Souvik Ghosh, Nobumichi Kobayashi

British Journal of Virology
...ortant RVA VP7- and VP4- protein encoding genes are important for vaccine development or judging the efficacy of existing RVA vaccines, they do not always provide conclusive information on the overall and complex genetic makeup of RVAs, as the remaining 9 RVA gene segments are also susceptible to the forces governing RVA genetic diversity. Whole genomic analysis of RVAs has revolutionized the study of RVA genomics, providing a plethora of conclusive and vital ...

El-Sayed M. Abdelwhab, Jutta Veits and Thomas C. Mettenleiter

Avian Influenza H5N1 in Egypt: What we Know and What we have to Know?
...n the hemagglutinin (HA) protein which improved the binding affinity to human receptors but simultaneously retained its specificity for avian-receptors. Vaccines were applied nationwide to control the disease in poultry. Meanwhile, the viruses accumulated several point mutations in the HA immunogenic epitopes resulting in antigenic drift and the establishment of infections in vaccinated poultry. The Egyptian H5N1 viruses remain susceptible to oseltamivir, but ...

Kathryne E. Taylor1 and Karen L. Mossman1,2*

...ature regarding the ICP0 protein from herpes simplex virus is complex and frequently contradictory, meaning that although this protein has been implicated in a wide variety of diverse functions, the mechanisms through which it produces these effects continue to be elusive. Recent investigations into the ability of ICP0 to block the activation of antiviral signaling have revealed a potential explanation for some of this confu...

Qin Zhao1,2, Yani Sun1,2, Gaiping Zhang1,3, Frederik Widen4, En-Min Zhou1,2,*

zhouem@nwsuaf.edu.cn

....

...

Weili Kong1, Guangpeng Ma2 and Jinhua Liu1*

...e non-structural 1 (NS1) protein plays a crucial role in moderating the virulence of influenza virus by multiple mechanisms. Due to C-terminal ‘tail’ (CTT) truncation of NS1, there are length variation types of NS1 in different subtype influenza viruses. CTT functions in several ways to defeat the cellular innate immune responses. Here, we discuss those different effects of CTT truncation or elongation of NS1 protein...

Gerald Misinzo1,*, Tebogo Kgotlele1, Epaphras A. Muse1, Jan Van Doorsselaere2, Mikael Berg3, and Muhammad Munir4

...ce analysis of the nucleoprotein (N) gene, the PPRV has been classified into four lineages. Serological investigations in Tanzania indicate that peste des petits ruminants (PPR) was introduced in 2004 in Ngorongoro district bordering Ken- ya before official confirmation of the disease in most districts of Northern Tanzania in 2008. In 2011, the presence of PPRV in goats of southern Tanzania district of Tandahimba bordering Mozambique was reported. The aim of t...

Qingzhong Yu

 

...ting a green fluorescent protein (GFP) gene upstream from the GE sequences of the viral genes and subsequent quantitative measurements of the GFP fluorescence intensity, we have concluded that the P and M junction region is the optimal insertion site for a high level of foreign gene expression by a NDV vector.

...

Malik Ikram Ullah1, Abdul Aziz Khakwani1*, Muhammad Sadiq1, Inayatullah Awan1, Muhammad Munir2, Ghazanfarullah1

... dry matter yield, crude protein, crude fiber and ash percentage were significantly increased with increase nitrogen levels (200, 240, and 280 kg N ha-1). However, highest benefit-cost ratio was estimated when 240 kg N ha-1 was applied which was found best compromise between forage yield and quality for maize cultivar Kissan under the agro-climatic conditions of Dera Ismail Khan, Pakistan. The study also indicates that crude protein

Shumaila Manzoor1, Afshan Ahmed1 and Muhammad Abubakar2*

... against FMDV structural proteins.

...

 Shubhada K Chothe, Bhushan M Jayarao and Suresh V Kuchipudi

...hich can escape the anti-protein environment in the virus infected cells and are likely to be conserved across the species. Here, we summarize our current knowledge about the role of lncRNAs in influenza virus infection and the exciting prospect of exploiting lncRNAs as targets to develop novel anti-viral therapies.

...

Muhammad Imran1*, Muhammad Mobashar2, Muhammad Irfan3, Shazia Hanif4, Sumaira Hanif5 and Muhammad Abubakar6

...ents, the value of crude protein (CP) digestibility coefficient was high (P<0.05) in treatment MLM4 as compared to MLM1. Similar trend was also observed in case NDF among treatments. Daily milk yield and 4 % FCM has increased (P<0.05) in buffaloes fed treatment MLM3 and MLM4 as compared to other treatments. While there was no significant (P>0.05) difference of percentage of fat, protein, lactose, ash, total solids a...

Kang-Seuk Choi

...rising only viral capsid proteins mimic the naive configuration of authentic IBD virus particles. The VLPs show intrinsic immunogenicity and a high safety profile.  Thus, VLPs are considered one of the most promising approaches to vaccine development and are an alternative to inactivated IBD vaccines. In addition, VLP technology has many applications. This paper reviews the potential of VLPs as an alternative to IBD vaccines, along with their specific app...

Jonas Johansson Wensman1*a, Karl-Johan Leuchowius2,3 a, Jiting Yan1, Anna-Lena Berg4, Liv Bode5, Hanns Ludwig5, Sandor Belak6, Ulf Landegren2, Ola Soderberg2, Mikael Berg6

... for studying virus-host protein-protein interactions. BDV P (phosphoprotein) and N (nucleoprotein) have previously been reported to interact with several host proteins, thereby interfering with various signaling pathways. In this study, we focused on some of these interactions (BDV P-HMGB1, BDV N/P-Cdc2). First, we us...

Yongfeng Li, Mo Zhou, Xiao Wang, Libao Xie, Hua-Ji Qiu*

...ently tracking the viral proteins in live cells as well as improving diagnostic methods and vaccines for classical swine fever.

...

Mohammed A. Rohaim1*, Rania F. El Naggar2, Ahmed M. Helal3, Hussein Ahmed Hussein1 and Neil LeBlanc4

...e site of the fusion (F) protein indicated the emergence of PPMV-1 in Egypt. Phylogenetic analysis of the F and haemagglutinin-neuraminidase (HN) genes indicated that the isolate clustered with the PPMV-1 strains recently reported from Israel within subgenotype VIb. Our findings report the emergence of PPMV-1 in Egyptian pigeons and the potential role these wild birds can play in the transmission and evolution dynamics of PPMV-1.

...

Amitha Reena Gomes1, Belamaranahally Muniveerappa Veeregowda2, Sonnahallipura Munivenkatappa Byregowda1, Vinayagamurthy Balamurugan3*

... technology, recombinant protein based vaccines and/or diagnostics are being tested in various heterologous systems across the globe for development of vaccines and/or diagnostic antigens. The recombinant viral proteins, virus like particle based vaccines, bivalent/multivalent vaccines, recombinant viral vectored vaccines, RNA interference as a therapy, suicidal DNAs, synthetic epitopes and peptides, reverse genetics, anti i...

Mohammad Mushfiqur Rahman1, Rokshana Parvin1, Ataur Rahman Bhuiyan1, Mohammad Giasuddin2, Shah Md. Ziqrul Haq Chowdhury3, Mohammad Rafiqul Islam1, Emdadul Haque Chowdhury1*

 

...he partial sequence of N protein.The recent Bangladeshi isolates are somewhat divergent from the earlier Bangladeshi isolate, indicating that the PPRV strains in Bangladesh are continuously changing their genetic character.

...

Muhammad Abubakar1*, Shumaila Manzoor2, Jonas Johansson Wensman3, Emeli Torsson3, Qurban Ali1 and Muhammad Munir4

...bstitutions in the nucleoprotein (NP) gene. Genetic variations within NP gene, and possibly in other proteins which are essentially mediating protective immunity, may explain the extreme infectious nature of the virus and its host-specific pathogenesis. Moreover, understanding the nature of such circulating field viruses is essential to underpin the endemic potential of PPRV and its possible spread to the susceptible wild or...

 Ishfaq Ahmed, Ihsan Mabood Qazi and Suraiya Jamal

...t was found that percent protein (8.93–12.25%), ash (0.52–1.01%) and moisture contents (4.47–7.09%) showed significant (P < 0.05) increase, while fat content (1.41-1.17%) showed significant (P < 0.05) decrease by blending WF with BRF. Similarly, water solubility index (WSI), water absorption index (WAI) and swelling power (SP) showed significant (P < 0.05) decrease as the concentration of wheat flour in the blends increases. The valu...

 Zafar Khan, Asad Sultan, Rajwali Khan, Sarzamin Khan, Imranullah and Kamran Farid

 
...e of the main sources of protein but if contaminated by toxic heavy metals will cause a harmful effect on human health. The concentration of heavy metals (Pb, Cd, Cr, Fe, Mn and Zn) present in poultry egg and meat were determined in the following three districts; Peshawar, Dir Lower and Malakand of Khyber Pakhtunkhwa by using atomic absorption spectrophotometer. In all the three districts the egg albumen was found to contain significantly higher levels of Pb, ...

 John G. Bruno and Jeffery C. Sivils

... that the aptamers bound proteins of the correct molecular weights for intact outer membrane proteins (OMPs), intimins and SLT-2. Some bands on the aptamer Western blots were shared between the “Big 6” non-O157 Shiga toxin-producing E. coli (STEC), E. coli O157 and related Gram negative bacteria. However, unrelated Gram positive bacteria exhibited very few, if any, bands in common with those identified on the E. ...

Mian Shamas Murtaza1, Aysha Sameen1, Nuzhat Huma1 and Fatma Hussain2

...creased the moisture and protein content. The addition of gums further augmented the moisture level owing to owing to their water retention properties. The melt-ability, flow-ability and yield of cheese decreased significantly (p < 0.05) on reducing the fat level, as anticipated. However, the addition of gums gradually improved these aspects with higher values for cheese containing guar gum as compared to xanthan gum. The full fat cheese showed the minimum ...

 Shaoling Lin and Jiamiao Hu

...ify;"> The tegument protein pUL23 of human cytomegalovirus (HCMV) plays an important in the virus pathobiology, however, its role in viral assembly and replication is poorly defined. In this study we demonstrated that HCMV pUL23 interacts with an essential component of capsid, the minor capsid protein (mCP, pUL85). Interaction was determined and confirmed with yeast two-hybrid, GST pull-down and co-immunoprecipitation a...

Wan-Long Zhu* and Gao Wenrong 

...ncrease in mitochondrial protein contents and COX activity both in liver and brown adipose tissue, suggesting that A. chevrieri was more sensitive to cold than that of photoperiod. Together, these data suggested that A. chevrieri mainly depend on increasing thermogenic capacity to cope with cold or winter condition.

...

Zuhao Huang1, Feiyun Tu2 and Dianhua Ke1*

...5 bp and comprises of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and two control regions CR and CCR, which was first reported in the order Coraciiformes. The overall A+T content for the mitogenome is 52%, and the GC and AT skews are -0.400 and 0.108. Unlike to many other birds, no extra base is inserted at certain position relative to ND3. Interestingly, a 484bp repeated sequence appears in both CR and CCR. Genetic distance shows that the differenc...

Laila M. Fadda1, Nouf M. Al-Rasheed1, Iman H. Hasan1, Hanaa M. Ali2,3*, Nawal M. Al-Rasheed1,4, Musaed Al-Fayez5, Aly M. Ahmed5, Nada Almutlaq1, Nehal Qasem1 and Reem Khalaf1

...hydrogenase (LDH), total protein, total bilirubin, hepatic glutathione (GSH), nitric oxide (NO), superoxide dismutase (SOD) and lipid peroxides (LP) levels were estimated. Moreover these biochemical parameters were confirmed by histopathological examination using hemotoxylin and eosin (H&E) and Mason trichrome stains (MTC). Immunohistochemical investigations for the expression of the proapoptotic protein (Bax) and the ex...

Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3*

...a concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii, O. rebecca

Ambreena Hafiz1, Tanzeela Riaz2 and Farah Rauf Shakoori1*

...t was found that soluble proteins, glucose contents and free amino acids increased, whereas glycogen and lipid contents were reduced in all deltamethrin-resistant populations as compared to deltamethrin-susceptible population. Soluble Proteins were significantly elevated (79, 100 and 37%) in 4th and 6th instar larvae and adult beetles of Gujranwala, (14, 24 and 14%) in Okara and (14, 13 and 2%) in D.G Khan populations, respe...

Misbah Riaz1, Qaiser Mansoor2, Maleeha Akram1, Muhammad Ismail2, Parveen Akhtar3, Shakeel Mirza4, Mazhar Qayyum1, Afzaal Ahmed Naseem1, Faheem Tahir5 and Syed Shakeel Raza Rizvi1*

...ify;">The signaling of G protein-coupled receptor 54 (GPR54) is a key regulator of secretion of gonadotropin-releasing hormone (GnRH), whereas GnRH is a crucial neurohormone regulating the secretion of follicle stimulating hormone (FSH) and luteinizing hormone (LH) at puberty. The deficiency in release or action of GnRH leads to hypogonadotropic hypogonadism (HH) characterized by low FSH, LH and testosterone (T) and absent or impaired sexual development at pub...

Siyu Yang1, Fukuan Du2 and Pao Xu1,2*

.... This SS cDNA encodes a protein with 114 amino acids that contains the SS14 sequence at its C-terminus. This putative peptide is identical to that generated by the SS1 gene in other vertebrates. Tissue distribution of C. nasus SS1 mRNA was analyzed by real-time polymerase chain reaction (PCR), which demonstrated high expression level in the brain. During embryogenesis, SS1 mRNA was detected during early-stage embryonic development, decreased during subsequent...

Wenmin Cheng1,2*, Weirong Pan1,2, Yubo Qing1, Yingchao Liu1, Xingqin Zha1,2, Yan Huang2, Jige Xin1,2, Hongjiang Wei1 and Yangzhi Zeng2

...pm) is the most abundant protein in the nucleus of oocytes which can promote in vitro nucleosome formation. In this study, to improve the efficiency of SCNT in Banna Mini-pig Inbred Line (BMI), we obtained the recombinant nucleoplasmin (Npm) by using a prokaryotic expression system and compared the difference on the developmental effects between exogenous Npm and its structural analog, polyglutamic acid (PGA). We chose the pMD18-T vector for Npm expression and...

Giselle R.R. Ayres* and Brandão P.E

... code for non-structural proteins (nsps) that are enrolled in viral transcription, replication and pathogenesis. The last 3’ one-third of the genome codes the four structural and accessory proteins. Nsps act in a complex replication process, made possible by the special characteristics of AvCoV genome. This manuscript aims to present an overview of the main aspects of the current knowledge on the main AvCoV replicase g...

Abdur Rahim1, Ghulam Abbas1, Muhammad Naeem2, Sara Ferrando3, Lorenzo Gallus3, Noor Khan4, Muhammad Hafeez-ur-Rehman4, Abdul Ghaffar5 and Abdul Mateen6

...ferent units showed that protein contents were 50.51% – 61.26% and energy was determined as 4042.0 cal/g – 4558.0 cal/g. Dry mater was calculated as 87.43% – 93.13% and fat was noted as 15.29% – 26.23%. Ash was found to be 12.32%–18.32% and fiber remained as 7.52% – 13.12%. Phosphorus was found as 0.21%–1.8%. In fish meal preparation, 24 species belonging to different families were noted in which the most abundantly us...

Muhammad Hafeez-ur-Rehman1, Farzana Abbas1, Muhammad Ashraf1, Naeem Tariq Narejo2, Khalid Javed Iqbal3, Ghulam Abbas4* and Syedah Andleeb5

... fed on 40%, 35% and 30% protein diet @5% of their live body weight. In 40% protein diet treatment, male fish was injected 1st dose with ovaprim + HCG (0.3+0.3ml) and female fish was given 2nd dose after 24 hrs of intervals with ovaprim (0.2ml), while 1st dose ovaprim (0.7ml)+HCG (1.0ml) and 2nd dose ovaprim (0.7ml) was given to the females. The treatment which was given 35% protein diet r...

Tasnim Farasat*, Saima Sharif, Farkhanda Manzoor, Muneeza Zafar and Shagufta Naz

...female. High density lipoprotein (HDL), both systolic and diastolic blood pressure, cholesterol level and serum insulin were significantly higher (p< 0.05) in proliferative group of diabetic retinopathy, while triglyceride level, HbA1c (%), and low density lipoprotein (LDL) were non-significantly higher (p> 0.05) in diabetic retinopathy groups. To conclude high prevalence of diabetic retinopathy was observed among newl...

Dilawar Hussain* and Abdul Mateen

...ficiency ratio (FER) and protein efficiency ratio (PRE), irrespective the addition of the 4TX in the diets. Among different dietary groups of the fish, % survival was not affected significantly (p<0.05). T1 showed maximum NWG (45.49±3.85), FER (0.739±0.02) and PER (36.36±1.83) when compared to other dietary treatment groups. The addition of 4TX clay in the diets at both 2 and 4 ppm AFB1 concentrations have almost the same effect on the ...

Xiangxing Zhu1, Junyu Nie1, Shouneng Quan1,2, Huiyan Xu1, Xiaogan Yang1, Yangqing Lu1, Kehuan Lu1 and Shengsheng Lu1*

...s carrying a fluorescent protein (DsRed) reporter gene regulated by the 2.2-kb human glial fibrillary acidic protein promoter (hGFAP-DsRed). This study characterized transgene expression in such transgenic Guangxi Bama mini-pigs and their offspring. Our findings indicate that the hGFAP promoter contains matching regulatory elements for directing specific expression in porcine astrocytes. However, the practical application of...

Abdur Rahim1, Ghulam Abbas1*, Lorenzo Gallus2, Sara Ferrando2, Muhammad Hafeez-ur-Rehman3, Abdul Ghaffar4 and Abdul Mateen5

...with diet comprising 40% protein and 20% lipid for 75 days. Higher percent weight gain (% WG), best feed conversion ratio (FCR) and specific growth rate (SGR) were recorded at ration level from 2.5 to 4.5% BW d−1 and feeding frequency of three to four times daily. The moisture, protein and ash contents of whole body of the fish were not significantly (P>0.05) affected by feeding frequency. The highest lipid contents...

Salma Shaheen, Mumtaz Khan, Muhammad Jamil Khan, Saleem Jilani, Zarina Bibi, Muhammad Munir and Mehwish Kiran

 

...ber, vitamin C and crude proteins were also increased in spinach with pressmud + EM application. It was concluded that EM-inoculated pressmud has higher potential to increases soil fertility as well as stimulate spinach growth and quality. Therefore, warrants further testing under field conditions.

...
Sidra Ilyas1, Abdul Rehman1* and Qasim Ilyas2
...r treatment, whereas non-protein thiol levels were higher after Cd and As treatment followed by those of Pb, Cr and Cu treatment. Candida sp. PS33 was able to remove 78% (Cd), 70% (As), 82% (Cu), 65% (Cr) and 87% (Pb) from the medium after 8 days of incubation. This multi-resistant yeast can be used efficiently for the removal of toxic metals from the wastewater.
...
Abdur Rahim1, Ghulam Abbas1,*, Sara Ferrando2, Lorenzo Gallus2 and Abdul Ghaffar3
...ed with artificial diet (protein 42%, lipid 20% and energy 25.2 kJ g-1) for 120 days in three equal meals. On the other hand, control ponds remained without additives. During the whole study period, water quality parameters of the experimental ponds remained as salinity (15‰ -20‰), dissolved oxygen (5.6 to 7.5ml/l), temperature (25°C to 28°C). pH (7.6-7.8), ammonia (NH4-N) and `nitrites (NO2-N) ...
Yang Wang1, Zhide Cheng2, Mengjie Tang3, Haixia Zhou1, Xiaolu Yuan4,Muhammad Aqeel Ashraf5, Shuting Mao1 and Jing Wang1,*
...mal saline. The mRNA and protein expression levels of Ldh-c in plateau pika skeletal muscles were determined by real-time PCR and Western blot. The LDH activities, lactate contents and ATP levels in skeletal muscle were compared between the experimental group and the control group. The results showed that 1) the expression levels of Ldh-c mRNA and protein were 0.804±0.059 and 0.979±0.176, respecti...
Jun Cui, Xiaoxu Zhou, Zhicheng Wang, Derong Kong, Xuemei Qiu, Hongdi Wang and Xiuli Wang*
...ture acclimation-related protein, and it plays an important role in adapting temperature shock. But the research about Wap65 in crucian carp is very limited. In this study, the CDS of Wap65 was firstly cloned and characterized from crucian carp (Carassius carassius). This sequence is 1338bp that encodes a polypeptide of 445 amino acids. The calculated molecular weight of crucian carp Wap65 protein (CcWap65) is ...
K.N. ArulJothi1, M. Abinaya1, B. Suruthi Abirami1, Melvin George2, S. Elangovan3 and A. Devi1*
... receptor class B type I protein (SCARB1) plays an essential role in cholesterol homeostasis. The effect of the polymorphisms in the gene have varying influences on lipid levels and development of cardiovascular disease (CVD) in different populations. In this study, we investigated the association of rs5888 polymorphism with serum lipid levels and CVD risk in an Indian population. A total of 412 samples which included 148 myocardial infarction survivors...
Zafar Iqbal1* and Muhammad Khurshid2 
...low leaf curl virus-coat protein (TYLCV-CP) and African cassava mosaic virus-coat protein (ACMV-CP) were used. However, immunocapture of ToLCNDV could only be achieved by using the TYLCV-CP antisera followed by PCR detection by using specific and degenerate primers. ToLCNDV is geographically wide spread Begomovirus (Family Geminiviridae), considered as a close relative of TYLCV, and cause severe losses for many economical im...

 Eman M. Farghaly1, Ahmed Samy1,2*, Heba Roshdy

...er the deficit in animal protein in developing countries including Egypt. However little is known about the prevalence and antibiotic resistance of major bacterial pathogens such as Escherichia Coli, Staphylococcus aureus Salmonella and Pasteurella spp. in Egyptian quail farms. Such information is important for drug choice and success of treatment as well as spotting the light on emerging antimicrobial resistance that represent major concern for public health....

 Abdul Wajid Khalil and Zafar Iqbal

...1.22±0.05%) while protein (37.46±0.02%) and organic matter (21.25±0.03%) was recorded higher in roots than the aerial parts of B. procumbens. Calcium (309.73±0.06mg/100g), potassium (274.59±0.08mg/100g) and iron (32.58±0.05mg/100g) were found in highest amounts in aerial parts as compared to the roots. The Cadmium metal was not detected while lead was found in permissible limits in both the aerial parts and roots of B....
Abdul Malik1,4, Ghulam Abbas1*, Hameeda Kalhoro2, Illahi Bux Kalhoro3, Syed Sajjad A. Shah4 and Halima Kalhoro3 
...pellets having 35% crude protein at 2% body weight twice a day for 60 days and eggs were collected weekly. Results showed that fertilized eggs were found to be greater in number at low salinity level as compared to higher salinity level. Survival of fry ranged from 1058 to 1100 at salinity level of 0‰ – 20‰ with 5% increment, after which fry number decreased significantly (P<0.05). The fertilized eggs did not differ for the fish at salin...

Mohammad Raoofi and Mohammad Taghi Alebrahim

...ms of nutrient elements, proteins and factors such as ADF, Ash, CF, NDF.

...

Wesam Hasan Mohamed Mady 1*, Bing Liu2, Dong Huang2, A. Arafa1, M.K. Hassan1, M.M. Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

... (HEK) cell line. The HA protein was analyzed using SDS-PAGE followed by Western blot and immunofluorescence assays. The pCAGG-optiH9 vaccine efficacy was evaluated by intramuscular immunization of SPF chickens with different concentrations of plasmid DNA and the sera were collected weekly post vaccination for antibody detection by HI test. All immunized chickens shown high HI antibody titers (9Log2) two weeks post-booster dose. The chickens were then challeng...
Adel Eid Mohamed Mahmoud*
...on coefficients of crude protein and digestible crude protein. Ruminal pH values and ammonia nitrogen concentrations did not show any significant differences among groups.No significant differences were observed in meat chemical analysis of slaughtered animals among different groups. Animals fed BBP recorded insignificant increase in growth rate by 9 g daily with improvement in feeding cost by 10%.Bakery waste can replace co...
Muhammad Tahirand Memoona Shehzadi*
...yield, harvest index and protein content were recorded where seed inoculation with PGPR-1 + PGPR-2 and full dose of recommended chemical was applied during both the growing seasons. Overall the performance of sunflower was better in spring as compared to autumn season. However, it was also noted that the combination of PGPR-1 + PGPR-2 and half recommended doses of chemical fertilizer gave results as full recommended dose of chemical fertilizer alone. Therefore...
Neenish Rana, Nosheen Ehsan, Awais Ihsan and Farrukh Jamil*
...rved that their putative protein products will be thermodynamically stable. The sequence-based predictions suggested that the pseudogenes-derived proteins may involve in different biological functions like translation, energy metabolism, amino acid metabolism and transport and binding.
...

A. K. Chaubey and Satyandra Kumar

Bio-management of root knot nematode and root rot disease by antagonistic fungi and rhizobacteria
...n and cultured in liquid protein supplemented broth medium and culture filtrates (CF) were prepared. In in-vitro test single eggmasses of uniform size were kept in 5ml CF in 5cm diameter Petri plates. Antifungal activity was tested by dual culture of wilt fungus with antagonist fungus and bacteria isolates in PDA media plates. In in-vivo test soil was amended with antagonist and wilt fungal and bacterial isolates 2 x 106 CFU/ml and 2 x 108 CFU/ml respectively ...
Beenish Zahid1,*, Asim Aslam2, Zafar Iqbal Chaudhry2 and Raheela Akhtar2
...s. The Albumin and total protein values were significantly low (P<0.05) in infected groups A and B as compared to control groups C and D on 5th and 7th day. The alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly (P<0.05) high in infected groups A and B. On 3rd, 5th and 9th day five birds from each group were slaughtered and histopathological lesions observed in bur...
Muhammad Mansoor, Zaigham Abbas and Nageen Husssain*
...e individuals. Gluten, a protein fraction commonly found in wheat grains, associated with food related disorders and a number of autoimmune diseases. We hypothesized that gluten containing diet would further exacerbate an already undergoing arbitrary immune reaction in SLE patients. Pristane was injected in female BALB/c mice to induce the disease. After five months, mice in various groups were treated with prednisone and fed with gluten containing and standar...
Bushra Niaz1,*, Tahir Zahoor1, Muhammad Atif Randhawa1 and Amer Jamil2
..., a multifunctional glycoprotein, occurring as awhey constitute in milk secretions of animals and humandisplays a variety of antimicrobial, antioxidant and immunomodulatory as well as a number of other biological functions. Its potential can be exploited in several food applications. Keeping in view the increased demand of natural antimicrobial agents to control prevalence of food borne pathogens in final packaged food products as well as for food preservation...
Burhan Azam1, Muhammad Naeem Tahir2,*, Faisal Shahzad2, Abdul Ghaffar3, Ghulam Abbas4, Madiha Gohar5 and Saima1
...opped. The yield of milk protein, fat, solids not fat and lactose were not affected (P>0.05). Milk fat, solids not fat and lactose concentrations differed (P<0.001) among the treatments but did not show (P>0.05) any linear or quadratic trends with increasing level of enzyme in the diet. Milk protein concentration linearly (P<0.001) increased with increasing level of enzyme in the diets. It is concluded that fibro...
Ayesha Zahid,Ammara Muazzam, Sidra Mustafa, Saba Irshad*,Malik Siddique Mahmood and Rehman Shahzad

 

...onal analysis of mutated protein was anticipated by bioinformatics tools, which manifest mild changes in overall charge but altered post translational modifications in a way which might have a deleterious effect on ion channels anatomy and on the whole, pave ways to the genesis of cataract.
...
Fariha Imtiaz1, Muhammad Islam1, Hamid Saeed2,*, Bushra Saleem1, Maryam Asghar1 and Zikria Saleem2
...tities of carbohydrates, proteins and secondary metabolites in methanol compared to other extracting solvents. Moreover, only ethanol (5 and 10%) and petroleum ether (5%) demonstrated significant hair growth promoting effects (p < 0.05) compared to standard, i.e., 5% minoxidil and extracts in other solvents. Likewise, ethanol (5% and 10 %) and petroleum ether (5%) extract had significant impact (p < 0.05) on hair length in comparison to minoxidil,...

Hussein Aly Hussein1*, Omneya Mohamed Khattab2, Shereen Mohamed Aly2, and Mohammed Abdel Mohsen Rohaim1 

...study, we analysed the G-protein-coupled chemokine receptor (GPCR) genes of two LSDV isolates from Ixodid (hard) ticks (Amblyomma hebraeum) in Egypt. Multiple alignments of the nucleotide sequences revealed that both isolates had nine nucleotide mutations in comparison with the local reference strain, LSDV-Egypt/89 Ismalia. Compared with the GPCR sequences of SPV and GPV strains, 21 nucleotide insertion and 12 nucleotides deletions were identified in the GPCR ...
Rafi Ullah1, Sarzamin Khan1,*, Abdul Hafeez1, Asad Sultan1, Nazir Ahmad Khan2, Naila Chand1 and Naseer Ahmad1 
...ly be used as a low-cost protein constituent in the broiler finisher ration.
...
Viram Kumar1,*, Moolchand Malhi1, Saeed Ahmed Soomro1, Toufique Ahmed Qureshi2, Muhammad Nawaz Sanjrani3 and Khushal Das Malhi1
....05) and the serum total protein and Mg concentrations were significantly lower (P < 0.05) in male compared to female peafowl. In conclusion, the present study provides base-line values for hematology and serum biochemistry of apparently healthy Indian adult blue peafowl of Thar and can be used as reference values to evaluate the health or diseased conditions in the same species.
...
Muzammil Sattar
...ing amounts of different proteins in the diet of adult Chrysoperla carnea (Stephens). Results show that proteins play a vital role in the fecundity, fertility and all the biological parameters of F1 for mass rearing. The tested proteins were: Casein, Protein hydrolysate, Torula yeast and Nu lure. Al these protei...
Muhammad Ayaz1,*, Muhammad Athar Abbas2, Pervez3, Noorulain3, Yasir Amin1, Zubair Ali3, Naila Siddique2 and Khalid Naeem2
...ggs. Identification of H protein was undertaken through hem agglutination Inhibition (HI) test while N typing was done using reverse transcriptase polymerase chain reaction (RT-PCR) procedure. Out of 600 examined locations twenty two (22) H9N2 subtypes isolates were recorded. The total prevalence recorded was 3.66%and out of 498 broiler operations yielded 17 (3.4%) positive isolates and 44 golden type native chicken farms yielded 05 (11.3...

Shahid Iqbal Khattak1*, Mohammad Safdar Baloch1, Khalid Naveed2 and Ejaz Ahmad Khan1

.... However, maximum grain protein content was recorded in soil applied method in comparison to foliar N application. In conclusion, higher results for all the quantitative parameters were observed at 120 kg N ha-1.

...
Aneela Qureshi1, Ammara Ainee1*, Muhammad Nadeem1, Masooma Munir1,2*, Tahir Mahmood Qureshi1, Saqib Jabbar2
...e, color, moisture, fat, protein, ash, NFE and fiber content changed significantly (p<0.05). Gross energy level in cake which is desirable by consumers was reduced but high fiber cake was dark colored, low in volume and with increased hardness. Treatment (T3) containing 5.6g grapefruit albedo powder shows significantly (p<0.05) higher sensory scores in term of color (8.02±0.50), flavor (8.04±0.29), taste (8.18±0.37), mouth...
A. Hamid1,*, M. Ilyas2 and S. Kalsoom3
...C), very low density lipoprotein (VLDL), low density lipoprotein (LDL), high density lipoprotein (HDL) and triglyceride level. Group I comprised control group of induced hypercholesterolemic rats fed on purified diet AIN-93 G. Group II comprised induced hypercholesterolemic rats fed on WBF. Group III comprised induced hypercholesterolemic rats fed on MBF, Group IV comprised hypercholestero...

Wesam Hasan Mohamed Mady1*, Bing Liu2, Dong Huang2, Abdel Satar Arafa1, Mohamed Khalifa Hassan1, Mona Mehrez Aly1, Pucheng Chen2, Yongping Jiang2* and Hualan Chen2

.... The confirmation of H5 protein expression was performed using SDS-PAGE followed by Western blotting and immunofluorescence assays. The humoral immune response was evaluated by intramuscular immunization of specific pathogen free (SPF) chickens with two different concentrations of Egy-H5 plasmid DNA 15µg and 60 µg. Results demonstrate that chickens developed detectable HI antibody titers up to 6log2 within two weeks post-booster vaccination. The c...
Yijin He1, Song Ma2, Bo Liu1,*, Ting Xue1, Qunlan Zhou1, Wu Jin1 and  Kui Chen2,*
...etween speculated fusion proteins. Under bioinformatics analysis, the T2R1 gene without introns was consistent with the structural domains characteristics of this family genes. The translation protein of T2R1 gene displayed with corresponding signal loci and functional domains of this gene family, and the result showed that the taste receptor translated by T2R1 gene belongs to G ...
Syed Makhdoom Hussain1,*, Tasneem Hameed1, Muhammad Afzal2, Arshad Javid3, Nosheen Aslam4, Syed Zakir Hussain Shah6, Majid Hussain5, Muhammad Zubair ul Hassan Arsalan1 and Muhammad Mudassar Shahzad1
...70% and 12.70% for crude protein, crude fat and apparent gross energy as compared to the reference diet, respectively at 1000 FTU kg-1 level. It was concluded that the phytase supplementation to sunflower meal based diet at 1000 FTU kg-1 level is optimum to release adequate chelated nutrients for maximum growth performance of C. mrigala fingerlings. Our results also suggested that phytase supplementation to sunflower meal based die...

