Submit or Track your Manuscript LOG-IN

Association between Myogenin Gene Polymorphism and Slaughter Traits of Meat Quails

PJZ_53_2_789-792

Association between Myogenin Gene Polymorphism and Slaughter Traits of Meat Quails

Jun Yan Bai*, Kun Peng Shi, Xiao Ning Lu, Xiao Hong Wu, Xue Yan Fu,

Heng Cao, Hong Deng Fan, Meng Ke Chen and Yong Kang Ma

Henan University of Science and Technology, College of Animal Science and Technology, Luoyang 471 023, China

ABSTRACT

To recognize molecular markers of slaughter performance of quail, SNP in control regions of cytogenin gene (MyoG) 5’ in French giant quail, and Savimit quailwas detected by PCR-SSCP method in this study. Moreover, correlations of control regions of MyoG 5’ with slaughter performance of quail were analyzed. Results demonstrated that: In meat quail, three genotypes (AA, BB and AB) were detected at locus A in the control region of MyoG 5’. For locus A, BB frequency of French giant quail and Savimit quail was the highest (0.531 and 0.750). For locus B, three genotypes (AA, AB and BB) were detected in Savimit quail, but only AA was detected in French giant quail. The BB frequency of Savimit quail was the highest, reaching 0.389. Locus A showed a significant correlation with liver weight of meat quails(P<0.05), while locus B presented significant correlations with body weight, carcass weight, carcass net weight, liver weight, breast muscle weight and leg muscle weight(P<0.05). Loci A and B in the control region of MyoG 5’ can be used as the molecular marker of slaughter performance of meat quails during marker assisted selection.


Article Information

Received 07 October 2019

Revised 02 December 2019

Accepted 12 December 2019

Available online 26 February 2021

Authors’ Contribution

JYB conceived and designed the study and conducted the lab work. KPS, XYF and HDF analyzed the data and wrote the article. XNL, HC and XHW helped in sampling. MKC and YKM helped in analysis of data.

Key words

Meat quail, Myogenin gene, Slaughter performance, Association analysis, SNP

DOI: https://dx.doi.org/10.17582/journal.pjz/20191007101045

* Corresponding author: junyanbai@163.com

0030-9923/2021/0002-0789 $ 9.00/0

Copyright 2021 Zoological Society of Pakistan



At present, quail breeding is more and more popular in poultry, and quail is smaller than other poultry, so quail can be used as a good new experimental animal (Zhang et al., 2013; Bai et al., 2016a, 2016b, 2020). The experimental values of quail in teaching and scientific studies are increasing gradually (Bai et al., 2017, 2019; Li et al., 2019). MyoGenin gene (MyoG) is a kind of MyoGenic regulatory factor and it regulates muscle growth together with MyoGenic determination gene, MyoGenic regulatory factor 4, myostatin and MyoGenic factor 5. As a transcriptional regulatory factor, MyoG triggers synthesis of a series of skeletal muscle specific embryonal receptor and contractile proteins. Therefore, MyoG is the only one irreplaceable MyoGenic regulatory factor (Hasty et al.,1993). Subsequently, abundant studies concerning the relationship between mutation of MyoG and human diseases have been reported in the whole world (Knapp et al., 2006). Recently, there are extensive studies on MyoG in China. However, most of them concentrate in formation mechanism of muscles as well as genetic expression and regulation of MyoG (Biressi et al., 2013). Few studies on correlation analysis between MyoG and slaughter performance of meat quail are available, therefore, correlations of MyoG with slaughter performance of meat quail were discussed in the present study, which provided references for marker assisted selection of meat quail.

Materials and methods

Blood samples (5ml each) were collected from vein in the wings of 50 French giant quail and 50 Savimit quail, which were stored in heparin sodium anticoagulant tubes and kept in a refrigerator at -20 for DNA extracting. Quails were slaughtered at the age of 5 weeks and the following slaughter performance indices were recorded: weight, carcass weight, whole net carcass, heart weight, liver weight, breast muscle weight, leg muscle weight, dressing percentage, whole net carcass rate, heart rate, liver rate, breast muscle rate and leg muscle rate.

Primers at loci A and B in the control region of MyoG 5’ were designed according to Wang et al. (2007) and were synthesized by Beijing Dingguo Changsheng Biotechnology Co., Ltd (Table I). The total volume of PCR reactionn mixture was 12 µL, including 8.15 µL of ddH2O, 1.25µL of 10×buffer, 0.75µL of Mg 2+ (25 mmol/L), 0.5µL of DNA template, 0.5µL (10 mmol/L) of upstream primers, 0.5µL (10 mmol/L) of downstream primers, 0.25µL of dNTPs, and 0.1µL of taq enzyme. The thermal cycle program was set as follows: pre-denaturation at 94for 4 min, then denaturation at 94 for 40 s, annealing at 57-60 for 1 min, annealing at 72 for 20 seconds, denaturation, annealing and elongation were carried out for 35 cycles, then elongation at 72 and finally the reaction was completed and cooled and preserved at 4.

