Nadeem Khan1*, Arshad Ali Khan1, Mukhtar Ahmad2, Muhammad Nouman2 and Badshah Islam1

... cm). In case of disease incidence maximum lesion on leaves were found in Kinnow (14.2) while in Cara Cara, Salustiana and Arnold Blood, lesser lesions were found. On the basis of results and overall performance Tarocco and Hamlin performed best in all aspects while Arnold Blood and Cara Cara revealed poor growth.  

...

Gurrappa Naidu Govindaraj, Vinayagamurthy Balamurugan*, Habibur Rahman

...sses based on the annual incidence, morbidity, mortality levels etc. derived from literature, discussion with experts, and based upon scientific facts. Different mathematical models were used to assess the losses due to mortality in young and adult sheep/goats, body weight loss in young and adult sheep/goats, milk loss, loss due to increased inter-lambing/kidding period, loss due to increased abortion, cost of high feeding and rearing inputs in young and adult...

 Inamullah Khan, Muhammad Subhan Qureshi, Rajwali Khan, Syed Muhammad Sohail, Ijaz Ahmad, Muhammad Shoaib and Asim Ijaz

...CR respectively. Highest incidence was found in farm workers (14.5%) followed by butchers (10.5%), veterinary assistant (10%) and abattoir workers (08.33%). High incidence was observed in butchers 20.58%, followed by veterinary assistants 14.28%, farm workers 12.28%, abattoir workers 11.53%, farm owners 10.41% and no positive cases were found in veterinarians through PCR.  

...

Atul Sharma, Aruna Chandra Singh, Gautam Bacher, Sunil Bhand

...ent. With the increasing incidences of antimicrobial contamination, especially in food, dairy products, agriculture and environment, their regular monitoring is on prime interest. Aptamers are synthetic short sequences of single stranded (ss) oligonucleotides (ss-RNA or DNA), which are developed by an in-vitro selection process known as “Systematic Evolution of Ligands by Exponential Enrichment (SELEX)” technique. Among the receptors available for ...

Oladipo Elijah Kolawole, Oloke Julius Kola and Awoyelu Hilda Elukunbi

...esigned to determine the incidence of EBV in Human immune-deficient virus (HIV)-infected individuals in Ogbomoso, Oyo State, Nigeria. Two hundred and seventy eight HIV-infected individuals were screened for EBV antibodies over a period of four months (August to November, 2014). The sera of individuals were subjected to serological assay for IgM using enzyme-linked immunosorbent assay. The mean age of subjects was 39.5±0.48 years and the mean CD4+ was 38...

Nighat Sultana1,2,*, Shazia Iftikhar1, Nafeesa Qudsia Hanif2 and Iffat Tahira2

Pam D Luka, Frank N Mwiine, Bitrus Yakubu, Joseph Erume, Ricardo Pérez-Sánchez, Hermann Unger and David Shamaki

...domestic pigs with a few incidences in wild pigs. However, to investigate the risk of a tick-domestic pig transmission cycle in Nigeria, 3,288 serum samples were collected from domestic pigs from 10 states and analysed for anti-tick antibodies using the recombinant TSGP1 indirect ELISA. Of the samples analysed, 13.4% (442/3,288) showed moderate to high reactivity, suggestive of domestic pigs’ exposure to tick-bite. Antibody reactivity’s were found ...
Yaoguo Li1,2 and Maoxian He1
... (P. fucata). The incidence of type II locus (hemi-methylation locus) was significantly correlated with the shell height and the shell length, with Pearson correlation coefficients of 0.204 and 0.233, separately. The incidence of type IV locus (super methylated locus) on the other hand was significantly correlated with the shell length, with Pearson correlation coefficient of 0.217. The genome methylation levels were ...

 Eman M. Farghaly1, Ahmed Samy1,2*, Heba Roshdy

...rious organs with higher incidence of mixed compared to single infection. Different serotypes of E.coli and Salmonella could be recovered from dead birds however E.coli (O78) and S.enteritidis were recovered mainly from heart and liver. The recovered E.coli, S.aureus and P. haemolytica isolates recovered from mixed infection cases showed (57.1-100%) resistance to highly important antibiotic group (Doxycycline, Tetracycline, Trimethoprim sulfa methoxazole and C...
Muhammad Shahid1, Iram Amin1,*, Samia Afzal1, Zareen Fatima1, Sadia Zahid1, Usman Ashraf1 and Muhammad Idrees2
...serotype 2 and 3. Higher incidence of RNA positivity by PCR was found in males (71%) as compared to the females (29%). The higher incidence of PCR positivity was found in age group of 16-25 rather than teenage (≤16) and older age group (≥50). From the result of this febrile illness study we concluded that males and young people are more susceptible to Dengue virus infection. Moreover serotype-2 was the main causative s...
Uzma Farid Durrani1,*,Sagar Mal Goyal2, Asim Khalid Mahmood1,Cathleen Hanlon3, Susan Moore3, Muhammad Waqas1 and Raheela Akhtar4
...e factors for increasing incidence of rabies in humans and dogs living in Lahore, Pakistan.
...

M.K. Pandit,P. K. Pal and B. K. Das

Effect of date of sowing on flowering and incidence and damage of melon fruit fly in snap melon Cucumis melo var.momordica genotypes
... well as lower fruit fly incidence. Three sowing dates viz. S =25 November, 2004, S =25 January 2005 and S =25 March, 2005 were selected to evaluate performance of eight genotypes, named as BCSM-1 to BCSM-8. The experimental design was factorial RBD with 3 replications. Observations on days to first male and female flowers, node number of first male and female flowers, total number of fruits and number of melon fruit-fly [Bactrocera cucurbitae (Coquillett),Dip...

M. D. Maji, N.K.Das, S. Chatterjee, A. Ghosh and A.K. Bajpai

Forecasting models of bacterial leaf spot disease of mulberry for Birbhum district of West Bengal
... in Birbhum district.BLS incidence appeared in May and continued up to November. The correlation coefficient between disease severity and meteorological parameters revealed that BLS disease severity showed significant positive correlation with max & min temperatures, min relative humidity, rainfall and number of rainy days. Step down multiple regression analysis revealed that the forecasting of BLS could best be done from min temp, minimum relative humidit...

1S. A. Khan and 2S. Jha

Effect of dates of sowing, moisture regimes, varieties and weather factors on incidences of aphid, Lipaphis erysimi (Kalt.) in rape and mustard
...ts revealed that initial incidence times of aphid varied from 19 November to 3 December, depending upon dates of sowing done during 1 October to 5 November, which fall under recommended dates of sowing. In crops sown during 22 October to 5 November, critical periods of aphid infestation (having greater than 30 aphids plant-1) prevailed between 19 December and 21 January. Number of aphids plant-1 was consistently greater in crops grown under irrigated condition...

Bijan Kumar Das

Incidence of Aleurocanthus spp. (Aleyrodidae: Hemiptera) on betelvine (Piper betle L.) and their interaction with host plants
...est Bengal. The seasonal incidence of A. rugosa in boroja was recorded during 2003-2004. A. rugosa adults were active in the boroja throughout the year with two peaks, one in pre-monsoon and another in post-monsoon i.e., period prior initiation of winter season. During the faunastic survey in betelvine, a new species of Aleurocanthus (description under process) was recorded from West Bengal. This had also been found to occur on Piper longum L. Another species,...

S. K. Dutta, S. Roy Chowdhuri, D. Pandit and A. K. Bajpai

Rot diseases of muga host, Som (Persea bombycina) in Assam, India
...ing 2004-06. The disease incidence (DI %) caused by B. mediterranea was 12% while P. contigus showed 20% infection. Correlating the age of Som plants with susceptibility rot infection was found to be maximum in 10 years old plantation. Keywords: Rot disease, Som, Muga, Heart rot, Canker rot, Phellinus contigus, Biscogniauxia mediterranea, Assam
 

 

...

Basudeb Dasgupta, Partha Dutta and Srikanta Das

Biological control of foot rot of betelvine (Piper betle L.) caused by Phytophthora parasitica Dastur
...s to study the impact of incidence of foot rot of betelvine caused by Phytophthora parasitica and growth, yield, and keeping quality by applying two bioagents, viz., P. fluorescens and Trichoderma harzianum. P. fluorescens inoculated in 500 kg oil cake ha-1 was applied once at pre-monsoon, twice during pre- and post- monsoon and four times at quarterly intervals. T. harzianum inoculated in 500 kg oil cake ha-1was applied at quarterly intervals. Bordeaux mixtur...

Debjani Chowdhury, P. C. Paul and B. Dasgupta

Management of leaf spot of Centella asiatica (Thankuni) caused by Alternaria sp. and target leaf spot of Rauvolfia serpentina (Sarpagandha) caused by Corynespora cassicola
...e lowest percent disease incidence (PDI) of leaf spot of Thankuni caused by Alternaria sp. and highest yield in number of leaves per sq.M was recorded where carbendazim was sprayed. The highest yield in fresh weight, dry weight of leaves, fresh weight and dry weight of 1000 leaves was recorded. Application of mancozeb resulted in the lowest PDI of target spot of Sarpagandha, increased the yield (both fresh weight and dry weight of the plant per sq.M) and incre...

Amitava Konar, Palash Mondal and N. Johnson Singh

Occurrence of potato pests in different dates of planting in Gangetic plains of West Bengal, India
...y;">An experiment on the incidence pattern of various insect pests of potato under five different planting dates (P1 to P5) was carried out for two consecutive years, 2006-07 and 2007-08 at Adisaptagram Block Seed Farm, Hooghly, West Bengal, India. Kufri Chandramukhi was planted in five dates of planting starting from 3rd week of November with one week interval upto 3rd week of December with a spacing of 60×20 cm. The trial was laid in Randomized Block D...

