgroup=proloc	Predict the sub-cellular localization of protein
DNAStar	-	Predict secondary structure of protein
InterProScan	http://www.ebi.ac.uk/interpro/search/sequence-search	Predict protein domains
I-TASSER[3] (Roy, 2010)	http://zhanglab.ccmb.med.umich.edu/I-TASSER/	Predict protein structure

 

Tissue distribution of water buffalo BMP15 mRNA

The removed tissues included cardiac, alveolar, renal, hepatic, neural, skin, bone, muscle, genital ridge, ovary, testis, hypophysis, hypothalamus, granulosa cell and cumulus cell as temples to study the distribution of the water buffalo BMP15 mRNA using the qBMP15 primers (Table I). The PCR mixtures contained 1 uL 50 ng/μL cDNA, 0.3 μL each of 10 μM forward and reverse primers, 8.7 μL PCR-grade Water, and 10 μL of Premix Taq™ (TAKARA, Daliang, China). Reaction conditions were 95°C for 5 min; 40 cycle of 95°C for 10 s, 55°C for 30 s, 72°C for 30 s; with a final extension at 72°C for 7 min in a Biometra thermocycler.

Collection of COC and embryo and reverse transcription

Cumulus-oocyte-complexes (COC), parthenogenetic activation, embryo culture, collection and reverse transcription were according to the method reported by our lab (Li et al., 2005; Li, 2006; Shi, 2007). COC were collected from different diameter follicles, including 0-2 mm, 2-4 mm, 4-6 mm, 6-8 mm and more than 8 mm.

Quantitative real-time PCR

To study the distribution of the water buffalo BMP15 mRNA during folliculogenesis and embryogeneis using the primers (Table I). The PCR mixtures contained 1 uL 50 ng/μL cDNA, 0.3 μL each of 10 μM forward and reverse primers, 8.7 μL PCR-grade Water, and 10 μL of SYBR Master Mix (TAKARA, Daliang, China). Reaction conditions were 95°C for 5 min; 40 cycle of 95°C for 10 s, 55°C for 30 s, 72°C for 30 s; 95°C for 5 s, 65°C for 1 min, 97°C continuous, 1 cycles; 40°C for 10 s. SYBR Green was used to detect specific PCR products. Amplification and detection of SYBR Green were performed with the ABI 7500 Instrument. At least three sets of embroys were analyzed for BMP15 examined, and all PCRs were conducted in triplicates. The comparative CT method was used for relative quantification of target gene expression levels. The quantification was normalized to the control β-actin gene. The calculation of ΔΔCT involved using the <2 mm sample ΔCT value as an arbitrary constant to subtract from all other ΔCT sample values. The ΔCT value was determined by subtracting the β-actin ΔCT value for each sample from the BMP15 gene ΔCT value of the sample. Fold-changes in the relative mRNA expression of the target gene were determined using the formula 2-ΔΔ CT.