Muhammad Abid1*, Tahir Yaqub2, Arslan Mehboob3 and Muhammad Zubair Shabbir4

...arious regions of the NA protein were determined with unknown functions and consequences. These findings warrant future studies for analysis of whole genome sequencing of prevailing H9N2 viruses in Pakistan which may further contribute towards the better understanding of the genetic nature and evolutionary behavior of these viruses in the country.

...
Netti Aryani1, Azrita2, Ainul Mardiah3 and Hafrijal Syandri2*
...kg, made up of 30% crude protein, 7% crude lipid, 6% crude fiber, 12% ash, and 12% moisture as a percentage of fish body weight, with three replicates per treatment. Fish were fed three times per day at 09:00, 14:00, and 18:00. The experiment was carried out for 120 days. Each month, 30 fish were removed from each of the floating net cages to be measured and weighed. The biomass of fish was calculated, and the amount of feed was adjusted. The feeding rate sign...
Tiansen Li1, Meiling Huang2, Zhen Wang1,Fei Guo3,Hui Zhang1,* and Chuangfu Chen1,*
...ts of the outer membrane protein 10 (Omp10) on bacterial survival, virulence, phagosome-lysosome fusion, and apoptosis induction, as assessed in appropriate in vitro (cell culture) and animal models. Results showed the omp10 mutant was dramatically attenuated for survival in macrophages and mice than the parent strain 2308. With decrease in the spleen/body weight ratios of mice infected with omp10 mutants were noted, inhibition of phagosom...

Kamran A. Awan1, Jawad Ali2 and Mohammad Akmal3

...5 in the season. Grains protein was observed high for sowing made on November 15-25 for wheat varieties Dharabi, Shahkar-2013, Pakhtunkhuwa-2015 and Ghanemat-2015 as un-irrigated crop for the area. The study suggests that none of the existing wheat variety has potential to sustain grain yield of wheat if planted on December 5 or thereafter. However, Ghanemat-2015 is relatively better option over the other varieties for Peshawar.

...
Muhammad Tariq Saeed1*, Muhammad Ashfaq Wahid1, Muhammad Farrukh Saleem1, Mumtaz Akhtar Cheema2, Muhammad Shahid1, Abdul-Shakoor1, Abdul-Sattar3
...mes rich in high quality protein and oil. Its cultivation in Pakistan is restricted to few areas due to poor germination and low seed viability. The optimum yield and quality of this oil seed crop is noticeably affected by its lower germination rate. To address the problem of poor germination and low seed viability, a field study was conducted at Agronomic Research Area, University of Agriculture Faisalabad, during spring 2011. The experiment was composed of t...
Furqan Sabir1, Muhammad Tayyab1,*, Bushra Muneer2, Abu Saeed Hashmi1, Ali Raza Awan1, Naeem Rashid3, Muhammad Wasim1 and Sehrish Firyal1
... the size of recombinant protein as 70 kDa. The optimization studies demonstrated the maximal production of recombinant phytase, when the recombinant cells were induced with 1.4 mM IPTG with the post induction time of 6 hours. PHYTN showed maximal activity at 80°C in 50 mM sodium acetate buffer pH 6. Presence of Fe3+ or Cu2+ showed an enhancing effect on the PHYTN activity. Thermostability studies demonstrated th...

Muhammad Sohail1, Muhammad Nauman-ul-Islam1, Hayazuddin2*, Imtiaz Ali Shah1, Abdur Raziq1, Subhan Ullah3 and Arsalan Ali Shah1

...nt (p>0.05) effect on protein, SNF and Lactose contents of the milk. These results concluded that milk yield and milk fat were increased by supplementation of MSC in the dairy cattle ration. The proportion of MSC up to 12% in the ration has shown the best efficiency of production as compare to other rations. 

...
Aqsa Qayyum1*, Masooma Munir1, Saeeda Raza1, Mussarat Gillani1, Saima Kanwal1, Nouman Rashid1, Amer Mumtaz1, Naeem Safdar1, Zarmina Gillani2
...y while ash, fat, fiber, protein, iron, zinc, magnesium and manganese contents increased significantly (p < 0.01). There was a non-significant (p > 0.05) effect on the color, flavor, taste and texture of biscuits. So, it is concluded that replacement of wheat flour with pea flour up to a level of 20% improved the nutritional potential of biscuits without affecting the consumer acceptability score.
...
Masooma Munir1,2*, Aqsa Qayyum1, Saeeda Raza1, Nouman Rashid Siddiqui1, Amer Mumtaz1, Naeem Safdar1, Sahar Shible1, Sohaib Afzal3, Saiqa Bashir4
...good source of fiber and protein but they provide appreciable amount of minerals and phenolic compounds. Swollen basil seeds were used to prepare beverage at three supplementation levels i.e. 0.2, 0.3 and 0.4%. Sensory evaluation of basil seed drink revealed that 0.3% basil seeds supplemented drink was liked most in term of taste, texture and over all acceptability whereas 0.4% basil seeds supplemented drink were least liked as compared to other treatments. It...
Aqsa Mehboob1, Noor Khan1,*, Usman Atiq1, Khalid Javed Iqbal2, Rafia Tayyab1, Syeda Suhaira Batool1, Hafiza Saleha Batool1, Sana Amjad1 and Mehwish Tanveer1 
...ts and control for crude protein while rest of the parameters remained same. Apparent digestibility of crude protein and fat was found non-significantly different among treatments. It is concluded that addition of fenugreek in fish feed can improve growth performance and also protein content of the fish meat as well.
...

Sanjukta Chakrabarti1, Colin J. Barrow2, Rupinder K. Kanwar3, Venkata Ramana1*, Rakesh N. Veedu4,5 and Jagat R. Kanwar3* 

...ial growth factor (VEGF) protein and its family of ligands and receptors (VEGFRs). Survival, proliferation, migration and invasion of endothelial cells which give rise to the vascular network, is mediated through VEGF/VEGFR activation of the signal transduction pathways. Thus blocking VEGF is an efficient strategy for blocking tumor angiogenesis. Several anti-VEGF drugs have been developed over the last two decades and some are still at different development s...
Naheed Bano* and Muhammad Afzal
...ment in body dry matter, protein, fat, energy and ash contents of L. rohita. Acidification and phytase supplementation showed significant (P < 0.05) interaction on body composition and mineral utilization in rohu. Citric acid and phytase supplementation improves the diet by increasing the availability of minerals and quality of fish by positively affecting the body composition of fish. 3% citric acid and 1000FTU phytase proves to be interacted positi...
Talat Bilal Yasoob and Nasir Ali Tauqir* 
....363%, respectively. The protein and energy level were 18% and 2800 kcal/kg, respectively. One eighty day-old broiler chicks were distributed in 18 units having 10 chicks each according to completely randomized design. Feed consumption, weight gain and feed conversion ratio (FCR) were significantly (P<0.05) improved in broilers fed all the experimental diets as compared to control during starter and finisher phases. A quadratic response was also obse...
Jiandong Wu, Miao Ye and Zaigui Wang*
...TG), and low-density lipoprotein-cholesterol (LDL-C) and increasing the concentration of high-density lipoprotein-cholesterol (HDL-C).
...
Xue-yang Wang1, Shang-zhi Zhang1, Ming-hui Liu2, Dong Yu1, Yan Ma1, Dong-qiong Fei1, Hai-zhong Yu1 and Jia-ping Xu1,*
...v>Armadillo (ARM)-repeat protein is involved in many biological processes, including cell–cell adhesion and the Wnt signaling pathway. However, the function of ARM-repeat protein in Bombyx mori has not been completely clarified. In this study, a gene encoding ARM-repeat protein was identified, which has an open reading fragment of 1923 bp, encoding a predicted 641 amino...
Farid S. Ataya,1,2,* Dalia Fouad,3,4 Ajamaluddin Malik,1 Nikolaos E. Labrou,5 Mohamed S. Daoud1,6 and Hesham M. Saeed7
...E3) as a ~24 kDa soluble protein and showed to be catalyticly active towards the model substrate 1-chloro-2,4-dinitrobenzene. The results of the present study provide new information into camelid evolution and give further insights into the diversity and complex enzymatic functions of GST superfamily.
...
Jianping Li1, Qian Jiang2, Wei Chen2, Yumei Li3, Huaizhi Jiang4, Jinlong Huo5 and Qiaoling Zhang2*
... KIT gene and its protein ingoats of different fur colors. The effect of KIT mutations on KIT protein expression was examined in white cashmere and black cashmere goats. A single A→G missense mutation in exon 13 differentiated cashmere goats with different colors. Only a histidine (H)→arginine (R) amino acid (AA) change was detected at KIT exon 13 in both the white cashmere goat and the ...
Amtul Jamil Sami1,*, Madeeha Khalid1, Rehman Shehzad1, Sana Mughal1 and A.R. Shakoori2 
...raction of extracellular proteins at pH 9.5 using Tris-Glycine buffer. Placental lactogen was purified by gel filtration chromatography using Sephadex-G100 and ion exchange chromatography on DEAE- Sepharose, employing a linear salt gradient. SDS-PAGE was used to monitor the purification steps, and protein band was located by immunoblotting technique. Bubaline placental lactogen was purified to homogeneity and showed a molecu...
Jing Xin Mao1,2, Guo Wei Wang2, Yuan She Huang3, Rui Wang2, Guo Ze Wang4, Bing Zeng1 and Fu Yuan Zuo1,*
...div>BPI is a pluripotent protein located in neutrophils and tissue that likely plays a vital role in host defense against GNB (gram-negative bacteria) and their endotoxin by means of its antibiotic and endotoxin neutralizing and disposing functions. BPI has several biological functions in mammals such as human, bovine, pig and rabbit, it also has major influence in the natural defense of the animal body. In this paper, by comparative study on BPI gene expressi...
Pei-feng Yin1,2,Xiu-xiu Li1,Qi-wei Zeng3, Cheng-chen Shen1, Le Gao1 andJian-zhang Ton2,*
...e differential expressed proteins. Almost 78 patho-stress responsive proteins which expression level more than 1.5-fold were identified, where 50 proteins were up-regulated and 28 proteins were down-regulated; The identified proteins were categorized into 16 classes, which are mainly including energy metabolism, gene e...

Muhammad Aqeel Sarwar1,2*, Muhammad Tahir2, Abid Ali3, Manzoor Hussain3, Muhammad Waheed Anwar4, Muhammad Khubaib Abuzar5 and Ijaz Ahmad

...ndex (34.22 %) and grain protein content (8.56%) was obtained with (moringa green manuring).While Among fertilizer levels (100% of RDF) produced maximum plant height (189.02 cm) cob length (18.21 cm), number of grains per cob (438.7), 1000-grain weight (216.57 g), biological yield (17.79 t ha-1) grain yield (6.99 t ha-1) harvest index (39.37%) and grain protein content (8.78%). It can be concluded from above results that alo...
Hailong Dong1, Hui Zhang2, Kun Li2, Khalid Mehmood2,3, Mujeeb Ur Rehman2, Fazul Nabi2, Yajing Wang2, Zhenyu Chang1,2, Qingxia Wu1,* and Jiakui Li1,2,*

 

...) and outer membrane protein (ompA). Moreover O-antigen serotype was tested by slide agglutination test and a mouse model was built to assess the lethality of the E.coli isolates through subcutaneous-infection. Out of 81 E.coli isolates, the most prevalent gene detected was ompA (90.12%), followed by ETT2 (69.14%), irp2 (54.32%), EAST1 (46.91%), CS31A (41.98%), estB (19.75%), eaeA (14.81...
Anan Kenthaoand Pornpimol Jearranaiprepame*
...ce as source of low-cost protein in Lower Mekong Region. The present study applied multivariate morphometric technique to identify fishery management units of C. apogon from six populations of three different river drainages: Pong, Chi, and Mun Rivers. Thirty-two truss measures and standard length were obtained using digital calliper from 291 fish individuals, and raw measured data were then subjected to allometric equation to remove size-dependent vari...
Aqsa Imtiaz and Abdul Rehman*
...d copper ions. A 130-kDa protein was detected from feather-treated bacterial cells, suggesting its role in degrading feather. B. subtilis BML5 can be used to overcome the poultry wastes based environmental pollution and keratinase could be used to improve feather meal digestibility in animal feed as an additive.
...
Muhammad Saqlain1, Humaira Kalsoom1, Muhammad Fiaz1,2, Abid Mahmood1, Rizwan Aziz Qazi4 ,Waseem Safdar5, Pakeeza Arzoo Shaiq1,Bernard M.Y. Cheung3 and Ghazala Kaukab Raja1,*
...tinal fatty acid binding protein in the pathogenesis of MetS.
...
Serap Gelibolu1,*, Yasemen Yanar2, M. Ayce Genc3 and Ercument Genc4
...rease in live weight and protein efficiency rates when were directly compared with mock-treated fish control. However, there was no statistically supported level of significance was observed for growth rates and feed conversion rates among groups. Improved live weight and protein efficiency rates reflected positively on the survival rate in MOS-fed fish. Interestingly, the whole body and fillet fatty acid composition shown n...
Lihong Qin1, Guoliang Zhang1, Chaojie Zhu1, Jian Wu1, Zhihui Zhao2,* and Yumin Zhao1,*
...addition, genes mRNA and protein levels were detected after bull testicular Sertoli cells were transfected with miR-122 and miR-449a. Meanwhile, DUSP4, PDK4 and FKBP1B overexpression experiments were conducted. Eventually, MTT assay was performed to observe the cells proliferation. The results showed that miR-122 and miR-449a were highly-expressed in testis tissues (p<0.01). The expression levels of miR-122 and miR-449a in the 24-month-...
Bian Xunguang1,2, Li Jiancheng1, Xu Chu1 and Yang Li2,3,4,*
...ibution of intracellular proteins in the oviduct of the hen, which provides an important basis for the regulation of the physiological activities of poultry oviduct and the molecular mechanism of sperm storage.
...
Tanzeela Riaz1, Farah Rauf Shakoori2,* and Syed Shahid Ali3
...hydroxylase) and soluble protein contents of a wheat grain pest, Trogoderma granarium collected from godowns of Punjab, Pakistan. Six populations of khpara beetle with different levels of susceptibility to phosphine were used in this study. Based on LC50, five populations (previously exposed to phosphine for 15 years)viz., Mandi Bahauddin-I (MBDIN-I), Mandi Bahauddin-II (MBDIN-II), Gujrat, Gujranwala and Sargodha were labeled as phosph...

Irfan1* , Arshad Javid2 , Muhammad Altaf3 , Muhammad Shahbaz3 , and Khalid Javed Iqbal4 

...±0.58 g/dL, total protein 5.35±0.55 g/L, urea 26.95±0.65 mg/dL, creatinine 0.83±0.01 µmol/L, alanine aminotransferase (ALT) 35.56±1.16iu/L and aspartate aminotransferase (AST) 44.16±1.83 iu/L were recorded for adult birds while alkaline phosphatase (ALP) values were significantly (P<0.05) higher 104.86±16.39 iu/L in grower birds. Similarly, the rearing systems also influenced biochemical parameters of M...

 Asma Akhtar, Abdul Rehman

...ial pattern of bacterial proteins in tellurite stress was obtained by SDS-PAGE. Both bacterial strains can be utilized to convert toxic tellurite into its elemental form from the contaminated sites.

...

Hafiz Muhammad Tahir1, Khanum Zahra2, Arooj Zaheer2, Khizar Samiullah3

...s categorized as fibrous protein. Spiders produce several types of silk. Spider silk is important because of its maximum mechanical strength, biocompatibility and biodegradability, pore filling ability and very low immunogenicity. In this review structure and types of silk producing gland, spinning process, chemistry of spider silk fiber, mechanical properties and applications of silk in health, military industry and many other fields is discussed. Its antifun...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4 and Lorenzo Gallus
...ial floating pellet (35% protein) at 3% body weight per day for 40 days. Results showed that fish growth was significantly (P<0.05) higher in term of weight gain, WG % of initial weight, mean daily WG, SGR, feed conversion and survival rate from 15‰ to 30‰ salinity than those reared in 35‰ and 40‰ salinity. Condition factor was found to be significantly higher on 40‰ salinity than 15‰ to 35‰ salinity. Feed co...
RuiHua Zhang, YongFang Jia, TingTing Liang, QianWen Yang, QiYan Du and ZhongJie Chang*
..., 784 and 602 amino acid protein, respectively. Chromosome synteny analyses revealed that CcSox5 and CcSox13 weretightly linked with the etnk gene, which was conserved in all species; however, there were no conserved regions flanking CcSox6. Numerous essential transcription factor binding sites (TFs) were predicted within the 2000 bp upstream of the 5’ end of these genes. These TFs include BSX, BRN4 and NGN–NEUROD, which have b...
Yunjun Yan, Zhenming Lü, Tianming Wang, Yongjiu Chen, Jingwen Yang, Baoying Guo, Lihua Jiang, Changwen Wu and Liqin Liu*
...ide pairs and encodes 13 proteins, 2 ribosomal RNAs (rRNAs), 22 transfer RNAs (tRNAs) and a major long noncoding region (LNCR) of the mitochondrion’s own protein synthesizing system. Seven of thirteen proteins, eight tRNAs are encoded by the plus strand, while the other proteins and tRNAs, as well as two rRNAs are encoded by the minus strand. Two (...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Sara Ferrando4, Lorenzo Gallus4 and Syed Sajjad A. Shah2,3
...d constituting 35% crude protein with 2% body weight twice a day. Eggs were collected on weekly basis by cultch removal method. Results showed that the highest fecundity, fertility, hatchability and survival of fry were obtained on salinity of 0%-15% and significantly decreased on 20‰ and 25‰. The eggs per gram body weight were also recorded in all treatments and highest eggs were obtained i.e. 4.0-4.3 per female on 0‰-15‰. W...
Jo Ik-Hwan1, Choi Kwang-Won1 and Muhammad Fiaz2,*
...reased (P<0.05) crude protein (CP) yield and carrying capacity for Hanwoo heifers than that of rye monoculture. DM and TDN yield under 100 kg manure was higher (P<0.05) than control and 50 kg N/ha levels but not different (P>0.05) with that of 150 kg N/ha. Manure levels did not affect (P>0.05) protein yield. The carrying capacity for Hanwoo heifers was not different among zero, 50 and 100 kg manure levels, wherea...
Abdul Malik1,2, Ghulam Abbas1,*, Abdul Ghaffar3, Ghulam Dastagir4, Sara Ferrando5, Lorenzo Gallus5, Asad Ali Muhammad1,6, Abdul Jabbar2 and Khalil-ur-Rehman2 
...ial floating pellet (35% protein) with 3% of total biomass day-1 for 50 days. Results showed that the growth increment reared on 10‰ - 20‰ salinity were significantly highest in term of weight gain, WG % of initial weight, daily weight gain, specific growth rate, condition factor and survival rate than those reared on 25‰ and 30‰. Feed conversion ratio was found similar in all levels which is not significantly different (...
Muhammad Hafeez-ur-Rehman1,Farzana Abbas2,Ghulam Abbas3,*, Arshad Javid4, Ali Hussain4, Syedah Andleeb5,Khalid Javed Iqbal6 and Muhammad Akmal1

 

...ect of different dietary protein levels on the growth and chemical conformation of broodfish and its eggs. There were three treatments (T1, T2 and T3) and a control with three replicates in each group. Control group was exclusively fed on natural food composed of tilapia fry while fish in T1 was fed on 30%, T2 on 35% and T3 on 40% protein diet, respectively. A...
Muhammad Aqeel Sarwar1*, Abid Ali2, Manzoor Hussain2, Saadia3, Muhammad Khubaib Abuzar4, Ijaz Ahmad5 and Sohail Latif6
...(5.40 t ha-1) protein contents (12.52%), nitrogen (28.22kg kg-1), phosphorus (34.85 kg kg-1) and potassium (47.40 kg kg-1) use efficiency were obtained with the treatment F2 (100% recommended dose of NPK).While in seed inoculants, maximum values of yield and yield contributing parameters were obtained in I1 (Inoculation with Azospirillum). However despite the better performance of F2...
Yanjie Guo1, Weini Wu1, Hongmei Wang2, Xiao Guo2 and Yongping Xu2,*
...t IL-18Rα mRNA and proteins are expressed in the IMG, which provides molecular evidence for the study of immune and neuro-modulation in the female reproductive system.
...

Muhammad Naeem Safdar, Khalid Naseem, Muhammad Amjad, Amer Mumtaz and Saeeda Raza*

...d grains, moisture, ash, protein (N x 5.7), wet and dry gluten, falling number, and minerals (copper, manganese, iron, zinc). It was observed that wheat samples varied considerably within each region and also between regions. Attock region samples had highest test weight (80.50 kg hl -1), protein (11.80 %) and lowest nonedible foreign matter (0.45%) and broken/shrunken grains (0.88 %). Highest wet and dry gluten (27.44 % and...

 Abdullah Adil Ansari* and Kumar Sukhraj**

...r percentage of fats and protein content in VW+VC when compared with those grown with chemical fertilizers by 23.86% and 19.86%, respectively. The combination treatment [VW+VC] also have a significant influence on the biochemical characteristics of the soil with marked improvement in soil micronutrients. The combination treatment [VW+VC] was found better suggesting qualitative improvement in the physical and chemical properties of the soil, which is substantia...

 Shazia Erum, Rashid Anwar and Shahid Masood*

...e analysis of total seed proteins of Kasuri methi (GI of Kasur, Pakistan) was evaluated with other Trigonella genotypes by SDS-PAGE. Results showed that at protein level Kasuri methi acquired a unique status as a G.I of Kasur. Cluster analysis (UPGMA) of 28 genotypes including both methi and methray from various agro ecological zones of Pakistan were interlinked to some extent however Kasuri methi make their identity by stan...

 Shazia Erum*, Muhammad Naeemullah, Shahid Masood** and Muhammad Irfan Khan*

... the basis of total seed protein and phenotypic characters, except Siam Queen and Lime basil stand alone, respectively. Euclidian distance for morphological traits ranged from 3.60 to 7.26. Conversely on the basis of total seed proteins genetic distances ranged from 0.11 to 1.00. Due to greater genetic diversity in Ocimum germplasm and its suitability for commercial cultivation even in the area under small holdings, the inve...

Iracema Nunes de Barros1,2, Luciane Dubina Pinto3, Rosely Bianca dos Santos Kuroda1, Sheila Oliveira de Souza Silva1, Leonardo José Richtzenhain1,2, Cláudio Wageck Canal3 and Paulo Eduardo Brandão1,2* 

...d (N) and non-structural protein 3b genes. Out of the samples collected, 40.17% were positive for CCoV; 57.45% of CCoV-infected animals showed enteritis and most of these (76%) were younger than 3 months and unvaccinated. Distance genealogy using CCoV sequences from GenBank for M gene showed that eight strains were CCoV-II twenty-six were CCoV-I. These findings show some genetic features of CCoV in Brazil and may require future studies to elucidate full genome...
Maryyum Khalil1, Hamda Azmat1,*, Noor Khan1, Arshad Javid2, Ali Hussain1, Syed Makhdoom Hussain3, Asim Ullah1 and Sumaira Abbas1
...n;0.36 g). The 40% crude protein diet was prepared by adding feed ingredients along with 0.75, 0.50, 0.25, 0.00 g kg-1 of α-amylase as T1, T2, T3 and T4 (control). At the end of feeding trial, 100% survival rate was recorded. Growth rate was significantly increased in fish fed with enzyme supplemented diets in comparison with control group. The maximum increase in growth rate was recorded in treatment # 2. Highest prot...
Saba Rafique1,2,*, Khalid Naeem1, Naila Siddique1, Muhammad Athar Abbas1, Aamer Ali Shah2, Akbar Ali1, Abdul Rahim1 and Farooq Rashid1
...to 974 base pairs. The S protein sequence was submitted to the GenBank with accession number KU145467. Phylogenetic grouping and maximum nucleotide sequence identity values were used to identify the isolate that looked to be derived from recombination. It showed maximum nucleotide homology 99.5% with ck/CH/LHB/121010 (KP036503), India/IBV572 (KF809797) and Japan/JP/Wakayama-2/2004 (AB363951.2) and 99.3% with 4/91 vaccine (KF377577), Iran/491/08 (HQ842715) and ...
Amtul Jamil Sami1,*, Sehrish Bilal1, Madeeha Khalid1, Muhammad Tahir Nazir1 and A.R. Shakoori2

 

...>T. castaneum enzyme protein. Computational studies inidicate that A. mellifera enzyme had a little binding affinity for saponin as compared to T. castaneum AChE. The amino acid residues of T. castaneum AChE identified at positions 259(SER), 176(SER), 173(GLY), and 502 (HIS) are involved in binding with saponin molecule to form four hydrogen bonds. Whereas in A. mellifera hydrogen bonds are formed at two positions by SER 171 and...

 Saima Rani and Irum Raza*

COMPARISON OF TREND ANALYSIS AND DOUBLE EXPONENTIAL SMOOTHING METHODS FOR PRICE ESTIMATION OF MAJOR PULSES IN PAKISTAN
...xpensive livestock-based protein-rich food will be badly affected.

...

 Munir Ahmad* and Asif Ali Mirani**

HEATED AIR DRYING OF GROUNDNUT
...roundnut contains 25-32% protein and 42-52% oil, therefore, it has the potential to become a significant contributor to edible oil production in Pakistan. It is harvested in October-November in Pakistan, when the weather is cold, and it is not possible to dry it down to a safe moisture level by sun drying. Therefore, the chance for developing aflatoxins in it is high. To solve this problem of the groundnut growers, a low cost mobile flat-bed dryer designed and...

 Nasia Batool*, Imtiaz Ahmad Qamar**, Imdad Hussain Mirza** and Muhammad Fateh Ullah Khan**

MIXING LESS PALATABLE GRASSES WITH UREA, MOLASSES AND EFFECTIVE MICROORGANISMS AND ITS EFFECT ON CHEMICAL COMPOSITION AND DIGESTIBILITY IN GOATS
...s was carried out. Crude protein content of mixtures improved as compared with sole grasses. Digestibility of HC supplemented with urea, molasses and EM in various combinations was also studied in growing goats. The highest digestibility of DM in goats was recorded in HC + 4% urea + 4% molasses treatment (85.51%) followed by HC + 4% urea (78.57%) and HC + 4% urea + 4% molasses + 1:100 EM (78.00%).

...

 Khalid Naseem*, Naseem Bibi**, Saeeda Raza*, Amer Mumtaz*, Nouman Rashid Siddiqui*, Amina Bibi*** and Muhammad Ahsan Khan****

DEVELOPMENT, CHARACTERIZATION AND EVALUATION OF HIGH ENERGY BISCUITS FOR COMBATING MALNOURISHMENT AMONG CHILDREN IN PAKISTAN
...t the highest values for protein, zinc and iron. Results of all treatments were in acceptable range regarding sensory evaluation. These results indicate that biscuits can be successfully supplemented with chickpea and oat. According to sensory evaluation, biscuits containing 20% chickpea and 15% oat were found to be the best among all treatments and could be a potential composition for preparing high energy biscuits for malnourished areas of Pakistan.

...

Ayesha Tahir* and Sonila Hassan**

ECONOMIC FEASIBILITY OF SMALL SCALE BUTTON MUSHROOM PRODUCTION IN PAKISTAN
...s widely cultivated as a proteineous vegetable in many countries of the world including Pakistan. Its cultivation requires less space, care, equipment and cost compared to many other crops and livestock. The present study was conducted in 2010 to estimate the profitability of small scale button mushroom production at National Agricultural Research Centre (NARC) Islamabad, Pakistan. The cost of production methodology was used for this study. The yield and gross...

 Adnan Umair*, Safdar Ali**, Muhammad Sarwar***, Kashif Bashir**, Muhammad Javed Tareen**** and Muhammad Asghar Malik*****

ASSESSMENT OF SOME PRIMING TECHNIQUES IN MUNGBEAN (VIGNA RADIATA) : A GREEN HOUSE STUDY
...riming also improved the protein concentration at the early stage of seedlings. Phosphorous application through priming significantly improved germination up to 95%, seedling -1 vigour index up to 23.05 and protein content up to 2.17 (g FW).

...

 Imtiaz Ahmad Qamar*, Maqsood Ahmad*, Gulshan Riaz* and Sartaj Khan*

PERFORMANCE OF SUMMER FORAGE LEGUMES AND THEIR RESIDUAL EFFECT ON SUBSEQUENT OAT CROP IN SUBTROPICAL SUBHUMID POTHWAR, PAKISTAN
...an had the highest crude protein content (23.2 %) followed by cowpea (22.6 %), lablab bean (21.6 %), rice bean (20.1 %) and sesbania (19.1 %). Millet had the lowest crude protein content of 6.2%. Dry matter yield of oats owing to the previous crops was least after millet (7.5 -1 -1 tha ) and ranged from 8.5 to 8.9 tha after sesbania, cluster bean and cowpeas. Differences in crude protein c...

 Mustaring,* I. Subagyo,** Soebarinoto** and Marsetyo*

 
GROWTH, YIELD AND NUTRITIVE VALUE OF NEW INTRODUCED BRACHIARIA SPECIES AND LEGUME HERBS AS RUMINANT FEED IN CENTRAL SULAWESI, INDONESIA
...llage number (64), crude protein (CP) content (8.64%), in vitro organic matter (OM) digestibility (47.36%) On the other hand, B. mulato had highest tillage number (117) and DM yield (0.79 kg -2 DMm ). Legume herb species affected significantly (P<0.05) plant height, yield, in vitro digestibility. At 8 weeks of age Dolichos lablab showed the -2 highest plant height (189 cm), DM yield (0.45 kg DM m ) and in vitro OM digestibility (71.12%). The nutrient conten...

 Saima Rani*, Hassnain Shah*, Umar Farooq** and Bushra Rehman**

SUPPLY, DEMAND, AND POLICY ENVIRONMENT FOR PULSES IN PAKISTAN
...lation in fulfilling the protein demand. Hence there is need to increase production through improving management practices and dissemination of improved technologies.

...

 Syeda Nasreen*, Mehwish Ishaque**, Muhammad Ayub Khan*, Saleem-ud-din* and Syeda Musarrat Gilani*

COMBINING ABILITY ANALYSIS FOR SEED PROTEINS, OIL CONTENT AND FATTY ACIDS COMPOSITION IN SUNFLOWER (HELIANTHUS ANNUUS L.)
...alues for seed 1 1 total proteins, oil content and fatty acids composition. Among parental lines, CMS-64, CMS-53, CMS-H55-2-2-1 and CMS-53 were the best general combiners for seed total proteins, oil content, oleic and linoleic acid, respectively. Among males, C-206-R, SF-187R, RHA-295 and RHA-854 were the potential parents exhibiting desirable GCA for seed total proteins, oil content, ole...

 ZafarUllah*, Muhammad Azim Malik*, Muhammad Ansar*, Shahzada Sohail Ijaz* and Muhammad Rasheed*

WINTER FORAGE QUALITY OF OATS (AVENA SATIVA), BARLEY (HORDEUM VULGARE) AND VETCH (VICIA SATIVA) IN PURE STAND AND CEREAL LEGUME MIXTURE
...e higher values of crude protein (CP) and lower values of neutral detergent fiber (NDF) and acid detergent fiber (ADF) reflected quality forage. CP for oats in oats-vetch -1 -1 mixture and barley in barley-vetch mixture was 175 g kg and 170 g kg , -1 respectively. NDF and ADF for oats in oats-vetch mixture were 494 g kg -1 and 341 g kg , respectively; while these values for barley in barley-vetch -1 -1 mixture were 340 g kg and 176 g kg , respectively.

...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Abdul Razzaq*

EFFECT OF MIXING LOW PALATABLE GRASSES AND IPIL IPIL LEAVES ON FORAGE QUALITY
...ximate parameters (crude protein (CP), crude fiber (CF), total ash and ether extract (EE)). The results revealed that there were significant differences in dry matter (DM) among different grasses. DM content of low palatable grasses was generally high (70-75%) as compared to Ipil ipil leaves (45-55%). DM content among mixtures was also variable. For the treatment grass 75% + Ipil ipil 25%, DM range was 65-70%, for grass 50% + Ipil ipil 50%, it was 60-65% and f...

 Maimoona Bashir*, Imtiaz Ahmad Qamar*, Muhammad Fateh Ullah Khan* and Raheel Babar*

EFFECT OF MIXING LOW PALATABLE GRASS OF HETEROPOGON CONTORTUS WITH IPIL IPIL LEAVES ON DIGESTIBILITY IN GOATS
...% dry matter (DM), crude protein (CP) and crude fibre (CF) consumption among all the treatments. The digestibility percentage of dry matter intake (DMI) varied among the treatments ranging from 68.25% to 41.66%. Mixtures of low palatable grass and Ipil ipil were in general more digestible with more than 65% dry matter digestibility. The lowest digestibility of dry matter (41.66%) was observed in HC 100%. A similar trend was noted for CP digestibility. However,...

 Muhammad Ayub*, Rizwan Maqbool*, Muhammad Tahir*, Zoaib Aslam*, Muhammad Ather Nadeem* and Muhammad Ibrahim**

IMPROVED GROWTH, SEED YIELD AND QUALITY OF FENNEL (FOENICULUM VULGARE MILL.) THROUGH SOIL APPLIED NITROGEN AND PHOSPHORUS
...arvest index by 162% and protein content by 6%. However, fertilizer NP -1 (90:45 kg ha ) decreased oil content by 26%. Therefore, addition of NP fertilizer had the potential to increase fennel seed yield, but reduce oil content, under Faisalabad conditions.

...