P. Barma and S. Jha

Biology, seasonal activity of fruit fly (Bactrocera cucurbitae Coq.) on pointed gourd (Trichosanthes dioica Roxb.) and weather relations
...t of pointed gourd. Peak incidence of it was obtained in third week of May to first week of June during all the three years of study (i.e. 2007-08, 2008-09, 2009-10). Studies on biology showed that the incubation, larval, pupal and adult longevity periods were 2 to 5 days, 5 to 7 days, 6 to 9 days, 37 to 41 days in June-July and 4 to 6 days, 16 to 19 days, 17 to 21 days, 23 to 32 days in August-October, respectively. Correlation with individual weather factors...

Amitava Konar, Kiran A. More and Pradip Mondal

Efficacy of some insecticides against cutworm and molecricket of potato in West Bengal
...ective in decreasing the incidence of cutworm and molecricket followed by soil treatment at planting with phorate 10 G @15kg ha-1 with addition drenching the ridges with imidacloprid 17.8 SL @ 0.004% (2ml/10L of water) on the occurrence of the pest (T6 ) than other treatments as well as control. Both the treatments (T5 and T6) were more or less equally effective to decrease the incidence of cutworm and molecricket. Yield of ...

A. Regupathy and R. Ayyasamy

Initiatives of papain industry by private-public-farmer link-ages in classical biocontrol program for papaya mealybug in Tamil Nadu
... the extent of mealy bug incidence. Secondly, it facilitated select cluster of papaya growers to meet the concerned authorities and scientists of Tamil Nadu Agricultural University (TNAU), Coimbatore to appraise them of the gravity of the situation and the need for getting effective biocontrol agent [Acerophagus papayae (Noyes and Schauff)] through ICAR-NBAII (National Bureau of Agriculturally Important Insects)-TNAU was emphasized as the existing biocontrol a...

P.S. Ajith, K.K. Lakshmesha, S. Mahadev Murthy and N. Lakshmidevi

Botanicals for control of anthracnose of bell peppers
... and 26% reduced disease incidence is recoded when compared to untreated control. In pot experiments, there is an increase in height and weight of the plants by 22% and 44% respectively in seeds treated with C. aromaticus when compared to chemical fungicide Bavistin and also 13% reduction in disease incidence is observed when compared to untreated control. From the results it is evident that C. aromaticus were effective in n...

S.K. Sahoo

Incidence and management of mustard aphid (Lipaphis ery-simi Kaltenbach) in West Bengal
...out to assess it’s incidence and their management during the winter seasons of 2009-10, 2010-11 and 2011-12 at the Pulses and Oilseeds Research Station, Berhampore, West Bengal (India). The natural appearances of the aphid on the yellow sarson variety, Binoy (B-9) was observed from 52nd standard week, with the peak population on 6th standard week and the aphid disappeared after 10th standard week. Among the different chemical insecticides evaluated for t...

Goutam Mondal

Plant growth promoting activity of some indigenous Tricho-derma isolates and their field performance against sheath blight of rice in old alluvial zone of North Bengal
...ce sheath blight disease incidence (46.32% to 70.54%) over check plot significantly. Again, the efficacy of the biocontrol agents was significantly greater in the block with green manured than the block without green manured. Application of hexaconazol 5% EC@ 2.0 ml litre-1 and carbendazim 50% WP @ 1.0 ml litre-1 also reduced the sheath blight disease incidence by 53.25% and 56.86% over the check plot respectively. It was in...

Dinesh Kachhawa and Sahidur Rahman

Factors influencing incidence of red spider mite of tea, Oligonychus coffeae (Nietner) in Assam
...orology, AAU, Jorhat.The incidence of red spider mite, Oligonychus coffeae on tea leaves was maximum during month of April to May-June and September-October (2011). The minimum number of mites was recorded from July- August and November (2011) to February (2012). The data taken from 1st week of April, 2011 to last week of March 2012. In case of eggs population, there was a gradual increasing trend in egg number to reach the peak population in the month of Apri...

Shams Ur Rehman, Muhammad Arif and Abdul Mateen 

 

Soil-borne viruses in major potato growing areas of Pakistan
...e average symptoms based incidence in Hazara divi-sion for PMTV was 8.83% and TRV was 6.80% while in Malakand division the average symptoms based inci-dence for PMTV was 8.46% and TRV was 9.95%. DAS-ELISA based average incidence in Hazara of PMTV and TRV was 17.34% and 11.99% respectively. The average DAS-ELISA based incidence in Malakand division for PMTV was 21.36% and TRV was 13.71%. Th...

Amitava Konar and N. Johnson Singh

Occurrence of aphids on various potato germplasms in eastern gangetic plains of West Bengal
...t Bengal to find out the incidence pattern and population dynamics of aphids on various potato germplasms. The common potato germplasms viz Kufri Chandramukhi, Kufri Jyoti, Kufri Jawhar along with three processing varieties like Kufri Chipsona-1, Kufri Chipsona-2 and Atlantic were screened against aphids. Potato seed tuber was planted by end of November following all standard agronomic practices except insecticide application. The aphid species viz. Myzus pers...

Shrinivas Mudigoudra and Shekharappa

Evaluation of plant products aganist sorghum shoot fly, Atherigona soccata Rondani
...o @ 5% in recording less incidence of shoot fly and obtaining higher grain yield. However, both the treatments were found next best only to carbofuran 3 G.

...

Manidipa Chowdhury 

Incidence of saw fly, Athalia lugens proxima Klug. as influenced by level of irrigation and fertilizers on mustard
...n objective to study the incidence of saw fly (Athalia lugens proxima Klug.) as influenced by level of irrigation and fertilizers on mustard c.v. NC-1 (Jhumka) of Brassica campestris var. yellow sarson. Highest saw fly population (0.26 larvae/plant) was recorded on the crop grown without irrigation and medium level of fertilizers (60:30:30 Kg NPK ha-1) while lowest population level (0.10 larvae/plant) was observed at highest level of irrigation (three) coupled...

S. Choudhury and S. Pal

Population dynamics of mustard aphid on different Brassica cultivars under terai agro-ecological conditions of West Bengal
...d-mustard cultivars. The incidence of aphid commenced from 52nd to 2nd standard week with a very low population levels on all the cultivars. The aphid (Lipaphis erysimi) population attained peak level from 7th to 9th standard week. The correlation coefficients between aphid population and different abiotic factors revealed contradictory results. Except for a few instances the weather parameters showed low order of associations with aphid population. Thus, the ...

Shyam Singh and L.P. Awasthi

Plant products for the management of yellow mosaic disease of mungbean and urdbean
...mum reduction in disease incidence recorded were 66.70 and 63.65 percent in mungbean and Urdbean, respectively by eight sprays of Clerodendrum aculeatum. Whereas, eight sprays of Boerhaavia diffusa root extract could reduce the disease incidence by 60.27 and 58.20 per cent followed by Azadirachta indica leaf extract by 42.43 and 42.92 percent in mungbean and urdbean, respectively. Maximum plant height (70.90 and 56.20 cm), p...
1Sitesh Chatterjee, 1Chirasree Gangopadhyay and 2Santosh Kumar Roy
...d in the main-field. The incidence of dead heart incidence was found lowest in chlorantraniliprole granule when applied in seedbed followed by spraying of chlorantraniliprole in the main-field or chlorantraniliprole granule application. Chlorantraniliprole granule application along with spraying of same chemical provided the best result against white heads due to stem borer followed by chlorantraniliprole granule application...

Muhammad Ibrahim1,2*, Syed Jawad Ahmad Shah1, Shaukat Hussain2, Musharaf Ahmad2 and Farhatullah3

 

... Fields with yellow rust incidence of 26% or higher than 26% were found maximum in the northeren zone (30%) which was followed by the central (6%) and southern zone (2%). Frequency of yellow rust severity of 5 (20-29% leaf area affected) to 9 (>75% of leaf area affected) was maximum in northeren zone (40%) which was followed by the central (10%) and southern zone (3.5%). A total of 35 known and unknown cultivars were deployed in the three wheat production z...
Muhammad Arslan Khan1,*, Sajid Aleem Khan1, Imran-ul-haq1 and Rashad Waseem Khan2
...d on disease prevalence, incidence, frequency percent of root rot fungi and nematodes population. Maximum disease prevalence was recorded in Tibba Sultanpur (100%) and Dunyapur (88%) whereas disease incidence calculated was 5% and 4.4%, respectively, in these areas. Rhizoctonia bataticola (Taub.) was frequently isolated (78%) from roots as well as in soil samples (81.7%) collected from infected fields. Among nematodes...

Abdur Rab1*, Muhammad Sajid1, Naveed Ahmad1, Khalid Nawab2, Syed Ghias Ali3

...nd blossom end rot (BER) incidence but significantly decreased the leaf K+ and Ca content of the fruit and yield. The foliar calcium application decreased the Na+ accumulation, Na+/ K+ ratio and BER incidence as well as increased the leaf K+ and Ca content of tomato fruit, yield and fruit firmness. The interaction of salinity and calcium significantly affected the yield and BER incidence o...