Immunohistochemical localization of BMP15

Swamp Buffalo ovaries and testis were sampled from the local slaughterhouse, and instantly fixed for 24 h in PBS containing 4% PFA (paraformaldehyde) in 4°C, and then administered in steadily alcohol and xylene, infiltrated with paraffin in a Biological Tissue Automatic Dehydration Machine, last embedded in paraffin. Serial sections 5-7 uM thick, were cut from laica RM 2235 rotary microtome, and then mounted on poly-L-lysine coated slides, dried in the 50°C drying oven overnight. Five to ten sections were processed in 1:49 APES: acetone for 60s to prevent the sections fall off, then deparafinized in xylene, and rehydrated. Then three 5-min washes with 0.1% Tween-20 in PBS (PBS-T) in a horizontal shaker, endogenous peroxidase was removed by incubating the deparaffinized sections in 3% hydrogen peroxide in methanol for 30 min. After three 5 min washes with PBS-T on a horizontal shaker, sections were treated with microwave heat-induced epitope retrieval three 6-min and 90% firepower with 5 min interval and cooled for 2 h to room temperature. Wash three times 5 min each in PBS-T, sections were incubated in PBS-T contain 1% Triton X-100 for 30 min, then wash three times 5 min each in PBS-T, wiped off the surrounding liquid of the sections, drawn a circle around the tissue sections with a Super Pub Pen (ZLI-9305, Beijing Solarbio Science and Technology Co., Ltd.), then dripped 5% BSA onto the sections incubate for 45min in room temperature to minimize non-specific binding. After that, sections were incubate in 4°C overnight with the rabbit polyclonal BMP15 (sc-27324, SANTA) antibody diluted 1:80 in PBS-T. The next day, the sections were incubated in 37°C for 45 min to ensure the antibody for the best combination with the target antigens. After three times washes, the sections were incubated with goat anti-rabbit Biotin-SP-conjugated antibody (SA00004-4, Protein Tech Group, Inc.) for 45 min at room temperature and 45 min at 37°C. Sections were washed three times in PBS-T before being incubated with Peroxidase-conjugated Streptavidin (SA00001-0, Protein Tech Group, Inc.) for 45 min at 37°C. After three 5 min washes with PBS-T, sections were incubated with DAB color development kit for 2 min at room temperature and then counterstained with hematoxylin, dehydration in a grade alcohol and mounted with Neutral Balsam. Negative controls were performed in which the primary antibody was replaced with rabbit IgG. All other incubations and washes were performed on a horizontal shaker except antibodies incubation. The sections were observed with a Nikon ECLIPSE E800 photomicroscope (Nikon, Tokyo, Japan).

Data of analysis

The expression of mRNA was investigated using SPSS software and SigmaPlot. One-way repeated-measures analysis of variance, followed by multiple pairwise comparisons using Student–Newman–Keuls Multiple Comparisons Test, was used for analysis of differences in mRNA expression assayed by QRT-PCR. A P-value of less than 0.05 was considered to be significant.

 

Results

Cloning and sequence analysis of the water buffalo BMP15

The full-length CDS of BMP15 gene was attained from the buffalo ovary cDNAs by RT-PCR and sequencing. One pair of primers was designed in the conserved regions of the Bos taurus, namely BMP15-F1/BMP15-R1, for amplifying the water buffalo BMP15 gene. Specific PCR products were obtain as seen by agarose/TAE gel electrophoresis (Fig. 1). The size of the products was 1185 bp, consistent with those expected. The sequence results and ORF Finder software analysis showed that the open reading frame (ORF) length size of water buffalo BMP15 gene was 1, 185 bp, and encoded 394 amino acids (Fig. 2).

 

 

The water buffalo BMP15 protein is the same size as that of Bos taurus, Capra hircus, Equus caballus and Sus scrofa (394 aa), more than that of Ovis aries (393 aa), Homo sapiens (392 aa), Rattus norvegicus (391 aa) and Mus musculus (392 aa), which contained the conserved domains of BMP15 proteins. The InterPro software on the EMBL-EBI Services revealed that protein structures of the water buffalo BMP15 contained the TGFB (278-394) (Figs. 3, 5). The overall similarity between the water buffalo BMP15 and others’ was very high that displayed 79%-98% similarity, showed 98%, 98%, 90%, 79% and 81% identity with that of Bos taurus, Ovis aries, Sus scrofa, Mus musculus and Homo sapiens. Figure 4 showed the phylogenetic tree based on amino acid sequence similarity. The water buffalo has the nearest relationship with Bos taurus than with those of other species, belonging to Bovidae.

 

 

 

The formula, theoretical Mw and pI for the deduced amino acid sequence of BMP15 were C2027H3188N586O549S16, 45.06 kDa and 9.65, respectively. The ProScale software analysis exhibited the water buffalo BMP15 protein was a weakly alkaline protein. Signal peptides predicted showed BMP15 had signal peptide at 25-26 sites by SignIP soft and Smart soft. The Softberry online tool predicted BMP15 was an extracellular protein.

The results of secondary structure prediction indicated that the deduced water buffalo BMP15 contained 14 alpha helices, 29 beta helices, 31 turns, and 21 random coils (Fig. 6). The tertiary structure of buffalo BMP15 protein prediction by I-TASSER server showed that the four species proteins were similar (Fig. 7).