 Muhammad Akhter*, Muhammad Azhar Ali**, Zulqarnain Haider* and Shahzad Muzammil***

PHYSICO-CHEMICAL CHANGES IN GRAINS OF SOME ADVANCE LINES/ VARIETIES OF RICE (ORYZA SATIVA L.) AFTER PARBOILING
...matter, crude fat, crude protein, crude fiber, vitamin B6; milling quality parameters such as total milling recovery, head rice recovery, ratio of broken grains and cooking quality parameters such as curling, bursting and cooked grain length. The study showed significant variation in efficacy of parboiling to different varieties/lines. The results clearly showed average increase in mineral contents in terms of ash% increase, dry matter, longer cooked grain len...

 Riaz Hussain*, Muhammad Riaz**, Mushtaq A. Saleem*** and Muhammad Ishaque Mastoi**

BIOCHEMICAL ABNORMALITIES INDUCED BY ABAMECTIN IN SIXTH INSTAR LARVAE OF THE RED FLOUR BEETLE, TRIBOLIUM CASTANEUM (HERBST)
...phosphatase (AcP), total protein, soluble protein and free amino acids (FAA). The sixth instar larvae of T. castaneum were released and exposed for 48h without food on abamectin treated glass petri dishes. The surviving ones were then homogenized in saline and centrifuged prior to biochemical analyses. Results showed differences in the activities of enzymes and quantities of total protein,...

 Muhammad Arshad Ullah*, Nazir Hussain**, Helge Schmeisky*** and Muhammad Rasheed**** 

IMPROVING FODDER QUALITY OF PANICUM GRASS THROUGH INTERCROPPING OF LEGUMES AND THEIR INOCULATION
...n. The 6-7% higher crude protein (CP) of mixed fodder was recorded from 67% intercropping in comparison to grass alone while inoculation increased it by further 1-2%. Results also suggested that total digestible nutrients (TDN) were increased by 2-4% as compared to other treatments.

...

 Zafar Abbas*, Ijaz Ahmad**, Adnan Shakeel**, Muhammad Abdullah***, Muhammad Islam**, Sadiq Muhammad*, Ghulam Murtaza* and Mushtaq Ahmad**

EFFECT OF PHOSPHORUS FERTILIZER AND WATER STRESS ON PROTEIN AND PHENOLIC CONTENTS IN COTTON (GOSSYPIUM HIRSUTUM L.)
...tative analysis of total protein and phenolic compounds, respectively. Proteins were greatly affected by fertilizer treatment and water stress, but phenolic compounds remained unchanged upon fertilizer treatment. However, they were greatly affected by irrigation and water -1 stress. Crop treated with 100 kg ha P O under water stress maintained high 2 5 protein content as compared to unfert...

 Saima Kanwal*, Saeeda Raza*, Khalid Naseem*, Muhammad Amjad*, Naseem Bibi* and Musarrat Gillani*

DEVELOPMENT, PHYSICO-CHEMICAL AND SENSORY PROPERTIES OF BISCUITS SUPPLEMENTED WITH PUMPKIN SEEDS TO COMBAT CHILDHOOD MALNUTRITION IN PAKISTAN
...our (20%) 5 with maximum protein (12.30%), fat (28.29%), ash (4.13%), iron (2.28%) and zinc (3.11%). Sensory results also revealed increasing trend in all sensory parameters. Results showed acceptability at all levels but treatment T with 15 % pumpkin 4 seed flour scored highest (8.0) for maximum overall acceptability. It was concluded that pumpkin seed flour can be supplemented successfully to partially replace wheat flour to prepare highly nutritious biscuit...

 Doulat Baig*, Fida Mohammad Abbasi*, Habib Ahmed*, Maqsood Qamar** and Muhammad Ayub Khan**

RESPONSE OF SUNFLOWER HYBRIDS TO DIFFERENT NITROGEN LEVELS FOR PHYSIOLOGICAL AND AGRONOMICAL TRAITS UNDER FIELD CONDITIONS
...d yield of the crop. The protein is wholly dependent upon the amount of nitrogen fertilization available in soil for the plant use. A two year study was conducted in 2012 and 2013 at National Agricultural Research Centre (NARC), Islamabad, Pakistan. The experiment was aimed to –1 –1 evaluate the effect of different nitrogen (N) levels (N = 0 kgha , N = 60 kgha , N = 0 1 2 –1 –1 –1 –1 80 kgha , N3 = 120 kgha , N4 = 180 kgha a...

  Sohaib Arshad*, Sarwat Naz Mirza*, Imtiaz Ahmad Qamar** and Maqbool Shahbaz**

DETERMINATION OF FORAGE QUALITY OF INDIGENOUS AND EXOTIC RHODES GRASS ACCESSIONS UNDER RAINFED CONDITIONS
...e energy, carbohydrates, proteins and other important minerals. As global warming is increasing, overall water scarcity is resulting in deterioration of natural resources, and it is need of the hour to find fodder crop resources which are more accustomed to change climatic conditions. Hence, different exotic and indigenous varieties of Rhodes grass were tested for quality and yield parameters. Three varieties were imported from Australia and Zimbabwe namely Sa...

 Muhammad Tahir* and Nawal Zafar* 

FORAGE YIELD AND QUALITY PERFORMANCE OF RABI CEREALS SOWN ALONE AND IN BLENDED POPULATION AT VARIABLE SEED RATIOS
...00% seed ratio and crude protein percentage was highest when oat was blended together with barley at 75% + 25% seed ratios.

...

 Muhammad Tahir* and Neelam Yasin*

EFFECT OF MICRONUTRIENTS FOLIAR APPLICATION ON YIELD AND QUALITY OF MAIZE
...ld, harvest index, grain protein and grain oil contents. However, micronutrients application at stem elongation stage showed non-significant effect on plant papulation and number of cobs plant . Therefore, for attaining maximum yield of maize, it is suggested that 250 ml ha at stem elongation stage of maize should be used.

...

 Tassadduq Rasool*, Ali Zohaib*, Ehsanullah*, Riaz Ahmad*, Tasawer Abbas*, Tahira Tabassum*, Muhammad Ather Nadeem*, Mahmood-ul-Hassan*

FORAGE YIELD AND QUALITY IN PEARL MILLET-SESBANIA INTERCROPPING SYSTEM UNDER VARIOUS GEOMETRICAL PATTERNS
... to sole-cropping. Crude protein (84%) was improved most by cross planting over sole pearl millet, while, crude fiber (36%) and ash contents (20%) were improved by blended seed sowing, as compared to sole cropping of sesbania. Potential benefits of forage pearl millet can be acquired by intercropping with sesbania and following the planting geometry of sesbania intercropped in 45 cm apart two-row strips of pearl millet.

...
Yanling Xia1,2, Heping Li2, Yuntao Liang2, Jichen Zhao2, Binshan Lu2 and Di Liu1,*
...transport of the recycle proteins from the endosome to Golgi, and Vps26A protein is an important component of the retromer complex. In the present study cDNA sequence of the full coding region of the Vps26A gene was successfully cloned from antler tip of the Sika deer (Cervus nippon hortulorum). The Vps26A cDNA contains an open reading frame of 984bp encoding a polypeptide with 327 amino acids. The deduced mole...
Rabia Faiz and Dilara A. Bukhari*
...usion bodies Cry and Cyt proteins. The present study focuses on determining the insecticidal activity of cyt positive B.t. strains against 3rd instar larvae of mosquito. Larval mortality was noted after 24 h and GCU B.t. 4 (400± 1.15) was found to be the most toxic against 3rd instar larvae of mosquitoes. Spores LC50 values of other isolates were 451± 0.90 (GCU B.t. 1), 511± 0.85...
Xiaopeng Tang1,3, Rong Xiang1, Sijia Chen1,3, Shufen Yang1,3, Hu Liu1,3, Rejun Fang1,3,* and Aike Li2,
...cottonseed meal on crude protein (CP), water-soluble protein (WSP), amino acid (AA) and peptide fractions, and the AA digestibility and metabolic energy of fermented cottonseed meal (FCSM) and enzymatic hydrolyzed cotton seed meal (EHCSM) in white leghorn roosters. Firstly, CSM were fermented with Aspergillus niger, or hydrolyzed with alcalase and flavourzyme. Secondly, a total of 32 white leghorn roosters with simila...
Zhiping Hu, Hussain Ahmad, Jingfei Zhang, Lili Zhang and Tian Wang*
... content (21d) and total protein content (42d) were lower in T2 group than that of CON group. Serum total antioxidant capacity was higher and malondialdehyde content was lower in T1 group than that of CON group at 21d. Serum glutathione peroxidase enzyme activity was significantly increased in T1 group compared to CON group at 42d. Malondialdehyde content of liver in T1 group was lower than that of CON group. These results suggested that dietary supplementatio...
Basit Zeshan1,2,*, Mushtaq A. Saleem2,Javed Iqbal Wattoo2, Mohd Mokhtar Arshad1 and Maizan Mohamed1
...acid residues of S1 glycoprotein) were amplified by overlap PCR, cloned into prokaryotic expression vector resulting pET-Sf200 and confirmed the construct by sequencing. The recombinant plasmid was identified by restriction enzyme and sequencing analysis. The in vitro expression of the truncated protein was analyzed in E. coli with a molecular weight of 38kDa determined through SDS-PAGE and confirmed...
Saba Parveen Samo1, Moolchand Malhi1,*, Javed Gadahi2, Yan Lei3, Allah Bux Kaciwal1 and Saeed Ahmed Soomro1
...f dry matter (DM), crude protein (CP) and crude fiber (CF) increased (P < 0.05) by 13.71, 12.02 and 4.78% at week 3 and by 11.11, 11.8 and 3.46 % at week 6 in B compared to A. Among carcass characteristics the carcass dressing % (52.99 ± 0.77 vs 49.41 ± 0.6 ) and leg weight (kg) (1.28 ± 0.06 vs 1.05 ± 0.04) increased (P < 0.05) in B compared to A. The physico-chemical properties of meat were not significantly different between...
Wei Dang1, Ning Xu1, Wen Zhang1, Jing Gao2, Handong Fan1 and Hongliang Lu 1,*
... adaptations. Heat shock proteins and other molecular chaperones play specific physiological roles in such thermal adaptation. Here, we analyzed heat shock protein 70 (Hsp70) expression in six lizard species to investigate the variation in Hsp70 response contributing to thermal adaptation. At first, we collected three lizard species of the genus Takydromus from different geographical locations. We found that either th...
Sabah Mansoor1, Muhammad Tayyab1,*, Amna Jawad1, Bushra Munir2, Sehrish Firyal1, Ali Raza Awan1, Naeem Rashid3 and Muhammad Wasim1
...denaturing the insoluble protein using 8M urea followed by refolding through gradual dialysis. The refolded enzyme exhibited optimum activity at 55 °C between pH 8-9. The effect of metal ions on the activity of AMYSBS showed that Co2+ remarkably enhanced the enzyme activity and 500µM was recorded as optimal Co2+ concentration for the maximal activity of AMYSBS. Presence of ionic (SDS) and nonionic (Tween-20...

Ikramullah Khan1,2*, Muhammad Subhan Qureshi2, Sohail Akhtar2, Ijaz Ali3 and Ghufran Ullah4 

... cortisol and Heat shock protein-70 (HSP-70). Thermal stress increased all physiological parameterssignificantly (P < 0.001). Holstein Frisian manifested maximumincrease in RT, RR and PR (3.33, 209.50 and 59.41%) than crossbred (0.59, 40.22 and 22.0%), Sahiwal (0.78, 42.54 and 34.31%) and Achai (0.78, 39.22 and 33.85%) respectively (P < 0.001).Thermal stress increased biochemical changes significantly (P < 0.001). The increase in serum glucose, cortis...
Ambreen Asghar, Tasleem Akhtar, Nadeem Sheikh*
... the variations in serum protein level induced by fat rich diet. For this purpose, two groups of Wister rats were fed with diets carrying difference in percentage of fats. Protein profiling of treated groups indicated a marked increase in serum protein (related to iron metabolism and immune response) level compared to low fat-fed rats. Additionally, a decreased level of serum

Hamza Khan1, Safdar Ali1, Ijaz Ahmad*2, Ihsanullah Khan3, Shujaat Hussain1, Bashir Ahmad Khan4 and Muhammad Suhaib5  

...ed upon oil content (%), protein content (%) and Fatty acid profile. Results showed that SMH-1001 and SMH-1215 hybrids performed best for yield and quality parameters, whereas, SMH-1006 and SMH-0909 were considered best for early maturing traits.  

...

Azhar Mehmood1,2,*, Muhammad Farrukh Saleem2, Muhammad Tahir2, Muhammad Aqeel Sarwar3, Tasawer Abbas4, Ali Zohaib2, Hafiz Tassawar Abbas

...lower plant. The oil and protein contents of sunflower were significantly affected by varying levels of both nitrogen and boron and maximum oil contents were observed when boron was applied @ 2 kg ha-1 with 0 kg ha-1 of nitrogen whereas maximum protein contents were recorded when 2 kg ha-1 boron was applied in combination with 150 kg ha-1 of nitrogen of both hybrids (H1=Hysun-33 and H2=DK-4040). The combined application of n...
Hamayun Khan1,*, Abdul Wahab1, Navaid Kazi2, Younas Muhammad1,Summaya Kazi3, Salman Kazi4, Azmatullah Khan1, Ikramullah Khan5 and Shakoor Ahmad1
... includes glucose, total protein, albumin, creatinine, triglycerides, blood urea nitrogen (BUN), alanine transaminase (ALT) and aspartate transaminase (AST). The current study demonstrated the ascertained value in amniotic fluid for glucose, total protein and albumin at day 18, 25 and 28 was 42.9±0.80, 37.4±0.90, 36.5±0.88mg/dl; 17.9±0.30, 16.1±0.22, 13.9±0.34g/l; 13.9±1.6,11....
Leila A. Kaimbayeva1,*, Elena S. Malysheva2, Rashit Kazikhanov3 and Saule R. Kazikhanova4
...s revealed the nature of protein substances, altered рН value of the meat and the intensity of glycolysis. All these parameters were indicative of autolysis process in the meat. The levels of water-binding capacity and structural-mechanical properties of red deer meat that occurred during the course of autolysis were further confirmed by the histological changes in the meat. Specifically, it was observed that post-mortem changes were characterized ...

Qasim Iqbal1, Safdar Ali1*, Muhammad Naveed Tahir1, Obaidullah Shafique1, Bashir Ahmed Khan2, Ijaz Ahmad3 and Ihsanullah Khan4  

...ed upon oil content (%), protein content (%), and fatty acid profile. The results showed that significantly highest seed yield (2187.3) kg ha-1 was produced by SF 16003 followed by SF16010 and SF 16002 having (2016.2) kg ha-1 and (1888.2) kg ha-1 seed yield respectively. The Cluster analysis also determined SF 16003 as best hybrid which was at a very close distance from the group of SF16010 and SF 16002. 

...
Muhammad Shahbaz Aslam1, Iram Gull1, Zaigham Abbas2,* and Muhammad Amin Athar1
...inant expression of some proteins in E. coli produces inclusion bodies which are misfolded proteins. The objective of this study was soluble expression of IFNα2-Tα1fusion protein in E. coli using pET-SUMO vector and determination of its biological activity. SUMO-IFNα2-Tα1 was successfully expressed in soluble form with IPTG induction to final concentra...
Farah Rauf Shakoori1,*, Anum Feroz1, Ayesha Gondal1,Sahar Akram2 and Tanzeela Riaz3
... amino acids and soluble proteins while contents of total proteins, lipids, glycogen and trehalose were significantly reduced with reference to their control (untreated group). Among carbohydrate metabolizing enzymes, the activities of amylase and invertase were significantly reduced while activity of trehalase were significantly increased after treatment with sub lethal dose of λ-cyhalothrin as compared to control. T...
Asad Sultan1,*, Shahroom Khan1, Sarzamin Khan1, Naila Chand1, Muhammad Shuaib Khan2 and Hamza Maris3
...05) in OA-2, while crude protein, crude fibre, ether extract and metabolizable energy increased significantly (P<0.05) in OA-1.5 and OA-2. In conclusion, addition of OA in drinking water at the rate of 2 ml/L improved weight gain, feed efficiency, nutrient digestibility, and tibial mineralization of Ca and P in broiler.
...
Baoying Guo*1, Yu Chen1, Chuan Zhang2, Zhenming Lv1, Kaida Xu3, Hongling Ping4 and Huilai Shi4
...,228 bp and contained 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 2 long-noncoding regions [both in the control regions (CR)]. The composition and order of genes in S. lycidas were similar to those of most other invertebrates. The overall base composition of S. lycidas is 35.8% T, 14.8% C, 41.3% A, and 8.1% G, with extremely high A+T content (77.1%). Both control regions contain termination-associated sequences and ...
Yijiang Liu1, Kun Li2, Hui Zhang2, Khalid Mehmood2,3, Muhammad Shahzad3, Houqiang Luo1,*, Muhammad Asif Yaseen4 and Xiong Jiang2,5,*
...79 bp) is composed of 13 protein coding genes, 22 tRNA genes and 2 rRNA genes. The ratio of the bases of the mt genome of R. pruinosus from Wenzhou are A (32.31%), T (31.04%), C (24.77%), G (11.88%), A+T (63.35%), respectively. The multivariable sites in rRNA were 1.98% and 5.53% in 12S rRNA and 16S rRNA, respectively. The multivariable sites in protein coding gene were ranged from 0 to 4.83%, while the multiva...
Muhammad Nazar Aftab1, Ahmed Ali1, Muhammad Asad1, Sadia Fatima2 and Furhan Iqbal2,*
...des (P = 0.0075 ), total proteins (P = 0.042) and creatinine (P = 0.0038)were significantly higher in treated male mice when compared with their untreated control group indicating the hazardous effects of AlCl3 on blood chemistry of adult male albino mice.
...
Farrukh Jamil*, Samra Raheel and Haroon Rasheed
...he other heme containing proteins and it may be a phosphate sensor.
...

Fatma Abdallah1*, Ola Hassnain2, Elsayed Attar3, Haytham Ali3,5, Mohamed Megahed1 and Venugopal Nair

...no acid sequences of Meq proteins possess several amino acid mutations associated with the MDV virulence and a unique distortion in the Proline repeats (Proline-to-Alanine) at position 176 in the Egyptian MDV strains. The Phylogenetic analysis grouped the eight analysed sequences with the previously investigated Meq from Egypt (2011-2013) together with the very virulent European and Chinese MDV isolates. The latter confirmed the geographical structuring of the...
Musrrat Fatima, Muhammad Saad Khan, Hamid Rashid, Asim Mehmood, Sumaira Kanwal, Muhammad Asif Rasheed and Farrukh Jamil*
...s been identified in the protein. Moreover, the identified site is used for structure-based virtual screening. After screening 100,000 compounds, 14 compounds are selected, which fulfilled different already established drug likeliness parameters such as rule of five and nontoxic nature. These 14 compounds are used for pharmacophore modeling, and Zinc natural compounds database (ZND) is screened against the developed pharmacophore. The compounds with the highes...
Tayfun Karataş
...crease in glucose, total protein, triglyceride, cholesterol, high-density lipoprotein and low-density lipoprotein levels as well as protein and lipid reserves in liver and muscle tissue of fish (p<0.05). The fasting period had no significant effect on the hepatic thiobarbituric acid reactive substances (TBARS), but, it caused a significant decrease in...
Changqing Zhao*, Zhuochi Chen and Yubin Li
...ermented jerky; the true protein content of the fermented jerky was lower than that of the non-fermented jerky; the free amino acids content of the fermented jerky was higher than the non-fermented jerky; the acid protease activity was slightly higher than the neutral protease activity in the fermented jerky; four and fifteen volatile compounds were detected for the non-fermented and fermented jerky, respectively. The important compounds affecting the flavor o...
Jia Chen*, Yuanxi Deng and Hui Xu
...ergen in mutton, soluble protein from mutton was extracted, and separated by SDS-PAGE. With the positive and negative sera of rats, the special allergen was identified with the Western Blot, showing that the 12kDa was the specific allergen. The protein of 12kDa was then analyzed by ion exchange and gel filtration chromatography, and the MALDI-TOF/TOF-MS search on the Internet. The results indicate that the
Bin Wang1, 2, Qianji Ning1,*, Qian Wang2, Wei Peng2, Tong Hao2,*and Jinsheng Sun2,*
...ndent analysis of single protein, rather than a protein-protein interaction. In this work, with the systematic point of view, the subcellular location of 830 unidentified proteins were annotated based on the previously reconstructed protein-protein interaction network (PIN) of E. ...
Syed Makhdoom Hussain1,*, Muhammad Zubair ul Hassan Arsalan1Arshad Javid2, Abdullah Ijaz Hussain3, Nosheen Aslam4, Qasim Ali5, Majid Hussain6Muhammad Masoom ul Hassan Rehan7, Muhammad Mudassar Shahzad1,8Anam Khalid1 and Danish Riaz1
...52% for crude fat, crude protein and supposed gross energy when compared to control diet, respectively. The next higher growth performance and nutrient digestibility values were observed at 20% replacement level based diet. It was concluded that the 10% replacement level of fish meal with MOLM is optimum which release adequate amount of chelated nutrients for maximum growth performance of L. rohita fingerlings.
...
Syed Makhdoom Hussain1,*, Nosheen Aslam2, Arshad Javid3, Shehzadi Liaquat1,Muhammad Mudassar Shahzad1, 4, Muhammad Zubair-ul-Hassan Arsalan1 and Muhammad Adnan Khalid1
...rcass composition (crude protein 17% and crude fat 10%) was found in fish fed on 3 gKg-1 level of probiotics supplemented canola meal based diet. Whereas higher ADC% of Na (75%), K (67%) and Mg (62%) were recorded by fish fed on 4 gKg-1 level of probiotics supplemented canola meal based diet. Similarly maximum improvements in RBCs, WBCs and Hb as well as higher mineral absorptions were recorded in fish fed on the said test diet. On the ba...
Selçuk Kaplan
...ding. Leptin is a 16 kDa protein which is highly expressed in adipose tissue. Leptin is one of the most significant candidate gene marker for MAS studies. Therefore, bubaline leptin gene exon 2, part of the intron 1 and intron 2 region were amplified and sequenced to identify nucleotide variations in Anatolian water buffaloes. Sequence analysis were revealed seven polymorphic site (G1072A, T1081C, T1131G, T1143C, T1145G, T1151G and C1221T) and one monomorphic ...

Muhammad Rehan Aslam1, Muhammad Maqsood1, Zahoor Ahmad2*, Sajjad Akhtar3, Muhammad Rizwan4 and Muhammad Usama Hameed

...st index (38.43%), grain protein contents (8.09%) and grain oil contents (4.76%) were obtained when two foliar sprays of 0.5% MgSO4 (T2) were applied. Similarly, highest cob weight without sheath (258 g), number of grains per cob (475.1), 1000-grains weight (272.5 g), biological yield (13.4 t ha-1), grain yield (5.15 t ha-1), harvest index (38.20%), grain protein contents (9.01%) and grain oil contents (4.76%) were recorded ...
Doğan Türkyılmaz1,*, Selçuk Özyürek2,Nurinisa Esenbuğa1 and Mustafa Yaprak1
... solid non-fat, density, protein, lactose and ash. Density of the milk is expressed in kg/m3 and the other components are in percent. Fat, solid non-fat, density, protein, lactose and ash percentages of the milk in this study were respectively 7.19%, 9.67%, 1030.78 kg/m3, 3.18%, 5.55%, 0.93% in Morkaraman; 7.20%, 9.95%, 1031.78 kg/m3, 3.29%, 5.70%, 0.96% in Tuj; 6.79%, 9.60%, 1030.77 kg/m
Farhat Ijaz1, Rana Khurram Aftab2*, Samia Jawed3
...rkers such as C-reactive protein (CRP), interleukins 6 (1L-6) and tumor necrosis factor alpha (TNF-α). Relation of TNF-α with obesity induced IR and T2DM is unclear as results obtained from different studies are very controversial.
Objective: This study was designed to compare TNF-α levels and insulin resistance in obese and non-obese type 2 diabetics.
Methodology: A cross sectional comparative study was ...
Nuzhat Huma1, Fozia Ghaffar1, Saima Rafiq2,*, Imran Pasha1, Aysha Sameen1, Imran Hayat2 and Imtiaz Hussain2
...itrogenous compounds and protein fractionations of casein and whey proteins of milk from different dairy animals like buffalo, cow, sheep, goat and camel. The buffalo and sheep milks have comparatively higher fat, solid-not-fat and total solid contents than other milks. Maximum whey proteins were found in the sheep milk (0.78%) whereas cow milk had lowest contents (0.54%). Non-casein-nitro...
Sana Rafique1, Hina Saqib1, Khushi Muhammad2, Nazia Akbar2, Abdul Rauf3, Muzafar Shah4,*
...gue virus non-structural protein using Rapid Diagnostic kit for Dengue virus (DENV) i.e. SD BIOLINE Dengue IgG/IgM. Data was obtained from patient’s record, filled forms and through questionnaire. Total 1332 blood samples were collected from 3 tehsils of District Mansehra. Out of which, 725 were found positive for dengue fever infection. Out of 725 positive cases, 410 (56.5%) were males and 315 (43%) were female’s patients. The high rate of ...
Rafa Almeer1,*, A. Alqarni1,2, S. Alqattan3, S. Abdi4,*, S. Alarifi1, Z.Hassan5 and A. Semlali6
...sue inhibitors of metalloproteinase (TIMPs) and two matrix metalloproteinase (MMPs) were measured by real-time PCR. All subgroups exhibited altered morphology with accelerated detachment compared to untreated cells. The MTT assay after 48 h revealed that treatment with H1 and H2, reduced cell viability by 48% and 91% respectively, compared to that of untreated cells. These results suggest that anticancer effect of Sidr and W...

Kashif Akbar* and Muhammad Ayub 

...73%), fat 24.23-23.94%), protein (8.20-7.68%), fiber (6.47-6.38%) while NFE increased slowly (57.86-58.60%). The color of the cookies ranged from F0-F6 (6.88-6.93), taste ranged F0-F6 (6.82-6.04) and texture ranged F0-F6 (6.91-6.15). Maximum overall acceptability was recorded in F2 (7.32) proceeded by F0 (6.99) whereas minimum mean score was recorded in F6 (6.37) proceeded by F5 (6.47). 

...

Ahmed Zein Elabdeen Mahmoud1, Muaz Magzob Abdellatif2* and Mohamed Abdelsalam Abdalla

...ied out to analyze nucleoprotein (N) gene of PPRV from fatal infections in small ruminants. For this purpose, RNA was extracted from suspected animal samples (n=18) and were screened by real time-PCR. Additionally, to assess the phylogenomics, the N gene was amplified and sequenced from sheep and goats (n=12). Nucleotide identity among Hail strains was identified to be 96.2-100%, while identity with previously sequenced Saudi Arabian strains and with reference...
Tanveer Hussain1,*, Masroor Ellahi Babar1, Marcos De Donato2, Abdul Wajid1, Asif Nadeem3, Zahoor Ahmad3, Waqas Ahmad Khan4, Sunday O. Peters5 and Ikhide G. Imumorin6
...mino acid changes in the protein sequence. The UPGMA tree showed a clear differentiation between taurine and indicine cattle, except mitochondrial taurine sequences in Lohani and Nari Master breeds. The within-breed estimates of divergence were very low in all breeds except for Nari Master (mixed-bred). The estimates of divergence among breeds were also low for most breed pairs, except for Nari Master and Dhanni. While the overall genetic divergence within the...
Jingen Xu1, Yang Liu2, Erhui Jin1, Youfang Gu1, Qin Zhang3 and Shenghe Li1,*
...ocesses, including the G-protein coupled receptor protein signaling pathway, intrinsic to membrane, cell junction and ion transport. KEGG pathway analysis showed that the neuroactive ligand-receptor interaction was significantly enriched. The results offer a foundation for exploration of immune functions and genetic control of peripheral blood T lymphocyte subsets. Also, several differentially expressed immune-related genes ...

Muhammad Khalid1,2 and Muhammad Naeem2* 

...composition of moisture, protein, lipids and carbohydrates. The purpose of this study was to affirm the proximate composition and nutritious status of Ctenopharyngodon idella. Standardized methods were used to determine the proximate composition of 72 samples. On wet weight basis, mean percentage for water was 80.76 %, ash 3.40 %, 4.31 % for fat and 11.53 % for protein in C. idella. Percent water contents showed inverse rela...
Wei Meng1,3, Tianyan Yang2,*, Yunguo Liu1, Mahmut Halik1 and Tianxiang Gao2
...enated H-strand-encoding protein genes were conducted by Neighbor-Joining method to reveal the evolutionary relationships within subfamily Schizothoracinae. Three different grades of schizothoracine fishes were well recognized from each other in branching diagram. The primitive group and the specialized group + the highly specialized group constituted a sister relationship with strong supports.
...
Ai Guo1,2,3, Jiaguang Xiao4, Binbin Shan4, Tianxiang Gao5 and Yongdong Zhou3,*
... ribosomal RNA genes, 13 protein-coding genes and non-coding regions. The mitogenomes of C. mystus N and C. mystus S shared the identical structural organization and gene arrangement with those of other Coilia fishes. Both lineages of C. mystus showeda similar features in not only the strand-specific asymmetry of nucleotide composition, but also the codon usage of genes. Whereas a significant variation among Coilia species wa...

Muhammad Amir Maqbool1*, Muhammad Aslam1, Waseem Akbar2, Muhammad Waheed Anwar3 and Ehtisham Shakeel Khokhar

...ustify;">Major intrinsic proteins (MIPs) of chickpea (Cicer arietinum L.), barrel medic (Medicago truncatula L.) and maize (Zea mays L.) were targeted in current studies. Amino acid sequences of major intrinsic proteins of chickpea, barrel medic and maize were retrieved from NCBI database followed by BLASTP. Pairwise and multiple alignment of sequences was done by using ClustalX software, and phylogenetic trees were construc...
Hülya Şereflişan and Beyza Ersoy Altun*
...ke Gölbaşı. Crude protein and lipid contents were higher in U. tigridis (10.75%, 0.96%) than in A. pseudodopsis (8.63%, 0.77%, respectively), whereas the situation was vise versa for fatty acid compositions. The proportions of Omega-3 (n3) were higher than those of Omega-6 (n6) in both of the mussels. n6/n3 ratio, which was 0.90 for A. pseudodopsis and 0.99 for U. tigridis, is an index for comparin...
Zisha Liu1, Na Song1, Takashi Yanagimoto2, Zhiqiang Han3, Bonian Shui3 and Tianxiang Gao3,*
...a concatenated set of 12 protein-coding genes, and adding 16 other species of gobies (Gobiidae). The mitogenome sequences of O. lacepedii, O. rebecca and Odontamblyopus sp. were all circular double-strand molecules, 17245 bp, 17009 bp and 17004 bp long, respectively. Compared with other bony fishes, the three species shared the similar features in gene arrangements, base composition and tRNA structure. The control region spanned 1571 bp, 1...
Farah Rauf Shakoori1,*, Tanzeela Riaz2, Uzma Ramzan1, Anum Feroz1 and Abdul Rauf Shakoori2,3,*
...e amino acid while total protein and total lipid contents, were significantly increased with reference to their control (untreated group). Among carbohydrate metabolizing enzymes, the activities of trehalase, amylase and invertase were significantly reduced after treatment with sub lethal dose of esfenvalerate as compared to control. The metabolic derangements induced by sub-lethal dose of esfenvalerate suggest that infestation caused by T. granarium in...
Muhammad Mobashar1, Muhammad Tahir1, Shahbaz Javaid2,*, Muhammad I. Anjum2, Insha Gul3, Nazir Ahmad1 andAbdul Sami1
...ilarly, intakes of crude protein (CP) and crude fat (CF) were significantly higher (P<0.05) on ration II compared to rations I and III. Neutral Detergent Fibre intake (Kg/day) in rations I, II and III was 5.4, 6.8 and 6.19, respectively. Intake of Acid Detergent Fibre (Kg/day) was higher in ration II while lower in ration I. Acid Detergent Lignin intake (Kg/day) in three rations ranged from 2.26 to 2.61. In vitro DM digestibility (%) signi...

Muhammad Zahid1, Naeem Iqbal1, Sohaib Muhammad2*, Summiya Faisal3, Wajid Mahboob3, Makhdoom Hussain4 and Zaheer ud din Khan2 

...tivity and total soluble proteins were increased with increase in sugar treatments under drought. Osmotic and water potentials were reduced under drought but foliar glucose sprays of 10 mM and 50 mM applied at reproductive phase significantly reversed the adverse effects of drought. Gas exchange characteristics including CO2 concentration, transpiration and photosynthesis rates were raised by glucose treatments under irrigated and non-irrigated conditions. Hen...
Nevran Eylem Akman Gündüz1,* and Özgür Özcan2
...o the synthetic diet and protein, lipid, carbohydrate and glycogen levels in the hemolymph were evaluated for the GA3 concentrations. The hemolymph protein level of the larvae increased significantly at 5, 10, 50 and 200 mg/L with respect to the control group. The lipid level of hemolymph fluctuated among the tested GA3 concentrations. It was significantly reduced at 5 and 10 mg/L, but increased at 50 a...
Arifa Mehreen1, Iram Liaqat2,Muhammad Arshad3, Muzzamil Waheed4 and Najma Arshad1,*
...n, Staphylococcus protein A (spa) was identified most frequently (81%) and proportions of capsular polysaccharides (CPs8), clumping factor A (clf A) andintracellular adhesion A (ica A) were 78%, 68.5% and 40%, respectively. ica D and CPs5 could not be amplified from any isolate. Toxin genes were present in 43.5% isolates. Among toxin genes, enterotoxins (SEs) were most frequently detected followed ...
Binbin Shan, Yan Liu, Changping Yang, Shengnan Liu and Dianrong Sun*
...t clusters of eukaryotic proteins. In addition, a total of 17,671 unigenes were classified into 311 KEGG pathways. Finally, we predicted the coding sequences of 13,072 unigenes and obtained 9,222 SSRs in the present study. The whole transcriptome is an important foundation for future genomic research on the P. penicillatus and can provide comprehensively understanding and further characterizations of transcriptomes of non-model organisms.
...
Majid Hussain1, Syed Makhdoom Hussain1,*, Razia Iqbal2, Arshad Javid3, Muhammad Mudassar Shahzad1,4 and Muhammad Zubair-ul-Hassan Arsalan1
...t digestibility of crude protein (68.57%) was observed at 4% CA level, whereas highest digestibility of crude fat (72.23%) and gross energy (66.63%) was observed at 3% CA level. Fingerlings also showed maximum weight gain (WG), weight gain% (WG%), specific growth rate (SGR) and lower FCR value at 3% CA level. Hematological indices of fingerlings fed CA supplemented MOLM based diets were significantly (p< 0.05) improved as compared to control diet. Maximum n...