Imtiaz Ahmed, Muhammad Abbas Khan, Noorullah Khan, Naveed Ahmed, Abdul Waheed, Fazal Yazdan Saleem, Sajjad Khan and Sohail Aslam 

...spacing had more disease incidence and severity (79 and 55.66% respectively). Plants with 20 cm spacing had more Bulb weight (99.33 g), Bulb diameter (67.33 mm), clove weight (11.65g) and no of cloves per bulb (12.5); whereas taller plants (54 cm) and maximum bulb yield of 12.85 t ha-1 was recorded in those plots planted with 10 cm spacings. While the highest unite price of Rs. 300 kg-1 (Rs. 3.315 m ha-1) was received from those garlic which were obtained from...
Muhammad Nabeel,1,* Humayun Javed1 and Tariq Mukhtar2
...s lacking therefore, its incidence and prevalence was determined in seven major maize growing districts of Punjab during 2016. The maximum overall incidence of maize borer (12%) was recorded in Khanewal district followed by Multan (6%) while it was the minimum (1%) in district Okara. On the other hand, maximum prevalence of maize borer was observed in district Vehari (100%) followed by districts of Khanewal and Multan (73%) ...

Manzoor Hussaina,b

...fter several days of the incidence. The study was designed to find the time interval at which autosomal STR system fails to generate the DNA profile the semen donor in the post-coital vaginal swabs. Sixty two post coital vaginal swabs (x3) were collected from six volunteers at different TSI (time since intercourse). Out of these, 42 post coital vaginal swabs (up to TSI 5 days) were used to generate the autosomal DNA profile of the semen donor and twenty of the...

Khalid Mahmood Aujla, Sajida Taj*, Khalid Mahmood** and Nadeem Akmal*

...cline in wheat area, the incidence of frost/cold spells, shortage of irrigation water over normal supplies, imbalanced use of fertilizers particularly of DAP fertilizer below the recommended doses, higher prices of inputs such as seed, fertilizer, diesel, electricity and less wheat prices during 2006-07 and late announcement of the minimum guaranteed wheat price for 2007-08 were the main reasons of lower wheat production in 2007-08. To enhance the wheat yield,...

 A. N. Naqvi and K. Fatima*

INCIDENCE OF LIVESTOCK DISEASES IN NOMAL AND NALTAR VALLEYS GILGIT, PAKISTAN
... undertaken to study the incidence of livestock diseases in Nomal and Naltar valleys, Gilgit. The data on cattle, goat, sheep and donkey were collected from the Animal Husbandry Department from 2003 to 2007. In total 19259 animals were found affected with various diseases. The disorders reported in the area were digestive diseases, infections, mastitis, reproductive diseases, endoparasites, ectoparasites, wounds, hematuria, respiratory diseases, emaciation, he...

 Ahmed Fatima*

INCIDENCE OF POVERTY AND THE ROLE OF NON-FARM ACTIVITIES
...ign: justify;"> The incidence of poverty, poverty gap and the severity of poverty for the nine agro-climatic zones of the country (rice/wheat Punjab, mixed Punjab, cotton/wheat Punjab, low intensity Punjab, Barani Punjab, cotton/wheat Sindh, rice other Sindh, Khyber Pakhtunkhwa and Balochistan) were calculated for farming and non-farming households. The indices of poverty were also measured for households that only did farming, undertook farming and non-f...

 S. Talat Gilani*, Shahid Hameed* and Hussain Shah* 

OCCURANCE AND DISTRIBUTION OF POTY VIRUSES INFECTING GARLIC IN PAKISTAN
...etermine the prevalence, incidence and distribution of the poty viruses causing diseases in garlic (Allium sativum) from major garlic growing areas of Pakistan. The yellow stripes, mosaic and chlorotic spot symptoms of the disease resemble the viral infection in garlic reported to occur worldwide. Altogether 690 samples were collected from 29 locations of Punjab and 40 locations of Khyber Pukhtunkhwa to determine the prevalence of Onion Yellow Dwarf Virus (OYD...

 Ummad-ud-Din Umar*, Muhammad Aslam Khan**, *Ateeq-urRehman*, Abdul Hannan***, Syed Atif Hasan Naqvi*, Azhar Ali Khan****, Muhammad Asif Zulfiqar****

DEVELOPMENT AND VALIDATION OF POTATO LEAF ROLL VIRUS DISEASE PREDICTION MODEL BASED ON ENVIRONMENTAL FACTORS FOR FAISALABAD, PAKISTAN
... year dataset of disease incidence and environmental variables and validated by two years data collected in Faisalabad, Pakistan. Maximum and minimum air temperatures, relative humidity and rainfall were employed as independent variables while PLRV disease incidence served as the response variable. Stepwise regression analysis was performed to select potentially useful predictor variables for model development. In stepwise r...
Ahmad Farooq1, Usman Waheed2,3, Hasan Abbas Zaheer2,3, Abdul Rauf4, Abida Arshad5, and Muhammad Arshad1,*
Tariq Mukhtar,1,* Abdul Jabbar1, Muhammad Usman Raja1 and Humayun Javed2
...of Pakistan. The overall incidence of ear cockle of wheat in the division was found to be 1.2% while the overall prevalence was 27%. As regards districts, the maximum incidence was recorded in district Bhakkar followed by Khushab. Similarly, the maximum prevalence was observed in district Bhakkar followed by Sargodha while it was the minimum in district Khushab. The incidence of the nemato...
Farhan Ahmad1,*, Muhammad Waris Sanjrani1, Shah Nawaz Khuhro1, Asif Sajjad2, Abid Ali3, Rashad Rasool Khan3, Farooq Ahmed3 and Junhe Liu4,*
...d monitoring of whitefly incidence and its parasitism.
...
Muzafar Shah1,*, Mazhar Ali2, Sardar Azhar Mehmood2, Shabir Ahmad2, Khushi Muhammad3, Israr Alam1, Kausar Saeed1
...rikot, District Swat for incidence of malarial disease. For this purpose a total of 997 individuals were screened for malarial test in the study area and divided into four category of age i.e. (1-15), (16-30), (31-45), (46-onward), gender wise, union council (Kota, Barikot, Shamozo and Ghalegi) and month wise. It was concluded that out of 997 samples, 204 (20.46%) were found positive, in which mostly under positive, under 15 year of age (23.36%), wherea...

Urooba Pervaiz1, Abdus Salam1, Dawood Jan2, Ayesha Khan1 and Mahmood Iqbal

...ledge, pest and diseases incidence, improper marketing of produce in the study area.  

...

Ghufran ul Haq1*, Muhammad Arif2, Asad Ali2 and Mian Inayatullah3 

...d 2013, to determine the incidence of TYLCV and the population of its vector. Triple antibody sandwich-enzyme linked immunosorbent assay (TAS-ELISA) was successful in detecting TYLCV in naturally and whiteflies inoculated tomato plants. Transmission properties of the virus were determined by inoculation of tomato plants of susceptible cultivar, Roma-VF, by whiteflies, determining the minimum time required for acquisition and inoculation of the virus, latency p...
Muhammad Asim Khan1,*, Shahid Niaz Khan1, Sanaullah Khan2, Abdul Jabbar Khan3, Muhammad Adnan4, Nawab Ali5 and Ijaz Ali6
...n districts, the overall incidence of Plasmodium slides positivity was 52.47% of which 91.07% were identified as Plasmodium vivax and 6.23% as P. falciparum and 2.69 was 43.62%, of which Plasmodium vivax were 91.2%, Plasmodium falciparum were 6.09% and 2.68% were identified as mixed infections. Malaria was most prevalent in the age group 11 - 20 years (61.68 %,) and 40 -50 > (81.63%) years patients. The results also showed...
Abdul Samad1, Ferhat Abbas1, Zafar Ahmad1, Olena Pokryrshko2 and Tauseef M Asmat1,*
... practices to reduce the incidence of food-borne diseases. 

...
Hasina Baloch1, Rahmatullah Rind2,*, Muhammad Rafique Rind3, Viram Kumar4, Nazia Baloch5 and Rajesh K. Oad6
... The overall higher mean incidence (31.81%) of subclinical mastitis was detected in hot humid summer.
...

Abdul Basit1, Muhammad Zeeshan Majeed1,4*, Sohail Ahmed2, Gohar Ali2 and Muhammad Javaid

...olor sheets on fruit fly incidence and infestation on bitter gourd plants and compared it with reduced-risk insecticide formulations of spinosad. Refractive sheets of red, orange, yellow, green, blue, black and white were installed in M. charantia beds at three different angles (30º, 60º and 90º). Results revealed that control treatment exhibited significantly higher fruit fly infestation (60%) with minimum marketable fruit yield (374g/bed) than...
Muhammad Shaheer1*, Asad Aslam Khan2, Nasir Ahmed3, Tehseen Mahmood Mahju4, Ummarah Rasheed5
...ecrease in thickness and incidence if glaucoma in such patients.
...
Hanif Ur Rahman1, Umer Saddique1, Zahoor-ul-Hassan1, Shakoor Ahmad1, Muhammad Kamal Shah1, Said Sajjad Ali Shah1, Farhan Anwar Khan1Fazli Rabbani2, Muhammad Asif Hussain2, Attaur-Rahman2, Irshad Ahmad3,4 and Sadeeq ur Rahman2,*
Mudassar Javed1,Muhammad Zeeshan Majeed1,*, Muhammad Sufyan1, Sajjad Ali2 and Muhammad Afzal1
...ction is hampered by the incidence of many insect pests. Particularly, okra shoot and fruit borer (Earias vittella) and okra fruit borer (Helicoverpa armigera) cause substantial quantitative and qualitative losses to okra crop. In this study, 18 pesticides including conventional and new-chemistry synthetic insecticides and different botanical extracts were screened against these pests on okra variety ‘Pusa Sawani’ under field c...
Shoukat Ara1, Sheikh Adil2,*and Manzoor Ahmad Khan3
...ficial in decreasing the incidence of egg breakage and thereby maximizing profits. The Azolla inclusion in the diet of layer chicken had no effect on SGPT and SGOT levels indicating that Azolla supplementation had no toxic effect in layer chicken even up to 20% levels.
...