After SSCP analysis 5µL denatured buffer (98% formamide, 2% glycerin, 10 m medta, 0.025% bromophenol blue, 0.025% xylene) was taken in 0.2 mL centrifuge tube. 5µL PCR products were added and mixed evenly. After denaturation in water bath at 98 for 10min, 10µL of mixed liquid was added into the point sample hole with a pipette gun, another sample hole was added with 5µL of DL2000 marker as reference. The electrophoresis tank was covered with upper cover, connected with the power supply to start electrophoresis. The electrophoresis conditions were 220V electrophoresis for 15min, then 90V electrophoresis for 6h. After electrophoresis, silver nitrate staining was carried out and the results were photographed.

Analytical model: yijkl = μ+Bi+Sj+Mk+eijkl, Yijkl is the phenotype value of traits, μ is the total mean value, Bi is the effect of the i th variety (i = 1, 2), Sj is the effect of the j th sex, Mk is the effect of the k th genotype effect, eijkl is the residual effect.

Results and discussion

Figure 1 shows the amplified bands of loci A and B in the control region of MyoG 5’. Figure 2 shows genotype at loci A and B of the control region of MyoG 5’ of French giant quail and Savimit quail. For French giant quail and Savimit quail, three genotypes (AA, BB and AB) were discovered at locus A. Besides that, three genotypes (AA, BB and AB) were discovered at locus B.

Tang et al. (2013) discovered one mutation site at exon 1 and exon 3 of MyoG of Jinghai yellow chicken, which involved 3 genotypes. Zhao et al. (2016) discovered 1, 2 and 3 mutation sites in exons 1, 2 and 3 of MyoG of three ear duck. Wang et al. (2007) discovered one mutation site and 3 genotypes at locus A in the control region of MyoG5’ of broiler chicken and found 3 SNPs loci and 6 genotypes at loci B. Wei et al. (2014) found 2 mutation sites and 6 genotypes in the third exon of MyoG of Bian chicken. In this study, polymorphism at loci A and B in the control region of MyoG 5’ of two meat quail groups was tested. Three genotypes were discovered at loci A and B, which were AA, AB and BB. This revealed that MyoG had rich polymorphism in meat quail groups, which was similar to polymorphism repored from other poultries.

Gene frequency and genotype frequency at loci A and B in the control region of MyoG 5’ in French giant quail and Savimit quail are listed in Table II. For locus A, BB frequency of French giant quail and Savimit quail is the highest, reaching 0.531 and 0.750. B allele frequency is the highest, which values 0.582 and 0.833, respectively. Genetic polymorphism of French giant quail is high (He=0.487). For locus B, three genotypes (AA, AB and BB) are detected in Savimit quail, but only AA is detected in French giant quail. For Savimit quail, the highest BB frequency is 0.389 and the highest B allele frequency is 0.569. Genetic polymorphism of Savimit quail is high (He= 0.490).


 

Note: M is Marker DL2000. Lane 1 is French giant quail and Lane 2 is Savimit quail.


 

Note: M is Marker DL2000; A: Lane1 is AA genotype, Lanes 2, 3, 4, 5, 6, 7 is BB genotype and Lane 8 is AB genotype. B: Lanes 9, 11, 12, 13 are BB genotypes. Lanes 10, 15 are AB genotypes. Lanes14, 16 are AA genotypes.

Correlation analysis between polymorphism of the control region of MyoG 5’ and slaughter performance of meat quail is shown in Table III. For locus A, liver weight of AA is significantly higher compared with that of AB (P<0.05), liver weights of AA and AB are similar with that of BB (P>0.05). AA, AB and BB genotypes of A locus in 5’regulatory region of MyoG gene here was no significant effect on other slaughter performance (P >0.05). For loci B in the control region of MyoG 5’, weight, carcass weight, carcass net weight, liver weight, breast muscle weight and leg muscle weight of AA and BB are significantly higher than those of AB (P<0.05), besides, there’s no significant difference between AA and BB in term of weight, carcass weight, carcass net weight, liver weight, breast muscle weight and leg muscle weight (P >0.05). Different genotype has no significant influences on other slaughter performances. (P >0.05).

In studies on correlation between MyoG polymorphism and production performance of poultries,

 

Table I. Primer sequence of A and B loci of MyoG.