Saif Ullah and Mohammad Akmal*

...lower for better oil and protein. The study suggests that N, P and S at the rate of 80, 90 and 30 kg ha-1 is the best combination for soils remained with cereal crops in cultivation to plant with sunflower good quality of oil and protein.  

...

Safina Naz1, Muhammad Akbar Anjum1, Saeed Akhtar2, Syed Atif Hasan Naqvi3* and Muhammad Asif Zulfiqar

...roximate (moisture, ash, protein and fiber) and heavy metal (Pb, Ni, Cu, Cd, Fe and Cr) contents. Significant differences were found for proximate composition of canal, tubewell and sewage water irrigated vegetables. The vegetables grown with tubewell water had higher moisture, ash and fiber contents compared with those grown with canal and sewage water; whereas protein content detected was higher in okra, tomato and spinach...

Muhammad Javed Iqbal and Muhammad Naeem* 

... rohita fed with various protein: Energy ratios; fish meal (T0), 25%CP (Crude proteins) (T1), 30%CP (T2), 35%CP (T3) and 40%CP (T4). Experiment was designed to replace enriched fish meal diets with cheaper plant origin crude protein diets in fish culture. A total of 15 aquaria having 20 samples each were arranged in triplicate for 90 days to study the effect of five feeding groups on Lengt...

Safina Naz1, Khushbo Hussain1, Muhammad Asif Zulfiqar2* and Syed Atif Hasan Naqvi3
 

...33 (mg g-1), while total protein content were 25.33(mg g-1), SOD 214.30 (IU min-1 mg protein-1), 895.52 POD (mmol min-1 mg protein-1) and catalase value was 2159.90. Similarly, SA application promoted total phenolic content up to 157.84 (mg g-1), while total protein content were 26.66(mg g-1), SOD 199.33(IU min-1 mg protein
Wajid Ali1,*, Asma Karim1, Muhammad Irfan2, Hafiz Abdullah Shakir3*, Ghulam Mustafa4, Zeeshan Shafique1, Ijaz Anwar1
...e, cholesterol and total protein) and gills for histology were taken after 96 hrs. After acute exposure to pesticide, significant changes were observed in serum biochemistry and histology. Serum glucose and cholesterol were increased while total protein was decreased. Histopathological result reveled that gills of experimental fish was damage severely resulting Necrosis, Damaged nuclei , rupturing of epithelial cells, Mucous...
Faxiang Wang, Yan Chen, Sai Chen, Xianghong Li, Jian Yu, Jianhui Wang and Yongle Liu*
...properties of grass carp protein. The results show that muscle proteins of grass carp were degraded and underwent conformational changes when stored at 4 °C, and significant changes of the proteins content, as shown by the SDS-PAGE fingerprint, was observed after 6 days of storage. Protein’s surface hydrophobicity and total SH content increased...

Sana Rana1, Sajid Abdullah1, Huma Naz2* and Khalid Abbas1 

...rtial purification total protein contents and percentage recovery decreased from crude extract to desalted sample while fold purification was increased. The maximum activity of purified CAT was recorded at 6.0 pH and 30°C temperature for gills of C. striata. As the temperature was raised further the catalase activity decreased. 

...

Safina Naz1, Muhammad Akbar Anjum1, Syed Atif Hasan Naqvi2*, Bushra Siddique3 and Muhammad Asif Zulfiqar4

...icon esculentum (93.7%), protein in Spinacia oleracea (2.23g/100g), fats and fiber in Abelmoschus esculentus (0.44g/100g and 3.27g/100g, respectively), ascorbic acid in Spinacia oleracea (84.5mg/100g) and carbohydrate and energy values in Daucus carota (11.25g/100g and 55.80 cal, respectively). While, higher mineral contents were recorded for phosphorous (P) in Spinacia oleracea (85.5mg/100g), sodium (Na) and iron (Fe) in Lycopericon esculentum (65.33mg/100g a...
Yang Liu1,2,3, Baimei Liu1,2,3, Chenchen Li1,2,3 and Meiwen An1,2,3,*
... The mRNA expression and protein secretion of supernatant were tested using Q-PCR and ELISA method, respectively. Co-culture KM&FM under 3.4 kPa pressure enhanced typeIcollagen and type III collagen mRNA expression and protein secretion from KM. It however reduced typeIcollagen and type III collagen mRNA expression and protein secretion from FM; it promoted mRNA expression and
Xiaojie Ding, Xiling Sun, Zuien Wang, Qiusheng Zheng, Xiaofei Yu, Wenjin Hao, Kejun Wang, Wenjuan Xu and Zhengping Dong*
...mRNA, to decrease TLR4/9 protein synthesis and expression. So we concluded that Wumei Pill probably reduce the release of pro-inflammatory cytokines and the bacterial endotoxins by blocking the transmission of TLR4/9-NF-kB signaling pathway so that Wumei Pill has a significant therapeutic effect on IBS-D.
...
Soumble Zulfiqar1, Khuram Shehzad1, Sana Tahir1, Khalid A. Al-Ghanim2 and Abdul Rauf Shakoori1,2,3,*
...;KW strain. The CueO protein was purified to homogeneity by nickel affinity chromatography. Enzyme assays of CueO protein with phenolic substrates revealed its laccase activity. The kinetic studies showed Km value of 0.2µM, kKcat 0.68 S-1 and Kcat/km 1.2S-1 µM-1 for 2,6-Dimethoxyphenol (DMP) and Km value of 0.25mM, Kcat 300 S-1 and Kcat/Km=1200S-1mM-...

Ali Muhammad*, Yasser Durrani, Majid Suhail Hashmi, Ihsan Mabood Qazi, Muhammad Ayub and Saifullah 

...xt-align: justify;">Whey proteins have many nutritional and beneficial therapeutic properties, which are indispensable for the functional and nutritional properties of foods. The aim of the study was to neutralize whey by addition of NaOH (0.1 and 0.01N) and NaHCO3 (0.1 and 0.01N) for fortification and enrichment of foods. However, addition of these solutions results in an increase in total solids and ash content of the whey sample The samples were normal whey...

Ambrin Rajput* 

...w yield (31050 kg ha-1), protein (15.77%), shoot N, P and K (2.1, 0.3 and 1.3 %) concencentration and N, P and K uptake (95.3, 16.4 and 49.9 kg ha-1) were recorded by combined application of N, P and K fertilizer application. However, the minimum values were obtained from control treatment. The combined application significantly increased chickpea yield compared the one without K application. There was positive significant relationship between all yield parame...

Waqas Ali* and Mudasser Habib 

...ic region but as a whole protein was under negative selection pressure for serotype O, A and Asia 1. Therefore, under mass vaccination campaigns and drastic environmental conditions strains under negative selection has the ability to make escape mutants. 

...
Tahira Jamil*1, Mohammad Asghar1, Fatma Husain1, Haq Nawaz Bhatti2
...h blood cholesterol, lipoproteins like low density lipoproteins, very low-density lipoprotein and decreased high density lipoprotein levels are the major risk factors involved in the development of cardio vascular diseases. Lovastatin is formed as secondary metabolic intermediate initiated by anion moiety (acetate) through polyketide chain reactions. The...
Muhammad Babar Khawar1, Muddasir Hassan Abbasi2*, Zillay Mariam1, Nadeem Sheikh1,2*
... (P=0.0001), total proteins (P<0.0001) and albumin (P<0.0001) when compared against control. Similarly, hematological analysis revealed a significant decrease in WBCs (P<0.0001), RBCs (P=0.0001), Hemoglobin (P<0.0001), Platelets (P<0.0001) and MCHC (P<0.0001) while MCV (P<0.0001) showed a remarkable positive change when compared with control. Hematocrit (P<0.0001) was found to be enhanced significantly in Group 1 but decreased in ...
Asima Bano1, Hafiz Muhammad Tahir2, Hira Sherawat3, Muhammad Mutlib4, Muhammad Arshad5, Muhammad Akram Qazi6, Sajida Naseem5, Rabia Ishaq1, Iram Liaqat2 
...ine the overall level of protein was also found to be decline. It is concluded from the study that these enzymes can be used as biomarker in the diagnosis of breast cancer. 
...

Asma Sohail1*, Kashif Sarfraz Abbasi1, Maryum Arif2 and Fatima Najam1 

...lysaccharides, vitamins, proteins, essential amino acids, carotenoids, fatty acids like linoleic acid and linolenic acid, lignans, minerals and various phytochemicals. Due to the presence of two unsaturated fatty acids, these oils can reduce their biological activity on heating, volatilization, and other parameters like oxidation and UV rays. This limits the commercial application of these oils. To overcome such problems encapsulation could be a gentle approac...

Shoaib Nawaz1, Muhammad Razaq1, Zahid Mahmood Sarwar1*, Muhammad Sajjad1*, Syeda Aneeza Ubaid1, Muhammad Asif Zulfiqar2 and Usman Haider

...ue to its nutrients like protein vitamin calcium potassium, value play an important role in Ghanaians diet. Sucking pest jassid become major problem on okra in tropical and subtropical regions and cause heavy losses. Neonicotinoid insecticide, like nitenpyram was used on calendar basis and ETL basis. Data was recorded on weekly basis. In first week jassid population in control and ETL treatments was equal with non-significant difference between them while in c...

 Sumera Siddique1,†, Hafiz Abdullah Shakir1, Javed Iqbal Qazi1*, Amtul Bari Tabinda2, Muhammad Irfan1

Screening of some agri-wastes for economical cultivation of Candida tropicalis SS1
...sSS1 for the single cell protein (SCP) production employing different fruit’s peels. The C. tropicalis SS1 was cultivated in media containing 2% pulverized peels of apples, mangoes, water melon and bagasse singly as well as in eleven different combinations. The media were inoculated with 1% (w/v) suspension of 24 h old yeast cultured in nutrient broth. The strain grew best in water melon (WM) at pH 7.0 and 37 °C under non agitation conditions. The pr...

Muhammad Babar Khawar, Nadeem Sheikh*

Effect of paper industry leachate on various serological indices and serum proteins of wistar rats
...01) and High density lipoproteins (HDL) (P<0.0001) while a significant negative change in triglycerides (P=0.0002) and creatinine (P=0.0370) level in both experimental groups. Alanine aminotransferases (ALT) level showed a significant increment in Group 1 and a decrement in Group 2 compared to control group (P<0.0001). SDS page analysis revealed an overall decreased expression of various proteins in both experimental g...

 Tahir Abbas*1, Khawaja Raees Ahmad2, Asmatullah3, Khalid Pervaiz Lone4, Muhammad Ali Kanwal2, Sadia Suleman2

Reno-hepatic protective effects of Jambul against chromium induced anomalies in mice
...Phosphatase (ALP), total protein, bilirubin, globulin, creatine and uric acid along with reduction of SGOT/SGPT, Blood Urea Nitrogen (BUN), urea and albumin as compared to control. Treatments with JFE after Cr+6 exposures significantly improved the hepatic and renal functional profiles possibly by partial liver rehabilitation and regeneration. The JFE significantly recovered the histopathological alterations in reno-hepatic tissue by free radicals scavenging a...

Tasleem Akhtar, Nadeem Sheikh*

Induction of acute phase in response to tacrolimus induced hepatotoxicity
...the level of acute phase proteins due to the toxic effect of an immunosuppressive drug (tacrolimus). Aqueous suspension of tacrolimus powder (3 mg/ml) was orally given to four experimental groups of wistar rats. Control group was provided with normal drinking water and dissections were done after 6, 12, 24 and 48 h of tacrolimus dose. Densitometric analysis revealed considerable elevated level of some positive acute phase protein

Riffat Mehboob1*, Sami Ullah Mumtaz2, Zoya Manzoor3, Sajid Abaidullah2, Fridoon Jawad Ahmad1

Deranged biochemical and hematological profile of septicemia patients in Mayo hospital, Lahore
... of patients while total protein was in normal range in 97.02% patients and the trend of albumin was towards low (44.55%).In Renal function tests, urea was elevated in 71.29% and creatinine in 51.48% patients and in electrolytes Na+ was low in 41.58% patients K+ were normal in majority of patients. Hematological parameters such as WBCs were high in 84.16%, hemoglobin was low in 78.12% and platelets were normal. The most common causes were urinary tract infecti...

Muddasir Hassan Abbasi1, 2, Noor Fatima1, Syed Shahid Imran Bukhari1, Asma Rashid khan3, Nadeem Sheikh2*

Variations in proteins and transaminases following experimental induction of Bisphenol A in mice
... the estimation of total protein and albumin and aminotransaminases activity. The sodium dodecyl sulphate
polyacrylamide gel electrophoresis (SDS-PAGE) was also run to analyze protein bands. Statistically significant
increase in total protein contents, albumin and aminotransaminases were noted in sample in comparison with control.
Comparative analysis between experimen...

 Abir Ishtiaq, Muhammad Naeem*

Length-weight relationships and condition factor for farmed Catla catla (Hamilton, 1822) from southern Punjab, Pakistan
...d 15%, 20% and 25% crude protein (CP). The regression
estimates for LWRs were highly significant (P <0.001) with coefficient of determination, r2-values being >0.930 in the
three studied groups and for overall data. The value of the regression coefficient (b) indicated negative allometric
growth (b= 2.87), isometric growth (b= 2.95) and positive allometric growth (b= 3.22) for fish fed 15 %, 20 % and 25
% crude

 Jhan Zeb, Muhammad Javed

Forecasting percentage contribution of plankton biomass towards increase in fish yield under composite culture conditions
...mentary diets at varying protein level viz., 22, 24, 26, 28, 30 and 32% digestible protein (DP), respectively @
2% of their wet body weight daily. However, control fish (T7) although had an access to plankton; but were devoid of
the availability of any supplementary diet. Data on dry weights of plankton biomass and increase in fish yield were
collected on monthly basis and subjected to regression analysi...

Sadaf Niaz1, Masroor Ellahi Babar2, Tanveer Hussain2, Asif Nadeem1, Misbah Hussain1, Riffat Mehboob3*, Fridoon Jawad Ahmad3

Mutation analysis of RING1 domain of Parkin in early onset of Parkinson’s disease in Pakistani patients-a pilot study
... domain of Parkin
protein was performed in a sample set of 30 patients (selected from different areas of Punjab, Pakistan) to find out
any Single Nucleotide Polymorphism (SNP).No SNP was detected in RING1 domain that could be related to the
disease. The data suggests that no genetic predisposition in RING1 domain may be responsible for the occurrence of
disease in local population. It may be due to genetic changes in any other part ...

 Muhammad Babar Khawar1, Muddasir Hassan Abbasi1, 2, Sana Fatima3, Khawaja Abdul Mujeeb2, Nadeem Sheikh1

Alterations in proteins and transaminases activity induced by thioacetamide in albino rats
...n tissue and serum total proteins and
albumin along with urea, uric acid and serum transaminases activity after 12 and 24h of TAA administration in albino
rats. Rats were randomly divided into three groups (n=3) namely control group, 12h group and 24h group. Each
experimental group (12h and 24h) was administered 300 mg/ kg TAA intraperitoneally (i.p) while control received
same volume of normal saline solution. Rats of 12h and 24h g...

Nabila Roohi, Mehjabeen, Samina Ashraf*

Effects of cigarette smoking on serum proteins profile in male active and passive smokers
... analysis of serum total proteins and fractions
(albumin, total globulins, gamma globulins and non-gamma globulins) of active and
passive smokers. Blood samples of 180 cigarette smokers were collected from
different locations of Lahore and 60 healthy non-smokers from University of the
Punjab, Quaid-e-Azam campus Lahore, in terms of comparable age, height, weight
and socioeconomic set up. Serum protein...

 Siddra Tayyab Akhtar, Anjum Nasim Sabri

Twitching, swimming, swarming in biofilm forming strains in response to chemical and physical factors
...motilites whereas
proteinase K enzyme showed weak antimotility effect against all tested bacterial
strains. From this study we proposed that instead of biofilm detachment by
expensive commercial detergents, we could change the physical environment of
sewage systems as well as flooding some specific chemicals, which disrupt
bacterial motilities and biofilm formation.

...

Farkhanda Asad1*, Samina Qamer1, Tayyaba Ali1, Ammara Behzad1 and Tahira Yasmin2 

...4 mg/Kg while, for crude protein higher value of nutrient digestibility was recorded in test diet T3(G/0.2, CrCl3.6H2O mg/Kg).It was concluded that chromium supplementation with gelatinized corn in fish (Cirrhinusmrigala) diet can improve the nutrients digestibility more efficiently as compared to non gelatinized and Cr-free diet. 

...
Fatih Korkmaz1, Veysel Parlak2, Özgür Kaynar3, Arzu Ucar2, Gonca Alak1,* and Muhammed Atamanalp2
...e evaluated based on the protein profile, bacterial content (total aerobic mesophilic, psychotropic and lactic acid bacteria, Pseudomonas and Enterobacteriaceae), lipid peroxidation (TBARS), total volatile basic nitrogen (TVB-N) and pH values on quality during 12 days. The decrease in bacterial growth activity, physicochemical values (TVB-N, TBARS and pH) and prolonged shelf life in a natural preservative dependence were observed in the fillets. General...
Gangchun Xu1,2, Fukuan Du2, Yuyu Wang2, Yan Li2, Zhijuan Nie2 and Pao Xu1,2,*
...ing Frame that encoded a protein of 388 amino acids. The 5′ and 3′ untranslated regions were 269 bp and 139 bp, respectively. The full length ortholog PTGES2b was 1,457 bp and contained a 729-bp ORF that encoded a protein of 242 amino acids. The 5′ and 3′ untranslated regions were 402 bp and 326 bp, respectively. One polyadenylation signal (AATAAA) was present 14 nucleotides upstream of the pol...

Sahar Shibli1,2*, Farzana Siddique1, Saeeda Raza2, Zaheer Ahsan3 and Irum Raza4 

...1 to 26.43±1.15 % proteins, 13.23±2.20 to 19.42±3.83 % carbohydrates and 4.95±0.06 to 8.53± % fiber. Mineral analysis of peanut cultivars showed 12.60±0.38 to 16.61±1.51 mg/100g Fe , 2.34±0.075 to 3.37±0.040 mg/100g Zn, 38.64±3.50 to 48.24±32.58 mg/100g Ca, 67.81±7.86 to 82.72±9.09 mg/100g Mg, 199.19±33.18 to 342.00±19.03 mg/100g Na and 1220.6±9.045 ...

Saima Yousaf1,2, Ali Zohaib2*, Shakeel Ahmad Anjum2, Tahira Tabassum2, Tasawer Abbas3, Sohail Irshad4, Usman Javed5 and Naila Farooq6 

...l yield, oil content and protein content of soybean, as compared to un-inoculated control. Seed inoculation with P. fluorescens was more effective than R. japonicum in improving grain yield and quality. The genotypes did not differ significantly in grain yield, biological yield and oil content; however, differed in protein content. Swat-84 was superior among all genotypes pertaining to yield formation and
Tamoor Azeem1,*, M. Yasin Tipu1, Asim Aslam1, Sajjad Ahmed2, Salman Ahmed Abid1, Abdullah Iqbal3, Naeem Akhtar4, Muhammad Saleem4, Aamerzish Mushtaq4 and Sajid Umar4
... while decrease in total protein and albumin (p>0.05).
...
Muhammad Huzaifa Mehmood1, Muhammad Ahmad Iqbal2, Muhammad Daood1, Muhammad Rizwan Tariq3*, Khubaib Ali3
...ed. The pH texture, fat, protein, blood lipid profile and PUFA concentration was significantly affected by the incorporation of oat in rabbit feed. It was concluded that the supplementation of 2% oat in rabbit feed increase n-3 PUFA in meat while improvement in serum lipid profile was observed by 4% supplementation of oat seeds. It was also observed that fat percentage in meat was also reduced by oat seed supplementation.
...
Pingping Cang1, Mingming Zhang1, Guo Qiao1,Qirui Sun1, Dehai Xu3, Qiang Li1, Xinghua Yuan4 and Wenbin Liu2,
...cal differences in crude protein (CP), crude lipid (CL) and ash contents of gibel carp muscle between BFT and control group at the end of experiment (P >0.05). The essential amino acids, non-essential amino acids and total amino acids contents of gibel carp muscle in BFT group were higher than those in control group. Bioflocs were composed with 29.8% CP, 3.2% CL and 19.1% ash at day 60. CP content was appropriate, and LP was lower for gibel carp. Eco...
Bei Liu1, Yanli Hong1, Huifang Zhou1,*, Zhenzhen Cao1, Shuang Zhang1, Jing Jin1, Miao Jiang1, Cunsi Shen2 and Jianjian Ji2
...each group. The mRNA and protein levels of GnRHR, the hub genes and key transcription factors in the downstream cAMP-PKA signaling pathways in RPC cells were also detected. The secretion and transcription levels of FSH and LH in Cetrorelix group were significantly decreased, while the expression of GnRHR was significantly increased compared to the blank group (p<0.05). Use of CSF with BSZYD alone showed no significant effect on the secretion of RPC, ...
Tafail Akbar Mughal1, Muhammad Zubair Saleem2, Shaukat Ali3,*, Khawaja Khurshid Anwar1, Muhammad Majid Bashir1, Muhammad Babar4 and Muhammad Adeeb Khan1
... lipids, cholesterol and protein contents both in the liver and blood while DNA and RNA contents only in liver. The administration of CCl4 resulted in increase in plasma ALAT and decrease in LDH. Vitamin E pre-treatment abolished CCl4-induced changes in the activities of these enzymes. Blood glucose content was increased while cholesterol content was decreased. Vitamin E pre-treatment abolished only CCl4-induced change in blood...

Omer Baris Ince* 

...gainst the nonstructural proteins (NSP) of Foot and Mouth Disease and evaluation the carrier rate in the region and the risk of infection and given information on the immune ratio of the animals. As a result, prevalence was observed to be 6.6% for breeding enterprises, 13.3% in bovine animals and 1% in ovine animals individually. Prevalence was found 13.3% throughout Konya. Generic immune ratio in bovine animals was found 58.8% for serotype O and 61.1% for ser...
Ali Raza Jahejo1,2, Nasir Rajput2, Wen-xia Tian1,*, Muhammad Naeem2, Dildar Hussain Kalhoro2, Asmatullah Kaka2, Sheng Niu1 and Fa-jie Jia1
... the absorption of crude protein (CP), crude fibre (CF), and metabolized energy (ME). However, the values of red blood cells and packed cell volume were non-significant whereas white blood cells, haemoglobin, and new castle disease antibody titer were significantly higher in basil supplementary group. The weight gain and feed conversion ratio significantly improved in basil treated group, while ascorbic acid and basil significantly decreased the water intake. ...
Hua-Lun Luo, Yi-Yu Zhang*, Yuan-Yu Qin and Lei Wu
...sponsive element-binding protein) plays a crucial role as a central regulator of lipid synthesis and glycolysis in animal liver. In this study, the relative quantitative real-time PCR analysis indicated that the duck ChREBP mRNA is widely expressed in all examined tissues. ChREBP mRNA level was the highest in abdominal fat and the lowest in gizzard. The g.247075G>A silent mutation in exon 10 was first identified by direct sequencing approach, and resulted i...
Rishen Liang*, Meng Zhou, Zhenxiang Lin, Guozhang Li, Yuan Chen, Xuan Lin and Zaohe Wu
... typical structure of 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and one noncoding control region. Genomic composition, organization and gene order were similar to that obtained in most vertebrates. By comparative analysis of the two genomes, 941 variable sites (5.69%) were found. Sequence divergences of 13 protein-coding genes, 2 rRNA genes and one control region which are commonly used as molecu...
Sakhra Mahmood1, M. Younus1, A. Aslam1, A.A. Anjum2, S. Umar3, Aamerzish Mushtaq3 and M.L. Sohail4,*
... the quails, an emerging protein source in developing countries.
...
Aisha Khalid1, Muhammad Tayyab1,*, Abdual Rauf Shakoori2, Abu Saeed Hashmi1, Tahir Yaqub3, Ali Raza Awan1, Muhammad Wasim1, Sehrish Firyal1, Zaheer Hussain4 and Munir Ahmad5
...binant enzyme as soluble protein. The recombinant protein was purified by affinity column chromatography. The characterization studies of purified protein demonstrated the optimal enzyme activity at 90°C and pH 4.8. The presence of cobalt enhanced the cellulase activity and 2.5 mM cobalt was recorded the optimal concentration for the maximal cellulase activity. SDS-PAGE ana...
Doğukan Ölmez1 and Gonca Alak2,*
... rich wastes in terms of protein. These wastes can be converted into different economic value products under controlled conditions. Under controlled conditions, byproducts have the potential to be converted into nutrients suitable for human consumption, as well as different products that have economic value. For this purpose, hydrolysates were prepared by enzymatic methods at different time periods using different trout byproducts. In this study, two different...
Yang Liu1, Jing-xin Mao2, Xiao-dong Wei2, Man Yi2, Xiao-long Zhang2, Ke Zheng3, Xian-xin Chen4, Guo-Ze Wang5 and Bing-bo Chen1,*
...the control group, total protein, albumin, and albumin/globulin ratio were increased in lactobacillus BFA group. The total bilirubin decreased significantly (P<0.05) both in lactobacillus BFA and Bacillus BFA group. Total weight gain and daily gain were increased in mixed fermentation BFA group significantly than the control group (P<0.05). For feed conversion rates in each group, the mixed fermentation BFA group had the highest feed efficiency, increase...
Naveed Ahmad1,*, P.J.A. Siddiqui1, Amjad Ali1, Khan Mir Khan2, Rafaqat Masroor3, Noor ul Akbar4, Muhammad Amin5 and Mohammad Attaullah6
...optimum level of dietary protein on growth performance, feed utilization, survival and carcass composition of yellowfin seabream, Acanthopagrus arabicus. Five semi-purified experimental diets were formulated containing 350 (P30), 400 (P35), 450 (P40), 500 (P45) and 550 (P50) grams of protein kg-1 of dry matter. Thirty healthy fish (20.94±0.81g initial weight) were stocked in each floating net cage (1...

Aqsa Khan1, Sabyan Faris Honey2*, Babar Bajwa2, Nelofer Jamil1 and Muhammad Sohail Mazhar2

...eir composition as major protein source and one diet without wheat germ were used. Addition of wheat germ in the diet composition for larvae resulted in significantly high percent survival (maximum value) (60± 4.56 and 56± 2.56) and significantly increased larval body weight of codling moth (0.58± 0.04 and 0.42± 0.03 gm). While diet without wheat germ resulted in low percent survival (40 + 5.46) and reduced larval body weight (0.15 ...
Shehzad Ghayyur1,3, Sadia Tabassum1, Munawar Saleem Ahmad2Naveed Akhtar1 and Muhammad Fiaz Khan1,*
...gent, while total plasma proteins and triglyceride level were significantly decreased (p < 0.05).

...
Jie Yang
...eptidoglycan recognition proteins (PGRPs) are innate immunity proteins that are conserved from insects to mammals, recognize bacterial peptidoglycan, and function in antibacterial immunity and inflammation. Mammals have four PGRPs (PGLYRP1, PGLYRP2, PGLYRP3 and GLYRP4). They are secreted proteins expressed in different tissues. It is significant to make a study of human PGLYRP1 because neu...

 Asad Sultan1, Rabia Ali1, Rifat Ullah Khan2,*, Sarzamin Khan1, Naila Chand1 and Ambrina Tariq3

...ofile with red higher in protein content (11.41%). It was observed that phytase inclusion in grain increased the availability of all nutrients except crude lipids. Total tract nitrogen retention was increased by 3% in red sorghum compared to white. Minerals absorption was increased but differently in different cultivars with higher degradation of phytate in both red and white sorghum. Apparent metabolizable energy was significantly enhanced both in red and whi...

 Mahroze Fatima1*, Muhammad Afzal2 and Syed Zakir Hussain Shah3

...nd for dry matter, crude protein, crude fat and ash content in fish body. Lipid peroxidation was determined in terms of thiobarbituric acid reactive substances (TBARS) and antioxidant enzyme activities. The minimum value of TBARS was recorded in VE150 group, which was increased again with supplementation of high vitamin E levels. Similarly, adequate supplementation levels (VE1000, VE1500) reduced the superoxide dismutase (SOD),...
Bibi Nazia Murtaza1,2, Azhar Qayum3, Shamaila Inayat Nadeem1, Naif Awdh Al-Maliki4, Abdulaziz Alamri4 and Abdul Rauf Shakoori2,5,*
...onal structure of mutant proteins were built by Swiss-Model and were further subjected to structural alignment and stability studies by I-Mutant Suite and DUET server. Both variants were predicted as ‘disease causing’ and protein stability analysis revealed p.G138V to be more destabilizing variant than p.E31K. When three-dimensional structures of variants were subjected to molecular docking with GTP, the mutated ...
Muhammad Shahid Nadeem*, Maryam A. Al-Ghamdi and Jalaluddin Azam Khan
...coli as heterologous protein under 0.3mM IPTG. The recombinant enzyme was purified by DEAE-Sephadex colum based anion-exchange chromatography. On SDS-PAGE, the enzyme exhibited a molecular weight of about 36 KDa. Its specific activity was 1650 U per mg of protein with about 5% glutaminase activity and no activity against D-asparagine. Optimal enzyme activity was found at 75°C and pH 9. The KM value of 5.9m...
Faiza Jabeen1,*, Bushra Muneer2 and Javed Iqbal Qazi3
...lded enough thermostable protein suggesting their potential in production of various enzymes and proteins in unconventional and economical substrates suitable for various industrial uses.
...
SiRui Wang1,2, Fekede Regasa Joka1,2, XiaoLong Wang1,2,* and SuYing Bai2,*
...yxovirus-resistance (Mx) protein in the evolution of different wild birds, 10 wild bird species, including Anas formosa, Anas crecca, Anas strepera, Mergus squamatus, Accipiter nisus, Buteo hemilasius, Buteo lagopus, Passer montanus, Psittacula roseata and Emberiza elegans, were selected.The sequences of the GTPase effector domain (GED) of the Mx gene were determined by PCR sequencing...

Fady Samir1, Rania F. El Naggar2, Mohamed M. Hamoud3, Manal M. Zaki1, Abdulrhman M. Gamal1, Samah E. Laban1, Shaimaa A. E. Nasr1, El Shaimaa Ismael1, Osama K. Zahran1* 

...ve pressures on NDV glycoproteins and their role in changing the NDV evolution in Egypt. 

...
Aisha Khalid1, Muhammad Tayyab1,*, Abu Saeed Hashmi1, Tahir Yaqub2, Ali Raza Awan1, Muhammad Wasim1, Shagufta Saeed1, Sehrish Firyal1 and Abdul Rauf Shakoori3
...roduction of recombinant protein. Higher level enzyme activity was recorded at 25°C, pH 7.0 when the cells were induced with 0.5 mM IPTG with 22h post induction incubation. Supplementation of LB medium with 1% glucose and yeast extract enhanced the production of recombinant thermostable cellulase. Enzyme showed strong potential for its use in paper and poultry feed industry. Under the optimal conditions we could able to produce 48 U/mL of recombinan...

Gulnaz Saleem1, Aijaz Hussain Soomro1*, Nouman Rashid2 and Mehar un Nisa Narejo3 

... Masoor-93 was higher in protein content (25.16%) than all other varieties. The supplementation resulted in a significant increase in protein, fat, crude fiber and ash contents of the biscuits. The thickness and spread factor of biscuits differ significantly while non-significant effect was observed in the width of the biscuits. Sensory analysis revealed that there were no significant differences (p>0.05) amongst all trea...
Zahra Nazir1, Saba Ijaz1, Roquyya Gul2 and Mahjabeen Saleem1,*
...nase was recognised as a protein with 47kDa molecular weight by SDS-PAGE. The optimum pH of purified polygalacturonase activity was found to be 4.5 and stable within pH range 3.5-5.5. Temperature dependent studies revealed temperature optimum of enzyme to be 40°C and stable up to 60°C. Among substrates, polygalacturonic acid was established as the best substrate for polygalacturonase showing its specificity in the hydrolysis of polysaccharide galacturo...

Fraza Ijaz1*, Umair Riaz2, Shazia Iqbal3, Qamar uz Zaman4, Muhammad Furqan Ijaz5, Hina Javed1, Muhammad Amjad Qureshi1, Zuhra Mazhar3, Ahmad Hassan Khan6, Hassan Mehmood7 and Ijaz Ahmad8 

...ritious Parameters crude protein (30.23%), neutral detergent fiber (33.45%) and acid detergent fiber (26.56%) gave significant results as compared to control (T1). Results indicated that the combined application of Rhizobium species and Tryptamine performed better by improving growth and yield and quality parameters. It is concluded that precursor-inoculum combination is an effective approach and should be tested in different ecologies. 

...