 

 

 

Tissue distribution of the water buffalo BMP15

To observe the differential distributions of the BMP15 in water buffalo tissues, 15 buffalo tissues or cells were tested by RT-PCR (Fig. 8). The expression pattern exploration results showed that buffalo BMP15 expressed in the six of 15 tested samples, including ovary, testis, granular cells, cumulus cells, hypophysis and genital ridge. To study the distribution of the water buffalo BMP15 mRNA during folliculogenesis and embryogeneis, COCs of different dimeter follicles and embryos of different development phase were tested by RT-PCR (Fig. 9). The results indicated that BMP15 existed spanning the entire stage of folliculogenesis and embryogenesis. During follicular development, BMP15 firstly up-regulated and then down-regulated, was significantly higher in the COCs of middle dimeter follicles than small and large follicles. Also, it demonstrated the same expression trend in parthenogenetic embryos at different stages of development, continued to rise until morula stage,

 

and fell sharply at blastula stage. The gene expression was very significantly greater in embryogenesis than folliculogenesis, with the exception of blastula stage. Immunohistochemistry showed BMP15 protein was bring into being in all types of follicles (Fig. 10), primordial granulosa cells (Fig. 10C), primary (Fig. 10D), secondary (Fig. 10E), and antral follicles (Fig. 10G) but weak reaction for cumulus cells of antral follicles (Fig. 10G), and absent in theca cells (Fig. 10F, G). BMP15 protein was earliest noticed in primordial cyst of genital ridge of female buffalo foetus (body slanting length was 6-8 cm, amplification of the SRY Gene for sex identification by PCR, data not shown) (Fig. 10A), it exhibited a further conspicuous reaction for BMP15 in follicles than that in granulosa cells and cumulus cells, especially in primordial follicles of ovary of female buffalo foetus (body slanting length was 30-40 cm, data not shown) (Fig. 10B). Also, it exhibited a more conspicuous reaction for BMP15 in primary and secondary follicle than that in small and large antral follicle (Fig. 10B-G). In addition, BMP15 protein was noticed in buffalo foetus testis (body slanting length was 30-40 cm, data not shown) and adult buffalo (Fig. 10H, I).

Discussion

Water buffalo are an earliest constituent of domestic livestock possessions, and it gives milk and meat, even though which is very little in contrast to cattle, grown up in many countries, such as China, India, Turkey (Yilmaz et al., 2012; Kaplan, 2018), Egypt (Wilson, 2012) and so on. The present study focused on molecular cloned buffalo BMP15 gene and estimated the dispersal of BMP15 mRNA and protein in buffalo tissues to conclude whether BMP15 may play a role in the development of follical and embryogenesis in the buffalo.

The name bone morphogenetic protein (BMP) was first given in 1965 by Urist (1965) to the active components in demineralized bone and bone extracts that are capable of inducing bone formation at ectopic sites. In 1988, the first BMPs were isolated, and their cDNAs were cloned by Wozney (1988). In this study, the full-length CDS of BMP15 gene was obtained from the buffalo ovary cDNAs by RT-PCR with direct sequencing, and was found to be 1,185 nucleotides encoding a protein of 394 residues. The homologous comparison showed buffalo BMP15 coding sequence had 98%, 98%, 90%, 79% and 81% identity with that of Bos taurus, Ovis aries, Sus scrofa, Mus musculus and Homo sapiens. This is consistent with the results of the zootaxy that further confirmed the reliability of the buffalo BMP15 cDNA sequence. Moreover, the sequence homology levels among species to a certain extent, reflected the phylogenetic relationships, and revealed the stability of the gene encoding protein has significance for the function of organisms in different species structures. The phylogenetic analyses exposed that the nearest relationship existed between the water buffalo and Bos taurus, which revealed that using information of the Bos taurus BMP15 protein to expect the function of the buffalo BMP15 protein by bioinformatic analysis. The SMART online tool and InterPro software on the EMBL-EBI Services for prediction of the buffalo BMP15 protein showed that this protein contained the TGFB domain (278-394). A distinguishing structural feature of the TGF-β superfamily is the presence of seven conserved cysteines, which are involved in folding the molecule into a unique three-dimensional structure called a cystine knot by Schlunegger and Grutter (1992). Interestingly, GDF-9 and BMP15 have only six of the seven conserved cysteines; both lack the fourth cysteine that is required for the intersubunit-disulfide bridge (Dube, 1998).