Abdur Rehman1* and Shad Khan Khalil2 

...ity (163.9 days). Aphids incidence decreased with 30% reduced irrigation water (37 aphids plant-1). Application of salicylic acid also decreased aphids incidence (47.31 aphids plant-1) compared to control. It is concluded that limited water supply affected canola growth and maturity. Salicylic acid was more effective than potassium nitrate, methanol and water spray in improving growth of canola under optimum and limited wate...
Amjad Islam Aqib1,*, Shagufta Nighat2, Rais Ahmed3, Saba Sana3, Muhammad Ameen Jamal4, Muhammad Fakhar-e-Alam Kulyar2 , Naimat Ullah Khan5, Mian Saeed Sarwar5, Muhammad Asif Hussain5, Asadullah5, Attaur Rahman5 and Sadeeq ur Rahman5,*
...t study investigates the incidence of subclinical mastitis (SCM), associated risk factors, involvement and antimicrobial susceptibility of Staphylococcus aureus in the development of SCM in District Faisalabad of Pakistan. For this purpose, a total of 384 goat milk samples were screened for SCM through surf field mastitis test (SFMT) and mastitis-positives cases were further investigated for isolation of S. aureus using standard procedures. Coagu...

Muhammad Asghar1*, Mirza Muhammad Qadeer Baig1, Sanaullalh Chaudhary1 and Muhammad Anjum Ali2 

... significantly decreased incidence of BLS per leaf (9.31) and resulted in significant increase in 1000 grain weight (22.54 g) and yield (3.57 tha-1) and gave an additional income of Rs.26305 ha-1 with benefit cost ratio of 11.31 compared with control. It is suggested that spray of difenoconazole and macro nutrients (NPK) at appropriate concentrations are handy to minimize incidence of BLS disease in rice crop. 

...
Ajmal Khan* and Rehan Ullah
...(14.07%). Such a highest incidence and prevalence of the infection revealed that malaria poses a great public health problem in the area, so Government and Health Authorities should pay attention on preventing and controlling the infection.
...

Muhammad Aslam Rajput1,3, Imtiaz Ahmed Khan2, Rehana Naz Syed3 and Abdul Mubeen Lodhi3* 

...egions of the world. Its incidence could effectively be minimized by planting smut resistant cultivars. For evaluating a large number of propagative materials; standardized germplasm screening protocols as well as optimized inoculation techniques are required. The pathogen inoculation method should be less cumbersome, simple, and rapid. Here, we compared the effectiveness of six different inoculation methods, i.e., dipping, paste, wound+paste, soil infestation...
Nasira Khatoon1, Aly Khan2,*, S.S. Shahid3, Z.S. Saify4, M. Arshad Azmi1 and Wali Khan5
...e diagnosis. To test the incidence in various age groups and body parts a chi-square (χ²) test of association (R × C contingency test) was performed. The association of body parts and age groups was significant. Most of the patients above the age of 10 were either working in vegetable market or were rag pickers working near garbage bins. The highest infection was recorded on the knees and the lowest on groin. There is need to diagnose der...

 Abdul Maalik1, Shahzad Ali1,*, Anam Iftikhar1, Muhammad Rizwan1, Haroon Ahmad2 and Iahtasham Khan1

... factors associated with incidence of mastitis.

...

 Muhammad Arshad Hussain1 and Tariq Mukhtar2,*

...were conducted to record incidence, prevalence, and severity of root-knot nematode species associated with okra in the major vegetable growing districts of the Punjab province of Pakistan. The overall incidence of 39%, prevalence of 85% and severity of 4.1 in terms of the galling index was recorded throughout the province. Differences in the incidence of root-knot nematodes were recorded f...
Rabia Khalid1, Saleema Bashir Shams1, Bibi Nazia Murtaza1,*, Gaitee Joshua1, Saira Mushtaq1, Hassan Al-Talhi2 and Abdulaziz Al-Amri2
... used to demonstrate the incidence of metabolic syndrome. Overall, 39.025% of bank employees and 22.53% of randomly selected control individuals have metabolic syndrome. Among the bank employees, prevalence of obesity was 67.53% and in general population it was 57.1%. The mean values of body mass index (BMI) for bank employees and control population was 24.10± 0.5 kg/m2 and 20.43±1.0 kg/m2, respectively. Analysis of the comp...
Xuefeng Cao1, Guangneng Peng1, Xiaobin Gu1, Changliang He1, Guizhou Yue2, Jun Shi3,* and Zhijun Zhong1,*
...methodology, while the coincidence rate for DARPM and the same method with DNA added was also 100%. Therefore, DARPM detects CPV and CDV without the need for pre-PCR nuclear acid extraction. Our results show that DARPM is a specific, sensitive, fast and powerful method for detecting CPV and CDV in clinical samples.
...
Shafqat Husnain Khan1, Shah Jahan2, Irshad Ahmad3,4, Sadeeq ur Rahman5,* and Tayyab ur Rehman4,*
...me. Literature regarding incidence of class B metallo-β-lactamases (MBLs) - producing E. coli has not yet judiciously been addressed. In this study, we investigated the occurrence of carbapenemase- and MBLs-producers among a collection of 100 carbapenem resistant E. coli obtained from a tertiary hospital at Lahore Pakistan. All carbapenemase producers were further investigated to identify frequency of blaIMP and bla<...

Waqas Raza*, Muhammad Usman Ghazanfar and Muhammad Imran Hamid 

...ustify;">A survey on the incidence and severity of late blight (Phytophthora infestans (Mont.) de Bary) of potato was conducted in the major potato growing areas of Punjab viz., Khushab, Sargodha, Sahiwal, Okara, Jhang and Chiniot districts during the cropping seasons of 2016-2017. A total of six districts comprising of three locations in each district were surveyed for the collection of late blight infected samples. During 2016 and 2017, prevalence of disease...
Naheed Ikram and Nafisa Shoaib*
...were not contaminated by incidence of fungi. Aspergillus flavus was the most dominant fungus as compared to other species of fungi but it represents the common mycoflora of this region. 
...
Zil-e-Huma1, 2, Abdul Malik Tareen3, Kaleem Ullah3, Tauseef M Asmat4,Abdul Samad4Asim Iqbal2, Mohammad Zahid Mustafa3*,Irshad Ahmad5 and Sadeeq ur Rahman6
 

Aftab Shaukat1,*, Khalid Medmood3, Irfan Shaukat2, Tauseef ur Rehman3, Muhammad Ahsan Naeem1,5, Ashar Mehfooz1, Muhammad Ijaz Saleem1, Zia-ud-Din Sindhu1, Shahid Ali Rajput4, Mubashar Hassan1,4, Saqib Umar1, Muhammad Ali Jamil1, Rao Zahid Abbas1 and Anas Sarwar Qureshi1

 

...ificantly influenced the incidence of disease in the cattle of district Faisalabad. A. marginale induced statistically significant reduction was observed in RBC count, Hb, MCV, PCV and MCHC in infected cattle compared to healthy animals (P<0.05). Anaplasmosis infected animals more effectively treated with combination of Oxytetracycline (22mg/kg, I/V, once/day for 5 days) and Imidocarb dipropionate (5mg/kg, I/M, twice 7 days apart) compared to ...

Zeshan Siraj1*, Amjad Farooq1 and Zahid Mehmood2 

...er was more suitable for incidence of jassids 

...
Hafiza Mehwish Iqbal1, Shahid Yousaf1, Salman Khurshid1*, Qurrat Ul Ain Akbar1, Saqib Arif1, Nasreen Fatima2 and Ali Murad Rahoo3
... samples. However, major incidence was recorded for Aspergillus niger (41.6%) followed by Fusarium oxysporum (27.7%). Infected samples (5.9) had high pH as compared to the healthy samples (3.1). Total soluble solids were decreased from 14 to 8.5% due to fungal infection. Whilst, the infected samples had increased sugar to acidity ratio. The correlation coefficient (r) has also confirmed the influence of fungal disease on postharvest physio...
Salma Javed1, Muhammad Fiaz Khan1, Irfan Ullah2, Sadia Tabassum1,*
...sults concluded that the incidence was high among people with a positive family history of diabetes in first-degree relatives, housewives, and retirees of District Battagram. Sedentary, as well as a stressful lifestyle, could attribute to the disease. So regional campaigns should be initiated for awareness. 
...
Tahsin Razzaq*, Muhammad Fareed Khan and Shahid Iqbal Awan
...ale. The percent disease incidence ranged from 20-60% and area under disease progressive curve (AUDPC) 22-362dsu (Development stage unit). On the basis of disease rating scale and pathological traits, it was reported that three parental genotypes Karamat-Bar-25, SZP-13200, NCEV-1530-11 had lowest values for all pathological traits and severity rating of 5R, 5R and 10R and marked as highly resistant (R) genotypes, whereas three parental genotypes Soan-3, Ghuari...

Turab Ali Kaurajo1*, Huma Rizwana1, Gulbahar Khaskheli2, Muhammad Haroon Baloch1, Muhammad Naeem Rajput1, Asad Ali Khaskheli3 and Mohsin Solangi

Tanweer Kumar1, Sahib Zada2,3,Muhammad Irfan4,*, Huma Batool5 and Wasim Sajjad2,6
...s, the highest number of incidences of HBV antibodies was found in the 16-25 age groups (7.01%). ICT positive samples were further screened by nested polymerase chain reaction (PCR) to determine the existence of active HBV-DNA. It was investigated that 5.7% (2382) of the total population (4758) tested was positive, among which the female 15.4% (367) possessed antibodies in their blood against HBV. Our results showed a higher male percentage than that of the fe...