Primer

Primer sequence(5’-3’)

Annealing temperature ()

Fragment size

A locus

F:GGTGGGTGTGGGGAATGTGCT

R:CCGGCTTTGCTCTTAACTCT

61.9

203bp

B locus

F:AAACCCACTCCATTGTGC

R:CACTACTTGGCTCCTCTAGTT

57.2

236bp

 

Table II. Polymorphism of myog gene in meat quail.

Polymorphism

A locus

B locus

French giant quail

Savimit quail

French giant quail

Savimit quail

Genotype frequency

AA

0.367

0.083

1

0.250

BB

0.531

0.750

0

0.389

AB

0.102

0.167

0

0.361

Allele frequency

A

0.418

0.167

1

0.431

B

0.582

0.833

0

0.569

Heterozygosity

He

0.487

0.278

0

0.490

Number of effective alleles

Na

1.948

1.385

1

1.963

Polymorphism information content

PIC

0.368

0.240

0

0.370

 

Table III. Association between MyoG gene and slaughter performance of meat quails.

Character

Genotype of locus A

Genotype of locus B

AA

AB

BB

AA

AB

BB

Weight (g)

145.238 ±3.925a

138.200 ±6.459a

140.960 ±3.010a

145.053 ±2.296a

122.646 ±8.229b

145.257 ±4.002a

Carcass weight (g)

137.638 ±3.808a

131.018 ±6.403a

133.575 ±2.925a

137.700 ±2.241a

115.338 ±7.877b

137.507 ±3.910a

Whole net carcass (g)

99.152 ±2.840a

95.482 ±5.018a

97.955 ±2.448a

100.536 ±1.829a

81.869 ±6.139b

102.050 ±3.180a

Heart weight (g)

1.100 ±0.068a

1.055 ±0.097a

1.119 ±0.044a

1.152 ±0.039a

0.892 ±0.108a

1.114 ±0.069a

Liver weight (g)

3.871 ±0.113a

3.427 ±0.166b

3.598 ±0.080ab

3.733 ±0.074a

3.169 ±0.131b

3.714 ±0.133a

Breast muscle weight (g)

31.514 ±1.098a

30.127 ±1.872a

30.940 ±0.936a

31.995 ±0.708a

24.692 ±2.050b

32.593 ±1.481a

Leg muscle weight (g)

7.300 ±0.297a

6.582 ±0.495a

6.845 ±0.177a

7.191 ±0.165a

5.631 ±0.399b

7.014 ±0.280a

Dressing percentage (%)

94.738 ±0.179a

94.712 ±0.272a

94.694 ±0.150a

94.896 ±0.120a

93.940 ±0.223a

94.640 ±0.319a

Whole net carcass rate (%)

68.216 ±0.461a

68.916 ±0.593a

69.165 ±0.472a

69.177 ±0.364a

66.275 ±0.919a

70.182 ±0.616a

Heart rate (%)

1.114 ±0.064a

1.100 ±0.078a

1.151 ±0.046a

1.152 ±0.037a

1.105 ±0.140a

1.092 ±0.060a

Liver rate (%)

3.942 ±0.121a

3.639 ±0.179a

3.786 ±0.119a

3.775 ±0.098a

4.074 ±0.272a

3.682 ±0.161a

Breast muscle rate (%)

31.688 ±0.413a

31.492 ±0.666a

31.390 ±0.362a

31.735 ±0.294a

29.976 ±0.664a

31.802 ±0.718a

Leg muscle rate (%)

14.720 ±0.443a

13.721 ±0.598a

14.077 ±0.224a

14.345 ±0.244a

13.974 ±0.546a

13.746 ±0.335a

 

Note: There are significant differences between the lower-case letters in the table (P < 0.05) and no significant differences between the same letters (P > 0.05).

Bhuiyan et al. (2009) discovered that C1111G mutation in MyoG gene of castle is significantly correlated with weight of living body (P<0.05). Jiusheng et al. (2009) reported that polymorphism of MyoG was significantly correlated with cross sectional area of psoas and water-holding capacity of Jinhua×Meishan pigs(P<0.05). Peng et al. (2007) studied influences of MyoG on some production traits of filial generation of Hubei white pigs, finding two genotypes (AA and AB). These two genotypes had no significant impacts on production traits, such as meat percentage and fat contents in muscles (P >0.05).