We revealed the expression of mRNA BMP15 gene in buffalo tissues, COCs and embryos as well as in ovary and testis. By using the RT-PCR we were able to demonstrate that ovary, testis, granular cells, cumulus cells, hypophysis and genital ridge expressed mRNA for BMP15. These results are similar to those reported by Silva (2005) for goats, rare minnow Gobiocypris rarus (Zhang, 2014), mouse (Otsuka and Shimasaki, 2002) where BMP15 mRNA were found in ovary, testis, gramular cells, cumulus cells and hypophysis. In this research work, BMP15 existed spanning the entire stage of folliculogenesis and embryogenesis. During follicular development, BMP15 firstly enhanced and then reduced, was considerably greater in the COCs of middle dimeter sized follicles than small and large sized follicles. Also, it indicated the same expression trend in parthenogenetic embryos at different stages of development, sustained to rise until morula stage, and fell sharply at blastula stage. The gene expression was very considerably greater in embryogenesis than folliculogenesis, with the exception of blastula stage. Immunohistochemistry exhibited BMP15 protein was bring into being in all kinds of follicles, primordial granulosa cells, primary, secondary, and antral follicles but weak reaction for cumulus cells of antral follicles, and absent in theca cells. In oocytes exhibited a more conspicuous reaction for BMP15 than in granulosa cells and cumulus cells, especially in primordial follicles. The mRNA expression was considerably higher in the COCs of middle dimeter sized follicles than small and large sized follicles, was reliable with the result of protein expression by immunohistochemistry, which displayed a more prominent reaction for BMP15 in primary and secondary follicle than in small and large antral follicle. These results are similar to those reported for goats (Silva, 2005), brushtail possum (Eckery, 2002), Sus (Li, 2008) where BMP15 mRNA were found as early as in oocytes of primordial follicles, BMP15 mRNA expressed at low levels in immature oocytes and increased to the highest level at 18 h of IVM, which coincides with the time of cumulus cell expansion. These results explained low expression in large follicle (>8 mm), but high expression in 2 cell embryo stage in this study, at that time the buffalo genome hadn’t been activated. The BMP15 mRNA were found as early as in oocytes of primordial follicles in this study and elsewhere goats et al, is earlier than that found for the mouse, rat, and human (Aaltonen, 1999; Dube, 1998; Elvin et al., 2000; Erickson and Shimasaki, 2003; Jaatinen, 1999; Laitinen, 1998), where they were first observed in oocytes of primary follicles. Surprisingly, the discover of detecting protein of BMP15 in the very early, genital ridge of foetus is intriguing and it suggests that BMP15 maybe play an important fuction in formation, growth and maintenance of primordial follicles in buffalo, as Bodin (2007) showed that homozygous FecXL adult females displayed an infantile genital tract and the ovaries did not carry any obvious follicular structures in Lacaune sheep.

BMP15 may play diverse roles in regulating early follicular development in different species. Yan (2001) showed that mice lacking BMP15 are subfertile. In contrast, ewes that have naturally occurring inactivating mutations in the BMP15 gene showed follicular development arrested at primary follicle stage and are infertile by Galloway (2000). BMP15 is known to stimulate granulosa cell mitosis and early follicular development in rodents as described by Otsuka (2000). Furthermore, the importance of BMP15 for early folliculogenesis is confirmed by the findings of Dong (1996) and Galloway (2000) which showed that BMP15-deficient sheep are infertile because follicle development does not proceed beyond the primary stage. Clearly, the buffalo BMP15 gene cDNAs were successful cloned that provide an important significance for further mining molecular markers associated buffalo reproduciton, exploring its function by TALENs or CRISPR/Cas systems, even breeding new twinning buffalo varieties.