Waseem Abbas1, Shakeel-ur-Rehman2, Abdul Rashid2, Muhammad Kamran3, Muhammad Atiq2 and Muhammad Ehetisham ul Haq3* 

...d indirectly the disease incidence. Leaves extracts of four plant extracts i.e. Calotropis gigantea, Zingiber officinale, Allium cepa and Azadirachta indica were evaluated at 3 % concentration against eggs hatchability and adult emergence of the whitefly in lab condition. Two consecutive sprays were applied to assess the relative impact of different plant extracts against adult whitefly population and the disease incidence o...

Majid Khan, Naveed Jehan*, Muhammad Zahoor and Nadia Naz 

...ct to reduce the poverty incidence

...
Tasbihullah1, Sadeeq ur Rahman2,*, Tariq Ali3 , Umer Saddique1, Shakoor Ahmad1, Muhammad Shafiq4, Sultan Ayaz2, Hamayun Khan1, Ijaz Ahmad1 Asadullah2, Raheela Taj5, Hafiz Nidaullah6 and Alamgir Khan7
...s conducted to determine incidence of extended spectrum β lactamase (ESBL) - producing Escherichia coli in table eggs and human with history of close association with table eggs. For this purpose, a total of 200 table eggs and 50 stool samples from human were analyzed. Results showed that out of 80 E. coli isolates recovered from eggs, 20 (25%) were found to be ESBL-producers, while, of the 17 human-isolates, 4 (23.5%) were ESBL producers. P...
Ali Asghar1*, Tariq Mukhtar1, Muhammad Usman Raja1 and Asim Gulzar2
...inations. Similarly, the incidence of bacterial wilt was lower where the nematode was absent. Minimum wilt incidence was recorded at the lowest density of R. solanacearum. The wilt incidence increased significantly when nematode was inoculated along with the bacterium and maximum incidence was recorded where both the pathogens were applied at thei...

Humayun Saleem1, Faisal Sohail Fateh2*, Zia-Ur-Rehman1 and Muhammad Abu Bakar Siddique

...rying degrees of disease incidence, frequency and disease index the prevalence of shot hole disease was 100 per cent. It was concluded that the markets near poor colonies are merely selling cheap fruits and they are not concerned with the diseased fruits. 

...
Quratulain1, Ata-ul-Mohsin1, Muhammad Naeem1, Ghulam Shabir1, Muhammad Khalid Rafique2 and Rashid Mahmood2*
...lts revealed that thrips incidence occur after 6th week of transplantation. Saryab red found relatively susceptible against thrips with maximum mean population of 52.41±15.42 individuals per plant while Red imposta was relatively resistant with 37.02±9.97 individuals per plant infestation. Thrips tabaci showed maximum activity at 24 oc which shows positive correlation between temperature and thrips development. Consid...

Gulnaz Hameed1, Abdul Saboor1, Khuram Nawaz Sadozai2*, Ghaffar Ali2, Dawood Jan2 and Mansoor Rasheed

...re was used to calculate incidence of poverty which is then used to model the probability expressions with the help of Logit to investigate the correlates of poverty in the research area. Poverty was found at below for registered members and investigations showed that education, area under cultivation, possession of assets, status of employment, ownership of livestock and jobs of females increased the likelihood of decrease in poverty. Therefore, successful co...
Sana Khan1, Raheela Taj1, Noor Rehman2, Asad Ullah3, Imad Khan3 and Sadeeq ur Rahman3,*

H. Liu1, X.P. Tang1, R.J. Fang1,*, F.Yi2, C. Zhang2, R.Q. Yang1, F. Sun1 and S.Y. Zhou1 

...D activity) and diarrhea incidence were measured in the 2-phase feeding program (1-14 d, 15-42 d). Results showed that: compared with the control diets, 1) Diets supplemented with Av-Cu or CuSO4 did not affect the average daily feed intake (ADFI) of weaned piglets; supplementing the diet with Av-Cu, the average daily gain (ADG) was linearly increased (P < 0.05), and the feed conversion ratio (FCR) was linearly decreased (P < 0.05); 90-100 mg/k...

Aurang Zeb, Abdur Rab and Shujaat Ali* 

...egarding percent disease incidence revealed that the highest disease incidence (26.66 %) was recorded from Torwarsak (Buner) 48 days of storage freshly harvested fruits. It is concluded that Sweet orange fruits from different locations can be best stored at room temperature (20±1 0C with relative humidity of 45-50 %). 

...
Saira Saleemi1*, Zafar Iqbal1, Abdul Nasir Khalid2
...ies, then the chances of incidence of aspergillosis in silver carp may be minimized. 
 

Zia-Ur-Rehman1, Faisal Sohail Fateh2*, Humayun Saleem1 and Muhammad Abu Bakar Siddique1 

...d to see the prevalence, incidence and severity of peach rot disease in the markets of Federal Territories of Islamabad to estimate the intensity of the disease by calculating the disease index. The prevalence of disease was 100% in all markets of Khanna Pul, Burma Chowk, Taramri, NIH Market, Chatha Bakhtawar, I-8, I-10/2, I-10 (Markaz), Sabzi Mandi, I-9. Maximum Mean Disease Index 77.78% was found in the market of Khanna Pul which supplies the fruits to high ...

Muhammad Abu Bakar Siddique1, Faisal Sohail Fateh2*, Zia-Ur-Rehman1 and Humayun Saleem

...d to see the prevalence, incidence and severity of black scurf disease in the markets of Federal Territories of Islamabad to estimate the intensity of the disease by calculating the disease index. Maximum disease index was observed in Abpara and F-10 markets i.e. 21.11% with varying disease incidence and severity percentage. However, the presence of black scurf disease in the market shows that in Pakistan the consumers do no...

Yasir Iftikhar1, Mustansar Mubeen1,2*, Waqas Raza1, Qaiser Shakeel3, Waseem Abbas1, Shehzad Iqbal1 and Ashara Sajid

...RV. The range of disease incidence was from 15.93% to 64.58%. Moreover, susceptible reaction was observed in five varieties (FD 71-1, Tota-704, FSD white, FD 76-24 and FD 8-1). Two varieties (Kuruda and SH 216 A) were moderately resistant, while three varieties, FD 74-41, FD 74-50 and N 96-25 were found to be moderately susceptible. In susceptible varieties, disease severity was significantly correlated with temperature (max and min), and relative humidity (RH...

Ehsan-Ul-Haque1, Akbar Hayat1*, Muhammad Asim1, Sajjad Hussain2, Muhammad Shakeel Hanif3, Muhammad Zubair1, Muhammad Abdullah Jamil1 and Faheem Khadija1 

... conditions. Least decay incidence 1.2% and 1.8% respectively in Kinnow and Willow leaf was observed in fruit treated with fungicide in wax followed by fruit treated with Potassium sorbate in wax (2.8% and 3.6%). TSS and acidity showed conversely increasing and decreasing trends respectively in both type of fruits with extension of storage period. Willow leaf proved as a close second with respect to various aspects of quality and nutritional value during the f...
Sitara Nawaz1, Shamaila Irum1, Haroon Ahmed2, Shazia Shamas1, Sadia Roshan1, Muhammad Ather Rafi4, Irfan Ullah5*, Gulnaz Parveen3*
...his study discovered the incidence of Leishmaniasis in selected areas and time period. That can be beneficial for identification and control of sandflies. This study will help the researcher to uncover the critical areas of leishmaniasis and the most common species in Pakistan.
...
Mah Jabeen and Amjad Farooq*
...11-2012. The data on the incidence of aphids were recorded at weekly interval. Host plant susceptibility indices were also calculated. B. napus was found to be susceptible showing maximum population of aphids i.e., 6.80 per 10-cm inflorescence whereas B. compestris showed comparatively resistant response with minimum population of aphids i.e., 0.43 per 10-cm inflorescence. The population of aphid was recorded to be the highest (12.8...
Kui Li1, Lijun Li1, Jialun Fu2, Yi He2, Zhaohui Song2, Shuiping Zhou2Luobu Gesang1* and Rui Liu2*
...o utilized to access AMS incidence and severity, twice a day, during the research period. AMS was further diagnosed when headaches and LLSS≥ 3 were present. A total of 54 subjects completed the study and no significant difference was observed in the number of individuals with AMS between the groups. However, during the whole observation period, the LLSS values for comprehensive AMS symptoms in the group receiving CDDPs indicated lower occurrence than those ...
Aamir Khan1, Rabia Noushin2, Mohammad Attaullah3, Shahid Naiz Khan1, Rafiqe Hussain4, Farman Ullah Dawar1, Faiz Ur Rehman1, Muhammad Ijaz1 and Kalim Ullah1*
...ough microscope. Overall incidence of babesiosis was 54.80%.B. bovesshowed high prevalence (35.46%) than B. bigemina (19.33%). Females were more prone as compared to male cattle for both B. bovesandB. bigemina. Cattle having age less than two years showed high positivity for bothB. boves (49.23%)and B. bigemina (26.15%). Similarly rate of positivity for both B. boves (47.12%)andB. bigemina (25.13%)...

Ummad ud Din Umar1, Syed Atif Hasan Naqvi1*, Ishfaq Ahmed1, Ateeq ur Rehman1, Muhammad Asif Zulfiqar2, Sibghat Ullah3, Shah Pasand4, Zehri Khan3 and Abdur Rehman5

Prevalence and Serological Detection of Spiroplasma citri, a Cause of Citrus Stubborn Disease in Southern Punjab, Pakistan
...nd Multan showed maximum incidence of CSD with “11.66” and “5.66%” respectively while least incidence was observed in District Bhakkar (03%) and District Khanewal with (02%) incidence. Sweet orange and grape fruit depicted themselves as susceptible ones showing maximum disease with “18.33” and minimum “02%” respectively. Kinnow mandarin and f...