Muhammad Sohail1*, Asad Sultan2, Said Sajjad Ali Shah3, Muhammad Sajid1 and Adnan Khan4

...1% and 17.04 MJ/kg). The protein levels in wheat varieties were 12.15 and 11.89% which were more than that of both of corn (8.21 and 8.05% respectively) and sorghum varieties (10.41% and 9.89% respectively). The bioavailability of crude protein was higher in maize followed by wheat and sorghum. The phytic acid contents were found highest in both varieties of sorghum (0.85% and 0.87% respectively) as compared to the wheat var...
Shengjie Zhou1,2, Pengfei Wang1,2, Chao Zhao1,2, Mingjun Fu3, Jian G. Qin4, Lihua Qiu1, Zhenhua Ma1, 4,* and Maoshang Lin1
...-type fatty acid binding proteins (L-FABP) gene in golden pompano Trachinotus ovatus larvae was cloned in the present study. The full length of L-FABP cDNA from golden pompano was 604 bp, including a 5’-untranslated region (UTR) of 154 bp, a 3’-UTR of 69 bp and an open reading frame (ORF) of 281 bp. L-FABP encoding a polypeptide of 126 amino acids with a predicted molecular weight of 14.06 kDa and a theoretical isoelectric point of 8....

Bina Khanzada1*, Ghulam Hussain Abro1, Tajwar Sultana Syed1 and Nazir Ahmed2 

...ested were honey, sugar, protein hydrolysate solution to enhance fecundity and fertility of the parasitoid under laboratory conditions and compared with the provision of flower nectors such as ornamental sunflower, merry gold and hollyhock in the laboratory. The ornamental plants sunflower, merry gold and hollyhock were also tested in the field for conservation of the C. flavipes. The results showed that during 2013 and 2014, the C. flavipes fed on Hollyhock p...
Sheng Niu1, Ali-Raza Jahejo1, Fa-jie Jia1, Xin Li1, Guan-bao Ning1, Ding Zhang1, Hai-li Ma1, Wei-fang Hao2, Wen-wei Gao1, Yu-jun Zhao1, Shi-min Gao1, Jian-hui Li1, Gui-lan Li1, Fang Yan1, Rong-kun Gao1, Huan-chun Chen1,3 and Wen-xia Tian1,*
...-transferase A3 (rGSTA3) proteins. We explored the responses of HDPs in erythrocytes to thiram-induced TD and rGSTA3 protein by quantitative real time PCR (qRT-PCR). The results showed many HDPs expressions were suppressed by thiram-induced TD, and the expressions of HDPs were upregulated by rGSTA3 protein. These findings demonstrated that mRNA expressions of HDPs are highly related to thi...
Muhammad Ahmad, Zohaib Noor*, Karim Johar Khan, Waqar Younas and Ajmal Hussain
...ues of (P<0.05) crude protein, fats, carbohydrates, Mg (%) and K (%) was recorded in the H. molitrix than C. catla. The results of the study showed that H. molitrix probably consumed all the phytoplankton density by filtering the water continuously resulting in the reduction of growth in other fish species in the polyculture system.
...
Nursinatrio and Rudy Agung Nugroho*
...), feed efficiency (FE), protein efficiency ratio (PER), survival rate (SR) and carcass proximate of red tilapia were measured. The results showed that HCFM up to 12% could be used as supplementation and showed positive effects on all growth parameters. Supplementation of HCFM above 6% in the red tilapia diet increased the protein and fat content of red tilapia’s carcass. The highest survival was found on red tilapia f...
Yuyu Wang, Gangchun Xu*, Zhijuan Nie, Quanjie Li, Nailin Shao and Pao Xu*
... significant lower total protein (TP), cholesterol (TC), triglyceride (TG) and glucose (Glu) content in serum compared with those reared at low density on day 90 and 120 (P<0.05). In conclusion, the present results indicated that the largemouth bass (36-308 g) could be reared at high stocking density without depressed growth and chronic stress in commercial-scale in-pond raceway systems under this experimental conditions.
...
Wang Zaigui1,*, Guo Panpan1, Ye Miao1, Sun Linghong1, Zhang Hongfu2 and Liu Chaoliang1,*
...>P<0.01). (5) The proteinase activity in middle intestine was higher than that of the blank group (P<0.05). Collectively, the results indicated that adding B.subtilis to the feed of silkworm had positive effects on growth performances of the Bombyx mori L. apparently.
...
Iram Gull*, Muhammad Shahbaz Aslam, Imran Tipu, Roohi Mushtaq and Muhammad Amin Athar
...human latency associated protein with insertion of HCV NS3 protease cleavage site at splicing junction is reported.
...
Pin Lyu1, Xiangxian Chen2* andQinlong Liu3*
...structure and C-reactive protein levels, followed by the other three groups. C-reactive protein decrease in exercise and massage, massage only or exercise only groups was significantly different comparing to control group (p<0.05).Combined treatment of exercise and massage therapy showed the best effect in inflammation suppression, skeletal muscle regeneration, control of skeletal muscle fibrosis and muscular tissu...
Xiaona Cao1,3-5, Yuanyuan Ren2-5, Xiaoteng Cui2-5, Baoxin Qian2-5, Chunyan Zhao 2-5, Jie Yang2-5, Chao Su2-5,* and Xingjie Gao2-5,*
...ibution of three nuclear proteins, including heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1), Hu Antigen R (HuR) and T cell intracellular antigen 1 (TIA1), in the SG aggregation and nucleus/cytoplasm localization under stress condition. We found that hnRNP A1, HuR and TIA1-containing SGs were aggregated in the cytoplasm of HeLa cells, and accompanies the alteration of nucleus/cytoplasm localization during arsenite indu...
Hong Zhang1, Shu-Fen Han2, Jing Wang1, Shao-Kang Wang1, Gui-Ju Sun1 and  Cheng-Kai Zhai1, *
...ease in high density lipoprotein cholesterol. However, CWD can improve blood lipid and blood sugar levels, and at the same time improve obesity and fat accumulation in rats. CWD significantly augmented the relative level of peroxisome proliferators-activated receptor γ (PPARγ) and suppressed the sterol regulatory element-binding protein 1c (SREBP-1c) protein expre...
Jun Yan Bai*, Shuai Yang, You Zhi Pang, Xiao Hong Wu and Guang Lu Li
...e quail (P<0.05), the protein height of Beijing white quail is greatly higher than those of ret two species (P<0.05). Based on comprehensive evaluation, the egg quality of Korea quail is better than those of other two species, egg production and laying rate of China yellow quail are significantly higher than those of Korea quail and Beijing white quail (P<0.05). The average egg weight of Korea quail is significantly higher than those of China yellow q...
Hashim Ullah1, Abdur Rahman1, Rifat Ullah Khan2, Shakoor Ahmad2 and Ambrina Tariq3, Shabana Naz4,*
... cholesterol, fat, crude protein, ash, moisture and dressing percentage of WaziriandMazaisheep. A total of 36 mature sheep of Waziri and Mazai were selected and processed for dressing percentage and meat quality through proximate analysis. Wazirisheephad lower cholesterol as compared to Mazai. With the increasing BCS, the cholesterol content was significantly increased in both the breeds. The dressing percentage and crude protein
Zhengfei Wang*, Dan Tang, Xuejia Shi, Huayun Guo, Xiuping Chen, Daizheng Zhang and Boping Tang*
...on between mitochondrial protein coding genes (PCGs) and adaptation to the extreme hydrothermal vent environment.Thirteen PCGs from mitochondrial genomes of 48 Brachyura species and one Diogenidae species were examined. Each of the genes was investigated and compared to orthologous sequences using PAML, Datamonkey, and TreeSAAP. Nine mitochondrial PCGs (ATP6, ATP8, COX1, COX3, CYTB, ND1, ND2, ND4, and ND5) were validated to have undergone positiv...
Hong Ma*, Bo Fu, Liang Wang, Zhong-qiu Li and Di Liu*

 

...ell 117 (HSPC117) protein has been identified as being involved in placental formation, and can be modified by epigenetics. However, whether HSPC117 affects development of cloned embryos mRNA expression is unknown. To investigate the influences of HSPC117 on embryonic development, we generated transgenic porcine embryos by handmade cloning. We then assessed the embryonic developmental rate at cleavage and blastocyst stages. Our results sho...
Muhammad Afzal1, Nighat Sultana1, Ali Hassan1, Syed Zakir Hussain Shah2,*, Mahroze Fatima3, Syed Makhdoom Hussain4, Muhammad Bilal5 and Majid Hussain2
...ies of dry matter, crude protein and crude fat in Labeo rohita juveniles when fed CA supplemented diet. Similar observations were also recorded for the group fed on PHY supplemented diet. Citric acid addition in the diet also resulted in improved (p<0.05) digestibilities of Ca, Mg, P, Na, K, Cu, Zn, Fe and Mn. Similarly, PHY pretreatment had also resulted in enhanced mineral digestibility as compare to control group. However, both the suppleme...
Junli Sun1,2,3, Lin Bai1 2, Xiaogan Yang1,2, Yangqing Lu1,2, Shengsheng Lu1,2,* and Kehuan Lu1,2,*
...embrane lipids, membrane proteins and nucleic acids. The PCA analysis also exhibited that these three groups were well distributed in different areas. In conclusion, the microoperation of ICSI caused some changes in the metabolism of embryos. Raman spectroscopy is a valuable technology for assessing embryonic metabolism.
...
Rabia Khalid1, Saleema Bashir Shams1, Bibi Nazia Murtaza1,*, Gaitee Joshua1, Saira Mushtaq1, Hassan Al-Talhi2 and Abdulaziz Al-Amri2
...s (TG), high density lipoproteins (HDL), low density lipoproteins (LDL) and fasting blood glucose (FBG) were used to demonstrate the incidence of metabolic syndrome. Overall, 39.025% of bank employees and 22.53% of randomly selected control individuals have metabolic syndrome. Among the bank employees, prevalence of obesity was 67.53% and in general population it was 57.1%. The mean values of body mass index (BMI) for bank e...
Iram Liaqat1,*, Nazish Mazhar Ali2, Najma Arshad3, Riffat Iqbal1 and Zain-ul-Abideen1
...icylidene acylhydrazide, proteinase k, trypsin and chymotrypsin target bacterial virulence in Desulfovibrio spp. that causes bacteremia, periodontitis and abdominal infections. Ten soil samples were collected and screened by morphological and biochemical study. Only one strain DUV1 was confirmed by 16S rRNA gene sequencing as D. vulgaris (accession number: KY698020). It showed significantly reduced biofilm formation (52%; p<0.05) by test tube ...

Ali Mahmoud Zanaty, Naglaa Mohammed Hagag, Neveen Rabie, Mahmoud Saied, Karim Selim, Saad A. Mousa, Azhar Gaber Shalaby, Abdel-Sattar Arafa and Mohamed Khalifa Hassan 

...g for the partial fusion protein. Phylogenetic analysis revealed that 20 samples are genotyped as very virulent NDVclass II of genotype VIIb, 4 samples were of high identity (94%-100%) with NDV class II of genotype II (vaccine strain) and 1 sample was phylogenetically related to NDV class II of genotype I with 98% identity. Furthermore, the intracerebral pathogenicity index (ICPI) for selected 5 virulent viruses reveals velogenic features with high pathogenici...
Jingchen Chen, Zhaochao Deng and Zhiqiang Han*
... TAA, T or TA) in the 13 protein-coding genes are found. Except for tRNA-Ser(AGN), the second-structure of other tRNAs is the typical clover structure. The lengths of 12S rRNA and 16S rRNA are 945 and 1,698 bp (AP1, AP2) and 1,696 (AP3). A control region containing key sequence tags have three different domains, namely, terminating sequences (TAS1, TAS2), central conservatives (CSB-F, CSB-E and CSB-D) and conservative sequences (CSB1, CSB2 and CSB3)...

Zafar Abbas1*, Muhammad Mubashir1, Umair Riaz1, Zeenat Javid1, Muhammad Ashraf1, Saeed ur Rehman1, Muhammad Javid Qamar1, Syed Ali Zulqadar1 and Shahzada Munawar Mehdi2 

...45 g 3.2 g and 1.48 g of protein, fat, carbohydrates, fiber and sugar, respectively. As well as one gram of okra contain 31.3 mg and 299mg of vitamin K and potassium, respectively. Therefore, to examine the effect of different forms of fertilizers (organic and inorganic) on the yield and physiochemical attributes of okra Abelmoschus esculentus a field trial was conducted. For this purpose, organic form of fertilizers like kitchen waste, poultry manure and comp...

Muhammad Shafique, Nosheen Noor Elahi*, Muhammad Rashid, Amjad Farooq and Kausar Hussain Shah

...production, nitrogen and proteins percentage of four mung bean varieties under different NaCI levels in sand culture after 5,7 and 9 weeks of sowing. Both inoculated and uninoculated plants were grown on mineral medium that were N-free either without NaCI or with a range of NaCI (20, 50,100, 200 and 300mM). Dry weight of plants was increased at 0-50mM NaCl and decreased at 100-300mM NaCI concentration. Inoculation effectively increased the dry weights of plant...

Samina Qamer1, Farkhanda Asad1*, Amna Faiz1, Robina Arshad1, Zunaira Shaheen1 and Tahira Yasmin2 

...on for dry matter, crude protein and gross energy. While comparing organic and inorganic Cr efficiency in fish feed, it was concluded that organic chromium (picolinate) inclusion increased the nutrients digestibility and enhanced the nutrients deposition in body muscles of fish. 

...
Tian-Yi Zhao1, Zi-Qing Liu2, Bo Yang1, Qiao Gao1, Hong-Yu Zhang1, Pei-Yu He1, Ming-Hua Duan1* and Yu-Li Yan1*
...t5, Bcl-2, and Cyclin D1 protein expression in peripheral blood.The red blood cell count and hemoglobin levels decreased in 5-Fu group compared with the control group (P < 0.05). 5-Fu+APs group showed a marked increase in the number of erythrocytes and a significant increase in hemoglobin content (P < 0.05). Compared with the control group, 5-Fu group showed a significant decreased in the number of CD71/Ter119-labeled erythrocytes (P <...
Syed Makhdoom Hussain1*, Nisar Ahmad1, Azhar Rasul1, Muhammad Mudassar Shahzad2, Muhammad Latif3, Muhammad Zubair Ul Hassan Arsalan1, Muhammad Umair1  and Hafiza Hina Shafqat1
...ent digestibility (crude protein 71% and gross energy 69%) and hematological parameters (WBCs 7.87×103mm-3, RBCs 3.04 ×106mm-3 and Platelets 67) were observed in the fingerlings fed with test diet supplemented with 2 mg kg-1 nano Cr while crude fat digestibility (79%) was found maximum at test diet supplemented with 1.5 mg kg-1 of nano Cr which were significantly different from fish fed with control and o...
Unal Kilic1*, Abdiwali Mohamoud Abdi1 and Deniz Ekinci2
...locks. In terms of crude protein content, the highest CP was obtained from the urea+molasses treatment for wheat, sorghum and soybean straws, while control groups were found to have the lowest CP content. The lowest NDF, ADF and lignin contents were found in sorghum straws (P<0.001). The highest gas production value was obtained from sorghum straws for 24-hours incubation process (P<0.001). Treatments did not cause any effects on 24-hours gas production ...

Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Gul Bahar Khaskheli2, Allah Jurio Khaskheli3, Arshad Ali Khaskheli4, Abdul Samad Magsi5, Ghulam Shabir Barham2, Arab Khan Lund5 and Maqbool Ahmed Jamali4 

...h concentration of crude protein. Further the Prosopis juliflora against Zea mays, in Acacia nilotica versus Alhagi maurorum, in Tamarix orientalis versus Trifolium alexandrinum, Tamarix gallica versus Cordia sinensis (Linn.) crude protein content existed statistically non-significant, but each of above set varied significantly to one another. Trifolium alexandrinum and Zea mays though had statistically similar concentration...
Riyadh S. Aljumaah1, Mutassim M. Abdelrahman1,*, Moez Ayadi1 and Abdullah H. Alyemni2
...ent levels of energy and protein viz. higher protein than recommended by National Research Council (1985; TMR1), and higher energy than National Research Council (1985; TMR2) compared with the traditional feeding system of barley and alfalfa hay; Control). A total of 96 Najdi ewes, about nine months old, were divided randomly into three dietary treatments two months before parturition (Late gestation). Lambing percentage, la...
Xiaopeng Tang1, Wen-qin Su1 and Re-jun Fang1,2,*
... treatment. The NaPi-IIb protein expression was determined by Western Blot, and the NaPi-IIb mRNA expression was determined by RT-PCR. The results showed that, compared with the control group, different levels of CT had no effect on cell proliferation, but it inhibited (P < 0.05) the absorption of phosphorus at CT concentration of 1×10-11, 1×10-10 mol/L and 1×10-9 mol/L. There was no effect of...
Constance Obiageli Ejilibe1, Helen O. Nwamba2, Ifeanyi Chinedu Atama3,*, Chiamaka Lynda Ani2, Ifeanyi Oscar Aguzie3, Josephine C. Madu3 and Christopher Didigwu Nwani3
...sphatase (ALP) and total protein (TP) concentrations in homogenized muscle samples was determined by standard procedures. ALT, AST and ALP increased significantly in response to concentrations of Butaforce® (7.00, 9.00 and 11.00 µgL-1) and Termex® (15.00, 20.00 and 25.00 µgL-1) used. The TP decreased in response to the same concentrations of pesticides. The response of these biochemical parameters...
Abd El-Nasser Ahmed Mohammed1,2,*
...lobin, glucose and total protein), oocyte quality after ovarian transplantation (cumlus enclosed, brilliant cresyl blue stain and diameter) and reproductive performances (litter size and weight) were determined and recorded. In addition, values of body temperature and blood glucose were determined after general anesthesia. The results indicated that N. sativa oil supplementation resulted in significant (P < 0.05) increase of RBCs, hematocrit, WBCs an...
Kun Wang1,2, Yinglin Cui2, Xu Zhao2 and Changjiang Hu1*
...NMT3b) and Matrix metalloproteinase-9 (MMP-9) was evaluated by western blot. And microRNA-29b was identified using quantitative real-time PCR. 3). Compared with the Model group, the group treated with XN had a significantly reduced number of dead neurons in hippocampus and cortical regions of ICH rats. Furthermore, this treatment significantly increased protein expression of claudin-5, ZO-1 and VE-cadherin while
Tanzeela Riaz1, Farah Rauf Shakoori2,*, Hareem Mansoor1, Sana Khan1 and Mushtaq A. Saleem1
...ure on soluble and total proteins, total lipids, glucose, glycogen, free amino acid and trehalose contents was also recorded. The results indicated that contents of glycogen, trehalose, total lipids, free amino acids, soluble proteins and total proteins were significantly deceased in both larval instars except the free amino acids that increased in 4th larval instar of both popu...
Gul Afshan1,2,*, Soumble Zulfiqar2, Sumaira Mehboob2, Muhammad Tahir Javed Khan1 and Abdul Rauf Shakoori2,*
...zing HCV3a envelope glycoprotein E2. HCV3a E2 gene was amplified and cloned first in cloning vector pTG19 and subcloned in expression vector pET21a. E2 protein, expressed in insoluble form, was purified by repeated sonications, followed by denaturation and refolding through fractional dialysis with urea. Multiple alignment with other sequences showed nucleotide variations of HCV3a E2 compared with already reported seq...
Tahir Iqbal1, Umer Rashid1*, Naveed Shahzad2, Amber Afroz1Muhammad Faheem Malik3 and Muhammad Idrees4

 

...domain (ORF1) and capsid protein (ORF2) revealed clustering of Pakistani aHEV (Pak aHEV) strains with members of Orthohepevirus B species. However, Pak aHEV strains were highly divergent from other known members within Orthohepevirus B suggesting as novel aHEV strains circulating in the population of layer chickens in the country. Detection of HEV in layer chickens may pose public health risk in context of zoonosis and food borne transmiss...

Abir Ishtiaq and Muhammad Naeem* 

...e the effects of dietary protein levels on growth and to elucidate the optimal dietary crude protein requirement for Catla catla (Thaila) in a polyculture system was conducted. Four experimental diets containing graded levels of protein (15, 20, 25 and 30%) were tested. Triplicate groups of C. catla stocked in outdoors earthen ponds at 2000 fish/acre were fed at 4% of body weight, 2 times ...
Zijuan Li1,2, Rong Ma2, Muhammad Khan3*, Chenchen Liu2, Xiaolin Cui2 and Yongming Li1,2*
...he expression of various proteins. The data demonstrated that piceatannol inhibited growth and induced G2/M phase arrest and apoptosis. Further studies showed that piceatannol induces mitochondrial apoptosis as shown by Bcl-2 family proteins modulation. Finally, piceatannol significantly enhanced apoptotic efficacy of CDDP in U2OS cells. On the basis of our findings, piceatannol is a promising anticancer agent which could be...
Huma Sattar1, Sehrish Firyal1,*, Ali Raza Awan1, Habib-Ur -Rehman2, Muhammad Sajid Hasni3 and Amjad Islam Aqib4*
...nge in the folding of 3D protein structure of clinical sample, while in subclinical samples, showing the same variation in overall 3D protein structure analysis of TNF-α gene. The association between polymorphism identified within the TNF-α gene with mastitis reported in this study revealed that SNPs has potential to serve as a molecular marker for screening of mastitis resistant and susceptible Sah...
Laiba Shafique1,*, Muhammad Afzal2, Syed Zakir Hussain Shah3, Mahroze Fatima4, Huma Naz5, Saif ur Rehman1, Youchuan Wei1 and Qingyou Liu1,*
...sub> increased the crude protein, ash and decreased the fat contents in muscles while same result was observed by supplementation of formic acid. In conclusion, dietary formic acid and vitamin D3 improves the growth performance and muscle proximate analysis for the C. idella fingerlings.
...
Muhammad Suleman1,*, Abu ul Hassan Faiz2, Muhammad Shahbaz2 and Ayesha Riaz3
...2 KDa by SDS-PAGE. Total protein present in crude enzyme was calculated as 188 mg/ml. Crude xylanase showed specific activity of 41.22 IU/mg protein. Partially purified xylanase showed protein content of 80.6 mg/ml. The novelty of this study is basic sources used are indigenous and cheap for production of xylanase.
...
Lin Qi, Lu Li, Danyang Chen, Mingxiao Liu, Yan Wu and Wei Hu*
...dman degradation using a protein/peptide sequencer. The antibacterial activity of the protein monomer in antlerplate was studied by disc diffusion method, and the antibacterial ring diameter of each antibacterial agent was measured to determine its antibacterial ability. The molecular mass and purity of this polypeptide was 18.970kDa and 90%. Amino acid sequence analyses indicated that the N-terminal amino-acid sequence of t...
Jinfeng Liu1,2, Yanhong Cao3, Tong Feng1, Laiba Shafique1, Chan Luo1, Peng Zhu1,4,* and Qingyou Liu1,*
...y exhibited BMP15 protein was located in germ cells of testis, in primordial granulosa cells, primary, secondary, and antral follicles of ovary, and none in theca cells. The more conspicuous reaction for BMP15 was observed in germ cells than cumulus cells and granulosa cells, particularly in primordial germ cells of genital ridge or in foetus ovary of buffalo. The expression pattern of BMP15 suggested that it may play a key role in the for...
Sabbah M. Allam, T.M. El-Bedawy, M.H. Bakr and A.E.M. Mahmoud*
...DN) and digestible crude protein, showed that there were insignificant (P>0.05) differences between cows fed R2, R3 and R4 compared with those fed R1 (control), except digestibility of nitrogen free extract which was significantly (P≤0.05) decreased by feeding experimental rations by increasing replacement level of DOP to more than 25% (R2). Blood constituents of experimental cows on all rations were within normal range for platelets, red blood cells (RB...
Abdulkareem Mohamed Matar1, Moez Ayadi1,2, Hassen Mohamed Sbihi3*, Imeddine Arbi Nehdi3, Mutassim Mohammad Abdelrahman1 and Riyadh Saleh Aljumaah1
...> (6.40%); however, milk protein percentage was higher in the milk of ewes fed CF1 (4.29%) and CF3 (4.64%) compared to TF (3.78%) and CF2 (3.57%). Total (C12:0 + C14:0 + C16:0) saturated fatty acids were significantly lower in milk fat from ewes fed TF (45.67%) and CF1 (42.13%) compared to CF3 (53.65%) and CF2 (49.67%). Linoleic acid (C18:2∆9c,12c; n-6) was significantly higher in milk fat fro...

 Li-na Li1, Sheng Li2, Ping Gui3, Jing-hui Li1, Fen Ai4,* and Li-li Cai1,*

...γ at both mRNA and protein levels. Furthermore, we found that MSCCM inhibited the activation of NF-κB signaling pathway induced by irradiation as well. Our data suggest that MSCCM could reduce irradiation-induced TGF-β1 production and ameliorate collagen deposition by inhibiting NF-κB signaling pathway. Our present study provides new insights into the treatment effect of uMSCs in radiation pulmonary fibrosis.
...
Muhammad Usman Akhtar1,2, Abdul Qayum3, Anshan Shan1,*, Shuli Chou1, Hyeonsoo Jo4, Syed Waqas Ali Shah4 and Ishfaq Muhammad5
...0 and 70% RDP of dietary protein represented as 30RDP, 40RDP, 50RDP, 60RDP and 70RDP, respectively. Feed intake was recorded, nutrient digestibilities (DM, CP, ADF and NDF) were determined and blood samples were taken at 3, 6, 9 and 12 h post feeding, and examined for BUN. In addition, milk produced by each goat was recorded. The results showed that increasing RDP level in the diet has a linear effect (dose-dependently) on nutrient digestibilites, nutrient int...
Ping Jiang1 , Zhihui Zhao1, 2, Xiaohui Li2, Mengyan Wang2, Lixin Xia2, Yang Cao3, Runjun Yang2 and Xibi Fang2*
... 1 (ABCA1) is a membrane protein. As a member of the superfamily of ABC transporters, ABCA1 can transport lipids and cholesterol across cell membranes. To further verify the relationship between the ABCA1 gene and milk fat metabolism of Chinese Holstein dairy cows, we exploited transient transfection mediated-RNA interference technology to specifically knockdown expression levels of the endogenous gene ABCA1 in bovine mammary epithelial cells (BMECs) to analys...
Qi Ren, Shufeng Sun, Chen Niu, Yuhong Li, Yingzhi Chong, Biao Li, Guoying Zheng and Fumin Feng*

 

...then the CYP1A1 mRNA and protein expression decreased with cell damage, thus suggesting that elevated methylation of the promoter region of the CYP1A1 gene may affect its expression and could be associated with cell damage. After treatment of the cells with AZA, increases in methylation rate and DNMTs expression were reduced, CYP1A1 mRNA and protein levels increased, and cell damage was ameliorated; these results indicate th...
Yating Cheng1, Wenlong Shi1, Xue Xiao2, Qirong Zhang2, Qihao Zhang1, Zhijian Su1, Qi Xiang1,2* and Yadong Huang1,2
...one of the most abundant proteins in humans and plays an essential role in cell maintenance and organization. Collagen has a unique triple-helix structure composed of three polypeptides, and hydroxylation of proline residues is vital for the stability of this triple-helix. Prolyl-4-hydroxylase (P4H) is an enzyme with an α2β2 tetramer arrangement that functions to post-translationally hydroxylate proline residues in the collagen chain. The α su...
Wiqar Ahmad1*, Farmanullah Khan2, Muhammad Sharif2 and Muhammad Jamal Khan2
...tistically similar crude protein content. Compared to the control, INM significantly (p<0.05) improved the wheat and lentil yield by 128 and 87%, respectively, and the crude protein by 17%. Yield improved by 13% for wheat in intercrop over the wheat after maize and by 46% for lentil after maize over the lentil in intercrop. The INM treatment showed 94% higher OM, 10% reduced bulk density (ρb) and 12, 20 and...
Sajida Sabahat1, Asif Nadeem1,*, Maryam Javed1, Muhammad Yasir Zahoor1, Abu Saeed Hashmi1, Ghulam Yasein2 and Ghulam Abbas1 
...egulation. IGF-1 control protein metabolism and is extremely conserved region amongst species. IGF-1 have not been studied before in camel. The DNA samples of Marecha camel were collected from the Camel Breeding and Research Station at Rakhmani Bhakkar, Pakistan. Four polymorphic sites were detected in the IGF-1 gene. A significant finding was the occurrence of a T→C polymorphism in exon 5 that causes a substitution of an amino acid from Cysteine t...
Memis Ozdemir
...d the expression of milk protein genes. It has been seen many studies about Prl/RsaI polymorphism found in the exon 3 or exon 4 region of bovine prolactin gene in the literature. The aim of this study was to determine whether the DNA sequence of the Prl gene exon 3 or exon 4 in cattle breeds has the RsaI polymorphic digestion site. As a result of the study, it has been seen that the Prl/RsaI specificpolymorphic site is on exo...

Aamir Saleem1, Arshad Mahmood Malik2*, Najam Ul Hassan1 and Imtiaz A. Qamar

...and dry weight and crude protein) and meteorological data regarding rain fall, temperature, pan evaporation, sunshine and wind speed for interpreting results along with their statistical analysis as fixing legume with grass has improved the forage quality. Overall, these results has suggested that grass-legume mixtures can improve livestock and pasture productivity, sustainability and as well as to fix atmospheric nitrogen and this may improve soil N status al...

Muhammad Naeem Khan* and Asad Jan 

...usmn;0.83 %) followed by protein (30.26±0.72 %) while crude fibers were found least in amount (1.43±0.53 %). Among different minerals, reasonable amount of calcium (3268±0.53 μg/g), potassium (2873±0.71 μg/g), sodium (591±0.23 μg/g) and iron (223 ± 0.46 μg/g) were found while no cadmium and chromium was detected. MCE and EAF displayed considerable antibacterial activity against Xanthomonas campestris and Ps...
Ali Mujtaba Shah1,2,3, Ali Raza Shah3, Muhammad Farooque Hassan2, Muhammad Yousif2, Zhisheng Wang1*
...ostrum, i.e. fat, protein, immunoglobulin, lactose, oligosaccharide, vitamins, minerals, growth factors and nucleotides and its benefits to health of animals.
...
Hafiz Muhammad Tahir*, Palwasha Jabeen, Chand Raza, Shaukat Ali
...h other. Spidroin is the protein found in spider silk while silkworm silk is made up of an inner core of fibroin and outer layer of sericin protein. After the removal of sericin, silk is non-immunogenic and non-allergic. It is a renowned biomaterial due to its biocompatible nature. Silk proteins have been found to possess antibacterial properties and application in culturing tissues includ...
Mehwish Faheem1*, Maleeha Rafeeq1, Aisha Majeed1 and Saba Khaliq2
...yp1a1 and heat shock proteins mRNA level was evaluated using real time qPCR. Results revealed that exposure to bisphenol A caused decrease expression of cyp1a1 in a concentration dependent manner. Exposure to graded concentrations of bisphenol-A resulted in significant increase in mRNA expression of heat shock proteins (hsp70 and hsp90). In the light of present results, expression of cyp1a1 or...
Peng Chen1,2, Zuhao Huang3,Chaoying Zhu1, Yuqing Han1, Zhifeng Xu1
Guanglong Sun1, Zhen Zhang1, Dongqin Zhao4, Gang Ge1 and Luzhang Ruan1*
... GC. The start codons in protein-coding genes (PCGs) included ATG, GTG, ATT, ATC and ATA, while its stop codons included TAA, TAG, AGG, AGA and the incomplete cipher T. In PCGs, the highest frequency of codon was CTA (Leu). The highest frequency of amino acids was Leu, whereas the lowest was Cys. In phylogenetic analyses, Gruiformes included Grui and Ralli, and Charadriformes included Charadrii, Lari and Scolopaci. The genus Porzana was closest to Po...
 

Aftab Shaukat1,2,*, Tauseef ur Rehman3, Rizwan Shukat4, Shahid Ali Rajput5, 

Shadab Shaukat6, Muhammad Ahsan Naeem2,5,8, Mubashar Hassan2,5, Tabassam Fatima2,5
Fayyaz Ahmad1, Muhammad Usman Saleem7, Fatima Arooj1, Ashar Mehfooz2 and Anas Sarwar Qureshi2
...0 g and 500 g with crude protein 17.5 % and metabolizable energy 2.9 Mcal/kg was offered to does for one month prior and post breeding season (15 September-30 October). Does were weighed at the start of breeding season T2 (BW=29.18±0.21kg) and T1 (BW=28.93±0.53kg), respectively. All the does were sent for grazing of jantar fodder for four hours daily and were sheltered during the rest time in different pens with separate fee...
Jam Nazeer Ahmad1,2*,Mujahid Manzoor1, Zubair Aslamand  Samina Jam Nazeer Ahmad1, 2
...P450 gene and associated protein in dsRNA treated population. The application of ds RNA specific for CYP450 also reduced insecticide resistance in R. ferruginous. The developmental parameters were highly affected in RPW treated with dsRNA as compared to control samples treated with water or dsGFP. These results support the RNAi application as a suitable tool for the management of insecticide resistance and control of R. ferruginous.
...
Sumaira Abbas1, Muhammad Sultan Haider2,*, Fatima Kafayet1, Sana Ashraf2, Atifa Masood3 and Moazma Batool4
...s nitrogenous diets (30% protein) were offered to Carassius auratus juvenile having body weight 20±7.54g in powder form for 92 days. Weight gain, length gain and FCR were calculated fortnightly. At completion of feeding trial, color intensity and pigment concentration was measured in Carassius auratus skin. Statistical analysis of results showed non-significant differences (P<0.05) among all treatments in weight gain and FCR. Maximum co...
Hüseyin Erdem* and Ibrahim Cihangir Okuyucu
...fat dry matter (NDM) and protein percentages were measured for colostrum produced at 2, 24, 48 and 72 h after birth. The specific gravity of colostrum (colostrum quality) was determined using a colostrometer. The effects of DPL, ADMY, parity and calving season on the specific gravity of colostrum (colostrum quality) were found to be significant at the 2nd h after birth. Colostrum quality of cows with ADMY low (Group 1) and high (Group 2) were found ...
Nazir Ahmad Khan1,*, Mudassir Alam1, Rafiullah khan1, Kamran Khan2 and Sadeeq ur Rahman3
...ility.
...
Asima Rani1,*, Syed Kashif Nawaz2 and Muhammad Arshad3
...omain-containing-adaptor-protein gene in malaria susceptibility and clinical outcomes upon P. falciparum and P. vivax exposure. Blood samples of 228 malaria patients and 226 healthy controls were selected from the local population. Malarial samples were divided in to complicated malaria (N=89) and mild malaria (N=139) groups according to WHO criteria. Malarial groups were further divided into P. vivax and P. falciparum groups based ...