 

Acknowledgments

We acknowledge our friend, colleague and mentor who offer a lot of help in this study. This work was supported by the National Natural Science Foundation of China (No. 31260552) and by Guangxi Natural Science Foundation (Grant No. AA18118041, AB16380042 and 1598013-2).

 

Statement of conflict of interest

The authors declare no conflict of interest.

 

References

Aaltonen, J., 1999. Human growth differentiation factor 9 (GDF-9) and its novel homolog GDF-9B are expressed in oocytes during early folliculogenesis. J. clin. Endocrinol. Metabol., 84: 2744-2750. https://doi.org/10.1210/jc.84.8.2744

Bodin, L., 2007. A novel mutation in the bone morphogenetic protein 15 gene causing defective protein secretion is associated with both increased ovulation rate and sterility in Lacaune sheep. Endocrinology, 148: 393-400. https://doi.org/10.1210/en.2006-0764

Dong, J., 1996. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature, 383: 531-535. https://doi.org/10.1038/383531a0

Dube, J.L., 1998. The bone morphogenetic protein 15 gene is X-linked and expressed in oocytes. Mol. Endocrinol., 12: 1809-1817. https://doi.org/10.1210/mend.12.12.0206

Eckery, D.C., 2002. Expression of mRNA encoding growth differentiation factor 9 and bone morphogenetic protein 15 during follicular formation and growth in a marsupial, the brushtail possum (Trichosurus vulpecula). Mol. cell. Endocrinol., 192: 115-126. https://doi.org/10.1016/S0303-7207(02)00085-0

Elvin, J.A., Yan, C. and Matzuk, M.M., 2000. Oocyte-expressed TGF-beta superfamily members in female fertility. Mol. cell. Endocrinol., 159: 1-5. https://doi.org/10.1016/S0303-7207(99)00185-9

Erickson, G.F. and Shimasaki, S., 2003. The spatiotemporal expression pattern of the bone morphogenetic protein family in rat ovary cell types during the estrous cycle. Reprod. Biol. Endocrinol., 5: 1-9.

Galloway, S.M., 2000. Mutations in an oocyte-derived growth factor gene (BMP15) cause increased ovulation rate and infertility in a dosage-sensitive manner. Nature Genet., 25: 279-283. https://doi.org/10.1038/77033

Huang, B., 2010. Generation and characterization of embryonic stem-like cell lines derived from in vitro fertilization Buffalo (Bubalus bubalis) embryos. Reprod. Domest. Anim., 45: 122-128. https://doi.org/10.1111/j.1439-0531.2008.01268.x

Jaatinen, R., 1999. Localization of growth differentiation factor-9 (GDF-9) mRNA and protein in rat ovaries and cDNA cloning of rat GDF-9 and its novel homolog GDF-9B. Mol. cell. Endocrinol., 156: 189-193. https://doi.org/10.1016/S0303-7207(99)00100-8

Juengel, J.L., 2002. Growth differentiation factor 9 and bone morphogenetic protein 15 are essential for ovarian follicular development in sheep. Biol. Reprod., 67: 1777-1789. https://doi.org/10.1095/biolreprod.102.007146

Kaplan, S., 2018. Nucleotide polymorphism of leptin gene in Anatolian Water Buffaloes. Pakistan J. Zool., 50: 1841-1846.

Laitinen, M., 1998. A novel growth differentiation factor-9 (GDF-9) related factor is co-expressed with GDF-9 in mouse oocytes during folliculogenesis. Mechan. Develop., 78: 135-140. https://doi.org/10.1016/S0925-4773(98)00161-0

Letunic, I., Doerks, T. and Bork, P., 2012. SMART 7: Recent updates to the protein domain annotation resource. Nucl. Acids Res., 40: D302-305. https://doi.org/10.1093/nar/gkr931

Li, H.K., 2008. Differential gene expression of bone morphogenetic protein 15 and growth differentiation factor 9 during in vitro maturation of porcine oocytes and early embryos. Anim. Reprod. Sci., 103: 312-322. https://doi.org/10.1016/j.anireprosci.2006.12.017

Li, X., 2006. Analysis of development-related gene expression in cloned bovine blastocysts with different developmental potential. Cloning Stem Cells, 8: 41-50. https://doi.org/10.1089/clo.2006.8.41

Li, X., Kato, Y. and Tsunoda, Y., 2005. Comparative analysis of development-related gene expression in mouse preimplantation embryos with different developmental potential. Mol. Reprod. Develop., 72: 152-160. https://doi.org/10.1002/mrd.20346

McNatty, K.P., 2003. Oocyte-derived growth factors and ovulation rate in sheep. Reproduction, 61(Suppl.): 339-351.