Iram Bilqees1, Yasir Iftikhar1, Mustansar Mubeen1,2*, Qaiser Shakeel3, Ashara Sajid1, Zahoor Hussain4, Aqleem Abbas2, Muhammad Aamir Sohail2, Judith Jeruto Kiptoo5 and Shehzad Iqbal2

Use of Nutrients and Plant Extract to Manage Okra Yellow Vein Mosaic Disease (OYVMD) in Sargodha, Punjab, Pakistan
...or the disease severity, incidence and its management through different nutrients and plant extract. Plant extract and multi-nutrients were used to manage the disease to avoid the hazardous effect of chemicals on human health and being the eco-friendly. Four varieties of okra viz., Indian Rachna, Sabz Pari, Desi Bhindi, and Rama Krishna were grown under RCBD. Five treatments viz., 2% garlic extract, 2% multi-nutrients, silicon (1 and 1.5%) s and water as contr...

Abdul Jalal, Abdur Rab* and Naveed Ahmad

Aloe Vera Gel Coating Retains Persimmon Fruit (Diospyros kaki) Quality during Storage at Room Temperature
... (Taste) score and decay incidence. Coating of persimmon fruits with 30% Aloe vera gel retarded the storage related changes and retained high fruit firmness, acidity and ascorbic acid as well as lower total soluble solids and decay incidence than control fruits. In control fruits (0 days storage + Distilled water treatment), the fruit firmness (3.33 kg cm-2), acidity (0.29%), and ascorbic acid content (46.25 mg/100g) decreas...
Gulzhan Aubakirova1*, Zhanat Adilbekov2, Assylkhan Inirbayev2, Assel Zhamanova2 and Aibar Akhmetov3
...losis were detected. The incidence of fish with bacteriosis was not observed, with the exception of isolated cases of aeromonosis. Exceeding the maximum permissible concentrations for residual amounts of toxic elements and radionuclides has not been established. We found that the most common fish disease in the water bodies of the Karaganda region was postdiplostomatosis, which was diagnosed in the roach in all the water bodies of three regions, and the most i...

Muhammad Tariq-Khan1*, Syed Zanib Ali Gardazi1, Abu Daud Ahmad Khan1, Muhammad Ilyas2 and Ishaq Ahmad3,4

Virulence and Distribution Trends of Root-Knot Nematode (RKN) Fauna on Summer Vegetables in District Bagh, Azad Jammu and Kashmir (Pakistan)
...locations with 72% field incidence. Okra was found with highest field infestation with 47.3% followed by cucurbits on 20% and tomato on 17.4% while zero infestation on chilies. Species were identified based on perineal pattern morphology. M. javanica was identified as predominant species of the study area. RKN tropical species was found on M. incognita 37%, M. javanica 38% and M. arenaria 28% sites parasitizing vegetable crops. Host preference of M. javanica a...
Mushtaq Ahamd Khan1, Ziaul Islam2, *, Amin Ullah Jan3, Kamran Khan2 and Abdullah Shah3
...regnancy. Higher (52.6%) incidence of T. gondii infection was observed in illiterate women. The study demonstrates that age, low level of education, pregnancy, contact with cat and soil are the major risk factor of T. gondii infection.
...
Yongmei Gao1, Peihong Gao2, Yanjun Wang3, Jinhua Han4 and Yang Shu1*
...reatment, p<0.05. The incidence of adverse reactions of the research group was significantly lower than that of control group, while the and overall nursing satisfaction of the research group was significantly higher than that of the control group, p<0.05. It is concluded that combination therapy of mifepristone and Guizhifuling capsule can significantly improve the treatment effect in patients with uterine fibroids.
...

Muhammad Iqbal1, Muhammad Ehetisham ul Haq1*, Muhammad Kamran1, Muhammad Idrees1, Shahid Nazir2, Ihsan Ullah3, Sumera Naz1, Shaukat Ali1 and Muhammad Zafar Iqbal2

Morpho-Molecular Characterization of Xanthomonas Axonopodis Pv. Citri Associated with Kinnow (Mandarin) and its Management
...was coined to record the incidence of the disease in the Sargodha districts of the Punjab province. Furthermore, isolated bacterium from diseased samples was characterized morphologically and molecularly. The relative efficacy of commercially available antibiotics against the pathogen was evaluated in the lab and in field conditions. A systematic survey of randomly ten localities/sampling sites was conducted for a reliable estimation of citrus canker disease i...
Saima Yaqub1, Tahir Yaqub1*, Muhammad Zubair Shabbir2, Asif Nadeem3Aziz-Ul-Rahman1, Muhammad Furqan Shahid1, Zarfishan Tahir4 and Nadia Mukhtar4
...ntial association of HIV incidence was observed in individuals with HCV infection (36.84%; 95% CI: 28.55-45.99; p<0.0001) followed by individuals involved in practices of shared injection equipment (21.17%; 95% CI: 25.07-40.21; p<0.0001), injected previously used syringes (30.2%; 95% CI: 23.4-37.99; p=0.0016), sex with IDUs (37.78%; 95% CI: 25.11-52.37; p=0.002) and those with an age between 30-39 years (27.17%; 95% CI: 19.13-...
Muhammad Riaz1*, Zahida Tasawar1, Muhammad Zaka Ullah2 and Zawar Hussain3
Parasitological and Molecular Survey on Theileriosis of Sheep and Goats and the Related Risk Factors in Musa Pak Shaheed Town, Multan, Pakistan
...cies, PCR identified the incidence of T. lestoquardi and T. ovis was 16.5% and 5% respectively while 6% blood samples revealed mixed infection of both species in overall small ruminants. The infection rate of T. lestoquardi was higher (9.5% and 7%) than T. ovis (3% and 2%) in sheep and goats respectively. Statistically significant correlation revealed between theileriosis and animal species, different age groups, presence of ticks, herd size and herd compositi...
Ashara Sajid1, Muhammad Usman Ghazanfar1, Saeed Rauf 2, Zahoor Hussain3, Salman Ahmad1 and Yasir Iftikhar1,*
...nformation about disease incidence is essential for the eradication and controlling measures of disease. In this context, a survey regarding the incidence of citrus green disease (CGD) was recorded in two cultivars Kinnow (Citrus reticulate Blanco) and Mosambi (Citrus sinensis (L.) Osbeck), among significant citrus-growing areas of Sargodha district based on symptoms. Random sampl...
Jia Shi
... hepatitis B, the pooled incidence of treatment responders in comparison to non-responders was significantly lower (OR = 0.78, CI (0.7-0.87), p <0.0001). High heterogeneity was observed in this analysis (I2 = 95%, p <0.0001). to investigate factors affecting heterogeneity, a subgroup analysis was done based on the HBV genotype. 5 Studies in which most patients (>90%) had...
Muhammad Hamayoon Khan*, Niaz Hussain Khuhro, Muhammad Awais, Muhammad Usman Asif and Raza Muhammad
 
 
...itive relation among the incidence of B. zonata and minimum and maximum temperatures and sunshine hours whereas relative humidity (R.H.) and rainfall were found to have a negative correlation with B. zonata abundance. Correlation analysis of B. dorsalis catches with respect to meteorological data revealed a significantly positive correlation of monthly captured flies with all the climatic factors such as maximum temperature, minimum temper...
Ying Liu1, Shankun Liu1, Hui Wang2 and Weihua Su2,*
...ing the GDM increase the incidence of oxidative stress. Caffeic acid is a powerful free radical scavenger and possesses antioxidant effect against the various diseases. Previous study suggests that the caffeic acid have potent anti-inflammatory activity. The aim of the current study was to scrutinize the protective effect of caffeic acid against the streptozotocin induced GDM in rats and explores the possible mechanism of action. A total 36 female rats were ca...
Saima Siddiqui1, Ghulam Hussain Abro1, Tajwar Sultana Syed 1Abdul Sattar Buriro2, Sohail Ahmad3, Muhammad Zeeshan Majeed4 and Muhammad Asam Riaz4*

 

... variety (CRIS-342). The incidence of sucking pest on cotton was recorded fortnightly. The physio-morphic characters (density and length of trichome on lamina, midrib and vein, gossypol glands on midrib and lamina) of above mentioned cotton varieties were correlated with the incidence of sucking pest. Result revealed that cotton varieties had significantly different physio- morphic characters. There was a negative and signif...

Allah Bakhsh1, Attiq Akhtar1*, Fiaz Hussain1 and Shabbir Ahmed2

...ity and minimize disease incidence in the King’s Ruby variety, FZLR was used for two seasons in a row. Total leaf removal was used before bloom, during full bloom, and four weeks after bloom, and was compared to an untreated control (non-defoliated). In all leaf removal treatments, titratable acidity and bunch rot incidence decreased significantly, while total soluble solids, total phenolic content, total sugars, and r...

Habiba ur Rehman, Muhammad Usman Ghazanfar and Waqas Raza

... 11.33), minimum disease incidence (12.33, 11.12 and 10.13 %), minimum disease severity (26.80, 24.67 and 11.37 %) and maximum plant survival (89.62, 94.35 and 98.37%) at 15, 30 and 45 days after treatment, respectively. The application of Success @ 6mM was also good but lowers than the Nativo. The poor performance and maximum disease incidence and disease severity were recorded from the controlled pots. Among all the treatm...