Awais Ahmed Khan1*, Zafar Iqbal1 and Muhammad Atiq2 

...OD activity (8.4 U/min g protein), SOD (6.96 U/ min g protein) and TPC (3.21 mg GAE/ 100g of sample) as compared to control where POD (1.13 U/min g protein), SOD (1.46 U/ min g protein), and TPC (1.14 mg GAE/ 100g of sample). Amount of hydrogen peroxide (H2O2), the signaling molecule was also significantly increased (30.33 mmol/ mg FW) and catalase (CAT)...
Huanxin Zhang1,2, Hongshuo Tang3, Jun Chen1, Yu Zang1,2, Xuexi Tang1,2,* and Ying Wang1,2,*
...e evolutionary conserved protein and have contributed to the understanding of the host defense processes against infection. Researches have been performed on the evolution in many species, but the evolutionary characteristics of African hunting dog TLR genes are scared. The available genome sequence of African hunting dog offers us the way to examine the innate immunity of this endangered carnivore. 10 TLR genes (TLR1-10) were initially identified from the Afr...
Bibi Nazia Murtaza1, Mazhar Saeed Chaudry2, Shamaila Inayat Nadeem1, Muhammad Shahid Nadeem3 and Abdul Rauf Shakoori4,*
...cascade activation. PTEN protein is involved in the negative regulation of PI3K pathway. Mutations in upstream kinases, growth factor receptors or intrinsic members of cascades can lead to induce or promote cancers. Number of somatic mutations in several genes, majority of which are involved in chromatin modification and transcriptional regulation, have been reported in NHL. G468R and G468A mutations in BRAF gene have been reported in NHL, BRAF is a mem...
Muhammad Muneeb1, Muhammad Ayub1, Sher Bahadar Khan2,*, Amjad Sohail1, Farkhanda Jabeen1, Mumtaz Ali Khan3, Amjad Khan4, Kashif Prince3, Asghar Khan5 and Irshad Ahmad6
...gar (17.92%) and maximum protein content was found in samples taken from Warsak Road (25.40%) followed by Hashnagri (24.24%). In sensory analysis the maximum mean score of judges for color, Flavor, Texture and overall acceptability were observed in Board Bazaar (7.97) followed by University Town (7.89) and the minimum values were given to the samples taken from Hashtnagri (7.57). Hence it was concluded that the samples taken from Hashtnagri and Chowk Yadgaar w...
Hafrijal Syandri1*, Ainul Mardiah2, Azrita3 and Netti Aryani4

 

...eed containing 29% crude protein and gross energy of 3,340.50 kkal/kg of feed and cultured for 90 days. The physicochemical parameters of water were always at satisfactory levels for fish culture throughout the experiments except for NH3-N (0.05 mg/L) and NO2-N (0.02 mg/L): water temperatures ranged from 27.5 to 30.5 °C, DO 4.3 to 5.6 mg/L, pH 6.56 to 6.96, alkalinity 50.65 to 52.25 mg/L, and hardness 6.65 to 66.85 mg/L. Survival was...
Sajida Rasool1, Saba Irshad1*, Neelam Saba1, Mehak Fiaz1Muhammad Sajid Hussain2, MuhammadWajid Hussain3 and Peter Nürnberg2

 

...ion. BICD2 is an adaptor protein which regulates the cellular trafficking of cargo molecules crucial for motor neuron growth and maturation. In present study, a Pakistani family of HSP penetrating in autosomal recessive pattern was ascertained. Patients presented spasticity and stiffness of upper and lower limbs, severe microcephaly, dysphagia, no speech, hearing loss and seizures. Genome wide linkage analysis and whole exome sequencing revealed a novel homozy...
Doulat Khan1, Hamayun Khan1, Nazir Ahmad2, Muhammad Tarique Tunio3, Muhammad Tahir2, Muhammad Saleem Khan2 and Rifat Ullah Khan1*
...regnancy Associated Glycoproteins (PAGs) in peripheral blood for early pregnancy identification in cattle, buffalo, goats and sheep. A total of 120 blood were taken from jugular vein of different breeds of cattle (Achai, Achai x Jersey, Holstein Friesian and Jersey), buffalo (Nilli Ravi, Aza Kheli and non-descript), goats (Beetal, Teddy and non-descript) and sheep (Bulkhi, Karri and non-descript). In cattle, the average sensitivity, specificity, false pregnanc...
Anam Tariq, Alina Gul, Majida Atta Muhammad, Samia Falak and Naeem Rashid*
...roduction of recombinant protein in the cytoplasm which secreted gradually to the extracellular culture medium. Determination of the N-terminal amino acid sequence of the recombinant protein, in the extracellular medium, revealed that the 19 amino acid signal peptide was cleaved between Ala19 and Gly20. It seems probable that the signal peptide of TK0522 can be used for secretion of other recombinant
Tong Feng, Zilu Zhang, Minghao Qu, Chan Luo, Laiba Shafique, Qingyou Liu and Kuiqing Cui*
...t species. The goat MC1R protein has a molecular mass of 34.65 ku, an isoelectric point of 8.70, which is weakly alkaline, and contains seven transmembrane domains typical of cell membrane receptor proteins. Sequencing analysis of the black, brown and white different color MC1R genes of Nubian goats revealed that there are three SNPs in the gene sequence, which are 219, 712 and 1160, respectively. The C/T mutation did not ca...

Anand Kushwaha, Amit Kumar, Aparna Madhavan, Durga Goswami, Golmei Poulinlu and Gnanavel Venkatesan* 

...e available, recombinant protein based diagnostic assays namely ELISA is safer and robust to handle large sample size and also to minimize labor/time. However, the genus Capripoxvirus encodes putative 147 proteins in their genome, among which some of them are reported as potential immunogenic candidate genes. Selection and use of such candidate immunogenic proteins from an array of genes l...

Nosheen Noor Elahi1, Muhammad Shafique1, Muhammad Imtiaz2, Umer Farooq3* and Muhammad Rashid1 

... having high quantity of proteins. In the present study, four varieties (CM44, CM91, CM98 and CM2000) were grown in the presence and absence of PGPR inoculated media and nitrogen in different salinity levels (20, 50, 100, 200 and 300mM NaCl). The biomass production of the varieties CM91 and CM98 increased at 20-100mM NaCl concentrations but drastically decreased at higher levels. While in varieties CM44 and CM2000 a gradual decrease of biomass with increasing ...
Saara Ahmad1,*, Iftikhar Ahmed2, Saida Haider3, Zehra Batool4, Laraib Liaquat3, Fatima Ahmed5, Asra Khan1, Tahira Perveen3, Mirza Jawad ul Hasnain6, Saima Khaliq7 and Saad Bilal Ahmed8
...F-α) and alpha-fetoprotein (AFP) were estimated before and after the administration of different meals. After the experiment, the liver samples were weighed and histopathologically evaluated using a knodell score to assess portal hypertension and liver damage. Animals fed with commercial chicken meat and feed for six weeks showed development of inflammation, necrosis, apoptosis and cirrhosis on histopathological examination of the liver, and had raised p...
Muhammad Afzal1, Mahroze Fatima2, Aasma Qamar1, Muhammad Farhan1 and Syed Zakir Hussain Shah3,*
...t;0.05) dry mater, crude protein, crude fat, and crude ash contents in the muscles and whole body of juveniles in response to CA and PHY supplementations were observed. Again, dietary acidification with CA also improved (p<0.05) the whole-body mineralization. Moreover, PHY pretreatment also resulted in higher (p<0.05) mineral deposition in the body as compared to control group. Both supplements interacted positively (p<0.05) to en...
Peng Peng1,3, Xiaopeng Tang2*, Dun Deng3, and Rejun Fang1*
... of GM as an alternative protein resource in meat duck diets. Firstly, the chemical composition, dry matter (DM) digestibility, metabolic energy (ME) were determined. Secondly, a total of four hundred eighty 15-day-old Shuanggui-tou meat ducks were divided into 4 treatments, 1) Control group (0% GM in the diet), 2) 3% GM group (3% GM in the diet), 3) 6% GM group (6% GM in the diet), and 4) 9% GM group (9% GM in the diet). All groups had 8 replicates and 1...
Tian-Yi Zhao1, Zi-Qing Liu2, Shu-Fei Ma3, Bo-Yang1, Fan-Fan Guo1 and Ming-Hua Duan1*

 

... changes of amyloid beta protein (Aβ)-induced AD. In vitro assays (MTT and flow cytometry) were applied to detect the effect of biatractylolide on PC12 cell proliferation, growth inhibition rate and apoptosis. In order to assess the spatial learning and memory abilities of AD rats, Morris water maze model was applied in vivo, and the activity of the NF-κB signaling pathway and concentrations of TNF-α, IL-6, and IL-1β were measured. The re...
Derya Kocamaz* and Elif Oruc
...), glutathione (GSH) and protein carbonil (PCO) increased in comparison to the control. After the recovery period, EROD, GST, malondialdehyde, estradiol/testosterone levels were found to be lower than the control. In the pesticide mixture group, the activity of antioxidant enzymes was highest and the level of hormones was lowered. The group of the mixture pesticide showed the highest lipid peroxidation and protein carbonylat...
Asim Faraz1,*, Abdul Waheed1, Riaz Hussain Mirza1, Muhammad Shahid Nabeel2 and Hafiz Muhammad Ishaq1
... gross composition (fat, protein, lactose, SNF and total solids percentages being 4.26, 3.62, 4.84, 9.02 and 13.28, respectively), Barela milk appears particularly rich compared to literature data. A long term monitoring, notably throughout the lactation, could be a good opportunity to assess the potential of this breed at national level.
...
Saeed Murtaza1, Abdul Sattar1*, Nasim Ahmad1, Muhammad Ijaz2Maqsood Akhtar3 and Muhammad Shahzad4
...results showed that fat, protein, lactose, freezing point, SNF and solids were significantly higher (P<0.05) in group-2 and group-3 as compared to group-1 except density and pH which remained non-significant (P>0.05) in all groups. On the basis of result, it may be concluded that oxytocin had no effect on uterine involution and progesterone; however, it had some role to affect the normal composition of milk in postpartum involution interval.
...

Asmaa A. Darwish 

... 0.05) increase in total protein, globulin, liver enzymatic activities, kidney function tests, total lipids, triglycerides, MMP-2 and MMP-9 concentrations was depicted in the three diseased groups. On the contrary, the total cholesterol, HDL-cholesterol, LDL-cholesterol, minerals, electrolytes, trace elements and total antioxidants capacity concentrations significantly (P< 0.05) decreased in the three diseased groups. Both of MMP-2 and MMP-9 yielded a sensi...

Shazia Mansoor1, Muhammad Sohail2*, Saima Aslam3 and Muhammad Nauman ul Islam4 

Mehtap Bayir*
...ative fugu Sod1 and Sod2 proteins and their orthologs from teleost fish and tetrapods. Phylogenetic clustering was seen between sod genes in fugu and their orthologs. Finally, highly conserved gene synteny was determined between fugu sod genes and their orthologs from teleost fish and human.
...
Boxin Dou, Ying Liu*, Yumeng Liu, Lili Fan, Yongqiang Ma, and Yanguo Shi
...c hydrolysis of RB crude protein purified by ultrafiltration, size exclusion chromatography and RP-HPLC. Using consecutive chromatographic techniques successively, the acidic hydrolysates of RB proteins were fractionated and the new ACE inhibitory triplet was isolated and identified. The amino acid sequence of the ACEI was identified as Ile-Thr-Leu or Leu-Thr-Ile. In vitro, ACE inhibition assays showed that the IC
Asad Ali Khaskheli1*, Gulfam Ali Mughal1, Muhammad Ibrahim Khaskheli2, Gul Bahar Khaskheli3, Allah Jurio Khaskheli2 and Arshad Ali Khaskheli1
...h), ether extract, crude protein, crude fiber, nitrogen free extract and total carbohydrate contents) were included. Comprehensive survey indicated year round availability of 19 different vegetations at study areas whereby dry matter contents in Calligonum polygonoides (93.63%) recorded significantly high, and in Trifolium alexandrinum it was low, while moisture content appeared vice versa to dry matter. Organic matter contents in Senegalia se...
Housh Muhammad Solangi1, Javaid Ali Gadahi1*, Mansoor Tariq2, Bachal Bhutto1Zubair Ahmed Laghari1, Jamila Soomro3, Taufeeq Ahhmed Khosa1 and Abdullah G Arijo1
...i>H. contortus crude proteins (HcCP). Protein profile of HcCP was checked by SDS PAGE and immunogenic proteins were recognized by the antisera produced by using the HcCP as antigen. Infective stage of the H. contortus (L3) was used for the challenge infection. Protein band pattern ranging from 10 to 170 kDa was observed and
Seval Dernekbasi* and Emin Karatas
...0.05). The highest crude protein, lipid and ash contents were determined in the FO/SFO group (p>0.05). Experimental diets containing vegetable oil (CO and SFO) and vegetable oil blend (CSFO) had significantly higher concentrations of n-6 fatty acids, predominantly in the form of linoleic (LA, 18:2n-6c) and oleic acid (OA, 18:1n-9c), while n-3 fatty acids were present in significantly higher concentrations in the FO group. The fatty acid composition of rainb...
Savas Atasever*, Ali Vaiz Garipoglu and Huseyin Erdem
...lk composition (fat (F), protein (P), lactose (L)), density (D), freezing point (FP), somatic cell count (SCC) and daily milk yield (DMY) according to the different feeding applications (grazing (G), silage usage (S), compound feed usage (C), number of milking cow (NMC), calf suckling period (CSP)). Average F (3.144±1.931%), P (3.022±0.448%), L (4.475±0.669%) and logSCC (5.386±0.529) values were within acceptable ranges. The present...
Larysa Kladnytska1, Anatoliy Mazurkevych1, Natalia Bezdieniezhnykh2Oleg Melnyc1, Sergiy Velychko3, Mykola Malyuk1, Vasyl Danilov1Yuriy Kharkevych1 and Magdalena Gryzinska4*
...cytoplasmic and membrane proteins on dog stem cells from fat tissue at the IVth and Xth passages was examined by immunohistochemical method using monoclonal antibodies. Determination the index of proliferationdogs adipose-derived stem cells (DADSCs) on IVth and Xth passages. Established that DADSCs contains multipotent stem cells, that are characterized by an almost homogenous fibroblast-like cells оn the IVth<...
Jing Zhang1,2, Xin Wang2, Yun Zhao2, Yongcheng Jin2, Yongfeng Zhou2, Junmei Wang2, Yurong Fu2, Rui Wang2, Ruihua Li2, Hengtong Fang2 and Hao Yu2,*
...generating islet-derived protein 3 gamma (Reg3γ), and tumor necrosis factor (TNF) were significantly downregulated. The mRNA expression levels of mucosal β-defensin, regenerating islet-derived protein 3 alpha (Reg3a), regenerating islet-derived protein 3 beta (Reg3β) and secretory immunoglobulin A (sIgA) levels were significantly increased. The interleukin-1beta (IL-1β...
Qaisra Siddique1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3

 

... (GST) activityand total protein contents (TPCs) in tissues viz. brain, gills, kidney, heart, muscle and liver of Labeo rohita kept under sub-lethal dose (4.13 µgL-1) of chlorpyrifos. Fish was kept under chlorpyrifos stress for two months and samples were collected on weekly basis. It was noted that GST level varied significantly with duration. The GST level was raised in first 28 days after that it was dropped off up to 56-day. The tre...
Waqas Ahmad Shams1*, Gauhar Rehman1, Khurshaid Khan1, Ibrar Ahmad1, Saima Bibi1, Saif Ul Islam2, Dawood Safi1, Saba Gul Ayaz1
...sh water is a source for proteins having immense importance and its use as a food is not hidden from anyone. Its use by the traditional healers and animal therapists as a healthy calcium supplement and in healing of other injuries is also proven. In the present study, the diversity and abundance of crabs from Buner district of Khyber Pakhtunkhwa Pakistan were looked over, over a period of three years extending from June 2013 till June 2016, collected at differ...
Masroor Ellahi Babar*
...n the expression of milk protein. It stabilizes the milk micelle and gene 5’ flanking region which works valuably in transcription regulation. Current study illustrates that Kappa-casein gene 5︠ flanking region in Dromedary camel of Pakistan is highly polymorphic and it is phylogeneticaly linked with other mammals. The analyses of the sequence of 5︠ flanking region in various breeds reveals the presence of different polymorphic regions includes cyste...

Jie Yang

...stern blot, the mRNA and protein expression were detected, respectively. Cellular apoptosis were examined by flow cytometry and Western blots was applied to assess the cleaved caspase-3, -8, -9, and cleaved poly-ADP-ribose polymerase. Protein expression of extracellular-regulated kinase were detected. Finally, data analysed statistically to determine significantly differences among groups. Results showed that breakpoint clus...

Asad Ullah1*, Umar Sadique2, Sultan Ayaz1, Muhammad Subhan Qureshi2 and Farhan Anwar Khan

...om already PPD (purified protein derivatives) tested lactating animals aseptically. The data obtained were finally analyzed statistically using chi squared test. The Mycobacterium was identified through ZN staining, culture and PCR. Out of 1608 milk samples, 60 (3.73%) were found positive for acid fast bacteria through ZN staining whereas the prevalence of Mycobacterium bovis was confirmed in 65 (4.04%) and 85 (5.29%) isolates through culture and PCR respectiv...
Asim Faraz1*, Abdul Waheed1, Annamaria Passantino2, Ayman Balla Mustafa3, Nasir Ali Tauqir4, Naeem Ullah Khan5, Muhammad Shahid Nabeel6
...ric diets with different protein levels as 18% (G1) and 22% (G2). Regarding roughage proportion lucerne and gram crop residues were fed. Daily feeding allowance was offered as 3% body weight. Water was provided twice a day. In blood-biochemical analyses, level of Hb (hemoglobin) concentration (P<0.05) was found to be significantly different as 16.4±0.14 and 16.8±0.09 (g/dL) with G1 and G2, respectively. The concentration levels of cholesterol,...
Asim Faraz1*, Abdul Waheed1, Muhammad Mudasser Nazir2, Aneela Hameed3, Nasir Ali Tauqir4, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal5
...k composition especially protein, fat, lactose and mineral concentration are influenced by exogenous OT administration. It affects the cell maintenance and mammary metabolism along with its proven physiological role in the milk ejection reflex. OT effects are not manifested through effects on cell remodeling. Observed effects of OT administration on reproductive anomalies are anestrous, the development of corpus-luteum cysts, follicular ovarian cysts, delayed ...

Saira Bano, Muhammad Naeem* and Samrah Masud 

...) fed at different crude protein (CP) levels ratios i.e., 15%, 20% and 25% CP. Fish were first collected, acclimatized, kept in triplicate aquaria under controlled conditions in three groups (T1, T2 and T3) and then 5 fish were selected from each treatment at the end of 12 weeks of feeding trial from January to April, 2018, during which fish were fed at the rate of 4% of their body weight. The blood variants were studied like Lymphocytes (LYM), Monocytes (MON)...

Anila Kousar, Muhammad Naeem* and Samrah Masud 

...uence of three different protein diets (T1=15%, T2 = 20% and T3 = 25% crude protein) on the proximate composition of Genetically Improved Farmed Tilapia (GIFT). It is a developed strain of Nile tilapia (Oreochromis niloticus). In the whole wet body weight of GIFT, the mean percentages for water, fat, ash, protein and organic content were observed as 79.13, 3.74, 2.75, 14.43 and 18.12 (T1,1...

Rabia Iqbal, Muhammad Naeem*, Samrah Masud and Abir Ishtiaq 

...ing them at three graded protein feeds (15%CP, 20%CP, 25%CP). Eighteen days old fry of hybrid (L. rohita ♀ and C. catla ♂) of 0.12±0.08 average weight(g) and length(cm) 1.63±0.21 were acclimatized and shifted in hapas (8x6x3 ft.), fed at the rate of 5% of their wet body weight. Ten samples from each hapa were randomly selected at the end of three months (90 days trial) for body composition analysis. Mean percent water, ash, fat and
Daniel Masood1, Noor Khan1*, Khalid Javed Iqbal2, Sadaf Dogar1, Abdul Hanan1, Sadia Nazir1, Sheeza Bano1, Azra Anwar2, Sameul A.M. Martin3  and Chris J. Secombes3
...heaper alternative plant protein moringa meal (Moringa oleifera) on growth and body composition of Labeo rohita fingerlings. L. rohita (average weight 190.25±00g) were stocked randomly in glass aquaria for a 90 day feeding trial. Fish were fed twice daily with four different iso-nitrogenous diets at a feeding level of 3% of total biomass. The diets contained 26% crude protein in which moringa meal...
Yan Xu1, Jia Zhou1, Guangfu Lv2, Yuexin Liu1, Xintong Zhao1, Xin Li1, Doudan Ye2, Xiaobo Qu1,* and Xiaowei Huang1*
...nd Bcl-2 expression. The protein levels of TGF-β/ Smad / ERK signaling pathway were detected by Western blot. We found that PAP significantly increased cell viability after DOX-induced injury, reduced LDH, CK-MB levels, up-regulated Bcl-2 expression and down-regulated Bax expression levels. In addition, PAP can delay cell G2/M phase arrest, reduce apoptosis, significantly reduce TGF-β1 protein levels and...
Ke Zhang1, Shuai Liu2, Qiu Chen1, Yu Wang1, Li Liu1, Bingjie Li1, Kai Ma1, Xiaoya Wei1, Aijun Li3 and Junyan Li2*
...were selected to prepare protein samples. Some of them were used for 2-DE, and the others were used to immunize mice to collect tick antiserum for WB. Then, 2-DE followed by WB and MALDI-TOF was carried out to screen and identify tick antigens. We identified 19 protein spots representing 12 ORFs: 4 from ticks and 8 from cattle. Among the the 4 ORFs, Tropomyosin, Elongation factor 1-alpha (EF-1α) and
Ambrin1*, Ghulam Dastagir1, Jehan Bakht2 and Muhammad Adil1
...o acids, reducing sugar, proteins, triterpenoids, gums and mucilages, fats, steroids, phenols and phytosterol.
...
Hui-Ying Chen1,2*, Ping-Chuan Yin1,2, Ya-Nan Lu1,2, Hai-Yun Li1,2*and Yang Shan3
...nalysis. Additionally, a protein-protein interaction network (PPI) was constructed and block analysis was performed using STRING and Cytoscape databases. A total of 248 genes were identified, of which 84 were downregulated and 164 were upregulated. Functional and pathway enrichment analyses indicated that upregulated genes were significantly involved in pyrimidine metabolism, glyoxylic acid metabolism and dicarboxylic acid m...
Yuhong Li1, Dongxue Wu1, Xue Wang1, Mi Zhang1, Hanyu Zhu1, Zhe Shi1 and Fumin Feng1,2*
...line group, the mRNA and protein levels of NF-κB and TNF-α in the H group showed an increasing trend, and p-NF-κB and p-IκB also showed an increasing trend. However, these indicators increased first and then slightly decreased in the R, Z and HRZ groups. Among them, the significant changes in the indicators of the HRZ group were earlier than those of other drug groups and the changes were most obvious. The mRNA and
Shaista Abbas1,Imtiaz Rabbani1, Hafsa Zaneb2, M. Shahbaz Yousaf1, Saima Ashraf2, Abid Hussain Shahzad3, M. Afzal Rashid4 and Habib Rehman1,*
...eriod. Serum urea, total proteins, albumin, globulin, albumin to globulin ratio, triiodothyronine, aspartate aminotransferase and alanine aminotransferase remained unchanged amongst the groups during the transition period. In conclusion, dietary yeast supplementation has resulted in better DMI and has a potential to improve the ability of Beetal goats to counteract the metabolic stress imposed by the transition period.
...
Fermín López-Uriostegui1, Jesus T. Ponce-Palafox2*, Fabiola Lango-Reynoso1, María R. Castañeda-Chávez1, Itzel Galaviz-Villa1, Sergio Castillo-Vargasmachuca2 and Arturo Ruiz Luna3
...ial shrimp feed with 35% protein, 12% lipid) daily at a ratio of 10% body weight, twice a day (10:00 and 18:00 h). The optimal growth intervals were from 26 to 29°C and from 3 to 11‰ of salinity, and survival was at 23 to 29°C and 0 to 5‰. The greatest effect of the temperature-salinity interaction was on the upper extremes of response. The analysis of response surfaces showed that the final weight and weight gain increased as temperature...
Arifa Savanur1,*, Tallat Naz1,2, Tayyaba Hamid1,3, Syed Abid Ali4, Mian Jahangir1,3 and Muhammad Abdul Azeem4
...s on the non-contractile proteins of Uromastix smooth muscle.
...
Tehreem Usman1, Sajid Abdullah1, Huma Naz2*, Khalid Abbas1, Laiba Shafique3 and Qaisra Siddique1
...(CAT) activity and total protein contents (TPC) in Ctenopharyngodon idella under binary mixtures of insecticides viz. endosulfan(ES)+chlorpyrifos(CPF) and endosulfan(ES)+bifenthrin (BIF). The fish behaviour was observed from both treated and control groups. Fish under exposure of insecticides mixtures exhibit abnormal behaviour and tried to jump out from water, come to surface and gulp air, showed increased opercular movement and erratic movements, hype...

Hassan Boulahyaoui1,2*, Sanaa Alaoui Amine1,3, Marouane Melloul4, Farida Hilali5, Elmostafa El-Fahime1,3, Saad Mrani1,2 and Nadia Touil1,5* 

...ions of the outer capsid proteins VP8* were compared with vaccine and field strains. Here we show that the VP4 gene of the P[14] strains detected in this study exhibited close identity with zoonotic Moroccan goat and bovine strains. The amino acid sequences of the antigenic regions inside VP8* proteins showed high conservation between the amino acid sequences of human and animal strains bearing P[14]

Nasrullah1*, Ahmad Nawaz Khoso1, Jamila Soomro2, Ilahi Bakhash Marghazani1, Masood-ul-Haq Kakar1, Abdul Hameed Baloch1, Sarfaraz Ahmed Brohi1 and Muhammad Asif Arain1* 

...tter intake (DMI), crude protein (CP) natural detergent fiber (NDF) and nutrient detergent fiber (NDF) were recorded significantly similar (P<0.05) in both species. Furthermore, digestibility of DM was observed similarly among two species while, digestibility of CP was recorded higher on millet fodder compare to other fodders. The digestibility of various nutrients such as CP, NDF and ADF were significantly higher (P<0.05) in sheep compared to goat. Dail...

Hafiz Muhammad Imran Javed* and Mushtaq Ahmed 

...son of three-dimensional protein structures. The N gene ORF was 1578 nucleotide long with a single open reading frame encoding 526 amino acids. Similarly, the ORF of F gene was 1641 nucleotide long which encoded 547 amino acids. Upon phylogenetic analysis of the country isolates with the vaccine strains, it was revealed that isolates were clustered within lineage IV (Asian Lineage) closer to Indian isolates. On the other hand, a number of substitutions were ob...

Ehsan-Ul-Haque1, Akbar Hayat1*, Muhammad Asim1, Sajjad Hussain2, Muhammad Shakeel Hanif3, Muhammad Zubair1, Muhammad Abdullah Jamil1 and Faheem Khadija1 

... (10.75 and 9.83), crude protein, crude fat and in DPPH activity respectively. The study depict that incorporation of salts to wax in substitution to the fungicide is an effective application to control postharvest citrus fruit decay with perks of safety and convenience. 

...

Parsa Riaz and Muhammad Naeem*

Digestive Enzymes Activity with Gut Morphometric Parameter of Carnivorous Fish Wallago attu (Siluridae, Siluriformes)
...ritional value, and high protein content in its flesh, Carnivorous in nature. Descriptive data of the studied traits included total body weight, total body length, gut weight, gut length, condition factor, standard length in Wallago attu. Fish body weight showed positive Pearson’s correlation with total length, gut weight, standard length and amylase enzyme. Fulton’s factor showed positive correlation with fish ZI, lipase and protease. ZI showed po...

Tanveer Sultan1, Anwaar Ahmed1, Aqsa Qayyum2*, Amer Mumtaz2 and Naeem Khalid

...o 3.80±0.04). The protein (8.93±0.03) and fat contents (3.01±0.06) were significantly higher in supplemented pasta having 50% buckwheat. However, it negatively influenced the cooking quality parameters (cooking time, loss of solids). The sensory scores emphasized that pasta with 30 % buckwheat supplementation was more appealing for taste, color and texture. The study postulated that buckwheat could be used as a potential source of gluten-f...
Sumaira, Ali Mujtaba Shah*, Ghulam Asghar Solangi, Ifra Anwar, Qudratullah Kalwar 
... carbohydrates, lactose, protein, minerals, nutrients and catalysts. A total of 20 % milk is obtained from different species including sheep, ass, horse, yak, goat, bison and camel while the 80 % milk is produced by cows. Milk of camel plays an essential part in the diet of human. Additionally, camel milk comprises numerous fatty acids and enzymes. Hence camel milk has many beneficial effects, such as antiviral, antibacterial, anti-diabetic, anti-carcinogenic ...

 Muhammad Shahzad1, Arif Iqbal Umar1, Syed Hamad Shirazi1, Muhammad Tariq Pervez2*, Zakir Khan1, Waqas Yousaf1

HCDP: HEPATITIS C DATA BANK OF PAKISTAN
...quitination sites in the protein sequences, motif/signature sub-sequences pattern, visual appearance of protein/nucleotide sequences for analysis of different sites, visual representation of multiple sequence alignments using colour code along with motif finding/conserved region in the sequence and analysing of graphical structure of phylogenetic tree. With the help of Format converter/Fasta generator tool use...

Muhammad Usama Hameed*, Zulfiqar Ali Gurmani, Sajjad Khan and Allah Bakhsh 

...(110-120 cm), high crude protein (36.23% over check variety S-2000), thick stem (14.86% more than check variety S-2000) and higher leaf area per plant (21.55% over check variety S-2000). The variety is drought tolerant may be grown in semiarid and arid areas having minimum rainfall up to 300 mm, highly lodging-resistant, late-maturing i.e. stay green till mid May, having up to 12 % crude protein and having green fodder poten...

Haiyan Yang1, Hongxia Liu1, Wenlong Wu1*, Weilin Li2 and Lianfei Lyu

...photosynthetic pigments, protein, soluble sugar, hydrogen peroxide (H2O2), malondialdehyde (MDA), ascorbate (AsA) and reduced glutathione (GSH), activities of superoxide dismutase (SOD) and peroxidase (POD) in leaves of ‘Hull Thornless’ were investigated. In the treatment group, water stress significantly increased EL, and the accumulation of photosynthetic pigments, protein, soluble sugar, H2O2 and MDA. After re...
Magbolah Salem Helal Alzahrani
...ed decrease in serum lipoprotein HDL, LDL, VLDL fraction levels, indicating liver damage. Rats given CCl4 and fed on 5% M. chamomilla showed the most significant increase in organ weight as compared to all levels of treatment suggesting that M. chamomilla can reduce liver damage. Rats given CCl4 then fed on a combination of all levels of M. chamomilla showed a decrease of AST, ALT and ALP enzyme levels in the serum, s...

Olga Mikhailovna Blinnikova1*, Vadim Anatolyevich Babushkin1, Lyudmila Gennadievna Eliseeva2 and Galina Severyanovna Usova3

Modeling a Formulation and Assessment of the Consumer Properties of the Special Purpose Starch Drink
... body to produce its own protein. Drinking kissel is a perspective product type for enrichment the CCR (Central Chernosem Region’s) fruit and berry’s by collagen and natural physiologically active agents. At the same time the new types of drinking kissel useful to health, in assortment are which confirms the feasibility of updating the range due to enriched drinking kissels. Drinking of one glass of kissel covers the body daily need for ascorbic ac...