Otsuka, F., Moore, R.K. and Shimasaki, S., 2001. Biological function and cellular mechanism of bone morphogenetic protein-6 in the ovary. J. biol. Chem., 276: 32889-32895. https://doi.org/10.1074/jbc.M103212200

Otsuka, F. and Shimasaki, S., 2002. A negative feedback system between oocyte bone morphogenetic protein 15 and granulosa cell kit ligand: Its role in regulating granulosa cell mitosis. Proc. natl. Acad. Sci. U.S.A., 99: 8060-8065. https://doi.org/10.1073/pnas.122066899

Otsuka, F. and Shimasaki, S., 2002. A novel function of bone morphogenetic protein-15 in the pituitary: Selective synthesis and secretion of FSH by gonadotropes. Endocrinology, 143: 4938-4941. https://doi.org/10.1210/en.2002-220929

Otsuka, F., 2000. Bone morphogenetic protein-15. Identification of target cells and biological functions. J. biol. Chem., 275: 39523-39528. https://doi.org/10.1074/jbc.M007428200

Petersen, T.N., Brunak, S., von Heijne, G. and Nielsen, H., 2011. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Meth., 8:785-786. https://doi.org/10.1038/nmeth.1701

Roy, A., Kucukural, A. and Zhang, Y., 2010. I-TASSER: A unified platform for automated protein structure and function prediction. Nat. Protoc., 5: 725-738. https://doi.org/10.1038/nprot.2010.5

Schlunegger, M.P. and Grutter, M.G., 1992. An unusual feature revealed by the crystal structure at 2.2 A resolution of human transforming growth factor-beta 2. Nature, 358: 430-434. https://doi.org/10.1038/358430a0

Shi, D., 2007. Buffalos (Bubalus bubalis) cloned by nuclear transfer of somatic cells. Biol. Reprod., 77: 285-291. https://doi.org/10.1095/biolreprod.107.060210

Silva, J.R., 2005. Expression of growth differentiation factor 9 (GDF9), bone morphogenetic protein 15 (BMP15), and BMP receptors in the ovaries of goats. Mol. Reprod. Develop., 70: 11-19. https://doi.org/10.1002/mrd.20127

Singh, S., 2012. Isolation and characterization of oviduct-specific glycoproteins from ampulla and isthmus parts of cyclic and acyclic buffalo for studying differential microenvironment. Appl. Biochem. Biotechnol., 166: 1814-1830. https://doi.org/10.1007/s12010-012-9599-6

Urist, M.R. 1965. Bone: formation by autoinduction. Science, 150: 893-899. https://doi.org/10.1126/science.150.3698.893

Wilson, R.T., 2012. The past and present of and potential for the domestic (water) buffalo in Africa. Trop. Anim. Hlth. Prod., 44: 1367-1373. https://doi.org/10.1007/s11250-012-0097-1

Wozney, J.M., 1988. Novel regulators of bone formation: Molecular clones and activities. Science, 242: 1528-1534. https://doi.org/10.1126/science.3201241

Yan, C., 2001. Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol. Endocrinol., 15: 854-866. https://doi.org/10.1210/mend.15.6.0662

Yilmaz, O., Ertugrul, M. and Wilson, R.T., 2012. Domestic livestock resources of Turkey: Water buffalo. Trop. Anim. Hlth. Prod., 44: 707-714. https://doi.org/10.1007/s11250-011-9957-3

Zhang, Y., 2014. Molecular characterization of GDF9 and BMP15 genes in rare minnow Gobiocypris rarus and their expression upon bisphenol A: Exposure in adult females. Gene, 546: 214-221. https://doi.org/10.1016/j.gene.2014.06.013