Gulnaz Parveen1*, Naila Mukhtar2, Shumaila Irum3 and Nain Bukhari4

Ahmed A. Kheder

...nostic techniques. Virus incidence was performed in different locations in five governorates during 2018-2020. Forty-one samples out of 693(5.94%) reacted positively to SLRSV. Specifically, the percentages of infection were 7.3, 6.7, 5.4, 5.16 and 2.63% in El-Qalyubia, El-Beheira, El- Menoufia, El-Sharkia and El-Ismailia governorates respectively. SLRSV was mechanically transmitted from infected strawberry plants onto ten herbaceous plant species, different ty...

Ahmed F. Afify1, Mohamed A. Shalaby2, Ahmed A. El-Sanousi2 and Amal S. Gaber1

....
...

Nelson D. Zambrano1, Wilber Arteaga1, José Velasquez2 and Dorys T. Chirinos1*

...in + thiamethoxam on the incidence of insect pests and its associated natural enemies. Results revealed that populations of B. tabaci were higher in plots treated with lambda cyhalothrin + thiamethoxam associated with low levels of parasitism. Further, A. gossypii were high and their parasitism low, in both treated and untreated plots. Individuals of T. palmi, B. thurberiella, H. virescens and A. vestitus were low in the treatments; while individuals of Dysder...
Amro A. Farrag1; Ahmed K. El-Attar1; Om-Hashem M. El-Banna2; Ibrahim A. I.2; H. M. Mazyad 1 

Megahed, A.A.1; Kh. A.El-Dougdoug2 and B.A. Othman2

...rmine the occurrence and incidence of Cucumber mosaic cucumovirus (CMV), Beet mosaic potyvirus (BtMV), Beet necrotic yellow vein benyvirus (BNYVV), Beet curly top geminivirus (BCTV) and Beet yellows closterovirus (BYV) symptomatology and serologically by double antibody sandwaich Enzyme linked immunosorbent assay (DAS-ELISA). The survey of sugar beet viruses achieved in 15 field locations belonging to 5 different Governorates, which performed by examination 91...

Rafia Ahsan1, Saif Ullah1, Ijaz Yaseen1, Faisal Sohail Fateh1, Muhammad Fayyaz1, Shahzad Asad1, Atif Jamal1, Muhammad Sufyan2 and Muhammad Zakria1*

... and Gujrat. The disease incidence in Gujranwala, Sialkot and Narowal was 35%, 50% and 21% respectively, and severity ranged from 0-80%, 0-70% and 0-70% respectively. In KP 3 rice growing areas were surveyed. In Mansehra the disease incidence (37%) and severity (0-70%) was lower compared to Swat and lower Dir. In comparison to Punjab and KP, BLB was less prevalent in Sindh. Highest disease prevalence was recorded in Badin (1...

Salama M. El-Saghir1, 2

...y is to characterize the incidence of PVS serologically with
authentic antiserum for PVS and, molecularly using specific primers for PVS.
Methods: In-direct ELISA (I-ELISA) and dot blotting immunobinding assay (DBIA) were used for
detection of the virus in commercial potato plants. IC RT-PCR amplified 187 bp of the virus coat
protein using antiserum for PVS and the specific primer 5’TGGCGAACACCGAGCAAATG3&rs...

Salama M. El-Saghir1, 2

...div>
examining the incidence of PNRSV and phytoplasma in these trees.
Methods: The incidence of PNRSV in the peach trees understudy was confirmed with DAS-ELISA
using an authentic antiserum for PNRSV. The incidence of phytoplasma as a second pathogen in the
trees was PCR tested using the universal primers for phytoplasma detection, P1/P7, in the fi...

Muhammad Nasir1, Muhammad Usman Asif2*, Abdul Hayee Abid1, Qurat ul Ain Haneef1 and Muhammad Awais2

...ch year. Hot spots (pest incidence at and above Economic Threshold level, ETL) for each tehsil were determined weekly, and then the combined infestation was calculated at the district level. The results showed that the weather conditions, during all the three years, had a significant impact on the insect pest abundance. The maximum percentage of whitefly hot spots ranged in line from 8.36-24.14% during three years study period followed by mealybug (6.71-11.79%...

Javed Anwar Shah1, Azhar Iqbal1, Muhammad Tariq Mahmood2, Muhammad Aslam3, Muneer Abbas4 and Ilyas Ahmad5*

...e conditions for disease incidence were developed by maintaining the temperature between15-20 °C and humidity >70%. Test entries were inoculated equally by spraying fungal suspension during initial flowering and pod filling stages. Observations on disease incidence were recorded by employing 1-9 Disease Rating Scale. Result showed that no line was resistant whereas, only eight chickpea desi lines were found moderately...

Jong Ho Ahn1, Jang Hoon Choi1,2 and In Sik Nam1,3,*

...TFC and GCFC groups. The incidence of C grade of meat yield was 33.3% with GCFC and GTFC) and 40.0% with GCFT and GTFT). The incidence of grade 1+ or higher meat quality was higher with (GCFT, 86.6%; GTFT, 73.3%) than (GCFC, 46.7%; GTFC, 66.6%) in the fattening period. In conclusion, feeding TMR to beef cattle has been shown to have a positive effect on productivity. Therefore, it is expected that TMR can help to improve the...

Fahima Khatun1, Abdullah-Al-Maruf2, Md. Mizanur Rahman2, Afroja Yasmin1, Mohammad Ali Zinnah3, Md. Aminul Islam4 and Mohammad Shah Alam5*

...ucted to investigate the incidence of gastrointestinal parasitic diseases in cattle that were sick and brought to veterinary hospitals for treatment. Fecal samples were collected from the rectum and examined by direct smear method and helminths identified by the presence of characteristic eggs in the feces. This study was carried out with three age groups: calves (<1 year), young (1-3 years), and adult (>3 years) and three different consecutive seasons (...

Azra Nadeem1*, Shaukat Hussain2, Saeedullah2, Asma Akbar3, Zahoor Ahmad4, Maryam Tariq5, Robina Karim6 and Muhammad Huzaifa7

...ed for disease severity, incidence, tuber weight, number of tubers/plant, fresh root weight and plant height at the time of harvest of the crop. The biocontrol agent (T. viride) showed lowest disease incidence (53.73%) and severity (1.27) at 8% moisture level. There was a reduction of 43.33% and 63.29% over control by T. viride for disease incidence and severity respectively at this moistu...

Junaid Ahmad1, Shahzeb Javed2*, Mehmood Khan1, Shadman1, Muhammad Farooq3*, Muhammad Saleem4, Rahila Afzal5, Muhammad Aasim6, Naqeeb Ullah7, Muhammad Noman Khan8, Dawood8 and Naila Ilyas9

...tant in Pakistan, as new incidences of food contaminants emerge, which, if overlooked, can result in a variety of health risks, illness, outbreaks, and even death. The goal of this study was to look at the students’ knowledge, attitudes, and practices on food safety and cleanliness at a different institution in KPK, Pakistan. A cross-sectional study was done among 1000 government and private university students in KPK, Pakistan, using a self-administered...

Mukhtar Iderawumi Abdulraheem1*, Muhammad Ihtisham2*, Abiodun Yusuff Moshood3, Nawab Khan4, Muhammad Owais Shahid5, Shafiq Hussain6, Kumail Abbas6 and Fawad Zaman7

...imes on the severity and incidence of not unusual viral diseases on okra without fertilizers/chemicals application. The treatments were (3×4) factorially designed and fitted into RCBD in field conditions. Weeding consisted of four levels i.e. no weeding, weeding once, weeding twice, and weeding thrice, whereas mulching types comprised of three levels i.e., no mulching, dry grasses mulching, and polythene mulching. The findings revealed that all of the ok...
Shabana Naz1*, Nishat Ali Khan1, Arnab Tanweer1, Shifa Moazzam1, Qudrat Ullah2, Farkhanda Asad1, Irfan Khattak3, Sajida Batool4 and Rifat Ullah Khan5

Eman H. Mahrous1, Mohamed. W. Abd Al -Azeem2, Faisal A. Wasel1, Waleed Younis2* 

...spectively, with a total incidence of 47 (31.3%). Biochemical reactions proved that 20 (42.5%) out of 47 isolates had the typical biochemical properties of P. multocida. However, only 10 isolates were identified as P. multocida using species-specific primers by conventional PCR with an incidence of 6.7%, besides belonging to serogroup A by multiplex PCR. Serologically only eight isolates belong to somatic serotypes 1, 3, an...

M. Hanafy1, Rehab Elhelw2, Soliman M. Soliman3, Sherif Marouf2* 

...al characterization, the incidence of Pasteurella multocida was 40.4%, and Mannheimia haemolytica was 7.1%. Using KMT1 gene for identification of the isolates for P. multocida and SSE gene for identification of the isolates for M. haemolytica, the results revealed that six isolates showing positive PCR for Pasteurella multocida and were subject to further phylogenic characterization. M. haemolytica could not be detected by PCR. Identification and characterizat...

Asad Ullah1*, Umar Sadique2, Ibadullah Jan2, Imad Khan1, Raheela Taj3, Mumtaz Ali Khan4, Salah-ud-din4, Naimat Ullah Khan1

...aimed to investigate the incidence of pulmonic tuberculosis caused by M. bovis in specific occupational groups; to study the socio-demographic conditions, awareness, level of knowledge and practices about tuberculosis; to investigate the molecular prevalence of bTB. Overall, 390 no of sputum samples collected as of 800-participants comprised of TB patients (100), livestock(L/S) farm employees(200), abattoir employees(174), butchers(294), veterinarian(10) and v...

Yan Jiang1,2, Xia Tao3,4 and Hongxia Chen5,6*

...ficant difference in the incidence of adverse reactions between the two groups (P>0.05). To conclude, the application of rituximab-assisted prednisone and cyclophosphamide in the treatment of IMN can improve serum nephrin and BAFF levels, reduce clinical symptoms, improve renal function and curative effect, and reduce recurrence rate, and is safe.

...

Sajad Ali Solangi1, Jamal-U-Ddin Hajano1*, Rehana Naz Syed1, Sohail Ahmed Otho2, Khadim Hussain Wagan1, Agha Mushtaque Ahmed2, Fahad Nazir Khoso2, Aftab Raza Jarwar3 and Suman Tarique Qazi1

...ns were taken on disease incidence, severity and whiteflies population at interval of week after date of transplantation. Additionally, relationship among the disease and vector insect was determined. The minimum incidence of the disease was recorded in variety Advanta-1211 (13.85%) and Lima (18.85%) followed by T-1359 (23.30%), Early king (25.51%), TO-1057 (27.21 %), Advanta-1225 (29.41%). Minimum 1-rating score was recorde...
Hadia Gul1, Abdul Haleem Shah1, Ricardo Harripaul2, Anna Mikhailov2, Ejaz Ullah Khan3, Wasim Shah3, Nisar Ahmad3, John B Vincent2,4 and Muzammil Ahmad Khan3*
...rts the evidence of high incidence of OCA2 gene mutations in Pakistani families.

...

Mohammed H. Galhoum1, Hamza M. Eed2, Essam S. Soliman1* 

...vealed higher resistance incidence up to 100% against amoxicillin-clavulanic acid (AMC; 30 μg), ampicillin (AMP; 10 μg), and nalidixic acid (NAL; 30 μg), 90% against enrofloxacin (ENR; 5 μg), and 80% against doxycycline HCL (DO; 30 μg). The conventional culture method revealed up to 83% sensitivity and 90% specificity while the molecular analysis revealed up to 100% sensitivity and 100% specificity for Salmonella detection. The study concluded t...
Heba Mohamed Shaheen1, Ali Meawad Ahmed1*, Hosny Abdelltief Abdelrahman1, Rania Helmy Abohatab Abdou2, Aya Salama Mohamed Kamel1
...esults revealed that the incidence of tetracycline residues was 260 (87%) in all examined chicken meat. The average concentration values of oxytetracycline (OTC), tetracycline (TTC), chlorotetracycline (CTC), and doxycycline (DOC) in broiler samples were 160.26, 89.19, 98.75, and 175.64µg/Kg respectively. Based on the local and international regulations, the results revealed that out of 260 positive samples for tetracycline levels, 170 (65.4%) were unfit...

Heba El-Zahar*, Zeinab Abd El-Rahman, Abbas El-Naggar 

...o the continuous rise in incidence, simple and cost-effective methods of diagnostic and clinical assessment are urgently required. The goal of this study was to look at the hematobiochemical alterations in association with the evaluation of C-reactive proteins (CRP), haptoglobin and fecal calprotectin concentration as prognostic markers in dogs with IBD. After a detailed clinical, laboratory and ultrasonographic examination 21 IBD dogs with symptoms of chronic...

Mohamed Abd El-Fattah Abo-Farw1, Maged Ahmed Aboul-Omran1, Abdel-Khalek El-Sayed Abdel-Khalek2* 

...by about 3.77%. Mastitis incidence at early postpartum in lactating Egyptian buffaloes delayed the resumption of estrous and ovarian activity and decreased pregnancy rate, antioxidant status, thyroid and reproductive hormones and trace elements such as Zn and Se.

Keywords | Mastitis, Buffaloes, Pregnancy rate, Antioxidant, Trace elements. 

...

Samah Samir, Amal Awad*, Gamal Younis 

...lity and reduce sickness incidence and economic losses.

Keywords | E. tarda, Fish farms, Virulence, Antimicrobial susceptibility, Biofilm. 

...

A.J. Shoyombo1, O.O. Alabi, B.M. Falana1*, R.A. Animashahun1, S.O. Olawoye1, F.A. Okenniyi1, M.A. Popoola2, C.I. Ukim2, A.M. Ake, A.E. Jubril3 

Muhammad Zahid Iqbal1, Aneela Zameer Durrani1, Jawaria Ali Khan1, Nisar Ahmad2, Muhammad Usman1,*, Abdul Jabbar1, Saba Usman3, Ahsan Anjum3, Muhammad Husnain1, Nadeem Raza1 and Anwar-ul-Haq4

...esigned to determine the incidence of coxiellosis in bovines, evaluate the association of various risk factors in the occurrence of Coxiella burnetii, determine phylogeny and genetic variability of various isolates identified during the study, and report hematology of the affected bovines. The incidence of coxiellosis was estimated as 32.12% and 12.5% in cows and buffaloes, respectively. The association of selected clinical ...

Ouedraogo Oumar1,2, Tianhoun Denté Fidèle2,4*, Séré Modou3, Kaboré Adama2, Tamboura H. Hamidou2 and Belem Adrien Marie Gaston4

...lence and socio-economic incidence of bovine tuberculosis. For this purpose, daily monitoring of cattle from various farms and slaughtered at the slaughter area was carried out from February to June 2019 during ante and post-mortem inspections. The results of the analysis of the data collected during these inspections revealed that 1,716 cattle of local breeds, consisting of 875 females and 841 males, were slaughtered and checked by the veterinary inspection o...

Muhammad Asif1*, Ahmad Ali Shahid1,2 and Nasir Ahmad3

...nt to reduce the disease incidence. Crude protein extract was also found beneficial to control the pathogen. The results for minimum inhibitory concentration (MIC) of crude protein extract reveal that 5mg/ml is the concentration, which inhibited 100% growth of A. solani. It was concluded that either mycelia or crude protein extract of G. lucidum could be used for pathogen inhibition.
...

Saied Belal1, Ashraf Albrakati1*, Khalaf Alsharif2, Saad Al-Shehri2, Mohamed Alblihed3, Malik Almuqati4, Anfal Alsharif5, Alaa Albarakati6 and Anas Al-sharif7

.... Also, there was a high incidence of low birth weight (15.6%) and preterm babies (10.9%) in Taif newborns. In this study, we concluded that high altitude reduces, significantly, the birth weight and birth length independent of other affecting factors. Other risk factors appear to influence newborn measures at high altitude in much the same way as at other altitudes. The effect of residence at high altitude on the prematurity rate needs further investigations....

Weam Mohamed Baher1, Wageh Sobhy Darwish2*, Abdelazim Elsayed Elhelaly3,4 

...results revealed overall incidence rates of Anisakis larvae in herrings and sardine at 70% and 50%, respectively. The parasite infested mainly (100%) the visceral organs of the positive samples in the two fish species; while infested the muscles in 30% and 10% of herrings and sardine, respectively. The highest prevalence rates for the two species were recorded in the collected samples from Damietta, followed by Alexandria, Port Said, Ismailia, and Suez, respec...

Yahia A. Amin1*, Alaa Eldin Z. Mahmoud2, Mohamed Sabry Aref3, Abd El-Latif Shaker Seddek4, Waleed Younis5 

...and E. coli has a higher incidence of infections with two microorganisms, while infection with Streptococcus and Klebsiella has the least incidence of infections with two microorganisms. The results also revealed that Cefoperazone is the most sensitive antibiotic. Cows infected with mixed infections have the longest postpartum period of pregnancy, especially those infected with E. coli, and Klebsiella. It is concluded that t...
Ch. Muhammad Rafiq1, Muhammad Rizwan1*, Bilal Atta1, Arshed Makhdoom Sabir1, Misbah Rizwan2, Muhammad Arshad3, Muhammad Zeeshan3, Hamza Latif3, Usama Bin Khalid1, Shawaiz Iqbal1
...ts in each plot had less incidence of N. lugens as compared to narrow spaced (0 and 30 cm) geometries. More number of N. lugens nymphs (80.0-95.0 number/plant) were recorded with less spaced planting geometry as compared to higher spaced planting geometry (27.0-29.5 numbers/plant) during both years. With different planting geometry, no significant difference was recorded in the agronomic parameters except yield and 1000 grain weight. The highest yield was reco...

Abdullah Channo1*, Asmatullah Kaka1, Qudratullah Kalwar2, Imdadullah Jamali3, Ghulam Jelani2, Muhammad Bakhsh4, Ghulam Nabi Dahri5 and Jai Parkash Goil6

...and finally culling. The incidence of COD is ranges from 5-30%, due to the improper managemental system, and the prevalence of COD is 10-13% which is associated with selection, heredity, age, environment, improper nutrition, herd size, housing, high milk production, body condition score, lactation period, seasons, retained placenta, stress, metabolic disorders and hormonal imbalance. COD is generally at highest from 30 to 60 days of postpartum. The exact patho...
Muhammad Zaeem Abbas1, Khurram Ashfaq1, Amjad Islam Aqib2, Mughees Aizaz Alvi1*, Muhammad Haleem Tayyab1, Muzafar Ghafoor1, Muhammad Usman Naseer3, Ali Abbas4 and Ali Hassan1

Liyun Chang1, Aiju Liu2, Jianshuang Zhang3, Yingbin Chen1 and Zhiyong Liu4*

...ame time. The positive coincidence rate of the two was 94.11%. Therefore, the newly established indirect ELISA method had high sensitivity, specificity, stability, and intra- and interbatch repeatability. It could be used for the diagnosis and epidemiological investigation of toxoplasmosis in cats, thus laying a good foundation for preparing ELISA kits for clinical detection.

...

Pakistan Journal of Zoology

October

Vol. 54, Iss. 5, Pages 2003-2500

Featuring

Click here for more

Subscribe Today

Receive free updates on new articles, opportunities and benefits


Subscribe Unsubscribe