Mazhar Abbas1*, Kishwar Jam1, Rashid Iqbal Khan1, Muhammad Zafar-ul-Hye2, Tariq Rafique3 and Zahid Mahmood

...e activity (64.42 U mg-1 protein), peroxidase activity (1.90 µmol min-1 g-1 protein), catalase activity (37.81 nmol-1 g-1 protein) and protein (6.28 mg g-1 fresh weight) contents. These commercial plant products based on amino acids enriched macro and micronutrients as well as acetyl-salicylic acid combined with ascorbic acid can be used carefully ...
Mahak Fatima1, Memoona Syed1, Rabia Zeeshan2, Farah Rauf Shakoori3, Naveed Shahzad4, Moazzam Ali1 and Zeeshan Mutahir1*
...siRNA transfection, MTH1 protein was knockdown to approximately 77% in the transfected sample and resulted in a 1.75-fold increase in sensitivity of MCF7-R cells to gemcitabine. Moreover, higher expression of p21 protein was also observed in transfected MCF7-R cells that may indicate induced cell death. This study highlights the effect of MTH1 gene silencing in drug-resistant cancer cells as a mean to improve combined...
Maryam Yousaf1, Naveed Shahzad2, Zeeshan Mutahir1 and Moazzam Ali1*
...ession of MRP-1 mRNA and protein in comparison with PC-3/Wt cells. MRP-1 was found distributed between intracellular and cell surface pools in PC-3/Res cells and was capable of drug efflux as shown by doxorubicin and epirubicin efflux assays. Moreover, qRT-PCR and Western blot analysis showed that PC-3/Res cells also had significantly up-regulated expression of Rab21. To study the effect of Rab21 on MRP-1 mediated multidrug resistance, siRNA mediated knockdown...
Ayesha Noreen1, Amina Elahi1, Dilara Abbas Bukhari2 and Abdul Rehman1*

 

...+ as cofactor. The protein profile of B. cereus 3.1S, showed two bands of approximately 14 and 70 kDa, which had their possible role in arsenite oxidation. This was confirmed by transforming E. coli DH5α with plasmid DNA of B. cereus 3.1S. This arsenite resistant bacterial strain oxidized 76 and 86.5% As3+ from the original industrial wastewater after 3 and 6 days of incubation, respectively. This bacterially treated...
Feng-Mei Yang1, Rui Li2, Xiu-Xue Hu3, Yong Liang4, Bo Gao3* and Wei Chen3*
...in and senescence marker protein-30 (SMP30) after normal human skin fibroblasts (NHSFs) irradiated by different UVB doses as well as durations, thus unveiling mechanisms underlying HSF senescence induced by Ultraviolet B (UVB). NHSFs treated under different doses (100, 200, 300 mJ/cm2) of UVB with different durations (1, 2, 3 days) were case group, while those without UVB irradiation were control group. Expressions of gene/p...
Zengwen Huang1,2, WuReliHazi Hazihan2*, Baheti Bodai2, Kadyken Rizabek3, Nuralieva Ulzhan3, Omarova Karlygash4, Juan Zhang1 and Yaling Gu1*
... to approximately 40 KDa protein. Q-PCR analysis showed that the plasmid pGenesil 10-3p-siRNA could interfere with the expression of INHα in granulosa cells to an efficiency of 83%, which was also confirmed through western Blot assay.This study successfully constructed the eukaryotic expression plasmid pGenesil 10-3p-siRNA, and confirmed that the plasmid interfered significantly with the expression of INHα gene in YM sheep. Our current findings can...
Yan Zhou1,2, Hai Xia Han1,2, Qiu Xia Lei1,2, Jin Bo Gao1,2, Wei Liu1,2, Fu Wei Li1,2, Jie Liu1,2 and Ding Guo Cao1,2*
...l;">Very low density lipoprotein receptor (VLDLR) is of vital importance for egg production in mediating the synthesis of yolk protein precursors. To better understand the effects of VLDLR on reproduction in chickens, the haplotypes and diplotypes based on three genetic mutations (NC_006127.2:g.8467G>A, NC_006127.2:g.12321G>A and NC_006127.2:g.13876A>G) were constructed, and the associations of diplotypes with repro...
Ishrat Perveen1, Yasar Saleem2 and Javed Iqbal Qazi3* 
...ic amines (HCAs) in high proteinaceous food specifically in cooked meats is a point of great concern for the health risk factor of Pakistani community. Ready-to-eat (RTE) chicken kabab samples of four commercially available brands (K, S, D and B) were analysed for the simultaneous determination of HCAs i.e. 2-amino-3-methyl-imidazo[4,5-f] quinoline (IQ), 2-amino-3,8-dimethylimidazo [4,5-f] quinoxaline (MeIQx) and 2-amino-1-methyl-6-phenyli...

Muhammad Jawad1*, Shahid Riaz Malik1, Rana Muhammad Atif2, Haris Ahmed2 and Muhammad Shahzad Afzal3

Species Identification of Gram Wilt Complex through ITS Region by PCR-RFLP Analysis
...me that serve as dietary protein source for poor farmers in the developing countries. Yield and production severely challenged by biotic stresses. Wilt complex is the major biotic factor that contribute significantly in yield loss. Wilt complex is caused by various pathogens, including diverse type of Fusarium species. Molecular approach is a useful technique for the identification of wilt complex pathogens. The study conducted to identify the polygenetic asso...

Rabab Rafaqat1, Habib Ahmed Rathore1, Tariq Masud2, Imran Hayat1* and Imtiaz Hussain1

Determination of Different Chemical Constituents of Fruit, Leaves and Oil of Olea cuspidata (Wild Olive) Grown at Rawalakot, Azad Jammu and Kashmir
...tent, crude fibre, crude protein, total oil, ash content and nitrogen free extract of fruit and leaves were studied. Extracts of wild olive fruit and leaves were made in four different solvents (ethanol, methanol, acetone and water). Total phenolic content (TPC) and total flavonoid content (TFC) of fruit and leaves extracts in these solvents were determined. Oil was extracted from wild olive fruit by the process of solvent extraction and was studied for physic...
Huma Abbas1, Muhammad Azhar Iqbal2, Muhammad Kamran3, Muhammad Umar Shahbaz3*, Haseeb Ullah Kamber1, Nazir Javed1, Muhammad Junaid1, Hira Abbas4 and Muhammad Ehetisham ul Haq3
Evaluation of Advanced Mung Bean Germplasm against Cercospora Leaf Spot and its In-vitro Management by Different Fungicides
...riod legume and poor man protein source along with carbohydrates and vitamins. Cercospora Leaf Spot is a devastating threat to the crop caused by Cercospora canescens, affects the whole crop and 95% yield losses may be attributed in severe conditions. To manage the diseases through tolerant germplasm and with environmentally safe fungicides is a cost-effective approach. The present study was aimed to find the resistant germplasm against the disease and to eval...

Khan Sher1*, Muhammad Subhan1, Muhammad Nisar2, Ali Hazrat2, Zahid Fazal1, Gul Rahim2, Imran Ahmad1, Riaz ul Haq1 and Shamia Bibi1

Genetic Diversity in Common Beans (Phaseolus vulgarus L.) Collected from Different Ecological Zones of Malakand Division (A Part of the Sino Japanese Region of Pakistan)
...g, high productivity and protein significance as compared to other parts of the world, which could be utilized for evolving better quality and high yielding cultivars of P. vulgarus.

...
Asim Faraz*
...ol, triglycerides, total protein, albumin, calcium and phosphorus were found to be significantly different higher in IMS compared to SIMS and EMS. The levels of urea, creatinine and glucose were found to be varied (P>0.05) among groups. Regarding hair mineral status Ca, Mg, Cu, Zn, Fe and Mn concentrations were found to be significantly different (P<0.05) among calf groups in IMS, SIMS and EMS.
...

Dalal H. Sary and Rama T. Rashad*

A Comparative Study on the Impact of Compost, Humate, and Silicate on the Nutritional Characteristics of Calcareous Soil Cultivated by Soybean
... significant increase of protein and total N (~77.07%) followed by K-Si (~60.67%) then K-H (~ 17.69%). However, compost and K-Si have almost decreased the concentration (mg kg-1) of Cu, Fe, Mn, Zn, and Si in soybean seeds significantly by increasing the application rate from 50 to 100 %. Potassium silicate was the most effective Si-source in this study due to its content of readily soluble Si in soil solution. Silicon uptake can partially control the availabil...

Muhammad Nauman, Unsar Naeem-Ullah*, Mehreen Hanif, Hafsah Ghaffar, Muhammad Shahid and Syed Haroon Masood Bokhari

Management of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) by using Microwave Oven
...ins have rich sources of proteins, fibers and minerals. This cereal crop has maximum proportion in daily basic diet of human in Pakistan. Disinfestation of wheat grains by using microwaves can be safe option than chemical control. Therefore, in this study a digital microwave oven of 50 Hz is used to determine the mortality of Tribolium castaneum (Herbst) and Rhyzopertha dominica (Fabricius) adults. Grain samples of 20 g in each petri dish were infested with bo...
MA Liman1, QI Yongxiao1, Wang Wenji2* and Zhong Qianyi3*
...resulted in reduced Vegf protein expression. Our study suggested that G-Rh2 may exert anti-angiogenic activity by downregulation of Vegf in zebrafish embryos, thus indicating its role as a potential therapeutic agent against cancer.
...

Syeda Farzana Bibi* and Siraj ud Din

Unraveling the Bioherbicidal Potential, Elemental Analysis and Nutritional Evaluation of Crataeva adansonii Dc Leaf and Bark
...ntages of carbohydrates, proteins, fats, fiber, ash, and moisture. The bioherbicidal potential of the proposed plant was evaluated through the Lemna minor model of phytotoxicity. C. adansonii is a source of several essential macro and micronutrients. A nutritional value analysis of this plant offers its use as a food source. Bioherbicidal/phytotoxic activity revealed significant results in the form of dose-dependent inhibition of frond growth. Ethanolic extrac...
Kui Zhang1,2, Ping Geng1, Sher Khan Panhwar3, Khadim Hussain Memon4 and Zuozhi Chen1,2,*
... the provision of animal protein, employment solutions, and foreign-exchange earnings through exports. However, stock assessments are available for few of the commercial marine fish species in Pakistani waters. Most commercial fish species lack assessments of maximum sustainable yield (MSY) and allowable catch, a situation that hinders effective fisheries management. A Catch–MSY model based on statistical catch data and prior information on population pa...

Kecheng Zhu1,2,3, Peiying He1, Baosuo Liu1,2,3, Huayang Guo1,2,3, Nan Zhang1,2,3, Liang Guo1,2,3, Shigui Jiang1,2,3 and Dianchang Zhang1,2,3,* 

...muscle-specific membrane protein that is essential for myoblast fusion. Myomaker is regulated by myoblast determination protein (MyoD), a muscle-specific basic helix-loop-helix (bHLH) transcription factor in higher vertebrates. However, the transcriptional regulatory mechanism of the myomaker gene has not been explored in marine fishes. In the present study, molecular cloning, bioinformatic analysis and transcriptiona...

Fan Sigang1, Guo Yihui1* and Xu Youhou2

...KEGG pathways related to protein glycosylation, fatty acid biosynthetic processes, hydrolase activity, and AMPK were enriched in the ovary, whereas those related to male organ formation and spermiogenesis were enriched in the testis. The glycosphingolipid biosynthesis pathway was identified for the first time in a mollusc testis.The present study provides the first transcriptomic analysis of C. nobilis, which will help clarify the molecular mechanisms o...

Asim Faraz1*, Abdul Waheed1, Ayman Balla Mustafa2, Nasir Ali Tauqir3, Riaz Hussain Mirza1, Hafiz Muhammad Ishaq1, Rana Muhammad Bilal4 and Muhammad Shahid Nabeel5

..., respectively. The fat, protein, lactose, SNF and total solids percentage was found to be 4.44, 4.40; 3.42, 3.38; 4.82, 4.76; 8.96, 8.93 and 13.38; 13.33, respectively under EMS and SIMS. The results could be used for future intensive camel production in Pakistan.
...
Yujun Zhao and Jianping Fan*
...ed factors Bcl-2 and Bax protein and the activities of Caspase-3 and Caspase-8 in colon cancer SW480 cells were studied. Compared with the control group without medication, the proliferation inhibition rate of cells processed with Kanglaite injection (10, 20 and 40 μL/mL) significantly increased (p <0.05), the apoptosis rate increased (p <0.05), the expression of Bcl-2 protein decreased (p <0...
Yahui Wang1, Ling Ren1, Yishen Xing1, Xin Hu1, 2, Qian Li1, Lingyang Xu1, Junya Li1* and Lupei Zhang1*
...ects of bone morphogenic protein 4 (BMP4) and rosiglitazone during differentiation were studied. Comparing with control group, progenitor cells treated with BMP4 or rosiglitazone accumulated more intracellular lipid. Furthermore, the mRNA expression level of adipocyte-specific genes also increased significantly in BMP4 or rosiglitazone treated cells. The result indicated that BMP4 and rosiglitazone could promote adipogenesis and be applied in adipogenic differ...

Mahmoud Mohamed Ahmed Youssef* and Suzan Abd-Elazeim Hassabo

The Role of Genetic Engineering in Management of Plant Parasitic Nematodes with Emphasis on Root-Knot Nematodes: A Review
...industrial production of proteins and peptides to manage root-knot nematode. Mi gene resistance in tomato plants has been utilized to manage M. incognita and M. javanica. Also, protoplast fusion between Pseudomonas fluorescens and P. aeruginosa to manage M. incognita was utilized. Many genes expressed in nematode feeding cells or the regulatory regions that control these genes have been isolated. Transproteins toxic to diffe...
Inga Kowalewska-Łuczak1 and Ewa Czerniawska-Piątkowska2,*
...y the highest content of protein and the lowest content of fat in milk. On the other hand, for the SAA2 c.114G>A polymorphism, it was shown that cows with GA genotype were characterized by the lowest calving interval (P≤0.05). In summary, the information contained in th...
Syed Zakir Hussain Shah1*, Muhammad Afzal2, Mahroze Fatima3Syed Makhdoom Hussain4 and Tanveer Ahmed5
...re contained 37.6% crude protein and 4.72 kcal/g gross energy. Results showed improved (p<0.05) dry matter, crude protein, crude fat and gross energy digestibility by fingerlings when fed PHY sprayed diet. Similarly, CA addition in the diet resulted in increased (p<0.05) digestibility of these nutrients. Also, the minerals digestibility was significantly (p<0.05) affected by top spraying of phyt...
Xuya Zhou1, Ying Liu1, Deqin Xu1, Jie Bao1, Yaru Cao2 and Yong Jin3*
...tern blot to explore the protein expression levels of COX-2 and cytochrome P450 (CYP) 4A1. The expression of CYP4A1 was detected by immunohistochemistry. Enzyme-linked immunosorbent assay (Elisa) was used to detect the prostaglandin E2 (PGE-2), 20-Hydroxyeicosatetraenoic acid (20-HETE), endothelin 1 (ET-1) and B-type natriuretic peptide (BNP) in blood serum of diabetes complicating arthritis rats. Blood pressure was measured by a noninvasive caudal artery bloo...

Muhammad Jahanzaib1*, Nazakat Nawaz1, Muhammad Arshad1, Shehzadi Saima4, Muhammad Suhaib2, Muzammil Husain3, Haris Khurshid1 and Shahid Ali Khan1

Effect of Temporal Application of Gypsum on Mineral Uptake and Economically Important Morphometric Traits in Groundnut (Arachis hypogea L) under Rain-fed Conditions
...dnut is a good source of protein, edible oil, and vitamins. A gradual decline in groundnut yield has been reportedly subjected to various agro-climatic conditions and soil fertility problems. In this study, various regimes of gypsum application and its effect on groundnut yield, morphometric parameters, and minerals (Ca, K, P) concentration in root and shoot have been examined. A newly released Pothowar groundnut variety (Variety name) was grown in 3 replicati...

Luqman* and Zahid Hussain

Impact of Tillage Tools and Weeding Regimes on Nutritive Values of Maize Grains
...e grains including crude protein content, fat content, ash content and dry matter content of the maize grains. The results showed 13% protein content, 5.8 % fat content, 0.93 % ash content and 89.6 % dry matter content in the maize grains, which were the higher values achieved in plots treated with mouldboard plough, while in the weeding regimes the crude protein content, fat content, ash ...

Muhammad Luqman1*, Roshan Hussain1, Muhammad Yaseen1, Muhammad Umer Mehmood1, Ijaz Asghar2 and Usman Saleem1

Comparative Analysis of Dietary Intake Patterns of Rural and Urban Communities of Southern Punjab, Pakistan
...f the communities prefer proteins with fats and sugar commodities. In lunch rural community is much attracted towards carbohydrates and dairy products, while urban community prefers wheat bread with fruits and vegetables. Fruits, dry fruits and legumes are a best source of attaining maximum micro and macro nutrients. In comparison to this rural community of the study area perceived that vegetables and fruits are rich in macro and micro nutrients. Keeping in vi...
Q. Sun1, Q. Liu1, R. Di1, Y. Wang1, S. Gan2, S. Liu2, X. Wang1, W. Hu1, X. Cao1, Zh. Pan1, X. Guo1, Y. Yang3, H.E. Rushdi4* and M. Chu1*
...>THRSP) is a crucial protein for cellular de novo lipogenesis. THRSP gene encodes a nuclear protein which regulates fatty acid synthesis in lipogenic tissues. Identification of single nucleotide polymorphisms (SNPs) of sheep THRSP gene and their association with fat deposition were investigated using Altay and White Suffolk sheep. In addition, the messenger RNA expression profiling of THRSP in fat-ta...
Muhammad Shafiq1,2,*,Rajwali Khan1, Ilyas Ali3, Sadeeq Ur Rahman4, Saif Ullah3Shah Jan Mohammad2, Mohammad Jan2 and Jinhu Huang2
...erum IgG and serum total protein concentration (b) colostrum immunoglobulin level and (c) their respective calves’ serum immunoglobulin and serum total protein concentration. Three breeds of cattle were observed: Jersey, Holstein Friesian (HF) and local Pakistani cow breed Achai. To assess serum IgG, sodium sulphite precipitation technique was used while IgG in colostrum were determined using digital Brix refrac...

Ambreen Akhtar Saddozai1, Amer Mumtaz2, Naseem Rauf1, Saeeda Raza2, Nouman Rashid Siddiqui2, Muhammad Naeem Safdar2, Sahar Shibli2, Muhammad Suhail Ibrahim3*, Muhammad Akhtar4 and Muhammad Saad Rehan5

Preparation and Quality Evaluation of Soymilk Carrot Blend
...eing potential source of protein was used as a carrier of pro- vitamin A. Carrot powder was blended in soya milk at three different concentrations levels 2%, 4% and 6% and packed in sterilized bottles. The product was kept at two different temperatures (ambient and refrigerated temperature) for 14 days to assess its shelf life. During the storage period the samples were analyzed for different chemical parameters total soluble solids, pH, total carotenoids,
Ahmad Sadiq1, Muzafar Shah2*, Habib Ullah1, Irfan Ali1, Amir Alam3
Navid Jalil1 and Muhammad Khan3
...nts with low density lipoprotein (LDL), high density lipoprotein (HDL) and body mass index (BMI) were found to be significantly lower (p > 0.05) than normal or control. Gender-based analysis has shown that HbA1c, RBS, DBP and SBP in male patients have significantly higher (p<0.05) than female. But in female patients the TC, TG and BMI are insignificantly higher (p<0.05) compared to male. High density lipo
Shikang Deng1,2, Yan Jin2, Jing Xu2, Xiufang Zhu2, Pinghai Hu2, Jiao Li2, Li Zhang2 and Jianzhong Tang2,*
...ta;1, cyclinD1, and CDK4 protein in each group of cells; and real-time polymerase chain reaction was used to detect the expression levels of TGF-β1, cyclinD1, and CDK4 mRNA in each group of cells. The results showed that after 5-FU intervention, the proliferation of bile duct scar fibroblasts was inhibited, and the expressions of TGF-β1, cyclinD1, CDK4 mRNA and protein in the cells were down-regulated (P<0.05), ...

Muhammad Shahid1*, Unsar Naeem-Ullah1, Waheed S. Khan2, Shafqat Saeed1 and Kashif Razzaq3

Application of Nanotechnology for Insect Pests Management: A Review
...ant extracts, fungi, and protein. This review article climaxes the latest mileposts accomplished for the production and imminent perspective of nanoparticles for the controlling of insect pests. 

...
Vijay Lal and Muhammad Naeem*
...ash 6.72%, fat 3.45% and protein 16.62% in the whole wet weight of body of T. jarbua. % water represented correlation with highly significant value (P<0.001) with protein, ash, fat and organic constituents in wet weight. Fish body weight represented highly significant (P<0.001) positive relation to all the studied body constituents in log transformed data. Total length also represented highly-significant positiv...

Junaid Ahmad1*, Shazma Anwar1, Anwar Ali Shad2, Fazal Yazdan Saleem Marwat3, Hamida Bibi4, Farhan Ahmad1, Wajia Noor5 and Bibi Sadia5

Yield and Nutritional Status of Mungbean as Influenced by Molybdenum and Phosphorus
...-1 molybdenum while more protein content (21.91 %), carbohydrates (60.36 %), nitrogen content in grain (3.76 %) and straw (1.10 %), phosphorus uptake in grain (0.380 %) and straw (0.186 %) was achieved with molybdenum applied at rate of 2.5 kg ha‑1. Whereas in case of phosphorus use maximum  seed yield (810.88 kg ha‑1) and harvest index (26.92 %) was observed with 60 kg ha‑1 P application while highest protein con...
Xiaopeng Tang1,*, Lei Chen1, Kangning Xiong1, Dun Deng2 and Peng Peng2,*
... presents an alternative protein resource to meet ever-increasing demands of feed ingredients in poultry production sectors.  
...
Abdul Hafeez1*, Akhtar Nawaz Khan2 and Zahid Ullah3
... molecules including DNA/proteins and diseased human cells can be detected by a variety of micro and nanoscale devices and systems. Unfortunately, these biomedical applications suffer from huge amount of data. That is, the data generated by such systems is so large that a typical computer workstation cannot handle it in real-time. Traditional approaches rely on unloading raw data to off line storage and suffer from the trade-off of an insufficiently rigorous s...
Abdul Nabi Jatt1,2*
...orum-quenching (QQ) AiiA protein. The present study, for the first time provides evidence that the QS system via AHL molecules involved in regulating the production of two different forms of an extracellular cellulase enzyme, i.e., exoglucanase and endoglucanase in marine snow associated bacterium C. freundii<...
Faheem Ahmed Khan1*, Sarzamin Khan2, Qurat-ul-Ain3, Saqib Ishaq1Muhammad Salman1, Abdul Rehman1, Ikram Ullah4, Kalsoom5 and Johar Jamil5
...tion of non-conventional proteins utilizing the available cheap sources. The indigenous Saccharomyces cerevisiae were isolated from different fruit samples, identified by conventional polymerase chain reaction (PCR) and were characterized for production of single cell microbial protein (SCMP). Out of 60 different fruit samples, a total number of confirmed S. cerevisiae isolates were 1, 2 and 1 from orange (C...
Mashal Malik and Mudassar Nawaz Khan*
 
...itionally rich source of proteins and fats. It is grown in many countries of world including US, China, Brazil and India. Pakistan grows soybean on a very limited land owing to lack of farmers interest and government attention. Soybean lines; B24G14, B23G5, B20G16, B21G2, B21G9, B6G23, B23G16 and B29G11 were grown for one month and analyzed for morphological and molecular variations. In order to analyze genetic varia...
Naveed Akhtar1*, Muhammad Fiaz Khan1*, Sadia Tabassum1
Munawar Saleem Ahmad2 and Khan Dil Badshah3
...s, cholesterol, urea and protein level decreased, whereas in the glucose level increased in all treated groups. In histopathology, dose dependent lesion and alterations in gills, liver, brain, kidney, intestine and muscles related with oxidative stress damage was observed. Genotoxicity increased with increase in time and concentration of cypermethrin. Cypermethrin is therefore extremly harmful to aquatic life.
...
Muhammad Rashid, Mahmood Ahmad Sajid, Nosheen Noor Elahi, Sibgha Noreen and Kausar Hussain Shah*
 
...tions. The total soluble proteins, proline, glycinebetaine and phenolic contents were improved in all three wheat varieties under drought stress. The variety Pu19 was exhibited a higher level of proline, glycine betaine and phenolic contents were. Similarly, hydrogen peroxide (H2O2) and malondialdehyde (MDA) were improved in all three wheat varieties but this increase was relatively lower in variety F23. The superoxide dismutase (SOD), pe...
Muneer Abbas1*, Dilbar Hussain2, Muhammad Saleem2, Abdul Ghaffar2Sohail Abbas3, Niaz Hussain1 and Abdul Ghaffar1
... A=sanitation, B=MAT, C= protein based baits, D= plant extracts and E= A+B+C+D were used during 2015-16. Data of % infested fallen fruits, total flies/trap, total flies captured/year, % fruit punctures, pupal population, % fruit infestation and market value of fruits was collected at regular intervals. Results indicated that when all the components were applied in a combined way they gave significant reduction of fruit losses. As a result of continuous sanitat...
Muhammad Naeem1,2, Nasir Rajput1,2, Sher Ali3, Asmatullah Kaka2, Dildar Hussain Kalhoro2, Mehvish Rajput2 and Tian Wang1,*
... TRS-II, while the crude protein (CP) were higher and acid detergent lignin (ADL) were lower (P<0.05) in AH than other groups. The concentration of acetate, butyrate and iso-butyrate were almost similar in TRS-II, AH and CWR; valeric and iso-valericwere lower (P<0.05) in CWR and TRS-I than AH and TRS-II, while the propionate and total VFA were higher in AH but similar in CWR and treated rice straw. The in vitro degradibility of DM, O...
Iram Liaqat1*, Tahir Hussain1,2, Aisha Waheed Qurashi3, Gulbeena Saleem2Asia Bibi4, Muhammad Fiaz Qamar5,ShaukatAli1 and Ikram-ul-Haq6 
...rypsin, chymotrypsin and proteinase k against S. Gallinarum. We observed that S. Gallinarum has strong biofilm forming ability as observed by dark black colonies on congo red medium. Quantification assays such as test tubes revealed significantly (p<0.001) strong biofilm after 5 days with significantly increased planktonic cells (after 3 days) and increased loosely bound cells (after 5 days). Similarly, air liquid interface coverslip indicated...
Qiang Tang1 and Qianli Tang2*
...evels of Ang-1 and Tie-2 proteins in skin tissue decreased (both p<0.001). Compared with model group, thickness of epidermis, dermis and collagen fibers, and expression levels of Ang-1 and Tie-2 proteins in skin tissue in isoliquiritin group increased (all p<0.001), and inflammatory factors TNF-α, IL-6 and IL-1β contents and expression level of Ang-2 protein ...
Junyan Bai*, Zhihao Dong, Youbing Yang, Ziheng Li, Xiaoning Lu and Huirong Gong
...P<0.05). Crude protein contents in forelegs, hind leg and back were remarkably higher than that in waist (P<0.05). The crude fat content of the waist was significantly higher than that of other parts (P<0.05). To sum up, due to low shearing force, meat quality of hind leg was tender just with slightly low crude fat content; crude fat content of waist was high, so flavor of waist was good. The correlation coefficients of flesh colo...
Sheza Shehzadi1, Mohammad Umar Farooq2*, Rukhsana Kausar1, Ijaz Ali1*, Muhammad Arshad Ullah3 and Maqbool Shahbaz4
...imate analysis including protein content, crude fiber, ether extract, and total digestible nutrients. Significant results were obtained by applying ANOVA test on the data retrieved. All three factors (BP, CC and CS) showed maximum results after 60 days of growth. The result indicated that after the 60 days interval the animal unit per month gave the maximum fodder (7.0667 AU/M/Ha) that proposed to be grazed for large ruminants and then 21 small ruminants on th...
Sadaqat Khan1,Saleem Ullah1* and Muhammad Sajid2
... ash, crude fiber, crude protein, crude fat ranged from 92.082 to 92.317, 3.097 to 3.85, 4.9133 to 5.2717, 5.0133 to 5.2867, 1.08 to 1.24, 0.0236 to 1.9567 g/100g and that of fruits with lesser values were also affected significantly (P<0.05). From the present study it was concluded that Se applied in the form of sodium selenite in irrigation and foliar spray considerably affected the physical parameter of tomato hybrid Salar F1, followed by proximate compo...
Yuanyuan Zhang1*, Liping Song1, Hui Guo2, Jun Wu1, Xiaoli Wang1 and Fangbin Yao1
...Nrf2 mRNA level and Nrf2 protein level in the liver nucleus, and those of the P5 group were highest. Overall, the results indicated that appropriate dietary curcumin supplementation could enhance the growth (especially 60 and 120 mg kg-1 curcumin per feed) of common carp and effectively protect the liver against CCl4 induced injury (especially 120 mg kg-1 curcumin per feed) in fish.
...
Sadaf Javaria1, Anum Marwat1, Muhammad Nadeem2, Mehwish Zerlasht1, Aiman Kareem3, Iqra Rubab1 and Masooma Munir4*
...solids (TSS), vitamin C, protein, iron and magnesium were investigated. Results of sensory evaluation showed that all the samples were in an acceptable range. However, Mix fruit leather with 50 % apple puree and 50% peach puree was liked the most by the panelists.
...
Salman Ali1*, Ayaz Ali2, Riaz Ali Rind2, Majid Ali3, Zulfiqar Ali Mastoi2, Shagufta Naz3, Muhammad Shakir3, Rashid Ahmed Qaim Khani1
...ty 1.78%, pH value 6.26, protein 24.07%, fat 3.76%. Whereas, the fried fish resulted moisture 62.16%, titratable acidity 1.39%, pH value 5.96, protein 21.11%, fat 5.93%. The fish grilled resulted in moisture 60.19%, titratable acidity 1.32%, pH value 5.89, protein 20.28%, and fat 4.13%. According to the sensory evaluation the result of microwave method were found significantly high than ot...
Yongyun Zhang1, 2, Xinyang Fan1, Fangting Zhou1, Weizhen Li3, Yina Ouyang1,4 and Yongwang Miao1*
...tudy, and accordingly, 6 protein variants and 2 synonymous variants of αS1-CN were inferred and named. The variants A, B’, B’’, C, E and F were observed only in river buffalo, whereas variant D was found only in swamp buffalo. The variant B was shared by both types of buffalo with high frequencies. The buffalo variants determined here did not exist in Bos genus. In addition, 9 amino acid differential sites of

 Muhammad Ajmal1, Saima Mustafa1, Fizza Ibrahim Bajwa1, Cheng Zhou2, Guangdong Wen2, Soe Lwin Myint2, Syed Irfan Raza3, Ihtasham Bukhari4, Mubashir Hassan5, Muhammad Faisal6 and Furhan Iqbal1*

...mature termiation of the protein after 23 amino acid residues (p.P144LfsX23), resulting in a truncated HR protein with 166 amino acid residues. The mutation followed Mendalian pattern of inheritance as all the patients are homozygous for the mutation while parents were heterozygous and unaffected siblings from both families were either heterozygous for the reported mutations or they lacked this mutation.
...
Saad A. Moussa1, Mohammed Ahmed Mahmoud Abdullah2*, Mahmoud Saied1, Mustafa Saleh1, Mohamed A. Soliman2 and Ali Mahmoud Zanaty2
...g for the partial fusion protein, The eight NDVs isolates of velogenic genotype VII and contain the unique cleavage site motif 112RRQKRF117 with high relation to very virulent NDV Chinese strain Chicken /China/SDWF07/2011 strain with nucleotide identity percentage (99.3% -100%). The main causative agent of recent ND outbreaks in vaccinated broiler flocks in Menofia governorate, Egypt was found to belong to very virulent genotype VII. This strain was geneticall...
Hafiz Tassawar Abbas1*, Tamoor Khan1, Ghulam Khaliq2, Muhammad Aqeel Sarwar3, Muhammad Rashid4, Intazar Ali5, Muhammad Abuzar Jaffar2, Ghulam Ali Bugti6 and Muhammad Waseem4
 

...s a rich source of plant protein. A number of diseases attack chickpea crop but wilt disease is the principle one. In mineral contents i.e. nitrogen, phosphorus, potassium, calcium, magnesium, sodium, zinc, iron and copper were decreased in chickpea plants affected with wilt disease. Leaves of three resistant and susceptible (un-inoculated and inoculated) chickpea lines/varieties were tested to find out their ionic status...
Sohail Akbar1*, Muhammad Shafiq2, Muhammad Yaqoob2, Muhammad Farooq Iqbal2, Kashif Ishaq2, Muhammad Kamran2, Shazia Shamas3, Arbab Sikander4 and Muhammad Hashim5
 
 
...es along with the bypass protein. So there is need of nutrition based management of animals in proper way.
...
Aylin Celile Oluk1*, Ugur Serbester2, Murat Reis Akkaya3 and Oya Berkay Karaca4
...6.50% fat and 4.80-5.10% protein. The lactose content did not differ significantly between milk samples from the two locations (3.90-4.20%). Total unsaturated fatty acid levels were significantly higher than total saturated fatty acid contents, irrespective of the lactation period (p<0.05). Milk from Hatay was high in saturated fatty acids, aromatic hydrocarbons and benzaldehydes, i.e. 4.50 g 100 g-1, 6.80-4.65 mg 100g-1 and 0.28-0.70 ...
Simeen Mansoor, Jabeen Farheen* and Meher Hassan
 

...rmal;">The specific proteins induced by sublethal-temperature are molecular chaperons that positively regulate plant growth and development that govern acclimation in plants but little has been known under lethal-temperature stress. Thus, the impact of induction of thermotolerance by sublethal-temperature (40 °C), 100 µM indoleacetic acid (IAA), and 100 µM gibberellic acid (GA
Suwati Suwati1, ErniRomansyah1,*, Syarifudin Syarifudin1, Yahya Jani2, Agus Heri Purnomo3
Damat Damat4 and Erkata Yandri5,6
...onsists of carbohydrate, protein, fat, fiber and ash, vitamin, and beta-carotene. Right drying methods are needed to preserve the quality of dried seaweed. This study aims to compare the trend of weight reduction in seaweed during drying by natural and cabinet methods. The methods were used experimentally in the field and laboratory. And the data were analyzed using simple linear regression to formulate a trend of reduction in the weight of seaweed while dryin...

Saad A. Moussa1, Ahmed F. Afify1*, Suzan Salah2 and Ayman Hamed3

...targeted to nucleocapsid protein gene (N-gene) was carried out followed by phylogenetic analysis. Positive samples were isolated on Vero cell culture and identified by TEM and immune-peroxidase technique. Betacoronavirus 1 was detected by ELISA in 6 out of 20 fecal samples (30%), PCR detected 4 out of 6 ELISA positive samples at specific M.W. band of 236 bp by electrophoresis, and one sample was sequenced and submitted on Genbank with acc.no. MW173144, further...

Masood Sadiq Butt1, Sadia Aslam1,2, Rizwan Shukat1,*, Syed Qamar Abbas1, Muhammad Issa Khan1, Shadab Shaukat3 and Muhammad Shahid4

...an appreciable amount of proteins, enzymes and fats. It was considered as garbage of no financial value and disposed of without any attempt of recovery. The aim of this study was to optimize the hydrolysis conditions for production of protein hydrolysate with enhanced functionality. Minced rohu (Labeo rohita) waste mainly comprising of head, tail, fins and skin was considered as raw material to prepare
Muhammad Farhan Qadir1, Xin-Yu Han1, Meng-li Qiao1, Ying Wang1, Ding Zhang1, Yu-hai Bi1,2, Ali Raza Jahejo1,Qian-qian Cheng1 and Wen-xia Tian1,*
...n blot analysis of COX-2 protein expression further supported the mRNA results. Moreover, this was first study indicating the expression levels of PG-related genes in the H9N2 infected chicken’s erythrocytes. This study may provide a new biomarker to detect H9N2 in chickens. Future studies are in process to know the morphological features, and to evaluate the mechanism exhibited by erythrocytes in response to H9N2 with new experimental evidence in chicke...
Aysha Riaz* and Said Wahab
...rich in nutrients namely proteins, fibers and minerals. Keeping in view the nutritional importance of moringa leaves powder, the present study was carried out to investigate the effect of moringa leaves enrichment on the overall quality of whole wheat flour biscuits. Composite flours were made by incorporating moringa leaves powder in different ratios (2, 4, 6, 8 and 10%) in whole wheat flour. Biscuits were prepared from the composite flours and were analyzed ...
Muhammad Farooq1*, Allah Rakha2,Jawad Ul Hassan2, Iftikhar Ahmed Solangi1, A. Shakoor3, Muhammad Bakhtiar4, Muhammad Noman Khan5,Shoaib Khan5, Ibrar Ahmad6, Shabir Ahmed7 andWang Yunyang1*
 

...owder on moisture, crude protein crude fat and nitrogen free extract of muffin were non-significant and effect on ash and crude fiber were significant when 0%, 10%, 20%, 30% and 40% mushroom powder based muffin were prepared. The effect of mushroom powder supplementations on loaf weight of muffin was significant and resulted in gradual decrease. However, the effect on loaf volume of muffins was non-significant. The effects of mushroom powder on texture and col...
Tanay Dineshkumar Shah
 

...hey are a rich source of protein and fiber and have very low calories and low cholesterol. Days are not far when mushrooms will be a regular alternative to vegetables for many vegetarians. India is having a favorable environmental condition to grow mushrooms. Hence various varieties of mushrooms are grown in different regions of India. However, the per capita consumption of mushroom in India is very less as compared to other countries though mushroom has many ...

Safdar Hussain1, Muhammad Naeem Mushtaq5, Ali Bakhsh3, Muhammad Mudassar Maqbool1, Muhammad Sarwar1, Muhammad Jan4*, Muhammad Abdul Qayyum2 and Arif Husain2

...ht yield index (92.21%), protein contents (17.37 mg g-1), leaf water contents (72.65 %), soil moisture contents (14.40 %). Comparing the genotypic performance Aas-2011 performed well as compared to Faisalabd-2008 and TD-1 wheat genotype.

...

M. Javed Iqbal1, Rizwan Shukat1, Muhammad Farooq2*, Iftikhar Ahmed Solangi2, Naila Ilyas3, Rahman Ullah4, A. Shakoor5, Muhammad Bakhtiar6 and Faraz Ahmed7 

...ent concentration of soy protein (0%, 4%, 8% and 12%) as foaming agent and Carboxyl methylcellulose (0.5%) as foam stabilizer and these were dried in hot air tray drier at different temperatures (55°C, 65°C and 75°C) with 3mm sheet thickness of onion foams. Effect of different concentration of foaming agent and drying temperature was studied on moisture loss drying rate of onion paste. Increase in concentration of foaming agent significantly increa...

Ali Zaman1, Nabila Roohi1 and Muhammad Irfan2*

...(LPS) and outer membrane protein (OMP) on Nili Ravi buffaloes. Prepubertal Nili Ravi female buffaloes (N=18) of 10-12 months age in good health condition were divided into five treatment groups (n=3 each) and a control group (n=3). Treatment groups’ animals were exposed to P. multocida bacterial culture and its immunogens, i.e., LPS (oral and intravenous) and OMP (oral and subcutaneous). Animals were analyzed for the development of clinical signs, hemato...

Arshad Mehmood Khattak1, Saleem Ullah1*, Farida Anjum2, Hamid U. Shah1 and Sahib Alam1

...er (6.60) in KK-2, Crude protein in Chattan (7.87) while Crude fat (2.22) was high in KK-1. Among the edible parts, Moisture (85.54) and Ash (3.54) were high in Green grains while Crude fiber (6.38), Crude protein (8.29) and Crude fat (1.99) were maximum in Tender leaves. Mineral (mgKg-1) content of the cultivars showed that Na (38.3), Pb (0.30) and Cu (0.09) were high in Sheenghar, Cr (0.36), Ni (0.92) in KK-2, Fe (0.29) in...
Tai-hua Jin1, An-gang Lou2,Jiu-xiu Ji1, Cheng-dou Cui2, Long-zheng Yu2 andLi-zeng Guan1*
...t the GH mRNA and protein level in pituitary cells of Yanbian yellow cattle could be significantly decreased by adding miR-1468 mimics (P<0.01), while these were significantly increased by adding miR-1468 inhibitor (P<0.05). The results of bioinformatics analysis and double luciferase reporter gene system validation showed that miR-1468 targeted 3’UTR of cAMP responsive element binding protein

Manzoor Hussain Memon1, Khalid Khan2, Anjum Parvez3, Sarfaraz Ahmed Shaikh4, Khan Mir Khan2, Guo Xiangyu5*, Mohammad Nasrullah6 and Saima Liaqat7

...or sources that fulfills protein and vitamin need of human body. Because of increased urbanization and change in human eating habits the global demand of meat has been increasing. At present, in Pakistan, poultry consumption is the key source of the general masses to get the mandatory protein and nutrients. The foremost impact of the poultry industry is to boost up nutrients value and provide an inexpensive and economical so...
Asim Faraz1*, Abdul Waheed1, Hafiz Muhammad Ishaq1 and  Muhammad Shahid Nabeel2 
...ric diets with different protein levels viz: one group with 18% CP and other group with 22% CP. Daily feeding allowance (@ 3% body weight) was calculated and adjusted according to fortnightly live weights. Water was provided twice a day. Daily weight gain was 953±50 and 996±40 g/d with 18% and 22% levels of protein ration, respectively while average DMI of concentrate, fodder and crop residues was 2.93±0...
Li Shengqing1,2,3, Zhang Xiyun2,3, Liu Shengcai2,3, Hu Guoyuan2, Fan Yuxia2,Liu Huaixin2, Wang Tingting2 and Zhang Yanming1*
...ly. The nucleic acid and protein sequences of the toxin exhibits 99% homology with those of a known type D botulinum neurotoxin gene, and the composition of the functional domain of the toxin is consistent with that of type D botulinum neurotoxin. For plateau pikas and plateau zokors, the LD50 values of intragastrically administered type D botulinum toxin is 6810 and 5840 MLD/kg weight, respectively, and those of orally administered type D botulinum...
Hesham Saeed1*, Manal Abdel-Fattah1, Ahmad Eldoksh1, Farid S. Ataya2 and Manal Shalaby3
...owed a 564-bp encoding a protein of 187 amino acids with a predicted molecular weight of 21 kDa. Basic local alignment search tool (BLAST) sequence analysis revealed that C. dromedarius IFNα gene shares high sequence identity with IFNα genes of other species, including C. ferus, Vicugna pacos, and Homo sapiens. Expression of C. dromedarius IFNα cDNA in Escherichia coli revealed a fusion
Xiujun Yao1, Haofeng Wang 2, Ligong Zhang3, Jingzhang Wu4 and Lijun Wang1*
...intervention, 24-h urine protein quantity, serum levels of IL-6, IFN-γ, and TNF-α ,kidney ROS and MDA levels, relative content of TGF-β1 and CTGF in TGP group were lower than that in model group (P <0.05); serum levels of IL-2 and CTLA-4,SOD levels in TGP group were higher than that in model group (P <0.05).These results indicated that TGP could reduce urinary protein quantity, inhibit inflammatory res...

Syed Muhammad Aun Naqvi1, Sara Tahir1, Tanveer Ahmed2*, Huma Naz3, Amara Gilani4, Atif Liaqat5

...d higher levels of crude protein and lipid percentage compared with W1 and W2. Highest ash (percentage) was measured in the gills of the weight group W3 as compared to W1 and W2. Generally, total carbohydrates are determined by the difference of the entire proximate body composition indices, and in this study, it was found that the liver contains maximum carbohydrates (percentage) relative to other sections of the body examined. Weight group W3 was found to ha...

Attaullah Jan1*, Saleem Khan2, Iftikhar Alam1, Farzeen Khan3 and Muhammad Farooq4*

...relation between age and protein and energy intake, and weight and energy and protein, showed that protein energy intake increased with increasing age and weight. Overall, both stunting and underweight were more common in girls than boys. Girls in general, had poor nutrient intake compared to boys, girls were therefore more likely to suffer from under-nutrition compared to boys.

...
Yawang Sun, Yongjiang Wu, Jingbo Chen, Zili Wang, Juncai Chen, You Yang and Guozhong Dong*
...complementation group D2 protein and Fanconi Anemia complementation group L had significantly higher gene expression at 100 ng/mL LPS level. The protein expression of phosphorylated histone 2AX showed a linear rise in the range of LPS levels from 0 to 12.5 ng/mL, then significantly declined at 100 ng/mL LPS level. Oxidative stress and oxidative damage to protein and DNA were induced by LPS...
Amreen Zahra1, Mushtaq A. Saleem1*, Hasnain Javed2, Muhammad Azmat Ullah Khan3, Muhammad Naveed1 and Abdul Rauf Shakoori4
...e of SNPs in the Gag-Pol proteins by molecular modeling approaches. Mutational analysis in our study revealed S61A, S61M, S61Y, S61G, S61Q and M90L as the most hypervirulent mutations. This induces a selection pressure and a rate of increased virulency on Gag-Pol cleavage sites. These results significantly highlight the fact that the identified SNPs possibly contribute towards a positive selection pressure contributing to the identification of novel mutations ...

Rabia Iqbal and Muhammad Naeem *

...ng levels of plant based protein diets (15%, 20%, and 25% crude protein) prepared from cheaper plant proteins, to keep minimum use of fish meal, on growth performance, survival and production of hybrid fry (Labeo rohita♀ x Catla catla ♂). The hybrid fry of mean 1.05±0.08 g body weight and 4.36±0.40 cm mean length were acclimatized and transferred to 8 X 6 X 3 ft. hapas. F...

Muhammad Ibrahim Kubar1, Fahad Nazir Khoso1*, Imran Khatri1, Niaz Hussain Khuhro2 and Arfan Ahmed Gilal1

Barış Bayraklı

...reeds densely, the crude protein (%13.52) rate was found to be the lowest compared to other months. In September, the crude fat rate (1.07%) was found to be the lowest, and in August, moisture was the highest. Among the essential amino acids (EAA) determined during the study, lysine reached the highest value each month followed by leucine and isoleucine, respectively. On the other hand, among the non-essential amino acids (NEAA), aspartic acid and glutamic aci...
Shuang Yang1,2, Huiting Zhao3, Xuewen Zhang2, Kai Xu1, Lina Guo1, Yali Du1 and Yusuo Jiang1,*
...uding 37 odorant-binding proteins, 35 chemosensory proteins, 33 olfactory receptors, 14 ionotropic receptors and 2 sensory neuron membrane proteins. The expression patterns of these genes were determined using the estimated fragments per kilobase of transcript per million fragments mapped. Among the 114 DEGs, 66 were expressed exclusively in the female antennae, whereas the remaining were ...

Arshad Khan1, Mohammad Ihsan1, Mohammad Nisar1, Ali Hazrat1*, Murad Ali3, Rashid Ul-Haq3, Khalid Khan2, Karishma Gul1 and Shah Faisal1 

...es of total seed storage protein resulted in a total of 18 polymorphic bands. Total genetic diversity on the basis of total seed storage protein analysis was 17.5%. In Band, the 14 total genetic diversity was (0.60%) followed by Band 16 (0.58%) and Band 17 (0.55%). Similarly, Band 3 showed diversity, while Band 8, 4 and 5 indicated 0.45, 0.38 and 0.35%, respectively. A cluster dendrogram tree was constructed which was divide...

Abdul Hameed1*, Ihtsham Ul Haq Padda1 and Abdul Salam2

...eholds were deficient in protein, with 58% in urban and 44% in rural areas. Micronutrient deficiency analysis shows that 22% of the survey households in Punjab, 30% in Sindh, 11% in KP, and 37% in Balochistan are suffering from iron deficiency. Besides, 57% of households in Balochistan, 56% in Sindh, 35% in Punjab, and 26% in KP experience deficiency of zinc. The vulnerability analysis of the survey data found 12% of the households at the national level to be ...

Saddar Faheem1,2, Hameeda Kalhoro1, Naeem Tariq Narejo1*, Muhammad Hanif Chandio3, Memon Samina4, Shahnaz Rashid5 and Ghulam Abbas5*

... serum constituents like protein, cholesterol and glucose were also assessed and it was reported that serum glucose was found more in male than female fish, while in male protein and cholesterol were high in female in summer. In winter season, female fish showed low level of cholesterol, though protein and glucose remained high. Based on the serum biochemical constituent data, it was concl...
Rahma Mohamed, Sara Nader, Dalia Hamza and Maha A. Sabry*
...hile capsular associated protein (CAP59) gene identified alone or associated with LAC1 gene in the other 2 C. gattii isolates. This study underlines a potential association of those fungi with human disease in Egypt. In order to strengthen existing therapeutic and control approaches, further analyses of the main risk factors and the other virulence of these pathogens should be further considered.
...

Sami Ul Haq1, Abid Hussain1*, Umair Riaz2, Muhammad Baqir Hussain1, Adnan Fareed1, Nabeel Ahmad Ikram3 and Fahim Nawaz3

...fur for oil contents and protein synthesis. A field trial was conducted to evaluate the effects of S application, alone or in combination with Compost containing sulfur-oxidizing bacteria (SOB), on the yield and growth of sunflower. Sulfur was applied as individual treatments (25, 50, 75 kg ha-1) and in combination with Compost (750 kg ha-1). The results showed a considerable increase in plant height (67.60%), chlorophyll b content (92.10%), stomatal conductan...

Ahmed A. Kheder

... amplify ~497bp for coat protein gene in RNA 2, the amplified product was confirmed with direct sequences. Phylogenetic analysis results indicated that SLRSV-Eg isolate under study (acc. no. MT648777.1), showed 65.9 – 99.5% nucleotide similarity with available homologous sequences from other crops. Reverse-transcription loop-mediated isothermal amplification (RT-LAMP) assay which is one of the most promising molecular diagnostic techniques was applied. T...

Syed Muhammad Sulaiman, Nazir Ahmad and Nazir Ahmad Khan*

...rom 6.01 to 7.90%, crude protein (CP) from 8.71 to 12.40% and crude fat (CFat) from 1.02 to 3.26%. The neutral detergent fibre (NDF) from 43.2 to 44.7%. The IVDMD varied from 48.4 to 58.9% and IVGP varied from 110 to 172 mL/g organic matter. Among the five wheat cultivars Bakhtawar-92 had maximum DM yield (2747 kg/ha), proportion of leaves (45%), CP (12.4%), IVDMD (58.9%) and IVGP (172 mL/g organic matter), and minimum portion of stem (55%) and NDF (43.2%), an...
Ying Yang 1,2,3, Tietao Zhang 1,2,3, Min Rong 1,2,3, JiaPing Xu 1,2,3 and Xiumei Xing 1,2,3*
...ulated with 32% of crude protein and increasing bean oil contents were fed to eight groups of mink. It were fed containing approximately 3, 6, 9, 12, 15, 18, 21 or 24% bean oil in the complete dry power respectively. Mink were voluntary feed intake was found to be dependent upon dietary energy content. Body weights were regulated by energy intake tended to increase at first and then decreased as the energy level was increased. The growth rate and voluntary fee...
Ala’audin Hakami,1AusamaA Yousif,2* Mohamed Zaki,3 Mahmoud Ismail,4,5 Ahmed Al-Ali,5 Abdu-Rahman Al-Ankari5 
.... A replicase-associated protein (Rep) gene-specific PCR was used to
amplify a 603 bp region of the viral genome. PBFDV was detected in
31.6% of clinical cases (3.5% of samples). Two positive samples were
collected during 2008, three during 2009, and one during 2010. Positive
samples were from clinical cases. Negative samples tested positive for bird
rDNA. In positive cases, feathers not blood, consis...

Hala K. Abdelmegeed 1, Eman M. Abohatab 1, Khattab,O. M. 1 , Salem, S.A.H. 1 , Arafa, A. 2, Nashwa M. Helmy 3

...ve for FMD non structure proteins( NSP) antibodies which indicated the natural infection. ELISA kit used for FMDV antigen detection for the epithelial suspension from 42 field samples collected from various geographic locations 10 governorates are ( El-Sharkia,Giza, Port Said, Assuit, Suize, Kafre El-Shake, Qina, Al-Gahrbia, Domiatte and Alexandria) Serotyping and molecular characterization by polymerase chain reaction PCR for (31) samples as FMD Serotype O , ...

Nashwa M. Helmy1 and Ahmed S. A.2

...es of FMDV nonstructural proteins (NSPs) are
useful in providing evidence of previous or current viral replication in the host,
irrespective of vaccination status. NSPs, unlike structural proteins are highly conserved
and therefore are not serotype specific and as a consequence, the detection of these
antibodies is not serotype restricted. The current study aimed on detection o...

Serag eldeen Sultana, M.W Abdel azeemb, Nahla Mohamed Eldamranyc

...it coated with AIV nucleoprotein and hemagglutination inhibition (HI) test against H5 and H9 antigens. The overall results using both ELISA and HI tests revealed that the prevalence of AIV antibodies was 12.6% (18/143). The seropositive samples represented 5/143 and 15/108 for ELISA and HI, respectively. The detection of both H5 and H9 antibodies in (4) samples indicated that co-infection may occur, while (10) samples were only containing H9 antibodies and (1)...

Aya El-Turkey1, A. K. El-Attar1, A. E. Aboulata1, B. Othman2 and K. A. El-dougdoug2

...-2 was isolated and Glycoprotein D (HSV-2gD) subunit was amplified using specific PCR primers.PCR product was molecularly cloned in t E.coli cells using PCR2.1/TOPO/ TA cloning vector. HSV-2gD fragment was liberated from 1 μg recombinant plasmid by using the restriction endonuclease EcoRI. HSV-2gD was successfully sub-cloned into binary plant expression vector PBI-121. HSV-2gD subunit-containing binary vector PBI 121 were transformed into Agrobacterium tumi...

K.A. El-Dougdoug1, A.R. Sofy2, A.A. Mousa2 and E.E. Refaey2

...concentration. Expressed protein
was differed in leaves of potato cultivars. Since PVY infection unexpectedly increased in
(Anabel, Sisi, Lady Balfor, Nicola and Execusa) or decrease of total protein in (Hermes and
Spunta). The potato cultivars (healthy and infected) varied in number and density of protein
bands. As well as specific bands wit...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 
...on-significant. The coat protein gene of
SLCV was PCR amplified from infected common bean plants. SLCV-CP was cloned in
pJET cloning vector and directly sequenced. The sequence alignment and phylogenetic
analysis showed a relatively high diversity among the three different isolates that the
identity ranged from 89 to 94%.
...

Amel, S.M. Abo-Senna1; M.A. Nasr-Eldin2; B.A. Othman3 and A.A. Megahed4

...in the nuclear inclusion protein b (NIb) coding region of the virus genome. The cytopathological effects of ZYMV on the infected cells were completely chloroplasts destruction, and deformation of vascular bundles. The effect of late ZYMV infection decreased fresh weight and yield of squash plants.

...

Amira A. Mazyad1; A. A. Kheder1; Ahmed K. El-Attar1; W. Amer.2; Mahasen, H. Ismail.2; Amal, A.F.1

...cific for the viral coat protein gene as a tool for molecular diagnosis. The PCR detection was confirmed with direct DNA sequencing and phylogenetic analysis for the coat protein gene. Further insurance of SLRSV infection was performed using light microscopy which showed presence of amorphous inclusion bodies, electron microscopy and chemical analysis.

...

AdlyAbd-Alla1,2, MahaNada3, Francois Cousserans1, and Max Bergoin1

...capsids showed two major proteins of 31 and 32 kDa
and a minor 78 kDa protein. Infection of third instar nymphs by feeding on contaminated food
induced similar disease symptoms and bioassay experiment confirmed virus concentration
response mortality. Injection of a purified virus suspension to third instar larvae of Galleria
melonella and Spodopteralittoralis failed to induce a...

Aly M. Abdel-Salam1 and Samah A. Mokbel2

...primer pair for the coat protein (CP) gene of Ilarvirus amplified products
similar to those produced from peach and apricot isolates of NRSV-infecting stone
fruits. Dot blotting immuno-binding assay (DBIA) showed positive reaction between
NRSV-infected apple sap and an Egyptian antiserum for NRSV. Purified preparation
from infected leaves, using the electro-elution technique yielded nucleo

Magdy, Mariam1 ; Abou ElHassan D.G. 2 ; and Salem, S.A.H 3

...tection of Non-Structral protein of FMDV by priocheck
test. Five hundred sera were collected from vaccinated cattle and buffalo from five Egyptian
governorates (Two governorates represent Delta region: El-Gharbia – Kafr El Sheikh , Two
governorates represent upper Egypt: El-Fayoum – El-Menya , and one governorate represents
central : El-Giza). The sera collected from diseased and apparent healthy anim...
Abd El-Hamid, M.I1, Seham, A.El-Zeedy1, El-Sanousi, A.A2, Reda, I.M2, Nehal, S. Saleh1, Abbas, A.M1
...ses on The envelope glycoprotein D of EHV-1 (EHV-1gD) due to its essential role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins .A wave of Abortions has been recorded in El Zahraa stud for Arabian Horses ,collected samples were either aborted fetal tissues either Lung and livers as well ...

Abd El-Hamid, M.I1; Seham, A. ElZeedy1; El-Sanousi A.A2, Reda, I.M2, Nehal, S. Saleh1., Abbas, A.M1

...hraa/2014 using the glycoprotein D of EVH-1 due to its role in virus infectivity and its function in entry of virus into cells and is considered as one of the most potent inducers of virus-neutralizing antibody among the spectrum of EHV-1 proteins based on sequence analysis and multiple alignment revealed single nucleotide substitution at the base pair number 121 from the start codon which give lead to single Amino Acid Subs...

A. A. Rezk1,3, K. A. Alhudaib2 and A. M. Soliman2,3

...de sequence for the coat protein (CP) gene was carried out and submitted in GenBank under accession number JN083790. The phylogenetic tree showed that there are two big clusters and the identity between them 90%. The isolated CYSDV in this study is located in the second cluster with the isolates from Sudan, Iran and the other isolate from Saudi Arabia. The analysis showed that the highest nucleotide identities were 100% with other isolates that isolated from S...

Sahar A. Youssef1; Manal A. El-Shazly1,2; Azza G.Farag1,3; Eman A. Khattab1,2

...he partial RNA3 movement protein product from PNRSV infected rose directly cloned using the TA cloning system. Nucleotide sequencing revealed the clones to be portion of PNRSV genome. These results indicate that the virus in rose is an isolate of PNRSV from Taif, KSA.

...

Manar F. Seioudy1, Magda M. Sayed1, Ahmed A. El-Sanousi2 and M. A. Shalaby2

...cation of fragments of N-protein. All batches are also subjected to sterility tests for detection of bovine viral diarrhea virus as possible extraneous virus contaminant using RT-PCR and detection of mycoplasma as possible bacterial contaminant using PCR technique. All of the four batches were positive when tested using specific primers and they were free from BVDV or mycoplasma contamination. Results in this study showed that molecular techniques could be use...

Amany Adel1, Abdelsatar Arafa1, Hussein A. Hussein2 and Ahmed El-Sanousi 2

...ions 80 to 84 in the NS1 protein along all Egyptian isolates under study. Ala149, which is a pathogeneicity marker for interferon antagonism was found in the studied indicating capability of these viruses to transmit between different avian species. PL motif ESEV was found in 6 isolates from chicken and ducks circulating in such population whereas 17 viruses have ESKV similar to those reported in human in 2006. Based on NS1 sequence analysis of the H5N1 Egypti...

Radwa M. Shafie 1 and Soha S. M. Mostafa2

...sh and dry weight. Algal proteins were identified by the protein profile pattern using SDS-PAGE method. The contents of alkaloids, phenols and terpenoids in both algal filtrates and biomass were determined.

...

Lala Rukh1, Muhammad Nadeem1, Tusneem Kausar1, Mian Anjum Murtaza1, Muhammad Luqman2*, Muhammad Bilal Shahid1 and Amal Shaukat3

...der (by product) and soy protein isolate in date paste. Date bars were formulated after ingredients optimization and were analyzed for physico-chemical, in-vitro starch and protein digestibility, antioxidants and microbial count. Results showed that date bars are rich source of protein, fiber, carbohydrates and fat with good digestibility properties. Date pit powder and soy

Nashwa M. Helmy1, Ahmed S. Ahmed2, and Zeinab3 Y. Mohamed

...while the level of total protein, albumin and calcium showed significant decrease and non-significant reaction in creatinine and non-organic phosphorus in infected cattle. The results of antioxidant both malondialdehyde (MDA) and catalase enzyme (CAT) showed significant increase while level of gloutathion (GSH), total antioxidant capacity (TAC) and gloutathion peroxidas (GPX) showed significant decrease in infected cattle. Conclusion: Sero-survey, conventional...

Aly M. Abdel-Salam

...was used to amplify coat protein genes for the two viruses using specific primers. DAS-ELISA and immuno-blotting were used for evaluating the induced antisera. Results: Antisera for CYSDV and CVYV were produced efficiently and used for virus diagnosis through DAS-ELISA, DBIA, and TBIA. RT-PCR confirmed the nature of the two viruses. However mixed infection was noticed for CVYV and CVYV upon using duplex RT-PCR. Conclusion: Mixed infection with WTV is common an...

Ehab M. El-Nahas1, Hemat S. El-Sayed2, Sawsan S. El-Basuni3, Gabr F. El-Bagoury1

...nd 69 (Valine) of the S1 proteins from H120 and M41.The cross-neutralization test revealed antigenic relatedness of Egypt/Qal/014p with Massachusetts serotypes. The commercial H120 vaccine conferred partial protection against proventriculitis induced by Egypt/Qal/014p. Conclusion: IBV strains exhibiting proventriculitis were found co-circulating in broiler chickens in Egypt and optimum control of IBV in Egypt require preparation of vaccine from indigenous isol...

Salama M. El-Saghir1, 2

...e virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3’ (sense)
and 5’ATGATCGAGTCCAAGGGCACTG3’ (antisense).
Results: A specific antiserum for PVS detected PVS in commercial potato plants with I-ELISA and
DBIA. Further, IC RT-PCR confirmed the presence of PVS in Egypt for the second time; yielding 187
bp of the virus coat

Ayman S. El-Habbaa 1, Gabr F. El-Bagoury1, Samar F. El-Adaway2, and Susan S. El-Mahdy2

... inhibition (HI) test. F protein encoding gene of NDV was amplified using Reverse Transcription-Polymerase Chain Reaction (RT-PCR) then subjected for nucleotide and amino acid sequence detection. Results: NDV Giza 2014 isolate and NDV Qualubiya 2014 were characterized as velogenic and lentogenic strains, respectively using Mean Death Time (MDT), Intracerebral Pathogenicity Index (ICPI) and studying amino acid motif of the F protein

Shimaa M. Mansour, Reham M. ElBakrey, Ahmed Orabi, Haytham Ali, Amal A. Eid

...ence within ARV- sigma C protein revealed 7/18 positive samples. All positive samples (7/18)
were successfully isolated on specific pathogen free embryonated chicken eggs (SPF-ECE). Additional
RT-PCR testing and re-isolation of ARV from ECEs of a breeder flock of a history of uneven growth
and/or arthritis revealed ARV infection in six (6/60) examined ECEs.
Conclusion: These results indicated the incrimination of...
Ruqayya Bint Khalid1, Asif Nadeem1,2*, Maryam Javed1, Muhammad Zubair Shabbir3 and Masroor Ellahi Babar4
... is second most abundant protein of cow’s milk. β-caseingene is highly polymorphic. A1 and A2 are the frequently occurred variants. A1 is recognized as potential cause of several human diseases. It is important to evaluate the A1/A2 β-casein status in milk. Current study was conducted to molecular characterize the exonic regions of β-casein gene and to explore the status of A1/A2 β-casein type in Cholistani cattle breed of Pakistan. B...
Saira Gul1,2, Sohail Ahmed2*, Tahir Usman1*, Khalid Khan3, Sultan Ayaz1, Saleha Gul4 and Nawab Ali5
...ively. Two major surface protein genes (MSP1a and MSP4) sequence were compared with cattle isolates from different origins. Phylogenetic analysis of local isolates showed a close homology with the isolates from Australia, Brazil, Turkey and Japan. It was found that aged, exotic and crossbreed cattle were more susceptible to A. marginale infection in summer season compared to the younger and indigenous cattle breeds, respectively ...

Akram I. Aboelkhair1, Ayman H. El-Deeb2, Momtaz A. Shahin1 and Hussein A. Hussein2

...of LSDV with PCR using G-protein-coupled chemokine receptor (G-PCR)
gene primer revealed positive result for LSDV, So classical Isolation of LSDV was started by
inoculation of nodules on Chorioallantoic membrane (CAM) 9-11 day old SPF eggs, then adaptation
on Madin-Derby bovine kidney cell line ( MDBK ); confirmation of LSD isolated virus was done by
using Electron microscopy (EM) on suspension of cell culture pa...
Nagwa K. Meselhy1, Mohamed A. Abo El-khair1, Basem M. Ahmed2, Sherif A. El-Soally3,
Abdelhamid M. Fares1, Mohamed A. Nayel1 and Hussein A. Hussein2
...ment of
glycoprotein B gene (ORF 33), followed by sequencing and phylogenetic analysis.
Results: The study revealed that 19% of our samples were positive to EHV-1 and phylogenetic
analysis showed that the Egyptian EHV-1 isolates were more than 99% similarity to European
abortogenic isolates (EHV-1 strains: Army 183 and Suffolk/48/2013). Indeed, the analysis reports that
these viruses are circulating i...
Allam A. Megahed, Badawi A. Othman, Samar S. El Masry, Abeer A. Faiesal and Mohamed A. Nasr Eldin
...s
using coat protein gene specific primers with an expected amplicon of 520 bp. Electron Microscopy
examination revealed that, the viral particles were slightly flexuous rod shape with about 680 x 13 nm
in size. Ultrastructure analysis showed different degrees of chloroplast degradation in PVM-infected
potato leaf tissues.
Conclusion: Occurrence of PVM was detected and confirmed in commercial potato s...

Ahmed K. El-Attar1, Samah A. Mokbel1 and Om-Hashem M. EL-Banna2

...rformed for the AMV coat protein (CP) gene. An amplicon of the
predicted size (∼666 bp) derived from O. basilicum isolate was purified and cloned in E.Coli
into pCR®4-TOPO vector before proceeding to DNA sequencing and the alignment of
sequences.
Results: Electron microscope examination of negatively stained preparations from
symptomatic basil leaves revealed viral particles have a bacilliform...

Ahmed M. Soliman

...rs designed for the coat protein gene of CMV were used to detect the virus. RT-PCR products (657 bp) of coat protein gene of CMV were cloned and then sequenced.
Results: CMV was isolated from four vegetable crops (cucumber, tomato, pepper and watermelon) using ELISA and RT-PCR assays and the coat protein gene of the four isolates were submitted to GenBank. The CMV isolates show...

Samah A. Mokbel, Eman A. Ahmed, Hanan F. El-Kammar, Ahmed A. Kheder

...m. Detection of the coat protein gene of
CMV in infected leaves has been done by reverse transcriptase-polymerase chain reaction (RT-PCR),
and the appearance of 678 bp bands confirmed the expected size of such gene. Light and transmission
electron microscopy were used to study the cytological and histological changes that occurred in the
leaves of the sugar beet plant by the pathogen, as well as, to determine som...

Anila Kousar, Muhammad Naeem*, Samrah Masud, Abir Ishtiaq, Zara Naeem and Rabia Iqbal

... effect of three dietary protein feeds (15% CP, 20%CP, 25%CP) composed of plant protein ingredients, on elemental concentration in Genetically Improved Farmed Tilapia (GIFT) fingerlings, a developed strain of Nile tilapia (Oreochromis niloticus). Feed preparation criteria was based on cost effectiveness and local availability of cheaper plant protein feed ingredients. Ten specimens were ra...
Ramazan Erdogan1*, Mikail Tel2, Vedat Cinar2 and Ragip Pala2
...FAS), zinc-α2-glycoprotein (ZAG), adipose triglyceride lipase (ATGL), glucose transporter-4 (GLUT-4) and insulin receptor substrate-1 (IRS-1) in adipose tissue of rats fed on zinc picolinate supplement diet. A total of 42 male 8-week-old Wistar albino rats were randomly divided into 6 groups, each of seven; Control (C), Zinc picolinate (ZP), Chronic exercise (CE), Chronic exercise+Zin picolinate (CE+ZP), Acute exercise (AE), Acute exercise+Zinc picolinat...