For correlation between MyoG polymorphism and production traits of poultries, Wang et al. (2007) discussed correlation of MyoG polymorphism with slaughter traits and meat quality of broiler chicken, finding significantly positive correlation between MyoG and muscle fiber growth of chicken (P < 0.05). Zhao et al. (2016) concluded that two mutations of MyoG could influence breast muscle rate, weight and carcass net weight of duck significantly (P < 0.05). Wei et al. (2014) analyzed correlation between MyoG and slaughter performance of Bian chicken, and recognized two same sense mutation sites on MyoG, polymorphism of these two mutation sites is correlated with slaughter performance of Bian chicken (P < 0.05), expressions of MyoG in breast muscle are far higher than that in leg muscle.This study shows that locus A in the control region of MyoG 5’ has a significant correlation with liver weight of meat quail (P<0.05), locus B is significantly correlated with weight, carcass weight, carcass net weight, liver weight, breast muscle weight and leg muscle weight (P<0.05). These conclusions are similar to those of Zhao et al. (2016) and Wei et al. (2014). To sum up, loci A and B in the control region of MyoG 5’ can be applied as molecular marker of slaughter performance of meat quail during marker assisted selection.

Acknowledgements

Sincere gratitude goes to the sponsor of National Natural Science Foundation (31201777) and Industry-University-Research Cooperation Project in Henan Province (152107000095.0).

Statement of conflict of interest

The authors have declared no conflict of interest.

References

Bai, J.Y., Pang, Y.Z., Qi, Y.X., Zhang, X.H. and Yun, Y.X., 2017. Indian J. Anim. Res., 51: 851-855.

Bai, J.Y., Pang, Y.Z., Zhang, X.H., Yun, Y.X. and Qi, Y.X., 2016a. Brazilian J. Poult. Sci., 18: 519-524. https://doi.org/10.1590/1806-9061-2015-0101

Bai, J.Y., Pang, Y.Z., Qi, Y.X., Zhang, X.H. and Yun, X.Y., 2016b. Brazilian J. Poult. Sci., 18: 027-032. https://doi.org/10.1590/1806-9061-2015-0124

Bai, J.Y., Yang, S., Pang, Y.Z., Wu, X.H. and Li, G.L., 2019. Pakistan J. Zool., 51: 1663-1666. https://doi.org/10.17582/journal.pjz/2019.51.5.1663.1666

Bai, J.Y., Cao, H., Yang, S., Pang, Y.Z., Jiang, M.J., Fan, H.D., Fu, X.Y., Zhang, J.Y. and Shi, H.J., 2020. Indian J. Anim. Res., 54: 392-395.

Bhuiyan, M.S.A., Kim, N.K., Cho, Y.M., Yoon, D., Kim, K.D., Jeon, J.T. and Lee, J.H., 2009. Livest. Prod. Sci., 126: 292-297. https://doi.org/10.1016/j.livsci.2009.05.019

Biressi, S., Bjornson, C.R.R., Carlig, P.M.M., Nishijo, K., Keller, C. and Rando, T.A., 2013. Devel. Biol., 379: 195-207. https://doi.org/10.1016/j.ydbio.2013.04.021

Hasty, P., Bradley, A. and Morris, J., 1993. Nature, 364: 501-506. https://doi.org/10.1038/364501a0

Jiusheng, W., Yuehuan, L. and Ningying, X., 2009. Meat Sci., 81: 108-115. https://doi.org/10.1016/j.meatsci.2008.07.010

Knapp, J., Davie, J., Myer, A., Meadows, E., Olson, E.N. and Klein, W.H., 2006. Development, 133: 601- 610. https://doi.org/10.1242/dev.02249

Li, Y.X., Zhang, X.H., Pang, Y.Z., Qi, Y.X. and Zhao, S.J., 2019. J. Poult. Sci., 56: 84-90. https://doi.org/10.2141/jpsa.0180058

Peng, X.W., Mei, S.Q., Sun, H., Li, L.H., Song, Z.X., Cheng, N., Huan, S., Guo, W.Z., 2007. J. Huazhong agric. Univ., 26: 809-812.

Tang, Y., Wang, J.Y., Zhang, G.X., Shi, H.Q. and Zhang, T., 2013. Chinese J. Anim. Sci., 49: 5-8.

Wang, Q., Liu, Y.P., Jiang, X.S., Yang, C.W., Du, H.R., Qiu, M.H. and Zhu, Q., 2007. Hereditas., 29: 1089- 1096.

Wei, Y., Zhang, G.X., Wang, J.Y., Zhang, T., Tang, Y., Fan, Q.C., Xue, Q., Wang, Y.N., Ding, F.X., 2014. Chinese J. Anim. Sci., 50: 1-5.

Zhang, X.H., Pang, Y.Z., Zhao, S.J., Xu, H.W., Li, Y.L., Xu, Y., Guo, Z. and Wang, D.D., 2013. Br. Poult. Sci.,54: 306-311.

Zhao, Z.h., Li, H., Yi, H.J., Yang, S.L., Peng, B.X. and Bu, X.Y., 2016. Scient. Agric. Sin., 49: 3649-3661.

To share on other social networks, click on any share button. What are these?

Pakistan Journal of Zoology

August

Vol. 53, Iss. 4, Pages 1201-1601

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe